The LpxC enzyme in the lipid A biosynthetic pathway is one of the most promising and clinically unexploited antibiotic targets for treatment of multidrug-resistant Gram-negative infections. Progress in medicinal chemistry has led to the discovery of potent LpxC inhibitors with a variety of chemical scaffolds and distinct antibiotic profiles. The vast majority of these compounds, including the nanomolar inhibitors L-161,240 and BB-78485, are highly effective in suppressing the activity of Escherichia coli LpxC (EcLpxC) but not divergent orthologs such as Pseudomonas aeruginosa LpxC (PaLpxC) in vitro. The molecular basis for such promiscuous inhibition of EcLpxC has remained poorly understood. Here, we report the crystal structure of EcLpxC bound to L-161,240, providing the first molecular insight into L-161,240 inhibition. Additionally, structural analysis of the EcLpxC/L-161,240 complex together with the EcLpxC/BB-78485 complex reveals an unexpected backbone flipping of the Insert I βa-βb loop in EcLpxC in comparison with previously reported crystal structures of EcLpxC complexes with l-threonyl-hydroxamate-based broad-spectrum inhibitors. Such a conformational switch, which has only been observed in EcLpxC but not in divergent orthologs such as PaLpxC, results in expansion of the active site of EcLpxC, enabling it to accommodate LpxC inhibitors with a variety of head groups, including compounds containing single (R- or S-enantiomers) or double substitutions at the neighboring Cα atom of the hydroxamate warhead group. These results highlight the importance of understanding inherent conformational plasticity of target proteins in lead optimization.
Also flagged:pancreatic cancergene expressioncancerdeathpathogenesispolymerase
Journal Article2013-10-31No SnippetsFang Y, Yao Q, Chen Z, Xiang J, William FE, Gibbs RA, Chen C.
Show Full Abstract
Recent advances in human genomics and biotechnologies have profound impacts on medical research and clinical practice. Individual genomic information, including DNA sequences and gene expression profiles, can be used for prediction, prevention, diagnosis, and treatment for many complex diseases. Personalized medicine attempts to tailor medical care to individual patients by incorporating their genomic information. In a case of pancreatic cancer, the fourth leading cause of cancer death in the United States, alteration in many genes as well as molecular profiles in blood, pancreas tissue, and pancreas juice has recently been discovered to be closely associated with tumorigenesis or prognosis of the cancer. This review aims to summarize recent advances of important genes, proteins, and microRNAs that play a critical role in the pathogenesis of pancreatic cancer, and to provide implications for personalized medicine in pancreatic cancer.
Also flagged:transcription factorsorganizationHKTSgene expressionTF
Journal Article2013-10-31✓ 5 SnippetsLi P, Hua X, Zhang Z, Li J, Wang J.
In-Text Gene Mentions
Results)
…GeneCards [24] documents the involvement of POU3F2 in the neurogenesis pathway and in SIDS (Sudden Infant Death Syndrome) susceptibility pathways.…
Results)
…For example,POU3F2, a brain TS…
Results)
…three mutually regulatePOU3F2, and also regulate…
Results)
…the targets ofPOU3F2(Figure 4 ).…
Results)
…the involvement ofPOU3F2in the neurogenesis…
Show Full Abstract
<h4>Background</h4>Transcription factors (TFs) and miRNAs are essential for the regulation of gene expression; however, the global view of human gene regulatory networks remains poorly understood. For example, how is the expression of so many genes regulated by limited cohorts of regulators and how are genes differentially expressed in different tissues despite the genetic code being the same in all tissues?<h4>Results</h4>We analyzed the network properties of housekeeping and tissue-specific genes in gene regulatory networks from seven human tissues. Our results show that different classes of genes behave quite differently in these networks. Tissue-specific miRNAs show a higher average target number compared with non-tissue specific miRNAs, which indicates that tissue-specific miRNAs tend to regulate different sets of targets. Tissue-specific TFs exhibit higher in-degree, out-degree, cluster coefficient and betweenness values, indicating that they occupy central positions in the regulatory network and that they transfer genetic information from upstream genes to downstream genes more quickly than other TFs. Housekeeping TFs tend to have higher cluster coefficients compared with other genes that are neither housekeeping nor tissue specific, indicating that housekeeping TFs tend to regulate their targets synergistically. Several topological properties of disease-associated miRNAs and genes were found to be significantly different from those of non-disease-associated miRNAs and genes.<h4>Conclusions</h4>Tissue-specific miRNAs, TFs and disease genes have particular topological properties within the transcriptional regulatory networks of the seven human tissues examined. The tendency of tissue-specific miRNAs to regulate different sets of genes shows that a particular tissue-specific miRNA and its target gene set may form a regulatory module to execute particular functions in the process of tissue differentiation. The regulatory patterns of tissue-specific TFs reflect their vital role in regulatory networks and their importance to biological functions in their respective tissues. The topological differences between disease and non-disease genes may aid the discovery of new disease genes or drug targets. Determining the network properties of these regulatory factors will help define the basic principles of human gene regulation and the molecular mechanisms of disease.
Journal Article2013-10-31✓ 1 SnippetKudo K, Mitsuoka D, Takasuga M, Sugiyama Y, Sugawara K, Katayama N, Sawa H, Kubo HS, Takamori K, Ichioka M, Fujii T, Mizokawa T, Nohara M.
In-Text Gene Mentions
I A O 0000326)
…Ca10…
Show Full Abstract
We report the unprecedented square-planar coordination of iridium in the iron iridium arsenide Ca(10)(Ir(4)As(8))(Fe(2)As(2))5. This material experiences superconductivity at 16 K. X-ray photoemission spectroscopy and first-principles band calculation suggest Ir(II) oxidation state, which yields electrically conductive Ir(4)As(8) layers. Such metallic spacer layers are thought to enhance the interlayer coupling of Fe(2)As(2), in which superconductivity emerges, thus offering a way to control the superconducting transition temperature.
Also flagged:antibodypanitumumabcolorectal cancercolorectal cancersepidermal growth factor receptorEGFR
Journal Article2013-10-31No SnippetsGrady WM, Pritchard CC.
Show Full Abstract
The promise of precision medicine is now a clinical reality. Advances in our understanding of the molecular genetics of colorectal cancer (CRC) are leading to the development of a variety of biomarkers that are being used as early detection markers, prognostic markers, and markers for predicting treatment responses. This is no more evident than in the recent advances in testing CRCs for specific molecular alterations in order to guide treatment with the monoclonal antibody therapies cetuximab and panitumumab, which target the epidermal growth factor receptor. In this review, we update a prior review published in 2010 and describe our current understanding of the molecular pathogenesis of CRC and how these alterations relate to emerging biomarkers for early detection and risk stratification (diagnostic markers), prognosis (prognostic markers), and the prediction of treatment responses (predictive markers).
Also flagged:emotional diseasesynthesisdepression5-hydroxytryptaminemetabolismmild
Journal Article2013-10-31✓ 2 SnippetsDong XZ, Li ZL, Zheng XL, Mu LH, Zhang GQ, Liu P.
In-Text Gene Mentions
Abstract)
…and 5-HT transporter (5-HTT) were observed.<h4>Results</h…
Abstract)
…the expression of5-HTTprotein and mRNA…
Show Full Abstract
<h4>Ethnopharmacological relevance</h4>Ding-Zhi-Xiao-Wan (DZ, also known as Kai-Xin-San) is a famous traditional Chinese medicine used for the treatment of emotional disease. Previously, we have found that in a variety of animal models of depression (such as tail suspension model, model of chronic fatigue and forced swimming model) DZ demonstrated significant antidepressant behavior and promoted the production of 5-hydroxytryptamine (5-HT). However, the mechanisms of 5-HT regulation are still unclear. Therefore, the current study is designed to further investigate the antidepressant effect of DZ by observing its influence on 5-HT synthesis, metabolism, transport and other key links, so as to clarify the molecular mechanism of its 5-HT regulation.<h4>Materials and methods</h4>Solitary rising combined with the chronic unpredictable mild stress (CMS) was used to establish the rat model of depression. The rats were given DZ for 3 weeks, the behavior change and the following items in hippocampus and prefrontal cortex were detected simultaneously: 5-HT, 5-hydroxyindoleacetic acid (5-HIAA), tryptophan hydroxylase (TPH), aromatic amino acid decarboxylase (AADC), monoamine oxidase (MAO) and 5-HT transporter (5-HTT) were observed.<h4>Results</h4>Our results showed that treatment with the DZ significantly improved the behavior and simultaneously increased the 5-HT level in the hippocampus, prefrontal cortex tissues and hippocampus extracellular of depressive rats. In future studies revealed that DZ could significantly increase the protein and mRNA expression of the key enzymes TPH during the 5-HT synthesis process in the hippocampus and prefrontal cortex of the depressed rats, and suppress the expression of 5-HTT protein and mRNA at the same time. But it had no effects on MAO-A and MAO-B activities.<h4>Conclusion</h4>We believe that antidepressant effect of DZ is caused by the increase of 5-HT synthesis and reduction of 5-HT re-uptake, and eventually increase the content of 5-HT in the brain and the synaptic gaps.
…Genetic mutation in HD is identified by an expansion of CAG repeats coding for glutamine (Q) in exon 1 of the huntingtin (htt) gene.…
Abstract)
…on how mutanthttleads to the…
Abstract)
…the huntingtin (htt) gene.…
Text
…htt…
Show Full Abstract
Huntington's disease (HD) is a fatal genetic disorder characterized by triad clinical symptoms of chorea, emotional distress, and cognitive decline. Genetic mutation in HD is identified by an expansion of CAG repeats coding for glutamine (Q) in exon 1 of the huntingtin (htt) gene. The exact mechanism on how mutant htt leads to the selective loss of medium spiny neurons (MSNs) in the striatum is still unknown. Recent studies suggest that nucleolar stress and dysfunction are linked to the pathogenesis of HD. Alterations of the nucleolar activity and integrity contribute to deregulation of ribosomal DNA (rDNA) transcription in HD pathogenesis. Furthermore, epigenetic modifications in the nucleolus are associated with neuronal damage in HD. In this review, we discuss about how post-translational modifications of upstream binding factor (UBF) are affected by histone acetyltransferase and histone methyltransferase and involved in the transcriptional regulation of rDNA in HD. The understanding of epigenetic modulation of UBF-dependent rDNA transcription in the nucleolus may lead to the identification of novel pathological markers and new therapeutic targets to treat HD. This article is part of a Special Issue entitled: Role of the Nucleolus in Human Disease.
Also flagged:watermicrobial infectionscell wallssecretionshostroot-knots
Journal Article2013-10-31✓ 1 SnippetDanchin EG, Arguel MJ, Campan-Fournier A, Perfus-Barbeoch L, Magliano M, Rosso MN, Da Rocha M, Da Silva C, Nottet N, Labadie K, Guy J, Artiguenave F, Abad P.
Root-knot nematodes are globally the most aggressive and damaging plant-parasitic nematodes. Chemical nematicides have so far constituted the most efficient control measures against these agricultural pests. Because of their toxicity for the environment and danger for human health, these nematicides have now been banned from use. Consequently, new and more specific control means, safe for the environment and human health, are urgently needed to avoid worldwide proliferation of these devastating plant-parasites. Mining the genomes of root-knot nematodes through an evolutionary and comparative genomics approach, we identified and analyzed 15,952 nematode genes conserved in genomes of plant-damaging species but absent from non target genomes of chordates, plants, annelids, insect pollinators and mollusks. Functional annotation of the corresponding proteins revealed a relative abundance of putative transcription factors in this parasite-specific set compared to whole proteomes of root-knot nematodes. This may point to important and specific regulators of genes involved in parasitism. Because these nematodes are known to secrete effector proteins in planta, essential for parasitism, we searched and identified 993 such effector-like proteins absent from non-target species. Aiming at identifying novel targets for the development of future control methods, we biologically tested the effect of inactivation of the corresponding genes through RNA interference. A total of 15 novel effector-like proteins and one putative transcription factor compatible with the design of siRNAs were present as non-redundant genes and had transcriptional support in the model root-knot nematode Meloidogyne incognita. Infestation assays with siRNA-treated M. incognita on tomato plants showed significant and reproducible reduction of the infestation for 12 of the 16 tested genes compared to control nematodes. These 12 novel genes, showing efficient reduction of parasitism when silenced, constitute promising targets for the development of more specific and safer control means.
Also flagged:Zictranscription factorsZIC3situs inversusXnr1Pitx2
Journal Article2013-10-31No SnippetsWinata CL, Kondrychyn I, Kumar V, Srinivasan KG, Orlov Y, Ravishankar A, Prabhakar S, Stanton LW, Korzh V, Mathavan S.
Show Full Abstract
Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.
…the C. elegansCondensinmutants were hypothesized…
Discussion)
…a role forCondensinsin organizing retrotransposons…
Show Full Abstract
Retrotransposon sequences are positioned throughout the genome of almost every eukaryote that has been sequenced. As mobilization of these elements can have detrimental effects on the transcriptional regulation and stability of an organism's genome, most organisms have evolved mechanisms to repress their movement. Here, we identify a novel role for the Drosophila melanogaster Condensin II subunit, dCAP-D3 in preventing the mobilization of retrotransposons located in somatic cell euchromatin. dCAP-D3 regulates transcription of euchromatic gene clusters which contain or are proximal to retrotransposon sequence. ChIP experiments demonstrate that dCAP-D3 binds to these loci and is important for maintaining a repressed chromatin structure within the boundaries of the retrotransposon and for repressing retrotransposon transcription. We show that dCAP-D3 prevents accumulation of double stranded DNA breaks within retrotransposon sequence, and decreased dCAP-D3 levels leads to a precise loss of retrotransposon sequence at some dCAP-D3 regulated gene clusters and a gain of sequence elsewhere in the genome. Homologous chromosomes exhibit high levels of pairing in Drosophila somatic cells, and our FISH analyses demonstrate that retrotransposon-containing euchromatic loci are regions which are actually less paired than euchromatic regions devoid of retrotransposon sequences. Decreased dCAP-D3 expression increases pairing of homologous retrotransposon-containing loci in tissue culture cells. We propose that the combined effects of dCAP-D3 deficiency on double strand break levels, chromatin structure, transcription and pairing at retrotransposon-containing loci may lead to 1) higher levels of homologous recombination between repeats flanking retrotransposons in dCAP-D3 deficient cells and 2) increased retrotransposition. These findings identify a novel role for the anti-pairing activities of dCAP-D3/Condensin II and uncover a new way in which dCAP-D3/Condensin II influences local chromatin structure to help maintain genome stability.
Also flagged:narcolepsyautoimmune disorderhypocretininfluenzaP2RY11DNMT1
Journal Article2013-10-31✓ 3 SnippetsHan F, Faraco J, Dong XS, Ollila HM, Lin L, Li J, An P, Wang S, Jiang KW, Gao ZC, Zhao L, Yan H, Liu YN, Li QH, Zhang XZ, Hu Y, Wang JY, Lu YH, Lu CJ, Zhou W, Hallmayer J, Huang YS, Strohl KP, Pollmächer T, Mignot E.
In-Text Gene Mentions
Introduction)
…P2RY11-DNMT1, CTSH andTNFSF4loci as additional…
Results)
…associations at theTNFSF4and CTSH loci…
Results)
…variants (rs7553711 atTNFSF4, or rs3843303 and…
Show Full Abstract
Previous studies in narcolepsy, an autoimmune disorder affecting hypocretin (orexin) neurons and recently associated with H1N1 influenza, have demonstrated significant associations with five loci. Using a well-characterized Chinese cohort, we refined known associations in TRA@ and P2RY11-DNMT1 and identified new associations in the TCR beta (TRB@; rs9648789 max P = 3.7 × 10(-9) OR 0.77), ZNF365 (rs10995245 max P = 1.2 × 10(-11) OR 1.23), and IL10RB-IFNAR1 loci (rs2252931 max P = 2.2 × 10(-9) OR 0.75). Variants in the Human Leukocyte Antigen (HLA)- DQ region were associated with age of onset (rs7744020 P = 7.9×10(-9) beta -1.9 years) and varied significantly among cases with onset after the 2009 H1N1 influenza pandemic compared to previous years (rs9271117 P = 7.8 × 10(-10) OR 0.57). These reflected an association of DQB1*03:01 with earlier onset and decreased DQB1*06:02 homozygosity following 2009. Our results illustrate how genetic association can change in the presence of new environmental challenges and suggest that the monitoring of genetic architecture over time may help reveal the appearance of novel triggers for autoimmune diseases.
The coordination of cell proliferation and cell fate determination is critical during development but the mechanisms through which this is accomplished are unclear. We present evidence that the Snail-related transcription factor CES-1 of Caenorhabditis elegans coordinates these processes in a specific cell lineage. CES-1 can cause loss of cell polarity in the NSM neuroblast. By repressing the transcription of the BH3-only gene egl-1, CES-1 can also suppress apoptosis in the daughters of the NSM neuroblasts. We now demonstrate that CES-1 also affects cell cycle progression in this lineage. Specifically, we found that CES-1 can repress the transcription of the cdc-25.2 gene, which encodes a Cdc25-like phosphatase, thereby enhancing the block in NSM neuroblast division caused by the partial loss of cya-1, which encodes Cyclin A. Our results indicate that CDC-25.2 and CYA-1 control specific cell divisions and that the over-expression of the ces-1 gene leads to incorrect regulation of this functional 'module'. Finally, we provide evidence that dnj-11 MIDA1 not only regulate CES-1 activity in the context of cell polarity and apoptosis but also in the context of cell cycle progression. In mammals, the over-expression of Snail-related genes has been implicated in tumorigenesis. Our findings support the notion that the oncogenic potential of Snail-related transcription factors lies in their capability to, simultaneously, affect cell cycle progression, cell polarity and apoptosis and, hence, the coordination of cell proliferation and cell fate determination.
Also flagged:Intellectual DisabilityIDID disorderscognitionRho GTPaseMAP kinase
Journal Article2013-10-31✓ 3 SnippetsOortveld MA, Keerthikumar S, Oti M, Nijhof B, Fernandes AC, Kochinke K, Castells-Nobau A, van Engelen E, Ellenkamp T, Eshuis L, Galy A, van Bokhoven H, Habermann B, Brunner HG, Zweier C, Verstreken P, Huynen MA, Schenck A.
In-Text Gene Mentions
Results)
…Drosophila ID genes,DARS2and GCH1 ,…
Results)
…including PEX7 ,ARFGEF2and PAFAH1B1 caused…
Discussion)
…, Rab3GAP2 ,ARFGEF2, FKRP ,…
Show Full Abstract
Intellectual Disability (ID) disorders, defined by an IQ below 70, are genetically and phenotypically highly heterogeneous. Identification of common molecular pathways underlying these disorders is crucial for understanding the molecular basis of cognition and for the development of therapeutic intervention strategies. To systematically establish their functional connectivity, we used transgenic RNAi to target 270 ID gene orthologs in the Drosophila eye. Assessment of neuronal function in behavioral and electrophysiological assays and multiparametric morphological analysis identified phenotypes associated with knockdown of 180 ID gene orthologs. Most of these genotype-phenotype associations were novel. For example, we uncovered 16 genes that are required for basal neurotransmission and have not previously been implicated in this process in any system or organism. ID gene orthologs with morphological eye phenotypes, in contrast to genes without phenotypes, are relatively highly expressed in the human nervous system and are enriched for neuronal functions, suggesting that eye phenotyping can distinguish different classes of ID genes. Indeed, grouping genes by Drosophila phenotype uncovered 26 connected functional modules. Novel links between ID genes successfully predicted that MYCN, PIGV and UPF3B regulate synapse development. Drosophila phenotype groups show, in addition to ID, significant phenotypic similarity also in humans, indicating that functional modules are conserved. The combined data indicate that ID disorders, despite their extreme genetic diversity, are caused by disruption of a limited number of highly connected functional modules.
Also flagged:Huntington's diseaseHDneurodegenerative diseaseglutaminepathogenesisHdh
Journal Article2013-10-31✓ 5 SnippetsPinto RM, Dragileva E, Kirby A, Lloret A, Lopez E, St Claire J, Panigrahi GB, Hou C, Holloway K, Gillis T, Guide JR, Cohen PE, Li GM, Pearson CE, Daly MJ, Wheeler VC.
In-Text Gene Mentions
Abstract)
…Together, these data identify Mlh1 and Mlh3 as novel critical genetic modifiers of HTT CAG instability, point to Mlh1 genetic variation as the likely source of the instability difference in B6 and 129 strains and suggest that MLH1 protein levels play an important role in driving of the efficiency of somatic expansions.…
Introduction)
…Huntington's disease (HD) is a fatal, dominantly inherited neurodegenerative disease, which is caused by the expansion of a CAG repeat within exon 1 of the HTT gene, resulting in an extended glutamine tract in the huntingtin protein (HTT) [1].…
Discussion)
…The identification of Mlh1 and Mlh3 as modifiers of CAG instability in HdhQ111 mice suggests that variation in the human MLH1 and MLH3 genes may contribute to differences in somatic HTT CAG expansion that occurs between HD patients [9], [11].…
Introduction)
…1 of theHTTgene, resulting in…
Introduction)
…the huntingtin protein (HTT) [1] .…
Show Full Abstract
The Huntington's disease gene (HTT) CAG repeat mutation undergoes somatic expansion that correlates with pathogenesis. Modifiers of somatic expansion may therefore provide routes for therapies targeting the underlying mutation, an approach that is likely applicable to other trinucleotide repeat diseases. Huntington's disease Hdh(Q111) mice exhibit higher levels of somatic HTT CAG expansion on a C57BL/6 genetic background (B6.Hdh(Q111) ) than on a 129 background (129.Hdh(Q111) ). Linkage mapping in (B6x129).Hdh(Q111) F2 intercross animals identified a single quantitative trait locus underlying the strain-specific difference in expansion in the striatum, implicating mismatch repair (MMR) gene Mlh1 as the most likely candidate modifier. Crossing B6.Hdh(Q111) mice onto an Mlh1 null background demonstrated that Mlh1 is essential for somatic CAG expansions and that it is an enhancer of nuclear huntingtin accumulation in striatal neurons. Hdh(Q111) somatic expansion was also abolished in mice deficient in the Mlh3 gene, implicating MutLγ (MLH1-MLH3) complex as a key driver of somatic expansion. Strikingly, Mlh1 and Mlh3 genes encoding MMR effector proteins were as critical to somatic expansion as Msh2 and Msh3 genes encoding DNA mismatch recognition complex MutSβ (MSH2-MSH3). The Mlh1 locus is highly polymorphic between B6 and 129 strains. While we were unable to detect any difference in base-base mismatch or short slipped-repeat repair activity between B6 and 129 MLH1 variants, repair efficiency was MLH1 dose-dependent. MLH1 mRNA and protein levels were significantly decreased in 129 mice compared to B6 mice, consistent with a dose-sensitive MLH1-dependent DNA repair mechanism underlying the somatic expansion difference between these strains. Together, these data identify Mlh1 and Mlh3 as novel critical genetic modifiers of HTT CAG instability, point to Mlh1 genetic variation as the likely source of the instability difference in B6 and 129 strains and suggest that MLH1 protein levels play an important role in driving of the efficiency of somatic expansions.
We describe a case of a severe neonatal infection by herpes simplex virus (HSV) type 1 acquired postnatally from his father. The delivery and the first days of life were normal. He developed liver failure and disseminated intravascular coagulation when he was 19 days old. He was treated with intravenous acyclovir and the outcome was favorable. This case underlines that prevention of post-natal transmission of HSV merits to be considered in educational pregnancy programs directed at mothers and fathers.
Also flagged:chondrogenesischronic diseasesosteoarthritisOAbindingtranscription factors
Journal Article2013-10-31No SnippetsShang J, Liu H, Zhou Y.
Show Full Abstract
Cartilage has limited repair and regeneration capacity, thus damage of cartilage often results in its dysfunction and even chronic diseases like osteoarthritis (OA). Chondrogenesis induced by tissue-engineering methods is essential to treating cartilage-related diseases. MicroRNAs (miRNAs) are a class of small non-coding single-stranded RNAs which exert their biological effects by binding to the target messenger RNAs (mRNAs), resulting in decay or translation suppression of target mRNAs. There are emerging evidence indicating that miRNAs may play important roles in regulating both prenatal and postnatal chondrogenesis. During embryonic skeletal development, prenatal chondrogenesis is thought to be a precondition for formation of cartilage in developing limbs. Plenty of studies on different types of stem cells have undoubtedly proven their capacity of differentiating into chondrocytes. MiRNAs are found to comprehensively modulate these processes by establishing an interaction network with target genes, transcription factors and cytokines et al. In addition, translational application of miRNA technology has also been explored. In this review, we focus on the up-dated progress on regulatory mechanisms of miRNAs in prenatal and postnatal chondrogenesis. In addition, several miRNA target genes and roles of miRNAs in cartilage-related diseases are also discussed. This will contribute to studies of chondrogenesis mechanisms and development of new treating methods.
HIV infection causes systemic immune inflammation, and increases the risk for cardiovascular (CVD) disease even among those on virologically suppressive anti-retroviral treatment (ART). We performed a biostatistical analysis and screen of candidate cellular and plasma biomarkers for association with carotid artery intima-media thickness (CIMT), independent of traditional CVD risk factors such as age, gender, systolic blood pressure (SBP), lipid levels, smoking and diabetes. We conducted a multi-stage analysis based on a cross-sectional study of CVD risk in HIV-infected subjects age >45 years on ART for >6 months. The goal of this analysis was to identify candidate cellular and plasma biomarkers of CIMT in HIV-1 infected adults. We further sought to determine if these candidate biomarkers were independent of traditional CVD risk factors previously identified in HIV negative adults. High-resolution B-mode ultrasound images of the right common carotid common artery (CCA) were obtained. Plasma soluble inflammatory mediators, cytokines and chemokines were detected. Monocytes were defined by CD14/CD16 expression, and CD8+ T-cell activation by CD38/HLA-DR expression. Subjects were a median of 49.5 years old, 87% male, had a CIMT of 0.73 mm, FRS of 6%, a median viral load of 48 copies/mL, and CD4+ T cell count of 479 cells/μL. Soluble VCAM-1, and expansion of CD14dimCD16- monocytes each associated with higher CIMT independently of age and SBP. These factors are distinct components of a shared atherogenic process; 1) vascular endothelial molecular expression and 2) vascular monocytes that enter into the vascular endothelium and promote atherosclerotic plaque.
Also flagged:serine proteinasechaperonesSerpinextracellularblood clottingdementia
Journal Article2013-10-30✓ 5 SnippetsHeit C, Jackson BC, McAndrews M, Wright MW, Thompson DC, Silverman GA, Nebert DW, Vasiliou V.
In-Text Gene Mentions
Methods)
…Some examples include knockout of Serpinag3 used in studying T cells in immunology [67], hepatic specific knockout of Serpinc1, which exhibits coagulopathy [68], and Agt knockout to study blood pressure regulation and the renin-angiotensin system where adipocyte-specific knockout of agt caused decreased systolic blood pressure [69].…
Methods)
…SERPINC1 deficiency has been correlated with autoimmune disease, especially in patients producing antinuclear antibodies, such as those with systemic lupus erythematosus [30].…
Methods)
…one serpin member,SERPINC1, more commonly known…
Methods)
…SERPINC1inhibits coagulation factors…
Methods)
…Serpinc1gene encodes antithrombin…
Show Full Abstract
The serpin family comprises a structurally similar, yet functionally diverse, set of proteins. Named originally for their function as serine proteinase inhibitors, many of its members are not inhibitors but rather chaperones, involved in storage, transport, and other roles. Serpins are found in genomes of all kingdoms, with 36 human protein-coding genes and five pseudogenes. The mouse has 60 Serpin functional genes, many of which are orthologous to human SERPIN genes and some of which have expanded into multiple paralogous genes. Serpins are found in tissues throughout the body; whereas most are extracellular, there is a class of intracellular serpins. Serpins appear to have roles in inflammation, immune function, tumorigenesis, blood clotting, dementia, and cancer metastasis. Further characterization of these proteins will likely reveal potential biomarkers and therapeutic targets for disease.
Also flagged:membraneneurological diseasesMembrane-associated proteinspost-translational modificationsphosphorylationamino acids
Journal Article2013-10-30No SnippetsMelo-Braga MN, Schulz M, Liu Q, Swistowski A, Palmisano G, Engholm-Keller K, Jakobsen L, Zeng X, Larsen MR.
Show Full Abstract
Human embryonic stem cells (hESCs) can differentiate into neural stem cells (NSCs), which can further be differentiated into neurons and glia cells. Therefore, these cells have huge potential as source for treatment of neurological diseases. Membrane-associated proteins are very important in cellular signaling and recognition, and their function and activity are frequently regulated by post-translational modifications such as phosphorylation and glycosylation. To obtain information about membrane-associated proteins and their modified amino acids potentially involved in changes of hESCs and NSCs as well as to investigate potential new markers for these two cell stages, we performed large-scale quantitative membrane-proteomic of hESCs and NSCs. This approach employed membrane purification followed by peptide dimethyl labeling and peptide enrichment to study the membrane subproteome as well as changes in phosphorylation and sialylation between hESCs and NSCs. Combining proteomics and modification specific proteomics we identified a total of 5105 proteins whereof 57% contained transmembrane domains or signal peptides. The enrichment strategy yielded a total of 10,087 phosphorylated peptides in which 78% of phosphopeptides were identified with ≥99% confidence in site assignment and 1810 unique formerly sialylated N-linked glycopeptides. Several proteins were identified as significantly regulated in hESCs and NSC, including proteins involved in the early embryonic and neural development. In the latter group of proteins, we could identify potential NSC markers as Crumbs 2 and several novel proteins. A motif analysis of the altered phosphosites showed a sequence consensus motif (R-X-XpS/T) significantly up-regulated in NSC. This motif is among other kinases recognized by the calmodulin-dependent protein kinase-2, emphasizing a possible importance of this kinase for this cell stage. Collectively, this data represent the most diverse set of post-translational modifications reported for hESCs and NSCs. This study revealed potential markers to distinguish NSCs from hESCs and will contribute to improve our understanding on the differentiation process.
Also flagged:schizophreniapsychotic disordersclinicalpathogenesisbipolar disorderPsychosis
Journal Article2013-10-30✓ 1 SnippetZammit S, Hamshere M, Dwyer S, Georgiva L, Timpson N, Moskvina V, Richards A, Evans DM, Lewis G, Jones P, Owen MJ, O'Donovan MC.
In-Text Gene Mentions
Methods)
…50 kb fromVRK222 and ZNF804A…
Show Full Abstract
Psychotic experiences are not uncommon in general population samples, but no studies have examined to what extent confirmed risk variants for schizophrenia are associated with such experiences. A total of 3483 children in a birth cohort study participated in semistructured interviews for psychotic experiences at ages 12 and 18. We examined whether (1) a composite measure of risk for schizophrenia conferred by common alleles (polygenic score) was associated with psychotic experiences, (2) variants with genome-wide evidence for association with schizophrenia were associated with psychotic experiences, and (3) we could identify genetic variants for psychotic experiences using a genome-wide association (GWA) approach. We found no evidence that a schizophrenia polygenic score, or variants showing genome-wide evidence of association with schizophrenia, were associated with adolescent psychotic experiences within the general population. In fact, individuals who had a higher number of risk alleles for genome-wide hits for schizophrenia showed a decreased risk of psychotic experiences. In the GWA study, no variants showed GWA for psychotic experiences, and there was no evidence that the strongest hits (P < 5 × 10(-5)) were enriched for variants associated with schizophrenia in large consortia. Although polygenic scores are weak tools for prediction of schizophrenia, they show strong evidence of association with this disorder. Our findings, however, lend little support to the hypothesis that psychotic experiences in population-based samples of adolescents share a comparable genetic architecture to schizophrenia, or that utilizing a broader and more common phenotype of psychotic experiences will be an efficient approach to increase understanding of the genetic etiology of schizophrenia.
Also flagged:Statingene expressionstatinscholesterolcardiovascular diseasesimvastatin
Journal Article2013-10-30No SnippetsBolotin E, Armendariz A, Kim K, Heo SJ, Boffelli D, Tantisira K, Rotter JI, Krauss RM, Medina MW.
Show Full Abstract
Human lymphoblastoid cell lines (LCLs), generated through Epstein-Barr Virus (EBV) transformation of B-lymphocytes (B-cells), are a commonly used model system for identifying genetic influences on human diseases and on drug responses. We have previously used LCLs to examine the cellular effects of genetic variants that modulate the efficacy of statins, the most prescribed class of cholesterol-lowering drugs used for the prevention and treatment of cardiovascular disease. However, statin-induced gene expression differences observed in LCLs may be influenced by their transformation, and thus differ from those observed in native B-cells. To assess this possibility, we prepared LCLs and purified B-cells from the same donors, and compared mRNA profiles after 24 h incubation with simvastatin (2 µm) or sham buffer. Genes involved in cholesterol metabolism were similarly regulated between the two cell types under both the statin and sham-treated conditions, and the statin-induced changes were significantly correlated. Genes whose expression differed between the native and transformed cells were primarily implicated in cell cycle, apoptosis and alternative splicing. We found that ChIP-seq signals for MYC and EBNA2 (an EBV transcriptional co-activator) were significantly enriched in the promoters of genes up-regulated in the LCLs compared with the B-cells, and could be involved in the regulation of cell cycle and alternative splicing. Taken together, the results support the use of LCLs for the study of statin effects on cholesterol metabolism, but suggest that drug effects on cell cycle, apoptosis and alternative splicing may be affected by EBV transformation. This dataset is now uploaded to GEO at the accession number GSE51444.
The initial reaction of bacterial carbazole degradation is catalysed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase, ferredoxin and ferredoxin reductase components. The reduced form of the terminal oxygenase component was crystallized at 293 K by the hanging-drop vapour-diffusion method using PEG MME 550 as the precipitant under anaerobic conditions. The crystals diffracted to a resolution of 1.74 Å and belonged to space group P6(5), with unit-cell parameters a = b = 92.0, c = 243.6 Å. The asymmetric unit contained a trimer of terminal oxygenase molecules.
Journal Article2013-10-30✓ 1 SnippetEldai H, Periyasamy S, Al Qarni S, Al Rodayyan M, Muhammed Mustafa S, Deeb A, Al Sheikh E, Afzal M, Johani M, Yousef Z, Aziz MA.
In-Text Gene Mentions
I A O 0000326)
…DCC…
Show Full Abstract
Genomic abnormalities leading to colorectal cancer (CRC) include somatic events causing copy number aberrations (CNAs) as well as copy neutral manifestations such as loss of heterozygosity (LOH) and uniparental disomy (UPD). We studied the causal effect of these events by analyzing high resolution cytogenetic microarray data of 15 tumor-normal paired samples. We detected 144 genes affected by CNAs. A subset of 91 genes are known to be CRC related yet high GISTIC scores indicate 24 genes on chromosomes 7, 8, 18 and 20 to be strongly relevant. Combining GISTIC ranking with functional analyses and degree of loss/gain we identify three genes in regions of significant loss (ATP8B1, NARS, and ATP5A1) and eight in regions of gain (CTCFL, SPO11, ZNF217, PLEKHA8, HOXA3, GPNMB, IGF2BP3 and PCAT1) as novel in their association with CRC. Pathway and target prediction analysis of CNA affected genes and microRNAs, respectively indicates TGF-β signaling pathway to be involved in causing CRC. Finally, LOH and UPD collectively affected nine cancer related genes. Transcription factor binding sites on regions of >35% copy number loss/gain influenced 16 CRC genes. Our analysis shows patient specific CRC manifestations at the genomic level and that these different events affect individual CRC patients differently.
Also flagged:nucleusfertilizationchromatinmyosincytokeratinGPX4
Journal Article2013-10-30No SnippetsKichine E, Di Falco M, Hales BF, Robaire B, Chan P.
Show Full Abstract
We investigated the identity and quantitative variations of proteins extracted from human sperm heads using a label-free Gel-MS approach. Sperm samples were obtained from three men with high sperm counts at three different time points. This design allowed us to analyse intra-individual and inter-individual variations of the human sperm head proteome. Each time point was analyzed in triplicate to minimize any background artifactual effects of the methodology on the variation analyses. Intra-individual analysis using the spectral counting method revealed that the expression levels of 90% of the common proteins identified in three samples collected at various time-points, separated by several months, had a coefficient of variation of less than 0.5 for each man. Across individuals, the expression level of more than 80% of the proteins had a CV under 0.7. Interestingly, 83 common proteins were found within the core proteome as defined by the intra- and inter-variation analyses set criteria (CV<0.7). Some of these uniformly expressed proteins were chaperones, peroxiredoxins, isomerases, and cytoskeletal proteins. Although there is a significant level of inter-individual variation in the protein profiles of human sperm heads even in a well-defined group of men with high sperm counts, the consistent expression levels of a wide range of proteins points to their essential role during spermatogenesis.
Also flagged:MOFdosage compensation complexMSL1MSL2MSL3dosage compensation
Journal Article2013-10-30No SnippetsAguado-Llera D, Hamidi T, Doménech R, Pantoja-Uceda D, Gironella M, Santoro J, Velázquez-Campoy A, Neira JL, Iovanna JL.
Show Full Abstract
The stress protein Nupr1 is a highly basic, multifunctional, intrinsically disordered protein (IDP). MSL1 is a histone acetyl transferase-associated protein, known to intervene in the dosage compensation complex (DCC). In this work, we show that both Nupr1 and MSL1 proteins were recruited and formed a complex into the nucleus in response to DNA-damage, which was essential for cell survival in reply to cisplatin damage. We studied the interaction of Nupr1 and MSL1, and their binding affinities to DNA by spectroscopic and biophysical methods. The MSL1 bound to Nupr1, with a moderate affinity (2.8 µM) in an entropically-driven process. MSL1 did not bind to non-damaged DNA, but it bound to chemically-damaged-DNA with a moderate affinity (1.2 µM) also in an entropically-driven process. The Nupr1 protein bound to chemically-damaged-DNA with a slightly larger affinity (0.4 µM), but in an enthalpically-driven process. Nupr1 showed different interacting regions in the formed complexes with Nupr1 or DNA; however, they were always disordered ("fuzzy"), as shown by NMR. These results underline a stochastic description of the functionality of the Nupr1 and its other interacting partners.
Also flagged:lactationchromosometranscription factorbindinggene expressionlactoferrin
Journal Article2013-10-30✓ 1 SnippetRodríguez-Cruz M, Coral-Vázquez RM, Hernández-Stengele G, Sánchez R, Salazar E, Sanchez-Muñoz F, Encarnación-Guevara S, Ramírez-Salcedo J.
In-Text Gene Mentions
Discussion)
…factors Runx2, Creb3l4,Pou3f2, and Pou2af1 .…
Show Full Abstract
The mammary gland (MG) undergoes functional and metabolic changes during the transition from pregnancy to lactation, possibly by regulation of conserved genes. The objective was to elucidate orthologous genes, chromosome clusters and putative conserved transcriptional modules during MG development. We analyzed expression of 22,000 transcripts using murine microarrays and RNA samples of MG from virgin, pregnant, and lactating rats by cross-species hybridization. We identified 521 transcripts differentially expressed; upregulated in early (78%) and midpregnancy (89%) and early lactation (64%), but downregulated in mid-lactation (61%). Putative orthologous genes were identified. We mapped the altered genes to orthologous chromosomal locations in human and mouse. Eighteen sets of conserved genes associated with key cellular functions were revealed and conserved transcription factor binding site search entailed possible coregulation among all eight block sets of genes. This study demonstrates that the use of heterologous array hybridization for screening of orthologous gene expression from rat revealed sets of conserved genes arranged in chromosomal order implicated in signaling pathways and functional ontology. Results demonstrate the utilization power of comparative genomics and prove the feasibility of using rodent microarrays to identification of putative coexpressed orthologous genes involved in the control of human mammary gland development.
Also flagged:Small intestinal neuroendocrine tumorNETgastrointestinal endocrine tumormidgut carcinoidsneuroendocrine tumor of theileal carcinoid
Journal Article2013-10-29✓ 5 SnippetsHashemi J, Fotouhi O, Sulaiman L, Kjellman M, Höög A, Zedenius J, Larsson C.
In-Text Gene Mentions
Results)
…CNs in chromosome 18 were verified in 12/19 (63%) of the tumors for EMILIN2, 11/18 (61%) for DCC, 11/17 (65%) for BCL2 and 11/18 (61%) for CDH19 (Additional file 3: Table S2).…
Methods)
…qPCR analysis of CNs was applied to all 43 SI-NETs for selected loci with frequent CN losses in 18p (EMILIN2), 18q (DCC, BCL2, CDH19), 16q (CDH1) and 11q (SDHD).…
<h4>Background</h4>Small intestinal neuroendocrine tumors (SI-NETs) are typically slow-growing tumors that have metastasized already at the time of diagnosis. The purpose of the present study was to further refine and define regions of recurrent copy number (CN) alterations (CNA) in SI-NETs.<h4>Methods</h4>Genome-wide CNAs was determined by applying array CGH (a-CGH) on SI-NETs including 18 primary tumors and 12 metastases. Quantitative PCR analysis (qPCR) was used to confirm CNAs detected by a-CGH as well as to detect CNAs in an extended panel of SI-NETs. Unsupervised hierarchical clustering was used to detect tumor groups with similar patterns of chromosomal alterations based on recurrent regions of CN loss or gain. The log rank test was used to calculate overall survival. Mann-Whitney U test or Fisher's exact test were used to evaluate associations between tumor groups and recurrent CNAs or clinical parameters.<h4>Results</h4>The most frequent abnormality was loss of chromosome 18 observed in 70% of the cases. CN losses were also frequently found of chromosomes 11 (23%), 16 (20%), and 9 (20%), with regions of recurrent CN loss identified in 11q23.1-qter, 16q12.2-qter, 9pter-p13.2 and 9p13.1-11.2. Gains were most frequently detected in chromosomes 14 (43%), 20 (37%), 4 (27%), and 5 (23%) with recurrent regions of CN gain located to 14q11.2, 14q32.2-32.31, 20pter-p11.21, 20q11.1-11.21, 20q12-qter, 4 and 5. qPCR analysis confirmed most CNAs detected by a-CGH as well as revealed CNAs in an extended panel of SI-NETs. Unsupervised hierarchical clustering of recurrent regions of CNAs revealed two separate tumor groups and 5 chromosomal clusters. Loss of chromosomes 18, 16 and 11 and gain of chromosome 20 were found in both tumor groups. Tumor group II was enriched for alterations in chromosome cluster-d, including gain of chromosomes 4, 5, 7, 14 and gain of 20 in chromosome cluster-b. Gain in 20pter-p11.21 was associated with short survival. Statistically significant differences were observed between primary tumors and metastases for loss of 16q and gain of 7.<h4>Conclusion</h4>Our results revealed recurrent CNAs in several candidate regions with a potential role in SI-NET development. Distinct genetic alterations and pathways are involved in tumorigenesis of SI-NETs.
Also flagged:Impaired glucose tolerancetype 2 diabetesobesityPPARγpioglitazoneglucose
Journal Article2013-10-29No SnippetsSims EK, Hatanaka M, Morris DL, Tersey SA, Kono T, Chaudry ZZ, Day KH, Moss DR, Stull ND, Mirmira RG, Evans-Molina C.
Show Full Abstract
Impaired glucose tolerance (IGT) and type 2 diabetes (T2DM) are polygenic disorders with complex pathophysiologies; recapitulating them with mouse models is challenging. Despite 70% genetic homology, C57BL/6J (BL6) and C57BLKS/J (BLKS) inbred mouse strains differ in response to diet- and genetic-induced obesity. We hypothesized these differences would yield insight into IGT and T2DM susceptibility and response to pharmacological therapies. To this end, male 8-wk-old BL6 and BLKS mice were fed normal chow (18% kcal from fat), high-fat diet (HFD; 42% kcal from fat), or HFD supplemented with the PPARγ agonist pioglitazone (PIO; 140 mg PIO/kg diet) for 16 wk. Assessments of body composition, glucose homeostasis, insulin production, and energy metabolism, as well as histological analyses of pancreata were undertaken. BL6 mice gained weight and adiposity in response to HFD, leading to peripheral insulin resistance that was met with increased β-cell proliferation and insulin production. By contrast, BLKS mice responded to HFD by restricting food intake and increasing activity. These behavioral responses limited weight gain and protected against HFD-induced glucose intolerance, which in this strain was primarily due to β-cell dysfunction. PIO treatment did not affect HFD-induced weight gain in BL6 mice, and decreased visceral fat mass, whereas in BLKS mice PIO increased total fat mass without improving visceral fat mass. Differences in these responses to HFD and effects of PIO reflect divergent human responses to a Western lifestyle and underscore the careful consideration needed when choosing mouse models of diet-induced obesity and diabetes treatment.
Also flagged:breast cancerL -glutaminepenicillinstreptomycinFulvestrantdeoxycytidine
Journal Article2013-10-29No SnippetsGiessrigl B, Schmidt WM, Kalipciyan M, Jeitler M, Bilban M, Gollinger M, Krieger S, Jäger W, Mader RM, Krupitza G.
Show Full Abstract
<h4>Background</h4>Breast cancer is the leading cause of cancer death in women living in the western hemisphere. Despite major advances in first-line endocrine therapy of advanced oestrogen receptor (ER)-positive breast cancer, the frequent recurrence of resistant cancer cells represents a serious obstacle to successful treatment. Understanding the mechanisms leading to acquired resistance, therefore, could pave the way to the development of second-line therapeutics. To this end, we generated an ER-positive breast cancer cell line (MCF-7) with resistance to the therapeutic anti-oestrogen fulvestrant (FUL) and studied the molecular changes involved in resistance.<h4>Methods</h4>Naive MCF-7 cells were treated with increasing FUL concentrations and the gene expression profile of the resulting FUL-resistant strain (FR.MCF-7) was compared with that of naive cells using GeneChip arrays. After validation by real-time PCR and/or western blotting, selected resistance-associated genes were functionally studied by siRNA-mediated silencing or pharmacological inhibition. Furthermore, general mechanisms causing aberrant gene expression were investigated.<h4>Results</h4>Fulvestrant resistance was associated with repression of GPER and the overexpression of CDK6, whereas ERBB2, ABCG2, ER and ER-related genes (GREB1, RERG) or genes expressed in resistant breast cancer (BCAR1, BCAR3) did not contribute to resistance. Aberrant GPER and CDK6 expression was most likely caused by modification of DNA methylation and histone acetylation, respectively. Therefore, part of the resistance mechanism was loss of RB1 control. The hSWI/SNF (human SWItch/Sucrose NonFermentable) chromatin remodelling complex, which is tightly linked to nucleosome acetylation and repositioning, was also affected, because as a stress response to FUL treatment-naive cells altered the expression of five subunits within a few hours (BRG1, BAF250A, BAF170, BAF155, BAF47). The aberrant constitutive expression of BAF250A, BAF170 and BAF155 and a deviant stress response of BRG1, BAF170 and BAF47 in FR.MCF-7 cells to FUL treatment accompanied acquired FUL resistance. The regular and aberrant expression profiles of BAF155 correlated directly with that of CDK6 in naive and in FR.MCF-7 cells corroborating the finding that CDK6 overexpression was due to nucleosome alterations.<h4>Conclusion</h4>The study revealed that FUL resistance is associated with the dysregulation of GPER and CDK6. A mechanism leading to aberrant gene expression was most likely unscheduled chromatin remodelling by hSWI/SNF. Hence, three targets should be conceptually addressed in a second-line adjuvant therapy: the catalytic centre of SWI/SNF (BRG1) to delay the development of FUL resistance, GPER to increase sensitivity to FUL and the reconstitution of the RB1 pathway to overcome resistance.
Also flagged:endometrial carcinomaendometrioid endometrial carcinomasendometrioid endometrial tumorsserous endometrial tumorsEndometrial Cancertumors
Journal Article2013-10-29No SnippetsLe Gallo M, Bell DW.
Show Full Abstract
<h4>Background</h4>Endometrial cancer is responsible for approximately 74 000 deaths annually among women worldwide. It is a heterogeneous disease comprising multiple histologic subtypes. In the US, the majority of deaths from endometrial carcinoma are attributed to the serous and endometrioid subtypes. An understanding of the fundamental genomic alterations that drive serous and endometrioid endometrial carcinomas lays the foundation for the identification of molecular markers that could improve the clinical management of patients presenting with these tumors.<h4>Content</h4>We review the current state of knowledge regarding somatic genomic alterations that occur in serous and endometrioid endometrial tumors. We present this knowledge in a historical context by reviewing the genomic alterations that studies of individual genes and proteins have identified over the past 2 decades or so. We then review very recent comprehensive and systematic surveys of genomic, exomic, transcriptomic, epigenomic, and proteomic alterations in serous and endometrioid endometrial carcinomas.<h4>Summary</h4>The recent mapping of the genomic landscape of serous and endometrioid endometrial carcinomas has produced the first comprehensive molecular classification of these tumors, which has distinguished 4 molecular subgroups: a POLE [polymerase (DNA directed), ε, catalytic subunit] ultramutated subgroup, a hypermutated/microsatellite-unstable subgroup, a copy number-low/microsatellite-stable subgroup, and a copy number-high subgroup. This molecular classification may ultimately serve to refine the diagnosis and treatment of women with endometrioid and serous endometrial tumors.
Also flagged:tumorfolic acidethylene glycolchitosanoligosaccharidelactate
Journal Article2013-10-29No SnippetsLi TS, Yawata T, Honke K.
Show Full Abstract
For effective ovarian cancer gene therapy, systemic administrated tumor-targeting siRNA/folic acid-poly(ethylene glycol)-chitosan oligosaccharide lactate (FA-PEG-COL) nanoparticles is vital for delivery to cancer site(s). siRNA/FA-PEG-COL nanoparticles were prepared by ionic gelation for effective FA receptor-expressing ovarian cancer cells transfection and in vivo accumulation. The chemical structure of FA-PEG-COL conjugate was characterized by MALDI-TOF-MS, FT-IR and (1)H NMR. The average size of siRNA/FA-PEG-COL nanoparticles was approximately 200 nm, and the surface charge was +8.4 mV compared to +30.5 mV with siRNA/COL nanoparticles. FA-PEG-COL nanoparticles demonstrated superior compatibility with erythrocytes in terms of degree of aggregation and haemolytic activity and also effects on cell viability was lower when compared with COL nanoparticles. FA grafting significantly facilitated the uptake of nanoparticles via receptor mediated endocytosis as demonstrated by flow cytometry. The in vitro transfection and gene knockdown efficiency of HIF-1α were superior to COL nanoparticles (76-62%, respectively) and was comparable to Lipofectamine 2000 (79%) as demonstrated by RT-qPCR and Western blot. Gene knockdown at the molecular level translated into effective inhibition of proliferation in vitro. Accumulation efficiency of FA-PEG-COL nanoparticles was investigated in BALB/c mice bearing OVK18 #2 tumor xenograft using in vivo imaging. The active targeting FA-PEG-COL nanoparticles showed significantly greater accumulation than the passive targeting COL nanoparticles. Based on the results obtained, siRNA/FA-PEG-COL nanoparticles show much potential for effective ovarian cancer treatment via gene therapy.
Also flagged:poly(ADP-ribose) polymerase-1PARP1Hereditary hemochromatosisHHironoverload
Journal Article2013-10-29✓ 5 SnippetsPelham C, Jimenez T, Rodova M, Rudolph A, Chipps E, Islam MR.
In-Text Gene Mentions
Abstract)
…Thus, PARP1 binding to the inverted repeat sequence on the HFE promoter may serve as a novel iron sensing mechanism as increased iron level can trigger PARP1 cleavage and relief of HFE transcriptional repression.…
Abstract)
…and relief of HFE transcriptional repression . …
Abstract)
…hemochromatosis protein (HFE…
Abstract)
…the hemochromatosis protein (HFE) involved in iron…
Abstract)
…of PARP1 increasesHFEmRNA and protein.…
Show Full Abstract
Hereditary hemochromatosis (HH) is a common autosomal recessive disorder of iron overload among Caucasians of northern European descent. Over 85% of all cases with HH are due to mutations in the hemochromatosis protein (HFE) involved in iron metabolism. Although the importance in iron homeostasis is well recognized, the mechanism of sensing and regulating iron absorption by HFE, especially in the absence of iron response element in its gene, is not fully understood. In this report, we have identified an inverted repeat sequence (ATGGTcttACCTA) within 1700bp (-1675/+35) of the HFE promoter capable to form cruciform structure that binds PARP1 and strongly represses HFE promoter. Knockdown of PARP1 increases HFE mRNA and protein. Similarly, hemin or FeCl3 treatments resulted in increase in HFE expression by reducing nuclear PARP1 pool via its apoptosis induced cleavage, leading to upregulation of the iron regulatory hormone hepcidin mRNA. Thus, PARP1 binding to the inverted repeat sequence on the HFE promoter may serve as a novel iron sensing mechanism as increased iron level can trigger PARP1 cleavage and relief of HFE transcriptional repression.
Also flagged:sclerostinagingbone formationnotchBMPTGFβ
Journal Article2013-10-29No SnippetsRoforth MM, Fujita K, McGregor UI, Kirmani S, McCready LK, Peterson JM, Drake MT, Monroe DG, Khosla S.
Show Full Abstract
Although aging is associated with a decline in bone formation in humans, the molecular pathways contributing to this decline remain unclear. Several previous clinical studies have shown that circulating sclerostin levels increase with age, raising the possibility that increased production of sclerostin by osteocytes leads to the age-related impairment in bone formation. Thus, in the present study, we examined circulating sclerostin levels as well as bone mRNA levels of sclerostin using quantitative polymerase chain reaction (QPCR) analyses in needle bone biopsies from young (mean age, 30.0years) versus old (mean age, 72.9years) women. In addition, we analyzed the expression of genes in a number of pathways known to be altered with skeletal aging, based largely on studies in mice. While serum sclerostin levels were 46% higher (p<0.01) in the old as compared to the young women, bone sclerostin mRNA levels were no different between the two groups (p=0.845). However, genes related to notch signaling were significantly upregulated (p=0.003 when analyzed as a group) in the biopsies from the old women. In an additional analysis of 118 genes including those from genome-wide association studies related to bone density and/or fracture, BMP/TGFβ family genes, selected growth factors and nuclear receptors, and Wnt/Wnt-related genes, we found that mRNA levels of the Wnt inhibitor, SFRP1, were significantly increased (by 1.6-fold, p=0.0004, false discovery rate [q]=0.04) in the biopsies from the old as compared to the young women. Our findings thus indicate that despite increases in circulating sclerostin levels, bone sclerostin mRNA levels do not increase in elderly women. However, aging is associated with alterations in several key pathways and genes in humans that may contribute to the observed impairment in bone formation. These include notch signaling, which represents a potential therapeutic target for increasing bone formation in humans. Our studies further identified mRNA levels of SFRP1 as being increased in aging bone in humans, suggesting that this may also represent a viable target for the development of anabolic therapies for age-related bone loss and osteoporosis.
Also flagged:Glucosediabetestype I diabetesdiabetes mellitusType I diabetes mellitusinsulin
Journal Article2013-10-29No SnippetsVashist SK.
Show Full Abstract
There have been continuous advances in the field of glucose monitoring during the last four decades, which have led to the development of highly evolved blood glucose meters, non-invasive glucose monitoring (NGM) devices and continuous glucose monitoring systems (CGMS). Glucose monitoring is an integral part of diabetes management, and the maintenance of physiological blood glucose concentration is the only way for a diabetic to avoid life-threatening diabetic complications. CGMS have led to tremendous improvements in diabetic management, as shown by the significant lowering of glycated hemoglobin (HbA1c) in adults with type I diabetes. Most of the CGMS have been minimally-invasive, although the more recent ones are based on NGM techniques. This manuscript reviews the advances in CGMS for diabetes management along with the future prospects and the challenges involved.
Also flagged:secretionextracellularastrocyte activationglial fibrillary acidic proteinoxygenaging
Journal Article2013-10-28No SnippetsMacco R, Pelizzoni I, Consonni A, Vitali I, Giacalone G, Martinelli Boneschi F, Codazzi F, Grohovaz F, Zacchetti D.
Show Full Abstract
<h4>Background</h4>Astrocytes respond to local insults within the brain and the spinal cord with important changes in their phenotype. This process, overall known as "activation", is observed upon proinflammatory stimulation and leads astrocytes to acquire either a detrimental phenotype, thereby contributing to the neurodegenerative process, or a protective phenotype, thus supporting neuronal survival. Within the mechanisms responsible for inflammatory neurodegeneration, oxidative stress plays a major role and has recently been recognized to be heavily influenced by changes in cytosolic iron levels. In this work, we investigated how activation affects the competence of astrocytes to handle iron overload and the ensuing oxidative stress.<h4>Methods</h4>Cultures of pure cortical astrocytes were preincubated with proinflammatory cytokines (interleukin-1β and tumor necrosis factor α) or conditioned medium from lipopolysaccharide-activated microglia to promote activation and then exposed to a protocol of iron overload.<h4>Results</h4>We demonstrate that activated astrocytes display an efficient protection against iron-mediated oxidative stress and cell death. Based on this evidence, we performed a comprehensive biochemical and molecular analysis, including a transcriptomic approach, to identify the molecular basis of this resistance.<h4>Conclusions</h4>We propose the protective phenotype acquired after activation not to involve the most common astrocytic antioxidant pathway, based on the Nrf2 transcription factor, but to result from a complex change in the expression and activity of several genes involved in the control of cellular redox state.
Also flagged:immune responsesoligonucleotideoligosaccharidebindinginterferonlocalization
Journal Article2013-10-28✓ 1 SnippetShaw N, Liu ZJ.
In-Text Gene Mentions
Text
…CXXC-type zinc finger-containing protein 1…
Show Full Abstract
The oligonucleotide/oligosaccharide binding (OB) fold is employed by proteins to bind nucleic acids during replication, transcription, and translation. Recently, a variation of the OB fold consisting of a tandem pair of OB folds named the HIN (hematopoietic expression, interferon-inducible nature, and nuclear localization) domain was shown to play essential roles in the regulation of innate immune responses originating from binding of nucleic acids in the cytoplasm or the nucleus of the cell. Although the two OB folds of the HIN domain are linked via a long linker region, conserved hydrophobic contacts between the two OB folds hold them together firmly, resulting in a single compact domain. This overall topology of the HIN domain seems to be highly conserved, and proteins containing the HIN domain have been grouped in the PYHIN family. Structures of the recently solved HIN domains reveal that these domains exhibit either absent in melanoma2 (Aim2) HIN-like or p202 HINa-like modes of DNA binding. These two modes of DNA binding seem to result in different responses and as a consequence confer distinct roles on the proteins. This review summarizes our current understanding of the structure and function of the HIN domains in context with the innate immune responses.
Lithium is an effective mood stabilizer that has been clinically used to treat bipolar disorder for several decades. Recent studies have suggested that lithium possesses robust neuroprotective and anti-tumor properties. Thus far, a large number of lithium targets have been discovered. Here, we report for the first time that HDAC1 is a target of lithium. Lithium significantly down-regulated HDAC1 at the translational level by targeting HDAC1 mRNA. We also showed that depletion of HDAC1 is essential for the neuroprotective effects of lithium and for the lithium-mediated degradation of mutant huntingtin through the autophagic pathway. Our studies explain the multiple functions of lithium and reveal a novel mechanism for the function of lithium in neurodegeneration.
Also flagged:sorafenibEGFRGene expressionNSCLCtumorLung Cancer
Journal Article2013-10-28No SnippetsBlumenschein GR, Saintigny P, Liu S, Kim ES, Tsao AS, Herbst RS, Alden C, Lee JJ, Tang X, Stewart DJ, Kies MS, Fossella FV, Tran HT, Mao L, Hicks ME, Erasmus J, Gupta S, Girard L, Peyton M, Diao L, Wang J, Davis SE, Minna JD, Wistuba I, Hong WK, Heymach JV, Lippman SM.
Show Full Abstract
<h4>Purpose</h4>To report the clinical efficacy of sorafenib and to evaluate biomarkers associated with sorafenib clinical benefit in the BATTLE (Biomarker-Integrated Approaches of Targeted Therapy for Lung Cancer Elimination) program.<h4>Patients and methods</h4>Patients with previously treated non-small cell lung cancer (NSCLC) received sorafenib until progression or unacceptable toxicity. Eight-week disease control rate (DCR), progression-free survival (PFS), and overall survival (OS) were assessed. Prespecified biomarkers included K-RAS, EGFR, and B-RAF mutations, and EGFR gene copy number. Gene expression profiles from NSCLC cell lines and patient tumor biopsies with wild-type EGFR were used to develop a sorafenib sensitivity signature (SSS).<h4>Results</h4>A total of 105 patients were eligible and randomized to receive sorafenib. Among 98 patients evaluable for eight-week DCR, the observed DCR was 58.2%. The median PFS and OS were 2.83 [95% confidence interval (CI), 2.04-3.58] and 8.48 months (95% CI, 5.78-10.97), respectively. Eight-week DCR was higher in patients with wild-type EGFR than patients with EGFR mutation (P = 0.012), and in patients with EGFR gene copy number gain (FISH-positive) versus patients FISH-negative (P = 0.048). In wild-type EGFR tumors, the SSS was associated with improved PFS (median PFS 3.61 months in high SSS vs. 1.84 months in low SSS; P = 0.026) but not with eight-week DCR. Increased expression of fibroblast growth factor-1, NF-κB, and hypoxia pathways were identified potential drivers of sorafenib resistance.<h4>Conclusion</h4>Sorafenib demonstrates clinical activity in NSCLC, especially with wild-type EGFR. SSS was associated with improved PFS. These data identify subgroups that may derive clinical benefit from sorafenib and merit investigation in future trials.
Also flagged:Steroidhormonescarbohydratelipidmetabolismglucocorticoids
Journal Article2013-10-28No SnippetsHu Z, Shen WJ, Cortez Y, Tang X, Liu LF, Kraemer FB, Azhar S.
Show Full Abstract
<h4>Background</h4>Given the emerging roles of miRNAs as potential posttranscriptional/posttranslational regulators of the steroidogenic process in adrenocortical and gonadal cells, we sought to determine miRNA profiles in rat adrenals from animals treated with vehicle, ACTH, 17α-E2 or dexamethasone. Key observations were also confirmed using hormone (Bt2cAMP)-treated mouse Leydig tumor cells, MLTC-1, and primary rat ovarian granulosa cells.<h4>Methodology</h4>RNA was extracted from rat adrenal glands and miRNA profiles were established using microarray and confirmed with qRT-PCR. The expression of some of the hormone-sensitive miRNAs was quantified in MLTC-1 and granulosa cells after stimulation with Bt2cAMP. Targets of hormonally altered miRNAs were explored by qRT-PCR and Western blotting in adrenals and granulosa cells.<h4>Results</h4>Adrenals from ACTH, 17α-E2 and dexamethasone treated rats exhibited miRNA profiles distinct from control animals. ACTH up-regulated the expression of miRNA-212, miRNA-182, miRNA-183, miRNA-132, and miRNA-96 and down-regulated the levels of miRNA-466b, miRNA-214, miRNA-503, and miRNA-27a. The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. Dexamethasone treatment decreased miRNA-200b, miR-122, miR-19a, miRNA-466b and miRNA27a levels, but increased miRNA-183 levels. Several adrenal miRNAs are subject to regulation by more than one hormone. Significant cAMP-induced changes in certain miRNAs were also noted in MLTC-1 and granulosa cells. Some of the hormone-induced miRNAs in steroidogenic cells were predicted to target proteins involved in lipid metabolism/steroidogenesis. We also obtained evidence that miR-132 and miRNA-214 inhibit the expression of SREBP-1c and LDLR, respectively.<h4>Conclusion</h4>Our results demonstrate that expression of a number of miRNAs in steroidogenic cells of the testis, ovary and adrenal glands is subject to hormonal regulation and that miRNAs and their regulation by specific hormones are likely to play a key role in posttranscriptional/posttranslational regulation of steroidogenesis.
Liver is a vital organ responsible for plethora of functions including detoxification, protein synthesis, and the production of biochemicals necessary for the sustenance of life. Therefore, patients with chronic liver diseases such as viral hepatitis, liver cirrhosis, and hepatocellular carcinoma need immediate attention to sustain life and as a result are often exposed to the prolonged treatment with drugs/herbal medications. Lack of site-specific delivery of these medications to the hepatocytes/nonparenchymal cells and adverse effects associated with their off-target interactions limit their continuous use. This calls for the development and fabrication of targeted delivery systems which can deliver the drug payload at the desired site of action for defined period of time. The primary aim of drug targeting is to manipulate the whole body distribution of drugs, that is, to prevent distribution to non-target cells and concomitantly increase the drug concentration at the targeted site. Carrier molecules are designed for their selective cellular uptake, taking advantage of specific receptors or binding sites present on the surface membrane of the target cell. In this review, various aspects of liver targeting of drug molecules and herbal medications have been discussed which elucidate the importance of delivering the drugs/herbal medications at their desired site of action.
Also flagged:mitochondriacytosolorganellesnucleusendoplasmic reticulumpathogenesis
Journal Article2013-10-28No SnippetsMukherjee R, Chakrabarti O.
Show Full Abstract
The cell has an intricate quality control system to protect its mitochondria from oxidative stress. This surveillance system is multi-tiered and comprises molecules that are present inside the mitochondria, in the cytosol, and in other organelles like the nucleus and endoplasmic reticulum. These molecules cross talk with each other and protect the mitochondria from oxidative stress. Oxidative stress is a fundamental part of early disease pathogenesis of neurodegenerative diseases. These disorders also damage the cellular quality control machinery that protects the cell against oxidative stress. This exacerbates the oxidative damage and causes extensive neuronal cell death that is characteristic of neurodegeneration.
Also flagged:NanohydroxyapatiteHydroxyapatitenanocrystalcalciumhydroxidesodium
Journal Article2013-10-28No SnippetsNoor Z.
Show Full Abstract
Hydroxyapatite is chemically related to the inorganic component of bone matrix as a complex structure with the formula of Ca10(OH)2(PO4)6. Previous studies have reported the application of microsized hydroxyapatite to bone regeneration, but the result is not satisfied. The limitation comes from the size of hydroxyapatite. In addition, the duration of treatment is very long. The advantages of hydroxyapatite nanocrystal are the osteoconduction, bioresorption, and contact in close distance. Crystal in osteoporotic bone is calcium phosphate hydroxide with the chemical formula of Ca10(OH)2(PO4)6. Crystal of normal bone is sodium calcium hydrogen carbonate phosphate hydrate with the chemical formula of Ca8H2(PO4)6 ·H2O-NaHCO3-H2O. The recent development is applying nanobiology approach to hydroxyapatite. This is based on the concept that the mineral atoms arranged in a crystal structure of hydroxyapatite can be substituted or incorporated by the other mineral atoms. In conclusion, the basic elements of hydroxyapatite crystals, composed of atomic minerals in a certain geometric pattern, and their relationship to the bone cell biological activity have opened opportunities for hydroxyapatite crystals supplement application on osteoporosis. Understanding of the characteristics of bone hydroxyapatite crystals as well as the behavior of mineral atom in the substitution will have a better impact on the management of osteoporosis.
Spinocerebellar ataxia type 7 (SCA7) is caused by a toxic polyglutamine (polyQ) expansion in the N-terminus of the protein ataxin-7. Ataxin-7 has a known function in the histone acetylase complex, Spt/Ada/Gcn5 acetylase (STAGA) chromatin-remodeling complex. We hypothesized that some histone deacetylase (HDAC) family members would impact the posttranslational modification of normal and expanded ataxin-7 and possibly modulate ataxin-7 function or neurotoxicity associated with the polyQ expansion. Interestingly, when we coexpressed each HDAC family member in the presence of ataxin-7 we found that HDAC3 increased the posttranslational modification of normal and expanded ataxin-7. Specifically, HDAC3 stabilized ataxin-7 and increased modification of the protein. Further, HDAC3 physically interacts with ataxin-7. The physical interaction of HDAC3 with normal and polyQ-expanded ataxin-7 affects the toxicity in a polyQ-dependent manner. We detect robust HDAC3 expression in neurons and glia in the cerebellum and an increase in the levels of HDAC3 in SCA7 mice. Consistent with this we found altered lysine acetylation levels and deacetylase activity in the brains of SCA7 transgenic mice. This study implicates HDAC3 and ataxin-7 interaction as a target for therapeutic intervention in SCA7, adding to a growing list of neurodegenerative diseases that may be treated by HDAC inhibitors.
Journal Article2013-10-27✓ 1 SnippetWopereis S, Wolvers D, van Erk M, Gribnau M, Kremer B, van Dorsten FA, Boelsma E, Garczarek U, Cnubben N, Frenken L, van der Logt P, Hendriks HF, Albers R, van Duynhoven J, van Ommen B, Jacobs DM.
In-Text Gene Mentions
Methods)
…CXCL2, CYP4A11, MRC1,PTGIS, EMP1, AKR1C3, and…
Show Full Abstract
<h4>Background</h4>Resilience or the ability of our body to cope with daily-life challenges has been proposed as a new definition of health, with restoration of homeostasis as target resultant of various physiological stress responses. Challenge models may thus be a sensitive measure to study the body's health. The objective of this study was to select a dietary challenge model for the assessment of inflammatory resilience. Meals are a challenge to metabolic homeostasis and are suggested to affect inflammatory pathways, yet data in literature are limited and inconsistent.<h4>Method</h4>The kinetic responses of three different dietary challenges and a water control challenge were assessed on various metabolic and inflammatory markers in 14 healthy males and females using a full cross-over study design. The dietary challenges included glucose (75 g glucose in 300 ml water), lipids (200 ml whipping cream) and a mix of glucose and lipids (same amounts as above), respectively. Blood samples were collected at baseline and at 0.5, 1, 2, 4, 6, 8 and 10 h after consumption of the treatment products. Inflammation (IFNγ, IL-1β, IL-6, IL-8, IL-10, IL-12p70, TNF-α CRP, ICAM-1, VCAM-1, SAA, E-selectin, P-selectin, thrombomodulin, leukocytes, neutrophils, lymphocytes) and clinical (e.g. glucose, insulin, triglycerides) markers as well as gene expression in blood cells and plasma oxylipin profiles were measured.<h4>Results</h4>All three dietary challenges induced changes related to metabolic control such as increases in glucose and insulin after the glucose challenge and increases in triglycerides after the lipid challenge. In addition, differences between the challenges were observed for precursor oxylipins and some downstream metabolites including DiHETrE's and HODE's. However, none of the dietary challenges induced an acute inflammatory response, except for a modest increase in circulating leukocyte numbers after the glucose and mix challenges. Furthermore, subtle, yet statistically significant increases in vascular inflammatory markers (sICAM-1 and sVCAM-1) were found after the mix challenge, when compared to the water control challenge.<h4>Conclusions</h4>This study shows that dietary glucose and lipid challenges did not induce a strong acute inflammatory response in healthy subjects, as quantified by an accurate and broad panel of parameters.
Also flagged:rosuvastatinOX40LPPAR-γatherosclerotic cerebral infarctiontumor necrosis factorOX40
Journal Article2013-10-27No SnippetsZhang JY, Liu B, Wang YN, Zhang WN, Wang FJ.
Show Full Abstract
Atherosclerotic cerebral infarction (ACI) is characterized by extremely high fatality and disability rate. Recent studies indicate that co-stimulatory signal of tumor necrosis factor superfamily OX40/OX40L contributes to the atherosclerosis effect in ACI patients. However, it remains unclear the mechanism underlying the anti-atherosclerosis process. So this study aims to investigate the effects of rosuvastatin on the expression of OX40L, peroxisome proliferator-activated receptors gamma (PPAR-γ) in human umbilical vein endothelial cells (HUVEC), and human peripheral blood lymphocytes. Different concentration of rosuvastatin and oxidized low-density lipoprotein (OX-LDL) co-intervene HUVEC to observe the expression of OX40L and PPAR-γ using real-time quantitative RT-PCR (Q-RTPCR) and Western-blot. Furthermore, we examined the level changes of plasmic sOX40L and hs-CRP in acute atherosclerotic cerebral infarction patients. The results demonstrated that concentration-dependent and time-dependent OX-LDL remarkably stimulate the expression of OX40L and inhibit the expression of PPAR-γ in vitro. But concentration-dependent rosuvastatin can reverse the impact of OX-LDL, suggesting that rosuvastatin can prevent the expression of OX40L, and the process may be associated with mevalonate pathway. In vivo, acute atherosclerotic cerebral infarction patients taking 20 mg rosuvastatin exhibited significantly reduced expression of OX40L in peripheral blood lymphocyte, sOX40L in blood plasma, and hs-CRP compared with before treatment. Our studies identified rosuvastatin as an effective medicine in controlling atherosclerosis process in ACI by inhibiting OX40L and stimulating PPAR-γ expression.
<h4>Background</h4>Recent advances in genomewide studies have revealed the abundance of long non-coding RNAs (lncRNAs) in mammalian transcriptomes. The ENCODE Consortium has elucidated the prevalence of human lncRNA genes, which are as numerous as protein-coding genes. Surprisingly, many lncRNAs do not show the same pattern of high interspecies conservation as protein-coding genes. The absence of functional studies and the frequent lack of sequence conservation therefore make functional interpretation of these newly discovered transcripts challenging. Many investigators have suggested the presence and importance of secondary structural elements within lncRNAs, but mammalian lncRNA secondary structure remains poorly understood. It is intriguing to speculate that in this group of genes, RNA secondary structures might be preserved throughout evolution and that this might explain the lack of sequence conservation among many lncRNAs.<h4>Scope of review</h4>Here, we review the extent of interspecies conservation among different lncRNAs, with a focus on a subset of lncRNAs that have been functionally investigated. The function of lncRNAs is widespread and we investigate whether different forms of functionalities may be conserved.<h4>Major conclusions</h4>Lack of conservation does not imbue a lack of function. We highlight several examples of lncRNAs where RNA structure appears to be the main functional unit and evolutionary constraint. We survey existing genomewide studies of mammalian lncRNA conservation and summarize their limitations. We further review specific human lncRNAs which lack evolutionary conservation beyond primates but have proven to be both functional and therapeutically relevant.<h4>General significance</h4>Pioneering studies highlight a role in lncRNAs for secondary structures, and possibly the presence of functional "modules", which are interspersed with longer and less conserved stretches of nucleotide sequences. Taken together, high-throughput analysis of conservation and functional composition of the still-mysterious lncRNA genes is only now becoming feasible.
<h4>Background</h4>Carbohydrate 19.9 antigen (CA19.9) has been used in the diagnosis and followup of gastrointestinal tumours. The aim of this prospective longitudinal study was the evaluation of CA19.9 levels in patients with chronic hepatitis and hepatic cirrhosis hepatitis C virus and B virus correlated.<h4>Materials and methods</h4>180 patients were enrolled, 116 with HCV-related chronic liver disease (48% chronic hepatitis, 52% cirrhosis) and 64 with HBV-related chronic liver disease (86% chronic hepatitis, 14% cirrhosis). Patients with high levels of CA19.9 underwent abdominal ecography, gastroendoscopy, colonoscopy, and abdominal CT scan.<h4>Results</h4>51.7% of patients with HCV-related chronic liver disease and 48.4% of those with HBV-related chronic liver disease presented high levels of CA19.9. None was affected by pancreatic or intestinal neoplasia, cholestatic jaundice, or other diseases potentially able to induce Ca19.9 elevations. CA19.9 levels were elevated in 43.3% of HCV chronic hepatitis, in 56.3% of HCV cirrhosis, in 45.1% of HBV chronic hepatitis, and in 58% of HBV cirrhosis.<h4>Conclusions</h4>CA19.9 commonly increases in the serum of patients with chronic viral hepatitis. Elevation of CA 19.9 is not specific for neoplastic disease and is related to the severity of fibrosis and to the viral aetiology of hepatitis.
Also flagged:autophagyeuropiumhydroxideneurodegenerative diseasesrapamycintrehalose
Journal Article2013-10-26No SnippetsWei PF, Zhang L, Nethi SK, Barui AK, Lin J, Zhou W, Shen Y, Man N, Zhang YJ, Xu J, Patra CR, Wen LP.
Show Full Abstract
Autophagy is one of the well-known pathways to accelerate the clearance of protein aggregates, which contributes to the therapy of neurodegenerative diseases. Although there are numerous reports that demonstrate the induction of autophagy with small molecules including rapamycin, trehalose and lithium, however, there are few reports mentioning the clearance of aggregate-prone proteins through autophagy induction by nanoparticles. In the present article, we have demonstrated that europium hydroxide [Eu(III)(OH)3] nanorods can reduce huntingtin protein aggregation (EGFP-tagged huntingtin protein with 74 polyQ repeats), responsible for neurodegenerative diseases. Again, we have found that these nanorods induce authentic autophagy flux in different cell lines (Neuro 2a, PC12 and HeLa cells) through the expression of higher levels of characteristic autophagy marker protein LC3-II and degradation of selective autophagy substrate/cargo receptor p62/SQSTM1. Furthermore, depression of protein aggregation clearance through the autophagy blockade has also been observed by using specific inhibitors (wortmannin and chloroquine), indicating that autophagy is involved in the degradation of huntingtin protein aggregation. Since [Eu(III)(OH)3] nanorods can enhance the degradation of huntingtin protein aggregation via autophagy induction, we strongly believe that these nanorods would be useful for the development of therapeutic treatment strategies for various neurodegenerative diseases in near future using nanomedicine approach.
Also flagged:prionprion proteinPrPneurodegenerative diseasesAlzheimer's diseaseParkinson's disease
Journal Article2013-10-26✓ 1 SnippetKrauss S, Vorberg I.
In-Text Gene Mentions
I A O 0000606)
…Htt:…
Show Full Abstract
Prions are unconventional infectious agents that are composed of misfolded aggregated prion protein. Prions replicate their conformation by template-assisted conversion of the endogenous prion protein PrP. Templated conversion of soluble proteins into protein aggregates is also a hallmark of other neurodegenerative diseases. Alzheimer's disease or Parkinson's disease are not considered infectious diseases, although aggregate pathology appears to progress in a stereotypical fashion reminiscent of the spreading behavior ofmammalian prions. While basic principles of prion formation have been studied extensively, it is still unclear what exactly drives PrP molecules into an infectious, self-templating conformation. In this review, we discuss crucial steps in the life cycle of prions that have been revealed in ex vivo models. Importantly, the persistent propagation of prions in mitotically active cells argues that cellular processes are in place that not only allow recruitment of cellular PrP into growing prion aggregates but also enable the multiplication of infectious seeds that are transmitted to daughter cells. Comparison of prions with other protein aggregates demonstrates that not all the characteristics of prions are equally shared by prion-like aggregates. Future experiments may reveal to which extent aggregation-prone proteins associated with other neurodegenerative diseases can copy the replication strategies of prions.
Also flagged:TumorcancerGRK2angiogenesisTGF-βgrowth
Journal Article2013-10-25✓ 1 SnippetRivas V, Carmona R, Muñoz-Chápuli R, Mendiola M, Nogués L, Reglero C, Miguel-Martín M, García-Escudero R, Dorn GW, Hardisson D, Mayor F, Penela P.
In-Text Gene Mentions
Text
…Factor-III…
Show Full Abstract
Tumor vessel dysfunction is a pivotal event in cancer progression. Using an in vivo neovascularization model, we identified G protein-coupled receptor kinase 2 (GRK2) as a key angiogenesis regulator. An impaired angiogenic response involving immature vessels was observed in mice hemizygous for Grk2 or in animals with endothelium-specific Grk2 silencing. ECs isolated from these animals displayed intrinsic alterations in migration, TGF-β signaling, and formation of tubular networks. Remarkably, an altered pattern of vessel growth and maturation was detected in postnatal retinas from endothelium-specific Grk2 knockout animals. Mouse embryos with systemic or endothelium-selective Grk2 ablation had marked vascular malformations involving impaired recruitment of mural cells. Moreover, decreased endothelial Grk2 dosage accelerated tumor growth in mice, along with reduced pericyte vessel coverage and enhanced macrophage infiltration, and this transformed environment promoted decreased GRK2 in ECs and human breast cancer vessels. Our study suggests that GRK2 downregulation is a relevant event in the tumoral angiogenic switch.
Also flagged:cancerTIMELESScell cyclebehavioralcell proliferationcervical cancer
Journal Article2013-10-25✓ 2 SnippetsMao Y, Fu A, Leaderer D, Zheng T, Chen K, Zhu Y.
In-Text Gene Mentions
Results)
…In contrast, SOD2[44,45], RHOB[46,47], G0S2[48], EMP1[49], TNFRSF4[50], TNFSF4[51], DMBT1[52,53], LIFR[54], TFPI2[55], and EPHB6[56] are frequently down-regulated in cancer and may be associated with tumor suppression or favorable prognostic outcome.…
Results)
…[ 50 ],TNFSF4[ 51 ],…
Show Full Abstract
<h4>Background</h4>The circadian clock and cell cycle are two global regulatory systems that have pervasive behavioral and physiological effects on eukaryotic cells, and both play a role in cancer development. Recent studies have indicated that the circadian and cell cycle regulator, TIMELESS, may serve as a molecular bridge between these two regulatory systems.<h4>Methods</h4>To assess the role of TIMELESS in tumorigenesis, we analyzed TIMELESS expression data from publically accessible online databases. A loss-of-function analysis was then performed using TIMELESS-targeting siRNA oligos followed by a whole-genome expression microarray and network analysis. We further tested the effect of TIMELESS down-regulation on cell proliferation rates of a breast and cervical cancer cell line, as suggested by the results of our network analysis.<h4>Results</h4>TIMELESS was found to be frequently overexpressed in different tumor types compared to normal controls. Elevated expression of TIMELESS was significantly associated with more advanced tumor stage and poorer breast cancer prognosis. We identified a cancer-relevant network of transcripts with altered expression following TIMELESS knockdown which contained many genes with known functions in cancer development and progression. Furthermore, we observed that TIMELESS knockdown significantly decreased cell proliferation rate.<h4>Conclusions</h4>Our results suggest a potential role for TIMELESS in tumorigenesis, which warrants further investigation of TIMELESS expression as a potential biomarker of cancer susceptibility and prognostic outcome.
Also flagged:thrombophiliathromboembolismgenetic thrombophiliavenous thromboembolismanticoagulant deficiencynatural anticoagulant deficiency
Journal Article2013-10-25✓ 5 SnippetsKim HJ, Seo JY, Lee KO, Bang SH, Lee ST, Ki CS, Kim JW, Jung CW, Kim DK, Kim SH.
In-Text Gene Mentions
Abstract)
…Two SERPINC1 mutations causing type II antithrombin deficiency, Arg79Cys and Ser158Pro, were prevalent in the population group.…
Abstract)
…for PROS1 andSERPINC1for dosage mutations.…
Abstract)
…TwoSERPINC1mutations causing type…
Abstract)
…PROS1 , andSERPINC1, followed by…
Text
…ATIII…
Show Full Abstract
Hereditary natural anticoagulant deficiencies are the major cause of genetic thrombophilia in Asia. Given the growing acknowledgment of the risk of venous thromboembolism in Asian populations, we investigated the frequency and mutation spectrums of natural anticoagulant deficiency in Korea. The group of patients consisted of consecutive patients with venous thromboembolism screened for thrombophilia. Genetic tests were performed on suspicion of natural anticoagulant deficiency. For the population group, >3,000 individuals were screened from routine check-ups, and those with a low level (<1(st) percentile) of natural anticoagulant underwent genetic tests. Mutations were detected by direct sequencing of PROC, PROS1, and SERPINC1, followed by additional multiplex ligation-dependent probe amplification for PROS1 and SERPINC1 for dosage mutations. Among 500 patients screened, 127 were suspected of having a natural anticoagulant deficiency, and this was genetically confirmed in 71: protein C deficiency in 36 (50.7%), antithrombin deficiency in 21 (29.6%), and protein S deficiency in 14 (19.7%). Among 3,129 individuals from the population who were screened, the frequency of natural anticoagulant deficiency was ~1.0%: antithrombin deficiency 0.49%, protein C deficiency 0.35%, and protein S deficiency 0.16%. Two PROC mutations causing type I protein C deficiency were prevalent (Arg211Trp and Met406Ile in patients and Arg211Trp in the population). Two SERPINC1 mutations causing type II antithrombin deficiency, Arg79Cys and Ser158Pro, were prevalent in the population group. This is the first study on the genetic epidemiology of natural anticoagulant deficiencies in Korea. The results demonstrated that the frequencies and spectrum of mutations underlying genetic thrombophilia in Korea are different not only from those in Caucasians but also those in other Asian populations.
Also flagged:Polycystic ovary syndromePCOShyperandrogenismpolycystic ovaryinsulin resistancehirsutism
Journal Article2013-10-25No SnippetsShen W, Zhang Y, Li W, Cong J, Zhou Y, Ng EH, Wu X.
Show Full Abstract
<h4>Introduction</h4>Polycystic ovary syndrome (PCOS) is one of the most common endocrine disorders in reproductive-age women. Chinese herbal medicine has been used for the treatment of PCOS, but the evidence for its efficacy and safety is minimal. Tanshinones are a class of bioactive molecules isolated from Salvia miltiorrhiza, a commonly used herb in Traditional Chinese Medicine. This study aims to evaluate the efficacy of tanshinones on hyperandrogenism and quality of life in women with PCOS who do not attempt to conceive.<h4>Methods and analysis</h4>A total of 100 patients will be recruited and randomised into the tanshinone or placebo group. Tanshinone or placebo capsules will be taken orally for 12 weeks. The primary outcome parameter will be a change in plasma testosterone. Secondary end points will be changes in human chorionic gonadotropin-induced androgen response, insulin resistance, reproductive hormones, fasting lipid profiles, oral glucose tolerance test, quality of life and side effects.<h4>Ethics and dissemination</h4>Written informed consent will be obtained from each participant at the time of enrolling in the study. The trial has been approved by the Ethics Committee of First Affiliated Hospital of Heilongjiang University of Chinese Medicine. Results will be disseminated through a publicly accessible website.<h4>Registration details</h4>The study has been registered at the Chinese Clinical Trials Registry (ChiCTR-TRC-12002973) and at clinicaltrials.gov (NCT 01452477).
Hematopoietic cell transplantation (HCT) is increasingly offered as a curative option for many patients with hematologic malignancies. Improvements in HCT strategies and supportive care have resulted in a growing number of long-term survivors. However, these survivors are at an increased risk of developing long-term debilitating chronic health conditions, including premature cardiovascular disease. These complications are more common than in the general population, and there are well-described associations between therapeutic exposures, traditional cardiovascular risk factors, and subsequent cardiovascular disease risk. The authors present herein an overview of the current state of knowledge regarding pathogenesis and risk factors for some of the more commonly occurring cardiovascular complications after HCT, highlighting existing surveillance recommendations and future directions for research to minimize cardiovascular morbidity in these survivors.
Also flagged:gene expressiontranslationallocalizationdegradationbindinghnRNP K
Journal Article2013-10-25✓ 4 SnippetsHuppertz I, Attig J, D'Ambrogio A, Easton LE, Sibley CR, Sugimoto Y, Tajnik M, König J, Ule J.
In-Text Gene Mentions
Methods)
…An RBP of around 40 kDa co-purifies with STAU1 when using the standard iCLIP protocol (see no urea treatment in Fig. 5).…
Methods)
…FLAG-tagged Staufen 1 (STAU1) was immunoprecipitated with…
Methods)
…kDa co-purifies withSTAU1when using the…
Methods)
…the signal ofSTAU1-RNA complexes ( Fig.…
Show Full Abstract
RNA-binding proteins (RBPs) are key players in the post-transcriptional regulation of gene expression. Precise knowledge about their binding sites is therefore critical to unravel their molecular function and to understand their role in development and disease. Individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) identifies protein-RNA crosslink sites on a genome-wide scale. The high resolution and specificity of this method are achieved by an intramolecular cDNA circularization step that enables analysis of cDNAs that truncated at the protein-RNA crosslink sites. Here, we describe the improved iCLIP protocol and discuss critical optimization and control experiments that are required when applying the method to new RBPs.
Also flagged:OrganosiloxanebenzeneFLChydrocarbonbiphenyldimethylsiloxyl
Journal Article2013-10-25No SnippetsLin CH.
Show Full Abstract
A series of new organosiloxane ferroelectric liquid crystalline (FLC) materials have been synthesized, and their mesomorphic and physical properties have been characterized. Four new disiloxanes and trisiloxanes, containing biphenyl 4-hydroxybenzoate and phenyl 4-hydroxybiphenylcarboxylate as mesogenic units and eleven methylene unit as spacers and (2S,3S)-2-chloro-3-methylvalerate unit as chiral end groups. The molecule, using three phenyl ring as a mesogenic unit, formulates much wider liquid crystalline phase temperature ranges than that of a two phenyl ring unit. The phenyl arrangement differences of mesogenic unit result in the greater differences of the liquid crystal phase formation. The siloxane molecule induction is helpful to the more regular smectic phase formation and smectic phase stabilization, such as chiral SC (SC*) and SB phases. The siloxane molecule is helpful to reduce the phase transition temperature and broaden the liquid crystal temperature range of the SC* phase and, simultaneously, it will not induce chain crystallization phenomenon and dilute the Ps value. The synthesis and characterization of the new FLCs materials, which exhibit a room temperature SC* phase and higher spontaneous polarization are presented.
Also flagged:StrokedeathNeurogenesisinjurymiddle cerebral artery occlusionNetrin-1
Journal Article2013-10-24✓ 2 SnippetsNada SE, Tulsulkar J, Shah ZA.
In-Text Gene Mentions
Abstract)
…and its receptors (DCCand UNC5B) that…
Text
…DCC…
Show Full Abstract
Stroke is the fourth leading cause of death and a major cause of disability in stroke survivors. Studies have underlined the importance of repair mechanisms in the recovery phase of stroke. Neurogenesis in response to brain injury is one of the regeneration processes that, if enhanced, may offer better stroke treatment alternatives. Previously, we have demonstrated antioxidant, neuritogenic, and angiogenic properties of Ginkgo biloba/EGb 761® (EGb 761) in different mouse models of stroke. In the present study, we were interested to study whether EGb 761 could protect mice from permanent middle cerebral artery occlusion (pMCAO) and enhance neurogenesis. EGb 761 pre- and posttreated mice had lower infarct volume and improved motor skills with enhanced proliferation of neuronal stem/progenitor cells (NSPCs) at 24 h and 7 days posttreatment. Netrin-1 and its receptors (DCC and UNC5B) that mediate axonal attraction and repulsion were observed to be overexpressed in NSPCs only, implying that netrin-1 and its receptors might have partly played a role in enhanced neurogenesis. Interestingly, in heme oxygenase 1 knockout mice (HO1(-/-)), neurogenesis was significantly lower than in vehicle-treated mice at day 8. Furthermore, EGb 761 posttreated mice also demonstrated heme oxygenase 1 (HO1)-activated pathway of phosphorylated glycogen synthase kinase 3 α/β (p-GSK-3 α/β), collapsin response mediator protein 2 (CRMP-2), semaphorin3A (SEMA3A), and Wnt, suggesting probable signaling pathways involved in proliferation, differentiation, and migration of NSPCs. Together, these results propose that EGb 761 not only has antioxidant, neuritogenic, and angiogenic properties, but can also augment the repair and regeneration mechanisms following stroke.
Also flagged:TestosteroneEPOirontransferrin receptorerythropoiesisErythrocytosis
Journal Article2013-10-24✓ 1 SnippetBachman E, Travison TG, Basaria S, Davda MN, Guo W, Li M, Connor Westfall J, Bae H, Gordeuk V, Bhasin S.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Background</h4>The mechanisms by which testosterone increases hemoglobin and hematocrit remain unclear.<h4>Methods</h4>We assessed the hormonal and hematologic responses to testosterone administration in a clinical trial in which older men with mobility limitation were randomized to either placebo or testosterone gel daily for 6 months.<h4>Results</h4>The 7%-10% increase in hemoglobin and hematocrit, respectively, with testosterone administration was associated with significantly increased erythropoietin (EPO) levels and decreased ferritin and hepcidin levels at 1 and 3 months. At 6 months, EPO and hepcidin levels returned toward baseline in spite of continued testosterone administration, but EPO levels remained nonsuppressed even though elevated hemoglobin and hematocrit higher than at baseline, suggesting a new set point. Consistent with increased iron utilization, soluble transferrin receptor (sTR) levels and ratio of sTR/log ferritin increased significantly in testosterone-treated men. Hormonal and hematologic responses were similar in anemic participants. The majority of testosterone-treated anemic participants increased their hemoglobin into normal range.<h4>Conclusions</h4>Testosterone-induced increase in hemoglobin and hematocrit is associated with stimulation of EPO and reduced ferritin and hepcidin concentrations. We propose that testosterone stimulates erythropoiesis by stimulating EPO and recalibrating the set point of EPO in relation to hemoglobin and by increasing iron utilization for erythropoiesis.
Also flagged:mitochondrialphenylalanine-tRNA synthetaseinfantile-onset epilepsyMitochondrial aminoacyl-tRNA synthetasesprotein synthesisamino acids
Journal Article2013-10-24✓ 3 SnippetsAlmalki A, Alston CL, Parker A, Simonic I, Mehta SG, He L, Reza M, Oliveira JM, Lightowlers RN, McFarland R, Taylor RW, Chrzanowska-Lightowlers ZM.
In-Text Gene Mentions
Introduction)
…These include mutations in the genes for DARS2 causing leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation (LBSL) [7,8], RARS2 causing pontocerebellar hypoplasia type 6 (PCH6) [9], YARS2 causing myopathy, lactic acidosis and sideroblastic anaemia (MLASA) syndrome [10,11], SARS2 causing hyperuricemia, pulmonary hypertension, renal failure in infancy and alkalosis (HUPRA) syndrome [12], HARS2 associated with ovarian dysgenesis and sensorineural hearing loss [13], AARS2 causing infantile cardiomyopathy [14], EARS2 associated with leukoencephalopathy [15], MARS2 causing neurodegenerative phenotype in flies and autosomal recessive spastic ataxia frequently associated with leucoencephalopathy (ARSAL) in humans [16], LARS2 associated with premature ovarian failure and hearing loss in Perrault syndrome [17] and KARS, which encodes both the cytosolic and mitochondrial lysl-tRNA synthetases, and is associated with non-syndromic hearing impairment [18].…
Mitochondrial aminoacyl-tRNA synthetases (aaRSs) are essential enzymes in protein synthesis since they charge tRNAs with their cognate amino acids. Mutations in the genes encoding mitochondrial aaRSs have been associated with a wide spectrum of human mitochondrial diseases. Here we report the identification of pathogenic mutations (a partial genomic deletion and a highly conserved p. Asp325Tyr missense variant) in FARS2, the gene encoding mitochondrial phenylalanyl-tRNA synthetase, in a patient with early-onset epilepsy and isolated complex IV deficiency in muscle. The biochemical defect was expressed in myoblasts but not in fibroblasts and associated with decreased steady state levels of COXI and COXII protein and reduced steady state levels of the mt-tRNA(Phe) transcript. Functional analysis of the recombinant mutant p. Asp325Tyr FARS2 protein showed an inability to bind ATP and consequently undetectable aminoacylation activity using either bacterial tRNA or human mt-tRNA(Phe) as substrates. Lentiviral transduction of cells with wildtype FARS2 restored complex IV protein levels, confirming that the p.Asp325Tyr mutation is pathogenic, causing respiratory chain deficiency and neurological deficits on account of defective aminoacylation of mt-tRNA(Phe).
Also flagged:Mendelian disorderssodiumhearinglosscolon cancerCancer
Journal Article2013-10-24✓ 2 SnippetsBerg JS, Amendola LM, Eng C, Van Allen E, Gray SW, Wagle N, Rehm HL, DeChene ET, Dulik MC, Hisama FM, Burke W, Spinner NB, Garraway L, Green RC, Plon S, Evans JP, Jarvik GP, Members of the CSER Actionability and Return of Results Working Group.
In-Text Gene Mentions
Text
…Hemochromatosis…
Text
…HFE…
Show Full Abstract
As genomic and exomic testing expands in both the research and clinical arenas, determining whether, how, and which incidental findings to return to the ordering clinician and patient becomes increasingly important. Although opinion is varied on what should be returned to consenting patients or research participants, most experts agree that return of medically actionable results should be considered. There is insufficient evidence to fully inform evidence-based clinical practice guidelines regarding return of results from genome-scale sequencing, and thus generation of such evidence is imperative, given the rapidity with which genome-scale diagnostic tests are being incorporated into clinical care. We present an overview of the approaches to incidental findings by members of the Clinical Sequencing Exploratory Research network, funded by the National Human Genome Research Institute, to generate discussion of these approaches by the clinical genomics community. We also report specific lists of "medically actionable" genes that have been generated by a subset of investigators in order to explore what types of findings have been included or excluded in various contexts. A discussion of the general principles regarding reporting of novel variants, challenging cases (genes for which consensus was difficult to achieve across Clinical Sequencing Exploratory Research network sites), solicitation of preferences from participants regarding return of incidental findings, and the timing and context of return of incidental findings are provided.Genet Med 15 11, 860-867.Genetics in Medicine (2013); 15 11, 860-867. doi:10.1038/gim.2013.133.
Also flagged:litChromosomeOCDtopGene expressionMAF
Journal Article2013-10-24No SnippetsDavis LK, Yu D, Keenan CL, Gamazon ER, Konkashbaev AI, Derks EM, Neale BM, Yang J, Lee SH, Evans P, Barr CL, Bellodi L, Benarroch F, Berrio GB, Bienvenu OJ, Bloch MH, Blom RM, Bruun RD, Budman CL, Camarena B, Campbell D, Cappi C, Cardona Silgado JC, Cath DC, Cavallini MC, Chavira DA, Chouinard S, Conti DV, Cook EH, Coric V, Cullen BA, Deforce D, Delorme R, Dion Y, Edlund CK, Egberts K, Falkai P, Fernandez TV, Gallagher PJ, Garrido H, Geller D, Girard SL, Grabe HJ, Grados MA, Greenberg BD, Gross-Tsur V, Haddad S, Heiman GA, Hemmings SM, Hounie AG, Illmann C, Jankovic J, Jenike MA, Kennedy JL, King RA, Kremeyer B, Kurlan R, Lanzagorta N, Leboyer M, Leckman JF, Lennertz L, Liu C, Lochner C, Lowe TL, Macciardi F, McCracken JT, McGrath LM, Mesa Restrepo SC, Moessner R, Morgan J, Muller H, Murphy DL, Naarden AL, Ochoa WC, Ophoff RA, Osiecki L, Pakstis AJ, Pato MT, Pato CN, Piacentini J, Pittenger C, Pollak Y, Rauch SL, Renner TJ, Reus VI, Richter MA, Riddle MA, Robertson MM, Romero R, Rosàrio MC, Rosenberg D, Rouleau GA, Ruhrmann S, Ruiz-Linares A, Sampaio AS, Samuels J, Sandor P, Sheppard B, Singer HS, Smit JH, Stein DJ, Strengman E, Tischfield JA, Valencia Duarte AV, Vallada H, Van Nieuwerburgh F, Veenstra-Vanderweele J, Walitza S, Wang Y, Wendland JR, Westenberg HG, Shugart YY, Miguel EC, McMahon W, Wagner M, Nicolini H, Posthuma D, Hanna GL, Heutink P, Denys D, Arnold PD, Oostra BA, Nestadt G, Freimer NB, Pauls DL, Wray NR, Stewart SE, Mathews CA, Knowles JA, Cox NJ, Scharf JM.
Show Full Abstract
The direct estimation of heritability from genome-wide common variant data as implemented in the program Genome-wide Complex Trait Analysis (GCTA) has provided a means to quantify heritability attributable to all interrogated variants. We have quantified the variance in liability to disease explained by all SNPs for two phenotypically-related neurobehavioral disorders, obsessive-compulsive disorder (OCD) and Tourette Syndrome (TS), using GCTA. Our analysis yielded a heritability point estimate of 0.58 (se = 0.09, p = 5.64e-12) for TS, and 0.37 (se = 0.07, p = 1.5e-07) for OCD. In addition, we conducted multiple genomic partitioning analyses to identify genomic elements that concentrate this heritability. We examined genomic architectures of TS and OCD by chromosome, MAF bin, and functional annotations. In addition, we assessed heritability for early onset and adult onset OCD. Among other notable results, we found that SNPs with a minor allele frequency of less than 5% accounted for 21% of the TS heritability and 0% of the OCD heritability. Additionally, we identified a significant contribution to TS and OCD heritability by variants significantly associated with gene expression in two regions of the brain (parietal cortex and cerebellum) for which we had available expression quantitative trait loci (eQTLs). Finally we analyzed the genetic correlation between TS and OCD, revealing a genetic correlation of 0.41 (se = 0.15, p = 0.002). These results are very close to previous heritability estimates for TS and OCD based on twin and family studies, suggesting that very little, if any, heritability is truly missing (i.e., unassayed) from TS and OCD GWAS studies of common variation. The results also indicate that there is some genetic overlap between these two phenotypically-related neuropsychiatric disorders, but suggest that the two disorders have distinct genetic architectures.
Also flagged:Autismneurodevelopmental disorderautism spectrum disordersFragile XRettTimothy syndrome
Journal Article2013-10-24✓ 1 SnippetTsang KM, Croen LA, Torres AR, Kharrazi M, Delorenze GN, Windham GC, Yoshida CK, Zerbo O, Weiss LA.
In-Text Gene Mentions
Results)
…between INSC andSOX6(rs939046, P =…
Show Full Abstract
Effects of parental genotype or parent-offspring genetic interaction are well established in model organisms for a variety of traits. However, these transgenerational genetic models are rarely studied in humans. We have utilized an autism case-control study with 735 mother-child pairs to perform genome-wide screening for maternal genetic effects and maternal-offspring genetic interaction. We used simple models of single locus parent-child interaction and identified suggestive results (P<10(-4)) that cannot be explained by main effects, but no genome-wide significant signals. Some of these maternal and maternal-child associations were in or adjacent to autism candidate genes including: PCDH9, FOXP1, GABRB3, NRXN1, RELN, MACROD2, FHIT, RORA, CNTN4, CNTNAP2, FAM135B, LAMA1, NFIA, NLGN4X, RAPGEF4, and SDK1. We attempted validation of potential autism association under maternal-specific models using maternal-paternal comparison in family-based GWAS datasets. Our results suggest that further study of parental genetic effects and parent-child interaction in autism is warranted.
Journal Article2013-10-24✓ 2 SnippetsIbragimova I, Slifker MJ, Maradeo ME, Banumathy G, Dulaimi E, Uzzo RG, Cairns P.
In-Text Gene Mentions
Results)
…Several genes with significant hypermethylation were previously reported to be aberrantly methylated in cancers other than RCC e.g. the CALCA, CDH13, DCC, MYOD1, EDNRB, LAMC3, CDKN2B/p15, GATA4 and CAV1 genes.…
Results)
…the CALCA, CDH13,DCC, MYOD1, EDNRB, LAMC3,…
Show Full Abstract
The majority of renal cell carcinoma (RCC) is now incidentally detected and presents as small renal masses (SRMs) defined as ≤ 4 cm in size. SRMs are heterogeneous comprising several histological types of RCC each with different biology and behavior, and benign tumors mainly oncocytoma. The varied prognosis of the different types of renal tumor has implications for management options. A key epigenetic alteration involved in the initiation and progression of cancer is aberrant methylation in the promoter region of a gene. The hypermethylation is associated with transcriptional repression and is an important mechanism of inactivation of tumor suppressor genes in neoplastic cells. We have determined the genome-wide promoter methylation profiles of 47 pT1a and 2 pT1b clear cell, papillary or chromophobe RCC, 25 benign renal oncocytoma ≤ 4 cm and 4 normal renal parenchyma specimens by Infinium HumanMethylation27 beadchip technology. We identify gene promoter hypermethylation signatures that distinguish clear cell and papillary from each other, from chromophobe and oncocytoma, and from normal renal cells. Pairwise comparisons revealed genes aberrantly hypermethylated in a tumor type but unmethylated in normal, and often unmethylated in the other renal tumor types. About 0.4% to 1.7% of genes comprised the promoter methylome in SRMs. The Infinium methylation score for representative genes was verified by gold standard technologies. The genes identified as differentially methylated implicate pathways involved in metabolism, tissue response to injury, epithelial to mesenchymal transition (EMT), signal transduction and G-protein coupled receptors (GPCRs), cancer, and stem cell regulation in the biology of RCC. Our findings contribute towards an improved understanding of the development of RCC, the different biology and behavior of histological types, and discovery of molecular subtypes. The differential methylation signatures may have utility in early detection and particularly differential diagnosis for prognostic stratification as well as identify novel gene and pathway targets for therapeutic intervention.
Also flagged:TuberculosisTBdeathinfectious diseaseAIDSlung infection
Journal Article2013-10-24No SnippetsLiu Y, Jiang J, Wang X, Zhai F, Cheng X.
Show Full Abstract
Macrophage apoptosis is a host innate defense mechanism against tuberculosis (TB). In this study, we found that percentage of apoptotic cells in peripheral blood monocytes from patients with active TB was lower than that from healthy controls (p<0.001). To understand whether microRNAs can modulate apoptosis of monocytes, we investigated differentially expressed microRNAs in patients with active TB. miR-582-5p was mainly expressed in monocytes and was upregulated in patients with active TB. The apoptotic percentage of THP-1 cells transfected with miR-582-5p mimics was significantly lower than those transfected with negative control of microRNA mimics (p<0.001), suggesting that miR-582-5p could inhibit apoptosis of monocytes. To our knowledge, the role of miR-582-5p in regulating apoptosis of monocytes has not been reported so far. Systematic bioinformatics analysis indicated that FOXO1 might be a target gene for miR-582-5p and its 3'UTR contains potential binding sites for miR-582-5p. To determine whether miR-582-5p could influence FOXO1 expression, miR-582-5p mimics or negative control of microRNA mimics were transfected into THP-1 cells. RT-PCR and western blot analysis showed that the miR-582-5p could suppress both FOXO1 mRNA and protein expression. Co-transfection of miR-582-5p and FOXO1 3'UTR-luciferase reporter vector into cells demonstrated that significant decrease in luciferase activity was only found in reporter vector that contained a wild type sequence of FOXO1 3'UTR, suggesting that miR-582-5p could directly target FOXO1. In conclusion, miR-582-5p inhibited apoptosis of monocytes by down-regulating FOXO1 expression and might play an important role in regulating anti-M. tuberculosis directed immune responses.
Direct lineage reprogramming is a promising approach for human disease modeling and regenerative medicine, with poorly understood mechanisms. Here, we reveal a hierarchical mechanism in the direct conversion of fibroblasts into induced neuronal (iN) cells mediated by the transcription factors Ascl1, Brn2, and Myt1l. Ascl1 acts as an "on-target" pioneer factor by immediately occupying most cognate genomic sites in fibroblasts. In contrast, Brn2 and Myt1l do not access fibroblast chromatin productively on their own; instead, Ascl1 recruits Brn2 to Ascl1 sites genome wide. A unique trivalent chromatin signature in the host cells predicts the permissiveness for Ascl1 pioneering activity among different cell types. Finally, we identified Zfp238 as a key Ascl1 target gene that can partially substitute for Ascl1 during iN cell reprogramming. Thus, a precise match between pioneer factors and the chromatin context at key target genes is determinative for transdifferentiation to neurons and likely other cell types.
Also flagged:obesitynonalcoholic fatty liver diseaseNAFLDinsulinlipidmetabolism
Journal Article2013-10-24No SnippetsMehta R, Birerdinc A, Younossi ZM.
Show Full Abstract
Nonalcoholic fatty liver disease (NAFLD) is a complex disease. The considerable variability in the natural history of the disease suggests an important role for genetic variants in the disease development and progression. There is evidence based on genome-wide association studies and/or candidate gene studies that genetic polymorphisms underlying insulin signaling, lipid metabolism, oxidative stress, fibrogenesis, and inflammation can predispose individuals to NAFLD. This review highlights some of the genetic variants in NAFLD.
…The underlying pathology of HD is initiated when the gene that codes for the huntingtin (HTT) protein, located on the short arm of chromosome 4, contains an increased number of CAG repeats [1].…
Introduction)
…The R6/2 mouse model of HD expresses the N-terminal portion of human htt, containing a highly expanded CAG repeat (145 to 155), and develops progressive neurological phenotypes resembling HD [3].…
Introduction)
…for the huntingtin (HTT) protein, located on…
Introduction)
…portion of humanhtt, containing a highly…
Show Full Abstract
<h4>Introduction</h4>Huntington's disease (HD) is an autosomal dominant disorder caused by an expanded CAG repeat on the short arm of chromosome 4 resulting in cognitive decline, motor dysfunction, and death, typically occurring 15 to 20 years after the onset of motor symptoms. Neuropathologically, HD is characterized by a specific loss of medium spiny neurons in the caudate and the putamen, as well as subsequent neuronal loss in the cerebral cortex. The transgenic R6/2 mouse model of HD carries the N-terminal fragment of the human HD gene (145 to 155 repeats) and rapidly develops some of the behavioral characteristics that are analogous to the human form of the disease. Mesenchymal stem cells (MSCs) have shown the ability to slow the onset of behavioral and neuropathological deficits following intrastriatal transplantation in rodent models of HD. Use of MSCs derived from umbilical cord (UC) offers an attractive strategy for transplantation as these cells are isolated from a noncontroversial and inexhaustible source and can be harvested at a low cost. Because UC MSCs represent an intermediate link between adult and embryonic tissue, they may hold more pluripotent properties than adult stem cells derived from other sources.<h4>Methods</h4>Mesenchymal stem cells, isolated from the UC of day 15 gestation pups, were transplanted intrastriatally into 5-week-old R6/2 mice at either a low-passage (3 to 8) or high-passage (40 to 50). Mice were tested behaviorally for 6 weeks using the rotarod task, the Morris water maze, and the limb-clasping response. Following behavioral testing, tissue sections were analyzed for UC MSC survival, the immune response to the transplanted cells, and neuropathological changes.<h4>Results</h4>Following transplantation of UC MSCs, R6/2 mice did not display a reduction in motor deficits but there appeared to be transient sparing in a spatial memory task when compared to untreated R6/2 mice. However, R6/2 mice receiving either low- or high-passage UC MSCs displayed significantly less neuropathological deficits, relative to untreated R6/2 mice.<h4>Conclusions</h4>The results from this study demonstrate that UC MSCs hold promise for reducing the neuropathological deficits observed in the R6/2 rodent model of HD.
Also flagged:watersynthesisaminesperfluoropolyetherpolyetherbinding
Journal Article2013-10-23No SnippetsDeJournette CJ, Kim J, Medlen H, Li X, Vincent LJ, Easley CJ.
Show Full Abstract
Currently, one of the most prominent methods used to impart biocompatibility to aqueous-in-oil droplets is to synthesize a triblock copolymer surfactant composed of perfluoropolyether and polyether blocks. The resulting surfactants (EA surfactant, KryJeffa, etc.) allow generation of highly biocompatible droplet surfaces while maintaining the heat stability of the starting material. However, production of these surfactants requires expertise in synthetic organic chemistry, creating a barrier to widespread adoption in the field. Herein, we describe a simple alternative to synthetic modification of surfactants to impart biocompatibility. We have observed that aqueous-in-oil droplet surfaces can be made biocompatible and heat stable by merely exploiting binding interactions between polyetherdiamine additives in the aqueous phase and carboxylated perfluorocarbon surfactants in the oil phase. Droplets formed under these conditions are shown to possess biocompatible surfaces capable of supporting picoliter-scale protein assays, droplet polymerase chain reaction (PCR), and droplet DNA amplification with isothermal recombinase polymerase amplification (RPA). Droplets formed with polyetherdiamine aqueous additives are stable enough to withstand temperature cycling during PCR (30-40 cycles at 60-94 °C) while maintaining biocompatibility, and the reaction efficiency of RPA is shown to be similar to that with a covalently modified surfactant (KryJeffa). The binding interaction was confirmed with various methods, including FT-IR spectroscopy, NMR spectroscopy, electrospray ionization mass spectrometry (ESI-MS), and fluorescence microscopy. Overall, our results suggest that, by simply introducing a commercially-available, polyetherdiamine additive (Jeffamine ED-900) to the aqueous phase, researchers can avoid synthetic methods in generating biocompatible droplet surfaces capable of supporting DNA and protein analysis at the subnanoliter scale.
Also flagged:chronic myeloid leukemiahomoharringtoninealkaloidleukemiaHHTForkhead box M1
Journal Article2013-10-23No SnippetsZhou M, Zeng J, Wang X, Guo Q, Huang T, Shen H, Fu Y, Wang L, Jia J, Chen C.
Show Full Abstract
<h4>Background</h4>Homoharringtonine (HHT) is a kind of cephalotaxus alkaloid used in traditional Chinese medicine. Although HHT has been successfully used as a therapeutic agent for leukemia, the drug resistance and toxicity are major concerns. MicroRNAs (miRNAs) have been identified to modulate cellular sensitivity to anticancer drugs. We examined the synergistic action between miR-370 and HHT in vitro and in vivo.<h4>Methods</h4>The synergistic action between miR-370 and HHT was examined by flow cytometry. The effect of HHT on miR-370 expression was determined by quantitative RT-PCR (qRT-PCR). The expression of miR-370 and Forkhead box M1 (FoxM1) in 23 patients with newly diagnosed chronic-phase chronic myeloid leukemia (CML-CP) and 10 patients with blast-crisis CML (CML-BP) as well as miR-370-targeted FoxM1 was determined by qRT-PCR and western blot analysis.<h4>Results</h4>Ectopic expression of miR-370 sensitized the CML K562 cell line to HHT by targeting FoxM1, the major regulator in cell proliferation and apoptosis. miR-370 significantly promoted HHT-mediated cell apoptosis and miR-370 and HHT cooperated in affecting FoxM1 expression. As well, miR-370 was moderately upregulated after HHT treatment in K562 cells. In addition, the expression of miR-370 was significantly reduced in CML patients as compared with healthy controls. Furthermore, the expression of miR-370 was lower in CML-BP than CML-CP patients.<h4>Conclusions</h4>MiR-370 sensitized K562 cells to HHT by inducing apoptosis in part by downregulation of FoxM1 expression. These findings may provide further information for CML treatment with HHT.
Also flagged:ossificationcaspase-3IL-6IhhICAM-1PAI-1
Journal Article2013-10-23✓ 1 SnippetPiao J, Tsuji K, Ochi H, Iwata M, Koga D, Okawa A, Morita S, Takeda S, Asou Y.
In-Text Gene Mentions
Results)
…expression of Sox5,Sox6and Sox9, the…
Show Full Abstract
Sirtuin 6 (Sirt6) is a mammalian homologue of NAD⁺-dependent histone deacetylase Sir2. Although Sirt6⁻/⁻ mice exhibit growth retardation, the role of Sirt6 in cartilage metabolism is unclear. The aim of this study was to investigate the Sirt6 signaling pathway in cartilage metabolism. Immunohistological evaluation of the tibial growth plate in Sirt6⁻/⁻ mice exhibited impaired proliferation and differentiation of chondrocytes, reduced expression of Indian hedgehog (Ihh), and a senescent phenotype. When Sirt6 was knocked down in chondrocytes in vitro, expression of Ihh and its downstream genes were reduced. Impaired differentiation by Sirt6 silencing was completely rescued by administration of a Hh signal agonist. When sirtuins were activated, chondrocyte differentiation was enhanced together with activation of Ihh signal, and these effects were abrogated by Sirt6 silencing. ChIP assay revealed the affinity of ATF4 to the Ihh promoter was markedly decreased by Sirt6 knockdown. These data indicate Sirt6 directly controls proliferation and differentiation of chondrocytes.
Also flagged:serotoninpositronserotonin transportermood disordersbehavioral
Journal Article2013-10-23✓ 3 SnippetsKalbitzer J, Kalbitzer U, Knudsen GM, Cumming P, Heinz A.
In-Text Gene Mentions
Title)
…changes of brain5-HTTas intermediate phenotype…
Abstract)
…of serotonin transporter (5-HTT) in the human…
Abstract)
…regulated via the5-HTT, are responsible for…
Show Full Abstract
Molecular imaging studies with positron emission tomography have revealed that the availability of serotonin transporter (5-HTT) in the human brain fluctuates over the course of the year. This effect is most pronounced in carriers of the short allele of the 5-HTT promoter region (5-HTTLPR), which has in several previous studies been linked to an increased risk to develop mood disorders. We argue that long-lasting fluctuations in the cerebral serotonin transmission, which is regulated via the 5-HTT, are responsible for mediating responses to environmental changes based on an assessment of the expected "safety" of the environment; this response is obtained in part through serotonergic modulation of the hypothalamic-pituitary-adrenal (HPA) axis. We posit that the intermediate phenotype of the s-allele may properly be understood as mediating a trade-off, wherein increased responsiveness of cerebral serotonin transmission to seasonal and other forms of environmental change imparts greater behavioral flexibility, at the expense of increased vulnerability to stress. This model may explain the somewhat higher prevalence of the s-allele in some human populations dwelling at geographic latitudes with pronounced seasonal climatic changes, while this hypothesis does not rule out that genetic drift plays an additional or even exclusive role. We argue that s-allele manifests as an intermediate phenotype in terms of an increased responsiveness of the 5-HTT expression to number of daylight hours, which may serve as a stable surrogate marker of other environmental factors, such as availability of food and safety of the environment in populations that live closer to the geographic poles.
Also flagged:PrPAβpeptideAlzheimer diseasedeathtransmissible spongiform encephalopathies
Journal Article2013-10-23✓ 1 SnippetRubel AA, Ryzhova TA, Antonets KS, Chernoff YO, Galkin A.
In-Text Gene Mentions
Text
…Htt…
Show Full Abstract
Alzheimer disease is associated with the accumulation of oligomeric amyloid β peptide (Aβ), accompanied by synaptic dysfunction and neuronal death. Polymeric form of prion protein (PrP), PrP(Sc), is implicated in transmissible spongiform encephalopathies (TSEs). Recently, it was shown that the monomeric cellular form of PrP (PrP(C)), located on the neuron surface, binds Aβ oligomers (and possibly other β-rich conformers) via the PrP(23-27) and PrP(90-110) segments, acting as Aβ receptor. On the other hand, PrP(Sc) polymers efficiently bind to Aβ monomers and accelerate their oligomerization. To identify specific PrP sequences that are essential for the interaction between PrP polymers and Aβ peptide, we have co-expressed Aβ and PrP (or its shortened derivatives), fused to different fluorophores, in the yeast cell. Our data show that the 90-110 and 28-89 regions of PrP control the binding of proteinase-resistant PrP polymers to the Aβ peptide, whereas the 23-27 segment of PrP is dispensable for this interaction. This indicates that the set of PrP fragments involved in the interaction with Aβ depends on PrP conformational state.
Also flagged:mitotic spindlecohesinspindleSmc4sir2GFP
Journal Article2013-10-23✓ 5 SnippetsStephens AD, Quammen CW, Chang B, Haase J, Taylor RM, Bloom K.
In-Text Gene Mentions
Introduction)
…Condensinis best fitted…
Results)
…Condensinhad a 3…
Results)
…Condensinwidth and clustering…
Results)
…Condensinis required for…
Results)
…Condensin, unlike cohesin, is…
Show Full Abstract
In mitosis, the pericentromere is organized into a spring composed of cohesin, condensin, and a rosette of intramolecular chromatin loops. Cohesin and condensin are enriched in the pericentromere, with spatially distinct patterns of localization. Using model convolution of computer simulations, we deduce the mechanistic consequences of their spatial segregation. Condensin lies proximal to the spindle axis, whereas cohesin is radially displaced from condensin and the interpolar microtubules. The histone deacetylase Sir2 is responsible for the axial position of condensin, while the radial displacement of chromatin loops dictates the position of cohesin. The heterogeneity in distribution of condensin is most accurately modeled by clusters along the spindle axis. In contrast, cohesin is evenly distributed (barrel of 500-nm width × 550-nm length). Models of cohesin gradients that decay from the centromere or sister cohesin axis, as previously suggested, do not match experimental images. The fine structures of cohesin and condensin deduced with subpixel localization accuracy reveal critical features of how these complexes mold pericentric chromatin into a functional spring.
Also flagged:geneticneurodegenerative diseasechoreapsychiatric disordersmitochondrialaxonal
Journal Article2013-10-23✓ 5 SnippetsMoumné L, Betuing S, Caboche J.
In-Text Gene Mentions
S I O 001029)
…Exp-Htt induces upregulation of p53 and its downstream targets, Bax and Puma, both in vitro and in postmortem brains of HD patients (32, 33).…
Introduction)
…Huntington’s disease (HD) is a dominantly inherited genetic disorder induced by an abnormal expansion of a CAG trinucleotide repeat at the 5′ terminal part of the Huntingtin (Htt) gene leading to a polyglutamine expansion in the Htt protein (1).…
Introduction)
…Expansion of polyglutamine in Htt leads to protein aggregation (9), a mechanism thought to be primarily involved in several neurological disorders caused by CAG repeats.…
S I O 001029)
…Decreased expression of PGC1-α accounts for abnormal myelination in HD, since Exp-Htt-induced down-regulation of PGC1-α in oligodendrocytes leads to inhibition of genes involved in myelination (40).…
Abstract)
…Huntington’s Disease (HD) is a genetic neurodegenerative disease caused by a CAG expansion in the gene encoding Huntingtin (Htt).…
Show Full Abstract
Huntington's Disease (HD) is a genetic neurodegenerative disease caused by a CAG expansion in the gene encoding Huntingtin (Htt). It is characterized by chorea, cognitive, and psychiatric disorders. The most affected brain region is the striatum, and the clinical symptoms are directly correlated to the rate of striatal degeneration. The wild-type Htt is a ubiquitous protein and its deletion is lethal. Mutated (expanded) Htt produces excitotoxicity, mitochondrial dysfunctions, axonal transport deficit, altered proteasome activity, and gene dysregulation. Transcriptional dysregulation occurs at early neuropathological stages in HD patients. Multiple genes are dysregulated, with overlaps of altered transcripts between mouse models of HD and patient brains. Nuclear localization of Exp-Htt interferes with transcription factors, co-activators, and proteins of the transcriptional machinery. Another key mechanism described so far, is an alteration of cytoplasmic retention of the transcriptional repressor REST, which is normally associated with wild-type Htt. As such, Exp-Htt causes alteration of transcription of multiple genes involved in neuronal survival, plasticity, signaling, and mitochondrial biogenesis and respiration. Besides these transcriptional dysregulations, Exp-Htt affects the chromatin structure through altered post-translational modifications (PTM) of histones and methylation of DNA. Multiple alterations of histone PTM are described, including acetylation, methylation, ubiquitylation, polyamination, and phosphorylation. Exp-Htt also affects the expression and regulation of non-coding microRNAs (miRNAs). First multiple neural miRNAs are controlled by REST, and dysregulated in HD, with concomitant de-repression of downstream mRNA targets. Second, Exp-Htt protein or RNA may also play a major role in the processing of miRNAs and hence pathogenesis. These pleiotropic effects of Exp-Htt on gene expression may represent seminal deleterious effects in the pathogenesis of HD.
<h4>Background</h4>Obstetric hemorrhage is the leading cause of maternal mortality. Using a cluster randomized design, we investigated whether application of the Non-pneumatic Anti-Shock Garment (NASG) before transport to referral hospitals (RHs) from primary health care centers (PHCs) decreased adverse outcomes among women with hypovolemic shock. We hypothesized the NASG group would have a 50% reduction in adverse outcomes.<h4>Methods and findings</h4>We randomly assigned 38 PHCs in Zambia and Zimbabwe to standard obstetric hemorrhage/shock protocols or the same protocols plus NASG prior to transport. All women received the NASG at the RH. The primary outcomes were maternal mortality; severe, end-organ failure maternal morbidity; and a composite mortality/morbidity outcome, which we labeled extreme adverse outcome (EAO). We also examined whether the NASG contributed to negative side effects and secondary outcomes. The sample size for statistical power was not reached; of a planned 2400 women, 880 were enrolled, 405 in the intervention group. The intervention was associated with a non-significant 46% reduced odds of mortality (OR 0.54, 95% CI 0.14-2.05, p = 0.37) and 54% reduction in composite EAO (OR 0.46, 95% CI 0.13-1.62, p = 0.22). Women with NASGs recovered from shock significantly faster (HR 1.25, 95% CI 1.02-1.52, p = 0.03). No differences were observed in secondary outcomes or negative effects. The main limitation was small sample size.<h4>Conclusions</h4>Despite a lack of statistical significance, the 54% reduced odds of EAO and the significantly faster shock recovery suggest there might be treatment benefits from earlier application of the NASG for women experiencing delays obtaining definitive treatment for hypovolemic shock. As there are no other tools for shock management outside of referral facilities, and no safety issues found, consideration of NASGs as a temporizing measure during delays may be warranted. A pragmatic study with rigorous evaluation is suggested for further research.<h4>Trial registration</h4>ClinicalTrials.gov NCT00488462.
Also flagged:signal transductioncell-to-cell signalingcellular growthß1-integrinepidermal growth factor receptorEGFR
Journal Article2013-10-23No SnippetsHongisto V, Jernström S, Fey V, Mpindi JP, Kleivi Sahlberg K, Kallioniemi O, Perälä M.
Show Full Abstract
The traditional method for studying cancer in vitro is to grow immortalized cancer cells in two-dimensional monolayers on plastic. However, many cellular features are impaired in these artificial conditions, and large changes in gene expression compared to tumors have been reported. Three-dimensional cell culture models have become increasingly popular and are suggested to be better models than two-dimensional monolayers due to improved cell-to-cell contact and structures that resemble in vivo architecture. The aim of this study was to develop a simple high-throughput three-dimensional drug screening method and to compare drug responses in JIMT1 breast cancer cells when grown in two dimensions, in poly(2-hydroxyethyl methacrylate) induced anchorage-independent three-dimensional models, and in Matrigel three-dimensional cell culture models. We screened 102 compounds with multiple concentrations and biological replicates for their effects on cell proliferation. The cells were either treated immediately upon plating, or they were allowed to grow in three-dimensional cultures for 4 days before the drug treatment. Large variations in drug responses were observed between the models indicating that comparisons of culture model-influenced drug sensitivities cannot be made based on the effects of a single drug. However, we show with the 63 most prominent drugs that, in general, JIMT1 cells grown on Matrigel were significantly more sensitive to drugs than cells grown in two-dimensional cultures, while the responses of cells grown in poly(2-hydroxyethyl methacrylate) resembled those of the two-dimensional cultures. Furthermore, comparing the gene expression profiles of the cell culture models to xenograft tumors indicated that cells cultured in Matrigel and as xenografts most closely resembled each other. In this study, we also suggest that three-dimensional cultures can provide a platform for systematic experimentation of larger compound collections in a high-throughput mode and be used as alternatives to traditional two-dimensional screens for better comparability to the in vivo state.
<h4>Rationale</h4>Bronchopulmonary dysplasia is one of the most serious complications observed in premature infants. Thanks to microarray technique, expression of nearly all human genes can be reliably evaluated.<h4>Objective</h4>To compare whole genome expression in the first month of life in groups of infants with and without bronchopulmonary dysplasia.<h4>Methods</h4>111 newborns were included in the study. The mean birth weight was 1029 g (SD:290), and the mean gestational age was 27.8 weeks (SD:2.5). Blood samples were drawn from the study participants on the 5th, 14th and 28th day of life. The mRNA samples were evaluated for gene expression with the use of GeneChip® Human Gene 1.0 ST microarrays. The infants were divided into two groups: bronchopulmonary dysplasia (n=68) and control (n=43).<h4>Results</h4>Overall 2086 genes were differentially expressed on the day 5, only 324 on the day 14 and 3498 on the day 28. Based on pathway enrichment analysis we found that the cell cycle pathway was up-regulated in the bronchopulmonary dysplasia group. The activation of this pathway does not seem to be related with the maturity of the infant. Four pathways related to inflammatory response were continuously on the 5(th), 14(th) and 28(th) day of life down-regulated in the bronchopulmonary dysplasia group. However, the expression of genes depended on both factors: immaturity and disease severity. The most significantly down-regulated pathway was the T cell receptor signaling pathway.<h4>Conclusion</h4>The results of the whole genome expression study revealed alteration of the expression of nearly 10% of the genome in bronchopulmonary dysplasia patients.
Also flagged:gene expressionneurological disorderHuntingtinHDpathogenesiscoagulation
Journal Article2013-10-23✓ 1 SnippetDiamanti D, Mori E, Incarnato D, Malusa F, Fondelli C, Magnoni L, Pollio G.
In-Text Gene Mentions
Introduction)
…R6/2 is one of the first HD transgenic mouse model created, expressing only the N-terminal fragment of HTT (exon 1) and it is characterized by short survival and development of pathological features mimicking human stages of disease [13,14].…
Show Full Abstract
<h4>Background</h4>Huntington Disease (HD) is a progressive neurological disorder, with pathological manifestations in brain areas and in periphery caused by the ubiquitous expression of mutant Huntingtin protein. Transcriptional dysregulation is considered a key molecular mechanism responsible of HD pathogenesis but, although numerous studies investigated mRNA alterations in HD, so far none evaluated a whole gene expression profile in blood of R6/2 mouse model.<h4>Findings</h4>To discover novel pathogenic mechanisms and potential peripheral biomarkers useful to monitor disease progression or drug efficacy, a microarray study was performed in blood of R6/2 at manifest stage and wild type littermate mice. This approach allowed to propose new peripheral molecular processes involved in HD and to suggest different panels of candidate biomarkers. Among the discovered deregulated processes, we focused on specific ones: complement and coagulation cascades, PPAR signaling, cardiac muscle contraction, and dilated cardiomyopathy pathways. Selected genes derived from these pathways were additionally investigated in other accessible tissues to validate these matrices as source of biomarkers, and in brain, to link central and peripheral disease manifestations.<h4>Conclusions</h4>Our findings validated the skeletal muscle as suitable source to investigate peripheral transcriptional alterations in HD and supported the hypothesis that immunological alteration may contribute to neurological degeneration. Moreover, the identification of altered signaling in mouse blood enforce R6/2 transgenic mouse as a powerful HD model while suggesting novel disease biomarkers for pre-clinical investigation.
<h4>Background and aims</h4>There is growing evidence that white adipose tissue is an important contributor in the pathogenesis of alcoholic liver disease (ALD). We investigated serum concentrations of total adiponectin (Acrp30), leptin, and resistin in patients with chronic alcohol abuse and different grades of liver dysfunction, as well as ALD complications.<h4>Materials and methods</h4>One hundred forty-seven consecutive inpatients with ALD were prospectively recruited. The evaluation of plasma adipokine levels was performed using immunoenzymatic ELISA tests. Multivariable logistic regression was applied in order to select independent predictors of advanced liver dysfunction and the disease complications.<h4>Results</h4>Acrp30 and resistin levels were significantly higher in patients with ALD than in controls. Lower leptin levels in females with ALD compared to controls, but no significant differences in leptin concentrations in males, were found. High serum Acrp30 level revealed an independent association with advanced liver dysfunction, as well as the development of ALD complications, that is, ascites and hepatic encephalopathy.<h4>Conclusion</h4>Gender-related differences in serum leptin concentrations may influence the ALD course, different in females compared with males. Serum Acrp30 level may serve as a potential prognostic indicator for patients with ALD.
The RING finger ubiquitin ligase seven in absentia homolog 2 (Siah2) was identified in the R7 photoreceptor cells of Drosophila melanogaster, and it regulates the stability of prolyl hydroxylase domains (PHDs), with a concomitant effect on HIF-1α availability in the hypoxia response pathway. We previously reported that the hypoxia response pathway contributes to eye development during the embryonic development of Xenopus laevis. In this paper, the role of Siah2-mediated hypoxia response pathway in eye development of X. laevis embryos was further characterized. Xenopus Siah2 (xSiah2) mRNA was detected in lens tissue and xSiah2 overexpression caused a thickened lens placode, leading to loss of the optic lens. In embryos overexpressing xSiah2, lens marker gene transcription was reduced, suggesting that xSiah2 contributes to lens formation. xSiah2 overexpression decreased Xenopus PHD accumulation and increased Xenopus HIF-1α (xHIF-1α) accumulation. xHIF-1α degeneration with resveratrol restored the optical abnormality caused by xSiah2 overexpression, suggesting that the xSiah2-mediated hypoxia response pathway contributes to lens formation. Moreover, xSiah2 overexpression decreased endothelial-mesenchymal transition (EMT)-related Notch signaling-responsive genes transcription during the invasion of the lens placode. Our results suggest that the hypoxia response pathway plays an important role in the regulation of the EMT via the Notch signaling pathway during lens formation.
<h4>Background</h4>Hereditary haemochromatosis may result in severe organ damage which can be prevented by therapy. We studied the possible advantages and disadvantages of erythrocytapheresis as compared with phlebotomy in patients with hereditary haemochromatosis.<h4>Materials and methods</h4>In a prospective, randomised, open-label study, patients with hereditary haemochromatosis were randomised to bi-weekly apheresis or weekly whole blood phlebotomy. Primary end-points were decrease in ferritin levels and transferrin saturation. Secondary endpoints were decrease in haemoglobin levels, discomfort during the therapeutic procedure, costs and technicians' working time.<h4>Results</h4>Sixty-two patients were included. Thirty patients were randomised to apheresis and 32 to whole blood phlebotomy. Initially, ferritin levels declined more rapidly in the apheresis group, and the difference became statistically highly significant at 11 weeks; however, time to normalisation of ferritin level was equal in the two groups. We observed no significant differences in decline of transferrin saturation, haemoglobin levels or discomfort. The mean cumulative technician time consumption until the ferritin level reached 50 μg/L was longer in the apheresis group, but the difference was not statistically significant. The cumulative costs for materials until achievement of the desired ferritin levels were three-fold higher in the apheresis group.<h4>Conclusion</h4>Treatment of hereditary haemochromatosis with erythrocytapheresis instead of whole blood phlebotomy results in a more rapid initial decline in ferritin levels and a reduced number of procedures per patient, but not in earlier achievement of target ferritin level. The frequency of discomfort was equally low with the two methods. The costs and, probably, technician time consumption were higher in the apheresis group.
Also flagged:ironinflammatory bowel diseasesulfateHbisomaltosideIron isomaltoside 1
Journal Article2013-10-22✓ 1 SnippetReinisch W, Staun M, Tandon RK, Altorjay I, Thillainayagam AV, Gratzer C, Nijhawan S, Thomsen LL.
In-Text Gene Mentions
Methods)
…causes of anemia,hemochromatosis, hemosiderosis, hypersensitiv…
Show Full Abstract
<h4>Objectives</h4>In the largest head-to-head comparison between an oral and an intravenous (IV) iron compound in patients with inflammatory bowel disease (IBD) so far, we strived to determine whether IV iron isomaltoside 1,000 is non-inferior to oral iron sulfate in the treatment of iron deficiency anemia (IDA).<h4>Methods</h4>This prospective, randomized, comparative, open-label, non-inferiority study was conducted at 36 sites in Europe and India. Patients with known intolerance to oral iron were excluded. A total of 338 IBD patients in clinical remission or with mild disease, a hemoglobin (Hb) <12 g/dl, and a transferrin saturation (TSAT) <20% were randomized 2:1 to receive either IV iron isomaltoside 1,000 according to the Ganzoni formula (225 patients) or oral iron sulfate 200 mg daily (equivalent to 200 mg elemental iron; 113 patients). An interactive web response system method was used to randomize the eligible patient to the treatment groups. The primary end point was change in Hb from baseline to week 8. Iron isomaltoside 1,000 and iron sulfate was compared by a non-inferiority assessment with a margin of -0.5 g/dl. The secondary end points, which tested for superiority, included change in Hb from baseline to weeks 2 and 4, change in s-ferritin, and TSAT to week 8, number of patients who discontinued study because of lack of response or intolerance of investigational drugs, change in total quality of life (QoL) score to weeks 4 and 8, and safety. Exploratory analyses included a responder analysis (proportion of patients with an increase in Hb ≥2 g/dl after 8 weeks), the effect of regional differences and total iron dose level, and other potential predictors of the treatment response.<h4>Results</h4>Non-inferiority in change of Hb to week 8 could not be demonstrated. There was a trend for oral iron sulfate being more effective in increasing Hb than iron isomaltoside 1,000. The estimated treatment effect was -0.37 (95% confidence interval (CI): -0.80, 0.06) with P=0.09 in the full analysis set (N=327) and -0.45 (95% CI: -0.88, -0.03) with P=0.04 in the per protocol analysis set (N=299). In patients treated with IV iron isomaltoside 1,000, the mean change in s-ferritin concentration was higher with an estimated treatment effect of 48.7 (95% CI: 18.6, 78.8) with P=0.002, whereas the mean change in TSAT was lower with an estimated treatment effect of -4.4 (95% CI: -7.4, -1.4) with P=0.005, compared with patients treated with oral iron. No differences in changes of QoL were observed. The safety profile was similar between the groups. The proportion of responders with Hb ≥2 g/dl (IV group: 67%; oral group: 61%) were comparable between the groups (P=0.32). Iron isomaltoside 1,000 was more efficacious with higher cumulative doses of >1,000 mg IV. Significant predictors of Hb response to IV iron treatment were baseline Hb and C-reactive protein (CRP).<h4>Conclusions</h4>We could not demonstrate non-inferiority of IV iron isomaltoside 1,000 compared with oral iron in this study. Based on the dose-response relationship observed with the IV iron compound, we suggest that the true iron demand of IV iron was underestimated by the Ganzoni formula in our study. Alternative calculations including Hb and CRP should be explored to gauge iron stores in patients with IBD.
Also flagged:Familial adenomatous polyposisFAPtumourpolypspolyposismalignant tumour
Journal Article2013-10-22✓ 2 SnippetsPlawski A, Banasiewicz T, Borun P, Kubaszewski L, Krokowicz P, Skrzypczak-Zielinska M, Lubinski J.
In-Text Gene Mentions
Introduction)
…It has been reported that a series of genes can be lost (P53, MCC, k-RAS and DCC) but without APC tumour development does not occur [6].…
Introduction)
…MCC, k-RAS andDCC) but without APC…
Show Full Abstract
Familial adenomatous polyposis (FAP) is a well-defined autosomal dominant predisposition to the development of polyposis in the colon and rectum at unusually early ages. The first symptoms of FAP are diarrhea and blood in the stool. Weight loss and weaknesses occur after the development of advanced tumour. The incidence of the FAP disorder is one per 10000 newborns. There are high levels of heterogeneity with regard to the number and timing of the occurrence of polyps. The classical form of FAP is characterized by the presence of more than 100 polyps, which appear in the second decade of life. The average time of occurrence of polyps is 15 years. The earliest symptoms of polyposis have been observed in a three-year-old child. The polyps are characterized by large potential for the development towards malignant tumour. Malignancy can occur from late childhood onwards. Attenuated adenomatous polyposis coli is characterized by a more benign course of disease in contrast to classical FAP. The occurrence of FAP is associated with mutations in the APC tumour suppressor gene, which was described in 1991. The APC gene is located on chromosome 5q21 and is involved in cell proliferation control. A recessive form of adenomatous polyposis is caused by mutations in the base excision repair gene - MUTYH gene. The MUTYH gene is involved in repairing DNA lesions as a result of oxidative DNA damage. MUTYH associated polyposis (MAP) is a predisposition to the development of polyps of the colon but the number of polyps is lower in comparison to classical FAP. The high risks of cancer observed in these two diseases make them important medical issues. Molecular studies of colonic polyposis have been performed in Poland for over fifteen years. A DNA Bank for Polish FAP patients was established at the Institute of Human Genetics in Poznan in which DNA samples from 600 FAP families have been collected.
Also flagged:VP1cDNACA6Hand, foot, and mouth diseaseinfectious diseasedeath
Journal Article2013-10-22✓ 5 SnippetsXu M, Su L, Cao L, Zhong H, Dong N, Xu J.
In-Text Gene Mentions
Introduction)
…Sporadic reports demonstrated that various enterovirus genotypes, such as CA2, CA4, CA5, CA6, CA8, CA10 and CA12 from species A, CB2 and CB4 from species B and some echoviruses can cause HFMD [13-17].…
Results)
…When we divided patients into 5 groups infected with different enterovirus genotypes, patients with EV71 infection had significantly longer mean hospital stays and a higher incidence of complications than those patients in the CA6,CA10, and CA16 infection groups ( P < 0.05), but not than those in the CA12 infection group.…
Discussion)
…OccasionalCA6- or CA10-related HFMD outbreaks have been reported.…
Discussion)
…The prevalence of CA6 andCA10was as high as 71% and 28%, respectively, in Finland in 2008, and 28% and 39.9%, respectively, in France in 2010 [ 43 , 44 ].…
Methods)
…CA6, KC834855-KC834877 forCA10, KC834878-KC834892 for CA16…
Show Full Abstract
<h4>Background</h4>A rapid expansion of hand, foot, and mouth disease (HFMD) outbreaks has occurred and caused deaths in China in recent years, but little is known about the other etiologic agents except enterovirus 71 (EV71) and coxsackievirus A 16 (CA16). The objective of this study is to determine the genotype compositions of enterovirus causing HFMD in Shanghai and identify any associations between enterovirus types and clinical manifestations.<h4>Methods</h4>Stool specimens were collected from patients hospitalized for treatment of HFMD, from May 2010 to April 2011. Enterovirus was detected by reverse transcription PCR and directly genotyped by sequencing the PCR products. Phylogenetic analysis was based on the VP1 partial gene.<h4>Results</h4>Of 290 specimens, 277 (95.5%) tested positive for enterovirus. The major genotypes were EV71 (63.8%), CA10 (9.0%), CA6 (8.3%), CA16 (6.9%), CA12 (2.4%), and CA4 (1.4%). The EV71 strains belonged to the C4a subtype and CA16 belonged to the B subtype. CA6 was closely related to strains detected in Japan, Taiwan and China, and CA10, CA12 and CA4 were phylogenetically similar to other strains circulating in China. Mean hospital stays and the prevalence of complications in patients with EV71 infection were higher than those in patients in CA6, CA10 or CA16 infection (P < 0.05 for all comparisons). Children with CA12 infection were the youngest, and most likely have the highest risk of complications when compared to the other non-EV71 infection groups.<h4>Conclusions</h4>This study demonstrated a diversified pathogen compositions attributing to HFMD and clinical symptoms differing in enterovirus genotypes. It deserves our attention as early identification of enterovirus genotypes is important for diagnosis and treatment of HFMD patients.
Ezrin, a member of the ezrin-radixin-moesin family (ERM), is an essential regulator of the structure of microvilli on the apical aspect of epithelial cells. Ezrin provides a linkage between membrane-associated proteins and F-actin, oscillating between active/open and inactive/closed states, and is regulated in part by phosphorylation of a C-terminal threonine. In the open state, ezrin can bind a number of ligands, but in the closed state the ligand-binding sites are inaccessible. In vitro analysis has proposed that there may be a third hyperactivated form of ezrin. To gain a better understanding of ezrin, we conducted an unbiased proteomic analysis of ezrin-binding proteins in an epithelial cell line, Jeg-3. We refined our list of interactors by comparing the interactomes using quantitative mass spectrometry between wild-type ezrin, closed ezrin, open ezrin, and hyperactivated ezrin. The analysis reveals several novel interactors confirmed by their localization to microvilli, as well as a significant class of proteins that bind closed ezrin. Taken together, the data indicate that ezrin can exist in three different conformational states, and different ligands "perceive" ezrin conformational states differently.
Also flagged:waterneurogenesiscorticosteronecFosArcNeuroD
Journal Article2013-10-22✓ 5 SnippetsKarabeg MM, Grauthoff S, Kollert SY, Weidner M, Heiming RS, Jansen F, Popp S, Kaiser S, Lesch KP, Sachser N, Schmitt AG, Lewejohann L.
In-Text Gene Mentions
Abstract)
…5-HTT deficiency affects neuroplasticity and increases stress sensitivity resulting in altered spatial learning performance in the Morris water maze but not in the Barnes maze.…
Discussion)
…Although there was no significant gene by treatment interaction WM-tested 5-HTT deficient mice tend to exhibit higher corticosterone concentrations compared to mice of the same 5-HTT genotype after BM experience in both stress hormone cohorts.…
Discussion)
…Thus, elevated Arc and cFos protein levels could represent a “stressed” brain phenotype in consequence of lifelong 5-HTT deficiency, thereby presenting the neurobiological correlate of increased stress sensitivity and heightened anxiety of 5-HTT-/- animals.…
Discussion)
…Moreover, stressful life events were shown to correlate with the severity and number of episodes of major depression in the individuals carrying lower expressing 5-HTT genes [103,104].…
Introduction)
…The S-allele entails lower 5-HTT mRNA/protein levels and is shown to be associated with personality traits of negative emotionality including anxiety, depression and aggressiveness [2-4,9-13].…
Show Full Abstract
The purpose of this study was to evaluate whether spatial hippocampus-dependent learning is affected by the serotonergic system and stress. Therefore, 5-HTT knockout (-/-), heterozygous (+/-) and wildtype (+/+) mice were subjected to the Barnes maze (BM) and the Morris water maze (WM), the latter being discussed as more aversive. Additionally, immediate early gene (IEG) expression, hippocampal adult neurogenesis (aN), and blood plasma corticosterone were analyzed. While the performance of 5-HTT-/- mice in the BM was undistinguishable from both other genotypes, they performed worse in the WM. However, in the course of the repeated WM trials 5-HTT-/- mice advanced to wildtype level. The experience of a single trial of either the WM or the BM resulted in increased plasma corticosterone levels in all genotypes. After several trials 5-HTT-/- mice exhibited higher corticosterone concentrations compared with both other genotypes in both tests. Corticosterone levels were highest in 5-HTT-/- mice tested in the WM indicating greater aversiveness of the WM and a greater stress sensitivity of 5-HTT deficient mice. Quantitative immunohistochemistry in the hippocampus revealed increased cell counts positive for the IEG products cFos and Arc as well as for proliferation marker Ki67 and immature neuron marker NeuroD in 5-HTT-/- mice compared to 5-HTT+/+ mice, irrespective of the test. Most differences were found in the suprapyramidal blade of the dentate gyrus of the septal hippocampus. Ki67-immunohistochemistry revealed a genotype x environment interaction with 5-HTT genotype differences in naïve controls and WM experience exclusively yielding more Ki67-positive cells in 5-HTT+/+ mice. Moreover, in 5-HTT-/- mice we demonstrate that learning performance correlates with the extent of aN. Overall, higher baseline IEG expression and increased an in the hippocampus of 5-HTT-/- mice together with increased stress sensitivity may constitute the neurobiological correlate of raised alertness, possibly impeding optimal learning performance in the more stressful WM.
Also flagged:Irisinpeptidesfollistatinmyostatinactivin AFNDC5
Journal Article2013-10-21No SnippetsVamvini MT, Aronis KN, Panagiotou G, Huh JY, Chamberland JP, Brinkoetter MT, Petrou M, Christophi CA, Kales SN, Christiani DC, Mantzoros CS.
Show Full Abstract
<h4>Objective</h4>Skeletal muscle is considered to be an endocrine organ that secretes a number of myokines including follistatin (FST), myostatin (MSTN), activin A, and the newly identified irisin. Irisin's biology and function exhibit similarities with the functions of the FST-MSTN-activin A axis. It remains unknown whether there is any interplay among these molecules. The aim of this study is to examine potential associations of irisin with the FST, MSTN, and activin A axis.<h4>Methods</h4>Two observational studies were performed to evaluate the associations of irisin with the other three peptides. Study A included 150 healthy males aged 18.48±0.16 years with BMI 23.18±3.75 kg/m(2). Fasting serum samples were used to measure the levels of the molecules of interest. Study B included 14 morbidly obese individuals, candidates for bariatric surgery, aged 53.14±8.93 years with BMI 50.18±10.63 kg/m(2). Blood samples were obtained after an overnight fast. Eight out of the 14 participants consented to an optional thigh biopsy during their bariatric surgery. Using the above blood and tissue samples, we measured circulating levels and muscle mRNA of irisin, FST, MSTN, and activin A.<h4>Results</h4>We report that FNDC5 mRNA in muscle is positively correlated with FST mRNA expression in morbidly obese subjects (ρ=0.93, P<0.001). We also found that circulating irisin is positively correlated with FST circulating levels among lean subjects (ρ=0.17, P=0.05) while this association was suggestive among the obese (ρ=0.56, P=0.07).<h4>Conclusion</h4>The newly identified myokine irisin may be positively associated with FST at both the mRNA and circulating protein level.
<h4>Background</h4>Although various cross-sectional studies have shown that erythrocyte parameters, including red blood cell (RBC), hemoglobin (Hb) and hematocrit (HCT), were linked with metabolic syndrome (MetS), few longitudinal studies have been used to confirm their relationship. The study, therefore, constructed a large-scale longitudinal cohort in urban Chinese population to highlight and confirm the association between erythrocyte parameters and MetS/its components.<h4>Methods</h4>A longitudinal cohort with 6,453 participants was established based on the routine health check-up systems to follow up MetS, and Generalized Estimating Equation (GEE) model was used to detect the association between erythrocyte parameters and MetS/its components (obesity, hyperglycemia, dyslipidemia, and hypertension).<h4>Results</h4>287 MetS occurred over the four-year follow-up, leading to a total incidence density of 14.19 per 1,000 person-years (287/20218 person-years). Both RBC and Hb were strongly associated with MetS (RR/95% CI, P value; 3.016/1.525-5.967, 0.002 for RBC; 3.008/1.481-6.109, 0.002 for Hb), with their dose-response trends detected. All three erythrocyte parameters (RBC, Hb and HCT) were found to be associated with obesity, hypertension and dyslipidemia with similar dose-response trends respectively, while only Hb showed a significant association with hyperglycemia.<h4>Conclusions</h4>Elevated erythrocyte parameters were confirmed to be associated with MetS/its components in urban Chinese population, suggesting that erythrocyte parameters might be served as a potential predictor for risk of MetS.
TAK1 is a MAP3K that mediates non-canonical TGF-β and BMP signaling. During the embryonic period, TAK1 is essential for cartilage and joint development as deletion of Tak1 in chondro-osteo progenitor cells leads to severe chondrodysplasia with defects in both chondrocyte proliferation and maturation. We have investigated the role of TAK1 in committed chondrocytes during early postnatal development. Using the Col2a1-CreER(T2); Tak1(f/f) mouse model, we induced deletion of Tak1 at postnatal day 7 and characterized the skeletal phenotypes of these mice at 1 and 3 months of age. Mice with chondrocyte-specific Tak1 deletion exhibited severe growth retardation and reduced proteoglycan and type II collagen content in the extracellular matrix of the articular cartilage. We found reduced Col2a1 and Acan expression, but increased Mmp13 and Adamts5 expression, in Tak1-deficient chondrocytes along with reduced expression of the SOX trio of transcription factors, SOX9, SOX5 and SOX6. In vitro, BMP2 stimulated Sox9 gene expression and Sox9 promoter activity. These effects were reduced; however, following Tak1 deletion or treatment with a TAK1 kinase inhibitor. TAK1 affects both canonical and non-canonical BMP signal transduction and we found that both of these pathways contribute to BMP2-mediated Sox9 promoter activation. Additionally, we found that ATF2 directly binds the Sox9 promoter in response to BMP signaling and that this effect is dependent upon TAK1 kinase activity. These novel findings establish that TAK1 contributes to BMP2-mediated Sox9 gene expression and is essential for the postnatal development of normal growth plate and articular cartilages.
Also flagged:chromosomechromosome-gene silencingheterochromatinhistoneposttranslational modifications
Journal Article2013-10-21✓ 1 SnippetEscamilla-Del-Arenal M, da Rocha ST, Spruijt CG, Masui O, Renaud O, Smits AH, Margueron R, Vermeulen M, Heard E.
In-Text Gene Mentions
Text
…ZNF644…
Show Full Abstract
X chromosome inactivation is a remarkable example of chromosome-wide gene silencing and facultative heterochromatin formation. Numerous histone posttranslational modifications, including H3K9me2 and H3K27me3, accompany this process, although our understanding of the enzymes that lay down these marks and the factors that bind to them is still incomplete. Here we identify Cdyl, a chromodomain-containing transcriptional corepressor, as a new chromatin-associated protein partner of the inactive X chromosome (Xi). Using mouse embryonic stem cell lines with mutated histone methyltransferase activities, we show that Cdyl relies on H3K9me2 for its general association with chromatin in vivo. For its association with Xi, Cdyl requires the process of differentiation and the presence of H3K9me2 and H3K27me3, which both become chromosomally enriched following Xist RNA coating. We further show that the removal of the PRC2 component Eed and subsequent loss of H3K27me3 lead to a reduction of both Cdyl and H3K9me2 enrichment on inactive Xi. Finally, we show that Cdyl associates with the H3K9 histone methyltransferase G9a and the MGA protein, both of which are also found on Xi. We propose that the combination of H3K9me2 and H3K27me3 recruits Cdyl to Xi, and this, in turn, may facilitate propagation of the H3K9me2 mark by anchoring G9a.
…Until recently, a noteworthy aspect to β2M in cancer cell signaling was to identify hemochromatosis (HFE) protein with which β2M induces epithelial-mesenchymal transition (EMT) and confers cancer lethality and bone metastasis in a variety of human cancer cells [8].…
S I O 001029)
…This suggests that β2M binds with HFE protein, namely β2M receptor, in association with transferring receptor to modulate iron homeostasis and activate iron-responsive HIF-1α (hypoxia inducible factor-1α) signaling in cancer cells.…
Show Full Abstract
β2-microglobulin (β2M) functions as a chaperon to maintain structural stability of MHC class I complex that is associated with antigen presentation to cytotoxic (CD8+) T lymphocytes. Cancerous cells in β2M loss-of-function are thought to avoid immune surveillance. As increased level of β2M present in tissue/serum is significantly associated with tumor status in various cancers, β2M may become an important prognostic and survival factor in a range of malignancies. It is believed that β2M acts as hormone-like molecule to trigger a pleiotropic signaling via a ligand-to-receptor binding mechanism. Anti- β2M monoclonal antibodies successfully induce apoptosis in malignant cells, suggesting a surprising therapeutic approach. Of note, β2M is largely localized in the cytoplasm of advanced oral cavity squamous cell carcinoma (OCSCC), in contrast to that in the plasma membrane of normal oral mucosa. This suggests that β2M-derived intracellular signaling might be preceded by its accumulation in the cytoplasm of epithelial cells of tumors. Hence, translocation of β2M from cell surface to cytoplasm in advanced tumors may shed light on the mechanism of β2M-mediated tumorigenesis.
Also flagged:HDdevelopmental cognitive disordercentral nervous system diseasepsychiatric illnesssubstance abusephenothiazine
Journal Article2013-10-21No SnippetsLong JD, Paulsen JS, Marder K, Zhang Y, Kim JI, Mills JA, Researchers of the PREDICT-HD Huntington's Study Group.
Show Full Abstract
The Unified Huntington's Disease Rating Scale is used to characterize motor impairments and establish motor diagnosis. Little is known about the timing of diagnostic confidence level categories and the trajectory of motor impairments during the prodromal phase. Goals of this study were to estimate the timing of categories, model the prodromal trajectory of motor impairments, estimate the rate of motor impairment change by category, and provide required sample size estimates for a test of efficacy in clinical trials. In total, 1010 gene-expanded participants from the Neurobiological Predictors of Huntington's Disease (PREDICT-HD) trial were analyzed. Accelerated failure time models were used to predict the timing of categories. Linear mixed effects regression was used to model the longitudinal motor trajectories. Age and length of gene expansion were incorporated into all models. The timing of categories varied significantly by gene expansion, with faster progression associated with greater expansion. For the median expansion, the third diagnostic confidence level category was estimated to have a first occurrence 1.5 years before diagnosis, and the second and first categories were estimated to occur 6.75 years and 19.75 years before diagnosis, respectively. Motor impairments displayed a nonlinear prodromal course. The motor impairment rate of change increased as the diagnostic confidence level increased, with added acceleration for higher progression scores. Motor items can detect changes in motor impairments before diagnosis. Given a sufficiently high progression score, there is evidence that the diagnostic confidence level can be used for prodromal staging. Implications for Huntington's disease research and the planning of clinical trials of efficacy are discussed.
Also flagged:DDM1ROS1pyrimidineschromatinmethylationphotolyases
Journal Article2013-10-21✓ 1 SnippetQüesta JI, Fina JP, Casati P.
In-Text Gene Mentions
Discussion)
…role as a5-meC glycosylaseglycosylase, it could…
Show Full Abstract
Absorption of UV-B by DNA induces the formation of covalent bonds between adjacent pyrimidines. In maize and arabidopsis, plants deficient in chromatin remodeling show increased DNA damage compared to WT plants after a UV-B treatment. However, the role of enzymes that participate in DNA methylation in DNA repair after UV-B damage was not previously investigated. In this work, we analyzed how chromatin remodeling activities that have an effect on DNA methylation affects the repair of UV-B damaged DNA using plants deficient in the expression of DDM1 and ROS1. First, we analyzed their regulation by UV-B radiation in arabidopsis plants. Then, we demonstrated that ddm1 mutants accumulated more DNA damage after UV-B exposure compared to Col0 plants. Surprisingly, ros1 mutants show less CPDs and 6-4PPs than WT plants after the treatment under light conditions, while the repair under dark conditions is impaired. Transcripts for two photolyases are highly induced by UV-B in ros1 mutants, suggesting that the lower accumulation of photoproducts by UV-B is due to increased photorepair in these mutants. Finally, we demonstrate that oxidative DNA damage does not occur after UV-B exposure in arabidopsis plants; however, ros1 plants accumulate high levels of oxoproducts, while ddm1 mutants have less oxoproducts than Col0 plants, suggesting that both ROS1 and DDM1 have a role in the repair of oxidative DNA damage. Together, our data provide evidence that both DDM1 and ROS1, directly or indirectly, participate in UV-B induced- and oxidative DNA damage repair.
Hepcidin is a peptide hormone that is secreted by the liver and that functions as the central regulator of systemic iron metabolism in mammals. Its expression is regulated at the transcriptional level by changes in iron status and iron requirements, and by inflammatory cues. There is considerable interest in understanding the mechanisms that influence hepcidin expression because dysregulation of hepcidin production is associated with a number of disease states and can lead to iron overload or iron-restricted anemia. In order to shed light on the factors that alter hepcidin expression, we carried out experiments with HepG2 and HuH7, human hepatoma cell lines that are widely used for this purpose. We found that the addition of heat-inactivated fetal calf serum to these cells resulted in a significant dose- and time-dependent up-regulation of hepcidin expression. Serum also activated signaling events known to be downstream of bone morphogenetic proteins (BMPs), a group of molecules that have been implicated previously in hepcidin regulation. Inhibition of these signals with dorsomorphin significantly suppressed serum-induced hepcidin up-regulation. Our results indicate that a BMP or BMP-like molecule present in serum may play an important role in regulating hepcidin expression.
Also flagged:Ldb1LIM-homeodomain (LIM-HD) transcription factorsLhx6Lhx8LIM-HD
Journal Article2013-10-21✓ 1 SnippetZhao Y, Flandin P, Vogt D, Blood A, Hermesz E, Westphal H, Rubenstein JL.
In-Text Gene Mentions
Text
…Sox6…
Show Full Abstract
The progenitor zones of the embryonic mouse ventral telencephalon give rise to GABAergic and cholinergic neurons. We have shown previously that two LIM-homeodomain (LIM-HD) transcription factors, Lhx6 and Lhx8, that are downstream of Nkx2.1, are critical for the development of telencephalic GABAergic and cholinergic neurons. Here we investigate the role of Ldb1, a nuclear protein that binds directly to all LIM-HD factors, in the development of these ventral telencephalon derived neurons. We show that Ldb1 is expressed in the Nkx2.1 cell lineage during embryonic development and in mature neurons. Conditional deletion of Ldb1 causes defects in the expression of a series of genes in the ventral telencephalon and severe impairment in the tangential migration of cortical interneurons from the ventral telencephalon. Similar to the phenotypes observed in Lhx6 or Lhx8 mutant mice, the Ldb1 conditional mutants show a reduction in the number of both GABAergic and cholinergic neurons in the telencephalon. Furthermore, our analysis reveals defects in the development of the parvalbumin-positive neurons in the globus pallidus and striatum of the Ldb1 mutants. These results provide evidence that Ldb1 plays an essential role as a transcription co-regulator of Lhx6 and Lhx8 in the control of mammalian telencephalon development.
Also flagged:heart failureinfectiongene expressionhemostasisGlobinnucleotide
Journal Article2013-10-21No SnippetsMitchell A, Guan W, Staggs R, Hamel A, Hozayen S, Adhikari N, Grindle S, Desir S, John R, Hall JL, Eckman P.
Show Full Abstract
<h4>Introduction</h4>Continuous-flow left ventricular assist devices (LVADs) are an established therapy for patients with end-stage heart failure. The short- and long-term impact of these devices on peripheral blood gene expression has not been characterized, and may provide insight into the molecular pathways mediated in response to left ventricular remodeling and an improvement in overall systemic circulation. We performed RNA sequencing to identify genes and pathways influenced by these devices.<h4>Methods</h4>RNA was extracted from blood of 9 heart failure patients (8 male) prior to LVAD implantation, and at 7 and 180 days postoperatively. Libraries were sequenced on an Illumina HiSeq2000 and sequences mapped to the human Ensembl GRCh37.67 genome assembly.<h4>Results</h4>A specific set of genes involved in regulating cellular immune response, antigen presentation, and T cell activation and survival were down-regulated 7 days after LVAD placement. 6 months following LVAD placement, the expression levels of these genes were significantly increased; yet importantly, remained significantly lower than age and sex-matched samples from healthy controls.<h4>Conclusions</h4>In summary, this genomic analysis identified a significant decrease in the expression of genes that promote a healthy immune response in patients with heart failure that was partially restored 6 months following LVAD implant.
…(e.g. autoimmune hepatitis,hemochromatosis, and Wilson’s disease).…
Show Full Abstract
<h4>Background</h4>Rapid virological response (RVR) strongly predicts sustained virological response (SVR) in patients with chronic hepatitis C (CHC), and abbreviates antiviral therapy in some patients.<h4>Objectives</h4>To identify factors predicting virological relapse (VR) in CHC patients who attained RVR.<h4>Patients and methods</h4>Medical records of 133 CHC patients with an RVR after completing 24 weeks of antiviral therapy (a combination of pegylated interferon-α and ribavirin) were analyzed. Baseline characteristics and on-treatment responses were compared between the patients with an SVR and those with VR. Patients with normal alanine aminotransferase (ALT) levels at weeks 4 and 12 and at the end-of-treatment (EoT) and patients with elevated, but constantly decreasing, ALT levels were classified as having favorable patterns of ALT change. A trend of increasing ALT levels either between weeks 4 and 12 or between weeks 12 and EoT was classified as unfavorable. A high viral load (HVL) was defined as a baseline HCV RNA ≥ 600000 IU/mL.<h4>Results</h4>In total, 116 (87.2%) patients had a SVR and 14 (10.5%) had VR. The VR rates were comparable between patients with genotype-1 (13.1%) and genotype-2 infection (8.7%) (P = 0.572). Multivariate analysis revealed that HVL (P = 0.015; odds ratio [OR] = 14.754; 95% confidence interval (CI) = 1.671-130.240), and unfavorable ALT patterns (P = 0.039; OR = 4.397; 95% CI = 1.078-17.930) independently predicted VR. In subgroup analysis, low viral load (LVL) patients had a minimal VR rate (1.8%). Among the HVL patients, the VR rate of those using peg-IFN-α-2a was relatively low (9.1%). Patients using peg-IFN-α-2b had a slightly higher VR rate (23.8%; P = 0.128), and patients with favorable patterns of ALT changes had a lower VR rate (10.3%) compared to the 53.8% in patients with unfavorable ALT patterns (P = 0.005).<h4>Conclusions</h4>In southern Taiwan, 24 weeks of antiviral therapy achieved a high SVR rate in patients with CHC attaining RVR, except in the subgroup of patients treated with peg-IFN-α-2b with HVL and on-treatment unfavorable ALT patterns.
Also flagged:NestinmedulloblastomaShhtumorstype IV intermediate filamentneurofilament
Journal Article2013-10-20No SnippetsLi P, Du F, Yuelling LW, Lin T, Muradimova RE, Tricarico R, Wang J, Enikolopov G, Bellacosa A, Wechsler-Reya RJ, Yang ZJ.
Show Full Abstract
It is generally believed that cerebellar granule neurons originate exclusively from granule neuron precursors (GNPs) in the external germinal layer (EGL). Here we identified a rare population of neuronal progenitors in mouse developing cerebellum that expresses Nestin. Although Nestin is widely considered a marker for multipotent stem cells, these Nestin-expressing progenitors (NEPs) are committed to the granule neuron lineage. Unlike conventional GNPs, which reside in the outer EGL and proliferate extensively, NEPs reside in the deep part of the EGL and are quiescent. Expression profiling revealed that NEPs are distinct from GNPs and, in particular, express markedly reduced levels of genes associated with DNA repair. Consistent with this, upon aberrant activation of Sonic hedgehog (Shh) signaling, NEPs exhibited more severe genomic instability and gave rise to tumors more efficiently than GNPs. These studies revealed a previously unidentified progenitor for cerebellar granule neurons and a cell of origin for medulloblastoma.
Also flagged:prion diseasesneurodegenerative diseasesbovine spongiform encephalopathyBSEscrapiechronic wasting disease
Journal Article2013-10-20✓ 1 SnippetMarciniuk K, Taschuk R, Napper S.
In-Text Gene Mentions
Introduction)
…1 in modulatingHttprotein function and…
Show Full Abstract
Transmissible spongiform encephalopathies (TSEs) are fatal, untreatable neurodegenerative diseases. While the impact of TSEs on human health is relatively minor, these diseases are having a major influence on how we view, and potentially treat, other more common neurodegenerative disorders. Until recently, TSEs encapsulated a distinct category of neurodegenerative disorder, exclusive in their defining characteristic of infectivity. It now appears that similar mechanisms of self-propagation may underlie other proteinopathies such as Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, and Huntington's disease. This link is of scientific interest and potential therapeutic importance as this route of self-propagation offers conceptual support and guidance for vaccine development efforts. Specifically, the existence of a pathological, self-promoting isoform offers a rational vaccine target. Here, we review the evidence of prion-like mechanisms within a number of common neurodegenerative disorders and speculate on potential implications and opportunities for vaccine development.
Also flagged:MAP kinaseMitogen-activated protein kinasesMAPKsERK1p38JNK
Journal Article2013-10-19No SnippetsPeti W, Page R.
Show Full Abstract
Mitogen-activated protein kinases (MAPKs; ERK1/2, p38, JNK, and ERK5) have evolved to transduce environmental and developmental signals (growth factors, stress) into adaptive and programmed responses (differentiation, inflammation, apoptosis). Almost 20 years ago, it was discovered that MAPKs contain a docking site in the C-terminal lobe that binds a conserved 13-16 amino acid sequence known as the D- or KIM-motif (kinase interaction motif). Recent crystal structures of MAPK:KIM-peptide complexes are leading to a precise understanding of how KIM sequences contribute to MAPK selectivity. In addition, new crystal and especially NMR studies are revealing how residues outside the canonical KIM motif interact with specific MAPKs and contribute further to MAPK selectivity and signaling pathway fidelity. In this review, we focus on these recent studies, with an emphasis on the use of NMR spectroscopy, isothermal titration calorimetry and small angle X-ray scattering to investigate these processes.
Also flagged:cardiomyopathiesmuscular dystrophiestranscription factorstranscriptional regulatorssarcomericmuscle diseases
Journal Article2013-10-19No SnippetsSpletter ML, Schnorrer F.
Show Full Abstract
Muscles coordinate body movements throughout the animal kingdom. Each skeletal muscle is built of large, multi-nucleated cells, called myofibers, which are classified into several functionally distinct types. The typical fiber-type composition of each muscle arises during development, and in mammals is extensively adjusted in response to postnatal exercise. Understanding how functionally distinct muscle fiber-types arise is important for unraveling the molecular basis of diseases from cardiomyopathies to muscular dystrophies. In this review, we focus on recent advances in Drosophila and mammals in understanding how muscle fiber-type specification is controlled by the regulation of transcription and alternative splicing. We illustrate the cooperation of general myogenic transcription factors with muscle fiber-type specific transcriptional regulators as a basic principle for fiber-type specification, which is conserved from flies to mammals. We also examine how regulated alternative splicing of sarcomeric proteins in both flies and mammals can directly instruct the physiological and biophysical differences between fiber-types. Thus, research in Drosophila can provide important mechanistic insight into muscle fiber specification, which is relevant to homologous processes in mammals and to the pathology of muscle diseases.
Also flagged:viral infectionsinfectionantibodyPD-1HCV infectionliver disease
Journal Article2013-10-19No SnippetsKroy DC, Ciuffreda D, Cooperrider JH, Tomlinson M, Hauck GD, Aneja J, Berger C, Wolski D, Carrington M, Wherry EJ, Chung RT, Tanabe KK, Elias N, Freeman GJ, de Kruyff RH, Misdraji J, Kim AY, Lauer GM.
Show Full Abstract
<h4>Background & aims</h4>There is an unclear relationship between inhibitory receptor expression on T cells and their ability to control viral infections. Studies of human immune cells have been mostly limited to T cells from blood, which is often not the site of infection. We investigated the relationship between T-cell location, expression of inhibitory receptors, maturation, and viral control using blood and liver T cells from patients with hepatitis C virus (HCV) and other viral infections.<h4>Methods</h4>We analyzed 36 liver samples from HCV antibody-positive patients (30 from patients with chronic HCV infection, 5 from patients with sustained virological responses to treatment, and 1 from a patient with spontaneous clearance) with 19 paired blood samples and 51 liver samples from HCV-negative patients with 17 paired blood samples. Intrahepatic and circulating lymphocytes were extracted; T-cell markers and inhibitory receptors were quantified for total and virus-specific T cells by flow cytometry.<h4>Results</h4>Levels of the markers PD-1 and 2B4 (but not CD160, TIM-3, or LAG-3) were increased on intrahepatic T cells from healthy and diseased liver tissues compared with T cells from blood. HCV-specific intrahepatic CD8(+) T cells from patients with chronic HCV infection were distinct in that they expressed TIM-3 along with PD-1 and 2B4. In comparison, HCV-specific CD8(+) T cells from patients with sustained virological responses and T cells that recognized cytomegalovirus lacked TIM-3 but expressed higher levels of LAG-3; these cells also had different memory phenotypes and proliferative capacity.<h4>Conclusions</h4>T cells from liver express different inhibitory receptors than T cells from blood, independent of liver disease. HCV-specific and cytomegalovirus-specific CD8(+) T cells can be differentiated based on their expression of inhibitory receptors; these correlate with their memory phenotype and levels of proliferation and viral control.
<h4>Unlabelled</h4>The American Association for the Study of Liver Diseases (AASLD) practice guidelines provide recommendations in diagnosing and managing patients with liver disease from available scientific evidence in combination with expert consensus opinions. The aim was to systematically review the evolution of recommendations from AASLD guidelines and identify gaps limiting the evidence-based foundations of these guidelines. Initial and current AASLD guidelines published from January 1998 to August 2012 were reviewed. The AGREE II instrument was used to evaluate rigor and transparency of guideline development. The number of recommendations, distribution of grades (strength or certainty), classes (benefit versus risk), and types of recommendations were evaluated. Whenever possible, multiple versions were evaluated for evolving scientific evidence. A total of 991 recommendations from 28 guidelines on 17 topics were evaluated. From initial to current guidelines, the total number of recommendations increased by 36% (512 to 699). The largest increases were from chronic hepatitis B virus (HBV) (+71), liver transplantation (+53), and autoimmune hepatitis (AIH) (+27). Most current recommendations are grade II (44%) and less than 20% are grade I. The AGREE II evaluation showed global improvement in guideline quality. Both HBV and chronic hepatitis C guidelines had greatest increases in grade I recommendations (+383% and +67%, respectively). The greatest increases in treatment recommendations were from HBV (grade I, +1,150%), liver transplantation (grade II, +112%), and AIH (grade III, +105%).<h4>Conclusion</h4>Despite significant increases in the numbers of recommendations within AASLD practice guidelines over time, only a minority are supported by grade I evidence, highlighting the need for developing well-designed investigations to provide evidence for areas of uncertainty and improving the quality of future guidelines in hepatobiliary diseases.
Also flagged:ceriumoxideCerium oxidenanoceriavery low density lipoprotein receptorvascular endothelial growth factor
Journal Article2013-10-18✓ 1 SnippetCai X, Seal S, McGinnis JF.
In-Text Gene Mentions
Text
…Prdx6…
Show Full Abstract
Cerium oxide nanoparticles (nanoceria) are direct antioxidants; they inhibit pathological neovascularization following a single intravitreal injection into new born very low density lipoprotein receptor knockout (vldlr(-/-)) mice. However, the long-term therapeutic effects and mechanisms of nanoceria action on regression of the existing pathologic neovascularization in the eyes are unknown. We intravitreally injected P28 vldlr(-/-) mice and extended the endpoint for analysis until P70. The data demonstrate that nanoceria sustained their therapeutic function up to 6 weeks. Multiple parameters for nanoceria effects were examined including: regression of existing abnormal blood vessels, reduction of vascular leakage, down-regulation of the expression of vascular endothelial growth factor (VEGF), acrolein, glial fibrillary acidic protein (GFAP) and caspase 3 as well as up-regulation of the expression of rod- and cone-opsin genes. Regulation of ASK1-P38/JNK-NF-κB signaling pathway by nanoceria was investigated. Our data demonstrated that a single intravitreal injection of nanoceria in P28 vldlr(-/-) mice produced sustained regression of existing oxidative stress-induced neovascularizations, prevented blood vessel leakage and inhibited apoptosis via down-regulation of the ASK1-P38/JNK-NF-κB signaling pathway.
Autism spectrum disorders (ASD) comprise a number of underlying sub-types with various symptoms and presumably different genetic causes. One important difference between these sub-phenotypes is IQ. Some forms of ASD such as Asperger's have relatively intact intelligence while the majority does not. In this study, we explored the role of genetic factors that might account for this difference. Using a case-control study based on IQ status in 1657 ASD probands, we analyzed both common and rare variants provided by the Autism Genome Project (AGP) consortium via dbGaP (database of Genotypes and Phenotypes). We identified a set of genes, among them HLA-DRB1 and KIAA0319L, which are strongly associated with IQ within a population of ASD patients.
Also flagged:wound healingdexamethasoneoxygenhypoxia inducible factorsHIFsHIF-2α
Journal Article2013-10-18✓ 1 SnippetTsang WP, Shu Y, Kwok PL, Zhang F, Lee KK, Tang MK, Li G, Chan KM, Chan WY, Wan C.
In-Text Gene Mentions
Results)
…(∼20-fold), followed bySox6(∼15-fold) and Foxa1…
Show Full Abstract
The human umbilical cord perivascular cells (HUCPVCs) have been considered as an alternative source of mesenchymal progenitors for cell based regenerative medicine. However, the biological properties of these cells remain to be well characterized. In the present study, HUCPVCs were isolated and sorted by CD146(+) pericyte marker. The purified CD146(+) HUCPVCs were induced to differentiate efficiently into osteoblast, chondrocyte and adipocyte lineages in vitro. Six weeks following subcutaneous transplantation of CD146(+) HUCPVCs-Gelfoam-alginate 3D complexes in severe combined immunodeficiency (SCID) mice, newly formed bone matrix with embedded osteocytes of donor origin was observed. The functional engraftment of CD146(+) HUCPVCs in the new bone regenerates was further confirmed in a critical-sized bone defect model in SCID mice. Hypoxic conditions suppressed osteogenic differentiation while increased cell proliferation and colony-forming efficiency of CD146(+) HUCPVCs as compared to that under normoxic conditions. Re-oxygenation restored the multi-differentiation potential of the CD146(+) HUCPVCs. Western blot analysis revealed an upregulation of HIF-1α, HIF-2α, and OCT-4 protein expression in CD146(+) HUCPVCs under hypoxia, while there was no remarkable change in SOX2 and NANOG expression. The gene expression profiles of stem cell transcription factors between cells treated by normoxia and hypoxic conditions were compared by PCR array analysis. Intriguingly, PPAR-γ was dramatically downregulated (20-fold) in mRNA expression under hypoxia, and was revealed to possess a putative binding site in the Hif-2α gene promoter region. Chromatin immunoprecipitation assays confirmed the binding of PPAR-γ protein to the Hif-2α promoter and the binding was suppressed by hypoxia treatment. Luciferase reporter assay showed that the Hif-2α promoter activity was suppressed by PPAR expression. Thus, PPAR-γ may involve in the regulation of HIF-2α for stemness maintenance and promoting the expansion of CD146(+) HUCPVCs in response to hypoxia. CD146(+) HUCPVCs may serve as a potential autologous cell source for bone regeneration.
Also flagged:chromosomesynthesisKabuki syndromeantigen receptorimmunoglobulincell receptor
Journal Article2013-10-18✓ 1 SnippetMarkello TC, Adams DR.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
The analysis of genome-scale sequence data can be defined as the interrogation of a complete set of genetic instructions in a search for individual loci that produce or contribute to a pathological state. Bioinformatic analysis of sequence data requires sufficient discriminant power to find this needle in a haystack. Current approaches make choices about selectivity and specificity thresholds, and the quality, quantity, and completeness of the data in these analyses. There are many software tools available for individual, analytic component-tasks, including commercial and open-source options. Three major types of techniques have been included in most published exome projects to date: frequency/population genetic analysis, inheritance state consistency, and predictions of deleteriousness. The required infrastructure and use of each technique during analysis of genomic sequence data for clinical and research applications are discussed. Future developments will alter the strategies and sequence of using these tools and are also discussed.
Also flagged:Type 2 diabetes mellitushepatitis C virus infectioninfectionHCV infectiondiabetesdiabetes mellitus
Journal Article2013-10-18✓ 1 SnippetGuo X, Jin M, Yang M, Liu K, Li JW.
In-Text Gene Mentions
Discussion)
…alcohol abuse andhemochromatosis).…
Show Full Abstract
The aim of this study was to evaluate the relationship between type 2 diabetes mellitus (T2DM) and hepatitis C virus (HCV) infection and to examine whether T2DM enhances the risk of HCV infection compared with the risk in the general population. We followed standard guidelines to perform a meta-analysis. The associated literature was selected based on the established inclusion criteria. The summary odds ratio (OR) and 95% confidence interval (95% CI) were used to investigate the strength of the association. Through electronic database and manual searching, 22 studies were identified for the final analysis, which included a total of 78,051 individuals. Based on the random effects model, the meta-analysis results showed that patients with T2DM were at a higher risk of acquiring HCV infection than non-T2DM patients (summary OR = 3.50, 95% CI = 2.54-4.82, I(2) = 82.3%). Based on the current limited evidence, this study suggests that T2DM is associated with increased susceptibility to HCV infection.
Epithelial-mesenchymal transition (EMT) is a process by which cancer cells acquire mesenchymal properties, such as induction of vimentin, while epithelial-associated genes like E-cadherin are lost. This enables cells to be more metastatic. Factors that are able to induce EMT include growth factors such as transforming growth factor-β (TGF-β) and epidermal growth factor, and transcription factors such as Snail. Snail-induced EMT promotes migration and invasion and we hypothesized that this may be mediated by the activity of urokinase-type plasminogen activator (uPA) and its receptor (uPAR). LNCaP, 22Rv1 and ARCaP human prostate cancer (CaP) cells stably transfected with empty vector control (Neo) or constitutively active Snail exhibited increased cell invasion. Superarray analysis revealed an upregulation in uPA and uPAR RNA expression in Snail-transfected ARCaP cells compared with that of a Neo control. In addition, the protein expression levels of Snail, uPA and uPAR were measured by western blot analysis which showed that overexpression of Snail increased uPA and uPAR protein levels. The activity of uPA in conditioned media was measured using an ELISA which revealed that uPA activity was elevated in LNCaP, 22Rv1 and ARCaP cells overexpressing Snail. Additionally, transient silencing of uPAR in ARCaP cells overexpressing Snail using short interfering RNA resulted in abrogation of Snail-mediated invasion. Snail overexpression was associated with increased extracellular-signal-regulated kinase activity, and antagonism of this activity with mitogen-activated protein (MAPK) inhibitor, UO126, inhibited cell invasion and decreased uPA activity. Therefore, Snail-mediated cell invasion in human CaP cells may occur via the regulation of uPA/uPAR and the MAPK signaling pathway.
Also flagged:nonalcoholic fatty liver diseaseNAFLDsteatosisalanine aminotransferaseaspartate aminotransferaseFatty Liver Disease
Journal Article2013-10-17✓ 1 SnippetNoureddin M, Lam J, Peterson MR, Middleton M, Hamilton G, Le TA, Bettencourt R, Changchien C, Brenner DA, Sirlin C, Loomba R.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Unlabelled</h4>The magnetic resonance imaging-estimated proton density fat fraction (MRI-PDFF) is a novel imaging-based biomarker that allows fat mapping of the entire liver, whereas the magnetic resonance spectroscopy-measured proton density fat fraction (MRS-PDFF) provides a biochemical measure of liver fat in small regions of interest. Cross-sectional studies have shown that MRI-PDFF correlates with MRS-PDFF. The aim of this study was to show the utility of MRI-PDFF in assessing quantitative changes in liver fat through a three-way comparison of MRI-PDFF and MRS-PDFF with the liver histology-determined steatosis grade at two time points in patients with nonalcoholic fatty liver disease (NAFLD). Fifty patients with biopsy-proven NAFLD who participated in a randomized trial underwent a paired evaluation with liver biopsy, MRI-PDFF, and MRS-PDFF at the baseline and 24 weeks. The mean age and body mass index were 47.8 ± 11.7 years and 30.7 ± 6.5 kg/m(2), respectively. MRI-PDFF showed a robust correlation with MRS-PDFF both at week 0 and at week 24 (r = 0.98, P < 0.0001 for both). Cross-sectionally, MRI-PDFF and MRS-PDFF increased with increases in the histology-determined steatosis grade both at week 0 and at week 24 (P < 0.05 for all). Longitudinally, patients who had a decrease (≥ 1%) or increase (≥ 1%) in MRI-PDFF (confirmed by MRS-PDFF) showed a parallel decrease or increase in their body weight and serum alanine aminotransferase and aspartate aminotransferase levels at week 24 (P < 0.05). This small increase or decrease in liver fat could not be quantified with histology.<h4>Conclusion</h4>In this longitudinal study, MRI-PDFF correlated well with MRS-PDFF and was more sensitive than the histology-determined steatosis grade in quantifying increases or decreases in the liver fat content. Therefore, it could be used to quantify changes in liver fat in future clinical trials.
Also flagged:serotonin transportercognition5-hydroxytryptamine transporter5SLC6A4gene expression
Journal Article2013-10-17✓ 4 SnippetsSalminen LE, Schofield PR, Pierce KD, Lane EM, Heaps JM, Bolzenius JD, Baker LM, Luo X, Paul RH.
In-Text Gene Mentions
Abstract)
…This suggests that possession of low-expressing genetic variants of 5-HTT is modestly associated with enhanced cognitive performance among healthy older adults.…
Abstract)
…ydroxytryptamine transporter (5-HTT)) expression, which is…
Abstract)
…genetic variants of5-HTTis modestly associated…
Text
…5-HTT…
Show Full Abstract
The biallelic serotonin transporter polymorphism (5-hydroxytryptamine transporter linked polymorphic region (5-HTTLPR)) is a common genetic sequence associated with serotonin transporter (5-hydroxytryptamine transporter (5-HTT)) expression, which is further modulated by a triallelic single-nucleotide polymorphism (rs25531). Recent studies using the biallelic 5-HTTLPR have identified a beneficial role of low 5-HTT expression on cognitive performance, although no studies have examined the impact of the triallelic 5-HTTLPR/rs25531 marker on cognitive performance among healthy older adults. In the present study, we addressed this issue in 84 healthy older adults genotyped for biallelic and triallelic variants of 5-HTT. Groups were created based on low, medium and high levels of expression, as indicated by the triallelic marker. Results indicated that individuals with low 5-HTT expression performed significantly better on a test of memory compared with individuals with medium 5-HTT expression. This suggests that possession of low-expressing genetic variants of 5-HTT is modestly associated with enhanced cognitive performance among healthy older adults.
Also flagged:Huntington diseaseHuntington's diseaseHDspinocerebellar ataxia type 2SCA2dentatorubral-pallidoluysian degeneration
Journal Article2013-10-17✓ 2 SnippetsCastilhos RM, Souza AF, Furtado GV, Gheno TC, Silva AL, Vargas FR, Lima MA, Barsottini O, Pedroso JL, Godeiro C, Salarini D, Pereira ET, Lin K, Toralles MB, Saute JA, Rieder CR, Quintas M, Sequeiros J, Alonso I, Saraiva-Pereira ML, Jardim LB.
In-Text Gene Mentions
Abstract)
…In HD, the median expanded (CAG)n (range) was 44 (40-81) units; R(2) between expanded HTT and age-at-onset (AO) was 0.55 (p=0.0001, Pearson).…
Abstract)
…Molecular studies ofHTT, ATXN2, TBP, ATN1,…
Show Full Abstract
The aim of this study was to identify the relative frequency of Huntington's disease (HD) and HD-like (HDL) disorders HDL1, HDL2, spinocerebellar ataxia type 2 (SCA2), SCA17, dentatorubral-pallidoluysian degeneration (DRPLA), benign hereditary chorea, neuroferritinopathy and chorea-acanthocytosis (CHAC), in a series of Brazilian families. Patients were recruited in seven centers if they or their relatives presented at least chorea, besides other findings. Molecular studies of HTT, ATXN2, TBP, ATN1, JPH3, FTL, NKX2-1/TITF1 and VPS13A genes were performed. A total of 104 families were ascertained from 2001 to 2012: 71 families from South, 25 from Southeast and 8 from Northeast Brazil. There were 93 HD, 4 HDL2 and 1 SCA2 families. Eleven of 104 index cases did not have a family history: 10 with HD. Clinical characteristics were similar between HD and non-HD cases. In HD, the median expanded (CAG)n (range) was 44 (40-81) units; R(2) between expanded HTT and age-at-onset (AO) was 0.55 (p=0.0001, Pearson). HDL2 was found in Rio de Janeiro (2 of 9 families) and Rio Grande do Sul states (2 of 68 families). We detected HD in 89.4%, HDL2 in 3.8% and SCA2 in 1% of 104 Brazilian families. There were no cases of HDL1, SCA17, DRPLA, neuroferritinopathy, benign hereditary chorea or CHAC. Only six families (5.8%) remained without diagnosis.
Journal Article2013-10-17✓ 4 SnippetsSugita K, Ikenouchi-Sugita A, Nakayama Y, Yoshioka H, Nomura T, Sakabe J, Nakahigashi K, Kuroda E, Uematsu S, Nakamura J, Akira S, Nakamura M, Narumiya S, Miyachi Y, Tokura Y, Kabashima K.
In-Text Gene Mentions
I A O 0000326)
…Ptgis…
Results)
…, Ptgfs ,Ptgis, and Tbxas1…
Results)
…, Ptgfs ,Ptgisand Tbxas1 mRNA…
Results)
…exposure, Ptges andPtgismRNA was increased…
Show Full Abstract
Pellagra is a photosensitivity syndrome characterized by three "D's": diarrhea, dermatitis, and dementia as a result of niacin deficiency. However, the molecular mechanisms of photosensitivity dermatitis, the hallmark abnormality of this syndrome, remain unclear. We prepared niacin deficient mice in order to develop a murine model of pellagra. Niacin deficiency induced photosensitivity and severe diarrhea with weight loss. In addition, niacin deficient mice exhibited elevated expressions of COX-2 and PGE syntheses (Ptges) mRNA. Consistently, photosensitivity was alleviated by a COX inhibitor, deficiency of Ptges, or blockade of EP4 receptor signaling. Moreover, enhanced PGE2 production in niacin deficiency was mediated via ROS production in keratinocytes. In line with the above murine findings, human skin lesions of pellagra patients confirmed the enhanced expression of Ptges. Niacin deficiency-induced photosensitivity was mediated through EP4 signaling in response to increased PGE2 production via induction of ROS formation.
Also flagged:renal failuremineralmetabolismchronic kidney diseasebone disorderbone diseases
Journal Article2013-10-17No SnippetsZhang C, Wen J, Li Z, Fan J.
Show Full Abstract
<h4>Background</h4>Chronic kidney disease-mineral and bone disorder (CKD-MBD) is a common complication in CKD patients, particularly in those with end-stage renal disease that requires dialysis. Lanthanum carbonate (LC) is a potent, non-aluminum, non-calcium phosphate binder. This systematic review evaluates the efficacy and safety of LC in CKD-MBD treatment for maintenance-dialysis patients.<h4>Methods</h4>A systematic review and meta-analysis on randomized controlled trials (RCTs) and quasi-RCTs was performed to assess the efficacy and safety of LC in maintenance hemodialysis or peritoneal dialysis patients. Analysis was performed using the statistical software Review Manager 5.1.<h4>Results</h4>Sixteen RCTs involving 3789 patients were identified and retained for this review. No statistical difference was found in all-cause mortality. The limited number of trials was insufficient to show the superiority of LC over other treatments in lowering vascular calcification or cardiovascular events and in improving bone morphology, bone metabolism, or bone turn-over parameters. LC decreased the serum phosphorus level and calcium × phosphate product (Ca × P) as compared to placebo. LC, calcium carbonate (CC), and sevelamer hydrochloride (SH) were comparable in terms of controlling the serum phosphorus, Ca × P product, and intact parathyroid hormone (iPTH) levels. However, LC resulted in a lower serum calcium level and a higher bone-specific alkaline phosphatase level compared with CC. LC had higher total cholesterol and low-density lipoprotein (LDL) cholesterol levels compared with SH. LC-treated patients appeared to have a higher rate of vomiting and lower risk of hypercalcemia, diarrhea, intradialytic hypotension, cramps or myalgia, and abdominal pain. Meta-analysis showed no significant difference in the incidence of other side effects. Accumulation of LC in blood and bone was below toxic levels.<h4>Conclusions</h4>LC has high efficacy in lowering serum phosphorus and iPTH levels without increasing the serum calcium. Current evidence does not show a higher rate of adverse effects for LC compared with other treatments, except for a higher incidence of vomiting. Moreover, LC accumulation in blood and bone was below toxic levels. Well-designed studies should be conducted to evaluate the long-term effects of LC.
Also flagged:waterarachidic acidhydrocarboncarboxylcyaninemetals
Journal Article2013-10-17No SnippetsMiura YF, Sano M, Sugimoto T.
Show Full Abstract
We have characterized the binary LB films of merocyanine dye (MS) and arachidic acid (C20) before and after hydrothermal treatment (HTT), which is defined as a heat treatment under relative humidity of 100%, focusing on the morphology studied by bright field (BF) microscopy and fluorescence (FL) microscopy. BF microscopy observation has revealed that the as-deposited MS-C20 binary LB film is found to emit intense red fluorescence over the whole film area by 540-nm excitation. Since the surface image is almost featureless, it is considered that the crystallite sizes of J-aggregate are less than 10 μm. Interestingly, after HTT, round-shaped domains are observed in the LB systems, and the sizes are reaching 100 μm in diameter. Crystallites of J-aggregate, which are bluish in color and emit intense red fluorescence, tend to be in the round domains. We have observed two different types of domains, i.e., blue-rimmed domains and white-rimmed domains, which are postulated to be confined in the inner layers and located at the outermost layer, respectively. The thickness of the domains is equal to or less than that of the double layer of the MS-C20 mixed LB film, which is ca. 5.52 nm. The molecular order of MS in the J-aggregate is improved by the HTT process leading to the significant sharpening of the band shape together with the further red shift of the band (from 590 to 594 nm up to 597 to 599 nm). The reorganized J-band is considered to be 'apparently' isotropic owing to the random growth of the J-aggregate in the film plane. We consider that the lubrication effect by the presence of water molecules predominates in the HTT process.
The receptor tyrosine kinase Met and its ligand, the hepatocyte growth factor, are essential to embryonic development, whereas the deregulation of Met signaling is associated with tumorigenesis. While ligand-activated Met promotes survival, caspase-dependent generation of the p40 Met fragment leads to apoptosis induction - hallmark of the dependence receptor. Although the survival signaling pathways induced by Met are well described, the pro-apoptotic signaling pathways are unknown. We show that, although p40 Met contains the entire kinase domain, it accelerates apoptosis independently of kinase activity. In cell cultures undergoing apoptosis, the fragment shows a mitochondrial localization, required for p40 Met-induced cell death. Fulminant hepatic failure induced in mice leads to the generation of p40 Met localized also in the mitochondria, demonstrating caspase cleavage of Met in vivo. According to its localization, the fragment induces mitochondrial permeabilization, which is inhibited by Bak silencing and Bcl-xL overexpression. Moreover, Met silencing delays mitochondrial permeabilization induced by an apoptotic treatment. Thus, the Met-dependence receptor in addition to its well-known role in survival signaling mediated by its kinase activity, also participates in the intrinsic apoptosis pathway through the generation of p40 Met - a caspase-dependent fragment of Met implicated in the mitochondrial permeabilization process.
Also flagged:serotoninbipolar affective disorderbipolar I disordermood disorderHTR2ASLC6A4
Journal Article2013-10-17No SnippetsXiang B, Yang Z, Lin Y, Guan L, Li X, Deng W, Jiang Z, Lao G, Wang Q, Hao X, Liu X, Wang Y, Zhao L, Ma X, Li T, Cao L, Hu X.
Show Full Abstract
Serotonin plays an important role in mood regulation, but the involvement of serotonin pathway genes in the development of bipolar I disorder (BP-I), a mood disorder, is not clear. We selected 21 single-nucleotide polymorphisms (SNPs) within the HTR2A gene, 8 within the SLC6A4 gene and 23 within the TPH2 gene for genotyping using the GoldenGate genotyping assay. A total of 375 patients with BP-I and 475 normal controls were recruited. Two out of 21 SNPs (rs1475196 and rs9567747) in the HTR2A gene and 1/23 SNPs (rs17110566) in the TPH2 gene were significantly associated with BP-I, both genotype-wise and allele-wise. Furthermore, a specific haplotype in the HTR2A gene showed a significant association with BP-I. Our results indicate that the HTR2A and TPH2 genes in the serotonin pathway play important roles in susceptibility to BP-I.
Also flagged:Inherited arrhythmiaslong QT syndromeBrugada syndromecatecholaminergic polymorphic ventricular tachycardiaion channelsSCN5A
Journal Article2013-10-17No SnippetsWalsh R, Peters NS, Cook SA, Ware JS.
Show Full Abstract
<h4>Background</h4>Distinguishing genetic variants that cause disease from variants that are rare but benign is one of the principal challenges in contemporary clinical genetics, particularly as variants are identified at a pace exceeding the capacity of researchers to characterise them functionally.<h4>Methods</h4>We previously developed a novel method, called paralogue annotation, which accurately and specifically identifies disease-causing missense variants by transferring disease-causing annotations across families of related proteins. Here we refine our approach, and apply it to novel variants found in 2266 patients across two large cohorts with inherited sudden death syndromes, namely catecholaminergic polymorphic ventricular tachycardia (CPVT) or Brugada syndrome (BrS).<h4>Results</h4>Over one third of the novel non-synonymous variants found in these studies, which would otherwise be reported in a clinical diagnostics setting as 'variants of unknown significance', are categorised by our method as likely disease causing (positive predictive value 98.7%). This identified more than 500 new disease loci for BrS and CPVT.<h4>Conclusions</h4>Our methodology is widely transferable across all human disease genes, with an estimated 150 000 potentially informative annotations in more than 1800 genes. We have developed a web resource that allows researchers and clinicians to annotate variants found in individuals with inherited arrhythmias, comprising a referenced compendium of known missense variants in these genes together with a user-friendly implementation of our approach. This tool will facilitate the interpretation of many novel variants that might otherwise remain unclassified.
Also flagged:Lgr5WntDkk1Wnt3aFertilizationgastrulation
Journal Article2013-10-17✓ 1 SnippetFordham RP, Yui S, Hannan NR, Soendergaard C, Madgwick A, Schweiger PJ, Nielsen OH, Vallier L, Pedersen RA, Nakamura T, Watanabe M, Jensen KB.
In-Text Gene Mentions
Results)
…stem cell markerOlfm4as well as…
Show Full Abstract
Regeneration and homeostasis in the adult intestinal epithelium is driven by proliferative resident stem cells, whose functional properties during organismal development are largely unknown. Here, we show that human and mouse fetal intestine contains proliferative, immature progenitors, which can be expanded in vitro as Fetal Enterospheres (FEnS). A highly similar progenitor population can be established during intestinal differentiation of human induced pluripotent stem cells. Established cultures of mouse fetal intestinal progenitors express lower levels of Lgr5 than mature progenitors and propagate in the presence of the Wnt antagonist Dkk1, and new cultures can be induced to form mature intestinal organoids by exposure to Wnt3a. Following transplantation in a colonic injury model, FEnS contribute to regeneration of colonic epithelium by forming epithelial crypt-like structures expressing region-specific differentiation markers. This work provides insight into mechanisms underlying development of the mammalian intestine and points to future opportunities for patient-specific regeneration of the digestive tract.
While nucleic acids such as small interfering RNA (siRNA) and plasmid DNA (pDNA) are promising research tools and therapeutic modalities, their potential in medical applications is limited by a fundamental mechanistic understanding and inadequate efficiency. Herein, two series of carbohydrate-based polycations were synthesized and examined that varied in the degree of polymerization (n), one containing trehalose [Tr4(n) series: Tr4(23), Tr4(55), Tr4(77)] and the other containing β-cyclodextrin [CD4(n) series: CD4(10), CD4(26), CD4(39), CD4(143), CD4(239)]. In addition, two monosaccharide models were examined for comparison that contain tartaramidoamine (T4) and galactaramidoamine (G4 or Glycofect) repeats. Delivery profiles for pDNA were compared with those obtained for siRNA delivery and reveal that efficacy differs significantly as a function of carbohydrate type, nucleic acid type and dose, polymer length, and presence of excess polymer in the formulation. The Tr4 polymers yielded higher efficacy for pDNA delivery, yet the CD4 polymers achieved higher siRNA delivery and gene down-regulation. The T4 and Glycofect derivatives, while efficient for pDNA delivery, were completely ineffective for siRNA delivery. A strong polymer length and dose dependence on target gene knockdown was observed for all polymers tested. Also, free polymer in solution (uncomplexed) was demonstrated to be a key factor in promoting siRNA uptake and gene down-regulation.
Also flagged:insitu tumorhepatocellular carcinomacancershydroxyapatitetumor
Journal Article2013-10-16No SnippetsAbei M, Okumura T, Fukuda K, Hashimoto T, Araki M, Ishige K, Hyodo I, Kanemoto A, Numajiri H, Mizumoto M, Sakae T, Sakurai H, Zenkoh J, Ariungerel G, Sogo Y, Ito A, Ohno T, Tsuboi K.
Show Full Abstract
<h4>Background</h4>Proton-beam radiotherapy (PBT) has been shown to be effective to hepatocellular carcinoma (HCC) as a nonsurgical local treatment option. However, HCC still remains as one of the most difficult cancers to be cured because of frequent recurrences. Thus, methods to inhibit the recurrence need to be explored. To prevent the HCC recurrence, we here report on a prospective phase I study of 'in situ' tumor vaccination using CalTUMP, a newly developed immunoadjuvant consisting of BCG extract bound to hydroxyapatite and microparticulated tuberculin, following local PBT for HCC.<h4>Methods</h4>Patients with locally advanced recurrent HCC, which had been heavily pretreated with various treatments, were enrolled. PBT was performed with the conventional method to the target HCC. Subsequently, CalTUMP was injected into the same irradiated-tumor three times at one-week intervals. Three dose-levels of CalTUMP (1/10, 1/3, and 1/1) were administered to 3 patients each. Vital signs, blood samples, ultrasound, and computed tomographic scans were monitored to evaluate the safety.<h4>Results</h4>Three intratumoral injections of CalTUMP following PBT (median dose: 72.6 GyE) were accomplished in 9 patients. Transient low-grade fever and minor laboratory changes were observed in 7 patients after CalTUMP injections. No other treatment-related adverse events were observed. Median progression-free survival was 6.0 months (range: 2.1-14.2) and 4 patients were progression-free for more than 1 year.<h4>Conclusions</h4>Intratumoral injection of CalTUMP following PBT was feasible and safe in patients with heavily pre-treated HCC. Further clinical studies to evaluate the efficacy of this in situ tumor vaccination are warranted.
Also flagged:Transcription factorsgene expressionTFbindingCD4of
Journal Article2013-10-16✓ 1 SnippetDiez D, Hutchins AP, Miranda-Saavedra D.
In-Text Gene Mentions
Methods)
…Sox2 and Brn2 (Pou3f2) performed in NPCs.…
Show Full Abstract
Transcription factors (TFs) combine with co-factors to form transcriptional regulatory modules (TRMs) that regulate gene expression programs with spatiotemporal specificity. Here we present a novel and generic method (rTRM) for the reconstruction of TRMs that integrates genomic information from TF binding, cell type-specific gene expression and protein-protein interactions. rTRM was applied to reconstruct the TRMs specific for embryonic stem cells (ESC) and hematopoietic stem cells (HSC), neural progenitor cells, trophoblast stem cells and distinct types of terminally differentiated CD4(+) T cells. The ESC and HSC TRM predictions were highly precise, yielding 77 and 96 proteins, of which ∼75% have been independently shown to be involved in the regulation of these cell types. Furthermore, rTRM successfully identified a large number of bridging proteins with known roles in ESCs and HSCs, which could not have been identified using genomic approaches alone, as they lack the ability to bind specific DNA sequences. This highlights the advantage of rTRM over other methods that ignore PPI information, as proteins need to interact with other proteins to form complexes and perform specific functions. The prediction and experimental validation of the co-factors that endow master regulatory TFs with the capacity to select specific genomic sites, modulate the local epigenetic profile and integrate multiple signals will provide important mechanistic insights not only into how such TFs operate, but also into abnormal transcriptional states leading to disease.
Also flagged:reproductionfertilizationthioredoxin peroxidase 1transthyretinretinol-binding proteinpeptide
Journal Article2013-10-16✓ 1 SnippetSeverino V, Malorni L, Cicatiello AE, D'Esposito V, Longobardi S, Colacurci N, Miraglia N, Sannolo N, Farina A, Chambery A.
The emergence of high-throughput protein quantification methodologies has enabled the comprehensive characterization by longitudinal and cross-sectional studies of biological fluids under physiological and pathological conditions. In particular, the simultaneous investigation of cytokines and growth factors signaling pathways and their associated downstream effectors by integrated multiplexed approaches offers a powerful strategy to gain insights into biological networks and processes in living systems. A growing body of research indicates that bioactive molecules of human reproductive fluids, including human follicular fluid (hFF), may affect oocyte quality, fertilization and embryo development, thus potentially influencing the physiopathology of pregnancy-related conditions. In this work, an iTRAQ labeling strategy has been complemented with a multiplexed protein array approach to analyze hFFs with the aim to investigate biological processes and pathways related to in vitro fertilization (IVF) outcome. The iTRAQ labeling strategy lead to the quantification of 89 proteins, 30 of which were differentially expressed in hFFs with successful compared to unsuccessful IVF outcome. The targeted study, based on multiplexed antibody protein arrays, allowed the simultaneous quantification of 27 low abundance proteins, including growth factors, chemokines and cytokines endowed with pro- and anti-inflammatory activity. A significant number of differentially regulated proteins were involved in biological functions related to blood coagulation, acute phase response signaling and complement system. Overall, the present results provide an integrated overview of protein changes in hFFs associated to IVF outcome, thus improving current knowledge in reproductive medicine and fertility research.
Also flagged:extracellularcollagenproteoglycansmatrix proteinsagingosteoarthritis
Journal Article2013-10-16✓ 5 SnippetsOutani H, Okada M, Yamashita A, Nakagawa K, Yoshikawa H, Tsumaki N.
In-Text Gene Mentions
Results)
…The transduction of HDFs with SOX9, SOX5 and SOX6 also produced 91 colonies in the presence of puromycin.…
Introduction)
…Sox9, Sox5 andSox6play important roles…
Introduction)
…Sox9, Sox5, andSox6activate the transcription…
Introduction)
…expression of Sox5,Sox6and Sox9 by…
Methods)
…Human SOX5 andSOX6cDNAs were PCR…
Show Full Abstract
The repair of large cartilage defects with hyaline cartilage continues to be a challenging clinical issue. We recently reported that the forced expression of two reprogramming factors (c-Myc and Klf4) and one chondrogenic factor (SOX9) can induce chondrogenic cells from mouse dermal fibroblast culture without going through a pluripotent state. We here generated induced chondrogenic (iChon) cells from human dermal fibroblast (HDF) culture with the same factors. We developed a chondrocyte-specific COL11A2 promoter/enhancer lentiviral reporter vector to select iChon cells. The human iChon cells expressed marker genes for chondrocytes but not fibroblasts, and were derived from non-chondrogenic COL11A2-negative cells. The human iChon cells formed cartilage but not tumors in nude mice. This approach could lead to the preparation of cartilage directly from skin in human, without going through pluripotent stem cells.
Also flagged:infectionsHCV infectionliver diseaseschronic hepatitiscirrhosishepatocellular carcinoma
Journal Article2013-10-16No SnippetsLee C.
Show Full Abstract
Chronic hepatitis C virus (HCV) infection is responsible for the development of liver cirrhosis and hepatocellular carcinoma. It has been a tremendous burden on global health care systems. With the advent of a number of new direct-acting and host-targeting antiviral agents, current interferon-α- and ribavirin-based HCV therapy has started to move towards an interferon-sparing or even interferon-free strategy. In this regard, a recently identified NS5A inhibitor, daclatasvir, showed a great promise in clinical trials as another new class of direct-acting anti-HCV therapeutics, with a distinct mechanism of action. In this review, a variety of preclinical as well as clinical proof-of-concept studies of daclatasvir, including the studies of its discovery, mechanism of action, viral resistance, and host polymorphism profiles are reviewed. In addition, a role of daclatasvir in the future therapy for HCV patients is discussed briefly.
Also flagged:gene expressioncancermethylationglioblastoma multiformeGBMregulation of
Journal Article2013-10-16✓ 2 SnippetsKim D, Shin H, Joung JG, Lee SY, Kim JH.
In-Text Gene Mentions
Results)
…HFE, one of the selected target genes of hsa-mir-20a, has been found to be associated with immune response in GBM and ovarian cancer [50,52].…
Results)
…HFE, one of…
Show Full Abstract
<h4>Background</h4>In computational biology, a novel knowledge has been obtained mostly by identifying 'intra-relation,' the relation between entities on a specific biological level such as from gene expression or from microRNA (miRNA) and many such researches have been successful. However, intra-relations are not fully explaining complex cancer mechanisms because the inter-relation information between different levels of genomic data is missing, e.g. miRNA and its target genes. The 'inter-relation' between different levels of genomic data can be constructed from biological experimental data as well as genomic knowledge.<h4>Methods</h4>Previously, we have proposed a graph-based framework that integrates with multi-layers of genomic data, copy number alteration, DNA methylation, gene expression, and miRNA expression, for the cancer clinical outcome prediction. However, the limitation of previous work was that we integrated with multi-layers of genomic data without considering of inter-relationship information between genomic features. In this paper, we propose a new integrative framework that combines genomic dataset from gene expression and genomic knowledge from inter-relation between miRNA and gene expression for the clinical outcome prediction as a pilot study.<h4>Results</h4>In order to demonstrate the validity of the proposed method, the prediction of short-term/long-term survival for 82 patients in glioblastoma multiforme (GBM) was adopted as a base task. Based on our results, the accuracy of our predictive model increases because of incorporation of information fused over genomic dataset from gene expression and genomic knowledge from inter-relation between miRNA and gene expression.<h4>Conclusions</h4>In the present study, the intra-relation of gene expression was reconstructed from inter-relation between miRNA and gene expression for prediction of short-term/long-term survival of GBM patients. Our finding suggests that the utilization of external knowledge representing miRNA-mediated regulation of gene expression is substantially useful for elucidating the cancer phenotype.
Also flagged:cancermitochondriamitochondrialcell growth8-oxoguanineapurinic/apyrimidinic endonuclease 1
Journal Article2013-10-15No SnippetsScott TL, Rangaswamy S, Wicker CA, Izumi T.
Show Full Abstract
<h4>Significance</h4>Reactive oxygen species (ROS) are generated by exogenous and environmental genotoxins, but also arise from mitochondria as byproducts of respiration in the body. ROS generate DNA damage of which pathological consequence, including cancer is well established. Research efforts are intense to understand the mechanism of DNA base excision repair, the primary mechanism to protect cells from genotoxicity caused by ROS.<h4>Recent advances</h4>In addition to the notion that oxidative DNA damage causes transformation of cells, recent studies have revealed how the mitochondrial deficiencies and ROS generation alter cell growth during the cancer transformation.<h4>Critical issues</h4>The emphasis of this review is to highlight the importance of the cellular response to oxidative DNA damage during carcinogenesis. Oxidative DNA damage, including 7,8-dihydro-8-oxoguanine, play an important role during the cellular transformation. It is also becoming apparent that the unusual activity and subcellular distribution of apurinic/apyrimidinic endonuclease 1, an essential DNA repair factor/redox sensor, affect cancer malignancy by increasing cellular resistance to oxidative stress and by positively influencing cell proliferation.<h4>Future directions</h4>Technological advancement in cancer cell biology and genetics has enabled us to monitor the detailed DNA repair activities in the microenvironment. Precise understanding of the intracellular activities of DNA repair proteins for oxidative DNA damage should provide help in understanding how mitochondria, ROS, DNA damage, and repair influence cancer transformation.
Also flagged:Transferrinimmune complex diseasegammopathyIgGhypersideremiahypertransferrinemia
Journal Article2013-10-15✓ 1 SnippetForni GL, Pinto V, Musso M, Mori M, Girelli D, Caldarelli I, Borriello A, Ragione FD.
In-Text Gene Mentions
Abstract)
…MGUS and ashemochromatosis.…
Show Full Abstract
The combination of marked hypersideremia, hypertransferrinemia, and monoclonal gammopathy of underdetermined significance (MGUS) should alert clinicians to the possible presence of an anti-transferrin immunoglobulin, an uncommon acquired disorder also defined as transferrin-immune complex disease (TICD). The authors have previously described a case of TICD with 100% transferrin saturation and liver iron overload. However, the findings in the few cases so far reported are heterogeneous, and the presence of high transferrin saturation and liver iron overload is not universal. In this article, the authors have described the identification of two additional patients with anti-transferrin monoclonal gammopathy, hypersideremia, and hypertransferrinemia, but with incomplete transferrin saturation and no hepatic iron overload. The autoantibodies were purified by using transferrin as affinity bait and characterized. One subject showed a high-titer monoclonal anti-transferrin IgM with a κ-type light chain. This finding is the first observation of IgM autoantibodies against transferrin. The other patient developed the disease after pregnancy. In this study, monoclonal antibody was an IgG mounting a κ-type light chain with altered molecular weight. These results highlight that transferrin might induce the development of a monoclonal immune response of different classes and specificity. The identification, in a single hematologic center, of three different subjects with anti-transferrin monoclonal gammopathy suggests that the disease probably represents a still underdiagnosed condition. From a clinical standpoint, these patients must be followed up both as MGUS and as hemochromatosis.
Intermolecular interactions in the aqueous phase must compete with the interactions between the two binding partners and their solvating water molecules. In biological systems, water molecules in protein binding sites cluster at well-defined hydration sites and can form strong hydrogen-bonding interactions with backbone and side-chain atoms. Displacement of such water molecules is only favorable when the ligand can form strong compensating hydrogen bonds. Conversely, water molecules in hydrophobic regions of protein binding sites make only weak interactions, and the requirements for favorable displacement are less stringent. The propensity of water molecules for displacement can be identified using inhomogeneous fluid solvation theory (IFST), a statistical mechanical method that decomposes the solvation free energy of a solute into the contributions from different spatial regions and identifies potential binding hotspots. In this study, we employed IFST to study the displacement of water molecules from the ATP binding site of Hsp90, using a test set of 103 ligands. The predicted contribution of a hydration site to the hydration free energy was found to correlate well with the observed displacement. Additionally, we investigated if this correlation could be improved by using the energetic scores of favorable probe groups binding at the location of hydration sites, derived from a multiple copy simultaneous search (MCSS) method. The probe binding scores were not highly predictive of the observed displacement and did not improve the predictivity when used in combination with IFST-based hydration free energies. The results show that IFST alone can be used to reliably predict the observed displacement of water molecules in Hsp90. However, MCSS can augment IFST calculations by suggesting which functional groups should be used to replace highly displaceable water molecules. Such an approach could be very useful in improving the hit-to-lead process for new drug targets.
Also flagged:cancerNutlin-3p53synthesisamidinecis -
Journal Article2013-10-15No SnippetsDavis TA, Vilgelm AE, Richmond A, Johnston JN.
Show Full Abstract
Chiral nonracemic cis-4,5-bis(aryl)imidazolines have emerged as a powerful platform for the development of cancer chemotherapeutics, stimulated by the Hoffmann-La Roche discovery that Nutlin-3 can restore apoptosis in cells with wild-type p53. The lack of efficient methods for the enantioselective synthesis of cis-imidazolines, however, has limited their more general use. Our disclosure of the first enantioselective synthesis of (-)-Nutlin-3 provided a basis to prepare larger amounts of this tool used widely in cancer biology. Key to the decagram-scale synthesis described here was the discovery of a novel bis(amidine) organocatalyst that provides high enantioselectivity at warmer reaction temperature (-20 °C) and low catalyst loadings. Further refinements to the procedure led to the synthesis of (-)-Nutlin-3 in a 17 g batch and elimination of all but three chromatographic purifications.
…Six percent of these premature deaths can possibly be avoided by early screening for TS or HFE genotype.<h4>Conclusions</h4>Individuals with diabetes, ascertained in the general population, with increased TS or HFE genotype have a twofold to sixfold increased risk of premature death.…
Title)
…transferrin saturation andhemochromatosisgenotype in individuals…
Abstract)
…of TS andhemochromatosisgenotype (HFE) G…
Abstract)
…for TS orHFEgenotype.<h4>Conclusions</h4>I…
Abstract)
…increased TS orHFEgenotype have a…
Show Full Abstract
<h4>Objective</h4>Mortality is increased in patients with hereditary hemochromatosis, in individuals from the general population with increased transferrin saturation (TS), and also in patients with type 1 diabetes and increased TS from a highly specialized diabetes clinic. Thus, we have recommended targeted screening for TS in specialized diabetes clinics. Whether mortality is also increased in individuals from the general population with diabetes and increased TS is unknown.<h4>Research design and methods</h4>In two Danish population studies (N = 84,865), we examined mortality according to baseline levels of TS and hemochromatosis genotype (HFE) G → A substitution at nucleotide 845 in codon 282 (C282Y/C282Y) in individuals with diabetes (type 1, N = 118; type 2, N = 3,228; total, N = 3,346).<h4>Results</h4>The cumulative survival rate was reduced in individuals with diabetes with TS ≥50% vs. <50% (log-rank; P < 0.0001), with median survival ages of 66 and 79 years, respectively. The hazard ratio (HR) for TS ≥50% vs. <50% was 2.0 (95% CI 1.3-2.8; P = 0.0004) for total mortality overall (and similar for men and women separately); 2.6 (1.3-5.4; P = 0.008) for neoplasms; and 3.4 (2.0-6.0; P = 0.00002) for endocrinological causes. A stepwise increased risk of total mortality was observed for stepwise increasing TS (log-rank test, P = 0.0001), with an HR for TS ≥70% vs. TS <20% of 4.8 (2.0-12; P = 0.0006). The HR for total mortality in individuals with diabetes for C282Y/C282Y versus wild type/wild type was 3.3 (1.04-10; P = 0.04), and for C282Y/C282Y and TS ≥50% versus wild type/wild type and TS <50% was 6.0 (1.5-24; P = 0.01). Six percent of these premature deaths can possibly be avoided by early screening for TS or HFE genotype.<h4>Conclusions</h4>Individuals with diabetes, ascertained in the general population, with increased TS or HFE genotype have a twofold to sixfold increased risk of premature death.
<h4>Objective</h4>To investigate the impact of iron status on survival in patients with type 2 diabetes and coronary artery disease (CAD).<h4>Research design and methods</h4>Serum ferritin, transferrin saturation (Tsat), and soluble transferrin receptor (sTfR) were measured in 287 patients with type 2 diabetes and stable CAD (65 ± 9 years of age, 78% men).<h4>Results</h4>During a mean follow-up of 45 ± 19 months, there were 59 (21%) deaths and 60 (21%) cardiovascular hospitalizations. Both serum ferritin and sTfR strongly predicted 5-year all-cause mortality rates, independently of other variables (including hemoglobin, measures of renal function, inflammation, and neurohormonal activation). There was an exponential relationship between sTfR and mortality (adjusted hazard ratio [HR] per 1 log mg/L: 4.24 [95% CI 1.43-12.58], P = 0.01), whereas the relationship between ferritin and mortality was U-shaped (for the lowest and the highest quintiles vs. the middle quintile [reference group], respectively: adjusted HR 7.18 [95% CI 2.03-25.46], P = 0.002, and adjusted HR 5.12 [1.48-17.73], P = 0.01). Similar patterns were observed for the composite outcome of all-cause mortality or cardiovascular hospitalization, and in these multivariable models, low Tsat was related to unfavorable outcome.<h4>Conclusions</h4>Both low and high serum ferritin (possibly reflecting depleted and excessive iron stores, respectively) along with high serum sTfR (reflecting reduced metabolically available iron) identify patients with type 2 diabetes and CAD who have a poor prognosis.
Also flagged:autoimmune diseasesextracellularGene expressionpolysomesbindingstem cell development
Journal Article2013-10-15✓ 1 SnippetSpangenberg L, Correa A, Dallagiovanna B, Naya H.
In-Text Gene Mentions
Results)
…DCN, BRK1, OSTC,PEBP1, BNIP3L, SAR1A and…
Show Full Abstract
Post-transcriptional regulation of stem cell differentiation is far from being completely understood. Changes in protein levels are not fully correlated with corresponding changes in mRNAs; the observed differences might be partially explained by post-transcriptional regulation mechanisms, such as alternative polyadenylation. This would involve changes in protein binding, transcript usage, miRNAs and other non-coding RNAs. In the present work we analyzed the distribution of alternative transcripts during adipogenic differentiation and the potential role of miRNAs in post-transcriptional regulation. Our in silico analysis suggests a modest, consistent, bias in 3'UTR lengths during differentiation enabling a fine-tuned transcript regulation via small non-coding RNAs. Including these effects in the analyses partially accounts for the observed discrepancies in relative abundance of protein and mRNA.
Also flagged:acute disorderschronic diseasesmetalsironnickelsulfur
Journal Article2013-10-15No SnippetsWei Y, Wang Z, Chang CY, Fan T, Su L, Chen F, Christiani DC.
Show Full Abstract
<h4>Background</h4>Welding-associated air pollutants negatively affect the health of exposed workers; however, their molecular mechanisms in causing disease remain largely unclear. Few studies have systematically investigated the systemic toxic effects of welding fumes on humans.<h4>Objectives</h4>To explore the effects of welding fumes on the plasma metabolome, and to identify biomarkers for risk assessment of welding fume exposure.<h4>Methods</h4>The two-stage, self-controlled exploratory study included 11 boilermakers from a 2011 discovery panel and 8 boilermakers from a 2012 validation panel. Plasma samples were collected pre- and post-welding fume exposure and analyzed by chromatography/mass spectrometry.<h4>Results</h4>Eicosapentaenoic or docosapentaenoic acid metabolic changes post-welding were significantly associated with particulate (PM2.5) exposure (p<0.05). The combined analysis by linear mixed-effects model showed that exposure was associated with a statistically significant decline in metabolite change of eicosapentaenoic acid [β(95% CI) = -0.013(-0.022 ≈ -0.004); p = 0.005], docosapentaenoic acid n3 [β(95% CI) = -0.010(-0.018 ≈ -0.002); p = 0.017], and docosapentaenoic acid n6 [β(95% CI) = -0.007(-0.013 ≈ -0.001); p = 0.021]. Pathway analysis identified an association of the unsaturated fatty acid pathway with exposure (p Study-2011 = 0.025; p Study-2012 = 0.021; p Combined = 0.009). The functional network built by these fatty acids and their interactive genes contained significant enrichment of genes associated with various diseases, including neoplasms, cardiovascular diseases, and lipid metabolism disorders.<h4>Conclusions</h4>High-dose exposure of metal welding fumes decreases unsaturated fatty acids with an exposure-response relationship. This alteration in fatty acids is a potential biological mediator and biomarker for exposure-related health disorders.
…To investigate this, we developed a murine model of combined liver injury by co-feeding the mildly iron overloaded, the hemochromatosis gene-null (Hfe(-/)) mouse ad libitum with ethanol and a high-fat diet (HFD) for 8 weeks.…
…he hemochromatosis gene-null (Hfe(-/)) mouse ad libitum…
Abstract)
…apoptosis in theHfe(-/-) mice as compared…
Abstract)
…elevated in theHfe(-/-) group co-fed ethanol…
Show Full Abstract
Endoplasmic reticulum (ER) stress is an important pathogenic mechanism for alcoholic (ALD) and nonalcoholic fatty liver disease (NAFLD). Iron overload is an important cofactor for liver injury in ALD and NAFLD, but its role in ER stress and associated stress signaling pathways is unclear. To investigate this, we developed a murine model of combined liver injury by co-feeding the mildly iron overloaded, the hemochromatosis gene-null (Hfe(-/)) mouse ad libitum with ethanol and a high-fat diet (HFD) for 8 weeks. This co-feeding led to profound steatohepatitis, significant fibrosis, and increased apoptosis in the Hfe(-/-) mice as compared with wild-type (WT) controls. Iron overload also led to induction of unfolded protein response (XBP1 splicing, activation of IRE-1α and PERK, as well as sequestration of GRP78) and ER stress (increased CHOP protein expression) following HFD and ethanol. This is associated with a muted autophagic response including reduced LC3-I expression and impaired conjugation to LC3-II, reduced beclin-1 protein, and failure of induction of autophagy-related proteins (Atg) 3, 5, 7, and 12. As a result of the impaired autophagy, levels of the sequestosome protein p62 were most elevated in the Hfe(-/-) group co-fed ethanol and HFD. Iron overload reduces the activation of adenosine monophosphate protein kinase associated with ethanol and HFD feeding. We conclude that iron toxicity may modulate hepatic stress signaling pathways by impairing adaptive cellular compensatory mechanisms in alcohol- and obesity-induced liver injury.
Also flagged:CYP2A6tobacco dependencenicotinebupropionHTR2A5HTT
Journal Article2013-10-14✓ 1 SnippetVerde Z, Santiago C, Rodríguez González-Moro JM, de Lucas Ramos P, López Martín S, Bandrés F, Lucia A, Lucia A, Gómez-Gallego F.
In-Text Gene Mentions
Abstract)
…polymorphisms in CYP2A6,5-HTTand HTR2A genes.…
Show Full Abstract
Despite progress made in the treatment of tobacco dependence, currently available treatments are effective for only a fraction of smokers. The aim of this study was to evaluate the association between the effectiveness of treatment with nicotine or bupropion in heavy smokers (n=70), and 6 candidate polymorphisms in CYP2A6, 5-HTT and HTR2A genes. Analysis revealed a significant association between "favourable" genotype combination carriers (CYP2A6 "slow metabolizer" or 5HTT L-allele or HTR2A-1438GG) and nicotine treatment outcome (OR=2.69, 95% CI=1.28-5.64). Genetic variations in CYP2A6 gene or genotypes associated with reduced synaptic serotonin activity may influence the success of smoking cessation treatment.
In a previous study using transgenic mice ectopically expressing Hoxa2 during chondrogenesis, we associated the animal phenotype to human idiopathic proportionate short stature. Our analysis showed that this overall size reduction was correlated with a negative influence of Hoxa2 at the first step of endochondral ossification. However, the molecular pathways leading to such phenotype are still unknown. Using protein immunodetection and histological techniques comparing transgenic mice to controls, we show here that the persistent expression of Hoxa2 in chondrogenic territories provokes a general down-regulation of the main factors controlling the differentiation cascade, such as Bapx1, Bmp7, Bmpr1a, Ihh, Msx1, Pax9, Sox6, Sox9 and Wnt5a. These data confirm the impairment of chondrogenic differentiation by Hoxa2 overexpression. They also show a selective effect of Hoxa2 on endochondral ossification processes since Gdf5 and Gdf10, and Bmp4 or PthrP were up-regulated and unmodified, respectively. Since Hoxa2 deregulation in mice induces a proportionate short stature phenotype mimicking human idiopathic conditions, our results give an insight into understanding proportionate short stature pathogenesis by highlighting molecular factors whose combined deregulation may be involved in such a disease.
Also flagged:dosage compensationgenomic imprintingchromatinneurological disorderspathogenesisamino acids
Journal Article2013-10-14✓ 1 SnippetFenoglio C, Ridolfi E, Galimberti D, Scarpini E.
In-Text Gene Mentions
S I O 001029)
…Huntington’s disease (HD) is caused by an expansion repeat mutation in the Htt gene, which encodes a ubiquitously expressed 3144 amino acid protein of unknown function, leading to a toxic gain of function in the mutant protein [80], which promotes aberrant nuclear-cytoplasmic trafficking of the master neuronal regulator REST.…
Show Full Abstract
A novel class of transcripts, long non coding RNAs (lncRNAs), has recently emerged as key players in several biological processes, including dosage compensation, genomic imprinting, chromatin regulation, embryonic development and segmentation, stem cell pluripotency, cell fate determination and potentially many other biological processes, which still are to be elucidated. LncRNAs are pervasively transcribed in the genome and several lines of evidence correlate dysregulation of different lncRNAs to human diseases including neurological disorders. Although their mechanisms of action are yet to be fully elucidated, evidence suggests lncRNA contributions to the pathogenesis of a number of diseases. In this review, the current state of knowledge linking lncRNAs to different neurological disorders is discussed and potential future directions are considered.
Also flagged:DVL1colorectal cancercancertumorgene expressionantibody
Journal Article2013-10-14No SnippetsHuang MY, Yen LC, Liu HC, Liu PP, Chung FY, Wang TN, Wang JY, Lin SR.
Show Full Abstract
Undetected micrometastasis plays a key role in the metastasis of cancer in colorectal cancer (CRC) patients. The aim of this study is to identify a biomarker of CRC patients with liver metastasis through the detection of circulating tumor cells (CTCs). Microarray and bioinformatics analysis of 10 CRC cancer tissue specimens compared with normal adjacent tissues revealed that 31 genes were up-regulated (gene expression ratio of cancer tissue to paired normal tissue > 2) in the cancer patients. We used a weighted enzymatic chip array (WEnCA) including 31 prognosis-related genes to investigate CTCs in 214 postoperative stage I-III CRC patients and to analyze the correlation between gene expression and clinico-pathological parameters. We employed the immunohistochemistry (IHC) method with polyclonal mouse antibody against DVL1 to detect DVL1 expression in 60 CRC patients. CRC liver metastasis occurred in 19.16% (41/214) of the patients. Using univariate analysis and multivariate proportional hazards regression analysis, we found that DVL1 mRNA overexpression had a significant, independent predictive value for liver metastasis in CRC patients (OR: 5.764; 95% CI: 2.588-12.837; p < 0.0001 on univariate analysis; OR: 3.768; 95% CI: 1.469-9.665; p = 0.006 on multivariate analysis). IHC staining of the immunoreactivity of DVL1 showed that DVL1 was localized in the cytoplasm of CRC cells. High expression of DVL1 was observed in 55% (33/60) of CRC tumor specimens and was associated significantly with tumor depth, perineural invasion and liver metastasis status (all p < 0.05). Our experimental results demonstrated that DVL1 is significantly overexpressed in CRC patients with liver metastasis, leading us to conclude that DVL1 could be a potential prognostic and predictive marker for CRC patients.
Also flagged:cDNAATG16L1ulcerative colitisinflammatory disordersinflammatory responseTNF-alpha
Journal Article2013-10-14✓ 5 SnippetsMontero-Meléndez T, Llor X, García-Planella E, Perretti M, Suárez A.
In-Text Gene Mentions
Results)
…Figure 5 summarizes the best sets of genes found to correctly classify patients between these groups. The predictor classifiers of IBD forms vs. healthy samples showed the highest accuracy (>90%) but it dropped to 79% (CD vs. UC), 85% (CD1 vs. UC1) and 68% (CD2 vs. UC2). This result underlines the high similarity of both conditions at the gene expression level. The best predictor of CD vs. UC consisted of 5 genes with a prediction error of 21% (Figure 5D). A set of 10 genes was found to be the best predictor between the “High Inflammation” subgroups (CD2 and UC2) although the prediction error increased to 33% (Figure 5F). The lowest prediction error (15%) was obtained with “Low Inflammation” samples, i.e. CD1 vs. UC1 (Figure 5E). Interestingly, more than one probe for the same gene was identified in several predictor sets, a fact that may increase the significance of that particular gene as a potential biomarker. This was the case for the genes that encode for pleiotrophin (PTN), copine VIII (CPNE8), NAD(P)H dehydrogenase quinone 2 (NQO2) and EFR3 homolog A (EFR3A). OLFM4 and PTN were up-regulated in the predictor set that discriminated healthy controls from UC and CD patients (Figure 5A-C) (Figure 5D-F), suggesting a common biological role for OLFM4 and PTN in both forms of IBD. NQO2 and CPNE8 were identified as classifiers that discriminate CD vs. UC and CD1 vs. UC1 (Figure 5D and E), suggesting a potential utility as biomarkers for IBD diagnosis.…
Discussion)
…The same accounts for the glycoprotein olfactomedin 4 (OLFM4), up-regulated in both forms of IBD according to our data, that is secreted into mucus [22] and acts by inhibiting immune responses against Helicobacter pylori, hence contributing to the persistence of infection by a mechanism involving NOD1 and NOD2 [23].…
Results)
…OLFM4and PTN were…
Results)
…biological role forOLFM4and PTN in…
Discussion)
…glycoprotein olfactomedin 4 (OLFM4), up-regulated in both…
Show Full Abstract
<h4>Background</h4>Improvement of patient quality of life is the ultimate goal of biomedical research, particularly when dealing with complex, chronic and debilitating conditions such as inflammatory bowel disease (IBD). This is largely dependent on receiving an accurate and rapid diagnose, an effective treatment and in the prediction and prevention of side effects and complications. The low sensitivity and specificity of current markers burden their general use in the clinical practice. New biomarkers with accurate predictive ability are needed to achieve a personalized approach that take the inter-individual differences into consideration.<h4>Methods</h4>We performed a high throughput approach using microarray gene expression profiling of colon pinch biopsies from IBD patients to identify predictive transcriptional signatures associated with intestinal inflammation, differential diagnosis (Crohn's disease or ulcerative colitis), response to glucocorticoids (resistance and dependence) or prognosis (need for surgery). Class prediction was performed with self-validating Prophet software package.<h4>Results</h4>Transcriptional profiling divided patients in two subgroups that associated with degree of inflammation. Class predictors were identified with predictive accuracy ranging from 67 to 100%. The expression accuracy was confirmed by real time-PCR quantification. Functional analysis of the predictor genes showed that they play a role in immune responses to bacteria (PTN, OLFM4 and LILRA2), autophagy and endocytocis processes (ATG16L1, DNAJC6, VPS26B, RABGEF1, ITSN1 and TMEM127) and glucocorticoid receptor degradation (STS and MMD2).<h4>Conclusions</h4>We conclude that using analytical algorithms for class prediction discovery can be useful to uncover gene expression profiles and identify classifier genes with potential stratification utility of IBD patients, a major step towards personalized therapy.
…Furthermore, these results support in vivo studies which suggest that Hfe and Tfr2 can independently regulate hepcidin.…
Methods)
…The mouse Hfe (mHfe) coding sequence minus the signal peptide was amplified from mouse liver cDNA using the following primers: FP2-mHfe-Mlu CCGACGCGTGCACTGCCACCGCGT and RP2-mHfe-Mlu CCGACGCGTTCACTCACAGTCTGT and cloned into the MluI site of the pEFIRES-FLAG-S plasmid to create a bicistronic construct containing the IL-3 signal peptide fused to amino-terminally FLAG-tagged mHfe with the puromycin resistance gene (pac) following an internal ribosome entry site (IRES).…
Title)
…In Situ Proximity Ligation Assays Indicate That Hemochromatosis Proteins Hfe and Transferrin Receptor 2 (Tfr2) Do Not Interact…
Results)
…In a previous study involving a domain swap of Tfr1 and Tfr2 [8] it was shown that amino acid residues 104-249 of TFR2 are sufficient for it to interact with HFE.…
Results)
…We performed a Co-IP experiment with anti-FLAG and anti-Tfr2 using lysates from cells expressing Hfe and Tfr2Y245X; Figure 8 C shows that the truncated form of Tfr2 which contains only the first 244 amino acids of Tfr2 does not exist in a complex with FLAG-tagged Hfe.…
Show Full Abstract
The hemochromatosis associated proteins HFE and Transferrin Receptor 2 (TFR2) have been shown to be important for the proper regulation of hepcidin. A number of in vitro studies using transient overexpression systems have suggested that an interaction between HFE and TFR2 is required for the regulation of hepcidin. This model of iron sensing which centers upon the requirement for an interaction between HFE and TFR2 has recently been questioned with in vivo studies in mice from our laboratory and others which suggest that Hfe and Tfr2 can regulate hepcidin independently of each other. To re-examine the postulated interaction between Hfe and Tfr2 we developed a novel expression system in which both proteins are stably co-expressed and used the proximity ligation assay to examine the interactions between Hfe, Tfr1 and Tfr2 at a cellular level. We were able to detect the previously described interaction between Hfe and Tfr1, and heterodimers between Tfr1 and Tfr2; however no interaction between Hfe and Tfr2 was observed in our system. The results from this study indicate that Hfe and Tfr2 do not interact with each other when they are stably expressed at similar levels. Furthermore, these results support in vivo studies which suggest that Hfe and Tfr2 can independently regulate hepcidin.
Also flagged:LIM homeobox proteinLHX6transcription factorparvalbuminPVsomatostatin
Journal Article2013-10-14✓ 1 SnippetRubin AN, Kessaris N.
In-Text Gene Mentions
Introduction)
…SOX6and the recently…
Show Full Abstract
The homeobox-encoding gene Prox1 and its Drosophila homologue prospero are key regulators of cell fate-specification. In the developing rodent cortex a sparse population of cells thought to correspond to late-generated cortical pyramidal neuron precursors expresses PROX1. Using a series of transgenic mice that mark cell lineages in the subcortical telencephalon and, more specifically, different populations of cortical interneurons, we demonstrate that neurons expressing PROX1 do not represent pyramidal neurons or their precursors but are instead subsets of cortical interneurons. These correspond to interneurons originating in the lateral/caudal ganglionic eminence (LGE/CGE) and a small number of preoptic area (POA)-derived neurons. Expression within the cortex can be detected from late embryonic stages onwards when cortical interneurons are still migrating. There is persistent expression in postmitotic cells in the mature brain mainly in the outer cortical layers. PROX1(+ve) interneurons express neurochemical markers such as calretinin, neuropeptide Y, reelin and vasoactive intestinal peptide, all of which are enriched in LGE/CGE- and some POA-derived cells. Unlike in the cortex, in the striatum PROX1 marks nearly all interneurons regardless of their origin. Weak expression of PROX1 can also be detected in oligodendrocyte lineage cells throughout the forebrain. Our data show that PROX1 can be used as a genetic lineage tracer of nearly all LGE/CGE- and subsets POA-derived cortical interneurons at all developmental and postnatal stages in vivo.
Also flagged:metabolic diseasesobesitydiabetesPeroxisome proliferator-activated receptor γPPARγadipocyte differentiation
Journal Article2013-10-14No SnippetsPereira-Fernandes A, Demaegdt H, Vandermeiren K, Hectors TL, Jorens PG, Blust R, Vanparys C.
Show Full Abstract
Recently the environmental obesogen hypothesis has been formulated, proposing a role for endocrine disrupting compounds (EDCs) in the development of obesity. To evaluate this hypothesis, a screening system for obesogenic compounds is urgently needed. In this study, we suggest a standardised protocol for obesogen screening based on the 3T3-L1 cell line, a well-characterised adipogenesis model, and direct fluorescent measurement using Nile red lipid staining technique. In a first phase, we characterised the assay using the acknowledged obesogens rosiglitazone and tributyltin. Based on the obtained dose-response curves for these model compounds, a lipid accumulation threshold value was calculated to ensure the biological relevance and reliability of statistically significant effects. This threshold based method was combined with the well described strictly standardized mean difference (SSMD) method for classification of non-, weak- or strong obesogenic compounds. In the next step, a range of EDCs, used in personal and household care products (parabens, musks, phthalates and alkylphenol compounds), were tested to further evaluate the obesogenicity screening assay for its discriminative power and sensitivity. Additionally, the peroxisome proliferator activated receptor γ (PPARγ) dependency of the positive compounds was evaluated using PPARγ activation and antagonist experiments. Our results showed the adipogenic potential of all tested parabens, several musks and phthalate compounds and bisphenol A (BPA). PPARγ activation was associated with adipogenesis for parabens, phthalates and BPA, however not required for obesogenic effects induced by Tonalide, indicating the role of other obesogenic mechanisms for this compound.
The obesity and diabetes epidemics are continuing to spread across the globe. There is increasing evidence that diabetes leads to a significantly higher risk for certain types of cancer. Both diabetes and cancer are characterized by severe metabolic perturbations and the branched chain amino acids (BCAAs) appear to play a significant role in both of these diseases. These essential amino acids participate in a wide variety of metabolic pathways, but it is now recognized that they are also critical regulators of a number of cell signaling pathways. An elevation in branched chain amino acids has recently been shown to be significantly correlated with insulin resistance and the future development of diabetes. In cancer, the normal demands for BCAAs are complicated by the conflicting needs of the tumor and the host. The severe muscle wasting syndrome experience by many cancer patients, known as cachexia, has motivated the use of BCAA supplementation. The desired improvement in muscle mass must be balanced by the need to avoid providing materials for tumor proliferation. A better understanding of the complex functions of BCAAs could lead to their use as biomarkers of the progression of certain cancers in diabetic patients.
Also flagged:celiac diseaseliver disordersmultisystem disorderliver diseaseshypertransaminasemiaCD
Journal Article2013-10-13✓ 5 SnippetsRostami-Nejad M, Haldane T, Aldulaimi D, Alavian SM, Zali MR, Rostami K.
In-Text Gene Mentions
Results)
…Hemochromatosisand CD are…
Results)
…of mutations inhemochromatosisgene (HFE) (…
Results)
…in hemochromatosis gene (HFE) ( 34 ).…
Results)
…increased incidence ofHFEmutations in patients…
Results)
…the association betweenhemochromatosisand CD might…
Show Full Abstract
<h4>Context</h4>Celiac disease (CD) is defined as a permanent intolerance to ingested gluten. The intolerance to gluten results in immune-mediated damage of small intestine mucosa manifested by villous atrophy and crypt hyperplasia. These abnormalities resolve with initiationa gluten-free diet.<h4>Evidence acquisition</h4>PubMed, Ovid, and Google were searched for full text articles published between 1963 and 2012. The associated keywords were used, and papers described particularly the impact of celiac disease on severity of liver disorder were identified.<h4>Results</h4>Recently evidence has emerged revealingthat celiac disease not only is associated with small intestine abnormalities and malabsorption, but is also a multisystem disorder affecting other systems outside gastrointestinal tract, including musculo-skeletal, cardiovascular and nervous systems. Some correlations have been assumed between celiac and liver diseases. In particular, celiac disease is associated with changes in liver biochemistry and linked to alter the prognosis of other disorders. This review will concentrate on the effect of celiac disease and gluten-free diets on the severity of liver disorders.<h4>Conclusions</h4>Although GFD effect on the progression of CD associated liver diseases is not well defined, it seems that GFD improves liver function tests in patients with a hypertransaminasemia.
Also flagged:heart failuretranslationalischemic heart failurecoronary artery diseasehypertensionvalvular heart disease
Journal Article2013-10-12✓ 3 SnippetsPaterson I, Wells GA, Ezekowitz JA, White JA, Friedrich MG, Mielniczuk LM, O'Meara E, Chow B, DeKemp RA, Klein R, Dennie C, Dick A, Coyle D, Dwivedi G, Rajda M, Wright GA, Laine M, Hanninen H, Larose E, Connelly KA, Leong-Poi H, Howarth AG, Davies RA, Duchesne L, Yla-Herttuala S, Saraste A, Farand P, Garrard L, Tardif JC, Arnold M, Knuuti J, Beanlands R, Chan KL.
In-Text Gene Mentions
Introduction)
…[ 26 ],hemochromatosis[ 27 ]…
Introduction)
…known amyloidosis orhemochromatosis)…
Introduction)
…example, phlebotomy forhemochromatosis; steroids for sarcoidosis).…
Show Full Abstract
<h4>Background</h4>Imaging has become a routine part of heart failure (HF) investigation. Echocardiography is a first-line test in HF given its availability and it provides valuable diagnostic and prognostic information. Cardiac magnetic resonance (CMR) is an emerging clinical tool in the management of patients with non-ischemic heart failure. Current ACC/AHA/CCS/ESC guidelines advocate its role in the detection of a variety of cardiomyopathies but there is a paucity of high quality evidence to support these recommendations.The primary objective of this study is to compare the diagnostic yield of routine cardiac magnetic resonance versus standard care (that is, echocardiography with only selective use of CMR) in patients with non-ischemic heart failure. The primary hypothesisis that the routine use of CMR will lead to a more specific diagnostic characterization of the underlying etiology of non-ischemic heart failure. This will lead to a reduction in the non-specific diagnoses of idiopathic dilated cardiomyopathy and HF with preserved ejection fraction.<h4>Design</h4>Tertiary care sites in Canada and Finland, with dedicated HF and CMR programs, will randomize consecutive patients with new or deteriorating HF to routine CMR or selective CMR. All patients will undergo a standard clinical echocardiogram and the interpreter will assign the most likely HF etiology. Those undergoing CMR will also have a standard examination and will be assigned a HF etiology based upon the findings. The treating physician's impression about non-ischemic HF etiology will be collected following all baseline testing (including echo ± CMR). Patients will be followed annually for 4 years to ascertain clinical outcomes, quality of life and cost. The expected outcome is that the routine CMR arm will have a significantly higher rate of infiltrative, inflammatory, hypertrophic, ischemic and 'other' cardiomyopathy than the selective CMR group.<h4>Discussion</h4>This study will be the first multicenter randomized, controlled trial evaluating the role of CMR in non-ischemic HF. Non-ischemic HF patients will be randomized to routine CMR in order to determine whether there are any gains over management strategies employing selective CMR utilization. The insight gained from this study should improve appropriate CMR use in HF.<h4>Trial registration</h4>NCT01281384.
Also flagged:HIF-1Doxorubicindaunorubicinhypoxia-inducible factor-1bindingretinal neovascularization
Journal Article2013-10-12No SnippetsIwase T, Fu J, Yoshida T, Muramatsu D, Miki A, Hashida N, Lu L, Oveson B, Lima e Silva R, Seidel C, Yang M, Connelly S, Shen J, Han B, Wu M, Semenza GL, Hanes J, Campochiaro PA.
Show Full Abstract
Doxorubicin (DXR) and daunorubicin (DNR) inhibit hypoxia-inducible factor-1 (HIF-1) transcriptional activity by blocking its binding to DNA. Intraocular injections of DXR or DNR suppressed choroidal and retinal neovascularization (NV), but also perturbed retinal function as demonstrated by electroretinograms (ERGs). DXR was conjugated to novel copolymers of branched polyethylene glycol and poly(sebacic acid) (DXR-PSA-PEG3) and formulated into nanoparticles that when placed in aqueous buffer, slowly released small DXR-conjugates. Intraocular injection of DXR-PSA-PEG3 nanoparticles (1 or 10 μg DXR content) reduced HIF-1-responsive gene products, strongly suppressed choroidal and retinal NV, and did not cause retinal toxicity. In transgenic mice that express VEGF in photoreceptors, intraocular injection of DXR-PSA-PEG3 nanoparticles (10 μg DXR content) suppressed NV for at least 35 days. Intraocular injection of DXR-PSA-PEG3 nanoparticles (2.7 mg DXR content) in rabbits resulted in sustained DXR-conjugate release with detectable levels in aqueous humor and vitreous for at least 105 days. This study demonstrates a novel HIF-1-inhibitor-polymer conjugate formulated into controlled-release particles that maximizes efficacy and duration of activity, minimizes toxicity, and provides a promising new chemical entity for treatment of ocular NV.
<h4>Background</h4>Alcohol dependence (AD) is a multiorgan disease in which excessive oxidative stress and apoptosis are implicated. Monoamine oxidase A (MAO-A) is an important enzyme on the outer mitochondrial membrane that participates in the cellular response to oxidative stress and mitochondrial toxicity. It is unknown whether MAO-A levels are abnormal in AD. We hypothesized that MAO-A VT, an index of MAO-A level, is elevated in the prefrontal cortex (PFC) during AD, because markers of greater oxidative stress and apoptosis are reported in the brain in AD and a microarray analysis reported greater MAO-A messenger RNA in the PFC of rodents exposed to alcohol vapor.<h4>Methods</h4>Sixteen participants with alcohol dependence and 16 healthy control subjects underwent [(11)C]-harmine positron emission tomography. All were nonsmoking, medication- and drug-free, and had no other past or present psychiatric or medical illnesses.<h4>Results</h4>MAO-A VT was significantly greater in the PFC (37%, independent samples t test, t₃₀ = 3.93, p < .001), and all brain regions analyzed (mean 32%, multivariate analysis of variance, F₇,₂₄ = 3.67, p = .008). Greater duration of heavy drinking correlated positively with greater MAO-A VT in the PFC (r = .67, p = .005) and all brain regions analyzed (r = .73 to .57, p = .001-.02).<h4>Conclusions</h4>This finding represents a new pathological marker present in AD that is therapeutically targetable through direct inhibition or by novel treatments toward oxidative/pro-apoptotic processes implicated by MAO-A overexpression.
Also flagged:ABCA4retinal diseaseStargardt diseaseinheritedmacular dystrophycentral macular atrophy
Journal Article2013-10-11No SnippetsFujinami K, Zernant J, Chana RK, Wright GA, Tsunoda K, Ozawa Y, Tsubota K, Webster AR, Moore AT, Allikmets R, Michaelides M.
Show Full Abstract
<h4>Purpose</h4>We applied a recently reported next-generation sequencing (NGS) strategy for screening the ABCA4 gene in a British cohort with ABCA4-associated disease and report novel mutations.<h4>Methods</h4>We identified 79 patients with a clinical diagnosis of ABCA4-associated disease who had a single variant identified by the ABCA4 microarray. Comprehensive phenotypic data were obtained, and the NGS strategy was applied to identify the second allele by means of sequencing the entire coding region and adjacent intronic sequences of the ABCA4 gene. Identified variants were confirmed by Sanger sequencing and assessed for pathogenicity by in silico analysis.<h4>Results</h4>Of the 42 variants detected by prescreening with the microarray, in silico analysis suggested that 34, found in 66 subjects, were disease-causing and 8, found in 13 subjects, were benign variants. We detected 42 variants by NGS, of which 39 were classified as disease-causing. Of these 39 variants, 31 were novel, including 16 missense, 7 splice-site-altering, 4 nonsense, 1 in-frame deletion, and 3 frameshift variants. Two or more disease-causing variants were confirmed in 37 (47%) of 79 patients, one disease-causing variant in 36 (46%) subjects, and no disease-causing variant in 6 (7%) individuals.<h4>Conclusions</h4>Application of the NGS platform for ABCA4 screening enabled detection of the second disease-associated allele in approximately half of the patients in a British cohort where one mutation had been detected with the arrayed primer extension (APEX) array. The time- and cost-efficient NGS strategy is useful in screening large cohorts, which will be increasingly valuable with the advent of ABCA4-directed therapies.
Also flagged:degradationglycoproteinLMAN1HSF1heat shock responseXBP1
Journal Article2013-10-11✓ 1 SnippetWang YJ, Han DY, Tabib T, Yates JR, Mu TW.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
γ-Amino butyric acid type C (GABA(C)) receptors inhibit neuronal firing primarily in retina. Maintenance of GABA(C) receptor protein homeostasis in cells is essential for its function. However, a systematic study of GABA(C) receptor protein homeostasis (proteostasis) network components is absent. Here coimmunoprecipitation of human GABA(C)-ρ1-receptor complexes was performed in HEK293 cells overexpressing ρ1 receptors. To enhance the coverage and reliability of identified proteins, immunoisolated ρ1-receptor complexes were subjected to three tandem mass spectrometry (MS)-based proteomic analyses, namely, gel-based tandem MS (GeLC-MS/MS), solution-based tandem MS (SoLC-MS/MS), and multidimensional protein identification technology (MudPIT). From the 107 identified proteins, we assembled GABA(C)-ρ1-receptor proteostasis network components, including proteins with protein folding, degradation, and trafficking functions. We studied representative individual ρ1-receptor-interacting proteins, including calnexin, a lectin chaperone that facilitates glycoprotein folding, and LMAN1, a glycoprotein trafficking receptor, and global effectors that regulate protein folding in cells based on bioinformatics analysis, including HSF1, a master regulator of the heat shock response, and XBP1, a key transcription factor of the unfolded protein response. Manipulating selected GABA(C) receptor proteostasis network components is a promising strategy to regulate GABA(C) receptor folding, trafficking, degradation and thus function to ameliorate related retinal diseases.
Also flagged:macular degenerative diseasesretinal degenerative diseasesretinal diseasesagingmacular degenerationsynthesis
Journal Article2013-10-11No SnippetsRatnapriya R, Swaroop A.
Show Full Abstract
Inherited retinal degenerative diseases (RDDs) display wide variation in their mode of inheritance, underlying genetic defects, age of onset, and phenotypic severity. Molecular mechanisms have not been delineated for many retinal diseases, and treatment options are limited. In most instances, genotype-phenotype correlations have not been elucidated because of extensive clinical and genetic heterogeneity. Next-generation sequencing (NGS) methods, including exome, genome, transcriptome and epigenome sequencing, provide novel avenues towards achieving comprehensive understanding of the genetic architecture of RDDs. Whole-exome sequencing (WES) has already revealed several new RDD genes, whereas RNA-Seq and ChIP-Seq analyses are expected to uncover novel aspects of gene regulation and biological networks that are involved in retinal development, aging and disease. In this review, we focus on the genetic characterization of retinal and macular degeneration using NGS technology and discuss the basic framework for further investigations. We also examine the challenges of NGS application in clinical diagnosis and management.
Also flagged:AspirinGestationReproductionfolic acidinfertilitymiscarriage
Journal Article2013-10-11No SnippetsSchisterman EF, Silver RM, Perkins NJ, Mumford SL, Whitcomb BW, Stanford JB, Lesher LL, Faraggi D, Wactawski-Wende J, Browne RW, Townsend JM, White M, Lynch AM, Galai N.
Show Full Abstract
<h4>Background</h4>Low-dose aspirin (LDA) has been proposed to improve pregnancy outcomes in couples experiencing recurrent pregnancy loss. However, results from studies of LDA on pregnancy outcomes have been inconsistent, perhaps because most studies evaluated LDA-initiated post-conception. The purpose of the Effects of Aspirin in Gestation and Reproduction (EAGeR) trial was to determine whether preconception-initiated LDA improves livebirth rates in women with one to two prior losses.<h4>Methods</h4>We performed a multicentre, block randomised, double-blind, placebo-controlled trial. Study participants were recruited using community-based advertisements and physician referral to four university medical centres in the US (2006-12). Eligible women were aged 18-40 years actively trying to conceive, with one to two prior losses. Participants were randomised to receive daily LDA (81 mg/day) or a matching placebo, and all were provided with daily 400-mcg folic acid. Follow-up continued for ≤6 menstrual cycles while attempting to conceive. For those who conceived, treatment was continued until 36 weeks gestation. The primary outcome was the cumulative livebirth rate over the trial period.<h4>Results</h4>There were 1228 women randomised (615 LDA, 613 placebo). Participants had a mean age of 28.7, were mostly white (95%), well educated (86% more than high school education), and employed (75%) with a household income >$100 000 annually (40%). The characteristics of those in the treatment and placebo arms were well balanced.<h4>Conclusions</h4>We describe the study design, recruitment, data collection, and baseline characteristics of participants enrolled in EAGeR, which aimed to determine the effect of LDA on livebirth and other pregnancy outcomes in these women.
Also flagged:breast cancerestrogenERprogesteronePRepidermal growth factor 2
Journal Article2013-10-11No SnippetsMilosevic J, Klinge J, Borg AL, Foukakis T, Bergh J, Tobin NP.
Show Full Abstract
<h4>Background</h4>Long-term estrogen deprivation models are widely employed in an in vitro setting to recapitulate the hormonal milieu of breast cancer patients treated with endocrine therapy. Despite the wealth information we have garnered from these models thus far, a comprehensive time-course analysis of the estrogen (ER), progesterone (PR), and human epidermal growth factor 2 (HER-2/neu) receptors on the gene and protein level, coupled with expression array data is currently lacking. We aimed to address this knowledge gap in order to enhance our understanding of endocrine therapy resistance in breast cancer patients.<h4>Methods</h4>ER positive MCF7 and BT474 breast cancer cells were grown in estrogen depleted medium for 10 months with the ER negative MDA-MB-231 cell line employed as control. ER, PR and HER-2/neu expression were analysed at defined short and long-term time points by immunocytochemistry (ICC), and quantitative real-time RT-PCR (qRT-PCR). Microarray analysis was performed on representative samples.<h4>Results</h4>MCF7 cells cultured in estrogen depleted medium displayed decreasing expression of ER up to 8 weeks, which was then re-expressed at 10 months. PR was also down-regulated at early time points and remained so for the duration of the study. BT474 cells generally displayed no changes in ER during the first 8 weeks of deprivation, however its expression was significantly decreased at 10 months. PR expression was also down-regulated early in BT474 samples and was absent at later time points. Finally, microarray data revealed that genes and cell processes down-regulated in both cell lines at 6 weeks overlapped with those down-regulated in aromatase inhibitor treated breast cancer patients.<h4>Conclusions</h4>Our data demonstrate that expression of ER, PR, and cell metabolic/proliferative processes are unstable in response to long-term estrogen deprivation in breast cancer cell lines. These results mirror recent clinical findings and again emphasize the utility of LTED models in translational research.
Also flagged:Huntington DiseaseHDcalciumparvalbuminPVbehavioral
Journal Article2013-10-11✓ 1 SnippetDougherty SE, Hollimon JJ, McMeekin LJ, Bohannon AS, West AB, Lesort M, Hablitz JJ, Cowell RM.
In-Text Gene Mentions
Text
…htt…
Show Full Abstract
Recent evidence suggests that interneurons are involved in the pathophysiology of Huntington Disease (HD). Abnormalities in the function of interneurons expressing the calcium buffer parvalbumin (PV) have been observed in multiple mouse models of HD, although it is not clear how PV-positive interneuron dysfunction contributes to behavioral and synaptic deficits. Here, we use the cre-lox system to drive expression of mutant huntingtin (mthtt) in parvalbumin (PV)-positive neurons and find that mutant mice exhibit diffuse mthtt immunoreactivity in PV-rich areas at 10months of age and mthtt aggregates in PV-positive processes at 24months of age. At midlife, mutant mice are hyperactive and display impaired GABA release in the motor cortex, characterized by reduced miniature inhibitory events and severely blunted responses to gamma frequency stimulation, without a loss of PV-positive interneurons. In contrast, 24month-old mutant mice show normalized behavior and responses to gamma frequency stimulation, possibly due to compensatory changes in pyramidal neurons or the formation of inclusions with age. These data indicate that mthtt expression in PV-positive neurons is sufficient to drive a hyperactive phenotype and suggest that mthtt-mediated dysfunction in PV-positive neuronal populations could be a key factor in the hyperkinetic behavior observed in HD. Further clarification of the roles for specific PV-positive populations in this phenotype is warranted to definitively identify cellular targets for intervention.
Also flagged:phenylureaoxygenasehemeiron oxygenaseROferredoxin
Journal Article2013-10-11No SnippetsGu T, Zhou C, Sørensen SR, Zhang J, He J, Yu P, Yan X, Li S.
Show Full Abstract
The environmental fate of phenylurea herbicides has received considerable attention in recent decades. The microbial metabolism of N,N-dimethyl-substituted phenylurea herbicides can generally be initiated by mono-N-demethylation. In this study, the molecular basis for this process was revealed. The pdmAB genes in Sphingobium sp. strain YBL2 were shown to be responsible for the initial mono-N-demethylation of commonly used N,N-dimethyl-substituted phenylurea herbicides. PdmAB is the oxygenase component of a bacterial Rieske non-heme iron oxygenase (RO) system. The genes pdmAB, encoding the α subunit PdmA and the β subunit PdmB, are organized in a transposable element flanked by two direct repeats of an insertion element resembling ISRh1. Furthermore, this transposable element is highly conserved among phenylurea herbicide-degrading sphingomonads originating from different areas of the world. However, there was no evidence of a gene for an electron carrier (a ferredoxin or a reductase) located in the immediate vicinity of pdmAB. Without its cognate electron transport components, expression of PdmAB in Escherichia coli, Pseudomonas putida, and other sphingomonads resulted in a functional enzyme. Moreover, coexpression of a putative [3Fe-4S]-type ferredoxin from Sphingomonas sp. strain RW1 greatly enhanced the catalytic activity of PdmAB in E. coli. These data suggested that PdmAB has a low specificity for electron transport components and that its optimal ferredoxin may be the [3Fe-4S] type. PdmA exhibited low homology to the α subunits of previously characterized ROs (less than 37% identity) and did not cluster with the RO group involved in O- or N-demethylation reactions, indicating that PdmAB is a distinct bacterial RO N-demethylase.
Also flagged:serotoninreuptakeserotonin transporterSLC6A4maternal depressionDepression
Journal Article2013-10-11✓ 5 SnippetsWeikum WM, Brain U, Chau CM, Grunau RE, Boyce WT, Diamond A, Oberlander TF.
In-Text Gene Mentions
Introduction)
…Reduced 5-HTT protein availability and 5-HT reuptake results in a higher effective “serotonin dose.”…
Abstract)
…We examined long-term effects of prenatal SRI exposure on EFs to determine whether effects are moderated by maternal mood and/or genetic variations in SLC6A4 (a gene that codes for the serotonin transporter [5-HTT] central to the regulation of synaptic serotonin levels and behavior).…
Abstract)
…the serotonin transporter [5-HTT] central to the…
Introduction)
…erotonin transporter protein (5-HTT), thereby increasing how…
Introduction)
…erotonin transporter protein (5-HTT)—the very target of…
Show Full Abstract
Prenatal exposure to serotonin reuptake inhibitor (SRI) antidepressants and maternal depression may affect prefrontal cognitive skills (executive functions; EFs) including self-control, working memory and cognitive flexibility. We examined long-term effects of prenatal SRI exposure on EFs to determine whether effects are moderated by maternal mood and/or genetic variations in SLC6A4 (a gene that codes for the serotonin transporter [5-HTT] central to the regulation of synaptic serotonin levels and behavior). Children who were exposed to SRIs prenatally (SRI-exposed N = 26) and non-exposed (N = 38) were studied at age 6 years (M = 6.3; SD = 0.5) using the Hearts & Flowers task (H&F) to assess EFs. Maternal mood was measured during pregnancy (3rd trimester) and when the child was age 6 years (Hamilton Depression Scale). Parent reports of child behavior were also obtained (MacArthur Health & Behavior Questionnaire). Parents of prenatally SRI-exposed children reported fewer child externalizing and inattentive (ADHD) behaviors. Generalized estimate equation modeling showed a significant 3-way interaction between prenatal SRI exposure, SLC6A4 variant, and maternal mood at the 6-year time-point on H&F accuracy. For prenatally SRI-exposed children, regardless of maternal mood, the H&F accuracy of children with reduced 5HTT expression (a short [S] allele) remained stable. Even with increasing maternal depressive symptoms (though all below clinical threshold), EFs of children with at least one short allele were comparable to children with the same genotype whose mothers reported few if any depressive symptoms-in this sense they showed resilience. Children with two long (L) alleles were more sensitive to context. When their mothers had few depressive symptoms, LL children showed extremely good EF performance-better than any other group. When their mothers reported more depressive symptoms, LL children's EF performance was worse than that of any other group. In the face of a mother with a more depressed mood, EFs were best preserved in children prenatally exposed to SRIs and with at least one short SLC6A4 allele. Yet, prenatally-exposed LL children hold out promise of possibly superior EF if their mother's mood remains euthymic or improves.
Also flagged:Bipolar disorderpathogenesisSLC6A4serotonin transporterBDNFbrain-derived neurotrophic factor
Journal Article2013-10-11✓ 2 SnippetsSzczepankiewicz A.
In-Text Gene Mentions
S I O 001029)
…SLC6A4/5-HTT has been one of the most extensively studied in psychiatric diseases.4 The transporter plays a crucial role in the active reuptake of serotonin at the synapse that is a known target of selective serotonin reuptake inhibitor antidepressants, which block transporter action.…
Abstract)
…( SLC6A4 /5-HTT[ serotonin transporter…
Show Full Abstract
Bipolar disorder (BD) is a complex disorder with a number of susceptibility genes and environmental risk factors involved in its pathogenesis. In recent years, huge progress has been made in molecular techniques for genetic studies, which have enabled identification of numerous genomic regions and genetic variants implicated in BD across populations. Despite the abundance of genetic findings, the results have often been inconsistent and not replicated for many candidate genes/single nucleotide polymorphisms (SNPs). Therefore, the aim of the review presented here is to summarize the most important data reported so far in candidate gene and genome-wide association studies. Taking into account the abundance of association data, this review focuses on the most extensively studied genes and polymorphisms reported so far for BD to present the most promising genomic regions/SNPs involved in BD. The review of association data reveals evidence for several genes (SLC6A4/5-HTT [serotonin transporter gene], BDNF [brain-derived neurotrophic factor], DAOA [D-amino acid oxidase activator], DTNBP1 [dysbindin], NRG1 [neuregulin 1], DISC1 [disrupted in schizophrenia 1]) to be crucial candidates in BD, whereas numerous genome-wide association studies conducted in BD indicate polymorphisms in two genes (CACNA1C [calcium channel, voltage-dependent, L type, alpha 1C subunit], ANK3 [ankyrin 3]) replicated for association with BD in most of these studies. Nevertheless, further studies focusing on interactions between multiple candidate genes/SNPs, as well as systems biology and pathway analyses are necessary to integrate and improve the way we analyze the currently available association data.
Also flagged:arthritisrheumatoid arthritisautoimmune arthritischromosomesGenetic ArthritisRA
Journal Article2013-10-11✓ 1 SnippetRanea LM, de Castro Marques A, Möller S, Gupta Y, Ibrahim SM.
In-Text Gene Mentions
Discussion)
…mediates TGF-β signaling;Dccgene encoding a…
Show Full Abstract
Identifying the genetic basis of complex diseases, such as rheumatoid arthritis, remains a challenge that requires experimental models to reduce the genetic and environmental variability. Numerous loci for arthritis have been identified in induced animal models; however, few spontaneous models have been genetically studied. Therefore, we generated a four-way advanced intercross line (AIL) from four inbred strains, including BXD2/TyJ which spontaneously develops autoimmune arthritis. A genome-wide scan for spontaneous arthritis was performed in a cohort of 366 mice of the fourth generation (G4) of this cross. Five loci contributing to clinical phenotypes were identified in chromosomes 3, 7, 13, 18, and X. Three of the loci found in this study, confirm previously identified loci; whereas two of them are novel loci. Interesting candidate genes for the loci are highlighted. This study provides a genetic overview of spontaneous arthritis in mice and aids to solve the genetic etiology of rheumatoid arthritis and to gain a better understanding of the disease.
Diacylglycerol acyltransferases (DGAT) catalyze the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT genes have been identified in numerous organisms. Multiple isoforms of DGAT are present in eukaryotes. We previously cloned DGAT1 and DGAT2 genes of tung tree (Vernicia fordii), whose novel seed TAGs are useful in a wide range of industrial applications. The objective of this study was to understand the developmental regulation of DGAT family gene expression in tung tree. To this end, we first cloned a tung tree gene encoding DGAT3, a putatively soluble form of DGAT that possesses 11 completely conserved amino acid residues shared among 27 DGAT3s from 19 plant species. Unlike DGAT1 and DGAT2 subfamilies, DGAT3 is absent from animals. We then used TaqMan and SYBR Green quantitative real-time PCR, along with northern and western blotting, to study the expression patterns of the three DGAT genes in tung tree tissues. Expression results demonstrate that 1) all three isoforms of DGAT genes are expressed in developing seeds, leaves and flowers; 2) DGAT2 is the major DGAT mRNA in tung seeds, whose expression profile is well-coordinated with the oil profile in developing tung seeds; and 3) DGAT3 is the major form of DGAT mRNA in tung leaves, flowers and immature seeds prior to active tung oil biosynthesis. These results suggest that DGAT2 is probably the major TAG biosynthetic isoform in tung seeds and that DGAT3 gene likely plays a significant role in TAG metabolism in other tissues. Therefore, DGAT2 should be a primary target for tung oil engineering in transgenic organisms.
Also flagged:IronlocalizationnitritewashMAPSferrocyanide
Journal Article2013-10-11✓ 5 SnippetsChen J, Marks E, Lai B, Zhang Z, Duce JA, Lam LQ, Volitakis I, Bush AI, Hersch S, Fox JH.
In-Text Gene Mentions
Introduction)
…Htt level and / or glutamine expansion within htt is therefore an important modulator of iron status.…
Introduction)
…Huntingtin protein (htt) is implicated in…
Introduction)
…Httlevel and /…
Introduction)
…glutamine expansion withinhttis therefore an…
Introduction)
…directly with N-terminalhttfragments [ 20…
Show Full Abstract
Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine-encoding CAG expansion in the huntingtin gene. Iron accumulates in the brains of HD patients and mouse disease models. However, the cellular and subcellular sites of iron accumulation, as well as significance to disease progression are not well understood. We used independent approaches to investigate the location of brain iron accumulation. In R6/2 HD mouse brain, synchotron x-ray fluorescence analysis revealed iron accumulation as discrete puncta in the perinuclear cytoplasm of striatal neurons. Further, perfusion Turnbull's staining for ferrous iron (II) combined with transmission electron microscope ultra-structural analysis revealed increased staining in membrane bound peri-nuclear vesicles in R6/2 HD striatal neurons. Analysis of iron homeostatic proteins in R6/2 HD mice revealed decreased levels of the iron response proteins (IRPs 1 and 2) and accordingly decreased expression of iron uptake transferrin receptor (TfR) and increased levels of neuronal iron export protein ferroportin (FPN). Finally, we show that intra-ventricular delivery of the iron chelator deferoxamine results in an improvement of the motor phenotype in R6/2 HD mice. Our data supports accumulation of redox-active ferrous iron in the endocytic / lysosomal compartment in mouse HD neurons. Expression changes of IRPs, TfR and FPN are consistent with a compensatory response to an increased intra-neuronal labile iron pool leading to increased susceptibility to iron-associated oxidative stress. These findings, together with protection by deferoxamine, support a potentiating role of neuronal iron accumulation in HD.
<h4>Purpose</h4>Stereotactic body radiation therapy (SBRT) for hepatocellular carcinoma (HCC) has been evaluated in several recent studies. The CyberKnife(®) is an SBRT system that allows for real-time tracking of the tumor. The purpose of this study was to evaluate the prognostic factors for local control and overall survival following this treatment.<h4>Patients and methods</h4>75 patients with 96 liver-confined HCC were treated with SBRT at the Oscar Lambret Comprehensive Cancer Center. Fiducials were implanted in the liver before treatment and were used as markers to track the lesion's movement. Treatment response was scored according to RECIST v1.1. Local control and overall survival were calculated using the Kaplan and Meier method. A stepwise multivariate analysis (Cox regression) of prognostic factors was performed for local control and overall survival.<h4>Results</h4>There were 67 patients with Child-Turcotte-Pugh (CTP) Class A and eight patients with CTP Class B. Treatment was administered in three sessions. A total dose of 40-45 Gy to the 80% isodose line was delivered. The median follow-up was 10 months (range, 3-49 months). The local control rate was 89.8% at 1 and 2 years. Overall survival was 78.5% and 50.4% at 1 and 2 years, respectively. Toxicity mainly consisted of grade 1 and grade 2 events. Higher alpha-fetoprotein (aFP) levels were associated with less favorable local control (HR=1.001; 95% CI [1.000, 1.002]; p=0.0063). A higher dose was associated with better local control (HR=0.866; 95% CI [0.753, 0.996]; p=0.0441). A Child-Pugh score higher than 5 was associated with worse overall survival (HR= 3.413; 95% CI [1.235, 9.435]; p=0.018).<h4>Conclusion</h4>SBRT affords good local tumor control and higher overall survival rates than other historical controls (best supportive care or sorafenib). High aFP levels were associated with lesser local control, but a higher treatment dose improved local control.
Also flagged:gibberellinsamineGA3hydroxyacetonitrile
Journal Article2013-10-11No SnippetsZhu G, Long S, Sun H, Luo W, Li X, Hao Z.
Show Full Abstract
A novel sensitive method based on tertiary amine labeling for the analysis of gibberellins (GAs) by capillary electrophoresis (CE) coupled with electrochemiluminescence (ECL) detection was proposed. GA3 was tagged with 2-(2-aminoethyl)-1-methylpyrrolidine (AEMP) using N, N'-dicyclohexylcarbodiimide (DCC) and 3,4-dihydro-3-hydroxy-4-oxo-1,2,3-benzotriazine (HOOBt) as coupling agents in acetonitrile to produce GA3-AEMP-derivative. The GA3-AEMP-derivative was injected into CE by electrokinetic injection and detected by Ru(bpy)3(2+)-based ECL. The parameters affecting derivatization, detection and separation such as concentration of reactants, detection potential, pH and concentration of separation buffer, were investigated in detail. Under optimum conditions, the linear concentration range for GA3 was from 2.0×10(-7) to 1.28×10(-4)M with a correlation coefficient of 0.9997. The detection limit was 8×10(-8)M (S/N=3). The relative standard deviations of migration time, peak intensity and peak area for nine continuous injections of 2.0×10(-5)M GA3-AEMP-derivative were 1.0%, 2.1% and 4.2%, respectively. The developed approach was successfully applied to the determination of total GAs in the stem, leaf and seed of soybean (Glycine max [L.] Merr.) with recoveries in the range from 89.6% to 99.3%.
Also flagged:adult-onset neurodegenerative disorderpolyglutamineHDpathogenesisproteasesproteolysis
Journal Article2013-10-11✓ 3 SnippetsGipson TA, Neueder A, Wexler NS, Bates GP, Housman D.
In-Text Gene Mentions
Title)
…Aberrantly spliced HTT, a new player in Huntington's disease pathogenesis.…
Title)
…Aberrantly splicedHTT, a new player…
Text
…HTT…
Show Full Abstract
Huntington's disease (HD) is an adult-onset neurodegenerative disorder caused by a mutated CAG repeat in the huntingtin gene that is translated into an expanded polyglutamine tract. The clinical manifestation of HD is a progressive physical, cognitive, and psychiatric deterioration that is eventually fatal. The mutant huntingtin protein is processed into several smaller fragments, which have been implicated as critical factors in HD pathogenesis. The search for proteases responsible for their production has led to the identification of several cleavage sites on the huntingtin protein. However, the origin of the small N-terminal fragments that are found in HD postmortem brains has remained elusive. Recent mapping of huntingtin fragments in a mouse model demonstrated that the smallest N-terminal fragment is an exon 1 protein. This discovery spurred our hypothesis that mis-splicing as opposed to proteolysis could be generating the smallest huntingtin fragment. We demonstrated that mis-splicing of mutant huntingtin intron 1 does indeed occur and results in a short polyadenylated mRNA, which is translated into an exon 1 protein. The exon 1 protein fragment is highly pathogenic. Transgenic mouse models containing just human huntingtin exon 1 develop a rapid onset of HD-like symptoms. Our finding that a small, mis-spliced HTT transcript and corresponding exon 1 protein are produced in the context of an expanded CAG repeat has unraveled a new molecular mechanism in HD pathogenesis. Here we present detailed models of how mis-splicing could be facilitated, what challenges remain in this model, and implications for therapeutic studies.
Also flagged:nestinalpha-fetoproteinactinCatecholaminergic Polymorphic Ventricular TachycardianodalREX1
Journal Article2013-10-10✓ 1 SnippetDi Pasquale E, Lodola F, Miragoli M, Denegri M, Avelino-Cruz JE, Buonocore M, Nakahama H, Portararo P, Bloise R, Napolitano C, Condorelli G, Priori SG.
In-Text Gene Mentions
Results)
…factor) and LIN-28 (zinc-finger CCHC domain-containing protein 1CCHC domain-containing protein…
Show Full Abstract
Induced pluripotent stem cells (iPSC) offer a unique opportunity for developmental studies, disease modeling and regenerative medicine approaches in humans. The aim of our study was to create an in vitro 'patient-specific cell-based system' that could facilitate the screening of new therapeutic molecules for the treatment of catecholaminergic polymorphic ventricular tachycardia (CPVT), an inherited form of fatal arrhythmia. Here, we report the development of a cardiac model of CPVT through the generation of iPSC from a CPVT patient carrying a heterozygous mutation in the cardiac ryanodine receptor gene (RyR2) and their subsequent differentiation into cardiomyocytes (CMs). Whole-cell patch-clamp and intracellular electrical recordings of spontaneously beating cells revealed the presence of delayed afterdepolarizations (DADs) in CPVT-CMs, both in resting conditions and after β-adrenergic stimulation, resembling the cardiac phenotype of the patients. Furthermore, treatment with KN-93 (2-[N-(2-hydroxyethyl)]-N-(4methoxybenzenesulfonyl)]amino-N-(4-chlorocinnamyl)-N-methylbenzylamine), an antiarrhythmic drug that inhibits Ca(2+)/calmodulin-dependent serine-threonine protein kinase II (CaMKII), drastically reduced the presence of DADs in CVPT-CMs, rescuing the arrhythmic phenotype induced by catecholaminergic stress. In addition, intracellular calcium transient measurements on 3D beating clusters by fast resolution optical mapping showed that CPVT clusters developed multiple calcium transients, whereas in the wild-type clusters, only single initiations were detected. Such instability is aggravated in the presence of isoproterenol and is attenuated by KN-93. As seen in our RyR2 knock-in CPVT mice, the antiarrhythmic effect of KN-93 is confirmed in these human iPSC-derived cardiac cells, supporting the role of this in vitro system for drug screening and optimization of clinical treatment strategies.
Also flagged:heterogeneous nuclear ribonucleoprotein KhnRNP KbindingSL1cytoplasmgene expression
Journal Article2013-10-10No SnippetsFan B, Lu KY, Reymond Sutandy FX, Chen YW, Konan K, Zhu H, Kao CC, Chen CS.
Show Full Abstract
Stem-loop I (SL1) located in the 5' untranslated region of the hepatitis C virus (HCV) genome initiates binding to miR-122, a microRNA required for hepatitis HCV replication. However, proteins that bind SL1 remain elusive. In this study, we employed a human proteome microarray, comprised of ∼17,000 individually purified human proteins in full-length, and identified 313 proteins that recognize HCV SL1. Eighty-three of the identified proteins were annotated as liver-expressing proteins, and twelve of which were known to be associated with hepatitis virus. siRNA-induced silencing of eight out of 12 candidate genes led to at least 25% decrease in HCV replication efficiency. In particular, knockdown of heterogeneous nuclear ribonucleoprotein K (hnRNP K) reduced HCV replication in a concentration-dependent manner. Ultra-violet-crosslinking assay also showed that hnRNP K, which functions in pre-mRNA processing and transport, showed the strongest binding to the HCV SL1. We observed that hnRNP K, a nuclear protein, is relocated in the cytoplasm in HCV-expressing cells. Immunoprecipitation of the hnRNP K from Huh7.5 cells stably expressing HCV replicon resulted in the co-immunoprecipitation of SL1. This work identifies a cellular protein that could have an important role in the regulation of HCV RNA gene expression and metabolism.
Also flagged:UNC5B receptorNetrin-1UNC5Bresponse to stresscisplatinp53
Journal Article2013-10-10No SnippetsRanganathan P, Jayakumar C, Navankasattusas S, Li DY, Kim IM, Ramesh G.
Show Full Abstract
Netrin-1 regulates cell survival and apoptosis by activation of its receptors, including UNC5B. However, the in vivo role of UNC5B in cell survival during cellular stress and tissue injury is unknown. We investigated the role of UNC5B in cell survival in response to stress using mice heterozygously expressing the UNC5B gene (UNC5B(-/flox)) and mice with targeted homozygous deletion of UNC5B in kidney epithelial cells (UNC5B(-/flox/GGT-cre)). Mice were subjected to two different models of organ injury: ischemia reperfusion injury of the kidney and cisplatin-induced nephrotoxicity. Both mouse models of UNC5B depletion had normal organ function and histology under basal conditions. After AKI, however, UNC5B(-/flox/GGT-cre) mice exhibited significantly worse renal function and damage, increased tubular apoptosis, enhanced p53 activation, and exacerbated inflammation compared with UNC5B(-/flox) and wild-type mice. shRNA-mediated suppression of UNC5B expression in cultured tubular epithelial cells exacerbated cisplatin-induced cell death in a p53-dependent manner and blunted Akt phosphorylation. Inhibition of PI3 kinase similarly exacerbated cisplatin-induced apoptosis; in contrast, overexpression of UNC5B reduced cisplatin-induced apoptosis in these cells. Taken together, these results show that the netrin-1 receptor UNC5B plays a critical role in cell survival and kidney injury through Akt-mediated inactivation of p53 in response to stress.
Also flagged:nucleoplasminNPH2A-H2Bhistone chaperonehistonechaperone
Journal Article2013-10-10✓ 1 SnippetRamos I, Fernández-Rivero N, Arranz R, Aloria K, Finn R, Arizmendi JM, Ausió J, Valpuesta JM, Muga A, Prado A.
In-Text Gene Mentions
Discussion)
…NP interacts withlinker histoneshistones H5 and…
Show Full Abstract
The role of Nucleoplasmin (NP) as a H2A-H2B histone chaperone has been extensively characterized. To understand its putative interaction with other histone ligands, we have characterized its ability to bind H3-H4 and histone octamers. We find that the chaperone forms distinct complexes with histones, which differ in the number of molecules that build the assembly and in their spatial distribution. When complexed with H3-H4 tetramers or histone octamers, two NP pentamers form an ellipsoidal particle with the histones located at the center of the assembly, in stark contrast with the NP/H2A-H2B complex that contains up to five histone dimers bound to one chaperone pentamer. This particular assembly relies on the ability of H3-H4 to form tetramers either in solution or as part of the octamer, and it is not observed when a variant of H3 (H3C110E), unable to form stable tetramers, is used instead of the wild-type protein. Our data also suggest that the distal face of the chaperone is involved in the interaction with distinct types of histones, as supported by electron microscopy analysis of the different NP/histone complexes. The use of the same structural region to accommodate all type of histones could favor histone exchange and nucleosome dynamics.
Journal Article2013-10-10✓ 1 SnippetTabaka M, Kalwarczyk T, Hołyst R.
In-Text Gene Mentions
Results)
…DNA: λ phageregulatory protein CIprotein CI in…
Show Full Abstract
We introduce macromolecular crowding quantitatively into the model for kinetics of gene regulation in Escherichia coli. We analyse and compute the specific-site searching time for 180 known transcription factors (TFs) regulating 1300 operons. The time is between 160 s (e.g. for SoxS Mw = 12.91 kDa) and 1550 s (e.g. for PepA6 of Mw = 329.28 kDa). Diffusion coefficients for one-dimensional sliding are between for large proteins up to for small monomers or dimers. Three-dimensional diffusion coefficients in the cytoplasm are 2 orders of magnitude larger than 1D sliding coefficients, nevertheless the sliding enhances the binding rates of TF to specific sites by 1-2 orders of magnitude. The latter effect is due to ubiquitous non-specific binding. We compare the model to experimental data for LacI repressor and find that non-specific binding of the protein to DNA is activation- and not diffusion-limited. We show that the target location rate by LacI repressor is optimized with respect to microscopic rate constant for association to non-specific sites on DNA. We analyse the effect of oligomerization of TFs and DNA looping effects on searching kinetics. We show that optimal searching strategy depends on TF abundance.
…Huntington's disease is an autosomal dominant inherited disorder caused by an elongated CAG repeat expansion in the huntingtin (HTT) gene.…
S I O 001029)
…In cellular models of Huntington's disease, miR-146a, miR-125b, and miR-150 are down regulated while miR-34b was elevated by the presence of mutant HTT protein (Sinha et al., 2010; Gaughwin et al., 2011).…
I A O 0000615)
…Lastly, the miR-34 family target SIRT1 to affect tau metabolism, are decreased in Parkinson's disease patients and show increased expression in the presence of mutant HTT (Wang et al., 2009; Schonrock and Gotz, 2012).…
I A O 0000615)
…presence of mutantHTT(Wang et al.,…
Show Full Abstract
MicroRNAs (miRNAs) are small, abundant RNA molecules that constitute part of the cell's non-coding RNA "dark matter." In recent years, the discovery of miRNAs has revolutionised the traditional view of gene expression and our understanding of miRNA biogenesis and function has expanded. Altered expression of miRNAs is increasingly recognized as a feature of many disease states, including neurodegeneration. Here, we review the emerging role for miRNA dysfunction in Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS) and Huntington's disease pathogenesis. We emphasize the complex nature of gene regulatory networks and the need for systematic studies, with larger sample cohorts than have so far been reported, to reveal the most important miRNA regulators in disease. Finally, miRNA diversity and their potential to target multiple pathways, offers novel clinical applications for miRNAs as biomarkers and therapeutic agents in neurodegenerative diseases.
Also flagged:c-kitgap junctionsadherens junctionsgene expressiondegradationlocalization
Journal Article2013-10-10✓ 3 SnippetsHosoda T.
In-Text Gene Mentions
Introduction)
…involved in differentiation,SOX6and PTBP3 hold…
Introduction)
…translational inhibition ofSOX6and PTBP3 genes…
Introduction)
…the 3′-UTRs ofSOX6and PTBP3 were…
Show Full Abstract
The recent identification of c-kit-positive cardiac stem cells revealed the great growth reserve of the heart, in which connection among cells might be essential in regulating their fate. Especially, the mircrine mechanism, translocation of microRNAs (miRs) from a cell to another via gap junctions, appeared to be important in controlling the differentiation of cardiac stem cells. The modification on miR expression and/or translocation may be able to enhance further the clinical efficacy of cellular therapy.
Also flagged:Alzheimer's diseaseADwatercoppersaltcognition
Journal Article2013-10-10✓ 1 SnippetBrewer GJ, Kaur S.
In-Text Gene Mentions
Introduction)
…iron management genes,hemochromatosis[ 12 ]…
Show Full Abstract
We are in the midst of an epidemic of Alzheimer's disease (AD) in developed countries. We have postulated that ingestion of inorganic copper from drinking water and taking supplement pills and a high fat diet are major causative factors. Ingestion of inorganic copper can directly raise the blood free copper level. Blood free copper has been shown by the Squitti group to be elevated in AD, to correlate with cognition, and to predict cognition loss. Secondly, we have shown that AD patients are zinc deficient compared to age matched controls. Zinc is important in neuronal protection. We carried out a 6-month small double blind trial of a new zinc formulation on AD patients. We found that in patients 70 years and older, zinc therapy protected against cognition decline compared to placebo controls. We also found that zinc therapy significantly lowered blood free copper levels. So zinc efficacy could be due to restoring neuronal zinc levels, to lowering blood free copper levels, or to both.
Also flagged:chromatingene expressionbindingtranscription factorsofhistone methyltransferase
Journal Article2013-10-10No SnippetsMathiyalagan P, Keating ST, Du XJ, El-Osta A, El-Osta A.
Show Full Abstract
Precisely regulated patterns of gene expression are dependent on the binding of transcription factors and chromatin-associated determinants referred to as co-activators and co-repressors. These regulatory components function with the core transcriptional machinery to serve in critical activities to alter chromatin modification and regulate gene expression. While we are beginning to understand that cell-type specific patterns of gene expression are necessary to achieve selective cardiovascular developmental programs, we still do not know the molecular machineries that localize these determinants in the heart. With clear implications for the epigenetic control of gene expression signatures, the ENCODE (Encyclopedia of DNA Elements) Project Consortium determined that about 90% of the human genome is transcribed while only 1-2% of transcripts encode proteins. Emerging evidence suggests that non-coding RNA (ncRNA) serves as a signal for decoding chromatin modifications and provides a potential molecular basis for cell type-specific and promoter-specific patterns of gene expression. The discovery of the histone methyltransferase enzyme EZH2 in the regulation of gene expression patterns implicated in cardiac hypertrophy suggests a novel role for chromatin-associated ncRNAs and is the focus of this article.
Also flagged:Wntfibroblast growth factorFGFbone morphogenetic proteinBMPSOX2
Journal Article2013-10-10No SnippetsHannan NR, Fordham RP, Syed YA, Moignard V, Berry A, Bautista R, Hanley NA, Jensen KB, Vallier L.
Show Full Abstract
Human pluripotent stem cells (hPSCs) could provide an infinite source of clinically relevant cells with potential applications in regenerative medicine. However, hPSC lines vary in their capacity to generate specialized cells, and the development of universal protocols for the production of tissue-specific cells remains a major challenge. Here, we have addressed this limitation for the endodermal lineage by developing a defined culture system to expand and differentiate human foregut stem cells (hFSCs) derived from hPSCs. hFSCs can self-renew while maintaining their capacity to differentiate into pancreatic and hepatic cells. Furthermore, near-homogenous populations of hFSCs can be obtained from hPSC lines which are normally refractory to endodermal differentiation. Therefore, hFSCs provide a unique approach to bypass variability between pluripotent lines in order to obtain a sustainable source of multipotent endoderm stem cells for basic studies and to produce a diversity of endodermal derivatives with a clinical value.
The norepinephrine (NE) transporter (NET) regulates synaptic NE availability for noradrenergic signaling in the brain and sympathetic nervous system. Although genetic variation leading to a loss of NET expression has been implicated in psychiatric and cardiovascular disorders, complete NET deficiency has not been found in people, limiting the utility of NET knockout mice as a model for genetically driven NET dysfunction. Here, we investigate NET expression in NET heterozygous knockout male mice (NET(+/-) ), demonstrating that they display an approximately 50% reduction in NET protein levels. Surprisingly, these mice display no significant deficit in NET activity assessed in hippocampal and cortical synaptosomes. We found that this compensation in NET activity was due to enhanced activity of surface-resident transporters, as opposed to surface recruitment of NET protein or compensation through other transport mechanisms, including serotonin, dopamine or organic cation transporters. We hypothesize that loss of NET protein in the NET(+/-) mouse establishes an activated state of existing surface NET proteins. The NET(+/-) mice exhibit increased anxiety in the open field and light-dark box and display deficits in reversal learning in the Morris water maze. These data suggest that recovery of near basal activity in NET(+/-) mice appears to be insufficient to limit anxiety responses or support cognitive performance that might involve noradrenergic neurotransmission. The NET(+/-) mice represent a unique model to study the loss and resultant compensatory changes in NET that may be relevant to behavior and physiology in human NET deficiency disorders.
Also flagged:chromatinorganization-pairingtranscription activator-like effectorsbinding
Journal Article2013-10-09✓ 1 SnippetGeisler S, Coller J.
In-Text Gene Mentions
Text
…STAU1…
Show Full Abstract
The increased application of transcriptome-wide profiling approaches has led to an explosion in the number of documented long non-coding RNAs (lncRNAs). While these new and enigmatic players in the complex transcriptional milieu are encoded by a significant proportion of the genome, their functions are mostly unknown. Early discoveries support a paradigm in which lncRNAs regulate transcription via chromatin modulation, but new functions are steadily emerging. Given the biochemical versatility of RNA, lncRNAs may be used for various tasks, including post-transcriptional regulation, organization of protein complexes, cell-cell signalling and allosteric regulation of proteins.
The sophisticated circuitry of the neocortex is assembled from a diverse repertoire of neuronal subtypes generated during development under precise molecular regulation. In recent years, several key controls over the specification and differentiation of neocortical projection neurons have been identified. This work provides substantial insight into the 'molecular logic' underlying cortical development and increasingly supports a model in which individual progenitor-stage and postmitotic regulators are embedded within highly interconnected networks that gate sequential developmental decisions. Here, we provide an integrative account of the molecular controls that direct the progressive development and delineation of subtype and area identity of neocortical projection neurons.
Genetic linkage maps are indispensable tools in genetic and genomic studies. Recent development of genotyping-by-sequencing (GBS) methods holds great promise for constructing high-resolution linkage maps in organisms lacking extensive genomic resources. In the present study, linkage mapping was conducted for a bivalve mollusc (Chlamys farreri) using a newly developed GBS method-2b-restriction site-associated DNA (2b-RAD). Genome survey sequencing was performed to generate a preliminary reference genome that was utilized to facilitate linkage and quantitative trait locus (QTL) mapping in C. farreri. A high-resolution linkage map was constructed with a marker density (3806) that has, to our knowledge, never been achieved in any other molluscs. The linkage map covered nearly the whole genome (99.5%) with a resolution of 0.41 cM. QTL mapping and association analysis congruously revealed two growth-related QTLs and one potential sex-determination region. An important candidate QTL gene named PROP1, which functions in the regulation of growth hormone production in vertebrates, was identified from the growth-related QTL region detected on the linkage group LG3. We demonstrate that this linkage map can serve as an important platform for improving genome assembly and unifying multiple genomic resources. Our study, therefore, exemplifies how to build up an integrative genomic framework in a non-model organism.
Also flagged:immune responseserythroleukemiamyeloid leukemialactate dehydrogenaseCD4polycythemia
Journal Article2013-10-09No SnippetsTsuji-Kawahara S, Kawabata H, Matsukuma H, Kinoshita S, Chikaishi T, Sakamoto M, Kawasaki Y, Miyazawa M.
Show Full Abstract
To assess the possible contribution of host immune responses to the exertion of Fv2-associated resistance to Friend virus (FV)-induced disease development, we inoculated C57BL/6 (B6) mice that lacked various subsets of lymphocytes with FV containing no lactate dehydrogenase-elevating virus. Fv2(r) B6 mice lacking CD4(+) T cells developed early polycythemia and fatal erythroleukemia, while B6 mice lacking CD8(+) T cells remained resistant. Erythroid progenitor cells infected with spleen focus-forming virus (SFFV) were eliminated, and no polycythemia was observed in B cell-deficient B6 mice, but they later developed myeloid leukemia associated with oligoclonal integration of ecotropic Friend murine leukemia virus. Additional depletion of natural killer and/or CD8(+) T cells from B cell-deficient B6 mice resulted in the expansion of SFFV proviruses and the development of polycythemia, indicating that SFFV-infected erythroid cells are not only restricted in their growth but are actively eliminated in Fv2(r) mice through cellular immune responses.
…Of interest, a fragment of Huntingtin (Htt) similar to those found in inclusions from Huntington's disease brains (Htt with 103Q glutamine stretch [Htt103Q]), is toxic when expressed ectopically in yeast, but only if [RNQ+] prions are present (Meriin et al., 2002).…
Methods)
…The Htt constructs were integrated under control of a galactose-inducible promoter (GAL1).…
Results)
…A construct encoding the first 17 amino acids of the Htt gene followed by 103 glutamines and a green fluorescent protein (GFP) moiety (Htt103Q) was integrated into a W303α strain under control of the galactose promoter.…
Abstract)
…activity reciprocally affectsHtttoxicity and the…
Abstract)
…of Sti1 exacerbatesHtttoxicity and hinders…
Show Full Abstract
Conformational diseases are associated with the conversion of normal proteins into aggregation-prone toxic conformers with structures similar to that of β-amyloid. Spatial distribution of amyloid-like proteins into intracellular quality control centers can be beneficial, but cellular mechanisms for protective aggregation remain unclear. We used a high-copy suppressor screen in yeast to identify roles for the Hsp70 system in spatial organization of toxic polyglutamine-expanded Huntingtin (Huntingtin with 103Q glutamine stretch [Htt103Q]) into benign assemblies. Under toxic conditions, Htt103Q accumulates in unassembled states and speckled cytosolic foci. Subtle modulation of Sti1 activity reciprocally affects Htt toxicity and the packaging of Htt103Q into foci. Loss of Sti1 exacerbates Htt toxicity and hinders foci formation, whereas elevation of Sti1 suppresses Htt toxicity while organizing small Htt103Q foci into larger assemblies. Sti1 also suppresses cytotoxicity of the glutamine-rich yeast prion [RNQ+] while reorganizing speckled Rnq1-monomeric red fluorescent protein into distinct foci. Sti1-inducible foci are perinuclear and contain proteins that are bound by the amyloid indicator dye thioflavin-T. Sti1 is an Hsp70 cochaperone that regulates the spatial organization of amyloid-like proteins in the cytosol and thereby buffers proteotoxicity caused by amyloid-like proteins.
…quence-structural features forATIIIspanning 50 vertebrate…
Show Full Abstract
Antithrombin III (ATIII) performs a critical anticoagulant function by precluding the activation of blood clotting proteinases, aided by its two cofactors, heparin and heparan sulfate. Though several studies have been carried out on physiological, biochemical and structural perspectives on ATIII, so far there are limited studies on the molecular evolution of ATIII. Herein, we carried out molecular phylogenetic analyses of ATIII genes, combining gene structures, synteny and sequence-structural features for ATIII spanning 50 vertebrate genomes. ATIII is maintained over 450 MY on same genomic loci in vertebrates with few changes in ray-finned fishes and lost one intron 262c in tetrapods and coelacanth. In ray-finned fishes, ATIII gene has additional intron at the position 262c, which shared by group V1 members, corroborating that it is lost in other vertebrates and also in lobed-finned fish coelacanth (Latimeria chalumnae). We found that heparin binding basic residues, hD helix, three pairs of Cys-Cys salt bridges, N-glycosylation sites, serpin motifs and inhibitory reactive center loop (RCL) of ATIII protein are highly conserved. Using 1092 human genomes available from 1000G project, we also compiled 1997 ATIII variants, which reveals 76.2% single nucleotide polymorphisms (SNPs), 11.8% deletions and 8.1% insertions as three major classes of gene variations. These understandings may have medical importance as well.
Also flagged:Insulin ResistanceMetabolic Syndromehyperglycemiahyperinsulinemiadyslipidemiafatty liver disease
Journal Article2013-10-09✓ 5 SnippetsVenn-Watson S, Smith CR, Stevenson S, Parry C, Daniels R, Jensen E, Cendejas V, Balmer B, Janech M, Neely BA, Wells R.
In-Text Gene Mentions
Introduction)
…isease, urate nephrolithiasis,hemochromatosis, and chronic elevations…
Discussion)
…liver disease andhemochromatosisat death (…
Discussion)
…Hemochromatosis, or iron overload,…
Discussion)
…Dolphins withhemochromatosishave higher 2…
Discussion)
…appear to havehemochromatosisat time of…
Show Full Abstract
Similar to people with metabolic syndrome, bottlenose dolphins (Tursiops truncatus) can have a sustained postprandial hyperglycemia and hyperinsulinemia, dyslipidemia, and fatty liver disease. A panel of potential postprandial blood-based indicators of insulin resistance and metabolic syndrome were compared among 34 managed collection dolphins in San Diego Bay, CA, USA (Group A) and 16 wild, free-ranging dolphins in Sarasota Bay, FL, USA (Group B). Compared to Group B, Group A had higher insulin (2.1 ± 2.5 and 13 ± 13 μIU/ml), glucose (87 ± 19 and 108 ± 12 mg/dl), and triglycerides (75 ± 28 and 128 ± 45 mg/dl) as well as higher cholesterol (total, high-density lipoprotein cholesterol, and very low density lipoprotein cholesterol), iron, transferrin saturation, gamma-glutamyl transpeptidase (GGT), alanine transaminase, and uric acid. Group A had higher percent unmodified adiponectin. While Group A dolphins were older, the same blood-based differences remained when controlling for age. There were no differences in body mass index (BMI) between the groups, and comparisons between Group B and Group A dolphins have consistently demonstrated lower stress hormones levels in Group A. Group A dolphins with high insulin (greater than 14 μIU/ml) had higher glucose, iron, GGT, and BMI compared to Group A dolphins with lower insulin. These findings support that some dolphin groups may be more susceptible to insulin resistance compared to others, and primary risk factors are not likely age, BMI, or stress. Lower high-molecular weight adiponectin has been identified as an independent risk factor for type 2 diabetes in humans and may be a target for preventing insulin resistance in dolphins. Future investigations with these two dolphin populations, including dietary and feeding differences, may provide valuable insight for preventing and treating insulin resistance in humans.
Also flagged:cholesterolglucoseALTASTTriglyceridesinsulin
Journal Article2013-10-09✓ 1 SnippetSeo JA, Eun CR, Cho H, Lee SK, Yoo HJ, Kim SG, Choi KM, Baik SH, Choi DS, Yim HJ, Shin C, Kim NH.
In-Text Gene Mentions
Methods)
…of history ofhemochromatosis, autoimmune hepatitis, cirrho…
Show Full Abstract
<h4>Objective</h4>To investigate the association between serum 25-hydroxyvitamin D [25(OH)D] levels and nonalcoholic fatty liver disease (NAFLD) independent of visceral obesity in Koreans and to examine whether the associations differ according to the presence of diabetes or insulin resistance.<h4>Research design and methods</h4>A total of 1081 adults were enrolled from a population-based cohort in Ansan city. Serum 25(OH)D concentrations were measured in all subjects. Insulin resistance was measured by homeostasis model assessment of insulin resistance (HOMA-IR). Using computed tomography, NAFLD was diagnosed if the liver attenuation index (LAI, the difference between the mean hepatic and splenic attenuation) was <5 Hounsfield Units.<h4>Results</h4>In subjects with diabetes (n = 282), 25(OH)D levels were negatively associated with waist circumference, fasting insulin, HOMA-IR, triglyceride levels, and visceral abdominal fat, and were positively associated with LAI after adjusting for age, sex, season, exercise, and vitamin supplementation. In subjects without diabetes, only triglyceride level was negatively associated with 25(OH)D. The adjusted odds ratio (OR) for NAFLD increased sequentially across decreasing quartiles of 25(OH)D in subjects with diabetes even after adjusting for visceral fat [Q1 vs. Q4; OR for NAFLD 2.5 (95% CI:1.0-6.2)]. In contrast, no significant difference in OR was observed in subjects without diabetes. When we classified non-diabetic subjects by HOMA-IR, an increase in the OR for NAFLD across decreasing quartiles of 25(OH)D was observed in the high HOMA-IR (≥2.5) group [n = 207, Q1 vs. Q4; OR 3.8(1.4-10.3)], but not in the low HOMA-IR (<2.5) group [n = 592, OR 0.8 (0.3-1.9)].<h4>Conclusions</h4>Low vitamin D status is closely associated with NAFLD, independent of visceral obesity in subjects with diabetes or insulin resistance.
Also flagged:Osteoporosissystemic diseasestrontiumbisphosphonateorganellesvesicles
Journal Article2013-10-09No SnippetsLips KS, Kauschke V, Hartmann S, Thormann U, Ray S, Kampschulte M, Langheinrich A, Schumacher M, Gelinsky M, Heinemann S, Hanke T, Kautz AR, Schnabelrauch M, Schnettler R, Heiss C, Alt V, Kilian O.
Show Full Abstract
Insertion of bone substitution materials accelerates healing of osteoporotic fractures. Biodegradable materials are preferred for application in osteoporotic patients to avoid a second surgery for implant replacement. Degraded implant fragments are often absorbed by macrophages that are removed from the fracture side via passage through veins or lymphatic vessels. We investigated if lymphatic vessels occur in osteoporotic bone defects and whether they are regulated by the use of different materials. To address this issue osteoporosis was induced in rats using the classical method of bilateral ovariectomy and additional calcium and vitamin deficient diet. In addition, wedge-shaped defects of 3, 4, or 5 mm were generated in the distal metaphyseal area of femur via osteotomy. The 4 mm defects were subsequently used for implantation studies where bone substitution materials of calcium phosphate cement, composites of collagen and silica, and iron foams with interconnecting pores were inserted. Different materials were partly additionally functionalized by strontium or bisphosphonate whose positive effects in osteoporosis treatment are well known. The lymphatic vessels were identified by immunohistochemistry using an antibody against podoplanin. Podoplanin immunopositive lymphatic vessels were detected in the granulation tissue filling the fracture gap, surrounding the implant and growing into the iron foam through its interconnected pores. Significant more lymphatic capillaries were counted at the implant interface of composite, strontium and bisphosphonate functionalized iron foam. A significant increase was also observed in the number of lymphatics situated in the pores of strontium coated iron foam. In conclusion, our results indicate the occurrence of lymphatic vessels in osteoporotic bone. Our results show that lymphatic vessels are localized at the implant interface and in the fracture gap where they might be involved in the removal of lymphocytes, macrophages, debris and the implants degradation products. Therefore the lymphatic vessels are involved in implant integration and fracture healing.
…We demonstrate IL-6-mediated activation of STAT3 occurs in conjunction with the phosphorylation of RKIP in vitro in human colon cancer cells.…
Show Full Abstract
<h4>Background</h4>A major obstacle in treating colorectal cancer (CRC) is the acquired resistance to chemotherapeutic agents. An important protein in the regulation of cancer cell death and clinical outcome is Raf kinase inhibitor protein (RKIP). In contrast, activated signal transducer and activator of transcription 3 (STAT3) is a protein that promotes tumor cell survival by inhibiting apoptosis and has an important role in cancer progression in many of cancer types. The aim of this study was to evaluate the regulation of RKIP and STAT3 after treatment with clinically relevant chemotherapeutic agents (camptothecin (CPT) and oxaliplatin (OXP)) and the cytokine interleukin-6 (IL-6) in HCT116 colon cancer cells as well as evaluate the association between RKIP and STAT3 with clinical outcome of Stage II colon cancer patients.<h4>Methods</h4>HCT-116 colon cancer cells were treated with CPT, OXP, and IL-6 separately or in combination in a time and dose-dependent manner and examined for phosphorylated and non-phosphorylated RKIP and STAT3 via Western blot analysis. STAT3 transcriptional activity was measured via a luciferase reporter assay in HCT116 cells treated with CPT, IL-6 or transfected with JAK 1, 2 separately or in combination. We extended these observations and determined STAT3 and RKIP/ pRKIP in tumor microarrays (TMA) in stage II colon cancer patients.<h4>Results</h4>We demonstrate IL-6-mediated activation of STAT3 occurs in conjunction with the phosphorylation of RKIP in vitro in human colon cancer cells. OXP and CPT block IL-6 mediated STAT3 activation and RKIP phosphorylation via the inhibition of the interaction of STAT3 with gp130. We determined that STAT3 and nuclear pRKIP are significantly associated with poor patient prognosis in stage II colon cancer patients.<h4>Conclusions</h4>In the analysis of tumor samples from stage II colon cancer patients and the human colon carcinoma cell line HCT116, pRKIP and STAT3, 2 proteins potentially involved in the resistance to conventional treatments were detected. The phosphorylation of pRKIP and STAT3 are induced by the cytokine IL-6 and suppressed by the chemotherapeutic drugs CPT and OXP. Therefore, these results suggest that STAT3 and pRKIP may serve as prognostic biomarkers in stage II colon cancer patients and may improve chemotherapy.
Also flagged:FerritinironmetabolismFerritinsmineralpolypeptide
Journal Article2013-10-08No SnippetsTheil EC.
Show Full Abstract
At the center of iron and oxidant metabolism is the ferritin superfamily: protein cages with Fe(2+) ion channels and two catalytic Fe/O redox centers that initiate the formation of caged Fe2O3·H2O. Ferritin nanominerals, initiated within the protein cage, grow inside the cage cavity (5 or 8 nm in diameter). Ferritins contribute to normal iron flow, maintenance of iron concentrates for iron cofactor syntheses, sequestration of iron from invading pathogens, oxidant protection, oxidative stress recovery, and, in diseases where iron accumulates excessively, iron chelation strategies. In eukaryotic ferritins, biomineral order/crystallinity is influenced by nucleation channels between active sites and the mineral growth cavity. Animal ferritin cages contain, uniquely, mixtures of catalytically active (H) and inactive (L) polypeptide subunits with varied rates of Fe(2+)/O2 catalysis and mineral crystallinity. The relatively low mineral order in liver ferritin, for example, coincides with a high percentage of L subunits and, thus, a low percentage of catalytic sites and nucleation channels. Low mineral order facilitates rapid iron turnover and the physiological role of liver ferritin as a general iron source for other tissues. Here, current concepts of ferritin structure/function/genetic regulation are discussed and related to possible therapeutic targets such as mini-ferritin/Dps protein active sites (selective pathogen inhibition in infection), nanocage pores (iron chelation in therapeutic hypertransfusion), mRNA noncoding, IRE riboregulator (normalizing the ferritin iron content after therapeutic hypertransfusion), and protein nanovessels to deliver medicinal or sensor cargo.
Also flagged:biomoleculepolysaccharidechitosanhydroxyapatitetripolyphosphateglutaraldehyde
Journal Article2013-10-08No SnippetsHuang LY, Liu TY, Liu TY, Mevold A, Hardiansyah A, Liao HC, Lin CC, Yang MC.
Show Full Abstract
Nanoscaled polymer composites were prepared from polysaccharide chitosan (CS) and Ca-deficient hydroxyapatite (CDHA). CS-CDHA nanocomposites were synthesized by in situ precipitation at pH 9, and the CS-CDHA carriers were then fabricated by ionic cross-linking methods using tripolyphosphate and chemical cross-linking methods by glutaraldehyde and genipin. Certain biomolecules such as vitamin B12, cytochrome c, and bovine serum albumin were loaded into the CS-CDHA carriers, and their release behaviors were investigated. Furthermore, these CS-CDHA carriers were examined by transmission electron microscopy, electron spectroscopy for chemical analysis, and X-ray diffraction. The release behavior of the biomolecules was controlled by the CS/CDHA ratios and cross-linked agents. By increasing the concentration of CS and the concentration of the cross-linking agents, cross-linking within carriers increases, and the release rate of the biomolecules is decreased. Moreover, the release rate of the biomolecules from the CS-CDHA carriers at pH 4 was higher than that at pH 10, displaying a pH-sensitive behavior. Therefore, these CS-CDHA hydrogel beads may be useful for intelligent drug release and accelerate bone reconstruction.
Also flagged:Prostate cancercancersPSAandrogentumorextracellular
Journal Article2013-10-08No SnippetsPanagopoulos K, Cross-Knorr S, Dillard C, Pantazatos D, Del Tatto M, Mills D, Goldstein L, Renzulli J, Quesenberry P, Chatterjee D.
Show Full Abstract
<h4>Background</h4>Extracellular vesicle (EV) trafficking is a fundamental cellular process that occurs in cells and is required for different aspects of pathophysiology. EV trafficking leads to changes in cellular function including apoptosis, angiogenesis and proliferation required for increased tumor formation.<h4>Results</h4>We report several phenotypic changes mediated by EVs isolated from non-malignant and malignant prostate cells as well as patient biopsied prostate tumor samples. EVs can reverse the resistance of prostate cancer cells to camptothecin EVs isolated from non-malignant PrECs (Prostate Epithelial Cells) can reverse soft agar colony formation of malignant DU145 cells, with the reciprocal effect observed. Isolation of EVs from 2 Gleason grade 8 prostate cancer patients significantly induced soft agar colony formation of non-malignant PrECs. We have identified proteins via antibody and Mass spectrometry analysis that may be responsible for the phenotypic changes. Mass spectrometry analysis of protein lysates using ProteoIQ revealed protein candidates associated with gene ontology annotations that may be responsible for this phenotypic change. Ingenuity Pathway Analysis was used to identify statistically relevant canonical pathways and functions associated the protein IDs and expression values obtained using ProteoIQ. Western blot analysis confirmed the increase of 14-3-3 zeta, pRKIP and prohibitin protein levels in PrEC cells co-cultured with patient EVs. 14-3-3 proteins were also found as common proteins of 3 other Gleason grade 8 patients.<h4>Conclusion</h4>Our study provides a rational basis to further investigate putative proteins, such as 14-3-3 and prohibitin and genetic factors that may be responsible for phenotypic changes that are associated with prostate cancer progression.
Also flagged:coagulopathytraumacoagulation factorsFibrinogencoagulationplatelet aggregation
Journal Article2013-10-08✓ 1 SnippetSchlimp CJ, Voelckel W, Inaba K, Maegele M, Schöchl H.
In-Text Gene Mentions
I A O 0000606)
…ANOVA: Analysis of variance; aPTT: Activated partial thromboplastin time; CA10: Clot amplitude at 10 minutes’ running time; CFT: Clot formation time; CT: Clotting time; ER: Emergency room; EXTEM: Extrinsically activated coagulation test using tissue factor; FC group: Patients receiving fibrinogen concentrate only; FC–PCC group: Patients receiving fibrinogen concentrate and prothrombin complex concentrate; FC–PCC–FFP group: Patients receiving fibrinogen concentrate, prothrombin complex concentrate and fresh frozen plasma; FFP: Fresh frozen plasma; FIBTEM: Fibrin polymerization test; GCS: Glasgow coma scale; Hb: Haemoglobin; HF: Hyperfibrinolysis; ICU: Intensive care unit; ISS: Injury severity score; MCF: Maximum clot firmness; NISS: New injury severity score; PT: Prothrombin time; RBC: Red blood cell; SCT: Standard coagulation test; SD-plasma: Solvent/detergent-treated plasma; TXA: Tranexamic acid.…
Show Full Abstract
<h4>Background</h4>Low plasma fibrinogen concentration is a predictor of poor outcome in major trauma patients. The role of fibrinogen concentrate for rapidly increasing fibrinogen plasma levels in severe trauma is not well defined.<h4>Methods</h4>In this retrospective study we included severe trauma patients treated with fibrinogen concentrate alone (FC group), fibrinogen concentrate with prothrombin complex concentrate (FC-PCC group) or fibrinogen concentrate with PCC and fresh frozen plasma (FC-PCC-FFP group). PCC was generally administered as the second step of intraoperative therapy, while FFP was only administered as a third step. All patients received ≥1 g fibrinogen concentrate within 24 hours. Plasma fibrinogen concentration and ROTEM parameters upon emergency room (ER) admission, intensive care unit (ICU) admission, and after 24 hours were analysed.<h4>Results</h4>Among 157 patients fulfilling the inclusion criteria, 83% were male; mean age was 44 years and median injury severity score (ISS) was 29. Standard coagulation tests reflected increasing severity of coagulopathy with increasing complexity of haemostatic therapy (highest severity in the FC-PCC-FFP group; p < 0.0001). Total 24-hour fibrinogen concentrate dose also increased with complexity of haemostatic therapy. Plasma fibrinogen concentration was maintained, with no significant difference between ER admission and ICU admission in all patient groups. FIBTEM clot firmness at 10 minutes (CA10) was similarly maintained, albeit with a small increase in the FC-PCC group. Fibrinogen concentration and FIBTEM CA10 were within the normal range in all groups at 24 hours. The ratio of fibrinogen concentrate to red blood cells (g:U) ranged between 0.7:1.0 and 1.0:1.0.<h4>Conclusion</h4>Fibrinogen concentrate therapy maintained fibrinogen concentration and FIBTEM CA10 during the initial phase of trauma care until ICU admission. After 24 hours, these parameters were comparable between the three groups and within the normal range for each of them. Further studies are warranted to investigate the effect of fibrinogen concentrate on clinical outcomes.
Also flagged:Aminoacyl-tRNA synthetasesamino acidscytoplasmmitochondriacytoplasmicCharcot-Marie-Tooth disease
Journal Article2013-10-08✓ 1 Snippetvan Meel E, Wegner DJ, Cliften P, Willing MC, White FV, Kornfeld S, Cole FS.
In-Text Gene Mentions
Discussion)
…MARS2, RARS2, FARS2,DARS2and EARS2 )…
Show Full Abstract
<h4>Background</h4>Methionyl-tRNA synthetase (MARS) catalyzes the ligation of methionine to its cognate transfer RNA and therefore plays an essential role in protein biosynthesis.<h4>Methods</h4>We used exome sequencing, aminoacylation assays, homology modeling, and immuno-isolation of transfected MARS to identify and characterize mutations in the methionyl-tRNA synthetase gene (MARS) in an infant with an unexplained multi-organ phenotype.<h4>Results</h4>We identified compound heterozygous mutations (F370L and I523T) in highly conserved regions of MARS. The parents were each heterozygous for one of the mutations. Aminoacylation assays documented that the F370L and I523T MARS mutants had 18 ± 6% and 16 ± 6%, respectively, of wild-type activity. Homology modeling of the human MARS sequence with the structure of E. coli MARS showed that the F370L and I523T mutations are in close proximity to each other, with residue I523 located in the methionine binding pocket. We found that the F370L and I523T mutations did not affect the association of MARS with the multisynthetase complex.<h4>Conclusion</h4>This infant expands the catalogue of inherited human diseases caused by mutations in aminoacyl-tRNA synthetase genes.
Also flagged:serotoninserotonin-transportermonoamine5-HTTLPR5-hydroxyindoleacetic acidhomovanillic acid
Journal Article2013-10-08✓ 5 SnippetsLuykx JJ, Bakker SC, van Geloven N, Eijkemans MJ, Horvath S, Lentjes E, Boks MP, Strengman E, DeYoung J, Buizer-Voskamp JE, Cantor RM, Lu A, van Dongen EP, Borgdorff P, Bruins P, Kahn RS, Ophoff RA.
Studying monoaminergic seasonality is likely to improve our understanding of neurobiological mechanisms underlying season-associated physiological and pathophysiological behavior. Studies of monoaminergic seasonality and the influence of the serotonin-transporter-linked polymorphic region (5-HTTLPR) on serotonin seasonality have yielded conflicting results, possibly due to lack of power and absence of multi-year analyses. We aimed to assess the extent of seasonal monoamine turnover and examined the possible involvement of the 5-HTTLPR. To determine the influence of seasonality on monoamine turnover, 5-hydroxyindoleacetic acid (5-HIAA) and homovanillic acid (HVA) were measured in the cerebrospinal fluid of 479 human subjects collected during a 3-year period. Cosine and non-parametric seasonal modeling were applied to both metabolites. We computed serotonin (5-HT) seasonality values and performed an association analysis with the s/l alleles of the 5-HTTLPR. Depressive symptomatology was assessed using the Beck Depression Inventory-II. Circannual variation in 5-HIAA fitted a spring-peak cosine model that was significantly associated with sampling month (P=0.0074). Season of sampling explained 5.4% (P=1.57 × 10(-7)) of the variance in 5-HIAA concentrations. The 5-HTTLPR s-allele was associated with increased 5-HIAA seasonality (standardized regression coefficient=0.12, P=0.020, N=393). 5-HIAA seasonality correlated with depressive symptoms (Spearman's rho=0.13, P=0.018, N=345). In conclusion, we highlight a dose-dependent association of the 5-HTTLPR with 5-HIAA seasonality and a positive correlation between 5-HIAA seasonality and depressive symptomatology. The presented data set the stage for follow-up in clinical populations with a role for seasonality, such as affective disorders.
Also flagged:Huntington's diseaseHDtranscription factorsmethyl-CpG binding protein 2polyglutaminenucleus
Journal Article2013-10-08✓ 5 SnippetsMcFarland KN, Huizenga MN, Darnell SB, Sangrey GR, Berezovska O, Cha JH, Outeiro TF, Sadri-Vakili G.
In-Text Gene Mentions
Abstract)
…Taken together, these findings suggest that aberrant interactions between Htt and MeCP2 contribute to transcriptional dysregulation in HD.…
Abstract)
…Finally, decreasing MeCP2 levels in mutant Htt-expressing cells using siRNA increases BDNF levels, suggesting that MeCP2 downregulates BDNF expression in HD.…
Abstract)
…Furthermore, we find increased binding of MeCP2 to the promoter of brain-derived neurotrophic factor (BDNF), a gene that is downregulated in HD, in the presence of mutant Htt.…
Abstract)
…Here we report that Htt directly interacts with methyl-CpG binding protein 2 (MeCP2) in mouse and cellular models of HD using complimentary biochemical and Fluorescent Lifetime Imaging to measure Förster Resonance Energy Transfer approaches.…
Abstract)
…that mutant huntingtin (Htt) protein interacts with…
Show Full Abstract
Transcriptional dysregulation has been proposed to play a major role in the pathology of Huntington's disease (HD). However, the mechanisms that cause selective downregulation of target genes remain unknown. Previous studies have shown that mutant huntingtin (Htt) protein interacts with a number of transcription factors thereby altering transcription. Here we report that Htt directly interacts with methyl-CpG binding protein 2 (MeCP2) in mouse and cellular models of HD using complimentary biochemical and Fluorescent Lifetime Imaging to measure Förster Resonance Energy Transfer approaches. Htt-MeCP2 interactions are enhanced in the presence of the expanded polyglutamine (polyQ) tract and are stronger in the nucleus compared with the cytoplasm. Furthermore, we find increased binding of MeCP2 to the promoter of brain-derived neurotrophic factor (BDNF), a gene that is downregulated in HD, in the presence of mutant Htt. Finally, decreasing MeCP2 levels in mutant Htt-expressing cells using siRNA increases BDNF levels, suggesting that MeCP2 downregulates BDNF expression in HD. Taken together, these findings suggest that aberrant interactions between Htt and MeCP2 contribute to transcriptional dysregulation in HD.
Also flagged:adiponectinWDR11FGFR2chromosomeOR8S1LALBA
Journal Article2013-10-08✓ 3 SnippetsWu Y, Gao H, Li H, Tabara Y, Nakatochi M, Chiu YF, Park EJ, Wen W, Adair LS, Borja JB, Cai Q, Chang YC, Chen P, Croteau-Chonka DC, Fogarty MP, Gan W, He CT, Hsiung CA, Hwu CM, Ichihara S, Igase M, Jo J, Kato N, Kawamoto R, Kuzawa CW, Lee JJ, Liu J, Lu L, McDade TW, Osawa H, Sheu WH, Teo Y, Vadlamudi S, Van Dam RM, Wang Y, Xiang YB, Yamamoto K, Ye X, Young TL, Zheng W, Zheng W, Zhu J, Shu XO, Shin C, Jee SH, Chuang LM, Miki T, Yokota M, Lin X, Mohlke KL, Tai ES.
In-Text Gene Mentions
Abstract)
…2.1 × 10(-10)),ZNF664(P = 2.3…
Abstract)
…at GPR109A andZNF664.…
Text
…ZNF664…
Show Full Abstract
Blood levels of adiponectin, an adipocyte-secreted protein correlated with metabolic and cardiovascular risks, are highly heritable. Genome-wide association (GWA) studies for adiponectin levels have identified 14 loci harboring variants associated with blood levels of adiponectin. To identify novel adiponectin-associated loci, particularly those of importance in East Asians, we conducted a meta-analysis of GWA studies for adiponectin in 7827 individuals, followed by two stages of replications in 4298 and 5954 additional individuals. We identified a novel adiponectin-associated locus on chromosome 10 near WDR11-FGFR2 (P = 3.0 × 10(-14)) and provided suggestive evidence for a locus on chromosome 12 near OR8S1-LALBA (P = 1.2 × 10(-7)). Of the adiponectin-associated loci previously described, we confirmed the association at CDH13 (P = 6.8 × 10(-165)), ADIPOQ (P = 1.8 × 10(-22)), PEPD (P = 3.6 × 10(-12)), CMIP (P = 2.1 × 10(-10)), ZNF664 (P = 2.3 × 10(-7)) and GPR109A (P = 7.4 × 10(-6)). Conditional analysis at ADIPOQ revealed a second signal with suggestive evidence of association only after conditioning on the lead SNP (Pinitial = 0.020; Pconditional = 7.0 × 10(-7)). We further confirmed the independence of two pairs of closely located loci (<2 Mb) on chromosome 16 at CMIP and CDH13, and on chromosome 12 at GPR109A and ZNF664. In addition, the newly identified signal near WDR11-FGFR2 exhibited evidence of association with triglycerides (P = 3.3 × 10(-4)), high density lipoprotein cholesterol (HDL-C, P = 4.9 × 10(-4)) and body mass index (BMI)-adjusted waist-hip ratio (P = 9.8 × 10(-3)). These findings improve our knowledge of the genetic basis of adiponectin variation, demonstrate the shared allelic architecture for adiponectin with lipids and central obesity and motivate further studies of underlying mechanisms.
Also flagged:Vitamin D 3hydroxylation25-hydroxyvitamin Dvitamin Dcalciumcell proliferation
Journal Article2013-10-08✓ 3 SnippetsTuohimaa P, Wang JH, Khan S, Kuuslahti M, Qian K, Manninen T, Auvinen P, Vihinen M, Lou YR.
In-Text Gene Mentions
Discussion)
…Sex determining region Y-box 6 (SOX6), an osteoporosis susceptibility gene shown by genome-wide association studies [46], [47], was up-regulated by more than twofold by 1α,25(OH)2D3 in hP29SN.…
Discussion)
…Y-box 6 (SOX6), an osteoporosis…
Discussion)
…Sox6was shown to…
Show Full Abstract
1α,25-Dihydroxyvitamin D3 (1α,25(OH)2D3) had earlier been regarded as the only active hormone. The newly identified actions of 25-hydroxyvitamin D3 (25(OH)D3) and 24R,25-dihydroxyvitamin D3 (24R,25(OH)2D3) broadened the vitamin D3 endocrine system, however, the current data are fragmented and a systematic understanding is lacking. Here we performed the first systematic study of global gene expression to clarify their similarities and differences. Three metabolites at physiologically comparable levels were utilized to treat human and mouse fibroblasts prior to DNA microarray analyses. Human primary prostate stromal P29SN cells (hP29SN), which convert 25(OH)D3 into 1α,25(OH)2D3 by 1α-hydroxylase (encoded by the gene CYP27B1), displayed regulation of 164, 171, and 175 genes by treatment with 1α,25(OH)2D3, 25(OH)D3, and 24R,25(OH)2D3, respectively. Mouse primary Cyp27b1 knockout fibroblasts (mCyp27b1 (-/-)), which lack 1α-hydroxylation, displayed regulation of 619, 469, and 66 genes using the same respective treatments. The number of shared genes regulated by two metabolites is much lower in hP29SN than in mCyp27b1 (-/-). By using DAVID Functional Annotation Bioinformatics Microarray Analysis tools and Ingenuity Pathways Analysis, we identified the agonistic regulation of calcium homeostasis and bone remodeling between 1α,25(OH)2D3 and 25(OH)D3 and unique non-classical actions of each metabolite in physiological and pathological processes, including cell cycle, keratinocyte differentiation, amyotrophic lateral sclerosis signaling, gene transcription, immunomodulation, epigenetics, cell differentiation, and membrane protein expression. In conclusion, there are three distinct vitamin D3 hormones with clearly different biological activities. This study presents a new conceptual insight into the vitamin D3 endocrine system, which may guide the strategic use of vitamin D3 in disease prevention and treatment.
Also flagged:neurodegenerative diseasesglutamineHDneurodegenerative disorderslocalizationvesicles
Journal Article2013-10-08✓ 5 SnippetsBaksi S, Jana NR, Bhattacharyya NP, Mukhopadhyay D.
In-Text Gene Mentions
Introduction)
…In order to decipher the normal biological function of Htt, critical to the understanding of HD pathology, several groups have observed the localization of Htt in vesicles, ER and nuclei in various cell models [2-4] and the N-terminal 18 amino acids of Htt were reported to constitute the membrane targeting domain that mediated the association of Htt with ER and late endosomes [2].…
Results)
…To understand any correlation between the vesicular localization of Htt-Grb2 interaction and consequent rise in the levels of autophagy markers (also previously reported in some HD models [32]), Grb2 was knocked down in both STHdhQ7/7 and STHdhQ111/111 cells using RNAi molecules, which showed downregulation of LC3 (Figure 5A, C, p<0.001 and p<0.05, n=3 respectively) and pERK1/2 (Figure 5A, B p<0.001 for both, n=3).…
Abstract)
…Huntingtin (Htt), a ubiquitously expressed protein, when mutated, forms toxic intracellular aggregates - the hallmark of Huntington’s disease (HD).…
Methods)
…Dr. Marcy E. MacDonald of Massachusetts General Hospital, USA, kindly gifted/donated these cells to us and they have published that STHdhQ111/111 cells exhibited dominant HD phenotypes and indicated a disruption of striatal cell homeostasis by the mutant HTT protein, via a mechanism that was different from its normal activity (STHdhQ7/7 cells) [3].…
Introduction)
…In the present study, we have examined the cellular fate of Grb2-Htt interaction in the context of HD.…
Show Full Abstract
Growth factor receptor protein binding protein 2 (Grb2) is known to be associated with intracellular growth and proliferation related signaling cascades. Huntingtin (Htt), a ubiquitously expressed protein, when mutated, forms toxic intracellular aggregates - the hallmark of Huntington's disease (HD). We observed an elevated expression of Grb2 in neuronal cells in animal and cell models of HD. Grb2 overexpression was predominantly regulated by the transcription factor Forkhead Box D3 (Foxd3). Exogenous expression of Grb2 also reduced aggregation of mutant Htt in Neuro2A cells. Grb2 is also known to interact with Htt, depending on epidermal growth factor receptor (EGFR) activation. Grb2- mutant Htt interaction in the contrary, took place in vesicular structures, independent of EGFR activation that eventually merged with autophagosomes and activated the autophagy machinery helping in autophagosome and lysosome fusion. Grb2, with its emerging dual role, holds promise for a survival mechanism for HD.
Also flagged:Integrinscell adhesion moleculesmembranemetal ionsbindingmetal
Journal Article2013-10-08✓ 1 SnippetRaborn J, Fu T, Wu X, Xiu Z, Li G, Luo BH.
In-Text Gene Mentions
Results)
…WT and MutantαIIbβ3 Integrin β3 IIntegrin β3 I…
Show Full Abstract
The Asp of the RGD motif of the ligand coordinates with the β I domain metal ion dependent adhesion site (MIDAS) divalent cation, emphasizing the importance of the MIDAS in ligand binding. There appears to be two distinct groups of integrins that differ in their ligand binding affinity and adhesion ability. These differences may be due to a specific residue associated with the MIDAS, particularly the β3 residue Ala(252) and corresponding Ala in the β1 integrin compared to the analogous Asp residue in the β2 and β7 integrins. Interestingly, mutations in the adjacent to MIDAS (ADMIDAS) of integrins α4β7 and αLβ2 increased the binding and adhesion abilities compared to the wild-type, while the same mutations in the α2β1, α5β1, αVβ3, and αIIbβ3 integrins demonstrated decreased ligand binding and adhesion. We introduced a mutation in the αIIbβ3 to convert this MIDAS associated Ala(252) to Asp. By combination of this mutant with mutations of one or two ADMIDAS residues, we studied the effects of this residue on ligand binding and adhesion. Then, we performed molecular dynamics simulations on the wild-type and mutant αIIbβ3 integrin β I domains, and investigated the dynamics of metal ion binding sites in different integrin-RGD complexes. We found that the tendency of calculated binding free energies was in excellent agreement with the experimental results, suggesting that the variation in this MIDAS associated residue accounts for the differences in ligand binding and adhesion among different integrins, and it accounts for the conflicting results of ADMIDAS mutations within different integrins. This study sheds more light on the role of the MIDAS associated residue pertaining to ligand binding and adhesion and suggests that this residue may play a pivotal role in integrin-mediated cell rolling and firm adhesion.
Also flagged:apomorphineCBFmuscimolhydroxydopaminesucroseextracellular
Journal Article2013-10-08✓ 5 SnippetsBarkus C, Line SJ, Huber A, Capitao L, Lima J, Jennings K, Lowry J, Sharp T, Bannerman DM, McHugh SB.
In-Text Gene Mentions
Abstract)
…Direct experimental manipulation of 5-HTT expression levels throughout the brain markedly altered fear learning, amygdala hemodynamic responses, and neuronal oscillations.…
I A O 0000326)
…HTT…
Abstract)
…Gene association studies detect an influence of natural variation in the 5-hydroxytryptamine transporter (5-HTT) gene on multiple aspects of individuality in brain function, ranging from personality traits through to susceptibility to psychiatric disorders such as anxiety and depression.…
Results)
…First, we established that amygdala 5-HTT expression, measured by [3H]citalopram binding, was 2.7-fold higher in 5-HTTOE compared with WT mice (121.4 ± 4.3 vs. 44.4 ± 5.5 fmol/mg; t9 = 11.2, p < .001).…
Abstract)
…ydroxytryptamine transporter (5-HTT) gene on multiple…
Show Full Abstract
<h4>Background</h4>Gene association studies detect an influence of natural variation in the 5-hydroxytryptamine transporter (5-HTT) gene on multiple aspects of individuality in brain function, ranging from personality traits through to susceptibility to psychiatric disorders such as anxiety and depression. The neural substrates of these associations are unknown. Human neuroimaging studies suggest modulation of the amygdala by 5-HTT variation, but this hypothesis is controversial and unresolved, and difficult to investigate further in humans.<h4>Methods</h4>We used a mouse model in which the 5-HTT is overexpressed throughout the brain and recorded hemodynamic responses (using a novel in vivo voltammetric monitoring method, analogous to blood oxygen level-dependent functional magnetic resonance imaging) and local field potentials during Pavlovian fear conditioning.<h4>Results</h4>Increased 5-HTT expression impaired, but did not prevent, fear learning and significantly reduced amygdala hemodynamic responses to aversive cues. Increased 5-HTT expression was also associated with reduced theta oscillations, which were a feature of aversive cue presentation in controls. Moreover, in control mice, but not those with high 5-HTT expression, there was a strong correlation between theta power and the amplitude of the hemodynamic response.<h4>Conclusions</h4>Direct experimental manipulation of 5-HTT expression levels throughout the brain markedly altered fear learning, amygdala hemodynamic responses, and neuronal oscillations.
Also flagged:erythropoiesiscell growthcell adhesioncDNARibosomal RNA18S rRNA
Journal Article2013-10-08✓ 1 SnippetYang Y, Wang H, Chang KH, Qu H, Zhang Z, Xiong Q, Qi H, Cui P, Lin Q, Ruan X, Yang Y, Li Y, Shu C, Li Q, Wakeland EK, Yan J, Hu S, Fang X.
In-Text Gene Mentions
Text
…SOX6…
Show Full Abstract
To explore the mechanisms controlling erythroid differentiation and development, we analyzed the genome-wide transcription dynamics occurring during the differentiation of human embryonic stem cells (HESCs) into the erythroid lineage and development of embryonic to adult erythropoiesis using high throughput sequencing technology. HESCs and erythroid cells at three developmental stages: ESER (embryonic), FLER (fetal), and PBER (adult) were analyzed. Our findings revealed that the number of expressed genes decreased during differentiation, whereas the total expression intensity increased. At each of the three transitions (HESCs-ESERs, ESERs-FLERs, and FLERs-PBERs), many differentially expressed genes were observed, which were involved in maintaining pluripotency, early erythroid specification, rapid cell growth, and cell-cell adhesion and interaction. We also discovered dynamic networks and their central nodes in each transition. Our study provides a fundamental basis for further investigation of erythroid differentiation and development, and has implications in using ESERs for transfusion product in clinical settings.
Journal Article2013-10-08✓ 3 SnippetsRhodes SL, Buchanan DD, Ahmed I, Taylor KD, Loriot MA, Sinsheimer JS, Bronstein JM, Elbaz A, Mellick GD, Rotter JI, Ritz B.
In-Text Gene Mentions
Abstract)
…CYB561 , orHFE.…
Text
…HFE…
Text
…hemochromatosis…
Show Full Abstract
Pathologic features of Parkinson's disease (PD) include death of dopaminergic neurons in the substantia nigra, presence of α-synuclein containing Lewy bodies, and iron accumulation in PD-related brain regions. The observed iron accumulation may be contributing to PD etiology but it also may be a byproduct of cell death or cellular dysfunction. To elucidate the possible role of iron accumulation in PD, we investigated genetic variation in 16 genes related to iron homeostasis in three case-control studies from the United States, Australia, and France. After screening 90 haplotype tagging single nucleotide polymorphisms (SNPs) within the genes of interest in the US study population, we investigated the five most promising gene regions in two additional independent case-control studies. For the pooled data set (1289 cases, 1391 controls) we observed a protective association (OR=0.83, 95% CI: 0.71-0.96) between PD and a haplotype composed of the A allele at rs1880669 and the T allele at rs1049296 in transferrin (TF; GeneID: 7018). Additionally, we observed a suggestive protective association (OR=0.87, 95% CI: 0.74-1.02) between PD and a haplotype composed of the G allele at rs10247962 and the A allele at rs4434553 in transferrin receptor 2 (TFR2; GeneID: 7036). We observed no associations in our pooled sample for haplotypes in SLC40A1, CYB561, or HFE. Taken together with previous findings in model systems, our results suggest that TF or a TF-TFR2 complex may have a role in the etiology of PD, possibly through iron misregulation or mitochondrial dysfunction within dopaminergic neurons.
Also flagged:genetic diseasesinheritedliver diseasesWilson's diseasehepatolenticular degenerationhereditary hemochromatosis
Journal Article2013-10-08✓ 2 SnippetsZarrilli F, Elce A, Scorza M, Giordano S, Amato F, Castaldo G.
In-Text Gene Mentions
S I O 001029)
…Surprisingly, if the diagnosis is based on traditional laboratory markers (i.e., serum ferritin and transferrin saturation) the incidence of the disease is higher as compared to that resulting from the analysis of hemochromatosis gene (HFE) mutations [17].…
S I O 001029)
…The interesting correlations between hemochromatosis and celiac disease: a first study demonstrated that occult celiac disease prevents penetrance of hemochromatosis [21]; later, it was evidenced that the C282Y mutation of HFE gene may mitigate the severity of celiac disease [22], and finally a large case-control study concluded that hemochromatosis predispose to celiac disease [23].…
Show Full Abstract
Liver inherited diseases are a group of genetically determined clinical entities that appear with an early chronic liver involvement. They include Wilson's disease (hepatolenticular degeneration), hereditary hemochromatosis, and alpha-1-antitrypsin deficiency. In addition, cystic fibrosis, although it is not specifically a liver disease, may cause a severe liver involvement in a significant percentage of cases. For all these pathologies, the disease gene is known, and molecular analysis may contribute to the unequivocal diagnosis. This approach could avoid the patient invasive procedures and limit complications associated with a delay in diagnosis. We review liver inherited diseases on the basis of the genetic defect, focusing on the contribution of molecular analysis in the multistep diagnostic workup.
Also flagged:netrin-1cancerstumourdeathDoxorubicin5-Fluorouracil
Journal Article2013-10-08✓ 5 SnippetsParadisi A, Creveaux M, Gibert B, Devailly G, Redoulez E, Neves D, Cleyssac E, Treilleux I, Klein C, Niederfellner G, Cassier PA, Bernet A, Mehlen P.
In-Text Gene Mentions
Methods)
…Netrin-1, DCC, p53 and p21 protein quantification in human cancer cells…
Results)
…DCC, which displays an overall low expression in the screened cancer cell lines, is the netrin-1 receptor showing the largest spectrum of upregulation as DCC expression was strongly increased in 40, 40 and 53% of cell lines in response to, respectively, Cisplatin, 5FU and Taxol.…
Results)
…As shown in Fig 1E, levels of DCC, UNC5A, UNC5B and UNC5D increase concomitantly to netrin-1 levels, in A549R cells treated with Doxorubicin.…
Results)
…Next, we analysed the level of the netrin-1 receptors DCC and UNC5H—UNC5A, UNC5B, UNC5C and UNC5D—in response to Doxorubicin.…
Methods)
…For DCC flow cytometry analysis, A549R cells were treated for 48 h with 2 μM Doxorubicin and after detachment cells were stained with α-DCC antibody (AF5, Abcam, Cambridge, MA, USA) diluted at 1/500 for 2 h at 4°C, following incubation for 1 h with phycoerytrin-conjugated anti-mouse antibody, diluted at 1/1000.…
Show Full Abstract
The secreted factor netrin-1 is upregulated in a fraction of human cancers as a mechanism to block apoptosis induced by netrin-1 dependence receptors DCC and UNC5H. Targeted therapies aiming to trigger tumour cell death via netrin-1/receptors interaction interference are under preclinical evaluation. We show here that Doxorubicin, 5-Fluorouracil, Paclitaxel and Cisplatin treatments trigger, in various human cancer cell lines, an increase of netrin-1 expression which is accompanied by netrin-1 receptors increase. This netrin-1 upregulation which appears to be p53-dependent is a survival mechanism as netrin-1 silencing by siRNA is associated with a potentiation of cancer cell death upon Doxorubicin treatment. We show that candidate drugs interfering with netrin-1/netrin-1 receptors interactions potentiate Doxorubicin, Cisplatin or 5-Fluorouracil-induced cancer cell death in vitro. Moreover, in a model of xenografted nude mice, we show that systemic Doxorubicin treatment triggers netrin-1 upregulation in the tumour but not in normal organs, enhancing and prolonging tumour growth inhibiting effect of a netrin-1 interfering drug. Together these data suggest that combining conventional chemotherapies with netrin-1 interference could be a promising therapeutic approach.
Also flagged:Myotonic dystrophydiseasemuscleblind-likeMBNLMBNL1Mbnl2
Journal Article2013-10-08✓ 3 SnippetsLee KY, Li M, Manchanda M, Batra R, Charizanis K, Mohan A, Warren SA, Chamberlain CM, Finn D, Hong H, Ashraf H, Kasahara H, Ranum LP, Swanson MS.
…pathogenesis (Mbnl3, Hnrnph1,Stau1) did not show…
Show Full Abstract
Myotonic dystrophy (DM) is a multi-systemic disease that impacts cardiac and skeletal muscle as well as the central nervous system (CNS). DM is unusual because it is an RNA-mediated disorder due to the expression of toxic microsatellite expansion RNAs that alter the activities of RNA processing factors, including the muscleblind-like (MBNL) proteins. While these mutant RNAs inhibit MBNL1 splicing activity in heart and skeletal muscles, Mbnl1 knockout mice fail to recapitulate the full-range of DM symptoms in these tissues. Here, we generate mouse Mbnl compound knockouts to test the hypothesis that Mbnl2 functionally compensates for Mbnl1 loss. Although Mbnl1(-/-) ; Mbnl2(-/-) double knockouts (DKOs) are embryonic lethal, Mbnl1(-/-) ; Mbnl2(+/-) mice are viable but develop cardinal features of DM muscle disease including reduced lifespan, heart conduction block, severe myotonia and progressive skeletal muscle weakness. Mbnl2 protein levels are elevated in Mbnl1(-/-) knockouts where Mbnl2 targets Mbnl1-regulated exons. These findings support the hypothesis that compound loss of MBNL function is a critical event in DM pathogenesis and provide novel mouse models to investigate additional pathways disrupted in this RNA-mediated disease.
…conditions such ashemochromatosis, gastric antral vascular…
Show Full Abstract
Iron-deficiency anemia is a prevalent condition treated with iron supplementation. Iron pill-induced gastritis is an under-recognized, albeit serious potential complication of iron pill ingestion. This entity must be identified by healthcare providers who prescribe iron. We present a case of a 59-year-old male with iron deficiency anemia on ferrous sulfate tablets who underwent an upper endoscopy, during which a single superficial gastric ulceration in the body was noted. Biopsies revealed heavy iron deposition confirming the ulceration was a consequence of the iron tablets. Iron pill-induced gastritis causes corrosive mucosal injury similar to that caused by chemical burns.
Also flagged:DICER1cancertumorscolorectal cancertumorepithelial-to-mesenchymal transition
Journal Article2013-10-07✓ 1 SnippetIliou MS, da Silva-Diz V, Carmona FJ, Ramalho-Carvalho J, Heyn H, Villanueva A, Muñoz P, Esteller M.
In-Text Gene Mentions
Results)
…, CCND1 andOLFM4( Figure 4d…
Show Full Abstract
Disruption of microRNA (miRNA) expression patterns is now being recognized as a hallmark of human cancer. The causes of these altered profiles are diverse, and, among them, we found the existence of defects in the miRNA processing machinery. However, little is known about how these alterations affect the biology of the underlying tumors. Herein, we show that colorectal cancer cells with an impairment in DICER1, a major miRNA biogenesis gene, undergo enrichment of tumor stemness features and an epithelial-to-mesenchymal transition. These phenotypes are associated with the downregulation of miRNAs, such as miR-34a, miR-126 and those of the miR-200 family, that target critical coding genes in these pathways. Most importantly, DICER1 impairment also induces the acquisition of a greater capacity for tumor initiation and metastasis, two properties associated with cancer stem cells.
Also flagged:cell-endmicrotubule polymerasemicrotubuleCKAP5XMAP215microtubules
Journal Article2013-10-07No SnippetsTakeshita N, Mania D, Herrero S, Ishitsuka Y, Nienhaus GU, Podolski M, Howard J, Fischer R.
Show Full Abstract
In the absence of landmark proteins, hyphae of Aspergillus nidulans lose their direction of growth and show a zigzag growth pattern. Here, we show that the cell-end marker protein TeaA is important for localizing the growth machinery at hyphal tips. The central position of TeaA at the tip correlated with the convergence of the microtubule (MT) ends to a single point. Conversely, in the absence of TeaA, the MTs often failed to converge to a single point at the cortex. Further analysis suggested a functional connection between TeaA and AlpA (an ortholog of the MT polymerase Dis1/CKAP5/XMAP215) for proper regulation of MT growth at hyphal tips. AlpA localized at MT plus-ends, and bimolecular fluorescence complementation assays suggested that it interacted with TeaA after MT plus-ends reached the tip cortex. In vitro MT polymerization assays showed that AlpA promoted MT growth up to sevenfold. Addition of the C-terminal region of TeaA increased the catastrophe frequency of the MTs. Thus, the control of the AlpA activity through TeaA might be a novel principle for MT growth regulation after reaching the cortex. In addition, we present evidence that the curvature of hyphal tips also could be involved in the control of MT growth at hyphal tips.
Also flagged:bindinggene expressionTFlocalizationchromatinGATA-1
Journal Article2013-10-07✓ 1 SnippetBurdach J, Funnell AP, Mak KS, Artuz CM, Wienert B, Lim WF, Tan LY, Pearson RC, Crossley M.
In-Text Gene Mentions
Results)
…the promoter ofRc3h1.…
Show Full Abstract
Transcription factors (TFs) are often regarded as being composed of a DNA-binding domain (DBD) and a functional domain. The two domains are considered separable and autonomous, with the DBD directing the factor to its target genes and the functional domain imparting transcriptional regulation. We examined an archetypal zinc finger (ZF) TF, Krüppel-like factor 3 with an N-terminal domain that binds the corepressor CtBP and a DBD composed of three ZFs at its C-terminus. We established a system to compare the genomic occupancy profile of wild-type Krüppel-like factor 3 with two mutants affecting the N-terminal functional domain: a mutant unable to contact the cofactor CtBP and a mutant lacking the entire N-terminal domain, but retaining the ZFs intact. Chromatin immunoprecipitation followed by sequencing was used to assess binding across the genome in murine embryonic fibroblasts. Unexpectedly, we observe that mutations in the N-terminal domain generally reduced binding, but there were also instances where binding was retained or even increased. These results provide a clear demonstration that the correct localization of TFs to their target genes is not solely dependent on their DNA-contact domains. This informs our understanding of how TFs operate and is of relevance to the design of artificial ZF proteins.
<h4>Background & aims</h4>The aim of our study was to determine whether the use of iron supplements during pregnancy affects the risk for celiac disease in children.<h4>Methods</h4>We assessed data from the prospective Norwegian Mother and Child cohort study, in which individuals with celiac disease were identified by answers on questionnaires and linkage to the Norwegian Patient Register. Complete data were available for 78,846 children (mean age 5.9 years, range 2-12 years); 314 children were identified with celiac disease. Questionnaires were given to pregnant women to collect information on use of iron-containing supplements, diet, anemia, and levels of hemoglobin.<h4>Results</h4>Celiac disease was diagnosed in 4.65 of 1000 children whose mothers took iron supplements while they were pregnant, compared with 3.15 of 1000 children whose mothers did not. After adjusting for children's age, sex, and age of gluten introduction, and the presence of celiac disease in mothers, iron supplementation during pregnancy remained significantly associated with celiac disease in children (odds ratio [OR], 1.33; 95% confidence interval [CI], 1.05-1.68; P = .019). However, celiac disease was not associated with the mothers' intake of iron from foods (adjusted OR, 1.00; 95% CI, 0.97-1.03). Anemia before or during the early stages of pregnancy was not significantly associated with the risk of celiac disease in children (adjusted OR, 1.24; 95% CI, 0.84-2.00; P = .24). The use of iron supplements during pregnancy remained significantly associated with celiac disease in children after adjusting for children who were given iron supplements before 18 months of age, which itself was associated with celiac disease.<h4>Conclusions</h4>In a prospective Norwegian Mother and Child cohort study, we found an increased risk of celiac disease in children whose mothers used iron supplements during pregnancy; this association does not appear to arise from maternal anemia.
Also flagged:RhoAsmall GTPasesbreast cancerestrogen receptor alphabreast adenocarcinomavitellogenin
Journal Article2013-10-06No SnippetsMalissein E, Meunier E, Lajoie-Mazenc I, Médale-Giamarchi C, Dalenc F, Doisneau-Sixou SF.
Show Full Abstract
<h4>Purpose</h4>RhoA and RhoC are closely related, small GTPases that are clearly involved in breast cancer tumorigenesis. Nonetheless, their specific roles in the control of estrogen receptor alpha (ERα) activities have not been elucidated.<h4>Methods</h4>We used siRNA sequences to specifically down-regulate RhoA and RhoC expression in ERα-positive breast adenocarcinoma MCF-7 cells. We then analyzed the consequences of down-regulation on ERα expression, ERα recruitment to the promoters of four target genes, and the mRNA levels of those genes.<h4>Results</h4>We demonstrated that RhoA and RhoC clearly and similarly modulated ERα recruitment to the vitellogenin estrogen responsive element (ERE) present in a luciferase reporter gene and to the promoters of progesterone receptor (PR), cathepsin D, and pS2 genes. Besides, RhoA up-regulated the ERE-luciferase reporter gene activity and PR mRNA expression and tended to down-regulate cathepsin D and pS2 mRNA expression. Conversely, RhoC inhibition had no significant effect at the mRNA level. Furthermore, RhoA inhibition, and to a lesser extent RhoC inhibition, increased ERα expression. No alteration in ERα mRNA levels was observed, suggesting potential post-translational control.<h4>Conclusions</h4>Taken together, our results strongly suggest that RhoA and RhoC play different, but clear, roles in ERα signaling. These GTPases are definitely involved, along with RhoB, in ERα recruitment and, to some extent, ERα cofactor balance. We hypothesize a differential role of RhoA in breast cancer tumors that depend on hormone status.
Also flagged:transcription factorsCOUP-TFIISp8transcription factorcell migrationinterneuron development
Journal Article2013-10-06✓ 1 SnippetMa T, Wang C, Wang L, Zhou X, Tian M, Zhang Q, Zhang Y, Li J, Liu Z, Cai Y, Liu F, You Y, Chen C, Campbell K, Song H, Ma L, Rubenstein JL, Yang Z.
In-Text Gene Mentions
Abstract)
…the continuity ofSox6, COUP-TFII and Sp8…
Show Full Abstract
Cortical GABAergic inhibitory interneurons have crucial roles in the development and function of the cerebral cortex. In rodents, nearly all neocortical interneurons are generated from the subcortical ganglionic eminences. In humans and nonhuman primates, however, the developmental origin of neocortical GABAergic interneurons remains unclear. Here we show that the expression patterns of several key transcription factors in the developing primate telencephalon are very similar to those in rodents, delineating the three main subcortical progenitor domains (the medial, lateral and caudal ganglionic eminences) and the interneurons tangentially migrating from them. On the basis of the continuity of Sox6, COUP-TFII and Sp8 transcription factor expression and evidence from cell migration and cell fate analyses, we propose that the majority of primate neocortical GABAergic interneurons originate from ganglionic eminences of the ventral telencephalon. Our findings reveal that the mammalian neocortex shares basic rules for interneuron development, substantially reshaping our understanding of the origin and classification of primate neocortical interneurons.
Also flagged:MODYdiabetesMendelian disordersmaturity-onset diabetes of thecardiovascular diseasetype 1 diabetes
Journal Article2013-10-06No SnippetsFlannick J, Beer NL, Bick AG, Agarwala V, Molnes J, Gupta N, Burtt NP, Florez JC, Meigs JB, Taylor H, Lyssenko V, Irgens H, Fox E, Burslem F, Johansson S, Brosnan MJ, Trimmer JK, Newton-Cheh C, Tuomi T, Molven A, Wilson JG, O'Donnell CJ, Kathiresan S, Hirschhorn JN, Njølstad PR, Rolph T, Seidman JG, Gabriel S, Cox DR, Seidman CE, Groop L, Altshuler D.
Show Full Abstract
Genome sequencing can identify individuals in the general population who harbor rare coding variants in genes for Mendelian disorders and who may consequently have increased disease risk. Previous studies of rare variants in phenotypically extreme individuals display ascertainment bias and may demonstrate inflated effect-size estimates. We sequenced seven genes for maturity-onset diabetes of the young (MODY) in well-phenotyped population samples (n = 4,003). We filtered rare variants according to two prediction criteria for disease-causing mutations: reported previously in MODY or satisfying stringent de novo thresholds (rare, conserved and protein damaging). Approximately 1.5% and 0.5% of randomly selected individuals from the Framingham and Jackson Heart Studies, respectively, carry variants from these two classes. However, the vast majority of carriers remain euglycemic through middle age. Accurate estimates of variant effect sizes from population-based sequencing are needed to avoid falsely predicting a substantial fraction of individuals as being at risk for MODY or other Mendelian diseases.
Also flagged:organizationK19Lgr5K14TamoxifenDoxycycline
Journal Article2013-10-06No SnippetsRompolas P, Mesa KR, Greco V.
Show Full Abstract
Stem-cell niches in mammalian tissues are often heterogeneous and compartmentalized; however, whether distinct niche locations determine different stem-cell fates remains unclear. To test this hypothesis, here we use the mouse hair follicle niche and combine intravital microscopy with genetic lineage tracing to re-visit the same stem-cell lineages, from their exact place of origin, throughout regeneration in live mice. Using this method, we show directly that the position of a stem cell within the hair follicle niche can predict whether it is likely to remain uncommitted, generate precursors or commit to a differentiated fate. Furthermore, using laser ablation we demonstrate that hair follicle stem cells are dispensable for regeneration, and that epithelial cells, which do not normally participate in hair growth, re-populate the lost stem-cell compartment and sustain hair regeneration. This study provides a general model for niche-induced fate determination in adult tissues.
…In the dorsal raphe nuclei (DRN) cell, BDNF activates genes in the serotonin pathway, such as those encoding the serotonin transporter (5-HTT) and the enzymes required for 5-HT synthesis.…
Introduction)
…the serotonin transporter (5-HTT) with maltreatment […
Introduction)
…approach in which5-HTTgene variations are…
Introduction)
…to block the5-HTT.…
Introduction)
…the serotonin transporter (5-HTT) and the enzymes…
Show Full Abstract
Major depressive disorder (MDD) is a multifactorial disorder known to be influenced by both genetic and environmental factors. MDD presents a heritability of 37%, and a genetic contribution has also been observed in studies of family members of individuals with MDD that imply that the probability of suffering the disorder is approximately three times higher if a first-degree family member is affected. Childhood maltreatment and stressful life events (SLEs) have been established as critical environmental factors that profoundly influence the onset of MDD. The serotonin pathway has been a strong candidate for genetic studies, but it only explains a small proportion of the heritability of the disorder, which implies the involvement of other pathways. The serotonin (5-HT) pathway interacts with the stress response pathway in a manner mediated by the hypothalamic-pituitary-adrenal (HPA) axis. To analyze the interaction between the pathways, we propose the use of a synchronous Boolean network (SBN) approximation. The principal aim of this work was to model the interaction between these pathways, taking into consideration the presence of selective serotonin reuptake inhibitors (SSRIs), in order to observe how the pathways interact and to examine if the system is stable. Additionally, we wanted to study which genes or metabolites have the greatest impact on model stability when knocked out in silico. We observed that the biological model generated predicts steady states (attractors) for each of the different runs performed, thereby proving that the system is stable. These attractors changed in shape, especially when anti-depressive drugs were also included in the simulation. This work also predicted that the genes with the greatest impact on model stability were those involved in the neurotrophin pathway, such as CREB, BDNF (which has been associated with major depressive disorder in a variety of studies) and TRkB, followed by genes and metabolites related to 5-HT synthesis.
…ms</h4>Serotonin transporter (5-HTT) plays a central…
Abstract)
…polymorphisms in the5-HTTgene may contribute…
Show Full Abstract
<h4>Aims</h4>Serotonin transporter (5-HTT) plays a central role in the regulation of serotonin (5-hydroxytryptamine [5-HT]) synaptic function. Disturbances in 5-HT transmission are the most frequently reported neurobiological substrates of suicidal behavior. Emerging evidence has shown that the common polymorphisms in the 5-HTT gene may contribute to the risk of epilepsy, but individually published studies showed inconclusive results. This meta-analysis aimed to derive a more precise estimation of the associations between 5-HTT gene polymorphisms and susceptibility to epilepsy.<h4>Methods</h4>A literature search of PubMed, Embase, Web of Science, and China BioMedicine (CBM) databases was conducted on articles published before June 1st, 2013. Crude odds ratios with 95% confidence intervals were calculated.<h4>Results</h4>Seven studies were assessed with a total 1303 epilepsy patients and 1288 healthy controls. The meta-analysis results indicated that there was no significant relationship between 5-HTT gene polymorphisms and an increased risk of epilepsy. Further subgroup analysis based on ethnicity also found no significant association between 5-HTT gene polymorphisms and epilepsy risk among both Caucasian and Asian populations. In addition, there was also no significant association between 5-HTT gene polymorphisms and the risk of psychiatric comorbidity in patients with epilepsy.<h4>Conclusion</h4>In conclusion, the current meta-analysis indicates that 5-HTT gene polymorphisms might not be the primary determinants of epilepsy susceptibility. 5-HTT genes might be expected to interact with other genes in different signaling pathways to initiate and promote the epileptogenic process.
Also flagged:nicotinic acetylcholine receptorbispidinehydrogenarylBispidine carboxamidesCarboxamide
Journal Article2013-10-05No SnippetsEibl C, Munoz L, Tomassoli I, Stokes C, Papke RL, Gündisch D.
Show Full Abstract
3,7-Diazabicyclo[3.3.1]nonane (bispidine) based nicotinic acetylcholine receptor (nAChR) ligands have been synthesized and evaluated for nAChRs interaction. Diverse spacer motifs were incorporated between the hydrogen bond acceptor (HBA) part and a variety of substituted (hetero)aryl moieties. Bispidine carboxamides bearing spacer motifs often showed high affinity in the low nanomolar range and selectivity for the α4β2(∗) nAChR. Compounds 15, 25, and 47 with Ki values of about 1 nM displayed the highest affinities for α4β2(∗) nAChR. All evaluated compounds are partial agonists or antagonists at α4β2(∗), with reduced or no effects on α3β4(∗) with the exception of compound 15 (agonist), and reduced or no effect at α7 and muscle subtypes.
Also flagged:nicotinic acetylcholine receptorhydrogennonanenicotinic acetylcholine receptorsnitrogencarboxamide
Journal Article2013-10-05No SnippetsEibl C, Tomassoli I, Munoz L, Stokes C, Papke RL, Gündisch D.
Show Full Abstract
3,7-Diazabicyclo[3.3.1]nonane is a naturally occurring scaffold interacting with nicotinic acetylcholine receptors (nAChRs). When one nitrogen of the 3,7-diazabicyclo[3.3.1]nonane scaffold was implemented in a carboxamide motif displaying a hydrogen bond acceptor (HBA) functionality, compounds with higher affinities and subtype selectivity for α4β2(∗) were obtained. The nature of the HBA system (carboxamide, sulfonamide, urea) had a strong impact on nAChR interaction. High affinity ligands for α4β2(∗) possessed small alkyl chains, small un-substituted hetero-aryl groups or para-substituted phenyl ring systems along with a carboxamide group. Electrophysiological responses of selected 3,7-diazabicyclo[3.3.1]nonane derivatives to Xenopus oocytes expressing various nAChR subtypes showed diverse activation profiles. Compounds with strongest agonistic profiles were obtained with small alkyl groups whereas a shift to partial agonism/antagonism was observed for aryl substituents.
Also flagged:TNFAIP3TNIP1BLKSLC15A4UBE2L3systemic lupus erythematosus
Journal Article2013-10-04✓ 5 SnippetsZuo XB, Sheng YJ, Hu SJ, Gao JP, Li Y, Tang HY, Tang XF, Cheng H, Yin XY, Wen LL, Sun LD, Yang S, Cui Y, Zhang XJ.
In-Text Gene Mentions
Title)
…Variants in TNFSF4, TNFAIP3, TNIP1, BLK, SLC15A4 and UBE2L3 interact to confer risk of systemic lupus erythematosus in Chinese population.…
Abstract)
…Our previous genome-wide association studies on SLE have identified several susceptibility genes involved in NF-κB signaling pathway, including TNFSF4, TNFAIP3, TNIP1, BLK, SLC15A4 and UBE2L3.…
Our previous genome-wide association studies on SLE have identified several susceptibility genes involved in NF-κB signaling pathway, including TNFSF4, TNFAIP3, TNIP1, BLK, SLC15A4 and UBE2L3. The aim of this study is to investigate the association model (additive, dominant, recessive) of these genes and search for possible gene-gene interactions between them. In this study, we explored the association model of these six genes and search for possible gene-gene interactions based on identified single-nucleotide polymorphisms (SNPs) among them by using logistic regression analysis in the combined sample of 4,199 cases and 8,255 controls. The most significant association evidence was observed under recessive model for all of these SNPs. Besides, significant interactions between these SNPs were observed in this study: the TNFSF4 and TNIP1 SNPs (P adjusted = 1.68E-10), the TNFSF4 and SLC15A4 SNPs (P adjusted = 3.55E-08), the TNFSF4 and UBE2L3 SNPs (P adjusted = 8.74E-13), the TNIP1 and BLK SNPs (P adjusted = 9.45E-10), the TNIP1 and UBE2L3 SNPs (P adjusted = 8.25E-11), the TNFAIP3 and UBE2L3 SNPs (P adjusted = 3.06E-14) and the BLK and SLC15A4 SNPs (P adjusted = 4.51E-12). These results may contribute to our understanding of SLE genetic interactions and account for the additional risk of certain patients to develop SLE.
Also flagged:statinAtorvastatinsimvastatinStatinsHMG-CoA reductaselipoprotein
Journal Article2013-10-04No SnippetsWei WQ, Feng Q, Jiang L, Waitara MS, Iwuchukwu OF, Roden DM, Jiang M, Xu H, Krauss RM, Rotter JI, Nickerson DA, Davis RL, Berg RL, Peissig PL, McCarty CA, Wilke RA, Denny JC.
Show Full Abstract
Efforts to define the genetic architecture underlying variable statin response have met with limited success, possibly because previous studies were limited to effect based on a single dose. We leveraged electronic medical records (EMRs) to extract potency (ED50) and efficacy (Emax) of statin dose-response curves and tested them for association with 144 preselected variants. Two large biobanks were used to construct dose-response curves for 2,026 and 2,252 subjects on simvastatin and atorvastatin, respectively. Atorvastatin was more efficacious, was more potent, and demonstrated less interindividual variability than simvastatin. A pharmacodynamic variant emerging from randomized trials (PRDM16) was associated with Emax for both. For atorvastatin, Emax was 51.7 mg/dl in subjects homozygous for the minor allele vs. 75.0 mg/dl for those homozygous for the major allele. We also identified several loci associated with ED50. The extraction of rigorously defined traits from EMRs for pharmacogenetic studies represents a promising approach to further understand the genetic factors contributing to drug response.
Also flagged:cancerataxia-telangiectasia mutatedATMJade1acetylasebinding
Journal Article2013-10-04✓ 1 SnippetWan G, Hu X, Liu Y, Han C, Sood AK, Calin GA, Calin GA, Zhang X, Lu X.
In-Text Gene Mentions
Text
…histone acetyltransferase complex…
Show Full Abstract
A prompt and efficient DNA damage response (DDR) eliminates the detrimental effects of DNA lesions in eukaryotic cells. Basic and preclinical studies suggest that the DDR is one of the primary anti-cancer barriers during tumorigenesis. The DDR involves a complex network of processes that detect and repair DNA damage, in which long non-coding RNAs (lncRNAs), a new class of regulatory RNAs, may play an important role. In the current study, we identified a novel lncRNA, lncRNA-JADE, that is induced after DNA damage in an ataxia-telangiectasia mutated (ATM)-dependent manner. LncRNA-JADE transcriptionally activates Jade1, a key component in the HBO1 (human acetylase binding to ORC1) histone acetylation complex. Consequently, lncRNA-JADE induces histone H4 acetylation in the DDR. Markedly higher levels of lncRNA-JADE were observed in human breast tumours in comparison with normal breast tissues. Knockdown of lncRNA-JADE significantly inhibited breast tumour growth in vivo. On the basis of these results, we propose that lncRNA-JADE is a key functional link that connects the DDR to histone H4 acetylation, and that dysregulation of lncRNA-JADE may contribute to breast tumorigenesis.
Also flagged:axonsglial cell line-derived neurotrophic factorGDNFnetrin-1GDNF family receptor α1axonal
Journal Article2013-10-04✓ 3 SnippetsZhang C, Jin Y, Ziemba KS, Fletcher AM, Ghosh B, Truit E, Yurek DM, Smith GM.
In-Text Gene Mentions
Text
…DCC…
Text
…DCC receptor…
Text
…DCC) receptor…
Show Full Abstract
Different experimental and clinical strategies have been used to promote survival of transplanted embryonic ventral mesencephalic (VM) neurons. However, few studies have focused on the long-distance growth of dopaminergic axons from VM transplants. The aim of this study is to identify some of the growth and guidance factors that support directed long-distance growth of dopaminergic axons from VM transplants. Lentivirus encoding either glial cell line-derived neurotrophic factor (GDNF) or netrin-1, or a combination of lenti-GDNF with either lenti-GDNF family receptor α1 (GFRα-1) or lenti-netrin-1 was injected to form a gradient along the corpus callosum. Two weeks later, a piece of embryonic day 14 VM tissue was transplanted into the corpus callosum adjacent to the low end of the gradient. Results showed that tyrosine hydroxylase (TH(+)) axons grew a very short distance from the VM transplants in control groups, with few axons reaching the midline. In GDNF or netrin-1 expressing groups, more TH(+) axons grew out of transplants and reached the midline. Pathways co-expressing GDNF with either GFRα-1 or netrin-1 showed significantly increased axonal outgrowth. Interestingly, only the GDNF/netrin-1 combination resulted in the majority of axons reaching the distal target (80%), whereas along the GDNF/GFRα-1 pathway only 20% of the axons leaving the transplant reached the distal target. This technique of long-distance axon guidance may prove to be a useful strategy in reconstructing damaged neuronal circuits, such as the nigrostriatal pathway in Parkinson's disease.
Also flagged:Pet-1SerotoninETSdomain transcription factorbehavioralfear conditioning
Journal Article2013-10-04✓ 1 SnippetWellman CL, Camp M, Jones VM, MacPherson KP, Ihne J, Fitzgerald P, Maroun M, Drabant E, Bogdan R, Hariri AR, Holmes A.
In-Text Gene Mentions
Text
…5-HTT…
Show Full Abstract
Serotonin is critical for shaping the development of neural circuits regulating emotion. Pet-1 (FEV-1) is an ETS-domain transcription factor essential for differentiation and forebrain targeting of serotonin neurons. Constitutive Pet-1 knockout (KO) causes major loss of serotonin neurons and forebrain serotonin availability, and behavioral abnormalities. We phenotyped Pet-1 KO mice for fear conditioning and extinction, and on a battery of assays for anxiety- and depression-related behaviors. Morphology of Golgi-stained neurons in basolateral amygdala (BLA) and prelimbic cortex was examined. Using human imaging genetics, a common variant (rs860573) in the PET-1 (FEV) gene was tested for effects on threat-related amygdala reactivity and psychopathology in 88 Asian-ancestry subjects. Pet-1 KO mice exhibited increased acquisition and expression of fear, and elevated fear recovery following extinction, relative to wild-type (WT). BLA dendrites of Pet-1 KO mice were significantly longer than in WT. Human PET-1 variation associated with differences in amygdala threat processing and psychopathology. This novel evidence for the role of Pet-1 in fear processing and dendritic organization of amygdala neurons and in human amygdala threat processing extends a growing literature demonstrating the influence of genetic variation in the serotonin system on emotional regulation via effects on structure and function of underlying corticolimbic circuitry.
Besides its "classical" neurotransmitter function, serotonin (5-HT) has been found to also act as a neurodevelopmental signal. During development, the 5-HT projection system, besides an external placental source, represents one of the earliest neurotransmitter systems to innervate the brain. One of the targets of the 5-HT projection system, originating in the brainstem raphe nuclei, is the medial prefrontal cortex (mPFC), an area involved in higher cognitive functions and important in the etiology of many neurodevelopmental disorders. Little is known, however, about the exact role of 5-HT and its signaling molecules in the formation of the raphe-prefrontal network. Using explant essays, we here studied the role of the 5-HT transporter (5-HTT), an important modulator of the 5-HT signal, in rostral raphe-prefrontal network formation. We found that the chemotrophic nature of the interaction between the origin (rostral raphe cluster) and a target (mPFC) of the 5-HT projection system was affected in rats lacking the 5-HTT (5-HTT(-/-)). While 5-HTT deficiency did not affect the dorsal raphe 5-HT-positive outgrowing neurites, the median raphe 5-HT neurites switched from a strong repulsive to an attractive interaction when co-cultured with the mPFC. Furthermore, the fasciculation of the mPFC outgrowing neurites was dependent on the amount of 5-HTT. In the mPFC of 5-HTT(-/-) pups, we observed clear differences in 5-HT innervation and the identity of a class of projection neurons of the mPFC. In the absence of the 5-HTT, the 5-HT innervation in all subareas of the early postnatal mPFC increased dramatically and the number of Satb2-positive callosal projection neurons was decreased. Together, these results suggest a 5-HTT dependency during early development of these brain areas and in the formation of the raphe-prefrontal network. The tremendous complexity of the 5-HT projection system and its role in several neurodevelopmental disorders highlights the need for further research in this largely unexplored area.
<h4>Background</h4>Scientific enthusiasm about gene × environment interactions, spurred by the 5-HTTLPR (serotonin transporter-linked polymorphic region) × SLEs (stressful life events) interaction predicting depression, have recently been tempered by sober realizations of small effects and meta-analyses reaching opposing conclusions. These mixed findings highlight the need for further research. Converging evidence suggests that the effects of 5-HTTLPR genotype may be neurodevelopmental in origin, but we are not aware of empirical studies that have investigated whether the 5-HTTLPR genotype × SLE interaction predicts preschool-onset depression (PO-MDD), the earliest validated form of depression.<h4>Methods</h4>Children (n = 234) aged 3-5 were recruited for a longitudinal study designed to examine PO-MDD. In a comprehensive baseline assessment, the child's primary caregivers completed questionnaires and were interviewed about their child's behaviors, psychiatric symptoms, and exposure to SLEs.<h4>Results</h4>A 5-HTTLPR × SLEs interaction emerged, such that children homozygous for the short allele were more susceptible to depression in the context of elevated SLE than long allele carriers. In contrast, at low SLE exposure, short allele homozygotes had fewer depressive symptoms. The data were best fit by a plasticity model with a substantial reduction in fit by diathesis-stress models.<h4>Conclusions</h4>Extending studies in adult and adolescent populations, these data suggest that 5-HTTLPR genotype may provide plasticity to environmental influence, for better or worse. Specifically, children homozygous for the short allele were more susceptible to the depressogenic effects of SLEs but benefitted, in the form of reduced depressive symptoms, in the context of relatively benign environmental conditions (i.e. relatively low SLE exposure). These data highlight the importance of examining gene × environment interactions across development, environment, and outcome but should be interpreted cautiously given the small sample size.
Mass spectrometry (MS)-based assays for the quantification of the iron regulatory hormone hepcidin are pivotal to discriminate between the bioactive 25-amino acid form that can effectively block the sole iron transporter ferroportin and other naturally occurring smaller isoforms without a known role in iron metabolism. Here we describe the design, validation and use of a novel stable hepcidin-25(+40) isotope as internal standard for quantification. Importantly, the relative large mass shift of 40 Da makes this isotope also suitable for easy-to-use medium resolution linear time-of-flight (TOF) platforms. As expected, implementation of hepcidin-25(+40) as internal standard in our weak cation exchange (WCX) TOF MS method yielded very low inter/intra run coefficients of variation. Surprisingly, however, in samples from kidney disease patients, we detected a novel peak (m/z 2673.9) with low intensity that could be identified as hepcidin-24 and had previously remained unnoticed due to peak interference with the formerly used internal standard. Using a cell-based bioassay it was shown that synthetic hepcidin-24 was, like the -22 and -20 isoforms, a significantly less potent inducer of ferroportin degradation than hepcidin-25. During prolonged storage of plasma at room temperature, we observed that a decrease in plasma hepcidin-25 was paralleled by an increase in the levels of the hepcidin-24, -22 and -20 isoforms. This provides first evidence that all determinants for the conversion of hepcidin-25 to smaller inactive isoforms are present in the circulation, which may contribute to the functional suppression of hepcidin-25, that is significantly elevated in patients with renal impairment. The present update of our hepcidin TOF MS assay together with improved insights in the source and preparation of the internal standard, and sample stability will further improve our understanding of circulating hepcidin and pave the way towards further optimization and standardization of plasma hepcidin assays.
Osteoporotic fracture carries an enormous public health burden in terms of mortality and morbidity. Current approaches to identify individuals at high risk for fracture are based on assessment of bone mineral density and presence of other osteoporosis risk factors. Bone mineral density and susceptibility to osteoporotic fractures are highly heritable, and over 60 loci have been robustly associated with one or both traits through genome-wide association studies carried out over the past 7 years. In this review, we discuss opportunities and challenges for incorporating these genetic discoveries into strategies to prevent osteoporotic fracture and translating new insights obtained from these discoveries into development of new therapeutic targets.
Journal Article2013-10-03✓ 1 SnippetKuo Y, Ren S, Lao U, Edgar BA, Wang T.
In-Text Gene Mentions
Methods)
…ninaE -Gal4, and GMR-htt-Q120 ( GMR-HQ )…
Show Full Abstract
A network of heat-shock proteins mediates cellular protein homeostasis, and has a fundamental role in preventing aggregation-associated neurodegenerative diseases. In a Drosophila model of polyglutamine (polyQ) disease, the HSP40 family protein, DNAJ-1, is a superior suppressor of toxicity caused by the aggregation of polyQ containing proteins. Here, we demonstrate that one specific HSP110 protein, 70 kDa heat-shock cognate protein cb (HSC70cb), interacts physically and genetically with DNAJ-1 in vivo, and that HSC70cb is necessary for DNAJ-1 to suppress polyglutamine-induced cell death in Drosophila. Expression of HSC70cb together with DNAJ-1 significantly enhanced the suppressive effects of DNAJ-1 on polyQ-induced neurodegeneration, whereas expression of HSC70cb alone did not suppress neurodegeneration in Drosophila models of either general polyQ disease or Huntington's disease. Furthermore, expression of a human HSP40, DNAJB1, together with a human HSP110, APG-1, protected cells from polyQ-induced neural degeneration in flies, whereas expression of either component alone had little effect. Our data provide a functional link between HSP40 and HSP110 in suppressing the cytotoxicity of aggregation-prone proteins, and suggest that HSP40 and HSP110 function together in protein homeostasis control.
<h4>Objective</h4>Polyphosphate and heparin are anionic polymers released by activated mast cells and platelets that are known to stimulate the contact pathway of coagulation. These polymers promote both the autoactivation of factor XII and the assembly of complexes containing factor XI, prekallikrein, and high-molecular-weight kininogen. We are searching for salivary proteins from blood-feeding insects that counteract the effect of procoagulant and proinflammatory factors in the host, including elements of the contact pathway.<h4>Approach and results</h4>Here, we evaluate the ability of the sand fly salivary proteins, PdSP15a and PdSP15b, to inhibit the contact pathway by disrupting binding of its components to anionic polymers. We attempt to demonstrate binding of the proteins to polyphosphate, heparin, and dextran sulfate. We also evaluate the effect of this binding on contact pathway reactions. We also set out to determine the x-ray crystal structure of PdSP15b and examine the determinants of relevant molecular interactions. Both proteins bind polyphosphate, heparin, and dextran sulfate with high affinity. Through this mechanism they inhibit the autoactivation of factor XII and factor XI, the reciprocal activation of factor XII and prekallikrein, the activation of factor XI by thrombin and factor XIIa, the cleavage of high-molecular-weight kininogen in plasma, and plasma extravasation induced by polyphosphate. The crystal structure of PdSP15b contains an amphipathic helix studded with basic side chains that forms the likely interaction surface.<h4>Conclusions</h4>The results of these studies indicate that the binding of anionic polymers by salivary proteins is used by blood feeders as an antihemostatic/anti-inflammatory mechanism.
Also flagged:TRIM28tripartite motif-containing 28transcriptional intermediary factor1βKrüppel-associated box-associated protein-1NR2C1NR2C2
Journal Article2013-10-03✓ 1 SnippetHosoya T, Clifford M, Losson R, Tanabe O, Engel JD.
In-Text Gene Mentions
Text
…SOX6…
Show Full Abstract
In previous mass spectrometry and coimmune precipitation studies, we identified tripartite motif-containing 28 (TRIM28; also known as transcriptional intermediary factor1β and Krüppel-associated box-associated protein-1) as a cofactor that specifically copurified with an NR2C1/NR2C2 (TR2/TR4) orphan nuclear receptor heterodimer that previous studies had implicated as an embryonic/fetal β-type globin gene repressor. TRIM28 has been characterized as a transcriptional corepressor that can associate with many different transcription factors and can play functional roles in multiple tissues and cell types. Here, we tested the contribution of TRIM28 to globin gene regulation and erythropoiesis using a conditional loss-of-function in vivo model. We discovered that Trim28 genetic loss in the adult mouse leads to defective immature erythropoiesis in the bone marrow and consequently to anemia. We further found that TRIM28 controls erythropoiesis in a cell-autonomous manner by inducibly deleting Trim28 exclusively in hematopoietic cells. Finally, in the absence of TRIM28, we observed increased apoptosis as well as diminished expression of multiple erythroid transcription factors and heme biosynthetic enzymes in immature erythroid cells. Thus, TRIM28 is essential for the cell-autonomous development of immature erythroblasts in the bone marrow.
Also flagged:type 1 diabetes mellitusDiabetes mellituschronic metabolic diseaseretinopathynephropathypathogenesis
Journal Article2013-10-03✓ 2 SnippetsCaseiro A, Barros A, Ferreira R, Padrão A, Aroso M, Quintaneiro C, Pereira A, Marinheiro R, Vitorino R, Amado F.
In-Text Gene Mentions
Abstract)
…From these, gelsolin and antithrombin-III appear as promising diagnosis markers for type 1 diabetes mellitus (T1DM), whereas ephrin type-B receptor 4 and vitamin K-dependent protein Z seem to be promising markers for advanced T1DM disease state presenting retinopathy and nephropathy (T1DM-R + N).…
Abstract)
…these, gelsolin andantithrombin-IIIappear as promising…
Show Full Abstract
Diabetes mellitus is a chronic metabolic disease with multiple complications, and its successful management requires early diagnosis, to allow timely interventions. Here, we have comprehensively analyzed the proteome changes in urine of type 1 diabetic subjects with and without complications such as retinopathy and nephropathy. gel electrophoresis combined to liquid chromatography-tandem mass spectrometry (GeLC-MS/MS) analysis of midstream urine highlighted the mechanisms involved in disease pathogenesis as, for instance wound healing and blood coagulation in all diabetics or altered ganglioside metabolism in retinopathy, and also some urinary proteins with potential diagnosis value. From these, gelsolin and antithrombin-III appear as promising diagnosis markers for type 1 diabetes mellitus (T1DM), whereas ephrin type-B receptor 4 and vitamin K-dependent protein Z seem to be promising markers for advanced T1DM disease state presenting retinopathy and nephropathy (T1DM-R + N). Data also suggest urinary ganglioside GM2 activator and beta-hexosaminidase subunit beta as potential urinary markers of retinopathy in diabetics. Taken together, the present exploratory urinary proteomic analysis might be seen as an important starting point for studies targeting specific urinary proteins aimed at the implementation of new biomarkers for the early detection of T1DM-related microvascular complications.
Also flagged:colorectal cancerepithelial proliferationcellularaging--related
Journal Article2013-10-03✓ 2 SnippetsLeiszter K, Galamb O, Sipos F, Krenács T, Veres G, Wichmann B, Kalmár A, Patai ÁV, Tóth K, Valcz G, Molnár B, Tulassay Z.
In-Text Gene Mentions
Introduction)
…Besides the genes (e.g. APC, KRAS, DCC and TP53) traditionally implicated in this cancer progression model, recently novel genes with altering mRNA expression have also been suggested to be contribute to malignant transformation of colorectal epithelium [16]–[18].…
Introduction)
…(e.g. APC, KRAS,DCCand TP53) traditionally…
Show Full Abstract
<h4>Background and aims</h4>Sporadic colorectal cancer (CRC) development is a sequential process showing age-dependency, uncontrolled epithelial proliferation and decreased apoptosis. During juvenile growth cellular proliferation and apoptosis are well balanced, which may be perturbed upon aging. Our aim was to correlate proliferative and apoptotic activities in aging human colonic epithelium and colorectal cancer. We also tested the underlying molecular biology concerning the proliferation- and apoptosis-regulating gene expression alterations.<h4>Materials and methods</h4>Colorectal biopsies from healthy children (n1 = 14), healthy adults (n2 = 10), adult adenomas (n3 = 10) and CRCs (n4 = 10) in adults were tested for Ki-67 immunohistochemistry and TUNEL apoptosis assay. Mitosis- and apoptosis-related gene expression was also studied in healthy children (n1 = 6), adult (n2 = 41) samples and in CRC (n3 = 34) in HGU133plus2.0 microarray platform. Measured alterations were confirmed with RT-PCR both on dependent and independent sample sets (n1 = 6, n2 = 6, n3 = 6).<h4>Results</h4>Mitotic index (MI) was significantly higher (p<0.05) in intact juvenile (MI = 0.33±0.06) and CRC samples (MI = 0.42±0.10) compared to healthy adult samples (MI = 0.15±0.06). In contrast, apoptotic index (AI) was decreased in children (0.13±0.06) and significantly lower in cancer (0.06±0.03) compared to healthy adult samples (0.17±0.05). Eight proliferation- (e.g. MKI67, CCNE1) and 11 apoptosis-associated genes (e.g. TNFSF10, IFI6) had altered mRNA expression both in the course of normal aging and carcinogenesis, mainly inducing proliferation and reducing apoptosis compared to healthy adults. Eight proliferation-associated genes including CCND1, CDK1, CDK6 and 26 apoptosis-regulating genes (e.g. SOCS3) were differently expressed between juvenile and cancer groups mostly supporting the pronounced cell growth in CRC.<h4>Conclusion</h4>Colorectal samples from children and CRC patients can be characterized by similarly increased proliferative and decreased apoptotic activities compared to healthy colonic samples from adults. Therefore, cell kinetic alterations during colorectal cancer development show uncontrolled rejuvenescence as opposed to the controlled cell growth in juvenile colonic epithelium.
Also flagged:neuropsychiatric disordersautism spectrum disordersneurodevelopmental disordersgene expressionHOXtranscription factors
Journal Article2013-10-03✓ 2 SnippetsChen J, Lin M, Foxe JJ, Pedrosa E, Hrabovsky A, Carroll R, Zheng D, Lachman HM.
In-Text Gene Mentions
Results)
…MYT1l, along withPOU3F2, and ASCL1 ,…
Results)
…POU3F2and ASCL1 also…
Show Full Abstract
Induced pluripotent stem cell (iPSC) technology is providing an opportunity to study neuropsychiatric disorders through the capacity to grow patient-specific neurons in vitro. Skin fibroblasts obtained by biopsy have been the most reliable source of cells for reprogramming. However, using other somatic cells obtained by less invasive means would be ideal, especially in children with autism spectrum disorders (ASD) and other neurodevelopmental conditions. In addition to fibroblasts, iPSCs have been developed from cord blood, lymphocytes, hair keratinocytes, and dental pulp from deciduous teeth. Of these, dental pulp would be a good source for neurodevelopmental disorders in children because obtaining material is non-invasive. We investigated its suitability for disease modeling by carrying out gene expression profiling, using RNA-seq, on differentiated neurons derived from iPSCs made from dental pulp extracted from deciduous teeth (T-iPSCs) and fibroblasts (F-iPSCs). This is the first RNA-seq analysis comparing gene expression profiles in neurons derived from iPSCs made from different somatic cells. For the most part, gene expression profiles were quite similar with only 329 genes showing differential expression at a nominally significant p-value (p<0.05), of which 63 remained significant after correcting for genome-wide analysis (FDR <0.05). The most striking difference was the lower level of expression detected for numerous members of the all four HOX gene families in neurons derived from T-iPSCs. In addition, an increased level of expression was seen for several transcription factors expressed in the developing forebrain (FOXP2, OTX1, and LHX2, for example). Overall, pathway analysis revealed that differentially expressed genes that showed higher levels of expression in neurons derived from T-iPSCs were enriched for genes implicated in schizophrenia (SZ). The findings suggest that neurons derived from T-iPSCs are suitable for disease-modeling neuropsychiatric disorder and may have some advantages over those derived from F-iPSCs.
Also flagged:Breast cancergene expressionbreast tumorscanceroncogenestumor
Journal Article2013-10-03✓ 1 SnippetHuang CC, Tu SH, Lien HH, Jeng JY, Huang CS, Huang CJ, Lai LC, Chuang EY.
In-Text Gene Mentions
Discussion)
…, BAG4 ,CSE1L, ERBB2 ,…
Show Full Abstract
The interplay between copy number variation (CNV) and differential gene expression may be able to shed light on molecular process underlying breast cancer and lead to the discovery of cancer-related genes. In the current study, genes concurrently identified in array comparative genomic hybridization (CGH) and gene expression microarrays were used to derive gene signatures for Han Chinese breast cancers. We performed 23 array CGHs and 81 gene expression microarrays in breast cancer samples from Taiwanese women. Genes with coherent patterns of both CNV and differential gene expression were identified from the 21 samples assayed using both platforms. We used these genes to derive signatures associated with clinical ER and HER2 status and disease-free survival. DISTRIBUTIONS OF SIGNATURE GENES WERE STRONGLY ASSOCIATED WITH CHROMOSOMAL LOCATION: chromosome 16 for ER and 17 for HER2. A breast cancer risk predictive model was built based on the first supervised principal component from 16 genes (RCAN3, MCOLN2, DENND2D, RWDD3, ZMYM6, CAPZA1, GPR18, WARS2, TRIM45, SCRN1, CSNK1E, HBXIP, CSDE1, MRPL20, IKZF1, and COL20A1), and distinct survival patterns were observed between the high- and low-risk groups from the combined dataset of 408 microarrays. The risk score was significantly higher in breast cancer patients with recurrence, metastasis, or mortality than in relapse-free individuals (0.241 versus 0, P<0.001). The concurrent gene risk predictive model remained discriminative across distinct clinical ER and HER2 statuses in subgroup analysis. Prognostic comparisons with published gene expression signatures showed a better discerning ability of concurrent genes, many of which were rarely identifiable if expression data were pre-selected by phenotype correlations or variability of individual genes. We conclude that parallel analysis of CGH and microarray data, in conjunction with known gene expression patterns, can be used to identify biomarkers with prognostic values in breast cancer.
Also flagged:peroxiredoxin 4PRDX4Peroxiredoxinhydrogenperoxidehydroperoxide
Journal Article2013-10-03✓ 1 SnippetMeng Y, Qian Y, Gao L, Cai LB, Cui YG, Liu JY.
In-Text Gene Mentions
Introduction)
…PRDX6expression levels were…
Show Full Abstract
Peroxiredoxin 4 (PRDX4), a member of Peroxiredoxin (PRDX) family, is a typical 2-Cys PRDX. PRDX4 monitors the oxidative burden within cellular compartment and reduces hydrogen peroxide and alkyl hydroperoxide related to oxidative stress and apoptosis. Antioxidant, like PRDX4, may promote follicle development and participate in the pathophysiology of PCOS. In our previous study, we found that PRDX4 was expressed in mice oocyte cumulus oophorus complex, and that PRDX4 could be associated with follicle development. In this study, we explored the expression of PRDX4 in human follicles and possible role of PRDX4 in PCOS pathophysiology. Our data showed that PRDX4 was mainly expressed in granulosa cells in human ovaries. When compared to control group, both PRDX4 mRNA level and protein level decreased in PCOS group. The lowered levels of PRDX4 may relate to oxidative stress in the pathophysiologic progress of PCOS. Furthermore, expression of PRDX4 in the granulosa cells of in vivo or in vitro matured follicles was higher than that in immatured follicles, which suggested that PRDX4 may have a close relationship with follicular development. Altogether, our findings may provide new clues of the pathophysiologic mechanism of PCOS and potential therapeutic strategy using antioxidant, like PRDX4.
Also flagged:colorectal cancerprimary tumorcancersGene expressiondeathlymph node metastasis
Journal Article2013-10-03No SnippetsSawada T, Yashiro M, Sentani K, Oue N, Yasui W, Miyazaki K, Kai K, Fujita H, Nakamura K, Maeda K, Kakeji Y, Natsugoe S, Shirabe K, Nomura S, Shimada Y, Tomita N, Hirakawa K, Maehara Y.
Show Full Abstract
Staging classification of colorectal cancers is performed by the UICC/TNM classification system, which is the global gold standard. However, we often experience in clinical practice that there are considerable differences in prognoses between patients who have the same classification particularly in stage II and III cancers. The aim of this study was to propose a new TNM-G classification to predict prognosis and recurrence by supplementing the conventional TNM classification. A total of 220 cases of colorectal cancer, including 77 at stage II and 143 at stage III, were registered from four independent facilities. Immunohistochemical staining for 7 molecules, such as p53, vascular endothelial growth factor (VEGF)-A, VEGF-C, regenerating islet-derived family, member 4 (Reg IV), olfactomedin 4, Claudin-18 and matrix metalloproteinase-7 (MMP‑7), was performed to investigate the correlation between clinicopathological factors and expression of each molecule. Based on the results, no significant correlation was observed between the immunostaining expression of these 7 factors and recurrence in total colorectal cancer. Recurrence in stage II (77 cases) was significantly higher in cases positive for Reg IV expression (P=0.042). On analysis of overall survival (OS) and disease‑free survival (DFS), VEGF-C and Reg IV expression had a correlation with poor prognosis, therefore, these factors were selected and applied to G-factor classifications so that cases negative for both could be classified as G0, cases positive for either of the factors could be classified as G1, and cases positive for both factors could be classified as G2. While no significant correlation was observed in the recurrence rates between G0 and G2, OS and DFS in stage II cases were significantly poorer for G2 cases in comparison with G0 or G1 cases. The survival curves of OS and DFS in stage II G2 were similar to that of stage III cases. According to these results, prognosis of VEGF-C/Reg IV both positive G2 cases in stage II colorectal cancer was found to be almost equal to the poor survival in stage III cases, and the advancement of one stage up migration based on G-factors may be supposed to be highly feasible for clinical application. In conclusion, the combination of VEGF-C and Reg IV may be a promising factor for clinical staging to supplement the classical TNM classification system, and it may suggest a good indication of adjuvant chemotherapy for G2 cases in stage II colorectal cancers.
Also flagged:primary headachesattachmentmigraineAnxietyheadachesleep
Journal Article2013-10-03✓ 3 SnippetsEsposito M, Esposito M, Parisi L, Gallai B, Marotta R, Di Dona A, Lavano SM, Roccella M, Carotenuto M.
In-Text Gene Mentions
Discussion)
…Serotonin is known to play an important role in the pathogenesis of migraine, although individual genetic association studies that have examined the relationship between polymorphisms of the serotonin transporter (5-HTT) gene and migraine have yielded inconsistent results;76 other neurotransmitters77 and the dopaminergic system disequilibrium may also be involved.57…
Discussion)
…the serotonin transporter (5-HTT) gene and migraine…
Discussion)
…the serotonin transporter (5-HTT) gene were found…
Show Full Abstract
<h4>Background</h4>In recent years, great attention has been given to the presence of psychological problems and psychiatric comorbidity that are also present in children affected by primary headaches. The relationship between pain and attachment has been identified, and it may be that pain perception may change in relation with specific attachment styles. The aim of the present study was to assess the prevalent attachment style and verify its putative relationship and correlation with the main characteristics of migraine attacks, in school-aged children affected by migraine without aura (MoA).<h4>Materials and methods</h4>The study population consisted of 219 children (103 males, 116 females) aged between 6 and 11 years (mean 8.96 ± 2.14 years), consecutively referred for MoA compared with 381 healthy controls (174 males, 207 females; mean age 9.01 ± 1.75 years) randomly selected from schools. All the children were classified according to the attachment typologies of the Italian modified version of the Separation Anxiety Test; monthly headache frequency and mean headache duration were assessed from daily headache diaries kept by all the children. Headache intensity was assessed on a visual analog scale. The chi-square test and t-test, where appropriate, were applied, and the Spearman rank correlation test was applied to explore the relationship between the types of attachment style and clinical aspects of MoA.<h4>Results</h4>The MoA group showed a significantly higher prevalence of type A (avoidant) attachment (P<0.001) and a significantly lower prevalence of type B (secure) attachment (P<0.001) compared with the control group. Moreover, the Spearman rank correlation analysis showed a significant relationship between MoA characteristics and the attachment style of MoA children.<h4>Conclusion</h4>The main findings of the present study were the higher prevalence among MoA children of the avoidant attachment style (type A) and the significantly lower prevalence of the secure style attachment (type B) compared with the normal controls, suggesting that the study of psychiatric comorbidity in pediatric headache may be enriched by this new aspect of analysis.
Also flagged:EndoplasmicTranscription Factor-3Activating transcription factor-(ATF-) 3stress-inducible transcription factorcancerpropolin G
Journal Article2013-10-03✓ 1 SnippetSuk FM, Lien GS, Huang WJ, Chen CN, Lu SY, Yang YC, Yan MD, Liang YC.
In-Text Gene Mentions
Introduction)
…disorder such ashemochromatosis, Wilson's disease, and…
Show Full Abstract
Activating transcription factor-(ATF-) 3, a stress-inducible transcription factor, is rapidly upregulated under various stress conditions and plays an important role in inducing cancer cell apoptosis. NBM-TP-007-GS-002 (GS-002) is a Taiwanese propolin G (PPG) derivative. In this study, we examined the antitumor effects of GS-002 in human hepatoma Hep3B and HepG2 cells in vitro. First, we found that GS-002 significantly inhibited cell proliferation and induced cell apoptosis in dose-dependent manners. Several main apoptotic indicators were found in GS-002-treated cells, such as the cleaved forms of caspase-3, caspase-9, and poly(ADP-ribose) polymerase (PARP). GS-002 also induced endoplasmic reticular (ER) stress as evidenced by increases in ER stress-responsive proteins including glucose-regulated protein 78 (GRP78), growth arrest- and DNA damage-inducible gene 153 (GADD153), phosphorylated eukaryotic initiation factor 2 α (eIF2 α ), phosphorylated protein endoplasmic-reticular-resident kinase (PERK), and ATF-3. The induction of ATF-3 expression was mediated by mitogen-activated protein kinase (MAPK) signaling pathways in GS-002-treated cells. Furthermore, we found that GS-002 induced more cell apoptosis in ATF-3-overexpressing cells. These results suggest that the induction of apoptosis by the propolis derivative, GS-002, is partially mediated through ER stress and ATF-3-dependent pathways, and GS-002 has the potential for development as an antitumor drug.
Also flagged:embryogenesisgene expressionHematological Diseaseerythropoiesishematological disordersTranscriptional regulators
Journal Article2013-10-03No SnippetsFraser ST.
Show Full Abstract
One of the most critical stages in mammalian embryogenesis is the independent production of the embryo's own circulating, functional red blood cells. Correspondingly, erythrocytes are the first cell type to become functionally mature during embryogenesis. Failure to achieve this invariably leads to in utero lethality. The recent application of technologies such as transcriptome analysis, flow cytometry, mutant embryo analysis, and transgenic fluorescent gene expression reporter systems has shed new light on the distinct erythroid lineages that arise early in development. Here, I will describe the similarities and differences between the distinct erythroid populations that must form for the embryo to survive. While much of the focus of this review will be the poorly understood primitive erythroid lineage, a discussion of other erythroid and hematopoietic lineages, as well as the cell types making up the different niches that give rise to these lineages, is essential for presenting an appropriate developmental context of these cells.
Also flagged:leukemiasBCR-ABLprotein tyrosine kinasechronic myeloid leukemiaCMLkinase
Journal Article2013-10-03No SnippetsJabbour E, Cortes J, Ravandi F, O'Brien S, Kantarjian H.
Show Full Abstract
Advances in the genetic and molecular characterizations of leukemias have enhanced our capabilities to develop targeted therapies. The most dramatic example of targeted therapy in cancer to date is the use of targeted BCR-ABL protein tyrosine kinase inhibitors (TKI), which has revolutionized the treatment of chronic myeloid leukemia (CML). Inhibition of the signaling activity of this kinase has proved to be a highly successful treatment target, transforming the prognosis of patients with CML. In contrast, acute myeloid leukemia (AML) is an extremely heterogeneous disease with outcomes that vary widely according to subtype of the disease. Targeted therapy with monoclonal antibodies and small molecule kinase inhibitors are promising strategies to help improve the cure rates in AML. In this review, we will highlight the results of recent clinical trials in which outcomes of CML and AML have been influenced significantly. Also, novel approaches to sequencing and combining available therapies will be covered.
Also flagged:bone formationpolyurethanedegradationbone morphogenetic protein-2osteoarthritiscalcium phosphate
Journal Article2013-10-02No SnippetsDumas JE, Prieto EM, Zienkiewicz KJ, Guda T, Wenke JC, Bible J, Holt GE, Guelcher SA.
Show Full Abstract
There is a compelling clinical need for bone grafts with initial bone-like mechanical properties that actively remodel for repair of weight-bearing bone defects, such as fractures of the tibial plateau and vertebrae. However, there is a paucity of studies investigating remodeling of weight-bearing bone grafts in preclinical models, and consequently there is limited understanding of the mechanisms by which these grafts remodel in vivo. In this study, we investigated the effects of the rates of new bone formation, matrix resorption, and polymer degradation on healing of settable weight-bearing polyurethane/allograft composites in a rabbit femoral condyle defect model. The grafts induced progressive healing in vivo, as evidenced by an increase in new bone formation, as well as a decrease in residual allograft and polymer from 6 to 12 weeks. However, the mismatch between the rates of autocatalytic polymer degradation and zero-order (independent of time) new bone formation resulted in incomplete healing in the interior of the composite. Augmentation of the grafts with recombinant human bone morphogenetic protein-2 not only increased the rate of new bone formation, but also altered the degradation mechanism of the polymer to approximate a zero-order process. The consequent matching of the rates of new bone formation and polymer degradation resulted in more extensive healing at later time points in all regions of the graft. These observations underscore the importance of balancing the rates of new bone formation and degradation to promote healing of settable weight-bearing bone grafts that maintain bone-like strength, while actively remodeling.
Also flagged:C-reactive proteinCRPCardiovascular diseasedeathcardiovascular diseasesCVD
Journal Article2013-10-02No SnippetsZhang J, Fang SC, Mittleman MA, Christiani DC, Cavallari JM.
Show Full Abstract
<h4>Background</h4>Although it has been well recognized that exposure to secondhand tobacco smoke (SHS) is associated with cardiovascular mortality, the mechanisms and time course by which SHS exposure may lead to cardiovascular effects are still being explored.<h4>Methods</h4>Non-smoking workers were recruited from a local union and monitored inside a union hall while exposed to SHS over approximately 6 hours. Participants were fitted with a continuous electrocardiographic monitor upon enrollment which was removed at the end of a 24-hr monitoring period. A repeated measures study design was used where resting ECGs and blood samples were taken from individuals before SHS exposure (baseline), immediately following SHS exposure (post) and the morning following SHS exposure (next-morning).Inflammatory markers, including high sensitivity C-reactive protein (CRP) and white blood cell count (WBC) were analyzed. Heart rate variability (HRV) was analyzed from the ECG recordings in time (SDNN, rMSSD) and frequency (LF, HF) domain parameters over 5-minute periods. SHS exposure was quantified using a personal fine particulate matter (PM2.5) monitor.Linear mixed effects regression models were used to examine within-person changes in inflammatory and HRV parameters across the 3 time periods. Exposure-response relationships with PM2.5 were examined using mixed effects models. All models were adjusted for age, BMI and circadian variation.<h4>Results</h4>A total of 32 male non-smokers were monitored between June 2010 and June 2012. The mean PM2.5 from SHS exposure was 132 μg/m3. Immediately following SHS exposure, a 100 μg/m3 increase in PM2.5 was associated with declines in HRV (7.8% [standard error (SE) =3%] SDNN, 8.0% (SE = 3.9%) rMSSD, 17.2% (SE = 6.3%) LF, 29.0% (SE = 10.1%) HF) and increases in WBC count 0.42 (SE = 0.14) k/μl. Eighteen hours following SHS exposure, a 100 μg/m3 increase in PM2.5 was associated with 24.2% higher CRP levels.<h4>Conclusions</h4>Our study suggest that short-term SHS exposure is associated with significantly lower HRV and higher levels of inflammatory markers. Exposure-associated declines in HRV were observed immediately following exposure while higher levels of CRP were not observed until 18 hours following exposure. Cardiovascular autonomic and inflammation responses may contribute to the pathophysiologic pathways that link SHS exposure with adverse cardiovascular outcomes.
Also flagged:cancerCOADThyroidglioblastomacarcinomamethylation
Journal Article2013-10-02✓ 1 SnippetCline MS, Craft B, Swatloski T, Goldman M, Ma S, Haussler D, Zhu J.
In-Text Gene Mentions
I A O 0000326)
…DCC…
Show Full Abstract
The UCSC Cancer Genomics Browser (https://genome-cancer.ucsc.edu) offers interactive visualization and exploration of TCGA genomic, phenotypic, and clinical data, as produced by the Cancer Genome Atlas Research Network. Researchers can explore the impact of genomic alterations on phenotypes by visualizing gene and protein expression, copy number, DNA methylation, somatic mutation and pathway inference data alongside clinical features, Pan-Cancer subtype classifications and genomic biomarkers. Integrated Kaplan-Meier survival analysis helps investigators to assess survival stratification by any of the information.
Also flagged:ironbeta-thalassemiahemochromatosisbeta-thalassemia majorpolymerase
Journal Article2013-10-02✓ 5 SnippetsTuredi A, Oymak Y, Meşe T, Yaman Y, Bayraktaroglu S, Alpman A, Ozkinay F, Aydınok Y, Vergin C.
In-Text Gene Mentions
Abstract)
…We aimed to investigate the effect of human hemochromatosis protein (HFE) polymorphisms on cardiac iron overload in patients with beta-thalassemia major.…
Abstract)
…<h4>Objective</h4>We aimed to investigate the effect of human hemochromatosis protein (HFE) polymorphisms on cardiac iron overload in patients with beta-thalassemia major.<h4>Methods</h4>Our study included 33 patients diagnosed with beta-thalassemia major who were treated with regular transfusions and chelation therapy.…
Abstract)
…The HFE polymorphisms (H63D, C282Y, S65C, Q283P, E168Q, E168X, W169X, P160delC, Q127H, H63H, V59M, and V53M) were studied using polymerase chain reaction.<h4>Results</h4>The H63D polymorphism was detected in six patients with beta-thalassemia major.…
Title)
…The effect ofHFEpolymorphisms on cardiac…
Abstract)
…uman hemochromatosis protein (HFE) polymorphisms on cardiac…
Show Full Abstract
<h4>Objective</h4>We aimed to investigate the effect of human hemochromatosis protein (HFE) polymorphisms on cardiac iron overload in patients with beta-thalassemia major.<h4>Methods</h4>Our study included 33 patients diagnosed with beta-thalassemia major who were treated with regular transfusions and chelation therapy. M-mode, tissue Doppler, and pulsed wave Doppler echocardiography were performed on all patients. T2* magnetic resonance imaging (MRI) scans were also performed. The HFE polymorphisms (H63D, C282Y, S65C, Q283P, E168Q, E168X, W169X, P160delC, Q127H, H63H, V59M, and V53M) were studied using polymerase chain reaction.<h4>Results</h4>The H63D polymorphism was detected in six patients with beta-thalassemia major. Five patients were heterozygous for the H63D polymorphism, while one was homozygous. There were no other polymorphisms. There was no relationship between the HFE polymorphisms and either the serum ferritin levels or the T2-weighted MRI values (P > .05). Moreover, conventional echo and tissue Doppler echo findings were not correlated with the HFE polymorphisms. Pulmonary vein atrial reversal flow velocity, which is a manifestation of diastolic dysfunction measured with pulse wave echo, was higher in the patients with HFE polymorphisms (P = .036).<h4>Conclusions</h4>The HFE polymorphisms had no effect on cardiac iron overload. However, pulmonary vein atrial reversal flow velocity measurements can provide important information for detecting diastolic dysfunction during cardiac follow-up of patients with HFE polymorphisms. Studies with more patients are needed to provide more information regarding this matter.
Ischemia reperfusion injury (IRI) contributes to partial flap and solid organ transplant failure. Heme-oxygenase 1 (HO-1) is an inducible, cytoprotective enzyme which protects against IRI in solid organ transplant models. Heme arginate (HA), a HO-1 inducer, is a promising, translatable, preconditioning agent. This study investigated the effects of preconditioning with HA on the clinical outcome of a myocutaneous IRI model. Forty male Lewis rats were randomized to intravenously receive 1) Control-NaCl, 2) HA, 3) HA and tin mesoporphyrin (SnMP), a HO-1 inhibitor; and 4) SnMP alone. Twenty-four hours later, an in situ transverse rectus abdominis myocutaneous flap was performed under isoflurane anesthesia. Viability of flaps was measured clinically and by laser-Doppler perfusion scanning. In vitro work on human epidermal keratinocytes (HEKa) assessed the effects of HA, SnMP, and the iron chelator desferrioxamine on 1) cytotoxicity, 2) intracellular reactive oxygen species (ROS) concentration, and 3) ROS-mediated DNA damage. In contrast to our hypothesis, HA preconditioning produced over 30% more flap necrosis at 48 h compared with controls (P = 0.02). HA-containing treatments produced significantly worse flap perfusion at all postoperative time points. In vitro work showed that HA is cytotoxic to keratinocytes. This cytotoxicity was independent of HO-1 and was mediated by the generation of ROS by free heme. In contrast to solid organ data, pharmacological preconditioning with HA significantly worsened clinical outcome, thus indicating that this is not a viable approach in free flap research.
Complex I (NADH ubiquinone oxidoreductase) in mammalian mitochondria is an L-shaped assembly of 44 subunits. One arm is embedded in the inner membrane with the other protruding ∼100 Å into the matrix of the organelle. The extrinsic arm contains binding sites for NADH and the primary electron acceptor FMN, and it provides a scaffold for seven iron-sulfur clusters that form an electron pathway linking FMN to the terminal electron acceptor, ubiquinone, which is bound in the region of the junction between the arms. The membrane arm contains four antiporter-like domains, probably energetically coupled to the quinone site and involved in pumping protons from the matrix into the intermembrane space contributing to the proton motive force. Complex I is put together from preassembled subcomplexes. Their compositions have been characterized partially, and at least 12 extrinsic assembly factor proteins are required for the assembly of the complex. One such factor, NDUFAF7, is predicted to belong to the family of S-adenosylmethionine-dependent methyltransferases characterized by the presence in their structures of a seven-β-strand protein fold. In the present study, the presence of NDUFAF7 in the mitochondrial matrix has been confirmed, and it has been demonstrated that it is a protein methylase that symmetrically dimethylates the ω-N(G),N(G') atoms of residue Arg-85 in the NDUFS2 subunit of complex I. This methylation step occurs early in the assembly of complex I and probably stabilizes a 400-kDa subcomplex that forms the initial nucleus of the peripheral arm and its juncture with the membrane arm.
Also flagged:olfactomedin 1brain dystrophyOlfm1glycoproteinamino aciddeath
Journal Article2013-10-02✓ 1 SnippetNakaya N, Sultana A, Munasinghe J, Cheng A, Mattson MP, Tomarev SI.
In-Text Gene Mentions
Text
…OLFM4…
Show Full Abstract
Olfactomedin 1 (Olfm1) is a secreted glycoprotein that is preferentially expressed in neuronal tissues. Here we show that deletion of exons 4 and 5 from the Olfm1 gene, which encodes a 52 amino acid long region in the N-terminal part of the protein, increased neonatal death and reduced body weight of surviving homozygous mice. Magnetic resonance imaging analyses revealed reduced brain volume and attenuated size of white matter tracts such as the anterior commissure, corpus callosum, and optic nerve. Adult Olfm1 mutant mice demonstrated abnormal behavior in several tests including reduced marble digging, elevated plus maze test, nesting activity and latency on balance beam tests as compared with their wild-type littermates. The olfactory system was both structurally and functionally disturbed by the mutation in the Olfm1 gene as shown by functional magnetic resonance imaging analysis and a smell test. Deficiencies of the olfactory system may contribute to the neonatal death and loss of body weight of Olfm1 mutant. Shotgun proteomics revealed 59 candidate proteins that co-precipitated with wild-type or mutant Olfm1 proteins in postnatal day 1 brain. Olfm1-binding targets included GluR2, Cav2.1, teneurin-4 and Kidins220. Modified interaction of Olfm1 with binding targets led to an increase in intracellular Ca(2+) concentration and activation of ERK1/2, MEK1 and CaMKII in the hippocampus and olfactory bulb of Olfm1 mutant mice compared with their wild-type littermates. Excessive activation of the CaMKII and Ras-ERK pathways in the Olfm1 mutant olfactory bulb and hippocampus by elevated intracellular calcium may contribute to the abnormal behavior and olfactory activity of Olfm1 mutant mice.
Journal Article2013-10-02No SnippetsErnst C, Morton CC.
Show Full Abstract
Long non-coding (lnc) RNAs are defined as non-protein coding RNAs distinct from housekeeping RNAs such as tRNAs, rRNAs, and snRNAs, and independent from small RNAs with specific molecular processing machinery such as micro- or piwi-RNAs. Recent studies of lncRNAs across different species have revealed a diverse population of RNA molecules of differing size and function. RNA sequencing studies suggest transcription throughout the genome, so there is a need to understand how sequence relates to functional and structural relationships amongst RNA molecules. Our synthesis of recent studies suggests that neither size, presence of a poly-A tail, splicing, direction of transcription, nor strand specificity are of importance to lncRNA function. Rather, relative genomic position in relation to a target is fundamentally important. In this review, we describe issues of key importance in functional assessment of lncRNA and how this might apply to lncRNAs important in neurodevelopment.
Also flagged:pyrrolidinonepiperidinoneurokinase receptoruPARcell-surface proteincancer
Journal Article2013-10-02No SnippetsMani T, Liu D, Zhou D, Li L, Knabe WE, Wang F, Oh K, Meroueh SO.
Show Full Abstract
The urokinase receptor (uPAR) is a cell-surface protein that is part of an intricate web of transient and tight protein interactions that promote cancer cell invasion and metastasis. Here, we evaluate the binding and biological activity of a new class of pyrrolidinone and piperidinone compounds, along with derivatives of previously-identified pyrazole and propylamine compounds. Competition assays revealed that the compounds displace a fluorescently labeled peptide (AE147-FAM) with inhibition constant (Ki ) values ranging from 6 to 63 μM. Structure-based computational pharmacophore analysis followed by extensive explicit-solvent molecular dynamics (MD) simulations and free energy calculations suggested the pyrazole-based and piperidinone-based compounds adopt different binding modes, despite their similar two-dimensional structures. In cells, pyrazole-based compounds showed significant inhibition of breast adenocarcinoma (MDA-MB-231) and pancreatic ductal adenocarcinoma (PDAC) cell proliferation, but piperidinone-containing compounds exhibited no cytotoxicity even at concentrations of 100 μM. One pyrazole-based compound impaired MDA-MB-231 invasion, adhesion, and migration in a concentration-dependent manner, while the piperidinone inhibited only invasion. The pyrazole derivative inhibited matrix metalloprotease-9 (gelatinase) activity in a concentration-dependent manner, while the piperidinone showed no effect suggesting different mechanisms for inhibition of cell invasion. Signaling studies further highlighted these differences, showing that pyrazole compounds completely inhibited ERK phosphorylation and impaired HIF1α and NF-κB signaling, while pyrrolidinones and piperidinones had no effect. Annexin V staining suggested that the effect of the pyrazole-based compound on proliferation was due to cell killing through an apoptotic mechanism. The compounds identified represent valuable leads in the design of further derivatives with higher affinities and potential probes to unravel the protein-protein interactions of uPAR.
Also flagged:apatitenanocrystalscarbonateamelogeninproteoglycanscalcium phosphate
Journal Article2013-10-02No SnippetsGhadimi E, Eimar H, Marelli B, Nazhat SN, Asgharian M, Vali H, Tamimi F.
Show Full Abstract
In previous studies, we showed that the size of apatite nanocrystals in tooth enamel can influence its physical properties. This important discovery raised a new question; which factors are regulating the size of these nanocrystals? Trace elements can affect crystallographic properties of synthetic apatite, therefore this study was designed to investigate how trace elements influence enamel's crystallographic properties and ultimately its physical properties. The concentration of trace elements in tooth enamel was determined for 38 extracted human teeth using inductively coupled plasma-optical emission spectroscopy (ICP-OES). The following trace elements were detected: Al, K, Mg, S, Na, Zn, Si, B, Co, Cr, Cu, Fe, Mn, Mo, Ni, Pb, Sb, Se and Ti. Simple and stepwise multiple regression was used to identify the correlations between trace elements concentration in enamel and its crystallographic structure, hardness, resistance to crack propagation, shade lightness and carbonate content. The presence of some trace elements in enamel was correlated with the size (Pb, Ti, Mn) and lattice parameters (Se, Cr, Ni) of apatite nanocrystals. Some trace elements such as Ti was significantly correlated with tooth crystallographic structure and consequently with hardness and shade lightness. We conclude that the presence of trace elements in enamel could influence its physical properties.
Also flagged:Gene expressiontyrosine kinasep38 MAPKp38 mitogen-activated protein kinasepolymerasecellular growth
Journal Article2013-10-02No SnippetsYe F, Yuan F, Li X, Cooper N, Tinney JP, Keller BB.
Show Full Abstract
Engineered cardiac tissues (ECTs) are platforms to investigate cardiomyocyte maturation and functional integration, the feasibility of generating tissues for cardiac repair, and as models for pharmacology and toxicology bioassays. ECTs rapidly mature in vitro to acquire the features of functional cardiac muscle and respond to mechanical load with increased proliferation and maturation. ECTs are now being investigated as platforms for in vitro models for human diseases and for pharmacologic screening for drug toxicities. We tested the hypothesis that global ECT gene expression patterns are complex and sensitive to mechanical loading and tyrosine kinase inhibitors similar to the maturing myocardium. We generated ECTs from day 14.5 rat embryo ventricular cells, as previously published, and then conditioned constructs after 5 days in culture for 48 h with mechanical stretch (5%, 0.5 Hz) and/or the p38 MAPK (p38 mitogen-activated protein kinase) inhibitor BIRB796. RNA was isolated from individual ECTs and assayed using a standard Agilent rat 4 × 44k V3 microarray and Pathway Analysis software for transcript expression fold changes and changes in regulatory molecules and networks. Changes in expression were confirmed by quantitative-polymerase chain reaction (q-PCR) for selected regulatory molecules. At the threshold of a 1.5-fold change in expression, stretch altered 1559 transcripts, versus 1411 for BIRB796, and 1846 for stretch plus BIRB796. As anticipated, top pathways altered in response to these stimuli include cellular development, cellular growth and proliferation; tissue development; cell death, cell signaling, and small molecule biochemistry as well as numerous other pathways. Thus, ECTs display a broad spectrum of altered gene expression in response to mechanical load and/or tyrosine kinase inhibition, reflecting a complex regulation of proliferation, differentiation, and architectural alignment of cardiomyocytes and noncardiomyocytes within ECT.
Also flagged:hereditary thrombophiliaDVTPEpathogenesisAntithrombin(AT
Journal Article2013-10-01✓ 1 SnippetDeng H, Chen J, Xie H, Gu Y, Yuan K, Wang P, Shen W, Liang W, Zhang H, Zhang J, Xie J, Zhang L.
In-Text Gene Mentions
Abstract)
…allele of theSERPINC1gene: p.…
Show Full Abstract
VTE is a complex disorder with two main manifestations: DVT and PE. Deficiency of natural anticoagulants plays an important role in the pathogenesis of VTE. Antithrombin (AT) deficiency is one of the most common hereditary thrombophilia in Asia. Subjects with AT deficiency have two mutations in the same allele of the SERPINC1 gene: p.Arg45Gln and p.Ser114Arg (Arg13Gln and Ser82Arg, according to the antithrombin mutation database). DNA sequencing, ELISA (enzyme-linked immuno sorbent assay), plasmid transfection, and homology modeling were performed to study the molecular pathophysiological mechanism of the deficiency. Recombinant expression of these mutations demonstrated a relevant functional effect on the p.Ser114Arg mutation, since it almost abolished the secretion of AT to the conditioned medium and increased intracellular retention, while the p.Arg45Gln mutation had negligible effects. Homology modeling showed that some atoms from Arg114 interfered with the atoms of the β-strand, the abstract power between Arg45 and S2 was larger than that between Gln45 and S2, and the electrostatic energy (-617.281 to -452.079 K) was the primary contributor to this difference. The functional mutation responsible for the deficiency of this potent anticoagulant p.Ser114Arg probably has conformational consequences on the folding of the protein leading to its intracellular accumulation and impaired secretion.
Also flagged:cerebral infarctionTumor necrosis factor superfamily member 4atherosclerosiscerebral infarctionsmyocardial infarctionCI
Journal Article2013-10-01✓ 5 SnippetsFeng J, Liu YH, Yang QD, Zhu ZH, Xia K, Tan XL, Xia J, Gu WP, Zhou L, Xiao B, Tang BS, Huang Q.
In-Text Gene Mentions
Abstract)
…TNFSF4 gene polymorphism rs3861950, but not rs3850641, is associated with the risk of atherosclerosis CI in a Chinese population.…
Abstract)
…Recent studies indicate that the single nucleotide polymorphism (SNP) rs3850641 in TNFSF4 is associated with higher risk of myocardial infarction, but little is known about the association between TNFSF4 variation and cerebral infarction (CI).…
Abstract)
…Tumor necrosis factor superfamily member 4 (TNFSF4) plays a key role in the process of atherosclerosis, a common risk factor for both myocardial and cerebral infarctions.…
Title)
…TNFSF4 gene polymorphism rs3861950 but not rs3850641 is associated with the risk of cerebral infarction in a Chinese population.…
Title)
…TNFSF4gene polymorphism rs3861950…
Show Full Abstract
Tumor necrosis factor superfamily member 4 (TNFSF4) plays a key role in the process of atherosclerosis, a common risk factor for both myocardial and cerebral infarctions. Recent studies indicate that the single nucleotide polymorphism (SNP) rs3850641 in TNFSF4 is associated with higher risk of myocardial infarction, but little is known about the association between TNFSF4 variation and cerebral infarction (CI). A case-control study involving 385 CI patients and 385 age-matched, sex-matched non-CI controls was conducted in a Chinese population, only the most common subtype, atherosclerosis CI, was recruited. Two SNPs of TNFSF4, rs3850641 and rs3861950, were genotyped by the TaqMan SNP genotyping method, and verified partly by genomic DNA sequencing. The results revealed a significant allelic association between rs3861950 and CI (Odds ration = 1.733, 95 % confidence interval = 1.333-2.254, P = 0.000). Genotypic association analysis demonstrated that the CC genotype of rs3861950 confers susceptibility to CI (Odds ration = 2.896, 95 % confidence interval = 1.368-6.132), and it was associated with a significantly higher risk of ischemic stroke (Odds ration = 3.520, 95 % confidence interval = 1.546-8.015, P = 0.003) after adjusting for the other confirmed risk factors such as the history of hypertension, diabetes, CAD, smoking and alcohol drinking. While the odds ratio of the T allele to the C allele was 1.733 (95 % confidence interval: 1.333-2.254). However, there was no significant association between rs3850641 and CI (Odds ration = 1.288, 95 % confidence interval = 0.993-1.670, P = 0.056). TNFSF4 gene polymorphism rs3861950, but not rs3850641, is associated with the risk of atherosclerosis CI in a Chinese population.
Loss-of-function and certain missense mutations in the Wnt coreceptor low-density lipoprotein receptor-related protein 5 (LRP5) significantly decrease or increase bone mass, respectively. These human skeletal phenotypes have been recapitulated in mice harboring Lrp5 knockout and knock-in mutations. We hypothesized that measuring mRNA expression in diaphyseal bone from mice with Lrp5 wild-type (Lrp5(+/+) ), knockout (Lrp5(-/-) ), and high bone mass (HBM)-causing (Lrp5(p.A214V/+) ) knock-in alleles could identify genes and pathways that regulate or are regulated by LRP5 activity. We performed RNA-seq on pairs of tibial diaphyseal bones from four 16-week-old mice with each of the aforementioned genotypes. We then evaluated different methods for controlling for contaminating nonskeletal tissue (ie, blood, bone marrow, and skeletal muscle) in our data. These methods included predigestion of diaphyseal bone with collagenase and separate transcriptional profiling of blood, skeletal muscle, and bone marrow. We found that collagenase digestion reduced contamination, but also altered gene expression in the remaining cells. In contrast, in silico filtering of the diaphyseal bone RNA-seq data for highly expressed blood, skeletal muscle, and bone marrow transcripts significantly increased the correlation between RNA-seq data from an animal's right and left tibias and from animals with the same Lrp5 genotype. We conclude that reliable and reproducible RNA-seq data can be obtained from mouse diaphyseal bone and that lack of LRP5 has a more pronounced effect on gene expression than the HBM-causing LRP5 missense mutation. We identified 84 differentially expressed protein-coding transcripts between LRP5 "sufficient" (ie, Lrp5(+/+) and Lrp5(p.A214V/+) ) and "insufficient" (Lrp5(-/-) ) diaphyseal bone, and far fewer differentially expressed genes between Lrp5(p.A214V/+) and Lrp5(+/+) diaphyseal bone.
Also flagged:Diabetesautoantibodytype 1 diabetestransglutaminaseislet autoimmunityceliac disease
Journal Article2013-10-01No SnippetsVehik K, Fiske SW, Logan CA, Agardh D, Cilio CM, Hagopian W, Simell O, Roivainen M, She JX, Briese T, Oikarinen S, Hyoty H, Ziegler AG, Rewers M, Lernmark A, Akolkar B, Krischer JP, Burkhardt BR, TEDDY Study Group.
Show Full Abstract
<h4>Background</h4>The vast array and quantity of longitudinal samples collected in The Environmental Determinants of Diabetes in the Young study present a series of challenges in terms of quality control procedures and data validity. To address this, pilot studies have been conducted to standardize and enhance both biospecimen collection and sample obtainment in terms of autoantibody collection, stool sample preservation, RNA, biomarker stability, metabolic biomarkers and T-cell viability.<h4>Research design and methods</h4>The Environmental Determinants of Diabetes in the Young is a multicentre, international prospective study (n = 8677) designed to identify environmental triggers of type 1 diabetes (T1D) in genetically at-risk children from ages 3 months until 15 years. The study is conducted through six primary clinical centres located in four countries.<h4>Results</h4>As of May 2012, over three million biological samples and 250 million total data points have been collected, which will be analysed to assess autoimmunity status, presence of inflammatory biomarkers, genetic factors, exposure to infectious agents, dietary biomarkers and other potentially important environmental exposures in relation to autoimmunity and progression to T1D.<h4>Conclusions</h4>Detailed procedures were utilized to standardize both data harmonization and management when handling a large quantity of longitudinal samples obtained from multiple locations. In addition, a description of the available specimens is provided that serve as an invaluable repository for the elucidation of determinants in T1D focusing on autoantibody concordance and harmonization, transglutaminase autoantibody, inflammatory biomarkers (T-cells), genetic proficiency testing, RNA lab internal quality control testing, infectious agents (monitoring cross-contamination, virus preservation and nasal swab collection validity) and HbA1c testing.
Virtual screening methods are now widely used in early stages of drug discovery, aiming to rank potential inhibitors. However, any practical ligand set (of active or inactive compounds) chosen for deriving new virtual screening approaches cannot fully represent all relevant chemical space for potential new compounds. In this study, we have taken a retrospective approach to evaluate virtual screening methods for the leukemia target kinase ABL1 and its drug-resistant mutant ABL1-T315I. 'Dual active' inhibitors against both targets were grouped together with inactive ligands chosen from different decoy sets and tested with virtual screening approaches with and without explicit use of target structures (docking). We show how various scoring functions and choice of inactive ligand sets influence overall and early enrichment of the libraries. Although ligand-based methods, for example principal component analyses of chemical properties, can distinguish some decoy sets from active compounds, the addition of target structural information via docking improves enrichment, and explicit consideration of multiple target conformations (i.e. types I and II) achieves best enrichment of active versus inactive ligands, even without assuming knowledge of the binding mode. We believe that this study can be extended to other therapeutically important kinases in prospective virtual screening studies.
Also flagged:pathogenesischronic inflammatory diseasesimmune responseviral infectionsinfectionToll‐like receptor 3
Journal Article2013-10-01✓ 1 SnippetPerales-Linares R, Navas-Martin S.
In-Text Gene Mentions
S I O 000419)
…Induces the expression of cellular TRIM38 upon infection, down‐regulating TRIF and further downstream signalLing cascades.35…
Show Full Abstract
Viral infections frequently induce acute and chronic inflammatory diseases, yet the contribution of the innate immune response to a detrimental host response remains poorly understood. In virus-infected cells, double-stranded RNA (dsRNA) is generated as an intermediate during viral replication. Cell necrosis (and the release of endogenous dsRNA) is a common event during both sterile and infectious inflammatory processes. The discovery of Toll-like receptor 3 (TLR3) as an interferon-inducing dsRNA sensor led to the assumption that TLR3 was the master sentinel against viral infections. This simplistic view has been challenged by the discovery of at least three members of the DExd/H-box helicase cytosolic sensors of dsRNA that share with TLR3 the Toll-interleukin-1 receptor (TIR) -adapter molecule TIR domain-containing adaptor protein interferon-β (TRIF) for downstream type I interferon signalling. Data are conflicting on the role of TLR3 in protective immunity against viruses in the mouse model. Varying susceptibility to infection and disease outcomes have been reported in TLR3-immunodeficient mice. Surprisingly, the susceptibility to develop herpes simplex virus-1 encephalitis in humans with inborn defects of the TLR3 pathway varies, and TLR3-deficient humans do not show increased susceptibility to other viral infections. Therefore, a current challenge is to understand the protective versus pathogenic contribution of TLR3 in viral infections. We review recent advances in the identification of TLR3-signalling pathways, endogenous and virus-induced negative regulators of the TLR3 cascade, and discuss the protective versus pathogenic role of TLR3 in viral pathogenesis.
Also flagged:Type II antithrombin deficiencyATtype II AT deficiencyAT type II deficiencytype II ATvenous thrombosis
Journal Article2013-10-01✓ 2 SnippetsPuurunen M, Salo P, Engelbarth S, Javela K, Perola M.
In-Text Gene Mentions
Abstract)
…Type II antithrombin deficiency caused by a founder mutation Pro73Leu in the Finnish population: clinical picture.…
Abstract)
…methods, and theSERPINC1gene was genotyped.<h4>Results…
Show Full Abstract
<h4>Background</h4>It has been shown that some antithrombin (AT) activity assays do not correctly detect inherited type II AT deficiency, but erroneously classify these patients as normal.<h4>Objectives</h4>Our aim was to investigate the mutations causing type II AT deficiency and to correlate the AT activity results with the genetic findings.<h4>Patients/methods</h4>A large population (n = 104; 42 families) of Finnish patients with known AT type II deficiency were interviewed for clinical data. Their AT activity was measured with five commercially available methods, and the SERPINC1 gene was genotyped.<h4>Results</h4>The mutations detected in type II AT-deficient patients were as follows: p.Pro73Leu (AT Basel) in 37 of 42 (88.1%) families; and p.Val30Glu, p.Arg425Cys and p.Pro439Ala in one family each. In two families, no mutation was detected. In the carriers of AT Basel two AT activity assays correctly identified most of the patients as AT-deficient, whereas three assays misclassified almost all of these patients as normal. Carriers of the founder mutation had, in addition to an elevated risk of venous thrombosis, a high risk of arterial thrombosis at young age, especially stroke.<h4>Conclusion</h4>In Finland, a population with a strong founder effect, AT type II deficiency is caused predominantly by a single point mutation, p.Pro73Leu. The mutation is associated with a significant thrombotic risk. Reduced AT activity caused by this mutation cannot be detected by all available screening methods. This must be taken into account in the choice of laboratory method used for screening.
Also flagged:immune responsesinflammatory responsesmethylationhistoneCNS disordersaddiction
Journal Article2013-10-01No SnippetsGarden GA.
Show Full Abstract
Innate immune responses in the central nervous system (CNS) have key roles influencing both physiological and pathological processes. Microglia are innate immune effector cells that reside within the CNS. These inflammatory cells are constantly surveying their external environment and rapidly respond to a variety of molecules that signal changes in CNS homeostasis. In response to these signals, microglia influence neuronal connections, modulate the functions of other glia, and mediate inflammatory responses to disease or injury. In parallel with the regulation of inflammatory responses outside of the CNS, investigators have observed that microglia are capable of heterogeneous responses to exogenous and endogenous signals. While much of this molecular and morphological heterogeneity is regulated by gene transcription, there is ample evidence that microglial behavior is determined, in part, by epigenetic regulation. Recent work has demonstrated that processes involving DNA methylation, histone modification, and noncoding RNAs also have important roles in modulating neuroinflammation. Here I will review the evidence supporting a role for epigenetic regulation of neuroinflammation and describe how this might influence the outcome of several CNS disorders, including addiction, infection, multiple sclerosis, and stroke.
Also flagged:OctreotideresveratrolMedullary thyroid cancerMTCneuroendocrine tumorNET
Journal Article2013-10-01No SnippetsXu W, Burke JF, Pilla S, Chen H, Jaskula-Sztul R, Gong S.
Show Full Abstract
Medullary thyroid cancer (MTC) is a neuroendocrine tumor (NET) that is often resistant to standard therapies. Resveratrol suppresses MTC growth in vitro, but it has low bioavailability in vivo due to its poor water solubility and rapid metabolic breakdown, as well as lack of tumor-targeting ability. A novel unimolecular micelle based on a hyperbranched amphiphilic block copolymer was designed, synthesized, and characterized for NET-targeted delivery. The hyperbranched amphiphilic block copolymer consisted of a dendritic Boltorn® H40 core, a hydrophobic poly(l-lactide) (PLA) inner shell, and a hydrophilic poly(ethylene glycol) (PEG) outer shell. Octreotide (OCT), a peptide that shows strong binding affinity to somatostatin receptors, which are overexpressed on NET cells, was used as the targeting ligand. Resveratrol was physically encapsulated by the micelle with a drug loading content of 12.1%. The unimolecular micelles exhibited a uniform size distribution and spherical morphology, which were determined by both transmission electron microscopy (TEM) and dynamic light scattering (DLS). Cellular uptake, cellular proliferation, and Western blot analyses demonstrated that the resveratrol-loaded OCT-targeted micelles suppressed growth more effectively than non-targeted micelles. Moreover, resveratrol-loaded NET-targeted micelles affected MTC cells similarly to free resveratrol in vitro, with equal growth suppression and reduction in NET marker production. These results suggest that the H40-based unimolecular micelle may offer a promising approach for targeted NET therapy.
Also flagged:AcetyltransferaseshistoneAcetylation modificationshistone acetyltransferasesHATdeacetylases
Journal Article2013-10-01No SnippetsSchneider A, Chatterjee S, Bousiges O, Selvi BR, Swaminathan A, Cassel R, Blanc F, Kundu TK, Boutillier AL.
Show Full Abstract
The acetylation of histone and non-histone proteins controls a great deal of cellular functions, thereby affecting the entire organism, including the brain. Acetylation modifications are mediated through histone acetyltransferases (HAT) and deacetylases (HDAC), and the balance of these enzymes regulates neuronal homeostasis, maintaining the pre-existing acetyl marks responsible for the global chromatin structure, as well as regulating specific dynamic acetyl marks that respond to changes and facilitate neurons to encode and strengthen long-term events in the brain circuitry (e.g., memory formation). Unfortunately, the dysfunction of these finely-tuned regulations might lead to pathological conditions, and the deregulation of the HAT/HDAC balance has been implicated in neurological disorders. During the last decade, research has focused on HDAC inhibitors that induce a histone hyperacetylated state to compensate acetylation deficits. The use of these inhibitors as a therapeutic option was efficient in several animal models of neurological disorders. The elaboration of new cell-permeant HAT activators opens a new era of research on acetylation regulation. Although pathological animal models have not been tested yet, HAT activator molecules have already proven to be beneficial in ameliorating brain functions associated with learning and memory, and adult neurogenesis in wild-type animals. Thus, HAT activator molecules contribute to an exciting area of research.
Also flagged:Huntington's diseaseHDhereditary neurodegenerative disorderchoreacognitive declineglutamine
Journal Article2013-10-01✓ 1 SnippetLee J, Hwang YJ, Kim KY, Kowall NW, Ryu H.
In-Text Gene Mentions
Text
…htt…
Show Full Abstract
Huntington's disease (HD) is an incurable and fatal hereditary neurodegenerative disorder of mid-life onset characterized by chorea, emotional distress, and progressive cognitive decline. HD is caused by an expansion of CAG repeats coding for glutamine (Q) in exon 1 of the huntingtin gene. Recent studies suggest that epigenetic modifications may play a key role in HD pathogenesis. Alterations of the epigenetic "histone code" lead to chromatin remodeling and deregulation of neuronal gene transcription that are prominently linked to HD pathogenesis. Furthermore, specific noncoding RNAs and microRNAs are associated with neuronal damage in HD. In this review, we discuss how DNA methylation, post-translational modifications of histone, and noncoding RNA function are affected and involved in HD pathogenesis. In addition, we summarize the therapeutic effects of histone deacetylase inhibitors and DNA binding drugs on epigenetic modifications and neuropathological sequelae in HD. Our understanding of the role of these epigenetic mechanisms may lead to the identification of novel biological markers and new therapeutic targets to treat HD.
Vitamin D3 is an essential vitamin that has been extensively studied due to its potential role as therapeutic for many diseases, including breast cancer. Previous research has indicated that calcitriol, the active form of Vitamin D3 has a negative effect on the metastatic ability of Inflammatory Breast Cancer (IBC) cells however the mechanism is not fully understood. The effect of calcitriol on IBC cells starting from cellular uptake must be investigated in order to understand these therapeutic effects. Calcitriol bound Quantum Dots (CalQDs) are a novel nanoparticle conjugated probe that can be used to directly examine the distribution, uptake, and signaling of calcitriol in live cells. Therefore we used these conjugated probes to directly investigate the uptake of calcitriol into live IBC cells. Interestingly, calcitriol uptake was observed to decrease when caveolae mediated endocytosis is disrupted. A luciferase assay confirmed that caveolae function is necessary; since calcitriol mediated activity decreases when caveolae mediated endocytosis is disrupted in IBC cells. In vitro examination of the localization of the probe indicated colocalization between caveolae and CalQDs. Additionally, Vitamin D Receptor (VDR) colocalization was observed with caveolae and calcitriol. This study demonstrates that in IBC cells calcitriol enters cells via caveolae mediated endocytosis and that caveolae are required for calcitriol to be uptaken at the increased rate.
Also flagged:posttranslational modificationslysineacetyltransferasesacetyldeacetylaseshistone deacetylases
Journal Article2013-10-01✓ 5 SnippetsLangley B, Sauve A.
In-Text Gene Mentions
S I O 001029)
…It is caused by an unstable expansion of CAG repeats in the coding region of the Huntingtin gene IT15 [150], which generates a stretch of glutamine residues spanning the N-terminus of the Huntingtin protein (HTT).…
S I O 001029)
…Contrary to these findings though, Pallos et al. [159] have used a Drosophila melanogaster model of HD to show that a 50 % reduction in Sir2 expression extends survival of photoreceptor neurons expressing mutant Htt [159].…
S I O 001029)
…In mouse models of HD, the role of SIRT1 in mutant HTT neurotoxicity has been more apparent.…
Introduction)
…the Huntingtin protein (HTT).…
Introduction)
…neurons expressing mutantHtt[ 159 ].…
Show Full Abstract
Sirtuins are a conserved family of deacetylases whose activities are dependent on nicotinamide adenine dinucleotide (NAD+). Sirtuins act in different cellular compartments, such as the nucleus where they deacetylate histones and transcriptional factors, in the cytoplasm where they modulate cytoskeletal and signaling molecules, and in the mitochondria where they engage components of the metabolic machinery. Collectively, they tune metabolic processes to energy availability, and modulate stress responses, protein aggregation, inflammatory processes, and genome stability. As such, they have garnered much interest and have been widely studied in aging and age-related neurodegeneration. In this chapter, we review the identification of sirtuins and their biological targets. We focus on their biological mechanisms of action and how they might be regulated, including via NAD metabolism, transcriptional and posttranscriptional control, and as targets of pharmacological agents. Lastly, we highlight the numerous studies suggesting that sirtuins are efficacious therapeutic targets in neurodegenerative disease and injury.
Also flagged:EphrinNetrinSemaphorinPlexinNeuropilinNRP
Journal Article2013-10-01No SnippetsKwon HB, Fukuhara S, Asakawa K, Ando K, Kashiwada T, Kawakami K, Hibi M, Kwon YG, Kim KW, Alitalo K, Mochizuki N.
Show Full Abstract
Blood vessels and neurons grow often side by side. However, the molecular and cellular mechanisms underlying their parallel development remain unclear. Here, we report that a subpopulation of secondary motoneurons extends axons ventrally outside of the neural tubes and rostrocaudally as a fascicle beneath the dorsal aorta (DA) in zebrafish. We tried to clarify the mechanism by which these motoneuron axons grow beneath the DA and found that Vegfc in the DA and Vegfr3 in the motoneurons were essential for the axon growth. Forced expression of either Vegfc in arteries or Vegfr3 in motoneurons resulted in enhanced axon growth of motoneurons over the DA. Both vegfr3 morphants and vegfc morphants lost the alignment of motoneuron axons with DA. In addition, forced expression of two mutant forms of Vegfr3 in motoneurons, potentially trapping endogenous Vegfc, resulted in failure of growth of motoneuron axons beneath the DA. Finally, a vegfr3 mutant fish lacked the motoneuron axons beneath the DA. Collectively, Vegfc from the preformed DA guides the axon growth of secondary motoneurons.
Also flagged:Parkinson diseasecoronary artery diseasenucleotidecomplexlung cancerPD
Journal Article2013-10-01✓ 1 SnippetLiu Y, Li X, Liu Z, Chen L, Ng MK.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
The study of gene regulatory network and protein-protein interaction network is believed to be fundamental to the understanding of molecular processes and functions in systems biology. In this study, the authors are interested in single nucleotide polymorphism (SNP) level and construct SNP-SNP interaction network to understand genetic characters and pathogenetic mechanisms of complex diseases. The authors employ existing methods to mine, model and evaluate a SNP sub-network from SNP-SNP interactions. In the study, the authors employ the two SNP datasets: Parkinson disease and coronary artery disease to demonstrate the procedure of construction and analysis of SNP-SNP interaction networks. Experimental results are reported to demonstrate the procedure of construction and analysis of such SNP-SNP interaction networks can recover some existing biological results and related disease genes.
…Together, our findings indicate that OLFM4 is a novel candidate tumor-suppressor gene for chromosome 13q and may shed new light on strategies that could be used for the diagnosis, prognosis, and treatment of prostate cancer patients.…
Title)
…Deletion of the olfactomedin 4 gene is associated with progression of human prostate cancer.…
Abstract)
…The olfactomedin 4 (OLFM4) gene is located…
Abstract)
…genetic evidence ofOLFM4gene alteration in…
Abstract)
…functions of theOLFM4gene in human…
Show Full Abstract
The olfactomedin 4 (OLFM4) gene is located on chromosome 13q14.3, which frequently is deleted in human prostate cancer. However, direct genetic evidence of OLFM4 gene alteration in human prostate cancer has not yet been obtained. In this study, we investigated the genetics, protein expression, and functions of the OLFM4 gene in human prostate cancer. We found overall 25% deletions within the OLFM4 gene in cancerous epithelial cells compared with adjacent normal epithelial cells that were microdissected from 31 prostate cancer specimens using laser-capture microdissection and genomic DNA sequencing. We found 28% to 45% hemizygous and 15% to 57% homozygous deletions of the OLFM4 gene via fluorescence in situ hybridization analysis from 44 different prostate cancer patient samples. Moreover, homozygous deletion of the OLFM4 gene significantly correlated with advanced prostate cancer. By using immunohistochemical analysis of 162 prostate cancer tissue array samples representing a range of Gleason scores, we found that OLFM4 protein expression correlated inversely with advanced prostate cancer, consistent with the genetic results. We also showed that a truncated mutant of OLFM4 that lacks the olfactomedin domain eliminated suppression of PC-3 prostate cancer cell growth. Together, our findings indicate that OLFM4 is a novel candidate tumor-suppressor gene for chromosome 13q and may shed new light on strategies that could be used for the diagnosis, prognosis, and treatment of prostate cancer patients.
Also flagged:CancertumourstumourcancerschromosomeTP53
Journal Article2013-10-01No SnippetsCancer Genome Atlas Research Network, Weinstein JN, Collisson EA, Mills GB, Shaw KR, Ozenberger BA, Ellrott K, Shmulevich I, Sander C, Stuart JM.
Show Full Abstract
The Cancer Genome Atlas (TCGA) Research Network has profiled and analyzed large numbers of human tumors to discover molecular aberrations at the DNA, RNA, protein and epigenetic levels. The resulting rich data provide a major opportunity to develop an integrated picture of commonalities, differences and emergent themes across tumor lineages. The Pan-Cancer initiative compares the first 12 tumor types profiled by TCGA. Analysis of the molecular aberrations and their functional roles across tumor types will teach us how to extend therapies effective in one cancer type to others with a similar genomic profile.
Also flagged:Chromatinneurological diseasesmetabolismneurodegenerative diseasesposttranslational modificationsoxygen
Journal Article2013-10-01No SnippetsBrochier C, Langley B.
Show Full Abstract
The integrity of the genome is continuously challenged by both endogenous and exogenous DNA damaging agents. Neurons, due to their post-mitotic state, high metabolism, and longevity are particularly prone to the accumulation of DNA lesions. Indeed, DNA damage has been suggested as a major contributor to both age-associated neurodegenerative diseases and acute neurological injury. The DNA damage response is a key factor in maintaining genome integrity. It relies on highly dynamic posttranslational modifications of the chromatin and DNA repair proteins to allow signaling, access, and repair of the lesion. Drugs that modulate the activity of the enzymes responsible for these modifications have emerged as attractive therapeutic compounds to treat neurodegeneration. In this review, we discuss the role of DNA double-strand breaks and abnormal chromatin modification patterns in a range of neurodegenerative conditions, and the chromatin modifiers that might ameliorate them. Finally, we suggest that understanding the epigenetic modifications specific to neuronal DNA repair is crucial for the development of efficient neurotherapeutic strategies.
<h4>Introduction</h4>Genetic influences on the development of malocclusion include heritable effects on both masticatory muscles and jaw skeletal morphology. Beyond genetic variations, however, the characteristics of muscle and bone are also influenced by epigenetic mechanisms that produce differences in gene expression. We studied 2 enzymes known to change gene expressions through histone modifications, chromatin-modifying histone acetyltransferase KAT6B and deacetylase HDAC4, to determine their associations with musculoskeletal variations in jaw deformation malocclusions.<h4>Methods</h4>Samples of masseter muscle were obtained from subjects undergoing orthognathic surgery from 6 malocclusion classes based on skeletal sagittal and vertical dysplasia. The muscles were characterized for fiber type properties by immunohistochemistry, and their total RNA was isolated for gene expression studies by microarray analysis and quantitative real-time polymerase chain reaction.<h4>Results</h4>Gene expressions for fast isoforms of myosins and contractile regulatory proteins and for KAT6B and HDAC4 were severalfold greater in masseter muscles from a patient with a deepbite compared with one with an open bite, and genes related to exercise and activity did not differ substantially. In the total population, expressions of HDAC4 (P = 0.03) and KAT6B (P = 0.004) were significantly greater in subjects with sagittal Class III than in Class II malocclusion, whereas HDAC4 tended to correlate negatively with slow myosin type I and positively with fast myosin gene, especially type IIX.<h4>Conclusions</h4>These data support other published reports of epigenetic regulation in the determination of skeletal muscle fiber phenotypes and bone growth. Further investigations are needed to elucidate how this regulatory model might apply to musculoskeletal development and malocclusion.
Also flagged:Colorectal cancercancerironiron overloadhereditary hemochromatosisoxygen
Journal Article2013-10-01✓ 5 SnippetsHamara K, Bielecka-Kowalska A, Przybylowska-Sygut K, Sygut A, Dziki A, Szemraj J.
In-Text Gene Mentions
Discussion)
…It may suggest, that this tendency of HAMP overexpression is related with up-regulation of HFE and HJV genes in tumors of the same individuals, which is confirmed with correlation analysis of both transcripts levels.…
Results)
…Moreover, association between both hepcidin regulatory genes (HFE and HJV) was found in all grades and stages of this disease, except stages IIIB and IV of cancer.…
Introduction)
…Expression of hepcidin is homeostatically regulated by anaemia, hypoxia, inflammation [13], and also by the function of the hemochromatosis protein (HFE), hemojuvelin (HJV) and TfR2, as indicated by their mutation that decreased hepcidin expression [14–16].…
Introduction)
…that patients withHFEmutations, suffering from…
Introduction)
…the hemochromatosis protein (HFE), hemojuvelin (HJV) and…
Show Full Abstract
Iron can play a role in colorectal cancer (CRC) development. The expression of genes involved in iron metabolism and its regulation in CRC has not been investigated well. Also the correlation between the level of iron-related genes expression and cancer progression is not known. In this study we collected paired samples of primary adenocarcinoma and adjacent normal mucosa from 73 patients. We assessed the mRNA or miRNA levels of 21 genes and verify their association with clinicopathological characteristics of CRC patients. Our experiments revealed, that the level of divalent metal transporter 1 transcript is well correlated with mRNA levels of iron regulatory proteins (IRPs) in tumor specimens. We have shown, that IRP2 can also be engaged in the mRNA stabilization of other iron transporter-transferrin receptor 1 (TfR1) in early stage of disease, however, in more advanced stages of CRC, mRNA level of TfR1 is related to miR-31 level. For the first time we have shown, that ferroportin concentration is significantly associated with miR-194 level, causing the reduction of this transporter amount in tumor tissues of patients with more advanced stages of CRC. We have also shown the alterations in expressing profile of miR-31, miR-133a, miR-141, miR-145, miR-149, miR-182 and miR-194, which were observed even in the early stage of disease, and identified a set of genes, which take place in correct assigning of patients in dependence of CRC stage. These iron-related genes could become potential diagnostic or prognostic indicators for patients with CRC.
Also flagged:HEBAnaplastic AstrocytomasKORCHSCHTGlioblastomas
Journal Article2013-10-01✓ 5 SnippetsRodríguez-Hernández I, Vázquez-Cedeira M, Santos-Briz A, García JL, Fernández IF, Gómez-Moreta JA, Martin-Vallejo J, González-Sarmiento R, Lazo PA.
In-Text Gene Mentions
Abstract)
…: High levels of VRK2 resulted in a…
I A O 0000326)
…VRK2…
Discussion)
…In that way VRK2 might contribute to the tumor biological characteristics by modulation of neural cells to growth factors.…
Methods)
…Immunohistochemical staining was evaluated semiquantitatively by a blinded pathologist to clinical or molecular information as follows: ki-67 expression was considered positive when >5% of tumor cells showed immunoreactivity; p53, p63, VRK1 and VRK2 expression were scored positive when >50% of tumor cells showed intense staining.…
Discussion)
…This is consistent with the role of high VRK2 level in breast cancer, in which also correlates with tumors having a better prognosis, those that are estrogen and progesterone receptor positive and ERBB2 negative [31,32].…
Show Full Abstract
<h4>Background</h4>Malignant astrocytomas are the most common primary brain tumors and one of the most lethal among human cancers despite optimal treatment. Therefore, the characterization of molecular alterations underlying the aggressive behavior of these tumors and the identification of new markers are thus an important step towards a better patient stratification and management.<h4>Methods and results</h4>VRK1 and VRK2 (Vaccinia-related kinase-1, -2) expression, as well as proliferation markers, were determined in a tissue microarray containing 105 primary astrocytoma biopsies. Kaplan Meier and Cox models were used to find clinical and/or molecular parameters related to overall survival. The effects of VRK protein levels on proliferation were determined in astrocytoma cell lines. High levels of both protein kinases, VRK1 or VRK2, correlated with proliferation markers, p63 or ki67. There was no correlation with p53, reflecting the disruption of the VRK-p53-DRAM autoregulatory loop as a consequence of p53 mutations. High VRK2 protein levels identified a subgroup of astrocytomas that had a significant improvement in survival. The potential effect of VRK2 was studied by analyzing the growth characteristics of astrocytoma cell lines with different EGFR/VRK2 protein ratios.<h4>Conclusion</h4>High levels of VRK2 resulted in a lower growth rate suggesting these cells are more indolent. In high-grade astrocytomas, VRK2 expression constitutes a good prognostic marker for patient survival.
Also flagged:nicotinemetabolismnicotine addictionobesityFTObehavioral
Journal Article2013-10-01✓ 1 SnippetThorgeirsson TE, Gudbjartsson DF, Sulem P, Besenbacher S, Styrkarsdottir U, Thorleifsson G, Walters GB, TAG Consortium, Oxford-GSK Consortium, ENGAGE consortium, Furberg H, Sullivan PF, Marchini J, McCarthy MI, Steinthorsdottir V, Thorsteinsdottir U, Stefansson K.
In-Text Gene Mentions
Results)
…), rs2815752-A (NEGR1) is among…
Show Full Abstract
Smoking influences body weight such that smokers weigh less than non-smokers and smoking cessation often leads to weight increase. The relationship between body weight and smoking is partly explained by the effect of nicotine on appetite and metabolism. However, the brain reward system is involved in the control of the intake of both food and tobacco. We evaluated the effect of single-nucleotide polymorphisms (SNPs) affecting body mass index (BMI) on smoking behavior, and tested the 32 SNPs identified in a meta-analysis for association with two smoking phenotypes, smoking initiation (SI) and the number of cigarettes smoked per day (CPD) in an Icelandic sample (N=34,216 smokers). Combined according to their effect on BMI, the SNPs correlate with both SI (r=0.019, P=0.00054) and CPD (r=0.032, P=8.0 × 10(-7)). These findings replicate in a second large data set (N=127,274, thereof 76,242 smokers) for both SI (P=1.2 × 10(-5)) and CPD (P=9.3 × 10(-5)). Notably, the variant most strongly associated with BMI (rs1558902-A in FTO) did not associate with smoking behavior. The association with smoking behavior is not due to the effect of the SNPs on BMI. Our results strongly point to a common biological basis of the regulation of our appetite for tobacco and food, and thus the vulnerability to nicotine addiction and obesity.
Also flagged:gene expressionidiopathic pulmonary fibrosisreverse transcriptiondeathTcell activation
Journal Article2013-10-01No SnippetsHerazo-Maya JD, Noth I, Duncan SR, Kim S, Ma SF, Tseng GC, Feingold E, Juan-Guardela BM, Richards TJ, Lussier Y, Huang Y, Vij R, Lindell KO, Xue J, Gibson KF, Shapiro SD, Garcia JG, Kaminski N.
Show Full Abstract
We aimed to identify peripheral blood mononuclear cell (PBMC) gene expression profiles predictive of poor outcomes in idiopathic pulmonary fibrosis (IPF) by performing microarray experiments of PBMCs in discovery and replication cohorts of IPF patients. Microarray analyses identified 52 genes associated with transplant-free survival (TFS) in the discovery cohort. Clustering the microarray samples of the replication cohort using the 52-gene outcome-predictive signature distinguished two patient groups with significant differences in TFS. We studied the pathways associated with TFS in each independent microarray cohort and identified decreased expression of "The costimulatory signal during T cell activation" Biocarta pathway and, in particular, the genes CD28, ICOS, LCK, and ITK, results confirmed by quantitative reverse transcription polymerase chain reaction (qRT-PCR). A proportional hazards model, including the qRT-PCR expression of CD28, ICOS, LCK, and ITK along with patient's age, gender, and percent predicted forced vital capacity (FVC%), demonstrated an area under the receiver operating characteristic curve of 78.5% at 2.4 months for death and lung transplant prediction in the replication cohort. To evaluate the potential cellular source of CD28, ICOS, LCK, and ITK expression, we analyzed and found significant correlation of these genes with the PBMC percentage of CD4(+)CD28(+) T cells in the replication cohort. Our results suggest that CD28, ICOS, LCK, and ITK are potential outcome biomarkers in IPF and should be further evaluated for patient prioritization for lung transplantation and stratification in drug studies.
Also flagged:Filamin Aneuronal migrationbrefeldin Aguanine exchange factor 2Periventricular heterotopiasBIG2
Journal Article2013-10-01✓ 3 SnippetsZhang J, Neal J, Lian G, Hu J, Lu J, Sheen V.
In-Text Gene Mentions
Abstract)
…Human mutations in the Filamin A (FLNA) and ADP-ribosylation factor guanine exchange factor 2 [ARFGEF2; encoding brefeldin-A-inhibited guanine exchange factor-2 (BIG2)] genes give rise to this disorder.…
Abstract)
…factor 2 [ARFGEF2; encoding brefeldin-A-inhibit…
Text
…ARFGEF2…
Show Full Abstract
Periventricular heterotopias is a malformation of cortical development, characterized by ectopic neuronal nodules around ventricle lining and caused by an initial migration defect during early brain development. Human mutations in the Filamin A (FLNA) and ADP-ribosylation factor guanine exchange factor 2 [ARFGEF2; encoding brefeldin-A-inhibited guanine exchange factor-2 (BIG2)] genes give rise to this disorder. Previously, we have reported that Big2 inhibition impairs neuronal migration and binds to FlnA, and its loss promotes FlnA phosphorylation. FlnA phosphorylation dictates FlnA-actin binding affinity and consequently alters focal adhesion size and number to effect neuronal migration. Here we show that FlnA loss similarly impairs migration, reciprocally enhances Big2 expression, but also alters Big2 subcellular localization in both null and conditional FlnA mice. FlnA phosphorylation promotes relocalization of Big2 from the Golgi toward the lipid ruffles, thereby activating Big2-dependent Arf1 at the cell membrane. Loss of FlnA phosphorylation or Big2 function impairs Arf1-dependent vesicle trafficking at the periphery, and Arf1 is required for maintenance of cell-cell junction connectivity and focal adhesion assembly. Loss of Arf1 activity disrupts neuronal migration and cell adhesion. Collectively, these studies demonstrate a potential mechanism whereby coordinated interactions between actin (through FlnA) and vesicle trafficking (through Big2-Arf) direct the assembly and disassembly of membrane protein complexes required for neuronal migration and neuroependymal integrity.
Also flagged:oxygenglucosepolyacrylamidecervical cancer-hydroxyethyl methacrylate-aminohexyl methacrylamide
Journal Article2013-10-01No SnippetsZhang L, Su F, Buizer S, Lu H, Gao W, Tian Y, Meldrum D.
Show Full Abstract
A dual glucose and oxygen sensor in a polymer format was developed. The dual sensor composed of a blue emitter as the glucose probe, a red emitter as an oxygen probe, and a yellow emitter as a built-in reference probe which does not respond to either glucose or oxygen. All the three probes were chemically immobilized in a polyacrylamide-based matrix. Therefore, the dual sensor possesses three well separated emission colors and ratiometric approach is applicable for analysis of the glucose and oxygen concentration at biological conditions. The sensor was applied for real-time monitoring of glucose and oxygen consumption of bacterial cells, Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis), and mammalian cells of mouse macrophage J774 and human cervical cancer HeLa cell lines. On the other hand, in order to achieve satisfactory sensing performance for glucose, compositions of the matrices among poly(2-hydroxyethyl methacrylate), polyacrylamide, and poly(6-aminohexyl methacrylamide) which is a linker polymer for grafting the glucose probe, were optimized.
The neurotrophic factors pleiotrophin (PTN) and midkine (MK) are highly upregulated in different brain areas relevant to drug addiction after administrations of different drugs of abuse, including psychostimulants. We have previously demonstrated that PTN and MK modulate amphetamine-induced neurotoxicity and that PTN prevents cocaine-induced cytotoxicity in NG108-15 and PC12 cells. In an effort to dissect the different mechanisms of action triggered by PTN and MK to exert their protective roles against psychostimulant neurotoxicity, we have now used a proteomic approach to study protein phosphorylation, in which we combined phosphoprotein enrichment, by immobilized metal affinity chromatography (IMAC), with two-dimensional gel electrophoresis and mass spectrometry, in order to identify the phosphoproteins regulated in the striatum of PTN knockout, MK knockout and wild type mice treated with a single dose of cocaine (15mg/kg, i.p.). We identified 7 differentially expressed phosphoproteins: 5'(3')-deoxyribonucleotidase, endoplasmic reticulum resident protein 60 (ERP60), peroxiredoxin-6 (PRDX6), glutamate dehydrogenase 1 (GLUD1), aconitase and two subunits of hemoglobin. Most of these proteins are related to neurodegeneration processes and oxidative stress and their variations specially affect the PTN knockout mice, suggesting a protective role of endogenous PTN against cocaine-induced neural alterations. Further studies are needed to validate these proteins as possible targets against neural alterations induced by cocaine.
Journal Article2013-10-01✓ 5 SnippetsWang L, Liu X, Zhang L, Yan H, Luo W, Liang J, Cheng D, Chen S, Ma X, Song X, Zhao K, Wang L.
In-Text Gene Mentions
I A O 0000326)
…CCDC92…
I A O 0000326)
…VSIG10…
I A O 0000326)
…ZNF644…
I A O 0000326)
…TAOK3…
I A O 0000326)
…ECI2…
Show Full Abstract
Copy number variations (CNVs) are one of the main contributors to genetic diversity in animals and are broadly distributed in the genomes of swine. Investigating the performance and evolutionary impacts of pig CNVs requires comprehensive knowledge of their structure and function within and between breeds. In the current study, 4 different programs (i.e., GADA, PennCNV, QuantiSNP, and cnvPartition) were used to analyze Porcine SNP60 genotyping data of 585 pigs from one Large White × Minzhu intercross population to detect copy number variant regions (CNVRs). Overlapping CNVRs recalled by at least 2 programs were used to construct a powerful and comprehensive CNVR map, which contained 249 CNVRs (i.e., 70 gains, 43 losses, and 136 gains/losses) and covered 26.22% of the regions in the swine genome. Ten CNVRs, representing different predicted statuses, were selected for validation via quantitative real-time PCR (QPCR); 9/10 CNVRs (i.e., 90%) were validated. When being traced back to the F0 generation, 58 events were identified in only Minzhu F0 parents and 2 events were identified in only Large White F0 parents. A series of CNVR function analyses were performed. Some of the CNVRs functions were predicted, and several interesting CNVRs for meat quality traits and hematological parameters were obtained. A comprehensive and lower false rate genome-wide CNV map was constructed for Large White and Minzhu pig genomes in this study. Our results may provide an important basis for determining the relationship between CNVRs and important qualitative and quantitative traits. In addition, it can help to further understand genetic processes in pigs.
Chronic inflammation has been associated with insulin resistance and type 2 diabetes (T2D) in humans. Postmortem hepatic and splenic tissue from a 46-year-old geriatric male bottlenose dolphin (Tursiops truncatus) with insulin resistance (chronic hyperinsulinemia with hyperglycemia), chronic inflammation (white blood cell count greater than 12,000 cells/μL), and mild fatty liver disease was evaluated for elevated pro-inflammatory mediators. Cytokine mRNA expression in postmortem hepatic and splenic tissue, as determined by real-time PCR, included an array of cytokines: TGF-β, TNF-α, IFN-γ, IL-2, IL-4, IL-10, IL-12p40, IL-13, and IL-18. Values from this dolphin were compared to a younger reference dolphin with no known chronic metabolic perturbations or inflammation. Levels of TGF-β, TNF-α, and IL-4 were higher in the case dolphin's liver compared to that of the reference dolphin. In the case dolphin's spleen, IL-10 and IFN-γ mRNA was upregulated while IL-4 was less than the reference dolphin. IL-18 and IL-13 were upregulated in both tissues. Fluorescent immunohistochemistry (IHC) utilized the following antibodies: anti-porcine IL-6, anti-bovine IFN-γ, IL-4, and IL-10, anti-human TGF-β, anti-ovine IL-1β, and anti-dolphin IL-8. Fluorescent IHC in spleen from the case dolphin revealed staining of IL-4, IL-6, IL-8, and TGF-β throughout the tissue. IL-10 and IFN-γ were seen to predominate in areas surrounding the follicles of splenic tissue. This is the first characterization of cytokine levels in dolphin hepatic and splenic tissue. While there are limitations to a case study, this report of inflammatory biomarkers in tissues of a dolphin with insulin resistance and fatty liver disease are similar to those observed in human patients.
Also flagged:liver infectionsthalassemiayersinia enterocolitishemophagocytosishemophagocytic lymphohistiocytosiscytopenia
Journal Article2013-10-01✓ 1 SnippetSelsky N, Forouhar F, Wu GY.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
A 49 years old Vietnamese male with a history of thalassemia, presented with gastrointestinal symptoms and signs of hemolysis. He was diagnosed with yersinia enterocolitis. Yersinia is a gram-negative rod that most frequently occurs in children especially during the winter months. In the current case, the bone marrow biopsy showed hemophagocytosis along with positive cultures for Yersinia. The microorganism likely triggered hemophagocytosis. This syndrome, also known as, hemophagocytic lymphohistiocytosis, is defined by fever for more than 7 d, cytopenia of two or more cell lines, hemophagocytosis, hepatitis, serum ferritin greater than 500, jaundice, lymphadenopathy, and hepatosplenomegaly. This disorder can be either familial or secondary to a strong immunologic activation. Both have an overwhelming activation of T-cells and macrophages.
Also flagged:papillary thyroid carcinomaBRAFvimentinHSP60SOD2
Journal Article2013-10-01✓ 2 SnippetsPark WS, Chung KW, Young MS, Kim SK, Lee YJ, Lee EK.
In-Text Gene Mentions
Abstract)
…We validated the association between these proteins and clinicopathological factors in a test set of 121 PTCs.<h4>Results</h4>The expression of vimentin was increased in PTCs with LNM, but the one for HSP60, SOD2 and PEBP1 was increased in samples without LNM.…
Abstract)
…HSP60, SOD2 andPEBP1was increased in…
Show Full Abstract
<h4>Background</h4>The prognostic role of the T1799A BRAF mutation is controversial. We investigated the protein expression in papillary thyroid carcinoma (PTCs) samples harboring the specific mutation using proteomic tools.<h4>Materials and methods</h4>We performed two-dimensional gel electrophoresis to identify differential protein expression regarding lymph node metastasis (LNM). Proteins were identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Immunohistochemical staining was performed for 38 PTCs harboring the mutation. We validated the association between these proteins and clinicopathological factors in a test set of 121 PTCs.<h4>Results</h4>The expression of vimentin was increased in PTCs with LNM, but the one for HSP60, SOD2 and PEBP1 was increased in samples without LNM. HSP60 protein was up-regulated in PTCs without LNM (84.2% vs. 36.8%. p=0.003) and in PTCs without LNM harboring the mutation (58% vs. 41.8%. p=0.003) in the test set as shown by immunohistochemical staining.<h4>Conclusion</h4>HSP60 protein expression may inhibit LNM in PTCs harboring the BRAF mutation and may be a useful prognostic marker.
Also flagged:cancertumorsTumorHER2breast cancerC-RAF
Journal Article2013-10-01No SnippetsEllis MJ, Gillette M, Carr SA, Paulovich AG, Smith RD, Rodland KK, Townsend RR, Kinsinger C, Mesri M, Rodriguez H, Liebler DC, Clinical Proteomic Tumor Analysis Consortium (CPTAC).
Show Full Abstract
The National Cancer Institute (NCI) Clinical Proteomic Tumor Analysis Consortium is applying the latest generation of proteomic technologies to genomically annotated tumors from The Cancer Genome Atlas (TCGA) program, a joint initiative of the NCI and the National Human Genome Research Institute. By providing a fully integrated accounting of DNA, RNA, and protein abnormalities in individual tumors, these datasets will illuminate the complex relationship between genomic abnormalities and cancer phenotypes, thus producing biologic insights as well as a wave of novel candidate biomarkers and therapeutic targets amenable to verification using targeted mass spectrometry methods.
Also flagged:Synapse formationsynapsepresynapsepresynaptic terminalsF-actinscaffolding proteins
Journal Article2013-10-01No SnippetsChia PH, Li P, Shen K.
Show Full Abstract
Synapse formation is a highly regulated process that requires the coordination of many cell biological events. Decades of research have identified a long list of molecular components involved in assembling a functioning synapse. Yet how the various steps, from transporting synaptic components to adhering synaptic partners and assembling the synaptic structure, are regulated and precisely executed during development and maintenance is still unclear. With the improvement of imaging and molecular tools, recent work in vertebrate and invertebrate systems has provided important insight into various aspects of presynaptic development, maintenance, and trans-synaptic signals, thereby increasing our understanding of how extrinsic organizers and intracellular mechanisms contribute to presynapse formation.
Also flagged:Acquired hemochromatosisirondiabetes mellitusdiabeteshepatic cirrhosismelanin
Journal Article2013-10-01✓ 4 SnippetsChacon AH, Morrison B, Hu S.
In-Text Gene Mentions
Abstract)
…<h4>Hemochromatosismay be classified…
Abstract)
…In the past,hemochromatosiswas usually recognized…
Abstract)
…due to secondaryhemochromatosisare discussed.…
Text
…hemochromatosis…
Show Full Abstract
<h4>Hemochromatosis may be classified into two groups</h4>primary (hereditary) or secondary (acquired). The acquired type most commonly occurs after massive intake of iron supplements or blood transfusions and is also known as transfusional iron overload. In the past, hemochromatosis was usually recognized at an advanced stage by the classic triad of hyperpigmentation, diabetes mellitus ("bronze diabetes"), and hepatic cirrhosis. Cutaneous hyperpigmentation is present in 70 percent of patients due to two different mechanisms: (1) hemosiderin deposition resulting in diffuse, slate-gray darkening and (2) increased production of melanin in the epidermis. A 47-year-old woman who receives regular transfusions due to low iron and chronic, unresolving anemia and who subsequently developed pronounced hyperpigmentation of the upper eyelids is described. The presentation, diagnosis, pathogenesis, and treatment options of hyperpigmentation due to secondary hemochromatosis are discussed.
The objectives of this study were to determine innate differences in gene expression in 2 regions of the extended amygdala between 5 different pairs of lines of male rats selectively bred for high or low ethanol consumption: a) alcohol-preferring (P) vs. alcohol-non-preferring (NP) rats, b) high-alcohol-drinking (HAD) vs. low-alcohol-drinking (LAD) rats (replicate line-pairs 1 and 2), c) ALKO alcohol (AA) vs. nonalcohol (ANA) rats, and d) Sardinian alcohol-preferring (sP) vs. Sardinian alcohol-nonpreferring (sNP) rats, and then to determine if these differences are common across the line-pairs. Microarray analysis revealed up to 1772 unique named genes in the nucleus accumbens shell (AcbSh) and 494 unique named genes in the central nucleus of the amygdala (CeA) that significantly differed [False Discovery Rate (FDR) = 0.10; fold-change at least 1.2] in expression between the individual line-pairs. Analysis using Gene Ontology (GO) and Ingenuity Pathways information indicated significant categories and networks in common for up to 3 or 4 line-pairs, but not for all 5 line-pairs. However, there were almost no individual genes in common within these categories and networks. ANOVAs of the combined data for the 5 line-pairs indicated 1014 and 731 significant (p < 0.01) differences in expression of named genes in the AcbSh and CeA, respectively. There were 4-6 individual named genes that significantly differed across up to 3 line-pairs in both regions; only 1 gene (Gsta4 in the CeA) differed in as many as 4 line-pairs. Overall, the findings suggest that a) some biological categories or networks (e.g., cell-to-cell signaling, cellular stress response, cellular organization, etc.) may be in common for subsets of line-pairs within either the AcbSh or CeA, and b) regulation of different genes and/or combinations of multiple biological systems may be contributing to the disparate alcohol drinking behaviors of these line-pairs.
Also flagged:Huntington's diseaseFAPHDbehaviouralwashhypersalivation
Journal Article2013-10-01✓ 1 SnippetYoussov K, Dolbeau G, Maison P, Boissé MF, Cleret de Langavant L, Roos RA, Bachoud-Lévi AC.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
The Unified Huntington's Disease Rating Scale (UHDRS) adequately measures decline in patients at early and moderate stages of Huntington's disease (HD). In advanced patients, floor effects hamper the evaluation, thus calling for an adjusted scale. We designed the UHDRS-For Advanced Patients (UHDRS-FAP), in order to improve longitudinal assessment of patients at advanced disease stage. Sixty-nine patients with a Total Functional Capacity (TFC) ≤ 5 were recruited in France and in the Netherlands. Among them, 45 patients were followed longitudinally (mean 1.6 ± 1.2 years) with the UHDRS-FAP; 30 were also assessed with the UHDRS. Cross-sectional analyses evaluated psychometric properties and interrater reliability of the scale. Longitudinal analyses evaluated the sensitivity to decline compared to the UHDRS. Internal consistency was higher for motor and cognitive scores than for somatic and behavioral scores (0.84, 0.91, 0.70, and 0.49, respectively). Interrater reliability was ≥ 0.88 in all scores. The somatic score, specific to the UHDRS-FAP, declined over time, as well as motor and cognitive performance with both scales. Although performance with the 2 scales correlated, the UHDRS-FAP appeared more sensitive to change and was the only scale that detected decline in patients with a TFC ≤ 1. Neither scale detected a significant decline in behavioral scores. The UHDRS-FAP is reliable and more sensitive to change than the original UHDRS for cognitive and motor domains. It offers items relevant for daily care. Behavioral scores tended to decline but this may reflect the decline in the communicative abilities of the patients.
Netrin-1 is a secreted protein that directs long-range axon guidance during early stages of neural circuit formation and continues to be expressed in the mammalian forebrain during the postnatal period of peak synapse formation. Here we demonstrate a synaptogenic function of netrin-1 in rat and mouse cortical neurons and investigate the underlying mechanism. We report that netrin-1 and its receptor DCC are widely expressed by neurons in the developing mammalian cortex during synapse formation and are enriched at synapses in vivo. We detect DCC protein distributed along the axons and dendrites of cultured cortical neurons and provide evidence that newly translated netrin-1 is selectively transported to dendrites. Using gain and loss of function manipulations, we demonstrate that netrin-1 increases the number and strength of excitatory synapses made between developing cortical neurons. We show that netrin-1 increases the complexity of axon and dendrite arbors, thereby increasing the probability of contact. At sites of contact, netrin-1 promotes adhesion, while locally enriching and reorganizing the underlying actin cytoskeleton through Src family kinase signaling and m-Tor-dependent protein translation to locally cluster presynaptic and postsynaptic proteins. Finally, we demonstrate using whole-cell patch-clamp electrophysiology that netrin-1 increases the frequency and amplitude of mEPSCs recorded from cortical pyramidal neurons. These findings identify netrin-1 as a synapse-enriched protein that promotes synaptogenesis between mammalian cortical neurons.
Also flagged:Ig transmembrane proteinaxonalreceptor tyrosine phosphataseleukocyte common antigen-related proteinLARaxon
Journal Article2013-10-01✓ 1 SnippetCameron S, Chang WT, Chen Y, Zhou Y, Taran S, Rao Y.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
Establishment of synaptic connections in the neuropils of the developing nervous system requires the coordination of specific neurite-neurite interactions (i.e., axon-axon, dendrite-dendrite and axon-dendrite interactions). The molecular mechanisms underlying coordination of neurite-neurite interactions for circuit assembly are incompletely understood. In this report, we identify a novel Ig superfamily transmembrane protein that we named Borderless (Bdl), as a novel regulator of neurite-neurite interactions in Drosophila. Bdl induces homotypic cell-cell adhesion in vitro and mediates neurite-neurite interactions in the developing visual system. Bdl interacts physically and genetically with the Ig transmembrane protein Turtle, a key regulator of axonal tiling. Our results also show that the receptor tyrosine phosphatase leukocyte common antigen-related protein (LAR) negatively regulates Bdl to control synaptic-layer selection. We propose that precise regulation of Bdl action coordinates neurite-neurite interactions for circuit formation in Drosophila.
Also flagged:gene expressiontranscription factorsstem cellfertilizationbindingmethylation
Journal Article2013-10-01No SnippetsChoi E, Choi E, Hwang KC.
Show Full Abstract
Mounting evidence in stem cell biology has shown that microRNAs (miRNAs) play a crucial role in cell fate specification, including stem cell self-renewal, lineage-specific differentiation, and somatic cell reprogramming. These functions are tightly regulated by specific gene expression patterns that involve miRNAs and transcription factors. To maintain stem cell pluripotency, specific miRNAs suppress transcription factors that promote differentiation, whereas to initiate differentiation, lineage-specific miRNAs are upregulated via the inhibition of transcription factors that promote self-renewal. Small molecules can be used in a similar manner as natural miRNAs, and a number of natural and synthetic small molecules have been isolated and developed to regulate stem cell fate. Using miRNAs as novel regulators of stem cell fate will provide insight into stem cell biology and aid in understanding the molecular mechanisms and crosstalk between miRNAs and stem cells. Ultimately, advances in the regulation of stem cell fate will contribute to the development of effective medical therapies for tissue repair and regeneration. This review summarizes the current insights into stem cell fate determination by miRNAs with a focus on stem cell self-renewal, differentiation, and reprogramming. Small molecules that control stem cell fate are also highlighted.
Primary liver cancer is the sixth most common cancer in the world and the third cause of cancer-related death. Hepatocellular carcinoma (HCC) represents more than 90% of primary liver cancers and generally occurs in patients with underlying chronic liver disease such as viral hepatitis, hemochromatosis, primary biliary cirrhosis and non-alcoholic steatohepatitis. Especially cirrhotic patients are at risk of HCC and regular surveillance could enable early detection and therapy, with potentially improved outcome. We here summarize existing evidence for surveillance including ultrasound, other radiological modalities and various serum biomarkers, and current international guideline recommendations for surveillance. Ultrasound and α-fetoprotein (alone or in combination) are most frequently used for surveillance, but their sensitivities and specificities are still far from perfect, and evidence for surveillance remains weak and controversial. Various other potential surveillance tools have been tested, including serum markers as des-carboxyprothrombin, lectin-bound α-fetoprotein, and (most recently) circulating TIE2-expressing monocytes, and radiological investigations such as computed tomography-scan or magnetic resonance imaging-scan. Although early results appear promising, these tools have generally been tested in diagnostic rather than surveillance setting, and in most cases, no detailed information is available on their cost-effectiveness. For the near future, it remains important to define those patients with highest risk of HCC and most benefit from surveillance, and to restrict surveillance to these categories.
Also flagged:nonalcoholic fatty liver diseaseNAFLDnonalcoholic steatohepatitisNASHalanine aminotransferaseALT
Journal Article2013-10-01✓ 1 SnippetMa YY, Li L, Yu CH, Shen Z, Chen LH, Li YM.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Aim</h4>To investigate the relationship between the gut-liver axis and nonalcoholic fatty liver disease (NAFLD), we performed a meta-analysis to evaluate the effects of probiotic therapy in NAFLD.<h4>Methods</h4>We searched PubMed, Medline, Embase, Web of Science, the Cochrane Library and Chinese Biomedicine Database for all relevant randomized controlled trials on probiotics in patients with NAFLD/nonalcoholic steatohepatitis (NASH). A statistical analysis was performed using RevMan 5.0 software.<h4>Results</h4>Four randomized trials involving 134 NAFLD/NASH patients were included. The results showed that probiotic therapy significantly decreased alanine aminotransferase (ALT), aspartate transaminase (AST), total-cholesterol (T-chol), high density lipoprotein (HDL), tumor necrosis factor (TNF)-α and homeostasis model assessment of insulin resistance (HOMA-IR) [ALT: weighted mean difference (WMD) -23.71, 95%CI: -33.46--13.95, P < 0.00001; AST: WMD -19.77, 95%CI: -32.55--7.00, P = 0.002; T-chol: WMD -0.28, 95%CI: -0.55--0.01, P = 0.04; HDL: WMD -0.09, 95%CI: -0.16-0.01, P = 0.03; TNF-α: WMD -0.32, 95%CI: -0.48--0.17, P < 0.0001; HOMA-IR: WMD -0.46, 95%CI: -0.73--0.19, P = 0.0008]. However, the use of probiotics was not associated with changes in body mass index (BMI), glucose (GLU) and low density lipoprotein (LDL) (BMI: WMD 0.05, 95%CI: -0.18-0.29, P = 0.64; GLU: WMD 0.05, 95%CI: -0.25-0.35, P = 0.76; LDL: WMD -0.38, 95%CI: -0.78-0.02, P = 0.06).<h4>Conclusion</h4>Probiotic therapies can reduce liver aminotransferases, total-cholesterol, TNF-α and improve insulin resistance in NAFLD patients. Modulation of the gut microbiota represents a new treatment for NAFLD.
Also flagged:insulinperoxiredoxin-6glucosemineralprohibitinmineralization
Journal Article2013-10-01No SnippetsWang JC, Li Y, Wang DS, E LL, Liu HC.
Show Full Abstract
<h4>Purpose</h4>To explore the effect of insulin on the expression of peroxiredoxin-6 in osteogenic differentiation of rat's mandibular bone marrow stromal cells(rBMSCs) in high glucose.<h4>Methods</h4>Bone marrow stromal cells were obtained from the mandible of Wistar rats and stimulated in three glucose concentrations mineral medium(5.5 mmol/L, 25 mmol/L and 45 mmol/L) with or without insulin(10-5mol/L) for 1, 3, 7, 14, and 21 days. The expression of prohibitin was quantified via enzyme-linked immuno sorbent assays (ELISA). The mineralization nodules were assessed at day 21 by alizarine red staining. Statistical analysis was performed using SPSS 15.0 soft ware package.<h4>Results</h4>High glucose of 45 mmol/L inhibited mineralization of rBMSCs and insulin can improve the mineralization in high glucose. The expression of peroxiredoxin-6 in 45 mmol/L group decreased significantly compared with 5.5 mmol/L group and 25 mmol/L group. The expression of peroxiredoxin-6 in each group achieved maximum at day 21. Insulin (10-5 mol/L) increased the expression of peroxiredoxin-6 in 25 mmol/L group and 45 mmol/L group in osteogenic differentiation of rBMSCs.<h4>Conclusions</h4>High glucose inhibits the expression of peroxiredoxin-6 in osteogenic differentiation of rBMSCs, while insulin upregulates the expression of peroxiredoxin-6 in rBMSCs. Peroxiredoxin-6 may play an important part in later stage in osteogenic differentiation of rBMSCs.
Also flagged:mineralmineralscarbonatedCarbonatetype I collagencollagens
Journal Article2013-10-01No SnippetsMcElderry JD, Zhu P, Mroue KH, Xu J, Pavan B, Fang M, Zhao G, McNerny E, Kohn DH, Franceschi RT, Holl MM, Tecklenburg MM, Ramamoorthy A, Morris MD.
Show Full Abstract
Solid-state (magic-angle spinning) NMR spectroscopy is a useful tool for obtaining structural information on bone organic and mineral components and synthetic model minerals at the atomic-level. Raman and <sup>31</sup>P NMR spectral parameters were investigated in a series of synthetic B-type carbonated apatites (CAps). Inverse <sup>31</sup>P NMR linewidth and inverse Raman PO<sub>4</sub><sup>3-</sup> ν<sub>1</sub> bandwidth were both correlated with powder XRD <i>c-axis</i> crystallinity over the 0.3-10.3 wt% CO<sub>3</sub><sup>2-</sup> range investigated. Comparison with bone powder crystallinities showed agreement with values predicted by NMR and Raman calibration curves. Carbonate content was divided into two domains by the <sup>31</sup>P NMR chemical shift frequency and the Raman phosphate ν<sub>1</sub> band position. These parameters remain stable except for an abrupt transition at 6.5 wt% carbonate, a composition which corresponds to an average of one carbonate per unit cell. This near-binary distribution of spectroscopic properties was also found in AFM-measured particle sizes and Ca/P molar ratios by elemental analysis. We propose that this transition differentiates between two charge-balancing ion-loss mechanisms as measured by Ca/P ratios. These results define a criterion for spectroscopic characterization of B-type carbonate substitution in apatitic minerals.
Also flagged:acute coronary syndromemyocardial infarctionpolymeraseischemic heart diseasemyocardial ischemiaaging
Journal Article2013-10-01No SnippetsWard JA, Esa N, Pidikiti R, Freedman JE, Keaney JF, Tanriverdi K, Vitseva O, Ambros V, Lee R, McManus DD.
Show Full Abstract
<h4>Background</h4>Differences in plasma and whole blood expression microRNAs (miRNAs) in patients with an acute coronary syndrome (ACS) have been determined in both in vitro and in vivo studies. Although most circulating miRNAs are located in the cellular components of whole blood, little is known about the miRNA profiles of whole blood subcomponents, including plasma, platelets and leukocytes in patients with myocardial ischemia.<h4>Methods</h4>Thirteen patients with a ST-segment-elevation (STEMI) or non-ST-segment elevation (NSTEMI) myocardial infarction were identified in the University of Massachusetts Medical Center Emergency Department (ED) or cardiac catheterization laboratory between February and June of 2012. Whole blood was obtained from arterial blood samples at the time of cardiac catheterization and cell-specific miRNA profiling was performed. Expression of 343 miRNAs was quantified from whole blood, plasma, platelets, and peripheral blood mononuclear cells using a high-throughput, quantitative Real-Time polymerase-chain reaction system (qRT-PCR).<h4>Results</h4>MiRNAs associated with STEMI as compared to NSTEMI patients included miR-25-3p, miR-221-3p, and miR-374b-5p. MiRNA 30d-5p was associated with plasma, platelets, and leukocytes in both STEMI and NSTEMI patients; miRNAs 221-3p and 483-5p were correlated with plasma and platelets only in NSTEMI patients.<h4>Conclusions</h4>Cell-specific miRNA profiles differed between patients with STEMI and NSTEMI. The miRNA distribution is also unique amongst plasma, platelets, and leukocytes in patients with ischemic heart disease or ACS. Our findings suggest unique miRNA profiles among the circulating subcomponents in patients presenting with myocardial ischemia.
Also flagged:saltsaltsionscomplexationiron oxidessilicic acid
Journal Article2013-10-01No SnippetsUskoković V.
Show Full Abstract
This review presents thoughts on some of the fundamental features of conceptual models applied in the design of fine particles in the frames of colloid and soft chemistry. A special emphasis is placed on the limitations of these models, an acknowledgment of which is vital in improving their intricacy and effectiveness in predicting the outcomes of the corresponding experimental settings. Thermodynamics of self-assembly phenomena illustrated on the examples of protein assembly and micellization is analyzed in relation to the previously elaborated thesis that each self-assembly in reality presents a co-assembly, since it implies a mutual reorganization of the assembling system and its immediate environment. Parameters used in the design of fine particles by precipitation are discussed while referring to solubility product, various measures of supersaturation levels, induction time, nucleation and crystal growth rates, interfacial energies, and the Ostwald-Lussac law of phases. Again, the main drawbacks and inadequacies of using the aforementioned parameters in tailoring the materials properties in a soft and colloidal chemical setting were particularly emphasized. The basic and practical limitations of zeta-potential analyses, routinely used to stabilize colloidal dispersions and initiate specific interactions between soft chemical entities, were also outlined. The final section of the paper reiterates the unavoidable presence of practical qualitative models in the design and control of nanoparticulate colloids, which is supported by the overwhelming complexity of quantitative relationships that govern the processes of their formation and assembly.
Also flagged:Synthesisacidhydroxyapatiteurethanemaleatedegradation
Journal Article2013-10-01No SnippetsMercado-Pagán AE, Kang Y, Ker DF, Park S, Yao J, Bishop J, Yang Y.
Show Full Abstract
Here, we report the synthesis and characterization of a novel 4-arm poly(lactic acid urethane)-maleate (4PLAUMA) elastomer and its composites with nano-hydroxyapatite (nHA) as potential weight-bearing composite. The 4PLAUMA/nHA ratios of the composites were 1:3, 2:5, 1:2 and 1:1. FTIR and NMR characterization showed urethane and maleate units integrated into the PLA matrix. Energy dispersion and Auger electron spectroscopy confirmed homogeneous distribution of nHA in the polymer matrix. Maximum moduli and strength of the composites of 4PLAUMA/nHA, respectively, are 1973.31 ± 298.53 MPa and 78.10 ± 3.82 MPa for compression, 3630.46 ± 528.32 MPa and 6.23 ± 1.44 MPa for tension, 1810.42 ± 86.10 MPa and 13.00 ± 0.72 for bending, and 282.46 ± 24.91 MPa and 5.20 ± 0.85 MPa for torsion. The maximum tensile strains of the polymer and composites are in the range of 5% to 93%, and their maximum torsional strains vary from 0.26 to 0.90. The composites exhibited very slow degradation rates in aqueous solution, from approximately 50% mass remaining for the pure polymer to 75% mass remaining for composites with high nHA contents, after a period of 8 weeks. Increase in ceramic content increased mechanical properties, but decreased maximum strain, degradation rate, and swelling of the composites. Human bone marrow stem cells and human endothelial cells adhered and proliferated on 4PLAUMA films and degradation products of the composites showed little-to-no toxicity. These results demonstrate that novel 4-arm poly(lactic acid urethane)-maleate (4PLAUMA) elastomer and its nHA composites may have potential applications in regenerative medicine.
Hepatocellular carcinoma (HCC) represents one of the most common neoplasmsworldwide. Liver trasnplantation (LT) is the treatment of choice forselected group of patients with HCC.LT is actually a consolidated therapeutic option for HCC because it cures bothtumor and underlying cirrhosis.In 1996, the publication of a pivotal prospective study on less than 50 patients,transplanted for HCC under predefined criteria (single HCC ≤ 5 cm or 3 HCC≤ 3 cm each), the so called "Milan criteria", showed a 4-year survival of 75%.However, the indication of LT for HCC treatment has evolved over recentyears. The possibility of an extension of Milan criteria as indication for LT is alreadya debated issue. Living donor LT (LDLT) is an alternative option if waiting list is long and offersthe possibility of a LT after a short time.In this review, the current indications and results of liver transplantion for HCChave been dsicusssed.
<h4>Background</h4>Corticosteroids are used to induce remission in auto-immune hepatitis.They are not universally effective; therefore, alternative treatments are needed.In this study Cysclosporine-A has been compared with prednisolone as an alternativetreatment in a randomized controlled trial. This paper is an interimanalysis of an ongoing clinical trial.<h4>Methods</h4>Sixteen years and older consenting patients were enrolled. Group-A receivedprednisolone and group-B cyclosporine-A according to a preset protocoland followed at regular intervals for 48 weeks. Final assessment was doneat week 48. Primary outcome was response rate as defined below. "Completeresponse" was defined as achieving AST and ALT in the normal range andabsence of any clinical signs of deterioration, and partial response was definedas a decrease in AST and ALT by less than half of their original values but notto within normal limit. Non-responding ones at week eight were switched tothe other arm.<h4>Results</h4>Thirty-nine patients were enrolled (24 group-A, 9 male). Mean AST andALT at baseline were higher in group-B, but other variables were comparable.At week 12, 34.8% and 64.3% of group-A and B had achieved AST and ALTin the normal range (less than 40 IU/L) respectively (p=0.081). Correspondingfigures at week 48 were 50.0% and 47.6% (p=0.62 & 0.48 respectively).At week 12, 86.9% and 85.7% of patients had AST and ALT levels less thantwice upper normal limit in groups-A and B respectively (p=0.54 & 0.42).Corresponding figures at week 48 were 90.0% for both groups. There was onetreatment failure in group-B which did not respond to prednisolone either.Serious adverse events (death and liver transplantation) occurred in group-Aonly. Serum creatinine did not change during the study period in either group.<h4>Conclusion</h4>According to our data, Cyclosporine-A is as effective as prednisolone forinduction of remission in AIH. Adverse events and serious adverse events weremore common with prednisolone.
Also flagged:thrombophiliathrombosisarterial thromboembolismhomocysteinecoagulationCRP
Journal Article2013-10-01✓ 4 SnippetsVagdatli E, Serafimidou O, Pantziarela E, Tsikopoulou F, Mitsopoulou K, Papoutsi A.
In-Text Gene Mentions
Abstract)
…The activity ofATIII, PC, PS, FVIII,…
Abstract)
…decreased activity ofATIII:1.47%, PC:1.47%, and FXII:5.9…
Text
…antithrombin-III…
Text
…ATIII…
Show Full Abstract
<h4>Objective</h4>The present study investigates the prevalence of thrombophilia in individuals with first or/and second degree family history of thromboembolism.<h4>Material-methods</h4>The study group consisted of 68 individuals with a first or second degree family history of venous or arterial thromboembolism, but without a personal history of thrombosis. The activity of ATIII, PC, PS, FVIII, FΧΙΙ and total homocysteine was measured on the ACL Advance coagulation analyzer. In addition, hemi-quantitative determination of CRP was performed to exclude an acute phase reaction. The existence of V-Leiden mutation was investigated by the modified pre-dilution method (1:5) with V-DEF. Prothrombin G20210A mutation was detected by the use of an in house PCR protocol. Family history was termed as follows: positive (thrombosis was reported in one parent and his/her family members) (group Α) or strongly positive (thrombosis was reported in both parents and their family members (group Β).<h4>Results</h4>Data analysis revealed decreased activity of ATIII:1.47%, PC:1.47%, and FXII:5.9%, increased activity of FVIII (without inflammation):11.8%, V-Leiden:13%, elevated Hcy:14.7%, and G20210A mutation:2.9%. Group A consisted of 55 individuals (74.5%), whereas group B of 16 (23.5%). The total percentage of thrombophilia was 48.5%, while the percentage within group A was 44.2% and within group B 62.5%.<h4>Conclusion</h4>The high prevalence of thrombophilia, reinforce the importance of an extensive laboratory thrombophilia screening when a family history of thromboembolism has been recorded, especially when it concerns both parents and/or their family members and even more when one or more acquired thrombophilic factors coexist.
Also flagged:BDNFTrkBPosttraumatic Stress DisorderPTSDanxiety disordermajor depression
Journal Article2013-10-01No SnippetsGreen CR, Corsi-Travali S, Neumeister A.
Show Full Abstract
Posttraumatic Stress Disorder (PTSD) is a prevalent, chronic, and disabling anxiety disorder that may develop following exposure to a traumatic event. The majority of individuals with PTSD often have comorbid psychiatric conditions such as major depression, generalized anxiety disorder, and substance use disorders, and are at increased risk for suicide. Despite the public health significance of PTSD, relatively little is known about the etiology or pathophysiology of this disorder, and pharmacotherapy development to date has been largely opportunistic instead of mechanism-based. One promising target for modulation is Tropomyosin Receptor Kinase B (TrkB), the receptor for Brain-Derived Neurotrophic Factor (BDNF), a signaling pathway important for neuronal plasticity, survival, and growth. The following discusses how genetic and environmental alterations to this signaling pathway may contribute to anatomical and functional changes in the hippocampus, amygdala, anterior cingulate cortex, ventromedial prefrontal cortex, and the nucleus accumbens. Changes in these brain regions may in turn contribute to the predisposition to or maintenance of some of the clinical manifestations of PTSD, including intrusive memories, hyperarousal, increased fear, and emotional numbing.