Gene Literature Dashboard

Viewing November 2013 — 287 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← October 2013 December 2013 →
Also flagged:Beckwith-Wiedemann syndromeovergrowth syndromemacroglossiatumorchromosomemethylation
Journal Article 2013-11-30 No Snippets Elalaoui SC, Garin I, Sefiani A, Perez de Nanclares G.
Show Full Abstract

Beckwith-Wiedemann syndrome (BWS; OMIM 130650) is a heterogeneous overgrowth syndrome characterized by visceromegaly, macroglossia, tumor predisposition, and other congenital abnormalities. BWS is usually associated with abnormalities of chromosome 11p15, including (epi)genetic changes, paternal disomy and point mutations. A number of identical twin pairs, mostly female, have been reported to be clinically discordant for BWS. Studies of monozygotic twins discordant for BWS provide more information about failure in the DNA methylation maintenance machinery during very early embryonic development. Here, we report a case of monozygotic male twins discordant for BWS phenotype. Methylation analysis of the 2 imprinted domains at 11p15.5 (H19DMR and KvDMR) was performed by methylation-specific MLPA and pyrosequencing of DNA extracted from peripheral blood and buccal swabs of both twins. Hypomethylation at KvDMR was identified in both cell types of the affected twin, whereas his healthy brother presented hypomethylation only in blood cells and a normal methylation profile in buccal swab. For diagnostic purposes, it is important to remember that twins can share fetal circulation and possibly share hematopoietic stem cells early in development; therefore, the affected and unaffected twins can share an epigenotype that will resemble partial hypomethylation. If a patient is a twin, it is valuable to obtain a sample from a tissue other than blood.

Also flagged:metaphasesex chromosomeSlnDC2organizationnucleotide
Journal Article 2013-11-29 No Snippets Oliveira SG, Cabral-de-Mello DC, Moura RC, Martins C.
Show Full Abstract

<h4>Background</h4>With the aim to increase the knowledge on the evolution of coleopteran genomes, we investigated through cytogenetics and nucleotide sequence analysis Mariner transposons in three Scarabaeinae species (Coprophanaeus cyanescens, C. ensifer and Diabroctis mimas).<h4>Results</h4>The cytogenetic mapping revealed an accumulation of Mariner transposon in the pericentromeric repetitive regions characterized as rich in heterochromatin and C0t-1 DNA fraction (DNA enriched with high and moderately repeated sequences). Nucleotide sequence analysis of Mariner revealed the presence of two major groups of Mariner copies in the three investigated coleoptera species.<h4>Conclusions</h4>The Mariner is accumulated in the centromeric area of the coleopteran chromosomes probably as a consequence of the absence of recombination in the heterochromatic regions. Our analysis detected high diversification of Mariner sequences during the evolutionary history of the group. Furthermore, comparisons between the coleopterans sequences with other insects and mammals, suggest that the horizontal transfer (HT) could have acted in the spreading of the Mariner in diverse non-related animal groups.

Also flagged:Ataxin-3spinocerebellar ataxia type 3protein degradationpolyglutamineglutaminesneurodegenerative disease
Journal Article 2013-11-29 No Snippets Evers MM, Toonen LJ, van Roon-Mom WM.
Show Full Abstract

Ataxin-3 is a ubiquitously expressed deubiqutinating enzyme with important functions in the proteasomal protein degradation pathway and regulation of transcription. The C-terminus of the ataxin-3 protein contains a polyglutamine (PolyQ) region that, when mutationally expanded to over 52 glutamines, causes the neurodegenerative disease spinocerebellar ataxia 3 (SCA3). In spite of extensive research, the molecular mechanisms underlying the cellular toxicity resulting from mutant ataxin-3 remain elusive and no preventive treatment is currently available. It has become clear over the last decade that the hallmark intracellular ataxin-3 aggregates are likely not the main toxic entity in SCA3. Instead, the soluble PolyQ containing fragments arising from proteolytic cleavage of ataxin-3 by caspases and calpains are now regarded to be of greater influence in pathogenesis. In addition, recent evidence suggests potential involvement of a RNA toxicity component in SCA3 and other PolyQ expansion disorders, increasing the pathogenic complexity. Herein, we review the functioning of ataxin-3 and the involvement of known protein and RNA toxicity mechanisms of mutant ataxin-3 that have been discovered, as well as future opportunities for therapeutic intervention.

Also flagged:chronic diseasescancerdiabetesmetabolismphenylketonuriairon overload
Journal Article 2013-11-29 ✓ 1 Snippet Hurlimann T, Menuz V, Graham J, Robitaille J, Vohl MC, Godard B.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Nutrigenomics and nutrigenetics (hereafter NGx) have stimulated expectations for beneficial applications in public health and individuals. Yet, the potential achievability of such promise is not without socioethical considerations that challenge NGx implementation. This paper focuses on the opinions of NGx researchers about potential risks raised by NGx. The results of an online survey show that these researchers (n = 126) are fairly confident about the potential benefits of NGx, and that most downplay its potential risks. Researchers in this field do not believe that NGx will reconfigure foods as medication or transform the conception of eating into a health hazard. The majority think that NGx will produce no added burden on individuals to get tested or to remain compliant with NGx recommendations, nor that NGx will threaten individual autonomy in daily food choice. The majority of researchers do not think that NGx will lead to discrimination against and/or stigmatization of people who do not comply with NGx dietary recommendations. Despite this optimism among NGx researchers, we suggest that key risk factors raised by the socioethical context in which NGx applications will be implemented need to be considered.

Also flagged:translationalphosphorylationneurofilamentcytoskeletalgluconeogenesiscarbonic anhydrase-2 and 3
Journal Article 2013-11-29 No Snippets Skeie JM, Mahajan VB.
Show Full Abstract

<h4>Purpose</h4>Human vitreoretinal diseases are due to presumed abnormal mechanical interactions between the vitreous and retina, and translational models are limited. This study determined whether nonstructural proteins and potential retinal biomarkers were expressed by the normal mouse vitreous and retina.<h4>Methods</h4>Vitreous and retina samples from mice were collected by evisceration and analyzed by liquid chromatography-tandem mass spectrometry. Identified proteins were further analyzed for differential expression and functional interactions using bioinformatic software.<h4>Results</h4>We identified 1,680 unique proteins in the retina and 675 unique proteins in the vitreous. Unbiased clustering identified protein pathways that distinguish retina from vitreous including oxidative phosphorylation and neurofilament cytoskeletal remodeling, whereas the vitreous expressed oxidative stress and innate immunology pathways. Some intracellular protein pathways were found in both retina and vitreous, such as glycolysis and gluconeogenesis and neuronal signaling, suggesting proteins might be shuttled between the retina and vitreous. We also identified human disease biomarkers represented in the mouse vitreous and retina, including carbonic anhydrase-2 and 3, crystallins, macrophage inhibitory factor, glutathione peroxidase, peroxiredoxins, S100 precursors, and von Willebrand factor.<h4>Conclusions</h4>Our analysis suggests the vitreous expresses nonstructural proteins that functionally interact with the retina to manage oxidative stress, immune reactions, and intracellular proteins may be exchanged between the retina and vitreous. This novel proteomic dataset can be used for investigating human vitreoretinopathies in mouse models. Validation of vitreoretinal biomarkers for human ocular diseases will provide a critical tool for diagnostics and an avenue for therapeutics.

Also flagged:p27Non-alcoholic steatohepatitisNASHchronic liver diseaseliver cirrhosishepatocellular carcinoma
Journal Article 2013-11-29 ✓ 1 Snippet Matsuda Y, Wakai T, Hirose Y, Osawa M, Fujimaki S, Kubota M.
In-Text Gene Mentions

…Wilson’s disease andhemochromatosis[ 38 ,…

Show Full Abstract

Non-alcoholic steatohepatitis (NASH) is a recently identified chronic liver disease, which progresses to liver cirrhosis and hepatocellular carcinoma (HCC). As the number of patients studied to date has been limited, clinically useful prognostic biomarkers of NASH-related HCC have not been available. In this study, we investigated the status of a cell-cycle regulator, p27, in NASH-related HCC. p27 has been regarded as a prognostic factor in various types of cancer patients. A total of 22 cases with NASH-related HCC were analyzed for p27 protein expression, and phosphorylation at threonine 157 (T157) and serine 10 (S10) by immunohistochemical analysis. The correlation of p27 with tumor characteristics, disease-free survival (DFS), and overall survival was analyzed. p27 expression was decreased in 13 HCCs (59%), and was significantly correlated with enlarged tumor size (p = 0.01) and increased cell proliferation (p < 0.01). Phospho-p27 at T157 and S10 was detected in four (18%) and seven (32%) cases, respectively, and patients positive for phospho-p27 (S10) showed reduced DFS (hazard ratio 7.623, p = 0.016) by univariate analysis. Further studies with more patients are required to verify the usefulness of p27 as a biomarker for predicting tumor recurrence in NASH patients.

Also flagged:tocopherollipidmetabolisminsulin resistancetriglyceridesperoxisome proliferator-activated receptor
Journal Article 2013-11-29 No Snippets Kim DY, Kim J, Ham HJ, Choue R.
Show Full Abstract

High-fat diet up-regulates either insulin resistance or triglycerides, which is assumed to be related to the expression of peroxisome proliferator-activated receptor (PPAR)-α and PPAR-γ. The beneficial effects of vitamin E on insulin resistance are well known; however, it is not clear if vitamin E with a high-fat diet alters the expression of PPAR-α and PPAR-γ. We investigated the effects of d-α-tocopherol supplementation on insulin sensitivity, blood lipid profiles, lipid peroxidation, and the expression of PPAR-α and PPAR-γ in a high-fat (HF) diet-fed male C57BL/6J model of insulin resistance. The animals were given a regular diet (CON; 10% fat), a HF diet containing 45% fat, or a HF diet plus d-α-tocopherol (HF-E) for a period of 20 weeks. The results showed that the HF diet induced insulin resistance and altered the lipid profile, specifically the triglyceride (TG) and total cholesterol (TC) levels (P < 0.05). In this animal model, supplementation with d-α-tocopherol improved insulin resistance as well as the serum levels of TG and very-low-density lipoprotein-cholesterol (VLDL-C) (P < 0.05). Moreover, the treatment decreased the levels of malondialdehyde (MDA) in the serum and liver while increasing hepatic PPAR-α expression and decreasing PPAR-γ expression. In conclusion, the oral administration of d-α-tocopherol with a high-fat diet had positive effects on insulin resistance, lipid profiles, and oxidative stress through the expression of PPAR-α and PPAR-γ in a high-fat diet-fed male mice.

Also flagged:nucleotidegene expressionneurodegenerative disorderscardio-vascular diseasesmetabolic disorderstranscriptional regulators
Journal Article 2013-11-29 No Snippets Srinivasan S, Selvan ST, Archunan G, Gulyas B, Padmanabhan P.
Show Full Abstract

MicroRNAs (miRNAs), an abundant class of ~22-nucleotide non-coding RNAs, regulate the expression of genes at post transcriptional level. MiRNAs are important regulators of eukaryotic gene expression and therefore implicated in a wide range of biological processes. The miRNA-related genetic alterations are possibly more implicated human diseases than currently appreciated. Genetic variants in miRNA target sites, called miRNA genes are identified to be associated with human diseases. This review discusses about the role of micro-RNA genes in various human diseases such as neurodegenerative disorders, cardio-vascular diseases, and metabolic disorders, and how they can be targeted as a new therapeutic tool in future with reference to drug discoveries/ development.

Also flagged:thrombocytosishaemolytic anaemiavein thrombosispyrimidine 5′-nucleotidasecongenital haemolytic anaemiashaematological disorders
Journal Article 2013-11-28 ✓ 1 Snippet Al-Jafar HA, Taqi A, Madda JP, Abdullah TA.
In-Text Gene Mentions

HFE

Show Full Abstract

Reactive and redistributional thrombocytosis is a well-known postsplenectomy occurrence .Usually it is transient and it rarely reaches extreme levels. We report a rare case of haemolytic anaemia where splenectomy was carried out following trauma to a massively enlarged spleen and was followed by extreme sustained thrombocytosis associated with extensive portal, splenic and mesenteric vein thrombosis despite standard antithrombotic prophylaxis.

Also flagged:serotoninreuptakedepressionneurogenesisanxietycorticosterone
Journal Article 2013-11-28 ✓ 1 Snippet Mendez-David I, David DJ, Darcet F, Wu MV, Kerdine-Römer S, Gardier AM, Hen R.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Selective serotonin reuptake inhibitors (SSRIs) display a delayed onset of action of several weeks. Past work in naive rats showed that 5-HT₄ receptor agonists had rapid effects on depression-related behaviors and on hippocampal neurogenesis. We decided to investigate whether 5-HT₄ receptor stimulation was necessary for the effects of SSRIs in a mouse model of anxiety/depression, and whether hippocampal neurogenesis contributed to these effects. Using the mouse corticosterone model of anxiety/depression, we assessed whether chronic treatment with a 5-HT₄ receptor agonist (RS67333, 1.5 mg/kg/day) had effects on anxiety- and depression-related behaviors, as well as on hippocampal neurogenesis in comparison with chronic fluoxetine treatment (18 mg/kg/day). Then, using our anxiety/depression model combined with ablation of hippocampal neurogenesis, we investigated whether neurogenesis was necessary for the behavioral effects of subchronic (7 days) or chronic (28 days) RS67333 treatment. We also assessed whether a 5-HT₄ receptor antagonist (GR125487, 1 mg/kg/day) could prevent the behavioral and neurogenic effects of fluoxetine. Chronic treatment with RS67333, similar to fluoxetine, induced anxiolytic/antidepressant-like activity and stimulated adult hippocampal neurogenesis, specifically facilitating maturation of newborn neurons. However, unlike fluoxetine, anxiolytic effects of RS67333 were already present after 7 days and did not require hippocampal neurogenesis. Chronic treatment with GR125487 prevented both anxiolytic/antidepressant-like and neurogenic effects of fluoxetine, indicating that 5-HT₄ receptor activation is necessary for these effects of SSRIs. 5-HT₄ receptor stimulation could represent an innovative and rapid onset therapeutic approach to treat depression with comorbid anxiety.

Also flagged:ContCH2synthesisethylacetatecarbodiimide
Journal Article 2013-11-28 No Snippets El-Faham A, Al Marhoon Z, Abdel-Megeed A, Albericio F.
Show Full Abstract

OxymaPure (ethyl 2-cyano-2-(hydroxyimino)acetate) was tested as an additive for use in the carbodiimide (DIC) approach for the synthesis of a novel series of α-ketoamide derivatives (4-[2-(2-acetylaminophenyl)-2-oxo-acetylamino]benzoyl amino acid ester derivatives). OxymaPure showed clear superiority to HOBt/DIC or carbodiimide alone in terms of purity and yield. The title compounds were synthesized via the ring opening of N-acylisatin. First, N-acetylisatin was reacted with 4-aminobenzoic acid under conventional heating as well as microwave irradiation to afford 4-(2-(2-acetamidophenyl)-2-oxoacetamido)benzoic acid. This α-ketoamide was coupled to different amino acid esters using OxymaPure/DIC as a coupling reagent to afford 4-[2-(2-acetylaminophenyl)-2-oxo-acetylamino]benzoyl amino acid ester derivatives in excellent yield and purity. The synthesized compounds were characterized using FT-IR, NMR, and elemental analysis.

Also flagged:L-polyglutaminePolyglutaminefibrilsglutaminepeptidesL-polyQ proteins
Journal Article 2013-11-28 ✓ 1 Snippet Kar K, Arduini I, Drombosky KW, van der Wel PC, Wetzel R.
In-Text Gene Mentions

Htt

Show Full Abstract

Polyglutamine (polyQ) amyloid fibrils are observed in disease tissue and have been implicated as toxic agents responsible for neurodegeneration in expanded CAG repeat diseases such as Huntington's disease. Despite intensive efforts, the mechanism of amyloid toxicity remains unknown. As a novel approach to probing polyQ toxicity, we investigate here how some cellular and physical properties of polyQ amyloid vary with the chirality of the glutamine residues in the polyQ. We challenged PC12 cells with small amyloid fibrils composed of either L- or D-polyQ peptides and found that D-fibrils are as cytotoxic as L-fibrils. We also found using fluorescence microscopy that both aggregates effectively seed the aggregation of cell-produced L-polyQ proteins, suggesting a surprising lack of stereochemical restriction in seeded elongation of polyQ amyloid. To investigate this effect further, we studied chemically synthesized D- and L-polyQ in vitro. We found that, as expected, D-polyQ monomers are not recognized by proteins that recognize L-polyQ monomers. However, amyloid fibrils prepared from D-polyQ peptides can efficiently seed the aggregation of L-polyQ monomers in vitro, and vice versa. This result is consistent with our cell results on polyQ recruitment but is inconsistent with previous literature reports on the chiral specificity of amyloid seeding. This chiral cross-seeding can be rationalized by a model for seeded elongation featuring a "rippled β-sheet" interface between seed fibril and docked monomers of opposite chirality. The lack of chiral discrimination in polyQ amyloid cytotoxicity is consistent with several toxicity mechanisms, including recruitment of cellular polyQ proteins.

Also flagged:ERK1ADAMTS5gene expressionprotein kinase CPKCextracellular
Journal Article 2013-11-28 ✓ 1 Snippet Tsirimonaki E, Fedonidis C, Pneumaticos SG, Tragas AA, Michalopoulos I, Mangoura D.
In-Text Gene Mentions

…R TGCTAGACACGCTTGAGTGC ;SOX6F GATGCCA TCAACTCCACAGC…

Show Full Abstract

The protein kinase C (PKC) signaling, a major regulator of chondrocytic differentiation, has been also implicated in pathological extracellular matrix remodeling, and here we investigate the mechanism of PKCε-dependent regulation of the chondrocytic phenotype in human nucleus pulposus (NP) cells derived from herniated disks. NP cells from each donor were successfully propagated for 25+ culture passages, with remarkable tolerance to repeated freeze-and-thaw cycles throughout long-term culturing. More specifically, after an initial downregulation of COL2A1, a stable chondrocytic phenotype was attested by the levels of mRNA expression for aggrecan, biglycan, fibromodulin, and lumican, while higher expression of SOX-trio and Patched-1 witnessed further differentiation potential. NP cells in culture also exhibited a stable molecular profile of PKC isoforms: throughout patient samples and passages, mRNAs for PKC α, δ, ε, ζ, η, ι, and µ were steadily detected, whereas β, γ, and θ were not. Focusing on the signalling of PKCε, an isoform that may confer protection against degeneration, we found that activation with the PKCε-specific activator small peptide ψεRACK led sequentially to a prolonged activation of ERK1/2, increased abundance of the early gene products ATF, CREB1, and Fos with concurrent silencing of transcription for Ki67, and increases in mRNA expression for aggrecan. More importantly, ψεRACK induced upregulation of hsa-miR-377 expression, coupled to decreases in ADAMTS5 and cleaved aggrecan. Therefore, PKCε activation in late passage NP cells may represent a molecular basis for aggrecan availability, as part of an PKCε/ERK/CREB/AP-1-dependent transcriptional program that includes upregulation of both chondrogenic genes and microRNAs. Moreover, this pathway should be considered as a target for understanding the molecular mechanism of IVD degeneration and for therapeutic restoration of degenerated disks.

Also flagged:Bipolar DisorderAnxiety DisordersCREBpsychiatric disorderanxiety spectrum disordersalcohol abuse
Journal Article 2013-11-28 ✓ 4 Snippets Kerner B, Rao AR, Christensen B, Dandekar S, Yourshaw M, Nelson SF.
In-Text Gene Mentions

…GADD45A, GOLGB1, PLSCR5,VRK2, MESDC2, and FGGY.…

…family, member 5),VRK2(vaccinia related kinase…

VRK2is a serine/threonine…

…Activation ofVRK2results in reduced…

Show Full Abstract

Bipolar disorder is a common, complex, and severe psychiatric disorder with cyclical disturbances of mood and a high suicide rate. Here, we describe a family with four siblings, three affected females and one unaffected male. The disease course was characterized by early-onset bipolar disorder and co-morbid anxiety spectrum disorders that followed the onset of bipolar disorder. Genetic risk factors were suggested by the early onset of the disease, the severe disease course, including multiple suicide attempts, and lack of adverse prenatal or early life events. In particular, drug and alcohol abuse did not contribute to the disease onset. Exome sequencing identified very rare, heterozygous, and likely protein-damaging variants in eight brain-expressed genes: IQUB, JMJD1C, GADD45A, GOLGB1, PLSCR5, VRK2, MESDC2, and FGGY. The variants were shared among all three affected family members but absent in the unaffected sibling and in more than 200 controls. The genes encode proteins with significant regulatory roles in the ERK/MAPK and CREB-regulated intracellular signaling pathways. These pathways are central to neuronal and synaptic plasticity, cognition, affect regulation and response to chronic stress. In addition, proteins in these pathways are the target of commonly used mood-stabilizing drugs, such as tricyclic antidepressants, lithium, and valproic acid. The combination of multiple rare, damaging mutations in these central pathways could lead to reduced resilience and increased vulnerability to stressful life events. Our results support a new model for psychiatric disorders, in which multiple rare, damaging mutations in genes functionally related to a common signaling pathway contribute to the manifestation of bipolar disorder.

Also flagged:magnesiumcalcium phosphatehydroxyapatitetitaniumCell adhesioncell proliferation
Journal Article 2013-11-28 No Snippets Park KD, Lee BA, Piao XH, Lee KK, Park SW, Oh HK, Kim YJ, Park HJ.
Show Full Abstract

<h4>Purpose</h4>The aim of this study was to evaluate the surface properties and in vitro bioactivity to osteoblasts of magnesium and magnesium-hydroxyapatite coated titanium.<h4>Materials and methods</h4>Themagnesium (Mg) and magnesium-hydroxyapatite (Mg-HA) coatings on titanium (Ti) substrates were prepared by radio frequency (RF) and direct current (DC) magnetron sputtering.The samples were divided into non-coated smooth Ti (Ti-S group), Mg coatinggroup (Ti-Mg group), and Mg-HA coating group (Ti-MgHA group).The surface properties were evaluated using scanning electron microscopy (SEM) and X-ray photoelectron spectroscopy (XPS). The surface roughness was evaluated by atomic force microscopy (AFM). Cell adhesion, cell proliferation and alkaline phosphatase (ALP) activity were evaluated using MC3T3-E1 cells. Reverse transcription polymerase chain reaction (RT-PCR) analysis was performed.<h4>Results</h4>Cross-sectional SEM images showed that Mg and Mg-HA depositionson titanium substrates were performed successfully. The surface roughness appeared to be similaramong the three groups. Ti-MgHA and Ti-Mg group had improved cellular responses with regard to the proliferation, alkaline phosphatase (ALP) activity, and bone-associated markers, such as bone sialoprotein (BSP) and osteocalcin (OCN) mRNA compared to those of Ti-S group. However, the differences between Ti-Mg group and Ti-MgHA group were not significant, in spite of the tendency of higher proliferation, ALP activity and BSP expression in Ti-MgHA group.<h4>Conclusion</h4>Mg and Mg-HAcoatings could stimulate the differentiation into osteoblastic MC3T3-E1 cells, potentially contributing to rapid osseointegration.

Also flagged:netrin-1axon guidance moleculelamininorganogenesisangiogenesisCD3
Journal Article 2013-11-28 ✓ 5 Snippets Guo XK, Liu YF, Zhou Y, Sun XY, Qian XP, Zhang Y, Zhang J.
In-Text Gene Mentions

…in colorectal cancer (DCC) and neogenin, the…

…oattractive Netrin-1 receptorsDCCor neogenin are…

…UNC5H2 (Unc5b) withDCCleads to a…

…everse: TTCTCAATGCCTCTCCTACTC;DCC, forward: CTCTTCACAGGATTGGAGA…

…AlthoughDCC, DSCAM, and Unc5d…

Show Full Abstract

Netrin-1, a known axon guidance molecule, being a secreted laminin-related molecule, has been suggested to be involved in multiple physiological and pathological conditions, such as organogenesis, angiogenesis, tumorigenesis, and inflammation-mediated tissue injury. However, its function in thymocyte development is still unknown. Here, we demonstrate that Netrin-1 is expressed in mouse thymus tissue and is primarily expressed in thymic stromal cells, and the expression of Netrin-1 in thymocytes can be induced by anti-CD3 antibody or IL-7 treatment. Importantly, Netrin-1 mediates the adhesion of thymocytes, and this effect is comparable to or greater than that of fibronectin. Furthermore, Netrin-1 specifically promotes the chemotaxis of CXCL12. These suggest that Netrin-1 may play an important role in thymocyte development.

Also flagged:oligonucleotidesargonaute 2AGO2gene silencingHuntingtinAtaxin-3
Journal Article 2013-11-27 ✓ 2 Snippets Aiba Y, Hu J, Liu J, Xiang Q, Martinez C, Corey DR.
In-Text Gene Mentions

…genes Huntingtin (HTT) and Ataxin-3…

HTT

Show Full Abstract

Unlocked nucleic acid (UNA) is an acyclic analogue of RNA that can be introduced into RNA or DNA oligonucleotides. The increased flexibility conferred by the acyclic structure fundamentally affects the strength of base pairing, creating opportunities for improved applications and new insights into molecular recognition. Here we test how UNA substitutions affect allele-selective inhibition of expression of trinucleotide repeat genes Huntingtin (HTT) and Ataxin-3 (ATX-3). We find that the either the combination of mismatched bases and UNA substitutions or UNA substitutions alone can improve potency and selectivity. Inhibition is potent, and selectivities of >40-fold for inhibiting mutant versus wild-type expression can be achieved. Surprisingly, even though UNA preserves the potential for complete base pairing, the introduction of UNA substitutions at central positions within fully complementary duplexes leads to >19-fold selectivity. Like mismatched bases, the introduction of central UNA bases disrupts the potential for cleavage of substrate by argonaute 2 (AGO2) during gene silencing. UNA-substituted duplexes are as effective as other strategies for allele-selective silencing of trinucleotide repeat disease genes. Modulation of AGO2 activity by the introduction of UNA substitutions demonstrates that backbone flexibility is as important as base pairing for catalysis of fully complementary duplex substrates. UNA can be used to tailor RNA silencing for optimal properties and allele-selective action.

Also flagged:lipopeptideoleoylpaclitaxelwatercancertumor
Journal Article 2013-11-27 No Snippets Zhang P, Lu J, Huang Y, Zhao W, Zhang Y, Zhang X, Li J, Venkataramanan R, Gao X, Li S.
Show Full Abstract

Micelles are attractive delivery systems for hydrophobic drugs due to their small size and the ease of application. However, the limited drug loading capacity and the intrinsic poor stability of drug-loaded formulations represent two major issues for some micellar systems. In this study, we designed and synthesized a micelle-forming PEG-lipopeptide conjugate with two Fmoc groups located at the interfacial region, and two oleoyl chains as the hydrophobic core. The significance of Fmoc groups as a broadly applicable drug-interactive motif that enhances the carrier-drug interaction was examined using eight model drugs of diverse structures. Compared with an analogue without carrying a Fmoc motif, PEG5000-(Fmoc-OA)₂ demonstrated a lower value of critical micelle concentration and three-fold increases of loading capacity for paclitaxel (PTX). These micelles showed tubular structures and small particle sizes (∼70 nm), which can be lyophilized and readily reconstituted with water without significant changes in particle sizes. Fluorescence quenching study illustrated the Fmoc/PTX π-π stacking contributes to the carrier/PTX interaction, and drug-release study demonstrated a much slower kinetics than Taxol, a clinically used PTX formulation. PTX/PEG5000-(Fmoc-OA)₂ mixed micelles exhibited higher levels of cytotoxicity than Taxol in several cancer cell lines and more potent inhibitory effects on tumor growth than Taxol in a syngeneic murine breast cancer model (4T1.2). We have further shown that seven other drugs can be effectively formulated in PEG5000-(Fmoc-OA)₂ micelles. Our study suggests that micelle-forming PEG-lipopeptide surfactants with interfacial Fmoc motifs may represent a promising formulation platform for a broad range of drugs with diverse structures.

Also flagged:phytoestrogensbisphenolbisphenol Aestrogen receptorsERERβ
Journal Article 2013-11-27 No Snippets Katchy A, Pinto C, Jonsson P, Nguyen-Vu T, Pandelova M, Riu A, Schramm KW, Samarov D, Gustafsson JÅ, Bondesson M, Williams C.
Show Full Abstract

Endocrine-disrupting chemicals (EDC) are abundant in our environment. A number of EDCs, including bisphenol A (BPA) can bind to the estrogen receptors (ER), ERα and ERβ, and may contribute to estrogen-linked diseases such as breast cancer. Early exposure is of particular concern; many EDCs cross the placenta and infants have measurable levels of, eg, BPA. In addition, infants are frequently fed soy-based formula (SF) that contains phytoestrogens. Effects of combined exposure to xeno- and phytoestrogens are poorly studied. Here, we extensively compared to what extent BPA, genistein, and an extract of infant SF mimic estrogen-induced gene transcription and cell proliferation. We investigated ligand-specific effects on ER activation in HeLa-ERα and ERβ reporter cells; on proliferation, genome-wide gene regulation and non-ER-mediated effects in MCF7 breast cancer cells; and how coexposure influenced these effects. The biological relevance was explored using enrichment analyses of differentially regulated genes and clustering with clinical breast cancer profiles. We demonstrate that coexposure to BPA and genistein, or SF, results in increased functional and transcriptional estrogenic effects. Using statistical modeling, we determine that BPA and phytoestrogens act in an additive manner. The proliferative and transcriptional effects of the tested compounds mimic those of 17β-estradiol, and are abolished by cotreatment with an ER antagonist. Gene expression profiles induced by each compound clustered with poor prognosis breast cancer, indicating that exposure may adversely affect breast cancer prognosis. This study accentuates that coexposure to BPA and soy-based phytoestrogens results in additive estrogenic effects, and may contribute to estrogen-linked diseases, including breast cancer.

Also flagged:ironTfr2iron deficiency anemiaHepcidin-peptide
Journal Article 2013-11-27 ✓ 5 Snippets McDonald CJ, Wallace DF, Ostini L, Subramaniam VN.
In-Text Gene Mentions

The hemochromatosis-associated proteins Hfe and transferrin receptor 2 (Tfr2) are known upstream regulators of hepcidin, although their precise roles are still unclear.

…through analysis ofHfe/Tfr2-null mice.…

…hromatosis-associated proteinsHfeand transferrin receptor…

…roles of theHfeand Tfr2, we…

…we subjected wild-type,Hfe(-/-), Tfr2(-/-), and Hfe(-/-)…

Show Full Abstract

Treatment for iron deficiency anemia can involve iron supplementation via dietary or parenteral routes that result in different cellular iron distributions. The effect of the administered iron on the iron regulatory system and hepcidin in the liver has not been well studied. Hepcidin, the liver-expressed central iron-regulatory peptide, is itself regulated through the bone morphogenetic protein (BMP)/SMAD signaling pathway. Specifically, Bmp6 expression is upregulated in response to iron and induces hepcidin through phosphorylation of Smad1/5/8. The hemochromatosis-associated proteins Hfe and transferrin receptor 2 (Tfr2) are known upstream regulators of hepcidin, although their precise roles are still unclear. To investigate the mechanisms of this regulation and the roles of the Hfe and Tfr2, we subjected wild-type, Hfe(-/-), Tfr2(-/-), and Hfe(-/-)/Tfr2(-/-) mice to iron loading via dietary or parenteral routes. Systematic analysis demonstrated that Tfr2 is required for effective upregulation of Bmp6 in response to hepatocyte iron, but not nonparenchymal iron. Hfe is not required for Bmp6 upregulation, regardless of iron localization, but rather, is required for efficient downstream transmission of the regulatory signal. Our results demonstrate that Hfe and Tfr2 play separate roles in the regulatory responses to iron compartmentalized in different cell types and further elucidates the regulatory mechanisms controlling iron homeostasis.

Also flagged:nucleosomeorganizationnucleosomesDNA binding proteinsbindingembryogenesis
Journal Article 2013-11-27 No Snippets Zhang Y, Vastenhouw NL, Feng J, Fu K, Wang C, Ge Y, Pauli A, van Hummelen P, Schier AF, Liu XS.
Show Full Abstract

The organization of nucleosomes influences transcriptional activity by controlling accessibility of DNA binding proteins to the genome. Genome-wide nucleosome binding profiles have identified a canonical nucleosome organization at gene promoters, where arrays of well-positioned nucleosomes emanate from nucleosome-depleted regions. The mechanisms of formation and the function of canonical promoter nucleosome organization remain unclear. Here we analyze the genome-wide location of nucleosomes during zebrafish embryogenesis and show that well-positioned nucleosome arrays appear on thousands of promoters during the activation of the zygotic genome. The formation of canonical promoter nucleosome organization is independent of DNA sequence preference, transcriptional elongation, and robust RNA polymerase II (Pol II) binding. Instead, canonical promoter nucleosome organization correlates with the presence of histone H3 lysine 4 trimethylation (H3K4me3) and affects future transcriptional activation. These findings reveal that genome activation is central to the organization of nucleosome arrays during early embryogenesis.

Also flagged:IRP2ironmetabolismcanceriron regulatory protein 2breast cancer
Journal Article 2013-11-27 ✓ 2 Snippets Wang W, Deng Z, Hatcher H, Miller LD, Di X, Tesfay L, Sui G, D'Agostino RB, Torti FM, Torti SV.
In-Text Gene Mentions

hemochromatosis

HFE

Show Full Abstract

Experimental and epidemiologic evidence suggests that dysregulation of proteins involved in iron metabolism plays a critical role in cancer. The mechanisms by which cancer cells alter homeostatic iron regulation are just beginning to be understood. Here, we demonstrate that iron regulatory protein 2 (IRP2) plays a key role in iron accumulation in breast cancer. Although both IRP1 and IRP2 are overexpressed in breast cancer, the overexpression of IRP2, but not IRP1, is associated with decreased ferritin H and increased transferrin receptor 1 (TfR1). Knockdown of IRP2 in triple-negative MDA-MB-231 human breast cancer cells increases ferritin H expression and decreases TfR1 expression, resulting in a decrease in the labile iron pool. Further, IRP2 knockdown reduces growth of MDA-MB-231 cells in the mouse mammary fat pad. Gene expression microarray profiles of patients with breast cancer demonstrate that increased IRP2 expression is associated with high-grade cancer. Increased IRP2 expression is observed in luminal A, luminal B, and basal breast cancer subtypes, but not in breast tumors of the ERBB2 molecular subtype. These results suggest that dysregulation of IRP2 is an early nodal point underlying altered iron metabolism in breast cancer and may contribute to poor outcome of some patients with breast cancer.

Also flagged:Ldb1erythropoiesisLmo2Gata1Tal1Klf1
Journal Article 2013-11-27 ✓ 1 Snippet Love PE, Warzecha C, Li L.
In-Text Gene Mentions

Sox6

Show Full Abstract

Elucidation of the genetic pathways that control red blood cell development has been a central goal of erythropoiesis research over the past decade. Notably, data from several recent studies have provided new insights into the regulation of erythroid gene transcription. Transcription profiling demonstrates that erythropoiesis is mainly controlled by a small group of lineage-restricted transcription factors [Gata binding protein 1 (Gata1), T cell acute lymphocytic leukemia 1 protein (Tal1), and Erythroid Kruppel-like factor (EKLF; henceforth referred to as Klf1)]. Binding-site mapping using ChIP-Seq indicates that most DNA-bound Gata1 and Tal1 proteins are contained within higher order complexes (Ldb1 complexes) that include the nuclear adapters Ldb1 and Lmo2. Ldb1 complexes regulate Klf1, and Ldb1 complex-binding sites frequently colocalize with Klf1 at erythroid genes and cis-regulatory elements, indicating strong functional synergy between Gata1, Tal1, and Klf1. Together with new data demonstrating that Ldb1 can mediate long-range promoter-enhancer interactions, these findings provide a foundation for the first comprehensive models of the global regulation of erythroid gene transcription.

Also flagged:alcohol use disordersalcohol use disorderHTR4pathogenesisalcohol dependenceAD
Journal Article 2013-11-27 ✓ 3 Snippets Xu Y, Guo WJ, Wang Q, Lanzi G, Luobu O, Ma XH, Wang YC, Zhen P, Deng W, Liu X, Zhuoma B, Liu XH, Li T, Hu X.
In-Text Gene Mentions

…of serotonin transporter (5-HTT) and serotonin (5-HT)…

…including DRD2 ,5-HTT, and HTR1B…

…transporter gene (5-HTT) is an…

Show Full Abstract

Studies of linkage and association in various ethnic populations have revealed many predisposing genes of multiple neurotransmitter systems for alcohol use disorders (AUD). However, evidence often is contradictory regarding the contribution of most candidate genes to the susceptibility of AUD. We, therefore, performed a case-control study to investigate the possible associations of genes selected from multiple neurotransmitter systems with AUD in a homogeneous Tibetan community population in China. AUD cases (N = 281) with an alcohol use disorder identification test (AUDIT) score ≥10, as well as healthy controls (N = 277) with an AUDIT score ≤5, were recruited. All participants were genotyped for 366 single nucleotide polymorphisms (SNPs) of 34 genes selected from those involved in neurotransmitter systems. Association analyses were performed using PLINK version 1.07 software. Allelic analyses before adjustment for multiple tests showed that 15 polymorphisms within seven genes were associated with AUD (p<0.05). After adjustment for the number of SNPs genotyped within each gene, only the association of a single marker (rs10044881) in HTR4 remained statistically significant. Haplotype analysis for two SNPs in HTR4 (rs17777298 and rs10044881) showed that the haplotype AG was significantly associated with the protective effect for AUD. In conclusion, the present study discovered that the HTR4 gene may play a marked role in the pathogenesis of AUD. In addition, this Tibetan population sample marginally replicated previous evidence regarding the associations of six genes in AUD.

Also flagged:Hsp90molecular chaperone Hsp90cancersynthesisgene expressionprotein synthesis
Journal Article 2013-11-27 No Snippets Fierro-Monti I, Echeverria P, Racle J, Hernandez C, Picard D, Quadroni M.
Show Full Abstract

The molecular chaperone Hsp90-dependent proteome represents a complex protein network of critical biological and medical relevance. Known to associate with proteins with a broad variety of functions termed clients, Hsp90 maintains key essential and oncogenic signalling pathways. Consequently, Hsp90 inhibitors are being tested as anti-cancer drugs. Using an integrated systematic approach to analyse the effects of Hsp90 inhibition in T-cells, we quantified differential changes in the Hsp90-dependent proteome, Hsp90 interactome, and a selection of the transcriptome. Kinetic behaviours in the Hsp90-dependent proteome were assessed using a novel pulse-chase strategy (Fierro-Monti et al., accompanying article), detecting effects on both protein stability and synthesis. Global and specific dynamic impacts, including proteostatic responses, are due to direct inhibition of Hsp90 as well as indirect effects. As a result, a decrease was detected in most proteins that changed their levels, including known Hsp90 clients. Most likely, consequences of the role of Hsp90 in gene expression determined a global reduction in net de novo protein synthesis. This decrease appeared to be greater in magnitude than a concomitantly observed global increase in protein decay rates. Several novel putative Hsp90 clients were validated, and interestingly, protein families with critical functions, particularly the Hsp90 family and cofactors themselves as well as protein kinases, displayed strongly increased decay rates due to Hsp90 inhibitor treatment. Remarkably, an upsurge in survival pathways, involving molecular chaperones and several oncoproteins, and decreased levels of some tumour suppressors, have implications for anti-cancer therapy with Hsp90 inhibitors. The diversity of global effects may represent a paradigm of mechanisms that are operating to shield cells from proteotoxic stress, by promoting pro-survival and anti-proliferative functions. Data are available via ProteomeXchange with identifier PXD000537.

Also flagged:neuropsychiatric disordersschizophreniaautismaxonNeogenindifferentiation
Journal Article 2013-11-27 ✓ 5 Snippets O'Leary C, Cole SJ, Langford M, Hewage J, White A, Cooper HM.
In-Text Gene Mentions

These Neo and DCC domains share 65 to 70% amino acid identity [34], [35], [76].

DCC, a netrin receptor…

…best demonstrated byDCCwhich exhibits chemoattraction…

…III domains ofDCC[74] , [75]…

…These Neo andDCCdomains share 65…

Show Full Abstract

The etiology of neuropsychiatric disorders, including schizophrenia and autism, has been linked to a failure to establish the intricate neural network comprising excitatory pyramidal and inhibitory interneurons during neocortex development. A large proportion of cortical inhibitory interneurons originate in the medial ganglionic eminence (MGE) of the ventral telencephalon and then migrate through the ventral subventricular zone, across the corticostriatal junction, into the embryonic cortex. Successful navigation of newborn interneurons through the complex environment of the ventral telencephalon is governed by spatiotemporally restricted deployment of both chemorepulsive and chemoattractive guidance cues which work in concert to create a migratory corridor. Despite the expanding list of interneuron guidance cues, cues responsible for preventing interneurons from re-entering the ventricular zone of the ganglionic eminences have not been well characterized. Here we provide evidence that the chemorepulsive axon guidance cue, RGMa (Repulsive Guidance Molecule a), may fulfill this function. The ventricular zone restricted expression of RGMa in the ganglionic eminences and the presence of its receptor, Neogenin, in the ventricular zone and on newborn and maturing MGE-derived interneurons implicates RGMa-Neogenin interactions in interneuron differentiation and migration. Using an in vitro approach, we show that RGMa promotes interneuron differentiation by potentiating neurite outgrowth. In addition, using in vitro explant and migration assays, we provide evidence that RGMa is a repulsive guidance cue for newborn interneurons migrating out of the ganglionic eminence ventricular zone. Intriguingly, the alternative Neogenin ligand, Netrin-1, had no effect on migration. However, we observed complete abrogation of RGMa-induced chemorepulsion when newborn interneurons were simultaneously exposed to RGMa and Netrin-1 gradients, suggesting a novel mechanism for the tight regulation of RGMa-guided interneuron migration. We propose that during peak neurogenesis, repulsive RGMa-Neogenin interactions drive interneurons into the migratory corridor and prevent re-entry into the ventricular zone of the ganglionic eminences.

Also flagged:gene expressionagingmetabolismBAK1cell cycleCDKN1B
Journal Article 2013-11-27 ✓ 1 Snippet Abdul Rahman A, Abdul Karim N, Abdul Hamid NA, Harun R, Ngah WZ.
In-Text Gene Mentions

…member 4 (TNFSF4), CD40 ligand…

Show Full Abstract

Mechanisms determining both functional rate of decline and the time of onset in aging remain elusive. Studies of the aging process especially those involving the comparison of long-lived individuals and young controls are fairly limited. Therefore, this research aims to determine the differential gene expression profile in related individuals from villages in Pahang, Malaysia. Genome-wide microarray analysis of 18 samples of peripheral blood mononuclear cells (PBMCs) from two groups: octo/nonagenarians (80-99 years old) and their offspring (50.2 ± 4.0 years old) revealed that 477 transcripts were age-induced and 335 transcripts were age-repressed with fold changes ≥1.2 in octo/nonagenarians compared to offspring. Interestingly, changes in gene expression were associated with increased capacity for apoptosis (BAK1), cell cycle regulation (CDKN1B), metabolic process (LRPAP1), insulin action (IGF2R), and increased immune and inflammatory response (IL27RA), whereas response to stress (HSPA8), damage stimulus (XRCC6), and chromatin remodelling (TINF2) pathways were downregulated in octo/nonagenarians. These results suggested that systemic telomere maintenance, metabolism, cell signalling, and redox regulation may be important for individuals to maintain their healthy state with advancing age and that these processes play an important role in the determination of the healthy life-span.

Neonatal hemochromatosis.

Also flagged:Neonatal hemochromatosisliver diseaseextrahepatic siderosisGestational alloimmune liver diseaseGALDIgG
Journal Article 2013-11-27 ✓ 1 Snippet Feldman AG, Whitington PF.
In-Text Gene Mentions

…NeonatalHemochromatosis

Show Full Abstract

Neonatal hemochromatosis is a clinical condition in which severe liver disease in the newborn is accompanied by extrahepatic siderosis. Gestational alloimmune liver disease (GALD) has been established as the cause of fetal liver injury resulting in nearly all cases of NH. In GALD, a women is exposed to a fetal antigen that she does not recognize as "self" and subsequently begins to produce IgG antibodies that are directed against fetal hepatocytes. These antibodies bind to fetal liver antigen and activate the terminal complement cascade resulting in hepatocyte injury and death. GALD can cause congenital cirrhosis or acute liver failure with and without iron overload and siderosis. Practitioners should consider GALD in cases of fetal demise, stillbirth, and neonatal acute liver failure. Identification of infants with GALD is important as treatment is available and effective for subsequent pregnancies.

Also flagged:PTSDbehavioraltraumaescitalopramPEpost-traumatic stress disorder
Journal Article 2013-11-27 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:organizationmental disordersEstrogen HormoneAlzheimer's DiseaseEstrogenEstradiol
Journal Article 2013-11-27 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

5-HTT

Show Full Abstract

No abstract available.

Also flagged:Agingcognitive deficitsbehavioralcholesterolobesitycognitive impairments
Journal Article 2013-11-27 ✓ 2 Snippets Unknown Authors
In-Text Gene Mentions

…on serotonin transporters (5-HTT), and on serotonin…

…and paroxetine on5-HTTand 5-HT1A receptors…

Show Full Abstract

No abstract available.

Also flagged:fibromyalgiaJuvenile-onsetsleepdysautonomiamood disordersanxiety
Journal Article 2013-11-26 ✓ 1 Snippet Kashikar-Zuck S, Ting TV.
In-Text Gene Mentions

5-HTT transporter

Show Full Abstract

Juvenile-onset fibromyalgia (JFM) is a poorly understood chronic pain condition most commonly affecting adolescent girls. The condition is characterized by widespread musculoskeletal pain and other associated symptoms, including fatigue, nonrestorative sleep, headaches, irritable bowel symptoms, dysautonomia and mood disorders such as anxiety and/or depression. In the past few years, there has been a greater focus on understanding JFM in adolescents. Research studies have provided insight into the clinical characteristics of this condition and its effect on both short-term and long-term psychosocial and physical functioning. The importance of early and effective intervention is being recognized, as research has shown that symptoms of JFM tend to persist and do not resolve over time as was previously believed. Efforts to improve treatments for JFM are underway, and new evidence strongly points to the potential benefits of cognitive-behavioural therapy on improving mood and daily functioning. Research into pharmacotherapy and other nonpharmacological options is in progress. Advancements in the understanding of adult fibromyalgia have paved the way for future studies on diagnosis, assessment and management of JFM. This Review focuses on our current knowledge of the condition, provides an update of the latest research advances, and highlights areas for further study.

Also flagged:Huntington's diseaseATMstatinsbisphosphonatesHDneurodegenerative syndrome
Journal Article 2013-11-26 ✓ 1 Snippet Ferlazzo ML, Sonzogni L, Granzotto A, Bodgi L, Lartin O, Devic C, Vogin G, Pereira S, Foray N.
In-Text Gene Mentions

Huntington's disease (HD) is a neurodegenerative syndrome caused by mutations of the IT15 gene encoding for the huntingtin protein.

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative syndrome caused by mutations of the IT15 gene encoding for the huntingtin protein. Some research groups have previously shown that HD is associated with cellular radiosensitivity in quiescent cells. However, there is still no mechanistic model explaining such specific clinical feature. Here, we examined the ATM-dependent signaling and repair pathways of the DNA double-strand breaks (DSB), the key damage induced by ionizing radiation, in human HD skin fibroblasts. Early after irradiation, quiescent HD fibroblasts showed an abnormally low rate of recognized DSB managed by non-homologous end-joining reflected by a low yield of nuclear foci formed by phosphorylated H2AX histones and by 53BP1 protein. Furthermore, HD cells elicited a significant but moderate yield of unrepaired DSB 24 h after irradiation. Irradiated HD cells also presented a delayed nucleo-shuttling of phosphorylated forms of the ATM kinase, potentially due to a specific binding of ATM to mutated huntingtin in the cytoplasm. Our results suggest that HD belongs to the group of syndromes associated with a low but significant defect of DSB signaling and repair defect associated with radiosensitivity. A combination of biphosphonates and statins complements these impairments by facilitating the nucleo-shuttling of ATM, increasing the yield of recognized and repaired DSB.

Also flagged:peptidestrypsindigestionpeptidetranslationalsilica
Journal Article 2013-11-26 ✓ 1 Snippet Sun L, Zhu G, Yan X, Champion MM, Dovichi NJ.
In-Text Gene Mentions

linker histones

Show Full Abstract

The vast majority of proteomic studies employ RP-HPLC coupled with MS/MS for analysis of the tryptic digest of a cellular lysate. This technology is quite mature, and typically provides identification of hundreds to thousands of peptides, which is used to infer the identity of hundreds to thousands of proteins. These studies usually require milligrams to micrograms of starting material. CZE provides an interesting alternative separation method based on a different separation mechanism than HPLC. CE received some attention for protein analysis beginning 25 years ago. Those efforts stalled because of the limited performance of the electrospray interfaces and the limited speed and sensitivity of mass spectrometers of that era. This review considers a new electrospray interface design coupled with Orbitrap Velos and linear Q-trap mass spectrometers. CZE coupled with this interface and these detectors provides single shot detection of >1250 peptides from an Escherichia coli digest in less than 1 h, identification of nearly 5000 peptides from analysis of seven fractions produced by SPE of the E. coli digest in a 6 h total analysis time, low attomole detection limits for peptides generated from standard proteins, and high zeptomole detection limits for selected ion monitoring of peptides. Incorporation of an integrated on-line immobilized trypsin microreactor allows digestion and analysis of picogram amounts of a complex eukaryotic proteome.

Also flagged:mGluR5ethanolanxietymetabotropic glutamate receptor 5methylpyridine
Journal Article 2013-11-26 No Snippets Kumar J, Hapidin H, Bee YT, Ismail Z.
Show Full Abstract

Abstinence from chronic ethanol consumption leads to the manifestation of a variety of symptoms attributed to central nervous system hyperexcitability, such as increased irritability, anxiety, and restlessness. Recent studies have demonstrated the importance of metabotropic glutamate receptor 5 (mGluR5) in addictive behaviours. This study investigates the effects of the mGluR5 antagonist 2-methyl-6-(phenylethynyl)-pyridine (MPEP) on ethanol withdrawal induced anxiety using two behavioural paradigms. Male Wistar rats were fed a Modified Liquid Diet (MLD) containing low fat cow milk, sucrose, and maltodextrin with a gradual introduction of 2.4%, 4.8% and 7.2% ethanol for 20 days. Six hours into ethanol withdrawal, the rats were intraperitoneally injected with normal saline and MPEP (2.5, 5.0, 10, 20, 30 mg/kg) and were assessed for ethanol withdrawal induced anxiety-like syndrome using an automated elevated plus maze and an open field. MPEP at 10 mg/kg significantly attenuated ethanol withdrawal induced anxiety without any compromising effects on locomotor activities. Despite reversing several indices of ethanol withdrawal induced anxiety in both the elevated plus maze and the open field, low doses of MPEP (2.5, 5 mg/kg) significantly compromised the locomotor activities of ethanol withdrawn rats. High doses of MPEP (20 and 30 mg/kg) significantly attenuated withdrawal anxiety when tested in the elevated plus maze but not in the open field. Administration of MPEP (2.5, 5, 10, 20, 30 mg/kg) has no significant compromising effect on the locomotor activities of ethanol naïve rats. Despite significantly reducing withdrawal anxiety in both behavioural paradigms at 10 mg/kg, the compromising effects of low and high doses of MPEP must be further explored along with the therapeutic efficiency of this drug for relieving withdrawal induced anxiety.

Also flagged:immune responseinfectionleprosyinfectious diseaseshost cellimmune responses
Journal Article 2013-11-26 ✓ 1 Snippet Masaki T, McGlinchey A, Cholewa-Waclaw J, Qu J, Tomlinson SR, Rambukkana A.
In-Text Gene Mentions

Hfe

Show Full Abstract

Recently, we showed a natural reprogramming process during infection with Mycobacterium leprae (ML), the causative organism of human leprosy. ML hijacks the notable plasticity of adult Schwann cells in the peripheral nervous system (PNS), bacteria's preferred nonimmune niche, to reprogram infected cells to progenitor/stem cell-like cells (pSLCs). Whereas ML appear to use this reprogramming process as a sophisticated bacterial strategy to spread infection to other tissues, understanding the mechanisms may shed new insights into the basic biology of cellular reprogramming and the development of new approaches for generating pSLC for therapeutic purposes as well as targeting bacterial infectious diseases at an early stage. Toward these goals, we extended our studies to identify other players that might be involved in this complex host cell reprogramming. Here we show that ML activates numerous immune-related genes mainly involved in innate immune responses and inflammation during early infection before downregulating Schwann cell lineage genes and reactivating developmental transcription factors. We validated these findings by demonstrating the ability of infected cells to secrete soluble immune factor proteins at early time points and their continued release during the course of reprogramming. By using time-lapse microscopy and a migration assay with reprogrammed Schwann cells (pSLCs) cultured with macrophages, we show that reprogrammed cells possess the ability to attract macrophages, providing evidence for a functional role of immune gene products during reprogramming. These findings suggest a potential role of innate immune response and the related signaling pathways in cellular reprogramming and the initiation of neuropathogenesis during ML infection.

Also flagged:EV71 infectionillnessaseptic meningitisencephalitispoliomelitis likefebrile illness
Journal Article 2013-11-26 ✓ 1 Snippet Li JX, Meng FY, Liang ZL, Mao QY, Zhu FC.
In-Text Gene Mentions

…CA6, CA7, CA9,CA10, and echoviruses 1,…

Show Full Abstract

The choice of endpoint was most important for an efficacy vaccine trial. The objective of this paper is to gear toward answering questions about the rationality and scientificity of the primary endpoints choosing, case capturing and diagnosis strategy in our recently reported EV71 vaccine efficacy phase 3 trial. In order to obtain both high sensitivity and specificity in the case detecting, EV71-associated disease had been chosen as primary endpoint, a broad spectrum of clinical symptoms was surveyed, both the real-time RT-PCR and virus isolation were combined for the laboratory diagnosis, and serial specimens since disease onset were collected for assays. Though, the EV71 vaccine efficacy was well measured in the phase 3 trial, several potential factors could also have influences on the cases confirming. More evidence of EV71 vaccine efficacy will be demanded in post-marketing studies in the future.

Also flagged:LGR5colorectal carcinomasLeucine-rich-repeat-containing G-protein-coupled receptor 5dextrane sodium sulfatecolon tumorsTumors
Journal Article 2013-11-26 ✓ 1 Snippet Hirsch D, Barker N, McNeil N, Hu Y, Camps J, McKinnon K, Clevers H, Ried T, Gaiser T.
In-Text Gene Mentions

SOX6

Show Full Abstract

Like normal colorectal epithelium, colorectal carcinomas (CRCs) are organized hierarchically and include populations of cells with stem-like properties. Leucine-rich-repeat-containing G-protein-coupled receptor 5 (LGR5) is associated with these stem cells in normal colorectal epithelium; however, the precise function of LGR5 in CRC remains largely unknown. Here, we analyzed the functional and molecular consequences of short hairpin RNA-mediated silencing of LGR5 in CRC cell lines SW480 and HT-29. Additionally, we exposed Lgr5-EGFP-IRES-CreERT2 mice to azoxymethane/dextrane sodium sulfate (AOM/DSS), which induces inflammation-driven colon tumors. Tumors were then flow-sorted into fractions of epithelial cells that expressed high or low levels of Lgr5 and were molecularly characterized using gene expression profiling and array comparative genomic hybridization. Silencing of LGR5 in SW480 CRC cells resulted in a depletion of spheres but did not affect adherently growing cells. Spheres expressed higher levels of several stem cell-associated genes than adherent cells, including LGR5. Silencing of LGR5 reduced proliferation, migration and colony formation in vitro and tumorigenicity in vivo. In accordance with these results, NOTCH signaling was downregulated upon LGR5 silencing. In AOM/DSS-induced colon tumors, Lgr5 high cells showed higher levels of several stem cell-associated genes and higher Wnt signaling than Lgr5 low tumor cells and Lgr5 high normal colon cells. Array comparative genomic hybridization revealed no genomic imbalances in either tumor cell fraction. Our data elucidate mechanisms that define the role of LGR5 as a marker for stem-like cells in CRC.

Also flagged:Huntington diseasepolyglutamineprolinefibril formationfibrilsHomopolymeric
Journal Article 2013-11-26 ✓ 5 Snippets Crick SL, Ruff KM, Garai K, Frieden C, Pappu RV.
In-Text Gene Mentions

Huntington disease is caused by mutational expansion of the CAG trinucleotide within exon 1 of the huntingtin (Htt) gene.

…of the huntingtin (Htt) gene.…

…(NTFs) of theHttprotein result from…

…transcripts of mutantHtt.…

Htt

Show Full Abstract

Huntington disease is caused by mutational expansion of the CAG trinucleotide within exon 1 of the huntingtin (Htt) gene. Exon 1 spanning N-terminal fragments (NTFs) of the Htt protein result from aberrant splicing of transcripts of mutant Htt. NTFs typically encompass a polyglutamine tract flanked by an N-terminal 17-residue amphipathic stretch (N17) and a C-terminal 38-residue proline-rich stretch (C38). We present results from in vitro biophysical studies that quantify the driving forces for and mechanisms of polyglutamine aggregation as modulated by N17 and C38. Although N17 is highly soluble by itself, it lowers the saturation concentration of soluble NTFs and increases the driving force, vis-à-vis homopolymeric polyglutamine, for forming insoluble aggregates. Kinetically, N17 accelerates fibril formation and destabilizes nonfibrillar intermediates. C38 is also highly soluble by itself, and it lends its high intrinsic solubility to lower the driving force for forming insoluble aggregates by increasing the saturation concentration of soluble NTFs. In NTFs with both modules, N17 and C38 act synergistically to destabilize nonfibrillar intermediates (N17 effect) and lower the driving force for forming insoluble aggregates (C38 effect). Morphological studies show that N17 and C38 promote the formation of ordered fibrils by NTFs. Homopolymeric polyglutamine forms a mixture of amorphous aggregates and fibrils, and its aggregation mechanisms involve early formation of heterogeneous distributions of nonfibrillar species. We propose that N17 and C38 act as gatekeepers that control the intrinsic heterogeneities of polyglutamine aggregation. This provides a biophysical explanation for the modulation of in vivo NTF toxicities by N17 and C38.

Also flagged:proteasomespolyglutamineinclusion bodiesNeurodegenerative disordersHuntington's diseaseprotein misfolding
Journal Article 2013-11-26 No Snippets Schipper-Krom S, Juenemann K, Jansen AH, Wiemhoefer A, van den Nieuwendijk R, Smith DL, Hink MA, Bates GP, Overkleeft H, Ovaa H, Reits E.
Show Full Abstract

Neurodegenerative disorders such as Huntington's disease are hallmarked by neuronal intracellular inclusion body formation. Whether proteasomes are irreversibly recruited into inclusion bodies in these protein misfolding disorders is a controversial subject. In addition, it has been proposed that the proteasomes may become clogged by the aggregated protein fragments, leading to impairment of the ubiquitin-proteasome system. Here, we show by fluorescence pulse-chase experiments in living cells that proteasomes are dynamically and reversibly recruited into inclusion bodies. As these recruited proteasomes remain catalytically active and accessible to substrates, our results challenge the concept of proteasome sequestration and impairment in Huntington's disease, and support the reported absence of proteasome impairment in mouse models of Huntington's disease.

Also flagged:HDAC4Histone deacetylase(HDAC) 4transcriptional repressorglutaminepathogenesis
Journal Article 2013-11-26 ✓ 5 Snippets Mielcarek M, Landles C, Weiss A, Bradaia A, Seredenina T, Inuabasi L, Osborne GF, Wadel K, Touller C, Butler R, Robertson J, Franklin SA, Smith DL, Park L, Marks PA, Wanker EE, Olson EN, Luthi-Carter R, van der Putten H, Beaumont V, Bates GP.
In-Text Gene Mentions

We have shown that reduction of HDAC4 shifts the ratio from aggregated to soluble HTT and therefore acts directly on the HD mutation.

In order to investigate the molecular consequences of HDAC4 knock-down in HD mice, we employed the Seprion ligand ELISA to quantify aggregate load [25] and time-resolved Förster resonance energy transfer (TR-FRET) to measure soluble mutant HTT levels [26].

Bdnf expression is repressed by RE1 silencing transcription factor (REST), which is retained in the cytoplasm in a complex containing HTT and which translocates to the nucleus in response to HD pathology [44].

Taken together, these data show that HDAC4 knock-down significantly reduced aggregate load and increased levels of soluble mutant HTT in HD mouse models, reflecting a delay in the aggregation process.

HDAC4 Knock-Down Reduces Aggregate Load and Increases Levels of Soluble HTT in Mouse Models of HD

Show Full Abstract

Histone deacetylase (HDAC) 4 is a transcriptional repressor that contains a glutamine-rich domain. We hypothesised that it may be involved in the molecular pathogenesis of Huntington's disease (HD), a protein-folding neurodegenerative disorder caused by an aggregation-prone polyglutamine expansion in the huntingtin protein. We found that HDAC4 associates with huntingtin in a polyglutamine-length-dependent manner and co-localises with cytoplasmic inclusions. We show that HDAC4 reduction delayed cytoplasmic aggregate formation, restored Bdnf transcript levels, and rescued neuronal and cortico-striatal synaptic function in HD mouse models. This was accompanied by an improvement in motor coordination, neurological phenotypes, and increased lifespan. Surprisingly, HDAC4 reduction had no effect on global transcriptional dysfunction and did not modulate nuclear huntingtin aggregation. Our results define a crucial role for the cytoplasmic aggregation process in the molecular pathology of HD. HDAC4 reduction presents a novel strategy for targeting huntingtin aggregation, which may be amenable to small-molecule therapeutics.

Also flagged:HDACCytoplasmNucleusHuntington's Disease
Journal Article 2013-11-26 ✓ 1 Snippet Robinson R.
In-Text Gene Mentions

The discovery that reducing HDAC4 has therapeutic effects in the HD model tested here—which happens to be a gold standard model in which most therapeutics fail when tested—will spur efforts to mimic this effect with small molecules to obstruct the interaction of HDAC4 and mutant HTT, or antisense therapies designed to prevent production of HDAC4 protein.

Show Full Abstract

No abstract available.

Also flagged:synthesisantimicrobial peptidesalkylLL-37membranedepolarization
Journal Article 2013-11-26 No Snippets Murugan RN, Jacob B, Ahn M, Hwang E, Sohn H, Park HN, Lee E, Seo JH, Cheong C, Nam KY, Hyun JK, Jeong KW, Kim Y, Shin SY, Bang JK.
Show Full Abstract

<h4>Background</h4>Much attention has been focused on the design and synthesis of potent, cationic antimicrobial peptides (AMPs) that possess both antimicrobial and anti-inflammatory activities. However, their development into therapeutic agents has been limited mainly due to their large size (12 to 50 residues in length) and poor protease stability.<h4>Methodology/principal findings</h4>In an attempt to overcome the issues described above, a set of ultra-short, His-derived antimicrobial peptides (HDAMPs) has been developed for the first time. Through systematic tuning of pendant hydrophobic alkyl tails at the N(π)- and N(τ)-positions on His, and the positive charge of Arg, much higher prokaryotic selectivity was achieved, compared to human AMP LL-37. Additionally, the most potent HDAMPs showed promising dual antimicrobial and anti-inflammatory activities, as well as anti-methicillin-resistant Staphylococcus aureus (MRSA) activity and proteolytic resistance. Our results from transmission electron microscopy, membrane depolarization, confocal laser-scanning microscopy, and calcein-dye leakage experiments propose that HDAMP-1 kills microbial cells via dissipation of the membrane potential by forming pore/ion channels on bacterial cell membranes.<h4>Conclusion/significance</h4>The combination of the ultra-short size, high-prokaryotic selectivity, potent anti-MRSA activity, anti-inflammatory activity, and proteolytic resistance of the designed HDAMP-1, -3, -5, and -6 makes these molecules promising candidates for future antimicrobial therapeutics.

Also flagged:oligozoospermiamale infertilitySIRPASox5idiopathicnon-obstructive azoospermia
Journal Article 2013-11-26 ✓ 1 Snippet Xu M, Qin Y, Qu J, Lu C, Wang Y, Wu W, Song L, Wang S, Chen F, Shen H, Sha J, Hu Z, Xia Y, Wang X.
In-Text Gene Mentions

…genes, SOX5 ,SOX6, and SOX13…

Show Full Abstract

<h4>Background</h4>Oligozoospermia is one of the severe forms of idiopathic male infertility. However, its pathology is largely unknown, and few genetic factors have been defined. Our previous genome-wide association study (GWAS) has identified four risk loci for non-obstructive azoospermia (NOA).<h4>Objective</h4>To investigate the potentially functional genetic variants (including not only common variants, but also less-common and rare variants) of these loci on spermatogenic impairment, especially oligozoospermia.<h4>Design setting and participants</h4>A total of 784 individuals with oligozoospermia and 592 healthy controls were recruited to this study from March 2004 and January 2011.<h4>Measurements</h4>We conducted a two-stage study to explore the association between oligozoospermia and new makers near NOA risk loci. In the first stage, we used next generation sequencing (NGS) in 96 oligozoospermia cases and 96 healthy controls to screen oligozoospermia-susceptible genetic variants. Next, we validated these variants in a large cohort containing 688 cases and 496 controls by SNPscan for high-throughput Single Nucleotide Polymorphism (SNP) genotyping.<h4>Results and limitations</h4>Totally, we observed seven oligozoospermia associated variants (rs3791185 and rs2232015 in PRMT6, rs146039840 and rs11046992 in Sox5, rs1129332 in PEX10, rs3197744 in SIRPA, rs1048055 in SIRPG) in the first stage. In the validation stage, rs3197744 in SIRPA and rs11046992 in Sox5 were associated with increased risk of oligozoospermia with an odds ratio (OR) of 4.62 (P  =  0.005, 95%CI 1.58-13.4) and 1.82 (P  =  0.005, 95%CI 1.01-1.64), respectively. Further investigation in larger populations and functional characterizations are needed to validate our findings.<h4>Conclusions</h4>Our study provides evidence of independent oligozoospermia risk alleles driven by variants in the potentially functional regions of genes discovered by GWAS. Our findings suggest that integrating sequence data with large-scale genotyping will serve as an effective strategy for discovering risk alleles in the future.

Also flagged:Huntington diseaseHDmitochondrialoxygenextracellularacidification
Journal Article 2013-11-26 ✓ 1 Snippet Gouarné C, Tardif G, Tracz J, Latyszenok V, Michaud M, Clemens LE, Yu-Taeger L, Nguyen HP, Bordet T, Pruss RM.
In-Text Gene Mentions

…into the mouseHTThomologue Hdh […

Show Full Abstract

In Huntington disease (HD), there is increasing evidence for a link between mutant huntingtin expression, mitochondrial dysfunction, energetic deficits and neurodegeneration but the precise nature, causes and order of these events remain to be determined. In this work, our objective was to evaluate mitochondrial respiratory function in intact, non-permeabilized, neurons derived from a transgenic rat model for HD compared to their wild type littermates by measuring oxygen consumption rates and extracellular acidification rates. Although HD striatal neurons had similar respiratory capacity as those from their wild-type littermates when they were incubated in rich medium containing a supra-physiological glucose concentration (25 mM), pyruvate and amino acids, respiratory defects emerged when cells were incubated in media containing only a physiological cerebral level of glucose (2.5 mM). According to the concept that glucose is not the sole substrate used by the brain for neuronal energy production, we provide evidence that primary neurons can use lactate as well as pyruvate to fuel the mitochondrial respiratory chain. In contrast to glucose, we found no major deficits in HD striatal neurons' capacity to use pyruvate as a respiratory substrate compared to wild type littermates. Additionally, we used extracellular acidification rates to confirm a reduction in anaerobic glycolysis in the same cells. Interestingly, the metabolic disturbances observed in striatal neurons were not seen in primary cortical neurons, a brain region affected in later stages of HD. In conclusion, our results argue for a dysfunction in glycolysis, which might precede any defects in the respiratory chain itself, and these are early events in the onset of disease.

Also flagged:non-alcoholic fatty liver diseaseNAFLDInsulinglucoseironIL-6
Journal Article 2013-11-26 ✓ 2 Snippets Utzschneider KM, Largajolli A, Bertoldo A, Marcovina S, Nelson JE, Yeh MM, Kowdley KV, Kahn SE.
In-Text Gene Mentions

HFE

hemochromatosis

Show Full Abstract

<h4>Aims</h4>We sought to determine whether NAFLD is associated with poorer β-cell function and if any β-cell dysfunction is associated with abnormal markers of iron or inflammation.<h4>Methods</h4>This was a cross-sectional study of 15 non-diabetic adults with NAFLD and 15 non-diabetic age and BMI-matched controls. Insulin sensitivity was measured by isotope-labeled hyperinsulinemic-euglycemic clamps and β-cell function by both oral (OGTT) and intravenous glucose tolerance tests. Liver and abdominal fat composition was evaluated by CT scan. Fasting serum levels of ferritin, transferrin-iron saturation, IL-6, TNFα and hsCRP were measured.<h4>Results</h4>Compared to controls, subjects with NAFLD had lower hepatic and systemic insulin sensitivity and β-cell function was decreased as measured by the oral disposition index. Fasting serum ferritin and transferrin-iron saturation were higher in NAFLD and were positively associated with liver fat. Serum ferritin was negatively associated with β-cell function measured by both oral and intravenous tests, but was not associated with insulin sensitivity. IL-6, TNFα and hsCRP did not differ between groups and did not correlate with serum ferritin, liver fat or measures of β-cell function.<h4>Conclusions</h4>These findings support a potential pathophysiological link between iron metabolism, liver fat and diabetes risk.

Also flagged:hereditary hemorrhagic telangiectasia type 1HHTepistaxisarteriovenous malformationsACVRL1ALK1
Journal Article 2013-11-25 No Snippets Fontalba A, Fernández-Luna JL, Zarrabeitia R, Recio-Poveda L, Albiñana V, Ojeda-Fernández ML, Bernabéu C, Alcaraz LA, Botella LM.
Show Full Abstract

<h4>Background</h4>The hereditary hemorrhagic telangiectasia syndrome (HHT), also known as the Rendu-Osler-Weber syndrome is a multiorganic vascular disorder inherited as an autosomal dominant trait. Diagnostic clinical criteria include: epistaxis, telangiectases in mucocutaneous and gastrointestinal sites, arteriovenous malformations (AVMs) most commonly found in pulmonary, hepatic and cerebral circulations, and familial inheritance. HHT is transmitted in 90% of the cases as an autosomal dominant condition due to mutations in either endoglin (ENG), or activin receptor-like kinase 1 (ACVRL1/ALK1) genes (HHT type 1 and 2, respectively).<h4>Methods</h4>We have carried out a genetic analysis of four independent Spanish families with HHT clinical criteria, which has permitted the identification of new large deletions in ENG. These mutations were first detected using the MLPA technique and subsequently, the deletion breakpoints were mapped using a customized copy number variation (CNV) microarray. The array was designed to cover the ENG gene and surrounding areas.<h4>Results</h4>All tested families carried large deletions ranging from 3-kb to 100-kb, involving the ENG gene promoter, several ENG exons, and the two downstream genes FGSH and CDK9. Interestingly, common breakpoints coincident with Alu repetitive sequences were found among these families.<h4>Conclusions</h4>The systematic hybridization of DNA from HHT families, with deletions or duplications, to custom designed microarrays, could allow the mapping of breakpoints, coincident with repetitive Alu sequences that might act as "hot spots" in the development of chromosomal anomalies.

Also flagged:Brainagingmetabolismactivatorsneuronal PAS domain protein 2period circadian clock 1
Journal Article 2013-11-25 ✓ 1 Snippet Musiek ES, Lim MM, Yang G, Bauer AQ, Qi L, Lee Y, Roh JH, Ortiz-Gonzalez X, Dearborn JT, Culver JP, Herzog ED, Hogenesch JB, Wozniak DF, Dikranian K, Giasson BI, Weaver DR, Holtzman DM, Fitzgerald GA.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Brain aging is associated with diminished circadian clock output and decreased expression of the core clock proteins, which regulate many aspects of cellular biochemistry and metabolism. The genes encoding clock proteins are expressed throughout the brain, though it is unknown whether these proteins modulate brain homeostasis. We observed that deletion of circadian clock transcriptional activators aryl hydrocarbon receptor nuclear translocator-like (Bmal1) alone, or circadian locomotor output cycles kaput (Clock) in combination with neuronal PAS domain protein 2 (Npas2), induced severe age-dependent astrogliosis in the cortex and hippocampus. Mice lacking the clock gene repressors period circadian clock 1 (Per1) and period circadian clock 2 (Per2) had no observed astrogliosis. Bmal1 deletion caused the degeneration of synaptic terminals and impaired cortical functional connectivity, as well as neuronal oxidative damage and impaired expression of several redox defense genes. Targeted deletion of Bmal1 in neurons and glia caused similar neuropathology, despite the retention of intact circadian behavioral and sleep-wake rhythms. Reduction of Bmal1 expression promoted neuronal death in primary cultures and in mice treated with a chemical inducer of oxidative injury and striatal neurodegeneration. Our findings indicate that BMAL1 in a complex with CLOCK or NPAS2 regulates cerebral redox homeostasis and connects impaired clock gene function to neurodegeneration.

Also flagged:antibodiesHSP90degradationHDautosomal dominant neurodegenerative disorderprogressive dementia
Journal Article 2013-11-25 ✓ 5 Snippets Massai L, Petricca L, Magnoni L, Rovetini L, Haider S, Andre R, Tabrizi SJ, Süssmuth SD, Landwehrmeyer BG, Caricasole A, Pollio G, Bernocco S.
In-Text Gene Mentions

Huntington's disease (HD) is a monogenic disorder caused by an aberrant expansion of CAG repeats in the huntingtin gene (HTT).

Recombinant human HTT full-length protein carrying a 3XFLAG tag at the N-terminus and a polyQ stretch of 138 glutamine residues (HTT-Q138) was produced using an inducible cell clone 293/T-Rex® Q138-CRE-RL1 (RL1) expressing intracellular HTT protein upon doxycycline induction [28].

HD is caused by an unstable CAG repeat expansion in the gene encoding huntingtin (HTT) on chromosome 4, leading to an extended polyglutamine (polyQ) stretch in the amino terminus of the HTT protein [3]; the disease is therefore associated with a mutant form of the HTT protein that contains 36 or more glutamine residues.

Nevertheless, loss of wild-type HTT function may also have a role in HD [14-16].

HTT-Q138 expression induced by 24 hours treatment with 1 μg/mL doxycycline was detected by our assay, showing an approximately 500-fold increase in HTT protein expression by these cells (Figure 2A).

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is a monogenic disorder caused by an aberrant expansion of CAG repeats in the huntingtin gene (HTT). Pathogenesis is associated with expression of the mutant (mHTT) protein in the CNS, with its levels most likely related to disease progression and symptom severity. Since non-invasive methods to quantify HTT in the CNS do not exist, measuring amount of soluble HTT in peripheral cells represents an important step in development of disease-modifying interventions in HD.<h4>Results</h4>An ELISA assay using commercially available antibodies was developed to quantify HTT levels in complex matrices like mammalian cell cultures lysates and human samples. The immunoassay was optimized using a recombinant full-length HTT protein, and validated both on wild-type and mutant HTT species. The ability of the assay to detect significant variations of soluble HTT levels was evaluated using an HSP90 inhibitor that is known to enhance HTT degradation. Once optimized, the bioassay was applied to peripheral blood mononuclear cells (PBMCs) from HD patients, demonstrating good potential in tracking the disease course.<h4>Conclusions</h4>The method described here represents a validated, simple and rapid bio-molecular assay to evaluate soluble HTT levels in blood cells as useful tool in disease and pharmacodynamic marker identification for observational and clinical trials.

Also flagged:CholesterolSulfotransferaseSULTcholesterol sulfotransferaseSULT2B1bsulfoconjugation
Journal Article 2013-11-25 No Snippets Shi X, Cheng Q, Xu L, Yan J, Jiang M, He J, Xu M, Stefanovic-Racic M, Sipula I, O'Doherty RM, Ren S, Xie W.
Show Full Abstract

Sulfotransferase (SULT)-mediated sulfation represents a critical mechanism in regulating the chemical and functional homeostasis of endogenous and exogenous molecules. The cholesterol sulfotransferase SULT2B1b catalyzes the sulfoconjugation of cholesterol to synthesize cholesterol sulfate (CS). In this study, we showed that the expression of SULT2B1b in the liver was induced in obese mice and during the transition from the fasted to the fed state, suggesting that the regulation of SULT2B1b is physiologically relevant. CS and SULT2B1b inhibited gluconeogenesis by targeting the gluconeogenic factor hepatocyte nuclear factor 4α (HNF4α) in both cell cultures and transgenic mice. Treatment of mice with CS or transgenic overexpression of the CS-generating enzyme SULT2B1b in the liver inhibited hepatic gluconeogenesis and alleviated metabolic abnormalities both in mice with diet-induced obesity (DIO) and in leptin-deficient (ob/ob) mice. Mechanistically, CS and SULT2B1b inhibited gluconeogenesis by suppressing the expression of acetyl coenzyme A (acetyl-CoA) synthetase (Acss), leading to decreased acetylation and nuclear exclusion of HNF4α. Our results also suggested that leptin is a potential effector of SULT2B1b in improving metabolic function. We conclude that SULT2B1b and its enzymatic by-product CS are important metabolic regulators that control glucose metabolism, suggesting CS as a potential therapeutic agent and SULT2B1b as a potential therapeutic target for metabolic disorders.

Also flagged:major histocompatibility complexMHCchromosomeHereditary HemochromatosisHHiron
Journal Article 2013-11-25 ✓ 5 Snippets Costa M, Cruz E, Barton JC, Thorstensen K, Morais S, da Silva BM, Pinto JP, Vieira CP, Vieira J, Acton RT, Porto G.
In-Text Gene Mentions

Effects of highly conserved major histocompatibility complex (MHC) extended haplotypes on iron and low CD8+ T lymphocyte phenotypes in HFE C282Y homozygous hemochromatosis patients from three geographically distant areas.

Hereditary Hemochromatosis (HH) is a recessively inherited disorder of iron overload occurring commonly in subjects homozygous for the C282Y mutation in HFE gene localized on chromosome 6p21.3 in linkage disequilibrium with the human leukocyte antigen (HLA)-A locus.

Effects of Highly Conserved Major Histocompatibility Complex (MHC) Extended Haplotypes on Iron and Low CD8+ T Lymphocyte Phenotypes in HFE C282Y Homozygous Hemochromatosis Patients from Three Geographically Distant Areas

…homozygosity for theHFEp.Cys282Tyr mutation (C282Y)…

HFEencodes a non-classical…

Show Full Abstract

Hereditary Hemochromatosis (HH) is a recessively inherited disorder of iron overload occurring commonly in subjects homozygous for the C282Y mutation in HFE gene localized on chromosome 6p21.3 in linkage disequilibrium with the human leukocyte antigen (HLA)-A locus. Although its genetic homogeneity, the phenotypic expression is variable suggesting the presence of modifying factors. One such genetic factor, a SNP microhaplotype named A-A-T, was recently found to be associated with a more severe phenotype and also with low CD8(+)T-lymphocyte numbers. The present study aimed to test whether the predictive value of the A-A-T microhaplotype remained in other population settings. In this study of 304 HH patients from 3 geographically distant populations (Porto, Portugal 65; Alabama, USA 57; Nord-Trøndelag, Norway 182), the extended haplotypes involving A-A-T were studied in 608 chromosomes and the CD8(+) T-lymphocyte numbers were determined in all subjects. Patients from Porto had a more severe phenotype than those from other settings. Patients with A-A-T seemed on average to have greater iron stores (p = 0.021), but significant differences were not confirmed in the 3 separate populations. Low CD8(+) T-lymphocytes were associated with HLA-A*03-A-A-T in Porto and Alabama patients but not in the greater series from Nord-Trøndelag. Although A-A-T may signal a more severe iron phenotype, this study was unable to prove such an association in all population settings, precluding its use as a universal predictive marker of iron overload in HH. Interestingly, the association between A-A-T and CD8(+) T-lymphocytes, which was confirmed in Porto and Alabama patients, was not observed in Nord-Trøndelag patients, showing that common HLA haplotypes like A*01-B*08 or A*03-B*07 segregating with HFE/C282Y in the three populations may carry different messages. These findings further strengthen the relevance of HH as a good disease model to search for novel candidate loci associated with the genetic transmission of CD8(+) T-lymphocyte numbers.

Also flagged:calciumHuntington's diseaseHDhereditaryneurodegenerative diseasepolyglutamine
Journal Article 2013-11-25 ✓ 5 Snippets Czeredys M, Gruszczynska-Biegala J, Schacht T, Methner A, Kuznicki J.
In-Text Gene Mentions

Our HD animal model, YAC128 transgenic mice express the full-length human HTT protein with 128 CAG repeats and display an age-dependent loss of striatal neurons, similar to those seen in human HD (Slow et al., 2003).

Inducible PC12 cells overexpress an expanded HTT with 73 glutamines (Apostol et al., 2003) and are useful for studying early changes in HD, since they accumulate aggregates of mutant HTT upon treatment with the steroid ponasterone A. Although others have used this inducible PC12 model successfully to study HD pathogenesis, no disturbances in the expression or function of the calcium signalosome have yet been described.

This genetic disorder is caused by the expansion of a CAG trinucleotide repeat in exon 1 of the huntingtin gene (HTT), which is translated into polyglutamine residues (polyQ) in the huntingtin protein (HTT).

To functionally evaluate our results at the cellular level, we adopted a cellular model of HD; namely, inducible PC12 cells (Apostol et al., 2003), in which an expanded HTT with 73 glutamines is expressed upon treatment with the insect steroid ponasterone A (Figure 3A).

Therefore, the aim of our study was to investigate whether mutated HTT is responsible for the changes in the expression of calciosome genes, and if so, which of such changes might explain the alterations observed in HD.

Show Full Abstract

Huntington's disease (HD) is a hereditary neurodegenerative disease caused by the expansion of a polyglutamine stretch in the huntingtin (HTT) protein and characterized by dysregulated calcium homeostasis. We investigated whether these disturbances are correlated with changes in the mRNA level of the genes that encode proteins involved in calcium homeostasis and signaling (i.e., the calciosome). Using custom-made TaqMan low-density arrays containing probes for 96 genes, we quantified mRNA in the striatum in YAC128 mice, a model of HD, and wildtype mice. HTT mutation caused the increased expression of some components of the calcium signalosome, including calretinin, presenilin 2, and calmyrin 1, and the increased expression of genes indirectly involved in calcium homeostasis, such as huntingtin-associated protein 1 and calcyclin-binding protein. To verify these findings in a different model, we used PC12 cells with an inducible expression of mutated full-length HTT. Using single-cell imaging with Fura-2AM, we found that store-operated Ca(2+) entry but not endoplasmic reticulum (ER) store content was changed as a result of the expression of mutant HTT. Statistically significant downregulation of the Orai calcium channel subunit 2, calmodulin, and septin 4 was detected in cells that expressed mutated HTT. Our data indicate that the dysregulation of calcium homeostasis correlates with changes in the gene expression of members of the calciosome. These changes, however, differed in the two models of HD used in this study. Our results indicate that each HD model exhibits distinct features that may only partially resemble the human disease.

Also flagged:IL28BPeginterferonRibavirinIL-28Binfectionpolymerase
Journal Article 2013-11-25 ✓ 1 Snippet Domagalski K, Pawlowska M, Tretyn A, Halota W, Tyczyno M, Kozielewicz D, Dybowska D.
In-Text Gene Mentions

…autoimmune liver diseases,hemochromatosis, or other coexistent…

Show Full Abstract

<h4>Background</h4>Three single nucleotide polymorphisms (SNPs) near interleukin-28B (IL-28B) gene were shown to be highly associated with treatment response (SVR) in patients with chronic hepatitis C virus (HCV) infection. There is limited data about the role of single and combined IL-28B polymorphisms in HCV-infected Polish population.<h4>Objectives</h4>This study's aim was to determine predictability of three IL-28B gene polymorphisms and other known prognostic factors on the treatment response in HCV genotype 1 and 4 infected Polish patients. The effect of IL-28B polymorphisms on therapy was also compared with other known prognostic factors.<h4>Patients and methods</h4>We genotyped IL-28B polymorphisms (rs12979860, rs12980275 and rs8099917) by polymerase chain reaction-based restriction fragment length polymorphism assay in a group of 293 patients from which a selected cohort of 174 treatment-naiev patients underwent treatment.<h4>Results</h4>We showed that rs12979860 CC [odds ratio (OR) = 4.6, P < 0.001], rs12980275 AA (OR = 2.9, P = 0.002) and rs8099917 TT (OR = 2.2, P = 0.016) genotypes were associated with successful treatment compared to the rs12979860 CT-TT, rs12980275 AG-GG and rs8099917 TG-GG, respectively. Patients bearing of IL-28B profile including the three favourable genotypes do not have much chance of a recovery (OR = 3.4, P = 0.002). Except for IL-28B polymorphisms, there was no association of SVR with any other pretreatment clinical data in analyzed group. The correlation of SNPs with other host and viral factors revealed association of favorable genotypes of IL-28B markers with high levels of alanine aminotransferase and baseline HCV viral load.<h4>Conclusions</h4>IL-28B polymorphisms were the strongest pretreatment predictors of response to pegylated interferon and ribavirin in Polish patients chronically infected with HCV genotype 1 and 4. This study confirm the strongest impact of IL-28B rs12979860 on SVR, nevertheless rs12980275 AA seems to be more important than rs8099917 TT in predicting positive treatment response.

Also flagged:methylationBCL2L2NDRG1multiple sclerosisLGMNCTSZ
Journal Article 2013-11-24 No Snippets Huynh JL, Garg P, Thin TH, Yoo S, Dutta R, Trapp BD, Haroutunian V, Zhu J, Donovan MJ, Sharp AJ, Casaccia P.
Show Full Abstract

Using the Illumina 450K array and a stringent statistical analysis with age and gender correction, we report genome-wide differences in DNA methylation between pathology-free regions derived from human multiple sclerosis-affected and control brains. Differences were subtle, but widespread and reproducible in an independent validation cohort. The transcriptional consequences of differential DNA methylation were further defined by genome-wide RNA-sequencing analysis and validated in two independent cohorts. Genes regulating oligodendrocyte survival, such as BCL2L2 and NDRG1, were hypermethylated and expressed at lower levels in multiple sclerosis-affected brains than in controls, while genes related to proteolytic processing (for example, LGMN, CTSZ) were hypomethylated and expressed at higher levels. These results were not due to differences in cellular composition between multiple sclerosis and controls. Thus, epigenomic changes in genes affecting oligodendrocyte susceptibility to damage are detected in pathology-free areas of multiple sclerosis-affected brains.

Also flagged:eye diseaseskeratoconuspathogenesisFuchs endothelial corneal dystrophyIronTransferrin
Journal Article 2013-11-24 ✓ 1 Snippet Wójcik KA, Synowiec E, Jiménez-García MP, Kaminska A, Polakowski P, Blasiak J, Szaflik J, Szaflik JP.
In-Text Gene Mentions

…numerous diseases, includinghemochromatosisand thalassemia […

Show Full Abstract

Oxidative stress may play a role in the pathogenesis of keratoconus (KC) and Fuchs endothelial corneal dystrophy (FECD). Iron may promote the stress by the Fenton reaction, so its homeostasis should be strictly controlled. Transferrin is essential for iron homeostasis because it transports iron from plasma into cells. The malfunction of transferrin, which may be caused by variation in its gene (TF) variation, may contribute to oxidative stress and change KC and FECD risk. To verify this hypothesis we investigated the association between three polymorphisms of the TF gene, g.3296G>A (rs8177178), g.3481A>G (rs8177179), and c.-2G>A (rs1130459), and KC and FECD occurrence. Genotyping was performed in blood lymphocytes in 216 patients with KC, 130 patients with FECD and 228 controls by PCR-RFLP. We studied also the influence of other risk factors. The A/A genotype and the A allele of the g.3296G>A polymorphism were associated with KC occurrence, while the G allele was negatively correlated with it. We observed a decrease in KC occurrence associated with the A/G genotype of the g.3481A>G polymorphism. We did not find any association between the c.-2G>A polymorphism and KC. No association was found between all three polymorphisms and FECD occurrence.

Also flagged:HLAantibodiesgraftvanishing bile duct syndromeMICABiliary cast syndrome
Journal Article 2013-11-24 ✓ 1 Snippet Ciszek M, Foroncewicz B, Mucha K, Żochowska D, Ziarkiewicz-Wróblewska B, Krawczyk M, Pączek L.
In-Text Gene Mentions

…disease, Budd-Chiari syndrome,hemochromatosis, and cholangial malformations…

Show Full Abstract

<h4>Objective</h4>Presence of anti-HLA antibodies has a well-known impact on kidney grafts survival; however their role in liver transplantation has not been fully elucidated. We conducted a 7-year prospective study to show correlation between presence of anti-HLA and anti-MICA antibodies and liver graft survival.<h4>Methods</h4>Blood samples from 123 liver transplant recipients were collected during patients routine visits. Time from transplantation to blood sample collection was different for each patient. Blood samples were tested for anti-HLA (separately class I and II) and MICA antibodies using Luminex assays.<h4>Results</h4>There were 32 (26%) patients with positive anti-HLA and 37 (30%) with positive anti-MICA antibodies. Graft loss occurred in 7 cases (23%) in anti-HLA positive group compared to 20 (22%) in anti-HLA negative group (P = ns) and in 8 cases (22%) in anti-MICA positive group but 19 (23%) in anti-MICA negative group (P = ns). No correlations were detected between presence of antibodies and acute graft rejection (AGR). Presence of any antibodies (anti-HLA or anti-MICA antibodies) correlated with late graft rejection (P = 0.04).<h4>Conclusion</h4>Presence of anti-HLA or anti-MICA had no impact on long-term liver graft survival; however, detection of any antibodies was correlated with episodes of late graft rejection.

Also flagged:DNase IGene expressionCD146CD14CD68hematopoiesis
Journal Article 2013-11-23 No Snippets Iwata M, Sandstrom RS, Delrow JJ, Stamatoyannopoulos JA, Torok-Storb B.
Show Full Abstract

Marrow stromal cells constitute a heterogeneous population of cells, typically isolated after expansion in culture. In vivo, stromal cells often exist in close proximity or in direct contact with monocyte-derived macrophages, yet their interaction with monocytes is largely unexplored. In this report, isolated CD146(+) and CD146(-) stromal cells, as well as immortalized cell lines representative of each (designated HS27a and HS5, respectively), were shown by global DNase I hypersensitive site mapping and principal coordinate analysis to have a lineage association with marrow fibroblasts. Gene expression profiles generated for the CD146(+) and CD146(-) cell lines indicate significant differences in their respective transcriptomes, which translates into differences in secreted factors. Consequently, the conditioned media (CM) from these two populations induce different fates in peripheral blood monocytes. Monocytes incubated in CD146(+) CM acquire a tissue macrophage phenotype, whereas monocytes incubated in CM from CD146(-) cells express markers associated with pre-dendritic cells. Importantly, when CD14(+) monocytes are cultured in contact with the CD146(+) cells, the combined cell populations, assayed as a unit, show increased levels of transcripts associated with organismal development and hematopoietic regulation. In contrast, the gene expression profile from cocultures of monocytes and CD146(-) cells does not differ from that obtained when monocytes are cultured with CD146(-) CM. These in vitro results show that the CD146(+) marrow stromal cells together with monocytes increase the expression of genes relevant to hematopoietic regulation. In vivo relevance of these data is suggested by immunohistochemistry of marrow biopsies showing juxtaposed CD146(+) cells and CD68(+) cells associated with these upregulated proteins.

Also flagged:obesityFTOtype 2 diabetesmelanocortin 4 receptorMC4RINSIG2
Journal Article 2013-11-23 ✓ 5 Snippets Martínez-García F, Mansego ML, Rojo-Martínez G, De Marco-Solar G, Morcillo S, Soriguer F, Redón J, Pineda Alonso M, Martín-Escudero JC, Cooper RS, Chaves FJ.
In-Text Gene Mentions

Furthermore, two other loci, one close to the NEGR1 gene and another near STK33 were also associated to obesity in some studies and the NEGR1 gene has been independently associated with obesity in a pediatric cohort [11].

Among the new discovered loci, ATXN2L, NEGR1 and SH2B1 have also shown a relationship with obesity.

The objective of the present study was to assess the association between individual genetic variants and haplotypes of several obesity-related genes (FTO, MC4R, MTCH2, NEGR1, SEC16B, INSIG2, TMEM18, KCTD15, SH2B1, FAIM2, ATXN2L, BDNF, BDNFOS, GNPDA2, ADRB2, PRL, PTER, ADIPOQ, ETV5, MAF, NPC1, CTNNBL1, and HTR2C) and BMI in two Spanish populations.

…close to theNEGR1gene and another…

…studies and theNEGR1gene has been…

Show Full Abstract

<h4>Background</h4>The objective was to investigate the association between BMI and single nucleotide polymorphisms previously identified of obesity-related genes in two Spanish populations. Forty SNPs in 23 obesity-related genes were evaluated in a rural population characterized by a high prevalence of obesity (869 subjects, mean age 46 yr, 62% women, 36% obese) and in an urban population (1425 subjects, mean age 54 yr, 50% women, 19% obese). Genotyping was assessed by using SNPlex and PLINK for the association analysis.<h4>Results</h4>Polymorphisms of the FTO were significantly associated with BMI, in the rural population (beta 0.87, p-value <0.001). None of the other SNPs showed significant association after Bonferroni correction in the two populations or in the pooled analysis. A weighted genetic risk score (wGRS) was constructed using the risk alleles of the Tag-SNPs with a positive Beta parameter in both populations. From the first to the fifth quintile of the score, the BMI increased 0.45 kg/m2 in Hortega and 2.0 kg/m2 in Pizarra. Overall, the obesity predictive value was low (less than 1%).<h4>Conclusion</h4>The risk associated with polymorphisms is low and the overall effect on BMI or obesity prediction is minimal. A weighted genetic risk score based on genes mainly acting through central nervous system mechanisms was associated with BMI but it yields minimal clinical prediction for the obesity risk in the general population.

Also flagged:chromatinSUMO-1SUMO1SUMO E3 ligaseK-bZIP
Journal Article 2013-11-23 No Snippets Chang PC, Cheng CY, Campbell M, Yang YC, Hsu HW, Chang TY, Chu CH, Lee YW, Hung CL, Lai SM, Tepper CG, Hsieh WP, Wang HW, Tang CY, Wang WC, Kung HJ.
Show Full Abstract

<h4>Background</h4>SUMOylation, as part of the epigenetic regulation of transcription, has been intensively studied in lower eukaryotes that contain only a single SUMO protein; however, the functions of SUMOylation during mammalian epigenetic transcriptional regulation are largely uncharacterized. Mammals express three major SUMO paralogues: SUMO-1, SUMO-2, and SUMO-3 (normally referred to as SUMO-1 and SUMO-2/3). Herpesviruses, including Kaposi's sarcoma associated herpesvirus (KSHV), seem to have evolved mechanisms that directly or indirectly modulate the SUMO machinery in order to evade host immune surveillance, thus advancing their survival. Interestingly, KSHV encodes a SUMO E3 ligase, K-bZIP, with specificity toward SUMO-2/3 and is an excellent model for investigating the global functional differences between SUMO paralogues.<h4>Results</h4>We investigated the effect of experimental herpesvirus reactivation in a KSHV infected B lymphoma cell line on genomic SUMO-1 and SUMO-2/3 binding profiles together with the potential role of chromatin SUMOylation in transcription regulation. This was carried out via high-throughput sequencing analysis. Interestingly, chromatin immunoprecipitation sequencing (ChIP-seq) experiments showed that KSHV reactivation is accompanied by a significant increase in SUMO-2/3 modification around promoter regions, but SUMO-1 enrichment was absent. Expression profiling revealed that the SUMO-2/3 targeted genes are primarily highly transcribed genes that show no expression changes during viral reactivation. Gene ontology analysis further showed that these genes are involved in cellular immune responses and cytokine signaling. High-throughput annotation of SUMO occupancy of transcription factor binding sites (TFBS) pinpointed the presence of three master regulators of immune responses, IRF-1, IRF-2, and IRF-7, as potential SUMO-2/3 targeted transcriptional factors after KSHV reactivation.<h4>Conclusion</h4>Our study is the first to identify differential genome-wide SUMO modifications between SUMO paralogues during herpesvirus reactivation. Our findings indicate that SUMO-2/3 modification near protein-coding gene promoters occurs in order to maintain host immune-related gene unaltered during viral reactivation.

Also flagged:gene expressioncell activationpsoriasisSPATS2LKLF6chronic inflammatory disease
Journal Article 2013-11-23 No Snippets Palau N, Julià A, Ferrándiz C, Puig L, Fonseca E, Fernández E, López-Lasanta M, López-Lasanta M, Tortosa R, Marsal S.
Show Full Abstract

<h4>Background</h4>Psoriasis is a chronic autoimmune disease in which T cells have a predominant role in initiating and perpetuating the chronic inflammation in skin. However, the mechanisms that regulate T cell activation in psoriasis are still incompletely understood. The objective of the present study was to characterize the main genetic pathways associated with T cell activation in psoriasis.<h4>Results</h4>Gene expression profiles from in vitro activated T cells were obtained from 17 psoriasis patients and 7 healthy controls using Illumina HT-12 v4 microarrays. From a total of 47,321 analyzed transcripts, 42 genes were found to be differentially expressed between psoriasis and controls (FDR p-value < 0.1, absolute fold-change > 1.2). Using an independent cohort of 8 patients and 8 healthy controls we validated the overexpression of SPATS2L (p-value =0.0009) and KLF6 (p-value =0.0012) genes in activated T cells from psoriasis patients. Using weighted correlation analysis we identified SPATS2L and KLF6 coexpression networks, which were also significantly associated with psoriasis (p-value < 0.05). Gene Ontology analysis allowed the identification of several biological processes associated with each coexpression network. Finally, using Gene Set Enrichment Analysis over the global T cell transcriptome we also found additional genetic pathways strongly associated with psoriasis (p-value < 0.0001).<h4>Conclusions</h4>This study has identified two new genes, SPATS2L and KLF6, strongly associated with T cell activation in psoriasis. Functional analyses of the gene expression profiles also revealed new biological processes and genetic pathways associated with psoriasis. The results of this study provide an important insight into the biology of this common chronic inflammatory disease.

Also flagged:heparanbiosynthesisheparan sulfateheparinsynthesisglycosaminoglycan
Journal Article 2013-11-23 ✓ 1 Snippet Sterner E, Li L, Paul P, Beaudet JM, Liu J, Linhardt RJ, Dordick JS.
In-Text Gene Mentions

ATIII

Show Full Abstract

O-sulfotransferases (OSTs) are critical enzymes in the cellular biosynthesis of the biologically and pharmacologically important heparan sulfate and heparin. Recently, these enzymes have been cloned and expressed in bacteria for application in the chemoenzymatic synthesis of glycosaminoglycan-based drugs. OST activity assays have largely relied on the use of radioisotopic methods using [(35)S] 3'-phosphoadenosine-5'-phosphosulfate and scintillation counting. Herein, we examine alternative assays that are more compatible with a biomanufacturing environment. A high throughput microtiter-based approach is reported that relies on a coupled bienzymic colorimetric assay for heparan sulfate and heparin OSTs acting on polysaccharide substrates using arylsulfotransferase-IV and p-nitrophenylsulfate as a sacrificial sulfogroup donor. A second liquid chromatography-mass spectrometric assay, for heparan sulfate and heparin OSTs acting on structurally defined oligosaccharide substrates, is also reported that provides additional information on the number and positions of the transferred sulfo groups within the product. Together, these assays allow quantitative and mechanistic information to be obtained on OSTs that act on heparan sulfate and heparin precursors.

Also flagged:nucleosidehepatitis Cchronic hepatitisvirus) infectionHCV infection
Journal Article 2013-11-23 No Snippets Coats SJ, Garnier-Amblard EC, Amblard F, Ehteshami M, Amiralaei S, Zhang H, Zhou L, Boucle SR, Lu X, Bondada L, Shelton JR, Li H, Liu P, Li C, Cho JH, Chavre SN, Zhou S, Mathew J, Schinazi RF.
Show Full Abstract

Chutes and Ladders is an exciting up-and-down-again game in which players race to be the first to the top of the board. Along the way, they will find ladders to help them advance, and chutes that will cause them to move backwards. The development of nucleoside analogs for clinical treatment of hepatitis C presents a similar scenario in which taking shortcuts may help quickly advance a program, but there is always a tremendous risk of being sent backwards as one competes for the finish line. In recent years the treatment options for chronic hepatitis C virus (HCV) infection have expand due to the development of a replicon based in vitro evaluation system, allowing for the identification of multiple drugable viral targets along with a concerted and substantial drug discovery effort. Three major drug targets have reached clinical study for chronic HCV infection: the NS3/4A serine protease, the large phosphoprotein NS5A, and the NS5B RNA-dependent RNA polymerase. Recently, two oral HCV protease inhibitors were approved by the FDA and were the first direct acting anti-HCV agents to result from the substantial research in this area. There are currently many new chemical entities from several different target classes that are being evaluated worldwide in clinical trials for their effectiveness at achieving a sustained virologic response (SVR) (Pham et al., 2004; Radkowski et al., 2005). Clearly the goal is to develop therapies leading to a cure that are safe, widely accessible and available, and effective against all HCV genotypes (GT), and all stages of the disease. Nucleoside analogs that target the HCV NS5B polymerase that have reached human clinical trials is the focus of this review as they have demonstrated significant advantages in the clinic with broader activity against the various HCV GT and a higher barrier to the development of resistant viruses when compared to all other classes of HCV inhibitors.

Also flagged:corticosteroidZNF432corticosteroidsasthmaSalmeterolCAMP
Journal Article 2013-11-23 No Snippets Wu AC, Himes BE, Lasky-Su J, Litonjua A, Peters SP, Lima J, Kubo M, Tamari M, Nakamura Y, Qiu W, Weiss ST, Tantisira K.
Show Full Abstract

<h4>Background</h4>Single nucleotide polymorphisms (SNPs) influence a patient's response to inhaled corticosteroids and β2-agonists, and the effect of treatment with inhaled corticosteroids is synergistic with the effect of β2-agonists. We hypothesized that use of inhaled corticosteroids could influence the effect of SNPs associated with a bronchodilator response.<h4>Objective</h4>To assess whether, among subjects with asthma, the association of SNPs with bronchodilator response is different between those treated with inhaled corticosteroids versus those on placebo.<h4>Methods</h4>A genome-wide association analysis was conducted by using 581 white subjects from the Childhood Asthma Management Program. By using data for 449,540 SNPs, we conducted a gene by environment analysis in PLINK with inhaled corticosteroid treatment as the environmental exposure and bronchodilator response as the outcome measure. We attempted to replicate the top 12 SNPs in the Leukotriene Modifier or Corticosteroid or Corticosteroid-Salmeterol Trial.<h4>Results</h4>The combined P value for the Childhood Asthma Management Program and Leukotriene Modifier or Corticosteroid or Corticosteroid-Salmeterol Trial populations was 4.8 × 10(-8) for rs3752120, which is located in the zinc finger protein gene ZNF432 and has an unknown function.<h4>Conclusions</h4>Inhaled corticosteroids appear to modulate the association of bronchodilator response with variant(s) in the ZNF432 gene among adults and children with asthma.

Also flagged:RTnevirapinereverse transcriptasenucleosideRNase Hbinding
Journal Article 2013-11-22 No Snippets Vijayan RS, Arnold E, Das K.
Show Full Abstract

HIV-1 reverse transcriptase (RT) is a multifunctional enzyme that is targeted by nucleoside analogs (NRTIs) and non-nucleoside RT inhibitors (NNRTIs). NNRTIs are allosteric inhibitors of RT, and constitute an integral part of several highly active antiretroviral therapy regimens. Under selective pressure, HIV-1 acquires resistance against NNRTIs primarily by selecting mutations around the NNRTI pocket. Complete RT sequencing of clinical isolates revealed that spatially distal mutations arising in connection and the RNase H domain also confer NNRTI resistance and contribute to NRTI resistance. However, the precise structural mechanism by which the connection domain mutations confer NNRTI resistance is poorly understood. We performed 50-ns molecular dynamics (MD) simulations, followed by essential dynamics, free-energy landscape analyses, and network analyses of RT-DNA, RT-DNA-nevirapine (NVP), and N348I/T369I mutant RT-DNA-NVP complexes. MD simulation studies revealed altered global motions and restricted conformational landscape of RT upon NVP binding. Analysis of protein structure network parameters demonstrated a dissortative hub pattern in the RT-DNA complex and an assortative hub pattern in the RT-DNA-NVP complex suggesting enhanced rigidity of RT upon NVP binding. The connection subdomain mutations N348I/T369I did not induce any significant structural change; rather, these mutations modulate the conformational dynamics and alter the long-range allosteric communication network between the connection subdomain and NNRTI pocket. Insights from the present study provide a structural basis for the biochemical and clinical findings on drug resistance caused by the connection and RNase H mutations.

Also flagged:Fragile X Syndromefragile X mental retardation 1FMR1mental retardationmethylationhistone
Journal Article 2013-11-22 ✓ 2 Snippets Volle CB, Delaney S.
In-Text Gene Mentions

…the huntingtin (HTT) gene is…

…mental retardation 1;HTT: Huntingtin; NCP: Nucleosome…

Show Full Abstract

<h4>Background</h4>Fragile X Syndrome (FXS), the most common inherited form of mental retardation, is caused by expansion of a CGG/CCG repeat tract in the 5'-untranslated region of the fragile X mental retardation (FMR1) gene, which changes the functional organization of the gene from euchromatin to heterochromatin. Interestingly, healthy-length repeat tracts possess AGG/CCT interruptions every 9-10 repeats, and clinical data shows that loss of these interruptions is linked to expansion of the repeat tract to disease-length. Thus, it is important to understand how these interruptions alter the behavior of the repeat tract in the packaged gene.<h4>Results</h4>To investigate how uninterrupted and interrupted CGG/CCG repeat tracts interact with the histone core, we designed experiments using the nucleosome core particle, the most basic unit of chromatin packaging. Using DNA containing 19 CGG/CCG repeats, flanked by either a nucleosome positioning sequence or the FMR1 gene sequence, we determined that the addition of a single AGG/CCT interruption modulates both the ability of the CGG/CCG repeat DNA to incorporate into a nucleosome and the rotational and translational position of the repeat DNA around the histone core when flanked by the nucleosome positioning sequence. The presence of these interruptions also alters the periodicity of the DNA in the nucleosome; interrupted repeat tracts have a greater periodicity than uninterrupted repeats.<h4>Conclusions</h4>This work defines the ability of AGG/CCT interruptions to modulate the behavior of the repeat tract in the packaged gene and contributes to our understanding of the role that AGG/CCT interruptions play in suppressing expansion and maintaining the correct functional organization of the FMR1 gene, highlighting a protective role played by the interruptions in genomic packaging.

Also flagged:apatitecalcium phosphate-tricalciumhydroxyapatitecalcium phosphatespore
Journal Article 2013-11-22 ✓ 1 Snippet Patlolla A, Arinzeh TL.
In-Text Gene Mentions

…HA ) ( Ca10 ( PO4 ) 6 ( OH ) 2 ) , in…

Show Full Abstract

Significant interest has been in examining calcium phosphate ceramics, specifically β-tricalcium phosphate (β-TCP) (Ca3 (PO4)2 ) and synthetic hydroxyapatite (HA) (Ca10 (PO4)6 (OH)2 ), in composites and more recently, in fibrous composites formed using the electrospinning technique for bone tissue engineering applications. Calcium phosphate ceramics are sought because they can be bone bioactive, which means an apatite forms on their surface that facilitates bonding to bone tissue, and are osteoconductive. However, studies examining the bioactivity of electrospun composites containing calcium phosphates and their corresponding osteogenic activity have been limited. In this study, electrospun composites consisting of (20/80) HA/TCP nanoceramics and poly (ϵ-caprolactone) (PCL) were fabricated. Solvent and solvent combinations were evaluated to form scaffolds with a maximum concentration and dispersion of ceramic and pore sizes large enough for cell infiltration and tissue growth. PCL was dissolved in either methylene chloride (Composite-MC) or a combination of methylene chloride (80%) and dimethylformamide (20%; Composite-MC + DMF). Composites were evaluated in vitro for degradation, apatite formation, and osteogenic differentiation of human mesenchymal stem cells (MSCs) with an emphasis on temporal gene expression of osteogenic markers and the pluripotent gene Sox-2. Apatite formation and the osteogenic differentiation was the greatest for Composite-MC as determined by gene expression, protein production and biochemical markers, even without the presence of osteoinductive factors in the media, in comparison to Composite-MC + DMF and unfilled PCL mats. Sox-2 levels also reduced over time. The results of this study demonstrate that the solvent or solvent combination used in preparing the electrospun composite mats plays a critical role in determining their bioactivity which may, in turn, affect cell behavior.

Also flagged:histonesgene expressionnucleosomechromatinbindingnucleosomes
Journal Article 2013-11-22 ✓ 2 Snippets Over RS, Michaels SD.
In-Text Gene Mentions

…processes mediated bylinker histoneshistones in plants.…

linker histones

Show Full Abstract

Histones package DNA in all eukaryotes and play key roles in regulating gene expression. Approximately 150 base pairs of DNA wraps around an octamer of core histones to form the nucleosome, the basic unit of chromatin. Linker histones compact chromatin further by binding to and neutralizing the charge of the DNA between nucleosomes. It is well established that chromatin packing is regulated by a complex pattern of posttranslational modifications (PTMs) to core histones, but linker histone function is less well understood. In this review, we describe the current understanding of the many roles that linker histones play in cellular processes, including gene regulation, cell division, and development, while putting the linker histone in the context of other nuclear proteins. Although intriguing roles for plant linker histones are beginning to emerge, much of our current understanding comes from work in animal systems. Many unanswered questions remain and additional work is required to fully elucidate the complex processes mediated by linker histones in plants.

Also flagged:autosomal dominant neurodegenerative disorderdeathHDHuntington's Diseasebehavioralneurodegenerative disorder
Journal Article 2013-11-22 ✓ 5 Snippets Hölter SM, Stromberg M, Kovalenko M, Garrett L, Glasl L, Lopez E, Guide J, Götz A, Hans W, Becker L, Rathkolb B, Rozman J, Schrewed A, Klingenspor M, Klopstock T, Schulz H, Wolf E, Wursta W, Gillis T, Wakimoto H, Seidman J, MacDonald ME, Cotman S, Gailus-Durner V, Fuchs H, de Angelis MH, Lee JM, Wheeler VC.
In-Text Gene Mentions

HD is caused by an expansion >35 repeats of a polymorphic CAG repeat tract within exon 1 of the HTT gene, elongating a glutamine stretch at the amino-terminus of an ~350 kDa protein called huntingtin [3].

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by the expansion of a CAG trinucleotide repeat in the HTT gene encoding huntingtin.

…a single mutantHTTallele in the…

…HTT homologue (Httor Hdh )…

…in some studies,HTTgene-positive individuals mani…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by the expansion of a CAG trinucleotide repeat in the HTT gene encoding huntingtin. The disease has an insidious course, typically progressing over 10-15 years until death. Currently there is no effective disease-modifying therapy. To better understand the HD pathogenic process we have developed genetic HTT CAG knock-in mouse models that accurately recapitulate the HD mutation in man. Here, we describe results of a broad, standardized phenotypic screen in 10-46 week old heterozygous HdhQ111 knock-in mice, probing a wide range of physiological systems. The results of this screen revealed a number of behavioral abnormalities in HdhQ111/+ mice that include hypoactivity, decreased anxiety, motor learning and coordination deficits, and impaired olfactory discrimination. The screen also provided evidence supporting subtle cardiovascular, lung, and plasma metabolite alterations. Importantly, our results reveal that a single mutant HTT allele in the mouse is sufficient to elicit multiple phenotypic abnormalities, consistent with a dominant disease process in patients. These data provide a starting point for further investigation of several organ systems in HD, for the dissection of underlying pathogenic mechanisms and for the identification of reliable phenotypic endpoints for therapeutic testing.

Also flagged:FTOobesitychronic diseasestype-2 diabetescardiovascular diseasescancer
Journal Article 2013-11-22 ✓ 2 Snippets Liu C, Mou S, Cai Y.
In-Text Gene Mentions

Recently, many single nucleotide polymorphisms (SNPs) were identified by genome-wide association studies (GWASs) in adults and children with respect to the pathogenesis of obesity, including FTO, TMEM18, GNPDA2, INSIG2, MC4R, NEGR1, 1q25, BDNF and KCTD15[7].

…, MC4R ,NEGR1, 1q25 ,…

Show Full Abstract

<h4>Objective</h4>The fat mass and obesity associated gene (FTO) polymorphisms have been implicated in the susceptibility of overweight/obesity in children and adolescents. However, the results have been inconsistent. In this study, we performed a meta-analysis to clarify the association of FTO gene polymorphisms with overweight/obesity risk among children and adolescents.<h4>Methods</h4>PubMed and Embase were used to search for eligible published literatures. Pooled odds ratios (ORs) with 95% confidence intervals (CIs) were calculated using random- or fixed-effect models.<h4>Results</h4>A total of 21 articles containing 23 studies (11208cases and 35015controls) were included in our analysis. The results indicated that variant in FTO gene was significantly associated with increased risk of overweight/obesity in children and adolescents (OR=1.35; 95%CI: 1.27-1.44; P<0.001). The overall pooled ORs for risk obesity and overweight were 1.34 (95%CI: 1.21-1.48) and 1.35 (95%CI: 1.25-1.47), respectively. Subgroup analyses also showed similar trends in most subgroups of adjustment for covariates and unadjustment, different ethnicities (Caucasians, Asians, and Amerindians), and each of three investigated polymorphisms (rs9939609, rs1421085, and rs1558902).<h4>Conclusions</h4>The present meta-analysis suggested a positive association between FTO gene polymorphism and overweight/obesity risk among children and adolescents. Further prospective studies should be recommended to confirm the observed association, and underlying mechanism should be investigated to clarify the association of FTO gene polymorphism with overweight/obesity.

Also flagged:Lipidgallstone diseasedigestive disordersgallstonegallstonescholesterol
Journal Article 2013-11-21 No Snippets Goodloe R, Brown-Gentry K, Gillani NB, Jin H, Mayo P, Allen M, McClellan B, Boston J, Sutcliffe C, Schnetz-Boutaud N, Dilks HH, Crawford DC.
Show Full Abstract

<h4>Background</h4>Gallstone disease is one of the most common digestive disorders, affecting more than 30 million Americans. Previous twin studies suggest a heritability of 25% for gallstone formation. To date, one genome-wide association study (GWAS) has been performed in a population of European-descent. Several candidate gene studies have been performed in various populations, but most have been inconclusive. Given that gallstones consist of up to 80% cholesterol, we hypothesized that common genetic variants associated with high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and triglycerides (TG) would also be associated with gallstone risk.<h4>Methods</h4>To test this hypothesis, the Epidemiologic Architecture for Genes Linked to Environment (EAGLE) study as part of the Population Architecture using Genomics and Epidemiology (PAGE) study performed tests of association between 49 GWAS-identified lipid trait SNPs and gallstone disease in non-Hispanic whites (446 cases and 1,962 controls), non-Hispanic blacks (179 cases and 1,540 controls), and Mexican Americans (227 cases and 1,478 controls) ascertained for the population-based Third National Health and Nutrition Examination Survey (NHANES III).<h4>Results</h4>At a liberal significance threshold of 0.05, five, four, and four SNP(s) were associated with disease risk in non-Hispanic whites, non-Hispanic blacks, and Mexican Americans, respectively. No one SNP was associated with gallstone disease risk in all three racial/ethnic groups. The most significant association was observed for ABCG5 rs6756629 in non-Hispanic whites [odds ratio (OR) = 1.89; 95% confidence interval (CI) = 1.44-2.49; p = 0.0001). ABCG5 rs6756629 is in strong linkage disequilibrium with rs11887534 (D19H), a variant previously associated with gallstone disease risk in populations of European-descent.<h4>Conclusions</h4>We replicated a previously associated variant for gallstone disease risk in non-Hispanic whites. Further discovery and fine-mapping efforts in diverse populations are needed to fully describe the genetic architecture of gallstone disease risk in humans.

Also flagged:Heat shock factor 1SOD1amyotrophic lateral sclerosisALScopperbinding
Journal Article 2013-11-21 ✓ 2 Snippets Lin PY, Simon SM, Koh WK, Folorunso O, Umbaugh CS, Pierce A.
In-Text Gene Mentions
⭐ same-sentence co-mention

SOD1: Cu/Zn superoxide dismutase 1; ALS: Amyotrophic lateral sclerosis; UCHL1: Ubiquitin carboxy-terminal hydrolase L1; bisANS: 4,4’-dianilino-1,1’-binaphthyl-5,5’-disulfonic acid; TDP-43: TAR DNA binding protein 43; FUS: Fused in sarcoma; fALS: familial ALS; HSPs: Heat shock proteins; HSF1: Heat shock factor 1; BCA: Bicinchoninic acid; ANOVA: Analysis of variance; TBST: Tris-buffered saline containing tween-20; dTT: dithiothreitol; HSP70: Inducible heat shock protein 70; Hsc70: Heat shock cognate 70; CHIP: Carboxyl terminus of Hsp70-interacting protein; actg1: cytoplasmic actin 2; aldoc: fructose bisphosphate aldolase C; ak1: adenylate kinase 1; pebp1: phosphatidylethanolamine-binding protein 1; ppia: peptidyl prolyl isomerase A; dpysl2: dihydropyrimidinase-related protein 2; gfap: glial fibrillary acidic protein isoform 1; tubb4b: tubulin beta-4B chain; eno1: alpha enolase; ldhb: lactate dehydrogenase B-chain; pgam1: phosphoglycerate mutase 1; Prdx6: Peroxiredoxin 6; Ywhaz: 14-3-3 protein zeta; Ywhag: 14-3-3 gamma; WT: Wild type; ChAT: Choline acetyltransferase; ANS: 1-Anilinonaphthalene-8-Sulfonic Acid; TIA1: T Cell intracellular antigen-1; BAG3: Bcl-associated athanogene 3; HDAC6: Histone deacetylase 6; MALDI-TOF: Matrix assisted laser desorption ionization time of flight; LC3-II: Membrane-bound microtubule-associated proteins 1A/1B light chain 3A.

…phosphoglycerate mutase 1;Prdx6: Peroxiredoxin 6; Ywhaz:…

Show Full Abstract

<h4>Background</h4>Mutations in the Cu/Zn superoxide dismutase gene (SOD1) are responsible for 20% of familial forms of amyotrophic lateral sclerosis (ALS), and mutant SOD1 has been shown to have increased surface hydrophobicity in vitro. Mutant SOD1 may adopt a complex array of conformations with varying toxicity in vivo. We have used a novel fluorescence-based proteomic assay using 4,4'-bis-1-anilinonaphthalene-8-sulfonate (bisANS) to assess the surface hydrophobicity, and thereby distinguish between different conformations, of SOD1 and other proteins in situ.<h4>Results</h4>Covalent bisANS labeling of spinal cord extracts revealed that alterations in surface hydrophobicity of H46R/H48Q mutations in SOD1 provoke formation of high molecular weight SOD1 species with lowered solubility, likely due to increased exposure of hydrophobic surfaces. BisANS was docked on the H46R/H48Q SOD1 structure at the disordered copper binding and electrostatic loops of mutant SOD1, but not non-mutant WT SOD1. 16 non-SOD1 proteins were also identified that exhibited altered surface hydrophobicity in the H46R/H48Q mutant mouse model of ALS, including proteins involved in energy metabolism, cytoskeleton, signaling, and protein quality control. Heat shock proteins (HSPs) were also enriched in the detergent-insoluble fractions with SOD1. Given that chaperones recognize proteins with exposed hydrophobic surfaces as substrates and the importance of protein homeostasis in ALS, we crossed SOD1 H46R/H48Q mutant mice with mice over-expressing the heat shock factor 1 (HSF1) transcription factor. Here we showed that HSF1 over-expression in H46R/H48Q ALS mice enhanced proteostasis as evidenced by increased expression of HSPs in motor neurons and astrocytes and increased solubility of mutant SOD1. HSF1 over-expression significantly reduced body weight loss, delayed ALS disease onset, decreases cases of early disease, and increased survival for the 25th percentile in an H46R/H48Q SOD1 background. HSF1 overexpression did not affect macroautophagy in the ALS background, but was associated with maintenance of carboxyl terminus of Hsp70 interacting protein (CHIP) expression which declined in H46R/H48Q mice.<h4>Conclusion</h4>Our results uncover the potential importance of changes in protein surface hydrophobicity of SOD1 and other non-SOD1 proteins in ALS, and how strategies that activate HSF1 are valid therapies for ALS and other age-associated proteinopathies.

Also flagged:tumourcolorectal cancerbeta-catenincyclin D1p53tumours
Journal Article 2013-11-21 ✓ 1 Snippet Brändstedt J, Wangefjord S, Borgquist S, Nodin B, Eberhard J, Manjer J, Jirström K.
In-Text Gene Mentions

…Polyposis Coli gene),DCC(Deleted in Colorectal…

Show Full Abstract

<h4>Background</h4>Obesity is a well established risk factor of colorectal cancer (CRC), but how body size influences risk of colorectal cancer defined by key molecular alterations remains unclear. In this study, we investigated the relationship between height, weight, body mass index (BMI), waist- and hip circumference, waist-hip ratio (WHR) and risk of CRC according to expression of beta-catenin, cyclin D1, p53 and microsatellite instability status of the tumours in men and women, respectively.<h4>Methods</h4>Immunohistochemical expression of beta-catenin, cyclin D1, p53 and MSI-screening status was assessed in tissue microarrays with tumours from 584 cases of incident CRC in the Malmö Diet and Cancer Study. Six anthropometric factors: height, weight, BMI, waist- and hip circumference, and WHR were categorized by quartiles of baseline measurements and relative risks of CRC according to expression of beta-catenin, cyclin D1, p53 and MSI status were calculated using multivariate Cox regression models.<h4>Results</h4>High height was associated with risk of cyclin D1 positive, and p53 negative CRC in women but not with any investigative molecular subsets of CRC in men. High weight was associated with beta-catenin positive, cyclin D1 positive, p53 negative and microsatellite stable (MSS) tumours in women, and with beta-catenin negative and p53 positive tumours in men. Increased hip circumference was associated with beta-catenin positive, p53 negative and MSS tumours in women and with beta-catenin negative, cyclin D1 positive, p53 positive and MSS tumours in men. In women, waist circumference and WHR were not associated with any molecular subsets of CRC. In men, both high WHR and high waist circumference were associated with beta-catenin positive, cyclin D1 positive and p53 positive tumours. WHR was also associated with p53 negative CRC, and waist circumference with MSS tumours. High BMI was associated with increased risk of beta-catenin positive and MSS CRC in women, and with beta-catenin positive, cyclin D1 positive and p53 positive tumours in men.<h4>Conclusions</h4>Findings from this large prospective cohort study indicate sex-related differences in the relationship between obesity and CRC risk according to key molecular characteristics, and provide further support of an influence of lifestyle factors on different molecular pathways of colorectal carcinogenesis.

Also flagged:16S rRNAironsulfidesulfur compoundscarbonbutyl
Journal Article 2013-11-21 ✓ 1 Snippet Kawaichi S, Ito N, Yoshida T, Sako Y.
In-Text Gene Mentions

…In light of the distribution of “HTT” in HS6, members of this group might be adapted to iron-rich environments at either high or moderate temperatures, although considerable effort is needed to speculate the functions of microbes from their phylogeny.…

Show Full Abstract

Physicochemical characteristics and archaeal and bacterial community structures in an iron-rich coastal hydrothermal field, where the temperature of the most active hot spot reaches above 100 °C, were investigated to obtain fundamental information on microbes inhabiting a coastal hydrothermal field. The environmental settings of the coastal hydrothermal field were similar in some degree to those of deep-sea hydrothermal environments because of its emission of H2, CO2, and sulfide from the bottom of the hot spot. The results of clone analyses based on the 16S rRNA gene led us to speculate the presence of a chemo-synthetic microbial ecosystem, where chemolithoautotrophic thermophiles, primarily the bacterial order Aquificales, function as primary producers using H2 or sulfur compounds as their energy source and CO2 as their carbon source, and the organic compounds synthesized by them support the growth of chemoheterotrophic thermophiles, such as members of the order Thermales and the family Desulfurococcaceae. In addition, the dominance of members of the bacterial genus Herbaspirillum in the high temperature bottom layer led us to speculate the temporal formation of mesophilic zones where they can also function as primary producing or nitrogen-fixing bacteria.

Also flagged:osteogenesistissue healingwatermembranepolytetrafluoroethylenebone formation
Journal Article 2013-11-21 No Snippets Roffi A, Filardo G, Kon E, Marcacci M.
Show Full Abstract

<h4>Background</h4>Several bone implants are applied in clinical practice, but none meets the requirements of an ideal implant. Platelet-rich plasma (PRP) is an easy and inexpensive way to obtain growth factors in physiologic proportions that might favour the regenerative process. The aim of this review is to analyse clinical studies in order to investigate the role of PRP in favouring bone integration of graft, graft substitutes, or implants, and to identify the materials for which the additional use of PRP might be associated with superior osseo- and soft tissues integration.<h4>Methods</h4>A search on PubMed database was performed considering the literature from 2000 to 2012, using the following string: ("Bone Substitutes"[Mesh] OR "Bone Transplantation"[Mesh] OR "Bone Regeneration"[Mesh] OR "Osseointegration"[Mesh]) AND ("Blood Platelets"[Mesh] OR "Platelet-Rich Plasma"[Mesh]). After abstracts screening, the full-texts of selected papers were analyzed and the papers found from the reference lists were also considered. The search focused on clinical applications documented in studies in the English language: levels of evidence included in the literature analysis were I, II and III.<h4>Results</h4>Literature analysis showed 83 papers that fulfilled the inclusion criteria: 26 randomized controlled trials (RCT), 14 comparative studies, 29 case series, and 14 case reports. Several implant materials were identified: 24 papers on autologous bone, 6 on freeze-dried bone allograft (FDBA), 16 on bovine porous bone mineral (BPBM), 9 on β-tricalcium phosphate (β-TCP), 4 on hydroxyapatite (HA), 2 on titanium (Ti), 1 on natural coral, 1 on collagen sponge, 1 on medical-grade calcium sulphate hemihydrate (MGCSH), 1 on bioactive glass (BG) and 18 on a combination of biomaterials. Only 4 papers were related to the orthopaedic field, whereas the majority belonged to clinical applications in oral/maxillofacial surgery.<h4>Conclusions</h4>The systematic research showed a growing interest in this approach for bone implant integration, with an increasing number of studies published over time. However, knowledge on this topic is still preliminary, with the presence mainly of low quality studies. Many aspects still have to be understood, such as the biomaterials that can benefit most from PRP and the best protocol for PRP both for production and application.

Also flagged:regulation of gene expressiontranscription factorTFbindinggene expressionchromatin
Journal Article 2013-11-21 ✓ 1 Snippet Wang S, Sun H, Ma J, Zang C, Wang C, Wang J, Tang Q, Meyer CA, Zhang Y, Liu XS.
In-Text Gene Mentions

HMGN4

Show Full Abstract

The combination of ChIP-seq and transcriptome analysis is a compelling approach to unravel the regulation of gene expression. Several recently published methods combine transcription factor (TF) binding and gene expression for target prediction, but few of them provide an efficient software package for the community. Binding and expression target analysis (BETA) is a software package that integrates ChIP-seq of TFs or chromatin regulators with differential gene expression data to infer direct target genes. BETA has three functions: (i) to predict whether the factor has activating or repressive function; (ii) to infer the factor's target genes; and (iii) to identify the motif of the factor and its collaborators, which might modulate the factor's activating or repressive function. Here we describe the implementation and features of BETA to demonstrate its application to several data sets. BETA requires ~1 GB of RAM, and the procedure takes 20 min to complete. BETA is available open source at http://cistrome.org/BETA/.

Also flagged:acute mountain sicknessperoxiredoxin 6glutathione peroxidasesulfhydryl oxidase 1oxygenheadache
Journal Article 2013-11-21 No Snippets Julian CG, Subudhi AW, Hill RC, Wilson MJ, Dimmen AC, Hansen KC, Roach RC.
Show Full Abstract

Our objective in this exploratory study was to identify novel biomarkers of importance for acute mountain sickness (AMS) using discovery-based proteomic methods. Peripheral blood samples were collected and AMS symptoms were assessed in 20 healthy volunteers prior to [-15 h (baseline) and 0 h; 1,609 m; barometric pressure = 625 mmHg] and after a 9-h exposure to hypobaric hypoxia (9 h; 4,875 m; barometric pressure = 425 mmHg). AMS status was assessed using the Lake Louise Questionnaire. Plasma samples were pooled according to AMS status at each time point. Protein composition of the samples was determined by a GeLC-MS/MS approach using two analytical platforms (LTQ-XL linear ion trap mass spectrometer and a LTQ-FT ultra hybrid mass spectrometer) for technical replication. Spectral counting was used to make semiquantitative comparisons of protein abundance between AMS-susceptible (AMS) and AMS-resistant (AMS·R) subjects with exposure to hypobaric hypoxia. After 9 h of hypoxia, the abundance of proteins with antioxidant properties (i.e., peroxiredoxin 6, glutathione peroxidase, and sulfhydryl oxidase 1) rose in AMS but not AMS·R. Our exploratory analyses suggest that exposure to hypobaric hypoxia enhances enzymatic antioxidant systems in AMS vs. AMS·R, which, we propose, may be an overcompensation for hypoxia-induced oxidant production. On the basis of our findings we 1) speculate that quenching oxidant activity may have adverse downstream effects that are of pathophysiological importance for AMS such as interrupting oxidant-sensitive cell signaling and gene transcription and 2) question the existing assumption that increased oxidant production in AMS is pathological.

Also flagged:chondrogenesisMIACD-RAPembryogenesisCol2a1Sox9
Journal Article 2013-11-21 ✓ 1 Snippet Schmid R, Bosserhoff AK.
In-Text Gene Mentions

…by enhanced Sox9,Sox6and AP-2α expression.…

Show Full Abstract

Recent in vitro analysis of MIA/CD-RAP-deficient (MIA(-/-)) mesenchymal stem cells revealed altered chondrogenic differentiation, characterised by enhanced proliferation and delayed differentiation. However, adult MIA(-/-) mice develop normally and show only ultrastructural defects of the cartilage but no major abnormalities. We therefore focused, in this study, on chondrogenesis in vivo in MIA(-/-) mouse embryos to reveal potential molecular changes during embryogenesis and possible redundant mechanisms, which explain the almost normal phenotype despite MIA/CD-RAP loss. In situ hybridisation analysis revealed larger expression areas of Col2a1 and Sox9 positive, proliferating chondrocytes at day 15.5 and 16.5 of embryogenesis in MIA(-/-) mice. The initially diminished zone of Col10a1-expressing hypertrophic chondrocytes at day 15.5 was compensated at day 16.5 in MIA(-/-) embryos. Supported by in vitro studies using mesenchymal stem cells, we discovered that chondrogenesis in MIA(-/-) mice is modified by enhanced Sox9, Sox6 and AP-2α expression. Finally, we identified reduced AP1 and CRE activity, analysed by reporter gene- and electrophoretic mobility shift assays, important for redundancy mechanism which rescued delayed hypertrophic differentiation and allows normal development of MIA(-/-) mice. In summary, as observed in other knockout models of molecules important for cartilage development and differentiation, viability and functional integrity is reached by remarkable molecular redundancy in MIA/CD-RAP knockout mice.

Also flagged:SIMSIM2SIM1GAPDHhypoxia-inducible factor αHIF-1α
Journal Article 2013-11-21 ✓ 1 Snippet Cai Q, Cai S, Zhu C, Verma SC, Choi JY, Robertson ES.
In-Text Gene Mentions

…proteins including thehistone deacetylase complexdeacetylase complex (NCoR1)…

Show Full Abstract

Kaposi's sarcoma-associated herpesvirus (KSHV) stabilizes hypoxia-inducible factor α (HIF-1α) during latent infection, and HIF-1α reactivates lytic replication under hypoxic stress. However, the mechanism utilized by KSHV to block lytic reactivation with the accumulation of HIF-1α in latency remains unclear. Here, we report that LANA encoded by KSHV contains a unique SUMO-interacting motif (LANA(SIM)) which is specific for interaction with SUMO-2 and facilitates LANA SUMOylation at lysine 1140. Proteomic and co-immunoprecipitation analysis further reveal that the SUMO-2 modified transcription repressor KAP1 is a critical factor recruited by LANA(SIM). Deletion of LANA(SIM) led to functional loss of both LANA-mediated viral episome maintenance and lytic gene silencing. Moreover, hypoxia reduced KAP1 SUMOylation and resulted in dissociation of both KAP1 and Sin3A repressors from LANA(SIM)-associated complex. Therefore, the LANA(SIM) motif plays an essential role in KSHV latency and is a potential drug target against KSHV-associated cancers.

Also flagged:PLP2membrane-associatedK3K5ubiquitin E3 ligases
Journal Article 2013-11-21 ✓ 1 Snippet Timms RT, Duncan LM, Tchasovnikarova IA, Antrobus R, Smith DL, Dougan G, Weekes MP, Lehner PJ.
In-Text Gene Mentions

…the MHC-I-related moleculeHFE[6] , the…

Show Full Abstract

The Kaposi's sarcoma-associated herpesvirus gene products K3 and K5 are viral ubiquitin E3 ligases which downregulate MHC-I and additional cell surface immunoreceptors. To identify novel cellular genes required for K5 function we performed a forward genetic screen in near-haploid human KBM7 cells. The screen identified proteolipid protein 2 (PLP2), a MARVEL domain protein of unknown function, as essential for K5 activity. Genetic loss of PLP2 traps the viral ligase in the endoplasmic reticulum, where it is unable to ubiquitinate and degrade its substrates. Subsequent analysis of the plasma membrane proteome of K5-expressing KBM7 cells in the presence and absence of PLP2 revealed a wide range of novel K5 targets, all of which required PLP2 for their K5-mediated downregulation. This work ascribes a critical function to PLP2 for viral ligase activity and underlines the power of non-lethal haploid genetic screens in human cells to identify the genes involved in pathogen manipulation of the host immune system.

Also flagged:ironoxygenerythropoiesisiron overload disordersbindingcitrate
Journal Article 2013-11-21 ✓ 3 Snippets Arezes J, Costa M, Vieira I, Dias V, Kong XL, Fernandes R, Vos M, Carlsson A, Rikers Y, Porto G, Rangel M, Rangel M, Hider RC, Pinto JP.
In-Text Gene Mentions

In addition, a negative correlation has been consistently found between total body iron stores and CD8+ lymphocytes in the peripheral blood and was also documented in liver biopsies from HFE-hemochromatosis patients [15], [16], supporting their role in the protection against iron accumulation.

…liver biopsies fromHFE-hemochromatosis patients [15]…

…liver biopsies from HFE-hemochromatosispatients [15] ,…

Show Full Abstract

Iron is an essential nutrient in several biological processes such as oxygen transport, DNA replication and erythropoiesis. Plasma iron normally circulates bound to transferrin. In iron overload disorders, however, iron concentrations exceed transferrin binding capacity and iron appears complexed with low molecular weight molecules, known as non-transferrin-bound iron (NTBI). NTBI is responsible for the toxicity associated with iron-overload pathologies but the mechanisms leading to NTBI uptake are not fully understood. Here we show for the first time that T lymphocytes are able to take up and accumulate NTBI in a manner that resembles that of hepatocytes. Moreover, we show that both hepatocytes and T lymphocytes take up the oligomeric Fe3Cit3 preferentially to other iron-citrate species, suggesting the existence of a selective NTBI carrier. These results provide a tool for the identification of the still elusive ferric-citrate cellular carrier and may also open a new pathway towards the design of more efficient iron chelators for the treatment of iron overload disorders.

Also flagged:polyglutamine diseasespolyglutamineAutophagyion transportersNHE1NHE5
Journal Article 2013-11-21 ✓ 5 Snippets Togashi K, Wakatsuki S, Furuno A, Tokunaga S, Nagai Y, Araki T.
In-Text Gene Mentions

Wong et al. reported that expression of HTT proteins with a pathologically extended glutamine repeat in cultured cells causes acidification of culture medium [23].

In HD, for example, the disease-causing mutation in huntingtin (HTT), a protein of uncertain function causes expansion of a stretch of glutamines (polyQ) near its N terminus, and the mutant form of HTT accumulates as nuclear and cytoplasmic inclusions in an HD brain [2].

To this end, we crossed N171-82Q mice (HD model mice overexpressing N-terminal fragment of HTT containing 82 glutamine repeats) with NHE5 knock-out mice.

We employed htt-Ex1-Q97, containing 97 stretch of glutamine chain in the first exon of HTT, as an abnormal polyQ-containing protein, and htt-Ex1-Q25 as a normal control.

…mutation in huntingtin (HTT), a protein of…

Show Full Abstract

In polyglutamine diseases, an abnormally elongated polyglutamine results in protein misfolding and accumulation of intracellular aggregates. Autophagy is a major cellular degradative pathway responsible for eliminating unnecessary proteins, including polyglutamine aggregates. Basal autophagy constitutively occurs at low levels in cells for the performance of homeostatic function, but the regulatory mechanism for basal autophagy remains elusive. Here we show that the Na(+)/H(+) exchanger (NHE) family of ion transporters affect autophagy in a neuron-like cell line (Neuro-2a cells). We showed that expression of NHE1 and NHE5 is correlated to polyglutamine accumulation levels in a cellular model of Huntington's disease, a fatal neurodegenerative disorder characterized by accumulation of polyglutamine-containing aggregate formation in the brain. Furthermore, we showed that loss of NHE5 results in increased polyglutamine accumulation in an animal model of Huntington's disease. Our data suggest that cellular pH regulation by NHE1 and NHE5 plays a role in regulating basal autophagy and thereby promotes autophagy-mediated degradation of proteins including polyglutamine aggregates.

Also flagged:nucleusdegenerative disc diseasesextracellularmetabolismsynthesislumbar disc herniation
Journal Article 2013-11-21 ✓ 2 Snippets Mern DS, Fontana J, Beierfuß A, Thomé C, Hegewald AA.
In-Text Gene Mentions

Furthermore, treatment of human NP and AF cells with 10 ng/ml recombinant IL-1β has shown increased expression of MMP-3, MMP-13 and ADAMTS-4 as well as decreased expression of aggrecan, collagen II, collagen I, and SOX6 [42].

…collagen I, andSOX6[ 42 ].…

Show Full Abstract

Painful degenerative disc diseases have been targeted by different biological treatment approaches. Nucleus pulposus (NP) cells play a central role in intervertebral disc (IVD) maintenance by orchestrating catabolic, anabolic and inflammatory factors that affect the extracellular matrix. IVD degeneration is associated with imbalances of these factors, resulting in a catabolic inflammatory metabolism. Therefore, accurate knowledge about their quantity and quality with regard to matrix synthesis is vital for a rational gene therapeutic approach. NP cells were isolated from 63 patients operated due to lumbar disc herniation (mean age 56 / range 29 - 84 years). Then, three-dimensional culture with low-glucose was completed in a collagen type I scaffold for four weeks. Subsequently cell proliferation evaluation was performed using 3-(4, 5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide and intracellular concentration of 28 endogenously expressed anabolic, catabolic, inflammatory factors and relevant matrix proteins was determined by enzyme-linked immunosorbent assay. Specimen-related grades of degeneration were confirmed by preoperative magnetic resonance imaging. Independent from gender, age and grade of degeneration proliferation rates remained similar in all groups of NP cells. Progressive grades of degeneration, however, showed a significant influence on accumulation of selective groups of factors such as disintegrin and metalloproteinase with thrombospondin motifs 4 and 5, matrix metalloproteinase 3, metalloproteinase inhibitor 1 and 2, interleukin-1β and interleukin-1 receptor. Along with these changes, the key NP matrix proteins aggrecan and collagen II decreased significantly. The concentration of anabolic factors bone morphogenetic proteins 2, 4, 6 and 7, insulin-like growth factor 1, transforming growth factor beta 1 and 3, however, remained below the minimal detectable quantities. These findings indicate that progressive degenerative changes in NP may be problematic with regard to biologic treatment strategies. Hence, gene therapeutic interventions regulating relevant bioactive factors identified in this work might contribute to the development of regenerative treatment approaches for degenerative disc diseases.

Also flagged:gene expressiontranscription factorsbindingtranscription factorembryogenesisamino acid
Journal Article 2013-11-21 ✓ 1 Snippet Doglio L, Goode DK, Pelleri MC, Pauls S, Frabetti F, Shimeld SM, Vavouri T, Elgar G.
In-Text Gene Mentions

…binding transcription factorPOU3F2, a protein known…

Show Full Abstract

Urochordates are the closest relatives of vertebrates and at the larval stage, possess a characteristic bilateral chordate body plan. In vertebrates, the genes that orchestrate embryonic patterning are in part regulated by highly conserved non-coding elements (CNEs), yet these elements have not been identified in urochordate genomes. Consequently the evolution of the cis-regulatory code for urochordate development remains largely uncharacterised. Here, we use genome-wide comparisons between C. intestinalis and C. savignyi to identify putative urochordate cis-regulatory sequences. Ciona conserved non-coding elements (ciCNEs) are associated with largely the same key regulatory genes as vertebrate CNEs. Furthermore, some of the tested ciCNEs are able to activate reporter gene expression in both zebrafish and Ciona embryos, in a pattern that at least partially overlaps that of the gene they associate with, despite the absence of sequence identity. We also show that the ability of a ciCNE to up-regulate gene expression in vertebrate embryos can in some cases be localised to short sub-sequences, suggesting that functional cross-talk may be defined by small regions of ancestral regulatory logic, although functional sub-sequences may also be dispersed across the whole element. We conclude that the structure and organisation of cis-regulatory modules is very different between vertebrates and urochordates, reflecting their separate evolutionary histories. However, functional cross-talk still exists because the same repertoire of transcription factors has likely guided their parallel evolution, exploiting similar sets of binding sites but in different combinations.

Also flagged:Gene expressionHuntington's diseaseinheritedtrinucleotidescytosineadenosine
Journal Article 2013-11-21 ✓ 2 Snippets Marchina E, Misasi S, Bozzato A, Ferraboli S, Agosti C, Rozzini L, Borsani G, Barlati S, Padovani A.
In-Text Gene Mentions

Huntington's disease is an inherited disorder caused by expanded stretch of consecutive trinucleotides (cytosine-adenosine-guanine, CAG) within the first exon of the huntingtin (HTT) gene on chromosome 4 (p16.3).

…of the huntingtin (HTT) gene on chromosome…

Show Full Abstract

Huntington's disease is an inherited disorder caused by expanded stretch of consecutive trinucleotides (cytosine-adenosine-guanine, CAG) within the first exon of the huntingtin (HTT) gene on chromosome 4 (p16.3). The mutated huntingtin (mHTT) gains toxic function, probably through mechanisms that involve aberrant interactions in several pathways, causing cytotoxicity. Pathophysiology of disease involves several tissues; indeed it has been shown that there is a broad toxic effect of mHTT in the peripheral tissue of patients with HD, not only in the central nervous system. In this study we compared gene expression profiles (GEP) of HD fibroblasts and matched controls using microarray technology. We used RT-PCR to test the consistency of the microarray data and we found four genes up-regulated in HD patients with respect to control individuals. The genes appear to be involved in different pathways that have been shown to be perturbed even in HD models and patients. Although our study is preliminary and has to be extended to a larger cohort of HD patients and controls, nevertheless it shows that gene expression profiles seem to be altered in the fibroblasts of HD patients. Validation of the differential expressions at the protein level is required to ascertain if this cell type can be considered a suitable model for the identification of HD biomarkers.

Also flagged:(γ-aminobutyricacid)-ergicorganizationneurological disordersschizophrenia
Journal Article 2013-11-21 No Snippets Sultan KT, Brown KN, Shi SH.
Show Full Abstract

Inhibitory GABA (γ-aminobutyric acid)-ergic interneurons are a vital component of the neocortex responsible for shaping its output through a variety of inhibitions. Consisting of many flavors, interneuron subtypes are predominantly defined by their morphological, physiological, and neurochemical properties that help to determine their functional role within the neocortex. During development, these cells are born in the subpallium where they then tangentially migrate over long distances before being radially positioned to their final location in the cortical laminae. As development progresses into adolescence, these cells mature and form chemical and electrical connections with both glutamatergic excitatory neurons and other interneurons ultimately establishing the cortical network. The production, migration, and organization of these cells are determined by vast array of extrinsic and intrinsic factors that work in concert in order to assemble a proper functioning cortical inhibitory network. Failure of these cells to undergo these processes results in abnormal positioning and cortical function. In humans, this can bring about several neurological disorders including schizophrenia, epilepsy, and autism spectrum disorders. In this article, we will review previous literature that has revealed the framework for interneuron neurogenesis and migratory behavior as well as discuss recent findings that aim to elucidate the spatial and functional organization of interneurons within the neocortex.

Also flagged:Lung cancercancerdeathanxietyNSCLCantibodies
Journal Article 2013-11-21 ✓ 1 Snippet Tsay JC, DeCotiis C, Greenberg AK, Rom WN.
In-Text Gene Mentions

DCC

Show Full Abstract

Lung cancer is the leading cause of cancer deaths worldwide largely owing to diagnosis of the disease at an advanced stage. Recent advances in blood-based biomarker research have the potential to reduce mortality by providing a means for detecting lung cancer at an earlier stage. Since the publication of the National Lung Cancer Screening Trial demonstrating reduction in mortality with computed tomography (CT) scan screening, the U.S. Preventive Services Task Force has released a draft statement recommending annual low-dose CT scan screening for high-risk patients. However, CT screening has a high false-positive rate leading to the need for additional imaging and invasive procedures. In this article, we review recent literature on blood-based lung cancer biomarkers that we believe will have a significant role in enhancing screening efficacy in the near future.

Also flagged:synapsesynaptogenesisantibodycellinnervationsynapses
Journal Article 2013-11-20 ✓ 1 Snippet Brugeaud A, Tong M, Luo L, Edge AS.
In-Text Gene Mentions

DCC

Show Full Abstract

The peripheral fibers that extend from auditory neurons to hair cells are sensitive to damage, and replacement of the fibers and their afferent synapse with hair cells would be of therapeutic interest. Here, we show that RGMa, a repulsive guidance molecule previously shown to play a role in the development of the chick visual system, is expressed in the developing, newborn, and mature mouse inner ear. The effect of RGMa on synaptogenesis between afferent neurons and hair cells, from which afferent connections had been removed, was assessed. Contact of neural processes with hair cells and elaboration of postsynaptic densities at sites of the ribbon synapse were increased by treatment with a blocking antibody to RGMa, and pruning of auditory fibers to achieve the mature branching pattern of afferent neurons was accelerated. Inhibition by RGMa could thus explain why auditory neurons have a low capacity to regenerate peripheral processes: postnatal spiral ganglion neurons retain the capacity to send out processes that respond to signals for synapse formation, but expression of RGMa postnatally appears to be detrimental to regeneration of afferent hair cell innervation and antagonizes synaptogenesis. Increased synaptogenesis after inhibition of RGMa suggests that manipulation of guidance or inhibitory factors may provide a route to increase formation of new synapses at deafferented hair cells.

Also flagged:sideroblastic anemiaALAS2X-linked sideroblastic anemiaXLSAcongenital sideroblastic anemiaheme biosynthesis protein
Journal Article 2013-11-20 No Snippets Campagna DR, de Bie CI, Schmitz-Abe K, Sweeney M, Sendamarai AK, Schmidt PJ, Heeney MM, Yntema HG, Kannengiesser C, Grandchamp B, Niemeyer CM, Knoers NV, Swart S, Marron G, van Wijk R, Raymakers RA, May A, Markianos K, Bottomley SS, Swinkels DW, Fleming MD.
Show Full Abstract

X-linked sideroblastic anemia (XLSA) is the most common form of congenital sideroblastic anemia. In affected males, it is uniformly associated with partial loss-of-function missense mutations in the erythroid-specific heme biosynthesis protein 5-aminolevulinate synthase 2 (ALAS2). Here, we report five families with XLSA owing to mutations in a GATA transcription factor binding site located in a transcriptional enhancer element in intron 1 of the ALAS2 gene. As such, this study defines a new class of mutations that should be evaluated in patients undergoing genetic testing for a suspected diagnosis of XLSA.

Also flagged:deathparturitionβ2mbehaviouralmatingpolycarbonate
Journal Article 2013-11-20 ✓ 2 Snippets Weber EM, Algers B, Hultgren J, Olsson IA.
In-Text Gene Mentions

…and the knockoutsHfe−/− and β2m…

…C57BL/6 background, knockoutsHfe−/− or β2m…

Show Full Abstract

<h4>Background</h4>Despite being the most commonly used mammal in biomedical research, problems with perinatal mortality in mice have received little attention and the causes of pup death are still poorly known. Females are often housed alone with their litters and since the lost pups are generally eaten, it is commonly assumed that the mother has killed them. However, more detailed observations than have been reported previously in the literature are required to establish if the cause of death is infanticide. Litter loss can only be prevented efficiently after underlying causes have been carefully investigated and interpreted. The aim of this study was to investigate if females actively kill their pups by observing the behaviour of females and pups in litters that later were lost. We used video recordings of females that lost their entire litter to observe females in detail from parturition until the pups died. In total, 10 C57BL/6 females (wildtype and the knockouts Hfe-/- and β2m-/-) were studied, housed in Makrolon II cages with or without access to a small amount of nesting material.<h4>Results</h4>Three of the females had pups that were never seen moving, and another three females had one or two pups that never moved, indicating that some pups were most likely still-born. In five females with live-born pups, detailed observations from the time when a pup was last seen moving until it died were possible to carry out. We observed females eating dead offspring and interacting with both moving and dead pups. However, we never observed a pup stop moving when manipulated by the female, nor were any wounds seen in the pups. Hence, we found no evidence of infanticide when studying females that had lost their entire litter.<h4>Conclusion</h4>These results suggest that other causes than infanticide plays a major role in mouse pup death, and stress the need for more systematic and careful investigations of the causality of litter loss.

Also flagged:Sox2Sox3Stem cell factorluciferaseSox10Med12
Journal Article 2013-11-20 ✓ 1 Snippet Hoffmann SA, Hos D, Küspert M, Lang RA, Lovell-Badge R, Wegner M, Reiprich S.
In-Text Gene Mentions

…events, Sox5 andSox6counteract Sox9 or…

Show Full Abstract

Neural precursor cells of the ventricular zone give rise to all neurons and glia of the central nervous system and rely for maintenance of their precursor characteristics on the closely related SoxB1 transcription factors Sox1, Sox2 and Sox3. We show in mouse spinal cord that, whereas SoxB1 proteins are usually downregulated upon neuronal specification, they continue to be expressed in glial precursors. In the oligodendrocyte lineage, Sox2 and Sox3 remain present into the early phases of terminal differentiation. Surprisingly, their deletion does not alter precursor characteristics but interferes with proper differentiation. Although a direct influence on myelin gene expression may be part of their function, we provide evidence for another mode of action. SoxB1 proteins promote oligodendrocyte differentiation in part by negatively controlling miR145 and thereby preventing this microRNA from inhibiting several pro-differentiation factors. This study presents one of the few cases in which SoxB1 proteins, including the stem cell factor Sox2, are associated with differentiation rather than precursor functions.

Also flagged:Dll4NotchFoxn4proneuralBMPTGFβ
Journal Article 2013-11-20 ✓ 1 Snippet Misra K, Luo H, Li S, Matise M, Xiang M.
In-Text Gene Mentions

Pou3f2

Show Full Abstract

During development of the ventral spinal cord, the V2 interneurons emerge from p2 progenitors and diversify into two major subtypes, V2a and V2b, that play key roles in locomotor coordination. Dll4-mediated Notch activation in a subset of p2 precursors constitutes the crucial first step towards generating neuronal diversity in this domain. The mechanism behind the asymmetric Notch activation and downstream signaling events are, however, unknown at present. We show here that the Ascl1 and Neurog basic helix-loop-helix (bHLH) proneural factors are expressed in a mosaic pattern in p2 progenitors and that Foxn4 is required for setting and maintaining this expression mosaic. By binding directly to a conserved Dll4 enhancer, Foxn4 and Ascl1 activate Dll4 expression, whereas Neurog proteins prevent this effect, thereby resulting in asymmetric activation of Dll4 expression in V2 precursors expressing different combinations of proneural and Foxn4 transcription factors. Lineage tracing using the Cre-LoxP system reveals selective expression of Dll4 in V2a precursors, whereas Dll4 expression is initially excluded from V2b precursors. We provide evidence that BMP/TGFβ signaling is activated in V2b precursors and that Dll4-mediated Notch signaling is responsible for this activation. Using a gain-of-function approach and by inhibiting BMP/TGFβ signal transduction with pathway antagonists and RNAi knockdown, we further demonstrate that BMP/TGFβ signaling is both necessary and sufficient for V2b fate specification. Our data together thus suggest that the mosaic expression of Foxn4 and proneural factors may serve as the trigger to initiate asymmetric Dll4-Notch and subsequent BMP/TGFβ signaling events required for neuronal diversity in the V2 domain.

Also flagged:PIGAFerro-Cerebro-Cutaneous syndromeepileptic encephalopathyironbiosynthesisGPI anchor protein
Journal Article 2013-11-20 ✓ 2 Snippets Swoboda KJ, Margraf RL, Carey JC, Zhou H, Newcomb TM, Coonrod E, Durtschi J, Mallempati K, Kumanovics A, Katz BE, Voelkerding KV, Opitz JM.
In-Text Gene Mentions

HFE

hemochromatosis

Show Full Abstract

Three related males presented with a newly recognized x-linked syndrome associated with neurodegeneration, cutaneous abnormalities, and systemic iron overload. Linkage studies demonstrated that they shared a haplotype on Xp21.3-Xp22.2 and exome sequencing was used to identify candidate variants. Of the segregating variants, only a PIGA mutation segregated with disease in the family. The c.328_330delCCT PIGA variant predicts, p.Leu110del (or c.1030_1032delCTT, p.Leu344del depending on the reference sequence). The unaffected great-grandfather shared his X allele with the proband but he did not have the PIGA mutation, indicating that the mutation arose de novo in his daughter. A single family with a germline PIGA mutation has been reported; affected males had a phenotype characterized by multiple congenital anomalies and severe neurologic impairment resulting in infantile lethality. In contrast, affected boys in the family described here were born without anomalies and were neurologically normal prior to onset of seizures after 6 months of age, with two surviving to the second decade. PIGA encodes an enzyme in the GPI anchor biosynthesis pathway. An affected individual in the family studied here was deficient in GPI anchor proteins on granulocytes but not erythrocytes. In conclusion, the PIGA mutation in this family likely causes a reduction in GPI anchor protein cell surface expression in various cell types, resulting in the observed pleiotropic phenotype involving central nervous system, skin, and iron metabolism.

Also flagged:serotonin transporteranxiety-related disordersdrug addictionsucrose
Journal Article 2013-11-20 ✓ 5 Snippets Nonkes LJ, van de Vondervoort II, Homberg JR.
In-Text Gene Mentions

In conclusion, the high CS sensitivity in 5-HTT(-/-) rats cannot be explained by enhanced incentive salience attribution to the CS as measured by the sign- versus goal-tracking paradigm.

…rotonin transporter knockout (5-HTT(-/-)) rats-mimicking the comm…

…rats-mimicking the common5-HTTpromoter polymorphism in…

…we tested the5-HTT(-/-) rats and their…

…Rather,5-HTT(-/-) rats may be…

Show Full Abstract

Understanding the neurobiological basis underlying individual differences in conditioned stimulus (CS) sensitivity is pertinent, given that excessive conditioned responses to CSs is a key feature of anxiety-related disorders and drug addiction. We have previously shown that behaviour of serotonin transporter knockout (5-HTT(-/-)) rats-mimicking the common 5-HTT promoter polymorphism in humans-is strongly driven by Pavlovian CSs. To investigate whether the knockout rats attribute greater incentive salience to CSs, we tested the 5-HTT(-/-) rats and their wild-type counterparts in the sucrose-reinforced sign-versus goal-tracking task. We also assessed whether motivational properties of the unconditioned stimulus (sucrose pellet) are involved in the individual differences under investigation, by testing the animals in a sucrose-reinforced progressive ratio schedule of reinforcement. We found no genotype differences in sign-versus goal-tracking behavior, despite that progressive ratio responding was increased in 5-HTT(-/-) rats. In conclusion, the high CS sensitivity in 5-HTT(-/-) rats cannot be explained by enhanced incentive salience attribution to the CS as measured by the sign- versus goal-tracking paradigm. Rather, 5-HTT(-/-) rats may be more sensitive to the motivational properties of the unconditioned stimulus.

Also flagged:Iron deficiencyiron regulatory hormoneobesityIL1βnonalcoholic fatty liver diseaseiron
Journal Article 2013-11-20 ✓ 3 Snippets Siddique A, Nelson JE, Aouizerat B, Yeh MM, Kowdley KV, NASH Clinical Research Network.
In-Text Gene Mentions

HFE

hemochromatosis

HFE hemochromatosis

Show Full Abstract

<h4>Background & aims</h4>Iron deficiency is often observed in obese individuals. The iron regulatory hormone hepcidin is regulated by iron and cytokines interleukin (IL) 6 and IL1β. We examine the relationship between obesity, circulating levels of hepcidin, and IL6 and IL1β, and other risk factors in patients with nonalcoholic fatty liver disease (NAFLD) with iron deficiency.<h4>Methods</h4>We collected data on 675 adult subjects (>18 years old) enrolled in the Nonalcoholic Steatohepatitis Clinical Research Network. Subjects with transferrin saturation <20% were categorized as iron deficient, whereas those with transferrin saturation ≥20% were classified as iron normal. We assessed clinical, demographic, anthropometric, laboratory, dietary, and histologic data from patients, and serum levels of hepcidin and cytokines IL6 and IL1β. Univariate and multivariate analysis were used to identify risk factors for iron deficiency.<h4>Results</h4>One-third of patients (231 of 675; 34%) were iron deficient. Obesity, diabetes, and metabolic syndrome were more common in subjects with iron deficiency (P < .01), compared with those that were iron normal. Serum levels of hepcidin were significantly lower in subjects with iron deficiency (61 ± 45 vs 81 ± 51 ng/mL; P < .0001). Iron deficiency was significantly associated with female gender, obesity, increased body mass index and waist circumference, presence of diabetes, lower alcohol consumption, black or American Indian/Alaska Native race (P ≤ .018), and increased levels of IL6 and IL1β (6.6 vs 4.8 for iron normal, P ≤ .0001; and 0.45 vs 0.32 for iron normal, P ≤ .005).<h4>Conclusions</h4>Iron deficiency is prevalent in patients with NAFLD and associated with female gender, increased body mass index, and nonwhite race. Serum levels of hepcidin were lower in iron-deficient subjects, reflecting an appropriate physiologic response to decreased circulating levels of iron, rather than a primary cause of iron deficiency in the setting of obesity and NAFLD.

Also flagged:Idraparinuxvenous thromboembolismpentasaccharideswarfarindeep venous thrombosisDVT
Journal Article 2013-11-20 ✓ 1 Snippet Song Y, Li X, Pavithra S, Li D.
In-Text Gene Mentions

…heparin and activateantithrombin-IIIafter binding with…

Show Full Abstract

<h4>Background</h4>Venous thromboembolism (VTE) is a prevalent disease with potential serious consequences. Idraparinux and idrabiotaparinux are two kinds of long-acting pentasaccharides. Evidence has shown that idraparinux and idrabiotaparinux are effective anticoagulants. However, up to now, there is no consensus on whether they are better than other anticoagulation methods for long-term VTE treatment.<h4>Objective</h4>To evaluate the effect of idraparinux or idrabiotaparinux versus other anticoagulation methods for long-term VTE treatment.<h4>Methods</h4>We searched Cochrane Central Register of Controlled Trials, PubMed, Embase, Web of science, clinical trial registry web sites (clinical trials,WHO clinical trial registry), Googlescholar, PubMed related articles and companies' web sites electronically up to Dec 30(th), 2012 and manually searched the reference lists and conference proceedings. Only randomized controlled trial (RCT) involving adult patients comparing idraparinux and/or idrabiotaparinux versus other anticoagulation methods for long-term VTE treatment was included. Two reviewers evaluated the studies and extracted data independently. Pooled risk ratios (RRs) were calculated as outcome measures and Revman 5.2 software was used to analyze data. Our primary efficacy and safety outcomes were the recurrent VTE and major bleeding rates.<h4>Results</h4>We included four RCTs and involved 8584 participants on idraparinux or idrabiotaparinux versus standard warfarin for VTE treatment from 9364 references. We did not perform meta-analysis on the VTE rate because of the significant heterogeneity. We used the fixed effect model to analyze the safety outcomes and demonstrated that idraparinux or idrabiotaparinux decreased major bleeding rate significantly (RR 0.73, 95% CI 0.54 to 0.98, P = 0.04) but had a trend to increase the all cause mortality (RR 1.26, 95% CI 1.00 to 1.57, P = 0.05) compared with warfarin.<h4>Conclusions</h4>Until now there is not sufficient evidence to clarify whether idraparinux or idrabiotaparinux is as effective and safe as the standard warfarin treatment for VTE treatment.

Also flagged:cancertumoroncogenesbladder cancerprostate cancercervical cancer
Journal Article 2013-11-20 ✓ 2 Snippets Ma XP, Zhang T, Peng B, Yu L, Jiang de K.
In-Text Gene Mentions

The presence of this mismatch would affect Sox6 and Rod1 genes, which are important for the etiology of cancers [72], [129].

…mismatch would affectSox6and Rod1 genes,…

Show Full Abstract

MicroRNAs (miRNAs) are small non-coding RNA molecules, which participate in diverse biological processes and may regulate tumor suppressor genes or oncogenes. Single nucleotide polymorphisms (SNPs) in miRNA may contribute to diverse functional consequences, including cancer development, by altering miRNA expression. Numerous studies have shown the association between miRNA SNPs and cancer risk; however, the results are generally debatable and inconclusive, mainly due to limited statistical power. To assess the relationship between the five most common SNPs (miR-146a rs2910164, miR-196a2 rs11614913, miR-499 rs3746444, miR-149 rs2292832, and miR-27a rs895919) and the risk cancer development, we performed a meta-analysis of 66 published case-control studies. Crude odds ratios at 95% confidence intervals were used to investigate the strength of the association. No association was observed between rs2910164 and cancer risk in the overall group. However, in stratified analysis, we found that either the rs2910164 C allele or the CC genotype was protective against bladder cancer, prostate cancer, cervical cancer, and colorectal cancer, whereas it was a risk factor for papillary thyroid carcinoma and squamous cell carcinoma of the head and neck (SCCHN). Further, rs11614913 was found to be significantly associated with decreased cancer risk, in particular, for bladder cancer, gastric cancer, and SCCHN. For miR-499, a significant association was found between the rs3746444 polymorphism and cancer risk in pooled analysis. In subgroup analysis, similar results were mainly observed for breast cancer. Finally, no association was found between rs2292832 and rs895919 polymorphisms and cancer risk in the overall group and in stratified analysis. In summary, miR-196a2 rs11614913, miR-146a rs2910164, and miR-499 rs3746444 are risk factors for cancer development, whereas mir-149 rs2292832 and miR-27a rs895919 are not associated with cancer risk.

Also flagged:gene expressionIschemiaheart failurecerebrovascular diseasenucleotidesdegradation
Journal Article 2013-11-20 No Snippets Zhou L, Zang G, Zhang G, Wang H, Zhang X, Johnston N, Min W, Luke P, Jevnikar A, Haig A, Zheng X.
Show Full Abstract

Ischemia reperfusion (I/R) injury is an unavoidable event occurring during heart transplantation, leading to graft failures and lower long-term survival rate of the recipient. Several studies have demonstrated that microRNAs (miRNAs) are vital regulators of signalling pathways involved in I/R injury. The present study aims to quantify the altered expression levels of miRNA and mRNA upon I/R injury in a mouse heart transplantation model, and to investigate whether these miRNA can regulate genes involved in I/R injury. We performed heterotopic heart transplantation on mouse models to generate heart tissue samples with I/R and non-I/R (control). The expression levels of miRNAs as well as genes were measured in heart grafts by microarray and real time RT-PCR. miRNA alteration in cardiomyocytes exposed to hypoxia was also detected by qRT-PCR. We observed significant alterations in miRNA and gene expression profile after I/R injury. There were 39 miRNAs significantly downregulated and 20 upregulated up to 1.5 fold in heart grafts with I/R injury compared with the grafts without I/R. 48 genes were observed with 3 fold change and p<0.05 and 18 signalling pathways were enriched using Keggs pathway library. Additionally, hypoxia/reperfusion induced primary cardiomyocyte apoptosis and altered miRNA expression profiles. In conclusion, this is the first report on miRNA expression profile for heart transplantation associated with I/R injury. These findings provide us with an insight into the role of miRNA in I/R injury in heart transplantation.

Also flagged:thrombindisc herniationspondylosisbehavioralhypersensitivitypro-inflammatory cytokines
Journal Article 2013-11-20 ✓ 5 Snippets Smith JR, Syre PP, Oake SA, Nicholson KJ, Weisshaar CL, Cruz K, Bucki R, Baumann BC, Janmey PA, Winkelstein BA.
In-Text Gene Mentions

…of antithrombin III (ATIII) at inhibiting thrombin…

…the addition ofATIII(Hyphen Biomed, Mason,…

ATIIIwas tested at…

…each concentration ofATIIIand normalized to…

…cleavage without anyATIIIin solution (0…

Show Full Abstract

Chronic neck pain is a major problem with common causes including disc herniation and spondylosis that compress the spinal nerve roots. Cervical nerve root compression in the rat produces sustained behavioral hypersensitivity, due in part to the early upregulation of pro-inflammatory cytokines, the sustained hyperexcitability of neurons in the spinal cord and degeneration in the injured nerve root. Through its activation of the protease-activated receptor-1 (PAR1), mammalian thrombin can enhance pain and inflammation; yet at lower concentrations it is also capable of transiently attenuating pain which suggests that PAR1 activation rate may affect pain maintenance. Interestingly, salmon-derived fibrin, which contains salmon thrombin, attenuates nerve root-induced pain and inflammation, but the mechanisms of action leading to its analgesia are unknown. This study evaluates the effects of salmon thrombin on nerve root-mediated pain, axonal degeneration in the root, spinal neuronal hyperexcitability and inflammation compared to its human counterpart in the context of their enzymatic capabilities towards coagulation substrates and PAR1. Salmon thrombin significantly reduces behavioral sensitivity, preserves neuronal myelination, reduces macrophage infiltration in the injured nerve root and significantly decreases spinal neuronal hyperexcitability after painful root compression in the rat; whereas human thrombin has no effect. Unlike salmon thrombin, human thrombin upregulates the transcription of IL-1β and TNF-α and the secretion of IL-6 by cortical cultures. Salmon and human thrombins cleave human fibrinogen-derived peptides and form clots with fibrinogen with similar enzymatic activities, but salmon thrombin retains a higher enzymatic activity towards coagulation substrates in the presence of antithrombin III and hirudin compared to human thrombin. Conversely, salmon thrombin activates a PAR1-derived peptide more weakly than human thrombin. These results are the first to demonstrate that salmon thrombin has unique analgesic, neuroprotective and anti-inflammatory capabilities compared to human thrombin and that PAR1 may contribute to these actions.

Also flagged:transcriptional regulatorsFoxG1Hes1Tlxbrain cancersneurogenesis
Journal Article 2013-11-20 ✓ 1 Snippet Coolen M, Katz S, Bally-Cuif L.
In-Text Gene Mentions

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disease caused by trinucleotide repeat expansions in the Huntingtin gene (Htt).

Show Full Abstract

Soon after its discovery, microRNA-9 (miR-9) attracted the attention of neurobiologists, since it is one of the most highly expressed microRNAs in the developing and adult vertebrate brain. Functional analyses in different vertebrate species have revealed a prominent role of this microRNA in balancing proliferation in embryonic neural progenitor populations. Key transcriptional regulators such as FoxG1, Hes1 or Tlx, were identified as direct targets of miR-9, placing it at the core of the gene network controlling the progenitor state. Recent data also suggest that this function could extend to adult neural stem cells. Other studies point to a role of miR-9 in differentiated neurons. Moreover miR-9 has been implicated in human brain pathologies, either displaying a protective role, such as in Progeria, or participating in disease progression in brain cancers. Altogether functional studies highlight a prominent feature of this highly conserved microRNA, its functional versatility, both along its evolutionary history and across cellular contexts.

Also flagged:glucocorticoid receptorCortisolcorticosteroidGRtranscription factorfertilization
Journal Article 2013-11-20 No Snippets Nesan D, Vijayan MM.
Show Full Abstract

Cortisol is the primary corticosteroid in teleosts that is released in response to stressor activation of the hypothalamus-pituitary-interrenal axis. The target tissue action of this hormone is primarily mediated by the intracellular glucocorticoid receptor (GR), a ligand-bound transcription factor. In developing zebrafish (Danio rerio) embryos, GR transcripts and cortisol are maternally deposited into the oocyte prior to fertilization and influence early embryogenesis. To better understand of the molecular mechanisms involved, we investigated changes in the developmental transcriptome prior to hatch, in response to morpholino oligonucleotide knockdown of GR using the Agilent zebrafish microarray platform. A total of 1313 and 836 mRNA transcripts were significantly changed at 24 and 36 hours post fertilization (hpf), respectively. Functional analysis revealed numerous developmental processes under GR regulation, including neurogenesis, eye development, skeletal and cardiac muscle formation. Together, this study underscores a critical role for glucocorticoid signaling in programming molecular events essential for zebrafish development.

Also flagged:CCAR1MED1GATA1erythropoiesiszincγ-globin
Journal Article 2013-11-19 ✓ 1 Snippet Mizuta S, Minami T, Fujita H, Kaminaga C, Matsui K, Ishino R, Fujita A, Oda K, Kawai A, Hasegawa N, Urahama N, Roeder RG, Ito M.
In-Text Gene Mentions

Cell cycle and apoptosis regulator 1

Show Full Abstract

The MED1 subunit of the Mediator transcriptional coregulator complex coactivates GATA1 and induces erythropoiesis. Here, we show the dual mechanism of GATA1- and MED1-mediated transcription. MED1 expression levels in K562 erythroleukemia cells paralleled the levels of GATA1-targeted gene transcription and erythroid differentiation. An N-terminal fragment of MED1, MED1(1-602), which is incapable of interacting with GATA1, enhanced GATA1-targeted gene transcription and erythroid differentiation, and introduction of MED1(1-602) into Med1(-/-) mouse embryonic fibroblasts (MEFs) partially rescued GATA1-mediated transcription. The C-terminal zinc-finger domain of GATA1 interacts with the MED1(1-602)-interacting coactivator CCAR1, CoCoA and MED1(681-715). CCAR1 and CoCoA synergistically enhanced GATA1-mediated transcription from the γ-globin promoter in MEFs. Recombinant GATA1, CCAR1, CoCoA and MED1(1-602) formed a complex in vitro, and GATA1, CCAR1, CoCoA and MED1 were recruited to the γ-globin promoter in K562 cells during erythroid differentiation. Therefore, in addition to the direct interaction between GATA1 and MED1, CoCoA and CCAR1 appear to relay the GATA1 signal to MED1, and multiple modes of the GATA1-MED1 axis may help to fine-tune GATA1 function during GATA1-mediated homeostasis events.

Also flagged:trehaloseHsp104Huntington's diseaseprotein-misfolding diseasesdisaccharideautophagy
Journal Article 2013-11-19 ✓ 1 Snippet Chaudhary RK, Kardani J, Singh K, Banerjee R, Roy I.
In-Text Gene Mentions

Deciphering the roles of trehalose and Hsp104 in the inhibition of aggregation of mutant huntingtin in a yeast model of Huntington's disease.

Show Full Abstract

Despite the significant amount of experimental data available on trehalose, the molecular mechanism responsible for its intracellular stabilising properties has not emerged yet. The repair of cellular homeostasis in many protein-misfolding diseases by trehalose is credited to the disaccharide being an inducer of autophagy, a mechanism by which aggregates of misfolded proteins are cleared by the cell. In this work, we expressed the pathogenic N-terminal fragment of huntingtin in Δnth1 mutant (unable to degrade trehalose) of Saccharomyces cerevisiae BY4742 strain. We show that the presence of trehalose resulted in the partitioning of the mutant huntingtin in the soluble fraction of the cell. This led to reduced oxidative stress and improved cell survival. The beneficial effect was independent of the expression of the major cellular antioxidant enzyme, superoxide dismutase. Additionally, trehalose led to the overexpression of the heat shock protein, Hsp104p, in mutant huntingtin-expressing cells, and resulted in rescue of the endocytotic defect in the yeast cell. We propose that at least in the initial stages of aggregation, trehalose functions as a stabiliser, increasing the level of monomeric mutant huntingtin protein, with its concomitant beneficial effects, in addition to its role as an inducer of autophagy.

Also flagged:SUMOchromatinsmall ubiquitin-like modifierhistoneDNA methyltransfersesdemethylases
Journal Article 2013-11-19 ✓ 1 Snippet Elrouby N, Bonequi MV, Porri A, Coupland G.
In-Text Gene Mentions

chromatin modifiers

Show Full Abstract

Posttranslational modification of proteins by small ubiquitin-like modifier (SUMO) plays essential roles in eukaryotic growth and development. Many covalently modified SUMO targets have been identified; however, the extent and significance of noncovalent interactions of SUMO with cellular proteins is poorly understood. Here, large-scale yeast two-hybrid screens repeatedly identified a surprisingly small number of proteins that interacted with three Arabidopsis SUMO isoforms. These SUMO-interacting proteins are nuclear and fall into two main categories: six histone or DNA methyltransferses or demethylases and six proteins that we show to be the evolutionary and functional homologs of SUMO-targeted ubiquitin ligases (STUbLs). The selectivity of the screen for several methylases and demethylases suggests that SUMO interaction with these proteins has a significant impact on chromatin methylation. Furthermore, the Arabidopsis STUbLs (AT-STUbLs) complemented to varying degrees the growth defects of the Schizosaccharomyces pombe STUbL mutant rfp1/rfp2, and three of them also complemented the genome integrity defects of this mutant, demonstrating that these proteins show STUbL activity. We show that one of the AT-STUbLs least related to the S. pombe protein, AT-STUbL4, has acquired a plant-specific function in the floral transition. It reduces protein levels of CYCLING DOF FACTOR 2, hence increasing transcript levels of CONSTANS and promoting flowering through the photoperiodic pathway.

Also flagged:CAPN3PARVBDuchenne Muscular DystrophyTNFtumor necrosis factorCASP3
Journal Article 2013-11-19 No Snippets van Haagen HH, 't Hoen PA, Mons B, Schultes EA.
Show Full Abstract

<h4>Motivation</h4>Weighted semantic networks built from text-mined literature can be used to retrieve known protein-protein or gene-disease associations, and have been shown to anticipate associations years before they are explicitly stated in the literature. Our text-mining system recognizes over 640,000 biomedical concepts: some are specific (i.e., names of genes or proteins) others generic (e.g., 'Homo sapiens'). Generic concepts may play important roles in automated information retrieval, extraction, and inference but may also result in concept overload and confound retrieval and reasoning with low-relevance or even spurious links. Here, we attempted to optimize the retrieval performance for protein-protein interactions (PPI) by filtering generic concepts (node filtering) or links to generic concepts (edge filtering) from a weighted semantic network. First, we defined metrics based on network properties that quantify the specificity of concepts. Then using these metrics, we systematically filtered generic information from the network while monitoring retrieval performance of known protein-protein interactions. We also systematically filtered specific information from the network (inverse filtering), and assessed the retrieval performance of networks composed of generic information alone.<h4>Results</h4>Filtering generic or specific information induced a two-phase response in retrieval performance: initially the effects of filtering were minimal but beyond a critical threshold network performance suddenly drops. Contrary to expectations, networks composed exclusively of generic information demonstrated retrieval performance comparable to unfiltered networks that also contain specific concepts. Furthermore, an analysis using individual generic concepts demonstrated that they can effectively support the retrieval of known protein-protein interactions. For instance the concept "binding" is indicative for PPI retrieval and the concept "mutation abnormality" is indicative for gene-disease associations.<h4>Conclusion</h4>Generic concepts are important for information retrieval and cannot be removed from semantic networks without negative impact on retrieval performance.

Also flagged:peptidesamyloid fibrilsAlzheimer'sHuntington'sprion diseasesmedullary thyroid cancer
Journal Article 2013-11-19 ✓ 5 Snippets Emily M, Talvas A, Delamarche C.
In-Text Gene Mentions

…amylome subset andhtt.…

…third dataset, calledhtt, recently published…

…conducted on thehttdataset.…

…scrambled sequences fromhtt

…subset and thehttdataset.…

Show Full Abstract

The aggregation of proteins or peptides in amyloid fibrils is associated with a number of clinical disorders, including Alzheimer's, Huntington's and prion diseases, medullary thyroid cancer, renal and cardiac amyloidosis. Despite extensive studies, the molecular mechanisms underlying the initiation of fibril formation remain largely unknown. Several lines of evidence revealed that short amino-acid segments (hot spots), located in amyloid precursor proteins act as seeds for fibril elongation. Therefore, hot spots are potential targets for diagnostic/therapeutic applications, and a current challenge in bioinformatics is the development of methods to accurately predict hot spots from protein sequences. In this paper, we combined existing methods into a meta-predictor for hot spots prediction, called MetAmyl for METapredictor for AMYLoid proteins. MetAmyl is based on a logistic regression model that aims at weighting predictions from a set of popular algorithms, statistically selected as being the most informative and complementary predictors. We evaluated the performances of MetAmyl through a large scale comparative study based on three independent datasets and thus demonstrated its ability to differentiate between amyloidogenic and non-amyloidogenic polypeptides. Compared to 9 other methods, MetAmyl provides significant improvement in prediction on studied datasets. We further show that MetAmyl is efficient to highlight the effect of point mutations involved in human amyloidosis, so we suggest this program should be a useful complementary tool for the diagnosis of these diseases.

Also flagged:zinc oxidefullerenecarbon nanotubessilvercarbongraphene
Journal Article 2013-11-19 No Snippets Søs Poulsen S, Jacobsen NR, Labib S, Wu D, Husain M, Williams A, Bøgelund JP, Andersen O, Købler C, Mølhave K, Kyjovska ZO, Saber AT, Wallin H, Yauk CL, Yauk CL, Vogel U, Halappanavar S.
Show Full Abstract

There is great interest in substituting animal work with in vitro experimentation in human health risk assessment; however, there are only few comparisons of in vitro and in vivo biological responses to engineered nanomaterials. We used high-content genomics tools to compare in vivo pulmonary responses of multiwalled carbon nanotubes (MWCNT) to those in vitro in cultured lung epithelial cells (FE1) at the global transcriptomic level. Primary size, surface area and other properties of MWCNT- XNRI -7 (Mitsui7) were characterized using DLS, SEM and TEM. Mice were exposed via a single intratracheal instillation to 18, 54, or 162 μg of Mitsui7/mouse. FE1 cells were incubated with 12.5, 25 and 100 μg/ml of Mitsui7. Tissue and cell samples were collected at 24 hours post-exposure. DNA microarrays were employed to establish mechanistic differences and similarities between the two models. Microarray results were confirmed using gene-specific RT-qPCR. Bronchoalveolar lavage (BAL) fluid was assessed for indications of inflammation in vivo. A strong dose-dependent activation of acute phase and inflammation response was observed in mouse lungs reflective mainly of an inflammatory response as observed in BAL. In vitro, a wide variety of core cellular functions were affected including transcription, cell cycle, and cellular growth and proliferation. Oxidative stress, fibrosis and inflammation processes were altered in both models. Although there were similarities observed between the two models at the pathway-level, the specific genes altered under these pathways were different, suggesting that the underlying mechanisms of responses are different in cells in culture and the lung tissue. Our results suggest that careful consideration should be given in selecting relevant endpoints when substituting animal with in vitro testing.

Also flagged:metalsironcoppermanganeselead poisoningdetoxification
Journal Article 2013-11-19 ✓ 5 Snippets Sánchez-Martín FJ, Fan Y, Lindquist DM, Xia Y, Puga A.
In-Text Gene Mentions

The same study found changes in the phosphorylation status of huntingtin (HTT), which acts as a transcription factor and a regulator of BDNF vesicle transport in physiological conditions, and when mutated, is responsible for Huntington’s disease [45].

…vesicle transport (Htt), and transcription…

…, Syn1 ,Htt, Vamp1 ,…

…vesicle transport (Htt), and mRNA…

…whereas Syp ,Htt, Gap43 ,…

Show Full Abstract

Exposure to environmental toxicants during embryonic life causes changes in the expression of developmental genes that may last for a lifetime and adversely affect the exposed individual. Developmental exposure to lead (Pb), an ubiquitous environmental contaminant, causes deficits in cognitive functions and IQ, behavioral effects, and attention deficit hyperactivity disorder (ADHD). Long-term effects observed after early life exposure to Pb include reduction of gray matter, alteration of myelin structure, and increment of criminal behavior in adults. Despite growing research interest, the molecular mechanisms responsible for the effects of lead in the central nervous system are still largely unknown. To study the molecular changes due to Pb exposure during neurodevelopment, we exposed mice to Pb in utero and examined the expression of neural markers, neurotrophins, transcription factors and glutamate-related genes in hippocampus, cortex, and thalamus at postnatal day 60. We found that hippocampus was the area where gene expression changes due to Pb exposure were more pronounced. To recapitulate gestational Pb exposure in vitro, we differentiated mouse embryonic stem cells (ESC) into neurons and treated ESC-derived neurons with Pb for the length of the differentiation process. These neurons expressed the characteristic neuronal markers Tubb3, Syp, Gap43, Hud, Ngn1, Vglut1 (a marker of glutamatergic neurons), and all the glutamate receptor subunits, but not the glial marker Gafp. Importantly, several of the changes observed in Pb-exposed mouse brains in vivo were also observed in Pb-treated ESC-derived neurons, including those affecting expression of Ngn1, Bdnf exon IV, Grin1, Grin2D, Grik5, Gria4, and Grm6. We conclude that our ESC-derived model of toxicant exposure during neural differentiation promises to be a useful model to analyze mechanisms of neurotoxicity induced by Pb and other environmental agents.

Also flagged:gene expressiontranslationalcancertumorepithelial-to-mesenchymal transitioncell division
Journal Article 2013-11-19 ✓ 1 Snippet Feng X, Wang Z, Fillmore R, Xi Y.
In-Text Gene Mentions

HFE

Show Full Abstract

MicroRNAs (miRNAs) are a set of non-coding small RNA molecules in control of gene expression at posttranscriptional/translational level. They not only play crucial roles in normal developmental progress, but also are commonly dysregulated in human diseases, including cancer. MiR-200 is a family of tumor suppressor miRNAs consisting of five members, which are significantly involved in inhibition of epithelial-to-mesenchymal transition (EMT), repression of cancer stem cells (CSCs) self-renewal and differentiation, modulation of cell division and apoptosis, and reversal of chemoresistance. In this article, we summarize the latest findings with regard to the tumor suppressor signatures of miR-200 and the regulatory mechanisms of miR-200 expression. The collected evidence supports that miR-200 is becoming a new star miRNA in study of human cancer.

Also flagged:serotonin transporter-health disorders5-HTTLPRbehavioralSLC6A4serotonin
Journal Article 2013-11-19 ✓ 3 Snippets Dobson SD, Brent LJ.
In-Text Gene Mentions

Serotonin transporter (5-HTT) proteins mediate the reuptake of serotonin from the synaptic cleft, which serves to terminate neurotransmission and replenish serotonin stores in presynaptic terminals.

…Serotonin transporter (5-HTT) proteins mediate the…

…reduced amounts of5-HTT(Hu et al.,…

Show Full Abstract

Some allelic variants of the serotonin transporter linked polymorphic region (5-HTTLPR) result in lower levels of expression of the serotonin transporter gene (SLC6A4). These low-expressing (LE) alleles are associated with mental-health disorders in a minority of humans that carry them. Humans are not the only primates that exhibit this polymorphism; other species, including some monkeys, also have LE and high-expressing (HE) variants of 5-HTTLPR. We propose a behavioral genetic framework to explain the adaptive evolution of this polymorphism in primates, including humans. We hypothesize that both LE and HE alleles are maintained by balancing selection in species characterized by short-term fluctuations in social competition levels. More specifically, we propose that LE carriers benefit from their hypervigilant tendencies during periods of elevated competition, whereas HE homozygotes cope best when competition levels do not deviate from the norm. Thus, both alleles have long-term benefits when competition levels tend to vary substantially over relatively short timescales within a social group. We describe this hypothesis in detail and outline a series of predictions to test it. Some of these predictions are supported by findings in the current literature, while others remain areas of future research.

Also flagged:Iron overload cardiomyopathydysfunctionironheart failureprimary hemochromatosischronic heart failure
Journal Article 2013-11-19 ✓ 1 Snippet Cheng CF, Lian WS.
In-Text Gene Mentions

…with existence ofhemochromatosis.…

Show Full Abstract

Iron overload cardiomyopathy (IOC), defined as the presence of systolic or diastolic cardiac dysfunction secondary to increased deposition of iron, is emerging as an important cause of heart failure due to the increased incidence of this disorder seen in thalassemic patients and in patients of primary hemochromatosis. At present, although palliative treatment by regular iron chelation was recommended; whereas IOC is still the major cause for mortality in patient with chronic heart failure induced by iron-overloading. Because iron is a prooxidant and the associated mechanism seen in iron-overload heart is still unclear; therefore, we intend to delineate the multiple signaling pathways involved in IOC. These pathways may include organelles such as calcium channels, mitochondria; paracrine effects from both macrophages and fibroblast, and novel mediators such as thromboxane A2 and adiponectin; with increased oxidative stress and inflammation found commonly in these signaling pathways. With further understanding on these complex and inter-related molecular mechanisms, we can propose potential therapeutic strategies to ameliorate the cardiac toxicity induced by iron-overloading.

Also flagged:OX40LinfectionCCR5OX40cytokineCXCR4
Journal Article 2013-11-18 No Snippets Kasahara D, Takara A, Takahashi Y, Kodama A, Tanaka R, Ansari AA, Tanaka Y.
Show Full Abstract

<h4>Background</h4>OX40 ligand (OX40L) co-stimulates and differentiates T cells via ligation of OX40 that is transiently induced on T cells upon activation, resulting in prolonged T cell survival and enhanced cytokine production by T cells. This view has led to the targeting of OX40 as a strategy to boost antigen specific T cells in the context of vaccination. In addition, the ligation of OX40 has also been shown to inhibit infection by CCR5-utilizing (R5) but not CXCR4-utilizing (X4) human immunodeficiency virus type-1 (HIV-1) via enhancement of production of CCR5-binding β-chemokines. It was reasoned that human T cell leukemia virus type-I (HTLV-1) immortalized T cell lines that express high levels of OX40L could serve as an unique source of physiologically functional OX40L. The fact that HTLV-1+ T cell lines simultaneously also express high levels of OX40 suggested a potential limitation.<h4>Results</h4>Results of our studies showed that HTLV-1+ T cell lines bound exogenous OX40 but not OX40L, indicating that HTLV-1+ T cell lines express an active form of OX40L but an inactive form of OX40. Anti-OX40 non-blocking monoclonal antibody (mAb), but not blocking mAb, stained HTLV-1+ T cell lines, suggesting that the OX40 might be saturated with endogenous OX40L. Functionality of the OX40L was confirmed by the fact that a paraformaldehyde (PFA)-fixed HTLV-1+ T cell lines inhibited the infection of autologous activated peripheral blood mononuclear cells (PBMCs) with R5 HIV-1 which was reversed by either anti-OX40L blocking mAb or a mixture of neutralizing mAbs against CCR5-binding β-chemokines.<h4>Conclusions</h4>Altogether, these results demonstrated that autologous T cell lines immortalized by HTLV-1 can be utilized as a conventional source of physiologically functional OX40L.

Also flagged:H2BFACTHistonechromatinhistoneshistones H2A
Journal Article 2013-11-18 ✓ 1 Snippet Zheng S, Crickard JB, Srikanth A, Reese JC.
In-Text Gene Mentions

…to those ofhistone chaperone complexchaperone complex FACT…

Show Full Abstract

Histone N-terminal tails play crucial roles in chromatin-related processes. The tails of histones H3 and H4 are highly conserved and well characterized, but much less is known about the functions of the tails of histones H2A and H2B and their sequences are more divergent among eukaryotes. Here we characterized the function of the only highly conserved region in the H2B tail, the H2B repression (HBR) domain. Once thought to play a role only in repression, it also has an uncharacterized function in gene activation and DNA damage responses. We report that deletion of the HBR domain impairs the eviction of nucleosomes at the promoters and open reading frames of genes. A closer examination of the HBR domain mutants revealed that they displayed phenotypes similar to those of histone chaperone complex FACT mutants, including an increase in intragenic transcription and the accumulation of free histones in cells. Biochemical characterization of recombinant nucleosomes indicates that deletion of the HBR domain impairs FACT-dependent removal of H2A-H2B from nucleosomes, suggesting that the HBR domain plays an important role in allowing FACT to disrupt dimer-DNA interactions. We have uncovered a previously unappreciated role for the HBR domain in regulating chromatin structure and have provided insight into how FACT acts on nucleosomes.

Also flagged:acute lymphoblastic leukemiaALLBCR-ABLoncoproteinchromosomechromosomes
Journal Article 2013-11-18 ✓ 2 Snippets Vakana E, Arslan AD, Szilard A, Altman JK, Platanias LC.
In-Text Gene Mentions

Despite the success of ponatinib and its recent approval for the treatment of TKI resistant patients, a new study shed light on three newly identified BCR-ABL mutations, L248R, T315V and F317R, detected in CML and Ph+ ALL patients that appear to exhibit differential resistance to TKIs, including the third-generation inhibitors ponatinib and DCC-2036, underscoring the need for novel therapies for resistant Ph+ CML and ALL [17].

…inhibitors ponatinib andDCC-2036, underscoring the need…

Show Full Abstract

Chronic myeloid leukemia (CML) and Ph+ acute lymphoblastic leukemia (ALL) are characterized by the presence of the BCR-ABL oncoprotein, which leads to activation of a plethora of pro-mitogenic and pro-survival pathways, including the mTOR signaling cascade. We provide evidence that in BCR-ABL expressing cells, treatment with tyrosine kinase inhibitors (TKIs) results in upregulation of mRNA levels and protein expression of sestrin3 (SESN3), a unique cellular inhibitor of mTOR complex 1 (mTORC1). Such upregulation appears to be mediated by regulatory effects on mTOR, as catalytic inhibition of the mTOR kinase also induces SESN3. Catalytic mTOR inhibition also results in upregulation of SESN3 expression in cells harboring the TKI-insensitive T315I-BCR-ABL mutant, which is resistant to imatinib mesylate. Overexpression of SESN3 results in inhibitory effects on different Ph+ leukemic cell lines including KT-1-derived leukemic precursors, indicating that SESN3 mediates anti-leukemic responses in Ph+ cells. Altogether, our findings suggest the existence of a novel mechanism for the generation of antileukemic responses in CML cells, involving upregulation of SESN3 expression.

Also flagged:iron deficiency anemiahereditary hemorrhagic telangiectasiatelangiectasiaalloantibodiesironerythropoiesis
Journal Article 2013-11-18 No Snippets Stross P.
Show Full Abstract

<h4>Background</h4>Hereditary hemorrhagic telangiectasia is an autosomal dominant disorder associated with frequent nose bleeds that can be troublesome and difficult to contain. A further manifestation is telangiectasia, which may develop in the upper and lower gastrointestinal tract. The associated blood loss can be chronic, resulting in iron deficiency anemia which, when severe, has historically been treated by blood transfusions. Further pulmonary, neurologic, and hepatic complications may appear in later life, and are well documented. Administering blood transfusions requires provision, storage, and serological testing to select suitable units. Recognition of the inherent potential risks of donated blood, the expense, and the concerns regarding blood supply, has resulted in a national policy for conservation and appropriate use of blood. For an individual patient, there may be development of alloantibodies which complicates future cross-matching for transfusions.<h4>Case report</h4>SG is a 66-year-old Caucasian woman who first presented to our hematology department in 2003, having just moved to the area. She had suffered with nose bleeds since her teenage years and presented with a low hemoglobin level and symptoms of iron deficiency anemia. Medical and nonmedical interventions failed to arrest the blood loss, which had not been massive or associated with hypovolemic shock. Pursuant to conserving blood supplies, and based on experience of patients with other causes of iron deficiency anemia, a regimen of high-dose iron supplementation was adopted. The aim was to sustain iron stores as a substrate for erythropoiesis and thereby achieve adequate hemoglobin levels whilst minimizing the need for blood transfusion.<h4>Discussion</h4>This approach has maintained the patient's hemoglobin levels at 6.4-11.6 g/dL over a period of 9 years. Until the time of writing in 2011, the maximum number of blood transfusions she has received in a year has been six, albeit there has been a steady slow increase since 2006. Her quality of life has been good throughout, with good levels of activity, a normal lifestyle, and no pain. The high-dose iron regimen is estimated to have avoided administration of up to 90 units of blood in 2011, at a saving to the National Health Service of at least £7000.

Also flagged:obesitymetabolic disordersMetabolismtype 2 diabetescardiovascular diseasecancer
Journal Article 2013-11-18 No Snippets Lee DA, Blackshaw S.
Show Full Abstract

During critical periods of development early in life, excessive or scarce nutritional environments can disrupt the development of central feeding and metabolic neural circuitry, leading to obesity and metabolic disorders in adulthood. A better understanding of the genetic networks that control the development of feeding and metabolic neural circuits, along with knowledge of how and where dietary signals disrupt this process, can serve as the basis for future therapies aimed at reversing the public health crisis that is now building as a result of the global obesity epidemic. This review of animal and human studies highlights recent insights into the molecular mechanisms that regulate the development of central feeding circuitries, the mechanisms by which gestational and early postnatal nutritional status affects this process, and approaches aimed at counteracting the deleterious effects of early over- and underfeeding.

Also flagged:mineralOSteoporosisGene expressionmetabolismSMOC1CLDN14
Journal Article 2013-11-17 ✓ 2 Snippets Zhang L, Choi HJ, Estrada K, Leo PJ, Li J, Pei YF, Zhang Y, Lin Y, Shen H, Liu YZ, Liu Y, Zhao Y, Zhang JG, Tian Q, Wang YP, Han Y, Ran S, Hai R, Zhu XZ, Wu S, Yan H, Liu X, Yang TL, Guo Y, Zhang F, Guo YF, Chen Y, Chen X, Tan L, Zhang L, Deng FY, Deng H, Rivadeneira F, Duncan EL, Lee JY, Han BG, Cho NH, Nicholson GC, McCloskey E, Eastell R, Prince RL, Eisman JA, Jones G, Reid IR, Sambrook PN, Dennison EM, Danoy P, Yerges-Armstrong LM, Streeten EA, Hu T, Xiang S, Papasian CJ, Brown MA, Shin CS, Uitterlinden AG, Deng HW.
In-Text Gene Mentions

…), 11p15.3 (SOX6), 11q13.4 (…

SOX6

Show Full Abstract

Aiming to identify novel genetic variants and to confirm previously identified genetic variants associated with bone mineral density (BMD), we conducted a three-stage genome-wide association (GWA) meta-analysis in 27 061 study subjects. Stage 1 meta-analyzed seven GWA samples and 11 140 subjects for BMDs at the lumbar spine, hip and femoral neck, followed by a Stage 2 in silico replication of 33 SNPs in 9258 subjects, and by a Stage 3 de novo validation of three SNPs in 6663 subjects. Combining evidence from all the stages, we have identified two novel loci that have not been reported previously at the genome-wide significance (GWS; 5.0 × 10(-8)) level: 14q24.2 (rs227425, P-value 3.98 × 10(-13), SMOC1) in the combined sample of males and females and 21q22.13 (rs170183, P-value 4.15 × 10(-9), CLDN14) in the female-specific sample. The two newly identified SNPs were also significant in the GEnetic Factors for OSteoporosis consortium (GEFOS, n = 32 960) summary results. We have also independently confirmed 13 previously reported loci at the GWS level: 1p36.12 (ZBTB40), 1p31.3 (GPR177), 4p16.3 (FGFRL1), 4q22.1 (MEPE), 5q14.3 (MEF2C), 6q25.1 (C6orf97, ESR1), 7q21.3 (FLJ42280, SHFM1), 7q31.31 (FAM3C, WNT16), 8q24.12 (TNFRSF11B), 11p15.3 (SOX6), 11q13.4 (LRP5), 13q14.11 (AKAP11) and 16q24 (FOXL1). Gene expression analysis in osteogenic cells implied potential functional association of the two candidate genes (SMOC1 and CLDN14) in bone metabolism. Our findings independently confirm previously identified biological pathways underlying bone metabolism and contribute to the discovery of novel pathways, thus providing valuable insights into the intervention and treatment of osteoporosis.

Also flagged:Insulin Resistancehepatic steatosisnonalcoholic fatty liver diseaseNAFLDinsulin-resistanceIR
Journal Article 2013-11-17 ✓ 1 Snippet Patel NS, Peterson MR, Lin GY, Feldstein A, Schnabl B, Bettencourt R, Seki E, Sirlin CB, Loomba R.
In-Text Gene Mentions

…(13) known phenotypichemochromatosis(HII greater than…

Show Full Abstract

Background. Ectopic fat deposition in the pancreas and its relationship with hepatic steatosis and insulin resistance have not been compared between patients with nonalcoholic fatty liver disease (NAFLD) and healthy controls. Aim. Using a novel magnetic resonance imaging (MRI) based biomarker, the proton-density-fat-fraction (MRI-PDFF), we compared pancreatic fat content in patients with biopsy-proven NAFLD to healthy controls and determined whether it is associated with insulin resistance and liver fat content. Methods. This nested case-control study was derived from two prospective studies including 43 patients with biopsy-proven NAFLD and 49 healthy controls who underwent biochemical testing and MRI. Results. Compared to healthy controls, patients with NAFLD had significantly higher pancreatic MRI-PDFF (3.6% versus 8.5%, P value <0.001), and these results remained consistent in multivariable-adjusted models including age, sex, body mass index, and diabetes (P value =0.03). We found a strong correlation between hepatic and pancreatic MRI-PDFF (Spearman correlation, P = 0.57, P value <0.001). Participants with increased insulin resistance determined by homeostatic-model-of-insulin-resistance (HOMA-IR) greater than 2.5 had higher pancreatic (7.3% versus 4.5%, P value =0.015) and liver (13.5% versus 4.0%, P value <0.001) MRI-PDFF. Conclusion. Patients with NAFLD have greater pancreatic fat than normal controls. Insulin resistance is associated with liver and pancreatic fat accumulation.

Also flagged:major depressive disorderdepressionhypercortisolismglucocorticoidsCRHcytokine
Journal Article 2013-11-17 ✓ 5 Snippets Hernandez ME, Mendieta D, Pérez-Tapia M, Bojalil R, Estrada-Garcia I, Estrada-Parra S, Pavón L.
In-Text Gene Mentions

In addition, lymphocytes from MDD patients have a lower density of 5-HTT [49] and impaired 5-HT1A receptor functions [45, 46].

The HPA axis is restored, following clinical responses to treatment with SSRIs—SSRIs decrease circulating cortisol levels by reestablishing the downregulated glucocorticoid receptor, increase serotonin levels in circulation by blocking its reuptake receptor (5-HTT), and modify circulating cytokine profiles by receptors for neurotransmitters, glucocorticoids, and cytokines [15, 18, 19].

…its reuptake receptor (5-HTT), and modify circulating…

…the serotonin transporter5-HTT.…

5-HTTcontrols the reuptake…

Show Full Abstract

Major depressive disorder (MDD) is a psychiatric illness that presents as a deficit of serotonergic neurotransmission in the central nervous system. MDD patients also experience alterations in cortisol and cytokines levels. Treatment with selective serotonin reuptake inhibitors (SSRIs) is the first-line antidepressant regimen for MDD. The aim of this study was to determine the effect of a combination of SSRIs and an immunomodulator-human dialyzable leukocyte extract (hDLE)-on cortisol and cytokines levels. Patients received SSRIs or SSRIs plus hDLE. The proinflammatory cytokines IL-1 β , IL-2, and IFN- γ ; anti-inflammatory cytokines IL-13 and IL-10; and 24-h urine cortisol were measured at weeks (W) 0, 5, 20, 36, and 52 of treatment. The reduction in cortisol levels in the SSRI-treated group was 30% until W52, in contrast, the combined treatment induced a 54% decrease at W36. The decline in cortisol in patients who were treated with SSRI plus hDLE correlated with reduction of anti-inflammatory cytokines and increases levels of proinflammatory cytokines at the study conclusion. These results suggest that the immune-stimulating activity of hDLE, in combination with SSRIs, restored the pro- and anti-inflammatory cytokine balance and cortisol levels in depressed patients versus those who were given SSRIs alone.

Also flagged:OligonucleotideALSC9orf72Amyotrophic lateral sclerosismotor neuron degenerationdeath
Journal Article 2013-11-17 ✓ 1 Snippet Fernandes SA, Douglas AG, Varela MA, Wood MJ, Aoki Y.
In-Text Gene Mentions

…expansion in theHTTgene causes progressive…

Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a progressive and lethal disease of motor neuron degeneration, leading to paralysis of voluntary muscles and death by respiratory failure within five years of onset. Frontotemporal dementia (FTD) is characterised by degeneration of frontal and temporal lobes, leading to changes in personality, behaviour, and language, culminating in death within 5-10 years. Both of these diseases form a clinical, pathological, and genetic continuum of diseases, and this link has become clearer recently with the discovery of a hexanucleotide repeat expansion in the C9orf72 gene that causes the FTD/ALS spectrum, that is, c9FTD/ALS. Two basic mechanisms have been proposed as being potentially responsible for c9FTD/ALS: loss-of-function of the protein encoded by this gene (associated with aberrant DNA methylation) and gain of function through the formation of RNA foci or protein aggregates. These diseases currently lack any cure or effective treatment. Antisense oligonucleotides (ASOs) are modified nucleic acids that are able to silence targeted mRNAs or perform splice modulation, and the fact that they have proved efficient in repeat expansion diseases including myotonic dystrophy type 1 makes them ideal candidates for c9FTD/ALS therapy. Here, we discuss potential mechanisms and challenges for developing oligonucleotide-based therapy for c9FTD/ALS.

Also flagged:ascancergene expressionp21transcription factorsTF
Journal Article 2013-11-17 No Snippets Lai X, Bhattacharya A, Schmitz U, Kunz M, Vera J, Wolkenhauer O.
Show Full Abstract

MicroRNAs (miRNAs) are potent effectors in gene regulatory networks where aberrant miRNA expression can contribute to human diseases such as cancer. For a better understanding of the regulatory role of miRNAs in coordinating gene expression, we here present a systems biology approach combining data-driven modeling and model-driven experiments. Such an approach is characterized by an iterative process, including biological data acquisition and integration, network construction, mathematical modeling and experimental validation. To demonstrate the application of this approach, we adopt it to investigate mechanisms of collective repression on p21 by multiple miRNAs. We first construct a p21 regulatory network based on data from the literature and further expand it using algorithms that predict molecular interactions. Based on the network structure, a detailed mechanistic model is established and its parameter values are determined using data. Finally, the calibrated model is used to study the effect of different miRNA expression profiles and cooperative target regulation on p21 expression levels in different biological contexts.

Also flagged:transcription factorATOH8HAMPironmetabolismSMAD
Journal Article 2013-11-16 ✓ 2 Snippets Patel N, Varghese J, Masaratana P, Latunde-Dada GO, Jacob M, Simpson RJ, McKie AT.
In-Text Gene Mentions

…to binding ofHfe(Robb & Wessling-Resnick,…

…not increased inHfeknockout mice, in…

Show Full Abstract

ATOH8 has previously been shown to be an iron-regulated transcription factor, however its role in iron metabolism is not known. ATOH8 expression in HEK293 cells resulted in increased endogenous HAMP mRNA levels as well as HAMP promoter activity. Mutation of the E-box or SMAD response elements within the HAMP promoter significantly reduced the effects of ATOH8, indicating that ATOH8 activates HAMP transcription directly as well as through bone morphogenic protein (BMP) signalling. In support of the former, Chromatin immunoprecipitation assays provided evidence that ATOH8 binds to E-box regions within the HAMP promoter while the latter was supported by the finding that ATOH8 expression in HEK293 cells led to increased phosphorylated SMAD1,5,8 levels. Liver Atoh8 levels were reduced in mice under conditions associated with increased erythropoietic activity such as hypoxia, haemolytic anaemia, hypotransferrinaemia and erythropoietin treatment and increased by inhibitors of erythropoiesis. Hepatic Atoh8 mRNA levels increased in mice treated with holo transferrin, suggesting that Atoh8 responds to changes in plasma iron. ATOH8 is therefore a novel transcriptional regulator of HAMP, which is responsive to changes in plasma iron and erythroid activity and could explain how changes in erythroid activity lead to regulation of HAMP.

Also flagged:immunoglobulinextracellularbindingcell surface-localized membersimmune responses
Journal Article 2013-11-16 ✓ 3 Snippets Yap EH, Rosche T, Almo S, Fiser A.
In-Text Gene Mentions

immunoglobulin superfamily DCC subclass member 4

HFE

DCC

Show Full Abstract

Secreted and cell-surface-localized members of the immunoglobulin superfamily (IgSF) play central roles in regulating adaptive and innate immune responses and are prime targets for the development of protein-based therapeutics. An essential activity of the ectodomains of these proteins is the specific recognition of cognate ligands, which are often other members of the IgSF. In this work, we provide functional insight for this important class of proteins through the development of a clustering algorithm that groups together extracellular domains of the IgSF with similar binding preferences. Information from hidden Markov model-based sequence profiles and domain architecture is calibrated against manually curated protein interaction data to define functional families of IgSF proteins. The method is able to assign 82% of the 477 extracellular IgSF protein to a functional family, while the rest are either single proteins with unique function or proteins that could not be assigned with the current technology. The functional clustering of IgSF proteins generates hypotheses regarding the identification of new cognate receptor-ligand pairs and reduces the pool of possible interacting partners to a manageable level for experimental validation.

Also flagged:TSLPThymic stromal lymphopoietinallergic diseasesdexamethasoneretinoid X receptorOX40L
Journal Article 2013-11-16 No Snippets Segawa R, Yamashita S, Mizuno N, Shiraki M, Hatayama T, Satou N, Hiratsuka M, Hide M, Hirasawa N.
Show Full Abstract

Thymic stromal lymphopoietin (TSLP) plays critical roles in the induction and exacerbation of allergic diseases. These findings suggest that an inhibitor of TSLP production may be a novel drug for allergic diseases. However, conducting high-throughput screening of such compounds is difficult because there is currently no appropriate in vitro system. In the present study, we demonstrated that the mouse keratinocyte cell line KCMH-1 produced higher amounts of TSLP than the mouse keratinocyte cell line PAM-212, human keratinocyte cell line HaCaT, or bronchial cell line BEAS-2B. A reporter gene assay revealed that transcriptional activity of the TSLP gene was also markedly higher in KCMH-1 than in PAM212 cells. Both dexamethasone and the retinoid X receptor agonist HX600 inhibited the production of TSLP in KCMH-1 cells, which indicated that its production could be pharmacologically regulated. Moreover, the biological activity of TSLP released from KCMH-1 cells in the medium was endorsed by the induction of OX40L expression in bone marrow-derived dendritic cells. These results indicate that KCMH-1 can be utilized in high-throughput screening of inhibitors of TSLP production and also as a source of native TSLP.

Also flagged:dosage compensationgene expressionchromosomesX chromosomeschromatinhistone
Journal Article 2013-11-16 ✓ 5 Snippets Custer LM, Snyder MJ, Flegel K, Csankovszki G.
In-Text Gene Mentions

…dosage compensation complex (DCC) localizes to both…

…TheDCCfirst localizes to…

…stage in aDCC-independent manner.…

…cell cycles afterDCClocalization to the…

…linked to differentiation,DCClocalization and H4K20me1…

Show Full Abstract

Dosage compensation (DC) equalizes X-linked gene expression between sexes. In Caenorhabditis elegans, the dosage compensation complex (DCC) localizes to both X chromosomes in hermaphrodites and downregulates gene expression 2-fold. The DCC first localizes to hermaphrodite X chromosomes at the 30-cell stage, coincident with a developmental transition from plasticity to differentiation. To test whether DC onset is linked to loss of developmental plasticity, we established a timeline for the accumulation of DC-mediated chromatin features on X (depletion of histone H4 lysine 16 acetylation (H4K16ac) and enrichment of H4K20 monomethylation (H4K20me1)) in both wild type and developmentally delayed embryos. Surprisingly, we found that H4K16ac is depleted from the X even before the 30-cell stage in a DCC-independent manner. This depletion requires the activities of MES-2, MES-3, and MES-6 (a complex similar to the Polycomb Repressive Complex 2), and MES-4. By contrast, H4K20me1 becomes enriched on X chromosomes several cell cycles after DCC localization to the X, suggesting that it is a late mark in DC. MES-2 also promotes differentiation, and mes-2 mutant embryos exhibit prolonged developmental plasticity. Consistent with the hypothesis that the onset of DC is linked to differentiation, DCC localization and H4K20me1 accumulation on the X chromosomes are delayed in mes mutant hermaphrodite embryos. Furthermore, the onset of hermaphrodite-specific transcription of sdc-2 (which triggers DC) is delayed in mes-2 mutants. We propose that as embryonic blastomeres lose their developmental plasticity, hermaphrodite X chromosomes transition from a MES protein-regulated state to DCC-mediated repression.

Also flagged:ion channelsligand-gated ion channelsacid-sensing ion channelsASICsneurodegenerative diseasesNeurotoxicity
Journal Article 2013-11-16 No Snippets Chu XP, Grasing KA, Wang JQ.
Show Full Abstract

Acidosis that occurs under pathological conditions not only affects intracellular signaling molecules, but also directly activates a unique family of ligand-gated ion channels: acid-sensing ion channels (ASICs). ASICs are widely expressed throughout the central and peripheral nervous systems and play roles in pain sensation, learning and memory, and fear conditioning. Overactivation of ASICs contributes to neurodegenerative diseases such as ischemic brain/spinal cord injury, multiple sclerosis, Parkinson's disease, and Huntington's disease. Thus, targeting ASICs might be a potential therapeutic strategy for these conditions. This mini-review focuses on the electrophysiology and pharmacology of ASICs and roles of ASICs in neuronal toxicity.

Also flagged:mitochondrialHuntington's diseaseHDHuntingtinmitochondrial fission proteindynamin-related protein 1
Journal Article 2013-11-15 ✓ 1 Snippet Guo X, Disatnik MH, Monbureau M, Shamloo M, Mochly-Rosen D, Qi X.
In-Text Gene Mentions

Htt

Show Full Abstract

Huntington's disease (HD) is the result of expression of a mutated Huntingtin protein (mtHtt), and is associated with a variety of cellular dysfunctions including excessive mitochondrial fission. Here, we tested whether inhibition of excessive mitochondrial fission prevents mtHtt-induced pathology. We developed a selective inhibitor (P110-TAT) of the mitochondrial fission protein dynamin-related protein 1 (DRP1). We found that P110-TAT inhibited mtHtt-induced excessive mitochondrial fragmentation, improved mitochondrial function, and increased cell viability in HD cell culture models. P110-TAT treatment of fibroblasts from patients with HD and patients with HD with iPS cell-derived neurons reduced mitochondrial fragmentation and corrected mitochondrial dysfunction. P110-TAT treatment also reduced the extent of neurite shortening and cell death in iPS cell-derived neurons in patients with HD. Moreover, treatment of HD transgenic mice with P110-TAT reduced mitochondrial dysfunction, motor deficits, neuropathology, and mortality. We found that p53, a stress gene involved in HD pathogenesis, binds to DRP1 and mediates DRP1-induced mitochondrial and neuronal damage. Furthermore, P110-TAT treatment suppressed mtHtt-induced association of p53 with mitochondria in multiple HD models. These data indicate that inhibition of DRP1-dependent excessive mitochondrial fission with a P110-TAT-like inhibitor may prevent or slow the progression of HD.

Also flagged:gene expressionDoxycyclinetetracyclinepolyethylene glycolfibroblast proliferationmatrix metalloproteinase
Journal Article 2013-11-15 No Snippets Gajbhiye V, Escalante L, Chen G, Laperle A, Zheng Q, Steyer B, Gong S, Saha K.
Show Full Abstract

Tissue engineering and advanced manufacturing of human stem cells requires a suite of tools to control gene expression spatiotemporally in culture. Inducible gene expression systems offer cell-extrinsic control, typically through addition of small molecules, but small molecule inducers typically contain few functional groups for further chemical modification. Doxycycline (DXC), a potent small molecule inducer of tetracycline (Tet) transgene systems, was conjugated to a hyperbranched dendritic polymer (Boltorn H40) and subsequently reacted with polyethylene glycol (PEG). The resulting PEG-H40-DXC nanoparticle exhibited pH-sensitive drug release behavior and successfully controlled gene expression in stem-cell-derived fibroblasts with a Tet-On system. While free DXC inhibited fibroblast proliferation and matrix metalloproteinase (MMP) activity, PEG-H40-DXC nanoparticles maintained higher fibroblast proliferation levels and MMP activity. The results demonstrate that the PEG-H40-DXC nanoparticle system provides an effective tool to controlling gene expression in human stem cell derivatives.

Also flagged:diabetescerebrovascular diseaseatherosclerosisagingcoronary artery diseasemyocardial infarction
Journal Article 2013-11-15 ✓ 1 Snippet Koskela JK, Tahvanainen A, Haring A, Tikkakoski AJ, Ilveskoski E, Viitala J, Leskinen MH, Lehtimäki T, Kähönen MA, Kööbi T, Niemelä O, Mustonen JT, Pörsti IH.
In-Text Gene Mentions

…chronic renal insufficiency,hemochromatosis, or medication for…

Show Full Abstract

<h4>Background</h4>High resting heart rate (HR) is associated with increased cardiovascular risk in general populations, possibly due to elevated blood pressure (BP) or sympathetic over-activity. We studied the association of resting HR with cardiovascular function, and examined whether the hemodynamics remained similar during passive head-up tilt.<h4>Methods</h4>Hemodynamics were recorded using whole-body impedance cardiography and continuous radial pulse wave analysis in 522 subjects (age 20-72 years, 261 males) without medication influencing HR or BP, or diagnosed diabetes, coronary artery, renal, peripheral arterial, or cerebrovascular disease. Correlations were calculated, and results analysed according to resting HR tertiles.<h4>Results</h4>Higher resting HR was associated with elevated systolic and diastolic BP, lower stroke volume but higher cardiac output and work, and lower systemic vascular resistance, both supine and upright (p < 0.05 for all). Subjects with higher HR also showed lower supine and upright aortic pulse pressure and augmentation index, and increased resting pulse wave velocity (p < 0.001). Upright stroke volume decreased less in subjects with highest resting HR (p < 0.05), and cardiac output decreased less in subjects with lowest resting HR (p < 0.009), but clear hemodynamic differences between the tertiles persisted both supine and upright.<h4>Conclusions</h4>Supine and upright hemodynamic profile associated with higher resting HR is characterized by higher cardiac output and lower systemic vascular resistance. Higher resting HR was associated with reduced central wave reflection, in spite of elevated BP and arterial stiffness. The increased cardiac workload, higher BP and arterial stiffness, may explain why higher HR is associated with less favourable prognosis in populations.

Also flagged:HDpolyglutaminecytosineadenineguaninemitochondrial
Journal Article 2013-11-15 ✓ 5 Snippets Lauterbach EC.
In-Text Gene Mentions

To review, there are as yet no data in HD models to indicate that individual psychotropics affect HTT or modifying gene transcription, CBP binding, miRNA, eRNA, REST, or HDAC although data from non-HD models suggest that these phenomena should be investigated in HD models at appropriate psychotropic doses and treatment durations.

Lithium 2.5–5 mM (2–5 times human therapeutic concentrations) for 3 days reduced apoptotic nuclear fragmentation in both COS-7 African green monkey kidney cells and SKNSH human neuroblastoma cell lines transfected with mutant Htt (exon 1 fragment with 74 CAG repeats), thought to be mediated by GSK-3β inhibition since similar effects were observed with the GSK-3β inhibitor SB216763 and GSK-3β knockdown [38].

Loxapine (1–10 μM) and cyproheptadine (1–10 μM) each blocked caspase-3 activation and rescued mouse striatal cells expressing mutant Htt (exon 1 with 111 repeats) from cell death in the Hdh (Q111/Q111) mouse striatal cell model, thought to be mediated by transient phosphorylated activation of ERK that was subsequently associated with reduced neurodegeneration and improved motor performance in R6/2 HD transgenic mice treated with the related drug pizotifen [155].

In studies of antipsychotics, neither haloperidol nor clozapine produced significant htt expression changes at 4 weeks (by two reporters) or 12 weeks (one reporter) of administration in mouse whole brain gene chip studies (GEO Profiles database data [16], no author cited for either study).

Chronic lithium administration (rearing in the presence of 4.2 mM lithium) reduced optic photoreceptor neuronal degeneration in the gmr-httQ120 HD Drosophila model expressing the first 171 residues of mutant Htt with 120 repeats, and combining lithium with the mTOR inhibitor rapamycin produced still greater neuroprotection than either drug alone [40].

Show Full Abstract

Psychotropics (antipsychotics, mood stabilizers, antidepressants, anxiolytics, etc.) are commonly prescribed to treat Huntington's disease (HD). In HD preclinical models, while no psychotropic has convincingly affected huntingtin gene, HD modifying gene, or huntingtin protein expression, psychotropic neuroprotective effects include upregulated huntingtin autophagy (lithium), histone acetylation (lithium, valproate, lamotrigine), miR-222 (lithium-plus-valproate), mitochondrial protection (haloperidol, trifluoperazine, imipramine, desipramine, nortriptyline, maprotiline, trazodone, sertraline, venlafaxine, melatonin), neurogenesis (lithium, valproate, fluoxetine, sertraline), and BDNF (lithium, valproate, sertraline) and downregulated AP-1 DNA binding (lithium), p53 (lithium), huntingtin aggregation (antipsychotics, lithium), and apoptosis (trifluoperazine, loxapine, lithium, desipramine, nortriptyline, maprotiline, cyproheptadine, melatonin). In HD live mouse models, delayed disease onset (nortriptyline, melatonin), striatal preservation (haloperidol, tetrabenazine, lithium, sertraline), memory preservation (imipramine, trazodone, fluoxetine, sertraline, venlafaxine), motor improvement (tetrabenazine, lithium, valproate, imipramine, nortriptyline, trazodone, sertraline, venlafaxine), and extended survival (lithium, valproate, sertraline, melatonin) have been documented. Upregulated CREB binding protein (CBP; valproate, dextromethorphan) and downregulated histone deacetylase (HDAC; valproate) await demonstration in HD models. Most preclinical findings await replication and their limitations are reviewed. The most promising findings involve replicated striatal neuroprotection and phenotypic disease modification in transgenic mice for tetrabenazine and for sertraline. Clinical data consist of an uncontrolled lithium case series (n = 3) suggesting non-progression and a primarily negative double-blind, placebo-controlled clinical trial of lamotrigine.

Also flagged:Autophagymembranevesiclesautophagosomescytoplasmicautophagosome
Journal Article 2013-11-15 ✓ 1 Snippet Wu AG, Wong VK, Xu SW, Chan WK, Ng CI, Liu L, Law BY.
In-Text Gene Mentions

Further investigation showed that among three single components derived from Radix Polygalae--i.e., polygalacic acid, senegenin and onjisaponin B--onjisaponin B was able to induce autophagy and accelerate both the removal of mutant huntingtin and A53T α-synuclein, which are highly associated with Huntington disease and Parkinson disease, respectively.

Show Full Abstract

Emerging evidence indicates important protective roles being played by autophagy in neurodegenerative disorders through clearance of aggregate-prone or mutant proteins. In the current study, we aimed to identify autophagy inducers from Chinese medicinal herbs as a potential neuroprotective agent that enhances the clearance of mutant huntingtin and α-synuclein in PC-12 cells. Through intensive screening using the green fluorescent protein-light chain 3 (GFP-LC3) autophagy detection platform, we found that the ethanol extracts of Radix Polygalae (Yuan Zhi) were capable of inducing autophagy. Further investigation showed that among three single components derived from Radix Polygalae--i.e., polygalacic acid, senegenin and onjisaponin B--onjisaponin B was able to induce autophagy and accelerate both the removal of mutant huntingtin and A53T α-synuclein, which are highly associated with Huntington disease and Parkinson disease, respectively. Our study further demonstrated that onjisaponin B induces autophagy via the AMPK-mTOR signaling pathway. Therefore, findings in the current study provide detailed insights into the protective mechanism of a novel autophagy inducer, which is valuable for further investigation as a new candidate agent for modulating neurodegenerative disorders through the reduction of toxicity and clearance of mutant proteins in the cellular level.

Also flagged:cholesterolheart diseasehemoglobin A1cdiabetes mellitustumorcancer
Journal Article 2013-11-15 ✓ 2 Snippets Zhi M, Ding EL, Theisen-Toupal J, Whelan J, Arnaout R.
In-Text Gene Mentions

These included tests of the basic metabolic panel (e.g. sodium, glucose) [18], [22], [23], [25], [28], [39], [50], [57], [60], [62] and complete blood count (hemoglobin, white blood cell count) [18], [22], [25], [39], [50], [57], [60]; common disease monitoring tests (cholesterol, hemoglobin A1c) [45], [50]; tests of cardiac (creatine kinase) [18], [50], liver (transaminases, alkaline phosphatase) [18], [23], [25], [39], [50], [54], [62], [63], [65], thyroid (thyroxine, thyroid stimulating hormone) [64], and kidney function (blood urea nitrogen, creatinine) [18], [22], [23], [25], [39], [50], [57], [60], [62], tests for anemia (iron, ferritin, B12, serum folate) [39], [40], coagulopathy (prothrombin time, partial thromboplastin time [PTT], protein C, protein S, D-dimer) [18], [39], [42], [50], [55], [57], [61], [66], and inflammation and autoimmunity (C-reactive protein, erythrocyte sedimentation rate, autoimmune antibodies, amylase, lipase) [15], [18], [19], [41], [44], [47], [50], [59], [62]; tests for infection (human immunodeficiency virus Western blot, hepatitis B surface antigen, Venereal Disease Research Laboratory syphilis testing, malarial smear, stool and urine microscopy) [17], [22], [25], [52], [54], [58]; tests for monitoring therapeutic drugs (digoxin, anti-epileptics) [20], [22], [36]–[38], [48], [51], [53]; cancer markers (carcinoembryonic antigen) [43], [44], [46], [56]; and molecular tests (HFE gene mutation).[26] In all, there were 104 chemistry (31 studies) [15], [18]–[20], [22], [23], [25], [36], [39], [41], [43]–[46], [48]–[51], [53], [56], [57], [59], [60], [62]–[65], [67] 24 hematology (13 studies) [18], [22], [25], [39], [40], [42], [47], [50], [55], [57], [60], [61], [66] 10 microbiology (six studies) [17], [22], [25], [52], [54], [58]; and three molecular test study measures (one study) [26].

…and molecular tests (HFEgene mutation). […

Show Full Abstract

<h4>Background</h4>Laboratory testing is the single highest-volume medical activity and drives clinical decision-making across medicine. However, the overall landscape of inappropriate testing, which is thought to be dominated by repeat testing, is unclear. Systematic differences in initial vs. repeat testing, measurement criteria, and other factors would suggest new priorities for improving laboratory testing.<h4>Methods</h4>A multi-database systematic review was performed on published studies from 1997-2012 using strict inclusion and exclusion criteria. Over- vs. underutilization, initial vs. repeat testing, low- vs. high-volume testing, subjective vs. objective appropriateness criteria, and restrictive vs. permissive appropriateness criteria, among other factors, were assessed.<h4>Results</h4>Overall mean rates of over- and underutilization were 20.6% (95% CI 16.2-24.9%) and 44.8% (95% CI 33.8-55.8%). Overutilization during initial testing (43.9%; 95% CI 35.4-52.5%) was six times higher than during repeat testing (7.4%; 95% CI 2.5-12.3%; P for stratum difference <0.001). Overutilization of low-volume tests (32.2%; 95% CI 25.0-39.4%) was three times that of high-volume tests (10.2%; 95% CI 2.6-17.7%; P<0.001). Overutilization measured according to restrictive criteria (44.2%; 95% CI 36.8-51.6%) was three times higher than for permissive criteria (12.0%; 95% CI 8.0-16.0%; P<0.001). Overutilization measured using subjective criteria (29.0%; 95% CI 21.9-36.1%) was nearly twice as high as for objective criteria (16.1%; 95% CI 11.0-21.2%; P = 0.004). Together, these factors explained over half (54%) of the overall variability in overutilization. There were no statistically significant differences between studies from the United States vs. elsewhere (P = 0.38) or among chemistry, hematology, microbiology, and molecular tests (P = 0.05-0.65) and no robust statistically significant trends over time.<h4>Conclusions</h4>The landscape of overutilization varies systematically by clinical setting (initial vs. repeat), test volume, and measurement criteria. Underutilization is also widespread, but understudied. Expanding the current focus on reducing repeat testing to include ordering the right test during initial evaluation may lead to fewer errors and better care.

Also flagged:anxiety disordersserotonin transporterserotoninsocial anxiety disorderSADpanic disorder
Journal Article 2013-11-15 ✓ 5 Snippets Andersson E, Rück C, Lavebratt C, Hedman E, Schalling M, Lindefors N, Eriksson E, Carlbring P, Andersson G, Furmark T.
In-Text Gene Mentions

…serotonin transporter (5-HTT) linked polymorphic…

…polymorphic region (5-HTTLPR), a 43-bp…

…the promoter of5-HTT, renders a…

…The s-allele of5-HTTLPR is associated…

…serotonin uptake and5-HTTexpression [18] .…

Show Full Abstract

<h4>Objective</h4>The role of genetics for predicting the response to cognitive behavior therapy (CBT) for social anxiety disorder (SAD) has only been studied in one previous investigation. The serotonin transporter (5-HTTLPR), the catechol-o-methyltransferase (COMT) val158met, and the tryptophan hydroxylase-2 (TPH2) G-703T polymorphisms are implicated in the regulation of amygdala reactivity and fear extinction and therefore might be of relevance for CBT outcome. The aim of the present study was to investigate if these three gene variants predicted response to CBT in a large sample of SAD patients.<h4>Method</h4>Participants were recruited from two separate randomized controlled CBT trials (trial 1: n = 112, trial 2: n = 202). Genotyping were performed on DNA extracted from blood or saliva samples. Effects were analyzed at follow-up (6 or 12 months after treatment) for both groups and for each group separately at post-treatment. The main outcome measure was the Liebowitz Social Anxiety Scale Self-Report.<h4>Results</h4>At long-term follow-up, there was no effect of any genotype, or gene × gene interactions, on treatment response. In the subsamples, there was time by genotype interaction effects indicating an influence of the TPH2 G-703T-polymorphism on CBT short-term response, however the direction of the effect was not consistent across trials.<h4>Conclusions</h4>None of the three gene variants, 5-HTTLPR, COMTval158met and TPH2 G-703T, was associated with long-term response to CBT for SAD.<h4>Trial registration</h4>ClinicalTrials.gov (ID-NCT0056496).

Also flagged:myotonic dystrophy type 1myotonic dystrophyand tibial muscular dystrophygene expressionSSBP3muscular dystrophies
Journal Article 2013-11-15 ✓ 1 Snippet Bachinski LL, Baggerly KA, Neubauer VL, Nixon TJ, Raheem O, Sirito M, Unruh AK, Zhang J, Nagarajan L, Timchenko LT, Bassez G, Eymard B, Gamez J, Ashizawa T, Mendell JR, Udd B, Krahe R.
In-Text Gene Mentions

SOX6

Show Full Abstract

The prevailing pathomechanistic paradigm for myotonic dystrophy (DM) is that aberrant expression of embryonic/fetal mRNA/protein isoforms accounts for most aspects of the pleiotropic phenotype. To identify aberrant isoforms in skeletal muscle of DM1 and DM2 patients, we performed exon-array profiling and RT-PCR validation on the largest DM sample set to date, including Duchenne, Becker and tibial muscular dystrophy (NMD) patients as disease controls, and non-disease controls. Strikingly, most expression and splicing changes in DM patients were shared with NMD controls. Comparison between DM and NMD identified almost no significant differences. We conclude that DM1 and DM2 are essentially identical for dysregulation of gene expression, and DM expression changes represent a subset of broader spectrum dystrophic changes. We found no evidence for qualitative splicing differences between DM1 and DM2. While some DM-specific splicing differences exist, most of the DM splicing differences were also seen in NMD controls. SSBP3 exon 6 missplicing was observed in all diseased muscle and led to reduced protein. We conclude there is no widespread DM-specific spliceopathy in skeletal muscle and suggest that missplicing in DM (and NMD) may not be the driving mechanism for the muscle pathology, since the same pathways show expression changes unrelated to splicing.

Also flagged:type 2 diabetes mellitusinsulinthiazolidinedionesPPARGperoxisome proliferator‐activated receptor gammaPeroxisome proliferator activated receptor gamma
Journal Article 2013-11-15 ✓ 1 Snippet Pattanayak AK, Bankura B, Balmiki N, Das TK, Chowdhury S, Das M.
In-Text Gene Mentions

…secondary diabetes (e.g.,hemochromatosis, pancreatitis) were excluded…

Show Full Abstract

<h4>Aims/introduction</h4>Peroxisome proliferator activated receptor gamma (PPARG) is a nuclear hormone receptor of the ligand-dependent transcription factor involved in adipogenesis, and a molecular target of the insulin sensitizer, thiazolidinediones. The present study aimed to investigate whether the PPARG gene is associated with type 2 diabetes mellitus and its related traits within the population of West Bengal, India.<h4>Materials and methods</h4>The study participants (200 type 2 diabetes mellitus and 200 normal individuals) were chosen randomly, and the variants were screened by direct sequencing.<h4>Results</h4>The results showed that rs1801282 (odds ratio 0.66; 95% confidence interval 0.15-2.96; P = 0.57) and rs3856806 (odds ratio 1.23; 95% confidence interval 0.73-2.06; P = 0.44) variants of the PPARG gene were not associated with type 2 diabetes mellitus.<h4>Conclusions</h4>The results showed that the PPARG gene was not associated with type 2 diabetes mellitus in our study population. As the lack of association might come from the small sample size, further studies with larger sample size are required to verify the present observation.

Also flagged:thrombinfactor V Leidenfactor V (FV) Leidenvenous thromboembolismFV Leidenactivated protein C
Journal Article 2013-11-14 ✓ 1 Snippet Segers O, Simioni P, Tormene D, Castoldi E.
In-Text Gene Mentions

…rs3136516), F10 (rs693335),SERPINC1(rs2227589), PROS1 (Heerlen…

Show Full Abstract

Carriership of the factor V (FV) Leiden mutation increases the risk of venous thromboembolism (VTE) ~4-fold, but the individual risk of each FV Leiden carrier depends on several co-inherited risk and protective factors. Under the hypothesis that thrombin generation might serve as an intermediate phenotype to identify genetic modulators of VTE risk, we enrolled 188 FV Leiden heterozygotes (11 with VTE) and determined the following parameters: thrombin generation in the absence and presence of activated protein C (APC); plasma levels of prothrombin, factor X, antithrombin, protein S and tissue factor pathway inhibitor; and the genotypes of 24 SNPs located in the genes encoding these coagulation factors and inhibitors. Multiple regression analysis was subsequently applied to identify the (genetic) determinants of thrombin generation. The endogenous thrombin potential (ETP) showed a striking inter-individual variability among different FV Leiden carriers and, especially when measured in the presence of APC, correlated with VTE risk. Several SNPs in the F2 (rs1799963, rs3136516), F10 (rs693335), SERPINC1 (rs2227589), PROS1 (Heerlen polymorphism) and TFPI (rs5940) genes significantly affected the ETP-APC and/or the ETP+APC in FV Leiden carriers. Most of these SNPs have shown an association with VTE risk in conventional epidemiological studies, suggesting that the genetic dissection of thrombin generation leads to the detection of clinically relevant SNPs. In conclusion, we have identified several SNPs that modulate thrombin generation in FV Leiden heterozygotes. These SNPs may help explain the large variability in VTE risk observed among different FV Leiden carriers.

Also flagged:strokesickle cell anaemiasickle cell diseaseCystic Fibrosisbeta globindeath
Journal Article 2013-11-14 No Snippets Wang WC, Dwan K.
Show Full Abstract

<h4>Background</h4>In sickle cell disease, a common inherited haemoglobin disorder, abnormal haemoglobin distorts red blood cells, causing anaemia, vaso-occlusion and dysfunction in most body organs. Without intervention, stroke affects around 10% of children with sickle cell anaemia (HbSS) and recurrence is likely. Chronic blood transfusion dilutes the sickled red blood cells, reducing the risk of vaso-occlusion and stroke. However, side effects can be severe.<h4>Objectives</h4>To assess risks and benefits of chronic blood transfusion regimens in people with sickle cell disease to prevent first stroke or recurrences.<h4>Search methods</h4>We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Trials Register, comprising references identified from comprehensive electronic database searches and handsearches of relevant journals and conference proceedings.Date of the latest search of the Group's Haemoglobinopathies Trials Register: 28 January 2013.<h4>Selection criteria</h4>Randomised and quasi-randomised controlled trials comparing blood transfusion as prophylaxis for stroke in people with sickle cell disease to alternative or no treatment.<h4>Data collection and analysis</h4>Both authors independently assessed the risk of bias of the included trials and extracted data.<h4>Main results</h4>Searches identified three eligible randomised trials (n = 342). The first two trials addressed the use of chronic transfusion to prevent primary stroke; the third utilized the drug hydroxycarbamide (hydroxyurea) and phlebotomy to prevent both recurrent (secondary) stroke and iron overload in patients who had already experienced an initial stroke. In the first trial (STOP) a chronic transfusion regimen for maintaining sickle haemoglobin lower than 30% was compared with standard care in 130 children with sickle cell disease judged (through transcranial Doppler ultrasonography) as high-risk for first stroke. During the trial, 11 children in the standard care group suffered a stroke compared to one in the transfusion group, odds ratio 0.08 (95% confidence interval 0.01 to 0.66). This meant the trial was terminated early. The transfusion group had a high complications rate, including iron overload, alloimmunisation, and transfusion reactions. The second trial (STOP II) investigated risk of stroke when transfusion was stopped after at least 30 months in this population. The trial closed early due to a significant difference in risk of stroke between participants who stopped transfusion and those who continued as measured by reoccurrence of abnormal velocities on Doppler examination or the occurrence of overt stroke in the group that stopped transfusion. The third trial (SWiTCH) was a non-inferiority trial comparing transfusion and iron chelation (standard management) with hydroxyurea and phlebotomy (alternative treatment) with the combination endpoint of prevention of stroke recurrence and reduction of iron overload. This trial was stopped early after enrolment and follow up of 133 children because of analysis showing futility in reaching the composite primary endpoint. The stroke rate (seven strokes on hydroxyurea and phlebotomy, none on transfusion and chelation, odds ratio 16.49 (95% confidence interval 0.92 to 294.84)) was within the non-inferiority margin, but the liver iron content was not better in the alternative arm.<h4>Authors' conclusions</h4>The STOP trial demonstrated a significantly reduced risk of stroke in participants with abnormal transcranial Doppler ultrasonography velocities receiving regular blood transfusions. The follow-up trial (STOP 2) indicated that individuals may revert to former risk status if transfusion is discontinued. The degree of risk must be balanced against the burden of chronic transfusions. The combination of hydroxyurea and phlebotomy is not as effective as "standard" transfusion and chelation in preventing secondary stroke and iron overload. Ongoing multicentre trials are investigating the use of chronic transfusion to prevent silent infarcts, the use of hydroxyurea as an alternative to transfusion in children with abnormal transcranial Doppler ultrasonography velocities, and the use of hydroxyurea to prevent conversion of transcranial Doppler ultrasonography velocities from conditional (borderline) to abnormal values.

Also flagged:HDHuntington DiseaseHuntingtinpolyglutamineneurodegenerative diseaseneurodegenerative disorders
Journal Article 2013-11-14 No Snippets Mahalingam S, Levy LM.
Show Full Abstract

No abstract available.

Also flagged:PARP-1sodiumpentobarbitalascorbateinfectionAMPK α 2
Journal Article 2013-11-14 ✓ 2 Snippets Kim TW, Cho HM, Choi SY, Suguira Y, Hayasaka T, Setou M, Koh HC, Hwang EM, Park JY, Kang SJ, Kim HS, Kim H, Sun W.
In-Text Gene Mentions

AMPK overactivation facilitated brain atrophy via increased formation of Htt aggregates in a mouse animal model of HD.54 In addition, activation of AMPK by metformin or AICAR triggered dendritic spine loss (a hallmark of atrophy) in mature hippocampal neurons in an AD model.55 These results suggest that overactivation of AMPK can contribute to the neuronal atrophy and subsequent neuronal degeneration in many different neurodegenerative diseases including PD.

…increased formation ofHttaggregates in a…

Show Full Abstract

Genetic and epidemiologic evidence suggests that cellular energy homeostasis is critically associated with Parkinson's disease (PD) pathogenesis. Here we demonstrated that genetic deletion of Poly (ADP-ribose) polymerase 1 completely blocked 6-hydroxydopamine-induced dopaminergic neurodegeneration and related PD-like symptoms. Hyperactivation of PARP-1 depleted ATP pools in dopaminergic (DA) neurons, thereby activating AMP-activated protein kinase (AMPK). Further, blockade of AMPK activation by viral infection with dominant-negative AMPK strongly inhibited DA neuronal atrophy with moderate suppression of nuclear translocation of apoptosis-inhibiting factor (AIF), whereas overactivation of AMPK conversely strengthened the 6-OHDA-induced DA neuronal degeneration. Collectively, these results suggest that manipulation of PARP-1 and AMPK signaling is an effective therapeutic approach to prevent PD-related DA neurodegeneration.

Also flagged:microcephalyPrimary microcephalyintellectual disabilitycell proliferationWDR62cortical
Journal Article 2013-11-14 ✓ 1 Snippet Adachi Y, Mochida G, Walsh C, Barkovich J.
In-Text Gene Mentions

ARFGEF2

Show Full Abstract

Microcephalies vary widely in clinical severity and in morphology. The purpose of this study is to determine the frequency of disproportion between the size of the cerebrum and the size of midbrain and hindbrain structures in infants and children with microcephaly, as analysis of such disproportions might aid understanding of these disorders and facilitate testing for specific genetic causes. The relative sizes of the forebrain, each component of the brain stem, and vermis and hemispheres of the cerebellum were analyzed visually on magnetic resonance (MR) images of 110 microcephalic patients. A disproportionally large cerebellum, compared with the cerebrum, was found in 50 cases (45.5%), a proportional cerebellum in 49 cases (44.5%), and a disproportionally small cerebellum in 11 cases (10%). Proportional cerebella were most common in mild (86%) and moderate (55%) microcephaly patients, whereas disproportionately large cerebella were most common in severe (57%) and moderate (32%) microcephaly. Disproportionately small cerebella were seen only in moderate (13%) and severe (9%) microcephaly. As genes are expressed at different times in cerebral and cerebellar development, it is postulated that analysis of relative cerebellar and brain stem size may be useful in the initial analysis of microcephaly by MR images both to categorize and to help determine likely genetic causes.

Also flagged:UBFheterochromatinchromatinnucleolusribosomebinding
Journal Article 2013-11-14 ✓ 5 Snippets Hwang YJ, Han D, Kim KY, Min SJ, Kowall NW, Yang L, Lee J, Kim Y, Ryu H.
In-Text Gene Mentions

HD is caused by an expansion of CAG repeats coding for glutamine (Q) in exon 1 of the Htt gene.

…such as huntingtin (Htt) and atrophin with…

…by which mutantHttcontributes to neurodegenerati…

…1 of theHttgene.…

…by which mutantHtt(mtHtt) contributes to…

Show Full Abstract

The remodeling of chromatin in the nucleolus is important for the control of ribosomal DNA (rDNA) transcription and ribosome biogenesis. Herein, we found that upstream binding factor (UBF) interacts with ESET, a histone H3K9 methyltransferase and is trimethylated at Lys (K) 232/254 by ESET. UBF trimethylation leads to nucleolar chromatin condensation and decreased rDNA transcriptional activity. UBF mutations at K232/254A and K232/254R restored rDNA transcriptional activity in response to ESET. Both ESET-ΔSET mutant and knockdown of ESET by short hairpin RNA reduced trimethylation of UBF and resulted in the restoration of rDNA transcription. Atomic force microscopy confirmed that UBF trimethylated by ESET modulates the plasticity of nucleolar chromatin. We further demonstrated that UBF trimethylation at K232/254 by ESET deregulates rDNA transcription in a cell model of Huntington's disease. Together, our findings show that a novel epigenetic modification of UBF is linked to impaired rDNA transcription and nucleolar chromatin remodeling, which may play key roles in the pathogenesis of neurodegeneration.

Also flagged:proteasecysteine proteasesdeathproteolysisarsenical pump-driving ATPaseperipherin
Journal Article 2013-11-14 No Snippets Kim C, Yun N, Lee YM, Jeong JY, Baek JY, Song HY, Ju C, Youdim MB, Jin BK, Kim WK, Oh YJ.
Show Full Abstract

Calpains are a family of calcium-dependent cysteine proteases that are ubiquitously expressed in mammals and play critical roles in neuronal death by catalyzing substrate proteolysis. Here, we developed two-dimensional gel electrophoresis-based protease proteomics to identify putative calpain substrates. To accomplish this, cellular lysates from neuronal cells were first separated by pI, and the immobilized sample on a gel strip was incubated with a recombinant calpain and separated by molecular weight. Among 25 altered protein spots that were differentially expressed by at least 2-fold, we confirmed that arsenical pump-driving ATPase, optineurin, and peripherin were cleaved by calpain using in vitro and in vivo cleavage assays. Furthermore, we found that all of these substrates were cleaved in MN9D cells treated with either ionomycin or 1-methyl-4-phenylpyridinium, both of which cause a calcium-mediated calpain activation. Their cleavage was blocked by calcium chelator or calpain inhibitors. In addition, calpain-mediated cleavage of these substrates and its inhibition by calpeptin were confirmed in a middle cerebral artery occlusion model of cerebral ischemia, as well as a stereotaxic brain injection model of Parkinson disease. Transient overexpression of each protein was shown to attenuate 1-methyl-4-phenylpyridinium-induced cell death, indicating that these substrates may confer protection of varying magnitudes against dopaminergic injury. Taken together, the data indicate that our protease proteomic method has the potential to be applicable for identifying proteolytic substrates affected by diverse proteases. Moreover, the results described here will help us decipher the molecular mechanisms underlying the progression of neurodegenerative disorders where protease activation is critically involved.

Also flagged:TBC1D20cataractsmale infertilityblindWarburg micro syndromebs
Journal Article 2013-11-14 ✓ 1 Snippet Liegel RP, Handley MT, Ronchetti A, Brown S, Langemeyer L, Linford A, Chang B, Morris-Rosendahl DJ, Carpanini S, Posmyk R, Harthill V, Sheridan E, Abdel-Salam GM, Terhal PA, Faravelli F, Accorsi P, Giordano L, Pinelli L, Hartmann B, Ebert AD, Barr FA, Aligianis IA, Sidjanin DJ.
In-Text Gene Mentions

…TBC1D20 as aRABGAPand the bs…

Show Full Abstract

blind sterile (bs) is a spontaneous autosomal-recessive mouse mutation discovered more than 30 years ago. Phenotypically, bs mice exhibit nuclear cataracts and male infertility; genetic analyses assigned the bs locus to mouse chromosome 2. In this study, we first positionally cloned the bs locus and identified a putative causative mutation in the Tbc1d20 gene. Functional analysis established the mouse TBC1D20 protein as a GTPase-activating protein (GAP) for RAB1 and RAB2, and bs as a TBC1D20 loss-of-function mutation. Evaluation of bs mouse embryonic fibroblasts (mEFs) identified enlarged Golgi morphology and aberrant lipid droplet (LD) formation. Based on the function of TBC1D20 as a RABGAP and the bs cataract and testicular phenotypes, we hypothesized that mutations in TBC1D20 may contribute to Warburg micro syndrome (WARBM); WARBM constitutes a spectrum of disorders characterized by eye, brain, and endocrine abnormalities caused by mutations in RAB3GAP1, RAB3GAP2, and RAB18. Sequence analysis of a cohort of 77 families affected by WARBM identified five distinct TBC1D20 loss-of-function mutations, thereby establishing these mutations as causative of WARBM. Evaluation of human fibroblasts deficient in TBC1D20 function identified aberrant LDs similar to those identified in the bs mEFs. Additionally, our results show that human fibroblasts deficient in RAB18 and RAB3GAP1 function also exhibit aberrant LD formation. These findings collectively indicate that a defect in LD formation/metabolism may be a common cellular abnormality associated with WARBM, although it remains unclear whether abnormalities in LD metabolism are contributing to WARBM disease pathology.

Also flagged:genetic diseasesgenetic disordersPTCdegradationgene expressionX-chromosome
Journal Article 2013-11-14 ✓ 1 Snippet Nguyen LS, Wilkinson MF, Gecz J.
In-Text Gene Mentions

STAU1

Show Full Abstract

Nonsense-mediated mRNA decay (NMD) is a regulatory pathway that functions to degrade transcripts containing premature termination codons (PTCs) and to maintain normal transcriptome homeostasis. Nonsense and frameshift mutations that generate PTCs cause approximately one-third of all known human genetic diseases and thus NMD has a potentially important role in human disease. In genetic disorders in which the affected genes carry PTC-generating mutations, NMD acts as a double-edge sword. While it can benefit the patient by degrading PTC-containing mRNAs that encode detrimental, dominant-negative truncated proteins, it can also make the disease worse when a PTC-containing mRNA is degraded that encodes a mutant but still functional protein. There is evidence that the magnitude of NMD varies between individuals, which, in turn, has been shown to correlate with both clinical presentations and the patients' responses to drugs that promote read-through of PTCs. In this review, we examine the evidence supporting the existence of inter-individual variability in NMD efficiency and discuss the genetic factors that underlie this variability. We propose that inter-individual variability in NMD efficiency is a common phenomenon in human populations and that an individual's NMD efficiency should be taken into consideration when testing, developing, and making therapeutic decisions for diseases caused by genes harboring PTCs.

Also flagged:Gene expressiontranscription factorsDNA polymerase IIpol IIbindingtranscription factor
Journal Article 2013-11-14 No Snippets Wang H, Wen J, Chang CC, Zhou X.
Show Full Abstract

More and more transcription factors and their motifs have been reported and linked to specific gene expression levels. However, focusing only on transcription is not sufficient for mechanism research. Most genes, especially in eukaryotes, are alternatively spliced to different isoforms. Some of these isoforms increase the biodiversity of proteins. From this viewpoint, transcription and splicing are two of important mechanisms to modulate expression levels of isoforms. To integrate these two kinds of regulation, we built a linear regression model to select a subset of transcription factors and splicing factors for each co-expressed isoforms using least-angle regression approach. Then, we applied this method to investigate the mechanism of myelodysplastic syndromes (MDS), a precursor lesion of acute myeloid leukemia. Results suggested that expression levels of most isoforms were regulated by a set of selected regulatory factors. Some of the detected factors, such as EGR1 and STAT family, are highly correlated with progression of MDS. We discovered that the splicing factor SRSF11 experienced alternative splicing switch, and in turn induced different amino acid sequences between MDS and controls. This splicing switch causes two different splicing mechanisms. Polymerase Chain Reaction experiments also confirmed that one of its isoforms was over-expressed in MDS. We analyzed the regulatory networks constructed from the co-expressed isoforms and their regulatory factors in MDS. Many of these networks were enriched in the herpes simplex infection pathway which involves many splicing factors, and pathways in cancers and acute or chronic myeloid leukemia.

Also flagged:HeT-Achromosomechromatingene expressiontelomereregulation of
Journal Article 2013-11-14 No Snippets Silva-Sousa R, Casacuberta E.
Show Full Abstract

In Drosophila, the non-LTR retrotransposons HeT-A, TART and TAHRE build a head-to-tail array of repetitions that constitute the telomere domain by targeted transposition at the end of the chromosome whenever needed. As a consequence, Drosophila telomeres have the peculiarity to harbor the genes in charge of telomere elongation. Understanding telomere expression is important in Drosophila since telomere homeostasis depends in part on the expression of this genomic compartment. We have recently shown that the essential kinase JIL-1 is the first positive regulator of the telomere retrotransposons. JIL-1 mediates chromatin changes at the promoter of the HeT-A retrotransposon that are necessary to obtain wild type levels of expression of these telomere transposons. With the present study, we show how JIL-1 is also needed for the expression of a reporter gene embedded in the telomere domain. Our analysis, using different reporter lines from the telomere and subtelomere domains of different chromosomes, indicates that JIL-1 likely acts protecting the telomere domain from the spreading of repressive chromatin from the adjacent subtelomere domain. Moreover, the analysis of the 4R telomere suggests a slightly different chromatin structure at this telomere. In summary, our results strongly suggest that the action of JIL-1 depends on which telomere domain, which chromosome and which promoter is embedded in the telomere chromatin.

Also flagged:inseminationchromosomesschizophreniareproductionmatingautosomes
Journal Article 2013-11-14 No Snippets Kim ES, Cole JB, Huson H, Wiggans GR, Van Tassell CP, Crooker BA, Liu G, Da Y, Sonstegard TS.
Show Full Abstract

The intensive selection programs for milk made possible by mass artificial insemination increased the similarity among the genomes of North American (NA) Holsteins tremendously since the 1960s. This migration of elite alleles has caused certain regions of the genome to have runs of homozygosity (ROH) occasionally spanning millions of continuous base pairs at a specific locus. In this study, genome signatures of artificial selection in NA Holsteins born between 1953 and 2008 were identified by comparing changes in ROH between three distinct groups under different selective pressure for milk production. The ROH regions were also used to estimate the inbreeding coefficients. The comparisons of genomic autozygosity between groups selected or unselected since 1964 for milk production revealed significant differences with respect to overall ROH frequency and distribution. These results indicate selection has increased overall autozygosity across the genome, whereas the autozygosity in an unselected line has not changed significantly across most of the chromosomes. In addition, ROH distribution was more variable across the genomes of selected animals in comparison to a more even ROH distribution for unselected animals. Further analysis of genome-wide autozygosity changes and the association between traits and haplotypes identified more than 40 genomic regions under selection on several chromosomes (Chr) including Chr 2, 7, 16 and 20. Many of these selection signatures corresponded to quantitative trait loci for milk, fat, and protein yield previously found in contemporary Holsteins.

Also flagged:β-galactosidase
Journal Article 2013-11-14 No Snippets Lim J, Vrignon J, Gruner P, Karamitros CS, Konrad M, Baret JC.
Show Full Abstract

We demonstrate the use of a hybrid microfluidic-micro-optical system for the screening of enzymatic activity at the single cell level. <i>Escherichia coli</i> β-galactosidase activity is revealed by a fluorogenic assay in 100 pl droplets. Individual droplets containing cells are screened by measuring their fluorescence signal using a high-speed camera. The measurement is parallelized over 100 channels equipped with microlenses and analyzed by image processing. A reinjection rate of 1 ml of emulsion per minute was reached corresponding to more than 10<sup>5</sup> droplets per second, an analytical throughput larger than those obtained using flow cytometry.

Also flagged:ZIC2RASGRF1highmyopiarefractive errorTOX
Journal Article 2013-11-13 ✓ 5 Snippets Oishi M, Yamashiro K, Miyake M, Akagi-Kurashige Y, Kumagai K, Nakata I, Nakanishi H, Yoshikawa M, Oishi A, Gotoh N, Tsujikawa A, Nagahama Study Group, Yamada R, Matsuda F, Yoshimura N.
In-Text Gene Mentions

The 5 single-nucleotide polymorphisms (SNPs) from the 5 genes TOX, RDH5, ZIC2, RASGRF1, and SHISA6, were genotyped in 1339 unrelated highly myopic Japanese patients and 3248 healthy Japanese participants in the Nagahama Study.

Association between ZIC2, RASGRF1, and SHISA6 genes and high myopia in Japanese subjects.

Significant associations between rs8000973 near ZIC2 (P = 7.16 × 10(-7)), rs4778879 in RASGRF1 (P = 3.40 × 10(-7)), and rs2969180 in SHISA6 (P = 0.033) and high myopia were observed.

In addition, genotypes were compared between high myopia patients without choroidal neovascularization (CNV) and patients with myopic CNV.<h4>Results</h4>Significant associations between rs8000973 near ZIC2 (P = 7.16 × 10(-7)), rs4778879 in RASGRF1 (P = 3.40 × 10(-7)), and rs2969180 in SHISA6 (P = 0.033) and high myopia were observed.

<h4>Purpose</h4>We investigated the association of genetic variations, which were identified recently in a large-scale genome-wide association study (GWAS) to confer risk of refractive error and common myopia in Caucasians, with high myopia in Japanese subjects.<h4>Methods</h4>The 5 single-nucleotide polymorphisms (SNPs) from the 5 genes TOX, RDH5, ZIC2, RASGRF1, and SHISA6, were genotyped in 1339 unrelated highly myopic Japanese patients and 3248 healthy Japanese participants in the Nagahama Study.

Show Full Abstract

<h4>Purpose</h4>We investigated the association of genetic variations, which were identified recently in a large-scale genome-wide association study (GWAS) to confer risk of refractive error and common myopia in Caucasians, with high myopia in Japanese subjects.<h4>Methods</h4>The 5 single-nucleotide polymorphisms (SNPs) from the 5 genes TOX, RDH5, ZIC2, RASGRF1, and SHISA6, were genotyped in 1339 unrelated highly myopic Japanese patients and 3248 healthy Japanese participants in the Nagahama Study. In addition, genotypes were compared between high myopia patients without choroidal neovascularization (CNV) and patients with myopic CNV.<h4>Results</h4>Significant associations between rs8000973 near ZIC2 (P = 7.16 × 10(-7)), rs4778879 in RASGRF1 (P = 3.40 × 10(-7)), and rs2969180 in SHISA6 (P = 0.033) and high myopia were observed. Odds ratios (95% confidence intervals) were 1.33 (1.19-1.49), 0.78 (0.71-0.86), and 1.11 (1.01-1.22) for the rs8000973 C allele, rs4778879 A allele, and rs2969180 G allele, respectively. The effect of the rs2969180 allele G contrasted with that observed in the original report, whereas the effect of the other 2 SNPs agreed. Further analysis using controls with -1.0 diopter (D) ≤ spherical equivalent ≤ +1.0 D showed a significant association between ZIC2 and RASGRF1, but not SHISA6. Among the patients with high myopia, 516 had myopic CNV in either eye, while 823 patients did not have myopic CNV in eyes. No evaluated genes showed a significant association with the development of myopic CNV.<h4>Conclusions</h4>ZIC2 and RASGRF1 are susceptibility genes, not only for common myopia, but also for high myopia.

Also flagged:lipoproteincholesterolanionpolyacrylamideapolipoprotein(apo) AI
Journal Article 2013-11-13 ✓ 2 Snippets Hsieh JY, Chang CT, Huang MT, Chang CM, Chen CY, Shen MY, Liao HY, Wang GJ, Chen CH, Chen CJ, Yang CY.
In-Text Gene Mentions

SERPINC1

antithrombin-III

Show Full Abstract

High-density lipoprotein (HDL) is regarded as atheroprotective because it provides antioxidant and anti-inflammatory benefits and plays an important role in reverse cholesterol transport. In this paper, we outline a novel methodology for studying the heterogeneity of HDL. Using anion-exchange chromatography, we separated HDL from 6 healthy individuals into five subfractions (H1 through H5) with increasing charge and evaluated the composition and biologic activities of each subfraction. Sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis showed that apolipoprotein (apo) AI and apoAII were present in all 5 subfractions; apoCI was present only in H1, and apoCIII and apoE were most abundantly present in H4 and H5. HDL-associated antioxidant enzymes such as lecithin-cholesterol acyltransferase, lipoprotein-associated phospholipase A2, and paraoxonase 1 were most abundant in H4 and H5. Lipoprotein isoforms were analyzed in each subfraction by using matrix-assisted laser desorption-time-of-flight mass spectrometry. To quantify other proteins in the HDL subfractions, we used the isobaric tags for the relative and absolute quantitation approach followed by nanoflow liquid chromatography-tandem mass spectrometry analysis. Most antioxidant proteins detected were found in H4 and H5. The ability of each subfraction to induce cholesterol efflux from macrophages increased with increasing HDL electronegativity, with the exception of H5, which promoted the least efflux activity. In conclusion, anion-exchange chromatography is an attractive method for separating HDL into subfractions with distinct lipoprotein compositions and biologic activities. By comparing the properties of these subfractions, it may be possible to uncover HDL-specific proteins that play a role in disease.

Also flagged:bubonic plagueplagueantibodysecretionIFN-γIL-2
Journal Article 2013-11-13 ✓ 1 Snippet Zhang Q, Wang Q, Tian G, Qi Z, Zhang X, Wu X, Qiu Y, Bi Y, Yang X, Xin Y, He J, Zhou J, Zeng L, Yang R, Wang X.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Yersinia pestis biovar Microtus is considered to be a virulent to larger mammals, including guinea pigs, rabbits and humans. It may be used as live attenuated plague vaccine candidates in terms of its low virulence. However, the Microtus strain's protection against plague has yet to be demonstrated in larger mammals. In this study, we evaluated the protective efficacy of the Microtus strain 201 as a live attenuated plague vaccine candidate. Our results show that this strain is highly attenuated by subcutaneous route, elicits an F1-specific antibody titer similar to the EV and provides a protective efficacy similar to the EV against bubonic plague in Chinese-origin rhesus macaques. The Microtus strain 201 could induce elevated secretion of both Th1-associated cytokines (IFN-γ, IL-2 and TNF-α) and Th2-associated cytokines (IL-4, IL-5, and IL-6), as well as chemokines MCP-1 and IL-8. However, the protected animals developed skin ulcer at challenge site with different severity in most of the immunized and some of the EV-immunized monkeys. Generally, the Microtus strain 201 represented a good plague vaccine candidate based on its ability to generate strong humoral and cell-mediated immune responses as well as its good protection against high dose of subcutaneous virulent Y. pestis challenge.

Also flagged:ironchronic kidney diseaseanemiaerythropoiesisantibodieshepcidin-binding proteins
Journal Article 2013-11-13 No Snippets Zumbrennen-Bullough K, Babitt JL.
Show Full Abstract

Iron is essential for most living organisms but iron excess can be toxic. Cellular and systemic iron balance is therefore tightly controlled. Iron homeostasis is dysregulated in chronic kidney disease (CKD) and contributes to the anemia that is prevalent in this patient population. Iron supplementation is one cornerstone of anemia management in CKD patients, but has not been rigorously studied in large prospective randomized controlled trials. This review highlights important advances from genetic studies and animal models that have provided key insights into the molecular mechanisms governing iron homeostasis and its disturbance in CKD, and summarizes how these findings may yield advances in the care of this patient population.

Also flagged:SpoTOxidase 1cell walldeathdosage compensationchromosome
Journal Article 2013-11-13 ✓ 5 Snippets Martin J, Chong T, Ferree PM.
In-Text Gene Mentions

…Dosage Compensation Complex (DCC) [11] .…

…First, loss ofDCCfunction rescues embryonic…

…male killing inDCCmutants occur during…

…of NSRO, theDCCmay act inappropriately…

…just after theDCCis normally expressed…

Show Full Abstract

Male killing bacteria such as Spiroplasma are widespread pathogens of numerous arthropods including Drosophila melanogaster. These maternally transmitted bacteria can bias host sex ratios toward the female sex in order to 'selfishly' enhance bacterial transmission. However, little is known about the specific means by which these pathogens disrupt host development in order to kill males. Here we show that a male-killing Spiroplasma strain severely disrupts nervous tissue development in male but not female D. melanogaster embryos. The neuroblasts, or neuron progenitors, form properly and their daughter cells differentiate into neurons of the ventral nerve chord. However, the neurons fail to pack together properly and they produce highly abnormal axons. In contrast, non-neural tissue, such as mesoderm, and body segmentation appear normal during this time, although the entire male embryo becomes highly abnormal during later stages. Finally, we found that Spiroplasma is altogether absent from the neural tissue but localizes within the gut and the epithelium immediately surrounding the neural tissue, suggesting that the bacterium secretes a toxin that affects neural tissue development across tissue boundaries. Together these findings demonstrate the unique ability of this insect pathogen to preferentially affect development of a specific embryonic tissue to induce male killing.

Also flagged:Rab11neurodegenerative disordersbehavioralsynapseRabGTPase
Journal Article 2013-11-13 ✓ 5 Snippets Giorgini F, Steinert JR.
In-Text Gene Mentions

-17 We have also found that Rab11 abrogates loss of dendritic spines in primary neurons expressing mutant HTT, and ameliorates neuron loss and shortened lifespan in adult HD flies.17

HD is caused by the expansion of a polyglutamine stretch near the N-terminus of the huntingtin (HTT) protein, which exerts cellular toxicity by perturbing a number of cellular processes, including vesicle trafficking and transcription, as well as by overwhelming antioxidant systems.5

A particularly striking feature of HD pathology and genetic models is the aggregation of mutant HTT protein, but it remains unknown how aggregates contribute to toxicity in this diseases.

We recently showed that mutant HTT is linked to synaptic pathology in Drosophila models of HD, in particular affecting synaptic vesicle homeostasis,29 which could represent an early physiological deficit before onset of disease pathology.

This suggests that toxic oligomeric species of mutant HTT may play a critical role in synaptic dysfunction in HD.

Show Full Abstract

Many neurodegenerative disorders are characterized by synaptic dysfunction preceding general neuronal loss and subsequent cognitive or behavioral anomalies. Much recent research has been aimed at understanding the early underlying processes leading to dysfunction at the synapse, as this knowledge would likely inform interventions that could potentially slow progression and delay onset of disease. We have recently reported that synaptic dysfunction in a Drosophila melanogaster model of Huntington's disease (HD) can be prevented by enhanced neuronal expression of Rab11, a Rab family GTPase involved in endosomal recycling, which complements studies that have found disrupted Rab11 activity in several models of this disorder. Indeed, inhibition of Rab11 function in fibroblasts of HD patients has been observed to perturb vesicle formation from recycling endosomes. Therefore, our study investigated a potential role of Rab11 in synaptic dysfunction prior to the onset of HD symptoms, with the aim of finding a possible early intervention to disease progression. We found that Rab11 ameliorates synaptic dysfunction due to expression of mutant huntingtin-the causative protein in HD-by normalizing synaptic vesicle size, which consequently ameliorates locomotor deficits in Drosophila larvae. Here we further consider these results and the implications this work has on potential therapeutic intervention in HD and other neurodegenerative disorders.

Also flagged:brain developmentdedicator ofcytokinesisRhoguanine nucleotide exchange factorsRac
Journal Article 2013-11-13 No Snippets Shi L.
Show Full Abstract

The family of dedicator of cytokinesis (Dock), a protein family that belongs to the atypical Rho guanine nucleotide exchange factors (GEFs) for Rac and/or Cdc42 GTPases, plays pivotal roles in various processes of brain development. To date, 11 members of Docks have been identified in the mammalian system. Emerging evidence has suggested that members of the Dock family are associated with several neurodegenerative and neuropsychiatric diseases, including Alzheimer disease and autism spectrum disorders. This review summarizes recent advances on the understanding of the roles of the Dock protein family in normal and diseased processes in the nervous system. Furthermore, interacting proteins and the molecular regulation of Docks are discussed.

Also flagged:CMLCPtyrosine kinasechronic myeloid leukemiachromosomeBCR-ABL
Journal Article 2013-11-12 ✓ 1 Snippet Jabbour EJ, Hughes TP, Cortés JE, Kantarjian HM, Hochhaus A.
In-Text Gene Mentions

DCC-2036

Show Full Abstract

Despite vast improvements in the treatment of Philadelphia chromosome-positive chronic myeloid leukemia (CML) in chronic phase (CP), advanced stages of CML, accelerated phase or blast crisis, remain notoriously difficult to treat. Treatments that are highly effective against CML-CP produce disappointing results against advanced disease. Therefore, a primary goal of therapy should be to maintain patients in CP for as long as possible, by (1) striving for deep, early molecular response to treatment; (2) using tyrosine kinase inhibitors that lower risk of disease progression; and (3) more closely observing patients who demonstrate cytogenetic risk factors at diagnosis or during treatment.

Also flagged:antibodyimmunoglobulin GIgGtranscriptional-autoimmune disease
Journal Article 2013-11-12 ✓ 1 Snippet Chevrier S, Kratina T, Emslie D, Karnowski A, Corcoran LM.
In-Text Gene Mentions

…mutation in theRc3h1gene encoding Roquin1,…

Show Full Abstract

Mice homozygous for a point mutation in the Rc3h1 gene encoding Roquin1, designated sanroque mice, develop a severe antibody-mediated autoimmune condition. The disease is T-cell intrinsic, exacerbated by macrophage-intrinsic defects and driven by excessive T follicular helper cell generation and spontaneous germinal centre (GC) formation. This culminates in abnormally high numbers of plasma cells secreting high-affinity autoreactive immunoglobulin G (IgG). Obf1 is a transcriptional co-activator required for normal T-cell-dependent antibody responses, and it is essential for GC formation under all circumstances so far tested. We crossed sanroque mice with Obf1-null mice to determine whether the hyperactivity of sanroque T cells could drive Obf1(-/-) B cells to differentiate to GC B cells, or conversely, if Obf1 loss would prevent sanroque-mediated autoimmune disease. Surprisingly, while sanroque/Obf1(-/-) mice did not form GC, they still developed autoimmune disease and succumbed even more rapidly than did sanroque mice. The disease was mediated by autoreactive IgM, which may have been derived from a pre-existing population of autoreactive B cells in the Obf1(-/-) mice responding to the over-exuberant activity of sanroque CD4 cells.

Also flagged:myocardial ischemiagene expressioncardiovascular diseasedeathheart failuremyocardial infarction
Journal Article 2013-11-12 ✓ 1 Snippet Sala V, Bergerone S, Gatti S, Gallo S, Ponzetto A, Ponzetto C, Crepaldi T.
In-Text Gene Mentions

Sox6

Show Full Abstract

MicroRNAs (miRNAs) are natural, single-stranded, small RNA molecules which subtly control gene expression. Several studies indicate that specific miRNAs can regulate heart function both in development and disease. Despite prevention programs and new therapeutic agents, cardiovascular disease remains the main cause of death in developed countries. The elevated number of heart failure episodes is mostly due to myocardial infarction (MI). An increasing number of studies have been carried out reporting changes in miRNAs gene expression and exploring their role in MI and heart failure. In this review, we furnish a critical analysis of where the frontier of knowledge has arrived in the fields of basic and translational research on miRNAs in cardiac ischemia. We first summarize the basal information on miRNA biology and regulation, especially concentrating on the feedback loops which control cardiac-enriched miRNAs. A focus on the role of miRNAs in the pathogenesis of myocardial ischemia and in the attenuation of injury is presented. Particular attention is given to cardiomyocyte death (apoptosis and necrosis), fibrosis, neovascularization, and heart failure. Then, we address the potential of miR-diagnosis (miRNAs as disease biomarkers) and miR-drugs (miRNAs as therapeutic targets) for cardiac ischemia and heart failure. Finally, we evaluate the use of miRNAs in the emerging field of regenerative medicine.

Also flagged:IronNeurodegenerative disordersdeathagingphagocytosisextracellular space
Journal Article 2013-11-12 ✓ 1 Snippet Andersen HH, Johnsen KB, Moos T.
In-Text Gene Mentions

…the treatment ofhemochromatosisand iron poisoning,…

Show Full Abstract

Neurodegenerative disorders are characterized by the presence of inflammation in areas with neuronal cell death and a regional increase in iron that exceeds what occurs during normal aging. The inflammatory process accompanying the neuronal degeneration involves glial cells of the central nervous system (CNS) and monocytes of the circulation that migrate into the CNS while transforming into phagocytic macrophages. This review outlines the possible mechanisms responsible for deposition of iron in neurodegenerative disorders with a main emphasis on how iron-containing monocytes may migrate into the CNS, transform into macrophages, and die out subsequently to their phagocytosis of damaged and dying neuronal cells. The dying macrophages may in turn release their iron, which enters the pool of labile iron to catalytically promote formation of free-radical-mediated stress and oxidative damage to adjacent cells, including neurons. Healthy neurons may also chronically acquire iron from the extracellular space as another principle mechanism for oxidative stress-mediated damage. Pharmacological handling of monocyte migration into the CNS combined with chelators that neutralize the effects of extracellular iron occurring due to the release from dying macrophages as well as intraneuronal chelation may denote good possibilities for reducing the deleterious consequences of iron deposition in the CNS.

Also flagged:Parkinson's diseaseserotonindepressive stateDepressionAcute Myocardial Infarctionlife stress
Journal Article 2013-11-12 ✓ 5 Snippets Culverhouse RC, Bowes L, Breslau N, Nurnberger JI, Burmeister M, Fergusson DM, Munafò M, Saccone NL, Bierut LJ, 5-HTTLPR, Stress, and Depression Consortium.
In-Text Gene Mentions

HTT

Summary: A repeat length polymorphism in the promoter of the 5-HTT gene that has been shown to affect the rate of serotonin uptake.

…transporter gene (5-HTT).…

…Also known asHTT; 5HTT; OCD1; SERT;…

…5HTT; OCD1; SERT;5-HTT; SERT1; hSERT.…

Show Full Abstract

<h4>Background</h4>Debate is ongoing about what role, if any, variation in the serotonin transporter linked polymorphic region (5-HTTLPR) plays in depression. Some studies report an interaction between 5-HTTLPR variation and stressful life events affecting the risk for depression, others report a main effect of 5-HTTLPR variation on depression, while others find no evidence for either a main or interaction effect. Meta-analyses of multiple studies have also reached differing conclusions.<h4>Methods/design</h4>To improve understanding of the combined roles of 5-HTTLPR variation and stress in the development of depression, we are conducting a meta-analysis of multiple independent datasets. This coordinated approach utilizes new analyses performed with centrally-developed, standardized scripts. This publication documents the protocol for this collaborative, consortium-based meta-analysis of 5-HTTLPR variation, stress, and depression.<h4>Study eligibility criteria</h4>Our goal is to invite all datasets, published or unpublished, with 5-HTTLPR genotype and assessments of stress and depression for at least 300 subjects. This inclusive approach is to minimize potential impact from publication bias.<h4>Data sources</h4>This project currently includes investigators from 35 independent groups, providing data on at least N = 33,761 participants.The analytic plan was determined prior to starting data analysis. Analyses of individual study datasets will be performed by the investigators who collected the data using centrally-developed standardized analysis scripts to ensure a consistent analytical approach across sites. The consortium as a group will review and interpret the meta-analysis results.<h4>Discussion</h4>Variation in 5-HTTLPR is hypothesized to moderate the response to stress on depression. To test specific hypotheses about the role of 5-HTTLPR variation on depression, we will perform coordinated meta-analyses of de novo results obtained from all available data, using variables and analyses determined a priori. Primary analyses, based on the original 2003 report by Caspi and colleagues of a GxE interaction will be supplemented by secondary analyses to help interpret and clarify issues ranging from the mechanism of effect to heterogeneity among the contributing studies. Publication of this protocol serves to protect this project from biased reporting and to improve the ability of readers to interpret the results of this specific meta-analysis upon its completion.

Also flagged:SynthesisMEK1kinaseintegrin receptoralkoxylaminemelanoma
Journal Article 2013-11-12 No Snippets Li X, Hou J, Wang C, Liu X, He H, Xu P, Yang Z, Chen Z, Wu Y, Zhang L.
Show Full Abstract

Two novel series of RGD-MEKI conjugates derived from a MEK1/2 kinase inhibitor--PD0325901--have been developed for integrin receptor mediated anticancer therapy. The first series, alkoxylamine analog RGD-MEKI conjugates 9a-g showed anti-proliferation activity in melanoma A375 cells by the same mechanism as that of PD0325901. PEGylation increased the IC50 value of 9f three-fold in the A375 assay, and the multi-cRGD peptide cargo significantly improved the receptor specific anti-proliferation activity of 9g in integrin-overexpressing U87 cells. In the second series, RGD-PD0325901 13 exhibited significantly increased antitumor properties compared to the alkoxylamine analogs by both inhibition of the ERK pathway activity and DNA replication of the cancer cells. Furthermore, 13 displayed more potent anti-proliferation activity in the U87 assay than PD0325901 in a dose-dependent manner. All these data demonstrate that RGD-MEKI conjugates with an ester bond linkage enhanced anticancer efficacy with improved targeting capability toward integrin-overexpressing tumor cells.

Also flagged:hypermethylationchromatincancermethylationendometrial carcinomaobesity
Journal Article 2013-11-12 ✓ 5 Snippets Jones A, Teschendorff AE, Li Q, Hayward JD, Kannan A, Mould T, West J, Zikan M, Cibula D, Fiegl H, Lee SH, Wik E, Hadwin R, Arora R, Lemech C, Turunen H, Pakarinen P, Jacobs IJ, Salvesen HB, Bagchi MK, Bagchi IC, Widschwendter M.
In-Text Gene Mentions

Interestingly, the hub of the second top-ranked EpiMod was DCC, a putative tumour suppressor [29].

…top-ranked EpiMod wasDCC, a putative…

…although DNAme ofDCCstrongly correlated with…

…S7 ), theDCCEpiMod did not…

…of HAND2 versusDCCDNA methylation and…

Show Full Abstract

<h4>Background</h4>Endometrial cancer incidence is continuing to rise in the wake of the current ageing and obesity epidemics. Much of the risk for endometrial cancer development is influenced by the environment and lifestyle. Accumulating evidence suggests that the epigenome serves as the interface between the genome and the environment and that hypermethylation of stem cell polycomb group target genes is an epigenetic hallmark of cancer. The objective of this study was to determine the functional role of epigenetic factors in endometrial cancer development.<h4>Methods and findings</h4>Epigenome-wide methylation analysis of >27,000 CpG sites in endometrial cancer tissue samples (n = 64) and control samples (n = 23) revealed that HAND2 (a gene encoding a transcription factor expressed in the endometrial stroma) is one of the most commonly hypermethylated and silenced genes in endometrial cancer. A novel integrative epigenome-transcriptome-interactome analysis further revealed that HAND2 is the hub of the most highly ranked differential methylation hotspot in endometrial cancer. These findings were validated using candidate gene methylation analysis in multiple clinical sample sets of tissue samples from a total of 272 additional women. Increased HAND2 methylation was a feature of premalignant endometrial lesions and was seen to parallel a decrease in RNA and protein levels. Furthermore, women with high endometrial HAND2 methylation in their premalignant lesions were less likely to respond to progesterone treatment. HAND2 methylation analysis of endometrial secretions collected using high vaginal swabs taken from women with postmenopausal bleeding specifically identified those patients with early stage endometrial cancer with both high sensitivity and high specificity (receiver operating characteristics area under the curve = 0.91 for stage 1A and 0.97 for higher than stage 1A). Finally, mice harbouring a Hand2 knock-out specifically in their endometrium were shown to develop precancerous endometrial lesions with increasing age, and these lesions also demonstrated a lack of PTEN expression.<h4>Conclusions</h4>HAND2 methylation is a common and crucial molecular alteration in endometrial cancer that could potentially be employed as a biomarker for early detection of endometrial cancer and as a predictor of treatment response. The true clinical utility of HAND2 DNA methylation, however, requires further validation in prospective studies. Please see later in the article for the Editors' Summary.

Also flagged:AMP-kinasedementiagene expressionADmetabolismautophagy
Journal Article 2013-11-12 ✓ 1 Snippet Caberlotto L, Lauria M, Nguyen TP, Scotti M.
In-Text Gene Mentions

…PLAU, APOE, APP,HFE, MPO, A2M).…

Show Full Abstract

Alzheimer's disease is the most common cause of dementia worldwide, affecting the elderly population. It is characterized by the hallmark pathology of amyloid-β deposition, neurofibrillary tangle formation, and extensive neuronal degeneration in the brain. Wealth of data related to Alzheimer's disease has been generated to date, nevertheless, the molecular mechanism underlying the etiology and pathophysiology of the disease is still unknown. Here we described a method for the combined analysis of multiple types of genome-wide data aimed at revealing convergent evidence interest that would not be captured by a standard molecular approach. Lists of Alzheimer-related genes (seed genes) were obtained from different sets of data on gene expression, SNPs, and molecular targets of drugs. Network analysis was applied for identifying the regions of the human protein-protein interaction network showing a significant enrichment in seed genes, and ultimately, in genes associated to Alzheimer's disease, due to the cumulative effect of different combinations of the starting data sets. The functional properties of these enriched modules were characterized, effectively considering the role of both Alzheimer-related seed genes and genes that closely interact with them. This approach allowed us to present evidence in favor of one of the competing theories about AD underlying processes, specifically evidence supporting a predominant role of metabolism-associated biological process terms, including autophagy, insulin and fatty acid metabolic processes in Alzheimer, with a focus on AMP-activated protein kinase. This central regulator of cellular energy homeostasis regulates a series of brain functions altered in Alzheimer's disease and could link genetic perturbation with neuronal transmission and energy regulation, representing a potential candidate to be targeted by therapy.

Also flagged:iron deficiency anemiamenstruationiron deficiencyironanemiamalignancy
Journal Article 2013-11-12 No Snippets Mast AE.
Show Full Abstract

Low hemoglobin deferral occurs in about 10% of attempted whole blood donations and commonly is a consequence of iron deficiency anemia. Pre-menopausal women often have iron deficiency anemia caused by menstruation and pregnancy and have low hemoglobin deferral on their first donation attempt. Frequent donors also develop iron deficiency and iron deficiency anemia because blood donation removes a large amount of iron from the donor and the 56-day minimum inter-donation interval for donors in the United States is not sufficient for recovery of hemoglobin and iron stores. Other causes for low hemoglobin deferral range from a medically insignificant deferral of a woman with hemoglobin between 12.0 and 12.4 g/dL, which is within the normal reference range but below the 12.5 g/dL needed to donate blood, to anemia caused by an unrecognized malignancy in a "healthy" individual attempting to donate blood. The diverse causes of anemia in blood donors make it difficult to provide accurate information to donors about the cause of their low hemoglobin deferral and complicate implementation of programs to prevent them by blood collecting agencies. This article reviews how hemoglobin is measured and the demographics and causes of low hemoglobin deferral in blood donors. It provides recommendations for how blood collection agencies can provide donors with accurate information about the cause of their deferral and discusses programs that can be implemented to decrease these deferrals in regular donors.

Also flagged:calcium orthophosphatecalciumhydroxyapatitebone formationcalcium orthophosphatesoxides
Journal Article 2013-11-12 No Snippets Dorozhkin SV.
Show Full Abstract

In early 1980s, researchers discovered self-setting calcium orthophosphate cements, which are bioactive and biodegradable grafting bioceramics in the form of a powder and a liquid. After mixing, both phases form pastes, which set and harden forming either a non-stoichiometric calcium deficient hydroxyapatite or brushite. Since both of them are remarkably biocompartible, bioresorbable and osteoconductive, self-setting calcium orthophosphate formulations appear to be promising bioceramics for bone grafting. Furthermore, such formulations possess excellent molding capabilities, easy manipulation and nearly perfect adaptation to the complex shapes of bone defects, followed by gradual bioresorption and new bone formation. In addition, reinforced formulations have been introduced, which might be described as calcium orthophosphate concretes. The discovery of self-setting properties opened up a new era in the medical application of calcium orthophosphates and many commercial trademarks have been introduced as a result. Currently such formulations are widely used as synthetic bone grafts, with several advantages, such as pourability and injectability. Moreover, their low-temperature setting reactions and intrinsic porosity allow loading by drugs, biomolecules and even cells for tissue engineering purposes. In this review, an insight into the self-setting calcium orthophosphate formulations, as excellent bioceramics suitable for both dental and bone grafting applications, has been provided.

Also flagged:magnetosomeorganizationorganellesmagnetosomesactin-like proteinmagnetosome membrane associated proteins
Journal Article 2013-11-11 No Snippets Carillo MA, Bennet M, Faivre D.
Show Full Abstract

Bacteria have recently revealed an unexpectedly complex level of intracellular organization. Magnetotactic bacteria represent a unique class of such organization through the presence of their magnetosome organelles, which are organized along the magnetosome filament. Although the role of individual magnetosomes-associated proteins has started to be unraveled, their interaction has not been addressed with current state-of-the-art optical microscopy techniques, effectively leaving models of the magnetotactic bacteria protein assembly arguable. Here we report on the use of FLIM-FRET to assess the interaction of MamK (actin-like protein) and MamJ, two magnetosome membrane associated proteins essential to the assembly of magnetosomes in a chain. We used a host organism (E. coli) to express eGFP_MamJ and MamK_mCherry, the latest expectedly forming a filament. We found that in the presence of MamK the fluorescence of eGFP_MamJ is distributed along the MamK filament. FRET analysis using the fluorescence lifetime of the donor, eGFP, revealed a spatial proximity of MamK_mCherry and eGFP_MamJ typical of a stable physical interaction between two proteins. Our study effectively led to the reconstruction of part of the magnetotactic apparatus in vivo.

Also flagged:Ezh2Tet2myelodysplastic disordersmyeloid malignanciesASXL1myelodysplastic syndromes
Journal Article 2013-11-11 ✓ 1 Snippet Muto T, Sashida G, Oshima M, Wendt GR, Mochizuki-Kashio M, Nagata Y, Sanada M, Miyagi S, Saraya A, Kamio A, Nagae G, Nakaseko C, Yokote K, Shimoda K, Koseki H, Suzuki Y, Sugano S, Aburatani H, Ogawa S, Iwama A.
In-Text Gene Mentions

…polycomb group PRCpolycomb repressiverepressive complex RefSeq…

Show Full Abstract

Polycomb group (PcG) proteins are essential regulators of hematopoietic stem cells. Recent extensive mutation analyses of the myeloid malignancies have revealed that inactivating somatic mutations in PcG genes such as EZH2 and ASXL1 occur frequently in patients with myelodysplastic disorders including myelodysplastic syndromes (MDSs) and MDS/myeloproliferative neoplasm (MPN) overlap disorders (MDS/MPN). In our patient cohort, EZH2 mutations were also found and often coincided with tet methylcytosine dioxygenase 2 (TET2) mutations. Consistent with these findings, deletion of Ezh2 alone was enough to induce MDS/MPN-like diseases in mice. Furthermore, concurrent depletion of Ezh2 and Tet2 established more advanced myelodysplasia and markedly accelerated the development of myelodysplastic disorders including both MDS and MDS/MPN. Comprehensive genome-wide analyses in hematopoietic progenitor cells revealed that upon deletion of Ezh2, key developmental regulator genes were kept transcriptionally repressed, suggesting compensation by Ezh1, whereas a cohort of oncogenic direct and indirect polycomb targets became derepressed. Our findings provide the first evidence of the tumor suppressor function of EZH2 in myeloid malignancies and highlight the cooperative effect of concurrent gene mutations in the pathogenesis of myelodysplastic disorders.

Also flagged:waterCTHcarbon
Journal Article 2013-11-11 No Snippets Fan J, Leung LR, Rosenfeld D, Chen Q, Li Z, Zhang J, Yan H.
Show Full Abstract

Deep convective clouds (DCCs) play a crucial role in the general circulation, energy, and hydrological cycle of our climate system. Aerosol particles can influence DCCs by altering cloud properties, precipitation regimes, and radiation balance. Previous studies reported both invigoration and suppression of DCCs by aerosols, but few were concerned with the whole life cycle of DCC. By conducting multiple monthlong cloud-resolving simulations with spectral-bin cloud microphysics that capture the observed macrophysical and microphysical properties of summer convective clouds and precipitation in the tropics and midlatitudes, this study provides a comprehensive view of how aerosols affect cloud cover, cloud top height, and radiative forcing. We found that although the widely accepted theory of DCC invigoration due to aerosol's thermodynamic effect (additional latent heat release from freezing of greater amount of cloud water) may work during the growing stage, it is microphysical effect influenced by aerosols that drives the dramatic increase in cloud cover, cloud top height, and cloud thickness at the mature and dissipation stages by inducing larger amounts of smaller but longer-lasting ice particles in the stratiform/anvils of DCCs, even when thermodynamic invigoration of convection is absent. The thermodynamic invigoration effect contributes up to ~27% of total increase in cloud cover. The overall aerosol indirect effect is an atmospheric radiative warming (3-5 W m(-2)) and a surface cooling (-5 to -8 W m(-2)). The modeling findings are confirmed by the analyses of ample measurements made at three sites of distinctly different environments.

Also flagged:SrfcartilageSox9club cell differentiationsecretoglobinFoxg1
Journal Article 2013-11-11 No Snippets Hines EA, Jones MK, Verheyden JM, Harvey JF, Sun X.
Show Full Abstract

In the trachea and bronchi of the mouse, airway smooth muscle (SM) and cartilage are localized to complementary domains surrounding the airway epithelium. Proper juxtaposition of these tissues ensures a balance of elasticity and rigidity that is critical for effective air passage. It is unknown how this tissue complementation is established during development. Here we dissect the developmental relationship between these tissues by genetically disrupting SM formation (through Srf inactivation) or cartilage formation (through Sox9 inactivation) and assessing the impact on the remaining lineage. We found that, in the trachea and main bronchi, loss of SM or cartilage resulted in an increase in cell number of the remaining lineage, namely the cartilage or SM, respectively. However, only in the main bronchi, but not in the trachea, did the loss of SM or cartilage lead to a circumferential expansion of the remaining cartilage or SM domain, respectively. In addition to SM defects, cartilage-deficient tracheas displayed epithelial phenotypes, including decreased basal cell number, precocious club cell differentiation, and increased secretoglobin expression. These findings together delineate the mechanisms through which a cell-autonomous disruption of one structural tissue can have widespread consequences on upper airway function.

Also flagged:histone modificationschromatintranscription factorTFbindinggene expression
Journal Article 2013-11-11 No Snippets Capra JA, Erwin GD, McKinsey G, Rubenstein JL, Pollard KS.
Show Full Abstract

The genetic changes underlying the dramatic differences in form and function between humans and other primates are largely unknown, although it is clear that gene regulatory changes play an important role. To identify regulatory sequences with potentially human-specific functions, we and others used comparative genomics to find non-coding regions conserved across mammals that have acquired many sequence changes in humans since divergence from chimpanzees. These regions are good candidates for performing human-specific regulatory functions. Here, we analysed the DNA sequence, evolutionary history, histone modifications, chromatin state and transcription factor (TF) binding sites of a combined set of 2649 non-coding human accelerated regions (ncHARs) and predicted that at least 30% of them function as developmental enhancers. We prioritized the predicted ncHAR enhancers using analysis of TF binding site gain and loss, along with the functional annotations and expression patterns of nearby genes. We then tested both the human and chimpanzee sequence for 29 ncHARs in transgenic mice, and found 24 novel developmental enhancers active in both species, 17 of which had very consistent patterns of activity in specific embryonic tissues. Of these ncHAR enhancers, five drove expression patterns suggestive of different activity for the human and chimpanzee sequence at embryonic day 11.5. The changes to human non-coding DNA in these ncHAR enhancers may modify the complex patterns of gene expression necessary for proper development in a human-specific manner and are thus promising candidates for understanding the genetic basis of human-specific biology.

Also flagged:intervertebralmineralsynthesiscartilagecell homeostasisautophagy
Journal Article 2013-11-11 No Snippets Shapiro IM, Layfield R, Lotz M, Settembre C, Whitehouse C.
Show Full Abstract

From an evolutionary perspective, the major function of bone is to provide stable sites for muscle attachment and affording protection of vital organs, especially the heart and lungs (ribs) and spinal cord (vertebrae and intervertebral discs). However, bone has a considerable number of other functions: serving as a store for mineral ions, providing a site for blood cell synthesis and participating in a complex system-wide endocrine system. Not surprisingly, bone and cartilage cell homeostasis is tightly controlled, as is the maintenance of tissue structure and mass. While a great deal of new information is accruing concerning skeletal cell homeostasis, one relatively new observation is that the cells of bone (osteoclasts osteoblasts and osteocytes) and cartilage (chondrocytes) exhibit autophagy. The focus of this review is to examine the significance of this process in terms of the functional demands of the skeleton in health and during growth and to provide evidence that dysregulation of the autophagic response is involved in the pathogenesis of diseases of bone (Paget disease of bone) and cartilage (osteoarthritis and the mucopolysaccharidoses). Delineation of molecular changes in the autophagic process is uncovering new approaches for the treatment of diseases that affect the axial and appendicular skeleton.

Also flagged:SenataxinDNA/RNA superfamily-1 helicaseSETXataxiaSpinocerebellar AtaxiaAutosomal Recessive 1
Journal Article 2013-11-11 ✓ 1 Snippet Bennett CL, Chen Y, Vignali M, Lo RS, Mason AG, Unal A, Huq Saifee NP, Fields S, La Spada AR.
In-Text Gene Mentions

…nucleosome remodeling andhistone deacetylase repressive complexdeacetylase repressive complex…

Show Full Abstract

Senataxin is a large 303 kDa protein linked to neuron survival, as recessive mutations cause Ataxia with Oculomotor Apraxia type 2 (AOA2), and dominant mutations cause amyotrophic lateral sclerosis type 4 (ALS4). Senataxin contains an amino-terminal protein-interaction domain and a carboxy-terminal DNA/RNA helicase domain. In this study, we focused upon the common ALS4 mutation, L389S, by performing yeast two-hybrid screens of a human brain expression library with control senataxin or L389S senataxin as bait. Interacting clones identified from the two screens were collated, and redundant hits and false positives subtracted to yield a set of 13 protein interactors. Among these hits, we discovered a highly specific and reproducible interaction of L389S senataxin with a peptide encoded by the antisense sequence of a brain-specific non-coding RNA, known as BCYRN1. We further found that L389S senataxin interacts with other proteins containing regions of conserved homology with the BCYRN1 reverse complement-encoded peptide, suggesting that such aberrant protein interactions may contribute to L389S ALS4 disease pathogenesis. As the yeast two-hybrid screen also demonstrated senataxin self-association, we confirmed senataxin dimerization via its amino-terminal binding domain and determined that the L389S mutation does not abrogate senataxin self-association. Finally, based upon detection of interactions between senataxin and ubiquitin-SUMO pathway modification enzymes, we examined senataxin for the presence of ubiquitin and SUMO monomers, and observed this post-translational modification. Our senataxin protein interaction study reveals a number of features of senataxin biology that shed light on senataxin normal function and likely on senataxin molecular pathology in ALS4.

Also flagged:serotonin receptor 3Banxietydepressionserotonin5-HTR3Breceptors
Journal Article 2013-11-11 ✓ 4 Snippets Horjales-Araujo E, Demontis D, Lund EK, Finnerup NB, Børglum AD, Jensen TS, Svensson P, Vase L.
In-Text Gene Mentions

…The serotonin transporter (5-HTT) plays a critical…

…The5-HTTis coded by…

…low levels of5-HTThas been associated…

…associated with high5-HTTexpression experienced increas…

Show Full Abstract

Pain catastrophizing, a coping style characterized by excessively negative thoughts and emotions in relation to pain, is one of the psychological factors that most markedly predicts variability in the perception of pain; however, only little is known about the underlying neurobiology. The aim of this study was to test for associations between psychological variables, such as pain catastrophizing, anxiety and depression, and selected polymorphisms in genes related to monoaminergic neurotransmission, in particular serotonin pathway genes. Three hundred seventy-nine healthy participants completed a set of psychological questionnaires: the Pain Catastrophizing Scale (PCS), the State-Trait Anxiety Inventory and Beck's Depression Inventory, and were genotyped for 15 single nucleotide polymorphisms (SNPs) in nine genes. The SNP rs1176744 located in the serotonin receptor 3B gene (5-HTR3B) was found to be associated with pain catastrophizing scores: both the global score and the subscales of magnification and helplessness. This is the first study to show an association between 5-HTR3B and PCS scores, thus suggesting a role of the serotonin pathway in pain catastrophizing. Since 5-HTR3B has previously been associated with descending pain modulation pathways, future studies will be of great interest to elucidate the molecular pathways involved in the relation between serotonin, its receptors and pain catastrophizing.

Also flagged:SIAH2estrogen receptorbreast cancerERESR1FGFR2
Journal Article 2013-11-11 ✓ 1 Snippet Zhang B, Li Y, Zheng X, Zuo X, Zhou F, Liang B, Zhu J, Li P, Ding Y, Huang Z, Wang B, Chen Z.
In-Text Gene Mentions

…POU2AF1, PML, NCOR1,DCC, and BAG1.…

Show Full Abstract

<h4>Background</h4>Genome-wide association studies (GWAS) have identified many loci associated with breast cancer risk. These studies have primarily been conducted in populations of European descent.<h4>Objective</h4>To determine whether previously reported susceptibility loci in other ethnic groups are also risk factors for breast cancer in a Chinese population.<h4>Method</h4>We genotyped 21 previously reported single nucleotide polymorphisms (SNPs) within a female Chinese cohort of 1203 breast cancer cases and 2525 healthy controls using the Sequenom iPlex platform. Fourteen SNPs passed the quality control test. These SNPs were subjected to statistical analysis for the entire cohort and were further analyzed for estrogen receptor (ER) status. The associations of the SNPs with disease susceptibility were assessed using logistic regression, adjusting for age. The Bonferroni correction was used to conservatively account for multiple testing, and the threshold for statistical significance was P<3.57×10(-3) (0.05/14).<h4>Result</h4>Although none of the SNPs showed an overall association with breast cancer, an analysis of the ER status of the breast cancer patients revealed that the SIAH2 locus (rs6788895; P = 5.73×10(-4), odds ratio [OR] = 0.81) is associated with ER-positive breast cancer.<h4>Conclusion</h4>A common variant in the SIAH2 locus is associated with ER-positive breast cancer in the Chinese Han population. The replication of published GWAS results in other ethnic groups provides important information regarding the genetic etiology of breast cancer.

Also flagged:obesitygestationFTORBJMC4RCADM2
Journal Article 2013-11-11 No Snippets Warrington NM, Howe LD, Wu YY, Timpson NJ, Tilling K, Pennell CE, Newnham J, Davey-Smith G, Palmer LJ, Beilin LJ, Lye SJ, Lawlor DA, Briollais L.
Show Full Abstract

<h4>Background</h4>While the number of established genetic variants associated with adult body mass index (BMI) is growing, the relationships between these variants and growth during childhood are yet to be fully characterised. We examined the association between validated adult BMI associated single nucleotide polymorphisms (SNPs) and growth trajectories across childhood. We investigated the timing of onset of the genetic effect and whether it was sex specific.<h4>Methods</h4>Children from the ALSPAC and Raine birth cohorts were used for analysis (n = 9,328). Genotype data from 32 adult BMI associated SNPs were investigated individually and as an allelic score. Linear mixed effects models with smoothing splines were used for longitudinal modelling of the growth parameters and measures of adiposity peak and rebound were derived.<h4>Results</h4>The allelic score was associated with BMI growth throughout childhood, explaining 0.58% of the total variance in BMI in females and 0.44% in males. The allelic score was associated with higher BMI at the adiposity peak (females  =  0.0163 kg/m(2) per allele, males  =  0.0123 kg/m(2) per allele) and earlier age (-0.0362 years per allele in males and females) and higher BMI (0.0332 kg/m(2) per allele in females and 0.0364 kg/m(2) per allele in males) at the adiposity rebound. No gene:sex interactions were detected for BMI growth.<h4>Conclusions</h4>This study suggests that known adult genetic determinants of BMI have observable effects on growth from early childhood, and is consistent with the hypothesis that genetic determinants of adult susceptibility to obesity act from early childhood and develop over the life course.

Also flagged:oxygenmembranevesiclesvesicular bodiesresponse to oxidative stressendothelial cell migration
Journal Article 2013-11-11 No Snippets Salomon C, Kobayashi M, Ashman K, Sobrevia L, Mitchell MD, Rice GE.
Show Full Abstract

Migration of extravillous trophoblasts (EVT) into decidua and myometrium is a critical process in the conversion of maternal spiral arterioles and establishing placenta perfusion. EVT migration is affected by cell-to-cell communication and oxygen tension. While the release of exosomes from placental cells has been identified as a significant pathway in materno-fetal communication, the role of placental-derived exosomes in placentation has yet to be established. The aim of this study was to establish the effect of oxygen tension on the release and bioactivity of cytotrophoblast (CT)-derived exosomes on EVT invasion and proliferation. CT were isolated from first trimester fetal tissue (n = 12) using a trypsin-deoxyribonuclease-dispase/Percoll method. CT were cultured under 8%, 3% or 1% O2 for 48 h. Exosomes from CT-conditioned media were isolated by differential and buoyant density centrifugation. The effect of oxygen tension on exosome release (µg exosomal protein/10(6)cells/48 h) and bioactivity were established. HTR-8/SVneo (EVT) were used as target cells to establish the effect (bioactivity) of exosomes on invasion and proliferation as assessed by real-time, live-cell imaging (Incucyte™). The release and bioactivity of CT-derived exosomes were inversely correlated with oxygen tension (p<0.001). Under low oxygen tensions (i.e. 1% O2), CT-derived exosomes promoted EVT invasion and proliferation. Proteomic analysis of exosomes identified oxygen-dependent changes in protein content. We propose that in response to changes in oxygen tension, CTs modify the bioactivity of exosomes, thereby, regulating EVT phenotype. Exosomal induction of EVT migration may represent a normal process of placentation and/or an adaptive response to placental hypoxia.

Also flagged:cagcagACD10RUNX3MUC1MUC17
Journal Article 2013-11-11 ✓ 3 Snippets Chung WC, Jung SH, Joo KR, Kim MJ, Youn GJ, Kim Y, Lee JS, Lee H, Jung JH, Lee YK.
In-Text Gene Mentions

The results of immunostaining for CA10, MUC2, MUC5AC, MUC6, and RUNX3 were considered to be positive if more than 10% of the tumor cells were stained.

…The results of immunostaining forCA10, MUC2, MUC5AC, MUC6, and RUNX3 were considered to be positive if more than 10% of the tumor cells were stained.…

…of immunostaining forCA10, MUC2, MUC5AC, MUC6,…

Show Full Abstract

<h4>Background/aims</h4>This study was performed to determine the association between RUNX3 expression and Helicobacter pylori infection in premalignant gastric lesions.<h4>Methods</h4>We examined 107 patients with gastric epithelial dysplasia who had undergone endoscopic mucosal resection or submucosal dissection. All tissue samples were evaluated by RUNX3 staining and subclassified by immunophenotype. H. pylori infection in dysplastic lesions and the normal surrounding tissue was examined by silver staining, and cagA status was assessed by polymerase chain reaction.<h4>Results</h4>The loss of RUNX3 expression was observed in 62 cases (57.9%), and an association with H. pylori infection was found in 54 cases (50.5%). The infection rate with the cagA-positive H. pylori strain was 63.0%. In RUNX3-negative lesions, the rate of H. pylori infection (p=0.03) and the frequency of category 4 lesions (according to the revised Vienna classification) were high (p=0.02). In addition, the gastric mucin phenotype was predominant. In RUNX3-negative category 4 lesions, the rate of cagA-positive H. pylori infection rate was high but not significantly increased (p=0.08).<h4>Conclusions</h4>Infection with H. pylori is associated with inactivation of RUNX3 in early gastric carcinogenesis. This mechanism was prominent in gastric cancer with a gastric mucin phenotype.

Also flagged:AGgene expressionrespiratory infectionadaptive immunitypolysaccharideCon
Journal Article 2013-11-11 No Snippets Yan J, Ma Y, Zhao F, Gu W, Jiao Y.
Show Full Abstract

Background. American ginseng (Panax quinquefolius, AG) has been used for more than 300 years. Some of its claimed benefits can be attributed to the immunomodulatory activities, whose molecular mechanisms are largely unknown. Methods. Murine splenic cells from adult male C57BL/6 (B6) mice were isolated and divided into 4 groups to mimic 4 basic pathophysiological states: (1) normal naïve; (2) normal activated; (3) deficient naïve; (4) deficient activated. Then, different AG extracts were added to all groups for 24 h incubation. MTT proliferation assays were performed to evaluate the phenotypic features of cells. Finally, microarray assays were carried out to identify differentially expressed genes associated with AG exposure. Real-time PCR was performed to validate the expression of selected genes. Results. Microarray data showed that most of gene expression changes were identified in the deficient naïve group, suggesting that the pathophysiological state has major impacts on transcriptomic changes associated with AG exposure. Specifically, this study revealed downregulation of interferon- γ signaling pathway in the deficient group of cells. Conclusion. Our study demonstrated that only specific groups of immune cells responded to AG intervention and immunocompromised cells were more likely regulated by AG treatment.

Also flagged:sepsisinfectionsdeathpathogenesisglycocalyxheparan
Journal Article 2013-11-11 ✓ 5 Snippets Lygizos MI, Yang Y, Altmann CJ, Okamura K, Hernando AA, Perez MJ, Smith LP, Koyanagi DE, Gandjeva A, Bhargava R, Tuder RM, Faubel S, Schmidt EP.
In-Text Gene Mentions

…(Cat # F3272-1G),heparinase-III(H8891), and HS…

…HS degradation byheparinase-III(heparitinase), a bacterial…

…or enzymatically activeheparinase-III(10 mU/mL in…

…This dose ofheparinase-IIIapproximates what has…

…of degradation, the HS/heparinase-IIImixture was heat-inactivated…

Show Full Abstract

Heparanase, a heparan sulfate-specific glucuronidase, mediates the onset of pulmonary neutrophil adhesion and inflammatory lung injury during early sepsis. We hypothesized that glomerular heparanase is similarly activated during sepsis and contributes to septic acute kidney injury (AKI). We induced polymicrobial sepsis in mice using cecal ligation and puncture (CLP) in the presence or absence of competitive heparanase inhibitors (heparin or nonanticoagulant N-desulfated re-N-acetylated heparin [NAH]). Four hours after surgery, we collected serum and urine for measurement of renal function and systemic inflammation, invasively determined systemic hemodynamics, harvested kidneys for histology/protein/mRNA, and/or measured glomerular filtration by inulin clearance. CLP-treated mice demonstrated early activation of glomerular heparanase with coincident loss of glomerular filtration, as indicated by a >twofold increase in blood urea nitrogen (BUN) and a >50% decrease in inulin clearance (P < 0.05) in comparison to sham mice. Administration of heparanase inhibitors 2 h prior to CLP attenuated sepsis-induced loss of glomerular filtration rate, demonstrating that heparanase activation contributes to early septic renal dysfunction. Glomerular heparanase activation was not associated with renal neutrophil influx or altered vascular permeability, in marked contrast to previously described effects of pulmonary heparanase on neutrophilic lung injury during sepsis. CLP induction of renal inflammatory gene (IL-6, TNF-α, IL-1β) expression was attenuated by NAH pretreatment. While serum inflammatory indices (KC, IL-6, TNF-α, IL-1β) were not impacted by NAH pretreatment, heparanase inhibition attenuated the CLP-induced increase in serum IL-10. These findings demonstrate that glomerular heparanase is active during sepsis and contributes to septic renal dysfunction via mechanisms disparate from heparanase-mediated lung injury.

Also flagged:synapsesynaptic transmissionRNA-binding proteinsFMRPCPEBNanos
Journal Article 2013-11-10 No Snippets Thomas MG, Pascual ML, Maschi D, Luchelli L, Boccaccio GL.
Show Full Abstract

The production of proteins from mRNAs localized at the synapse ultimately controls the strength of synaptic transmission, thereby affecting behavior and cognitive functions. The regulated transcription, processing, and transport of mRNAs provide dynamic control of the dendritic transcriptome, which includes thousands of messengers encoding multiple cellular functions. Translation is locally modulated by synaptic activity through a complex network of RNA-binding proteins (RBPs) and various types of non-coding RNAs (ncRNAs) including BC-RNAs, microRNAs, piwi-interacting RNAs, and small interference RNAs. The RBPs FMRP and CPEB play a well-established role in synaptic translation, and additional regulatory factors are emerging. The mRNA repressors Smaug, Nanos, and Pumilio define a novel pathway for local translational control that affects dendritic branching and spines in both flies and mammals. Recent findings support a role for processing bodies and related synaptic mRNA-silencing foci (SyAS-foci) in the modulation of synaptic plasticity and memory formation. The SyAS-foci respond to different stimuli with changes in their integrity thus enabling regulated mRNA release followed by translation. CPEB, Pumilio, TDP-43, and FUS/TLS form multimers through low-complexity regions related to prion domains or polyQ expansions. The oligomerization of these repressor RBPs is mechanistically linked to the aggregation of abnormal proteins commonly associated with neurodegeneration. Here, we summarize the current knowledge on how specificity in mRNA translation is achieved through the concerted action of multiple pathways that involve regulatory ncRNAs and RBPs, the modification of translation factors, and mRNA-silencing foci dynamics.

Also flagged:ChromatinRNA polymerasesgene expressionRNA polymerase IIRNAPII
Journal Article 2013-11-10 No Snippets Zhang Y, Wong CH, Birnbaum RY, Li G, Favaro R, Ngan CY, Lim J, Tai E, Poh HM, Wong E, Mulawadi FH, Sung WK, Nicolis S, Ahituv N, Ruan Y, Wei CL.
Show Full Abstract

In multicellular organisms, transcription regulation is one of the central mechanisms modelling lineage differentiation and cell-fate determination. Transcription requires dynamic chromatin configurations between promoters and their corresponding distal regulatory elements. It is believed that their communication occurs within large discrete foci of aggregated RNA polymerases termed transcription factories in three-dimensional nuclear space. However, the dynamic nature of chromatin connectivity has not been characterized at the genome-wide level. Here, through a chromatin interaction analysis with paired-end tagging approach using an antibody that primarily recognizes the pre-initiation complexes of RNA polymerase II, we explore the transcriptional interactomes of three mouse cells of progressive lineage commitment, including pluripotent embryonic stem cells, neural stem cells and neurosphere stem/progenitor cells. Our global chromatin connectivity maps reveal approximately 40,000 long-range interactions, suggest precise enhancer-promoter associations and delineate cell-type-specific chromatin structures. Analysis of the complex regulatory repertoire shows that there are extensive colocalizations among promoters and distal-acting enhancers. Most of the enhancers associate with promoters located beyond their nearest active genes, indicating that the linear juxtaposition is not the only guiding principle driving enhancer target selection. Although promoter-enhancer interactions exhibit high cell-type specificity, promoters involved in interactions are found to be generally common and mostly active among different cells. Chromatin connectivity networks reveal that the pivotal genes of reprogramming functions are transcribed within physical proximity to each other in embryonic stem cells, linking chromatin architecture to coordinated gene expression. Our study sets the stage for the full-scale dissection of spatial and temporal genome structures and their roles in orchestrating development.

Also flagged:gastric cancercancersmalignant tumors ofpathogenesistumorRAF kinase inhibitor protein
Journal Article 2013-11-09 ✓ 2 Snippets Gu H, Zhan X, Zhang G, Yan L, Cho WC, Li M, Liu T, Chen Z.
In-Text Gene Mentions

Mapping the interactome of overexpressed RAF kinase inhibitor protein in a gastric cancer cell line.

Down-regulation or absence of RAF kinase inhibitor protein (RKIP) was associated with the occurrence, differentiation, invasion, and metastasis of GC.

Show Full Abstract

<h4>Background</h4>Gastric cancer (GC) is a threat to human health with increasing incidence and mortality worldwide. Down-regulation or absence of RAF kinase inhibitor protein (RKIP) was associated with the occurrence, differentiation, invasion, and metastasis of GC. This study aims to investigate the molecular mechanisms and biological functions of RKIP in the GC biology.<h4>Methods</h4>The fusion expression plasmid pcDNA3.1-RKIP-3xFLAG was transfected into SGC7901 cells, the RKIP fusion proteins were purified with anti-flag M2 magnetic beads, and the RKIP-interacting proteins were identified with tandem mass spectrometry (MS/MS), and were analyzed with bioinformatics tools. Western blot and co-immunoprecipitation were used to confirm the interaction complex.<h4>Results</h4>A total of 72 RKIP-interacting proteins were identified by MS/MS. Those proteins play roles in enzyme metabolism, molecular chaperoning, biological oxidation, cytoskeleton organization, signal transduction, and enzymolysis. Three RKIP-interaction protein network diagrams were constructed with Michigan Molecular Interactions, functional linage network, and Predictome analysis to address the molecular pathways of the functional activity of RKIP. The MS/MS-characterized components of the existing interaction complex (RKIP, HSP90, 14-3-3ε, and keratin 8) were confirmed by Western blot analysis and co-immunoprecipitation.<h4>Conclusion</h4>This study is the first discovery of the interaction of RKIP with HSP90, 14-3-3, and keratin. The present data would provide insight into the molecular mechanisms of how RKIP inhibits the occurrence and development of GC.

Also flagged:alcoholaddictionAlcoholismpsychiatric disorderresponse toflushing syndrome
Journal Article 2013-11-09 ✓ 1 Snippet Enoch MA.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Although very many individuals drink alcohol at safe levels, a significant proportion escalates their consumption with addiction as the end result. Alcoholism is a common, moderately heritable, psychiatric disorder that is accompanied by considerable morbidity and mortality. Variation in clinical presentation suggests inter-individual variation in mechanisms of vulnerability including genetic risk factors. The development of addiction is likely to involve numerous functional genetic variants of small effects. The first part of this review will focus on genetic factors underlying inter-individual variability in response to alcohol consumption, including variants in alcohol metabolizing genes that produce an aversive response (the flushing syndrome) and variants that predict the level of subjective and physiological response to alcohol. The second part of this review will report on genetic variants that identify subgroups of alcoholics who are more likely to respond to pharmacotherapy to reduce levels of drinking or maintain abstinence. Genetic analyses of the level of response to alcohol, particularly of the functional OPRM1 A118G polymorphism and 5' and 3' functional polymorphisms in SLC6A4, are beginning to provide insights into the etiology of alcoholism and also genotype-stratified subgroup responses to naltrexone and SSRIs/ondansetron respectively. Because of large inter-ethnic variation in allele frequencies, the relevance of these functional polymorphisms will vary between ethnic groups. However there are relatively few published studies in this field, particularly with large sample sizes in pharmacogenetic studies, therefore it is premature to draw any conclusions at this stage.

Also flagged:cancerresponse to damageLgr5olfactomedin 4achaete-scute complex homolog 2Ascl2
Journal Article 2013-11-09 ✓ 1 Snippet von Furstenberg RJ, Buczacki SJ, Smith BJ, Seiler KM, Winton DJ, Henning SJ.
In-Text Gene Mentions

Olfm4

Show Full Abstract

We report here that side population (SP) sorting allows for the simultaneous isolation of two intestinal stem cell (ISC) subsets from wild-type (WT) mice which are phenotypically different and represent cycling and non-cycling pools of cells. Following 5-ethynyl-2'-deoxyuridine (EdU) injection, in the upper side population (USP) the percentage of EdU+ was 36% showing this fraction to be highly proliferative. In the lower side population (LSP), only 0.4% of cells were EdU+, indicating this fraction to be predominantly non-cycling. Using Lgr5-EGFP mice, we show that Lgr5-EGFP(hi) cells, representing actively cycling ISCs, are essentially exclusive to the USP. In contrast, using histone 2B-YFP mice, SP analysis revealed YFP label retaining cells (LRCs) in both the USP and the LSP. Correspondingly, evaluation of the SP fractions for mRNA markers by qRT-PCR showed that the USP was enriched in transcripts associated with both quiescent and active ISCs. In contrast, the LSP expressed mRNA markers of quiescent ISCs while being de-enriched for those of the active ISC. Both the USP and LSP are capable of generating enteroids in culture which include the four intestinal lineages. We conclude that sorting of USP and LSP fractions represents a novel isolation of cycling and non-cycling ISCs from WT mice.

Also flagged:axonalRhoARac1Cdc42Netrin-1lead zirconate titanate
Journal Article 2013-11-08 ✓ 4 Snippets Wen J, Liu M.
In-Text Gene Mentions

Colorectal Cancer (DCC

…in Colorectal Cancer (DCC).…

…of Netrin-1 andDCC.…

…of Netrin-1 andDCCto mediate axonal…

Show Full Abstract

Electrical stimulation is critical for axonal connection, which can stimulate axonal migration and deformation to promote axonal growth in the nervous system. Netrin-1, an axonal guidance cue, can also promote axonal guidance growth, but the molecular mechanism of axonal guidance growth under indirect electric stimulation is still unknown. We investigated the molecular mechanism of axonal guidance growth under piezoelectric ceramic lead zirconate titanate (PZT) stimulation in the primary cultured cortical neurons. PZT induced marked axonal elongation. Moreover, PZT activated the excitatory postsynaptic currents (EPSCs) by increasing the frequency and amplitude of EPSCs of the cortical neurons in patch clamp assay. PZT downregulated the expression of Netrin-1 and its receptor Deleted in Colorectal Cancer (DCC). Rho GTPase signaling is involved in interactions of Netrin-1 and DCC. PZT activated RhoA. Dramatic decrease of Cdc42 and Rac1 was also observed after PZT treatment. RhoA inhibitor Clostridium botulinum C3 exoenzyme (C3-Exo) prevented the PZT-induced downregulation of Netrin-1 and DCC. We suggest that PZT can promote axonal guidance growth by downregulation of Netrin-1 and DCC to mediate axonal repulsive responses via the Rho GTPase signaling pathway. Obviously, piezoelectric materials may provide a new approach for axonal recovery and be beneficial for clinical therapy in the future.

Also flagged:dryEthanolcarbonglycerolCENfermentations
Journal Article 2013-11-08 No Snippets Swinnen S, Klein M, Carrillo M, McInnes J, Nguyen HTT, Nevoigt E.
Show Full Abstract

<h4>Background</h4>Glycerol has attracted attention as a carbon source for microbial production processes due to the large amounts of crude glycerol waste resulting from biodiesel production. The current knowledge about the genetics and physiology of glycerol uptake and catabolism in the versatile industrial biotechnology production host Saccharomyces cerevisiae has been mainly based on auxotrophic laboratory strains, and carried out in the presence of growth-supporting supplements such as amino acids and nucleic bases. The latter may have resulted in ambiguous conclusions concerning glycerol growth in this species. The purpose of this study was to re-evaluate growth of S. cerevisiae in synthetic glycerol medium without the addition of supplements.<h4>Results</h4>Initial experiments showed that prototrophic versions of the laboratory strains CEN.PK, W303, and S288c did not exhibit any growth in synthetic glycerol medium without supporting supplements. However, a screening of 52 S. cerevisiae isolates for growth in the same medium revealed a high intraspecies diversity. Within this group significant variation with respect to the lag phase and maximum specific growth rate was observed. A haploid segregant of one good glycerol grower (CBS 6412-13A) was selected for detailed analysis. Single deletions of the genes encoding for the glycerol/H+ symporter (STL1), the glycerol kinase (GUT1), and the mitochondrial FAD+-dependent glycerol 3-phosphate dehydrogenase (GUT2) abolished glycerol growth in this strain, implying that it uses the same glycerol utilization pathway as previously identified in auxotrophic laboratory strains. Segregant analysis of a cross between CBS 6412-13A and CEN.PK113-1A revealed that the glycerol growth phenotype is a quantitative trait. Genetic linkage and reciprocal hemizygosity analysis demonstrated that GUT1CBS 6412-13A is one of the multiple genetic loci contributing to the glycerol growth phenotype.<h4>Conclusion</h4>The S. cerevisiae intraspecies diversity with regard to glycerol growth is a valuable starting point to identify the genetic and molecular basis of this phenotype. This knowledge can be applied for further rational strain improvement with the goal of using glycerol as a carbon source in industrial biotechnology processes based on S. cerevisiae as a production organism.

Also flagged:globulincyclosporineaplastic anemiaantithymocyte globulinimmunosuppressioninfections
Journal Article 2013-11-08 ✓ 1 Snippet Jeong DC, Chung NG, Cho B, Zou Y, Ruan M, Takahashi Y, Muramatsu H, Ohara A, Kosaka Y, Yang W, Kim HK, Zhu X, Kojima S.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Some prospective studies showed that rabbit antithymocyte globulin was inferior to horse antithymocyte globulin as first-line therapy for patients with severe aplastic anemia. We retrospectively analyzed the clinical outcome of 455 children with severe aplastic anemia who received horse antithymocyte globulin (n=297) or rabbit antithymocyte globulin (n=158) combined with cyclosporine as first-line therapy between 1992 and 2010. The response rates were comparable between the horse and rabbit antithymocyte globulin groups at 3 months [46% (136/294) versus 42% (66/153), P=0.55] and 6 months [60% (178/292) versus 55% (87/143), P=1.0]. Using multivariate analysis, differences in antithymocyte globulin preparations were not associated with response rates. However, 2-year and 10-year overall survival rates in the horse antithymocyte globulin group were significantly better than those in the rabbit antithymocyte globulin group (2-year overall survival: 96% versus 87%, 10-year overall survival: 92% versus 84%, P=0.004). On the basis of multivariate analysis, use of rabbit antithymocyte globulin was a significant adverse factor for overall survival (hazard ratio = 3.56, 95% confidence interval, 1.53 - 8.28, P=0.003). Rabbit antithymocyte globulin caused more profound immunosuppression, which might be responsible for the higher incidence of severe infections. Considering that there are no studies showing the superiority of rabbit antithymocyte globulin over horse antithymocyte globulin, horse antithymocyte globulin should be recommended as a first-line therapy. However, our results justify the use of rabbit antithymocyte globulin as first-line therapy if horse antithymocyte globulin is not available.

Also flagged:menopausecapsulessleepbehavioralpolyunsaturated fatty acidscapsule
Journal Article 2013-11-08 No Snippets Reed SD, Guthrie KA, Newton KM, Anderson GL, Booth-LaForce C, Caan B, Carpenter JS, Cohen LS, Dunn AL, Ensrud KE, Freeman EW, Hunt JR, Joffe H, Larson JC, Learman LA, Rothenberg R, Seguin RA, Sherman KJ, Sternfeld BS, LaCroix AZ.
Show Full Abstract

<h4>Objective</h4>The purpose of this study was to determine the efficacy of 3 nonhormonal therapies for the improvement of menopause-related quality of life in women with vasomotor symptoms.<h4>Study design</h4>We conducted a 12-week 3 × 2 randomized, controlled, factorial design trial. Peri- and postmenopausal women, 40-62 years old, were assigned randomly to yoga (n = 107), exercise (n = 106), or usual activity (n = 142) and also assigned randomly to a double-blind comparison of omega-3 (n = 177) or placebo (n = 178) capsules. We performed the following interventions: (1) weekly 90-minute yoga classes with daily at-home practice, (2) individualized facility-based aerobic exercise training 3 times/week, and (3) 0.615 g omega-3 supplement, 3 times/day. The outcomes were assessed with the following scores: Menopausal Quality of Life Questionnaire (MENQOL) total and domain (vasomotor symptoms, psychosocial, physical and sexual).<h4>Results</h4>Among 355 randomly assigned women who average age was 54.7 years, 338 women (95%) completed 12-week assessments. Mean baseline vasomotor symptoms frequency was 7.6/day, and the mean baseline total MENQOL score was 3.8 (range, 1-8 from better to worse) with no between-group differences. For yoga compared to usual activity, baseline to 12-week improvements were seen for MENQOL total -0.3 (95% confidence interval, -0.6 to 0; P = .02), vasomotor symptom domain (P = .02), and sexuality domain (P = .03) scores. For women who underwent exercise and omega-3 therapy compared with control subjects, improvements in baseline to 12-week total MENQOL scores were not observed. Exercise showed benefit in the MENQOL physical domain score at 12 weeks (P = .02).<h4>Conclusion</h4>All women become menopausal, and many of them seek medical advice on ways to improve quality of life; little evidence-based information exists. We found that, among healthy sedentary menopausal women, yoga appears to improve menopausal quality of life; the clinical significance of our finding is uncertain because of the modest effect.

Also flagged:tumoroncogenestumor suppressor genescancerpolymerasesolid tumors
Journal Article 2013-11-08 No Snippets Kassahn KS, Holmes O, Nones K, Patch AM, Miller DK, Christ AN, Harliwong I, Bruxner TJ, Xu Q, Anderson M, Wood S, Leonard C, Taylor D, Newell F, Song S, Idrisoglu S, Nourse C, Nourbakhsh E, Manning S, Wani S, Steptoe A, Pajic M, Cowley MJ, Pinese M, Chang DK, Gill AJ, Johns AL, Wu J, Wilson PJ, Fink L, Biankin AV, Waddell N, Grimmond SM, Pearson JV.
Show Full Abstract

Somatic mutation calling from next-generation sequencing data remains a challenge due to the difficulties of distinguishing true somatic events from artifacts arising from PCR, sequencing errors or mis-mapping. Tumor cellularity or purity, sub-clonality and copy number changes also confound the identification of true somatic events against a background of germline variants. We have developed a heuristic strategy and software (http://www.qcmg.org/bioinformatics/qsnp/) for somatic mutation calling in samples with low tumor content and we show the superior sensitivity and precision of our approach using a previously sequenced cell line, a series of tumor/normal admixtures, and 3,253 putative somatic SNVs verified on an orthogonal platform.

Also flagged:behavioral disorderpsychiatric diseasebehavioralpsychiatric diseasespsychiatric disordersanxiety
Journal Article 2013-11-08 ✓ 1 Snippet Armario A, Nadal R.
In-Text Gene Mentions

Interestingly, heterozygote mice appear to be more sensitive to the negative impact of early life experience on anxiety (Carola et al., 2008), suggesting enhanced vulnerability to stress similar to that observed in humans carrying the short allele of the 5-HTT gene (Caspi et al., 2003).

Show Full Abstract

Despite the development of valuable new techniques (i.e., genetics, neuroimage) for the study of the neurobiological substrate of psychiatric diseases, there are strong limitations in the information that can be gathered from human studies. It is thus critical to develop appropriate animal models of psychiatric diseases to characterize their putative biological bases and the development of new therapeutic strategies. The present review tries to offer a general perspective and several examples of how individual differences in animals can contribute to explain differential susceptibility to develop behavioral alterations, but also emphasizes methodological problems that can lead to inappropriate or over-simplistic interpretations. A critical analysis of the approaches currently used could contribute to obtain more reliable data and allow taking full advantage of new and sophisticated technologies. The discussion is mainly focused on anxiety-like and to a lower extent on depression-like behavior in rodents.

Also flagged:methionineprolineNS3 proteasemethionine-dipeptideNS3
Journal Article 2013-11-08 No Snippets Zhou GC, Weng Z, Shao X, Liu F, Nie X, Liu J, Wang D, Wang C, Guo K.
Show Full Abstract

A series of methionine-proline dipeptide derivatives and their analogues were designed, synthesized and assayed against the serotype 2 dengue virus NS2B-NS3 protease, and methionine-proline anilides 1 and 2 were found to be the most active DENV 2 NS2B-NS3 competitive inhibitors with Ki values of 4.9 and 10.5 μM. The structure and activity relationship and the molecular docking revealed that L-proline, L-methionine and p-nitroaniline in 1 and 2 are the important characters in blocking the active site of NS2B-NS3 protease. Our current results suggest that the title dipeptidic scaffold represents a promising structural core to discover a new class of active NS2B-NS3 competitive inhibitors.

Also flagged:agingwatertranscription factor
Journal Article 2013-11-08 ✓ 1 Snippet Fraser DJ, Calvert AM, Bernatchez L, Coon A.
In-Text Gene Mentions

…a protein (Sox6, a transcription factor)…

Show Full Abstract

The potential of genetic, genomic, and phenotypic metrics for monitoring population trends may be especially high in isolated regions, where traditional demographic monitoring is logistically difficult and only sporadic sampling is possible. This potential, however, is relatively underexplored empirically. Over eleven years, we assessed several such metrics along with traditional ecological knowledge and catch data in a socioeconomically important trout species occupying a large, remote lake. The data revealed largely stable characteristics in two populations over 2-3 generations, but possible contemporary changes in a third population. These potential shifts were suggested by reduced catch rates, reduced body size, and changes in selection implied at one gene-associated single nucleotide polymorphism. A demographic decline in this population, however, was ambiguously supported, based on the apparent lack of temporal change in effective population size, and corresponding traditional knowledge suggesting little change in catch. We illustrate how the pluralistic approach employed has practicality for setting future monitoring efforts of these populations, by guiding monitoring priorities according to the relative merits of different metrics and availability of resources. Our study also considers some advantages and disadvantages to adopting a pluralistic approach to population monitoring where demographic data are not easily obtained.

Also flagged:transcription factorhistonepathogenesischronic diseasegene-expressioncancer
Journal Article 2013-11-07 ✓ 1 Snippet Mayburd A, Baranova A.
In-Text Gene Mentions

ADORA2A,ATP,ATP6V1H,CACNA1E,CACNA2D3,CACNB2,DYNC1I1,EIF1,EIF5B,FOS,GPR1 (includes EG:100004124),IDS,KDM5B,KIFAP3, KLF15,L-glutamic acid,LANCL1,MAP2K7,MAPK3, MYC,MZT1,PNO1,PPP1R7,RAD51C,REEP1,RPL15,SLC17A7,SLC17A,SRSF2,TGFB1 (includes EG:21803),TIMM23,TMEM97,TUBGCP2,TUBGCP3,XRCC3

Show Full Abstract

<h4>Background</h4>High-throughput profiling of human tissues typically yield as results the gene lists comprised of a mix of relevant molecular entities with multiple false positives that obstruct the translation of such results into mechanistic hypotheses. From general probabilistic considerations, gene lists distilled for the mechanistically relevant components can be far more useful for subsequent experimental design or data interpretation.<h4>Results</h4>The input candidate gene lists were processed into different tiers of evidence consistency established by enrichment analysis across subsets of the same experiments and across different experiments and platforms. The cut-offs were established empirically through ontological and semantic enrichment; resultant shortened gene list was re-expanded by Ingenuity Pathway Assistant tool. The resulting sub-networks provided the basis for generating mechanistic hypotheses that were partially validated by literature search. This approach differs from previous consistency-based studies in that the cut-off on the Receiver Operating Characteristic of the true-false separation process is optimized by flexible selection of the consistency building procedure. The gene list distilled by this analytic technique and its network representation were termed Compact Disease Model (CDM). Here we present the CDM signature for the study of early-stage Alzheimer's disease. The integrated analysis of this gene signature allowed us to identify the protein traffic vesicles as prominent players in the pathogenesis of Alzheimer's. Considering the distances and complexity of protein trafficking in neurons, it is plausible that spontaneous protein misfolding along with a shortage of growth stimulation result in neurodegeneration. Several potentially overlapping scenarios of early-stage Alzheimer pathogenesis have been discussed, with an emphasis on the protective effects of AT-1 mediated antihypertensive response on cytoskeleton remodeling, along with neuronal activation of oncogenes, luteinizing hormone signaling and insulin-related growth regulation, forming a pleiotropic model of its early stages. Alignment with emerging literature confirmed many predictions derived from early-stage Alzheimer's disease' CDM.<h4>Conclusions</h4>A flexible approach for high-throughput data analysis, the Compact Disease Model generation, allows extraction of meaningful, mechanism-centered gene sets compatible with instant translation of the results into testable hypotheses.

Also flagged:deficiencyantithrombin deficiencyATheparinAT deficiency type IIHBSproteases
Journal Article 2013-11-07 ✓ 2 Snippets Luxembourg B, Pavlova A, Geisen C, Spannagl M, Bergmann F, Krause M, Alesci S, Seifried E, Lindhoff-Last E.
In-Text Gene Mentions

Impact of the type of SERPINC1 mutation and subtype of antithrombin deficiency on the thrombotic phenotype in hereditary antithrombin deficiency.

…the type ofSERPINC1mutation and subtype…

Show Full Abstract

Mutations in the antithrombin (AT) gene can impair the capacity of AT to bind heparin (AT deficiency type IIHBS), its target proteases such as thrombin (type IIRS), or both (type IIPE). Type II AT deficiencies are almost exclusively caused by missense mutations, whereas type I AT deficiency can originate from missense or null mutations. In a retrospective cohort study, we investigated the impact of the type of mutation and type of AT deficiency on the manifestation of thromboembolic events in 377 patients with hereditary AT deficiencies (133 from our own cohort, 244 reported in the literature). Carriers of missense mutations showed a lower risk of venous thromboembolism (VTE) than those of null mutations (adjusted hazard ratio [HR] 0.39, 95% confidence interval [CI] 0.27-0.58, p<0.001), and the risk of VTE was significantly decreased among patients with type IIHBS AT deficiency compared to patients with other types of AT deficiency (HR 0.23, 95%CI 0.13-0.41, p<0.001). The risk of pulmonary embolism complicating deep-vein thrombosis was lower in all type II AT deficiencies compared to type I AT deficiency (relative risk 0.69, 95%CI 0.56-0.84). By contrast, the risk of arterial thromboembolism tended to be higher in carriers of missense mutations than in those with null mutations (HR 6.08-fold, 95%CI 0.74-49.81, p=0.093) and was 5.9-fold increased (95%CI 1.22-28.62, p=0.028) in type IIHBS versus other types of AT deficiency. Our data indicate that the type of inherited AT defect modulates not only the risk of thromboembolism but also the localisation and encourage further studies to unravel this phenomenon.

Also flagged:post-translational modificationsdeathcell growthmethyl methanesulphonatehistonesKRAS
Journal Article 2013-11-07 No Snippets Ryan CJ, Cimermančič P, Szpiech ZA, Sali A, Hernandez RD, Krogan NJ.
Show Full Abstract

Proteins are not monolithic entities; rather, they can contain multiple domains that mediate distinct interactions, and their functionality can be regulated through post-translational modifications at multiple distinct sites. Traditionally, network biology has ignored such properties of proteins and has instead examined either the physical interactions of whole proteins or the consequences of removing entire genes. In this Review, we discuss experimental and computational methods to increase the resolution of protein-protein, genetic and drug-gene interaction studies to the domain and residue levels. Such work will be crucial for using interaction networks to connect sequence and structural information, and to understand the biological consequences of disease-associated mutations, which will hopefully lead to more effective therapeutic strategies.

Also flagged:oligonucleotidesHuntingtinreverse transcriptionnucleotideBts Isynthesis
Journal Article 2013-11-07 ✓ 1 Snippet Busan S, Weeks KM.
In-Text Gene Mentions

The length of the CAG-repeat region in the huntingtin mRNA is predictive of Huntington's disease.

Show Full Abstract

The length of the CAG-repeat region in the huntingtin mRNA is predictive of Huntington's disease. Structural studies of CAG-repeat-containing RNAs suggest that these sequences form simple hairpin structures; however, in the context of the full-length huntingtin mRNA, CAG repeats may form complex structures that could be targeted for therapeutic intervention. We examined the structures of transcripts spanning the first exon of the huntingtin mRNA with both healthy and disease-prone repeat lengths. In transcripts with 17-70 repeats, the CAG sequences base paired extensively with nucleotides in the 5' UTR and with conserved downstream sequences including a CCG-repeat region. In huntingtin transcripts with healthy numbers of repeats, the previously observed CAG hairpin was either absent or short. In contrast, in transcripts with disease-associated numbers of repeats, a CAG hairpin was present and extended from a three-helix junction. Our findings demonstrate the profound importance of sequence context in RNA folding and identify specific structural differences between healthy and disease-inducing huntingtin alleles that may be targets for therapeutic intervention.

Also flagged:Ironelectron transferoxygenmitochondrialsynthesissecretion
Journal Article 2013-11-07 ✓ 2 Snippets Meynard D, Babitt JL, Lin HY.
In-Text Gene Mentions

hemochromatosis

Hfe

Show Full Abstract

Iron is a micronutrient essential for almost all organisms: bacteria, plants, and animals. It is a metal that exists in multiple redox states, including the divalent ferrous (Fe(2+)) and the trivalent ferric (Fe(3+)) species. The multiple oxidation states of iron make it excellent for electron transfer, allowing iron to be selected during evolution as a cofactor for many proteins involved in central cellular processes including oxygen transport, mitochondrial respiration, and DNA synthesis. However, the redox cycling of ferrous and ferric iron in the presence of H2O2, which is physiologically present in the cells, also leads to the production of free radicals (Fenton reaction) that can attack and damage lipids, proteins, DNA, and other cellular components. To meet the physiological needs of the body, but to prevent cellular damage by iron, the amount of iron in the body must be tightly regulated. Here we review how the liver is the central conductor of systemic iron balance and show that this central role is related to the secretion of a peptide hormone hepcidin by hepatocytes. We then review how the liver receives and integrates the many signals that report the body's iron needs to orchestrate hepcidin production and maintain systemic iron homeostasis.

Also flagged:lipidneurological disordersacylbiotinylpalmitoylHip14
Journal Article 2013-11-07 ✓ 1 Snippet Wan J, Savas JN, Roth AF, Sanders SS, Singaraja RR, Hayden MR, Yates JR, Davis NG.
In-Text Gene Mentions

HTT

Show Full Abstract

Protein palmitoylation, a reversible lipid modification of proteins, is widely used in the nervous system, with dysregulated palmitoylation being implicated in a variety of neurological disorders. Described below is ABE/SILAM, a proteomic strategy that couples acyl-biotinyl exchange (ABE) purification of palmitoyl-proteins to whole animal stable isotope labeling (SILAM) to provide an accurate tracking of palmitoylation change within rodent disease models. As a first application, we have used ABE/SILAM to look at Huntington's disease (HD), profiling palmitoylation change in two HD-relevant mouse mutants: the transgenic HD model mouse YAC128 and the hypomorphic Hip14-gt mouse, which has sharply reduced expression for HIP14 (Zdhhc17), a palmitoyl-transferase implicated in the HD disease process. Rather than mapping to the degenerating neurons themselves, the biggest disease changes instead map to astrocytes and oligodendrocytes (i.e., the supporting glial cells).

Also flagged:Ironoxygenmetabolismiron-related disordershaemochromatosisgenetic disorder
Journal Article 2013-11-07 ✓ 5 Snippets Mitchell S, Mendes P.
In-Text Gene Mentions

HFE knockout validation—The simulation of type-1 hereditary haemochromatosis closely matches experimental findings at steady state.

…human haemochromatosis gene (HFE) mutation.…

…man haemochromatosis protein (HFE) competes with transferrin-bo…

…mechanism by whichHFE-TfR2 interactions induce hepc…

…proposed role ofHFEand TFR2 as…

Show Full Abstract

Iron is essential for all known life due to its redox properties; however, these same properties can also lead to its toxicity in overload through the production of reactive oxygen species. Robust systemic and cellular control are required to maintain safe levels of iron, and the liver seems to be where this regulation is mainly located. Iron misregulation is implicated in many diseases, and as our understanding of iron metabolism improves, the list of iron-related disorders grows. Recent developments have resulted in greater knowledge of the fate of iron in the body and have led to a detailed map of its metabolism; however, a quantitative understanding at the systems level of how its components interact to produce tight regulation remains elusive. A mechanistic computational model of human liver iron metabolism, which includes the core regulatory components, is presented here. It was constructed based on known mechanisms of regulation and on their kinetic properties, obtained from several publications. The model was then quantitatively validated by comparing its results with previously published physiological data, and it is able to reproduce multiple experimental findings. A time course simulation following an oral dose of iron was compared to a clinical time course study and the simulation was found to recreate the dynamics and time scale of the systems response to iron challenge. A disease state simulation of haemochromatosis was created by altering a single reaction parameter that mimics a human haemochromatosis gene (HFE) mutation. The simulation provides a quantitative understanding of the liver iron overload that arises in this disease. This model supports and supplements understanding of the role of the liver as an iron sensor and provides a framework for further modelling, including simulations to identify valuable drug targets and design of experiments to improve further our knowledge of this system.

Also flagged:translationalcancertumorcancersHepatocellular carcinomahepatitis B
Journal Article 2013-11-07 ✓ 1 Snippet Nassirpour R, Mehta PP, Yin MJ.
In-Text Gene Mentions

…disorders such ashemochromatosisand α1-antitrypsin deficiency…

Show Full Abstract

MicroRNAs (miRNAs) have been implicated in the orchestration of diverse cellular processes including differentiation, proliferation, and apoptosis and are believed to play pivotal roles as oncogenes and tumor suppressors. miR-122, a liver specific miRNA, is significantly down-regulated in most hepatocellular carcinomas (HCCs) but its role in tumorigenesis remains poorly understood. Here we identify AKT3 as a novel and direct target of miR-122. Restoration of miR-122 expression in HCC cell lines decreases AKT3 levels, inhibits cell migration and proliferation, and induces apoptosis. These anti-tumor phenotypes can be rescued by reconstitution of AKT3 expression indicating the essential role of AKT3 in miR-122 mediated HCC transformation. In vivo, restoration of miR-122 completely inhibited xenograft growth of HCC tumor in mice. Our data strongly suggest that miR-122 is a tumor suppressor that targets AKT3 to regulate tumorigenesis in HCCs and a potential therapeutic candidate for liver cancer.

Also flagged:diabetic retinopathydiabetes mellitusdiabeteschronic kidney diseaseretinopathychromosome
Journal Article 2013-11-07 ✓ 2 Snippets Chen P, Ong RT, Tay WT, Sim X, Ali M, Xu H, Suo C, Liu J, Chia KS, Vithana E, Young TL, Aung T, Lim WY, Khor CC, Cheng CY, Wong TY, Teo YY, Tai ES.
In-Text Gene Mentions

…rs1800562 at theHFElocus had a…

…( SPTA1 ,HFE, ANK1 ,…

Show Full Abstract

Glycated hemoglobin A1C (HbA1C) level is used as a diagnostic marker for diabetes mellitus and a predictor of diabetes associated complications. Genome-wide association studies have identified genetic variants associated with HbA1C level. Most of these studies have been conducted in populations of European ancestry. Here we report the findings from a meta-analysis of genome-wide association studies of HbA1C levels in 6,682 non-diabetic subjects of Chinese, Malay and South Asian ancestries. We also sought to examine the associations between HbA1C associated SNPs and microvascular complications associated with diabetes mellitus, namely chronic kidney disease and retinopathy. A cluster of 6 SNPs on chromosome 17 showed an association with HbA1C which achieved genome-wide significance in the Malays but not in Chinese and Asian Indians. No other variants achieved genome-wide significance in the individual studies or in the meta-analysis. When we investigated the reproducibility of the findings that emerged from the European studies, six loci out of fifteen were found to be associated with HbA1C with effect sizes similar to those reported in the populations of European ancestry and P-value ≤ 0.05. No convincing associations with chronic kidney disease and retinopathy were identified in this study.

Also flagged:neurodegenerative disorderchromosomecognitive dysfunctionHDbehavioraldeath
Journal Article 2013-11-07 ✓ 4 Snippets Oakeshott S, Farrar A, Port R, Cummins-Sutphen J, Berger J, Watson-Johnson J, Ramboz S, Howland D, Brunner D.
In-Text Gene Mentions

Huntington’s disease (HD) is a dominant autosomal disorder resulting from expansion of a stretch of CAG repeats near the N-terminus of the HTT gene that encodes for the protein huntingtin.

…expansion on theHTTgene located on…

…N-terminus of theHTTgene that encodes…

…the mutant humanHTTgene 4 .…

Show Full Abstract

Huntington's disease (HD), a devastating neurodegenerative disorder caused by a CAG repeat expansion on the HTT gene located on chromosome 4, is associated with a characteristic pattern of progressive cognitive dysfunction known to involve early deficits in executive function. A modified Go/No-go successive discrimination task was designed to assess the type of online response control/executive function known to be disrupted in patients with HD. The present studies show that this simple discrimination assay revealed early and robust deficits in two mouse models of HD, the zQ175 KI mouse (deficits from 28 weeks of age) and the R6/2 mouse, carrying ~240 CAG repeats (deficits from 9 weeks of age). These deficits are not due to gross motor dysfunction in the test animals, but instead appear to measure some inability to inhibit responding in the HD mouse models, suggesting this assay may measure deficits in underlying attentional and/or behavioral inhibition processes. Accordingly, this assay may be well suited to evaluation of simple deficits in cognitive function in mouse HD models, providing a potential platform for preclinical screening.

Also flagged:methylationADHDAttention deficit/hyperactivity disorderpsychiatric disorderpsychiatric disordersDRD4
Journal Article 2013-11-07 No Snippets van Mil NH, Steegers-Theunissen RP, Bouwland-Both MI, Verbiest MM, Rijlaarsdam J, Hofman A, Steegers EA, Heijmans BT, Jaddoe VW, Verhulst FC, Stolk L, Eilers PH, Uitterlinden AG, Tiemeier H.
Show Full Abstract

Attention deficit/hyperactivity disorder (ADHD) is a common and highly heritable psychiatric disorder. In addition, early life environmental factors contribute to the occurrence of ADHD. Recently, DNA methylation has emerged as a mechanism potentially mediating genetic and environmental effects. Here, we investigated whether newborn DNA methylation patterns of selected candidate genes involved in psychiatric disorders or fetal growth are associated with ADHD symptoms in childhood. Participants were 426 children from a large population based cohort of Dutch national origin. Behavioral data were obtained at age 6 years with the Child Behavior Checklist. For the current study, 11 regions at 7 different genes were selected. DNA methylation levels of cord blood DNA were measured for the 11 regions combined and for each region separately. We examined the association between DNA methylation levels at different regions and ADHD symptoms with linear mixed models. DNA methylation levels were negatively associated with ADHD symptom score in the overall analysis of all 11 regions. This association was largely explained by associations of DRD4 and 5-HTT regions. Other candidate genes showed no association between DNA methylation levels and ADHD symptom score. Associations between DNA methylation levels and ADHD symptom score were attenuated by co-occurring Oppositional defiant disorder and total symptoms. Lower DNA methylation levels of the 7 genes assessed at birth, were associated with more ADHD symptoms of the child at 6 years of age. Further studies are needed to confirm our results and to investigate the possible underlying mechanism.

Also flagged:iron storage diseaseliver diseaseiron regulatory hormonehereditary hemochromatosisamino acidpeptide
Journal Article 2013-11-07 ✓ 1 Snippet Stasiak IM, Smith DA, Crawshaw GJ, Hammermueller JD, Bienzle D, Lillie BN.
In-Text Gene Mentions

Hemochromatosis, or iron storage…

Show Full Abstract

Hemochromatosis, or iron storage disease, has been associated with significant liver disease and mortality in captive Egyptian fruit bats (Rousettus aegyptiacus). The physiologic basis for this susceptibility has not been established. In humans, a deficiency or resistance to the iron regulatory hormone, hepcidin has been implicated in the development of hereditary hemochromatosis. In the present study, we compared the coding sequence of the hepcidin gene in eight species of bats representing three distinct taxonomic families with diverse life histories and dietary preferences. Bat hepcidin mRNA encoded a 23 amino acid signal peptide, a 34 or 35 amino acid pro-region, and a 25 amino acid mature peptide, similar to other mammalian species. Differences in the sequence of the portion of the hepcidin gene that encodes the mature peptide that might account for the increased susceptibility of the Egyptian fruit bat to iron storage disease were not identified. Variability in gene sequence corresponded to the taxonomic relationship amongst species.

Also flagged:growth conecell projectionAxonphatglr-2unc-51
Journal Article 2013-11-06 ✓ 2 Snippets Refai O, Rohs P, Mains PE, Gaudet J.
In-Text Gene Mentions

…Netrins and theirDCCand UNC5 receptors…

…two receptors, UNC-40 /DCCand UNC-5 (…

Show Full Abstract

The guidance of axons to their correct targets is a critical step in development. The C. elegans pharynx presents an attractive system to study neuronal pathfinding in the context of a developing organ. The worm pharynx contains relatively few cells and cell types, but each cell has a known lineage and stereotyped developmental patterns. We found that extension of the M1 pharyngeal axon, which spans the entire length of the pharynx, occurs in two distinct phases. The first proximal phase does not require genes that function in axon extension (unc-34, unc-51, unc-115, and unc-119), whereas the second distal phase does use these genes and is guided in part by the adjacent g1P gland cell projection. unc-34, unc-51, and unc-115 had incompletely penetrant defects and appeared to act in conjunction with the g1P cell for distal outgrowth. Only unc-119 showed fully penetrant defects for the distal phase. Mutations affecting classical neuronal guidance cues (Netrin, Semaphorin, Slit/Robo, Ephrin) or adhesion molecules (cadherin, IgCAM) had, at best, weak effects on the M1 axon. None of the mutations we tested affected the proximal phase of M1 elongation. In a forward genetic screen, we isolated nine mutations in five genes, three of which are novel, showing defects in M1, including axon overextension, truncation, or ectopic branching. One of these mutations appeared to affect the generation or differentiation of the M1 neuron. We conclude that M1 axon extension is a robust process that is not completely dependent on any single guidance mechanism.

Also flagged:immune responsesinflammatory responseshemostasiscell proliferationtissue remodelinginflammatory response
Journal Article 2013-11-06 No Snippets Chromy BA, Eldridge A, Forsberg JA, Brown TS, Kirkup BC, Jaing C, Be NA, Elster E, Luciw PA.
Show Full Abstract

<h4>Background</h4>The ability to forecast whether a wound will heal after closure without further debridement(s), would provide substantial benefits to patients with severe extremity trauma.<h4>Methods</h4>Wound effluent is a readily available material which can be collected without disturbing healthy tissue. For analysis of potential host response biomarkers, forty four serial combat wound effluent samples from 19 patients with either healing or failing traumatic- and other combat-related wounds were examined by 2-D DIGE. Spot map patterns were correlated to eventual wound outcome (healed or wound failure) and analyzed using DeCyder 7.0 and differential proteins identified via LC-MS/MS.<h4>Results</h4>This approach identified 52 protein spots that were differentially expressed and thus represent candidate biomarkers for this clinical application. Many of these proteins are intimately involved in inflammatory and immune responses. Furthermore, discriminate analysis further refined the 52 differential protein spots to a smaller subset of which successfully differentiate between wounds that will heal and those that will fail and require further surgical intervention with greater than 83% accuracy.<h4>Conclusion</h4>These results suggest candidates for a panel of protein biomarkers that may aid traumatic wound care prognosis and treatment. We recommend that this strategy be refined, and then externally validated, in future studies of traumatic wounds.

Also flagged:huntingtonHuntington diseaseneurodegenerative disorderHDamino
Journal Article 2013-11-06 ✓ 4 Snippets Bard J, Wall MD, Lazari O, Arjomand J, Munoz-Sanjuan I.
In-Text Gene Mentions

Huntington disease is a monogenic, autosomal dominant, progressive neurodegenerative disorder caused by a trinucleotide CAG repeat expansion in exon 1 of the huntingtin (HTT) gene; age of onset of clinical symptoms inversely correlates with expanded CAG repeat length.

HD leads to extensive degeneration of the basal ganglia, hypothalamic nuclei, and selected cortical areas, and a wide range of molecular mechanisms have been implicated in disease pathology in animal or cellular models expressing mutated HTT (mHTT) proteins, either full-length or amino-terminal fragments.

…of the huntingtin (HTT) gene; age of…

…models expressing mutatedHTT(mHTT) proteins, either…

Show Full Abstract

Huntington disease is a monogenic, autosomal dominant, progressive neurodegenerative disorder caused by a trinucleotide CAG repeat expansion in exon 1 of the huntingtin (HTT) gene; age of onset of clinical symptoms inversely correlates with expanded CAG repeat length. HD leads to extensive degeneration of the basal ganglia, hypothalamic nuclei, and selected cortical areas, and a wide range of molecular mechanisms have been implicated in disease pathology in animal or cellular models expressing mutated HTT (mHTT) proteins, either full-length or amino-terminal fragments. However, HD cellular models that recapitulate the slow progression of the disease have not been available due to the toxicity of overexpressed exogenous mHTT or to limitations with using primary cells for long-term studies. Most investigations of the effects of mHTT relied on cytotoxicity or aggregation end points in heterologous systems or in primary embryonic neuroglial cultures derived from HD mouse models. More innovative approaches are currently under active investigation, including screening using electrophysiological endpoints, as well as the recent use of primary blood mononuclear cells and of human embryonic stem cells derived from a variety of HD research participants. Here we describe how these cellular systems are being used to investigate HD biology as well as to identify mechanisms with therapeutic potential.

Also flagged:fibrilspeptideinclusion bodiesHuntington diseasepolyglutamineglutamines
Journal Article 2013-11-06 ✓ 5 Snippets Ormsby AR, Ramdzan YM, Mok YF, Jovanoski KD, Hatters DM.
In-Text Gene Mentions

…treatment with theHttalone control.…

…system of theHttaggregation state (…

…46Gln variant ofHttTC9 -Cerulean also…

…with dispersed cytosolicHtt(ni population; gating…

…relative levels ofHttcould be related…

Show Full Abstract

Our capacity for tracking how misfolded proteins aggregate inside a cell and how different aggregation states impact cell biology remains enigmatic. To address this, we built a new toolkit that enabled the high throughput tracking of individual cells enriched with polyglutamine-expanded Htt exon 1 (Httex1) monomers, oligomers, and inclusions using biosensors of aggregation state and flow cytometry pulse shape analysis. Supplemented with gel filtration chromatography and fluorescence-adapted sedimentation velocity analysis of cell lysates, we collated a multidimensional view of Httex1 aggregation in cells with respect to time, polyglutamine length, expression levels, cell survival, and overexpression of protein quality control chaperones hsp40 (DNAJB1) and hsp70 (HSPA1A). Cell death rates trended higher for Neuro2a cells containing Httex1 in inclusions than with Httex1 dispersed through the cytosol at time points of expression over 2 days. hsp40 stabilized monomers and suppressed inclusion formation but did not otherwise change Httex1 toxicity. hsp70, however, had no major effect on aggregation of Httex1 but increased the survival rate of cells with inclusions. hsp40 and hsp70 also increased levels of a second bicistronic reporter of Httex1 expression, mKate2, and increased total numbers of cells in culture, suggesting these chaperones partly rectify Httex1-induced deficiencies in quality control and growth rates. Collectively, these data suggest that Httex1 overstretches the protein quality control resources and that the defects can be partly rescued by overexpression of hsp40 and hsp70. Importantly, these effects occurred in a pronounced manner for soluble Httex1, which points to Httex1 aggregation occurring subsequently to more acute impacts on the cell.

Also flagged:telaprevirIL28Bamino acidInfectionpeginterferonribavirin
Journal Article 2013-11-06 ✓ 1 Snippet Akuta N, Suzuki F, Fukushima T, Kawamura Y, Sezaki H, Suzuki Y, Hosaka T, Kobayashi M, Hara T, Kobayashi M, Saitoh S, Arase Y, Ikeda K, Kumada H.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

The clinical usefulness of detecting telaprevir-resistant variants is unclear. Two hundred fifty-two Japanese patients infected with hepatitis C virus (HCV) genotype 1b received triple therapy with telaprevir-peginterferon (PEG-IFN)-ribavirin and were evaluated for telaprevir-resistant variants by direct sequencing at baseline and at the time of reelevation of the viral load. An analysis of the entire group indicated that 76% achieved a sustained virological response. Multivariate analysis identified a PEG-IFN dose of <1.3 μg/kg of body weight, an IL28B rs8099917 genotype (genotype non-TT), detection of telaprevir-resistant variants of amino acid (aa) 54 at baseline, nonresponse to prior treatment, and a leukocyte count of <5,000/mm(3) as significant pretreatment factors for detection of telaprevir-resistant variants at the time of reelevation of the viral load. In 63 patients who showed nonresponse to prior treatment, a higher proportion of patients with no detected telaprevir-resistant variants at baseline (54%) achieved a sustained virological response than did patients with detected telaprevir-resistant variants at baseline (0%). Furthermore, 2 patients who did not have a sustained virological response from the first course of triple therapy with telaprevir received a second course of triple therapy with telaprevir. These patients achieved a sustained virological response by the second course despite the persistence of very-high-frequency variants (98.1% for V36C) or a history of the emergence of variants (0.2% for R155Q and 0.2% for A156T) by ultradeep sequencing. In conclusion, this study indicates that the presence of telaprevir-resistant variants at the time of reelevation of viral load can be predicted by a combination of host, viral, and treatment factors. The presence of resistant variants at baseline might partly affect treatment efficacy, especially in those with nonresponse to prior treatment.

Also flagged:adaptive immune responsemuscular dystrophiescancerspathogenesishaematological malignanciescardiovascular disease
Journal Article 2013-11-06 ✓ 2 Snippets Delihas N.
In-Text Gene Mentions

…the Huntingtin gene HTT [18]; mutations in …

… [18]; mutations in HTT cause Huntington’…

Show Full Abstract

This Special Issue of IJMS is devoted to regulation by non-coding RNAs and contains both original research and review articles. An attempt is made to provide an up-to-date analysis of this very fast moving field and cover regulatory roles of both microRNAs and long non-coding RNAs. Multifaceted functions of these RNAs in normal cellular processes, as well as in disease progression, are highlighted.

Also flagged:Nonalcoholic fatty liver diseaseNAFLDliver diseasessimple steatosisnonalcoholic steatohepatitisNASH
Journal Article 2013-11-06 ✓ 1 Snippet Hashiba M, Ono M, Hyogo H, Ikeda Y, Masuda K, Yoshioka R, Ishikawa Y, Nagata Y, Munekage K, Ochi T, Hirose A, Nozaki-Fujimura Y, Noguchi S, Okamoto N, Chayama K, Suganuma N, Saibara T.
In-Text Gene Mentions

…including viral hepatitis,hemochromatosis, Wilson's disease, and…

Show Full Abstract

<h4>Unlabelled</h4>Patients with nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH) often have metabolic disorders including insulin resistance and type 2 diabetes mellitus (T2DM). We clarified the predictive factors in glucose metabolism for progression of hepatic fibrosis in patients with NAFLD by the 75-g oral glucose tolerance test (75gOGTT) and a continuous glucose monitoring system (CGMS). One hundred sixty-nine patients (68 female and 101 male patients) with biopsy-proven NAFLD with performance with 75gOGTT were enrolled and divided into four groups according to the stage of hepatic fibrosis (F0-3). The proportion of patients with T2DM significantly gradually increased, HbA1c and the homeostasis model assessment of insulin resistance were significantly elevated, and 1,5-anhydroglucitol (1,5-AG) was remarkably decreased with the progression of fibrosis. In the 75gOGTT, both plasma glucose and insulin secretion were remarkably increased with the progression of fibrosis. The only factor significantly associated with advanced fibrosis was 1,5-AG (P = 0.008) as determined by multivariate logistic regression analysis. We next evaluated the changes in blood glucose during 24 hours by monitoring with the CGMS to confirm the relationship between glycemic variability and progression of fibrosis. Variability of median glucose, standard deviation of median glucose (P = 0.0022), maximum blood glucose (P = 0.0019), and ΔMin-max blood glucose (P = 0.0029) were remarkably higher in severe fibrosis than in mild fibrosis.<h4>Conclusion</h4>Hyperinsulinemia and hyperglycemia, especially glycemic variability, are important predictive factors in glucose impairment for the progression of hepatic fibrosis in NAFLD.

Also flagged:cDNAcRNA18S ribosomal RNA18S rRNAvtg4T3
Journal Article 2013-11-06 No Snippets Hao R, Bondesson M, Singh AV, Riu A, McCollum CW, Knudsen TB, Gorelick DA, Gustafsson JÅ.
Show Full Abstract

Estrogen signaling is important for vertebrate embryonic development. Here we have used zebrafish (Danio rerio) as a vertebrate model to analyze estrogen signaling during development. Zebrafish embryos were exposed to 1 µM 17β-estradiol (E2) or vehicle from 3 hours to 4 days post fertilization (dpf), harvested at 1, 2, 3 and 4 dpf, and subjected to RNA extraction for transcriptome analysis using microarrays. Differentially expressed genes by E2-treatment were analyzed with hierarchical clustering followed by biological process and tissue enrichment analysis. Markedly distinct sets of genes were up and down-regulated by E2 at the four different time points. Among these genes, only the well-known estrogenic marker vtg1 was co-regulated at all time points. Despite this, the biological functional categories targeted by E2 were relatively similar throughout zebrafish development. According to knowledge-based tissue enrichment, estrogen responsive genes were clustered mainly in the liver, pancreas and brain. This was in line with the developmental dynamics of estrogen-target tissues that were visualized using transgenic zebrafish containing estrogen responsive elements driving the expression of GFP (Tg(5xERE:GFP)). Finally, the identified embryonic estrogen-responsive genes were compared to already published estrogen-responsive genes identified in male adult zebrafish (Gene Expression Omnibus database). The expressions of a few genes were co-regulated by E2 in both embryonic and adult zebrafish. These could potentially be used as estrogenic biomarkers for exposure to estrogens or estrogenic endocrine disruptors in zebrafish. In conclusion, our data suggests that estrogen effects on early embryonic zebrafish development are stage- and tissue- specific.

Also flagged:Ironagingobesitypeptide hormoneimmune responseiron deficiency
Journal Article 2013-11-06 No Snippets Dao MC, Meydani SN.
Show Full Abstract

Iron status and immune response become impaired in situations that involve chronic inflammation, such as obesity or aging. Little is known, however, about the additional burden that obesity may place on the iron status and immune response in the elderly. This question is relevant given the rising numbers of elderly obese (BMI >30 kg/m(2)) individuals and the high prevalence of iron deficiency worldwide. Iron is necessary for proper function of both the innate and adaptive immune system. Hepcidin, a peptide hormone that regulates cellular iron export, is essential for the maintenance of iron homeostasis. Therefore, since immune cells require iron for proper function hepcidin may also play an important role in immune response. In this review, we summarize the evidence for hepcidin as a link between the fields of gerontology, obesity, iron biology, and immunology. We also identify several gaps in knowledge and unanswered questions pertaining to iron homeostasis and immunity in obese populations. Finally, we review studies that have shown the impact of weight loss, focusing on calorie restriction, iron homeostasis, and immunity. These studies are important both in elucidating mechanistic links between obesity and health impairments and identifying possible approaches to target immune impairment and iron deficiency as comorbidities of obesity.

Also flagged:serotonin5-hydroxytryptamineblood clottingenteramineindoleplatelet aggregation
Journal Article 2013-11-06 ✓ 5 Snippets Sadkowski M, Dennis B, Clayden RC, Elsheikh W, Rangarajan S, Dejesus J, Samaan Z.
In-Text Gene Mentions

The serotonin transporter, 5-HTT, is encoded by the SLC6A4 gene, located on the long arm of chromosome 17 (17q11.1–17q.12).124 A 2001 study by Glatt et al80 identified 15 polymorphisms in the coding regions of SLC6A4. Of these 15 polymorphisms, six were synonymous (C164T, C7T, T87C, C73T, G53A, and G113A) and nine induced changes to the amino acid sequence (T133A, G292A, E165K, S41F, P44L, L8M, I69V, K166N, and P43S).80 These polymorphisms have yet to be investigated in relation to SB.

Perhaps one of the best studied polymorphisms of the serotonergic system is a 44 bp deletion/insertion polymorphism (5-HTTLPR), which is present in the 5′ flanking regulatory region of SLC6A4. 125 The corresponding alleles, termed the “L” or long allele, and the “s” or short allele, exhibit a dominant–recessive effect.126 There are important implications for carriers of the L allele; these implications are that the basal transcription activity of 5-HTT promoters containing this L variant is more than twice that of promoters with the s form.126 In lymphoblast cell lines, cells homozygous for the L allele produced concentrations of 5-HTT mRNA that were 1.4 to 1.7 times higher than those of cells containing one or two copies of the s variant.126 In addition, Lesch et al126 noted that “H-serotonin uptake in cells homozygous for the l allele was 1.9 to 2.2 times that in cells carrying one or two endogenous copies of the s variant.”

5-HTT( SLC6A4 )…

…The serotonin transporter,5-HTT, is encoded by…

…produced concentrations of5-HTTmRNA that were…

Show Full Abstract

Serotonin is a widely investigated neurotransmitter in several psychopathologies, including suicidal behavior (SB); however, its role extends to several physiological functions involving the nervous system, as well as the gastrointestinal and cardiovascular systems. This review summarizes recent research into ten serotonergic genes related to SB. These genes - TPH1, TPH2, SLC6A4, SLC18A2, HTR1A, HTR1B, HTR2A, DDC, MAOA, and MAOB - encode proteins that are vital to serotonergic function: tryptophan hydroxylase; the serotonin transporter 5-HTT; the vesicular transporter VMAT2; the HTR1A, HTR1B, and HTR2A receptors; the L-amino acid decarboxylase; and the monoamine oxidases. This review employed a systematic search strategy and a narrative research methodology to disseminate the current literature investigating the link between SB and serotonin.

Also flagged:Vitamin DasthmapathogenesisLAMP3PIP5K1BSCARB2
Journal Article 2013-11-05 ✓ 1 Snippet Kho AT, Sharma S, Qiu W, Gaedigk R, Klanderman B, Niu S, Anderson C, Leeder JS, Weiss ST, Tantisira KG.
In-Text Gene Mentions

…LGMN, MED13, NFKBIA,TNFSF4and VDR .…

Show Full Abstract

<h4>Background</h4>Poor maternal vitamin D intake is a risk factor for subsequent childhood asthma, suggesting that in utero changes related to vitamin D responsive genes might play a crucial role in later disease susceptibility. We hypothesized that vitamin D pathway genes are developmentally active in the fetal lung and that these developmental genes would be associated with asthma susceptibility and regulation in asthma.<h4>Methods</h4>Vitamin D pathway genes were derived from PubMed and Gene Ontology surveys. Principal component analysis was used to identify characteristic lung development genes.<h4>Results</h4>Vitamin D regulated genes were markedly over-represented in normal human (odds ratio OR 2.15, 95% confidence interval CI: 1.69-2.74) and mouse (OR 2.68, 95% CI: 2.12-3.39) developing lung transcriptomes. 38 vitamin D pathway genes were in both developing lung transcriptomes with >63% of genes more highly expressed in the later than earlier stages of development. In immortalized B-cells derived from 95 asthmatics and their unaffected siblings, 12 of the 38 (31.6%) vitamin D pathway lung development genes were significantly differentially expressed (OR 3.00, 95% CI: 1.43-6.21), whereas 11 (29%) genes were significantly differentially expressed in 43 control versus vitamin D treated immortalized B-cells from Childhood Asthma Management Program subjects (OR 2.62, 95% CI: 1.22-5.50). 4 genes, LAMP3, PIP5K1B, SCARB2 and TXNIP were identified in both groups; each displays significant biologic plausibility for a role in asthma.<h4>Conclusions</h4>Our findings demonstrate a significant association between early lung development and asthma-related phenotypes for vitamin D pathway genes, supporting a genomic mechanistic basis for the epidemiologic observations relating maternal vitamin D intake and childhood asthma susceptibility.

Also flagged:prostate cancerPCacell growthcell cycledeathtranscription factors
Journal Article 2013-11-05 No Snippets Tyagi A, Raina K, Shrestha SP, Miller B, Thompson JA, Wempe MF, Agarwal R, Agarwal C.
Show Full Abstract

Recently, we identified procyanidin B2 3,3(″)-di-O-gallate (B2G2) as most active constituent of grape seed extract (GSE) for efficacy against prostate cancer (PCa). Isolating large quantities of B2G2 from total GSE is labor intensive and expensive, thereby limiting both efficacy and mechanistic studies with this novel anticancer agent. Accordingly, here we synthesized gram-scale quantities of B2G2, compared it with B2G2 isolated from GSE for possible equivalent biological activity and conducted mechanistic studies. Both B2G2 preparations inhibited cell growth, decreased clonogenicity, and induced cell cycle arrest and apoptotic death, comparable to each other, in various human PCa cell lines. Mechanistic studies focusing on transcription factors involved in apoptotic and survival pathways revealed that B2G2 significantly inhibits NF-κB and activator protein1 (AP1) transcriptional activity and nuclear translocation of signal transducer and activator of transcription3 (Stat3) in PCa cell lines, irrespective of their functional androgen receptor status. B2G2 also decreased survivin expression which is regulated by NF-κB, AP1, and Stat3 and increased cleaved PARP level. In summary, we report B2G2 chemical synthesis at gram-quantity with equivalent biological efficacy against human PCa cell lines and same molecular targeting profiles at key transcription factors level. The synthetic B2G2 will stimulate more research on prostate and possibly other malignancies in preclinical models and clinical translation.

Also flagged:BRAFVemurafenibdabrafenibv-Raf murine sarcoma viral oncogene homolog B1kinasemelanoma
Journal Article 2013-11-05 No Snippets Vin H, Ojeda SS, Ching G, Leung ML, Chitsazzadeh V, Dwyer DW, Adelmann CH, Restrepo M, Richards KN, Stewart LR, Du L, Ferguson SB, Chakravarti D, Ehrenreiter K, Baccarini M, Ruggieri R, Curry JL, Kim KB, Ciurea AM, Duvic M, Prieto VG, Ullrich SE, Dalby KN, Flores ER, Tsai KY.
Show Full Abstract

Vemurafenib and dabrafenib selectively inhibit the v-Raf murine sarcoma viral oncogene homolog B1 (BRAF) kinase, resulting in high response rates and increased survival in melanoma. Approximately 22% of individuals treated with vemurafenib develop cutaneous squamous cell carcinoma (cSCC) during therapy. The prevailing explanation for this is drug-induced paradoxical ERK activation, resulting in hyperproliferation. Here we show an unexpected and novel effect of vemurafenib/PLX4720 in suppressing apoptosis through the inhibition of multiple off-target kinases upstream of c-Jun N-terminal kinase (JNK), principally ZAK. JNK signaling is suppressed in multiple contexts, including in cSCC of vemurafenib-treated patients, as well as in mice. Expression of a mutant ZAK that cannot be inhibited reverses the suppression of JNK activation and apoptosis. Our results implicate suppression of JNK-dependent apoptosis as a significant, independent mechanism that cooperates with paradoxical ERK activation to induce cSCC, suggesting broad implications for understanding toxicities associated with BRAF inhibitors and for their use in combination therapies. DOI: http://dx.doi.org/10.7554/eLife.00969.001.

Also flagged:serotonin receptortransporter5-hydroxytryptamine transporterparanoid depressionserotonin5-HTR2A
Journal Article 2013-11-05 ✓ 3 Snippets Staeker J, Leucht S, Laika B, Steimer W.
In-Text Gene Mentions

…ydroxytryptamine transporter (5-HTT) variable number of…

5-HTTVNTR and 5-HTR2A…

…and nonselective SRI (5-HTTVNTR 12/12: n…

Show Full Abstract

Serotonergic pathways are known to play an essential role in the effects generated by antidepressants. Polymorphisms in serotonin receptor and transporter genes have been identified as an important factor. To investigate which of these polymorphisms may be useful to predict clinical outcome, we assessed their effect in a naturalistic clinical study. We studied the influence of the 5-hydroxytryptamine transporter (5-HTT) variable number of tandem repeats (VNTR), 5-HTTLPR/rs25531 and a 5-HTR2A intron 2 SNP with regard to response and side effects in 273 psychiatric inpatients. Main clinical assessments included Clinical Global Impressions ratings, paranoid depression scale self-rating scale and Dosage Record, and Treatment Emergent Symptoms (DOTES) Scale. We found significant associations between 5-HTTLPR/rs25531 S/L(G) alleles and response and side effects in 100 patients with selective serotonin reuptake inhibitor (SSRI) treatment (p = 0.037, CGI-I ≤ 2: 0% vs. 19% and p = 0.0005, DOTES cluster c: 0.76 vs. 0.19). 5-HTT VNTR and 5-HTR2A intron 2 polymorphisms were associated significantly with adverse effects in patients with selective and nonselective SRI (5-HTT VNTR 12/12: n = 170, p = 0.0001, side effect rates: 51% vs. 19% and rs7997012 [A/A]: n = 50, p = 0.020, side effects rates: 43% vs. 11%). No impact of the polymorphisms on mirtazapine treatment was found. Our study confirms the influence of serotonergic polymorphisms at the receptor and transporter level on SSRI response and side effects, supporting previous reports based on various study designs. The effects were strong enough to be noticed clinically in this naturalistic setting. However, randomized controlled trials are warranted to provide unequivocal evidence of the clinical usefulness of pretherapeutic screening for these polymorphisms.

Also flagged:X-linked microtubule-associated proteinMid1axonOpitz syndromeOSgenetic neurological disorder
Journal Article 2013-11-05 ✓ 1 Snippet Lu T, Chen R, Cox TC, Moldrich RX, Kurniawan N, Tan G, Perry JK, Ashworth A, Bartlett PF, Xu L, Zhang J, Lu B, Wu M, Shen Q, Liu Y, Richards LJ, Xiong Z.
In-Text Gene Mentions

DCC

Show Full Abstract

Opitz syndrome (OS) is a genetic neurological disorder. The gene responsible for the X-linked form of OS, Midline-1 (MID1), encodes an E3 ubiquitin ligase that regulates the degradation of the catalytic subunit of protein phosphatase 2A (PP2Ac). However, how Mid1 functions during neural development is largely unknown. In this study, we provide data from in vitro and in vivo experiments suggesting that silencing Mid1 in developing neurons promotes axon growth and branch formation, resulting in a disruption of callosal axon projections in the contralateral cortex. In addition, a similar phenotype of axonal development was observed in the Mid1 knockout mouse. This defect was largely due to the accumulation of PP2Ac in Mid1-depleted cells as further down-regulation of PP2Ac rescued the axonal phenotype. Together, these data demonstrate that Mid1-dependent PP2Ac turnover is important for normal axonal development and that dysregulation of this process may contribute to the underlying cause of OS.

Also flagged:AutismChannelopathypathogenesisautism spectrum disordersAutism spectrum disorderbrain development
Journal Article 2013-11-05 ✓ 1 Snippet Schmunk G, Gargus JJ.
In-Text Gene Mentions

Eichler and Meier (2008) also identified exon-disrupting CNV deletions not found in healthy controls in the paralog calcium channel accessory subunit CACNA2D3 in their analysis of recurrent CNV hotspots in ASD (Girirajan et al., 2013). Eichler’s group further identified de novo rare alleles in alpha subunit loci CACNA1D and CACNA1E as “top de novo risk mutations” for autism in a whole exome resequencing study (O’Roak et al., 2012b), and, using a high density custom microarray in a different cohort of ASD, implicated a completely different type of calcium channel, a calcium-permeable cation channel called a transient receptor potential (TRP) channel, encoded by TRPM1. This gene had previously been shown to carry pathogenic alleles for Complete Congenital Stationary Night Blindness (Audo et al., 2009) and subsequently to participate in the metabotropic glutamate receptor signaling cascade (Devi et al., 2013). They observed that the CNV deletion at the 15q13.3 locus that is enriched in ASD, was found in 5 out of 2,588 cases, and that although CHRNA7 had been previously implicated as contributing to neurological defects in this lesion (see below), in their cohort they found no deletions of this gene, but instead found that all five cases had deletions of TRPM1 in this locus, including one homozygous deletion never observed in a control.

Show Full Abstract

Autism spectrum disorder (ASD) is a syndrome that affects normal brain development and is characterized by impaired social interaction as well as verbal and non-verbal communication and by repetitive, stereotypic behavior. ASD is a complex disorder arising from a combination of multiple genetic and environmental factors that are independent from racial, ethnic and socioeconomical status. The high heritability of ASD suggests a strong genetic basis for the disorder. Furthermore, a mounting body of evidence implies a role of various ion channel gene defects (channelopathies) in the pathogenesis of autism. Indeed, recent genome-wide association, and whole exome- and whole-genome resequencing studies linked polymorphisms and rare variants in calcium, sodium and potassium channels and their subunits with susceptibility to ASD, much as they do with bipolar disorder, schizophrenia and other neuropsychiatric disorders. Moreover, animal models with these genetic variations recapitulate endophenotypes considered to be correlates of autistic behavior seen in patients. An ion flux across the membrane regulates a variety of cell functions, from generation of action potentials to gene expression and cell morphology, thus it is not surprising that channelopathies have profound effects on brain functions. In the present work, we summarize existing evidence for the role of ion channel gene defects in the pathogenesis of autism with a focus on calcium signaling and its downstream effects.

Also flagged:chondrogenesistransforming growth factor beta 2S100collagen type IIsynthesisproteoglycans
Journal Article 2013-11-05 ✓ 1 Snippet Lehmann M, Martin F, Mannigel K, Kaltschmidt K, Sack U, Anderer U.
In-Text Gene Mentions

…coactivators SOX5 andSOX6) transcription factors 52…

Show Full Abstract

Cartilage regeneration based on isolated and culture-expanded chondrocytes has been studied in various in vitro models, but the quality varies with respect to the morphology and the physiology of the synthesized tissues. The aim of our study was to promote in vitro chondrogenesis of human articular chondrocytes using a novel three-dimensional (3-D) cultivation system in combination with the chondrogenic differentiation factors transforming growth factor beta 2 (TGF-b2) and L-ascorbic acid. Articular chondrocytes isolated from six elderly patients were expanded in monolayer culture. A single-cell suspension of the dedifferentiated chondrocytes was then added to agar-coated dishes without using any scaffold material, in the presence, or absence of TGF-b2 and/or L-ascorbic acid. Three-dimensional cartilage-like constructs, called single spheroids, and microtissues consisting of several spheroids fused together, named as fusions, were formed. Generated tissues were mainly characterized using histological and immunohistochemical techniques. The morphology of the in vitro tissues shared some similarities to native hyaline cartilage in regard to differentiated S100-positive chondrocytes within a cartilaginous matrix, with strong collagen type II expression and increased synthesis of proteoglycans. Finally, our innovative scaffold-free fusion culture technique supported enhanced chondrogenesis of human articular chondrocytes in vitro. These 3-D hyaline cartilage-like microtissues will be useful for in vitro studies of cartilage differentiation and regeneration, enabling optimization of functional tissue engineering and possibly contributing to the development of new approaches to treat traumatic cartilage defects or osteoarthritis.

Also flagged:cancergene expressioncerebellar tumormedulloblastomabreast cancerglioblastoma
Journal Article 2013-11-05 No Snippets Chen P, Fan Y, Man TK, Hung YS, Lau CC, Wong ST.
Show Full Abstract

<h4>Background</h4>Subtypes are widely found in cancer. They are characterized with different behaviors in clinical and molecular profiles, such as survival rates, gene signature and copy number aberrations (CNAs). While cancer is generally believed to have been caused by genetic aberrations, the number of such events is tremendous in the cancer tissue and only a small subset of them may be tumorigenic. On the other hand, gene expression signature of a subtype represents residuals of the subtype-specific cancer mechanisms. Using high-throughput data to link these factors to define subtype boundaries and identify subtype-specific drivers, is a promising yet largely unexplored topic.<h4>Results</h4>We report a systematic method to automate the identification of cancer subtypes and candidate drivers. Specifically, we propose an iterative algorithm that alternates between gene expression clustering and gene signature selection. We applied the method to datasets of the pediatric cerebellar tumor medulloblastoma (MB). The subtyping algorithm consistently converges on multiple datasets of medulloblastoma, and the converged signatures and copy number landscapes are also found to be highly reproducible across the datasets. Based on the identified subtypes, we developed a PCA-based approach for subtype-specific identification of cancer drivers. The top-ranked driver candidates are found to be enriched with known pathways in certain subtypes of MB. This might reveal new understandings for these subtypes.<h4>Conclusions</h4>Our study indicates that subtype-signature defines the subtype boundaries, characterizes the subtype-specific processes and can be used to prioritize signature-related drivers.

Also flagged:filamin Acytoskeletoncancertumorlocalizationcytoplasm
Journal Article 2013-11-04 No Snippets Savoy RM, Ghosh PM.
Show Full Abstract

Filamin A (FlnA) has been associated with actin as cytoskeleton regulator. Recently its role in the cell has come under scrutiny for FlnA's involvement in cancer development. FlnA was originally revealed as a cancer-promoting protein, involved in invasion and metastasis. However, recent studies have also found that under certain conditions, it prevented tumor formation or progression, confusing the precise function of FlnA in cancer development. Here, we try to decipher the role of FlnA in cancer and the implications for its dual role. We propose that differences in subcellular localization of FlnA dictate its role in cancer development. In the cytoplasm, FlnA functions in various growth signaling pathways, such as vascular endothelial growth factor, in addition to being involved in cell migration and adhesion pathways, such as R-Ras and integrin signaling. Involvement in these pathways and various others has shown a correlation between high cytoplasmic FlnA levels and invasive cancers. However, an active cleaved form of FlnA can localize to the nucleus rather than the cytoplasm and its interaction with transcription factors has been linked to a decrease in invasiveness of cancers. Therefore, overexpression of FlnA has a tumor-promoting effect, only when it is localized to the cytoplasm, whereas if FlnA undergoes proteolysis and the resulting C-terminal fragment localizes to the nucleus, it acts to suppress tumor growth and inhibit metastasis. Development of drugs to target FlnA and cause cleavage and subsequent localization to the nucleus could be a new and potent field of research in treating cancer.

Also flagged:Hepatocellular carcinomaliver cancertumoralcoholhepatitisaflatoxin
Journal Article 2013-11-04 ✓ 1 Snippet Jin Y, Wang S, Chen W, Zhang J, Wang B, Guan H, Tang J.
In-Text Gene Mentions

…aflatoxin, liver cirrhosis,hemochromatosis, and type 2…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is one of the leading causes of cancer death in China. This study investigated the effects of Annexin A7 (ANXA7) on the inhibition of HCC lymph node metastasis in a mouse model.<h4>Methods</h4>The stable knockup and knockdown of Annexin A7-expressing HCC cells using Annexin A7 cDNA and shRNA vectors, respectively, were injected into a mouse footpad to establish primary and metastatic tumors in mice. On the 14th, 21st, and 28th days after HCC cells inoculation, the mice were sacrificed for inspection of primary and secondary tumors and immunohistochemistry of Annexin A7 expression.<h4>Results</h4>The lymph node metastasis rate of the FANXA7-control group was 77%, and the lymph node metastasis rate of the FANXA7-down group was 100% (p<0.05). In contrast, the lymph node metastasis rate of the PANXA7-up group was 0% and that of the PANXA7-control group was 36% (p<0.05). Furthermore, immunohistochemistry experiments revealed that the subcellular localization of Annexin A7 protein in both primary and lymph node-metastasized tumors was mainly in the cytosol. In addition, the expression of the 47 kDa and 51 kDa isoforms of Annexin A7 protein changed during tumor progression.<h4>Conclusion</h4>This study indicated that Annexin A7 expression was able to inhibit HCC lymph node metastasis, whereas knockdown of Annexin A7 expression significantly induced HCC metastasis to local lymph nodes.

Also flagged:Quercetinanxietydepressionflavonoidaminemonoamine oxidase
Journal Article 2013-11-04 ✓ 1 Snippet Chakraborty J, Singh R, Dutta D, Naskar A, Rajamma U, Mohanakumar KP.
In-Text Gene Mentions

Htt

Show Full Abstract

<h4>Aim</h4>Huntington's disease (HD) is an autosomal dominant disorder, for which clinically available drugs offer only symptomatic relief. These prescription drugs are not free of side effects, and the patients usually suffer from anxiety and depression. We investigated quercetin, a dietary flavonoid with free radical scavenging properties, for its beneficial potential if any, in 3-nitropropionic acid (3-NP)-induced HD in rats where both drugs were administered simultaneously.<h4>Methods</h4>Performance of rats on beam balancing, elevated plus maze and gait traits were investigated following 3-NP and/or quercetin treatments for 4 days. Striatal biogenic amine levels and monoamine oxidase activity were assayed. Striatal sections were examined for Cd11B and glial fibrillary acidic protein immunoreactivity, and for evidences of neuronal lesion.<h4>Results</h4>Quercetin significantly attenuated 3-NP-induced anxiety, motor coordination deficits, and gait despair. While the dopaminergic hyper-metabolism was unaffected, quercetin provided a significant reduction of 3-NP mediated increase in serotonin metabolism. Quercetin failed to affect 3-NP-induced striatal neuronal lesion, but decreased microglial proliferation, and increased astrocyte numbers in the lesion core.<h4>Conclusion</h4>These results taken together suggest that quercetin could be of potential use not only for correcting movement disturbances and anxiety in HD, but also for addressing inflammatory damages.

Also flagged:pericentromeresmicrotubuleschromatinspindle checkpointchromosomemicrotubule
Journal Article 2013-11-04 ✓ 1 Snippet Stephens AD, Snider CE, Haase J, Haggerty RA, Vasquez PA, Forest MG, Bloom K.
In-Text Gene Mentions

Condensin-dependent chromatin compactio…

Show Full Abstract

The mitotic segregation apparatus composed of microtubules and chromatin functions to faithfully partition a duplicated genome into two daughter cells. Microtubules exert extensional pulling force on sister chromatids toward opposite poles, whereas pericentric chromatin resists with contractile springlike properties. Tension generated from these opposing forces silences the spindle checkpoint to ensure accurate chromosome segregation. It is unknown how the cell senses tension across multiple microtubule attachment sites, considering the stochastic dynamics of microtubule growth and shortening. In budding yeast, there is one microtubule attachment site per chromosome. By labeling several chromosomes, we find that pericentromeres display coordinated motion and stretching in metaphase. The pericentromeres of different chromosomes exhibit physical linkage dependent on centromere function and structural maintenance of chromosomes complexes. Coordinated motion is dependent on condensin and the kinesin motor Cin8, whereas coordinated stretching is dependent on pericentric cohesin and Cin8. Linking of pericentric chromatin through cohesin, condensin, and kinetochore microtubules functions to coordinate dynamics across multiple attachment sites.

Also flagged:nucleotidebindingtranscription factorschromatintranscription factorgene expression
Journal Article 2013-11-04 No Snippets Mathelier A, Zhao X, Zhang AW, Parcy F, Worsley-Hunt R, Arenillas DJ, Buchman S, Chen CY, Chou A, Ienasescu H, Lim J, Shyr C, Tan G, Zhou M, Lenhard B, Sandelin A, Wasserman WW.
Show Full Abstract

JASPAR (http://jaspar.genereg.net) is the largest open-access database of matrix-based nucleotide profiles describing the binding preference of transcription factors from multiple species. The fifth major release greatly expands the heart of JASPAR-the JASPAR CORE subcollection, which contains curated, non-redundant profiles-with 135 new curated profiles (74 in vertebrates, 8 in Drosophila melanogaster, 10 in Caenorhabditis elegans and 43 in Arabidopsis thaliana; a 30% increase in total) and 43 older updated profiles (36 in vertebrates, 3 in D. melanogaster and 4 in A. thaliana; a 9% update in total). The new and updated profiles are mainly derived from published chromatin immunoprecipitation-seq experimental datasets. In addition, the web interface has been enhanced with advanced capabilities in browsing, searching and subsetting. Finally, the new JASPAR release is accompanied by a new BioPython package, a new R tool package and a new R/Bioconductor data package to facilitate access for both manual and automated methods.

Also flagged:bronchiolitis obliteranshematoxylinP63Foxp3CD3lung injury
Journal Article 2013-11-04 No Snippets Zhao Y, Gillen JR, Harris DA, Kron IL, Murphy MP, Lau CL.
Show Full Abstract

<h4>Objective</h4>Bone marrow-derived mesenchymal stem cells (MSCs) have shown therapeutic potential in acute lung injury. Recently, placenta-derived human mesenchymal stem cells (PMSCs) have shown similarities with bone marrow-derived MSCs in terms of regenerative capabilities and immunogenicity. This study investigates the hypothesis that treatment with PMSCs reduces the development of bronchiolitis obliterans in a murine heterotopic tracheal transplant model.<h4>Methods</h4>A murine heterotopic tracheal transplant model was used to study the continuum from acute to chronic rejection. In the treatment groups, PMSCs or PMSC-conditioned medium (PMSCCM) were injected either locally or intratracheally into the allograft. Phosphate-buffered saline (PBS) or blank medium was injected in the control groups. Tracheal luminal obliteration was assessed on sections stained with hematoxylin and eosin. Infiltration of inflammatory and immune cells and epithelial progenitor cells was assessed using immunohistochemistry and densitometric analysis.<h4>Results</h4>Compared with injection of PBS, local injection of PMSCs significantly reduced luminal obliteration at 28 days after transplantation (P = .015). Intratracheal injection of PMSCs showed similar results to local injection of PMSCs compared with injection of PBS and blank medium (P = .022). Tracheas treated with PMSC/PMSCCM showed protection against the loss of epithelium on day 14, with an increase in P63+CK14+ epithelial progenitor cells and Foxp3+ regulatory T cells. In addition, injection of PMSCs and PMSCCM significantly reduced the number of neutrophils and CD3+ T cells on day 14.<h4>Conclusions</h4>This study demonstrates that treatment with PMSCs is protective against the development of bronchiolitis obliterans in an heterotopic tracheal transplant model. These results indicate that PMSCs could provide a novel therapeutic option to reduce chronic rejection after lung transplant.

Also flagged:photoreceptor degenerationcell bodiesCASTChromosomeChromosomesMfrp
Journal Article 2013-11-04 ✓ 1 Snippet Won J, Charette JR, Philip VM, Stearns TM, Zhang W, Naggert JK, Krebs MP, Nishina PM.
In-Text Gene Mentions

Serpinc1

Show Full Abstract

The identification of genes that modify pathological ocular phenotypes in mouse models may improve our understanding of disease mechanisms and lead to new treatment strategies. Here, we identify modifier loci affecting photoreceptor cell loss in homozygous Mfrp(rd6) mice, which exhibit a slowly progressive photoreceptor degeneration. A cohort of 63 F2 homozygous Mfrp(rd6) mice from a (B6.C3Ga-Mfrp(rd6)/J × CAST/EiJ) F1 intercross exhibited a variable number of cell bodies in the retinal outer nuclear layer at 20 weeks of age. Mice were genotyped with a panel of single nucleotide polymorphism markers, and genotypes were correlated with phenotype by quantitative trait locus (QTL) analysis to map modifier loci. A genome-wide scan revealed a statistically significant, protective candidate locus on CAST/EiJ Chromosome 1 and suggestive modifier loci on Chromosomes 6 and 11. Multiple regression analysis of a three-QTL model indicated that the modifier loci on Chromosomes 1 and 6 together account for 26% of the observed phenotypic variation, while the modifier locus on Chromosome 11 explains only an additional 4%. Our findings indicate that the severity of the Mfrp(rd6) retinal degenerative phenotype in mice depends on the strain genetic background and that a significant modifier locus on CAST/EiJ Chromosome 1 protects against Mfrp(rd6)-associated photoreceptor loss.

Also flagged:Cell-cellsecretionCresyl Bluecell communicationKit
Journal Article 2013-11-04 ✓ 2 Snippets Sohel MM, Hoelker M, Noferesti SS, Salilew-Wondim D, Tholen E, Looft C, Rings F, Uddin MJ, Spencer TE, Schellander K, Tesfaye D.
In-Text Gene Mentions

…MAP3K1, SOCS4, BRMS1L,ZNFX1, CD44 and VEGFA)…

…miR-640), BRMS1L &ZNFX1(as target of…

Show Full Abstract

Cell-cell communication within the follicle involves many signaling molecules, and this process may be mediated by secretion and uptake of exosomes that contain several bioactive molecules including extra-cellular miRNAs. Follicular fluid and cells from individual follicles of cattle were grouped based on Brilliant Cresyl Blue (BCB) staining of the corresponding oocytes. Both Exoquick precipitation and differential ultracentrifugation were used to separate the exosome and non-exosomal fraction of follicular fluid. Following miRNA isolation from both fractions, the human miRCURY LNA™ Universal RT miRNA PCR array system was used to profile miRNA expression. This analysis found that miRNAs were present in both exosomal and non-exosomal fraction of bovine follicular fluid. We found 25 miRNAs differentially expressed (16 up and 9 down) in exosomes and 30 miRNAs differentially expressed (21 up and 9 down) in non-exosomal fraction of follicular fluid in comparison of BCB- versus BCB+ oocyte groups. Expression of selected miRNAs was detected in theca, granulosa and cumulus oocyte complex. To further explore the potential roles of these follicular fluid derived extra-cellular miRNAs, the potential target genes were predicted, and functional annotation and pathway analysis revealed most of these pathways are known regulators of follicular development and oocyte growth. In order to validate exosome mediated cell-cell communication within follicular microenvironment, we demonstrated uptake of exosomes and resulting increase of endogenous miRNA level and subsequent alteration of mRNA levels in follicular cells in vitro. This study demonstrates for the first time, the presence of exosome or non-exosome mediated transfer of miRNA in the bovine follicular fluid, and oocyte growth dependent variation in extra-cellular miRNA signatures in the follicular environment.

Also flagged:NRF1Nuclear respiratory factor 1transcription factormitochondrialmitochondrial respiratory complexheme
Journal Article 2013-11-04 ✓ 3 Snippets Satoh J, Kawana N, Yamamoto Y.
In-Text Gene Mentions

HD, an intractable disease causing chorea and psychiatric disturbances due to expansion of a CAG trinucleotide repeat in the huntingtin (HTT) gene, is characterized by a loss of long projection neurons in the striatum and the cortex.

…in the huntingtin (HTT) gene, is characterized…

…We identifiedHTT-interacting TAF4 (TAFII130) a…

Show Full Abstract

Nuclear respiratory factor 1 (NRF1) serves as a transcription factor that activates the expression of a wide range of nuclear genes essential for mitochondrial biogenesis and function, including mitochondrial respiratory complex subunits, heme biosynthetic enzymes, and regulatory factors involved in the replication and transcription of mitochondrial DNA. Increasing evidence indicates that mitochondrial function is severely compromised in the brains of aging-related neurodegenerative diseases. To identify the comprehensive set of human NRF1 target genes potentially relevant to the pathogenesis of neurodegenerative diseases, we analyzed the NRF1 chromatin immunoprecipitation followed by deep sequencing (ChIP-Seq) dataset retrieved from the Encyclopedia of DNA Elements (ENCODE) project. Overall, we identified 2,470 highly stringent ChIP-Seq peaks on protein-coding genes in SK-N-SH human neuroblastoma cells. They were accumulated in the proximal promoter regions with an existence of the NRF1-binding consensus sequence. The set of ChIP-Seq-based NRF1 target genes included known NRF1 targets such as EIF2S1, EIF2S2, CYCS, FMR1, FXR2, E2F6, CD47, and TOMM34. By pathway analysis, the molecules located in the core pathways related to mitochondrial respiratory function were determined to be highly enriched in NRF1 target genes. Furthermore, we found that NRF1 target genes play a pivotal role in regulation of extra-mitochondrial biological processes, including RNA metabolism, splicing, cell cycle, DNA damage repair, protein translation initiation, and ubiquitin-mediated protein degradation. We identified a panel of neurodegenerative disease-related genes, such as PARK2 (Parkin), PARK6 (Pink1), PARK7 (DJ-1), and PAELR (GPR37) for Parkinson's disease, as well as PSENEN (Pen2) and MAPT (tau) for Alzheimer's disease, as previously unrecognized NRF1 targets. These results suggest a logical hypothesis that aberrant regulation of NRF1 and its targets might contribute to the pathogenesis of human neurodegenerative diseases via perturbation of diverse mitochondrial and extra-mitochondrial functions.

Also flagged:POU3F3intellectual disabilitychromosomeMRPS9IDlearning disabilities
Journal Article 2013-11-02 ✓ 1 Snippet Dheedene A, Maes M, Vergult S, Menten B.
In-Text Gene Mentions

Pou3f2

Show Full Abstract

We describe a boy presenting with intellectual disability and dysmorphic features in whom a cryptic microdeletion in chromosome band 2q12.1 was identified with array CGH. The deletion results in a loss of the POU3F3 and MRPS9 genes. In this paper, we discuss the possible role of POU3F3 haploinsufficiency in relation to the boy's phenotype.

Also flagged:transmembrane proteinsynapsessynapticscaffold proteincell-adhesionmembranes
Journal Article 2013-11-01 ✓ 1 Snippet Liu DC, Jow GM, Chuang CC, Peng YJ, Hsu PH, Tang CY.
In-Text Gene Mentions

Densin-180is not a…

Show Full Abstract

In the central nervous system, densin-180 (densin) is one of the major components of the post-synaptic density (PSD) of excitatory synapses. Through its intricate interaction with various post-synaptic proteins, this scaffold protein may play a key role in synaptic regulation. Initial structural analyses suggest that densin is a transmembrane protein and may participate in cell-adhesion function between pre- and post-synaptic membranes. Whereas recent biochemical and mass spectrometry studies indicate that densin may instead be a membrane-associated protein with no extracellular domain. To further investigate the structural topology of densin, we began with examining the extracellular accessibility of multiple epitopes in densin. We have provided immunofluorescence evidence showing that none of the tested epitope sites in densin was accessible to extracellularly applied antibodies. In addition, both protease digestion and surface biotinylation data failed to affirm the presence of extracellular domain for densin. However, protein extraction experiments indicated that densin exhibited a significant hydrophobic interaction with the cell membrane that was not expected of cytosolic proteins. Our data therefore do not support the transmembrane model, but rather are consistent with the idea that the topology of densin involves the membrane association configuration.

Also flagged:endothelial nitric oxide synthaseeNOSnitric oxidemembranebiosynthesisphosphorylation
Journal Article 2013-11-01 No Snippets Ramadoss J, Pastore MB, Magness RR.
Show Full Abstract

Complex regulatory processes alter the activity of endothelial nitric oxide synthase (eNOS) leading to nitric oxide (NO) production by endothelial cells under various physiological states. These complex processes require specific subcellular eNOS partitioning between plasma membrane caveolar domains and non-caveolar compartments. Translocation of eNOS from the plasma membrane to intracellular compartments is important for eNOS activation and subsequent NO biosynthesis. We present data reviewing and interpreting information regarding: (i) the coupling of endothelial plasma membrane receptor systems in the caveolar structure relative to eNOS trafficking; (ii) how eNOS trafficking relates to specific protein-protein interactions for inactivation and activation of eNOS; and (iii) how these complex mechanisms confer specific subcellular location relative to eNOS multisite phosphorylation and signalling. Dysfunction in the regulation of eNOS activation may contribute to several disease states, in particular gestational endothelial abnormalities (pre-eclampsia, gestational diabetes etc.), that have life-long deleterious health consequences that predispose the offspring to develop hypertensive disease, Type 2 diabetes and adiposity.

Also flagged:deathEIF5BPLK1canceroligonucleotideDicer
Journal Article 2013-11-01 ✓ 1 Snippet Bhinder B, Djaballah H.
In-Text Gene Mentions

DCC

Show Full Abstract

RNA interference (RNAi) has opened promising avenues to better understand gene function. Though many RNAi screens report on the identification of genes, very few, if any, have been further studied and validated. Data discrepancy is emerging as one of RNAi main pitfalls. We reasoned that a systematic analysis of lethality-based screens, since they score for cell death, would examine the extent of hit discordance at inter-screen level. To this end, we developed a methodology for literature mining and overlap analysis of several screens using both siRNA and shRNA flavors, and obtained 64 gene lists censoring an initial list of 7,430 nominated genes. We further performed a comparative analysis first at a global level followed by hit re-assessment under much more stringent conditions. To our surprise, none of the hits overlapped across the board even for PLK1, which emerged as a strong candidate in siRNA screens; but only marginally in the shRNA ones. Furthermore, EIF5B emerges as the most common hit only in the shRNA screens. A highly unusual and unprecedented result was the observation that 5,269 out of 6,664 nominated genes (~80%) in the shRNA screens were exclusive to the pooled format, raising concerns as to the merits of pooled screens which qualify hits based on relative depletions, possibly due to multiple integrations per cell, data deconvolution or inaccuracies in intracellular processing causing off-target effects. Without golden standards in place, we would encourage the community to pay more attention to RNAi screening data analysis practices, bearing in mind that it is combinatorial in nature and one active siRNA duplex or shRNA hairpin per gene does not suffice credible hit nomination. Finally, we also would like to caution interpretation of pooled shRNA screening outcomes.

Also flagged:peptidesfibrilsamino acidHuntingtinpeptidesynthesis
Journal Article 2013-11-01 ✓ 4 Snippets Roland BP, Kodali R, Mishra R, Wetzel R.
In-Text Gene Mentions

The 17- amino acid N-terminal segment of the Huntingtin protein, htt(NT), grows into stable α-helix rich oligomeric aggregates when incubated under physiological conditions.

…the Huntingtin protein,httNT , grows…

…versions of anhttNT peptide for…

htt

Show Full Abstract

The 17- amino acid N-terminal segment of the Huntingtin protein, htt(NT), grows into stable α-helix rich oligomeric aggregates when incubated under physiological conditions. We examined 15 scrambled sequence versions of an htt(NT) peptide for their stabilities against aggregation in aqueous solution at low micromolar concentration and physiological conditions. Surprisingly, given their derivation from a sequence that readily assembles into highly stable α-helical aggregates that fail to convert into β-structure, we found that three of these scrambled peptides rapidly grow into amyloid-like fibrils, while two others also develop amyloid somewhat more slowly. The other 10 scrambled peptides do not detectibly form any aggregates after 100 h incubation under these conditions. We then analyzed these sequences using four previously described algorithms for predicting the tendencies of peptides to grow into amyloid or other β-aggregates. We found that these algorithms-Zyggregator, Tango, Waltz, and Zipper-varied greatly in the number of sequences predicted to be amyloidogenic and in their abilities to correctly identify the amyloid forming members of this scrambled peptide collection. The results are discussed in the context of a review of the sequence and structural factors currently thought to be important in determining amyloid formation kinetics and thermodynamics.

Also flagged:irontransferrin receptormetabolismhemochromatosis type Ianemia of chronic disease
Journal Article 2013-11-01 ✓ 1 Snippet Van Heghe L, Delanghe J, Van Vlierberghe H, Vanhaecke F.
In-Text Gene Mentions

…The results forhemochromatosispatients plotted with…

Show Full Abstract

As the iron status of an individual cannot be adequately assessed on the basis of the (total) Fe concentration in whole blood or serum, in medicine a number of parameters, such as the serum concentrations of ferritin, transferrin and soluble transferrin receptor and the transferrin saturation, are routinely determined instead. As previous research has shown that also the isotopic composition of Fe in blood and tissues is dependent on the metabolism, the present study assessed whether Fe isotopic composition in whole blood provides information as to an individual's iron status. Fe isotopic analysis of whole blood samples from a reference population (healthy volunteers) was carried out using multi-collector ICP-mass spectrometry (after chromatographic target element isolation) and the results obtained were investigated by statistical means as to their potential relation with the iron status parameters conventionally used in medicine. A low δ(56)Fe value was demonstrated to coincide with high iron status and a high δ(56)Fe value with low iron status, thus reflecting the response of the body to this iron status in terms of iron uptake, distribution between blood and stores and mobilization of storage iron. In a second phase, the iron isotopic composition in blood from patients treated for hemochromatosis type I and from patients with anemia of chronic disease (ACD) was determined. The results for hemochromatosis patients plotted with the values of low iron status, while those for ACD patients plotted with the values of high iron status. By taking a closer look at the aberrant iron metabolism that comes with these diseases, it can be seen that the patient samples confirm the conclusions drawn for the reference population. Patients with hemochromatosis type I have a strongly upregulated iron uptake, like healthy individuals with low iron status. The metabolism of patients suffering from ACD tries to remove iron from the circulation by downregulating the iron uptake, moving more absorbed iron to the stores and by not using any iron from these storage sites, which is in agreement with the responses of the human body to high iron status. This suggests that the conclusions made for healthy individuals are extendable to patients with aberrant iron metabolism.

Also flagged:Vanadiumtransitionmembranescoordinationmetal ionsvanadyl
Journal Article 2013-11-01 No Snippets Willsky GR, Halvorsen K, Godzala ME, Chi LH, Most MJ, Kaszynski P, Crans DC, Goldfine AB, Kostyniak PJ.
Show Full Abstract

Vanadium, abbreviated V, is an early transition metal that readily forms coordination complexes with a variety of biological products such as proteins, metabolites, membranes and other structures. The formation of coordination complexes stabilizes metal ions, which in turn impacts the biodistribution of the metal. To understand the biodistribution of V, V in oxidation state iv in the form of vanadyl sulfate (25, 50, 100 mg V daily) was given orally for 6 weeks to 16 persons with type 2 diabetes. Elemental V was determined using Graphite Furnas Atomic Absorption Spectrometry against known concentrations of V in serum, blood or urine. Peak serum V levels were 15.4 ± 6.5, 81.7 ± 40 and 319 ± 268 ng ml(-1) respectively, and mean peak serum V was positively correlated with dose administered (r = 0.992, p = 0.079), although large inter-individual variability was found. Total serum V concentration distribution fit a one compartment open model with a first order rate constant for excretion with mean half times of 4.7 ± 1.6 days and 4.6 ± 2.5 days for the 50 and 100 mg V dose groups respectively. At steady state, 24 hour urinary V output was 0.18 ± 0.24 and 0.97 ± 0.84 mg in the 50 and 100 mg V groups respectively, consistent with absorption of 1 percent or less of the administered dose. Peak V in blood and serum were positively correlated (r = 0.971, p < 0.0005). The serum to blood V ratio for the patients receiving 100 mg V was 1.7 ± 0.45. Regression analysis showed that glycohemoglobin was a negative predictor of the natural log(ln) peak serum V (R(2) = 0.40, p = 0.009) and a positive predictor of the euglycemic-hyperinsulinemic clamp results at high insulin values (R(2) = 0.39, p = 0.010). Insulin sensitivity measured by euglycemic-hyperinsulinemic clamp was not significantly correlated with ln peak serum V. Globulin and glycohemoglobin levels taken together were negative predictors of fasting blood glucose (R(2) = 0.49, p = 0.013). Although V accumulation in serum was dose-dependent, no correlation between total serum V concentration and the insulin-like response was found in this first attempt to correlate anti-diabetic activity with total serum V. This study suggests that V pools other than total serum V are likely related to the insulin-like effect of this metal. These results, obtained in diabetic patients, document the need for consideration of the coordination chemistry of metabolites and proteins with vanadium in anti-diabetic vanadium complexes.

Also flagged:bicyclospirooxindolesynthesismarcfortine BSpirocyclic Oxindole AlkaloidsPalladium
Journal Article 2013-11-01 No Snippets Trost BM, Bringley DA, Zhang T, Cramer N.
Show Full Abstract

The marcfortines are complex secondary metabolites that show potent anthelmintic activity and are characterized by the presence of a bicyclo[2.2.2]diazaoctane fused to a spirooxindole. Herein, we report the synthesis of two members of this family. The synthesis of marcfortine B utilizes a carboxylative TMM cycloaddition to establish the spirocyclic core, followed by an intramolecular Michael addition and oxidative radical cyclization to access the strained bicyclic ring system. In addition, the first asymmetric synthesis of (−)-marcfortine C is described. The key step involves a cyano-substituted TMM cycloaddition, which proceeds in nearly quantitative yield with high diastereo- and enantioselectivity. The resulting chiral center was used to establish all remaining stereocenters in the natural product.

Also flagged:silencingCNS disordersCNS diseasesRNA silencingRNA-silencinggene expression
Journal Article 2013-11-01 ✓ 1 Snippet Hutson TH, Foster E, Moon LD, Yáñez-Muñoz RJ.
In-Text Gene Mentions

HTT

Show Full Abstract

RNA silencing is an established method for investigating gene function and has attracted particular interest because of the potential for generating RNA-based therapeutics. Using lentiviral vectors as an efficient delivery system that offers stable, long-term expression in postmitotic cells further enhances the applicability of an RNA-based gene therapy for the CNS. In this review we provide an overview of both lentiviral vectors and RNA silencing along with design considerations for generating lentiviral vectors capable of RNA silencing. We go on to describe the current preclinical data regarding lentiviral vector-mediated RNA silencing for CNS disorders and discuss the concerns of side effects associated with lentiviral vectors and small interfering RNAs and how these might be mitigated.

Also flagged:OPNmineralcollagenhydroxyapatiteamino acidslysine
Journal Article 2013-11-01 No Snippets Nikel O, Laurencin D, McCallum SA, Gundberg CM, Vashishth D.
Show Full Abstract

Mechanical resilience of bone tissue decreases with age. The ability to comprehensively probe and understand bone properties could help alleviate this problem. One important aspect of bone quality that has recently been made evident is the presence of dilatational bands formed by osteocalcin (OC) and osteopontin (OPN), which contribute to fracture toughness. However, experimental evidence of the structural role of these two proteins at the organic-mineral interface in bone is still needed. Solid state nuclear magnetic resonance (SSNMR) is emerging as a useful technique in probing molecular level aspects of bone. Here, we present the first SSNMR study of bone tissue from genetically modified mice lacking OC and/or OPN. Probing the mineral phase, the organic matrix and their interface revealed that, despite the absence of OC and OPN, the organic matrix and mineral were well preserved, and the overall exposure of collagen to hydroxyapatite (HA) nanoparticles was hardly affected. However, the proximity to the HA surface was slightly increased for a number of bone components including less abundant amino acids like lysine, suggesting that this is how the tissue compensates for the lack of OC and OPN. Taken together, the NMR data supports the recently proposed model, in which the contribution of OC-OPN to fracture toughness is related to their presence at the extrafibrillar organic-mineral interfaces, where they reinforce the network of mineralized fibrils and form dilatational bands. In an effort toward further understanding the structural role of individual amino acids of low abundance in bone, we then explored the possibility of specific (13)C enrichment of mouse bone, and report the first SSNMR spectra of 97% (13)C lysine-enriched tissue. Results show that such isotopic enrichment allows valuable molecular-level structural information to be extracted, and sheds light on post-translational modifications undergone by specific amino acids in vivo.

Also flagged:ironsilverhepcidin antimicrobial peptideiron-restricted anemiabone morphogenetic proteinhereditary hemochromatosis
Journal Article 2013-11-01 ✓ 4 Snippets Roy CN.
In-Text Gene Mentions

The discovery of these proteins and their interactions with "old friends," such as the 1st known hereditary hemochromatosis gene product, HFE and transferrin receptor, has opened the field of iron homeostasis to include regulatory networks involving signal transduction pathways, in particular, the mitogen-activated protein kinase and Smad pathways.

…patients with inheritedhemochromatosisfrom across the…

…hemochromatosis gene product,HFEand transferrin receptor,…

…egulatory disorders, includinghemochromatosis.…

Show Full Abstract

A classic Girl Scout song says, "Make new friends/but keep the old/One is silver/and the other gold." This review focuses on the past decade of discovery in the field of iron homeostasis, which has identified "new friends" or key modifiers of the critical systemic iron regulator, hepcidin antimicrobial peptide. The foundation for these discoveries has been the identification of mutated genes in well-characterized cohorts of patients with inherited hemochromatosis from across the globe. Transgenic mouse models of iron overload and iron-restricted anemia have also contributed to understanding molecular pathophysiology in ways that could never be accomplished in human subjects alone. The majority of these newly discovered molecules coordinate signaling through the bone morphogenetic protein pathway of ligands, receptors and coreceptors, intracellular signaling and transcription. The discovery of these proteins and their interactions with "old friends," such as the 1st known hereditary hemochromatosis gene product, HFE and transferrin receptor, has opened the field of iron homeostasis to include regulatory networks involving signal transduction pathways, in particular, the mitogen-activated protein kinase and Smad pathways. These newly discovered partnerships have also made way for opportunities to develop novel therapeutics for the treatment of iron regulatory disorders, including hemochromatosis.

Also flagged:non-small cell lung cancercancertumorbenignNSCLCprimary tumor
Journal Article 2013-11-01 No Snippets Ulivi P, Silvestrini R.
Show Full Abstract

<h4>Background</h4>The release of DNA into peripheral blood is a common event in cancer patients, occurring as a consequence of necrotic and apoptotic processes typical of tumor cells. However, free circulating DNA (fcDNA) is also present in patients with benign diseases and in healthy individuals. Both quantitative and qualitative aspects of fcDNA have been studied as potential biomarkers in a number of tumor types. In particular, quantitative analysis of fcDNA has been shown to play an important role in the diagnosis of non-small cell lung cancer (NSCLC), because of its ability to discriminate between healthy subjects and individuals with NSCLC. Additionally, fcDNA in cancer patients derives predominantly from tumor tissue and, as such, it can be used for the molecular characterization of the primary tumor. Targeted therapies in NSCLC have, in recent years, produced promising results, highlighting the importance of molecular profiling of the primary cancer lesions. Considering that little or no tumor material is available for at least some of the patients, the possibility of using fcDNA for molecular analysis becomes increasingly important. In the present review we evaluated several quantitative and qualitative aspects of fcDNA that could be instrumental for the differential diagnosis of lung disease.<h4>Conclusions</h4>There is ample evidence in the literature to support the possible use of peripheral blood-derived fcDNA in the early diagnosis and molecular characterization of lung cancer. This non-invasive method may also turn out to be valuable in monitoring drug response and in identifying induced mechanisms of drug resistance. Before it can be implemented in routine clinical practice, however, additional efforts are needed to standardize the methodology.

Also flagged:acetic anhydridesilicaphenolsodiumaminoSuccinyl
Journal Article 2013-11-01 ✓ 1 Snippet Zhang YJ, Shen LL, Cheon HG, Xu YN, Jeong JH.
In-Text Gene Mentions

DCC

Show Full Abstract

In this study, a series of fused-heterocyclic derivatives were systematically designed and synthesized using an efficient route, and evaluated in terms of GLP-1R agonist activity. We employed short synthetic steps and reactions that are tolerant of the presence of various functional groups and suitable for parallel operations to enable the rapid generation of libraries of diverse and structurally complex small molecules. Of the compounds synthesized, 3-(8-chloro-6-(trifluoromethyl)imidazo[1,2-a] pyridin-2-yl)phenyl methanesulfonate (8e) was the most potent agonist with an EC50 of 7.89 μM, and thus is the compound with the greatest potential for application. These findings represent a valuable starting point for the design and discovery of small-molecule GLP-1R agonists that can be administered orally.

Also flagged:tyrosine kinaseBCR-ABLponatinibchronic myeloid leukemiaCMLALL
Journal Article 2013-11-01 No Snippets Cortes JE, Kim DW, Pinilla-Ibarz J, le Coutre P, Paquette R, Chuah C, Nicolini FE, Apperley JF, Khoury HJ, Talpaz M, DiPersio J, DeAngelo DJ, Abruzzese E, Rea D, Baccarani M, Müller MC, Gambacorti-Passerini C, Wong S, Lustgarten S, Rivera VM, Clackson T, Turner CD, Haluska FG, Guilhot F, Deininger MW, Hochhaus A, Hughes T, Goldman JM, Shah NP, Kantarjian H, PACE Investigators.
Show Full Abstract

<h4>Background</h4>Ponatinib is a potent oral tyrosine kinase inhibitor of unmutated and mutated BCR-ABL, including BCR-ABL with the tyrosine kinase inhibitor-refractory threonine-to-isoleucine mutation at position 315 (T315I). We conducted a phase 2 trial of ponatinib in patients with chronic myeloid leukemia (CML) or Philadelphia chromosome-positive acute lymphoblastic leukemia (Ph-positive ALL).<h4>Methods</h4>We enrolled 449 heavily pretreated patients who had CML or Ph-positive ALL with resistance to or unacceptable side effects from dasatinib or nilotinib or who had the BCR-ABL T315I mutation. Ponatinib was administered at an initial dose of 45 mg once daily. The median follow-up was 15 months.<h4>Results</h4>Among 267 patients with chronic-phase CML, 56% had a major cytogenetic response (51% of patients with resistance to or unacceptable side effects from dasatinib or nilotinib and 70% of patients with the T315I mutation), 46% had a complete cytogenetic response (40% and 66% in the two subgroups, respectively), and 34% had a major molecular response (27% and 56% in the two subgroups, respectively). Responses were observed regardless of the baseline BCR-ABL kinase domain mutation status and were durable; the estimated rate of a sustained major cytogenetic response of at least 12 months was 91%. No single BCR-ABL mutation conferring resistance to ponatinib was detected. Among 83 patients with accelerated-phase CML, 55% had a major hematologic response and 39% had a major cytogenetic response. Among 62 patients with blast-phase CML, 31% had a major hematologic response and 23% had a major cytogenetic response. Among 32 patients with Ph-positive ALL, 41% had a major hematologic response and 47% had a major cytogenetic response. Common adverse events were thrombocytopenia (in 37% of patients), rash (in 34%), dry skin (in 32%), and abdominal pain (in 22%). Serious arterial thrombotic events were observed in 9% of patients; these events were considered to be treatment-related in 3%. A total of 12% of patients discontinued treatment because of an adverse event.<h4>Conclusions</h4>Ponatinib had significant antileukemic activity across categories of disease stage and mutation status. (Funded by Ariad Pharmaceuticals and others; PACE ClinicalTrials.gov number, NCT01207440 .).

Also flagged:SMG1Suppressor of morphogenesis in genitalia 1phosphatidylinositol 3-kinase-related kinaseUpf1SMG5-7proline-rich nuclear receptor coregulatory protein
Journal Article 2013-11-01 ✓ 4 Snippets Cho H, Han S, Park OH, Kim YK.
In-Text Gene Mentions

…in staufen 1 (Stau1)-mediated mRNA decay (SMD),…

…is complexed withStau1, Upf1, and Dcp1a.…

…by artificially tetheredStau1or Upf1 downstream…

…Furthermore,Stau1and Upf1 colocalize…

Show Full Abstract

Suppressor of morphogenesis in genitalia 1 (SMG1), a member of the phosphatidylinositol 3-kinase-related kinase family, is involved in nonsense-mediated mRNA decay (NMD). SMG1 phosphorylates Upf1, a key NMD factor. Subsequently, hyperphosphorylated Upf1 associates with SMG5-7 or proline-rich nuclear receptor coregulatory protein (PNRC2) to elicit rapid mRNA degradation. Upf1 is also known to be involved in staufen 1 (Stau1)-mediated mRNA decay (SMD), which is closely related to NMD. However, the biological and molecular roles of SMG1 in SMD remain unknown. Here, we provide evidence that SMG1 is involved in SMD. The immunoprecipitation results show that SMG1 is complexed with Stau1, Upf1, and Dcp1a. Downregulation of SMG1 or overexpression of a kinase-inactive mutant of SMG1 inhibits SMD efficiency. In addition, downregulation of SMG1 inhibits rapid degradation elicited by artificially tethered Stau1 or Upf1 downstream of the normal termination codon. Furthermore, Stau1 and Upf1 colocalize in processing bodies in an SMG1-dependent manner. We also find that the level of SMG1 increases during adipogenesis. Accordingly, downregulation of SMG1 causes the reduction in the level of Upf1 phosphorylation and delays adipogenesis, suggesting the functional involvement of SMG1 in adipogenesis via SMD.

Also flagged:MenaRac1connexin 43EnaVASPactin regulatory proteins
Journal Article 2013-11-01 ✓ 1 Snippet Ram R, Wescott AP, Varandas K, Dirksen RT, Blaxall BC.
In-Text Gene Mentions

Ras GTPase-activating-like protein 1

Show Full Abstract

Mena, a member of the Ena/VASP family of actin regulatory proteins, modulates microfilaments and interacts with cytoskeletal proteins associated with heart failure. Mena is localized at the intercalated disc (ICD) of adult cardiac myocytes, colocalizing with numerous cytoskeletal proteins. Mena's role in the maintainence of mechanical myocardial stability at the cardiomyocyte ICD remains unknown. We hypothesized that Mena may modulate signals from the sarcolemma to the actin cytoskeleton at the ICD to regulate the expression and localization of connexin 43 (Cx43). The small GTPase Rac1 plays a pivotal role in the regulation of actin cytoskeletal reorganization and mediating morphological and transcriptional changes in cardiomyocytes. We found that Mena is associated with active Rac1 in cardiomyocytes and that RNAi knockdown of Mena increased Rac1 activity significantly. Furthermore, Mena knockdown increased Cx43 expression and altered Cx43 localization and trafficking at the ICD, concomitant with faster intercellular communication, as assessed by dye transfer between cardiomyocyte pairs. In mice overexpressing constitutively active Rac1, left ventricular Mena expression was increased significantly, concomitant with lateral redistribution of Cx43. These results suggest that Mena is a critical regulator of the ICD and is required for normal localization of Cx43 in part via regulation of Rac1.

Also flagged:Hepcidinpeptide hormoneirondisordersinsufficiencyhereditary hemochromatosis
Journal Article 2013-11-01 ✓ 1 Snippet Fung E, Nemeth E.
In-Text Gene Mentions

HFE

Show Full Abstract

Hepcidin, the liver-produced peptide hormone, is a principal regulator of iron homeostasis. Abnormal hepcidin production has emerged as a causative factor in several common iron disorders. Hepcidin insufficiency results in iron overload in hereditary hemochromatosis and iron-loading anemias, whereas hepcidin excess causes or contributes to the development of iron-restricted anemias in inflammatory diseases, infections, some cancers and chronic kidney disease. Not surprisingly, hepcidin and related pathways have become the target for the development of novel therapeutics for iron disorders. In this review, we will summarize the strategies and development programs that have been devised for agonizing or antagonizing hepcidin and its receptor ferroportin.

Also flagged:watersodiumpentobarbitalspermatogenesisnitrogenparaformaldehyde
Journal Article 2013-11-01 ✓ 1 Snippet Ouh IO, Seo MG, Shah FA, Gim SA, Koh PO.
In-Text Gene Mentions

Prdx6-knockout mice were more…

Show Full Abstract

Testicular torsion is a urological emergency that leads to serious testicular damage and male infertility. We performed this study to identify specific proteins that are differentially expressed in response to testicular torsion and detorsion-induced ischemia-reperfusion (I-R) injury. Adult male rats were divided into two groups: a sham-operated group and a testicular I-R group. Testicular torsion was induced by rotating the left testis 720° in a clockwise direction for 1 hr, and then, detorsion was performed for 24 hr. After this testicular tissues were collected, protein analysis was performed using two-dimensional gel electrophoresis and Western blot analyses. Testicular I-R injury resulted in serious histopathologic damage to the germinal cells in the seminiferous tubules and increased the number of TUNEL-positive cells in testicular tissue. Specific protein spots with a greater than 2.5-fold change in intensity between the sham-operated and testicular I-R groups were identified by mass spectrometry. Among these proteins, levels of peroxiredoxin 6, thioredoxin, heterogeneous nuclear ribonucleoproteins, ubiquitin carboxyl terminal hydrolase isozyme L5 and zinc finger AN1-type domain 3 were decreased in the testicular I-R group compared to the sham-operated group. Moreover, Western blot analysis clearly showed the decrease of these proteins in the testicular I-R group. These proteins have spermatogenesis and anti-oxidative functions. These findings suggest that testicular I-R results in cell death due to altered expression of several proteins with spermatogenesis and anti-oxidation functions.

Also flagged:Ribosomesribonucleoproteinnucleotidesnucleolusnucleotidebinding
Journal Article 2013-11-01 No Snippets Woolford JL, Baserga SJ.
Show Full Abstract

Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes.

Also flagged:fluoxetinegeneralized anxiety disorderpsychiatric disordersserotoninmirtazapinediazepam
Journal Article 2013-11-01 ✓ 3 Snippets Zou C, Ding X, Flaherty JH, Dong B.
In-Text Gene Mentions

Furthermore, a number of studies have shown that serotonin transporter (5-HTT) variation in genotypes were associated with different efficacy/response to SSRIs in both depression and GAD.33,34 A meta-analysis has demonstrated the long variant of the serotonin transporter gene, which leads to higher expression of brain 5-HTT compared to the deletion variant (short allele).

…that serotonin transporter (5-HTT) variation in genotypes…

…expression of brain5-HTTcompared to the…

Show Full Abstract

<h4>Background</h4>Generalized anxiety disorder (GAD) is a prevalent, disabling disease and is highly comorbid with other psychiatric disorders both in Western countries and the People's Republic of China. Fluoxetine, a selective inhibitor of serotonin reuptake (SSRI), is widely utilized in the management of GAD in clinical practice despite the lack of strong evidence. This article reviews fluoxetine trials to investigate fluoxetine's efficacy and tolerability in Chinese patients with GAD.<h4>Methods</h4>A literature review was conducted using the following databases up to and including April 2013: Chinese BioMedical Literature, China National Knowledge Infrastructure, EMBASE, MEDLINE, and PsycINFO. We selected clinical studies that utilized fluoxetine for GAD in which all participants were Chinese.<h4>Results</h4>Fifteen open-label, non-placebo trials were identified and analyzed; eleven anxiolytics were compared with fluoxetine separately. Short-term efficacy of fluoxetine had been established in these open-label, head-to-head controlled trials. Fluoxetine had rapid onset of action (approximately 1-2 weeks) and seemed to be effective in maintenance treatment. Fluoxetine was generally well-tolerated with the most common side effect of dry month and nausea. Compared to other anxiolytic agents, fluoxetine was equivalent with all of the comparative anxiolytics in terms of efficacy except mirtazapine which showed conflicting results with fluoxetine in two studies. In terms of side effects, fluoxetine was better tolerated than diazepam, doxepine, and amitriptyline, less tolerated than escitalopram, and had similar tolerability with duloxetine as well as alprazolam.<h4>Conclusion</h4>Given the high risk of bias of the included studies, the overall small sample size of the studies, the lack of placebo control groups as well as the lack of certain clinically meaningful outcomes, it is not possible to recommend fluoxetine as a reliable first-line treatment in Chinese patients with GAD. Furthermore, no definitive implications for clinical practice in choosing anxiolytics can be drawn from this review. Trials with larger sample sizes, better quality, longer duration, and more clinically meaningful outcomes are needed in future research.

Also flagged:ribosomesMitochondriaphosphorylationcytoplasmicRNA helicasesRNA chaperones
Journal Article 2013-11-01 ✓ 2 Snippets De Silva D, Fontanesi F, Barrientos A.
In-Text Gene Mentions

…proteins Mrpl16 andMrpl39.…

Mrpl39

Show Full Abstract

Proteins in a cell are universally synthesized by ribosomes. Mitochondria contain their own ribosomes, which specialize in the synthesis of a handful of proteins required for oxidative phosphorylation. The pathway of mitoribosomal biogenesis and factors involved are poorly characterized. An example is the DEAD box proteins, widely known to participate in the biogenesis of bacterial and cytoplasmic eukaryotic ribosomes as either RNA helicases or RNA chaperones, whose mitochondrial counterparts remain completely unknown. Here, we have identified the Saccharomyces cerevisiae mitochondrial DEAD box protein Mrh4 as essential for large mitoribosome subunit biogenesis. Mrh4 interacts with the 21S rRNA, mitoribosome subassemblies, and fully assembled mitoribosomes. In the absence of Mrh4, the 21S rRNA is matured and forms part of a large on-pathway assembly intermediate missing proteins Mrpl16 and Mrpl39. We conclude that Mrh4 plays an essential role during the late stages of mitoribosome assembly by promoting remodeling of the 21S rRNA-protein interactions.

Also flagged:type 2 diabetesCell growthenhancer of zeste homolog 2EZH2cyclin-dependent kinase inhibitor 2aobesity
Journal Article 2013-11-01 ✓ 1 Snippet Zhou JX, Dhawan S, Fu H, Snyder E, Bottino R, Kundu S, Kim SK, Bhushan A.
In-Text Gene Mentions

histone methyltransferase called

Show Full Abstract

Inadequate functional β cell mass underlies both type 1 and type 2 diabetes. β Cell growth and regeneration also decrease with age through mechanisms that are not fully understood. Age-dependent loss of enhancer of zeste homolog 2 (EZH2) prevents adult β cell replication through derepression of the gene encoding cyclin-dependent kinase inhibitor 2a (INK4a). We investigated whether replenishing EZH2 could reverse the age-dependent increase of Ink4a transcription. We generated an inducible pancreatic β cell-specific Ezh2 transgenic mouse model and showed that transgene expression of Ezh2 was sufficient to increase β cell replication and regeneration in young adult mice. In mice older than 8 months, induction of Ezh2 was unable to repress Ink4a. Older mice had an enrichment of a trithorax group (TrxG) protein complex at the Ink4a locus. Knockdown of TrxG complex components, in conjunction with expression of Ezh2, resulted in Ink4a repression and increased replication of β cells in aged mice. These results indicate that combined modulation of polycomb group proteins, such as EZH2, along with TrxG proteins to repress Ink4a can rejuvenate the replication capacity of aged β cells. This study provides potential therapeutic targets for expansion of adult β cell mass.

Also flagged:deathnerve growthNGFtyrosine kinase receptortropomyosin receptor kinase ATrkA
Journal Article 2013-11-01 ✓ 1 Snippet Dekkers MP, Nikoletopoulou V, Barde YA.
In-Text Gene Mentions

…the dependence receptorDCC(deleted in colorectal…

Show Full Abstract

The concept that target tissues determine the survival of neurons has inspired much of the thinking on neuronal development in vertebrates, not least because it is supported by decades of research on nerve growth factor (NGF) in the peripheral nervous system (PNS). Recent discoveries now help to understand why only some developing neurons selectively depend on NGF. They also indicate that the survival of most neurons in the central nervous system (CNS) is not simply regulated by single growth factors like in the PNS. Additionally, components of the cell death machinery have begun to be recognized as regulators of selective axonal degeneration and synaptic function, thus playing a critical role in wiring up the nervous system.

Also flagged:liver diseaseIsoleucineMethioninepatatin-like phospholipase domain-containing 3lipidmetabolism
Journal Article 2013-11-01 No Snippets Dongiovanni P, Donati B, Fares R, Lombardi R, Mancina RM, Romeo S, Valenti L.
Show Full Abstract

The 148 Isoleucine to Methionine protein variant (I148M) of patatin-like phospholipase domain-containing 3 (PNPLA3), a protein is expressed in the liver and is involved in lipid metabolism, has recently been identified as a major determinant of liver fat content. Several studies confirmed that the I148M variant predisposes towards the full spectrum of liver damage associated with fatty liver: from simple steatosis to steatohepatitis and progressive fibrosis. Furthermore, the I148M variant represents a major determinant of progression of alcohol related steatohepatitis to cirrhosis, and to influence fibrogenesis and related clinical outcomes in chronic hepatitis C virus hepatitis, and possibly chronic hepatitis B virus hepatitis, hereditary hemochromatosis and primary sclerosing cholangitis. All in all, studies suggest that the I148M polymorphism may represent a general modifier of fibrogenesis in liver diseases. Remarkably, the effect of the I148M variant on fibrosis was independent of that on hepatic steatosis and inflammation, suggesting that it may affect both the quantity and quality of hepatic lipids and the biology of non-parenchymal liver cells besides hepatocytes, directly promoting fibrogenesis. Therefore, PNPLA3 is a key player in liver disease progression. Assessment of the I148M polymorphism will possibly inform clinical practice in the future, whereas the determination of the effect of the 148M variant will reveal mechanisms involved in hepatic fibrogenesis.

Also flagged:Huntington diseaseHDneurodegenerative disorderspolyglutaminechromosomechorea
Journal Article 2013-11-01 ✓ 5 Snippets Abada YS, Nguyen HP, Ellenbroek B, Schreiber R.
In-Text Gene Mentions

Chorea and psychiatric symptoms are hallmarks of Huntington disease (HD), a neurodegenerative disorder, genetically characterized by the presence of expanded CAG repeats (>35) in the HUNTINGTIN (HTT) gene.

…the HUNTINGTIN (HTT) gene on…

…of age abundanthttaggregates in the…

…BACHD rats showhttaggregates in both…

…the emergence ofhttaggregates in brain…

Show Full Abstract

Chorea and psychiatric symptoms are hallmarks of Huntington disease (HD), a neurodegenerative disorder, genetically characterized by the presence of expanded CAG repeats (>35) in the Huntingtin (HTT) gene. HD patients present psychiatric symptoms prior to the onset of motor symptoms and we recently found a similar emergence of non motor and motor deficits in BACHD rats carrying the human full length mutated HTT (97 CAG-CAA repeats). We evaluated cognitive performance in reversal learning and associative memory tests in different age cohorts of BACHD rats. Male wild type (WT) and transgenic (TG) rats between 2 and 12 months of age were tested. Learning and strategy shifting were assessed in a cross-maze test. Associative memory was evaluated in different fear conditioning paradigms (context, delay and trace). The possible confound of a fear conditioning phenotype by altered sensitivity to a 'painful' stimulus was assessed in a flinch-jump test. In the cross maze, 6 months old TG rats showed a mild impairment in reversal learning. In the fear conditioning tasks, 4, 6 and 12 months old TG rats showed a marked reduction in contextual fear conditioning. In addition, TG rats showed impaired delay conditioning (9 months) and trace fear conditioning (3 months). This phenotype was unlikely to be affected by a change in 'pain' sensitivity as WT and TG rats showed no difference in their threshold response in the flinch-jump test. Our results suggest that BACHD rats have a profound associative memory deficit and, possibly, a deficit in reversal learning as assessed in a cross maze task. The time course for the emergence of these symptoms (i.e., before the occurrence of motor symptoms) in this rat model for HD appears similar to the time course in patients. These data suggest that BACHD rats may be a useful model for preclinical drug discovery.

Also flagged:5-Fluorouracilsolid tumourscolorectal canceruracilcancershead cancer
Journal Article 2013-11-01 No Snippets Mojardín L, Botet J, Quintales L, Moreno S, Salas M.
Show Full Abstract

5-Fluorouracil (5FU) is a chemotherapeutic drug widely used in treating a range of advanced, solid tumours and, in particular, colorectal cancer. Here, we used high-density tiling DNA microarray technology to obtain the specific transcriptome-wide response induced by 5FU in the eukaryotic model Schizosaccharomyces pombe. This approach combined with real-time quantitative PCR analysis allowed us to detect splicing defects of a significant number of intron-containing mRNA, in addition to identify some rRNA and tRNA processing defects after 5FU treatment. Interestingly, our studies also revealed that 5FU specifically induced the expression of certain genes implicated in the processing of mRNA, tRNA and rRNA precursors, and in the post-transcriptional modification of uracil residues in RNA. The transcription of several tRNA genes was also significantly induced after drug exposure. These transcriptional changes might represent a cellular response mechanism to counteract 5FU damage since deletion strains for some of these up-regulated genes were hypersensitive to 5FU. Moreover, most of these RNA processing genes have human orthologs that participate in conserved pathways, suggesting that they could be novel targets to improve the efficacy of 5FU-based treatments.

Also flagged:Raf-1 kinaseductal breast cancerRaf Kinase inhibitory proteinRKIPcancersbreast cancer
Journal Article 2013-11-01 No Snippets Al-Mulla F, Bitar MS, Thiery JP, Zea TT, Chatterjee D, Bennett L, Park S, Edwards J, Yeung KC.
Show Full Abstract

Raf Kinase inhibitory protein (RKIP) is a well-established metastasis suppressor that is frequently downregulated in aggressive cancers. The impact of RKIP and its phosphorylated form on disease-free survival (DFS) and other clinicopathological parameters in breast cancer is yet to be discovered. To this end, we examined RKIP expression in 3 independent breast cancer cohorts. At the Protein level, loss or reduced total RKIP expression was associated with large-sized tumors characterized by high proliferative index, high-grade and diminished estrogen (ER) and progesterone receptor expression. Loss or diminution of RKIP expression was significantly associated with shorter DFS in all cohorts. Moreover, the complete loss of p-RKIP was an independent prognostic factor using multivariate analysis in operable invasive ductal breast cancer. We show for the first time that ER, partly, drives RKIP expression through MTA3-Snail axis. Consistent with this finding, we found that, at the mRNA level, RKIP expression varied significantly across the different molecular subtypes of breast cancer with the Luminal (ER+) subtype expressing high levels of RKIP and the more aggressive Claudin-low (ER-) subtype, which depicted the highest epithelial to mesenchymal transition (EMT) registered the lowest RKIP expression levels. In conclusion, loss of expression/diminution of RKIP or its phosphorylated form is associated with poor diseases-free survival in breast cancer. Determining the expression of RKIP and p-RKIP adds significant prognostic value to the management and subtyping of this disease.

Also flagged:prostacyclin synthasenitric oxide synthaseDiabetic endothelial dysfunctionendothelium-dependentendothelial nitric oxide synthaseeNOS
Journal Article 2013-11-01 No Snippets Safiah Mokhtar S, M Vanhoutte P, W S Leung S, Imran Yusof M, Wan Sulaiman WA, Zaharil Mat Saad A, Suppian R, Ghulam Rasool AH.
Show Full Abstract

Diabetic endothelial dysfunction is characterized by impaired endothelium-dependent relaxation. In this study, we measured the expression of endothelial nitric oxide synthase (eNOS), cyclooxygenase-1 (COX-1), cyclooxygenase-2 (COX-2), prostacyclin synthase (PGIS), and prostacyclin receptor (IP) in subcutaneous arteries of type-2 diabetic and non-diabetic patients. Subcutaneous arteries were dissected from tissues from seven diabetics (4 males and 3 females) and seven non-diabetics (5 males and 2 females) aged between 18 to 65 years, who underwent lower limb surgical procedures. Diabetics had higher fasting blood glucose compared to non-diabetics, but there were no differences in blood pressure, body mass index and age. Patients were excluded if they had uncontrolled hypertension, previous myocardial infarction, coronary heart disease, renal or hepatic failure and tumor. The relative expression levels of eNOS, COX-1, COX-2, PGIS and IP receptor were determined by Western blotting analysis, normalized with the β-actin level. Increased expression of COX-2 was observed in subcutaneous arteries of diabetics compared to non-diabetics, whereas the expression levels of eNOS and PGIS were significantly lower in diabetics. There were no significant differences in expression levels of COX-1 and IP receptor between the two groups. Immunohistochemical study of subcutaneous arteries showed that the intensities of eNOS and PGIS staining were lower in diabetics, with higher COX-2 staining. In conclusion, type-2 diabetes is associated with higher COX-2 expression, but lower eNOS and PGIS expression in subcutaneous arteries. These alterations may lead to impaired endothelium-dependent vasodilatation, and thus these proteins may be potential targets for protection against the microvascular complications of diabetes.

Also flagged:transmitterInt1depolarizationpyrokininpeptidemill rhythm
Journal Article 2013-11-01 No Snippets Rodriguez JC, Blitz DM, Nusbaum MP.
Show Full Abstract

Different modulatory inputs commonly elicit distinct rhythmic motor patterns from a central pattern generator (CPG), but they can instead elicit the same pattern. We are determining the rhythm-generating mechanisms in this latter situation, using the gastric mill (chewing) CPG in the crab (Cancer borealis) stomatogastric ganglion, where stimulating the projection neuron MCN1 (modulatory commissural neuron 1) or bath applying CabPK (C. borealis pyrokinin) peptide elicits the same gastric mill motor pattern, despite configuring different gastric mill circuits. In both cases, the core rhythm generator includes the same reciprocally inhibitory neurons LG (lateral gastric) and Int1 (interneuron 1), but the pyloric (food-filtering) circuit pacemaker neuron AB (anterior burster) is additionally necessary only for CabPK rhythm generation. MCN1 drives this rhythm generator by activating in the LG neuron the modulator-activated inward current (IMI), which waxes and wanes periodically due to phasic feedback inhibition of MCN1 transmitter release. Each buildup of IMI enables the LG neuron to generate a self-terminating burst and thereby alternate with Int1 activity. Here we establish that CabPK drives gastric mill rhythm generation by activating in the LG neuron IMI plus a slowly activating transient, low-threshold inward current (ITrans-LTS) that is voltage, time, and Ca(2+) dependent. Unlike MCN1, CabPK maintains a steady IMI activation, causing a subthreshold depolarization in LG that facilitates a periodic postinhibitory rebound burst caused by the regular buildup and decay of the availability of ITrans-LTS. Thus, different modulatory inputs can use different rhythm-generating mechanisms to drive the same neuronal rhythm. Additionally, the same ionic current (IMI) can play different roles under these different conditions, while different currents (IMI, ITrans-LTS) can play the same role.

Also flagged:epilepsyLGI1limbic encephalitisADAM22AMPA receptorsautosomal dominant lateral temporal lobe epilepsy
Journal Article 2013-11-01 ✓ 2 Snippets Ohkawa T, Fukata Y, Yamasaki M, Miyazaki T, Yokoi N, Takashima H, Watanabe M, Watanabe O, Fukata M.
In-Text Gene Mentions

…surface antigens includingDCC, DPP10, and ADAM23.…

DCC

Show Full Abstract

More than 30 mutations in LGI1, a secreted neuronal protein, have been reported with autosomal dominant lateral temporal lobe epilepsy (ADLTE). Although LGI1 haploinsufficiency is thought to cause ADLTE, the underlying molecular mechanism that results in abnormal brain excitability remains mysterious. Here, we focused on a mode of action of LGI1 autoantibodies associated with limbic encephalitis (LE), which is one of acquired epileptic disorders characterized by subacute onset of amnesia and seizures. We comprehensively screened human sera from patients with immune-mediated neurological disorders for LGI1 autoantibodies, which also uncovered novel autoantibodies against six cell surface antigens including DCC, DPP10, and ADAM23. Our developed ELISA arrays revealed a specific role for LGI1 antibodies in LE and concomitant involvement of multiple antibodies, including LGI1 antibodies in neuromyotonia, a peripheral nerve disorder. LGI1 antibodies associated with LE specifically inhibited the ligand-receptor interaction between LGI1 and ADAM22/23 by targeting the EPTP repeat domain of LGI1 and reversibly reduced synaptic AMPA receptor clusters in rat hippocampal neurons. Furthermore, we found that disruption of LGI1-ADAM22 interaction by soluble extracellular domain of ADAM22 was sufficient to reduce synaptic AMPA receptors in rat hippocampal neurons and that levels of AMPA receptor were greatly reduced in the hippocampal dentate gyrus in the epileptic LGI1 knock-out mouse. Therefore, either genetic or acquired loss of the LGI1-ADAM22 interaction reduces the AMPA receptor function, causing epileptic disorders. These results suggest that by finely regulating the synaptic AMPA receptors, the LGI1-ADAM22 interaction maintains physiological brain excitability throughout life.

Also flagged:Lynch syndromeType 2 diabetestranslationalcolon cancercolorectal cancerDuchenne muscular dystrophy
Journal Article 2013-11-01 ✓ 1 Snippet Buchanan J, Wordsworth S, Schuh A.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Aim</h4>Genomic interventions could enable improved disease stratification and individually tailored therapies. However, they have had a limited impact on clinical practice to date due to a lack of evidence, particularly economic evidence. This is partly because health economists are yet to reach consensus on whether existing methods are sufficient to evaluate genomic technologies. As different approaches may produce conflicting adoption decisions, clarification is urgently required. This article summarizes the methodological issues associated with conducting economic evaluations of genomic interventions.<h4>Materials & methods</h4>A structured literature review was conducted to identify references that considered the methodological challenges faced when conducting economic evaluations of genomic interventions.<h4>Results</h4>Methodological challenges related to the analytical approach included the choice of comparator, perspective and timeframe. Challenges in costing centered around the need to collect a broad range of costs, frequently, in a data-limited environment. Measuring outcomes is problematic as standard measures have limited applicability, however, alternative metrics (e.g., personal utility) are underdeveloped and alternative approaches (e.g., cost-benefit analysis) underused. Effectiveness data quality is weak and challenging to incorporate into standard economic analyses, while little is known about patient and clinician behavior in this context. Comprehensive value of information analyses are likely to be helpful.<h4>Conclusion</h4>Economic evaluations of genomic technologies present a particular challenge for health economists. New methods may be required to resolve these issues, but the evidence to justify alternative approaches is yet to be produced. This should be the focus of future work in this field.

Also flagged:NMDA receptorsL-argininenitric oxidecyclic guanosine monophosphatedepressive disordersN-methyl-D-aspartate (NMDA) receptors
Journal Article 2013-11-01 No Snippets Freitas AE, Moretti M, Budni J, Balen GO, Fernandes SC, Veronezi PO, Heller M, Micke GA, Pizzolatti MG, Rodrigues AL.
Show Full Abstract

Bark infusion of Tabebuia avellanedae Lorentz ex Griseb is consumed in tropical America folk medicine for the treatment of several diseases, including depressive disorders. It was recently demonstrated that the extract from this plant has antidepressant properties. The present study was aimed at investigating the contribution of N-methyl-D-aspartate (NMDA) receptors and the L-arginine-nitric oxide (NO)-cyclic guanosine 3'5'-monophosphate (cGMP) pathway to the antidepressant-like action of the ethanolic extract from T. avellanedae (EET) in the tail suspension test (TST). The anti-immobility effect of the extract (30 mg/kg, orally [p.o.]) was prevented by pretreatment of mice with NMDA (0.1 pmol/site, intracerebroventicular [i.c.v.]), L-arginine (750 mg/kg, intraperitoneally [i.p.]), and sildenafil (5 mg/kg, i.p.). Additionally, the combination of MK-801 (0.01 mg/kg, p.o.), 7-nitroindazole (25 mg/kg, i.p.), and 1H-[1,2,4]oxadiazole[4,3-a]quinoxalin-1-one (ODQ) (30 pmol/site, i.c.v.) with a subeffective dose of EET (1 mg/kg, p.o.) produced a synergistic antidepressant-like effect in the TST, without causing significant alterations in the locomotor activity. Moreover, the administration of an effective dose of EET (30 mg/kg, p.o.) produced a reduction in NOx levels in the cerebral cortex. Conversely, a subeffective dose of EET (1 mg/kg, p.o.) caused no changes in the cortical NOx levels. Results suggest that the antidepressant-like effect of EET in the TST is dependent on a blockade of NMDA receptor activation and inhibition of NO-cGMP synthesis, significantly extending literature data about the antidepressant-like action of this plant and reinforcing the notion that this plant may be useful in the management of depressive disorders.

Also flagged:chromosomebinCancersegmentationtumornucleotide
Journal Article 2013-11-01 No Snippets Liu B, Morrison CD, Johnson CS, Trump DL, Qin M, Conroy JC, Wang J, Liu S.
Show Full Abstract

Accurate detection of somatic copy number variations (CNVs) is an essential part of cancer genome analysis, and plays an important role in oncotarget identifications. Next generation sequencing (NGS) holds the promise to revolutionize somatic CNV detection. In this review, we provide an overview of current analytic tools used for CNV detection in NGS-based cancer studies. We summarize the NGS data types used for CNV detection, decipher the principles for data preprocessing, segmentation, and interpretation, and discuss the challenges in somatic CNV detection. This review aims to provide a guide to the analytic tools used in NGS-based cancer CNV studies, and to discuss the important factors that researchers need to consider when analyzing NGS data for somatic CNV detections.

Also flagged:siloxaneoctamethyltrisiloxanehexamethyldisiloxanedecamethyltetrasiloxanedodecamethylpentasiloxanesiloxanes
Journal Article 2013-11-01 ✓ 5 Snippets Meyers VE, García HD, McMullin TS, Tobin JM, James JT.
In-Text Gene Mentions

tumors were caused by a male rat-specific α-2-µ-globulin mechanism that is not relevant to humans (DCC,

tumor type is common in Fischer 344 rats and occurred spontaneously in all control animals by the end of the study; however, the study authors also observed that exposure may have accelerated LCT progression, based on the data collected 1 year after exposure (DCC

pertrophy (DCC,

pertrophy in females at every exposure level (800, 1600 and 3200 ppm) and males exposed to the highest dose (DCC, 20

day/week 28 days (females) 29 days (males)0, 400No adverse treatment-related effects400 ppme DCC (2007b) Subchronic L2F-344 rats 20/sex/dose6 hr/day 5 day/week 13 weeks0, 50, 200, 600, 1500, 5000Male-specific hyaline casts at 600, 1500, and 5000 ppmb 5000 ppmDCC (1998, Cassidy (2001)L2SD rats 30/sex/dose6 hr/day 7 day/week 146 days (F0 males) 138 days (F1 males)c 163 days (F0 females) 159 days (F1 females)c 0, 100, 400, 1600, 5000Subtle neurological endpoints noted in offspringc; Male-specific hyaline casts at 5000 ppmb; Hepatic porphyrins, periportal inflammation, and bile duct hyperplasia at 5000 ppm in the F0 generation1600 ppmDCC (2006, DCC (2008)L3SD rats 10/sex/dose6 hr/day 7 day/week 90 days0, 95, 400, 3200Hepatic porphyrins in males at 3200 ppm; Increased liver weight in males at 400 and 3200 ppma; Periportal inflammation in 10 males/1 female at 3200 ppm, 1 male/1 female at 400 ppm, 1 female at 95 ppm, and 1 male/1 female controld 400 ppmDCC (2010a)L4SD rats 10/sex/dose6 hr/day 7 day/week 90 days0, 70, 400No adverse treatment-related effects400 ppme DCC (2010b) Chronic L2F-344 rats 20/sex/dose6 hr/day 5 day/week 24 months0, 100, 400, 1600, 5000Male-specific hyaline casts at 5000 ppmb; Increased liver weights in males at 1500 and 5000 ppma; Leydig cell tumors in all males (including controls)d 5000 ppmDCC (2004b)aConsidered adaptive metabolic response, rather than adverse effect, due to lack of histopathological findings.bConsidered irrelevant to human risk asses

Show Full Abstract

<h4>Background</h4>Low molecular weight siloxanes are used in industrial processes and consumer products, and their vapors have been detected in the atmospheres of the Space Shuttle and International Space Station. Therefore, the National Aeronautics and Space Administration (NASA) developed spacecraft maximum allowable concentrations (SMACs) for siloxane vapors to protect astronaut health. Since publication of these original SMACs, new studies and new risk assessment approaches have been published that warrant re-examination of the SMACs.<h4>Objective</h4>To reevaluate SMACs published for octamethyltrisiloxane (L3) for exposures ranging from 1 hour to 180 days, to develop a 1000-day SMAC, and to expand the applicability of those values to the family of linear siloxanes.<h4>Methods</h4>A literature review was conducted to identify studies conducted since the SMACs for L3 were set in 1994. The updated data were reviewed to determine the sensitive toxicity endpoints, and current risk assessment approaches and methods for dosimetric adjustments were evaluated.<h4>Results</h4>Recent data were used to update the original 1-hour, 24-hour, 30-day, and 180-day SMACs for L3, and a 1000-day SMAC was developed to protect crewmembers during future exploration beyond Earth orbit. Group SMACs for the linear siloxane family, including hexamethyldisiloxane (L2), L3, decamethyltetrasiloxane (L4), and dodecamethylpentasiloxane (L5), were set for exposures of 1-hour to 1000 days.<h4>Conclusion</h4>New SMACs, based on acute pulmonary and neurotoxicity at high doses only achievable with L2 and potential liver effects following longer-term exposures to L2 and L3, were established to protect crewmembers from the adverse effects of exposure to linear siloxanes.

Also flagged:hepatocellular carcinomaliver tumorcancerschronic liver diseasecirrhosistumor
Journal Article 2013-11-01 ✓ 1 Snippet Vivarelli M, Vivarelli M, Montalti R, Risaliti A.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Hepatocellular carcinoma (HCC) is the most frequent primary liver tumor, and overall, it is one of the most frequent cancers. The association of HCC with chronic liver disease, and cirrhosis in particular, is well known, making treatment complex and challenging. The treatment of HCC must take into account the presence and stage of chronic liver disease, with the aim of preserving hepatic function that is often already impaired, the stage of HCC and the clinical condition of the patient. The different treatment options include surgical resection, transplantation, local ablation, chemoembolization, radioembolization and molecular targeted therapies; these treatments can be combined in various ways to achieve different goals. Ideally, liver transplantation is best treatment for early stage HCC on cirrhosis because it removes both the tumor and the chronic disease that produced it; however, the application of this powerful tool is limited by the scarcity of donors. Downstaging and bridging are different strategies for the management of HCC patients who will undergo liver transplantation. Several professionals, including gastroenterologists, radiologists and surgeons, are involved in the choice of the most appropriate treatment for a single case, and a multidisciplinary approach is necessary to optimize the outcome. The purpose of this review is to provide a comprehensive description of the current treatment options for patients with HCC by analyzing the advantages, disadvantages and rationale for their use.

Also flagged:acyl-CoA synthetaselumencell proliferationWntNotchHedgehog
Journal Article 2013-11-01 No Snippets Klaus C, Jeon MK, Kaemmerer E, Gassler N.
Show Full Abstract

The intestinal mucosa is characterized by a high complexity in terms of structure and functions and allows for a controlled demarcation towards the gut lumen. On the one hand it is responsible for pulping and selective absorption of alimentary substances ensuring the immunological tolerance, on the other hand it prevents the penetration of micro-organisms as well as bacterial outgrowth. The continuous regeneration of surface epithelia along the crypt-villus-axis in the small intestine is crucial to assuring these various functions. The core phenomena of intestinal epithelia regeneration comprise cell proliferation, migration, differentiation, and apoptosis. These partly contrarily oriented processes are molecularly balanced through numerous interacting signaling pathways like Wnt/β-catenin, Notch and Hedgehog, and regulated by various modifying factors. One of these modifiers is acyl-CoA synthetase 5 (ACSL5). It plays a key role in de novo lipid synthesis, fatty acid degradation and membrane modifications, and regulates several intestinal processes, primarily through different variants of protein lipidation, e.g., palmitoylation. ACSL5 was shown to interact with proapoptotic molecules, and besides seems to inhibit proliferation along the crypt-villus-axis. Because of its proapoptotic and antiproliferative characteristics it could be of significant relevance for intestinal homeostasis, cellular disorder and tumor development.

Also flagged:nonalcoholic steatohepatitisnon-alcoholic steatohepatitisNASHliver fibrosissimple steatosisnon-alcoholic fatty liver disease
Journal Article 2013-11-01 ✓ 1 Snippet Cengiz M, Candır BA, Yılmaz G, Akyol G, Ozenirler S.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Aim</h4>To evaluate the red cell distribution width (RDW) as an indicator of the presence of non-alcoholic steatohepatitis (NASH) and its association with fibrotic scores.<h4>Methods</h4>A retrospective study was carried out that included sixty-two biopsy proven NASH, 32 simple steatosis patients and 30 healthy controls. The correlation between the clinical and histopathological features of NASH patients and RDW values was evaluated. Liver fibrosis scores were measured using a 0 to 4 point scale and were divided in to two groups; fibrosis scores 0-1 were termed mild and fibrosis scores 2-4 were termed advanced fibrosis. RDW values were compared between NASH, simple steatosis and healthy controls. Univariate and multivariate analyses were performed to evaluate the independent predicting factors for the presence of liver fibrosis caused by NASH.<h4>Results</h4>Patients with NASH had higher RDW values compared with simple steatosis and healthy control groups [14.28% ± 0.25% vs 13.37% ± 0.12%, 12.96% ± 0.14% (P < 0.01), respectively]. Patients with advanced fibrosis had higher RDW values than the mild fibrosis group (15.86% ± 0.4% vs 13.63% ± 0.67%, P < 0.01, respectively). RDW also correlated with fibrotic scores (r = 0.579 and P < 0.01). The variables that were significant in the univariate analysis were evaluated in multivariate logistic regression analysis, and RDW was an independent predicting factor of NASH (OR = 1.75, 95%CI: 1.129-2.711, P < 0.05).<h4>Conclusion</h4>RDW a new non-invasive marker that can be used to demonstrate the presence of NASH and indicate advanced fibrotic scores.

Also flagged:HDACsHistone deacetylasesynthesisbindingHDAC2chromosome
Journal Article 2013-11-01 No Snippets Zhang Y, Inks ES, Zhu M, Chou CJ, Fang H, Li M, Shen Y, Yi F, Xu W.
Show Full Abstract

Histone deacetylase inhibitors (HDACi) are still the focus of epigenetic modulator development due to their effective intervention in many pathological processes. In our previous research, a potent HDACi was designed, synthesized and validated as a promising antitumor candidate named ZYJ-34c. Enlarged scale synthesis of ZYJ-34c for further detailed research was hindered by the occurrence of a by-product, which was identified as an isomer of ZYJ-34c by HRMS and <sup>1</sup>H NMR. Subsequent synthesis route modification and optimization revealed that these two isomers were a pair of epimers and their absolute configurations could be directly determined by our optimized synthesis routes, through which each optically pure epimer could be stereoselectively synthesized, respectively. Based on these results, we concluded that our previously reported absolute configuration of ZYJ-34c was incorrect. It is worth noting that the epimer of ZYJ-34c exhibited more potent HDACs inhibition and both in vitro and in vivo antitumor activities, and moreover, their different HDACs inhibitory activities could be rationalized by computational simulations of their binding modes in HDAC2.

Also flagged:posterior periventricular nodular heterotopiasepilepsyperiventricular nodular heterotopiasbrainneuronal migrationfilamin A
Journal Article 2013-11-01 ✓ 1 Snippet Kovac S, Micallef C, Diehl B, Duncan J.
In-Text Gene Mentions

ARFGEF2

Show Full Abstract

No abstract available.

Also flagged:innate immunityHepatocellular carcinomaliver cancerinfectionalcoholobesity
Journal Article 2013-11-01 ✓ 1 Snippet Aravalli RN.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Hepatocellular carcinoma (HCC) is the most common form of liver cancer worldwide. It is caused by a variety of risk factors, most common ones being infection with hepatitis viruses, alcohol, and obesity. HCC often develops in the background of underlying cirrhosis, and even though a number of interventional treatment methods are currently in use, recurrence is fairly common among patients who have had a resection. Therefore, whole liver transplantation remains the most practical treatment option for HCC. Due to the growing incidence of HCC, intense research efforts are being made to understand cellular and molecular mechanisms of the disease so that novel therapeutic strategies can be developed to combat liver cancer. In recent years, it has become clear that innate immunity plays a critical role in the development of a number of liver diseases, including HCC. In particular, the activation of Toll-like receptor signaling results in the generation of immune responses that often results in the production of pro-inflammatory cytokines and chemokines, and could cause acute inflammation in the liver. In this review, the current knowledge on the role of innate immune responses in the development and progression of HCC is examined, and emerging therapeutic strategies based on molecular mechanisms of HCC are discussed.

Also flagged:TrkBbrain-derived neurotrophic factorBDNFHuntington's diseaseHDpathogenesis
Journal Article 2013-11-01 ✓ 2 Snippets Simmons DA, Belichenko NP, Yang T, Condon C, Monbureau M, Shamloo M, Jing D, Massa SM, Longo FM.
In-Text Gene Mentions

Ligand-induced TrkB activation was associated with a reduction in HD pathologies in the striatum including decreased DARPP-32 levels, neurite degeneration of parvalbumin-containing interneurons, inflammation, and intranuclear huntingtin aggregates.

HTT

Show Full Abstract

Loss of neurotrophic support in the striatum caused by reduced brain-derived neurotrophic factor (BDNF) levels plays a critical role in Huntington's disease (HD) pathogenesis. BDNF acts via TrkB and p75 neurotrophin receptors (NTR), and restoring its signaling is a prime target for HD therapeutics. Here we sought to determine whether a small molecule ligand, LM22A-4, specific for TrkB and without effects on p75(NTR), could alleviate HD-related pathology in R6/2 and BACHD mouse models of HD. LM22A-4 was administered to R6/2 mice once daily (5-6 d/week) from 4 to 11 weeks of age via intraperitoneal and intranasal routes simultaneously to maximize brain levels. The ligand reached levels in the R6/2 forebrain greater than the maximal neuroprotective dose in vitro and corrected deficits in activation of striatal TrkB and its key signaling intermediates AKT, PLCγ, and CREB. Ligand-induced TrkB activation was associated with a reduction in HD pathologies in the striatum including decreased DARPP-32 levels, neurite degeneration of parvalbumin-containing interneurons, inflammation, and intranuclear huntingtin aggregates. Aggregates were also reduced in the cortex. Notably, LM22A-4 prevented deficits in dendritic spine density of medium spiny neurons. Moreover, R6/2 mice given LM22A-4 demonstrated improved downward climbing and grip strength compared with those given vehicle, though these groups had comparable rotarod performances and survival times. In BACHD mice, long-term LM22A-4 treatment (6 months) produced similar ameliorative effects. These results support the hypothesis that targeted activation of TrkB inhibits HD-related degenerative mechanisms, including spine loss, and may provide a disease mechanism-directed therapy for HD and other neurodegenerative conditions.

Also flagged:embryogenesisindole-3-acetic acidindole-3-butyric acidamideYUCCATRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS 1
Journal Article 2013-11-01 No Snippets Ayil-Gutiérrez B, Galaz-Ávalos R, Peña-Cabrera E, Loyola-Vargas V.
Show Full Abstract

Most of the somatic embryogenesis (SE) process requires the presence, either before or during the embryogenic process, of at least one exogenous auxin. This exogenous auxin induces the presence of endogenous auxins, which appears to be essential for SE induction. We found that during the preincubation period of SE in Coffea canephora, there is an important increase in both free and conjugated indole-3-acetic acid (IAA), as well as indole-3-butyric acid. This increase is accompanied by an increase in the expression of YUCCA (CcYUC), TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS 1 (CcTAA1), and GRETCHEN HAGEN 3 (GH3) genes. On the other hand, most of the IAA compounds decreased during the induction of SE. The results presented in this research suggest that a balance between free IAA and its amide conjugates is necessary to allow the expression of SE-related genes.

Also flagged:mineralnon-alcoholic steatohepatitisNASHvitamin-D3tumor necrosis factor-αinterleukin-1
Journal Article 2013-11-01 ✓ 1 Snippet Kaya M, Işık D, Beştaş R, Evliyaoğlu O, Akpolat V, Büyükbayram H, Kaplan MA.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Aim</h4>To determine the relationship between non-alcoholic steatohepatitis (NASH) and bone mineral density (BMD).<h4>Methods</h4>A total of 38 patients (25 males) with a diagnosis of histologically proven NASH and 42 healthy controls (24 males) were enrolled in the study. Demographic features, clinical findings, complete blood count and routine biochemical analysis, as well as adrenal, thyroid and gonadal functions, were recorded. Additionally, intact parathormone, 25-OH-vitamin-D3, tumor necrosis factor-α, interleukin-6, interleukin-1, insulin-like growth factor-1 and insulin-like growth factor binding protein-3 levels were measured in both groups. Furthermore, lumbar spine and femoral neck BMD of both groups were measured by the dual-energy X-ray absorptiometry (DXA) method.<h4>Results</h4>The mean age was 41 ± 12 years in the NASH group and 43 ± 11 years in the control group. Among demographic features, waist circumference was significantly larger in the NASH group compared to the control group (P < 0.019). Among laboratory parameters, serum triglyceride (P < 0.008), alanine transaminase (P < 0.0001), aspartate transaminase (P < 0.001), alkaline phosphatase (P < 0.016), gamma glutamyl transferase (P < 0.0001), ferritin (P < 0.001) and 25-OH-vitamin-D3 levels (P < 0.0001) were significantly higher in the NASH group compared to the control group. Lumbar BMD was significantly higher in the NASH group compared to the control group (1.057 ± 0.119 g/cm(2) vs 0.941 ± 0.133 g/cm(2); P < 0.001, respectively). In the NASH group, there was no significant relationship between BMD and fibrosis stage in liver biopsy.<h4>Conclusion</h4>NASH increases BMD and may be related to an elevated serum 25-OH-vitamin D3 level.

Also flagged:attachmentdevelopmental psychopathologychild abuse and neglectchild abuseneglectbehavioral
Journal Article 2013-11-01 ✓ 1 Snippet Toth SL, Gravener-Davis JA, Guild DJ, Cicchetti D.
In-Text Gene Mentions

5-HTT

Show Full Abstract

It is well established that child maltreatment has significant deleterious effects for the individual as well as for society. We briefly review research regarding the impact of child maltreatment on the attachment relationship, highlighting the need for relational interventions for maltreated children and their families to effectively thwart negative developmental cascades that are so often observed in the context of child maltreatment. Next, historical and contemporaneous perspectives on relational interventions for individuals with histories of child maltreatment are discussed, with attention to the empirical evidence for and the current evidence-based status of several relationally based interventions for child maltreatment. Differential sensitivity to the environment is then discussed as a theoretical framework with important implications for interventions for individuals who have been reared in maltreating environments. Current research on neurobiology and maltreatment is then reviewed, with an emphasis on the need for future investigations on genetic variants, epigenetics, and the efficacy of relational interventions for maltreated children. We conclude with a discussion of the tenets of developmental psychopathology, their implications for relational interventions for child maltreatment, and recommendations for advancing the development, provision, and evaluation of relational interventions for individuals with histories of child maltreatment.

Also flagged:inflammatory responsesInterleukinsTNF-αMCP-1
Journal Article 2013-11-01 No Snippets Ayan E, Koksel O, Polat A, Tamer L, Ersöz G, Demir M, Yıldırım Yaroğlu H, Akdağ A, Ozdülger A, Erden S.
Show Full Abstract

<h4>Background</h4>Blunt chest trauma and its complications are commonly encountered in emergency medicine. Herein, we used a rat model to investigate the role of thoracic trauma in inflammation, apoptosis and bacterial translocation following multiple traumas.<h4>Methods</h4>Ninety Wistar rats were divided equally into nine groups. Rats underwent a standardized blunt thoracic and/or head trauma and were sacrificed 24 or 48 hours after the trauma. Specimens from various organs and blood samples were collected and quantitatively cultured for aerobic organisms. Interleukins, TNF-α, and MCP-1 levels were assessed in the sera and markers of apoptosis were detected in the lungs.<h4>Results</h4>Levels of interleukins, TNF-α and MCP-1 in all of the groups undergoing trauma were significantly higher than those of the control group (p=0.001). Levels of apoptotic cells in the groups undergoing head and thoracic trauma (HTT) were significantly higher than those of the control group (p=0.009). Light microscopic evaluation indicated that damage in the HTT groups was significantly higher than that in the control group. The incidence of bacterial translocation was also significantly higher in the HTT groups (p=0.003).<h4>Conclusion</h4>Multiple inflammatory mediators are activated in multiple traumas (including blunt thoracic trauma), which allow bacterial translocation and apoptotic processes to occur. Our results indicate that thoracic trauma plays a major role in post-traumatic bacterial translocation, inflammation, and apoptosis following multiple traumas.

Also flagged:mineralhydroxylmineralshydrogenhydroxide ionswater
Journal Article 2013-11-01 No Snippets Taylor AJ, Rendina E, Smith BJ, Zhou DH.
Show Full Abstract

Bone minerals possess two primary hydrogen sources: hydroxide ions in the nanocrystalline core and structural water in the amorphous surface layer. In order to accurately measure their concentrations using hydrogen to phosphorus cross polarization NMR spectroscopy, it is necessary to analyze the dependence of signal intensities on serial contact times, namely, cross polarization kinetics. A reliable protocol is developed to iteratively decompose the severely overlapped spectra and to analyze the cross-polarization kinetics, leading to measurement of hydroxyl and structural water concentrations. Structural water concentration is used to estimate mineral specific surface area and nanocrystal thickness for intact bone.

Also flagged:SerotoninEpilepsy5-HT 1A receptor5-HT transportertemporal lobe epilepsy5-HT
Journal Article 2013-11-01 ✓ 1 Snippet Gidal BE.
In-Text Gene Mentions

5-HTT

Show Full Abstract

No abstract available.

Also flagged:Cortisolendocrinopathiesdehydroepiandrosterone sulfateACTHadrenal insufficiencycosyntropin
Journal Article 2013-11-01 ✓ 1 Snippet Soliman AT, Soliman AT, Yassin M, Majuid NM, Sabt A, Abdulrahman MO, De Sanctis V.
In-Text Gene Mentions

…function secondary tohemochromatosisof pituitary gland…

Show Full Abstract

<h4>Background</h4>Thalassemia major patients with repeated blood transfusion have high prevalence of endocrinopathies due to iron overload.<h4>Materials and methods</h4>We examined the adrenocortical function in 23 thalassemic patients (10 children and 13 young adults) aged 8-26 years. Serum cortisol and dehydroepiandrosterone sulfate (DHEA-S) concentrations were determined in each subject before blood transfusion both in basal condition and after low dose (LD) (1 μg), followed by standard dose (SD) (250 μg, respectively) with synthetic corticotrophin beta 1-24 ACTH (Synacthen, Ciba). Normal controls were a group of 13 age- and sex-matched normal subjects.<h4>Results</h4>Using a peak total cortisol cutoff level of 550 nmol/L and increments of 200 μg above basal cortisol, adrenal insufficiency (AI) was demonstrated in 8 patients (34.7%) after the LD ACTH and in 2 patients (8.7%) after SD cosyntropin (ACTH) test, but none of the controls. Using a peak total cortisol cutoff level of 420 nmol/L and increments of 200 μg above basal cortisol, AI was demonstrated in 5 patients (21.7%) after the LD ACTH and in 2 patients after SD ACTH test (8.7%), but none of controls. All patients with biochemical AI were asymptomatic with normal serum sodium and potassium concentrations and had no history suggestive of adrenal pathology. The peak cortisol concentrations in thalassemic patients with impaired adrenal function both after 1 μg and 250 μg cosyntropin (294 ± 51 nmol/L and 307 ± 58.6) were significantly lower than those with patients with normal (454 ± 79.7 nmol/L and 546.1 ± 92.2 nmol/L, respectively) and controls (460.2 ± 133.4 nmol/L and 554.3 ± 165.8 nmol/L, respectively). Adolescents and young adults, but not children with thalassaemia, had significantly lower peak cortisol concentration after SD ACTH versus controls. Peak cortisol response to LD ACTH was correlated significantly with peak cortisol response to SD in all patients (r = 0.83, P < 0.0001). In adolescents and young adults with thalassemia, DHEA-S levels before and after LD ACTH stimulation were significantly lower and the cortisol/DHEA-S ratios were significantly higher than the controls.<h4>Conclusion</h4>The use of LD ACTH test diagnoses more adrenal abnormalities versus SD ACTH in thalassemic patients. The relatively high prevalence of AI in thalassemic adolescents and young adults necessitates that these patients have to be investigated for AI before major surgery and those with impaired cortisol secretion should receive stress doses of corticosteroids during the stressful event.

Also flagged:Epithelial OvarianHypercalcemiavitamin Dcancercancersvitamin D receptor
Journal Article 2013-11-01 No Snippets Kawar N, Maclaughlan S, Horan TC, Uzun A, Lange TS, Kim KK, Hopson R, Singh AP, Sidhu PS, Glass KA, Shaw S, Padbury JF, Vorsa N, Arnold LA, Moore RG, Brard L, Singh RK.
Show Full Abstract

Hypercalcemia remains a major impediment to the clinical use of vitamin D in cancer treatment. Approaches to remove hypercalcemia and development of nonhypercalcemic agents can lead to the development of vitamin D-based therapies for treatment of various cancers. In this report, in vitro and in vivo anticancer efficacy, safety, and details of vitamin D receptor (VDR) interactions of PT19c, a novel nonhypercalcemic vitamin D derived anticancer agent, are described. PT19c was synthesized by bromoacetylation of PTAD-ergocalciferol adduct. Broader growth inhibitory potential of PT19c was evaluated in a panel of chemoresistant breast, renal, ovarian, lung, colon, leukemia, prostate, melanoma, and central nervous system cancers cell line types of NCI60 cell line panel. Interactions of PT19c with VDR were determined by a VDR transactivation assay in a VDR overexpressing VDR-UAS-bla-HEK293 cells, in vitro VDR-coregulator binding, and molecular docking with VDR-ligand binding domain (VDR-LBD) in comparison with calcitriol. Acute toxicity of PT19c was determined in nontumored mice. In vivo antitumor efficacy of PT19c was determined via ovarian and endometrial cancer xenograft experiments. Effect of PT19c on actin filament organization and focal adhesion formation was examined by microscopy. PT19c treatment inhibited growth of chemoresistant NCI60 cell lines (log10GI50 ~ -4.05 to -6.73). PT19c (10 mg/kg, 35 days) reduced growth of ovarian and endometrial xenograft tumor without hypercalcemia. PT19c exerted no acute toxicity up to 400 mg/kg (QDx1) in animals. PT19c showed weak VDR antagonism, lack of VDR binding, and inverted spatial accommodation in VDR-LBD. PT19c caused actin filament dysfunction and inhibited focal adhesion in SKOV-3 cells. PT19c is a VDR independent nonhypercalcemic vitamin D-derived agent that showed noteworthy safety and efficacy in ovarian and endometrial cancer animal models and inhibited actin organization and focal adhesion in ovarian cancer cells.

Also flagged:interferonIFNribavirinchronic liver diseaseIFN alphapolymerase
Journal Article 2013-11-01 ✓ 1 Snippet Amir M, Rahman AS, Jamal Q, Siddiqui MA.
In-Text Gene Mentions

…chronic hepatitis, andhemochromatosiswere excluded.…

Show Full Abstract

<h4>Background and objectives</h4>This study aimed to determine the end treatment response (ETR) and sustained viral response (SVR) to interferon (IFN) and ribavirin in hepatitis C virus (HCV) genotype 3 in the Pakistani population.<h4>Design and settings</h4>This is an interventional study conducted from January 2010 to December 2012 in Lyari General Hospital and Abbasi Shaheed Hospital, Karachi, outpatients department.<h4>Methods</h4>All patients with chronic hepatitis C genotype 3 infections were included. Patients with decompensated chronic liver disease, or having coexisting hepatitis B virus/human immunodeficiency virus were excluded. All patients received IFN alpha, 3 million international units (MIU), subcutaneously 3 times weekly and ribavirin > 800 mg/d for a period of 6 months. Outcome parameters included ETR (negative polymerase chain reaction [PCR] at the end of therapy), SVR (negative PCR both at the end of treatment and 6 months later), and relapse (PCR negative at the end of treatment but positive 6 months later) were determined.<h4>Results</h4>A total of 1170 patients were included with a female to male ratio of 1.64:1 and a mean age of 31.6 (8.4) years. Among 1170 patients, 985 completed the therapy as per the protocol, 119 were defaulted (treatment abandoned before completion), and 66 had to stop treatment due to side effects. ETR was 74.1%, SVR was 98%, relapse rate was 1.5%, and 10.1% were nonresponders. SVR was seen only in patients who had achieved an ETR (n=867). SVR was achieved in 848 patients (out of 867) (98%), relapse was seen in 13 (1.5%), and 6 (0.7%) patients lost follow-up after stopping treatment. Patients achieving ETR and SVR had a mean serum alanine aminotransferase of 71.3 (57.1) and 71.0 (56.5), respectively, which is approximately twice the upper normal limit.<h4>Conclusion</h4>The conventional IFN and ribavirin therapy in genotype 3 chronic HCV-infected patients gives an ETR and SVR of 74.1% and 98%, respectively.

Also flagged:Subependymal heterotopianeuronal migration disorderbrain malformationsgestationheterotopiabrain
Journal Article 2013-11-01 ✓ 1 Snippet Manganaro L, Saldari M, Bernardo S, Aliberti C, Silvestri E.
In-Text Gene Mentions

ARFGEF2

Show Full Abstract

Subependymal heterotopia (SEH) is a neuronal migration disorder characterized by nodules of gray matter along the lateral ventricular walls and often associated with other brain malformations. We present two cases of SEH associated with ventriculomegaly and cerebellar abnormalities diagnosed by fetal magnetic resonance imaging (MRI) at 20 and 23 weeks' gestation respectively. Fetal MRI findings of this association of abnormalities have never been reported in literature. This report emphasizes the role of fetal MRI in recognition of subependymal heterotopia and other associated brain anomalies at early age of gestation along with its importance for a more targeted counseling and management strategies.

Also flagged:equolgene expressionphytoestrogenestradiolestrogen receptoratherosclerosis
Journal Article 2013-11-01 No Snippets Eyster K, Appt S, Chalpe A, Register T, Clarkson T.
Show Full Abstract

<h4>Background and aims</h4>To examine effects of equol, the soy phytoestrogen metabolite, on gene expression in the monkey iliac artery.<h4>Methods and results</h4>A high fat/high cholesterol diet was fed to eight ovariectomized cynomolgus monkeys for 6.5 years. After biopsy of the left iliac artery, the animals were randomized to two treatment groups for 8 months; the treatment groups were equol (23.7 mg/100 g diet, n = 4) and vehicle (n = 4). The right iliac artery was removed at necropsy. Gene expression in the iliac arteries in response to equol was determined by DNA microarray. Comparison of atherosclerotic lesions and plasma lipids at pre-versus post-equol treatment time points and in vehicle versus equol treatment groups did not identify any significant differences. Despite the lack of effect of equol on these parameters, 59 genes were down-regulated and 279 were up-regulated in response to equol. Comparison of these data to previous work identified 10 genes regulated in opposite directions by equol compared to presence of atherosclerosis plaque (Menopause 2011; 18:1087-1095) and 55 genes differentially expressed in the same direction in response to both equol and estradiol (Eyster et al., Menopause 2014;21:143-152.).<h4>Conclusions</h4>Similar responses of genes to both equol and estradiol may reflect the extent to which equol serves as a natural selective estrogen receptor modulator in the arteries. Opposite responses of 10 genes to equol versus the presence of atherosclerosis implicates those genes in the potential protective effects of equol in arteries.

Also flagged:translationalgene expressionageingischemic heart diseasetype 2 diabetescerebrovascular disease
Journal Article 2013-11-01 No Snippets Readhead B, Dudley J.
Show Full Abstract

<h4>Significance</h4>A majority of therapeutic interventions occur late in the pathological process, when treatment outcome can be less predictable and effective, highlighting the need for new precise and preventive therapeutic development strategies that consider genomic and environmental context. Translational bioinformatics is well positioned to contribute to the many challenges inherent in bridging this gap between our current reactive methods of healthcare delivery and the intent of <i>precision medicine</i>, particularly in the areas of drug development, which forms the focus of this review.<h4>Recent advances</h4>A variety of powerful informatics methods for organizing and leveraging the vast wealth of available molecular measurements available for a broad range of disease contexts have recently emerged. These include methods for data driven disease classification, drug repositioning, identification of disease biomarkers, and the creation of disease network models, each with significant impacts on drug development approaches.<h4>Critical issues</h4>An important bottleneck in the application of bioinformatics methods in translational research is the lack of investigators who are versed in both biomedical domains and informatics. Efforts to nurture both sets of competencies within individuals and to increase interfield visibility will help to accelerate the adoption and increased application of bioinformatics in translational research.<h4>Future directions</h4>It is possible to construct predictive, multiscale network models of disease by integrating genotype, gene expression, clinical traits, and other multiscale measures using causal network inference methods. This can enable the identification of the "key drivers" of pathology, which may represent novel therapeutic targets or biomarker candidates that play a more direct role in the etiology of disease.

Also flagged:collagennanofibersL-lactic acidgelatincollagen-like proteinsnanofiber
Journal Article 2013-11-01 No Snippets Kane R, Ma1 PX.
Show Full Abstract

Key features of bone tissue structure and composition are capable of directing cellular behavior towards the generation of new bone tissue. Bone tissue, as well as materials derived from bone, have a long and successful history of use as bone grafting materials. Recent developments in design and processing of synthetic scaffolding systems has allowed the replication of the bone's desirable biological activity in easy to fabricate polymeric materials with nano-scale features exposed on the surface. The biological response to these new tissue-engineering scaffold materials oftentimes exceeds that seen on scaffolds produced using biological materials.

Also flagged:MAPTsporadic amyotrophic lateral sclerosismicrotubule-associated protein Taupathogenesisamyotrophic lateral sclerosisbulbar palsy
Journal Article 2013-11-01 ✓ 1 Snippet Fang P, Xu W, Wu C, Zhu M, Li X, Hong D.
In-Text Gene Mentions

…endonuclease[ 9 ],hemochromatosis[ 10 ], survival…

Show Full Abstract

A previous study of European Caucasian patients with sporadic amyotrophic lateral sclerosis demonstrated that a polymorphism in the microtubule-associated protein Tau (MAPT) gene was significantly associated with sporadic amyotrophic lateral sclerosis pathogenesis. Here, we tested this association in 107 sporadic amyotrophic lateral sclerosis patients and 100 healthy controls from the Chinese Han population. We screened the mutation-susceptible regions of MAPT - the 3' and 5' untranslated regions as well as introns 9, 10, 11, and 12 - by direct sequencing, and identified 33 genetic variations. Two of these, 105788 A > G in intron 9 and 123972 T > A in intron 11, were not present in the control group. The age of onset in patients with the 105788 A > G and/or the 123972 T > A variant was younger than that in patients without either genetic variation. Moreover, the pa-tients with a genetic variation were more prone to bulbar palsy and breathing difficulties than those with the wild-type genotype. This led to a shorter survival period in patients with a MAPT genetic variant. Our study suggests that the MAPT gene is a potential risk gene for sporadic amyotrophic lateral sclerosis in the Chinese Han population.

Also flagged:Merkel Cell Carcinomaneuroendocrine cancer of the skinmetastatic diseaseneuroendocrine tumorcarcinoid tumor of the lungMAPK
Journal Article 2013-11-01 No Snippets Shao Q, Byrum SD, Moreland LE, Mackintosh SG, Kannan A, Lin Z, Morgan M, Stack BC, Cornelius LA, Tackett AJ, Gao L.
Show Full Abstract

Merkel Cell Carcinoma (MCC) is an aggressive neuroendocrine cancer of the skin. The incidence has been quadrupled with a 5-year mortality rate of 46%, presently there is no cure for metastatic disease. Despite the contribution of Merkel cell polyomavirus, the molecular events of MCC carcinogenesis are poorly defined. To better understand MCC carcinogensis, we have performed the first quantitative proteomic comparison of formalin-fixed, paraffin-embedded (FFPE) MCC tissues using another neuroendocrine tumor (carcinoid tumor of the lung) as controls. Bioinformatic analysis of the proteomic data has revealed that MCCs carry distinct protein expression patterns. Further analysis of significantly over-expressed proteins suggested the involvement of MAPK, PI3K/Akt/mTOR, wnt, and apoptosis signaling pathways. Our previous study and that from others have shown mTOR activation in MCCs. Therefore, we have focused on two downstream molecules of the mTOR pathway, lactate dehydrogenase B (LDHB) and heterogeneous ribonucleoprotein F (hnRNPF). We confirm over-expression of LDHB and hnRNPF in two primary human MCC cell lines, 16 fresh tumors, and in the majority of 80 tissue microarray samples. Moreover, mTOR inhibition suppresses LDHB and hnRNPF expression in MCC cells. The results of the current study provide insight into MCC carcinogenesis and provide rationale for mTOR inhibition in pre-clinical studies.

CELL BIOLOGY AND SIGNALING

Also flagged:IkarosDNA-binding proteinIkaros family zinc finger protein 1IKZF1chronic myelogenous leukemiastumor
Journal Article 2013-11-01 No Snippets Agarwal M, Nitta R, Dovat S, Li G, Arita H, Narita Y, Fukushima S, Tateishi K, Matsushita Y, Yoshida A, Miyakita Y, Ohno M, Collins V, Kawahara N, Shibui S, Ichimura K, Kahn S, Gholamin S, Junier M, Chneiweiss H, Weissman I, Mitra S, Cheshier S, Avril T, Hamlat A, Le Reste P, Mosser J, Quillien V, Carrato C, Muñoz-Mármol A, Serrano L, Pijuán L, Hostalot C, Villa S, Ariza A, Etxaniz O, Balaña C, Benveniste E, Zheng Y, McFarland B, Drygin D, Bellis S, Bredel M, Lötsch D, Engelmaier C, Allerstorfer S, Grusch M, Pichler J, Weis S, Hainfellner J, Marosi C, Spiegl-Kreinecker S, Berger W, Bronisz A, Nowicki M, Wang Y, Ansari K, Chiocca E, Godlewski J, Brown K, Kwatra M, Brown K, Kwatra M, Zhu S, Kozono D, Li J, Kushwaha D, Carter B, Chen C, Schulte J, Srikanth M, Das S, Zhang J, Lathia J, Yin L, Rich J, Olson E, Kessler J, Chenn A, Cong D, Zhu W, Shi Y, Clark P, Kuo J, Hu S, Sun D, Dey A, Robitaille M, Remke M, Faury D, Maier C, Malhotra A, Jabado N, Taylor M, Angers S, Kenney A, Ren X, Zhou H, Schur M, Baweja A, Singh M, Erdreich-Epstein A, Gomez G, Volinia S, Croce C, Brennan C, Cavenee W, Furnari F, Gonzalez-Huarriz M, Aldave G, Ravi D, Rubio A, Diez-Valle R, Marigil M, Jauregi P, Vera B, de la Rocha A, Tejada-Solís S, Alonso M, Gruber-Olipitz M, Dabral S, Ramkissoon S, Kung A, Pak E, Chung J, Theisen M, Sun Y, Monrose V, Franchetti Y, Sun Y, Shulman D, Redjal N, Tabak B, Beroukhim R, Zhao J, Buonamici S, Ligon K, Kelleher J, Segal R, Haas B, Canton D, Diaz P, Scott J, Stella N, Hara K, Kageji T, Mizobuchi Y, Kitazato K, Okazaki T, Fujihara T, Nakajima K, Mure H, Kuwayama K, Hara T, Nagahiro S, Hill L, Botfield H, Hossain-Ibrahim K, Logan A, Cruickshank G, Hu Y, Vo C, Li Z, Ke C, Ru N, Hess K, Linskey M, Zhou Y, Jackson P, Larson J, Beckmann D, Moriarity B, Largaespada D, Kang S, Yu M, Song N, Park K, Chi S, Chung Y, Kim S, Kim J, Kim J, Kim J, Choi S, Kim T, Lee S, Kim S, Park S, Kim I, Park C, Jung H, Agnihotri S, Gugel I, Remke M, Bornemann A, Pantazis G, Mack S, Shih D, Sabha N, Taylor M, Tatagiba M, Zadeh G, Krischek B, Schulte A, Liffers K, Kathagen A, Riethdorf S, Westphal M, Lamszus K, Lee J, Xiao J, Patel P, Schade J, Wang J, Deneen B, Erdreich-Epstein A, Song H, Leiss L, Gjerde C, Saed H, Rahman A, Lellahi M, Enger P, Sun S, Lee D, Ho A, Pu J, Zhang X, Lee N, Dat P, Leung G, Loetsch D, Steiner E, Holzmann K, Spiegl-Kreinecker S, Pirker C, Hlavaty J, Petznek H, Hegedus B, Garay T, Mohr T, Sommergruber W, Grusch M, Berger W, Lukiw W, Jones B, Zhao Y, Bhattacharjee S, Culicchia F, Magnus N, Garnier D, Meehan B, McGraw S, Hashemi M, Lee T, Milsom C, Gerges N, Jabado N, Trasler J, Pawlinski R, Mackman N, Rak J, Malhotra A, Choi S, Potts C, Ford D, Nahle Z, Kenney A, Matlaf L, Khan S, Zider A, Singer E, Cobbs C, Soroceanu L, Mizowaki T, Sasayama T, Tanaka K, Mizukawa K, Nishihara M, Nakamizo S, Tanaka H, Kohta M, Hosoda K, Kohmura E, Moeckel S, Meyer K, Leukel P, Bogdahn U, Riehmenschneider M, Bosserhoff A, Spang R, Hau P, Mukasa A, Watanabe A, Ogiwara H, Saito N, Aburatani H, Mukherjee J, Obha S, See W, Pieper R, Nakajima K, Hara K, Kageji T, Mizobuchi Y, Kitazato K, Fujihara T, Otsuka R, Kung D, Nagahiro S, Ott M, Litzenburger U, Rauschenbach K, Bunse L, Pusch S, Ochs K, Sahm F, Opitz C, von Deimling A, Wick W, Platten M, Peruzzi P, Chiocca E, Godlewski J, Read R, Fenton T, Gomez G, Wykosky J, Vandenberg S, Babic I, Iwanami A, Yang H, Cavenee W, Mischel P, Furnari F, Thomas J, Ronellenfitsch M, Thiepold A, Harter P, Mittelbronn M, Steinbach J, Rybakova Y, Kalen A, Sarsour E, Goswami P, Sonabend A, Bansal M, Guarnieri P, Lei L, Soderquist C, Leung R, Yun J, Kennedy B, Sisti J, Bruce S, Bruce R, Shakya R, Ludwig T, Rosenfeld S, Sims P, Bruce J, Califano A, Canoll P, Stringer B, Day B, Barry G, Piper M, Jamieson P, Ensbey K, Bruce Z, Richards L, Boyd A, Sufit A, Burleson T, Le J, Keating A, Sundstrøm T, Varughese J, Harter P, Prestegarden L, Petersen K, Azuaje F, Tepper C, Ingham E, Even L, Johnson S, Skaftnesmo K, Lund-Johansen M, Bjerkvig R, Ferrara K, Thorsen F, Takeshima H, Yamashita S, Yokogami K, Mizuguchi S, Nakamura H, Kuratsu J, Fukushima T, Morishita K, Tanaka H, Sasayama T, Tanaka K, Nakamizo S, Mizukawa K, Kohmura E, Tateishi K, Narita Y, Nakamura T, Cahill D, Kawahara N, Ichimura K, Tiemann K, Hedman H, Niclou S, Fan Q, Cheng C, Gustafson W, Charron E, Zipper P, Wong R, Chen J, Lau J, Knobbe-Thosen C, Weller M, Jura N, Reifenberger G, Shokat K, Weiss W, Wykosky J, Hu J, Taylor T, Villa G, Gomez G, Mischel P, Gonias S, Cavenee W, Furnari F, Yamashita D, Kondo T, Takahashi H, Inoue A, Kohno S, Harada H, Ohue S, Ohnishi T, Li P, Ng J, Yuelling L, Du F, Curran T, Yang Z, Zhu W, Begum G, Wang Q, Clark P, Yang S, Lin S, Kahle K, Kuo J, Sun D.
Show Full Abstract

No abstract available.