Journal Article2015-09-30✓ 5 SnippetsSoylu-Kucharz R, Adlesic N, Baldo B, Kirik D, Petersén Å.
In-Text Gene Mentions
S I O 001029)
…Here we provide further insight, showing that selective hypothalamic overexpression of mutant HTT directly leads to a reduction of the TH A13 group in the zona incerta with downstream negative effects on BAT (Fig.…
I A O 0000326)
…HTT…
Results)
…For this purpose, we used brain tissue from wild-type mice that were stereotactically injected with rAAV serotype 5 (rAAV5) vectors expressing the first 853 amino acids of HTT with 79Q (rAAV5-HTT853-79Q; disease causing mutant HTT) or 18Q (rAAV5-HTT853-18Q; wild-type variant) into the hypothalamus.…
S I O 001029)
…The disease-causing form of huntingtin (HTT) is the culprit of the neurodegenerative Huntington disease (HD)11.…
Abstract)
…Expression of mutant huntingtin (htt) protein has been shown to cause metabolic imbalance in animal models of Huntington disease (HD).…
Show Full Abstract
Expression of mutant huntingtin (htt) protein has been shown to cause metabolic imbalance in animal models of Huntington disease (HD). The pathways involved are not fully understood but dysfunction of both the hypothalamus and brown adipose tissue (BAT) has been implicated. Here we show that targeted expression of mutant HTT in the hypothalamus leads to loss of the A13 dopaminergic cell group located in the zona incerta and reduced mRNA expression of neuropeptide Y1 receptor in the hypothalamus. Furthermore, this is accompanied by downregulation of uncoupling protein 1 expression and PPARγ coactivator-1 alpha in BAT and a rapid body weight gain. Taken together, our data might provide a mechanistic link between expression of mutant HTT, reduced activity of a hypothalamic dopaminergic pathway and dysfunction of BAT and in part explain the development of an obese phenotype in HD mouse models.
Journal Article2015-09-30✓ 1 SnippetKesarwani M, Huber E, Kincaid Z, Evelyn CR, Biesiada J, Rance M, Thapa MB, Shah NP, Meller J, Zheng Y, Azam M.
In-Text Gene Mentions
Discussion)
…AP24534 54 andDCC-203655 .…
Show Full Abstract
Emergence of genetic resistance against kinase inhibitors poses a great challenge for durable therapeutic response. Here, we report a novel mechanism of JAK2 kinase inhibition by fedratinib (TG101348) that prevents emergence of genetic resistance. Using in vitro drug screening, we identified 211 amino-acid substitutions conferring resistance to ruxolitinib (INCB018424) and cross-resistance to the JAK2 inhibitors AZD1480, CYT-387 and lestaurtinib. In contrast, these resistant variants were fully sensitive to fedratinib. Structural modeling, coupled with mutagenesis and biochemical studies, revealed dual binding sites for fedratinib. In vitro binding assays using purified proteins showed strong affinity for the substrate-binding site (Kd = 20 nM) while affinity for the ATP site was poor (Kd = ~8 μM). Our studies demonstrate that mutations affecting the substrate-binding pocket encode a catalytically incompetent kinase, thereby preventing emergence of resistant variants. Most importantly, our data suggest that in order to develop resistance-free kinase inhibitors, the next-generation drug design should target the substrate-binding site.
Also flagged:autismAutism spectrum disorderneurodevelopmental disordercognitionlanguage developmentneural differentiation
Journal Article2015-09-30No SnippetsLim CS, Yang JE, Lee YK, Lee K, Lee JA, Kaang BK.
Show Full Abstract
Autism spectrum disorder (ASD) is a complex neurodevelopmental disorder characterized by deficits in social cognition, language development, and repetitive/restricted behaviors. Due to the complexity and heterogeneity of ASD and lack of a proper human cellular model system, the pathophysiological mechanism of ASD during the developmental process is largely unknown. However, recent progress in induced pluripotent stem cell (iPSC) technology as well as in vitro neural differentiation techniques have allowed us to functionally characterize neurons and analyze cortical development during neural differentiation. These technical advances will increase our understanding of the pathogenic mechanisms of heterogeneous ASD and help identify molecular biomarkers for patient stratification as well as personalized medicine. In this review, we summarize our current knowledge of iPSC generation, differentiation of specific neuronal subtypes from iPSCs, and phenotypic characterizations of human ASD patient-derived iPSC models. Finally, we discuss the current limitations of iPSC technology and future directions of ASD pathophysiology studies using iPSCs.
Also flagged:T cell receptor-cell activationinfectionviremiaantibodyCD4
Journal Article2015-09-30✓ 1 SnippetBhattarai N, McLinden JH, Xiang J, Kaufman TM, Stapleton JT.
In-Text Gene Mentions
Results)
…kinase D2 (PKD2),CSE1L, and others […
Show Full Abstract
T cell receptor (TCR) signaling is required for T-cell activation, proliferation, differentiation, and effector function. Hepatitis C virus (HCV) infection is associated with impaired T-cell function leading to persistent viremia, delayed and inconsistent antibody responses, and mild immune dysfunction. Although multiple factors appear to contribute to T-cell dysfunction, a role for HCV particles in this process has not been identified. Here, we show that incubation of primary human CD4+ and CD8+ T-cells with HCV RNA-containing serum, HCV-RNA containing extracellular vesicles (EVs), cell culture derived HCV particles (HCVcc) and HCV envelope pseudotyped retrovirus particles (HCVpp) inhibited TCR-mediated signaling. Since HCVpp's contain only E1 and E2, we examined the effect of HCV E2 on TCR signaling pathways. HCV E2 expression recapitulated HCV particle-induced TCR inhibition. A highly conserved, 51 nucleotide (nt) RNA sequence was sufficient to inhibit TCR signaling. Cells expressing the HCV E2 coding RNA contained a short, virus-derived RNA predicted to be a Dicer substrate, which targeted a phosphatase involved in Src-kinase signaling (PTPRE). T-cells and hepatocytes containing HCV E2 RNA had reduced PTPRE protein levels. Mutation of 6 nts abolished the predicted Dicer interactions and restored PTPRE expression and proximal TCR signaling. HCV RNA did not inhibit distal TCR signaling induced by PMA and Ionomycin; however, HCV E2 protein inhibited distal TCR signaling. This inhibition required lymphocyte-specific tyrosine kinase (Lck). Lck phosphorylated HCV E2 at a conserved tyrosine (Y613), and phospho-E2 inhibited nuclear translocation of NFAT. Mutation of Y613 restored distal TCR signaling, even in the context of HCVpps. Thus, HCV particles delivered viral RNA and E2 protein to T-cells, and these inhibited proximal and distal TCR signaling respectively. These effects of HCV particles likely aid in establishing infection and contribute to viral persistence.
Also flagged:autosomal dominant neurodegenerative disorderHuntington diseaseHDdeathneurodegenerative diseasechorea
Journal Article2015-09-30✓ 2 SnippetsZhang N, Bailus BJ, Ring KL, Ellerby LM.
In-Text Gene Mentions
Abstract)
…Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder, caused by an expansion of the CAG repeat in exon 1 of the huntingtin gene.…
Text
…HTT…
Show Full Abstract
Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder, caused by an expansion of the CAG repeat in exon 1 of the huntingtin gene. The disease generally manifests in middle age with both physical and mental symptoms. There are no effective treatments or cures and death usually occurs 10-20 years after initial symptoms. Since the original identification of the Huntington disease associated gene, in 1993, a variety of models have been created and used to advance our understanding of HD. The most recent advances have utilized stem cell models derived from HD-patient induced pluripotent stem cells (iPSCs) offering a variety of screening and model options that were not previously available. The discovery and advancement of technology to make human iPSCs has allowed for a more thorough characterization of human HD on a cellular and developmental level. The interaction between the genome editing and the stem cell fields promises to further expand the variety of HD cellular models available for researchers. In this review, we will discuss the history of Huntington's disease models, common screening assays, currently available models and future directions for modeling HD using iPSCs-derived from HD patients. This article is part of a Special Issue entitled SI: PSC and the brain.
Also flagged:dependencecolorectal cancerregulation ofgene expressionchromatinreverse-transcription
Journal Article2015-09-30✓ 4 SnippetsKazemzadeh M, Safaralizadeh R, Feizi MA, Somi MH, Shokoohi B.
In-Text Gene Mentions
Abstract)
…In the case of cis-regulation, by recruiting chromatin-modifying complexes, lincRNAs influence adjacent gene expression.<h4>Methods</h4>We used quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) to evaluate the coexpression of LOC100287225, a lincRNA, and DCC, one of its adjacent genes that is often decreased in colorectal cancer, in pairs of tumor and adjacent tumor-free tissues of 30 colorectal cancer patients.<h4>Results</h4>The qRT-PCR results revealed the misregulation of these genes during tumorigenesis.…
<h4>Background</h4>Long non-coding RNAs (lncRNAs), a class of regulatory RNAs, play a major role in various cellular processes. Long intergenic non-coding RNAs (lincRNAs), a subclass of lncRNAs, are involved in the trans- and cis-regulation of gene expression. In the case of cis-regulation, by recruiting chromatin-modifying complexes, lincRNAs influence adjacent gene expression.<h4>Methods</h4>We used quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) to evaluate the coexpression of LOC100287225, a lincRNA, and DCC, one of its adjacent genes that is often decreased in colorectal cancer, in pairs of tumor and adjacent tumor-free tissues of 30 colorectal cancer patients.<h4>Results</h4>The qRT-PCR results revealed the misregulation of these genes during tumorigenesis. Their relative expression levels were significantly lower in tumor tissues than adjacent tumor-free tissues. However, the analysis found no significant correlation between reduced expression of these genes.<h4>Conclusions</h4>Our study demonstrated the concurrent misregulation of DCC and LOC100287225 in colorectal cancer.
Also flagged:antibodyautoantibodiesgene expressionRNA-binding proteinsRoquinsystemic lupus erythematosus
Journal Article2015-09-30No SnippetsJiang SH, Shen N, Vinuesa CG.
Show Full Abstract
T follicular helper (Tfh) cells are crucial to induce protective extrafollicular and germinal center antibody responses against protein antigens. Over the last decade, control of Tfh cell numbers has emerged as an important regulatory checkpoint which, when perturbed, may lead to production of autoantibodies. Recent progress in understanding how Tfh cells are kept limiting has revealed an important role for posttranscriptional control of gene expression mediated by microRNAs such as miR-17 ∼ 92, miR-155 and miR-146a, and the RNA-binding proteins Roquin and Regnase. Additionally, T cell microRNAs dysregulated in patients with systemic lupus erythematosus have been shown to influence processes such as DNA hypomethylation, IL-2 and CCL5 secretion, and Treg function, which contribute to autoantibody formation and tissue damage.
Also flagged:Neuropeptide YNPYbiosynthesisY1Y2Y2 receptor
Journal Article2015-09-30No SnippetsReichmann F, Holzer P.
Show Full Abstract
Stress is defined as an adverse condition that disturbs the homeostasis of the body and activates adaptation responses. Among the many pathways and mediators involved, neuropeptide Y (NPY) stands out due to its unique stress-relieving, anxiolytic and neuroprotective properties. Stress exposure alters the biosynthesis of NPY in distinct brain regions, the magnitude and direction of this effect varying with the duration and type of stress. NPY is expressed in particular neurons of the brainstem, hypothalamus and limbic system, which explains why NPY has an impact on stress-related changes in emotional-affective behaviour and feeding as well as on stress coping. The biological actions of NPY in mammals are mediated by the Y1, Y2, Y4 and Y5 receptors, Y1 receptor stimulation being anxiolytic whereas Y2 receptor activation is anxiogenic. Emerging evidence attributes NPY a role in stress resilience, the ability to cope with stress. Thus there is a negative correlation between stress-induced behavioural disruption and cerebral NPY expression in animal models of post-traumatic stress disorder. Exogenous NPY prevents the negative consequences of stress, and polymorphisms of the NPY gene are predictive of impaired stress processing and increased risk of neuropsychiatric diseases. Stress is also a factor contributing to, and resulting from, neurodegenerative diseases such as Alzheimer's, Parkinson's and Huntington's disease, in which NPY appears to play an important neuroprotective role. This review summarizes the evidence for an implication of NPY in stress-related and neurodegenerative pathologies and addresses the cerebral NPY system as a therapeutic target.
…It is notable that SERPINC1 was identified as being under positive selection in addition to containing a convergent amino acid change in two cetaceans (T. truncatus and O. orca), the walrus and manatee, in a recent study of marine mammal genomes [18].…
Results)
…For example,SERPINC1produces the protein…
Results)
…is notable thatSERPINC1was identified as…
Show Full Abstract
Recent studies have reported multiple cases of molecular adaptation in cetaceans related to their aquatic abilities. However, none of these has included the hippopotamus, precluding an understanding of whether molecular adaptations in cetaceans occurred before or after they split from their semi-aquatic sister taxa. Here, we obtained new transcriptomes from the hippopotamus and humpback whale, and analysed these together with available data from eight other cetaceans. We identified more than 11 000 orthologous genes and compiled a genome-wide dataset of 6845 coding DNA sequences among 23 mammals, to our knowledge the largest phylogenomic dataset to date for cetaceans. We found positive selection in nine genes on the branch leading to the common ancestor of hippopotamus and whales, and 461 genes in cetaceans compared to 64 in hippopotamus. Functional annotation revealed adaptations in diverse processes, including lipid metabolism, hypoxia, muscle and brain function. By combining these findings with data on protein-protein interactions, we found evidence suggesting clustering among gene products relating to nervous and muscular systems in cetaceans. We found little support for shared ancestral adaptations in the two taxa; most molecular adaptations in extant cetaceans occurred after their split with hippopotamids.
Journal Article2015-09-30✓ 5 SnippetsAbou Arkoub R, Wang D, Zimmerman D.
In-Text Gene Mentions
I A O 0000613)
…(3) Clostridium difficile toxin B was detected by PCR, (4) normal genetic testing for HFE (human hemochromatosis protein gene) mutation excluding hemochromatosis, negative flow cytometry for PNH (paroxysmal nocturnal hemoglobinuria), a normal glucose-6-phosphate dehydrogenase screen (excluding hemolysis secondary to G6PD deficiency anemia), and (5) transesophageal echocardiogram which showed that the prosthetic mitral valve is functioning well without evidence of paravalvular leak or mitral valve regurgitation…
Kidney failure secondary to renal hemosiderosis has been reported in diseases with intravascular hemolysis, like paroxysmal nocturnal hemoglobinuria, and valvular heart diseases. We present here a case of hemosiderin induced acute tubular necrosis secondary to intravascular hemolysis from Clostridium difficile infection with possible role of supratherapeutic INR. We discuss the pathophysiology, causes, and prognosis of acute tubular injury from hemosiderosis.
Intravascular large B-cell lymphoma (IVLBCL) is a rare subtype of extranodal diffuse large B-cell lymphoma that most commonly involves the central nervous system and skin. To our knowledge, no state-of-the art imaging findings have been reported for hepatic IVLBCL in the English literature. We report the first case of hepatic involvement of IVLBCL along with a literature review.
Also flagged:Hepatocellular carcinomacancermalignant neoplasmsSorafenibRafvascular-endothelial growth factor
Journal Article2015-09-30✓ 1 SnippetPark JG.
In-Text Gene Mentions
Discussion)
…a patient withhemochromatosisand metastatic HCC…
Show Full Abstract
<h4>Background/aims</h4>Sorafenib is currently the sole molecular targeted agent that improves overall survival in advanced hepatocellular carcinoma (HCC). Despite the efficacy of sorafenib, the response rate varies in patients with advanced HCC. We retrospectively analyzed a series of Korean patients with advanced HCC with complete remission (CR) after sorafenib therapy.<h4>Methods</h4>In total, 523 patients with advanced HCC were treated with sorafenib in 3 large tertiary referral hospitals in Korea. A survey was conducted to collect data on patients who experienced CR after sorafenib monotherapy, and their medical records and follow-up data were analyzed. The tumor response and recurrence rates were assessed by radiologic study, based on modified response evaluation criteria in solid tumors.<h4>Results</h4>Seven patients with advanced HCC experienced CR after sorafenib therapy. The median time to tumor disappearance and the median disease-free survival time were 3 months and 9 months, respectively. HCC recurrence was identified in three cases (42.9%). Of these, two patients discontinued sorafenib before or after achieving CR and the other patient continued sorafenib after achieving CR. HCC recurred at 3, 10, and 42 months after CR in these three patients. Three patients needed dose reduction for toxicity and adverse events.<h4>Conclusions</h4>Though CR was achieved after sorafenib therapy in patients with advanced HCC, the recurrence rate was relatively high. Subsequent strategies to reduce a chance of recurrence after sorafenib therapy are required to investigate.
Also flagged:Synthesisaminoglycosideshydroxybutyrateamikacinkanamycin Anetilmicin
Journal Article2015-09-30No SnippetsThamban Chandrika N, Green KD, Houghton JL, Garneau-Tsodikova S.
Show Full Abstract
Despite issues with oto/nephrotoxicity and bacterial resistance, aminoglycosides (AGs) remain an effective and widely used class of antibacterial agents. For decades now, efforts toward the development of novel AGs with potential to overcome some of these problems have been major research focuses. 1-N-Acylation, especially γ-amino-β-hydroxybutyrate (AHB) derivatization, has proven to be one of the most successful strategies for improving the overall properties of AGs, including their ability to avoid certain resistance mechanisms. More recently, 6'-N-acylation arose as another possible strategy to improve the properties of these drugs. In this study, we report on the glycinyl, carboxybenzyl, and AHB mono- and diderivatization at the 1-, 6'-, and/or 4‴-amines of the AGs amikacin, kanamycin A, netilmicin, sisomicin, and tobramycin. We also present the antibacterial activities and the reduced reactivity of AG-modifying enzymes (AMEs) toward these new AG derivatives, and identify the AMEs present in the bacterial strains tested.
Also flagged:β-galactosidasefluoresceinSiliconepolydimethylsiloxanesilicontri-block
Journal Article2015-09-30No SnippetsLabanieh L, Nguyen TN, Zhao W, Kang DK.
Show Full Abstract
We describe the design, fabrication and use of a dual-layered microfluidic device for ultrahigh-throughput droplet trapping, analysis, and recovery using droplet buoyancy. To demonstrate the utility of this device for digital quantification of analytes, we quantify the number of droplets, which contain a β-galactosidase-conjugated bead among more than 100,000 immobilized droplets. In addition, we demonstrate that this device can be used for droplet clustering and real-time analysis by clustering several droplets together into microwells and monitoring diffusion of fluorescein, a product of the enzymatic reaction of β-galactosidase and its fluorogenic substrate FDG, between droplets.
Also flagged:glutamateextracellularcystinecysteinexCToxygen
Journal Article2015-09-29No SnippetsMassie A, Boillée S, Hewett S, Knackstedt L, Lewerenz J.
Show Full Abstract
System xc(-) is a cystine/glutamate antiporter that exchanges extracellular cystine for intracellular glutamate. Cystine is intracellularly reduced to cysteine, a building block of GSH. As such, system xc(-) can regulate the antioxidant capacity of cells. Moreover, in several brain regions, system xc(-) is the major source of extracellular glutamate. As such this antiporter is able to fulfill key physiological functions in the CNS, while evidence indicates it also plays a role in certain brain pathologies. Since the transcription of xCT, the specific subunit of system xc(-), is enhanced by the presence of reactive oxygen species and inflammatory cytokines, system xc(-) could be involved in toxic extracellular glutamate release in neurological disorders that are associated with increased oxidative stress and neuroinflammation. System xc(-) has also been reported to contribute to the invasiveness of brain tumors and, as a source of extracellular glutamate, could participate in the induction of peritumoral seizures. Two independent reviews (Pharmacol. Rev. 64, 2012, 780; Antioxid. Redox Signal. 18, 2013, 522), approached from a different perspective, have recently been published on the functions of system xc(-) in the CNS. In this review, we highlight novel achievements and insights covering the regulation of system xc(-) as well as its involvement in emotional behavior, cognition, addiction, neurological disorders and glioblastomas, acquired in the past few years. System xc(-) constitutes an important source of extrasynaptic glutamate in the brain. By modulating the tone of extrasynaptic metabotropic or ionotropic glutamate receptors, it affects excitatory neurotransmission, the threshold for overexcitation and excitotoxicity and, as a consequence, behavior. This review describes the current knowledge of how system xc(-) is regulated and involved in physiological as well as pathophysiological brain functioning.
Sézary syndrome (SS) is an aggressive leukaemia of mature T cells with poor prognosis and limited options for targeted therapies. The comprehensive genetic alterations underlying the pathogenesis of SS are unknown. Here we integrate whole-genome sequencing (n=6), whole-exome sequencing (n=66) and array comparative genomic hybridization-based copy-number analysis (n=80) of primary SS samples. We identify previously unknown recurrent loss-of-function aberrations targeting members of the chromatin remodelling/histone modification and trithorax families, including ARID1A in which functional loss from nonsense and frameshift mutations and/or targeted deletions is observed in 40.3% of SS genomes. We also identify recurrent gain-of-function mutations targeting PLCG1 (9%) and JAK1, JAK3, STAT3 and STAT5B (JAK/STAT total ∼11%). Functional studies reveal sensitivity of JAK1-mutated primary SS cells to JAK inhibitor treatment. These results highlight the complex genomic landscape of SS and a role for inhibition of JAK/STAT pathways for the treatment of SS.
Also flagged:IronanemiaerythropoiesisbindingChronic Kidney DiseaseIron deficiency
Journal Article2015-09-29✓ 1 SnippetGest J, Langston C, Eatroff A.
In-Text Gene Mentions
Discussion)
…in iron overload,hemochromatosissecondary to repeated…
Show Full Abstract
<h4>Background</h4>Iron deficiency is a proposed mechanism for the anemia that occurs in cats with chronic kidney disease (CKD). Minimal research investigating the iron status of these cats has been performed.<h4>Objective</h4>To compare indicators of iron status in cats with CKD versus healthy cats and cats with nonrenal illness (NRI). To compare indicators of iron status in anemic versus nonanemic cats with CKD.<h4>Animals</h4>Thiry-nine client or employee owned healthy cats, 40 cats with CKD and 34 cats with NRI included.<h4>Methods</h4>Exclusion criteria included prior iron or erythropoiesis stimulating agent administration, blood transfusion, or concurrent CKD and NRI. Complete blood counts, serum chemistries, serum iron concentrations, total iron binding capacity (TIBC), and ferritin concentrations were measured and percent transferrin saturation (TSAT) calculated on all cats. Data were analyzed using nonparametric statistical testing.<h4>Results</h4>No statistically significant differences were detected among groups for iron concentration (P = .50), ferritin concentration (P = .47), or TSAT (P = .19). TIBC was significantly lower in CKD (median 262 μg/dL; IQR 233-302; range 165-488) versus healthy cats (median 316 μg/dL; IQR 272-345, range 196-464); (P = .0030). When comparing anemic (hemoglobin <9.5 g/dL) versus nonanemic cats with CKD, TSAT was significantly lower (P = .033) in anemic (median 20.2%; IQR 17.8-34.5; range 17.6-35.9) compared to nonanemic (median 29.0%; IQR 25.5-44.1; range 11.5-94.4). No statistically significant differences found for ferritin concentration (P = .94), iron concentration (P = .21) or TIBC (P = .97).<h4>Conclusions and clinical importance</h4>These results indicate that an iron deficient state exists in anemic cats with CKD and is more likely functional rather than absolute.
Journal Article2015-09-29✓ 1 SnippetWang K, Liu D, Hernandez-Sanchez J, Chen J, Liu C, Wu Z, Fang M, Li N.
In-Text Gene Mentions
Results)
…contained the genesMLLT10and SKIDA1 (…
Show Full Abstract
In this study, 796 male Duroc pigs were used to identify genomic regions controlling growth traits. Three production traits were studied: food conversion ratio, days to 100 KG, and average daily gain, using a panel of 39,436 single nucleotide polymorphisms. In total, we detected 11 genome-wide and 162 chromosome-wide single nucleotide polymorphism trait associations. The Gene ontology analysis identified 14 candidate genes close to significant single nucleotide polymorphisms, with growth-related functions: six for days to 100 KG (WT1, FBXO3, DOCK7, PPP3CA, AGPAT9, and NKX6-1), seven for food conversion ratio (MAP2, TBX15, IVL, ARL15, CPS1, VWC2L, and VAV3), and one for average daily gain (COL27A1). Gene ontology analysis indicated that most of the candidate genes are involved in muscle, fat, bone or nervous system development, nutrient absorption, and metabolism, which are all either directly or indirectly related to growth traits in pigs. Additionally, we found four haplotype blocks composed of suggestive single nucleotide polymorphisms located in the growth trait-related quantitative trait loci and further narrowed down the ranges, the largest of which decreased by ~60 Mb. Hence, our results could be used to improve pig production traits by increasing the frequency of favorable alleles via artificial selection.
Also flagged:Serotonin Transportermemories5-HTTLPRAutism spectrum disorderPervasive Developmental Disorder5
Journal Article2015-09-29✓ 1 SnippetNishikawa S, Toshima T, Kobayashi M.
In-Text Gene Mentions
Methods)
…(5-HTTLPR) of the5-HTTgene regulatory region…
Show Full Abstract
This study examined changes in prefrontal oxy-Hb levels measured by NIRS (Near-Infrared Spectroscopy) during a facial-emotion recognition task in healthy adults, testing a mediational/moderational model of these variables. Fifty-three healthy adults (male = 35, female = 18) aged between 22 to 37 years old (mean age = 24.05 years old) provided saliva samples, completed a EMBU questionnaire (Swedish acronym for Egna Minnen Beträffande Uppfostran [My memories of upbringing]), and participated in a facial-emotion recognition task during NIRS recording. There was a main effect of maternal rejection on RoxH (right frontal activation during an ambiguous task), and a gene × environment (G × E) interaction on RoxH, suggesting that individuals who carry the SL or LL genotype and who endorse greater perceived maternal rejection show less right frontal activation than SL/LL carriers with lower perceived maternal rejection. Finally, perceived parenting style played a mediating role in right frontal activation via the 5-HTTLPR genotype. Early-perceived parenting might influence neural activity in an uncertain situation i.e. rating ambiguous faces among individuals with certain genotypes. This preliminary study makes a small contribution to the mapping of an influence of gene and behaviour on the neural system. More such attempts should be made in order to clarify the links.
SK2- and KV4.2-containing K+ channels modulate evoked synaptic potentials in CA1 pyramidal neurons. Each is coupled to a distinct Ca2+ source that provides Ca2+-dependent feedback regulation to limit AMPA receptor (AMPAR)- and NMDA receptor (NMDAR)-mediated postsynaptic depolarization. SK2-containing channels are activated by Ca2+ entry through NMDARs, whereas KV4.2-containing channel availability is increased by Ca2+ entry through SNX-482 (SNX) sensitive CaV2.3 R-type Ca2+ channels. Recent studies have challenged the functional coupling between NMDARs and SK2-containing channels, suggesting that synaptic SK2-containing channels are instead activated by Ca2+ entry through R-type Ca2+ channels. Furthermore, SNX has been implicated to have off target affects, which would challenge the proposed coupling between R-type Ca2+ channels and KV4.2-containing K+ channels. To reconcile these conflicting results, we evaluated the effect of SK channel blocker apamin and R-type Ca2+ channel blocker SNX on evoked excitatory postsynaptic potentials (EPSPs) in CA1 pyramidal neurons from CaV2.3 null mice. The results show that in the absence of CaV2.3 channels, apamin application still boosted EPSPs. The boosting effect of CaV2.3 channel blockers on EPSPs observed in neurons from wild type mice was not observed in neurons from CaV2.3 null mice. These data are consistent with a model in which SK2-containing channels are functionally coupled to NMDARs and KV4.2-containing channels to CaV2.3 channels to provide negative feedback regulation of EPSPs in the spines of CA1 pyramidal neurons.
Also flagged:Neuronopathic Gaucher diseasepathogenesischaperonelysosomal acid β-glucosidaseGCaseGaucher disease
Journal Article2015-09-29✓ 1 SnippetDasgupta N, Xu YH, Li R, Peng Y, Pandey MK, Tinch SL, Liou B, Inskeep V, Zhang W, Setchell KD, Keddache M, Grabowski GA, Sun Y.
In-Text Gene Mentions
Text
…Dcc…
Show Full Abstract
Defective lysosomal acid β-glucosidase (GCase) in Gaucher disease causes accumulation of glucosylceramide (GC) and glucosylsphingosine (GS) that distress cellular functions. To study novel pathological mechanisms in neuronopathic Gaucher disease (nGD), a mouse model (4L;C*), an analogue to subacute human nGD, was investigated for global profiles of differentially expressed brain mRNAs (DEGs) and miRNAs (DEmiRs). 4L;C* mice displayed accumulation of GC and GS, activated microglial cells, reduced number of neurons and aberrant mitochondrial function in the brain followed by deterioration in motor function. DEGs and DEmiRs were characterized from sequencing of mRNA and miRNA from cerebral cortex, brain stem, midbrain and cerebellum of 4L;C* mice. Gene ontology enrichment and pathway analysis showed preferential mitochondrial dysfunction in midbrain and uniform inflammatory response and identified novel pathways, axonal guidance signaling, synaptic transmission, eIF2 and mammalian target of rapamycin (mTOR) signaling potentially involved in nGD. Similar analyses were performed with mice treated with isofagomine (IFG), a pharmacologic chaperone for GCase. IFG treatment did not alter the GS and GC accumulation significantly but attenuated the progression of the disease and altered numerous DEmiRs and target DEGs to their respective normal levels in inflammation, mitochondrial function and axonal guidance pathways, suggesting its regulation on miRNA and the associated mRNA that underlie the neurodegeneration in nGD. These analyses demonstrate that the neurodegenerative phenotype in 4L;C* mice was associated with dysregulation of brain mRNAs and miRNAs in axonal guidance, synaptic plasticity, mitochondria function, eIF2 and mTOR signaling and inflammation and provides new insights for the nGD pathological mechanism.
Also flagged:Cancerepithelial-to-mesenchymal transitionlung cancertumortumorsbladder cancers
Journal Article2015-09-29No SnippetsMak MP, Tong P, Diao L, Cardnell RJ, Gibbons DL, William WN, Skoulidis F, Parra ER, Rodriguez-Canales J, Wistuba II, Heymach JV, Weinstein JN, Coombes KR, Wang J, Byers LA.
Show Full Abstract
<h4>Purpose</h4>We previously demonstrated the association between epithelial-to-mesenchymal transition (EMT) and drug response in lung cancer using an EMT signature derived in cancer cell lines. Given the contribution of tumor microenvironments to EMT, we extended our investigation of EMT to patient tumors from 11 cancer types to develop a pan-cancer EMT signature.<h4>Experimental design</h4>Using the pan-cancer EMT signature, we conducted an integrated, global analysis of genomic and proteomic profiles associated with EMT across 1,934 tumors including breast, lung, colon, ovarian, and bladder cancers. Differences in outcome and in vitro drug response corresponding to expression of the pan-cancer EMT signature were also investigated.<h4>Results</h4>Compared with the lung cancer EMT signature, the patient-derived, pan-cancer EMT signature encompasses a set of core EMT genes that correlate even more strongly with known EMT markers across diverse tumor types and identifies differences in drug sensitivity and global molecular alterations at the DNA, RNA, and protein levels. Among those changes associated with EMT, pathway analysis revealed a strong correlation between EMT and immune activation. Further supervised analysis demonstrated high expression of immune checkpoints and other druggable immune targets, such as PD1, PD-L1, CTLA4, OX40L, and PD-L2, in tumors with the most mesenchymal EMT scores. Elevated PD-L1 protein expression in mesenchymal tumors was confirmed by IHC in an independent lung cancer cohort.<h4>Conclusions</h4>This new signature provides a novel, patient-based, histology-independent tool for the investigation of EMT and offers insights into potential novel therapeutic targets for mesenchymal tumors, independent of cancer type, including immune checkpoints.
Also flagged:lymphocyte antigen receptorreceptorcolitisantigen receptorsHeliosFoxp3
Journal Article2015-09-29No SnippetsNishio J, Baba M, Atarashi K, Tanoue T, Negishi H, Yanai H, Habu S, Hori S, Honda K, Taniguchi T.
Show Full Abstract
The regulation of intestinal homeostasis by the immune system involves the dynamic interplay between gut commensal microbiota and resident immune cells. It is well known that a large and diverse lymphocyte antigen receptor repertoire enables the immune system to recognize and respond to a wide range of invading pathogens. There is also an emerging appreciation for a critical role the T-cell receptor (TCR) repertoire serves in the maintenance of peripheral tolerance by regulatory T cells (Tregs). Nevertheless, how the diversity of the TCR repertoire in Tregs affects intestinal homeostasis remains unknown. To address this question, we studied mice whose T cells express a restricted TCR repertoire. We observed the development of spontaneous colitis, accompanied by the induction of T-helper type 17 cells in the colon that is driven by gut commensal microbiota. We provide further evidence that a restricted TCR repertoire causes a loss of tolerogenicity to microbiota, accompanied by a paucity of peripherally derived, Helios(-) Tregs and hyperactivation of migratory dendritic cells. These results thus reveal a new facet of the TCR repertoire in which Tregs require a diverse TCR repitoire for intestinal homeostasis, suggesting an additional driving force in the evolutional significance of the TCR repertoire.
Also flagged:cancerHIV-1 infectionviral infectionsgene expression regulationgene expressionPTEN
Journal Article2015-09-29✓ 1 SnippetGupta A, Brown CT, Zheng YH, Adami C.
In-Text Gene Mentions
Introduction)
…Tumor suppressor gene PTENsuppressor gene PTEN,…
Show Full Abstract
Not all pseudogenes are transcriptionally silent as previously thought. Pseudogene transcripts, although not translated, contribute to the non-coding RNA pool of the cell that regulates the expression of other genes. Pseudogene transcripts can also directly compete with the parent gene transcripts for mRNA stability and other cell factors, modulating their expression levels. Tissue-specific and cancer-specific differential expression of these "functional" pseudogenes has been reported. To ascertain potential pseudogene:gene interactions in HIV-1 infection, we analyzed transcriptomes from infected and uninfected T-cells and found that 21 pseudogenes are differentially expressed in HIV-1 infection. This is interesting because parent genes of one-third of these differentially-expressed pseudogenes are implicated in HIV-1 life cycle, and parent genes of half of these pseudogenes are involved in different viral infections. Our bioinformatics analysis identifies candidate pseudogene:gene interactions that may be of significance in HIV-1 infection. Experimental validation of these interactions would establish that retroviruses exploit this newly-discovered layer of host gene expression regulation for their own benefit.
Also flagged:ironinfectious diseasebindingmetabolismiron overload disordershereditary hemochromatosis
Journal Article2015-09-29✓ 4 SnippetsBarber MF, Elde NC.
In-Text Gene Mentions
Discussion)
…HH caused by the C282Y mutation in the HFE gene is the most common genetic disorder among those of European descent, carried by approximately 10% of these individuals.…
Discussion)
…mutation in theHFEgene is the…
Discussion)
…mechanisms by whichHFEmutations cause HH…
Discussion)
…are still unclear,HFEis expressed on…
Show Full Abstract
Host-pathogen interactions provide valuable systems for the study of evolutionary genetics and natural selection. The sequestration of essential iron has emerged as a crucial innate defense system termed nutritional immunity, leading pathogens to evolve mechanisms of 'iron piracy' to scavenge this metal from host proteins. This battle for iron carries numerous consequences not only for host-pathogen evolution but also microbial community interactions. Here we highlight recent and potential future areas of investigation on the evolutionary implications of microbial iron piracy in relation to molecular arms races, host range, competition, and virulence. Applying evolutionary genetic approaches to the study of microbial iron acquisition could also provide new inroads for understanding and combating infectious disease.
The genome has the ability to respond in a precise and co-ordinated manner to cellular signals. It achieves this through the concerted actions of transcription factors and the chromatin platform, which are targets of the signaling pathways. Our understanding of the molecular mechanisms through which transcription factors and the chromatin landscape each control gene activity has expanded dramatically over recent years, and attention has now turned to understanding the complex, multifaceted interplay between these regulatory layers in normal and disease states. It has become apparent that transcription factors as well as the components and modifiers of the epigenetic machinery are frequent targets of genomic alterations in cancer cells. Through the study of these factors, we can gain unique insight into the dynamic interplay between transcription factors and the epigenome, and how their dysregulation leads to aberrant gene expression programs in cancer. Here, we will highlight how these factors normally co-operate to establish and maintain the transcriptional and epigenetic landscape of cells, and how this is reprogramed in cancer, focusing on the RUNX1 transcription factor and oncogenic derivative RUNX1-ETO in leukemia as paradigms of transcriptional and epigenetic reprograming.
Also flagged:anthracyclinesoxygendoxorubicincancerscardiomyopathycancer
Journal Article2015-09-29✓ 1 SnippetAngsutararux P, Luanpitpong S, Issaragrisil S.
In-Text Gene Mentions
Methods)
…For example,Hfe-deficient mice with excess…
Show Full Abstract
Chemotherapy-induced cardiotoxicity is a serious complication that poses a serious threat to life and limits the clinical use of various chemotherapeutic agents, particularly the anthracyclines. Understanding molecular mechanisms of chemotherapy-induced cardiotoxicity is a key to effective preventive strategies and improved chemotherapy regimen. Although no reliable and effective preventive treatment has become available, numerous evidence demonstrates that chemotherapy-induced cardiotoxicity involves the generation of reactive oxygen species (ROS). This review provides an overview of the roles of oxidative stress in chemotherapy-induced cardiotoxicity using doxorubicin, which is one of the most effective chemotherapeutic agents against a wide range of cancers, as an example. Current understanding in the molecular mechanisms of ROS-mediated cardiotoxicity will be explored and discussed, with emphasis on cardiomyocyte apoptosis leading to cardiomyopathy. The review will conclude with perspectives on model development needed to facilitate further progress and understanding on chemotherapy-induced cardiotoxicity.
Also flagged:Peginterferon alpha-Peginterferon-alphainterferonhepatitis CPeginterferonHepatitis
Journal Article2015-09-29✓ 1 SnippetPouresmaeeli M, Alavian SM, Keshvari M, Salimi S, Mehrnoush L.
In-Text Gene Mentions
Methods)
…mediated disease, thalassemia,hemochromatosis, retinopathy or active…
Show Full Abstract
<h4>Background</h4>Nearly 0.5% of Iranians are infected with HCV. Peginterferon-alpha-2a and Peginterferon-alpha-2b are the two available types of interferon for the treatment of hepatitis C. Comparing the results of these two treatments is still a challenge.<h4>Objectives</h4>The aim of this study was to compare the results of Peginterferon-alpha-2a and Peginterferon-alpha-2b in Iranian patients with chronic hepatitis C.<h4>Patients and methods</h4>289 patients with chronic hepatitis C attending Tehran Hepatitis Center (THC) and Hepatitis Clinic of Tehran Blood Transfusion Organization (TBTO) from January 2008 to April 2013 and treated with combination of Peginterferon-alpha-2a or Peginterferon-alpha-2b plus Ribavirin were enrolled in this retrospective cross-sectional study. Treatment response and side effects were compared.<h4>Results</h4>Among all naive patients, 82.0% achieved SVR, 5.4% were resistant to therapy and 11.0% withdrew the treatment. Relapse was seen in 12.2% of naive patients who finished the course of treatment. RVR and EVR were seen in 67.7% and 90.6% of naive patients, respectively. Patients divided into two groups. Group A consists of 247 patients treated with Peginterferon-alpha-2a and group B 42 patients treated with Peginterferon-alpha-2b. No significant difference in treatment response was observed between naive patients of the two groups. The rates of arthralgia/myalgia, alopecia, pruritus, insomnia, dyspnea and anorexia were higher in group A and the rates of dermal problems, coryza and bleeding were higher in group B. In a subgroup analysis, the two kinds of Peginterferon-alpha-2a available in Iran were compared. Rapid and early viral responses and relapse rates were lower in the one made in Iran and the long-term responses were not different. The rates of arthralgia/myalgia, fever, alopecia, pruritus, insomnia, dyspnea, anorexia, cough, headache and abdominal pain were higher and the rates of irritability and coryza were lower in the one made in Iran.<h4>Conclusions</h4>There was no significant difference in the efficacy of Peginterferon-alpha-2a and Peginterferon-alpha-2b in Iranian patients. Physicians might choose the treatment regimen for every individual concerning the differences in side effects of Peginterferons.
Also flagged:acute lymphoblastic leukemiaALLcancersLIFporphyrinmetabolism
Journal Article2015-09-29No SnippetsSui S, Wang X, Zheng H, Guo H, Chen T, Ji DM.
Show Full Abstract
Pediatric acute lymphoblastic leukemia (ALL) accounts for over one-quarter of all pediatric cancers. Interacting genes and proteins within the larger human gene interaction network of the human genome are rarely investigated by studies investigating pediatric ALL. In the present study, interaction networks were constructed using the empirical Bayesian approach and the Search Tool for the Retrieval of Interacting Genes/proteins database, based on the differentially-expressed (DE) genes in pediatric ALL, which were identified using the RankProd package. Enrichment analysis of the interaction network was performed using the network-based methods EnrichNet and PathExpand, which were compared with the traditional expression analysis systematic explored (EASE) method. In total, 398 DE genes were identified in pediatric ALL, and LIF was the most significantly DE gene. The co-expression network consisted of 272 nodes, which indicated genes and proteins, and 602 edges, which indicated the number of interactions adjacent to the node. Comparison between EASE and PathExpand revealed that PathExpand detected more pathways or processes that were closely associated with pediatric ALL compared with the EASE method. There were 294 nodes and 1,588 edges in the protein-protein interaction network, with the processes of hematopoietic cell lineage and porphyrin metabolism demonstrating a close association with pediatric ALL. Network enrichment analysis based on the PathExpand algorithm was revealed to be more powerful for the analysis of interaction networks in pediatric ALL compared with the EASE method. LIF and MLLT11 were identified as the most significantly DE genes in pediatric ALL. The process of hematopoietic cell lineage was the pathway most significantly associated with pediatric ALL.
Also flagged:GSTcancercancerstumordetoxificationglutathione
Journal Article2015-09-29No SnippetsHan B, Wang Y, Wang L, Shang Z, Wang S, Pei J.
Show Full Abstract
During the chemotherapy of cancer, drug resistance is the first issue that chemotherapeutic drugs cannot be effectively used for the treatment of cancers repeatedly for a long term, and the main reason for this is that tumor cell detoxification is mediated by GSH (glutathione) catalyzed by GST (glutathione-S-transferase). In this study, a GST inhibitor, ethacrynic acid (ECA), was designed to be coupled with methoxy poly(ethylene glycol)-poly(lactide) (MPEG-PLA) by disulfide bonds to prepare methoxy poly(ethylene glycol)-poly(lactide)-disulphide bond-mthacrynic acid (MPEG-PLA-SS-ECA) as a carrier material of the nanoparticles. Nanoparticles of pingyangmycin (PYM) and carboplatin (CBP) were prepared, respectively, and their physicochemical properties were investigated. The ECA at the disulfide could be released in the presence of GSH, the pingyangmycin, carboplatin and ECA were all uniformly released, and the nanoparticles could release all the drugs completely within 10 days. The half maximal inhibitory concentration (IC<sub>50</sub><sub>)</sub> of the prepared MPEG-PLA-SS-ECA/CBP and MPEG-PLA-SS-ECA/PYM nanoparticles in drug-resistant oral squamous cell carcinoma cell lines SCC15/CBP and SCC15/PYM cells was 12.68 μg·mL<sup>-</sup>¹ and 12.76 μg·mL<sup>-</sup>¹, respectively; the resistant factor RF of them in the drug-resistant cells were 1.51 and 1.24, respectively, indicating that MPEG-PLA-SS-ECA nanoparticles can reverse the drug resistance of these two drug-resistant cells.
Also flagged:obesityosteoarthritiscomplexOAFTOschizophrenia
Journal Article2015-09-28No SnippetsAsimit JL, Panoutsopoulou K, Wheeler E, Berndt SI, GIANT consortium, the arcOGEN consortium, Cordell HJ, Morris AP, Zeggini E, Barroso I.
Show Full Abstract
Diseases often cooccur in individuals more often than expected by chance, and may be explained by shared underlying genetic etiology. A common approach to genetic overlap analyses is to use summary genome-wide association study data to identify single-nucleotide polymorphisms (SNPs) that are associated with multiple traits at a selected P-value threshold. However, P-values do not account for differences in power, whereas Bayes' factors (BFs) do, and may be approximated using summary statistics. We use simulation studies to compare the power of frequentist and Bayesian approaches with overlap analyses, and to decide on appropriate thresholds for comparison between the two methods. It is empirically illustrated that BFs have the advantage over P-values of a decreasing type I error rate as study size increases for single-disease associations. Consequently, the overlap analysis of traits from different-sized studies encounters issues in fair P-value threshold selection, whereas BFs are adjusted automatically. Extensive simulations show that Bayesian overlap analyses tend to have higher power than those that assess association strength with P-values, particularly in low-power scenarios. Calibration tables between BFs and P-values are provided for a range of sample sizes, as well as an approximation approach for sample sizes that are not in the calibration table. Although P-values are sometimes thought more intuitive, these tables assist in removing the opaqueness of Bayesian thresholds and may also be used in the selection of a BF threshold to meet a certain type I error rate. An application of our methods is used to identify variants associated with both obesity and osteoarthritis.
Nattokinase (NK) is a serine protease extracted from a traditional Japanese food called natto. Due to its strong fibrinolytic and thrombolytic activity, NK is regarded as a valuable dietary supplement or nutraceutical for the oral thrombolytic therapy. In addition, NK has been investigated for some other medical applications including treatment of hypertension, Alzheimer's disease, and vitreoretinal disorders. The most widely used clinical anticoagulants are heparin and low molecular weight heparins. The interactions between heparin and proteins modulate diverse patho-physiological processes and heparin modifies the activity of serine proteases. Indeed, heparin plays important roles in almost all of NK's potential therapeutically applications. The current report relies on surface plasmon resonance spectroscopy to examine NK interacting with heparin as well as other glycosaminoglycans (GAGs). These studies showed that NK is a heparin binding protein with an affinity of ~250 nM. Examination with differently sized heparin oligosaccharides indicated that the interaction between NK and heparin is chain-length dependent and the minimum size for heparin binding is a hexasaccharide. Studies using chemically modified heparin showed the 6-O-sulfo as well as the N-sulfo groups but not the 2-O-sulfo groups within heparin, are essential for heparin's interaction with NK. Other GAGs (including HS, DS, and CSE) displayed modest binding affinity to NK. NK also interfered with other heparin-protein interactions, including heparin's interaction with antithrombin and fibroblast growth factors.
Also flagged:Hepatocellular CarcinomacancermidkineMDKalpha-fetoproteinAFP
Journal Article2015-09-28✓ 5 SnippetsAwan FM, Naz A, Obaid A, Ali A, Ahmad J, Anjum S, Janjua HA.
In-Text Gene Mentions
Abstract)
…Finally, interactome analysis of these proteins with midkine (MDK), dickkopf-1 (DKK-1), current standard HCC biomarker alpha-fetoprotein (AFP), its interacting partners in conjunction with HCC-specific circulating and liver deregulated miRNAs target filtration highlighted seven novel statistically significant putative biomarkers including complement component 8, alpha (C8A), mannose binding lectin (MBL2), antithrombin III (SERPINC1), 11β-hydroxysteroid dehydrogenase type 1 (HSD11B1), alcohol dehydrogenase 6 (ADH6), beta-ureidopropionase (UPB1) and cytochrome P450, family 2, subfamily A, polypeptide 6 (CYP2A6).…
Results)
…Expression of AFP in the tumor compartment was not statistically significant with longer RFS (log rank P = 0.2) whereas the expressions of C8A, MBL2, SERPINC1, HSD11B1, ADH6, UPB1 and CYP2A6 were statistically significantly with longer RFS (log rank P = 0.03) as shown in Fig 6.…
Discussion)
…Interestingly, C4A and MDK are previously characterized circulating biomarkers for HCC [1] whereas SERPINC1 (also prioritized as a potential biomarker in our study) is an interacting partner of AFP, C8A, F2, UPB1, F10, AHSG, APOA5, APOC3 and IGFBP1 (involved in cancer progression) (Fig 4).…
Results)
…The ROC curves documented a significant statistical correlation of the proposed candidate biomarkers with MBL2, C8A, SERPINC1, HSD11B1, ADH6, UPB1 and CYP2A6 levels predicting HCC-free survival considerably well {area under ROC = 0.861 (KM), and area under ROC = 0.854 (NNE)}, while no significance was found for AFP and HCC-free survival rate (area under ROC = 0.354 (KM), and area under ROC = 0.5 (NNE).…
Discussion)
…SERPINC1 was found to be differentially expressed between serum of HCC patients and healthy subjects [43].…
Show Full Abstract
Hepatocellular carcinoma (HCC) is the world's third most widespread cancer. Currently available circulating biomarkers for this silently progressing malignancy are not sufficiently specific and sensitive to meet all clinical needs. There is an imminent and pressing need for the identification of novel circulating biomarkers to increase disease-free survival rate. In order to facilitate the selection of the most promising circulating protein biomarkers, we attempted to define an objective method likely to have a significant impact on the analysis of vast data generated from cutting-edge technologies. Current study exploits data available in seven publicly accessible gene and protein databases, unveiling 731 liver-specific proteins through initial enrichment analysis. Verification of expression profiles followed by integration of proteomic datasets, enriched for the cancer secretome, filtered out 20 proteins including 6 previously characterized circulating HCC biomarkers. Finally, interactome analysis of these proteins with midkine (MDK), dickkopf-1 (DKK-1), current standard HCC biomarker alpha-fetoprotein (AFP), its interacting partners in conjunction with HCC-specific circulating and liver deregulated miRNAs target filtration highlighted seven novel statistically significant putative biomarkers including complement component 8, alpha (C8A), mannose binding lectin (MBL2), antithrombin III (SERPINC1), 11β-hydroxysteroid dehydrogenase type 1 (HSD11B1), alcohol dehydrogenase 6 (ADH6), beta-ureidopropionase (UPB1) and cytochrome P450, family 2, subfamily A, polypeptide 6 (CYP2A6). Our proposed methodology provides a swift assortment process for biomarker prioritization that eventually reduces the economic burden of experimental evaluation. Further dedicated validation studies of potential putative biomarkers on HCC patient blood samples are warranted. We hope that the use of such integrative secretome, interactome and miRNAs target filtration approach will accelerate the selection of high-priority biomarkers for other diseases as well, that are more amenable to downstream clinical validation experiments.
…In our study, p.282Y variant (rs1800562 A allele) was significantly associated with the risk of varicose veins (OR 1.79, 95 % CI = 1.11-2.89, P = 0.02).…
Abstract)
…We hypothesized that HFE gene polymorphism might be involved not only in ulceration process, but also in susceptibility to primary varicose veins.…
Abstract)
…Recently, the association of polymorphism rs1800562 (p.C282Y) in the hemochromatosis (HFE) gene with the increased risk of venous ulceration was shown.…
Abstract)
…We conclude that the HFE gene polymorphism can affect the risk of developing primary varicose veins.…
Title)
…HFE p.C282Y gene variant is associated with varicose veins in Russian population.…
Show Full Abstract
Recently, the association of polymorphism rs1800562 (p.C282Y) in the hemochromatosis (HFE) gene with the increased risk of venous ulceration was shown. We hypothesized that HFE gene polymorphism might be involved not only in ulceration process, but also in susceptibility to primary varicose veins. We genotyped HFE p.C282Y (rs1800562) and p.H63D (rs1799945) variants in patients with primary varicose veins (n = 463) and in the control group (n = 754). In our study, p.282Y variant (rs1800562 A allele) was significantly associated with the risk of varicose veins (OR 1.79, 95 % CI = 1.11-2.89, P = 0.02). A borderline significant reverse association of p.63D variant (rs1799945 G allele) with venous leg ulcer development was revealed in Russians (OR 0.25, 95 % CI = 0.06-1.00, P = 0.05), but not in the meta-analysis (P = 0.56). We conclude that the HFE gene polymorphism can affect the risk of developing primary varicose veins.
…We examined expression of OLFM4 in epithelial cells by immunohistochemistry and found that OLFM4 is highly expressed in proliferating benign epithelial cells and in some carcinoma cells.…
Title)
…Plasma levels of OLFM4 in normals and patients with gastrointestinal cancer.…
Discussion)
…Much to our surprise, we found plasma levels of OLFM4 covering a wide range, but largely segregating both normals and cancer patients into two groups, one with OLFM4 levels that are barely detectable and one with levels that are 2–4 orders of magnitude higher.…
Introduction)
…As mentioned above, OLFM4 was identified as a gene highly up‐regulated in cancers of the gastrointestinal tract.…
Discussion)
…In agreement with this, another study correlating plasma levels of OLFM4 with cancers concluded that plasma concentration of OLFM4 did not correlate well with OLFM4 expression in the tumours as determined by immunohistochemistry, although that study did not identify patients with high plasma levels as we observe 23.…
Show Full Abstract
Olfactomedin 4 (OLFM4) is a secreted glycoprotein predominantly expressed in bone marrow and gastrointestinal tissues. Aberrant expression of OLFM4 has been shown in several cancers. However, the clinical significance hereof is currently controversial. OLFM4 has been proposed as a candidate biomarker of gastrointestinal cancers. To address this, we developed monoclonal antibodies against synthetic peptides representing various segments of OLFM4. We examined expression of OLFM4 in epithelial cells by immunohistochemistry and found that OLFM4 is highly expressed in proliferating benign epithelial cells and in some carcinoma cells. We developed an Enzyme Linked Immunosorbent Assay for OLFM4 and investigated whether plasma levels of OLFM4 reflect colorectal malignancies, but were unable to see any such association. Instead, we observed two populations of individuals with respect to OLFM4 levels in plasma, the majority with OLFM4 in plasma between 0 and 0.1 μg/ml, mean 0.028 μg/ml while 10% of both normals and patients with cancers had OLFM4 between 4 and 60 μg/ml, mean 15 μg/ml. The levels were constant over time. The background for this high plasma level is not known, but must be taken into account if OLFM4 is used as biomarker for GI cancers.
Journal Article2015-09-28✓ 5 SnippetsHermine O, Dine G, Genty V, Marquet LA, Fumagalli G, Tafflet M, Guillem F, Van Lierde F, Rousseaux-Blanchi MP, Palierne C, Lapostolle JC, Cervetti JP, Frey A, Jouven X, Noirez P, Toussaint JF.
In-Text Gene Mentions
Abstract)
…The HFE gene encodes a protein involved in iron homeostasis; individuals with mutations in both alleles develop hemochromatosis.…
Title)
…Eighty percent of French sport winners in Olympic, World and Europeans competitions have mutations in the hemochromatosis HFE gene.…
Title)
…mutations in thehemochromatosisHFE gene.…
Title)
…in the hemochromatosisHFEgene.…
Abstract)
…TheHFEgene encodes a…
Show Full Abstract
The HFE gene encodes a protein involved in iron homeostasis; individuals with mutations in both alleles develop hemochromatosis. 27% of the French population is heterozygous for mutations in this gene. We found that 80% of the French athletes who won international competitions in rowing, Nordic skiing and judo display mutations in one allele of HFE, thus demonstrating the existence of a favourable phenotype linked to this heterozygosity.
Hepatic steatosis is characterized by the accumulation of lipid droplets (LDs), which are composed of a neutral lipid core surrounded by a phospholipid monolayer embedded with many proteins. Although the LD-associated proteome has been investigated in multiple tissues and organisms, the dynamic changes in the murine LD-associated proteome in response to obesity and hepatic steatosis have not been studied. We characterized the hepatic LD-associated proteome of C57BL/6J male mouse livers following high-fat feeding using isobaric tagging for relative and absolute quantification. Of the 1,520 proteins identified with a 5% local false discovery rate, we report a total of 48 proteins that were increased and 52 proteins that were decreased on LDs in response to high-fat feeding. Most notably, ribosomal and endoplasmic reticulum proteins were increased and extracellular and cytosolic proteins were decreased in response to high-fat feeding. Additionally, many proteins involved in fatty acid catabolism or xenobiotic metabolism were enriched in the LD fraction following high-fat feeding. In contrast, proteins involved in glucose metabolism and liver X receptor or retinoid X receptor activation were decreased on LDs of high-fat-fed mice. This study provides insights into unique biological functions of hepatic LDs under normal and steatotic conditions.
Also flagged:MethylationInflammatory Bowel DiseasepolymeraseTRAF6hypermethylationgene expression
Journal Article2015-09-28✓ 1 SnippetMcDermott E, Ryan EJ, Tosetto M, Gibson D, Burrage J, Keegan D, Byrne K, Crowe E, Sexton G, Malone K, Harris RA, Kellermayer R, Mill J, Cullen G, Doherty GA, Mulcahy H, Murphy TM.
In-Text Gene Mentions
Text
…TNFSF4…
Show Full Abstract
<h4>Background and aims</h4>Inflammatory bowel diseases (IBDs) are heterogeneous disorders with complex aetiology. Quantitative genetic studies suggest that only a small proportion of the disease variance observed in IBD is accounted for by genetic variation, indicating a potential role for differential epigenetic regulation in disease aetiology. The aim of this study was to assess genome-wide DNA methylation changes specifically associated with ulcerative colitis (UC), Crohn's disease (CD) and IBD activity.<h4>Methods</h4>DNA methylation was quantified in peripheral blood mononuclear cells (PBMCs) from 149 IBD cases (61 UC, 88 CD) and 39 controls using the Infinium HumanMethylation450 BeadChip. Technical and functional validation was performed using pyrosequencing and the real-time polymerase chain reaction. Cross-tissue replication of the top differentially methylated positions (DMPs) was tested in colonic mucosa tissue samples obtained from paediatric IBD cases and controls.<h4>Results</h4>A total of 3196 probes were differentially methylated between CD cases and controls, while 1481 probes were differentially methylated between UC cases and controls. There was considerable (45%) overlap between UC and CD DMPs. The top-ranked IBD-associated PBMC differentially methylated region (promoter region of TRIM39-RPP2) was also significantly hypomethylated in colonic mucosa from paediatric UC patients. In addition, we confirmed TRAF6 hypermethylation using pyrosequencing and found reduced TRAF6 gene expression in PBMCs of IBD patients.<h4>Conclusions</h4>Our data provide new insights into differential epigenetic regulation of genes and molecular pathways, which may contribute to the pathogenesis and activity of IBD.
Also flagged:Catel-Manzke-like syndromehyperphalangismX-chromosomenucleotidepathogenesis
Journal Article2015-09-28✓ 3 SnippetsStanghellini I, Dassi E, Bertorelli R, De Sanctis V, Caleffi A, Landi A, Percesepe A.
In-Text Gene Mentions
Abstract)
…DNAH10 and the genes involved in the other syndromes…
Abstract)
…only one gene,DNAH10, emerged as a…
Abstract)
…biological functions ofDNAH10and the genes…
Show Full Abstract
In the present study we describe the exome sequencing and analysis of a patient with Catel-Manzke-like phenotype showing bilateral hyperphalangism of the second finger and thumb clinodactyly due to a unilateral delta phalanx, associated with growth, cardiac and vertebral defects. The exome sequencing analysis excluded pathogenetic mutations in the genes known to cause syndromes with hyperphalangism and did not identify any alteration in the X-chromosome or de novo mutations in likely candidate genes. Under the assumption of an autosomal recessive mode of inheritance and based on the frequency of the single nucleotide variants found in homozygous or double heterozygous states and the results of computer prediction programs, only one gene, DNAH10, emerged as a candidate in the pathogenesis of the disease in our patient. However, the differences among the known biological functions of DNAH10 and the genes involved in the other syndromes with hyperphalangism, suggest caution in the interpretation of the results.
<h4>Background</h4>Over 25 years, the National Cancer Institute's Division of Cancer Prevention has entered some 800 agents into a chemopreventive agent testing program. Two critical steps involve: 1) in vitro/in vivo morphologic assays and 2) animal tumor assays (incidence/multiplicity reduction). We sought to determine how accurately the earlier-stage (morphologic) assays predict efficacy in the later-stage (animal tumor) assays.<h4>Methods</h4>Focusing on 210 agents tested in both morphologic and animal tumor assays, we carried out statistical modeling of how well the six most commonly used morphologic assays predicted drug efficacy in animal tumor assays. Using multimodel inference, three statistical models were generated to evaluate the ability of these six morphologic assays to predict tumor outcomes in three different sets of animal tumor assays: 1) all tumor types, 2) mammary cancer only, and 3) colon cancer only. Using this statistical modeling approach, each morphologic assay was assigned a value reflecting how strongly it predicted outcomes in each of the three different sets of animal tumor assays.<h4>Results</h4>We demonstrated differences in the predictive value of specific morphologic assays for positive animal tumor assay results. Some of the morphologic assays were strongly predictive of meaningful positive efficacy outcomes in animal tumor assays representing specific cancer types, particularly the aberrant crypt focus (ACF) assay for colon cancer. Moreover, less strongly predictive assays can be combined and sequenced, resulting in enhanced composite predictive ability.<h4>Conclusions</h4>Predictive models such as these could be used to guide selection of preventive agents as well as morphologic and animal tumor assays, thereby improving the efficiency of our approach to chemopreventive agent development.
Also flagged:chronic kidney diseaserenal diseaseACEcreatinineglomerular filtrationalbumin
Journal Article2015-09-28✓ 2 SnippetsWuttke M, Wong CS, Wühl E, Epting D, Luo L, Hoppmann A, Doyon A, Li Y, CKDGen Consortium, Sözeri B, Thurn D, Helmstädter M, Huber TB, Blydt-Hansen TD, Kramer-Zucker A, Mehls O, Melk A, Querfeld U, Furth SL, Warady BA, Schaefer F, Köttgen A.
In-Text Gene Mentions
I A O 0000326)
…CCPG1…
I A O 0000326)
…UNC13C…
Show Full Abstract
<h4>Background</h4>Chronic kidney disease (CKD) in children is characterized by rapid progression and a high incidence of end-stage renal disease and therefore constitutes an important health problem. While unbiased genetic screens have identified common risk variants influencing renal function and CKD in adults, the presence and identity of such variants in pediatric CKD are unknown.<h4>Methods</h4>The international Pediatric Investigation for Genetic Factors Linked with Renal Progression (PediGFR) Consortium comprises three pediatric CKD cohorts: Chronic Kidney Disease in Children (CKiD), Effect of Strict Blood Pressure Control and ACE Inhibition on the Progression of CRF in Pediatric Patients (ESCAPE) and Cardiovascular Comorbidity in Children with CKD (4C). Clean genotype data from > 10 million genotyped or imputed single-nucleotide polymorphisms (SNPs) were available for 1136 patients with measurements of serum creatinine at study enrollment. Genome-wide association studies were conducted to relate the SNPs to creatinine-based estimated glomerular filtration rate (eGFR crea) and proteinuria (urinary albumin- or protein-to-creatinine ratio ≥ 300 and ≥ 500 mg/g, respectively). In addition, European-ancestry PediGFR patients (cases) were compared with 1347 European-ancestry children without kidney disease (controls) to identify genetic variants associated with the presence of CKD.<h4>Results</h4>SNPs with suggestive association P-values < 1 × 10(-5) were identified in 10 regions for eGFR crea, four regions for proteinuria and six regions for CKD including some plausible biological candidates. No SNP was associated at genome-wide significance (P < 5 × 10(-8)). Investigation of the candidate genes for proteinuria in adults from the general population provided support for a region on chromosome 15 near RSL24D1/UNC13C/RAB27A. Conversely, targeted investigation of genes harboring GFR-associated variants in adults from the general population did not reveal significantly associated SNPs in children with CKD.<h4>Conclusions</h4>Our findings suggest that larger collaborative efforts will be needed to draw reliable conclusions about the presence and identity of common variants associated with eGFR, proteinuria and CKD in pediatric populations.
Also flagged:fluorescein diacetatephotonethylene glycolpolyethyleneimineblock copolymerswater
Journal Article2015-09-28No SnippetsLi J, Li Z, Zhou T, Zhang J, Xia H, Li H, He J, He S, Wang L.
Show Full Abstract
<h4>Purpose</h4>The cornea is a main barrier to drug penetration after topical application. The aim of this study was to evaluate the abilities of micelles generated from a positively charged triblock copolymer to penetrate the cornea after topical application.<h4>Methods</h4>The triblock copolymer poly(ethylene glycol)-poly(ε-caprolactone)-g-polyethyleneimine was synthesized, and the physicochemical properties of the self-assembled polymeric micelles were investigated, including hydrodynamic size, zeta potential, morphology, drug-loading content, drug-loading efficiency, and in vitro drug release. Using fluorescein diacetate as a model drug, the penetration capabilities of the polymeric micelles were monitored in vivo using a two-photon scanning fluorescence microscopy on murine corneas after topical application.<h4>Results</h4>The polymer was successfully synthesized and confirmed using nuclear magnetic resonance and Fourier transform infrared. The polymeric micelles had an average particle size of 28 nm, a zeta potential of approximately +12 mV, and a spherical morphology. The drug-loading efficiency and drug-loading content were 75.37% and 3.47%, respectively, which indicates that the polymeric micelles possess a high drug-loading capacity. The polymeric micelles also exhibited controlled-release behavior in vitro. Compared to the control, the positively charged polymeric micelles significantly penetrated through the cornea.<h4>Conclusion</h4>Positively charged micelles generated from a triblock copolymer are a promising vehicle for the topical delivery of hydrophobic agents in ocular applications.
Also flagged:cholecystokininposttraumatic stress disorderCCKanxietypanic attackspanic disorder
Journal Article2015-09-28No SnippetsBadour CL, Hirsch RL, Zhang J, Mandel H, Hamner M, Wang Z.
Show Full Abstract
<h4>Background</h4>Cholecystokinin (CCK) is a neuropeptide that has been implicated in understanding the acquisition and extinction of fear. Research on CCK in anxiety has primarily focused on understanding panic attacks and panic disorder. Emerging data suggests that CCK may also hold promise in understanding the development and maintenance of posttraumatic stress disorder (PTSD).<h4>Method</h4>The present study examined whether a single nucleotide polymorphism in the promoter region of the CCK gene (C>T; rs1799923) was associated with an increased prevalence of PTSD as well as with severity of PTSD symptoms among a sample of 457 combat veterans.<h4>Results</h4>Results demonstrated that participants with either the heterozygous or homozygous T allele had an increased prevalence of PTSD relative to participants with the CC genotype (OR=2.17; 95% CI [1.37-3.43]).<h4>Limitations</h4>The relatively small sample size precluded examination of racial/ethnic differences. Findings were also limited by the absence of a systematic assessment of comorbid anxiety psychopathology.<h4>Conclusions</h4>These data offer preliminary evidence supporting an association between the rs1799923 polymorphism in the CCK gene and PTSD. Additional research is needed to better understand the nature of this relationship.
A significant need for reliable and accurate cancer diagnostics and prognosis compels the search for novel biomarkers that would be able to discriminate between indolent and aggressive tumors at the early stages of disease. The aim of this work was identification of potential diagnostic biomarkers for characterization of different types of prostate tumors. NotI-microarrays with 180 clones associated with chromosome 3 genes/loci were applied to determine genetic and epigenetic alterations in 33 prostate tumors. For 88 clones, aberrations were detected in more than 10% of tumors. The major types of alterations were DNA methylation and/or deletions. Frequent methylation of the discovered loci was confirmed by bisulfite sequencing on selective sampling of genes: FGF12, GATA2, and LMCD1. Three genes (BHLHE40, BCL6, and ITGA9) were tested for expression level alterations using qPCR, and downregulation associated with hypermethylation was shown in the majority of tumors. Based on these data, we proposed the set of potential biomarkers for detection of prostate cancer and discrimination between prostate tumors with different malignancy and aggressiveness: BHLHE40, FOXP1, LOC285205, ITGA9, CTDSPL, FGF12, LOC440944/SETD5, VHL, CLCN2, OSBPL10/ZNF860, LMCD1, FAM19A4, CAND2, MAP4, KY, and LRRC58. Moreover, we probabilistically estimated putative functional relations between the genes within each set using the network enrichment analysis.
Also flagged:TRMT10Amicrocephalyperinatal brain injurycongenital infectionhypoxic ischemic encephalopathygenetic syndrome
Journal Article2015-09-28✓ 1 SnippetNarayanan M, Ramsey K, Grebe T, Schrauwen I, Szelinger S, Huentelman M, Craig D, Narayanan V, C4RCD Research Group.
In-Text Gene Mentions
Discussion)
…, ATR ,ARFGEF2, and RAB3GAP1…
Show Full Abstract
Microcephaly is a fairly common feature observed in children with delayed development, defined as head circumference less than 2 standard deviations below the mean for age and gender. It may be the result of an acquired insult to the brain, such prenatal or perinatal brain injury (congenital infection or hypoxic ischemic encephalopathy), or be a part of a genetic syndrome. There are over 1000 conditions listed in OMIM (Online Mendelian Inheritance in Man) where microcephaly is a key finding; many of these are associated with specific somatic features and non-CNS anomalies. The term primary microcephaly is used when microcephaly and delayed development are the primary features, and they are not part of another recognized syndrome. In this case report, we present the clinical features of siblings (brother and sister) with primary microcephaly and delayed development, and subtle dysmorphic features. Both children had brain MRI studies that showed periventricular and subcortical T2/FLAIR hyperintensities, without signs of white matter volume loss, and no parenchymal calcifications by CT scan. The family was enrolled in a research study for whole exome sequencing of probands and parents. Analysis of variants determined that the children were compound heterozygotes for nonsense mutations, c.277C>T (p.Arg93*) and c.397C>T (p.Arg133*), in the TRMT10A gene. Mutations in this gene have only recently been reported in children with microcephaly and early onset diabetes mellitus. Our report adds to current knowledge of TRMT10A related neurodevelopmental disorders and demonstrates imaging findings suggestive of delayed or abnormal myelination of the white matter in this disorder. Accurate diagnosis through genomic testing, as in the children described here, allows for early detection and management of medical complications, such as diabetes mellitus.
<h4>Background</h4>This study was designed to evaluate the effect of cumin on nonalcoholic steatohepatitis (NASH) in compare to placebo.<h4>Materials and methods</h4>One hundred patients with histopathological diagnosis NASH in two groups of case and control received oral cumin capsule or placebo thrice daily for 6 months. Clinical and laboratory data were body mass index (BMI), serum triglyceride, serum total cholesterol, alanine aminotransferase (ALT), aspartate aminotransferase (AST), high-density lipoprotein (HDL), low-density lipoprotein (LDL), fasting blood sugar (FBS), steatosis grade, and side-effects and were measured at baseline and after treatment period using standard clinical chemistry techniques. The grade of steatosis was assessed by liver sonography in 3 stages (mild, moderate and severe).<h4>Results</h4>Of 100 eligible patients during follow-up 10/50 cases and 9/50 controls were excluded. At baseline and after treatment BMI, triglyceride, cholesterol, ALT, AST, HDL, LDL, and FBS were not statistically significant between groups (P ≥ 0.5). BMI, triglyceride, cholesterol, ALT, AST, LDL, and FBS after treatment decreased compare to baseline but were not statistically significant (P ≥ 0.5). The mean of changes in the level of BMI, triglyceride, cholesterol, ALT, LDL and FBS were not statistically significant (P ≥ 0.5). The mean of changes in AST and HDL between groups was significant (P < 0.05). The grade of steatosis before and after treatment between studied groups was not statistically significant (P ≥ 0.5). Side-effects were not statistically significant among the two groups.<h4>Conclusion</h4>Findings show that there the effect of cumin in in the treatment of NASH was not significantly different in compare to placebo.
Also flagged:OX40Myocardial InfarctionTumor necrosis factorTNFatherosclerotic plaquesinflammatory response
Journal Article2015-09-28No SnippetsMaalhagh M, Shojaei M, Erfanian S, Sotoodeh Jahromi A, Sanie MS, Yusefi A, Zabetian H, Hakimelahi H, Madani A, Hojjat-Farsangi M.
Show Full Abstract
Tumor necrosis factor (TNF) is one of the inflammatory cytokines which has an important role in inflammation and migration of other inflammatory cells to the atherosclerotic plaques. OX40 is a member of the TNF super family receptor protein. OX40 and OX40 ligand are co-stimulators for T-cells and can increase inflammatory response in atherosclerotic plaques. The aim of this study was to determine the association of rs17568 polymorphism in OX40 gene with premature myocardial infarction. This case control study was done on 100 patients with premature acute myocardial infarction (AMI) and a similar number of sex, age and some other cardiovascular risk factor matched healthy people. The OX40 rs17568 polymorphism was genotyped, using PCR-RFLP method. A-allele frequency of rs17568 SNP was lower non-significantly in Premature AMI, compared to healthy subjects (49% vs. 51%). The analysis of rs17568 (A/G) polymorphism showed an odds ratio of 1.127 (95% CI: 0.635-1.999; P= 0.686) for the GG genotype and 5.761 (95% CI: 1.200-27.655; P= 0.029) for the AG genotype, compared to the AA genotype. The results of this study indicate that the rs17568 SNP of OX40 gene is not associated with premature AMI in the evaluated population.
Also flagged:α-Tocopherol SuccinateDextranDoxorubicinnasopharyngeal epidermoid carcinomadoxorubicin hydrochloridepolysaccharide
Journal Article2015-09-28No SnippetsYu J, Zhou Y, Chen W, Ren J, Zhang L, Lu L, Luo G, Huang H.
Show Full Abstract
In the present study, α-tocopherol succinate (TOS) conjugated dextran (Dex-TOS) was synthesized and characterized by fourier transform infrared (FT-IR) spectroscopy, ¹H nuclear magnetic resonance (¹H NMR), dynamic light scattering (DLS) and fluorescence spectroscopy. Dex-TOS could form nanoscaled micelles in aqueous medium. The critical micelle concentration (CMC) is 0.0034 mg/mL. Doxorubicin (Dox) was selected as a model drug. Dox-loaded Dex-TOS (Dex-TOS/Dox) micelles were prepared by a dialysis method. The size of Dex-TOS/Dox micelles increased from 295 to 325 nm with the Dox-loading content increasing from 4.21% to 8.12%. The Dex-TOS/Dox micelles were almost spherical in shape, as determined by transmission electron microscopy (TEM). <i>I</i><i>n vitro</i> release demonstrated that Dox release from the micelles was in a sustained manner for up to 96 h. The cellular uptake of Dex-TOS/Dox micelles in human nasopharyngeal epidermoid carcinoma (KB) cells is an endocytic process determined by confocal laser scanning microscopy (CLSM). Moreover, Dex-TOS/Dox micelles exhibited comparable cytotoxicity in contrast with doxorubicin hydrochloride. These results suggested that Dex-TOS micelles could be a promising carrier for drug delivery.
Also flagged:autism spectrum disorderneurodevelopmental brain disordercognitionimmunoglobulin Efood allergiesgluten-related disorders
Journal Article2015-09-28✓ 2 SnippetsWasilewska J, Klukowski M.
In-Text Gene Mentions
Introduction)
…Maternal genetic factors as well as environmental factors affecting the mother before and during pregnancy also seem to play a role in the pathogenesis of ASD.13 The genetic architecture of autism has proven to be complex and heterogeneous as shown by studies of cytogenetics, linkage, association, whole-genome linkage or association, and whole-genome or exome sequencing.14,15 A complex, multigene model of inheritance implicates the interactions of several genes with most being involved in neurodevelopmental processes (neuronal synaptogenesis, neurotransmitter transformation, neurometabolic conditions, lipid metabolism, and mitochondrial dysfunction).12,16–18 Candidate genes include, among others, MeCP2 (Xq28; Rett syndrome), HOXA-1 (7p15.3) and HOXB-1 (7q21.32; embryonal development of the rhombencephalon), EN2 (7q36.3; developmental regulation of the cerebellum), FOXP-2 (7q31.1; speech disorder), WNT2 (7q31-33; fetal development and social deficits), 5-HTT (17q11.1-q12; hyperserotonemia), GABRA3 (15q11-q13; GABAergic neurotransmission), OXTR 2 (3p26.2; decreased serum oxytocin levels), ASL (22q13.1-q13.2; impairment of purine biosynthesis), and PTEN (macrocephaly, tumor growth).4,16,19–22 Other mono-genetic disorders, such as fragile X syndrome, tuberous sclerosis, Down’s syndrome, phenylketonuria, neurofibromatosis type I, or Angelman syndrome, are found in 10%–15% of patients with ASD.23 Newer and newer genetic testing techniques and technologies are being used to investigate ASD and to develop a screening test which could help identify and diagnose ASD at a much earlier age than what is currently possible.24,25…
Introduction)
…and social deficits),5-HTT(17q11.1-q12; hyperserotonemia…
Show Full Abstract
Autism spectrum disorder (ASD) is a genetically determined neurodevelopmental brain disorder presenting with restricted, repetitive patterns of behaviors, interests, and activities, or persistent deficits in social communication and social interaction. ASD is characterized by many different clinical endophenotypes and is potentially linked with certain comorbidities. According to current recommendations, children with ASD are at risk of having alimentary tract disorders - mainly, they are at a greater risk of general gastrointestinal (GI) concerns, constipation, diarrhea, and abdominal pain. GI symptoms may overlap with ASD core symptoms through different mechanisms. These mechanisms include multilevel pathways in the gut-brain axis contributing to alterations in behavior and cognition. Shared pathogenetic factors and pathophysiological mechanisms possibly linking ASD and GI disturbances, as shown by most recent studies, include intestinal inflammation with or without autoimmunity, immunoglobulin E-mediated and/or cell-mediated GI food allergies as well as gluten-related disorders (celiac disease, wheat allergy, non-celiac gluten sensitivity), visceral hypersensitivity linked with functional abdominal pain, and dysautonomia linked with GI dysmotility and gastroesophageal reflux. Dysregulation of the gut microbiome has also been shown to be involved in modulating GI functions with the ability to affect intestinal permeability, mucosal immune function, and intestinal motility and sensitivity. Metabolic activity of the microbiome and dietary components are currently suspected to be associated with alterations in behavior and cognition also in patients with other neurodegenerative diseases. All the above-listed GI factors may contribute to brain dysfunction and neuroinflammation depending upon an individual patient's genetic vulnerability. Due to a possible clinical endophenotype presenting as comorbidity of ASD and GI disorders, we propose treating this situation as an "overlap syndrome". Practical use of the concept of an overlap syndrome of ASD and GI disorders may help in identifying those children with ASD who suffer from an alimentary tract disease. Unexplained worsening of nonverbal behaviors (agitation, anxiety, aggression, self-injury, sleep deprivation) should alert professionals about this possibility. This may shorten the time to diagnosis and treatment commencement, and thereby alleviate both GI and ASD symptoms through reducing pain, stress, or discomfort. Furthermore, this may also protect children against unnecessary dietary experiments and restrictions that have no medical indications. A personalized approach to each patient is necessary. Our understanding of ASDs has come a long way, but further studies and more systematic research are warranted.
Also flagged:nasopharyngeal carcinomatumorMaspinRKIPGRP78
Journal Article2015-09-27No SnippetsYi HM, Yi H, Zhu JF, Xiao T, Lu SS, Guan YJ, Xiao ZQ.
Show Full Abstract
Radioresistance poses a major challenge in nasopharyngeal carcinoma (NPC) treatment. Clinical tumor-node-metastasis (TNM) staging has limited accuracy in predicting NPC radioresponse and determining its therapeutic regimens. To construct a risk score model for predicting NPC radioresistance, immunohistochemistry was used to assess the expression of four proteins (14-3-3σ, Maspin, RKIP, and GRP78) in 149 NPC samples with different radiosensitivity. Sequentially, a logistic regression analysis was performed to identify independent predictors of NPC radioresistance and establish a risk score model. As a result, a risk score model, Z = -3.189 - 1.478 (14-3-3σ) - 1.082 (Maspin) - 1.666 (RKIP) + 2.499 (GRP78) + 2.597 (TNM stage), was constructed, and a patient's risk score was estimated by the formula: e (Z)/(e (Z) + 1) × 100, where "e" is the base of natural logarithm. High-risk score was closely associated with NPC radioresistance, and was observed more frequently in the radioresistant patients than that in the radiosensitive patients. The sensitivity, specificity, and accuracy of the risk score model for predicting NPC radioresistance was 88.00, 86.48, and 87.25 %, respectively, which was clearly superior to each individual protein and TNM stage. Furthermore, Kaplan-Meier survival analysis showed that high-risk score correlated with the markedly reduced overall survival (OS) and disease-free survival (DFS) of the patients, and Cox regression analysis showed that the risk score model was an independent predictor for OS and DFS. This study constructs a risk score model for predicting NPC radioresistance and patient survival, and it may serve as a complement to current radioresistance risk stratification approaches.
Also flagged:Infectionhepatocellular carcinomaandrogensestrogensHBV infectionandrogen
Journal Article2015-09-27✓ 1 SnippetMontella M, D'Arena G, Crispo A, Capunzo M, Nocerino F, Grimaldi M, Barbieri A, D'Ursi AM, Tecce MF, Amore A, Galdiero M, Ciliberto G, Giudice A.
In-Text Gene Mentions
Introduction)
…diseases such ashemochromatosisand α -antitrypsin…
Show Full Abstract
Infection with hepatitis B virus (HBV) is a major risk factor for hepatocellular carcinoma (HCC) in developed countries. Epidemiological reports indicate that the incidence of HBV-related HCC is higher in males and postmenopausal females than other females. Increasing evidence suggests that sex hormones such as androgens and estrogens play an important role in the progression of an HBV infection and in the development of HBV-related HCC. While androgen is supposed to stimulate the androgen signaling pathway and cooperate to the increased transcription and replication of HBV genes, estrogen may play a protecting role against the progression of HBV infections and in the development of HBV-related HCC through decreasing HBV RNA transcription and inflammatory cytokines levels. Additionally, sex hormones can also affect HBV-related hepatocarcinogenesis by inducing epigenetic changes such as the regulation of mRNA levels by microRNAs (miRNAs), DNA methylation, and histone modification in liver tissue. This review describes the molecular mechanisms underlying the gender disparity in HBV-related HCC with the aim of improving the understanding of key factors underneath the sex disparity often observed in HBV infections. Furthermore, the review will propose more effective prevention strategies and treatments of HBV-derived diseases.
Also flagged:Spinal Cord Injurydemyelinating disordersaxonalmyelinationneurotrophinstranscription factors
Journal Article2015-09-27No SnippetsLi N, Leung GK.
Show Full Abstract
Spinal cord injury (SCI) is a devastating condition to individuals, families, and society. Oligodendrocyte loss and demyelination contribute as major pathological processes of secondary damages after injury. Oligodendrocyte precursor cells (OPCs), a subpopulation that accounts for 5 to 8% of cells within the central nervous system, are potential sources of oligodendrocyte replacement after SCI. OPCs react rapidly to injuries, proliferate at a high rate, and can differentiate into myelinating oligodendrocytes. However, posttraumatic endogenous remyelination is rarely complete, and a better understanding of OPCs' characteristics and their manipulations is critical to the development of novel therapies. In this review, we summarize known characteristics of OPCs and relevant regulative factors in both health and demyelinating disorders including SCI. More importantly, we highlight current evidence on post-SCI OPCs transplantation as a potential treatment option as well as the impediments against regeneration. Our aim is to shed lights on important knowledge gaps and to provoke thoughts for further researches and the development of therapeutic strategies.
Also flagged:RNA-binding proteincell proliferationcell cyclemedulloblastomaglioblastomabreast cancer
Journal Article2015-09-26✓ 1 SnippetCambuli FM, Correa BR, Rezza A, Burns SC, Qiao M, Uren PJ, Kress E, Boussouar A, Galante PA, Penalva LO, Plateroti M.
In-Text Gene Mentions
Text
…Olfm4…
Show Full Abstract
The intestinal epithelium is very peculiar for its continuous cell renewal, fuelled by multipotent stem cells localized within the crypts of Lieberkühn. Several lines of evidence have established the evolutionary conserved RNA-binding protein Musashi1 as a marker of adult stem cells, including those of the intestinal epithelium, and revealed its roles in stem cell self-renewal and cell fate determination. Previous studies from our laboratories have shown that Musashi1 controls stem cell-like features in medulloblastoma, glioblastoma, and breast cancer cells, and has pro-proliferative and pro-tumorigenic properties in intestinal epithelial progenitor cells in vitro. To undertake a detailed study of Musashi1's function in the intestinal epithelium in vivo, we have generated a mouse model, referred to as v-Msi, overexpressing Musashi1 specifically in the entire intestinal epithelium. Compared with wild type litters, v-Msi1 mice exhibited increased intestinal crypt size accompanied by enhanced proliferation. Comparative transcriptomics by RNA-seq revealed Musashi1's association with gut stem cell signature, cell cycle, DNA replication, and drug metabolism. Finally, we identified and validated three novel mRNA targets that are stabilized by Musashi1, Ccnd1 (Cyclin D1), Cdk6, and Sox4. In conclusion, the targeted expression of Musashi1 in the intestinal epithelium in vivo increases the cell proliferation rate and strongly suggests its action on stem cells activity. This is due to the modulation of a complex network of gene functions and pathways including drug metabolism, cell cycle, and DNA synthesis and repair.
Also flagged:Glucocorticoid receptorGRchromatinGene expressionmetabolismmTOR
Journal Article2015-09-26No SnippetsSingh P, Brock CO, Volden PA, Hernandez K, Skor M, Kocherginsky M, Park JE, Brady MJ, Conzen SD.
Show Full Abstract
<h4>Objective</h4>To identify glucocorticoid receptor (GR)-associated chromatin sequences and target genes in primary human abdominal subcutaneous fat.<h4>Methods</h4>GR chromatin immunoprecipitation (ChIP)-sequencing (seq) methodology in subcutaneous human adipocytes treated ex vivo with dexamethasone (dex) was optimized to identify genome-wide dex-dependent GR-binding regions (GBRs). Gene expression analyses were performed in parallel ± dex treatment.<h4>Results</h4>Fat was obtained from four female surgical patients without obesity with a median age of 50.5 years. ChIP-seq analysis revealed 219 dex-associated GBRs. Of these, 136 GBRs were located within 100 kb of the transcriptional start site and associated with 123 genes. Combining these data with dex-induced gene expression, 70 of the 123 putative direct target genes were significantly up- or downregulated following 4 hours of dex treatment. Gene expression analysis demonstrated that the top 10 pathways reflected regulation of cellular metabolism and inflammation. DEPTOR, an inhibitor of mTOR, was identified as a potential direct GR target gene.<h4>Conclusions</h4>This is the first report of genome-wide GR ChIP-seq and gene expression analysis in human fat. The results implicate regulation of key GR target genes that are involved in dampening inflammation and promoting cellular metabolism.
Also flagged:Huntington diseaseneurodegenerative disorderHDcytosineadenineguanine
Journal Article2015-09-26✓ 1 SnippetLiu D, Long JD, Zhang Y, Raymond LA, Marder K, Rosser A, McCusker EA, Mills JA, Paulsen JS, PREDICT-HD Investigators and Coordinators of the Huntington Study Group.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
Huntington disease (HD) is a neurodegenerative disorder characterized by motor dysfunction, cognitive deterioration, and psychiatric symptoms, with progressive motor impairments being a prominent feature. The primary objectives of this study are to delineate the disease course of motor function in HD, to provide estimates of the onset of motor impairments and motor diagnosis, and to examine the effects of genetic and demographic variables on the progression of motor impairments. Data from an international multisite, longitudinal observational study of 905 prodromal HD participants with cytosine-adenine-guanine (CAG) repeats of at least 36 and with at least two visits during the followup period from 2001 to 2012 was examined for changes in the diagnostic confidence level from the Unified Huntington's Disease Rating Scale. HD progression from unimpaired to impaired motor function, as well as the progression from motor impairment to diagnosis, was associated with the linear effect of age and CAG repeat length. Specifically, for every 1-year increase in age, the risk of transition in diagnostic confidence level increased by 11% (95% CI 7-15%) and for one repeat length increase in CAG, the risk of transition in diagnostic confidence level increased by 47% (95% CI 27-69%). Findings show that CAG repeat length and age increased the likelihood of the first onset of motor impairment as well as the age at diagnosis. Results suggest that more accurate estimates of HD onset age can be obtained by incorporating the current status of diagnostic confidence level into predictive models.
Also flagged:venous thromboembolismchronic venous diseasevenous diseasevaricose veinsulcerschronic venous insufficiency
Journal Article2015-09-26✓ 1 SnippetWassel CL, Rasmussen-Torvik LJ, Callas PW, Denenberg JO, Durda JP, Reiner AP, Smith NL, Allison MA, Rosendaal FR, Criqui MH, Cushman M.
In-Text Gene Mentions
Text
…SERPINC1…
Show Full Abstract
<h4>Background</h4>Chronic venous disease is common and shares some risk factors with venous thromboembolism (VTE). Several genetic loci have been discovered and well-replicated for VTE in European descent populations. We examined associations of a genetic risk score (GRS), comprising known VTE loci, with chronic venous disease.<h4>Methods</h4>The San Diego Population Study (SDPS) is a multi-ethnic cohort that evaluated 2404 men and women aged 29-91 from 1994 to 1998 for chronic venous disease. The current study includes 1447 participants genotyped for 33 variants in 22 established VTE risk loci. Using these variants, unweighted and weighted GRS were constructed. Logistic regression was used to examine associations with venous disease.<h4>Results</h4>In non-Hispanic whites, African-Americans, Hispanics, and Asians, each standard deviation increment higher of the unweighted 33-SNP GRS was associated with a 1.45-fold (95% CI (1.26, 1.67)), 1.74-fold (1.18, 2.55), a 1.80-fold (1.30, 2.51), and 1.88-fold (1.30, 2.73) greater odds, respectively, for moderate plus severe disease. The difference in c-statistics was significant between a known venous risk factor model and a model adding the 33-SNP GRS for whites (p=0.008), African-Americans (0.03), and Hispanics (p=0.04), with marginal significance in Asians (p=0.06).<h4>Conclusions</h4>GRS comprising variants primarily from VTE findings in European descent populations were associated with chronic venous disease across all race/ethnic groups, and contributed significantly to prediction, indicating some level of generalizability to other race/ethnic groups. Future work should focus on more in depth examination of racial/ethnic group genetic architecture in relation to chronic venous disease.
Also flagged:CircadianCircadian rhythmssleepneurodegenerative disordersbrain disordersneurological disorders
Journal Article2015-09-26✓ 1 SnippetVidenovic A, Zee PC.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
Circadian rhythms have a major role in physiology and behavior. Circadian disruption has negative consequences for physiologic homeostasis at molecular, cellular, organ-system, and whole-organism levels. The onset of many cerebrovascular insults shows circadian temporal trends. Impaired sleep-wake cycle, the most robust output rhythms of the circadian system, is significantly affected by neurodegenerative disorders, may precede them by decades, and may also affect their progression. Emerging evidence suggests that circadian disruption may be a risk factor for these neurologic disorders. This article discusses the implications of circadian rhythms in brain disorders, with an emphasis on cerebrovascular and neurodegenerative disorders.
Also flagged:activin ATGFβgestationpre-eclampsiaPEhypertensive disorder of pregnancy
Journal Article2015-09-26✓ 1 SnippetYong HE, Murthi P, Wong MH, Kalionis B, Cartwright JE, Brennecke SP, Keogh RJ.
In-Text Gene Mentions
Abstract)
…vasoactive factors eNOS,PTGISand EDN1, as…
Show Full Abstract
<h4>Objectives</h4>Activin A, a TGFβ family member, circulates in the maternal blood at increasing concentrations throughout gestation during a healthy pregnancy. The circulating concentration of activin A is further increased in pre-eclampsia (PE), a hypertensive disorder of pregnancy that is marked by systemic maternal vascular endothelial cell dysfunction. The effect of increasing activin A concentrations on the maternal vascular endothelium is unknown. The study aim was to investigate the effect of physiological and pathological activin A concentrations observed in normotensive and PE pregnancies respectively, on vascular endothelial cell function.<h4>Methods and results</h4>Immunostaining demonstrated the presence of the activin A receptor, ACVR2A, in SGHEC-7 cells used to model the vascular endothelium. SGHEC-7 cells were treated with activin A concentrations representative of concentrations throughout gestation in normotensive (0-10ng/ml) and PE (50ng/ml) pregnancies. xCELLigence functional assays revealed that normotensive activin A concentrations increased SGHEC-7 proliferation and migration, which was inhibited by PE concentrations. Additionally, fluorescence based assays showed that PE concentrations increased endothelial permeability. None of the tested activin A concentrations affected cell apoptosis. PE concentrations also resulted in an imbalance of the vasoactive factors eNOS, PTGIS and EDN1, as determined by quantitative real-time polymerase chain reaction and enzyme-linked immunosorbent assays.<h4>Conclusion</h4>Compared with normotensive activin A concentrations, the higher PE activin A concentrations resulted in abnormal endothelial functions, which may contribute to the systemic maternal vascular endothelial cell dysfunction observed in the disorder.
Also flagged:Ironhereditary hemochromatosisosteoarthritisHHOAgene expression
Journal Article2015-09-25✓ 5 SnippetsCamacho A, Simão M, Ea HK, Cohen-Solal M, Richette P, Branco J, Cancela ML.
In-Text Gene Mentions
Abstract)
…<h4>Objective</h4>Hereditary hemochromatosis (HH) is a disease caused by mutations in the Hfe gene characterised by systemic iron overload and associated with an increased prevalence of osteoarthritis (OA) but the role of iron overload in the development of OA is still undefined.…
Abstract)
…Gene expression and immunohistochemical analysis showed a significant increase in the expression of matrix metallopeptidase 3 (MMP-3) in the joints of Hfe-KO mice compared with control mice at 8 weeks after surgery.<h4>Conclusions</h4>HH was associated with an accelerated development of OA in mice.…
<h4>Objective</h4>Hereditary hemochromatosis (HH) is a disease caused by mutations in the Hfe gene characterised by systemic iron overload and associated with an increased prevalence of osteoarthritis (OA) but the role of iron overload in the development of OA is still undefined. To further understand the molecular mechanisms involved we have used a murine model of HH and studied the progression of experimental OA under mechanical stress.<h4>Design</h4>OA was surgically induced in the knee joints of 10-week-old C57BL6 (wild-type) mice and Hfe-KO mice. OA progression was assessed using histology, micro CT, gene expression and immunohistochemistry at 8 weeks after surgery.<h4>Results</h4>Hfe-KO mice showed a systemic iron overload and an increased iron accumulation in the knee synovial membrane following surgery. The histological OA score was significantly higher in the Hfe-KO mice at 8 weeks after surgery. Micro CT study of the proximal tibia revealed increased subchondral bone volume and increased trabecular thickness. Gene expression and immunohistochemical analysis showed a significant increase in the expression of matrix metallopeptidase 3 (MMP-3) in the joints of Hfe-KO mice compared with control mice at 8 weeks after surgery.<h4>Conclusions</h4>HH was associated with an accelerated development of OA in mice. Our findings suggest that synovial iron overload has a definite role in the progression of HH-related OA.
Also flagged:RKIPRaf kinase inhibitory proteincancerstumor necrosis factor-related apoptosis-inducing ligandTRAILtumors
Journal Article2015-09-25No SnippetsFarooqi AA, Li Y, Sarkar FH.
Show Full Abstract
The Raf kinase inhibitory protein (RKIP) has been demonstrated to modulate different intracellular signaling pathways in cancers. Studies have shown that RKIP is frequently downregulated in cancers; therefore, attempts have been made to upregulate the expression of RKIP using natural and synthetic agents for the treatment of human malignancies. Moreover, various regulators such as specific proteins and microRNAs (miRNAs) that are involved in the regulation of RKIP expression have also been identified. RKIP mechanistically modulates the apoptotic regulators of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) signaling. Because of its critical role in human cancers, RKIP has drawn much research attention, and our understanding is expanding rapidly. Here, we summarize some of the biological complexities of RKIP regulation. However, we restrict our discussion to selected tumors by focusing on TRAIL, miRNAs and natural agents. Emerging evidence suggests a role for natural agents in RKIP regulation in cancer cells; therefore, naturally occurring agents may serve as cancer-targeting agents for cancer treatment. Although the literature suggests some advancement in our knowledge of RKIP biology, it is incomplete with regard to its preclinical and clinical efficacy; thus, further research is warranted. Furthermore, the mechanism by which chemotherapeutic drugs and novel compounds modulate RKIP and how nanotechnologically delivered RKIP can be therapeutically exploited remain to be determined.
Also flagged:chronic diseasestype-2 diabetesailmentschronic inflammatory metabolic disordersmetabolic disordersdyslipidemia
Journal Article2015-09-25✓ 1 SnippetNerurkar PV, Hwang PW, Saksa E.
In-Text Gene Mentions
Discussion)
…virus, autoimmune hepatitis,hemochromatosis, and Wilson’s disease…
Show Full Abstract
Escalating trends of chronic diseases such as type-2 diabetes (T2D) have sparked a renewed interest in complementary and alternative medicine, including herbal products. Morinda citrifolia (noni) has been used for centuries by Pacific Islanders to treat various ailments. Commercial noni fruit juice has been marketed as a dietary supplement since 1996. In 2003, the European Commission approved Tahitian noni juice as a novel food by the Health and Consumer Protection Directorate General. Among noni's several health benefits, others and we have demonstrated the anti-diabetic effects of fermented noni fruit juice in animal models. Unfortunately, noni's exciting journey from Polynesian medicine to the research bench does not reach its final destination of successful clinical outcomes when translated into commercial products. Noni products are perceived to be safe due to their "natural" origin. However, inadequate evidence regarding bioactive compounds, molecular targets, mechanism of action, pharmacokinetics, long-term safety, effective dosages, and/or unanticipated side effects are major roadblocks to successful translation "from bench side to bedside". In this review we summarize the anti-diabetic potential of noni, differences between traditional and modern use of noni, along with beneficial clinical studies of noni products and challenges in clinical translation of noni's health benefits.
Mutations of FBXL4, which encodes an orphan mitochondrial F-box protein, are a recently identified cause of encephalomyopathic mtDNA depletion. Here, we describe the detailed clinical and biochemical phenotype of a neonate presenting with hyperlactatemia, leukoencephalopathy, arrhythmias, pulmonary hypertension, dysmorphic features, and lymphopenia. Next-generation sequencing in the proband identified a homozygous frameshift, c.1641_1642delTG, in FBXL4, with a surrounding block of SNP marker homozygosity identified by microarray. Muscle biopsy showed a paucity of mitochondria with ultrastructural abnormalities, mitochondrial DNA depletion, and profound deficiency of all respiratory chain complexes. Cell-based mitochondrial phenotyping in fibroblasts showed mitochondrial fragmentation, decreased basal and maximal respiration, absence of ATP-linked respiratory and leak capacity, impaired survival under obligate aerobic respiration, and reduced mitochondrial inner membrane potential, with relative sparing of mitochondrial mass. Cultured fibroblasts from the patient exhibited a more oxidized glutathione ratio, consistent with altered cellular redox poise. High-resolution respirometry of permeabilized muscle fibers showed marked deficiency of oxidative phosphorylation using a variety of mitochondrial energy substrates and inhibitors. This constitutes the fourth and most detailed report of FBXL4 deficiency to date. In light of our patient's clinical findings and genotype (homozygous frameshift), this phenotype likely represents the severe end of the FBXL4 clinical spectrum.
Also flagged:Protocadherin17MethylationClear Cell Renal Cell CarcinomatumorcancersccRCC
Journal Article2015-09-25✓ 5 SnippetsLin YL, Gui SL, Guo H, Ma JG, Li WP.
In-Text Gene Mentions
S I O 001029)
…Our study indicated that PCDH17 methylation occurred more frequently and was associated with malignant clinicopathological characteristics and poor prognosis in ccRCC patients, suggesting that it could be used as a potential prognostic biomarker in this malignancy.…
Abstract)
…PCDH17 methylation occurred more frequently and was associated with malignant clinicopathological characteristics and poor prognosis in ccRCC patients.…
Discussion)
…To our knowledge this is the first study to investigate the clinical significance of PCDH17 methylation in ccRCC.…
Discussion)
…In addition, when we correlated the methylation of PCDH17 to clinicopathological features of ccRCC patients, we found that PCDH17 methylation associated with advanced stage, higher grade, lymph node metastasis and progression after surgery.…
Abstract)
…The aim of the present study was to investigate the methylation status of PCDH17 in ccRCC and its potential relevance to clinicopathological parameters and prognosis.…
Show Full Abstract
<h4>Background</h4>Protocadherin17 (PCDH17) is a tumor suppressor gene, and is frequently silenced by promoter methylation in human cancers, including clear cell renal cell carcinoma (ccRCC). However, the clinical significance of PCDH17 methylation in ccRCC remains largely unclear. The aim of the present study was to investigate the methylation status of PCDH17 in ccRCC and its potential relevance to clinicopathological parameters and prognosis.<h4>Material and methods</h4>Methylation-specific PCR was used to examine the methylation status of PCDH17 in 191 ccRCC tumors and matched paired adjacent noncancerous tissues. Subsequently, the associations between PCDH17 methylation and clinicopathological parameters and prognosis of patients with ccRCC were analyzed.<h4>Results</h4>PCDH17 methylation occurred in 66.5% of ccRCC tumors, but in only 12.1% of adjacent noncancerous tissues. PCDH17 methylation is significantly correlated with advanced stage, higher grade, and lymph node metastasis in ccRCC. Moreover, it is an independent prognostic factor for progression-free survival and overall survival of patients with ccRCC.<h4>Conclusions</h4>PCDH17 methylation occurred more frequently and was associated with malignant clinicopathological characteristics and poor prognosis in ccRCC patients. Thus, PCDH17 methylation may be used as a novel biomarker to predict the prognosis of patients with ccRCC.
Also flagged:p53Cell Cycleproteasomeautophagypolyglutaminemitosis
Journal Article2015-09-25✓ 1 SnippetLu M, Boschetti C, Tunnacliffe A.
In-Text Gene Mentions
Text
…Htt…
Show Full Abstract
Juxtanuclear aggresomes form in cells when levels of aggregation-prone proteins exceed the capacity of the proteasome to degrade them. It is widely believed that aggresomes have a protective function, sequestering potentially damaging aggregates until these can be removed by autophagy. However, most in-cell studies have been carried out over a few days at most, and there is little information on the long term effects of aggresomes. To examine these long term effects, we created inducible, single-copy cell lines that expressed aggregation-prone polyglutamine proteins over several months. We present evidence that, as perinuclear aggresomes accumulate, they are associated with abnormal nuclear morphology and DNA double-strand breaks, resulting in cell cycle arrest via the phosphorylated p53 (Ser-15)-dependent pathway. Further analysis reveals that aggresomes can have a detrimental effect on mitosis by steric interference with chromosome alignment, centrosome positioning, and spindle formation. The incidence of apoptosis also increased in aggresome-containing cells. These severe defects developed gradually after juxtanuclear aggresome formation and were not associated with small cytoplasmic aggregates alone. Thus, our findings demonstrate that, in dividing cells, aggresomes are detrimental over the long term, rather than protective. This suggests a novel mechanism for polyglutamine-associated developmental and cell biological abnormalities, particularly those with early onset and non-neuronal pathologies.
Also flagged:cancercardiovascular diseasesgene expressionIRcell cyclesignal transduction
Journal Article2015-09-25✓ 1 SnippetColeman MA, Sasi SP, Onufrak J, Natarajan M, Manickam K, Schwab J, Muralidharan S, Peterson LE, Alekseyev YO, Yan X, Goukassian DA.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
There are 160,000 cancer patients worldwide treated with particle radiotherapy (RT). With the advent of proton, and high (H) charge (Z) and energy (E) HZE ionizing particle RT, the cardiovascular diseases risk estimates are uncertain. In addition, future deep space exploratory-type missions will expose humans to unknown but low doses of particle irradiation (IR). We examined molecular responses using transcriptome profiling in left ventricular murine cardiomyocytes isolated from mice that were exposed to 90 cGy, 1 GeV proton ((1)H) and 15 cGy, 1 GeV/nucleon iron ((56)Fe) over 28 days after exposure. Unsupervised clustering analysis of gene expression segregated samples according to the IR response and time after exposure, with (56)Fe-IR showing the greatest level of gene modulation. (1)H-IR showed little differential transcript modulation. Network analysis categorized the major differentially expressed genes into cell cycle, oxidative responses, and transcriptional regulation functional groups. Transcriptional networks identified key nodes regulating expression. Validation of the signal transduction network by protein analysis and gel shift assay showed that particle IR clearly regulates a long-lived signaling mechanism for ERK1/2, p38 MAPK signaling and identified NFATc4, GATA4, STAT3, and NF-κB as regulators of the response at specific time points. These data suggest that the molecular responses and gene expression to (56)Fe-IR in cardiomyocytes are unique and long-lasting. Our study may have significant implications for the efforts of National Aeronautics and Space Administration to develop heart disease risk estimates for astronauts and for patients receiving conventional and particle RT via identification of specific HZE-IR molecular markers.
Also flagged:nucleusadamantaneacetylvalineL-alaninewater
Journal Article2015-09-25No SnippetsGupta R, Hou G, Polenova T, Vega AJ.
Show Full Abstract
In this report we discuss the effect of radiofrequency field (RF) inhomogeneity on cross-polarization (CP) under magic-angle spinning (MAS) by reviewing the dependence of the CP-detected signal intensity as a function of the position in the sample space. We introduce a power-function model to quantify the position-dependent RF-amplitude profile. The applicability of this model is experimentally verified by nutation spectra obtained by direct signal detection, as well as by CPMAS signal detection, in two commercial MAS probes with different degrees of RF inhomogeneity. A conclusion is that substantial sections of a totally filled rotor, even in a probe with rather good homogeneity, do not contribute at all to the detected spectra. The consequence is that in CPMAS-based recoupling experiments, such as the CP-with-variable-contact-time (CPVC), spatial selectivity of the Hartmann-Hahn matching condition overcomes complications that could be caused by RF inhomogeneity permitting determination of accurate spectral parameters even in cases with high inhomogeneity.
Also flagged:p53breast cancercell cyclecell cycle-relatedTumor suppressor p53transcription factor
Journal Article2015-09-25No SnippetsZhou E, Hui NA, Shu M, Wu B, Zhou J.
Show Full Abstract
Numerous miRNAs have been found to be involved in the regulation of the p53 signaling pathway. Conversely, p53 regulates the transcription or processing of microRNAs (miRNAs). Given that complexities in the association between p53 and miRNAs exist, and due to the rapidly increasing amount of literature regarding the interactions between p53 and miRNAs, the present study systematically analyzed the associations between miRNAs and p53 in breast cancer using a literature-based discovery approach, natural language processing. A total of 22 miRNAs were found to be associated with p53. Next, three popular online tools (PicTar, miRanda and TargetScan) were used to predict the targets of each miRNA, and certain targets were validated by experiments. Gene Ontology annotation and network analysis demonstrated that the majority of the targets of the p53-related miRNAs were enriched in the cell cycle process. These results suggest that, in addition to regulating the transcription of cell cycle-related genes, p53 also indirectly modulates the cell cycle via miRNAs.
Also flagged:Dihydroartemisinincerebral malariaphenylephrineartesunateartemetherArtemisinin
Journal Article2015-09-24No SnippetsBertinaria M, Orjuela-Sanchez P, Marini E, Guglielmo S, Hofer A, Martins YC, Zanini GM, Frangos JA, Gasco A, Fruttero R, Carvalho LJ.
Show Full Abstract
Hybrid products in which the dihydroartemisinin scaffold is combined with NO-donor furoxan and NONOate moieties have been synthesized and studied as potential tools for the treatment of cerebral malaria (CM). The designed products were able to dilate rat aorta strips precontracted with phenylephrine with a NO-dependent mechanism. All hybrid compounds showed preserved antiplasmodial activity in vitro and in vivo against Plasmodium berghei ANKA, comparable to artesunate and artemether. Hybrid 10, selected for additional studies, was capable of increasing survival of mice with late-stage CM from 27.5% to 51.6% compared with artemether. Artemisinin-NO-donor hybrid compounds show promise as potential new drugs for treating cerebral malaria.
Also flagged:lysineSirt5succinylationmetabolismmitochondriapeptides
Journal Article2015-09-24✓ 2 SnippetsBoylston JA, Sun J, Chen Y, Gucek M, Sack MN, Murphy E.
In-Text Gene Mentions
Abstract)
…The 46 unique proteins in Sirt5(-/-) heart participate in metabolic processes such as fatty acid β-oxidation (Eci2) and branched chain amino acid catabolism, and include respiratory chain proteins (Ndufa7, 12, 13, Dhsa).…
Abstract)
…fatty acid β-oxidation (Eci2) and branched chain…
Show Full Abstract
Succinylation refers to modification of lysine residues with succinyl groups donated by succinyl-CoA. Sirtuin5 (Sirt5) is a mitochondrial NAD(+)-dependent deacylase that catalyzes the removal of succinyl groups from proteins. Sirt5 and protein succinylation are conserved across species, suggesting functional importance of the modification. Sirt5 loss impacts liver metabolism but the role of succinylation in the heart has not been explored. We combined affinity enrichment with proteomics and mass spectrometry to analyze total succinylated lysine content of mitochondria isolated from WT and Sirt5(-/-) mouse hearts. We identified 887 succinylated lysine residues in 184 proteins. 44 peptides (5 proteins) occurred uniquely in WT samples, 289 (46 proteins) in Sirt5(-/-) samples, and 554 (133 proteins) were common to both groups. The 46 unique proteins in Sirt5(-/-) heart participate in metabolic processes such as fatty acid β-oxidation (Eci2) and branched chain amino acid catabolism, and include respiratory chain proteins (Ndufa7, 12, 13, Dhsa). We performed label-free analysis of the peptides common to WT and Sirt5(-/-) hearts. 16 peptides from 9 proteins were significantly increased in Sirt5(-/-) by at least 30%. The adenine nucleotide transporter 1 showed the highest increase in succinylation in Sirt5(-/-) (108.4 fold). The data indicate that succinylation is widespread in the heart and enriched in metabolic pathways. We examined whether the loss of Sirt5 would impact ischemia-reperfusion (I/R) injury and we found an increase in infarct size in Sirt5(-/-) hearts compared to WT littermates (68.5(+)/-1.1% Sirt5(-/-) vs 39.6(+)/(-) 6.8% WT) following 20min of ischemia and 90-min reperfusion. We further demonstrate that I/R injury in Sirt5(-/-) heart is restored to WT levels by pretreatment with dimethyl malonate, a competitive inhibitor of succinate dehydrogenase (SDH), implicating alteration in SDH activity as causative of the injury.
Also flagged:Methylphenidateserotonin transporterADHDSLC6A4tics5
Journal Article2015-09-24✓ 2 SnippetsPark SY, Kim EJ, Cheon KA.
In-Text Gene Mentions
Introduction)
…The L allele compared with the S allele has increased 5-HTT mRNA expression that leads to faster serotonin reuptake from the serotonin transporter, which in turn results in low serotonin concentration in the synaptic clefts (Lesch et al. 1994; Heils et al. 1996).…
Introduction)
…allele has increased5-HTTmRNA expression that…
Show Full Abstract
<h4>Objectives</h4>The purpose of this study is to examine the relationship between 5-HTTLPR polymorphism (44-bp insertion/deletion polymorphism of serotonin transporter gene) and methylphenidate (MPH) treatment response, as well as the association between the adverse events of MPH treatment and 5-HTTLPR polymorphism in children with attention-deficit/hyperactivity disorder (ADHD).<h4>Methods</h4>A total of 114 children with ADHD (mean age 9.08 ± 1.94 years) were recruited from the child psychiatric clinic in a hospital in South Korea. We have extracted the genomic DNA of the subjects from their blood lymphocytes and analyzed 5-HTTLPR polymorphism of the SLC6A4 gene. All children were treated with MPH for 8 weeks, with clinicians monitoring both the improvement of ADHD symptoms and the side effects. We compared the response to MPH treatment and adverse events among those with the genotype of 5-HRRLPR polymorphism.<h4>Results</h4>There was no significant association between the 5-HTTLPR genotype and the response to MPH treatment in children with ADHD. Subjects with the S/L+L/L genotype tended to have tics and nail biting (respectively, p < 0.001, p = 0.017).<h4>Conclusions</h4>The results of this study do not support the association between the 5-HTTLPR polymorphism and treatment response with MPH in ADHD. However, our findings suggest the association between 5-HTTLPR polymorphism and the occurrence of tics and nail-biting as an adverse event of methylphenidate. This may aid in our understanding of the genetic contribution and genetic susceptibility of a particular allele in those ADHD patients with tics or nail biting.
Also flagged:arthritisrheumatoid arthritisAAcorticosteronecorticosteroid binding globulincytokine
Journal Article2015-09-24No SnippetsBodnar TS, Hill LA, Taves MD, Yu W, Soma KK, Hammond GL, Weinberg J.
Show Full Abstract
Sprague Dawley rats from different vendor colonies display divergent responses in a variety of experimental paradigms. An adjuvant-induced arthritis (AA) model of human rheumatoid arthritis was used to examine immune and endocrine responses to inflammatory challenge in Sprague Dawley rats from Charles River and Harlan colonies. Rats were injected with either complete Freund's adjuvant or physiological saline (control), weights, and paw volumes measured over 15 days, and blood and tissue were collected 16 days post-injection. Overall, Harlan rats developed more severe AA than Charles River rats. In addition, despite comparable corticosterone levels, corticosteroid binding globulin levels were lower in Harlan compared with Charles River rats in the absence of inflammation, suggesting that a lower corticosterone reservoir in Harlan rats may underlie their greater susceptibility to inflammation. With increasing AA severity, there was an increase in plasma corticosterone (total and free) and a decrease in corticosteroid binding globulin in both Charles River and Harlan rats. However, contrasting patterns of cytokine activation were observed in the hind paw, suggesting a reliance on different cytokine networks at different stages of inflammation, with Charles River rats exhibiting increased TNF-α, monocyte chemotactic protein-1 (MCP-1), keratinocyte chemoattractant/growth-regulated oncogene (KC/GRO), and IL-1β in the absence of clinical signs of arthritis, whereas Harlan had increased TNF-α, monocyte chemotactic protein-1, and IL-6 with mild to moderate arthritis. These colony-specific differences in endocrine and immune responses to AA in Sprague Dawley rats must be considered when comparing data from different laboratories and could be exploited to provide insight into physiological changes and therapeutic outcomes in arthritis and other inflammatory disorders.
Brain serotonergic signaling is coupled to arachidonic acid (AA)-releasing calcium-dependent phospholipase A2. Increased brain serotonin concentrations and disturbed serotonergic neurotransmission have been reported in the Flinders Sensitive Line (FSL) rat model of depression, suggesting that brain AA metabolism may be elevated. To test this hypothesis, (14)C-AA was intravenously infused to steady-state levels into control and FSL rats derived from the same Sprague-Dawley background strain, and labeled and unlabeled brain phospholipid and plasma fatty acid concentrations were measured to determine the rate of brain AA incorporation and turnover. Brain AA incorporation and turnover did not differ significantly between controls and FSL rats. Compared to controls, plasma unesterified docosahexaenoic acid was increased, and brain phosphatidylinositol AA and total lipid linoleic acid and n-3 and n-6 docosapentaenoic acid were significantly decreased in FSL rats. Several plasma esterified fatty acids differed significantly from controls. In summary, brain AA metabolism did not change in FSL rats despite reported increased levels of serotonin concentrations, suggesting possible post-synaptic dampening of serotonergic neurotransmission involving AA.
Also flagged:Prostate CancerCholinePCaprostate-specific antigentumor
Journal Article2015-09-24✓ 1 SnippetIncerti E, Fodor A, Mapelli P, Fiorino C, Alongi P, Kirienko M, Giovacchini G, Busnardo E, Gianolli L, Di Muzio N, Picchio M.
In-Text Gene Mentions
Abstract)
…The aim was to assess the predictive role of imaging parameters derived by (11)C-choline PET/CT on survival outcomes-overall survival, locoregional relapse-free survival, clinical relapse-free survival (cRFS), and biochemical relapse-free survival (bRFS)-in patients treated with helical tomotherapy (HTT) for LN recurrence.<h4>Methods</h4>This retrospective study included 68 patients affected by PCa (mean age, 68 y; age range, 51-81 y) with biochemical recurrence after primary treatment (median prostate-specific antigen values obtained at the time of PET/CT scan, 2.42 ng/mL; range, 0.61-27.56 ng/mL) who underwent (11)C-choline PET/CT from January 2005 to January 2013 and were treated with HTT in correspondence of the pathologic choline LN uptake.…
Show Full Abstract
<h4>Unlabelled</h4>PET/CT is a valuable tool to detect lymph node (LN) metastases in patients with biochemical failure after primary treatment for prostate cancer (PCa). The aim was to assess the predictive role of imaging parameters derived by (11)C-choline PET/CT on survival outcomes-overall survival, locoregional relapse-free survival, clinical relapse-free survival (cRFS), and biochemical relapse-free survival (bRFS)-in patients treated with helical tomotherapy (HTT) for LN recurrence.<h4>Methods</h4>This retrospective study included 68 patients affected by PCa (mean age, 68 y; age range, 51-81 y) with biochemical recurrence after primary treatment (median prostate-specific antigen values obtained at the time of PET/CT scan, 2.42 ng/mL; range, 0.61-27.56 ng/mL) who underwent (11)C-choline PET/CT from January 2005 to January 2013 and were treated with HTT in correspondence of the pathologic choline LN uptake. PET-derived parameters, including maximum/mean standardized uptake value (SUVmax and SUVmean, respectively) and metabolic tumor volume (MTV) with a threshold of 40%, 50%, and 60% were calculated. The best cutoff values of PET-derived parameters discriminating between patients with and without relapse, after treatment guided by PET, were assessed by receiver-operating-characteristic (ROC) curve analysis. Univariate and multivariate Cox regression analysis including the most predictive PET-derived parameters and survival outcomes were performed.<h4>Results</h4>The median follow-up was 20 mo (mean, 26 mo; range, 3-97 mo). (11)C-choline PET/CT showed pathologic LN uptake in 4 patients at the pelvic level, in 5 at the abdominal level, in 13 at both the pelvic and the abdominal level, and in 46 at the abdominal or pelvic or other sites. The 2-y overall survival, locoregional relapse-free survival, cRFS, and bRFS were 87%, 91%, 51%, and 40%, respectively. On the basis of ROC curves, the most discriminative cutoff value for MTV values was an MTV threshold of 60% (MTV60) of greater than 0.64 cm(3). No significant cutoff values were found for SUVmax or SUVmean at univariate analysis, whereas MTV60 was confirmed as an independent predictor in multivariate analysis and significantly correlated with bRFS and cRFS. MTV60 and extrapelvic disease well predict the risk of cRFS.<h4>Conclusion</h4>(11)C-choline PET/CT performed as a guide for HTT on LN recurrence is predictive of survival. In particular, MTV60 and extrapelvic disease were the best predictors of tumor response for bRFS and cRFS in PCa patients with LN recurrence after primary treatment. This information may be useful in emerging treatment strategies.
Also flagged:DDX6DEAD box RNA helicaseYBX1EIF4Etranscription factorKLF4
Journal Article2015-09-24✓ 2 SnippetsWang Y, Arribas-Layton M, Chen Y, Lykke-Andersen J, Sen GL.
In-Text Gene Mentions
Text
…PTGIS…
Text
…STAU1…
Show Full Abstract
In adult tissues, stem and progenitor cells must balance proliferation and differentiation to maintain homeostasis. How this is done is unclear. Here, we show that the DEAD box RNA helicase, DDX6 is necessary for maintaining adult progenitor cell function. DDX6 loss results in premature differentiation and decreased proliferation of epidermal progenitor cells. To maintain self-renewal, DDX6 associates with YBX1 to bind the stem loops found in the 3' UTRs of regulators of proliferation/self-renewal (CDK1, EZH2) and recruit them to EIF4E to facilitate their translation. To prevent premature differentiation of progenitor cells, DDX6 regulates the 5' UTR of differentiation inducing transcription factor, KLF4 and degrades its transcripts through association with mRNA degradation proteins. Our results demonstrate that progenitor function is maintained by DDX6 complexes through two distinct pathways that include the degradation of differentiation-inducing transcripts and by promoting the translation of self-renewal and proliferation mRNAs.
Also flagged:Nucleic AcidacidDNA polymerasenucleasewaterbinding
Journal Article2015-09-24No SnippetsMorinishi LS, Blainey P.
Show Full Abstract
Digital assays are powerful methods that enable detection of rare cells and counting of individual nucleic acid molecules. However, digital assays are still not routinely applied, due to the cost and specific equipment associated with commercially available methods. Here we present a simplified method for readout of digital droplet assays using a conventional real-time PCR instrument to measure bulk fluorescence of droplet-based digital assays. We characterize the performance of the bulk readout assay using synthetic droplet mixtures and a droplet digital multiple displacement amplification (MDA) assay. Quantitative MDA particularly benefits from a digital reaction format, but our new method applies to any digital assay. For established digital assay protocols such as digital PCR, this method serves to speed up and simplify assay readout. Our bulk readout methodology brings the advantages of partitioned assays without the need for specialized readout instrumentation. The principal limitations of the bulk readout methodology are reduced dynamic range compared with droplet-counting platforms and the need for a standard sample, although the requirements for this standard are less demanding than for a conventional real-time experiment. Quantitative whole genome amplification (WGA) is used to test for contaminants in WGA reactions and is the most sensitive way to detect the presence of DNA fragments with unknown sequences, giving the method great promise in diverse application areas including pharmaceutical quality control and astrobiology.
Also flagged:chromosomeDnaA initiator proteinDnaAorganizationbindingDARS1
Journal Article2015-09-24✓ 5 SnippetsFrimodt-Møller J, Charbon G, Krogfelt KA, Løbner-Olesen A.
In-Text Gene Mentions
Methods)
…The DARS2 deletion was moved from ALO4254 to ALO4292 by P1 transduction using established procedures (Miller, 1972) and by selection for chloramphenicol resistance, resulting in ALO4310.…
Results)
…Loss of datA was similar to the loss of DARS2. Following co-infection in mice both wild-type and datA cells increased in numbers to level at 109 and 107 cfu per gram feces, respectively, and remained at these levels for the duration of the experiment (Figure 5H).…
Abstract)
…( DARS1 andDARS2) reactivate DnaA…
Abstract)
…DARS1 , andDARS2were found conserved…
Abstract)
…DARS1 , andDARS2, respectively, was…
Show Full Abstract
In Escherichia coli, chromosome replication is initiated from oriC by the DnaA initiator protein associated with ATP. Three non-coding regions contribute to the activity of DnaA. The datA locus is instrumental in conversion of DnaA(ATP) to DnaA(ADP) (datA dependent DnaA(ATP) hydrolysis) whereas DnaA rejuvenation sequences 1 and 2 (DARS1 and DARS2) reactivate DnaA(ADP) to DnaA(ATP). The structural organization of oriC, datA, DARS1, and DARS2 were found conserved among 59 fully sequenced E. coli genomes, with differences primarily in the non-functional spacer regions between key protein binding sites. The relative distances from oriC to datA, DARS1, and DARS2, respectively, was also conserved despite of large variations in genome size, suggesting that the gene dosage of either region is important for bacterial growth. Yet all three regions could be deleted alone or in combination without loss of viability. Competition experiments during balanced growth in rich medium and during mouse colonization indicated roles of datA, DARS1, and DARS2 for bacterial fitness although the relative contribution of each region differed between growth conditions. We suggest that this fitness advantage has contributed to conservation of both sequence and chromosomal location for datA, DARS1, and DARS2.
<h4>Objective</h4>To identify CSF biomarkers for multiple sclerosis (MS) in children with an initial acquired CNS demyelinating syndrome (ADS).<h4>Methods</h4>CSF was collected from a cohort of 39 children with initial ADS, 18 of whom were diagnosed with MS and 21 of whom had a monophasic disease course. Proteomic analysis of trypsinized CSF (20 μL) was performed by nano-liquid chromatography Orbitrap mass spectrometry. Univariate statistical analysis was used to identify differentially abundant proteins between childhood-onset MS and monophasic ADS.<h4>Results</h4>A total of 2,260 peptides corresponding to 318 proteins were identified in the total set of samples. Of these 2,260 peptides, 88 were identified as being most distinctive between MS and ADS. Fifty-three peptides, corresponding to 14 proteins, had higher abundance in children with MS compared to children with monophasic ADS. Twelve of these 14 proteins were linked to neuronal functions and structures, such as synapses, axons, and CNS proteases (e.g., neurofascin, carboxypeptidase E, brevican core protein, and contactin-2). The other 2 were functionally related to immune function. The 35 peptides identified with decreased abundance in children with MS corresponded to 7 proteins. Six of them were linked to innate immune function (e.g., haptoglobin, haptoglobin-related protein, C4b-binding protein alpha chain, and monocyte differentiation antigen CD14) and 1 was linked to cellular adhesion (protein diaphanous homolog 1).<h4>Conclusion</h4>At first onset of ADS, CSF of children diagnosed with MS showed increased abundance of CNS gray matter-related proteins, whereas CSF of children with a monophasic disease course showed increased abundance of innate immunity-related proteins.
Also flagged:tongue carcinomahead and neck tumorsCDKN2ANOTCH1Notchchromatin remodeling
Journal Article2015-09-23✓ 2 SnippetsVettore AL, Ramnarayanan K, Poore G, Lim K, Ong CK, Huang KK, Leong HS, Chong FT, Lim TK, Lim WK, Cutcutache I, Mcpherson JR, Suzuki Y, Zhang S, Skanthakumar T, Wang W, Tan DS, Cho BC, Teh BT, Rozen S, Tan P, Iyer NG.
In-Text Gene Mentions
Discussion)
…In this study, apart from detecting mutations in genes previously associated with HNSCC (TP53, NOTCH1, FAT1, and CASP8), they also identified recurring alterations in genes specific to this disease (USP9X, MLL4/KMT2B, ARID2, UNC13C, and TRPM3) [22].…
Introduction)
…, ARID2 ,UNC13C, and TRPM3…
Show Full Abstract
<h4>Background</h4>Carcinoma of the oral tongue (OTSCC) is the most common malignancy of the oral cavity, characterized by frequent recurrence and poor survival. The last three decades has witnessed a change in the OTSCC epidemiological profile, with increasing incidence in younger patients, females and never-smokers. Here, we sought to characterize the OTSCC genomic landscape and to determine factors that may delineate the genetic basis of this disease, inform prognosis and identify targets for therapeutic intervention.<h4>Methods</h4>Seventy-eight cases were subjected to whole-exome (n = 18) and targeted deep sequencing (n = 60).<h4>Results</h4>While the most common mutation was in TP53, the OTSCC genetic landscape differed from previously described cohorts of patients with head and neck tumors: OTSCCs demonstrated frequent mutations in DST and RNF213, while alterations in CDKN2A and NOTCH1 were significantly less frequent. Despite a lack of previously reported NOTCH1 mutations, integrated analysis showed enrichments of alterations affecting Notch signaling in OTSCC. Importantly, these Notch pathway alterations were prognostic on multivariate analyses. A high proportion of OTSCCs also presented with alterations in drug targetable and chromatin remodeling genes. Patients harboring mutations in actionable pathways were more likely to succumb from recurrent disease compared with those who did not, suggesting that the former should be considered for treatment with targeted compounds in future trials.<h4>Conclusions</h4>Our study defines the Asian OTSCC mutational landscape, highlighting the key role of Notch signaling in oral tongue tumorigenesis. We also observed somatic mutations in multiple therapeutically relevant genes, which may represent candidate drug targets in this highly lethal tumor type.
Reproductive homing migration of salmonids requires accurate interaction between the reception of external olfactory cues for navigation to the spawning grounds and the regulation of sexual maturation processes. This study aimed at providing insights into the hypothesized functional link between olfactory sensing of the spawning ground and final sexual maturation. We have therefore assessed the presence and expression levels of olfactory genes by RNA sequencing (RNAseq) of the olfactory rosettes in homing chum salmon Oncorhynchus keta Walbaum from the coastal sea to 75 km upstream the rivers at the pre-spawning ground. The progression of sexual maturation along the brain-pituitary-gonadal axis was assessed through determination of plasma steroid levels by time-resolved fluoroimmunoassays (TR-FIA), pituitary gonadotropin subunit expression and salmon gonadotropin-releasing hormone (sgnrh) expression in the brain by quantitative real-time PCR. RNAseq revealed the expression of 75 known and 27 unknown salmonid olfactory genes of which 13 genes were differentially expressed between fish from the pre-spawning area and from the coastal area, suggesting an important role of these genes in homing. A clear progression towards final maturation was characterised by higher plasma 17α,20β-dihydroxy-4-pregnen-3-one (DHP) levels, increased pituitary luteinizing hormone β subunit (lhβ) expression and sgnrh expression in the post brain, and lower plasma testosterone (T) and 17β-estradiol (E2) levels. Olfactomedins and ependymin are candidates among the differentially expressed genes that may connect olfactory reception to the expression of sgnrh to regulate final maturation.
…iron overload diseasehemochromatosisare more likely…
Show Full Abstract
Currently, sorafenib is the only available chemotherapeutic agent for advanced hepatocellular carcinoma (HCC), but it cannot be used in patients with liver cirrhosis (LC) or thrombocytopenia. In these cases, sorafenib is likely effective if given in combination with treatments that increase the number of platelets, such as thrombopoietin (TPO) receptor agonists. Increasing the platelet count via TPO treatment resulted in reduction of LC. Eltrombopag (EP), a TPO receptor agonist, has been reported to have antitumor effects against certain cancers, despite their lack of TPO receptor expression. We hypothesized that EP may possess antitumor activity against HCC in addition to its ability to suppress hepatic fibrosis by increasing the platelet count. In the present study, the antitumor activity of EP was examined by assessing the inhibition of cell proliferation and then ascertaining the ability of iron supplementation to reverse these effects in HepG2, Hep3B and Huh7 cells. In addition, a cell cycle assay was performed using flow cytometry, and signal transduction was evaluated by analyzing cell cycle-related protein expression. The results of EP were compared with those of the most common iron chelator, deferoxamine (DFO). The combined effect of EP and sorafenib was also assessed. The results revealed that EP exerts antitumor activity in HCC that is mediated by the modulation of intracellular iron content. EP suppressed the expression of the cell cycle-related protein cyclin D1 and elicited cell cycle arrest in the G0/G1 phase. The activity of EP was comparable to that of DFO in HCC, and EP did not compete with sorafenib at low concentrations. In conclusion, our findings suggest that EP is a good candidate chemotherapeutic agent for the treatment of HCC in patients with LC and thrombocytopenia.
Also flagged:glycineasparticpeptidesradiosynthesistumorexcretion
Journal Article2015-09-23No SnippetsHu K, Tang X, Tang G, Yao S, Yao B, Wang H, Nie D, Liang X, Tang C, He S.
Show Full Abstract
Radiolabeled cyclic arginine-glycine-aspartic (RGD) peptides can be used for noninvasive determination of integrin αvβ3 expression in tumors. In this study, we performed radiosynthesis and biological evaluation of a new 18F-labeled RGD homodimeric peptide with one 8-amino-3,6-dioxaoctanoic acid (PEG2) linker on the glutamate β-amino group (18F-FP-PEG2-β-Glu-RGD2) as a symmetric PET tracer for tumor imaging. Biodistribution studies showed that radioactivity of 18F-FP-PEG2-β-Glu-RGD2 was rapidly cleared from blood by predominately renal excretion. MicroPET-CT imaging with 18F-FP-PEG2-β-Glu-RGD2 revealed high tumor contrast and low background in A549 human lung adenocarcinoma-bearing mouse models, PC-3 prostate cancer-bearing mouse models, and orthotopic transplanted C6 brain glioma models. 18F-FP-PEG2-β-Glu-RGD2 exhibited good stability in vitro and in vivo. The results suggest that this tracer is a potential PET tracer for tumor imaging.
Also flagged:Foot and Mouth Diseasehand foot and mouth diseaseVP1encephalitismeningoencephalitismeningitis
Journal Article2015-09-23✓ 5 SnippetsXu M, Su L, Cao L, Zhong H, Dong N, Dong Z, Xu J.
In-Text Gene Mentions
Results)
…An elevated serum C-reactive protein (CRP) level >40 mg/L was noted in a substantial proportion of the patients in the CA6 and CA10 infection groups.…
Discussion)
…However, other enterovirus genotypes, especially CA6 and CA10, have now become the most common pathogens of HFMD, replacing EV71 and CA16 in some regions in recent years [9–15].…
Abstract)
…EV71, CA16 andCA10were prevalent throughout…
Methods)
…CA6, KP717666-KP717683 forCA10, KP717684-KP717686 for CA16…
Results)
…EV71, CA16 andCA10were detected throughout…
Show Full Abstract
Sporadic HFMD (hand foot and mouth disease, HFMD) cases and outbreaks caused by etiologic agents other than EV71 and CA16 have increased globally. We conducted this study to investigate the prevalence and genetic characteristics of enteroviruses, especially the non-EV71 and non-CA16 enteroviruses, causing HFMD in Shanghai. Clinical specimens were collected from patients with a diagnosis of HFMD. A partial length of VP1 was amplified with RT-PCR and subjected to direct sequencing. Phylogenetic analyses were performed using MEGA 5.0. The ages of the HFMD cases ranged from 3 to 96 months, and the male/female ratio was 1.41. The median hospital stay was 2.96 days. Up to 18.0% of patients had neurologic system complications such as encephalitis, meningoencephalitis or meningitis. Of the 480 samples, 417 were positive for enterovirus (86.9%) with RT-PCR. A total of 13 enterovirus genotypes were identified. The most frequent genotypes were CA6 (31.9%), EV71 (30.6%), CA16 (8.8%) and CA10 (7.5%). Infections with CA6, EV71, CA16 and CA10 were prevalent throughout the years of study, while the proportion of CA6 notably increased from Sep. 2012 to Dec. 2013. Phylogenetic analyses showed that EV71 strains belonged to the C4a subgenogroup and CA16 was identified as B1b subgenogroup. The CA6 strains were assigned to genogroup F, whereas the CA10 strains were assigned to genogroup D. Patients infected with CA6 were typically younger, had a shorter hospital stay and had a lower incidence of neurologic system complications when compared to patients infected with EV71. Our study demonstrates that the enterovirus genotypes causing HFMD were diversified, and there was an increasing prevalence of the non-EV71 and non-CA16 enteroviruses from 2012 to 2013. CA6 was the most predominant pathogen causing HFMD from Sep. 2012 to Dec. 2013, and it often caused relatively mild HFMD symptoms. Most severe HFMD cases were associated with EV71 infection.
Also flagged:AutismAutism spectrum disorderneurodevelopmental syndromebrain developmentGABA-ergicmitochondrial
Journal Article2015-09-23✓ 1 SnippetMahfouz A, Ziats MN, Rennert OM, Lelieveldt BP, Reinders MJ.
In-Text Gene Mentions
Results)
…, ZFAND6 ,DNAJC1, C6orf130 ,…
Show Full Abstract
Autism spectrum disorder (ASD) is a neurodevelopmental syndrome known to have a significant but complex genetic etiology. Hundreds of diverse genes have been implicated in ASD; yet understanding how many genes, each with disparate function, can all be linked to a single clinical phenotype remains unclear. We hypothesized that understanding functional relationships between autism candidate genes during normal human brain development may provide convergent mechanistic insight into the genetic heterogeneity of ASD. We analyzed the co-expression relationships of 455 genes previously implicated in autism using the BrainSpan human transcriptome database, across 16 anatomical brain regions spanning prenatal life through adulthood. We discovered modules of ASD candidate genes with biologically relevant temporal co-expression dynamics, which were enriched for functional ontologies related to synaptogenesis, apoptosis, and GABA-ergic neurons. Furthermore, we also constructed co-expression networks from the entire transcriptome and found that ASD candidate genes were enriched in modules related to mitochondrial function, protein translation, and ubiquitination. Hub genes central to these ASD-enriched modules were further identified, and their functions supported these ontological findings. Overall, our multi-dimensional co-expression analysis of ASD candidate genes in the normal developing human brain suggests the heterogeneous set of ASD candidates share transcriptional networks related to synapse formation and elimination, protein turnover, and mitochondrial function.
Also flagged:Histone H3F3AHIST1H3Bdiffuse intrinsic pontine gliomasDiffuse intrinsic pontine gliomaDIPGsolid tumour
Journal Article2015-09-23No SnippetsCastel D, Philippe C, Calmon R, Le Dret L, Truffaux N, Boddaert N, Pagès M, Taylor KR, Saulnier P, Lacroix L, Mackay A, Jones C, Sainte-Rose C, Blauwblomme T, Andreiuolo F, Puget S, Grill J, Varlet P, Debily MA.
Show Full Abstract
Diffuse intrinsic pontine glioma (DIPG) is the most severe paediatric solid tumour, with no significant therapeutic progress made in the past 50 years. Recent studies suggest that diffuse midline glioma, H3-K27M mutant, may comprise more than one biological entity. The aim of the study was to determine the clinical and biological variables that most impact their prognosis. Ninety-one patients with classically defined DIPG underwent a systematic stereotactic biopsy and were included in this observational retrospective study. Histone H3 genes mutations were assessed by immunochemistry and direct sequencing, whilst global gene expression profiling and chromosomal imbalances were determined by microarrays. A full description of the MRI findings at diagnosis and at relapse was integrated with the molecular profiling data and clinical outcome. All DIPG but one were found to harbour either a somatic H3-K27M mutation and/or loss of H3K27 trimethylation. We also discovered a novel K27M mutation in HIST2H3C, and a lysine-to-isoleucine substitution (K27I) in H3F3A, also creating a loss of trimethylation. Patients with tumours harbouring a K27M mutation in H3.3 (H3F3A) did not respond clinically to radiotherapy as well, relapsed significantly earlier and exhibited more metastatic recurrences than those in H3.1 (HIST1H3B/C). H3.3-K27M-mutated DIPG have a proneural/oligodendroglial phenotype and a pro-metastatic gene expression signature with PDGFRA activation, while H3.1-K27M-mutated tumours exhibit a mesenchymal/astrocytic phenotype and a pro-angiogenic/hypoxic signature supported by expression profiling and radiological findings. H3K27 alterations appear as the founding event in DIPG and the mutations in the two main histone H3 variants drive two distinct oncogenic programmes with potential specific therapeutic targets.
Also flagged:prostaglandinsoxygengene expressionIntegrin-alpha6cell adhesionion transport
Journal Article2015-09-23✓ 1 SnippetMandon M, Hermo L, Cyr DG.
In-Text Gene Mentions
Text
…Sox6…
Show Full Abstract
There is little information on the function of epididymal basal cells. These cells secrete prostaglandins, can metabolize radical oxygen species, and have apical projections that are components of the blood-epididymis barrier. The objective of this study was to develop a reproducible protocol to isolate rat epididymal basal cells and to characterize their function by gene expression profiling. Integrin-alpha6 was used to isolate a highly purified population of basal cells. Microarray analysis indicated that expression levels of 552 genes were enriched in basal cells relative to other cell types. Among these genes, 45 were expressed at levels of 5-fold or greater. These highly expressed genes coded for proteins implicated in cell adhesion, cytoskeletal function, ion transport, cellular signaling, and epidermal function, and included proteases and antiproteases, signal transduction, and transcription factors. Several highly expressed genes have been reported in adult stem cells, suggesting that basal cells may represent an epididymal stem cell population. A basal cell culture was established that showed that these basal cells can differentiate in vitro from keratin (KRT) 5-positive cells to cells that express KRT8 and connexin 26, a marker of columnar cells. These data provide novel information on epididymal basal cell gene expression and suggest that these cells can act as adult stem cells.
Also flagged:silymarinTuberculosisDILIsuperoxide dismutaseSODglutathione
Journal Article2015-09-23✓ 1 SnippetLuangchosiri C, Thakkinstian A, Chitphuk S, Stitchantrakul W, Petraksa S, Sobhonslidsuk A.
In-Text Gene Mentions
Methods)
…hepatitis, Wilson’s disease,hemochromatosis, or cirrhosis), acquired…
Show Full Abstract
<h4>Background</h4>Hepatitis is a common adverse effect of antituberculosis drugs. Silymarin prevented drug-induced hepatoxicity in animals with anti-oxidative mechanisms but its effect in human has been unknown. We aimed to evaluate the efficacy of silymarin for preventing antituberculosis-drug induced liver injury (antiTB-DILI) in patients with tuberculosis.<h4>Methods</h4>A double-blind randomized placebo-controlled trial was performed. Tuberculosis patients were randomly allocated to receive placebo or silymarin. The outcomes of interests were antiTB-DILI and the maximum liver enzymes at week 4. Antioxidative enzymes (i.e., superoxide dismutase (SOD), glutathione and malondialdehyde assays) were assessed. The risks of antiTB-DILI between the two groups were compared. A number need to treat was estimated.<h4>Results</h4>A total of 55 out of 70 expected numbers of patients were enrolled. There were 1/27 (3.7%) and 9/28 (32.1%) patients who developed antiTB-DILI in the silymarin and the placebo groups. Risk reduction was 0.28 (0.10, 0.47), i.e., receiving silymarin was 28% at lower risk for antiTB-DILI than placebo. This led to prevention of 28 patients from being antiTB-DILI among 100 treated patients. Median (IQR) of ALT levels at week 4 in the placebo and the silymarin group were 35.0 (15, 415) IU/L and 31.5 (20, 184) IU/L (p = 0.455). The decline of SOD level at week 4 in the silymarin group was less than the placebo group (p < 0.027).<h4>Conclusions</h4>Silymarin reduced the incidence of antiTB-DILI. The benefit of silymarin may be explained from superoxide dismutase restoration. Larger clinical trials are required to confirm the result of our small study [Clinicaltrials.Gov Identifier Nct01800487].
Also flagged:VP1antibodiesinfectionsEV71 infectionbindingheparan sulfate
Journal Article2015-09-23No SnippetsKu Z, Ye X, Shi J, Wang X, Liu Q, Huang Z.
Show Full Abstract
<h4>Unlabelled</h4>Antibodies play a critical role in immunity against enterovirus 71 (EV71). However, how EV71-specific antibodies neutralize infections remains poorly understood. Here we report the working mechanism for a group of three monoclonal antibodies (MAbs) that potently neutralize EV71. We found that these three MAbs (termed D5, H7, and C4, respectively) recognize the same conserved neutralizing epitope within the VP1 GH loop of EV71. Single MAbs in this group, exemplified by D5, could inhibit EV71 infection in cell cultures at both the pre- and postattachment stages in a cell type-independent manner. Specifically, MAb treatment resulted in the blockade of multiple steps of EV71 entry, including virus attachment, internalization, and subsequent uncoating and RNA release. Furthermore, we show that the D5 and C4 antibodies can interfere with EV71 binding to its key receptors, including heparan sulfate, SCARB2, and PSGL-1, thus providing a possible explanation for the observed multi-inhibitory function of the MAbs. Collectively, our study unravels the mechanism of neutralization by a unique group of anti-EV71 MAbs targeting the conserved VP1 GH loop. The findings should enhance our understanding of MAb-mediated immunity against enterovirus infections and accelerate the development of MAb-based anti-EV71 therapeutic drugs.<h4>Importance</h4>Enterovirus 71 (EV71) is a major causative agent of hand, foot, and mouth disease (HFMD), which has caused significant morbidities and mortalities in young children. Neither a vaccine nor an antiviral drug is available. Neutralizing antibodies are major protective components in EV71 immunity. Here, we unraveled an unusual mechanism of EV71 neutralization by a group of three neutralizing monoclonal antibodies (MAbs). All of these MAbs bound the same conserved epitope located at the VP1 GH loop of EV71. Interestingly, mechanistic studies showed that single antibodies in this MAb group could block EV71 attachment and internalization during the viral entry process and interfere with EV71 binding to heparan sulfate, SCARB2, and PSGL-1 molecules, which are key receptors involved in different steps of EV71 entry. Our findings greatly enhance the understanding of the interplays among EV71, neutralizing antibodies, and host receptors, which in turn should facilitate the development of an MAb-based anti-EV71 therapy.
Also flagged:pathogenesisBurkitt's lymphomaBLlymphoproliferative disordersEBV nuclear antigen 1EBNA1
Journal Article2015-09-23✓ 1 SnippetOussaief L, Fendri A, Chane-Woon-Ming B, Poirey R, Delecluse HJ, Joab I, Pfeffer S.
In-Text Gene Mentions
Text
…Kem-III…
Show Full Abstract
<h4>Unlabelled</h4>Epstein-Barr virus (EBV) is an oncogenic human herpesvirus involved in the pathogenesis of Burkitt's lymphoma (BL) and various other lymphoproliferative disorders. In BL, EBV protein expression is restricted to EBV nuclear antigen 1 (EBNA1), but small noncoding RNAs such as EBV-encoded small RNAs (EBERs) and microRNAs (miRNAs) can also be detected. miRNAs play major roles in crucial processes such as proliferation, differentiation, and cell death. It has recently become clear that alterations in the expression profile of miRNAs contribute to the pathogenesis of a number of malignancies. During latent infection, EBV expresses 25 viral pre-miRNAs and modulates the expression of specific cellular miRNAs, such as miR-155 and miR-146, which potentially play a role in oncogenesis. Here, we established the small-RNA expression profiles of three BL cell lines. Using large-scale sequencing coupled to Northern blotting and real-time reverse transcription-PCR (RT-PCR) analysis validation, we demonstrated the differential expression of some cellular and viral miRNAs. High-level expression of the miR-183-96-182 cluster and EBV miR-BamHI A rightward transcript (miR-BART) cluster was significantly associated with EBV type I latency. This expression was not affected by viral reactivation since transforming growth factor β1 (TGF-β1) stimulation did not significantly change the miRNA profiles. However, using several approaches, including de novo infection with a mutant virus, we present evidence that the expression of latent membrane protein 1 (LMP-1) triggered downregulation of the expression of the miR-183-96-182 cluster. We further show that this effect involves the Akt signaling pathway.<h4>Importance</h4>In addition to expressing their own miRNAs, herpesviruses also impact the expression levels of cellular miRNAs. This regulation can be either positive or negative and usually results in the perturbation of pathways to create a cellular environment that is more "virus-friendly." For example, EBV induces the expression of miR-155, a well-characterized oncomiR, which leads to increased cell proliferation and decreased cell death. Here, we show that EBV-encoded LMP-1 is also involved in the downregulation of a cluster of three miRNAs, miR-183, -96, and -182, which are known to be also repressed in several cancers. We therefore identify yet another potential player in EBV-induced oncogenesis.
Also flagged:Hemophagocytic lymphohistiocytosisimmune responsehyperferritinemiasteroidsIdiopathic Hemophagocytic Lymphohistiocytosismacrophage-activation syndrome
Journal Article2015-09-23✓ 1 SnippetSamra B, Yasmin M, Arnaout S, Azzi J.
In-Text Gene Mentions
Introduction)
…marker of inflammation (hemochromatosis, malignancies, rheumatologic …
Show Full Abstract
Hemophagocytic lymphohistiocytosis (HLH) is a rare and severe clinical syndrome characterized by a dysregulated hyperinflammatory immune response. The diagnosis of HLH during pregnancy is especially challenging due to the rarity of this condition. The highly variable clinical presentation, laboratory findings, and associated diagnoses accompanying this syndrome further complicate the problem. A pronounced hyperferritinemia in the setting of systemic signs and symptoms along with a negative infectious and rheumatological workup should raise suspicions for HLH. While treatment ideally consists of immunosuppressive chemotherapy and hematopoietic stem cell transplant, the potential toxicity to both the pregnant woman and the fetus poses a challenging decision. We report the first case of idiopathic HLH presenting as fever of unknown origin in a pregnant woman successfully treated with steroids.
Also flagged:genetic diseasesgenetic disordersbirthneurodevelopmental disorderserrors ofmetabolism
Journal Article2015-09-23No SnippetsRajab A, Hamza N, Al Harasi S, Al Lawati F, Gibbons U, Al Alawi I, Kobus K, Hassan S, Mahir G, Al Salmi Q, Mons B, Robinson P.
Show Full Abstract
The Sultanate of Oman is a rapidly developing Muslim country with well-organized government-funded health care services, and expanding medical genetic facilities. The preservation of tribal structures within the Omani population coupled with geographical isolation has produced unique patterns of rare mutations. In order to provide diagnosticians and researchers with access to an up-to-date resource that will assist them in their daily practice we collated and analyzed all of the Mendelian disease-associated mutations identified in the Omani population. By the 1 (st) of August 2015, the dataset contained 300 mutations detected in over 150 different genes. More than half of the data collected reflect novel genetic variations that were first described in the Omani population, and most disorders with known mutations are inherited in an autosomal recessive fashion. A number of novel Mendelian disease genes have been discovered in Omani nationals, and the corresponding mutations are included here. The current study provides a comprehensive resource of the mutations in the Omani population published in scientific literature or reported through service provision that will be useful for genetic care in Oman and will be a starting point for variation databases as next-generation sequencing technologies are introduced into genetic medicine in Oman.
Also flagged:colorectal carcinomamultiple myelomamonoclonal gammopathy of undetermined significancecolorectalcarcinomanetrin-1 receptor
Journal Article2015-09-22✓ 5 SnippetsNagoshi H, Taki T, Chinen Y, Tatekawa S, Tsukamoto T, Maegawa S, Yamamoto-Sugitani M, Tsutsumi Y, Kobayashi T, Matsumoto Y, Horiike S, Okuno Y, Fujiwara S, Hata H, Kuroda J, Taniwaki M.
In-Text Gene Mentions
Abstract)
…While allele loss or decreased expression of DCC has been associated with the progression of solid tumors and hematologic malignancies, including leukemias and malignant lymphomas, its involvement has not been evaluated in multiple myeloma (MM), a plasma cell malignancy characterized by complex and heterogenous molecular abnormalities.…
Title)
…Transcriptional dysregulation of the deleted in colorectal carcinoma gene in multiple myeloma and monoclonal gammopathy of undetermined significance.…
Abstract)
…While allele loss or decreased expre…
Abstract)
…We here show that 10 of 11 human myeloma-derived cell lines (HMCLs) expressed non-translated aberrant DCC transcriptional variants, in which exon 2 fuses with intron 1 instead of exon 1 (mt.DCC).…
Abstract)
…in colorectal carcinoma (DCC) gene at 18q21…
Show Full Abstract
The deleted in colorectal carcinoma (DCC) gene at 18q21 encodes a netrin-1 receptor, a tumor suppressor that prevents cell growth. While allele loss or decreased expression of DCC has been associated with the progression of solid tumors and hematologic malignancies, including leukemias and malignant lymphomas, its involvement has not been evaluated in multiple myeloma (MM), a plasma cell malignancy characterized by complex and heterogenous molecular abnormalities. We here show that 10 of 11 human myeloma-derived cell lines (HMCLs) expressed non-translated aberrant DCC transcriptional variants, in which exon 2 fuses with intron 1 instead of exon 1 (mt.DCC). Among them, two co-expressed wild type transcripts (wt.DCC), while eight co-expressed the splicing variant (sv.DCC) lacking exon 1. The remaining HMCL expressed only sv.DCC. In addition, analyses revealed that there were two types of mt.DCC that differed in their fusion of intron 1 with exon 2. In patient-derived samples from 30 MM and 8 monoclonal gammopathy of undetermined significance (MGUS) patients, wt.DCC was expressed in 53% of MM, but not in MGUS, while 23% of MM and 75% of MGUS expressed only sv.DCC. Considering that 25% of MGUS, 57% of MM, and 91% HMCLs expressed mt.DCC, our results suggest that the acquisition of mt.DCC might be a secondary genetic change in plasma cell dyscrasia.
Also flagged:serotonin transportermemory impairmentserotoninsynapse5-HTTLPRcognition
Journal Article2015-09-22✓ 1 SnippetGarrett A, Gupta S, Reiss AL, Waring J, Sudheimer K, Anker L, Sosa N, Hallmayer JF, O'Hara R.
In-Text Gene Mentions
Discussion)
…al. 55 that5-HTTgenotype may impact…
Show Full Abstract
Studies have shown that a functional polymorphism of the serotonin transporter gene (5-HTTLPR) impacts performance on memory-related tasks and the hippocampal structures that subserve these tasks. The short (s) allele of 5-HTTLPR has been linked to greater susceptibility for impaired memory and smaller hippocampal volume compared to the long allele (l). However, previous studies have not examined the associations between 5-HTTLPR allele and activation in subregions of the hippocampus. In this study, we used functional magnetic resonance imaging (fMRI) to measure activation in hippocampal and temporal lobe subregions in 36 elderly non-clinical participants performing a face-name encoding and recognition task. Although there were no significant differences in task performance between s allele carriers and l homozygotes, right CA1 and right parahippocampal activation during recognition errors was significantly greater in individuals bearing the s allele. In an exploratory analysis, we determined that these effects were more pronounced in s allele carriers with the apolipoprotein ɛ4 allele. Our results suggest that older individuals with the s allele inefficiently allocate neural resources while making errors in recognizing face-name associations, which could negatively impact memory performance during more challenging tasks.
Also flagged:serotoninreuptakepsychiatric disordersdepressionbipolar affective disorderanxiety-related disorders
Journal Article2015-09-22✓ 2 SnippetsKroeze Y, Peeters D, Boulle F, Pawluski JL, van den Hove DL, van Bokhoven H, Zhou H, Homberg JR.
In-Text Gene Mentions
Introduction)
…The primary target of SSRIs is the serotonin transporter (5-HTT); its blockade by SSRIs leads to increases in extracellular serotonin (5-HT) levels.…
Introduction)
…the serotonin transporter (5-HTT); its blockade by…
Show Full Abstract
The selective serotonin reuptake inhibitor (SSRI) fluoxetine is widely prescribed for the treatment of symptoms related to a variety of psychiatric disorders. After chronic SSRI treatment, some symptoms remediate on the long term, but the underlying mechanisms are not yet well understood. Here we studied the long-term consequences (40 days after treatment) of chronic fluoxetine exposure on genome-wide gene expression. During the treatment period, we measured body weight; and 1 week after treatment, cessation behavior in an SSRI-sensitive anxiety test was assessed. Gene expression was assessed in hippocampal tissue of adult rats using transcriptome analysis and several differentially expressed genes were validated in independent samples. Gene ontology analysis showed that upregulated genes induced by chronic fluoxetine exposure were significantly enriched for genes involved in myelination. We also investigated the expression of myelination-related genes in adult rats exposed to fluoxetine at early life and found two myelination-related genes (Transferrin (Tf) and Ciliary neurotrophic factor (Cntf)) that were downregulated by chronic fluoxetine exposure. Cntf, a neurotrophic factor involved in myelination, showed regulation in opposite direction in the adult versus neonatally fluoxetine-exposed groups. Expression of myelination-related genes correlated negatively with anxiety-like behavior in both adult and neonatally fluoxetine-exposed rats. In conclusion, our data reveal that chronic fluoxetine exposure causes on the long-term changes in expression of genes involved in myelination, a process that shapes brain connectivity and contributes to symptoms of psychiatric disorders.
Also flagged:Influenzarespiratory diseaseInfectionsinfluenza infectionintrauterine growth restrictioninfection
Journal Article2015-09-22✓ 1 SnippetWilkinson JM, Gunvaldsen RE, Detmer SE, Dyck MK, Dixon WT, Foxcroft GR, Plastow GS, Harding JC.
In-Text Gene Mentions
Results)
…biology, such asMLLT10, SHE ,…
Show Full Abstract
Influenza viruses are a common cause of respiratory disease in swine. Infections range in severity from asymptomatic to causing significant morbidity. The main objective of this study was to compare lung transcriptomic and epigenetic responses to influenza infection in pigs from high or low birth weight litters. The latter is a potential indicator of intrauterine growth restriction, a significant risk factor for prenatal programming effects. Individual pigs from high (HBW) or low birth weight (LBW) litters (n = 17) were inoculated with influenza A virus and euthanized 48 hours later. Lesion severity and viral loads were assessed as previously described. The transcriptional response to infection in LBW and HBW groups (n = 16) was assessed by microarray. A separate analysis of pigs classified as 'Resilient' (RES) or 'Susceptible' (SUS) (n = 6) on the basis of severity of lung pathology was also conducted. Eight genes were confirmed as differentially expressed for the birth weight comparison, including three antiviral genes with lower expression in LBW: ISG15, OAS1, and OAS2 (P<0.05). The promoter region methylation status of these three genes was assessed for each birth weight group, and no differences were found. These expression data are consistent with our previous finding that LBW pigs had less severe lesion scores and a trend towards lower viral titres in lung than the HBW cohort. The SUS v RES comparison identified 91 differentially expressed genes (FDR<0.05) that were enriched with functional annotation terms and pathways associated with inflammation. The cytokine genes IL6, IL8, and CCL2 were all upregulated in SUS pigs, and may have driven disease severity in these animals. In conclusion, this study found no evidence that the transcriptional immune response to influenza was adversely affected by low litter birth weight, but did identify several candidate genes for driving disease pathology.
Netrin 1 (Ntn1) is a multifunctional guidance cue expressed in the ventricular zone and floor plate of the embryonic neural tube. Although Ntn1 is best known for acting as an axon guidance cue through Dcc and neogenin receptors, it is also thought to regulate neuronal survival and blood vessel development through Unc5 family receptors. However, the Ntn1 gene trap mutant mouse does not display all the phenotypes predicted from in vitro assays or analyses of mice lacking predicted receptors. Since the gene trap strain still produces wild-type Ntn1 protein, it is unclear whether the absence of phenotypes reflects the activity of alternative cues or of residual Ntn1. To resolve the full contribution of Ntn1 to development, we generated a null allele of Ntn1 and re-examined tissues exhibiting phenotypic discrepancies between receptor mutants and Ntn1 hypomorphs. We found that in Ntn1 null animals commissural axons rarely cross the midline, resulting in a strongly enhanced phenotype relative to Ntn1 hypomorphs, which retain many axons with normal trajectories. Thus, low levels of Ntn1 can account for persistent attraction to the midline in hypomorphs. By contrast, Ntn1 null mice do not show all of the phenotypes reported for Unc5 receptor mutants, indicating that Ntn1 is not necessarily the dominant ligand for Unc5 family members in vivo and ruling out primary roles in survival or angiogenesis.
Also flagged:Guanabenzoligonucleotidegene silencingGuanabenz acetateoligonucleotides-
Journal Article2015-09-22✓ 3 SnippetsOsborn MF, Alterman JF, Nikan M, Cao H, Didiot MC, Hassler MR, Coles AH, Khvorova A.
In-Text Gene Mentions
Results)
…A dose response of a Huntingtin (HTT)-targeting hsiRNA was performed in the presence of 100 μM Clonidine or 60 μM Guanabenz (Supplementary Figure S14, structure Figure 4B).…
Results)
…In this assay, Guanabenz enhanced HTT mRNA silencing by ∼30% over an untreated (1% DMSO) control.…
Results)
…a Huntingtin (HTT)-targeting hsiRNA was…
Show Full Abstract
One of the major obstacles to the pharmaceutical success of oligonucleotide therapeutics (ONTs) is efficient delivery from the point of injection to the intracellular setting where functional gene silencing occurs. In particular, a significant fraction of internalized ONTs are nonproductively sequestered in endo-lysosomal compartments. Here, we describe a two-step, robust assay for high-throughput de novo detection of small bioactive molecules that enhance cellular uptake, endosomal escape, and efficacy of ONTs. Using this assay, we screened the LOPAC (Sigma-Aldrich) Library of Pharmacologically Active Compounds and discovered that Guanabenz acetate (Wytensin™), an FDA-approved drug formerly used as an antihypertensive agent, is capable of markedly increasing the cellular internalization and target mRNA silencing of hydrophobically modified siRNAs (hsiRNAs), yielding a ∼100-fold decrease in hsiRNA IC50 (from 132 nM to 2.4 nM). This is one of the first descriptions of a high-throughput small-molecule screen to identify novel chemistries that specifically enhance siRNA intracellular efficacy, and can be applied toward expansion of the chemical diversity of ONTs.
Also flagged:gene expressionimmunoglobulin alpha heavy chaintumor necrosis factor receptor superfamily member 13BTNFRSF13Bmannan-binding lectin serine protease 1 isoform X1MASP1
Journal Article2015-09-22No SnippetsWang A, Liu F, Chen S, Wang M, Jia R, Zhu D, Liu M, Sun K, Wu Y, Chen X, Cheng A.
Show Full Abstract
The goose (Anser cygnoides), having high nutritional value, high-quality feathers and high economic benefit, is an economically important poultry species. However, the molecular mechanisms underlying the higher susceptibility to pathogens in goslings than in adult geese remains poorly understood. In this study, the histological sections of spleen tissue from a two-week-old gosling and an adult goose, respectively, were subjected to comparative analysis. The spleen of gosling was mainly composed of mesenchyma, accompanied by scattered lymphocytes, whereas the spleen parenchyma was well developed in the adult goose. To investigate goose immune-related genes, we performed deep transcriptome and gene expression analyses of the spleen samples using paired-end sequencing technology (Illumina). In total, 50,390 unigenes were assembled using Trinity software and TGICL software. Moreover, these assembled unigenes were annotated with gene descriptions and gene ontology (GO) analysis was performed. Through Kyoto encyclopedia of genes and genomes (KEGG) analysis, we investigated 558 important immune-relevant unigenes and 23 predicted cytokines. In addition, 22 immune-related genes with differential expression between gosling and adult goose were identified, among which the three genes showing largest differences in expression were immunoglobulin alpha heavy chain (IgH), mannan-binding lectin serine protease 1 isoform X1 (MASP1) and C-X-C chemokine receptor type 4 (CXCR4). Finally, of these 22 differentially expressed immune-related genes, seven genes, including tumor necrosis factor receptor superfamily member 13B (TNFRSF13B), C-C motif chemokine 4-like (CCL4), CXCR4, interleukin 2 receptor alpha (IL2RA), MHC class I heavy chain (MHCIα), transporter of antigen processing 2 (TAP2) IgH, were confirmed by quantitative real-time PCR (qRT-PCR). The expression levels of all the candidate unigenes were up-regulated in adult geese other than that of TNFRSF13B. The comparative analysis of the spleen transcriptomes of gosling and adult goose may promote better understanding of immune molecular development in goose.
Also flagged:neurological diseasesAlzheimer'sParkinson's diseaseneurogenesisneurodegenerative diseasesAlzheimer's disease
Journal Article2015-09-22No SnippetsAgrawal M, Biswas A.
Show Full Abstract
Molecular diagnostics provide a powerful method to detect and diagnose various neurological diseases such as Alzheimer's and Parkinson's disease. The confirmation of such diagnosis allows early detection and subsequent medical counseling that help specific patients to undergo clinically important drug trials. This provides a medical pathway to have better insight of neurogenesis and eventual cure of the neurodegenerative diseases. In this short review, we present recent advances in molecular diagnostics especially biomarkers and imaging spectroscopy for neurological diseases. We describe advances made in Alzheimer's disease (AD), Parkinson's disease (PD), Amyotrophic lateral sclerosis (ALS) and Huntington's disease (HD), and finally present a perspective on the future directions to provide a framework for further developments and refinements of molecular diagnostics to combat neurodegenerative disorders.
The organization of neural circuits that form the locomotor central pattern generator (CPG) and provide flexor-extensor and left-right coordination of neuronal activity remains largely unknown. However, significant progress has been made in the molecular/genetic identification of several types of spinal interneurons, including V0 (V0D and V0V subtypes), V1, V2a, V2b, V3, and Shox2, among others. The possible functional roles of these interneurons can be suggested from changes in the locomotor pattern generated in mutant mice lacking particular neuron types. Computational modeling of spinal circuits may complement these studies by bringing together data from different experimental studies and proposing the possible connectivity of these interneurons that may define rhythm generation, flexor-extensor interactions on each side of the cord, and commissural interactions between left and right circuits. This review focuses on the analysis of potential architectures of spinal circuits that can reproduce recent results and suggest common explanations for a series of experimental data on genetically identified spinal interneurons, including the consequences of their genetic ablation, and provides important insights into the organization of the spinal CPG and neural control of locomotion.
Also flagged:NFATc2melanomaMITFtranscription factormelanocyte differentiation antigensMART-1
Journal Article2015-09-21✓ 1 SnippetPerotti V, Baldassari P, Molla A, Vegetti C, Bersani I, Maurichi A, Santinami M, Anichini A, Mortarini R.
In-Text Gene Mentions
Abstract)
…downmodulated c-myc andPOU3F2/Brn2.…
Show Full Abstract
Melanoma dedifferentiation, characterized by the loss of MITF and MITF regulated genes and by upregulation of stemness markers as CD271, is implicated in resistance to chemotherapy, target therapy and immunotherapy. The identification of intrinsic mechanisms fostering melanoma dedifferentiation may provide actionable therapeutic targets to improve current treatments. Here, we identify NFATc2 transcription factor as an intrinsic regulator of human melanoma dedifferentiation. In panels of melanoma cell lines, NFATc2 expression correlated inversely with MITF at both mRNA and protein levels. NFATc2(+/Hi) melanoma cell lines were CD271(+) and deficient for expression of melanocyte differentiation antigens (MDAs) MART-1, gp100, tyrosinase and of GPNMB, PGC1-α and Rab27a, all regulated by MITF. Targeting of NFATc2 by small interfering RNA, short hairpin RNA and by an NFATc2 inhibitor upregulated MITF, MDAs, GPNMB, PGC-1α, tyrosinase activity and pigmentation and suppressed CD271. Mechanistically, we found that NFATc2 controls melanoma dedifferentiation by inducing expression in neoplastic cells of membrane-bound tumor necrosis factor-α (mTNF-α) and that melanoma-expressed TNF-α regulates a c-myc-Brn2 axis. Specifically, NFATc2, mTNF-α and expression of TNF receptors were significantly correlated in panels of cell lines. NFATc2 silencing suppressed TNF-α expression, and neutralization of melanoma-expressed TNF-α promoted melanoma differentiation. Moreover, silencing of NFATc2 and TNF-α neutralization downmodulated c-myc and POU3F2/Brn2. Brn2 was strongly expressed in NFATc2(+/Hi) MITF(Lo) cell lines and its silencing upregulated MITF. Targeting of c-myc, by silencing or by a c-myc inhibitor, suppressed Brn2 and upregulated MITF and MART-1 in melanoma cells. The relevance of NFATc2-dependent melanoma dedifferentiation for immune escape was shown by cytolytic T-cell assays. NFATc2(Hi) MITF(Lo) MDA(Lo) HLA-A2.1(+) melanoma cells were poorly recognized by MDA-specific and HLA-A2-restricted CTL lines, but NFATc2 targeting significantly increased CTL-mediated tumor recognition. Taken together, these results suggest that the expression of NFATc2 promotes melanoma dedifferentiation and immune escape.
Also flagged:colon cancernucleotidesgene expressiondegradationtranslationalRNase
Journal Article2015-09-21No SnippetsZhang K, Kang DK, Ali MM, Liu L, Labanieh L, Lu M, Riazifar H, Nguyen TN, Zell JA, Digman MA, Gratton E, Li J, Zhao W.
Show Full Abstract
Quantification of miRNAs in blood can be potentially used for early disease detection, surveillance monitoring and drug response evaluation. However, quantitative and robust measurement of miRNAs in blood is still a major challenge in large part due to their low concentration and complicated sample preparation processes typically required in conventional assays. Here, we present the 'Integrated Comprehensive Droplet Digital Detection' (IC 3D) system where the plasma sample containing target miRNAs is encapsulated into microdroplets, enzymatically amplified and digitally counted using a novel, high-throughput 3D particle counter. Using Let-7a as a target, we demonstrate that IC 3D can specifically quantify target miRNA directly from blood plasma at extremely low concentrations ranging from 10s to 10 000 copies per mL in ≤3 hours without the need for sample processing such as RNA extraction. Using this new tool, we demonstrate that target miRNA content in colon cancer patient blood is significantly higher than that in healthy donor samples. Our IC 3D system has the potential to introduce a new paradigm for rapid, sensitive and specific detection of low-abundance biomarkers in biological samples with minimal sample processing.
Also flagged:steroiddeathintraventricular hemorrhagechronic lung diseasesepsisnecrotizing enterocolitis
Journal Article2015-09-21No SnippetsSong D, Jegatheesan P, DeSandre G, Govindaswami B.
Show Full Abstract
<h4>Background</h4>Delayed cord clamping (DCC, ≥30 s) increases blood volume in newborns and is associated with fewer blood transfusions and short-term neonatal complications. The optimal timing of cord clamping for very preterm infants should maximize placental transfusion without interfering with stabilization and resuscitation.<h4>Aim</h4>We compared the effect of different durations of DCC, 30-45 s vs. 60-75 s, on delivery room (DR) and neonatal outcomes in preterm infants <32 weeks gestational age (GA).<h4>Methods</h4>This is a single-center prospective observational study. Data were collected prospectively from eligible infants from two groups: 30-45 s DCC group (January 2008 to February 2011, n = 187) and 60-75 s DCC group (March 2011 to April 2014, n = 166).<h4>Results</h4>The 60-75 s DCC group compared to the 30-45 s DCC group had higher hematocrits at <2 hours (49.2% vs. 47.4%, p = 0.02). In infants <28 weeks GA, the 12-36 hours hematocrit was higher in the 60-75 s DCC group compared to the 30-45 s DCC group (47.9% vs. 42.1%, p = 0.002). The 60-75 s DCC group had reductions in DR intubation (11% vs. 22%, p = 0.004), hypothermia on admission (1% vs. 5%, p = 0.01), surfactant therapy (13% vs. 28%, p = 0.001), intubation in the first 24 hours (20% vs. 34%, p = 0.004), any intubation (27% vs. 40%, p = 0.007), and any red blood cell transfusion (20% vs. 33%, p = 0.008) during the hospitalization compared to the 30-45 s DCC group. These reductions remained significant after adjusting for GA, gender and >48 hours of antenatal steroid exposure. There was no difference between the two groups in neonatal death, intraventricular hemorrhage, chronic lung disease, late onset sepsis, necrotizing enterocolitis and severe retinopathy of prematurity.<h4>Conclusion</h4>In this study cohort increasing DCC duration from 30-45 s to 60-75 s is associated with decreased hypothermia on admission, neonatal respiratory interventions and red blood cell transfusions without increase in neonatal mortality and morbidities.
Also flagged:breast cancercancertumourinvasive ductal carcinomaductal carcinoma in situinvasive lobular carcinoma
Journal Article2015-09-21No SnippetsCava C, Bertoli G, Castiglioni I.
Show Full Abstract
<h4>Background</h4>Development of human cancer can proceed through the accumulation of different genetic changes affecting the structure and function of the genome. Combined analyses of molecular data at multiple levels, such as DNA copy-number alteration, mRNA and miRNA expression, can clarify biological functions and pathways deregulated in cancer. The integrative methods that are used to investigate these data involve different fields, including biology, bioinformatics, and statistics.<h4>Results</h4>These methodologies are presented in this review, and their implementation in breast cancer is discussed with a focus on integration strategies. We report current applications, recent studies and interesting results leading to the identification of candidate biomarkers for diagnosis, prognosis, and therapy in breast cancer by using both individual and combined analyses.<h4>Conclusion</h4>This review presents a state of art of the role of different technologies in breast cancer based on the integration of genetics and epigenetics, and shares some issues related to the new opportunities and challenges offered by the application of such integrative approaches.
Also flagged:Type I Fibrillinopathycardiovascular-related disordersheart diseasefibrillinopathiesfibrillinMarfan syndrome
Journal Article2015-09-21✓ 1 SnippetRodríguez-González M, Matamala-Morillo MÁ, Segado-Arenas A, Marín-Iglesias Mdel R, Lechuga-Sancho AM.
In-Text Gene Mentions
Abstract)
…Type 1 fibrillinopathies1 fibrillinopathies are…
Show Full Abstract
Chest pain is the second most common reason for referral to a pediatric cardiologist, because cardiovascular-related disorders are a major concern for children and their families when seeking medical attention. On the rare occasions when pediatric chest pain is a result of severe heart disease, it is usually associated with well-known cardiovascular risk factors such as fibrillinopathies. Type 1 fibrillinopathies are heritable disorders caused by mutations in the fibrillin genes that lead to a broad spectrum of connective tissue phenotypes ranging from Marfan syndrome, at the most severe end, to patients displaying mild marfanoid features, or milder Marfan (MM). We report the case of an adolescent patient with MM and suspected acute coronary syndrome, with chest pain and electrocardiographic changes suggestive of myocardial ischemia. Despite the low risk of coronary or aortic dissection/aneurysm in MM, these possibilities should be tested. Once they are ruled out, mitral valve prolapse should be considered as the main cause of chest pain with ischemic-like changes in the inferior electrocardiogram leads. We emphasize that clinical and echocardiographic follow-up over years is warranted in the pediatric population to ensure that the aortic root does not show progressive dilatation or a tendency to dissect. Finally, genotyping is clinically indicated for early and complete diagnosis in patients with MM as well as de novo Marfan syndrome to take advantage of educational and clinical programs for young carriers of the mutation.
Tripartite motif (TRIM)38 is an E3 ubiquitin ligase that was reported to regulate signaling in innate immune and inflammatory responses in certain cell lines. In this study, we show that Trim38 deficiency markedly increased TLR3- and TLR4-mediated induction of type I IFNs and proinflammatory cytokines, such as TNF-α, IL-1β, and IL-6, in immune cells and in vivo. Trim38 deficiency also caused the mice to be more susceptible to death triggered by polyinosinic-polycytidylic acid, LPS, and Salmonella typhimurium. Mechanistically, TRIM38 catalyzed K48-linked polyubiquitination of the TLR3/4 adapter protein TIR domain-containing adapter-inducing IFN-β at K228 and promoted its proteasomal degradation in immune cells. Moreover, Trim38 was highly induced by type I IFNs, which then negatively regulated TNF-α/IL-1β signaling in IFN-β-primed immune cells, but not unprimed immune cells, by mediating degradation of Tab2 in a lysosomal-dependent process. These results suggest that Trim38 negatively regulates TLR3/4-mediated innate immune and inflammatory responses by two sequential and distinct mechanisms. This study increases our understanding of how the innate immune response is initiated during the early phase of infection to defend against microbial invasion and is efficiently terminated during the late phase to prevent excessive and harmful inflammatory responses.
Also flagged:polyethylene glycolneurogenesisgene expressionpeptidethiolsynaptic transmission
Journal Article2015-09-21✓ 1 SnippetSchwartz MP, Hou Z, Propson NE, Zhang J, Engstrom CJ, Santos Costa V, Jiang P, Nguyen BK, Bolin JM, Daly W, Wang Y, Stewart R, Page CD, Murphy WL, Thomson JA.
In-Text Gene Mentions
Text
…POU3F2…
Show Full Abstract
Human pluripotent stem cell-based in vitro models that reflect human physiology have the potential to reduce the number of drug failures in clinical trials and offer a cost-effective approach for assessing chemical safety. Here, human embryonic stem (ES) cell-derived neural progenitor cells, endothelial cells, mesenchymal stem cells, and microglia/macrophage precursors were combined on chemically defined polyethylene glycol hydrogels and cultured in serum-free medium to model cellular interactions within the developing brain. The precursors self-assembled into 3D neural constructs with diverse neuronal and glial populations, interconnected vascular networks, and ramified microglia. Replicate constructs were reproducible by RNA sequencing (RNA-Seq) and expressed neurogenesis, vasculature development, and microglia genes. Linear support vector machines were used to construct a predictive model from RNA-Seq data for 240 neural constructs treated with 34 toxic and 26 nontoxic chemicals. The predictive model was evaluated using two standard hold-out testing methods: a nearly unbiased leave-one-out cross-validation for the 60 training compounds and an unbiased blinded trial using a single hold-out set of 10 additional chemicals. The linear support vector produced an estimate for future data of 0.91 in the cross-validation experiment and correctly classified 9 of 10 chemicals in the blinded trial.
Also flagged:vitamin Dmetabolismcytokineantigen presentationchemokineallergic disease
Journal Article2015-09-21✓ 1 SnippetBarragan M, Good M, Kolls JK.
In-Text Gene Mentions
Discussion)
…superfamily, member 4 (TNFSF4) in CD11c +…
Show Full Abstract
Studies over the last two decades have revealed profound immunomodulatory aspects of vitamin D on various aspects of the immune system. This review will provide an overview of Vitamin D metabolism, a description of dendritic cell subsets, and highlight recent advances on the effects of vitamin D on dendritic cell function, maturation, cytokine production and antigen presentation. The active form of vitamin D, 1,25(OH)₂D₃, has important immunoregulatory and anti-inflammatory effects. Specifically, the 1,25(OH)₂D₃-Vitamin D₃ complex can affect the maturation and migration of many dendritic cell subsets, conferring a special immunoregulatory role as well as tolerogenic properties affecting cytokine and chemokine production. Furthermore, there have been many recent studies demonstrating the effects of Vitamin D on allergic disease and autoimmunity. A clear understanding of the effects of the various forms of Vitamin D will provide new opportunities to improve human health.
Also flagged:chronic obstructive pulmonary diseaseCOPDgene expressionnicotine receptorairway obstructionAging
Journal Article2015-09-21✓ 1 SnippetObeidat M, Hao K, Bossé Y, Nickle DC, Nie Y, Postma DS, Laviolette M, Sandford AJ, Daley DD, Hogg JC, Elliott WM, Fishbane N, Timens W, Hysi PG, Kaprio J, Wilson JF, Hui J, Rawal R, Schulz H, Stubbe B, Hayward C, Polasek O, Järvelin MR, Zhao JH, Jarvis D, Kähönen M, Franceschini N, North KE, Loth DW, Brusselle GG, Smith AV, Gudnason V, Bartz TM, Wilk JB, O'Connor GT, Cassano PA, Tang W, Wain LV, Soler Artigas M, Gharib SA, Strachan DP, Sin DD, Tobin MD, London SJ, Hall IP, Paré PD.
In-Text Gene Mentions
Text
…TRIM38…
Show Full Abstract
<h4>Background</h4>Lung function measures reflect the physiological state of the lung, and are essential to the diagnosis of chronic obstructive pulmonary disease (COPD). The SpiroMeta-CHARGE consortium undertook the largest genome-wide association study (GWAS) so far (n=48,201) for forced expiratory volume in 1 s (FEV1) and the ratio of FEV1 to forced vital capacity (FEV1/FVC) in the general population. The lung expression quantitative trait loci (eQTLs) study mapped the genetic architecture of gene expression in lung tissue from 1111 individuals. We used a systems genetics approach to identify single nucleotide polymorphisms (SNPs) associated with lung function that act as eQTLs and change the level of expression of their target genes in lung tissue; termed eSNPs.<h4>Methods</h4>The SpiroMeta-CHARGE GWAS results were integrated with lung eQTLs to map eSNPs and the genes and pathways underlying the associations in lung tissue. For comparison, a similar analysis was done in peripheral blood. The lung mRNA expression levels of the eSNP-regulated genes were tested for associations with lung function measures in 727 individuals. Additional analyses identified the pleiotropic effects of eSNPs from the published GWAS catalogue, and mapped enrichment in regulatory regions from the ENCODE project. Finally, the Connectivity Map database was used to identify potential therapeutics in silico that could reverse the COPD lung tissue gene signature.<h4>Findings</h4>SNPs associated with lung function measures were more likely to be eQTLs and vice versa. The integration mapped the specific genes underlying the GWAS signals in lung tissue. The eSNP-regulated genes were enriched for developmental and inflammatory pathways; by comparison, SNPs associated with lung function that were eQTLs in blood, but not in lung, were only involved in inflammatory pathways. Lung function eSNPs were enriched for regulatory elements and were over-represented among genes showing differential expression during fetal lung development. An mRNA gene expression signature for COPD was identified in lung tissue and compared with the Connectivity Map. This in-silico drug repurposing approach suggested several compounds that reverse the COPD gene expression signature, including a nicotine receptor antagonist. These findings represent novel therapeutic pathways for COPD.<h4>Interpretation</h4>The system genetics approach identified lung tissue genes driving the variation in lung function and susceptibility to COPD. The identification of these genes and the pathways in which they are enriched is essential to understand the pathophysiology of airway obstruction and to identify novel therapeutic targets and biomarkers for COPD, including drugs that reverse the COPD gene signature in silico.<h4>Funding</h4>The research reported in this article was not specifically funded by any agency. See Acknowledgments for a full list of funders of the lung eQTL study and the Spiro-Meta CHARGE GWAS.
Also flagged:Hepatocellular carcinomacancergadoliniumextracellularchronic diseasecirrhosis
Journal Article2015-09-21✓ 1 SnippetNiendorf E, Spilseth B, Wang X, Taylor A.
In-Text Gene Mentions
Introduction)
…as alcohol abuse,hemochromatosis, and primary biliary…
Show Full Abstract
Hepatocellular carcinoma (HCC) is the 6th most common cancer worldwide. Imaging plays a critical role in HCC screening and diagnosis. Initial screening of patients at risk for HCC is performed with ultrasound. Confirmation of HCC can then be obtained by Computed Tomography (CT) or Magnetic Resonance Imaging (MRI), due to the relatively high specificity of both techniques. This article will focus on reviewing MRI techniques for imaging HCC, felt by many to be the exam of choice for HCC diagnosis. MRI relies heavily upon the use of gadolinium-based contrast agents and while primarily extracellular gadolinium-based contrast agents are used, there is an emerging role of hepatobiliary contrast agents in HCC imaging. The use of other non-contrast enhanced MRI techniques for assessing HCC will also be discussed and these MRI strategies will be reviewed in the context of the pathophysiology of HCC to help understand the MR imaging appearance of HCC.
Glioblastoma multiforme (GBM), designated as World Health Organization (WHO) grade IV astrocytoma, is a lethal and therapy-resistant brain cancer comprised of several tumor cell subpopulations, including GBM stem cells (GSCs) which are believed to contribute to tumor recurrence following initial response to therapies. Emerging evidence demonstrates that GBM tumors are initiated from GSCs. The development and use of novel therapies including small molecule inhibitors of specific proteins in signaling pathways that regulate stemness, proliferation and migration of GSCs, immunotherapy, and non-coding microRNAs may provide better means of treating GBM. Identification and characterization of GSC-specific signaling pathways would be necessary to identify specific therapeutic targets which may lead to the development of more efficient therapies selectively targeting GSCs. Several signaling pathways including mTOR, AKT, maternal embryonic leucine zipper kinase (MELK), NOTCH1 and Wnt/β-catenin as well as expression of cancer stem cell markers CD133, CD44, Oct4, Sox2, Nanog, and ALDH1A1 maintain GSC properties. Moreover, the data published in the Cancer Genome Atlas (TCGA) specifically demonstrated the activated PI3K/AKT/mTOR pathway in GBM tumorigenesis. Studying such pathways may help to understand GSC biology and lead to the development of potential therapeutic interventions to render them more sensitive to chemotherapy and radiation therapy. Furthemore, recent demonstration of dedifferentiation of GBM cell lines into CSC-like cells prove that any successful therapeutic agent or combination of drugs for GBM therapy must eliminate not only GSCs, but the differentiated GBM cells and the entire bulk of tumor cells.
Also flagged:Signal TransductionDrug addictionheroincocaine addictioncocaineCDK5R1
Journal Article2015-09-19No SnippetsLevran O, Peles E, Randesi M, Correa da Rosa J, Ott J, Rotrosen J, Adelson M, Kreek MJ.
Show Full Abstract
<h4>Aim</h4>Drug addiction is characterized, in part, by deregulation of synaptic plasticity in circuits involved in reward, stress, cue learning, and memory. This study was designed to assess whether 185 variants in 32 genes central to synaptic plasticity and signal transduction contribute to vulnerability to develop heroin and/or cocaine addiction.<h4>Methods</h4>Analyses were conducted in a sample of 1860 subjects divided according to ancestry (African and European) and drug of abuse (heroin or cocaine).<h4>Results</h4>Eighteen SNPs in 11 genes (CDK5R1, EPHA4, EPHA6, FOSL2, MAPK3, MBP, MPDZ, NFKB1, NTRK2, NTSR1, and PRKCE) showed significant associations (P < 0.01), but the signals did not survive correction for multiple testing. SNP rs230530 in the NFKB1 gene, encoding the transcription regulator NF-kappa-B, was the only SNP indicated in both ancestry groups and both addictions. This SNP was previously identified in association with alcohol addiction. SNP rs3915568 in NTSR1, which encodes neurotensin receptor, and SNP rs1389752 in MPDZ, which encodes the multiple PDZ domain protein, were previously associated with heroin addiction or alcohol addiction, respectively.<h4>Conclusions</h4>The study supports the involvement of genetic variation in signal transduction pathways in heroin and cocaine addiction and provides preliminary evidence suggesting several new risk or protective loci that may be relevant for diagnosis and treatment success.
Also flagged:protocadherin-17EGFRMEKERKhepatocellular carcinomacancer
Journal Article2015-09-19✓ 1 SnippetDang Z, Shangguan J, Zhang C, Hu P, Ren Y, Lv Z, Xiang H, Wang X.
In-Text Gene Mentions
Title)
…Loss of protocadherin-17 (PCDH-17) promotes metastasis and invasion through hyperactivation of EGFR/MEK/ERK signaling pathway in hepatocellular carcinoma.…
Show Full Abstract
Metastasis has been one of the major reasons for cancer-related mortality, with multiple genes and pathways being involved in this complex process. Given the molecular variations underlying metastasis of hepatocellular carcinoma (HCC) remains largely unknown; in our previous work, we found copying number of protocadherin-17 (PCDH-17) was significantly deleted in HCC tissues that occurred to metastasize compared with that in the primary HCC without metastasis. Therefore, we hypothesized that PCDH-17 may suppress the metastasis of HCC. There has been, however, no relevant literature available regarding PCDH-17 in HCC. In the present study, we have immunohistochemically detected and clinicopathologically analyzed the expression of PCDH-17 in vivo in clinical tissues; besides, we have explored the role of PCDH-17 ex vivo using a panel of HCC cell lines. It was discovered that PCDH-17 expression was clinically correlated with overall prognosis as well as metastasis in vivo and that PCDH-17 inhibited metastasis via EGFR/MEK/ERK signaling pathway ex vivo. Together, our results obtained both in vivo and ex vivo suggested that activation of EGFR/MEK/ERK signaling pathway through PCDH-17 promotes metastasis in HCC.
Investigations on survival of patients with hepatitis B virus related acute-on-chronic liver failure (HBV-ACLF) are sparse and urgently needed. The current study aimed to evaluate the prognostic value of circulating cell death biomarkers (M30-anigen, M65-antigen and HMGB1) for HBV ACLF. In this prospective study (2/2013-8/2014), 94 patients including 54 HBV-ACLF and 40 chronic hepatitis B (CHB) patients were recruited. 40 healthy controls (HC) were also recruited. HBV-ACLF were followed up for 3 months for short-term mortality. All three biomarkers were significantly elevated in HBV-ACLF compared with CHB or HC. M30- and M65-antigens could significantly discriminate between non-survivors and survivors in HBV-ACLF. However, HMGB1 showed no prognostic value. By Cox regression analysis, M30- and M65-antigens and MELD were identified as independent predictors for short-term mortality. A novel prognostic model, MELD-CD (MELD-cell death) was established based on the multivariate results. The adjusted Harrell's C-index of MELD-CD was 0.86 (P < 0.001) and was significantly higher (P < 0.001 for all) than the currently used models, MELD (C-index, 0.71, P < 0.001), MELD-NA (0.67, P < 0.001), CTPs (0.61, P < 0.05). Dynamic analyses further confirmed the prognostic utility of M30- and M65-antigen. Future studies are warranted to validate the results.
…Five patterns of activity were noted: 1) inhibition under both baseline and forskolin stimulated expression (GPR15, GPR17, GPR18, GPR20, GPR25, GPR27, GPR31, GPR32, GPR45, GPR57, GPR68, GPR83, GPR84, GPR132, GPR150, GPR176); 2) no effect on baseline expression, but inhibition of forskolin stimulated expression (GPR4, GPR26, GPR61, GPR62, GPR78, GPR101, GPR119); 3) elevation of baseline signaling coupled with inhibition of forskolin stimulated expression (GPR6, GPR12); 4) elevation of baseline signaling without inhibition of forskolin stimulated expression (GPR3, GPR21, GPR52, GPR65); and 5) no effect on expression (GPR1, GPR19, GPR22, GPR34, GPR35, GPR39, GPR63, GPR82, GPR85, GPR87).…
I A O 0000615)
…Similarly, receptors in a second closely related group (GPR21 and GPR52) both stimulated cAMP-dependent signaling without inhibiting activity in the presence of forskolin.…
The purpose of this study was to evaluate the extent of constitutive activity among orphan class-A G protein coupled receptors within the cAMP signaling pathway. Constitutive signaling was revealed by changes in gene expression under control of the cAMP response element. Gene expression was measured in Chinese hamster ovary cells transiently co-transfected with plasmids containing a luciferase reporter and orphan receptor. Criteria adopted for defining constitutive activation were: 1) 200% elevation over baseline reporter gene expression; 2) 40% inhibition of baseline expression; and 3) 40% inhibition of expression stimulated by 3 μM forskolin. Five patterns of activity were noted: 1) inhibition under both baseline and forskolin stimulated expression (GPR15, GPR17, GPR18, GPR20, GPR25, GPR27, GPR31, GPR32, GPR45, GPR57, GPR68, GPR83, GPR84, GPR132, GPR150, GPR176); 2) no effect on baseline expression, but inhibition of forskolin stimulated expression (GPR4, GPR26, GPR61, GPR62, GPR78, GPR101, GPR119); 3) elevation of baseline signaling coupled with inhibition of forskolin stimulated expression (GPR6, GPR12); 4) elevation of baseline signaling without inhibition of forskolin stimulated expression (GPR3, GPR21, GPR52, GPR65); and 5) no effect on expression (GPR1, GPR19, GPR22, GPR34, GPR35, GPR39, GPR63, GPR82, GPR85, GPR87). Constitutive activity was observed in 75% of the orphan class-A receptors examined (30 of 40). This constitutive signaling cannot be explained by simple overexpression of the receptor. Inhibition of cAMP mediated expression was far more common (65%) than stimulation of expression (15%). Orphan receptors that were closely related based on amino acid homology tended to have similar effects on gene expression. These results suggest that identification of inverse agonists may be a fruitful approach for categorizing these orphan receptors and targeting them for pharmacological intervention.
Also flagged:post-translational modificationslysineargininemethylationglycinebinding
Journal Article2015-09-18✓ 1 SnippetPinkin NK, N Power A, Waters ML.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
Small molecule receptors are attractive potential sensors of post-translational modifications, including methylated lysine and methylated arginine. Using dynamic combinatorial chemistry (DCC), our lab previously identified a suite of receptors that bind to Kme3 with a range of affinities ranging from low micromolar to high nanomolar, each with a unique selectivity for Kme3 over the lower methylation states. To enable these receptors to have broad application as Kme3 sensors, we have developed a method for their late-stage modification, which we used to synthesize biotinylated derivatives of A2B, A2D, and A2G in a single step. For our most attractive receptor for applications, A2N, we needed to develop an alternative method for its selective functionalization, which we achieved by "activating" the carboxylic acids on the constituent monomer A or N by pre-functionalizing them with glycine (Gly). Using the resulting Gly-A and Gly-N monomers, we synthesized the novel A2N variants A2Gly-N, Gly-A2N, and Gly-A2Gly-N, which enabled the late stage biotinylation of A2N wherever Gly was incorporated. Finally, we performed ITC and NMR binding experiments to study the effect that carboxylate spacing has on the affinity and selectivity of A2Gly-N and Gly-A2N for KmeX guests compared to A2N. These studies revealed the proximity of the carboxylates to play a complex role in the molecular recognition event, despite their positioning on the outside of the receptor.
Also flagged:tumormitochondrialmetastatic colorectal cancercolorectal carcinomatumorsmetastatic tumors
Journal Article2015-09-18✓ 1 SnippetXu L, Ziegelbauer J, Wang R, Wu WW, Shen RF, Juhl H, Zhang Y, Rosenberg A.
In-Text Gene Mentions
Text
…ZNFX1…
Show Full Abstract
<h4>Purpose</h4>To gain insight into factors involved in tumor progression and metastasis, we examined the role of noncoding RNAs in the biologic characteristics of colorectal carcinoma, in paired samples of tumor together with normal mucosa from the same colorectal carcinoma patient. The tumor and healthy tissue samples were collected and stored under stringent conditions, thereby minimizing warm ischemic time.<h4>Experimental design</h4>We focused particularly on distinctions among high-stage tumors and tumors with known metastases, performing RNA-Seq analysis that quantifies transcript abundance and identifies novel transcripts.<h4>Results</h4>In comparing 35 colorectal carcinomas, including 9 metastatic tumors (metastases to lymph nodes and lymphatic vessels), with their matched healthy control mucosa, we found a distinct signature of mitochondrial transfer RNAs (MT-tRNA) and small nucleolar RNAs (snoRNA) for metastatic and high-stage colorectal carcinoma. We also found the following: (i) MT-TF (phenylalanine) and snord12B expression correlated with a substantial number of miRNAs and mRNAs in 14 colorectal carcinomas examined; (ii) an miRNA signature of oxidative stress, hypoxia, and a shift to glycolytic metabolism in 14 colorectal carcinomas, regardless of grade and stage; and (iii) heterogeneous MT-tRNA/snoRNA fingerprints for 35 pairs.<h4>Conclusions</h4>These findings could potentially assist in more accurate and predictive staging of colorectal carcinoma, including identification of those colorectal carcinomas likely to metastasize.
Also flagged:ironiron-overload disordershereditary hemochromatosisβ-thalassemia intermediamyelodysplastic syndromesheme
Journal Article2015-09-18✓ 2 Snippetsde Swart L, Hendriks JC, van der Vorm LN, Cabantchik ZI, Evans PJ, Hod EA, Brittenham GM, Furman Y, Wojczyk B, Janssen MC, Porter JB, Mattijssen VE, Biemond BJ, MacKenzie MA, Origa R, Galanello R, Hider RC, Swinkels DW.
In-Text Gene Mentions
Text
…HFE…
Text
…hemochromatosis…
Show Full Abstract
Non-transferrin-bound iron and its labile (redox active) plasma iron component are thought to be potentially toxic forms of iron originally identified in the serum of patients with iron overload. We compared ten worldwide leading assays (6 for non-transferrin-bound iron and 4 for labile plasma iron) as part of an international inter-laboratory study. Serum samples from 60 patients with four different iron-overload disorders in various treatment phases were coded and sent in duplicate for analysis to five different laboratories worldwide. Some laboratories provided multiple assays. Overall, highest assay levels were observed for patients with untreated hereditary hemochromatosis and β-thalassemia intermedia, patients with transfusion-dependent myelodysplastic syndromes and patients with transfusion-dependent and chelated β-thalassemia major. Absolute levels differed considerably between assays and were lower for labile plasma iron than for non-transferrin-bound iron. Four assays also reported negative values. Assays were reproducible with high between-sample and low within-sample variation. Assays correlated and correlations were highest within the group of non-transferrin-bound iron assays and within that of labile plasma iron assays. Increased transferrin saturation, but not ferritin, was a good indicator of the presence of forms of circulating non-transferrin-bound iron. The possibility of using non-transferrin-bound iron and labile plasma iron measures as clinical indicators of overt iron overload and/or of treatment efficacy would largely depend on the rigorous validation and standardization of assays.
Our understanding of the specific genetic lesions in allergy has improved in recent years due to identification of common risk variants from genome-wide association studies (GWAS) and studies of rare, monogenic diseases. Large-scale GWAS have identified novel susceptibility loci and provided information about shared genetics between allergy, related phenotypes and autoimmunity. Studies of monogenic diseases have elucidated critical cellular pathways and protein functions responsible for allergy. These complementary approaches imply genetic mechanisms involved in Th2 immunity, T-cell differentiation, TGFβ signaling, regulatory T-cell function and skin/mucosal function as well as yet unknown mechanisms associated with newly identified genes. Future studies, in combination with data on gene expression and epigenetics, are expected to increase our understanding of the pathogenesis of allergy.
Also flagged:Polycystic Ovary SyndromeinfertilityinfertilePolycystic Ovary Syndrome IIPPCOS IIclomiphene
Journal Article2015-09-18No SnippetsUsadi RS, Diamond MP, Legro RS, Schlaff WD, Hansen KR, Casson P, Christman G, Wright Bates G, Baker V, Seungdamrong A, Rosen MP, Lucidi S, Thomas T, Huang H, Santoro N, Eisenberg E, Zhang H, Alvero R, Reproductive Medicine Network.
Show Full Abstract
<h4>Background</h4>Recruitment of individuals into clinical trials is a critical step in completing studies. Reports examining the effectiveness of different recruitment strategies, and specifically in infertile couples, are limited.<h4>Methods</h4>We investigated recruitment methods used in two NIH sponsored trials, Pregnancy in Polycystic Ovary Syndrome (PPCOS II) and Assessment of Multiple Intrauterine Gestations from Ovarian Stimulation (AMIGOS), and examined which strategies yielded the greatest number of participants completing the trials.<h4>Results</h4>3683 couples were eligible for screening. 1650 participants were randomized and 1339 completed the trials. 750 women were randomized in PPCOS II; 212 of the participants who completed the trial were referred by physicians. Participants recruited from radio ads (84/750) and the internet (81/750) resulted in similar rates of trial completion in PPCOS II. 900 participants were randomized in AMIGOS. 440 participants who completed the trial were referred to the study by physicians. The next most successful method in AMIGOS was the use of the internet, achieving 78 completed participants. Radio ads proved the most successful strategy in both trials for participants who earned <$50,000 annually. Radio ads were most successful in enrolling white patients in PPCOS II and black patients in AMIGOS. Seven ancillary Clinical Research Scientist Training (CREST) sites enrolled 324 of the participants who completed the trials.<h4>Conclusions</h4>Physician referral was the most successful recruitment strategy. Radio ads and the internet were the next most successful strategies, particularly for women of limited income. Ancillary clinical sites were important for overall recruitment.
Also flagged:Synthesisgadoliniumtumorsuccinimidyl esterbenzoatepeptide
Journal Article2015-09-18No SnippetsJackson AW, Chandrasekharan P, Shi J, Rannard SP, Liu Q, Yang CT, He T.
Show Full Abstract
Branched copolymer nanoparticles (D(h) =20-35 nm) possessing 1,4,7, 10-tetraazacyclododecane-N,N',N″,N‴-tetraacetic acid macrocycles within their cores have been synthesized and applied as magnetic resonance imaging (MRI) nanosized contrast agents in vivo. These nanoparticles have been generated from novel functional monomers via reversible addition-fragmentation chain transfer polymerization. The process is very robust and synthetically straightforward. Chelation with gadolinium and preliminary in vivo experiments have demonstrated promising characteristics as MRI contrast agents with prolonged blood retention time, good biocompatibility, and an intravascular distribution. The ability of these nanoparticles to perfuse and passively target tumor cells through the enhanced permeability and retention effect is also demonstrated. These novel highly functional nanoparticle platforms have succinimidyl ester-activated benzoate functionalities within their corona, which make them suitable for future peptide conjugation and subsequent active cell-targeted MRI or the conjugation of fluorophores for bimodal imaging. We have also demonstrated that these branched copolymer nanoparticles are able to noncovalently encapsulate hydrophobic guest molecules, which could allow simultaneous bioimaging and drug delivery.
Also flagged:cognitive impairmentmild cognitive impairmentbehavioral disorderscognitive declineagingneurocognitive disorders
Journal Article2015-09-18No SnippetsGuerriero F, Botarelli E, Mele G, Polo L, Zoncu D, Renati P, Sgarlata C, Rollone M, Ricevuti G, Maurizi N, Francis M, Rondanelli M, Perna S, Guido D, Mannu P.
Show Full Abstract
<h4>Background and aims</h4>In the last decade, the development of different methods of brain stimulation by electromagnetic fields (EMF) provides a promising therapeutic tool for subjects with impaired cognitive functions. Emisymmetric bilateral stimulation (EBS) is a novel and innovative EMF brain stimulation, whose working principle is to introduce very weak noise-like stimuli through EMF to trigger self-arrangements in the cortex of treated subjects, thereby improving cognitive faculties. The aim of this pilot study was to investigate in patients with cognitive impairment the effectiveness of EBS treatment with respect to global cognitive function, episodic memory, and executive functions.<h4>Methods</h4>Fourteen patients with cognitive decline (six with mild cognitive impairment and eight with Alzheimer's disease) underwent three EBS applications per week to both the cerebral cortex and auricular-specific sites for a total of 5 weeks. At baseline, after 2 weeks and 5 weeks, a neuropsychological assessment was performed through mini-mental state examination, free and cued selective reminding tests, and trail making test. As secondary outcomes, changes in behavior, functionality, and quality of life were also evaluated.<h4>Results</h4>After 5 weeks of standardized EBS therapy, significant improvements were observed in all neurocognitive assessments. Mini-mental state examination score significantly increased from baseline to end treatment (+3.19, P=0.002). Assessment of episodic memory showed an improvement both in immediate and delayed recalls (immediate recall =+7.57, P=0.003; delayed recall =+4.78, P<0.001). Executive functions significantly improved from baseline to end stimulation (trail making test A -53.35 seconds; P=0.001). Of note, behavioral disorders assessed through neuropsychiatric inventory significantly decreased (-28.78, P<0.001). The analysis concerning the Alzheimer's disease and mild cognitive impairment group confirmed a significant improvement of cognitive functions and behavior after EBS treatment.<h4>Conclusion</h4>This pilot study has shown EBS to be a promising, effective, and safe tool to treat cognitive impairment, in addition to the drugs presently available. Further investigations and controlled clinical trials are warranted.
This review focuses on pyridoacridine-related metabolites as one biologically interesting group of alkaloids identified from marine sources. They are produced by marine sponges, ascidians and tunicates, and they are structurally comprised of four to eight fused rings including heterocycles. Acridine, acridone, dihydroacridine, and quinolone cores are features regularly found in these alkaloid skeletons. The lack of hydrogen atoms next to quaternary carbon atoms for two or three rings makes the chemical shift assignment a difficult task. In this regard, one of the aims of this review is the compilation of previously reported, pyridoacridine (13)C NMR data. Observations have been made on the delocalization of electrons and the presence of some functional groups that lead to changes in the chemical shift of some carbon resonances. The lack of mass spectra information for these alkaloids due to the compactness of their structures is further discussed. Moreover, the biosynthetic pathways of some of these metabolites have been shown since they could inspire biomimetic synthesis. The synthesis routes used to prepare members of these marine alkaloids (as well as their analogues), which are synthesized for biological purposes are also discussed. Pyridoacridines were found to have a large spectrum of bioactivity and this review highlights and compares the pharmacophores that are responsible for the observed bioactivity.
Also flagged:InfectionsmethicillinmecAmacrolideaminoglycosidetrimethoprim
Journal Article2015-09-17No SnippetsMcManus BA, Coleman DC, Deasy EC, Brennan GI, O' Connell B, Monecke S, Ehricht R, Leggett B, Leonard N, Shore AC.
Show Full Abstract
This study compares the characteristics of Staphylococcus epidermidis (SE) and Staphylococcus haemolyticus (SH) isolates from epidemiologically unrelated infections in humans (Hu) (28 SE-Hu; 8 SH-Hu) and companion animals (CpA) (12 SE-CpA; 13 SH-CpA). All isolates underwent antimicrobial susceptibility testing, multilocus sequence typing and DNA microarray profiling to detect antimicrobial resistance and SCCmec-associated genes. All methicillin-resistant (MR) isolates (33/40 SE, 20/21 SH) underwent dru and mecA allele typing. Isolates were predominantly assigned to sequence types (STs) within a single clonal complex (CC2, SE, 84.8%; CC1, SH, 95.2%). SCCmec IV predominated among MRSE with ST2-MRSE-IVc common to both Hu (40.9%) and CpA (54.5%). Identical mecA alleles and nontypeable dru types (dts) were identified in one ST2-MRSE-IVc Hu and CpA isolate, however, all mecA alleles and 2/4 dts detected among 18 ST2-MRSE-IVc isolates were closely related, sharing >96.5% DNA sequence homology. Although only one ST-SCCmec type combination (ST1 with a non-typeable [NT] SCCmec NT9 [class C mec and ccrB4]) was common to four MRSH-Hu and one MRSH-CpA, all MRSH isolates were closely related based on similar STs, SCCmec genes (V/VT or components thereof), mecA alleles and dts. Overall, 39.6% of MR isolates harbored NT SCCmec elements, and ACME was more common amongst MRSE and CpA isolates. Multidrug resistance (MDR) was detected among 96.7% of isolates but they differed in the prevalence of specific macrolide, aminoglycoside and trimethoprim resistance genes amongst SE and SH isolates. Ciprofloxacin, rifampicin, chloramphenicol [fexA, cat-pC221], tetracycline [tet(K)], aminoglycosides [aadD, aphA3] and fusidic acid [fusB] resistance was significantly more common amongst CpA isolates. SE and SH isolates causing infections in Hu and CpA hosts belong predominantly to STs within a single lineage, harboring similar but variable SCCmec genes, mecA alleles and dts. Host and staphylococcal species-specific characteristics were identified in relation to antimicrobial resistance genes and phenotypes, SCCmec and ACME.
Also flagged:amineesterconjugationBone morphogenetic protein 2BMP-2alkaline phosphatase
Journal Article2015-09-17No SnippetsChang CH, Yeh SY, Lee BH, Chen CJ, Su CT, Lin YT, Liu CL, Chen HY.
Show Full Abstract
The biotechnology to immobilize biomolecules on material surfaces has been developed vigorously due to its high potentials in medical applications. In this study, a simple and effective method was designed to immobilize biomolecules via amine-N-hydroxysuccinimide (NHS) ester conjugation reaction using functionalized poly-p-xylylene coating on material surfaces. The NHS ester functionalized coating is synthesized via chemical vapor deposition, a facile and solvent-less method, creating a surface which is ready to perform a one-step conjugation reaction. Bone morphogenetic protein 2 (BMP-2) is immobilized onto material surfaces by this coating method, forming an osteogenic environment. The immobilization process is controlled at a low temperature which does not damage proteins. This modified surface induces differentiation of preosteoblast into osteoblast, manifested by alkaline phosphatase (ALP) activity assay, Alizarin Red S (ARS) staining and the expression of osteogenic gene markers, Alpl and Bglap3. With this coating technology, immobilization of growth factors onto material surface can be achieved more simply and more effectively.
Also flagged:Ductal carcinoma in situDCISprostate cancersinvasive cancerinvasive ductal carcinomabreast cancer
Journal Article2015-09-17✓ 1 SnippetElsarraj HS, Hong Y, Valdez KE, Michaels W, Hook M, Smith WP, Chien J, Herschkowitz JI, Troester MA, Beck M, Inciardi M, Gatewood J, May L, Cusick T, McGinness M, Ricci L, Fan F, Tawfik O, Marks JR, Knapp JR, Yeh HW, Thomas P, Carrasco DR, Fields TA, Godwin AK, Behbod F.
In-Text Gene Mentions
Results)
…genes such asSox6compared to wild…
Show Full Abstract
<h4>Introduction</h4>There are an estimated 60,000 new cases of ductal carcinoma in situ (DCIS) each year. A lack of understanding in DCIS pathobiology has led to overtreatment of more than half of patients. We profiled the temporal molecular changes during DCIS transition to invasive ductal carcinoma (IDC) using in vivo DCIS progression models. These studies identified B cell lymphoma-9 (BCL9) as a potential molecular driver of early invasion. BCL9 is a newly found co-activator of Wnt-stimulated β-catenin-mediated transcription. BCL9 has been shown to promote progression of multiple myeloma and colon carcinoma. However BCL9 role in breast cancer had not been previously recognized.<h4>Methods</h4>Microarray and RNA sequencing were utilized to characterize the sequential changes in mRNA expression during DCIS invasive transition. BCL9-shRNA knockdown was performed to assess the role of BCL9 in in vivo invasion, epithelial-mesenchymal transition (EMT) and canonical Wnt-signaling. Immunofluorescence of 28 patient samples was used to assess a correlation between the expression of BCL9 and biomarkers of high risk DCIS. The cancer genome atlas data were analyzed to assess the status of BCL9 gene alterations in breast cancers.<h4>Results</h4>Analysis of BCL9, by RNA and protein showed BCL9 up-regulation to be associated with DCIS transition to IDC. Analysis of patient DCIS revealed a significant correlation between high nuclear BCL9 and pathologic characteristics associated with DCIS recurrence: Estrogen receptor (ER) and progesterone receptor (PR) negative, high nuclear grade, and high human epidermal growth factor receptor2 (HER2). In vivo silencing of BCL9 resulted in the inhibition of DCIS invasion and reversal of EMT. Analysis of the TCGA data showed BCL9 to be altered in 26 % of breast cancers. This is a significant alteration when compared to HER2 (ERBB2) gene (19 %) and estrogen receptor (ESR1) gene (8 %). A significantly higher proportion of basal like invasive breast cancers compared to luminal breast cancers showed BCL9 amplification.<h4>Conclusion</h4>BCL9 is a molecular driver of DCIS invasive progression and may predispose to the development of basal like invasive breast cancers. As such, BCL9 has the potential to serve as a biomarker of high risk DCIS and as a therapeutic target for prevention of IDC.
Also flagged:cell cyclep21p53propidium iodidetumor suppressor p53transcription factor
Journal Article2015-09-17No SnippetsFischer M, Quaas M, Steiner L, Engeland K.
Show Full Abstract
The tumor suppressor p53 functions predominantly as a transcription factor by activating and downregulating gene expression, leading to cell cycle arrest or apoptosis. p53 was shown to indirectly repress transcription of the CCNB2, KIF23 and PLK4 cell cycle genes through the recently discovered p53-p21-DREAM-CDE/CHR pathway. However, it remained unclear whether this pathway is commonly used. Here, we identify genes regulated by p53 through this pathway in a genome-wide computational approach. The bioinformatic analysis is based on genome-wide DREAM complex binding data, p53-depedent mRNA expression data and a genome-wide definition of phylogenetically conserved CHR promoter elements. We find 210 target genes that are expected to be regulated by the p53-p21-DREAM-CDE/CHR pathway. The target gene list was verified by detailed analysis of p53-dependent repression of the cell cycle genes B-MYB (MYBL2), BUB1, CCNA2, CCNB1, CHEK2, MELK, POLD1, RAD18 and RAD54L. Most of the 210 target genes are essential regulators of G2 phase and mitosis. Thus, downregulation of these genes through the p53-p21-DREAM-CDE/CHR pathway appears to be a principal mechanism for G2/M cell cycle arrest by p53.
Also flagged:organizationneurodegenerative diseaseautosomal dominant neurodegenerative disorderchromosomeneurodegenerative diseasesnucleus
Journal Article2015-09-17✓ 1 SnippetMcColgan P, Seunarine KK, Razi A, Cole JH, Gregory S, Durr A, Roos RA, Stout JC, Landwehrmeyer B, Scahill RI, Clark CA, Rees G, Tabrizi SJ, Track-HD Investigators.
In-Text Gene Mentions
Introduction)
…expansion in theHTTgene on chromosome…
Show Full Abstract
Huntington's disease can be predicted many years before symptom onset, and thus makes an ideal model for studying the earliest mechanisms of neurodegeneration. Diffuse patterns of structural connectivity loss occur in the basal ganglia and cortex early in the disease. However, the organizational principles that underlie these changes are unclear. By understanding such principles we can gain insight into the link between the cellular pathology caused by mutant huntingtin and its downstream effect at the macroscopic level. The 'rich club' is a pattern of organization established in healthy human brains, where specific hub 'rich club' brain regions are more highly connected to each other than other brain regions. We hypothesized that selective loss of rich club connectivity might represent an organizing principle underlying the distributed pattern of structural connectivity loss seen in Huntington's disease. To test this hypothesis we performed diffusion tractography and graph theoretical analysis in a pseudo-longitudinal study of 50 premanifest and 38 manifest Huntington's disease participants compared with 47 healthy controls. Consistent with our hypothesis we found that structural connectivity loss selectively affected rich club brain regions in premanifest and manifest Huntington's disease participants compared with controls. We found progressive network changes across controls, premanifest Huntington's disease and manifest Huntington's disease characterized by increased network segregation in the premanifest stage and loss of network integration in manifest disease. These regional and whole brain network differences were highly correlated with cognitive and motor deficits suggesting they have pathophysiological relevance. We also observed greater reductions in the connectivity of brain regions that have higher network traffic and lower clustering of neighbouring regions. This provides a potential mechanism that results in a characteristic pattern of structural connectivity loss targeting highly connected brain regions with high network traffic and low clustering of neighbouring regions. Our findings highlight the role of the rich club as a substrate for the structural connectivity loss seen in Huntington's disease and have broader implications for understanding the connection between molecular and systems level pathology in neurodegenerative disease.
Also flagged:SynthesisIsoflavoneinsulinIRgenisteinglucose
Journal Article2015-09-17No SnippetsLi P, Shi X, Wei Y, Qin L, Sun W, Xu G, Xu T, Liu T.
Show Full Abstract
A set of novel isoflavone derivatives from chickpea were synthesized. The structures of derivatives were identified by proton nuclear magnetic resonance (¹H-NMR), carbon-13 ((13)C)-NMR and mass spectrometry (MS) spectral analyses. Their anti-diabetic activities were evaluated using an insulin-resistant (IR) HepG2 cell model. Additionally, the structure-activity relationships of these derivatives were briefly discussed. Compounds 1c, 2h, 3b, and 5 and genistein exhibited significant glucose consumption-enhancing effects in IR-HepG2 cells. In addition, the combinations of genistein, 2h, and 3b (combination 6) and of 3b, genistein, and 1c (combination 10) exhibited better anti-diabetic activity than the individual compounds. At the same dosage, there was no difference in effect between the combination 10 and the positive control (p > 0.05). Aditionally, we found the differences between the combination 10 and combination 6 for the protective effect of HUVEC (human umbilical vein endothelial cells) under high glucose concentration. The protective effects of combination 10 was stronger than combination 6, which suggested that combination 10 may have a better hypoglycemic activity in future studies. This study provides useful clues for the further design and discovery of anti-diabetic agents.
Also flagged:bronchopulmonary dysplasiaproliferating cell nuclear antigenPCNAplatelet endothelial cell adhesion molecule-1PECAM-1CD31
Journal Article2015-09-17No SnippetsXing Y, Fu J, Yang H, Yao L, Qiao L, Du Y, Xue X.
Show Full Abstract
In this study, we investigated the mechanisms through which microRNAs (miRNAs or miRs) regulate lung development after birth, as well as the role of miRNAs in the development of bronchopulmonary dysplasia (BPD). For this purpose, a total of 90 neonatal Wistar rats were randomly and equally assigned to either a model group or a control group. On postnatal days 3, 7 and 14, the lung tissues were collected for histological analysis to determine morphological changes. The expression levels of proliferating cell nuclear antigen (PCNA) and platelet endothelial cell adhesion molecule-1 (PECAM-1, also known as CD31) were measured by RT-qPCR and western blot analysis. A miRCURY™ LNA array was employed to screen for differentially expressed miRNAs, and the possible target genes of those miRNAs were predicted. Our results revealed that, compared with the control group, the following changes induced by hyperoxia were observed in the model group over time: a decrease in the number, but an increase in the size of the alveoli, and a decrease in the number of secondary septa formed. In the model group, from postnatal days 3-14, the mRNA and protein expression levels of PCNA and CD31 were significantly lower than those in the control group. The differentially expressed miRNAs between the 2 groups were identified on days 3, 7 and 14 after birth. Possible target genes were identified for 32 differentially expressed miRNAs. Taken together, these findings suggest that during the development of BPD, an alveolarization disorder with microvascular dysplasia co-exists with the differential expression of certain miRNAs during the different stages of alveolar development in a neonatal rat model of hyperoxia‑induced BPD. This indicates that miRNAs may participate in the occurrence and development of BPD.
Also flagged:SynthesishydrazinopeptidesPeptidomimeticsα-amino acidsprotease
Journal Article2015-09-17No SnippetsSuć J, Jerić I.
Show Full Abstract
Peptidomimetics based on hydrazino derivatives of α-amino acids represent an important class of peptidic foldamers with promising biological activities, like protease inhibition and antimicrobial activity. However, the lack of straightforward method for the synthesis of optically pure hydrazino acids and efficient incorporation of hydrazino building blocks into peptide sequence hamper wider exploitation of hydrazino peptidomimetics. Here we described the utility of N (α)-benzyl protected and unprotected hydrazino derivatives of natural α-amino acids in synthesis of peptidomimetics. While incorporation of N (α)-benzyl-hydrazino acids into peptide chain and deprotection of benzyl moiety proceeded with difficulties, unprotected hydrazino acids allowed fast and simple construction of hybrid peptidomimetics.
Also flagged:zincmetalsmagnesiumirongene expressioncell adhesion
Journal Article2015-09-17✓ 1 SnippetMa J, Zhao N, Zhu D.
In-Text Gene Mentions
Text
…PTGIS…
Show Full Abstract
Biodegradable zinc (Zn) metals, a new generation of biomaterials, have attracted much attention due to their excellent biodegradability, bioabsorbability, and adaptability to tissue regeneration. Compared with magnesium (Mg) and iron (Fe), Zn exhibits better corrosion and mechanical behaviors in orthopedic and stent applications. After implantation, Zn containing material will slowly degrade, and Zn ions (Zn<sup>2+</sup>) will be released to the surrounding tissue. For stent applications, the local Zn<sup>2+</sup>concentration near endothelial tissue/cells could be high. However, it is unclear how endothelia will respond to such high concentrations of Zn<sup>2+</sup>, which is pivotal to vascular remodeling and regeneration. Here, we evaluated the short-term cellular behaviors of primary human coronary artery endothelial cells (HCECs) exposed to a concentration gradient (0-140 μM) of extracellular Zn<sup>2+</sup>. Zn<sup>2+</sup> had an interesting biphasic effect on cell viability, proliferation, spreading, and migration. Generally, low concentrations of Zn<sup>2+</sup> promoted viability, proliferation, adhesion, and migration, while high concentrations of Zn<sup>2+</sup> had opposite effects. For gene expression profiles, the most affected functional genes were related to cell adhesion, cell injury, cell growth, angiogenesis, inflammation, vessel tone, and coagulation. These results provide helpful information and guidance for Zn-based alloy design as well as the controlled release of Zn<sup>2+</sup>in stent and other related medical applications.
Also flagged:Peptidesnucleic acidsnucleotidesoligonucleotideα-hemolysinα-HL
Journal Article2015-09-16No SnippetsBiswas S, Song W, Borges C, Lindsay S, Zhang P.
Show Full Abstract
Foremost among the challenges facing single molecule sequencing of proteins by nanopores is the lack of a universal method for driving proteins or peptides into nanopores. In contrast to nucleic acids, the backbones of which are uniformly negatively charged nucleotides, proteins carry positive, negative and neutral side chains that are randomly distributed. Recombinant proteins carrying a negatively charged oligonucleotide or polypeptide at the C-termini can be translocated through a α-hemolysin (α-HL) nanopore, but the required genetic engineering limits the generality of these approaches. In this present study, we have developed a chemical approach for addition of a charged oligomer to peptides so that they can be translocated through nanopores. As an example, an oligonucleotide PolyT20 was tethered to peptides through first selectively functionalizing their N-termini with azide followed by a click reaction. The data show that the peptide-PolyT20 conjugates translocated through nanopores, whereas the unmodified peptides did not. Surprisingly, the conjugates with their peptides tethered at the 5'-end of PolyT20 passed the nanopores more rapidly than the PolyT20 alone. The PolyT20 also yielded a wider distribution of blockade currents. The same broad distribution was found for a conjugate with its peptide tethered at the 3'-end of PolyT20, suggesting that the larger blockades (and longer translocation times) are associated with events in which the 5'-end of the PolyT20 enters the pore first.
…TART, and TAHRE (HTT) retroposon arrays regulate…
Show Full Abstract
Unlike the telomerase-dependent mammalian telomeres, HeT-A, TART, and TAHRE (HTT) retroposon arrays regulate Drosophila telomere length. Cap prevents telomeric associations (TAs) and telomeric fusions (TFs). Our results suggest important roles of Hrb87F in telomeric HTT array and cap maintenance in Drosophila. All chromosome arms, except 2L, in Df(3R)Hrb87F homozygotes (Hrb87F-null) displayed significantly elongated telomeres with amplified HTT arrays and high TAs, all of which resolved without damage. Presence of FLAG-tagged Hrb87F (FLAG-Hrb87F) on cap and subtelomeric regions following hsFLAG-Hrb87F transgene expression in Df(3R)Hrb87F homozygotes suppressed TAs without affecting telomere length. A normal X-chromosome telomere expanded within five generations in Hrb87F-null background and displayed high TAs, but not when hsFLAG-Hrb87F was co-expressed. Tel (1) /Gaiano line or HP1 loss-of-function mutant-derived expanded telomeres carry Hrb87F on cap and HTT arrays while Hrb87F-null telomeres have HP1 and HOAP on caps and expanded HTT arrays. ISWI, seen only on cap on normal telomeres, was abundant on Hrb87F-null expanded HTT arrays. Extended telomeres derived from Tel (1) (Gaiano) or HP1-null mutation background interact with those from Hrb87F-null, since while the end association frequency was negligible in Df(3R)Hrb87F/+ nuclei, it increased significantly in co-presence of Tel (1) or HP1-null-based expanded telomere/s. Together, these suggest complex interactions between members of the proteome of telomere so that absence of any key member leads to telomere expansion and/or enhanced TAs/TFs. HTT expansion in Hrb87F-null condition is not developmental but a germline event presumably because absence of Hrb87F in germline may deregulate HTT retroposition/replication leading to telomere elongation.
Also flagged:colorectal cancermetastatic diseaseMACROD2CancerAPCTP53
Journal Article2015-09-16✓ 3 Snippetsvan den Broek E, Dijkstra MJ, Krijgsman O, Sie D, Haan JC, Traets JJ, van de Wiel MA, Nagtegaal ID, Punt CJ, Carvalho B, Ylstra B, Abeln S, Meijer GA, Fijneman RJ.
In-Text Gene Mentions
Discussion)
…TRIM38, MTA1 ,…
Discussion)
…TRIM38may counteract NF-κB…
Discussion)
…that loss ofTRIM38might enhance tumorigenesis.…
Show Full Abstract
<h4>Background</h4>Cancer is caused by somatic DNA alterations such as gene point mutations, DNA copy number aberrations (CNA) and structural variants (SVs). Genome-wide analyses of SVs in large sample series with well-documented clinical information are still scarce. Consequently, the impact of SVs on carcinogenesis and patient outcome remains poorly understood. This study aimed to perform a systematic analysis of genes that are affected by CNA-associated chromosomal breaks in colorectal cancer (CRC) and to determine the clinical relevance of recurrent breakpoint genes.<h4>Methods</h4>Primary CRC samples of patients with metastatic disease from CAIRO and CAIRO2 clinical trials were previously characterized by array-comparative genomic hybridization. These data were now used to determine the prevalence of CNA-associated chromosomal breaks within genes across 352 CRC samples. In addition, mutation status of the commonly affected APC, TP53, KRAS, PIK3CA, FBXW7, SMAD4, BRAF and NRAS genes was determined for 204 CRC samples by targeted massive parallel sequencing. Clinical relevance was assessed upon stratification of patients based on gene mutations and gene breakpoints that were observed in >3% of CRC cases.<h4>Results</h4>In total, 748 genes were identified that were recurrently affected by chromosomal breaks (FDR <0.1). MACROD2 was affected in 41% of CRC samples and another 169 genes showed breakpoints in >3% of cases, indicating that prevalence of gene breakpoints is comparable to the prevalence of well-known gene point mutations. Patient stratification based on gene breakpoints and point mutations revealed one CRC subtype with very poor prognosis.<h4>Conclusions</h4>We conclude that CNA-associated chromosomal breaks within genes represent a highly prevalent and clinically relevant subset of SVs in CRC.
Also flagged:methylationgene expressioninflammatory bowel diseasedigestionpathogenesisintestinal diseases
Journal Article2015-09-16✓ 1 SnippetKraiczy J, Nayak K, Ross A, Raine T, Mak TN, Gasparetto M, Cario E, Rakyan V, Heuschkel R, Zilbauer M.
In-Text Gene Mentions
Discussion)
…as olfactomedin4 (OLFM4).…
Show Full Abstract
DNA methylation is one of the major epigenetic mechanisms implicated in regulating cellular development and cell-type-specific gene expression. Here we performed simultaneous genome-wide DNA methylation and gene expression analysis on purified intestinal epithelial cells derived from human fetal gut, healthy pediatric biopsies, and children newly diagnosed with inflammatory bowel disease (IBD). Results were validated using pyrosequencing, real-time PCR, and immunostaining. The functional impact of DNA methylation changes on gene expression was assessed by employing in-vitro assays in intestinal cell lines. DNA methylation analyses allowed identification of 214 genes for which expression is regulated via DNA methylation, i.e. regulatory differentially methylated regions (rDMRs). Pathway and functional analysis of rDMRs suggested a critical role for DNA methylation in regulating gene expression and functional development of the human intestinal epithelium. Moreover, analysis performed on intestinal epithelium of children newly diagnosed with IBD revealed alterations in DNA methylation within genomic loci, which were found to overlap significantly with those undergoing methylation changes during intestinal development. Our study provides novel insights into the physiological role of DNA methylation in regulating functional maturation of the human intestinal epithelium. Moreover, we provide data linking developmentally acquired alterations in the DNA methylation profile to changes seen in pediatric IBD.
Also flagged:HDcell adhesioncytoskeletonneuroblastomaneuronal diseasesHuntington's Disease
Journal Article2015-09-16✓ 3 SnippetsFu MH, Li CL, Lin HL, Tsai SJ, Lai YY, Chang YF, Cheng PH, Chen CM, Yang SH.
In-Text Gene Mentions
Introduction)
…Huntington’s disease (HD) is a dominantly inherited neurodegenerative disease caused by an expansion of CAG repeats located in first exon of the Huntingtin (HTT) gene.…
Introduction)
…the Huntingtin (HTT) gene.…
Discussion)
…to interact withHTT[ 38 –…
Show Full Abstract
High throughput screening is a powerful tool to identify the potential candidate molecules involved during disease progression. However, analysis of complicated data is one of the most challenging steps on the way to obtaining useful results from this approach. Previously, we showed that a specific miRNA, miR-196a, could ameliorate the pathological phenotypes of Huntington's disease (HD) in different models, and performed high throughput screening by using the striatum of transgenic mice. In this study, we further tried to identify the potential regulatory mechanisms using different bioinformatic tools, including Database for Annotation, Visualization and Integrated Discovery (DAVID), Molecular Signatures Database (MSigDB), TargetScan and MetaCore. The results showed that miR-196a dominantly altered "ABC transporters", "RIG-I-like receptor signaling pathway", immune system", "adaptive immune system","tissue remodeling and wound repair" and "cytoskeleton remodeling". In addition, miR-196a also changed the expression of several well-defined pathways of HD, such as apoptosis and cell adhesion. Since these analyses showed the regulatory pathways are highly related to the modification of the cytoskeleton, we further confirmed that miR-196a could enhance the neurite outgrowth in neuroblastoma cells, suggesting miR-196a might provide beneficial functions through the alteration of cytoskeleton structures. Since impairment of the cytoskeleton has been reported in several neuronal diseases, this study will provide not only the potential working mechanisms of miR-196a but also insights for therapeutic strategies for use with different neuronal diseases.
Also flagged:GLUT10TGFβextracellulararterial tortuosity syndromeconnective tissue disorderpathogenesis
Journal Article2015-09-16✓ 1 SnippetZoppi N, Chiarelli N, Cinquina V, Ritelli M, Colombi M.
In-Text Gene Mentions
Results)
…i.e. IL6 ,TNFSF4, TBX5 ,…
Show Full Abstract
Arterial tortuosity syndrome (ATS) is an autosomal recessive connective tissue disorder caused by loss-of-function mutations in SLC2A10, which encodes facilitative glucose transporter 10 (GLUT10). The role of GLUT10 in ATS pathogenesis remains an enigma, and the transported metabolite(s), i.e. glucose and/or dehydroascorbic acid, have not been clearly elucidated. To discern the molecular mechanisms underlying the ATS aetiology, we performed gene expression profiling and biochemical studies on skin fibroblasts. Transcriptome analyses revealed the dysregulation of several genes involved in TGFβ signalling and extracellular matrix (ECM) homeostasis as well as the perturbation of specific pathways that control both the cell energy balance and the oxidative stress response. Biochemical and functional studies showed a marked increase in ROS-induced lipid peroxidation sustained by altered PPARγ function, which contributes to the redox imbalance and the compensatory antioxidant activity of ALDH1A1. ATS fibroblasts also showed activation of a non-canonical TGFβ signalling due to TGFBRI disorganization, the upregulation of TGFBRII and connective tissue growth factor, and the activation of the αvβ3 integrin transduction pathway, which involves p125FAK, p60Src and p38 MAPK. Stable GLUT10 expression in patients' fibroblasts normalized redox homeostasis and PPARγ activity, rescued canonical TGFβ signalling and induced partial ECM re-organization. These data add new insights into the ATS dysregulated biological pathways and definition of the pathomechanisms involved in this disorder.
Also flagged:Tatmitochondrialviral proteinmetabolismcytoskeletal proteinsmitochondria
Journal Article2015-09-16No SnippetsRodríguez-Mora S, Mateos E, Moran M, Martín MÁ, López JA, Calvo E, Terrón MC, Luque D, Muriaux D, Alcamí J, Coiras M, López-Huertas MR.
Show Full Abstract
<h4>Background</h4>HIV-1 replication results in mitochondrial damage that is enhanced during antiretroviral therapy (ART). The onset of HIV-1 replication is regulated by viral protein Tat, a 101-residue protein codified by two exons that elongates viral transcripts. Although the first exon of Tat (aa 1-72) forms itself an active protein, the presence of the second exon (aa 73-101) results in a more competent transcriptional protein with additional functions.<h4>Results</h4>Mitochondrial overall functions were analyzed in Jurkat cells stably expressing full-length Tat (Tat101) or one-exon Tat (Tat72). Representative results were confirmed in PBLs transiently expressing Tat101 and in HIV-infected Jurkat cells. The intracellular expression of Tat101 induced the deregulation of metabolism and cytoskeletal proteins which remodeled the function and distribution of mitochondria. Tat101 reduced the transcription of the mtDNA, resulting in low ATP production. The total amount of mitochondria increased likely to counteract their functional impairment. These effects were enhanced when Tat second exon was expressed.<h4>Conclusions</h4>Intracellular Tat altered mtDNA transcription, mitochondrial content and distribution in CD4+ T cells. The importance of Tat second exon in non-transcriptional functions was confirmed. Tat101 may be responsible for mitochondrial dysfunctions found in HIV-1 infected patients.
Also flagged:chronic kidney diseasehearing impairmentglomerular filtrationhearingkidney dysfunction-impairment
Journal Article2015-09-16No SnippetsSeo YJ, Ko SB, Ha TH, Gong TH, Bong JP, Park DJ, Park SY.
Show Full Abstract
<h4>Background</h4>We aimed to evaluate the association between hearing impairment and the prevalence of chronic kidney disease (CKD) in the largest population-based cross-sectional study to date.<h4>Methods</h4>This cross-sectional study was based on the Korean National Health and Nutritional Examination Survey (KNHANES). It included 5226 participants ≥19 years of age whose estimated glomerular filtration rate (eGFR) and hearing threshold had been measured. We diagnosed CKD as an eGFR <60 mL/min/1.73 m(2). The participants were also evaluated for the presence of other contributing factors related to kidney dysfunction. We divided the participants at the 40-dB threshold into hearing-impairment and no-hearing-impairment groups, using the average threshold of all six frequencies (500, 1000, 2000, 3000, 4000, and 6000 Hz) for both ears.<h4>Results</h4>The odds of hearing impairment was 1.25 times higher (95 % confidence interval: 1.12-1.64, p-value < 0.001) in participants with an eGFR <60 mL/min/1.73 m(2) than in those with an eGFR ≥60 mL/min/1.73 m(2) after adjustments for age, sex, smoking, alcohol, body mass index, diabetes mellitus, hypertension, dyslipidemia, and microalbuminuria. Among the risk parameters of CKD associated with hearing impairment, linear regression analysis adjusted for age and sex determined that each increase of serum creatinine or blood pressure was positively associated with an increase in hearing threshold (p-value < 0.01).<h4>Conclusion</h4>The odds of hearing impairment were greater with lower eGFR than with normal eGFR. Individuals with CKD were more likely to also have hearing impairment. We recommend screening the hearing of patients with CKD to provide earlier identification of hearing impairment and earlier intervention, thereby preventing progression of hearing impairment and providing appropriate treatment strategies.
Also flagged:ActincytoskeletonCullin 3Cul3ubiquitin E3 ligasecytoskeletal
Journal Article2015-09-16✓ 1 SnippetHudson AM, Mannix KM, Cooley L.
In-Text Gene Mentions
Text
…KLHL20…
Show Full Abstract
The Drosophila Kelch protein is required to organize the ovarian ring canal cytoskeleton. Kelch binds and cross-links F-actin in vitro, and it also functions with Cullin 3 (Cul3) as a component of a ubiquitin E3 ligase. How these two activities contribute to cytoskeletal remodeling in vivo is not known. We used targeted mutagenesis to investigate the mechanism of Kelch function. We tested a model in which Cul3-dependent degradation of Kelch is required for its function, but we found no evidence to support this hypothesis. However, we found that mutant Kelch deficient in its ability to interact with Cul3 failed to rescue the kelch cytoskeletal defects, suggesting that ubiquitin ligase activity is the principal activity required in vivo. We also determined that the proteasome is required with Kelch to promote the ordered growth of the ring canal cytoskeleton. These results indicate that Kelch organizes the cytoskeleton in vivo by targeting a protein substrate for degradation by the proteasome.
Chromosome 22q11.2 microdeletions impart a high but incomplete risk for schizophrenia. Possible mechanisms include genome-wide effects of DGCR8 haploinsufficiency. In a proof-of-principle study to assess the power of this model, we used high-quality, whole-genome sequencing of nine individuals with 22q11.2 deletions and extreme phenotypes (schizophrenia, or no psychotic disorder at age >50 years). The schizophrenia group had a greater burden of rare, damaging variants impacting protein-coding neurofunctional genes, including genes involved in neuron projection (nominal P = 0.02, joint burden of three variant types). Variants in the intact 22q11.2 region were not major contributors. Restricting to genes affected by a DGCR8 mechanism tended to amplify between-group differences. Damaging variants in highly conserved long intergenic noncoding RNA genes also were enriched in the schizophrenia group (nominal P = 0.04). The findings support the 22q11.2 deletion model as a threshold-lowering first hit for schizophrenia risk. If applied to a larger and thus better-powered cohort, this appears to be a promising approach to identify genome-wide rare variants in coding and noncoding sequence that perturb gene networks relevant to idiopathic schizophrenia. Similarly designed studies exploiting genetic models may prove useful to help delineate the genetic architecture of other complex phenotypes.
This review summarises genetic studies in which calcium channel genes have been connected to the spectrum of neuropsychiatric syndromes, from bipolar disorder and schizophrenia to autism spectrum disorders and intellectual impairment. Among many other genes, striking numbers of the calcium channel gene superfamily have been implicated in the aetiology of these diseases by various DNA analysis techniques. We will discuss how these relate to the known monogenic disorders associated with point mutations in calcium channels. We will then examine the functional evidence for a causative link between these mutations or single nucleotide polymorphisms and the disease processes. A major challenge for the future will be to translate the expanding psychiatric genetic findings into altered physiological function, involvement in the wider pathology of the diseases, and what potential that provides for personalised and stratified treatment options for patients.
Here, we have developed a novel method for forming hydrogel arrays using surfaces patterned with differential wettability. Our method for benchtop array formation is suitable for enhanced-throughput, combinatorial screening of biochemical and biophysical cues from chemically defined cell culture substrates. We demonstrated the ability to generate these arrays without the need for liquid handling systems and screened the combinatorial effects of substrate stiffness and immobilized cell adhesion peptide concentration on human mesenchymal stem cell (hMSC) behavior during short-term 2-dimensional cell culture. Regardless of substrate stiffness, hMSC initial cell attachment, spreading, and proliferation were linearly correlated with immobilized CRGDS peptide concentration. Increasing substrate stiffness also resulted in increased hMSC initial cell attachment, spreading, and proliferation; however, examination of the combinatorial effects of CRGDS peptide concentration and substrate stiffness revealed potential interplay between these distinct substrate signals. Maximal hMSC proliferation seen on substrates with either high stiffness or high CRGDS peptide concentration suggests that some baseline level of cytoskeletal tension was required for hMSC proliferation on hydrogel substrates and that multiple substrate signals could be engineered to work in synergy to promote mechanosensing and regulate cell behavior.<h4>Statement of significance</h4>Our novel array formation method using surfaces patterned with differential wettability offers the advantages of benchtop array formation for 2-dimensional cell cultures and enhanced-throughput screening without the need for liquid handling systems. Hydrogel arrays formed via our method are suitable for screening the influence of chemical (e.g. cell adhesive ligands) and physical (stiffness, size, shape, and thickness) substrate properties on stem cell behavior. The arrays are also fully compatible with commercially available micro-array add-on systems, which allows for simultaneous control of the insoluble and soluble cell culture environment. This study used hydrogel arrays to demonstrate that synergy between cell adhesion and mechanosensing can be used to regulate hMSC behavior.
Gastric cancer (GC) is now one of the most common malignancies with a relatively high incidence and high mortality rate. The prognosis is closely related to the degree of tumor metastasis. The mechanism of metastasis is still unclear. Proteomics analysis is a powerful tool to study and evaluate protein expression in tumor tissues. In the present study, we collected 15 gastric cancer and adjacent normal gastric tissues and used the isobaric tags for relative and absolute quantitation (iTRAQ) method to identify differentially expressed proteins. A total of 134 proteins were differentially expressed between the cancerous and non-cancerous samples. Azurocidin 1 (AZU1), CPVL, olfactomedin 4 (OLFM4) and Villin 1 (VIL1) were upregulated and confirmed by western blot analysis, real-time quantitative PCR and immunohistochemical analyses. These results were in accordance with iTRAQ. Furthermore, silencing the OLFM4 expression suppressed the migration, invasion and proliferation of the GC cells in vitro. The present study represents a successful application of the iTRAQ method in analyzing the expression levels of thousands of proteins. Overexpression of OLFM4 in gastric cancer may induce the development of gastric cancer. Overall, suppression of OLFM4 expression may be a promising strategy in the development of novel cancer therapeutic drugs.
…Huntington disease (HD) is an autosomal dominant, neurodegenerative disorder caused by an expanded trinucleotide (CAG) repeat sequence in the first exon of the HD (HTT) gene, leading to an enlarged polyglutamine tract in the encoded protein huntingtin.1 Unwanted choreiform movements, psychiatric and behavioural disturbances and cognitive impairment characterize the disease.…
Introduction)
…the HD (HTT) gene, leading…
Show Full Abstract
<h4>Background</h4>Recently a profound depletion of cystathionine γ-lyase (CSE), the principal enzyme involved in the generation of cysteine from cystathionine, was shown in Huntington disease (HD) patients and several transgenic HD mouse models. We therefore hypothesized that blood and urine cystathionine levels may be increased in HD patients and that this increase might correlate with disease progression.<h4>Methods</h4>We measured concentrations of cystathionine as well as 22 other amino acids in fasting plasma and 24-h urine samples of nine early-stage HD patients and nine age, sex, and body mass index matched controls.<h4>Results</h4>There were no significant differences in the plasma or urine concentrations of cystathionine or any other amino acid between HD patients and controls.<h4>Conclusion</h4>We found no evidence for changes in plasma or urine concentrations of cystathionine in early-stage HD patients. Therefore, cystathionine levels are unlikely to be useful as a state biomarker in HD.
The sight is one of the five senses allowing an autonomous and high-quality life, so that alterations of any ocular component may result in several clinical phenotypes (from conjunctivitis to severe vision loss and irreversible blindness). Most parts of clinical phenotypes have been significantly associated with mutations in genes regulating the normal formation and maturation of the anterior segments of the eye. Among the eye anterior segment disorders, special attention is given to Glaucoma as it represents one of the major causes of bilateral blindness in the world, with an onset due to Mendelian or multifactorial genetic-causative traits. This review will point out the attention on the Primary Congenital Glaucoma (PCG), which is usually transmitted according to an autosomal-recessive inheritance pattern. Taking into consideration the genetic component of the PCG, it is possible to observe a strong heterogeneity concerning the disease-associated loci (GLC3), penetrance defects, and expressivity of the disease. Given the strong PGC heterogeneity, pre- and posttest genetic counseling plays an essential role in the achievement of an appropriate management of PCG, in terms of medical, social, and psychological impact of the disease.
Also flagged:peroxiredoxin Iperoxiredoxin 6nuclear factor-κBTumororal cancerCOX-2
Journal Article2015-09-16✓ 5 SnippetsLee EY, Kang JY, Kim KW.
In-Text Gene Mentions
Abstract)
…The present study investigates whether the expression levels of cyclooxygenase-2 (COX-2), nuclear factor-κB (NF-κB), peroxiredoxin 1 (PRDX1) and PRDX6 are associated with the development, proliferation, differentiation and recurrence of oral squamous cell carcinoma (OSCC).…
Abstract)
…The mRNA expression levels of COX-2, NF-κB, PRDX1 and PRDX6 were examined in 50 OSCC specimens and 19 normal oral mucosae by quantitative polymerase chain reaction (qPCR).…
Abstract)
…1 (PRDX1) andPRDX6are associated with…
Abstract)
…NF-κB, PRDX1 andPRDX6were examined in…
Text
…PRDX6…
Show Full Abstract
Tumor development and progression are multistep processes that involve local tumor growth and invasion, followed by metastasis. The aggressiveness of the tumor is the major determinant of the mortality of oral cancer patients. The present study investigates whether the expression levels of cyclooxygenase-2 (COX-2), nuclear factor-κB (NF-κB), peroxiredoxin 1 (PRDX1) and PRDX6 are associated with the development, proliferation, differentiation and recurrence of oral squamous cell carcinoma (OSCC). The mRNA expression levels of COX-2, NF-κB, PRDX1 and PRDX6 were examined in 50 OSCC specimens and 19 normal oral mucosae by quantitative polymerase chain reaction (qPCR). qPCR analysis showed that the mRNA levels of COX-2 in OSCC were significantly higher than those in the normal oral mucosae (P=0.021). The expression levels of PRDX1 in high-stage tumors (T3 and T4) were significantly elevated compared with those in low-stage tumors (T1) (P=0.047). Additionally, the expression levels of NF-κB in the high-grade tumor were significantly elevated compared with those in the low-grade tumors (P=0.030). Overall, it was indicated that the expression of COX-2 is strongly associated with the development of OSCC. Moreover, the enhanced expression of PRDX1 and NF-κB may function in the progression of OSCC, which serves as a useful marker for prognosis in patients with oral cancer.
Colorectal cancer (CRC) is one of the leading causes of cancer-related mortality worldwide. Our recent study demonstrated that the expression of Wilms' tumor 1 gene (<i>WT1</i>) is associated with surgical outcome in CRC patients. The present study aimed to investigate the genetic association of the single-nucleotide polymorphism rs16754 in the <i>WT1</i> gene with the occurrence of CRC, using an age-matched case-control study design. In addition, the correlation between genotype and <i>WT1</i> expression was investigated. Genomic DNA samples from 104 CRC cases, aged 15-65 years, and 208 healthy controls, were genotyped for rs16754 using the TaqMan genotyping method. The genotype distribution conformed to the Hardy-Weinberg equilibrium (P=0.80). The overall minor allele frequency (MAF) of rs16754 (allele A) was 0.33. The MAF among CRC cases was significantly higher compared with that in controls (0.39 vs. 0.31, respectively; P=0.03). The AA genotype was significantly associated with the disease (odds ratio = 2.51, 95% confidence interval: 1.24-5.07, P=0.01). Cases with the AA genotype exhibited a significantly poorer 3-year overall survival (60%), compared with those with the GG or GA genotypes (80%) (log-rank test, P<0.01). Reverse transcription quantitative polymerase chain reaction analysis demonstrated that the expression of <i>WT1</i> in tumor tissues was higher compared with that in normal tissue; however, there were no significant differences in its expression among different genotypes. Therefore, rs16754 was found to be associated with the occurrence and prognosis of CRC in our subjects.
Also flagged:silicapulmonary fibrosisbleomycinlung fibrosissilicosisidiopathic pulmonary fibrosis
Journal Article2015-09-15✓ 1 SnippetJi X, Wu B, Fan J, Han R, Luo C, Wang T, Yang J, Han L, Zhu B, Wei D, Chen J, Ni C.
In-Text Gene Mentions
Discussion)
…Furthermore,OLFM4was recently proposed…
Show Full Abstract
To identify microRNAs (miRNAs, miRs) with potential roles in lung fibrogenesis, we performed genome-wide profiling of miRNA expression in lung tissues from a silica-induced mouse model of pulmonary fibrosis using microarrays. Seventeen miRNAs were selected for validation via qRT-PCR based on the fold changes between the silica and the control group. The dysregulation of five miRNAs, including miR-21, miR-455, miR-151-3p, miR-486-5p and miR-3107, were confirmed by qRT-PCRs in silica-induced mouse model of pulmonary fibrosis and were also confirmed in a bleomycin (BLM)-induced mouse lung fibrosis. Notably, miR-486-5p levels were decreased in the serum samples of patients with silicosis, as well as in the lung tissues of patients with silicosis and idiopathic pulmonary fibrosis (IPF). In addition, as determined by luciferase assays and Western blotting, SMAD2, a crucial mediator of pulmonary fibrosis, was identified to be one of target genes of miR-486-5p. To test the potential therapeutic significance of this miRNA, we overexpressed miR-486-5p in animal models. At day 28, miR-486-5p expression significantly decreased both the distribution and severity of lung lesions compared with the silica group (P < 0.01). In addition, miR-486-5p had a similar effect in the BLM group (P < 0.001). These results indicate that miR-486-5p may inhibit fibrosis.
Also flagged:MyoAhost cellsglideosometype XIV myosinessential light chain 2light chains
Journal Article2015-09-15✓ 1 SnippetWilliams MJ, Alonso H, Enciso M, Egarter S, Sheiner L, Meissner M, Striepen B, Smith BJ, Tonkin CJ.
In-Text Gene Mentions
Results)
…included at ELC1EF hand Ihand I (EFI),…
Show Full Abstract
<h4>Unlabelled</h4>Key to the virulence of apicomplexan parasites is their ability to move through tissue and to invade and egress from host cells. Apicomplexan motility requires the activity of the glideosome, a multicomponent molecular motor composed of a type XIV myosin, MyoA. Here we identify a novel glideosome component, essential light chain 2 (ELC2), and functionally characterize the two essential light chains (ELC1 and ELC2) of MyoA in Toxoplasma. We show that these proteins are functionally redundant but are important for invasion, egress, and motility. Molecular simulations of the MyoA lever arm identify a role for Ca(2+) in promoting intermolecular contacts between the ELCs and the adjacent MLC1 light chain to stabilize this domain. Using point mutations predicted to ablate either the interaction with Ca(2+) or the interface between the two light chains, we demonstrate their contribution to the quality, displacement, and speed of gliding Toxoplasma parasites. Our work therefore delineates the importance of the MyoA lever arm and highlights a mechanism by which this domain could be stabilized in order to promote invasion, egress, and gliding motility in apicomplexan parasites.<h4>Importance</h4>Tissue dissemination and host cell invasion by apicomplexan parasites such as Toxoplasma are pivotal to their pathogenesis. Central to these processes is gliding motility, which is driven by an actomyosin motor, the MyoA glideosome. Others have demonstrated the importance of the MyoA glideosome for parasite motility and virulence in mice. Disruption of its function may therefore have therapeutic potential, and yet a deeper mechanistic understanding of how it works is required. Ca(2+)-dependent and -independent phosphorylation and the direct binding of Ca(2+) to the essential light chain have been implicated in the regulation of MyoA activity. Here we identify a second essential light chain of MyoA and demonstrate the importance of both to Toxoplasma motility. We also investigate the role of Ca(2+) and the MyoA regulatory site in parasite motility and identify a potential mechanism whereby binding of a divalent cation to the essential light chains could stabilize the myosin to allow productive movement.
Also flagged:genetic disordersgeneticcognitionpsychiatric diseaseautism spectrum disordercerebral palsy
Journal Article2015-09-15✓ 2 SnippetsBlair LM, Pickler RH, Anderson C.
In-Text Gene Mentions
Text
…5-HTT…
Text
…HFE…
Show Full Abstract
Preterm infants are at elevated risk for a host of neurodevelopmental problems, including disorders that appear later in life. Gene-environment interactions and prematurity may combine to increase the risk for poor neurodevelopmental outcomes. Increasing evidence supports a genetic link to risk for atypical development; however, no genomic risk profiles are currently used for infants without apparent genetic disorders. The purpose of this review was to synthesize recent evidence of genetic associations with atypical neurodevelopmental outcomes that may affect preterm infants who do not have a rare genetic disease. Electronic and hand-search strategies were used to find relevant articles that were English-language, peer-reviewed primary research or meta-analysis reports published between July 2009 and July 2014, involving human participants. Articles included in the analysis (N = 29) used a wide range of study designs and methodologies, complicating the analysis. An integrative-review design was used to synthesize the data. Numerous genes (n = 43) and additional large deletion copy number variants were associated with neurodevelopmental outcomes, including cognition, attention, perception, psychiatric disease, autism spectrum disorder, cerebral palsy, infant behavior, and alterations in brain architecture. The creation of genetic risk profiles for complex disorders of neurodevelopment is presently hindered by inconsistent genetic-association evidence, methodological considerations, reporting problems, and lack of replication. However, several avenues of investigation offer promise, including large (>100 kb) copy number variants and the candidate genes MET, NRG3, and SLC6A4, each of which were reported to have associations with neurodevelopmental outcomes in multiple, high-quality studies.
Also flagged:cancerbreast cancerretinoblastomacancerspediatric cancersEwing sarcoma
Journal Article2015-09-15No SnippetsMachiela MJ, Ho BM, Fisher VA, Hua X, Chanock SJ.
Show Full Abstract
<h4>Background</h4>Genome wide-association studies have successfully identified several hundred independent loci harboring common cancer susceptibility alleles that are distinct from the more than 110 cancer predisposition genes. The latter are generally characterized by disruptive mutations in coding genes that have been established as 'drivers' of cancer in large somatic sequencing studies. We set out to determine whether, similarly, common cancer susceptibility loci map to genes that have altered frequencies of mutation.<h4>Results</h4>In our analysis of the intervals defined by the cancer susceptibility markers, we observed that cancer susceptibility regions have gene mutation frequencies comparable to background mutation frequencies. Restricting analyses to genes that have been determined to be pleiotropic across cancer types, genes affected by expression quantitative trait loci, or functional genes indicates that most cancer susceptibility genes classified into these subgroups do not display mutation frequencies that deviate from those expected. We observed limited evidence that cancer susceptibility regions that harbor common alleles with small estimated effect sizes are preferential targets for altered somatic mutation frequencies.<h4>Conclusions</h4>Our findings suggest a complex interplay between germline susceptibility and somatic mutation, underscoring the cumulative effect of common variants on redundant pathways as opposed to driver genes. Complex biological pathways and networks likely link these genetic features of carcinogenesis, particularly as they relate to distinct polygenic models for each cancer type.
Regeneration of lost synaptic connections following spinal cord injury (SCI) is limited by local ischemia, cell death, and an excitotoxic environment, which leads to the development of an inhibitory glial scar surrounding a cystic cavity. While a variety of single therapy interventions provide incremental improvements to functional recovery after SCI, they are limited; a multifactorial approach that combines several single therapies may provide a better chance of overcoming the multitude of obstacles to recovery. To this end, fibrin scaffolds were modified to provide sustained delivery of neurotrophic factors and anti-inhibitory molecules, as well as encapsulation of embryonic stem cell-derived progenitor motor neurons (pMNs). In vitro characterization of this combination scaffold confirmed that pMN viability was unaffected by culture alongside sustained delivery systems. When transplanted into a rat sub-acute SCI model, fibrin scaffolds containing growth factors (GFs), anti-inhibitory molecules without pMNs, or pMNs with GFs had lower chondroitin sulfate proteoglycan levels compared to scaffolds containing anti-inhibitory molecules with pMNs. Scaffolds containing pMNs, but not anti-inhibitory molecules, showed survival, differentiation into neuronal cell types, axonal extension in the transplant area, and the ability to integrate into host tissue. However, the combination of pMNs with sustained-delivery of anti-inhibitory molecules led to reduced cell survival and increased macrophage infiltration. While combination therapies retain potential for effective treatment of SCI, further work is needed to improve cell survival and to limit inflammation.<h4>Statement of significance</h4>Spinal cord injury (SCI) creates a highly complex inhibitory environment with a multitude of obstacles that limit recovery. Many therapeutic options have been developed to overcome single obstacles, but single therapies typically only lead to limited functional improvement. Therefore combination therapies may improve recovery by targeting several inhibitory obstacles simultaneously. The present study used biomaterial scaffolds to combine the sustained release of anti-inhibitory molecules and growth factors with cell transplantation of highly purified progenitor motor neurons. This expands upon previously established biomaterial scaffolds by supporting surviving cells, limiting inhibition from the extracellular environment, and replenishing lost cell populations. We show that while promising, certain combinations may exacerbate negative side-effects instead of augmenting positive features.
Also flagged:ion channelsneurotransmitter receptorsNG2gene expressionaxonsmultiple sclerosis
Journal Article2015-09-15No SnippetsLarson VA, Zhang Y, Bergles DE.
Show Full Abstract
NG2(+) glial cells are a dynamic population of non-neuronal cells that give rise to myelinating oligodendrocytes in the central nervous system. These cells express numerous ion channels and neurotransmitter receptors, which endow them with a complex electrophysiological profile that is unique among glial cells. Despite extensive analysis of the electrophysiological properties of these cells, relatively little was known about the molecular identity of the channels and receptors that they express. The generation of new RNA-Seq datasets for NG2(+) cells has provided the means to explore how distinct genes contribute to the physiological properties of these progenitors. In this review, we systematically compare the results obtained through RNA-Seq transcriptional analysis of purified NG2(+) cells to previous physiological and molecular studies of these cells to define the complement of ion channels and neurotransmitter receptors expressed by NG2(+) cells in the mammalian brain and discuss the potential significance of the unique physiological properties of these cells. This article is part of a Special Issue entitled SI:NG2-glia(Invited only).
Also flagged:autophagyTFEBdegradationorganellesneurodegenerative disordersamyotrophic lateral sclerosis
Journal Article2015-09-15✓ 1 SnippetChen Y, Liu H, Guan Y, Wang Q, Zhou F, Jie L, Ju J, Pu L, Du H, Wang X.
In-Text Gene Mentions
Text
…Htt…
Show Full Abstract
Autophagy is an intracellular degradation process that clears away aggregated proteins or aged and damaged organelles. Abnormalities in autophagy result in defects in clearance of these misfolded and aggregate proteins, which have been associated with neurodegenerative disorders. A key neuropathological hallmark of amyotrophic lateral sclerosis (ALS) that contributes to the progressive loss of motor neurons is abnormal protein aggregation of mutant Cu/Zn superoxide dismutase1 (SOD1). TFEB is a recently described gene that regulates autophagy. Several studies have reported that autophagy is altered in ALS, but little is known about the role and mechanisms of TFEB-mediated autophagy during the progression of ALS. In this study, altered expression of TFEB and Beclin-1 were detected in the spinal cords of ALS transgenic mice at different stages and in an NSC-34 cell model with the SOD1-G93A mutation using RT-PCR, western blot, and immunohistochemistry. The majority of cells positive for TFEB and Beclin-1 are β-tubulin III-labeled neurons, especially in the anterior horn of the gray matter. Overexpression of TFEB in NSC-34 cells with the SOD1-G93A mutation increased the mRNA and protein levels of Beclin-1, accompanied by increased levels of LC3-II protein. MTS assay revealed that TFEB overexpression increased proliferation and survival of NSC-34 cells with the SOD1-G93A mutation. Our findings suggest that TFEB promotes autophagy by enhancing the expression of Beclin-1. The altered autophagy mediated by TFEB is a key element in the pathogenesis of ALS, making TFEB a very promising target for the development of novel drugs and new gene therapeutics for ALS.
Also flagged:chronic hepatitis CinterferonribavirinHCV infectionIL-28BIL-17A
Journal Article2015-09-15✓ 1 SnippetNan YM, Zhang YG, Zheng HW, An CM, Li YS, Zhang Y, Sun DX, Li CY, Li Q, Tong LX, Kong LB, Zhao SX, Wang RQ, Meng P, Su SS, He H, Niu XM.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
Combination therapy comprising pegylated interferon-alpha (PegIFNα) and ribavirin (RBV) has been the standard of care for the chronic hepatitis C patients for more than a decade. Recently, direct antiviral agents show better efficacy, tolerance, and shorter treatment duration. However, the prohibitive costs of the regimens limit their use in developing countries where most of the HCV infection exists. Optimizing the treatment and understanding the host- and virus-factors associated with viral clearance were necessary for individualizing therapy to maximize sustained virologic response. To explore individualized antiviral strategies with PegIFNα-2a/IFNα-2b plus ribavirin for CHC patients, and to clarify predictive factors for virological response. A cohort of 314 patients were included in this open-label, prospective clinical trial, which received individualized doses of PegIFNα-2a or IFNα-2b combined with RBV according to body weight, disease status and complications, with the duration of 44 weeks after HCV RNA undetectable. All the IL-28B (rs8099917), IL-17A (rs8193036), IL-17B (rs2275913) and PD-1.1 SNPs were genotyped using the TaqMan system. The sustained virological response (SVR) in PegIFNα-2a group was significantly higher than that in IFNα-2b (85.8% vs 75.0%, P = 0.034), especially in HCV genotype 1 (84.0% vs 64.3%, P = 0.022). However, no significant differences were found in rapid virological response (RVR), complete early virological response (cEVR) and SVR between PegIFNα-2a and IFNα-2b according to different doses, respectively. The genotype frequency of IL-28B TT in patients with cEVR, SVR was higher than that in non-responsed patients (93.8% vs 78.1%, χ(2) = 7.827, P = 0.005; 95.9% vs 80.4%, χ(2) = 9.394, P = 0.002). No significant correlation between the genotype distribution of IL-17A, IL-17B and PD-1.1 with virological response. Individualized regimens of PegIFNα-2a/RBV and IFNα-2b/RBV could achieve satisfied virological response in Chinese HCV patients. The IL-28B (rs8099917) TT genotype is a clinical usefully marker for cEVR and SVR.
Also flagged:gastric cancerchromosomecell cycleTP53solid tumorscancers of the colon
Journal Article2015-09-15✓ 5 SnippetsTsukamoto Y, Fumoto S, Noguchi T, Yanagihara K, Hirashita Y, Nakada C, Hijiya N, Uchida T, Matsuura K, Hamanaka R, Murakami K, Seto M, Inomata M, Moriyama M.
In-Text Gene Mentions
Abstract)
…Furthermore, multivariate analysis of GC patients showed that high expression of DDX27 was independently associated with poorer prognosis.…
Abstract)
…We found that DDX27 was frequently upregulated in GC tissues (98 of 140 cases, 70%), and significantly associated with venous invasion and liver metastasis.…
Abstract)
…We also found that knockdown of DDX27 reduced the viability of GC cells through inhibition of cell cycle progression independently of apoptosis.…
Abstract)
…Thus, our results suggest that expression of DDX27 contributes to colony formation by GC cells through cell cycle control and may be a potential therapeutic target for GC patients with chromosome gain at 20q13.…
Abstract)
…Previously, we have reported that gain at chromosome 20q13 is the most common genomic copy number aberration in gastric cancer (GC) (29/30 cases), and that among the genes located in this region, we have identified DDX27, whose expression level shows the highest correlation with genomic copy number, as a candidate therapeutic target for GC.…
Show Full Abstract
Previously, we have reported that gain at chromosome 20q13 is the most common genomic copy number aberration in gastric cancer (GC) (29/30 cases), and that among the genes located in this region, we have identified DDX27, whose expression level shows the highest correlation with genomic copy number, as a candidate therapeutic target for GC. Here, we analyzed the clinicopathological significance of DDX27 using immunohistochemistry and studied its functions using knockdown assays. We found that DDX27 was frequently upregulated in GC tissues (98 of 140 cases, 70%), and significantly associated with venous invasion and liver metastasis. Furthermore, multivariate analysis of GC patients showed that high expression of DDX27 was independently associated with poorer prognosis. In functional assays, knockdown of DDX27 reduced the ability of GC cells to form colonies both on conventional plates and soft agar, but had little effect on their invasiveness. We also found that knockdown of DDX27 reduced the viability of GC cells through inhibition of cell cycle progression independently of apoptosis. Interestingly, DDX27 depletion induced accumulation of TP53 in a TP53 wild-type cell line, AGS, but not in a TP53-deleted cell line, 44As3, although DDX27 knockdown commonly reduced the viability of both, indicating the TP53-dependent and independent cell cycle control of DDX27. Thus, our results suggest that expression of DDX27 contributes to colony formation by GC cells through cell cycle control and may be a potential therapeutic target for GC patients with chromosome gain at 20q13.
Also flagged:obesityTMEM18pediatric obesityFTOMC4RSH2B1
Journal Article2015-09-14✓ 1 SnippetRask-Andersen M, Sällman Almén M, Jacobsson JA, Ameur A, Moschonis G, Dedoussis G, Marcus C, Gyllensten U, Fredriksson R, Schiöth HB.
In-Text Gene Mentions
Text
…NEGR1…
Show Full Abstract
Genome-wide association studies (GWAS) have revealed association of a locus approximately 25b downstream of the TMEM18 gene with body mass and obesity. We utilized targeted re-sequencing of the body mass associated locus in proximity of TMEM18 in a case-control population of severely obese children and adolescents from the Stockholm area. We expanded our study to include the TMEM18 gene itself, with the aim of identifying body mass associated genetic variants. Sequencing was performed on the SOLiD platform, on long-range PCR fragments generated through targeted amplification of the regions of interest. Candidate single nucleotide polymorphisms (SNPs) were validated by TaqMan genotyping. We were able to observe 131 SNPs across the re-sequenced regions. Chi squared tests comparing the allele frequencies between cases and controls revealed 57 SNPs as candidates for association with obesity. Validation and replication genotyping revealed robust associations for SNPs within the haplotype block region located downstream from the TMEM18 gene. This study provides a high resolution map of the genetic variation pattern in the TMEM18 gene, as well as the associated haplotype block, and further strengthens the association of variants within the proximal haplotype block with obesity and body mass.
Also flagged:acute myocardial infarctionMIgene expressionplatelet aggregationST-segment elevation MIplatelet activation
Journal Article2015-09-14✓ 3 SnippetsEicher JD, Wakabayashi Y, Vitseva O, Esa N, Yang Y, Zhu J, Freedman JE, McManus DD, Johnson AD.
In-Text Gene Mentions
Abstract)
…FBXL4, ECHDC3, KCNE1, TAOK2, AURKB, ERG, and FKBP5) and lower (MIAT, PVRL3, and PZP) expression in STEMI platelets compared to NSTEMI…
Abstract)
…suggestively higher (FBXL4, ECHDC3, KCNE1,…
Text
…FBXL4…
Show Full Abstract
Transcripts in platelets are largely produced in precursor megakaryocytes but remain physiologically active as platelets translate RNAs and regulate protein/RNA levels. Recent studies using transcriptome sequencing (RNA-seq) characterized the platelet transcriptome in limited number of non-diseased individuals. Here, we expand upon these RNA-seq studies by completing RNA-seq in platelets from 32 patients with acute myocardial infarction (MI). Our goals were to characterize the platelet transcriptome using a population of patients with acute MI and relate gene expression to platelet aggregation measures and ST-segment elevation MI (STEMI) (n = 16) vs. non-STEMI (NSTEMI) (n = 16) subtypes. Similar to other studies, we detected 9565 expressed transcripts, including several known platelet-enriched markers (e.g. PPBP, OST4). Our RNA-seq data strongly correlated with independently ascertained platelet expression data and showed enrichment for platelet-related pathways (e.g. wound response, hemostasis, and platelet activation), as well as actin-related and post-transcriptional processes. Several transcripts displayed suggestively higher (FBXL4, ECHDC3, KCNE1, TAOK2, AURKB, ERG, and FKBP5) and lower (MIAT, PVRL3, and PZP) expression in STEMI platelets compared to NSTEMI. We also identified transcripts correlated with platelet aggregation to TRAP (ATP6V1G2, SLC2A3), collagen (CEACAM1, ITGA2), and ADP (PDGFB, PDGFC, ST3GAL6). Our study adds to current platelet gene expression resources by providing transcriptome-wide analyses in platelets isolated from patients with acute MI. In concert with prior studies, we identify various genes for further study in regards to platelet function and acute MI. Future platelet RNA-seq studies examining more diverse sets of healthy and diseased samples will add to our understanding of platelet thrombotic and non-thrombotic functions.
Also flagged:RadiometabolismDiphenyl Sulfideserotonin transporterSERTdiarylsulfidemetabolism
Journal Article2015-09-14✓ 2 SnippetsGourand F, Amini N, Jia Z, Stone-Elander S, Guilloteau D, Barré L, Halldin C.
In-Text Gene Mentions
Introduction)
…The serotonin transporter (SERT, also known as 5-HTT) has been implicated in a variety of neurological and psychiatric disorders such as depression, schizophrenia, mental illness and neurodegenerative pathologies such as Parkinson’s and Alzheimer’s diseases.…
Introduction)
…also known as5-HTT) has been implicated…
Show Full Abstract
In quantitative PET measurements, the analysis of radiometabolites in plasma is essential for determining the exact arterial input function. Diphenyl sulfide compounds are promising PET and SPECT radioligands for in vivo quantification of the serotonin transporter (SERT) and it is therefore important to investigate their radiometabolism. We have chosen to explore the radiometabolic profile of [11C]MADAM, one of these radioligands widely used for in vivo PET-SERT studies. The metabolism of [11C]MADAM/MADAM was investigated using rat and human liver microsomes (RLM and HLM) in combination with radio-HPLC or UHPLC/Q-ToF-MS for their identification. The effect of carrier on the radiometabolic rate of the radioligand [11C]MADAM in vitro and in vivo was examined by radio-HPLC. RLM and HLM incubations were carried out at two different carrier concentrations of 1 and 10 μM. Urine samples after perfusion of [11C]MADAM/MADAM in rats were also analysed by radio-HPLC. Analysis by UHPLC/Q-ToF-MS identified the metabolites produced in vitro to be results of N-demethylation, S-oxidation and benzylic hydroxylation. The presence of carrier greatly affected the radiometabolism rate of [11C]MADAM in both RLM/HLM experiments and in vivo rat studies. The good concordance between the results predicted by RLM and HLM experiments and the in vivo data obtained in rat studies indicate that the kinetics of the radiometabolism of the radioligand [11C]MADAM is dose-dependent. This issue needs to be addressed when the diarylsulfide class of compounds are used in PET quantifications of SERT.
Also flagged:Nucleic acidsDCNDNasenorepinephrinepovidone-iodineSCG
Journal Article2015-09-14No SnippetsHartley SW, Coon SL, Savastano LE, Mullikin JC, NISC Comparative Sequencing Program, Fu C, Klein DC.
Show Full Abstract
The term neurotranscriptomics is used here to describe genome-wide analysis of neural control of transcriptomes. In this report, next-generation RNA sequencing was using to analyze the effects of neonatal (5-days-of-age) surgical stimulus deprivation on the adult rat pineal transcriptome. In intact animals, more than 3000 coding genes were found to exhibit differential expression (adjusted-p < 0.001) on a night/day basis in the pineal gland (70% of these increased at night, 376 genes changed more than 4-fold in either direction). Of these, more than two thousand genes were not previously known to be differentially expressed on a night/day basis. The night/day changes in expression were almost completely eliminated by neonatal removal (SCGX) or decentralization (DCN) of the superior cervical ganglia (SCG), which innervate the pineal gland. Other than the loss of rhythmic variation, surgical stimulus deprivation had little impact on the abundance of most genes; of particular interest, expression levels of the melatonin-synthesis-related genes Tph1, Gch1, and Asmt displayed little change (less than 35%) following DCN or SCGX. However, strong and consistent changes were observed in the expression of a small number of genes including the gene encoding Serpina1, a secreted protease inhibitor that might influence extracellular architecture. Many of the genes that exhibited night/day differential expression in intact animals also exhibited similar changes following in vitro treatment with norepinephrine, a superior cervical ganglia transmitter, or with an analog of cyclic AMP, a norepinephrine second messenger in this tissue. These findings are of significance in that they establish that the pineal-defining transcriptome is established prior to the neonatal period. Further, this work expands our knowledge of the biological process under neural control in this tissue and underlines the value of RNA sequencing in revealing how neurotransmission influences cell biology.
Also flagged:EN1mineralWNT16menopauseBglapTnfrsf11a
Journal Article2015-09-14No SnippetsZheng HF, Forgetta V, Hsu YH, Estrada K, Rosello-Diez A, Leo PJ, Dahia CL, Park-Min KH, Tobias JH, Kooperberg C, Kleinman A, Styrkarsdottir U, Liu CT, Uggla C, Evans DS, Nielson CM, Walter K, Pettersson-Kymmer U, McCarthy S, Eriksson J, Kwan T, Jhamai M, Trajanoska K, Memari Y, Min J, Huang J, Danecek P, Wilmot B, Li R, Chou WC, Mokry LE, Moayyeri A, Claussnitzer M, Cheng CH, Cheung W, Medina-Gómez C, Ge B, Chen SH, Choi K, Oei L, Fraser J, Kraaij R, Hibbs MA, Gregson CL, Paquette D, Hofman A, Wibom C, Tranah GJ, Marshall M, Gardiner BB, Cremin K, Auer P, Hsu L, Ring S, Tung JY, Thorleifsson G, Enneman AW, van Schoor NM, de Groot LC, van der Velde N, Melin B, Kemp JP, Christiansen C, Sayers A, Zhou Y, Calderari S, van Rooij J, Carlson C, Peters U, Berlivet S, Dostie J, Uitterlinden AG, Williams SR, Farber C, Grinberg D, LaCroix AZ, Haessler J, Chasman DI, Giulianini F, Rose LM, Ridker PM, Eisman JA, Nguyen TV, Center JR, Nogues X, Nogues X, Garcia-Giralt N, Launer LL, Gudnason V, Mellström D, Vandenput L, Amin N, van Duijn CM, Karlsson MK, Ljunggren Ö, Svensson O, Hallmans G, Rousseau F, Giroux S, Bussière J, Arp PP, Koromani F, Prince RL, Lewis JR, Langdahl BL, Hermann AP, Jensen JE, Kaptoge S, Khaw KT, Reeve J, Formosa MM, Xuereb-Anastasi A, Åkesson K, McGuigan FE, Garg G, Olmos JM, Zarrabeitia MT, Riancho JA, Ralston SH, Alonso N, Jiang X, Goltzman D, Pastinen T, Grundberg E, Gauguier D, Orwoll ES, Karasik D, Davey-Smith G, AOGC Consortium, Smith AV, Smith AV, Siggeirsdottir K, Harris TB, Zillikens MC, van Meurs JB, Thorsteinsdottir U, Maurano MT, Timpson NJ, Soranzo N, Durbin R, Wilson SG, Ntzani EE, Brown MA, Stefansson K, Hinds DA, Spector T, Cupples LA, Ohlsson C, Greenwood CM, UK10K Consortium, Jackson RD, Rowe DW, Loomis CA, Evans DM, Ackert-Bicknell CL, Joyner AL, Duncan EL, Kiel DP, Rivadeneira F, Richards JB.
Show Full Abstract
The extent to which low-frequency (minor allele frequency (MAF) between 1-5%) and rare (MAF ≤ 1%) variants contribute to complex traits and disease in the general population is mainly unknown. Bone mineral density (BMD) is highly heritable, a major predictor of osteoporotic fractures, and has been previously associated with common genetic variants, as well as rare, population-specific, coding variants. Here we identify novel non-coding genetic variants with large effects on BMD (ntotal = 53,236) and fracture (ntotal = 508,253) in individuals of European ancestry from the general population. Associations for BMD were derived from whole-genome sequencing (n = 2,882 from UK10K (ref. 10); a population-based genome sequencing consortium), whole-exome sequencing (n = 3,549), deep imputation of genotyped samples using a combined UK10K/1000 Genomes reference panel (n = 26,534), and de novo replication genotyping (n = 20,271). We identified a low-frequency non-coding variant near a novel locus, EN1, with an effect size fourfold larger than the mean of previously reported common variants for lumbar spine BMD (rs11692564(T), MAF = 1.6%, replication effect size = +0.20 s.d., Pmeta = 2 × 10(-14)), which was also associated with a decreased risk of fracture (odds ratio = 0.85; P = 2 × 10(-11); ncases = 98,742 and ncontrols = 409,511). Using an En1(cre/flox) mouse model, we observed that conditional loss of En1 results in low bone mass, probably as a consequence of high bone turnover. We also identified a novel low-frequency non-coding variant with large effects on BMD near WNT16 (rs148771817(T), MAF = 1.2%, replication effect size = +0.41 s.d., Pmeta = 1 × 10(-11)). In general, there was an excess of association signals arising from deleterious coding and conserved non-coding variants. These findings provide evidence that low-frequency non-coding variants have large effects on BMD and fracture, thereby providing rationale for whole-genome sequencing and improved imputation reference panels to study the genetic architecture of complex traits and disease in the general population.
Also flagged:LonAgeingcommunicable Diseaseobesitydiabetesneurodevelopmental disorders
Journal Article2015-09-14No SnippetsUK10K Consortium, Walter K, Min JL, Huang J, Crooks L, Memari Y, McCarthy S, Perry JR, Xu C, Futema M, Lawson D, Iotchkova V, Schiffels S, Hendricks AE, Danecek P, Li R, Floyd J, Wain LV, Barroso I, Humphries SE, Hurles ME, Zeggini E, Barrett JC, Plagnol V, Richards JB, Greenwood CM, Timpson NJ, Durbin R, Soranzo N.
Show Full Abstract
The contribution of rare and low-frequency variants to human traits is largely unexplored. Here we describe insights from sequencing whole genomes (low read depth, 7×) or exomes (high read depth, 80×) of nearly 10,000 individuals from population-based and disease collections. In extensively phenotyped cohorts we characterize over 24 million novel sequence variants, generate a highly accurate imputation reference panel and identify novel alleles associated with levels of triglycerides (APOB), adiponectin (ADIPOQ) and low-density lipoprotein cholesterol (LDLR and RGAG1) from single-marker and rare variant aggregation tests. We describe population structure and functional annotation of rare and low-frequency variants, use the data to estimate the benefits of sequencing for association studies, and summarize lessons from disease-specific collections. Finally, we make available an extensive resource, including individual-level genetic and phenotypic data and web-based tools to facilitate the exploration of association results.
Also flagged:Huntington diseaseHuntington's disorderHDgenetic diseasepolyglutamineSH3GL3
Journal Article2015-09-14✓ 5 SnippetsGopalakrishnan C, Kalsi N, Jethi S, Purohit R.
In-Text Gene Mentions
Abstract)
…Our research provided a propitious approach to understand the consequence of polyglutamination in Htt and its relation with HD.…
Abstract)
…encodes the huntingtin (Htt) protein.…
Abstract)
…Htt, along with its…
Abstract)
…interaction behavior betweenHtt(in three polyglutamine…
Abstract)
…states that isHtt0Q, 17Q and…
Show Full Abstract
Huntington's disorder (HD), caused by mutations of the IT-15 gene, is an autosomal genetic disease that causes the breakdown of the nerve cells in the brain. The IT-15 gene encodes the huntingtin (Htt) protein. Htt, along with its interacting partners, are involved in maintaining proper communication among neurons. Our work is based on the interaction behavior between Htt (in three polyglutamine (polyQ) states that is Htt 0Q, 17Q and 36Q) and SH3GL3 interacting protein by using computational methods. We used the HADDOCK docking platform to find out the extent of interaction between Htt polyQ models and SH3GL3. The Htt36Q (mutated) showed higher interaction than Htt17Q (native) with SH3GL3. Molecular dynamics simulation was performed to uncover the structural fluctuations of polyQ models and their complexes. RMSD, Rg, SASA, and total interaction energy graph showed significant results, where as mutant Htt showed higher fluctuations and flexibility than native Htt. The increase in the length of polyQ was found to affect the stability, flexibility, and compactness of the protein and its complex. Our research provided a propitious approach to understand the consequence of polyglutamination in Htt and its relation with HD.
Also flagged:nucleoside triphosphatesantibodiesoligonucleotidesnucleotidesbindingnucleic acids
Journal Article2015-09-14No SnippetsDiafa S, Hollenstein M.
Show Full Abstract
The enzymatic co-polymerization of modified nucleoside triphosphates (dN*TPs and N*TPs) is a versatile method for the expansion and exploration of expanded chemical space in SELEX and related combinatorial methods of in vitro selection. This strategy can be exploited to generate aptamers with improved or hitherto unknown properties. In this review, we discuss the nature of the functionalities appended to nucleoside triphosphates and their impact on selection experiments. The properties of the resulting modified aptamers will be described, particularly those integrated in the fields of biomolecular diagnostics, therapeutics, and in the expansion of genetic systems (XNAs).
Also flagged:FerritinMetabolic Syndromediabetescardiovascular diseaseneurodegenerative disorderschronic diseases
Journal Article2015-09-14✓ 2 SnippetsAvila F, Echeverría G, Pérez D, Martinez C, Strobel P, Castillo O, Villaroel L, Mezzano D, Rozowski J, Urquiaga I, Leighton F.
In-Text Gene Mentions
Discussion)
…not related tohemochromatosis.…
Discussion)
…mutation of theHFEgene, in Chilean…
Show Full Abstract
<h4>Background and aims</h4>Hyperferritinemia has been related with a wide spectrum of pathologies, including diabetes, cardiovascular disease, neurodegenerative disorders, and metabolic syndrome. The aim of this study was to investigate the association between hyperferritinemia and iron consumption.<h4>Methods and results</h4>Serum ferritin concentration was evaluated in 66 presumed healthy men, along with other clinical and biochemical markers of chronic diseases. A three-day food questionnaire was applied for nutrition information. Hyperferritinemia was a condition found in 13.4% of the volunteers analyzed. Significant correlations were found between serum ferritin concentration and metabolic syndrome parameters (HDL cholesterol, triglycerides, and fasting glucose) as well as an increase of the serum ferritin mean value with the number of risk factors of metabolic syndrome. Also, oxidative stress markers (carbonyl groups, AOPP, and glycated hemoglobin), hepatic damage markers (GGT, SGOT), and parameters related to insulin resistance (HOMA, blood insulin, and blood glucose) correlate significantly with serum ferritin. Volunteers had an excessive iron intake, principally by bread consumption. Analyses of food intake showed that red meat consumption correlates significantly with serum ferritin.<h4>Conclusion</h4>Red meat consumption, metabolic syndrome, and chronic disease markers are associated with hyperferritinemia in a population of Chilean men.
Purpose. Replacement of the diseased retinal pigment epithelium (RPE) with cells capable of performing the specialized functions of the RPE is the aim of cell replacement therapy for treatment of macular degenerative diseases. A storage method for RPE is likely to become a prerequisite for the establishment of such treatment. Herein, we analyze the effect of storage temperature on key functions of cultured RPE cells. Methods. Cultured ARPE-19 cells were stored in Minimum Essential Medium at 4°C, 16°C, and 37°C for seven days. Total RNA was isolated and the gene expression profile was determined using DNA microarrays. Comparison of the microarray expression values with qRT-PCR analysis of selected genes validated the results. Results. Expression levels of several key genes involved in phagocytosis, pigment synthesis, the visual cycle, adherens, and tight junctions, and glucose and ion transport were maintained close to control levels in cultures stored at 4°C and 16°C. Cultures stored at 37°C displayed regulational changes in a larger subset of genes related to phagocytosis, adherens, and tight junctions. Conclusion. RPE cultures stored at 4°C and 16°C for one week are capable of maintaining the expression levels of genes important for key RPE functions close to control levels.
…in two spots (antithrombin-III) in our reanalysis…
Results)
…Braoudaki et al.;antithrombin-IIIwas found to…
Results)
…Thus,antithrombin-IIIcould be another…
Show Full Abstract
In recent years the plasma proteomes of several different myelodysplastic syndrome (MDS) subgroups have been investigated and compared with those of healthy donors. However, the resulting data do not facilitate a direct and statistical comparison of the changes among the different MDS subgroups that would be useful for the selection and proposal of diagnostic biomarker candidates. The aim of this work was to identify plasma protein biomarker candidates for different MDS subgroups by reanalyzing the proteomic data of four MDS subgroups: refractory cytopenia with multilineage dysplasia (RCMD), refractory anemia or refractory anemia with ringed sideroblasts (RA-RARS), refractory anemia with excess blasts subtype 1 (RAEB-1), and refractory anemia with excess blasts subtype 2 (RAEB-2). Reanalysis of a total of 47 MDS patients revealed biomarker candidates, with alpha-2-HS-glycoprotein and leucine-rich alpha-2-glycoprotein as the most promising candidates.
Diabetes mellitus (DM) is a major worldwide health problem and its prevalence has been rapidly increasing in the last century. It is caused by defects in insulin secretion or insulin action or both, leading to hyperglycemia. Of the various types of DM, type 2 occurs most frequently. Multiple genes and their interactions are involved in the insulin secretion pathway. Insulin secretion is mediated through the ATP-sensitive potassium (KATP) channel in pancreatic beta cells. This channel is a heteromeric protein, composed of four inward-rectifier potassium ion channel (Kir6.2) tetramers, which form the pore of the KATP channel, as well as sulfonylurea receptor 1 subunits surrounding the pore. Kir6.2 is encoded by the potassium inwardly rectifying channel, subfamily J, member 11 (KCNJ11) gene, a member of the potassium channel genes. Numerous studies have reported the involvement of single nucleotide polymorphisms of the KCNJ11 gene and their interactions in the susceptibility to DM. This review discusses the current evidence for the contribution of common KCNJ11 genetic variants to the development of DM. Future studies should concentrate on understanding the exact role played by these risk variants in the development of DM.
Also flagged:dexamethasonefluoxetineglucoseinsulinIRgluconeogenesis
Journal Article2015-09-13No SnippetsLi T, Guo K, Qu W, Han Y, Wang S, Lin M, An S, Li X, Ma S, Wang T, Ji S, Hanson C, Fu J.
Show Full Abstract
<h4>Aim/introduction</h4>Both glucocorticoids and 5-hydroxytryptamine (5-HT) have been shown to induce insulin resistance (IR) in hepatocytes and adipocytes. Here, we explore whether there is a correlation between them.<h4>Materials and methods</h4>Except for the control group, male rats were exposed to dexamethasone treated with or without para-chlorophenylalanine (pCPA), or carbidopa for 20 days. Except for the control group, buffalo rat liver 3A (BRL-3A) cells were exposed to dexamethasone for 24 h, treated with or without pCPA, carbidopa, or clorgiline for 48 h, or exposed to 5-HT treated with or without fluoxetine for 48 h. Whole-body IR was determined by both glucose tolerance test and measurement of fasting blood glucose and insulin, whereas hepatocytes or adipocytes IR was determined by examining either hepatic gluconeogenesis, steatosis and glucose transporter 2 expression or lipolysis.<h4>Results</h4>Dexamethasone-induced whole-body IR, liver and intraabdominal adipose IR were accompanied by upregulated expressions of tryptophan hydroxylase-1 and aromatic amino acid decarboxylase with increased 5-HT level in both tissues, which were attenuated significantly by pCPA, inhibiting tryptophan hydroxylase-1, or carbidopa, inhibiting aromatic amino acid decarboxylase. [Correction added on 22 September 2015, after first online publication: 'inhibiting aromatic amino acid decarboxylase' was duplicated and has been replaced by 'tryptophan hydroxylase-1'.] In the BRL-3A cells, dexamethasone-induced IR was also accompanied by upregulated 5-HT synthesis in dose- and time-dependent manners, and was attenuated by pCPA or carbidopa, but exacerbated by clorgiline, inhibiting monoamine oxidase-A to further increase 5-HT level. Dexamethasone also enhanced 5-HT 2A and 2B receptor expressions in both tissues and BRL-3A cells. Additionally, blocking 5-HT transporter with fluoxetine significantly suppressed 5-HT-induced IR in BRL-3A cells.<h4>Conclusion</h4>Enhancement of 5-HT synthesis in liver and intra-abdominal adipose is an important reason for glucocorticoids-induced IR.
Also flagged:neurodegenerative diseasesamyotrophic lateral sclerosisALSdeathneurodegenerative diseaseHDAC6
Journal Article2015-09-12✓ 1 SnippetLee JY, Kawaguchi Y, Li M, Kapur M, Choi SJ, Kim HJ, Park SY, Zhu H, Yao TP.
In-Text Gene Mentions
Text
…Htt…
Show Full Abstract
Aberrant accumulation of protein aggregates is a pathological hallmark of many neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS). Although a buildup of protein aggregates frequently leads to cell death, whether it is the key pathogenic factor in driving neurodegenerative disease remains controversial. HDAC6, a cytosolic ubiquitin-binding deacetylase, has emerged as an important regulator of ubiquitin-dependent quality control autophagy, a lysosome-dependent degradative system responsible for the disposal of misfolded protein aggregates and damaged organelles. Here, we show that in cell models HDAC6 plays a protective role against multiple disease-associated and aggregation-prone cytosolic proteins by facilitating their degradation. We further show that HDAC6 is required for efficient localization of lysosomes to protein aggregates, indicating that lysosome targeting to autophagic substrates is regulated. Supporting a critical role of HDAC6 in protein aggregate disposal in vivo, genetic ablation of HDAC6 in a transgenic SOD1G93A mouse, a model of ALS, leads to dramatic accumulation of ubiquitinated SOD1G93A protein aggregates. Surprisingly, despite a robust buildup of SOD1G93A aggregates, deletion of HDAC6 only moderately modified the motor phenotypes. These findings indicate that SOD1G93A aggregation is not the only determining factor to drive neurodegeneration in ALS, and that HDAC6 likely modulates neurodegeneration through additional mechanisms beyond protein aggregate clearance.
Also flagged:TRIM39NFκBCactinposttranslational modificationsphosphorylationneddylation
Journal Article2015-09-12✓ 1 SnippetSuzuki M, Watanabe M, Nakamaru Y, Takagi D, Takahashi H, Fukuda S, Hatakeyama S.
In-Text Gene Mentions
Text
…TRIM38…
Show Full Abstract
NFκB is one of the central regulators of cell survival, immunity, inflammation, carcinogenesis and organogenesis. The activation of NFκB is strictly regulated by several posttranslational modifications including phosphorylation, neddylation and ubiquitination. Several types of ubiquitination play important roles in multi-step regulations of the NFκB pathway. Some of the tripartite motif-containing (TRIM) proteins functioning as E3 ubiquitin ligases are known to regulate various biological processes such as inflammatory signaling pathways. One of the TRIM family proteins, TRIM39, for which the gene has single nucleotide polymorphisms, has been identified as one of the genetic factors in Behcet's disease. However, the role of TRIM39 in inflammatory signaling had not been fully elucidated. In this study, to elucidate the function of TRIM39 in inflammatory signaling, we performed yeast two-hybrid screening using TRIM39 as a bait and identified Cactin, which has been reported to inhibit NFκB- and TLR-mediated transcriptions. We show that TRIM39 stabilizes Cactin protein and that Cactin is upregulated after TNFα stimulation. TRIM39 knockdown also causes activation of the NFκB signal. These findings suggest that TRIM39 negatively regulates the NFκB signal in collaboration with Cactin induced by inflammatory stimulants such as TNFα.
Also flagged:Membranesbasement membrane proteinsorganizationmembraneformationorgan growth
Journal Article2015-09-12✓ 1 SnippetClay MR, Sherwood DR.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
The nematode worm Caenorhabditis elegans has all the major basement membrane proteins found in vertebrates, usually with a smaller gene family encoding each component. With its powerful forward genetics, optical clarity, simple tissue organization, and the capability to functionally tag most basement membrane components with fluorescent proteins, C. elegans has facilitated novel insights into the assembly and function of basement membranes. Although basement membranes are generally thought of as static structures, studies in C. elegans have revealed their active properties and essential functions in tissue formation and maintenance. Here, we review discoveries from C. elegans development that highlight dynamic aspects of basement membrane assembly, function, and regulation during organ growth, tissue polarity, cell migration, cell invasion, and tissue attachment. These studies have helped transform our view of basement membranes from static support structures to dynamic scaffoldings that play broad roles in regulating tissue organization and cellular behavior that are essential for development and have important implications in human diseases.
…These findings suggest that PRDX6 may serve as a biomarker for TBI and that autoimmune profiling is a viable strategy for the discovery of novel TBI biomarkers.…
Abstract)
…PRDX6), as a target for autoantibodies evoked in response to traumatic brain injury…
Introduction)
…PRDX6 may contribute to a biomarker signature for acute mild brain injury…
Results)
…PRDX6 in microglia and neurons (not shown) confirmed that PRDX6 is primarily expressed by brain astrocytes. Figure 2 depicts the discovery of PRDX6 as a protein reactive with autoantibodies induced by brain injury…
Results)
…PRDX6) is highly expressed in astrocytes in rat cerebral cortex and up-regulated following traumatic brain injury…
Show Full Abstract
Autoimmune profiling in rats revealed the antioxidant enzyme, peroxiredoxin 6 (PRDX6), as a target for autoantibodies evoked in response to traumatic brain injury (TBI). Consistent with this proposal, immunohistochemical analysis of rat cerebral cortex demonstrated that PRDX6 is highly expressed in the perivascular space, presumably contained within astrocytic foot processes. Accordingly, an immunosorbent electrochemiluminescence assay was developed for investigating PRDX6 in human samples. PRDX6 was found to be measurable in human blood and highly expressed in human cerebral cortex and platelets. Circulating levels of PRDX6 were elevated fourfold over control values 4 to 24 h following mild-to-moderate TBI. These findings suggest that PRDX6 may serve as a biomarker for TBI and that autoimmune profiling is a viable strategy for the discovery of novel TBI biomarkers.
Also flagged:LGR5ASCL2EPHB2colorectal cancersadenomasReverse transcription
Journal Article2015-09-11✓ 3 SnippetsJang BG, Kim HS, Kim KJ, Rhee YY, Kim WH, Kang GH.
In-Text Gene Mentions
Abstract)
…Notably, in traditional serrated adenomas, expression of LGR5 and ASCL2 was localized to the ectopic crypts as in the normal crypts, but expression of EPHB2 and OLFM4 was distributed in a diffuse manner, which is suggestive of a progenitor-like features.<h4>Conclusions</h4>The expression and distribution profile of ISC markers possibly provides insights into the organization of stem and progenitor-like cells in each type of precancerous lesion of CRC.…
Abstract)
…ASCL2, EPHB2 andOLFM4, and their clinical…
Abstract)
…of EPHB2 andOLFM4was distributed in…
Show Full Abstract
<h4>Aims</h4>Intestinal stem cell (ISC) markers such as LGR5, ASCL2, EPHB2 and OLFM4, and their clinical implications have been studied extensively in colorectal cancers (CRCs). However, little is known about their expression in precancerous lesions of CRCs. Here, we investigated the expression and distribution of ISC markers in serrated polyps and conventional adenomas.<h4>Methods and results</h4>Reverse transcription-polymerase chain reaction (RT-PCR) analysis revealed that all ISC markers were up-regulated significantly in conventional adenomas with low-grade dysplasia (CALGs) compared with other lesions. RNA in-situ hybridization confirmed that CALGs exhibited strong and diffuse expression of all ISC markers, which indicate a stem cell-like phenotype. However, normal colonic mucosa, hyperplastic polyps and sessile serrated adenomas harboured LGR5(+) cells that were confined to the crypt base and demonstrated an organized expression of ISC markers. Notably, in traditional serrated adenomas, expression of LGR5 and ASCL2 was localized to the ectopic crypts as in the normal crypts, but expression of EPHB2 and OLFM4 was distributed in a diffuse manner, which is suggestive of a progenitor-like features.<h4>Conclusions</h4>The expression and distribution profile of ISC markers possibly provides insights into the organization of stem and progenitor-like cells in each type of precancerous lesion of CRC.
Also flagged:IDUAWNT16PhosphorylationMineralosteoporosispost-translational modification
Journal Article2015-09-11No SnippetsNiu T, Liu N, Yu X, Zhao M, Choi HJ, Leo PJ, Brown MA, Zhang L, Pei YF, Shen H, He H, Fu X, Lu S, Chen XD, Tan LJ, Yang TL, Guo Y, Cho NH, Shen J, Guo YF, Nicholson GC, Prince RL, Eisman JA, Jones G, Sambrook PN, Tian Q, Zhu XZ, Papasian CJ, Duncan EL, Uitterlinden AG, Shin CS, Xiang S, Deng HW.
Show Full Abstract
Protein phosphorylation regulates a wide variety of cellular processes. Thus, we hypothesize that single-nucleotide polymorphisms (SNPs) that may modulate protein phosphorylation could affect osteoporosis risk. Based on a previous conventional genome-wide association (GWA) study, we conducted a three-stage meta-analysis targeting phosphorylation-related SNPs (phosSNPs) for femoral neck (FN)-bone mineral density (BMD), total hip (HIP)-BMD, and lumbar spine (LS)-BMD phenotypes. In stage 1, 9593 phosSNPs were meta-analyzed in 11,140 individuals of various ancestries. Genome-wide significance (GWS) and suggestive significance were defined by α = 5.21 × 10(-6) (0.05/9593) and 1.00 × 10(-4), respectively. In stage 2, nine stage 1-discovered phosSNPs (based on α = 1.00 × 10(-4)) were in silico meta-analyzed in Dutch, Korean, and Australian cohorts. In stage 3, four phosSNPs that replicated in stage 2 (based on α = 5.56 × 10(-3), 0.05/9) were de novo genotyped in two independent cohorts. IDUA rs3755955 and rs6831280, and WNT16 rs2707466 were associated with BMD phenotypes in each respective stage, and in three stages combined, achieving GWS for both FN-BMD (p = 8.36 × 10(-10), p = 5.26 × 10(-10), and p = 3.01 × 10(-10), respectively) and HIP-BMD (p = 3.26 × 10(-6), p = 1.97 × 10(-6), and p = 1.63 × 10(-12), respectively). Although in vitro studies demonstrated no differences in expressions of wild-type and mutant forms of IDUA and WNT16B proteins, in silico analyses predicts that WNT16 rs2707466 directly abolishes a phosphorylation site, which could cause a deleterious effect on WNT16 protein, and that IDUA phosSNPs rs3755955 and rs6831280 could exert indirect effects on nearby phosphorylation sites. Further studies will be required to determine the detailed and specific molecular effects of these BMD-associated non-synonymous variants.
Also flagged:GSK3βosteoporosisAspartic acid oligopeptideshydroxyapatitemineralaspartic acid
Journal Article2015-09-11No SnippetsLow SA, Galliford CV, Yang J, Low PS, Kopeček J.
Show Full Abstract
Bone fractures constitute a major cause of morbidity and mortality especially in the elderly. Complications associated with osteoporosis drugs and the age of the patient slow bone turnover and render such fractures difficult to heal. Increasing the speed of fracture repair by administration of a fracture-targeted bone anabolic agent could find considerable application. Aspartic acid oligopeptides are negatively charged molecules at physiological pH that adsorb to hydroxyapatite, the mineral portion of bone. This general adsorption is the strongest where bone turnover is highest or where hydroxyapatite is freshly exposed. Importantly, both of these conditions are prominent at fracture sites. GSK3β inhibitors are potent anabolic agents that can promote tissue repair when concentrated in a damaged tissue. Unfortunately, they can also cause significant toxicity when administered systemically and are furthermore difficult to deliver due to their strong hydrophobicity. In this paper, we solve both problems by conjugating the hydrophobic GSK3β inhibitor to a hydrophilic aspartic acid octapeptide using a hydrolyzable bond, thereby generating a bone fracture-targeted water-soluble form of the drug. The resulting amphiphile is shown to assemble into micelles, extending its circulation time while maintaining its fracture-targeting abilities. For measurement of pharmacokinetics, an 125I was introduced at the location of the bromine in the GSK3β inhibitor to minimize any structural differences. Biodistribution studies demonstrate a greater than 4-fold increase in fracture accumulation over healthy bone.
BMP-SMAD signalling plays a crucial role in numerous biological processes including embryonic development and iron homeostasis. Dysregulation of the iron-regulatory hormone hepcidin is associated with many clinical iron-related disorders. We hypothesised that molecules which mediate BMP-SMAD signalling play important roles in the regulation of iron homeostasis and variants in these proteins may be potential genetic modifiers of iron-related diseases. We examined the role of endofin, a SMAD anchor, and show that knockdown of endofin in liver cells inhibits basal and BMP-induced hepcidin expression along with other BMP-regulated genes, ID1 and SMAD7. We show for the first time, the in situ interaction of endofin with SMAD proteins and significantly reduced SMAD phosphorylation with endofin knockdown, suggesting that endofin modulates hepcidin through BMP-SMAD signalling. Characterisation of naturally occurring SNPs show that mutations in the conserved FYVE domain result in mislocalisation of endofin, potentially affecting downstream signalling and modulating hepcidin expression. In conclusion, we have identified a hitherto unrecognised link, endofin, between the BMP-SMAD signalling pathway, and the regulation of hepcidin expression and iron homeostasis. This study further defines the molecular network involved in iron regulation and provides potential targets for the treatment of iron-related disorders.
Also flagged:FGFfibroblast growth factorsFGFsembryo developmentOct3Pou5f1
Journal Article2015-09-11✓ 2 SnippetsMak SS, Alev C, Nagai H, Wrabel A, Matsuoka Y, Honda A, Sheng G, Ladher RK.
In-Text Gene Mentions
Results)
…ByEGK-VIII, formation of an…
Results)
…either EGK-VI orEGK-VIII.…
Show Full Abstract
Innate pluripotency of mouse embryos transits from naive to primed state as the inner cell mass differentiates into epiblast. In vitro, their counterparts are embryonic (ESCs) and epiblast stem cells (EpiSCs), respectively. Activation of the FGF signaling cascade results in mouse ESCs differentiating into mEpiSCs, indicative of its requirement in the shift between these states. However, only mouse ESCs correspond to the naive state; ESCs from other mammals and from chick show primed state characteristics. Thus, the significance of the naive state is unclear. In this study, we use zebra finch as a model for comparative ESC studies. The finch blastoderm has mESC-like properties, while chick blastoderm exhibits EpiSC features. In the absence of FGF signaling, finch cells retained expression of pluripotent markers, which were lost in cells from chick or aged finch epiblasts. Our data suggest that the naive state of pluripotency is evolutionarily conserved among amniotes.
Also flagged:α-SynucleinNeuroactive-Ligand Receptorneurodegenerative disorderdeathLewy bodiesPD
Journal Article2015-09-11No SnippetsKong Y, Liang X, Liu L, Zhang D, Wan C, Gan Z, Yuan L.
Show Full Abstract
Parkinson's disease (PD) is a prevalent neurodegenerative disorder with pathological features including death of dopaminergic neurons in the substantia nigra and intraneuronal accumulations of Lewy bodies. As the main component of Lewy bodies, α-synuclein is implicated in PD pathogenesis by aggregation into insoluble filaments. However, the detailed mechanisms underlying α-synuclein induced neurotoxicity in PD are still elusive. MicroRNAs are ~20nt small RNA molecules that fine-tune gene expression at posttranscriptional level. A plethora of miRNAs have been found to be dysregulated in the brain and blood cells of PD patients. Nevertheless, the detailed mechanisms and their in vivo functions in PD still need further investigation. By using Drosophila PD model expressing α-synuclein A30P, we examined brain miRNA expression with high-throughput small RNA sequencing technology. We found that five miRNAs (dme-miR-133-3p, dme-miR-137-3p, dme-miR-13b-3p, dme-miR-932-5p, dme-miR-1008-5p) were upregulated in PD flies. Among them, miR-13b, miR-133, miR-137 are brain enriched and highly conserved from Drosophila to humans. KEGG pathway analysis using DIANA miR-Path demonstrated that neuroactive-ligand receptor interaction pathway was most likely affected by these miRNAs. Interestingly, miR-137 was predicted to regulate most of the identified targets in this pathway, including dopamine receptor (DopR, D2R), γ-aminobutyric acid (GABA) receptor (GABA-B-R1, GABA-B-R3) and N-methyl-D-aspartate (NMDA) receptor (Nmdar2). The validation experiments showed that the expression of miR-137 and its targets was negatively correlated in PD flies. Further experiments using luciferase reporter assay confirmed that miR-137 could act on specific sites in 3' UTR region of D2R, Nmdar2 and GABA-B-R3, which downregulated significantly in PD flies. Collectively, our findings indicate that α-synuclein could induce the dysregulation of miRNAs, which target neuroactive ligand-receptor interaction pathway in vivo. We believe it will help us further understand the contribution of miRNAs to α-synuclein neurotoxicity and provide new insights into the pathogenesis driving PD.
Also flagged:membraneendoplasmic reticulumsecretionchaperonescytosolproteasome
Journal Article2015-09-11No SnippetsHe K, Ravindran MS, Tsai B.
Show Full Abstract
A dedicated network of cellular factors ensures that proteins translocated into the endoplasmic reticulum (ER) are folded correctly before they exit this compartment en route to other cellular destinations or for secretion. When proteins misfold, selective ER-resident enzymes and chaperones are recruited to rectify the protein-misfolding problem in order to maintain cellular proteostasis. However, when a protein becomes terminally misfolded, it is ejected into the cytosol and degraded by the proteasome via a pathway called ER-associated degradation (ERAD). Strikingly, toxins and viruses can hijack elements of the ERAD pathway to access the host cytosol and cause infection. This review focuses on emerging data illuminating the molecular mechanisms by which these toxic agents co-opt the ER-to-cytosol translocation process to cause disease.
Also flagged:phenothiazinedibenzazepinetricyclicscanceraminebehavioral
Journal Article2015-09-11No SnippetsKastrinsky DB, Sangodkar J, Zaware N, Izadmehr S, Dhawan NS, Narla G, Ohlmeyer M.
Show Full Abstract
The phenothiazine and dibenzazepine tricyclics are potent neurotropic drugs with a documented but underutilized anti-cancer side effect. Reengineering these agents (TFP, CPZ, CIP) by replacing the basic amine with a neutral polar functional group (e.g., RTC-1, RTC-2) abrogated their CNS effects as demonstrated by in vitro pharmacological assays and in vivo behavioral models. Further optimization generated several phenothiazines and dibenzazepines with improved anti-cancer potency, exemplified by RTC-5. This new lead demonstrated efficacy against a xenograft model of an EGFR driven cancer without the neurotropic effects exhibited by the parent molecules. Its effects were attributed to concomitant negative regulation of PI3K-AKT and RAS-ERK signaling.
Also flagged:cell divisionDNA polymerasereplication forkscell cyclechromatingene expression
Journal Article2015-09-11No SnippetsKhurana S, Oberdoerffer P.
Show Full Abstract
DNA replication is essential for cell division. Challenges to the progression of DNA polymerase can result in replication stress, promoting the stalling and ultimately collapse of replication forks. The latter involves the formation of DNA double-strand breaks (DSBs) and has been linked to both genome instability and irreversible cell cycle arrest (senescence). Recent technological advances have elucidated many of the factors that contribute to the sensing and repair of stalled or broken replication forks. In addition to bona fide repair factors, these efforts highlight a range of chromatin-associated changes at and near sites of replication stress, suggesting defects in epigenome maintenance as a potential outcome of aberrant DNA replication. Here, we will summarize recent insight into replication stress-induced chromatin-reorganization and will speculate on possible adverse effects for gene expression, nuclear integrity and, ultimately, cell function.
Also flagged:ERKautophagyeuropiumhydroxidetrehaloseneurodegenerative diseases
Journal Article2015-09-11No SnippetsWei PF, Jin PP, Barui AK, Hu Y, Zhang L, Zhang JQ, Shi SS, Zhang HR, Lin J, Zhou W, Zhang YJ, Ruan RQ, Patra CR, Wen LP.
Show Full Abstract
Accelerating the clearance of intracellular protein aggregates through elevation of autophagy represents a viable approach for the treatment of neurodegenerative diseases. In our earlier report, we have demonstrated the enhanced degradation of mutant huntingtin protein aggregates through autophagy process induced by europium hydroxide nanorods [EHNs: Eu(III)(OH)3], but the underlying molecular mechanism of EHNs mediated autophagy was unclear. The present report reveals that EHNs induced autophagy does not follow the classical AKT-mTOR and AMPK signaling pathways. The inhibition of ERK1/2 phosphorylation using the specific MEK inhibitor U0126 partially abrogates the autophagy as well as the clearance of mutant huntingtin protein aggregates mediated by EHNs suggesting that nanorods stimulate the activation of MEK/ERK1/2 signaling pathway during autophagy process. In contrast, another mTOR-independent autophagy inducer trehalose has been found to induce autophagy without activating ERK1/2 signaling pathway. Interestingly, the combined treatment of EHNs and trehalose leads to more degradation of mutant huntingtin protein aggregates than that obtained with single treatment of either nanorods or trehalose. Our results demonstrate the rational that further enhanced clearance of intracellular protein aggregates, needed for diverse neurodegenerative diseases, may be achieved through the combined treatment of two or more autophagy inducers, which stimulate autophagy through different signaling pathways.
Also flagged:SRYbindingfungicidevinclozolinmethylationChromatin
Journal Article2015-09-11No SnippetsSkinner MK, Bhandari RK, Haque MM, Nilsson EE.
Show Full Abstract
A critical transcription factor required for mammalian male sex determination is SRY (sex determining region on the Y chromosome). The expression of SRY in precursor Sertoli cells is one of the initial events in testis development. The current study was designed to determine the impact of environmentally induced epigenetic transgenerational inheritance on SRY binding during gonadal sex determination in the male. The agricultural fungicide vinclozolin and vehicle control (DMSO) exposed gestating females (F0 generation) during gonadal sex determination promoted the transgenerational inheritance of differential DNA methylation in sperm of the F3 generation (great grand-offspring). The fetal gonads in F3 generation males were used to identify potential alterations in SRY binding sites in the developing Sertoli cells. Chromatin immunoprecipitation with an SRY antibody followed by genome-wide promoter tiling array (ChIP-Chip) was used to identify alterations in SRY binding. A total of 81 adjacent oligonucleotide sites and 173 single oligo SRY binding sites were identified to be altered transgenerationally in the Sertoli cell vinclozolin lineage F3 generation males. Observations demonstrate the majority of the previously identified normal SRY binding sites were not altered and the altered SRY binding sites were novel and new additional sites. The chromosomal locations, gene associations and potentially modified cellular pathways were investigated. In summary, environmentally induced epigenetic transgenerational inheritance of germline epimutations appears to alter the cellular differentiation and development of the precursor Sertoli cell SRY binding during gonadal sex determination that influence the developmental origins of adult onset testis disease.
Also flagged:sodium sulfateAD-3AD-2AD-1amine groupstrichloroacetic acid
Journal Article2015-09-11✓ 1 SnippetLi G, Zheng W, Chen Z, Zhou Y, Liu Y, Yang J, Huang Y, Li X.
In-Text Gene Mentions
I A O 0000326)
…DCC…
Show Full Abstract
We report a method for the preparation and selection of DNA-encoded dynamic libraries (DEDLs). The library is composed of two sets of DNA-linked small molecules that are under dynamic exchange through DNA hybridization. Addition of the protein target shifted the equilibrium, favouring the assembly of high affinity bivalent binders. Notably, we introduced a novel locking mechanism to stop the dynamic exchange and "freeze" the equilibrium, thereby enabling downstream hit isolation and decoding by PCR amplification and DNA sequencing. Our DEDL approach has circumvented the limitation of library size and realized the analysis and selection of large dynamic libraries. In addition, this method also eliminates the requirement for modified and immobilized target proteins.
…romatosis-associated protein (HFE), hepcidin, ferritin and…
Abstract)
…In iron deficiency,HFEand FPN were…
Abstract)
…of FPN andHFE; and (ii) for…
Show Full Abstract
<h4>New findings</h4>What is the central question of this study? The aim was to explore the role and hitherto unclear mechanisms of action of iron proteins in protecting the lung against the harmful effects of iron accumulation and the ability of pulmonary cells to mobilize iron in iron deficiency. What is the main finding and its importance? We show that pulmonary hepcidin appears not to modify cellular iron mobilization in the lung. We propose pathways for supplying iron to the lung in iron deficiency and for protecting the lung against iron excess in iron overload, mediated by the co-ordinated action of iron proteins, such as divalent metal transporter 1, ZRT-IRE-like-protein 14, transferrin receptor, ferritin, haemochromatosis-associated protein and ferroportin. Iron dyshomeostasis is associated with several forms of chronic lung disease, but its mechanisms of action remain to be elucidated. The aim of the present study was to determine the role of the lung in whole-animal models with iron deficiency and iron overload, studying the divalent metal transporter 1 (DMT1), ZRT-IRE-like protein 14 (ZIP14), transferrin receptor (TfR), haemochromatosis-associated protein (HFE), hepcidin, ferritin and ferroportin (FPN) expression. In each model, adult CF1 mice were divided into the following groups (six mice per group): (i) iron-overload model, iron saccharate i.p. and control group (iron adequate), 0.9% NaCl i.p.; and (ii) iron-deficiency model, induced by repeated bleeding, and control group (sham operated). Proteins were assessed by immunohistochemistry and Western blot. In control mice, DMT1 was localized in the cytoplasm of airway cells, and in iron deficiency and overload it was in the apical membrane. Divalent metal transporter 1 and TfR increased in iron deficiency, without changes in iron overload. ZRT-IRE-like protein 14 decreased in airway cells in iron deficiency and increased in iron overload. In iron deficiency, HFE and FPN were immunolocalized close to the apical membrane. Ferroportin increased in iron overload. Prohepcidin was present in control groups, with no changes in iron deficiency and iron overload. In iron overload, ferritin showed intracytoplasmic localization close to the apical membrane of airway cells and intense immunostaining in macrophage-like cells. The results show that pulmonary hepcidin does not appear to modify cellular iron mobilization in the lung. We propose the following two novel pathways in the lung: (i) for supplying iron in iron deficiency, mediated principally by DMT1 and TfR and regulated by the action of FPN and HFE; and (ii) for iron detoxification in order to protect the lung against iron overload, facilitated by the action of DMT1, ZIP14, FPN and ferritin.
Venous thrombosis (VT) is a common multifactorial disease with a genetic component that was first suspected nearly 60 years ago. In this review, we document the genetic determinants of the disease, and update recent findings delivered by the application of high-throughput genotyping and sequencing technologies. To date, 17 genes have been robustly demonstrated to harbour genetic variations associated with VT risk: ABO, F2, F5, F9, F11, FGG, GP6, KNG1, PROC, PROCR, PROS1, SERPINC1, SLC44A2, STXBP5, THBD, TSPAN15 and VWF. The common polymorphisms are estimated to account only for a modest part (~5 %) of the VT heritability. Much remains to be done to fully disentangle the exact genetic (and epigenetic) architecture of the disease. A large suite of powerful tools and research strategies can be deployed on the large collections of patients that have already been assembled (and additional are ongoing).
Also flagged:Bcl-2/E1B 19-kDa interacting proteinmitochondrialHuntington's diseaseHDneurodegenerative disorder
Journal Article2015-09-10✓ 5 SnippetsSassone F, Margulets V, Maraschi A, Rodighiero S, Passafaro M, Silani V, Ciammola A, Kirshenbaum LA, Sassone J.
In-Text Gene Mentions
Abstract)
…Hence, our results suggest that changes in mitochondrial morphology and transmembrane potential, induced by mutant htt protein, are dependent and linked to BNip3 and not to Bax/Bak activation.…
Abstract)
…Huntington's disease (HD) is a neurodegenerative disorder caused by the expansion of a CAG repeat in the IT15 gene that encodes the protein huntingtin (htt).…
Abstract)
…These results provide new compelling evidence that underlies the molecular mechanisms by which mutant htt causes mitochondrial dysfunction and cell death, suggesting BNip3 as a potential target for HD therapy.…
Abstract)
…the protein huntingtin (htt).…
Abstract)
…shows that mutanthttcauses mitochondrial depolariz…
Show Full Abstract
Huntington's disease (HD) is a neurodegenerative disorder caused by the expansion of a CAG repeat in the IT15 gene that encodes the protein huntingtin (htt). Evidence shows that mutant htt causes mitochondrial depolarization and fragmentation, but the underlying molecular mechanism has yet to be clarified. Bax/Bak and BNip3 are pro-apoptotic members of the Bcl-2 family protein whose activation triggers mitochondrial depolarization and fragmentation inducing cell death. Evidence suggests that Bax/Bak and BNip3 undergo activation upon mutant htt expression but whether these proteins are required for mitochondrial depolarization and fragmentation induced by mutant htt is unclear. Our results show that BNip3 knock-out cells are protected from mitochondrial damage and cell death induced by mutant htt whereas Bax/Bak knock-out cells are not. Moreover, deletion of BNip3 C-terminal transmembrane domain, required for mitochondrial targeting, suppresses mitochondrial depolarization and fragmentation in a cell culture model of HD. Hence, our results suggest that changes in mitochondrial morphology and transmembrane potential, induced by mutant htt protein, are dependent and linked to BNip3 and not to Bax/Bak activation. These results provide new compelling evidence that underlies the molecular mechanisms by which mutant htt causes mitochondrial dysfunction and cell death, suggesting BNip3 as a potential target for HD therapy.
Also flagged:tannic acidinfectionsrhabdoviral infectionspeptidevirionsviral infections
Journal Article2015-09-10No SnippetsEstepa A, Coll J.
Show Full Abstract
While exploring the molecular mechanisms behind the fin hemorrhages that follow zebrafish (Danio rerio) early infection with viral haemorrhagic septicemia virus (VHSV), we discovered that most serpin (serine protease inhibitor) gene transcripts were upregulated, except those of serpine1. Surprisingly, only SERPINe1-derived 14-mer peptide and low molecular weight drugs targeting SERPINe1 (i.e. tannic acid, EGCG, tiplaxtinin) inhibited in vitro infections not only of VHSV, but also of other fish rhabdoviruses such as infectious hematopoietic necrosis virus (IHNV) and spring viremia carp virus (SVCV). While the mechanisms that inhibited rhabdoviral infections remain speculative, these and other results suggested that SERPINEe1-derived peptide specifically targeted viral infectivity rather than virions. Practical applications might be developed from these studies since preliminary evidences showed that tannic acid could be used to reduce VHSV-caused mortalities. These studies are an example of how the identification of host genes targeted by viral infections using microarrays might facilitate the identification of novel prevention drugs in aquaculture and illuminate viral infection mechanisms.
Also flagged:methylationovarian cancerepithelial ovarian cancerNF3cancerCC
Journal Article2015-09-10No SnippetsEarp MA, Cunningham JM.
Show Full Abstract
Survival after a diagnosis of ovarian cancer has not improved, and despite histological differences, treatment is similar for all cases. Understanding the molecular basis for ovarian cancer risk and prognosis is fundamental, and to this end much has been gleaned about genetic changes contributing to risk, and to a lesser extent, survival. There's considerable evidence for genetic differences between the four pathologically defined histological subtypes; however, the contribution of epigenetics is less well documented. In this report, we review alterations in DNA methylation in ovarian cancer, focusing on histological subtypes, and studies examining the roles of methylation in determining therapy response. As epigenetics is making its way into clinical care, we review the application of cell free DNA methylation to ovarian cancer diagnosis and care. Finally, we comment on recurrent limitations in the DNA methylation literature for ovarian cancer, which can and should be addressed to mature this field.
Also flagged:brain diseasesschizophreniaautismepilepsyParvalbuminSomatostatin
Journal Article2015-09-10✓ 1 SnippetAhn S, Kim TG, Kim KS, Chung S.
In-Text Gene Mentions
Text
…Sox6…
Show Full Abstract
Human pluripotent stem cells (PSCs) represent an opportunity to study human development in vitro, to model diseases in a dish, to screen drugs as well as to provide an unlimited and ethically unimpeded source of therapeutic cells. Cortical GABAergic interneurons, which are generated from Medial Ganglionic Eminence (MGE) cells and Caudal Ganglionic Eminence (CGE) cells during embryonic development, regulate cortical neural networks by providing inhibitory inputs. Their malfunction, resulting in failure to intricately regulate neural circuit balance, has been implicated in brain diseases, such as schizophrenia, autism and epilepsy. In this study, using combinatorial and temporal modulation of developmentally relevant dorsoventral and rostrocaudal signaling pathways, we efficiently generated MGE cells vs. CGE cells from human PSCs, which predominantly generate Parvalbumin-expressing or Somatostatin-expressing interneurons vs. Calretinin-expressing interneurons, respectively. Efficient generation of specific differentiated progenies of hPSCs as shown in this study will be a pivotal step to realize the full potential of hPSCs for regenerative medicine, developmental studies, disease modeling, bioassay, and drug screening.
Also flagged:MAP4KMst-like KinasesHippo kinasekinasetranscriptional coactivatorTAZ
Journal Article2015-09-10✓ 1 SnippetZheng Y, Wang W, Liu B, Deng H, Uster E, Pan D.
In-Text Gene Mentions
Text
…TAOK3…
Show Full Abstract
In Drosophila and mammals, the canonical Hippo kinase cascade is mediated by Hpo/Mst acting through the intermediary kinase Wts/Lats to phosphorylate the transcriptional coactivator Yki/YAP/TAZ. Despite recent reports linking Yki/YAP/TAZ activity to the actin cytoskeleton, the underlying mechanisms are poorly understood and/or controversial. Using Drosophila imaginal discs as an in vivo model, we show that Wts, but not Hpo, is genetically indispensable for cytoskeleton-mediated subcellular localization of Yki. Through a systematic screen, we identify the Ste-20 kinase Happyhour (Hppy) and its mammalian counterpart MAP4K1/2/3/5 as an alternative kinase that phosphorylates the hydrophobic motif of Wts/Lats in a similar manner as Hpo/Mst. Consistent with their redundant function as activating kinases of Wts/Lats, combined loss of Hpo/Mst and Hppy/MAP4K abolishes cytoskeleton-mediated regulation of Yki/YAP subcellular localization, as well as YAP cytoplasmic translocation induced by contact inhibition. These Hpo/Mst-like kinases provide an expanded view of the Hippo kinase cascade in development and physiology.
Also flagged:Hereditary hemochromatosisHHgenetic disorderironliver cirrhosishepatocellular carcinoma
Journal Article2015-09-10✓ 5 SnippetsGallego CJ, Burt A, Sundaresan AS, Ye Z, Shaw C, Crosslin DR, Crane PK, Fullerton SM, Hansen K, Carrell D, Kuivaniemi H, Derr K, de Andrade M, McCarty CA, Kitchner TE, Ragon BK, Stallings SC, Papa G, Bochenek J, Smith ME, Aufox SA, Pacheco JA, Patel V, Friesema EM, Erwin AL, Gottesman O, Gerhard GS, Ritchie M, Motulsky AG, Kullo IJ, Larson EB, Tromp G, Brilliant MH, Bottinger E, Denny JC, Roden DM, Williams MS, Jarvik GP.
In-Text Gene Mentions
Abstract)
…The diagnostic rate of HH in males was 24.4% for p.Cys282Tyr homozygotes and 3.5% for compound heterozygotes (p < 0.001); in females, it was 14.0% for p.Cys282Tyr homozygotes and 2.3% for compound heterozygotes (p < 0.001).…
Title)
…Penetrance of Hemochromatosis in HFE Genotypes Resulting in p.Cys282Tyr and p.[Cys282Tyr];[His63Asp] in the eMERGE Network.…
Abstract)
…We used the eMERGE Network, a multicenter cohort with genotype data linked to electronic medical records, to estimate the diagnostic rate and clinical penetrance of HH in 98 individuals homozygous for the variant coding for HFE p.Cys282Tyr and 397 compound heterozygotes with variants resulting in p.[His63Asp];[Cys282Tyr].…
Introduction)
…Several other hemochromatosis-associated pathogenic variants in HFE have been described, as well as variants in genes other than HFE (e.g., HJV [MIM: 608374], HAMP [MIM: 606464], and TFR2 [MIM: 604720]), but these are rare.5,6…
Introduction)
…2 Variants inHFE(MIM: 613609 ;…
Show Full Abstract
Hereditary hemochromatosis (HH) is a common autosomal-recessive disorder associated with pathogenic HFE variants, most commonly those resulting in p.Cys282Tyr and p.His63Asp. Recommendations on returning incidental findings of HFE variants in individuals undergoing genome-scale sequencing should be informed by penetrance estimates of HH in unselected samples. We used the eMERGE Network, a multicenter cohort with genotype data linked to electronic medical records, to estimate the diagnostic rate and clinical penetrance of HH in 98 individuals homozygous for the variant coding for HFE p.Cys282Tyr and 397 compound heterozygotes with variants resulting in p.[His63Asp];[Cys282Tyr]. The diagnostic rate of HH in males was 24.4% for p.Cys282Tyr homozygotes and 3.5% for compound heterozygotes (p < 0.001); in females, it was 14.0% for p.Cys282Tyr homozygotes and 2.3% for compound heterozygotes (p < 0.001). Only males showed differences across genotypes in transferrin saturation levels (100% of homozygotes versus 37.5% of compound heterozygotes with transferrin saturation > 50%; p = 0.003), serum ferritin levels (77.8% versus 33.3% with serum ferritin > 300 ng/ml; p = 0.006), and diabetes (44.7% versus 28.0%; p = 0.03). No differences were found in the prevalence of heart disease, arthritis, or liver disease, except for the rate of liver biopsy (10.9% versus 1.8% [p = 0.013] in males; 9.1% versus 2% [p = 0.035] in females). Given the higher rate of HH diagnosis than in prior studies, the high penetrance of iron overload, and the frequency of at-risk genotypes, in addition to other suggested actionable adult-onset genetic conditions, opportunistic screening should be considered for p.[Cys282Tyr];[Cys282Tyr] individuals with existing genomic data.
Also flagged:forksreplisometo forkG9areplication forksreplication checkpoint
Journal Article2015-09-10✓ 3 SnippetsDungrawala H, Rose KL, Bhat KP, Mohni KN, Glick GG, Couch FB, Cortez D.
In-Text Gene Mentions
Abstract)
…we demonstrate thatZNF644complexes with the…
Text
…ZNF644…
Text
…MMS22L…
Show Full Abstract
The ATR replication checkpoint ensures that stalled forks remain stable when replisome movement is impeded. Using an improved iPOND protocol combined with SILAC mass spectrometry, we characterized human replisome dynamics in response to fork stalling. Our data provide a quantitative picture of the replisome and replication stress response proteomes in 32 experimental conditions. Importantly, rather than stabilize the replisome, the checkpoint prevents two distinct types of fork collapse. Unsupervised hierarchical clustering of protein abundance on nascent DNA is sufficient to identify protein complexes and place newly identified replisome-associated proteins into functional pathways. As an example, we demonstrate that ZNF644 complexes with the G9a/GLP methyltransferase at replication forks and is needed to prevent replication-associated DNA damage. Our data reveal how the replication checkpoint preserves genome integrity, provide insights into the mechanism of action of ATR inhibitors, and will be a useful resource for replication, DNA repair, and chromatin investigators.
Also flagged:hypoxic-ischemic brain damageneurogenesisCasp6Adrb2cell proliferationpathogenesis
Journal Article2015-09-09✓ 2 SnippetsZhao F, Qu Y, Liu J, Liu H, Zhang L, Feng Y, Wang H, Gan J, Lu R, Mu D.
In-Text Gene Mentions
Discussion)
…included 6 genes,DCC, MET, NRP1, PAK3,…
Discussion)
…DCC(deleted in colorectal…
Show Full Abstract
Long noncoding RNAs (lncRNAs) play critical roles in cellular homeostasis. However, little is known about their effect in developing rat brains with hypoxic-ischemic brain damage (HIBD). To explore the expression and function of lncRNA in HIBD, we analyzed the expression profiles of lncRNAs in hypoxic-ischemic (HI) brains and sham control using microarray analysis. The results showed a remarkable difference in lncRNA between HI and sham brains. A total of 322 lncRNAs were found to be differentially expressed in HI brains, compared to sham control. Among these, BC088414 was one of the most significantly urpregulated lncRNAs. In addition, 375 coding genes were differentially expressed between HI brains and sham control. Pathway and gene ontology analysis indicated that the upregulated coding genes mostly involved in wounding, inflammation and defense, whereas the downregulated transcripts were largely associated with neurogenesis and repair. Moreover, coding non-coding co-expression network analysis showed that the BC088414 lncRNA expression was correlated with apoptosis-related genes, including Casp6 and Adrb2. Silencing of lncRNA BC088414 in PC12 cells caused reduced mRNA level of Casp6 and Adrb2, decreased cell apoptosis and increased cell proliferation. These results suggested lncRNA might participate in the pathogenesis of HIBD via regulating coding genes.
Also flagged:neurodegenerative disordersHDpolyglutamineglutaminesfibrilsdegradation
Journal Article2015-09-09✓ 5 SnippetsSahl SJ, Lau L, Vonk WI, Weiss LE, Frydman J, Moerner WE.
In-Text Gene Mentions
Abstract)
…In HD, expansion of the CAG-repeat-encoded polyglutamine (polyQ) stretch beyond ~40 glutamines in huntingtin (Htt) and its N-terminal fragments leads to the formation of large (up to several μm) globular neuronal inclusion bodies (IBs) over time.…
Introduction)
…Exon 1 of Htt, the leading ~100 amino acids, which was long thought to be a routine protease cleavage product but whose production was recently identified as resulting from repeat-length-dependent aberrant splicing of the exon 1 HTT gene (Sathasivam et al. 2013), is the predominant component of IBs analyzed in human autopsy brains (DiFiglia et al. 1997).…
Introduction)
…Details of the aggregation process of mutant (i.e. polyQ-expanded) huntingtin (Htt) and its N-terminal fragments – notably Htt exon 1 (Httex1) – have been the subject of intense study over the last 15–20 years, ever since the genetic cause, an autosomal-dominant inherited increase in the cytosine, adenine, guanine (CAG) repeat number, was uncovered two decades ago (Huntington’s Disease Collaborative Research Group, 1993).…
Results)
…Importantly, the reduction of aggregation was shown to hold in the present experiments for full-exon1 variants of mutant Htt, in addition to the proline-domain-lacking variant employed by Sontag et al. 2013.…
Abstract)
…glutamines in huntingtin (Htt) and its N-terminal…
Show Full Abstract
Aberrant aggregation of improperly folded proteins is the hallmark of several human neurodegenerative disorders, including Huntington's Disease (HD) with autosomal-dominant inheritance. In HD, expansion of the CAG-repeat-encoded polyglutamine (polyQ) stretch beyond ~40 glutamines in huntingtin (Htt) and its N-terminal fragments leads to the formation of large (up to several μm) globular neuronal inclusion bodies (IBs) over time. We report direct observations of aggregating Htt exon 1 in living and fixed cells at enhanced spatial resolution by stimulated emission depletion (STED) microscopy and single-molecule super-resolution optical imaging. Fibrils of Htt exon 1 arise abundantly across the cytosolic compartment and also in neuritic processes only after nucleation and aggregation into a fairly advanced stage of growth of the prominent IB have taken place. Structural characterizations of fibrils by STED show a distinct length cutoff at ~1·5 µm and reveal subsequent coalescence (bundling/piling). Cytosolic fibrils are observed even at late stages in the process, side-by-side with the mature IB. Htt sequestration into the IB, which in neurons has been argued to be a cell-protective phenomenon, thus appears to saturate and over-power the cellular degradation systems and leaves cells vulnerable to further aggregation producing much smaller, potentially toxic, conformational protein species of which the fibrils may be comprised. We further found that exogenous delivery of the apical domain of the chaperonin subunit CCT1 to the cells via the cell medium reduced the aggregation propensity of mutant Htt exon 1 in general, and strongly reduced the occurrence of such late-stage fibrils in particular.
Also flagged:lactationendoplasmic reticulumphosphorylationPERKnuclear factor-κBprotein response
Journal Article2015-09-09✓ 1 SnippetGessner DK, Gröne B, Couturier A, Rosenbaum S, Hillen S, Becker S, Erhardt G, Reiner G, Ringseis R, Eder K.
In-Text Gene Mentions
Results)
…was observed forPRDX6, whereas the…
Show Full Abstract
Lactating sows have been shown to develop typical signs of an inflammatory condition in the liver during the transition from pregnancy to lactation. Hepatic inflammation is considered critical due to the induction of an acute phase response and the activation of stress signaling pathways like the endoplasmic reticulum (ER) stress-induced unfolded protein response (UPR), both of which impair animal's health and performance. Whether ER stress-induced UPR is also activated in the liver of lactating sows and whether dietary fish oil as a source of anti-inflammatory effects n-3 PUFA is able to attenuate hepatic inflammation and ER stress-induced UPR in the liver of sows is currently unknown. Based on this, two experiments with lactating sows were performed. The first experiment revealed that ER stress-induced UPR occurs also in the liver of sows during lactation. This was evident from the up-regulation of a set of genes regulated by the UPR and numerically increased phosphorylation of the ER stress-transducer PERK and PERK-mediated phosphorylation of eIF2α and IκB. The second experiment showed that fish oil inhibits ER stress-induced UPR in the liver of lactating sows. This was demonstrated by decreased mRNA levels of a number of UPR-regulated genes and reduced phosphorylation of PERK and PERK-mediated phosphorylation of eIF2α and IκB in the liver of the fish oil group. The mRNA levels of various nuclear factor-κB-regulated genes encoding inflammatory mediators and acute phase proteins in the liver of lactating sows were also reduced in the fish oil group. In line with this, the plasma levels of acute phase proteins were reduced in the fish oil group, although differences to the control group were not significant. In conclusion, ER stress-induced UPR is present in the liver of lactating sows and fish oil is able to inhibit inflammatory signaling pathways and ER stress-induced UPR in the liver.
Also flagged:Gene Expression-nucleotidesynthesistranscriptional factorssilk formation
Journal Article2015-09-09✓ 2 SnippetsSu H, Cheng Y, Wang Z, Li Z, Stanley D, Yang Y.
In-Text Gene Mentions
Discussion)
…discovered the DrosophilaPEBP1(CG18594) is expressed…
Discussion)
…inferred that DrosophilaPEBP1acts in immunity.…
Show Full Abstract
The cotton leaf roller, Sylepta derogata, is a silk-producing insect pest. While young larvae feed on the underside of leaves, the older ones roll cotton leaves and feed on the leaf edges, which defoliates cotton plants. The larvae produce silk to stabilize the rolled leaf and to balloon from used to new leaves. Despite the significance of silk in the biology of pest insect species, there is virtually no information on the genes involved in their silk production. This is a substantial knowledge gap because some of these genes may be valuable targets for developing molecular pest management technologies. We addressed the gap by posing the hypothesis that silk gland gene expression changes during the transition from larvae to pupae. We tested our hypothesis using RNA-seq to investigate changes in silk gland gene expression at three developmental stages, 5th instar larvae (silk producing; 15,445,926 clean reads), prepupae (reduced silk producing; 13,758,154) and pupae (beyond silk producing; 16,787,792). We recorded 60,298 unigenes and mapped 50,158 (larvae), 48,415 (prepupae) and 46,623 (pupae) of them to the NCBI database. Most differentially expressed genes in the 5th instar larvae/prepupae libraries were relevant to nucleotide synthesis and maintenance of silk gland function. We identified down-regulated transcriptional factors and several genes involved in silk formation in the three libraries and verified the expression pattern of eight genes by qPCR. The developmental- and tissue-specific expression patterns of the fibroin light chain gene showed it was highly expressed during the larval silk-producing stage. We recorded highest expression of this gene in the larval silk gland, compared to other tissues, including midgut, hindgut, epidermis, Malpighian tubes, hemolymph and fat body. These data are a genetic resource to guide selection of key genes that may be targeted for in planta and other gene-silencing technologies for sustainable cotton agriculture.
Also flagged:stem cell differentiationembryoid bodyNANOGSOX2OCT3E-cadherin
Journal Article2015-09-09✓ 5 SnippetsSuchorska WM, Lach MS, Richter M, Kaczmarczyk J, Trzeciak T.
In-Text Gene Mentions
Abstract)
…Cells were labeled for markers expressed during the differentiation process at different time points (pluripotent: NANOG, SOX2, OCT3/4, E-cadherin; prochondrogenic: SOX6, SOX9, Collagen type II; extracellular matrix components: chondroitin sulfate, heparan sulfate; beta-catenin, CXCR4, and Brachyury).…
To improve the recovery of damaged cartilage tissue, pluripotent stem cell-based therapies are being intensively explored. A number of techniques exist that enable monitoring of stem cell differentiation, including immunofluorescence staining. This simple and fast method enables changes to be observed during the differentiation process. Here, two protocols for the differentiation of human embryonic stem cells into chondrocytes were used (monolayer cell culture and embryoid body formation). Cells were labeled for markers expressed during the differentiation process at different time points (pluripotent: NANOG, SOX2, OCT3/4, E-cadherin; prochondrogenic: SOX6, SOX9, Collagen type II; extracellular matrix components: chondroitin sulfate, heparan sulfate; beta-catenin, CXCR4, and Brachyury). Comparison of the signal intensity of differentiated cells to control cell populations (articular cartilage chondrocytes and human embryonic stem cells) showed decreased signal intensities of pluripotent markers, E-cadherin and beta-catenin. Increased signal intensities of prochondrogenic markers and extracellular matrix components were observed. The changes during chondrogenic differentiation monitored by evaluation of pluripotent and chondrogenic markers signal intensity were described. The changes were similar to several studies over chondrogenesis. These results were confirmed by semi-quantitative analysis of IF signals. In this research we indicate a bioimaging as a useful tool to monitor and semi-quantify the IF pictures during the differentiation of hES into chondrocyte-like.
Conversion of fibroblasts to functional cardiomyocytes represents a potential approach for restoring cardiac function after myocardial injury, but the technique thus far has been slow and inefficient. To improve the efficiency of reprogramming fibroblasts to cardiac-like myocytes (iCMs) by cardiac transcription factors [Gata4, Hand2, Mef2c, and Tbx5 (GHMT)], we screened 192 protein kinases and discovered that Akt/protein kinase B dramatically accelerates and amplifies this process in three different types of fibroblasts (mouse embryo, adult cardiac, and tail tip). Approximately 50% of reprogrammed mouse embryo fibroblasts displayed spontaneous beating after 3 wk of induction by Akt plus GHMT. Furthermore, addition of Akt1 to GHMT evoked a more mature cardiac phenotype for iCMs, as seen by enhanced polynucleation, cellular hypertrophy, gene expression, and metabolic reprogramming. Insulin-like growth factor 1 (IGF1) and phosphoinositol 3-kinase (PI3K) acted upstream of Akt whereas the mitochondrial target of rapamycin complex 1 (mTORC1) and forkhead box o3 (Foxo3a) acted downstream of Akt to influence fibroblast-to-cardiomyocyte reprogramming. These findings provide insights into the molecular basis of cardiac reprogramming and represent an important step toward further application of this technique.
Also flagged:Cell SurfaceGlycosylationMannoseGlycomeextracellularglycans
Journal Article2015-09-09✓ 1 SnippetPark D, Brune KA, Mitra A, Marusina AI, Maverakis E, Lebrilla CB.
In-Text Gene Mentions
Text
…B4GALT5…
Show Full Abstract
Changes in cell surface glycosylation occur during the development and differentiation of cells and have been widely correlated with the progression of several diseases. Because of their structural diversity and sensitivity to intra- and extracellular conditions, glycans are an indispensable tool for analyzing cellular transformations. Glycans present on the surface of intestinal epithelial cells (IEC) mediate interactions with billions of native microorganisms, which continuously populate the mammalian gut. A distinct feature of IECs is that they differentiate as they migrate upwards from the crypt base to the villus tip. In this study, nano-LC/ESI QTOF MS profiling was used to characterize the changes in glycosylation that correspond to Caco-2 cell differentiation. As Caco-2 cells differentiate to form a brush border membrane, a decrease in high mannose type glycans and a concurrent increase in fucosylated and sialylated complex/hybrid type glycans were observed. At day 21, when cells appear to be completely differentiated, remodeling of the cell surface glycome ceases. Differential expression of glycans during IEC maturation appears to play a key functional role in regulating the membrane-associated hydrolases and contributes to the mucosal surface innate defense mechanisms. Developing methodologies to rapidly identify changes in IEC surface glycans may lead to a rapid screening approach for a variety of disease states affecting the GI tract.
Also flagged:B-cell lymphomasIL-21angioimmunoblastic T-cell lymphomaGene expressionNeoplasmsCD4
Journal Article2015-09-09✓ 1 SnippetJain S, Chen J, Nicolae A, Wang H, Shin DM, Adkins EB, Sproule TJ, Leeth CM, Sakai T, Kovalchuk AL, Raffeld M, Ward JM, Rehg JE, Waldmann TA, Jaffe ES, Roopenian DC, Morse HC.
In-Text Gene Mentions
Text
…Rc3h1…
Show Full Abstract
SJL/J mice exhibit a high incidence of mature B-cell lymphomas that require CD4(+) T cells for their development. We found that their spleens and lymph nodes contained increased numbers of germinal centers and T follicular helper (TFH) cells. Microarray analyses revealed high levels of transcripts encoding IL-21 associated with high levels of serum IL-21. We developed IL-21 receptor (IL21R)-deficient Swiss Jim Lambart (SJL) mice to determine the role of IL-21 in disease. These mice had reduced numbers of TFH cells, lower serum levels of IL-21, and few germinal center B cells, and they did not develop B-cell tumors, suggesting IL-21-dependent B-cell lymphomagenesis. We also noted a series of features common to SJL disease and human angioimmunoblastic T-cell lymphoma (AITL), a malignancy of TFH cells. Gene expression analyses of AITL showed that essentially all cases expressed elevated levels of transcripts for IL21, IL21R, and a series of genes associated with TFH cell development and function. These results identify a mouse model with features of AITL and suggest that patients with the disease might benefit from therapeutic interventions that interrupt IL-21 signaling.
Also flagged:Transcription factorsSox5Pdgf receptor alphaPdgf-ASox9Sox10
Journal Article2015-09-08✓ 5 SnippetsBaroti T, Zimmermann Y, Schillinger A, Liu L, Lommes P, Wegner M, Stolt CC.
In-Text Gene Mentions
Abstract)
…Sox5 and Sox6 in the central nervous…
Abstract)
…Sox6 in the central nervous…
Title)
…factors Sox5 andSox6exert direct and…
Abstract)
…proteins Sox5 andSox6in the central…
Abstract)
…that Sox5 andSox6cooperate with Sox9…
Show Full Abstract
Transcription factors of the SoxD protein family have previously been shown to prevent precocious specification and terminal differentiation of oligodendrocyte progenitor cells in the developing spinal cord. Using mice with specific deletion of the SoxD proteins Sox5 and Sox6 in the central nervous system, we now show that SoxD proteins additionally influence migration of oligodendrocyte progenitors in the spinal cord as well as in the forebrain. In mutant mice, emigration of oligodendrocyte progenitors from the ventricular zone and colonization of the mantle zone are significantly delayed probably because of reduced expression of Pdgf receptor alpha and decreased responsiveness toward Pdgf-A as a main migratory cue. In addition to this direct cell-autonomous effect on Pdgf receptor alpha expression, SoxD proteins furthermore promote oligodendroglial migration by keeping the cells in an undifferentiated state and preventing a premature loss of their migratory capacity. This indirect effect becomes particularly important during late embryonic and early postnatal phases of oligodendroglial development. Finally, we show that Sox5 and Sox6 cooperate with Sox9 and Sox10 to activate Pdgf receptor alpha expression and thereby maintain oligodendrocyte progenitors in the immature state. This contrasts with their behavior on myelin genes where they antagonize the function of SoxE proteins. It argues that SoxD proteins can function either as repressors or as co-activators of SoxE proteins thereby modulating their function in a stage-specific manner.
Also flagged:depressionmajor depressive disordercognitive impairmentcognitive dysfunctioncognitionserotonin
Journal Article2015-09-08No SnippetsDale E, Pehrson AL, Jeyarajah T, Li Y, Leiser SC, Smagin G, Olsen CK, Sanchez C.
Show Full Abstract
The hippocampus plays an important role in emotional and cognitive processing, and both of these domains are affected in patients with major depressive disorder (MDD). Extensive preclinical research and the notion that modulation of serotonin (5-HT) neurotransmission plays a key role in the therapeutic efficacy of selective serotonin reuptake inhibitors (SSRIs) support the view that 5-HT is important for hippocampal function in normal and disease-like conditions. The hippocampus is densely innervated by serotonergic fibers, and the majority of 5-HT receptor subtypes are expressed there. Furthermore, hippocampal cells often co-express multiple 5-HT receptor subtypes that can have either complementary or opposing effects on cell function, adding to the complexity of 5-HT neurotransmission. Here we review the current knowledge of how 5-HT, through its various receptor subtypes, modulates hippocampal output and the activity of hippocampal pyramidal cells in rodents. In addition, we discuss the relevance of 5-HT modulation for cognitive processing in rodents and possible clinical implications of these results in patients with MDD. Finally, we review the data on how SSRIs and vortioxetine, an antidepressant with multimodal activity, affect hippocampal function, including cognitive processing, from both a preclinical and clinical perspective.
Also flagged:CircularexoribonucleasecytoplasmplasmETS1P450 2C24
Journal Article2015-09-08✓ 1 SnippetShen T, Han M, Wei G, Ni T.
In-Text Gene Mentions
Introduction)
…abundances from theDCCgene in the…
Show Full Abstract
Circular RNAs (circRNAs), a kind of covalently closed RNA molecule, were used to be considered a type of by-products of mis-splicing events and were discovered sporadically due to the technological limits in the early years. With the great technological progress such as high-throughput next-generation sequencing, numerous circRNAs have recently been detected in many species. CircRNAs were expressed in a spatio-temporally specific manner, suggesting their regulatory functional potentials were overlooked previously. Intriguingly, some circRNAs were indeed found with critical physiological functions in certain circumstances. CircRNAs have a more stable molecular structure that can resist to exoribonuclease comparing to those linear ones, and their molecular functions include microRNA sponge, regulatory roles in transcription, mRNA traps that compete with linear splicing, templates for translation and possibly other presently unknown roles. Here, we review the discovery and characterization of circRNAs, the origination and formation mechanism, the physiological functions and the molecular roles, along with the methods for detection of circRNAs. We further look into the future and propose key questions to be answered for these magical RNA molecules.
Also flagged:PKCαcancertumorlapatinibNotch-1ErbB-2
Journal Article2015-09-08No SnippetsPandya K, Wyatt D, Gallagher B, Shah D, Baker A, Bloodworth J, Zlobin A, Pannuti A, Green A, Ellis IO, Filipovic A, Sagert J, Rana A, Albain KS, Miele L, Denning MF, Osipo C.
Show Full Abstract
<h4>Purpose</h4>Breast cancer is the second leading cause of cancer mortality among women worldwide. The major problem with current treatments is tumor resistance, recurrence, and disease progression. ErbB-2-positive breast tumors are aggressive and frequently become resistant to trastuzumab or lapatinib. We showed previously that Notch-1 is required for trastuzumab resistance in ErbB-2-positive breast cancer.<h4>Experimental design</h4>Here, we sought to elucidate mechanisms by which ErbB-2 attenuates Notch signaling and how this is reversed by trastuzumab or lapatinib.<h4>Results</h4>The current study elucidates a novel Notch inhibitory mechanism by which PKCα downstream of ErbB-2 (i) restricts the availability of Jagged-1 at the cell surface to transactivate Notch, (ii) restricts the critical interaction between Jagged-1 and Mindbomb-1, an E3 ligase that is required for Jagged-1 ubiquitinylation and subsequent Notch activation, (iii) reverses trastuzumab resistance in vivo, and (iv) predicts better outcome in women with ErbB-2-positive breast cancer.<h4>Conclusions</h4>The clinical impact of these studies is PKCα is potentially a good prognostic marker for low Notch activity and increased trastuzumab sensitivity in ErbB-2-positive breast cancer. Moreover, women with ErbB-2-positive breast tumors expressing high Notch activation and low PKCα expression could be the best candidates for anti-Notch therapy.
Also flagged:neurodegenerative diseasespolyglutamineendocytosisexocytosisN -ethylmalemidesensitive fusion protein 1
Journal Article2015-09-08✓ 5 SnippetsBabcock DT, Ganetzky B.
In-Text Gene Mentions
Abstract)
…We show that Htt aggregates cause non-cell-autonomous pathology, including loss of vulnerable neurons that can be prevented by inhibiting endocytosis in these neurons.…
Abstract)
…Here we use a polyglutamine-expanded form of human huntingtin (Htt) with a fluorescent tag to monitor the spreading of aggregates in the Drosophila brain in a model of Huntington's disease.…
Abstract)
…of human huntingtin (Htt) with a fluorescent…
Abstract)
…and uptake ofHttaggregates are important…
Abstract)
…We show thatHttaggregates cause non–cell-auto…
Show Full Abstract
A key feature of many neurodegenerative diseases is the accumulation and subsequent aggregation of misfolded proteins. Recent studies have highlighted the transcellular propagation of protein aggregates in several major neurodegenerative diseases, although the precise mechanisms underlying this spreading and how it relates to disease pathology remain unclear. Here we use a polyglutamine-expanded form of human huntingtin (Htt) with a fluorescent tag to monitor the spreading of aggregates in the Drosophila brain in a model of Huntington's disease. Upon expression of this construct in a defined subset of neurons, we demonstrate that protein aggregates accumulate at synaptic terminals and progressively spread throughout the brain. These aggregates are internalized and accumulate within other neurons. We show that Htt aggregates cause non-cell-autonomous pathology, including loss of vulnerable neurons that can be prevented by inhibiting endocytosis in these neurons. Finally we show that the release of aggregates requires N-ethylmalemide-sensitive fusion protein 1, demonstrating that active release and uptake of Htt aggregates are important elements of spreading and disease progression.
Meiotic homologous recombination (HR) is not uniform across eukaryotic genomes, creating regions of HR hot- and coldspots. Previous study reveals that the Spo11 homolog Rec12 responsible for initiation of meiotic double-strand breaks in the fission yeast Schizosaccharomyces pombe is not targeted to Tf2 retrotransposons. However, whether Tf2s are HR coldspots is not known. Here, we show that the rates of HR across Tf2s are similar to a genome average but substantially increase in mutants deficient for the CENP-B homologs. Abp1, which is the most prominent of the CENP-B family members and acts as the primary determinant of HR suppression at Tf2s, is required to prevent gene conversion and maintain proper recombination exchange of homologous alleles flanking Tf2s. In addition, Abp1-mediated suppression of HR at Tf2s requires all three of its domains with distinct functions in transcriptional repression and higher-order genome organization. We demonstrate that HR suppression of Tf2s can be robustly maintained despite disruption to chromatin factors essential for transcriptional repression and nuclear organization of Tf2s. Intriguingly, we uncover a surprising cooperation between the histone methyltransferase Set1 responsible for histone H3 lysine 4 methylation and the nonhomologous end joining pathway in ensuring the suppression of HR at Tf2s. Our study identifies a molecular pathway involving functional cooperation between a transcription factor with epigenetic regulators and a DNA repair pathway to regulate meiotic recombination at interspersed repeats.
Also flagged:Vortioxetine5-HT1A5-HT1B5-HT7 receptorsserotonin transportermajor depressive episode
Journal Article2015-09-08✓ 2 SnippetsColle R, Corruble E.
In-Text Gene Mentions
Abstract)
…Vortioxetine is a new antidepressant, which mechanism of action is multimodal, targeting the 5-HT1A, 5-HT1B, 5-HT1D, 5-HT3, 5-HT7 receptors and the serotonin transporter (5-HTT).…
Abstract)
…the serotonin transporter (5-HTT).…
Show Full Abstract
Vortioxetine is a new antidepressant, which mechanism of action is multimodal, targeting the 5-HT1A, 5-HT1B, 5-HT1D, 5-HT3, 5-HT7 receptors and the serotonin transporter (5-HTT). Its efficacy and safety were assessed in fourteen studies including more than 3700 patients with a major depressive episode and treated with vortioxetine. In short-term studies (8 weeks), vortioxetine is more efficacious than placebo in decreasing depressive symptoms as measured by the MADRS total score, response rate (vortioxetine: 53.2% vs placebo: 35.2%) and remission rate (vortioxetine: 29.2% vs placebo: 19.3%). In a long-term study (52 weeks), vortioxetine is also superior to placebo in preventing relapses and recurrences. Moreover, in second line treatment, after failure of a first line selective serotonin reuptake inhibitor (SSRI) or serotonin norepinephrin reuptake inhibitor (SNRI), vortioxetine is superior to agomelatine in improving depressive symptoms and achieving response and remission. Furthermore, the positive effects of vortioxetine on improvement of cognitive symptoms of major depressive episodes are particularly well established in several clinical trials. The tolerability profile of vortioxetine is favourable. The recommended daily posology of vortioxetine is 10mg/d. Vortioxetine is a new antidepressant drug with a multimodal mechanism of action, well-documented efficacy and safety profiles.
Also flagged:vilazodone5-hydroxytryptamine1Ah5-HT1A) receptorserotonin transporterextracellularnorepinephrine
Journal Article2015-09-08✓ 3 SnippetsEl Mansari M, Crnic A, Oosterhof C, Blier P.
In-Text Gene Mentions
Abstract)
…Vilazodone acted as an agonist at 5-HT1A receptors, while showing a 5-HTT blocking capacity when injected acutely.…
Abstract)
…the serotonin transporter (5-HTT).…
Abstract)
…while showing a5-HTTblocking capacity when…
Show Full Abstract
Vilazodone has high affinity for the human 5-hydroxytryptamine1A (h5-HT1A) receptor and for the serotonin transporter (5-HTT). A previous in vivo microdialysis experiment showed that a single administration of vilazodone, dose-dependently increases extracellular 5-HT but not norepinephrine (NE) or dopamine (DA) levels in rat medial prefrontal cortex and ventral hippocampus. The effects of vilazodone on monoaminergic systems were assessed using single-unit extracellular recordings and microiontophoresis in the rat brain. Following depletion of 5-HT with para-chlorophenylalanine methyl-ester hydrochloride (PCPA), vilazodone still suppressed neuronal firing of dorsal raphe nucleus (DRN) 5-HT neurons to a similar extent than controls, indicating that this inhibition is via 5-HT1A receptors activation. Following 2-day intraperitoneal administration of vilazodone (5 mg/kg/day), there was a significant decrease in 5-HT neuronal firing which recovered to baseline levels by day 14 of administration, likely due to 5-HT1A autoreceptor desensitization. Two- and 14-day administration of vilazodone decreased the mean firing and bursting activities of ventral tegmental area (VTA) DA neurons, while only its repeated administration significantly dampened the mean firing rate of locus coeruleus (LC) NE neurons. Vilazodone acted as an agonist at 5-HT1A receptors, while showing a 5-HTT blocking capacity when injected acutely. After repeated vilazodone regimen, while there was no change in sensitivity of 5-HT1A receptors, the enhancement in 5-HT transmission yielded an increase in the tonic activation of these receptors located in the hippocampus.
Also flagged:RosiglitazonePPARγPeroxisome proliferator-activated receptor gammatranscription factorbrain diseasesHuntington's Disease
Journal Article2015-09-08No SnippetsChiang MC, Cheng YC, Nicol CJ, Lin KH, Yen CH, Chen SJ, Huang RN.
Show Full Abstract
Peroxisome proliferator-activated receptor gamma (PPARγ) is a crucial transcription factor for neuroprotection in several brain diseases. Using a mouse model of Huntington's Disease (HD), we recently showed that PPARγ not only played a major function in preventing HD, but also oral intake of a PPARγ agonist (thiazolidinedione, TZD) significantly reduced the formation of mutant Huntingtin (mHtt) aggregates in the brain (e.g., cortex and striatum). The molecular mechanisms by which PPARγ exerts its HD neuroprotective effects remain unresolved. We investigated whether the PPARγ agonist (rosiglitazone) mediates neuroprotection in the mHtt expressing neuroblastoma cell line (N2A). Here we show that rosiglitazone upregulated the endogenous expression of PPARγ, its downstream target genes (including PGC1α, NRF-1 and Tfam) and mitochondrial function in mHtt expressing N2A cells. Rosiglitazone treatment also significantly reduced mHtt aggregates that included ubiquitin (Ub) and heat shock factor 1 (HSF1), as assessed by a filter-retardation assay, and increased the levels of the functional ubiquitin-proteasome system (UPS), HSF1 and heat shock protein 27/70 (HSP27/70) in N2A cells. Moreover, rosiglitazone treatment normalized endoplasmic reticulum (ER) stress sensors Bip, CHOP and ASK1, and significantly increased N2A cell survival. Taken together, these findings unveil new insights into the mechanisms by which activation of PPARγ signaling protects against the HD-mediated neuronal impairment. Further, our data also support the concept that PPARγ may be a novel therapeutic target for treating HD.
Also flagged:Tetracyclinesimvastatinmineralizationosteoporosismineralconjugation
Journal Article2015-09-08No SnippetsWang H, Liu J, Tao S, Chai G, Wang J, Hu FQ, Yuan H.
Show Full Abstract
<h4>Purpose</h4>Nanoparticles (NPs) that target bone tissue were developed using poly(lactic-co-glycolic acid) (PLGA) copolymers and tetracycline (TC)-based bone-targeting moieties. These NPs are expected to enable the transport of drugs, such as simvastatin (SIM), for the treatment of osteoporosis.<h4>Methods</h4>The molecular structures of TC-PLGA were validated by (1)H-NMR, and the SIM-loaded NPs were prepared using the solvent emulsification method. The surface properties, cytotoxicity, cellular uptake, cell mineralization, bone targeting potential, and animal pharmacodynamics of the TC-PLGA NPs were evaluated and compared to those of PLGA NPs.<h4>Results</h4>It was confirmed that the average particle size of the NPs was approximately 220 nm. In phosphate-buffered saline (PBS, pH 7.4), the SIM-loaded NPs exhibited a cumulative release of up to 80% within 72 hours. An in vitro cell evaluation indicated that the NPs had an excellent cellular uptake capacity and showed great biocompatibility with MC3T3-E1 cells, thereby reducing the cytotoxic effects of SIM. The cell mineralization assay showed that the SIM-loaded NPs induced osteogenic differentiation and mineralized nodule formation in MC3T3-E1 cells, thereby achieving the same effect as SIM. Preliminary findings from in vitro and in vivo bone affinity assays indicated that the TC-PLGA NPs may display increased bone-targeting efficiency compared to PLGA NPs lacking a TC moiety. The use of SIM-loaded TC-PLGA NPs in treating osteoporosis was tested through animal pharmacodynamics analyses performed in ovariectomized rats, and the results suggested that the SIM-loaded TC-PLGA NPs can improve the curative effects of SIM on the recovery of bone mineral density compared to either SIM-loaded PLGA NPs or SIM alone.<h4>Conclusion</h4>Bone-targeting NPs, which were based on the conjugation of TC to PLGA copolymers, have the ability to target bone. These NPs may be developed as a delivery system for hydrophobic drugs, and they are expected to improve the curative effects of drugs, reduce the administered drug doses, and reduce side effects in other organs.
Also flagged:ALSpathogenesissuperoxide dismutase 1SOD1frontotemporal dementiaoligonucleotide
Journal Article2015-09-08No SnippetsBoylan K.
Show Full Abstract
Genes linked to amyotrophic lateral sclerosis (ALS) susceptibility are being identified at an increasing rate owing to advances in molecular genetic technology. Genetic mechanisms in ALS pathogenesis seem to exert major effects in about 10% of patients, but genetic factors at some level may be important components of disease risk in most patients with ALS. Identification of gene variants associated with ALS has informed concepts of the pathogenesis of ALS, aided the identification of therapeutic targets, facilitated research to develop new ALS biomarkers, and supported the establishment of clinical diagnostic tests for ALS-linked genes.
Also flagged:degradationagingtitaniumcobalt-chromiumosteopenia
Journal Article2015-09-08No SnippetsUddin MS, Hall C, Murphy P.
Show Full Abstract
Due to their excellent biodegradability characteristics, Mg and Mg-based alloys have become an emerging material in biomedical implants, notably for repair of bone as well as coronary arterial stents. However, the main problem with Mg-based alloys is their rapid corrosion in aggressive environments such as human bodily fluids. Previously, many approaches such as control of alloying materials, composition and surface treatments, have been attempted to regulate the corrosion rate. This article presents a comprehensive review of recent research focusing on surface treatment techniques utilised to control the corrosion rate and surface integrity of Mg-based alloys in both <i>in vitro</i> and <i>in vivo</i> environments. Surface treatments generally involve the controlled deposition of thin film coatings using various coating processes, and mechanical surfacing such as machining, deep rolling or low plasticity burnishing. The aim is to either make a protective thin layer of a material or to change the micro-structure and mechanical properties at the surface and sub-surface levels, which will prevent rapid corrosion and thus delay the degradation of the alloys. We have organised the review of past works on coatings by categorising the coatings into two classes-conversion and deposition coatings-while works on mechanical treatments are reviewed based on the tool-based processes which affect the sub-surface microstructure and mechanical properties of the material. Various types of coatings and their processing techniques under two classes of coating and mechanical treatment approaches have been analysed and discussed to investigate their impact on the corrosion performance, biomechanical integrity, biocompatibility and cell viability. Potential challenges and future directions in designing and developing the improved biodegradable Mg/Mg-based alloy implants were addressed and discussed. The literature reveals that no solutions are yet complete and hence new and innovative approaches are required to leverage the benefit of Mg-based alloys. Hybrid treatments combining innovative biomimetic coating and mechanical processing would be regarded as a potentially promising way to tackle the corrosion problem. Synergetic cutting-burnishing integrated with cryogenic cooling may be another encouraging approach in this regard. More studies focusing on rigorous testing, evaluation and characterisation are needed to assess the efficacy of the methods.
Also flagged:ageingcognitive impairmentAlzheimer diseaseADdementiacardiovascular disease
Journal Article2015-09-07✓ 2 SnippetsSood S, Gallagher IJ, Lunnon K, Rullman E, Keohane A, Crossland H, Phillips BE, Cederholm T, Jensen T, van Loon LJ, Lannfelt L, Kraus WE, Atherton PJ, Howard R, Gustafsson T, Hodges A, Timmons JA.
In-Text Gene Mentions
Results)
…We did note that the 150 genes included some previously identified ‘ageing’ genes, for example, LMNA (linked with Hutchinson-Gilford progeria syndrome), Unc-13 homolog (UNC13C; linked with beta-amyloid biology), as well as COL1A1 (thought to change in skin ageing).…
Results)
…Unc-13 homolog (UNC13C; linked with…
Show Full Abstract
<h4>Background</h4>Diagnostics of the human ageing process may help predict future healthcare needs or guide preventative measures for tackling diseases of older age. We take a transcriptomics approach to build the first reproducible multi-tissue RNA expression signature by gene-chip profiling tissue from sedentary normal subjects who reached 65 years of age in good health.<h4>Results</h4>One hundred and fifty probe-sets form an accurate classifier of young versus older muscle tissue and this healthy ageing RNA classifier performed consistently in independent cohorts of human muscle, skin and brain tissue (n = 594, AUC = 0.83-0.96) and thus represents a biomarker for biological age. Using the Uppsala Longitudinal Study of Adult Men birth-cohort (n = 108) we demonstrate that the RNA classifier is insensitive to confounding lifestyle biomarkers, while greater gene score at age 70 years is independently associated with better renal function at age 82 years and longevity. The gene score is 'up-regulated' in healthy human hippocampus with age, and when applied to blood RNA profiles from two large independent age-matched dementia case-control data sets (n = 717) the healthy controls have significantly greater gene scores than those with cognitive impairment. Alone, or when combined with our previously described prototype Alzheimer disease (AD) RNA 'disease signature', the healthy ageing RNA classifier is diagnostic for AD.<h4>Conclusions</h4>We identify a novel and statistically robust multi-tissue RNA signature of human healthy ageing that can act as a diagnostic of future health, using only a peripheral blood sample. This RNA signature has great potential to assist research aimed at finding treatments for and/or management of AD and other ageing-related conditions.
Also flagged:cardiovascular diseasediabetessubstance abusebehaviouralincontinenceheart failure
Journal Article2015-09-07No SnippetsFlodgren G, Rachas A, Farmer AJ, Inzitari M, Shepperd S.
Show Full Abstract
<h4>Background</h4>Telemedicine (TM) is the use of telecommunication systems to deliver health care at a distance. It has the potential to improve patient health outcomes, access to health care and reduce healthcare costs. As TM applications continue to evolve it is important to understand the impact TM might have on patients, healthcare professionals and the organisation of care.<h4>Objectives</h4>To assess the effectiveness, acceptability and costs of interactive TM as an alternative to, or in addition to, usual care (i.e. face-to-face care, or telephone consultation).<h4>Search methods</h4>We searched the Effective Practice and Organisation of Care (EPOC) Group's specialised register, CENTRAL, MEDLINE, EMBASE, five other databases and two trials registers to June 2013, together with reference checking, citation searching, handsearching and contact with study authors to identify additional studies.<h4>Selection criteria</h4>We considered randomised controlled trials of interactive TM that involved direct patient-provider interaction and was delivered in addition to, or substituting for, usual care compared with usual care alone, to participants with any clinical condition. We excluded telephone only interventions and wholly automatic self-management TM interventions.<h4>Data collection and analysis</h4>For each condition, we pooled outcome data that were sufficiently homogenous using fixed effect meta-analysis. We reported risk ratios (RR) and 95% confidence intervals (CI) for dichotomous outcomes, and mean differences (MD) for continuous outcomes.<h4>Main results</h4>We included 93 eligible trials (N = 22,047 participants), which evaluated the effectiveness of interactive TM delivered in addition to (32% of studies), as an alternative to (57% of studies), or partly substituted for usual care (11%) as compared to usual care alone.The included studies recruited patients with the following clinical conditions: cardiovascular disease (36), diabetes (21), respiratory conditions (9), mental health or substance abuse conditions (7), conditions requiring a specialist consultation (6), co morbidities (3), urogenital conditions (3), neurological injuries and conditions (2), gastrointestinal conditions (2), neonatal conditions requiring specialist care (2), solid organ transplantation (1), and cancer (1).Telemedicine provided remote monitoring (55 studies), or real-time video-conferencing (38 studies), which was used either alone or in combination. The main TM function varied depending on clinical condition, but fell typically into one of the following six categories, with some overlap: i) monitoring of a chronic condition to detect early signs of deterioration and prompt treatment and advice, (41); ii) provision of treatment or rehabilitation (12), for example the delivery of cognitive behavioural therapy, or incontinence training; iii) education and advice for self-management (23), for example nurses delivering education to patients with diabetes or providing support to parents of very low birth weight infants or to patients with home parenteral nutrition; iv) specialist consultations for diagnosis and treatment decisions (8), v) real-time assessment of clinical status, for example post-operative assessment after minor operation or follow-up after solid organ transplantation (8) vi), screening, for angina (1).The type of data transmitted by the patient, the frequency of data transfer, (e.g. telephone, e-mail, SMS) and frequency of interactions between patient and healthcare provider varied across studies, as did the type of healthcare provider/s and healthcare system involved in delivering the intervention.We found no difference between groups for all-cause mortality for patients with heart failure (16 studies; N = 5239; RR:0.89, 95% CI 0.76 to 1.03, P = 0.12; I(2) = 44%) (moderate to high certainty of evidence) at a median of six months follow-up. Admissions to hospital (11 studies; N = 4529) ranged from a decrease of 64% to an increase of 60% at median eight months follow-up (moderate certainty of evidence). We found some evidence of improved quality of life (five studies; N = 482; MD:-4.39, 95% CI -7.94 to -0.83; P < 0.02; I(2) = 0%) (moderate certainty of evidence) for those allocated to TM as compared with usual care at a median three months follow-up. In studies recruiting participants with diabetes (16 studies; N = 2768) we found lower glycated haemoglobin (HbA1c %) levels in those allocated to TM than in controls (MD -0.31, 95% CI -0.37 to -0.24; P < 0.00001; I(2)= 42%, P = 0.04) (high certainty of evidence) at a median of nine months follow-up. We found some evidence for a decrease in LDL (four studies, N = 1692; MD -12.45, 95% CI -14.23 to -10.68; P < 0.00001; I(2 =) 0%) (moderate certainty of evidence), and blood pressure (four studies, N = 1770: MD: SBP:-4.33, 95% CI -5.30 to -3.35, P < 0.00001; I(2) = 17%; DBP: -2.75 95% CI -3.28 to -2.22, P < 0.00001; I(2) = 45% (moderate certainty evidence), in TM as compared with usual care.Seven studies that recruited participants with different mental health and substance abuse problems, reported no differences in the effect of therapy delivered over video-conferencing, as compared to face-to-face delivery. Findings from the other studies were inconsistent; there was some evidence that monitoring via TM improved blood pressure control in participants with hypertension, and a few studies reported improved symptom scores for those with a respiratory condition. Studies recruiting participants requiring mental health services and those requiring specialist consultation for a dermatological condition reported no differences between groups.<h4>Authors' conclusions</h4>The findings in our review indicate that the use of TM in the management of heart failure appears to lead to similar health outcomes as face-to-face or telephone delivery of care; there is evidence that TM can improve the control of blood glucose in those with diabetes. The cost to a health service, and acceptability by patients and healthcare professionals, is not clear due to limited data reported for these outcomes. The effectiveness of TM may depend on a number of different factors, including those related to the study population e.g. the severity of the condition and the disease trajectory of the participants, the function of the intervention e.g., if it is used for monitoring a chronic condition, or to provide access to diagnostic services, as well as the healthcare provider and healthcare system involved in delivering the intervention.
Also flagged:Endothelial dysfunctionpathogenesishypertensionatherosclerosischronic kidney diseaseCytoskeleton
Journal Article2015-09-07No SnippetsJiang YH, Sun W, Li W, Hu HZ, Zhou L, Jiang HH, Xu JX.
Show Full Abstract
<h4>Background</h4>Dysfunction of vascular endothelium is implicated in many pathological situations. Cytoskeleton plays an importance role in vascular endothelial permeability barrier and inflammatory response. Many Chinese herbs have the endothelial protective effect, of which, "Astragalus membranaceus" is a highly valued herb for treatment of cardiovascular and renal diseases in traditional Chinese medicine, In this study, we tested whether calycosin-7-O-β-D-glucoside (Calycosin), a main effective monomer component of "Astragalus membranaceus", could protect endothelial cells from bacterial endotoxin (LPS)-induced cell injury.<h4>Methods</h4>Endothelial cell injury was induced by exposing human umbilical vein endothelial cells (HUVECs) to LPS. The effects of calycosin on LPS-induced changes in cell viability, apoptosis rate, cell migration, nitric oxide synthase (NOS), generationof intracellular reactive oxygen species (ROS) and cytoskeleton organization were determined. Microarray assay was employed to screen the possible gene expression change. Based on the results of microarray assay, the expression profile of genes involved in Rho/ROCK pathway and AKT pathway were further evaluated with quantitative real-time RT-PCR or western blot methods.<h4>Results</h4>Calycosin improved cell viability, suppressed apoptosis and protected the cells from LPS-induced reduction in cell migration and generation of ROS, protein level of NOS at a comparable magnitude to that of Y27632 and valsartan. Similar to Y27632 and valsartan, Calycosin, also neutralized LPS-induced actomyosin contraction and vinculin protein aggregation. Microarray assay, real-time PCR and western blot results revealed that LPS induced expression of FN, ITG A5, RhoA, PI3K (or PIP2 in western blotting), FAK, VEGF and VEGF R2, and inhibited expression of MLCP. We believed multiple pathways involved in the regulation of calycosin on HUVECs. Calycosin are considered to be able to activate MLCP through promoting the generation of NO, decreasing PMLC, suppressing the cytoskeleton remodeling caused by activation of Rho/ROCK pathway and inhibiting AKT pathway by decreasing VEGF, VEGF R2 and PI3K level.<h4>Conclusion</h4>Calycosin protected HUVEC from LPS-induced endothelial injury, possibly through suppression of Rho/ROCK pathway and regulation of AKT pathway.
Also flagged:chronic hepatitiscirrhosishepatocellular carcinomapeginterferonribavirinHCV infection
Journal Article2015-09-07✓ 1 SnippetNakamoto S, Imazeki F, Arai M, Yasui S, Nakamura M, Haga Y, Sasaki R, Kanda T, Shirasawa H, Yokosuka O.
In-Text Gene Mentions
Methods)
…primary biliary cirrhosis,hemochromatosis, Wilson disease, or…
Show Full Abstract
We examined whether hepatitis C virus (HCV) genotype 1b core- and NS5A-region mutations are associated with response to peginterferon α-2b plus ribavirin combination therapy. A total of 103 patients with high HCV genotype 1b viral loads (≥ 100 KIU/mL) were treated with the combination therapy. Pretreatment mutations in the core region and interferon sensitivity determining region (ISDR) in the NS5A region were analyzed. In univariate analysis, arginine and leucine at positions 70 and 91 in the core region, defined as double wild (DW)-type, were associated with early virologic response (p = 0.002), sustained virologic response (SVR) (p = 0.004), and non-response (p = 0.005). Non-threonine at position 110 was associated with SVR (p = 0.004). Multivariate analysis showed the following pretreatment predictors of SVR: hemoglobin level ≥ 14 g/dL (odds ratio (OR) 6.2, p = 0.04); platelet count ≥ 14 × 10⁴/mm³ (OR 5.2, p = 0.04); aspartate aminotransferase (AST)/alanine aminotransferase (ALT) ratio < 0.9 (OR 6.17, p = 0.009); DW-type (OR 6.8, p = 0.02); non-threonine at position 110 (OR 14.5, p = 0.03); and ≥ 2 mutations in the ISDR (OR 12.3, p = 0.02). Patients with non-DW-type, non-threonine at position 110, and < 2 ISDR mutations showed significantly lower SVR rates than others (11/45 (24.4%) vs. 27/37 (73.0%), respectively; p < 0.001). SVR can be predicted through core and NS5A region mutations and host factors like hemoglobin, platelet count, and AST/ALT ratio in HCV genotype 1b-infected patients treated with peginterferon and ribavirin combination therapy.
Also flagged:polyacrylamidebiosynthesisregulatory proteinschaperonesstructural proteinscell migration
Journal Article2015-09-07No SnippetsWille M, Schümann A, Wree A, Kreutzer M, Glocker MO, Mutzbauer G, Schmitt O.
Show Full Abstract
In this study, we searched for proteins that change their expression in the cerebellum (Ce) of rats during ontogenesis. This study focuses on the question of whether specific proteins exist which are differentially expressed with regard to postnatal stages of development. A better characterization of the microenvironment and its development may result from these study findings. A differential two-dimensional polyacrylamide gel electrophoresis (2DE) and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) analysis of the samples revealed that the number of proteins of the functional classes differed depending on the developmental stages. Especially members of the functional classes of biosynthesis, regulatory proteins, chaperones and structural proteins show the highest differential expression within the analyzed stages of development. Therefore, members of these functional protein groups seem to be involved in the development and differentiation of the Ce within the analyzed development stages. In this study, changes in the expression of proteins in the Ce at different postnatal developmental stages (postnatal days (P) 7, 90, and 637) could be observed. At the same time, an identification of proteins which are involved in cell migration and differentiation was possible. Especially proteins involved in processes of the biosynthesis and regulation, the dynamic organization of the cytoskeleton as well as chaperones showed a high amount of differentially expressed proteins between the analyzed dates.
Journal Article2015-09-07No SnippetsChauhan J, Chen SE, Fenstermacher KJ, Naser-Tavakolian A, Reingewertz T, Salmo R, Lee C, Williams E, Raje M, Sundberg E, DeStefano JJ, Freire E, Fletcher S.
Show Full Abstract
Small-molecule mimetics of the β-hairpin flap of HIV-1 protease (HIV-1 PR) were designed based on a 1,4-benzodiazepine scaffold as a strategy to interfere with the flap-flap protein-protein interaction, which functions as a gated mechanism to control access to the active site. Michaelis-Menten kinetics suggested our small-molecules are competitive inhibitors, which indicates the mode of inhibition is through binding the active site or sterically blocking access to the active site and preventing flap closure, as designed. More generally, a new bioactive scaffold for HIV-1PR inhibition has been discovered, with the most potent compound inhibiting the protease with a modest K(i) of 11 μM.
Also flagged:Rapamycinbronchiolitis obliteransimmune responsepicrosirius redsecretionIL-10
Journal Article2015-09-07No SnippetsZhao Y, Gillen JR, Meher AK, Burns JA, Kron IL, Lau CL.
Show Full Abstract
<h4>Objective</h4>B lymphocytes are generally considered to be activators of the immune response; however, recent findings have shown that a subtype of B lymphocytes, regulatory B lymphocytes, play a role in attenuating the immune response. Bronchiolitis obliterans remains the major limitation to modern-day lung transplantation. The role of regulatory B lymphocytes in bronchiolitis obliterans has not been elucidated. We hypothesized that regulatory B lymphocytes play a role in the attenuation of bronchiolitis obliterans.<h4>Methods</h4>We performed a standard heterotopic tracheal transplant model. Tracheas from Balb/c mice were transplanted into C57BL/6 recipients. Rapamycin treatment and dimethyl sulfoxide control groups were each treated for the first 14 days after the transplant. Tracheas were collected on days 7, 14, and 28 post-transplantation. Luminal obliteration was evaluated by hematoxylin-eosin staining and Picrosirius red staining. Immune cell infiltration and characteristics, and secretion of interleukin-10 and transforming growth factor-β1 were accessed by immunohistochemistry. Cytokines and transforming growth factor-β1 were measured using the Luminex assay (Bio-Rad, Hercules, Calif).<h4>Results</h4>The results revealed that intraperitoneal injection of rapamycin for 14 days after tracheal transplantation significantly reduced luminal obliteration on day 28 when compared with the dimethyl sulfoxide control group (97.78% ± 3.63% vs 3.02% ± 2.14%, P < .001). Rapamycin treatment markedly induced regulatory B lymphocytes (B220(+)IgM(+)IgG(-)IL-10(+)TGF-β1(+)) cells when compared with dimethyl sulfoxide controls. Rapamycin treatment inhibited interleukin-1β, 6, 13, and 17 on days 7 and 14. Rapamycin also greatly increased interleukin-10 and transforming growth factor-β1 production in B cells and regulatory T lymphocytes infiltration on day 28.<h4>Conclusions</h4>Mammalian target of rapamycin inhibition decreases the development of bronchiolitis obliterans via inhibition of proinflammatory cytokines and increasing regulatory B lymphocytes cell infiltration, which subsequently produces anti-inflammatory cytokines and upregulates regulatory T lymphocyte cells.
Also flagged:grapheneoxideethylenediamineironcobaltnickel
Journal Article2015-09-07No SnippetsZawisza B, Baranik A, Malicka E, Talik E, Sitko R.
Show Full Abstract
We describe a novel solid phase sorbent that was synthesized by coupling graphene oxide (GO) to ethylenediamine (EDA). This nanomaterial (referred to as GO-EDA) is capable of adsorbing the ions of iron, cobalt, nickel, copper, zinc and lead. The ethylenediamine-modified graphene oxide was characterized by X-ray photoelectron spectroscopy, scanning electron microscopy and Fourier transform infrared spectroscopy. The analytical procedure relies on (a) sorption of metal ions on GO-EDA dispersed in aqueous samples; (b) filtering, and (c) direct submission of the filter paper to energy-dispersive X-ray fluorescence spectrometry. This kind of dispersive micro-solid phase extraction was optimized with respect to pH values, concentration of GO-EDA, contact time, and the effects of interfering ions and humic acid on recovery of determined elements. Under optimized conditions, the recoveries of spiked samples range from 90 to 98 %. The detection limits are 0.07, 0.10, 0.07, 0.08, 0.06 and 0.10 ng mL<sup>-1</sup> for Fe(III), Co(II), Ni(II), Cu(II), Zn(II) and Pb(II), respectively. The method has a relative standard deviation of <6 %, and its accuracy was verified by analysis of two standard reference materials [LGC6016 (estuarine water) and BCR-610 (groundwater)]. It was successfully applied to the determination of trace amounts of these metal ions in water samples. Graphical AbstractGraphene oxide was coupled to ethylenediamine in order to obtain an effective sorbent (GO-EDA) for preconcentration of Fe(III), Co(II), Ni(II), Cu(II), Zn(II) and Pb(II) from environmental water samples.
Also flagged:chromosomeschromatinorganizationcell nucleusregulation of gene expressionchromosome
Journal Article2015-09-05No SnippetsDekker J, Heard E.
Show Full Abstract
Recent studies have shown that chromosomes in a range of organisms are compartmentalized in different types of chromatin domains. In mammals, chromosomes form compartments that are composed of smaller Topologically Associating Domains (TADs). TADs are thought to represent functional domains of gene regulation but much is still unknown about the mechanisms of their formation and how they exert their regulatory effect on embedded genes. Further, similar domains have been detected in other organisms, including flies, worms, fungi and bacteria. Although in all these cases these domains appear similar as detected by 3C-based methods, their biology appears to be quite distinct with differences in the protein complexes involved in their formation and differences in their internal organization. Here we outline our current understanding of such domains in different organisms and their roles in gene regulation.
Also flagged:transcription factorMybinfectionCD274CD40CD154
Journal Article2015-09-05✓ 5 SnippetsJindra PT, Conway SE, Ricklefs SM, Porcella SF, Anzick SL, Haagenson M, Wang T, Spellman S, Milford E, Kraft P, McDermott DH, Abdi R.
In-Text Gene Mentions
Abstract)
…Given the discovery cohort, functional data, and importance of TNFSF4 in infection clearance, TNFSF4C may associate with outcomes and warrants future studies.…
Despite stringent procedures to secure the best HLA matching between donors and recipients, life-threatening complications continue to occur after hematopoietic stem cell transplantation (HSCT). Studying single nucleotide polymorphism (SNP) in genes encoding costimulatory molecules could help identify patients at risk for post-HSCT complications. In a stepwise approach we selected SNPs in key costimulatory molecules including CD274, CD40, CD154, CD28, and TNFSF4 and systematically analyzed their association with post-HSCT outcomes. Our discovery cohort analysis of 1157 HLA-A, -B, -C, -DRB1, and -DQB1 matched cases found that patients with donors homozygous for the C variant of rs10912564 in TNFSF4 (48%) had better disease-free survival (P = .029) and overall survival (P = .009) with less treatment-related mortality (P = .006). Our data demonstrate the TNFSF4C variant had a higher affinity for the nuclear transcription factor Myb and increased percentage of TNFSF4-positive B cells after stimulation compared with CT or TT genotypes. However, these associations were not validated in a more recent cohort, potentially because of changes in standard of practice or absence of a true association. Given the discovery cohort, functional data, and importance of TNFSF4 in infection clearance, TNFSF4C may associate with outcomes and warrants future studies.
Also flagged:SynthesisIpomoeassin Fmacrolidedisaccharidetumorcell growth
Journal Article2015-09-04No SnippetsZong G, Barber E, Aljewari H, Zhou J, Hu Z, Du Y, Shi WQ.
Show Full Abstract
Ipomoeassin F, a macrolide glycoresin containing an embedded disaccharide, possesses potent in vitro antitumor activity with an unknown mechanism of function. It inhibits tumor cell growth with single-digit nanomolar IC50 values, superior to many clinical chemotherapeutic drugs. To facilitate translation of its bioactivity into protein function for drug development, we report here a new synthesis for the gram-scale production of ipomoeassin F (3.8% over 17 linear steps) from commercially available starting materials. The conformation-controlled subtle reactivity differences of the hydroxyl groups in carbohydrates were utilized to quickly construct the disaccharide core, which, along with judicial selection of protecting groups, made the current synthesis very efficient. The same strategy was also applied to the smooth preparation of the 11R-epimer of ipomoeassin F for the first time. Cytotoxicity assays demonstrated the crucial role of the natural 11S configuration. In addition, cell cycle analyses and apoptosis assays on ipomoeassin F and/or its epimer were conducted. This work has laid a solid foundation for understanding the medicinal potential of the ipomoeassin family of glycolipids in the future.
Also flagged:Mitochondrial NADH Dehydrogenase Subunit 3MJDMT ‐ ND 3ND 3spinocerebellar ataxia type 3SCA3
Journal Article2015-09-04✓ 1 SnippetChen S, Gan SR, Cai PP, Ni W, Zhou Q, Dong Y, Wang N, Wu ZY.
In-Text Gene Mentions
Text
…Htt…
Show Full Abstract
<h4>Aims</h4>To investigate the potential effect of six previously reported candidate single nucleotide polymorphisms on age at onset (AAO) among Chinese patients with Machado-Joseph disease (MJD).<h4>Methods</h4>Three hundred and twenty-four unrelated molecular-confirmed MJD patients were recruited between January 2006 and December 2014. The screening of candidate polymorphisms was first performed in 173 subjects using the SNaPshot(®) Multiplex System. The mitochondrial NADH dehydrogenase subunit 3 (MT-ND3) polymorphism 10398A>G (rs2853826) was further verified with Sanger sequencing in additional 151 patients.<h4>Results</h4>An inverse correlation was found between expanded CAG repeat length and AAO. The expanded CAG repeat length can explain 63% of AAO variance. The 10398A polymorphism was significantly associated with a 3-year earlier AAO in male patients with MJD (P = 0.001). Stepwise multiple regressions revealed that the 10398A polymorphism could account for nearly 2% of AAO variance in male patients.<h4>Conclusion</h4>Six candidate SNPs have been screened in Chinese patients with MJD. A remarkable earlier AAO was noted in male Chinese MJD patients with MT-ND3 gene 10398A polymorphism.
Also flagged:degenerative disordersProtein AggregationDegenerative Diseasesamyloid disordersextracellularamyloid diseases
Journal Article2015-09-04No SnippetsEisele YS, Monteiro C, Fearns C, Encalada SE, Wiseman RL, Powers ET, Kelly JW.
Show Full Abstract
The aggregation of specific proteins is hypothesized to underlie several degenerative diseases, which are collectively known as amyloid disorders. However, the mechanistic connection between the process of protein aggregation and tissue degeneration is not yet fully understood. Here, we review current and emerging strategies to ameliorate aggregation-associated degenerative disorders, with a focus on disease-modifying strategies that prevent the formation of and/or eliminate protein aggregates. Persuasive pharmacological and genetic evidence now supports protein aggregation as the cause of postmitotic tissue dysfunction or loss. However, a more detailed understanding of the factors that trigger and sustain aggregate formation and of the structure-activity relationships underlying proteotoxicity is needed to develop future disease-modifying therapies.
Also flagged:5-HT transporteralcohol use problemsAlcoholusealcohol usealcoholism
Journal Article2015-09-04✓ 2 SnippetsRubens M, Ramamoorthy V, Attonito J, Saxena A, Appunni S, Shehadeh N, Dévieux JG.
In-Text Gene Mentions
Text
…5-HTT…
Text
…5-HTT transporter…
Show Full Abstract
Alcohol use and sexual risk behaviors are multidimensional phenomena involving many genetic and environmental factors. 5-HT transporter linked promoter region (5-HTTLPR) polymorphism constitutes an important factor affecting alcohol use problems and risky sexual behaviors. This paper narratively reviews studies on 5-HTTLPR polymorphism and its associations with alcohol use problems and sexual risk behaviors. We searched the electronic databases, PubMed, Ovid, and Google Scholar for articles using MeSH terms. Relevant articles were reviewed and eligible articles were selected for the study. Many studies have reported a significant but moderate association between 5-HTTLPR polymorphism and alcohol use problems. These studies have implicated the presence of at least one S allele to be associated with significant increases in alcohol use problems. Similarly, some studies associate the S allele with increased sexual risk behaviors. Effective alcohol cessation initiatives and STI/HIV prevention programs should be modified to account for 5-HTTLPR polymorphism before planning interventions; genetic effects could moderate the intervention effect.
Also flagged:choreaanxietymemoryHuntington's Diseaseguaninehappy
Journal Article2015-09-04No SnippetsLong JD, Paulsen JS, PREDICT-HD Investigators and Coordinators of the Huntington Study Group.
Show Full Abstract
<h4>Background</h4>It is well known in Huntington's disease that cytosine-adenine-guanine expansion and age at study entry are predictive of the timing of motor diagnosis. The goal of this study was to assess whether additional motor, imaging, cognitive, functional, psychiatric, and demographic variables measured at study entry increased the ability to predict the risk of motor diagnosis over 12 years.<h4>Methods</h4>One thousand seventy-eight Huntington's disease gene-expanded carriers (64% female) from the Neurobiological Predictors of Huntington's Disease study were followed up for up to 12 y (mean = 5, standard deviation = 3.3) covering 2002 to 2014. No one had a motor diagnosis at study entry, but 225 (21%) carriers prospectively received a motor diagnosis. Analysis was performed with random survival forests, which is a machine learning method for right-censored data.<h4>Results</h4>Adding 34 variables along with cytosine-adenine-guanine and age substantially increased predictive accuracy relative to cytosine-adenine-guanine and age alone. Adding six of the common motor and cognitive variables (total motor score, diagnostic confidence level, Symbol Digit Modalities Test, three Stroop tests) resulted in lower predictive accuracy than the full set, but still had twice the 5-y predictive accuracy than when using cytosine-adenine-guanine and age alone. Additional analysis suggested interactions and nonlinear effects that were characterized in a post hoc Cox regression model.<h4>Conclusions</h4>Measurement of clinical variables can substantially increase the accuracy of predicting motor diagnosis over and above cytosine-adenine-guanine and age (and their interaction). Estimated probabilities can be used to characterize progression level and aid in future studies' sample selection.
Also flagged:psychiatric disordersimmune disordersbrain disordersimmune dysregulationDNase Iimmune disorder
Journal Article2015-09-04✓ 1 SnippetWang Q, Yang C, Gelernter J, Zhao H.
In-Text Gene Mentions
Text
…ABT1…
Show Full Abstract
Although some existing epidemiological observations and molecular experiments suggested that brain disorders in the realm of psychiatry may be influenced by immune dysregulation, the degree of genetic overlap between psychiatric disorders and immune disorders has not been well established. We investigated this issue by integrative analysis of genome-wide association studies of 18 complex human traits/diseases (five psychiatric disorders, seven immune disorders, and others) and multiple genome-wide annotation resources (central nervous system genes, immune-related expression-quantitative trait loci (eQTL) and DNase I hypertensive sites from 98 cell lines). We detected pleiotropy in 24 of the 35 psychiatric-immune disorder pairs. The strongest pleiotropy was observed for schizophrenia-rheumatoid arthritis with MHC region included in the analysis (p = 3.9 x 10(-285), and schizophrenia-Crohn's disease with MHC region excluded (p = 1.1 x 10(-36). Significant enrichment (> 1.4 fold) of immune-related eQTL was observed in four psychiatric disorders. Genomic regions responsible for pleiotropy between psychiatric disorders and immune disorders were detected. The MHC region on chromosome 6 appears to be the most important with other regions, such as cytoband 1p13.2, also playing significant roles in pleiotropy. We also found that most alleles shared between schizophrenia and Crohn's disease have the same effect direction, with similar trend found for other disorder pairs, such as bipolar-Crohn's disease. Our results offer a novel bird's-eye view of the genetic relationship and demonstrate strong evidence for pervasive pleiotropy between psychiatric disorders and immune disorders. Our findings might open new routes for prevention and treatment strategies for these disorders based on a new appreciation of the importance of immunological mechanisms in mediating risk of many psychiatric diseases.
Also flagged:Phosphorylationresponse to hormonesprotein kinase APKAkinasemetabolism
Journal Article2015-09-04No SnippetsRinaldi L, Sepe M, Donne RD, Feliciello A.
Show Full Abstract
Phosphorylation waves drive the propagation of signals generated in response to hormones and growth factors in target cells. cAMP is an ancient second messenger implicated in key biological functions. In mammals, most of the effects elicited by cAMP are mediated by protein kinase A (PKA). Activation of the kinase by cAMP results in the phosphorylation of a variety of cellular substrates, leading to differentiation, proliferation, survival, metabolism. The identification of scaffold proteins, namely A-Kinase Anchor proteins (AKAPs), that localize PKA in specific cellular districts, provided critical cues for our understanding of the role played by cAMP in cell biology. Multivalent complexes are assembled by AKAPs and include signaling enzymes, mRNAs, adapter molecules, receptors and ion channels. A novel development derived from the molecular analysis of these complexes nucleated by AKAPs is represented by the presence of components of the ubiquitin-proteasome system (UPS). More to it, the AKAP complex can be regulated by the UPS, eliciting relevant effects on downstream cAMP signals. This represents a novel, yet previously unpredicted interface between compartmentalized signaling and the UPS. We anticipate that impairment of these regulatory mechanisms could promote cell dysfunction and disease. Here, we will focus on the reciprocal regulation between cAMP signaling and UPS, and its relevance to human degenerative and proliferative disorders.
Also flagged:Hydrogen SulfideHepcidinIL-6SecretionSTAT3iron
Journal Article2015-09-03✓ 1 SnippetXin H, Wang M, Tang W, Shen Z, Miao L, Wu W, Li C, Wang X, Xin X, Zhu YZ.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Aims</h4>Anemia of inflammation is quite prevalent in hospitalized patients with poor prognosis. Concerns about the effectiveness and safety of iron supplementation have arisen, driving the demand for alternative therapies. Induction of hepatic hepcidin, the master hormone of iron homeostasis, causes anemia under inflammatory conditions. Previous studies indicated that hydrogen sulfide (H2S), the third gasotransmitter and a well-known regulator of inflammation, may inhibit the secretion of inflammatory cytokines. We thus investigated the effect of H2S on inflammatory hepcidin induction.<h4>Results</h4>H2S suppressed lipopolysaccharide (LPS)-induced hepcidin production and regulated iron homeostasis in mice by decreasing serum interleukin-6 (IL-6) and Janus kinase 2 (JAK2)/signal transducer and activator of transcription 3 (STAT3) activation; similar results were obtained in Huh7 cells exposed to conditioned medium from LPS-challenged THP-1 macrophages. Intriguingly, we found H2S also attenuated hepcidin levels in Huh7 cells and mouse primary hepatocytes in a sirtuin 1 (SIRT1)-dependent manner. By promoting SIRT1 expression and stabilizing SIRT1-STAT3 interactions, H2S ameliorated IL-6-induced STAT3 acetylation, resulting in reduced hepcidin production. Inhibition and silencing of SIRT1 diminished H2S-mediated suppression of hepcidin, as opposed to SIRT1 activation and overexpression. Consistent results were observed in vivo. Furthermore, knockout of cystathionine γ-lyase (CSE), an endogenous H2S synthase, exaggerated inflammatory hepcidin expression in mice.<h4>Innovation</h4>For the first time, we elucidated the effects and possible mechanisms of H2S on inflammatory hepcidin and established a novel regulatory link between SIRT1 and hepcidin.<h4>Conclusion</h4>Our work demonstrates that H2S attenuates inflammation-induced hepatic hepcidin via multipathways and suggests new treatment strategies for anemia of inflammation.
Also flagged:Polyglutamineneurodegenerative diseasesHuntingtinmitochondrialsulfuriron
Journal Article2015-09-03✓ 2 SnippetsPapsdorf K, Kaiser CJ, Drazic A, Grötzinger SW, Haeßner C, Eisenreich W, Richter K.
In-Text Gene Mentions
Introduction)
…In Huntington’s disease, Huntingtin (Htt), a protein with yet unattributed function, exhibits a tendency to aggregate within cells if mutated [6].…
Introduction)
…ington’s disease, Huntingtin (Htt), a protein with…
Show Full Abstract
<h4>Background</h4>Protein aggregation and its pathological effects are the major cause of several neurodegenerative diseases. In Huntington's disease an elongated stretch of polyglutamines within the protein Huntingtin leads to increased aggregation propensity. This induces cellular defects, culminating in neuronal loss, but the connection between aggregation and toxicity remains to be established.<h4>Results</h4>To uncover cellular pathways relevant for intoxication we used genome-wide analyses in a yeast model system and identify fourteen genes that, if deleted, result in higher polyglutamine toxicity. Several of these genes, like UGO1, ATP15 and NFU1 encode mitochondrial proteins, implying that a challenged mitochondrial system may become dysfunctional during polyglutamine intoxication. We further employed microarrays to decipher the transcriptional response upon polyglutamine intoxication, which exposes an upregulation of genes involved in sulfur and iron metabolism and mitochondrial Fe-S cluster formation. Indeed, we find that in vivo iron concentrations are misbalanced and observe a reduction in the activity of the prominent Fe-S cluster containing protein aconitase. Like in other yeast strains with impaired mitochondria, non-fermentative growth is impossible after intoxication with the polyglutamine protein. NMR-based metabolic analyses reveal that mitochondrial metabolism is reduced, leading to accumulation of metabolic intermediates in polyglutamine-intoxicated cells.<h4>Conclusion</h4>These data show that damages to the mitochondrial system occur in polyglutamine intoxicated yeast cells and suggest an intricate connection between polyglutamine-induced toxicity, mitochondrial functionality and iron homeostasis in this model system.
Also flagged:methylationrectal cancercolorectal cancerscolon cancerrectal tumourtumours
Journal Article2015-09-03✓ 5 SnippetsExner R, Pulverer W, Diem M, Spaller L, Woltering L, Schreiber M, Wolf B, Sonntagbauer M, Schröder F, Stift J, Wrba F, Bergmann M, Weinhäusel A, Egger G.
In-Text Gene Mentions
Results)
…Using the different classification algorithms described in the ‘Material and Methods' section, we were able to define a three-gene signature, comprising TFPI2, DCC and PTGS2. The combined information of these three genes allowed a perfect discrimination between tumour samples and peripheral blood with a classification success of 100% (sensitivity: 1; specificity: 1; AUC: 1) (Figure 3 and Supplementary Table 3).…
Discussion)
…The signature differentiating tumours from PBMCs contained PTGS2 (prostaglandin-endoperoxide synthase 2), DCC (deleted in colorectal carcinoma) and TFPI2 (tissue factor pathway inhibitor 2).…
Discussion)
…DCC is a tumour suppressor and both deletion and promoter methylation of DCC are involved in its frequent downregulation in colorectal cancer (Tanaka et al, 1991; Derks et al, 2009).…
Results)
…, SFRP2 ,DCC, ESR1 ,…
Results)
…comprising TFPI2 ,DCCand PTGS2 .…
Show Full Abstract
<h4>Background</h4>Aberrant DNA methylation is more prominent in proximal compared with distal colorectal cancers. Although a number of methylation markers were identified for colon cancer, yet few are available for rectal cancer.<h4>Methods</h4>DNA methylation differences were assessed by a targeted DNA microarray for 360 marker candidates between 22 fresh frozen rectal tumour samples and 8 controls and validated by microfluidic high-throughput and methylation-sensitive qPCR in fresh frozen and formalin-fixed paraffin-embedded (FFPE) samples, respectively. The CpG island methylator phenotype (CIMP) was assessed by MethyLight in FFPE material from 78 patients with pT2 and pT3 rectal adenocarcinoma.<h4>Results</h4>We identified and confirmed two novel three-gene signatures in fresh frozen samples that can distinguish tumours from adjacent tissue as well as from blood with a high sensitivity and specificity of up to 1 and an AUC of 1. In addition, methylation of individual CIMP markers was associated with specific clinical parameters such as tumour stage, therapy or patients' age. Methylation of CDKN2A was a negative prognostic factor for overall survival of patients.<h4>Conclusions</h4>The newly defined methylation markers will be suitable for early disease detection and monitoring of rectal cancer.
Also flagged:ZincG9a MethyltransferaseG9aGLPlysine methyltransferaseshistone H3
Journal Article2015-09-03✓ 1 SnippetSimon JM, Parker JS, Liu F, Rothbart SB, Ait-Si-Ali S, Strahl BD, Jin J, Davis IJ, Mosley AL, Pattenden SG.
In-Text Gene Mentions
Text
…ZNF644…
Show Full Abstract
G9a and GLP lysine methyltransferases form a heterodimeric complex that is responsible for the majority of histone H3 lysine 9 mono- and di-methylation (H3K9me1/me2). Widely interspaced zinc finger (WIZ) associates with the G9a-GLP protein complex, but its role in mediating lysine methylation is poorly defined. Here, we show that WIZ regulates global H3K9me2 levels by facilitating the interaction of G9a with chromatin. Disrupting the association of G9a-GLP with chromatin by depleting WIZ resulted in altered gene expression and protein-protein interactions that were distinguishable from that of small molecule-based inhibition of G9a/GLP, supporting discrete functions of the G9a-GLP-WIZ chromatin complex in addition to H3K9me2 methylation.
Also flagged:PDneurodegenerative diseaseironpathogenesismetabolismSynthesis
Journal Article2015-09-03✓ 5 SnippetsDuan C, Wang M, Zhang Y, Wei X, Huang Y, Zhang H, Cheng L, Gai Z.
In-Text Gene Mentions
Title)
…C282Y and H63D Polymorphisms in Hemochromatosis Gene and Risk of Parkinson's Disease: A Meta-Analysis.…
Abstract)
…HFE) gene and the risk of Parkinson's disease…
Abstract)
…hemochromatosis (HFE…
Title)
…H63D Polymorphisms inHemochromatosisGene and Risk…
Abstract)
…the association betweenhemochromatosis(HFE) gene and…
Show Full Abstract
<h4>Objective</h4>A meta-analysis was performed to better clarify the association between hemochromatosis (HFE) gene and the risk of Parkinson's disease (PD).<h4>Methods</h4>Pooled odds ratio (OR) with 95% confidence interval (CI) was calculated from fixed- and random-effect models. Heterogeneity among studies was evaluated using the I(2) and Q test. Egger's test was used to estimate the publication bias.<h4>Results</h4>We identified 8 articles with 9 independent studies for this meta-analysis. The present meta-analysis showed no significant association of Y allele with the risk of PD in dominant (OR = 0.87, 95% CI = 0.70-1.09), recessive (OR = 1.58, 95% CI = 0.61-4.10), and codominant (OR = 0.88, 95% CI = 0.72-1.09) models for C282Y. There were also no significant associations of D allele with the risk of PD in dominant (OR = 1.04, 95% CI = 0.87-1.24), recessive (OR = 1.23, 95% CI = 0.70-2.18), and codominant (OR = 1.04, 95% CI = 0.89-1.22) genetic models for H63D. No publication bias was detected.<h4>Conclusion</h4>The meta-analysis indicated that C282Y and H63D polymorphisms in the HFE gene might not be associated with PD.
Also flagged:organizationOtoinfectionCD3tumor necrosis factor
Journal Article2015-09-03No SnippetsTacchi L, Larragoite ET, Muñoz P, Amemiya CT, Salinas I.
Show Full Abstract
One of the most remarkable innovations of the vertebrate adaptive immune system is the progressive organization of the lymphoid tissues that leads to increased efficiency of immune surveillance and cell interactions. The mucosal immune system of endotherms has evolved organized secondary mucosal lymphoid tissues (O-MALT) such as Peyer's patches, tonsils, and adenoids. Primitive semi-organized lymphoid nodules or aggregates (LAs) were found in the mucosa of anuran amphibians, suggesting that O-MALT evolved from amphibian LAs ∼250 million years ago. This study shows for the first time the presence of O-MALT in the mucosa of the African lungfish, an extant representative of the closest ancestral lineage to all tetrapods. Lungfish LAs are lymphocyte-rich structures associated with a modified covering epithelium and express all IGH genes except for IGHW2L. In response to infection, nasal LAs doubled their size and increased the expression of CD3 and IGH transcripts. Additionally, de novo organogenesis of inducible LAs resembling mammalian tertiary lymphoid structures was observed. Using deep-sequencing transcriptomes, we identified several members of the tumor necrosis factor (TNF) superfamily, and subsequent phylogenetic analyses revealed its extraordinary diversification within sarcopterygian fish. Attempts to find AICDA in lungfish transcriptomes or by RT-PCR failed, indicating the possible absence of somatic hypermutation in lungfish LAs. These findings collectively suggest that the origin of O-MALT predates the emergence of tetrapods and that TNF family members play a conserved role in the organization of vertebrate mucosal lymphoid organs.
Also flagged:Infectious Diseasesacquired immune deficiency syndromebehaviouraldiarrhoeaAIDSwater
Journal Article2015-09-03No SnippetsEjemot-Nwadiaro RI, Ehiri JE, Arikpo D, Meremikwu MM, Critchley JA.
Show Full Abstract
<h4>Background</h4>Diarrhoea accounts for 1.8 million deaths in children in low- and middle-income countries (LMICs). One of the identified strategies to prevent diarrhoea is hand washing.<h4>Objectives</h4>To assess the effects of hand washing promotion interventions on diarrhoeal episodes in children and adults.<h4>Search methods</h4>We searched the Cochrane Infectious Diseases Group Specialized Register (27 May 2015); CENTRAL (published in the Cochrane Library 2015, Issue 5); MEDLINE (1966 to 27 May 2015); EMBASE (1974 to 27 May 2015); LILACS (1982 to 27 May 2015); PsycINFO (1967 to 27 May 2015); Science Citation Index and Social Science Citation Index (1981 to 27 May 2015); ERIC (1966 to 27 May 2015); SPECTR (2000 to 27 May 2015); Bibliomap (1990 to 27 May 2015); RoRe, The Grey Literature (2002 to 27 May 2015); World Health Organization (WHO) International Clinical Trial Registry Platform (ICTRP), metaRegister of Controlled Trials (mRCT), and reference lists of articles up to 27 May 2015. We also contacted researchers and organizations in the field.<h4>Selection criteria</h4>Individually randomized controlled trials (RCTs) and cluster-RCTs that compared the effects of hand washing interventions on diarrhoea episodes in children and adults with no intervention.<h4>Data collection and analysis</h4>Three review authors independently assessed trial eligibility, extracted data, and assessed risk of bias. We stratified the analyses for child day-care centres or schools, community, and hospital-based settings. Where appropriate, incidence rate ratios (IRR) were pooled using the generic inverse variance method and random-effects model with 95% confidence intervals (CIs). We used the GRADE approach to assess the quality of evidence.<h4>Main results</h4>We included 22 RCTs: 12 trials from child day-care centres or schools in mainly high-income countries (54,006 participants), nine community-based trials in LMICs (15,303 participants), and one hospital-based trial among people with acquired immune deficiency syndrome (AIDS) (148 participants).Hand washing promotion (education activities, sometimes with provision of soap) at child day-care facilities or schools prevents around one-third of diarrhoea episodes in high income countries (rate ratio 0.70; 95% CI 0.58 to 0.85; nine trials, 4664 participants, high quality evidence), and may prevent a similar proportion in LMICs but only two trials from urban Egypt and Kenya have evaluated this (rate ratio 0.66, 95% CI 0.43 to 0.99; two trials, 45,380 participants, low quality evidence). Only three trials reported measures of behaviour change and the methods of data collection were susceptible to bias. In one trial from the USA hand washing behaviour was reported to improve; and in the trial from Kenya that provided free soap, hand washing did not increase, but soap use did (data not pooled; three trials, 1845 participants, low quality evidence).Hand washing promotion among communities in LMICs probably prevents around one-quarter of diarrhoea episodes (rate ratio 0.72, 95% CI 0.62 to 0.83; eight trials, 14,726 participants, moderate quality evidence). However, six of these eight trials were from Asian settings, with only single trials from South America and sub-Saharan Africa. In six trials, soap was provided free alongside hand washing education, and the overall average effect size was larger than in the two trials which did not provide soap (soap provided: rate ratio 0.66, 95% CI 0.56 to 0.78; six trials, 11,422 participants; education only: rate ratio: 0.84, 95% CI 0.67 to 1.05; two trials, 3304 participants). There was increased hand washing at major prompts (before eating/cooking, after visiting the toilet or cleaning the baby's bottom), and increased compliance to hand hygiene procedure (behavioural outcome) in the intervention groups than the control in community trials (data not pooled: three trials, 3490 participants, high quality evidence).Hand washing promotion for the one trial conducted in a hospital among high-risk population showed significant reduction in mean episodes of diarrhoea (1.68 fewer) in the intervention group (Mean difference 1.68, 95% CI 1.93 to 1.43; one trial, 148 participants, moderate quality evidence). There was increase in hand washing frequency, seven times per day in the intervention group versus three times in the control in this hospital trial (one trial, 148 participants, moderate quality evidence).We found no trials evaluating or reporting the effects of hand washing promotions on diarrhoea-related deaths, all-cause-under five mortality, or costs.<h4>Authors' conclusions</h4>Hand washing promotion probably reduces diarrhoea episodes in both child day-care centres in high-income countries and among communities living in LMICs by about 30%. However, less is known about how to help people maintain hand washing habits in the longer term.
Also flagged:pruritisviral infectionssclerosing cholangitislymph-adenopathysecondary sclerosing cholangitisvanishing bile duct syndrome
Journal Article2015-09-03✓ 1 SnippetAbedi SH, Ghassami M, Molaei M, Mohsenifar Z, Mohammad Alizadeh AH.
In-Text Gene Mentions
Abstract)
…autoimmune process, andhemochromatosis.…
Show Full Abstract
<h4>Context</h4>Liver damage is relatively common in patients affected by HL, but paraneoplastic cholestasis is an uncommon presenting symptom in HL.<h4>Case report</h4>We report the case of a 38-year-old man who came to our hospital with jaundice, pruritis, nausea, vomiting, weight loss, and recurrent episodes of fever without any hepatosplenomegaly or lymphadenopathy. Laboratory findings showed abnormal liver functioning with mixed hepatocellular and cholestatic patterns. Sonographic evaluation of the biliary tract was normal. We ruled out viral infections, autoimmune process, and hemochromatosis. The patient was put on ursobile and NAC (N-acetyl-systeine) and prednisolone treatment. In magnetic resonance cholangiopancreatography examination, there were multiple strictures in the intrahepatic and extrahepatic bile ducts with mild dilatation. Histologic finding of liver biopsy was compatible with sclerosing cholangitis or drug-induced cholestasis. General condition and laboratory examination results of the patient became better, but we found lymph-adenopathy on monthly follow-up examination. Histological finding of the lymph node was compatible with HL.<h4>Conclusion</h4>This report emphasizes that HL can be presented with different paraneoplastic symptoms and that one of them is secondary sclerosing cholangitis. It has better prognosis than vanishing bile duct syndrome, and perhaps steroid treatment can be suggested.
Peroxidases are enzymes catalyzing redox reactions that cleave peroxides. Their active redox centers have heme, cysteine thiols, selenium, manganese, and other chemical moieties. Peroxidases and their mimetic systems have several technological and biomedical applications such as environment protection, energy production, bioremediation, sensors and immunoassays design, and drug delivery devices. The combination of peroxidases or systems with peroxidase-like activity with nanostructures such as nanoparticles, nanotubes, thin films, liposomes, micelles, nanoflowers, nanorods and others is often an efficient strategy to improve catalytic activity, targeting, and reusability.
Also flagged:methanebiomethanedigestionbiomethanationcarbonnitrogen
Journal Article2015-09-03No SnippetsBarbot YN, Thomsen L, Benz R.
Show Full Abstract
Eutrophication is a phenomenon which can rapidly generate masses of marine macroalgae, particularly in areas with high nutrient pollution. Washed ashore, this biomass impairs coastal tourism and negatively affects the coastal ecosystem. The present study evaluates the biochemical methane potential (BMP) of a macroalgae mix (Rügen-Mix, RM (RM = Rügen-Mix)) originating from Rügen, Germany. To improve biomethane recovery, thermo-acidic pretreatment was applied to the biomass prior to biomethanation to disintegrate the biomass macrostructure. Acid hydrolysis was successfully triggered with 0.2 M industry-grade HCl at 80 °C for a 2 h period, increasing biomethane recovery by +39%, with a maximum BMP of 121 mL·g(-1) volatile solids (VS). To reduce the necessity for input material, HCl was replaced by the acidic waste product flue gas condensate (FGC). Improved performance was achieved by showing an increase in biomethane recovery of +24% and a maximum BMP of 108 mL·g(-1) VS. Continuous anaerobic digestion trials of RM were conducted for three hydraulic retention times, showing the feasibility of monodigestion. The biomethane recovery was 60 mL and 65 mL·g(-1) VS·d(-1) for thermophilic and mesophilic operation, respectively. The quality of biomethanation performance aligned to the composition of the source material which exhibited a low carbon/nitrogen ratio and an increased concentration of sulfur compounds.
Also flagged:extracellularcancerfolatedoxorubicinfumarateester
Journal Article2015-09-03No SnippetsLiu X, Miller AL, Waletzki BE, Mamo TK, Yaszemski MJ, Lu L.
Show Full Abstract
Biodegradable micelle systems with both extracellular stabilities and specific targeting properties are highly desirable for anti-cancer drug delivery. Here, we report a biodegradable and crosslinkable poly(propylene fumarate)-<i>co</i>-poly(lactide-<i>co</i>-glycolide)-<i>co</i>-poly(ethylene glycol) (PPF-PLGA-PEG) copolymer conjugated with folate (FA) molecules for receptor-mediated delivery of doxorubicin. Micelles with folate ligands on surface and fumarate bonds within the core were self-assembled and crosslinked, which exhibited better stability against potential physiological conditions during and after drug administration. A pH sensitive drug release profile was observed showing robust release at acidic environment due to the ester hydrolysis of PLGA (50:50). Further, micelles with folate ligands on surface showed strong targeting ability and therapeutic efficacy through receptor-mediated endocytosis, as evidenced by efficacious cancer killing and fatal DNA damage. These results imply promising potential for ligand-conjugated core crosslinked PPF-PLGA-PEG-FA micelles as carrier system for targeted anti-cancer drug delivery.
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
Also flagged:Serotonin TransporterdepressionSLE5-hydroxytryptamine transporterbehavioralserotonin
Journal Article2015-09-02✓ 1 SnippetArpawong TE, Lee J, Phillips DF, Crimmins EM, Levine ME, Prescott CA.
In-Text Gene Mentions
Text
…5-HTT…
Show Full Abstract
Depending on genetic sensitivity to it, stress may affect depressive symptomatology differentially. Applying the stress-diathesis hypothesis to older adults, we postulate: (1) recent stress will associate with increased depressive symptom levels and (2) this effect will be greater for individuals with at least one short allele of the serotonin transporter gene promoter region (5-HTTLPR). Further, we employ a design that addresses specific limitations of many prior studies that have examined the 5-HTTLPR × SLE relation, by: (a) using a within-person repeated-measures design to address fluctuations that occur within individuals over time, increase power for detecting G × E, and address GE correlation; (b) studying reports of exogenous stressful events (those unlikely to be caused by depression) to help rule out reverse causation and negativity bias, and in order to assess stressors that are more etiologically relevant to depressive symptomatology in older adults. The sample is drawn from the Health and Retirement Study, a U.S. population-based study of older individuals (N = 28,248; mean age = 67.5; 57.3 % female; 80.7 % Non-Hispanic White, 14.9 % Hispanic/Latino, 4.5 % African American; genetic subsample = 12,332), from whom measures of depressive symptoms and exogenous stressors were collected biannually (1994-2010). Variation in the 5-HTTLPR was characterized via haplotype, using two single nucleotide polymorphisms (SNPs). Ordered logit models were constructed to predict levels of depressive symptoms from 5-HTTLPR and stressors, comparing results of the most commonly applied statistical approaches (i.e., comparing allelic and genotypic models, and continuous and categorical predictors) used in the literature. All models were stratified by race/ethnicity. Overall, results show a main effect of recent stress for all ethnic groups, and mixed results for the variation in 5-HTTLPR × stress interaction, contingent upon statistical model used. Findings suggest there may be a differential effect of stressors and 5-HTTLPR on depressive symptoms by ethnicity, but further research is needed, particularly when using a haplotype to characterize variation in 5-HTTLPR in population-based sample with a diverse ethnic composition.
Also flagged:Gastric cancercancerscancerdeathpathogenesisprimary cancer
Journal Article2015-09-02No SnippetsZhang J, Huang JY, Chen YN, Yuan F, Zhang H, Yan FH, Wang MJ, Wang G, Su M, Lu G, Huang Y, Dai H, Ji J, Zhang J, Zhang JN, Jiang YN, Chen SJ, Zhu ZG, Yu YY.
Show Full Abstract
Gastric cancer is one of the most aggressive cancers and is the second leading cause of cancer death worldwide. Approximately 40% of global gastric cancer cases occur in China, with peritoneal metastasis being the prevalent form of recurrence and metastasis in advanced disease. Currently, there are limited clinical approaches for predicting and treatment of peritoneal metastasis, resulting in a 6-month average survival time. By comprehensive genome analysis will uncover the pathogenesis of peritoneal metastasis. Here we describe a comprehensive whole-genome and transcriptome sequencing analysis of one advanced gastric cancer case, including non-cancerous mucosa, primary cancer and matched peritoneal metastatic cancer. The peripheral blood is used as normal control. We identified 27 mutated genes, of which 19 genes are reported in COSMIC database (ZNF208, CRNN, ATXN3, DCTN1, RP1L1, PRB4, PRB1, MUC4, HS6ST3, MUC17, JAM2, ITGAD, IREB2, IQUB, CORO1B, CCDC121, AKAP2, ACAN and ACADL), and eight genes have not previously been described in gastric cancer (CCDC178, ARMC4, TUBB6, PLIN4, PKLR, PDZD2, DMBT1and DAB1).Additionally,GPX4 and MPND in 19q13.3-13.4 region, is characterized as a novel fusion-gene. This study disclosed novel biological markers and tumorigenic pathways that would predict gastric cancer occurring peritoneal metastasis.
Also flagged:Immune Responsesto stressIRaggressionsBF2Immune Response
Journal Article2015-09-02✓ 3 SnippetsSevane N, Cañon J, Gil I, Dunner S.
In-Text Gene Mentions
Discussion)
…In fact, 40% of the genes included in pathways related to cellular proliferation play also roles in different IR processes, some of them directly implicated in leukocyte proliferation, as for example: i) CD3E, essential for early thymocyte maturation, differentiation and proliferation of T lymphocytes [46]; ii) the T lymphocyte membrane protein CD5 (CD5), which plays a key role in B1 cell physiology [47]; iii) the protein kinases PRKCQ and SYK, with important roles from controlling cell growth and proliferation to the initiation and regulation of immunological responses [48]; or iv) TNFSF4, also known as OX40L, which promotes T cells proliferation, survival and differentiation, and regulates their cytokine production [49] (S4 Table).…
Discussion)
…]; or iv)TNFSF4, also known…
Discussion)
…, C1QTNFG ,TNFSF4, TNFRSF18 ,…
Show Full Abstract
Present and future challenges for wild partridge populations include the resistance against possible disease transmission after restocking with captive-reared individuals, and the need to cope with the stress prompted by new dynamic and challenging scenarios. Selection of individuals with the best immune ability may be a good strategy to improve general immunity, and hence adaptation to stress. In this study, non-infectious challenges with phytohemagglutinin (PHA) and sheep red blood cells allowed the classification of red-legged partridges (Alectoris rufa) according to their overall immune responses (IR). Skin from the area of injection of PHA and spleen, both from animals showing extreme high and low IR, were selected to investigate the transcriptional profiles underlying the different ability to cope with pathogens and external aggressions. RNA-seq yielded 97 million raw reads from eight sequencing libraries and approximately 84% of the processed reads were mapped to the reference chicken genome. Differential expression analysis identified 1488 up- and 107 down-regulated loci in individuals with high IR versus low IR. Partridges displaying higher innate IR show an enhanced activation of host defence gene pathways complemented with a tightly controlled desensitization that facilitates the return to cellular homeostasis. These findings indicate that the immune system ability to respond to aggressions (either diseases or stress produced by environmental changes) involves extensive transcriptional and post-transcriptional regulations, and expand our understanding on the molecular mechanisms of the avian immune system, opening the possibility of improving disease resistance or robustness using genome assisted selection (GAS) approaches for increased IR in partridges by using genes such as AVN or BF2 as markers. This study provides the first transcriptome sequencing data of the Alectoris genus, a resource for molecular ecology that enables integration of genomic tools in further studies.
<h4>Background</h4>Glomerular podocytes are highly differentiated cells that are key components of the kidney filtration units. The podocyte cytoskeleton builds the basis for the dynamic podocyte cytoarchitecture and plays a central role for proper podocyte function. Recent studies implicate that immunosuppressive agents including the mTOR-inhibitor everolimus have a protective role directly on the stability of the podocyte actin cytoskeleton. In contrast, a potential stabilization of microtubules by everolimus has not been studied so far.<h4>Methods</h4>To elucidate mechanisms underlying mTOR-inhibitor mediated cytoskeletal rearrangements, we carried out microarray gene expression studies to identify target genes and corresponding pathways in response to everolimus. We analyzed the effect of everolimus in a puromycin aminonucleoside experimental in vitro model of podocyte injury.<h4>Results</h4>Upon treatment with puromycin aminonucleoside, microarray analysis revealed gene clusters involved in cytoskeletal reorganization, cell adhesion, migration and extracellular matrix composition to be affected. Everolimus was capable of protecting podocytes from injury, both on transcriptional and protein level. Rescued genes included tubulin beta 2B class IIb (TUBB2B) and doublecortin domain containing 2 (DCDC2), both involved in microtubule structure formation in neuronal cells but not identified in podocytes so far. Validating gene expression data, Western-blot analysis in cultured podocytes demonstrated an increase of TUBB2B and DCDC2 protein after everolimus treatment, and immunohistochemistry in healthy control kidneys confirmed a podocyte-specific expression. Interestingly, Tubb2bbrdp/brdp mice revealed a delay in glomerular podocyte development as showed by podocyte-specific markers Wilm's tumour 1, Podocin, Nephrin and Synaptopodin.<h4>Conclusions</h4>Taken together, our study suggests that off-target, non-immune mediated effects of the mTOR-inhibitor everolimus on the podocyte cytoskeleton might involve regulation of microtubules, revealing a potential novel role of TUBB2B and DCDC2 in glomerular podocyte development.
Also flagged:bindinglocalizationchromosomegene expressiongerm cell developmentmitochondrial
Journal Article2015-09-02✓ 3 SnippetsClaußen M, Lingner T, Pommerenke C, Opitz L, Salinas G, Pieler T.
In-Text Gene Mentions
Methods)
…), 1:10,000; and anti-Stau1( Allison et…
Results)
…the exception ofStau1( Allison et…
Results)
…strong interaction ofStau1with the control…
Show Full Abstract
RNAs that localize to the vegetal cortex during Xenopus laevis oogenesis have been reported to function in germ layer patterning, axis determination, and development of the primordial germ cells. Here we report on the genome-wide, comparative analysis of differentially localizing RNAs in Xenopus laevis and Xenopus tropicalis oocytes, revealing a surprisingly weak degree of conservation in respect to the identity of animally as well as vegetally enriched transcripts in these closely related species. Heterologous RNA injections and protein binding studies indicate that the different RNA localization patterns in these two species are due to gain/loss of cis-acting localization signals rather than to differences in the RNA-localizing machinery.
Journal Article2015-09-02No SnippetsFrausto RF, Le DJ, Aldave AJ.
Show Full Abstract
The corneal endothelium plays a primary role in maintaining corneal homeostasis and clarity and must be surgically replaced with allogenic donor corneal endothelium in the event of visually significant dysfunction. However, a worldwide shortage of donor corneal tissue has led to a search for alternative sources of transplantable tissue. Cultured human corneal endothelial cells (HCEnC) have been shown to restore corneal clarity in experimental models of corneal endothelial dysfunction in animal models, but characterization of cultured HCEnC remains incomplete. To this end, we utilized next-generation RNA sequencing technology to compare the transcriptomic profile of ex vivo human corneal endothelial cells (evHCEnC) with that of primary HCEnC (pHCEnC) and HCEnC lines and to determine the utility of cultured and immortalized corneal endothelial cells as models of in vivo corneal endothelium. Multidimensional analyses of the transcriptome data sets demonstrated that primary HCEnC have a closer relationship to evHCEnC than do immortalized HCEnC. Subsequent analyses showed that the majority of the genes specifically expressed in HCEnC (not expressed in ex vivo corneal epithelium or fibroblasts) demonstrated a marked variability of expression in cultured cells compared with evHCEnC. In addition, genes associated with either corneal endothelial cell function or corneal endothelial dystrophies were investigated. Significant differences in gene expression and protein levels were observed in the cultured cells compared with evHCEnC for each of the genes tested except for AGBL1 and LOXHD1, which were not detected by RNA-seq or qPCR. Our transcriptomic analysis suggests that at a molecular level pHCEnC most closely resemble evHCEnC and thus represent the most viable cell culture-based therapeutic option for managing corneal endothelial cell dysfunction. Our findings also suggest that investigators should perform an assessment of the entire transcriptome of cultured HCEnC prior to determination of their potential clinical utility for the management of corneal endothelial cell failure.
Also flagged:reproductioninfertilitychromosomesteroidogenesispeptideMale infertility
Journal Article2015-09-02No SnippetsButler MG, Rafi SK, McGuire A, Manzardo AM.
Show Full Abstract
<h4>Objective</h4>To provide an update of currently recognized clinically relevant candidate and known genes for human reproduction and related infertility plotted on high resolution chromosome ideograms (850 band level) and represented alphabetically in tabular form.<h4>Method</h4>Descriptive authoritative computer-based website and peer-reviewed medical literature searches used pertinent keywords representing human reproduction and related infertility along with genetics and gene mutations. A master list of genes associated with human reproduction and related infertility was generated with a visual representation of gene locations on high resolution chromosome ideograms. GeneAnalytics pathway analysis was carried out on the resulting list of genes to assess underlying genetic architecture for infertility.<h4>Results</h4>Advances in genetic technology have led to the discovery of genes responsible for reproduction and related infertility. Genes identified (N=371) in our search primarily impact ovarian steroidogenesis through sex hormone biology, germ cell production, genito-urinary or gonadal development and function, and related peptide production, receptors and regulatory factors.<h4>Conclusions</h4>The location of gene symbols plotted on high resolution chromosome ideograms forms a conceptualized image of the distribution of human reproduction genes. The updated master list can be used to promote better awareness of genetics of reproduction and related infertility and advance discoveries on genetic causes and disease mechanisms.
Also flagged:calcium channelsdendritessuperoxide dismutase 1SOD1amyotrophic lateral sclerosisALS
Journal Article2015-09-02No SnippetsDurand J, Filipchuk A, Pambo-Pambo A, Amendola J, Borisovna Kulagina I, Guéritaud JP.
Show Full Abstract
We studied the rapid changes in electrical properties of lumbar motoneurons between postnatal days 3 and 9 just before mice weight-bear and walk. The input conductance and rheobase significantly increased up to P8. A negative correlation exists between the input resistance (Rin) and rheobase. Both parameters are significantly correlated with the total dendritic surface area of motoneurons, the largest motoneurons having the lowest Rin and the highest rheobase. We classified the motoneurons into three groups according to their discharge firing patterns during current pulse injection (transient, delayed onset, sustained). The delayed onset firing type has the highest rheobase and the fastest action potential (AP) whereas the transient firing group has the lowest rheobase and the less mature AP. We found 32 and 10% of motoneurons with a transient firing at P3-P5 and P8, respectively. About 20% of motoneurons with delayed onset firing were detected at P8. At P9, all motoneurons exhibit a sustained firing. We defined five groups of motoneurons according to their discharge firing patterns in response to ascending and descending current ramps. In addition to the four classical types, we defined a fifth type called transient for the quasi-absence of discharge during the descending phase of the ramp. This transient type represents about 40% between P3-P5 and tends to disappear with age. Types 1 and 2 (linear and clockwise hysteresis) are the most preponderant at P6-P7. Types 3 and 4 (prolonged sustained and counter clockwise hysteresis) emerge at P8-P9. The emergence of types 3 and 4 probably depends on the maturation of L type calcium channels in the dendrites of motoneurons. No correlation was found between groups defined by step or triangular ramp of currents with the exception of transient firing patterns. Our data support the idea that a switch in the electrical properties of lumbar motoneurons might exist in the second postnatal week of life in mice.
Also flagged:LanthanumHydroxyapatiteTitaniumalkaline phosphatasecell proliferationapatite
Journal Article2015-09-02No SnippetsLou W, Dong Y, Zhang H, Jin Y, Hu X, Ma J, Liu J, Wu G.
Show Full Abstract
Titanium (Ti) has been widely used in clinical applications for its excellent biocompatibility and mechanical properties. However, the bioinertness of the surface of Ti has motivated researchers to improve the physicochemical and biological properties of the implants through various surface modifications, such as coatings. For this purpose, we prepared a novel bioactive material, a lanthanum-incorporated hydroxyapatite (La-HA) coating, using a dip-coating technique with a La-HA sol along with post-heat treatment. The XRD, FTIR and EDX results presented in this paper confirmed that lanthanum was successfully incorporated into the structure of HA. The La-HA coating was composed of rod-like particles which densely compacted together without microcracks. The results of the interfacial shear strength test indicated that the incorporation of lanthanum increased the bonding strength of the HA coating. The mass loss ratios under acidic conditions (pH=5.5) suggested that the La-HA coatings have better acid resistance. The cytocompatibility of the La-HA coating was also revealed by the relative activity of alkaline phosphatase, cellular morphology and cell proliferation assay in vitro. The present study suggested that La-HA coated on Ti has promising potential for applications in the development of a new type of bioactive coating for metal implants.
…Overexpression of OLFM4 has been reported to promote progression of some cancer types [82].…
Show Full Abstract
Cholangiocarcinoma (CCA) is an aggressive biliary tract malignancy arising from the epithelial bile duct. The lack of early diagnostic biomarkers as well as therapeutic measures results in severe outcomes and poor prognosis. Thus, effective early diagnostic, prognostic, and therapeutic biomarkers are required to improve the prognosis and prolong survival rates in CCA patients. Recent advancement in omics technologies combined with the integrative experimental and clinical validations has provided an insight into the underlying mechanism of CCA initiation and progression as well as clues towards novel biomarkers. This work highlights the discovery and validation of molecular markers in CCA identified through omics approaches. The possible roles of these molecules in various cellular pathways, which render CCA carcinogenesis and progression, will also be discussed. This paper can serve as a reference point for further investigations to yield deeper understanding in the complex feature of this disease, potentially leading to better approaches for diagnosis, prognosis, and therapeutics.
Also flagged:Gene Expressionagingorganellebindingactivitycell cycle
Journal Article2015-09-02No SnippetsWei H, Liu X, Yuan J, Li L, Zhang D, Guo X, Liu L, Zhang S.
Show Full Abstract
The biological function of human ovaries declines with age. To identify the potential molecular changes in ovarian aging, we performed genome-wide gene expression analysis by microarray of ovaries from young, middle-aged, and old rhesus monkeys. Microarray data was validated by quantitative real-time PCR. Results showed that a total of 503 (60 upregulated, 443 downregulated) and 84 (downregulated) genes were differentially expressed in old ovaries compared to young and middle-aged groups, respectively. No difference in gene expression was found between middle-aged and young groups. Differentially expressed genes were mainly enriched in cell and organelle, cellular and physiological process, binding, and catalytic activity. These genes were primarily associated with KEGG pathways of cell cycle, DNA replication and repair, oocyte meiosis and maturation, MAPK, TGF-beta, and p53 signaling pathway. Genes upregulated were involved in aging, defense response, oxidation reduction, and negative regulation of cellular process; genes downregulated have functions in reproduction, cell cycle, DNA and RNA process, macromolecular complex assembly, and positive regulation of macromolecule metabolic process. These findings show that monkey ovary undergoes substantial change in global transcription with age. Gene expression profiles are useful in understanding the mechanisms underlying ovarian aging and age-associated infertility in primates.
Also flagged:copper deficiency anemiazincvitamin B12anemiacoppercopper deficiency
Journal Article2015-09-02✓ 1 SnippetMerza H, Sood N, Sood R.
In-Text Gene Mentions
Discussion)
…as seen inhemochromatosishave also been…
Show Full Abstract
Prompt serum copper and zinc in addition to vitamin B12 levels should be measured in patients suffering from refractory anemia with neurological symptoms. A timely copper supplementation can help revert the hematological and possibly the neurological manifestations.
<h4>Background</h4>The peptide hepcidin plays a central role in regulating dietary iron absorption and body iron distribution. This 25-amino acid hormone is produced and secreted predominantly by hepatocytes. Hepcidin has been suggested as a promising diagnostic marker for iron-related disorders. However, its accurate quantification for clinical use remains so far challenging. In this report we describe a highly specific and quantitative serum hepcidin method using liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS).<h4>Material</h4>The analytical validation included the determination of the limit of detection, of quantification, repeatability, reproducibility and linearity. This assay was developed for human and mouse hepcidin. The human assay was performed on serum patients with unexplained microcytic anemia. We applied our LC-MS/MS method for quantifying hepcidin-1 in mouse in various conditions: inflammation, hemolytic anemia, Hamp-1, Hjv and Hfe KO mice.<h4>Results</h4>We show that the LC-MS/MS is suitable for accurate determination of hepcidin-25 in clinical samples, thereby representing a useful tool for the clinical diagnosis and follow-up of iron-related diseases. In mouse, a strong correlation between hepatic Hamp-1 mRNA expression and serum hepcidin-1 levels was found (r=0.88; p=0.0002) and the expected variations in mouse models of iron disorders were observed.<h4>Conclusions</h4>Therefore, we propose this adaptive LC-MS/MS method as a suitable method for accurate determination of hepcidin-25 in clinical samples and as a major tool contributing to the clinical diagnosis, follow-up and management of iron-related disorders. It also opens new avenues to measure hepcidin in animal models without interspecies antigenic limitations.
Also flagged:Voltage-gated calcium channelsmembranedepolarizationsecretioncalcium channelCalcium
Journal Article2015-09-01✓ 1 SnippetCampiglio M, Flucher BE.
In-Text Gene Mentions
Introduction)
…Densin, another PDZ domain…
Show Full Abstract
Voltage-gated calcium channels (VGCCs) represent the sole mechanism to convert membrane depolarization into cellular functions like secretion, contraction, or gene regulation. VGCCs consist of a pore-forming α(1) subunit and several auxiliary channel subunits. These subunits come in multiple isoforms and splice-variants giving rise to a stunning molecular diversity of possible subunit combinations. It is generally believed that specific auxiliary subunits differentially regulate the channels and thereby contribute to the great functional diversity of VGCCs. If auxiliary subunits can associate and dissociate from pre-existing channel complexes, this would allow dynamic regulation of channel properties. However, most auxiliary subunits modulate current properties very similarly, and proof that any cellular calcium channel function is indeed modulated by the physiological exchange of auxiliary subunits is still lacking. In this review we summarize available information supporting a differential modulation of calcium channel functions by exchange of auxiliary subunits, as well as experimental evidence in support of alternative functions of the auxiliary subunits. At the heart of the discussion is the concept that, in their native environment, VGCCs function in the context of macromolecular signaling complexes and that the auxiliary subunits help to orchestrate the diverse protein-protein interactions found in these calcium channel signalosomes. Thus, in addition to a putative differential modulation of current properties, differential subcellular targeting properties and differential protein-protein interactions of the auxiliary subunits may explain the need for their vast molecular diversity.
<h4>Introduction</h4>Venous thromboembolism (VTE) in children who undergo hematopoietic stem cell transplantation (HSCT) has high morbidity. The aim of this study is to assess the incidence of VTE in allogeneic pediatric HSCT recipients and the contribution of pretransplant prothrombotic risk factors to thrombosis.<h4>Methods</h4>We retrospectively evaluated 92 patients between April 2010 and November 2012 undergoing allogeneic HSCT who had completed 100 days post-HSCT. Before HSCT, coagulation profiles; acquired and inherited prothrombotic risk factors including factor V Leiden, prothrombin G20210A, methylenetetrahydrofolate reductase (MTHFR) C677T, and MTHFR A1298C mutations; and serum homocysteine and lipoprotein(a), plasma antithrombin III, protein C, and protein S levels were obtained from all patients.<h4>Results</h4>In the screening of thrombophilia, 8 patients (9%) were heterozygous for factor V Leiden, 5 (6%) were homozygous for MTHFR 677TT, 12 (14%) were homozygous for MTHFR 1298CC, and 2 (2%) were heterozygous for prothrombin G20210A mutation. We observed VTE in 5 patients (5.4%); a prothrombotic risk factor was found in 3 out of these 5 patients, while 4 out of 5 patients had central venous catheters. It was determined there was no significant relationship between VTE and inherited prothrombotic risk factors.<h4>Discussion and conclusion</h4>VTE after HSCT seems to be a low-frequency event that may be due to low-dose, low-molecular-weight heparin prophylaxis, and the role of inherited prothrombotic risk factors cannot be entirely excluded without a prospective study.
Also flagged:cancerPeroxiredoxin 6lung cancercell growthperoxidasescalcium
Journal Article2015-09-01✓ 5 SnippetsLee HL, Park MH, Son DJ, Song HS, Kim JH, Ko SC, Song MJ, Lee WH, Yoon JH, Ham YW, Han SB, Hong JT.
In-Text Gene Mentions
Abstract)
…Since AP-1 is implicated in tumor growth and PRDX6 expression, in the present study, we investigated whether SVT inhibits PRDX6, thereby preventing human lung cancer cell growth (A549 and NCI-H460) through inactivation of AP-1.…
Discussion)
…Previously, we found that PRDX6 accelates lung tumor progression [29].…
Discussion)
…Our previous study also found that higher lung tumor growth in PRDX6-overexpressing transgenic mice was associated with an increase in AP-1 DNA-binding activity [30].…
Introduction)
…PRDX6 expression was significantly higher in human tissue samples of TSCCs (tongue squamous cell carcinomas) compared with the 10 corresponding adjacent normal tissues [28].…
S I O 001029)
…Tumor sections of mice were analyzed by H&E, PCNA, PRDX6, Caspase-3 and c-Fos by immunohistochemistry C. Expression of iPLA2 was detected by ELISA kit D. AP-1 activity in tumor tissue E. The resultant tissues were developed with DAB, and counterstained with hematoxylin.…
Show Full Abstract
Snake venom toxin (SVT) from Vipera lebetina turanica contains a mixture of different enzymes and proteins. Peroxiredoxin 6 (PRDX6) is known to be a stimulator of lung cancer cell growth. PRDX6 is a member of peroxidases, and has calcium-independent phospholipase A2 (iPLA2) activities. PRDX6 has an AP-1 binding site in its promoter region of the gene. Since AP-1 is implicated in tumor growth and PRDX6 expression, in the present study, we investigated whether SVT inhibits PRDX6, thereby preventing human lung cancer cell growth (A549 and NCI-H460) through inactivation of AP-1. A docking model study and pull down assay showed that SVT completely fits on the basic leucine zipper (bZIP) region of c-Fos of AP-1. SVT (0-10 μg/ml) inhibited lung cancer cell growth in a concentration dependent manner through induction of apoptotic cell death accompanied by induction of cleaved caspase-3, -8, -9, Bax, p21 and p53, but decreased cIAP and Bcl2 expression via inactivation of AP-1. In an xenograft in vivo model, SVT (0.5 mg/kg and 1 mg/kg) also inhibited tumor growth accompanied with the reduction of PRDX6 expression, but increased expression of proapoptotic proteins. These data indicate that SVT inhibits tumor growth via inhibition of PRDX6 activity through interaction with its transcription factor AP-1.
Extracorporeal membrane oxygenation (ECMO) is a pivotal bridge to recovery for cardiopulmonary failure in children. Besides its life-saving quality, it is often associated with severe system-related complications, such as hemolysis, inflammation, and thromboembolism. Novel oxygenator and pump systems may reduce such ECMO-related complications. The ExMeTrA oxygenator is a newly designed pediatric oxygenator with an integrated pulsatile pump minimizing the priming volume and reducing the surface area of blood contact. The aim of our study was to investigate the feasibility and safety of this new ExMeTrA (expansion mediated transport and accumulation) oxygenator in an animal model. During 6 h of extracorporeal circulation (ECC) in pigs, parameters of the hemostatic system including coagulation, platelets and complement activation, and flow rates were investigated. A nonsignificant trend in C3 consumption, thrombin-antithrombin-III (TAT) complex formation and a slight trend in hemolysis were detected. During the ECC, the blood flow was constantly at 500 ml/min using only flexible silicone tubes inside the oxygenator as pulsatile pump. Our data clearly indicate that the hemostatic markers were only slightly influenced by the ExMeTrA oxygenator. Additionally, the oxygenator showed a constant quality of blood flow. Therefore, this novel pediatric oxygenator shows the potential to be used in pediatric and neonatal support with ECMO.
Also flagged:hypomethylationcolorectal cancercolon cancertumormethylationhMLH1
Journal Article2015-09-01✓ 1 SnippetZhuo C, Li Q, Wu Y, Li Y, Nie J, Li D, Peng J, Lian P, Li B, Cai G, Li X, Cai S.
In-Text Gene Mentions
Introduction)
…mutations in theDCC, SMAD2/SMAD4 and TP53…
Show Full Abstract
Genetic and epigenetic pathways are not independent in colorectal cancer (CRC) carcinogenesis. We aimed to determine the influence of various molecular features on Chinese patients' colon cancer-specific survival (CCSS). Various genetic and epigenetic modifications were detected in paired tumor and normal mucosa tissue samples. The prognostic variables regarding patient CCSS were determined. Overall, 127 patients, including 83 males and 44 females, completed a median follow-up of 65 (3-85) months. A mean LINE-1 methylation rate of 64.62% (range, 9.45-86.93) was observed. Hypermethylation at the hMLH1 gene promoter was detected in 26 (20.47%) patients. KRAS was mutated in 52 (40.94%) patients. Sixteen (12.60%) patients were confirmed as microsatellite instability (MSI)-High, and 76 (59.84%) were found to have loss of heterozygosity at 18q. The LINE-1 methylation level, MSI status, perineural invasion and distant metastases were confirmed as independent prognostic factors for patient CCSS. A stratified survival analysis further revealed that certain subgroups of patients with LINE-1 hypomethylation had significantly worse survival (all p < 0.05). Our data revealed that both genetic and epigenetic abnormalities can concurrently exist during colonic tumorigenesis. As a global epigenetic change, LINE-1 hypomethylation in normal colon mucosa might be associated with a worse outcome in certain Chinese patients with colon cancer.
Also flagged:ALSFTDTDP-43glioblastomaAmyotrophic lateral sclerosisfrontotemporal dementia
Journal Article2015-09-01✓ 3 SnippetsDing X, Ma M, Teng J, Teng RK, Zhou S, Yin J, Fonkem E, Huang JH, Wu E, Wang X.
In-Text Gene Mentions
Introduction)
…The intercellular transfer of aggregates made of tau, α-synuclein, and huntingtin (Htt) has been demonstrated; evidence for such a prion-like propagation mechanism has now spread to TDP-43 aggregates implicated in ALS and/or FTD.…
Introduction)
…α-synuclein, and huntingtin (Htt) has been demonstrated;…
Results)
…22 ] andHttaggregates [ 23…
Show Full Abstract
Amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) represent a continuum of devastating neurodegenerative diseases, characterized by transactive response DNA-binding protein of 43 kDa (TDP-43) aggregates accumulation throughout the nervous system. Despite rapidly emerging evidence suggesting the hypothesis of 'prion-like propagation' of TDP-43 positive inclusion in the regional spread of ALS symptoms, whether and how TDP-43 aggregates spread between cells is not clear. Herein, we established a cerebrospinal fluid (CSF)-cultured cell model to dissect mechanisms governing TDP-43 aggregates formation and propagation. Remarkably, intracellular TDP-43 mislocalization and aggregates were induced in the human glioma U251 cells following exposure to ALS-FTD-CSF but not ALS-CSF and normal control (NC) -CSF for 21 days. The exosomes derived from ALS-FTD-CSF were enriched in TDP-43 C-terminal fragments (CTFs). Incubation of ALS-FTD-CSF induced the increase of mislocated TDP-43 positive exosomes in U251 cells. We further demonstrated that exposure to ALS-FTD-CSF induced the generations of tunneling nanotubes (TNTs)-like structure and exosomes at different stages, which mediated the propagation of TDP-43 aggregates in the cultured U251 cells. Moreover, immunoblotting analyses revealed that abnormal activations of apoptosis and autophagy were induced in U251 cells, following incubation of ALS-CSF and ALS-FTD-CSF. Taken together, our data provide direct evidence that ALS-FTD-CSF has prion-like transmissible properties. TNTs-like structure and exosomes supply the routes for the transfer of TDP-43 aggregates, and selective inhibition of their over-generations may interrupt the progression of TDP-43 proteinopathy.
Also flagged:Asiatic acidmaslinic acidtriterpenoidsglucosecreatine phosphokinaselactate dehydrogenase
Journal Article2015-09-01✓ 1 SnippetHung YC, Yang HT, Yin MC.
In-Text Gene Mentions
Abstract)
…intake maintained circulatingantithrombin-IIIand protein C…
Show Full Abstract
The cardiac protective effects of asiatic acid (AA) and maslinic acid (MA) in diabetic mice were examined. These triterpenoids at 0.1 or 0.2% of the diet were supplied to diabetic mice for 12 weeks. The AA or MA treatments decreased plasma glucose and HbA1c levels, and creatine phosphokinase and lactate dehydrogenase activities in diabetic mice (p < 0.05). AA or MA intake increased the amount deposited in the heart which retained the cardiac glutathione content and reduced the production of reactive oxygen species, N(ε)-(carboxymethyl)-lysine, pentosidine, methylglyoxal, interleukin-6, tumor necrosis factor-alpha and monocyte chemoattractant protein-1 in the hearts of diabetic mice (p < 0.05). AA or MA intake lowered plasma von Willebrand factor and fibrinogen levels, and factor VII activity (p < 0.05), also AA or MA intake maintained circulating antithrombin-III and protein C activities (p < 0.05). AA or MA treatments down-regulated cardiac expression of NADPH oxidase, aldose reductase, nuclear factor kappa B (NF-κB) p65 and p-p38; as well as reserving glyoxalase 1 expression (p < 0.05). These two compounds at only 0.2% lowered cardiac expression of NF-κB p50, p-ERK1/2 and the receptor of the advanced glycation endproduct (p < 0.05). These findings support the conclusion that the supplement of these triterpenoids could protect the heart under diabetic conditions via attenuating glycative injury and coagulatory disorders.
Also flagged:Hereditary hemochromatosisiron storage diseaseliver cirrhosisdiabetesironarthropathy
Journal Article2015-09-01✓ 3 SnippetsOppl B, Zwerina J.
In-Text Gene Mentions
Abstract)
…The homozygous C282Y mutation in the HFE gene is responsible for most cases of hereditary hemochromatosis, although other much rarer mutations in other genes have been recently identified.…
Title)
…[Hemochromatosis].…
Abstract)
…mutation in theHFEgene is responsible…
Show Full Abstract
Hereditary hemochromatosis is a frequent autosomal recessive iron storage disease in northern and western Europe. The classical clinical triad of liver cirrhosis, hyperpigmentation and diabetes is nowadays rare, most probably because of early recognition. The homozygous C282Y mutation in the HFE gene is responsible for most cases of hereditary hemochromatosis, although other much rarer mutations in other genes have been recently identified. Progressive iron overload not only causes liver cirrhosis but also triggers development of a characteristic arthropathy. Bony swelling with intermittent arthritis of the second and third metacarpophalangeal joints is typical as well as occurrence of chondrocalcinosis in wrists and knee joints. The therapy of choice is excess iron removal by phlebotomy. Treatment usually prevents or even reverses liver damage but does not alter the course of hemochromatosis arthropathy.
Also flagged:peptideMHClipidCD1infectionscell activation
Journal Article2015-09-01No Snippetsde Jong A.
Show Full Abstract
Over two decades ago, it was discovered that the human T-cell repertoire contains T cells that do not recognize peptide antigens in the context of MHC molecules but instead respond to lipid antigens presented by CD1 antigen-presenting molecules. The ability of T cells to 'see' lipid antigens bound to CD1 enables these lymphocytes to sense changes in the lipid composition of cells and tissues as a result of infections, inflammation, or malignancies. Although foreign lipid antigens have been shown to function as antigens for CD1-restricted T cells, many CD1-restricted T cells do not require foreign antigens for activation but instead can be activated by self-lipids presented by CD1. This review highlights recent developments in the field, including the identification of common mammalian lipids that function as autoantigens for αβ and γδ T cells, a novel mode of T-cell activation whereby CD1a itself rather than lipids serves as the autoantigen, and various mechanisms by which the activation of CD1-autoreactive T cells is regulated. As CD1 can induce T-cell effector functions in the absence of foreign antigens, multiple mechanisms are in place to regulate this self-reactivity, and stimulatory CD1-lipid complexes appear to be tightly controlled in space and time.
Also flagged:GlioblastomaGBMbrain tumorgene expressionCDC6DLG7
Journal Article2015-09-01✓ 3 SnippetsStangeland B, Mughal AA, Grieg Z, Sandberg CJ, Joel M, Nygård S, Meling T, Murrell W, Vik Mo EO, Langmoen IA.
In-Text Gene Mentions
Results)
…We also looked into interactions between the proteins encoded by the 20 selected genes and products of SOX2, OLIG2, POU3F2 and SALL2 that were recently identified as a core set of transcriptional factors essential for neurodevelopment and GBM propagation [27].…
Results)
…of SOX2, OLIG2,POU3F2and SALL2 that…
Results)
…HIF1A, EGFR, NF1,POU3F2and SALL2 .…
Show Full Abstract
Glioblastoma (GBM) is both the most common and the most lethal primary brain tumor. It is thought that GBM stem cells (GSCs) are critically important in resistance to therapy. Therefore, there is a strong rationale to target these cells in order to develop new molecular therapies.To identify molecular targets in GSCs, we compared gene expression in GSCs to that in neural stem cells (NSCs) from the adult human brain, using microarrays. Bioinformatic filtering identified 20 genes (PBK/TOPK, CENPA, KIF15, DEPDC1, CDC6, DLG7/DLGAP5/HURP, KIF18A, EZH2, HMMR/RHAMM/CD168, NOL4, MPP6, MDM1, RAPGEF4, RHBDD1, FNDC3B, FILIP1L, MCC, ATXN7L4/ATXN7L1, P2RY5/LPAR6 and FAM118A) that were consistently expressed in GSC cultures and consistently not expressed in NSC cultures. The expression of these genes was confirmed in clinical samples (TCGA and REMBRANDT). The first nine genes were highly co-expressed in all GBM subtypes and were part of the same protein-protein interaction network. Furthermore, their combined up-regulation correlated negatively with patient survival in the mesenchymal GBM subtype. Using targeted proteomics and the COGNOSCENTE database we linked these genes to GBM signalling pathways.Nine genes: PBK, CENPA, KIF15, DEPDC1, CDC6, DLG7, KIF18A, EZH2 and HMMR should be further explored as targets for treatment of GBM.
Also flagged:Adrenocortical carcinomaACCmitotaneantibodiesinsulin-like growth factor IIIGFII) receptor
Journal Article2015-09-01No SnippetsCasaburi I, Avena P, De Luca A, Chimento A, Sirianni R, Malivindi R, Rago V, Fiorillo M, Domanico F, Campana C, Cappello AR, Sotgia F, Lisanti MP, Pezzi V.
Show Full Abstract
The pathogenesis of the adrenocortical cancer (ACC) involves integration of molecular signals and the interplay of different downstream pathways (i.e. IGFII/IGF1R, β-catenin, Wnt, ESR1). This tumor is characterized by limited therapeutic options and unsuccessful treatments. A useful strategy to develop an effective therapy for ACC is to identify a common downstream target of these multiple pathways. A good candidate could be the transcription factor estrogen-related receptor alpha (ERRα) because of its ability to regulate energy metabolism, mitochondrial biogenesis and signalings related to cancer progression. In this study we tested the effect of ERRα inverse agonist, XCT790, on the proliferation of H295R adrenocortical cancer cell line. Results from in vitro and in vivo experiments showed that XCT790 reduced H295R cell growth. The inhibitory effect was associated with impaired cell cycle progression which was not followed by any apoptotic event. Instead, incomplete autophagy and cell death by a necrotic processes, as a consequence of the cell energy failure, induced by pharmacological reduction of ERRα was evidenced. Our results indicate that therapeutic strategies targeting key factors such as ERRα that control the activity and signaling of bioenergetics processes in high-energy demanding tumors could represent an innovative/alternative therapy for the treatment of ACC.
Also flagged:BortezomibBurkitt's lymphomacell proliferationhnRNP Kproteasomemultiple myelomas
Journal Article2015-09-01No SnippetsSuk FM, Lin SY, Lin RJ, Hsine YH, Liao YJ, Fang SU, Liang YC.
Show Full Abstract
Bortezomib (Velcal) was the first proteasome inhibitor to be approved by the US Food and Drug Administration to treat patients with relapsed/refractory multiple myelomas. Previous studies have demonstrated that bortezomib inhibits tumor cell proliferation and induces apoptosis by blocking the nuclear factor (NF)-κB pathway. However, the exact mechanism by which bortezomib induces cancer cell apoptosis is still not well understood. In this study, we found that bortezomib significantly inhibited cell proliferation in both human Burkitt's lymphoma CA46 and Daudi cells. Through proteomic analysis, we found that bortezomib treatment changed the expression of various proteins in distinct functional categories including unfolding protein response (UPS), RNA processing, protein targeting and biosynthesis, apoptosis, and signal transduction. Among the proteins with altered expression, hnRNP K, hnRNP H, Hsp90α, Grp78, and Hsp7C were common to both Daudi and CA46 cells. Interestingly, bortezomib treatment downregulated the expression of high-molecular-weight (HMw) hnRNP K and c-Myc but upregulated the expression of low-molecular-weight (LMw) hnRNP K. Moreover, cell proliferation was significantly correlated with high expression of HMw hnRNP K and c-Myc. HMw and LMw hnRNP K were identified as sumoylated and desumoylated hnRNP K, respectively. Using transient transfection, we found that sumoylated hnRNP K increased c-Myc expression at the translational level and contributed to cell proliferation, and that Lys422 of hnRNP K is the candidate sumoylated residue. Our results suggest that besides inhibiting the ubiquitin-proteasome pathway, bortezomib may inhibit cell proliferation by downregulating sumoylated hnRNP K and c-Myc expression in Burkitt's lymphoma cells.
Also flagged:degradationubiquitinproteasomeE3 ubiquitin ligasesF-box adaptor proteinsF-box proteins
Journal Article2015-09-01✓ 1 SnippetSaritas-Yildirim B, Pliner HA, Ochoa A, Silva EM.
In-Text Gene Mentions
Methods)
…but 8 genes (Fbxl4, Fbxo10, Fbxo15, Fbxo32,…
Show Full Abstract
Protein degradation via the multistep ubiquitin/26S proteasome pathway is a rapid way to alter the protein profile and drive cell processes and developmental changes. Many key regulators of embryonic development are targeted for degradation by E3 ubiquitin ligases. The most studied family of E3 ubiquitin ligases is the SCF ubiquitin ligases, which use F-box adaptor proteins to recognize and recruit target proteins. Here, we used a bioinformatics screen and phylogenetic analysis to identify and annotate the family of F-box proteins in the Xenopus tropicalis genome. To shed light on the function of the F-box proteins, we analyzed expression of F-box genes during early stages of Xenopus development. Many F-box genes are broadly expressed with expression domains localized to diverse tissues including brain, spinal cord, eye, neural crest derivatives, somites, kidneys, and heart. All together, our genome-wide identification and expression profiling of the Xenopus F-box family of proteins provide a foundation for future research aimed to identify the precise role of F-box dependent E3 ubiquitin ligases and their targets in the regulatory circuits of development.
Also flagged:lackCrizotinibMAPK7Everolimusairphenol
Journal Article2015-09-01No SnippetsCuriel-Olmo S, García-Castaño A, Vidal R, Pisonero H, Varela I, León-Castillo A, Trillo E, González-Vela C, García-Diaz N, Almaraz C, Moreno T, Cereceda L, Madureira R, Martinez N, Ortiz-Romero P, Valdizán E, Piris MA, Vaqué JP.
Show Full Abstract
Targeted treatment of advanced melanoma could benefit from the precise molecular characterization of melanoma samples. Using a melanoma-specific selection of 217 genes, we performed targeted deep sequencing of a series of biopsies, from advanced melanoma cases, with a Breslow index of ≥ 4 mm, and/or with a loco-regional infiltration in lymph nodes or presenting distant metastasis, as well of a collection of human cell lines. This approach detected 3-4 mutations per case, constituting unique mutational signatures associated with specific inhibitor sensitivity. Functionally, case-specific combinations of inhibitors that simultaneously targeted MAPK-dependent and MAPK-independent mechanisms were most effective at inhibiting melanoma growth, against each specific mutational background. These observations were challenged by characterizing a freshly resected biopsy from a metastatic lesion located in the skin and soft tissue and by testing its associated therapy ex vivo and in vivo using melanocytes and patient-derived xenografted mice, respectively. The results show that upon mutational characterization of advanced melanoma patients, specific mutational profiles can be used for selecting drugs that simultaneously target several deregulated genes/pathways involved in tumor generation or progression.
Also flagged:proteasomeProteasomeshomeostasisprotein degradationproteostasiscancer
Journal Article2015-09-01✓ 2 SnippetsTsvetkov P, Mendillo ML, Zhao J, Carette JE, Merrill PH, Cikes D, Varadarajan M, van Diemen FR, Penninger JM, Goldberg AL, Brummelkamp TR, Santagata S, Lindquist S.
In-Text Gene Mentions
Results)
…When we treated control cells with bortezomib, the mRNA transcripts of many of these genes increased significantly (e.g., ATG4A, DDX27, GADD45A, NUP54, ODC1, PMAIP1/NOXA, SETX, SNIP1, and TAX1BP1) (Supplementary file 3).…
Proteasomes are central regulators of protein homeostasis in eukaryotes. Proteasome function is vulnerable to environmental insults, cellular protein imbalance and targeted pharmaceuticals. Yet, mechanisms that cells deploy to counteract inhibition of this central regulator are little understood. To find such mechanisms, we reduced flux through the proteasome to the point of toxicity with specific inhibitors and performed genome-wide screens for mutations that allowed cells to survive. Counter to expectation, reducing expression of individual subunits of the proteasome's 19S regulatory complex increased survival. Strong 19S reduction was cytotoxic but modest reduction protected cells from inhibitors. Protection was accompanied by an increased ratio of 20S to 26S proteasomes, preservation of protein degradation capacity and reduced proteotoxic stress. While compromise of 19S function can have a fitness cost under basal conditions, it provided a powerful survival advantage when proteasome function was impaired. This means of rebalancing proteostasis is conserved from yeast to humans.
Also flagged:bone morphogenetic proteinBMPretinoic acidWntfibroblast growth factorsFGFs
Journal Article2015-09-01No SnippetsHenrique D, Abranches E, Verrier L, Storey KG.
Show Full Abstract
Neuromesodermal progenitors (NMps) contribute to both the elongating spinal cord and the adjacent paraxial mesoderm. It has been assumed that these cells arise as a result of patterning of the anterior neural plate. However, as the molecular mechanisms that specify NMps in vivo are uncovered, and as protocols for generating these bipotent cells from mouse and human pluripotent stem cells in vitro are established, the emerging data suggest that this view needs to be revised. Here, we review the characteristics, regulation, in vitro derivation and in vivo induction of NMps. We propose that these cells arise within primitive streak-associated epiblast via a mechanism that is separable from that which establishes neural fate in the anterior epiblast. We thus argue for the existence of two distinct routes for making central nervous system progenitors.
Also flagged:Proprotein Convertase 1PC1Cancersecretionpro-inflammatory cytokineschemokines
Journal Article2015-09-01No SnippetsDuhamel M, Rodet F, Delhem N, Vanden Abeele F, Kobeissy F, Nataf S, Pays L, Desjardins R, Gagnon H, Wisztorski M, Fournier I, Day R, Salzet M.
Show Full Abstract
Macrophages provide the first line of host immune defense. Their activation triggers the secretion of pro-inflammatory cytokines and chemokines recruiting other immune cells. In cancer, macrophages present an M2 anti-inflammatory phenotype promoting tumor growth. In this way, strategies need to be develop to reactivate macrophages. Previously thought to be expressed only in cells with a neural/neuroendocrine phenotype, the proprotein convertase 1/3 has been shown to also be expressed in macrophages and regulated as a function of the Toll-like receptor immune response. Here, we investigated the intracellular impact of the down-regulation of the proprotein convertase 1/3 in NR8383 macrophages and confirmed the results on macrophages from PC1/3 deficient mice. A complete proteomic study of secretomes and intracellular proteins was undertaken and revealed that inhibition of proprotein convertase 1/3 orient macrophages toward an M1 activated phenotype. This phenotype is characterized by filopodial extensions, Toll-like receptor 4 MyD88-dependent signaling, calcium entry augmentation and the secretion of pro-inflammatory factors. In response to endotoxin/lipopolysaccharide, these intracellular modifications increased, and the secreted factors attracted naïve T helper lymphocytes to promote the cytotoxic response. Importantly, the application of these factors onto breast and ovarian cancer cells resulted in a decrease viability or resistance. Under inhibitory conditions using interleukin 10, PC1/3-knockdown macrophages continued to secrete inflammatory factors. These data indicate that targeted inhibition of proprotein convertase 1/3 could represent a novel type of immune therapy to reactivate intra-tumoral macrophages.
Also flagged:amino acidneurodegenerative diseasesamyotrophic lateral sclerosisfrontotemporal dementiafragile X tremor ataxia syndromemyotonic dystrophy type 1
Journal Article2015-09-01✓ 2 SnippetsSantarriaga S, Petersen A, Ndukwe K, Brandt A, Gerges N, Bruns Scaglione J, Scaglione KM.
In-Text Gene Mentions
Text
…Htt…
Text
…Htt Q103…
Show Full Abstract
The expression, misfolding, and aggregation of long repetitive amino acid tracts are a major contributing factor in a number of neurodegenerative diseases, including C9ORF72 amyotrophic lateral sclerosis/frontotemporal dementia, fragile X tremor ataxia syndrome, myotonic dystrophy type 1, spinocerebellar ataxia type 8, and the nine polyglutamine diseases. Protein aggregation is a hallmark of each of these diseases. In model organisms, including yeast, worms, flies, mice, rats, and human cells, expression of proteins with the long repetitive amino acid tracts associated with these diseases recapitulates the protein aggregation that occurs in human disease. Here we show that the model organism Dictyostelium discoideum has evolved to normally encode long polyglutamine tracts and express these proteins in a soluble form. We also show that Dictyostelium has the capacity to suppress aggregation of a polyglutamine-expanded Huntingtin construct that aggregates in other model organisms tested. Together, these data identify Dictyostelium as a novel model organism with the capacity to suppress aggregation of proteins with long polyglutamine tracts.
Also flagged:cell cyclecenppcircadian cyclecdc20cdc45plk1
Journal Article2015-09-01No SnippetsWalter RB, Walter DJ, Boswell WT, Caballero KL, Boswell M, Lu Y, Chang J, Savage MG.
Show Full Abstract
We report RNA-Seq results from skin of X. maculatus Jp 163 B after exposure to various doses of "cool white" fluorescent light (FL). We show that FL exposure incites a genetic transcriptional response in skin nearly as great as observed for UVB exposure; however, the gene sets modulated due to exposure to the two light sources are quite different. Known light responsive genes involved in maintaining circadian cycling (e.g., clock, cry2a, cry1b, per1b, per2, per3, and arntl1a) exhibited expected shifts in transcriptional expression upon FL exposure. Exposure to FL also resulted in down-regulated transcription of many genes involved with cell cycle progression (e.g., cdc20, cdc45, cdca7b, plk1, cdk1, ccnb-3, and cdca7a) and chromosome segregation (e.g., cenpe, cenpf, cenpi, cenpk, cenpo, cenpp, and cenpu; cep70; knstrm, kntc, mcm2, mcm5; smc2). In addition, several DNA replication and recombination repair genes (e.g., pola1, pole, rec52, rad54l, rpa1, and parpbp) exhibit reduced expression in FL exposed X. maculatus skin. Some genes down modulated by FL are known to be associated with DNA repair and human diseases (e.g., atm2, brip1, fanc1, fancl, and xrcc4). The overall suppression of genes involved with mitotic progression in the skin of adult fish is consistent with entry into the light phase of the circadian cycle. Current efforts are aimed at determining specific wavelengths that may lead to differential expression among the many genes affected by fluorescent light exposure.
Also flagged:Colorectal cancerdeathpathogenesiscancercolonic tumorsAPC
Journal Article2015-09-01No SnippetsNarayan S, Sharma R.
Show Full Abstract
Colorectal cancer (CRC) is the third leading cause of death in both men and women in North America. Despite chemotherapeutic efforts, CRC is associated with a high degree of morbidity and mortality. Thus, to develop effective treatment strategies for CRC, one needs knowledge of the pathogenesis of cancer development and cancer resistance. It is suggested that colonic tumors or cell lines harbor truncated adenomatous polyposis coli (APC) without DNA repair inhibitory (DRI)-domain. It is also thought that the product of the APC gene can modulate base excision repair (BER) pathway through an interaction with DNA polymerase β (Pol-β) and flap endonuclease 1 (Fen-1) to mediate CRC cell apoptosis. The proposed therapy with temozolomide (TMZ) exploits this particular pathway; however, a high percentage of colorectal tumors continue to develop resistance to chemotherapy due to mismatch repair (MMR)-deficiency. In the present communication, we have comprehensively reviewed a critical issue that has not been addressed previously: a novel mechanism by which APC-induced blockage of single nucleotide (SN)- and long-patch (LP)-BER play role in DNA-alkylation damage-induced colorectal carcinogenesis.
Also flagged:deathmitochondrionmitochondrialAmyotrophic Lateral SclerosisALSoligonucleotide
Journal Article2015-09-01No SnippetsAlves CJ, Maximino JR, Chadi G.
Show Full Abstract
Schwann cells are the main source of paracrine support to motor neurons. Oxidative stress and mitochondrial dysfunction have been correlated to motor neuron death in Amyotrophic Lateral Sclerosis (ALS). Despite the involvement of Schwann cells in early neuromuscular disruption in ALS, detailed molecular events of a dying-back triggering are unknown. Sciatic nerves of presymptomatic (60-day-old) SOD1(G93A) mice were submitted to a high-density oligonucleotide microarray analysis. DAVID demonstrated the deregulated genes related to death, stress and mitochondrion, which allowed the identification of Cell cycle, ErbB signaling, Tryptophan metabolism and Rig-I-like receptor signaling as the most representative KEGG pathways. The protein-protein interaction networks based upon deregulated genes have identified the top hubs (TRAF2, H2AFX, E2F1, FOXO3, MSH2, NGFR, TGFBR1) and bottlenecks (TRAF2, E2F1, CDKN1B, TWIST1, FOXO3). Schwann cells were enriched from the sciatic nerve of presymptomatic mice using flow cytometry cell sorting. qPCR showed the up regulated (Ngfr, Cdnkn1b, E2f1, Traf2 and Erbb3, H2afx, Cdkn1a, Hspa1, Prdx, Mapk10) and down-regulated (Foxo3, Mtor) genes in the enriched Schwann cells. In conclusion, molecular analyses in the presymptomatic sciatic nerve demonstrated the involvement of death, oxidative stress, and mitochondrial pathways in the Schwann cell non-autonomous mechanisms in the early stages of ALS.
The spatial organization of metazoan genomes has a direct influence on fundamental nuclear processes that include transcription, replication, and DNA repair. It is imperative to understand the mechanisms that shape the 3D organization of the eukaryotic genomes. Chromatin insulators have emerged as one of the central components of the genome organization tool-kit across species. Recent advancements in chromatin conformation capture technologies have provided important insights into the architectural role of insulators in genomic structuring. Insulators are involved in 3D genome organization at multiple spatial scales and are important for dynamic reorganization of chromatin structure during reprogramming and differentiation. In this review, we will discuss the classical view and our renewed understanding of insulators as global genome organizers. We will also discuss the plasticity of chromatin structure and its re-organization during pluripotency and differentiation and in situations of cellular stress.
Also flagged:vitamin ENASHtriglyceridelipoproteinalanine aminotransferasecholesterol
Journal Article2015-09-01✓ 1 SnippetKoh H, Kim S, Kim MJ, Kim HG, Shin HJ, Lee MJ.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Aim</h4>To evaluate the possibility of treatment effect monitoring using hepatic fat quantification magnetic resonance (MR) in pediatric nonalcoholic steatohepatitis (NASH).<h4>Methods</h4>We retrospectively reviewed the medical records of patients who received educational recommendations and vitamin E for NASH and underwent hepatic fat quantification MR from 2011 to 2013. Hepatic fat fraction (%) was measured using dual- and triple-echo gradient-recalled-echo sequences at 3T. The compliant and non-compliant groups were compared clinically, biochemically, and radiologically.<h4>Results</h4>Twenty seven patients (M:F = 24:3; mean age: 12 ± 2.3 years) were included (compliant group = 22, non-compliant = 5). None of the baseline findings differed between the 2 groups, except for triglyceride level (compliant vs non-compliant, 167.7 mg/dL vs 74.2 mg/dL, P = 0.001). In the compliant group, high-density lipoprotein increased and all other parameters decreased after 1-year follow-up. However, there were various changes in the non-compliant group. Dual-echo fat fraction (-19.2% vs 4.6, P < 0.001), triple-echo fat fraction (-13.4% vs 3.5, P < 0.001), alanine aminotransferase (-110.7 IU/L vs -10.6 IU/L, P = 0.047), total cholesterol (-18.1 mg/dL vs 3.8 mg/dL, P = 0.016), and triglyceride levels (-61.3 mg/dL vs 11.2 mg/dL, P = 0.013) were significantly decreased only in the compliant group. The change in body mass index and dual-echo fat fraction showed a positive correlation (ρ = 0.418, P = 0.030).<h4>Conclusion</h4>Hepatic fat quantification MR can be a non-invasive, quantitative and useful tool for monitoring treatment effects in pediatric NASH.
Also flagged:ADHDAttention Deficit Hyperactivity Disorderneurobiological disordercholinergic receptorGRM1GRM5
Journal Article2015-09-01No SnippetsConnolly JJ, Glessner JT, Elia J, Hakonarson H.
Show Full Abstract
Attention deficit hyperactivity disorder (ADHD) is the most common neurobiological disorder in children, with a prevalence of ~6-7%<sup>1,2</sup> that has remained stable for decades<sup>2</sup>. The social and economic burden associated with patients<sup>3</sup>, families, and broader systems (healthcare/educational) is substantial, with the annual economic impact of ADHD exceed $30 billion in the US alone<sup>4</sup>. Efficacy of pharmacotherapy in treating ADHD symptoms has generally been considerable with at least ¾ of individuals benefitting from pharmacotherapy, typically in the form of stimulants<sup>5</sup>. In this review, we begin by briefly reviewing the history of pharmacotherapy in relation to ADHD, before focusing (primarily) on the state-of-the-field on themes such as biophysiology, pharmacokinetics, and pharmacogenomics. We conclude with a summary of emerging clinical and research studies, particularly the potential role for precision therapy in matching ADHD patients and drug types.
Also flagged:Prox1RELNVIPtranscription factorCalb2homeodomain transcription factor
Journal Article2015-09-01✓ 1 SnippetMiyoshi G, Young A, Petros T, Karayannis T, McKenzie Chang M, Lavado A, Iwano T, Nakajima M, Taniguchi H, Huang ZJ, Heintz N, Oliver G, Matsuzaki F, Machold RP, Fishell G.
In-Text Gene Mentions
Text
…Sox6…
Show Full Abstract
Neurogliaform (RELN+) and bipolar (VIP+) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been elucidated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP). Interestingly, Prox1 promotes the maturation of CGE-derived interneuron subtypes through intrinsic differentiation programs that operate in tandem with extrinsically driven neuronal activity-dependent pathways. Thus Prox1 represents the first identified transcription factor specifically required for the embryonic and postnatal acquisition of CGE-derived cortical interneuron properties.<h4>Significance statement</h4>Despite the recognition that 30% of GABAergic cortical interneurons originate from the caudal ganglionic eminence (CGE), to date, a specific transcriptional program that selectively regulates the development of these populations has not yet been identified. Moreover, while CGE-derived interneurons display unique patterns of tangential and radial migration and preferentially populate the superficial layers of the cortex, identification of a molecular program that controls these events is lacking.Here, we demonstrate that the homeodomain transcription factor Prox1 is expressed in postmitotic CGE-derived cortical interneuron precursors and is maintained into adulthood. We found that Prox1 function is differentially required during both embryonic and postnatal stages of development to direct the migration, differentiation, circuit integration, and maintenance programs within distinct subtypes of CGE-derived interneurons.
Also flagged:Gastric cancercancerdeathtumorcarcinoembryonic antigencarbohydrate
Journal Article2015-09-01No SnippetsKanda M, Kodera Y.
Show Full Abstract
Gastric cancer (GC) is the third most common cause of cancer-related death in the world, representing a major global health issue. Although the incidence of GC is declining, the outcomes for GC patients remain dismal because of the lack of effective biomarkers to detect early GC and predict both recurrence and chemosensitivity. Current tumor markers for GC, including serum carcinoembryonic antigen and carbohydrate antigen 19-9, are not ideal due to their relatively low sensitivity and specificity. Recent improvements in molecular techniques are better able to identify aberrant expression of GC-related molecules, including oncogenes, tumor suppressor genes, microRNAs and long non-coding RNAs, and DNA methylation, as novel molecular markers, although the molecular pathogenesis of GC is complicated by tumor heterogeneity. Detection of genetic and epigenetic alterations from gastric tissue or blood samples has diagnostic value in the management of GC. There are high expectations for molecular markers that can be used as new screening tools for early detection of GC as well as for patient stratification towards personalized treatment of GC through prediction of prognosis and drug-sensitivity. In this review, the studies of potential molecular biomarkers for GC that have been reported in the publicly available literature between 2012 and 2015 are reviewed and summarized, and certain highlighted papers are examined.
Gastric cancer (GC) is the fourth most common cancer and the third leading cause of cancer mortality worldwide. MicroRNAs (miRNAs) and long non-coding RNAs (lncRNAs) are the most popular non-coding RNAs in cancer research. To date, the roles of miRNAs and lncRNAs have been extensively studied in GC, suggesting that miRNAs and lncRNAs represent a vital component of tumor biology. Furthermore, circulating miRNAs and lncRNAs are found to be dysregulated in patients with GC compared with healthy individuals. Circulating miRNAs and lncRNAs may function as promising biomarkers to improve the early detection of GC. Multiple possibilities for miRNA secretion have been elucidated, including active secretion by microvesicles, exosomes, apoptotic bodies, high-density lipoproteins and protein complexes as well as passive leakage from cells. However, the mechanism underlying lncRNA secretion and the functions of circulating miRNAs and lncRNAs have not been fully illuminated. Concurrently, to standardize results of global investigations of circulating miRNAs and lncRNAs biomarker studies, several recommendations for pre-analytic considerations are put forward. In this review, we summarize the known circulating miRNAs and lncRNAs for GC diagnosis. The possible mechanism of miRNA and lncRNA secretion as well as methodologies for identification of circulating miRNAs and lncRNAs are also discussed. The topics covered here highlight new insights into GC diagnosis and screening.
<h4>Aim</h4>To assess the practice of Egyptian physicians in screening patients for hepatocellular carcinoma (HCC).<h4>Methods</h4>The study included 154 physicians from all over Egypt caring for patients at risk for HCC. The study was based on a questionnaire with 20 items. Each questionnaire consisted of two parts: (1) personal information regarding the physician (name, age, specialty and type of health care setting); and (2) professional experience in the care of patients at risk for HCC development (screening, knowledge about the cause and natural course of liver diseases and HCC risk).<h4>Results</h4>Sixty-eight percent of doctors with an MD degree, 48% of doctors with a master degree or a diploma and 40% of doctors with a Bachelor of Medicine, Bachelor of Surgery certificate considered the hepatitis C virus (HCV) genotype as risk factor for HCC development (P < 0.05). Ninety percent of physicians specialized in tropical medicine, internal medicine or gastroenterology and 67% of physicians in other specialties advise patients to undergo screening for HCV and hepatitis B virus infection as well as liver cirrhosis (P < 0.05). Eighty-six percent of doctors in University Hospitals and 69% of Ministry of Health (MOH) doctors consider HCV infection as the leading cause of HCC in Egypt (P < 0.05). Seventy-two percent of doctors with an MD degree, 55% of doctors with a master degree or a diploma, 56% of doctors with an MBBCH certificate, 74% of doctors in University Hospitals and 46% of MOH hospital doctors consider abdominal ultrasonography as the most important investigation in HCC screening (P < 0.05). Sixty-five percent of physicians in tropical medicine, internal medicine or gastroenterology and 37% of physicians in other specialties recommend as HCC screening interval of 3 mo (P < 0.05). Seventy-one percent of doctors with an MD degree, 50% of doctors with a master degree or diploma and 60% of doctors with an MBBCH certificate follow the same recommendation.<h4>Conclusion</h4>In Egypt, physicians specialized in tropical medicine, internal medicine or gastroenterology with an MD degree and working in a University Hospital are best informed about HCC.
Also flagged:detoxificationgene expressionreverse transcription-polymeraseinjuryacetaminophen
Journal Article2015-09-01No SnippetsYoshida K, Ushida Y, Ishijima T, Suganuma H, Inakuma T, Yajima N, Abe K, Nakai Y.
Show Full Abstract
<h4>Aim</h4>To investigate the effects of broccoli sprout extract (BSEx) on liver gene expression and acute liver injury in the rat.<h4>Methods</h4>First, the effects of BSEx on liver gene expression were examined. Male rats were divided into two groups. The Control group was fed the AIN-76 diet, and the BSEx group was fed the AIN-76 diet containing BSEx. After a 10-d feeding period, rats were sacrificed and their livers were used for DNA microarray and real-time reverse transcription-polymerase chain reaction (RT-PCR) analyses. Next, the effects of BSEx on acute liver injury were examined. In experiments using acute liver injury models, 1000 mg/kg acetaminophen (APAP) or 350 mg/kg D-galactosamine (D-GalN) was used to induce injury. These male rats were divided into four groups: Control, BSEx, Inducer (APAP or D-GalN), and Inducer+BSEx. The feeding regimens were identical for the two analyses. Twenty-four hours following APAP administration via p.o. or D-GalN administration via i.p., rats were sacrificed to determine serum aspartate transaminase (AST) and alanine transaminase (ALT) levels, hepatic glutathione (GSH) and thiobarbituric acid-reactive substances accumulation and glutathione-S-transferase (GST) activity.<h4>Results</h4>Microarray and real-time RT-PCR analyses revealed that BSEx upregulated the expression of genes related to detoxification and glutathione synthesis in normal rat liver. The levels of AST (70.91 ± 15.74 IU/mL vs 5614.41 ± 1997.83 IU/mL, P < 0.05) and ALT (11.78 ± 2.08 IU/mL vs 1297.71 ± 447.33 IU/mL, P < 0.05) were significantly suppressed in the APAP + BSEx group compared with the APAP group. The level of GSH (2.61 ± 0.75 nmol/g tissue vs 1.66 ± 0.59 nmol/g tissue, P < 0.05) and liver GST activity (93.19 ± 16.55 U/g tissue vs 51.90 ± 16.85 U/g tissue, P < 0.05) were significantly increased in the APAP + BSEx group compared with the APAP group. AST (4820.05 ± 3094.93 IU/mL vs 12465.63 ± 3223.97 IU/mL, P < 0.05) and ALT (1808.95 ± 1014.04 IU/mL vs 3936.46 ± 777.52 IU/mL, P < 0.05) levels were significantly suppressed in the D-GalN + BSEx group compared with the D-GalN group, but the levels of AST and ALT in the D-GalN + BSEx group were higher than those in the APAP + BSEx group. The level of GST activity was significantly increased in the D-GalN + BSEx group compared with the D-GalN group (98.04 ± 15.75 U/g tissue vs 53.15 ± 8.14 U/g tissue, P < 0.05).<h4>Conclusion</h4>We demonstrated that BSEx protected the liver from various types of xenobiotic substances through induction of detoxification enzymes and glutathione synthesis.
Journal Article2015-09-01No SnippetsSu YR, Chiusa M, Brittain E, Hemnes AR, Absi TS, Lim CC, Di Salvo TG.
Show Full Abstract
Little is known about the right ventricular (RV) proteome in human heart failure (HF), including possible differences compared to the left ventricular (LV) proteome. We used 2-dimensional differential in-gel electrophoresis (pH: 4-7, 10-150 kDa), followed by liquid chromatography tandem mass spectrometry, to compare the RV and LV proteomes in 12 explanted human hearts. We used Western blotting and multiple-reaction monitoring for protein verification and RNA sequencing for messenger RNA and protein expression correlation. In all 12 hearts, the right ventricles (RVs) demonstrated differential expression of 11 proteins relative to the left ventricles (LVs), including lesser expression of CRYM, TPM1, CLU, TXNL1, and COQ9 and greater expression of TNNI3, SAAI, ERP29, ACTN2, HSPB2, and NDUFS3. Principal-components analysis did not suggest RV-versus-LV proteome partitioning. In the nonischemic RVs (n = 6), 7 proteins were differentially expressed relative to the ischemic RVs (n = 6), including increased expression of CRYM, B7Z964, desmin, ANXA5, and MIME and decreased expression of SERPINA1 and ANT3. Principal-components analysis demonstrated partitioning of the nonischemic and ischemic RV proteomes, and gene ontology analysis identified differences in hemostasis and atherosclerosis-associated networks. There were no proteomic differences between RVs with echocardiographic dysfunction (n = 8) and those with normal function (n = 4). Messenger RNA and protein expression did not correlate consistently, suggesting a major role for RV posttranscriptional protein expression regulation. Differences in contractile, cytoskeletal, metabolic, signaling, and survival pathways exist between the RV and the LV in HF and may be related to the underlying HF etiology and differential posttranscriptional regulation.
Also flagged:Dopamine ReceptorsDopamineDA receptorsneurodegenerative disordersHuntington diseaseHD
Journal Article2015-09-01No SnippetsRangel-Barajas C, Coronel I, Florán B.
Show Full Abstract
Dopamine (DA) is one of the major neurotransmitters and participates in a number of functions such as motor coordination, emotions, memory, reward mechanism, neuroendocrine regulation etc. DA exerts its effects through five DA receptors that are subdivided in 2 families: D1-like DA receptors (D1 and D5) and the D2-like (D2, D3 and D4). All DA receptors are widely expressed in the central nervous system (CNS) and play an important role in not only in physiological conditions but also pathological scenarios. Abnormalities in the DAergic system and its receptors in the basal ganglia structures are the basis Parkinson's disease (PD), however DA also participates in other neurodegenerative disorders such as Huntington disease (HD) and multiple sclerosis (MS). Under pathological conditions reorganization of DAergic system has been observed and most of the times, those changes occur as a mechanism of compensation, but in some cases contributes to worsening the alterations. Here we review the changes that occur on DA transmission and DA receptors (DARs) at both levels expression and signals transduction pathways as a result of neurotoxicity, inflammation and in neurodegenerative processes. The better understanding of the role of DA receptors in neuropathological conditions is crucial for development of novel therapeutic approaches to treat alterations related to neurodegenerative diseases.
Also flagged:ferrocenegold nanoparticlescarbonferrocenylmethyllipoic acidester
Journal Article2015-09-01✓ 1 SnippetArgoubi W, Saadaoui M, Ben Aoun S, Raouafi N.
In-Text Gene Mentions
Methods)
…3H2O (99.9%), dicyclohexylcarbodiimide (DCC) (99%), sodium nitrate (≥98%), human IgG (hIgG, ≥95%), polyclonal anti-human IgG antibody (α-hIgG), polyclonal anti-human IgG antibody (gIgG, produced in goat), bovine serum albumin (98%), ascorbic acid, dopamine, H2O2, silica gel 60 mesh and F254 nm fluorescent silica-coated aluminum TLC plates were purchased from Sigma-Aldrich (Germany) and used as received without further purification.…
Show Full Abstract
The demand for on-site nanodevices is constantly increasing. The technology development for the design of such devices is highly regarded. In this work, we report the design of a disposable platform that is structured with cauliflower-shaped gold nanoparticles (cfAuNPs) and we show its applications in immunosensing and enzyme-based detection. The electrochemical reduction of Au(III) allows for the electrodeposition of highly dispersed cauliflower-shaped gold nanoparticles on the surface of screen-printed carbon electrodes (SPCEs). The nanostructures were functionalized using ferrocenylmethyl lipoic acid ester which allowed for the tethering of the ferrocene group to gold, which serves as an electrochemical transducer/mediator. The bioconjugation of the surface with anti-human IgG antibody (α-hIgG) or horseradish peroxidase (HRP) enzyme yields biosensors, which have been applied for the selective electrochemical detection of human IgG (hIgG) or H2O2 as model analytes, respectively. Parameters such as the number of sweeps, amount of charge generated from the oxidation of the electrodeposited gold, time of incubation and concentration of the ferrocene derivatives have been studied using cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and scanning electron microscopy (SEM). Selectivity and specificity tests have been also performed in the presence of potentially interfering substances to either hIgG or H2O2. Results showed that the devised immunosensor is endowed with good selectivity and specificity in the presence of several folds of competitive analytes. The enzyme-based platform showed a good catalytic activity towards H2O2 oxidation which predestined it to potential applications pertaining to enzymatic kinetics studies. The levels of hIgG in human serum and H2O2 in honey were successfully determined and served as assessment tools of the applicability of the platforms for real samples analysis.
Also flagged:Hepcidinchronic liver diseaseironIL-6transforming growth factor-βTGF-β
Journal Article2015-09-01✓ 1 SnippetCakir M, Erduran E, Turkmen ES, Aliyazicioglu Y, Reis GP, Cobanoglu U, Demir S.
In-Text Gene Mentions
Methods)
…primary or secondaryhemochromatosis, with hepatocellular carcinom…
Show Full Abstract
<h4>Background/aim</h4>We aimed to analyze serum hepcidin level in children with chronic liver disease (CLD) and its relationship with serum cytokines level, liver function tests, hepatic iron content, and liver fibrosis.<h4>Patients and methods</h4>The study included 34 children with CLD, and 15 age- and gender-matched healthy children. Serum hepcidin, ferritin, iron level, interleukin-6 (IL-6), transforming growth factor-β (TGF-β ), total oxidant status (TOS), and antioxidant status (TAS) were studied in all patients and in the control group. Liver iron content (LIC) was measured from the liver biopsy specimen.<h4>Results</h4>Serum ferritin levels were higher in patients with CLD than control group (100.1 ± 98.2 ng/mL vs 50.5 ± 32.2 ng/mL, P = 0.016). No significant difference was found in hepcidin levels. Hepcidin levels in children with CLD was positively correlated with ferritin (r = 0.75, P = 0.001), pediatric end-stage liver disease (PELD) score (r = 0.56, P = 0.001), TAS (r = 0.42,P = 0.02), but negatively correlated with albumin level (r = -0.45,P = 0.008). Transferrin saturation and hepcidin:ferritin ratio were significantly low in patients with severe fibrosis compared with patients with mild/without fibrosis (15.5 ± 5.5 vs 34.3 ± 30.1, P = 0.017 and 1 ± 0.5 vs 1.9 ± 1.4,P = 0.04, respectively).<h4>Conclusion</h4>Serum hepcidin levels in children with CLD reflect both liver functions and TAS, and severe fibrosis is associated with low hepcidin:ferritin ratio in children with CLD.
Also flagged:cancerdeathtumortumorsprostate cancercancers
Journal Article2015-09-01No SnippetsOronsky B, Carter CA, Reid TR, Scicinski J, Oronsky A, Lybeck M, Caroen S, Stirn M, Oronsky N, Langecker P.
Show Full Abstract
Overall survival (OS) has emerged as the definitive regulatory "be-all, end-all" for the demonstration of benefit in cancer clinical trials. The reason and the rationale for why this is so are easily appreciated: literally a "test of time," OS is a seemingly unambiguous, agenda-free end point, independent of bias-prone variables such as the frequency and methods of assessment, clinical evaluation, and the definition of progression. However, by general consensus, OS is an imperfect end point for several reasons: First, it may often be impractical because of the length, cost, and the size of clinical trials. Second, OS captures the impact of subsequent therapies, both beneficial (i.e., active) and detrimental, on survival but it does not take into account the contribution of subsequent therapies by treatment arm; the postprogression period is treated as an unknown black box (no information about the potential influence of next-line therapies on the outcome) under the implicit assumption that the clinical trial treatment is the only clinical variable that matters: what OS explicitly measures is the destination, that is, the elapsed time between the date of randomization (or intention to treat) and the date of death, not the journey, that is, what transpires in-between. In long-term maintenance strategies, patients receive treatment in temporally separated but mutually interdependent and causally linked sequences that exert a "field of influence" akin to action-at-a-distance forces like gravity, electricity, and magnetism on both the tumor and each other. Hence, in this setting, a new end point, PFS2, is required to measure this field of influence. This article reviews the definition and use in clinical trials of PFS2 and makes the case for its potential applicability as a preferred end point to measure the mutual influence of individual regimens in long-term maintenance strategies with resensitizing agents in particular.
Also flagged:CARP-1triple negative breast cancernon-small cell lung cancersCell growthCCAR1binding
Journal Article2015-09-01✓ 1 SnippetMuthu M, Somagoni J, Cheriyan VT, Munie S, Levi E, Ashour AE, Yassin AE, Alafeefy AM, Sochacki P, Polin LA, Reddy KB, Larsen SD, Singh M, Rishi AK.
In-Text Gene Mentions
Text
…Cell cycle and apoptosis regulator 1…
Show Full Abstract
The triple negative breast cancer (TNBCs) and non-small cell lung cancers (NSCLCs) often acquire mutations that contribute to failure of drugs in clinic and poor prognosis, thus presenting an urgent need to develop new and improved therapeutic modalities. Here we report that CARP-1 functional mimetic (CFMs) compounds 4 and 5, and 4.6, a structurally related analog of CFM-4, are potent inhibitors of TNBC and NSCLC cells in vitro. Cell growth suppression by CFM-4 and -4.6 involved interaction and elevated expression of CARP-1/CCAR1 and Death Effector Domain (DED) containing DNA binding (DEDD)2 proteins. Apoptosis by these compounds also involved activation of pro-apoptotic stress-activated kinases p38 and JNK1/2, cleavage of PARP and loss of mitotic cyclin B1. Both the CFMs inhibited abilities of NSCLC and TNBC cells to migrate, invade, and form colonies in suspension, while disrupting tubule formation by the human umbilical vein endothelial cells (HUVECs). Nano-lipid formulation of CFM-4 (CFM-4 NLF) enhanced its serum bioavailability when compared with the free CFM-4. Oral administration of CFM-4 NLF reduced weights and volume of the xenografted tumors derived from A549 NSCLC and MDA-MB-231 TNBC cells. Although no gross tissue or histological toxicities were noticed, the immuno-histochemical analysis revealed increased CARP-1 and DNA fragmentation in tumors of the CFM-4 NLF-treated animals. In conclusion, while stimulation of pro-apoptotic CARP-1 and DEDD2 expression and their binding underscore a novel mechanism of apoptosis transduction by CFM compounds, our proof-of-concept xenograft studies demonstrate therapeutic potential of CFM-4 for TNBC and NSCLC.
Also flagged:glycoproteinshepatocellular carcinomacancerdimethylfibrinogen gammaFGG
Journal Article2015-09-01No SnippetsGao HJ, Chen YJ, Zuo D, Xiao MM, Li Y, Guo H, Zhang N, Chen RB.
Show Full Abstract
<h4>Objective</h4>Hepatocellular carcinoma (HCC) is a leading cause of cancer-related deaths. Novel serum biomarkers are required to increase the sensitivity and specificity of serum screening for early HCC diagnosis. This study employed a quantitative proteomic strategy to analyze the differential expression of serum glycoproteins between HCC and normal control serum samples.<h4>Methods</h4>Lectin affinity chromatography (LAC) was used to enrich glycoproteins from the serum samples. Quantitative mass spectrometric analysis combined with stable isotope dimethyl labeling and 2D liquid chromatography (LC) separations were performed to examine the differential levels of the detected proteins between HCC and control serum samples. Western blot was used to analyze the differential expression levels of the three serum proteins.<h4>Results</h4>A total of 2,280 protein groups were identified in the serum samples from HCC patients by using the 2D LC-MS/MS method. Up to 36 proteins were up-regulated in the HCC serum, whereas 19 proteins were down-regulated. Three differential glycoproteins, namely, fibrinogen gamma chain (FGG), FOS-like antigen 2 (FOSL2), and α-1,6-mannosylglycoprotein 6-β-N-acetylglucosaminyltransferase B (MGAT5B) were validated by Western blot. All these three proteins were up-regulated in the HCC serum samples.<h4>Conclusion</h4>A quantitative glycoproteomic method was established and proven useful to determine potential novel biomarkers for HCC.
Also flagged:localizationorbital diseasesVitreoretinal diseasesocular inflammatory diseasestumoursvision
Journal Article2015-09-01No SnippetsNagaraju RM, Gurushankar G, Bhimarao, Kadakola B.
Show Full Abstract
<h4>Background</h4>The complicated anatomy of orbit and the wide spectrum of pathological conditions present a formidable challenge for early diagnosis, which is critical for management. Ultrasonography provides a detailed cross sectional anatomy of the entire globe with excellent topographic visualization and real time display of the moving organ.<h4>Objectives of the study</h4>To evaluate the efficacy of high frequency Ultrasound in localization of orbital diseases and to characterize various orbital pathologies sonologically.<h4>Materials and methods</h4>Hundred eyes of 85 patients were examined with ultrasound using linear high frequency probe (5 to 17 MHz) of PHILPS IU22 ultrasound system. Sonological diagnosis was made based on location, acoustic characteristics, kinetic properties and Doppler flow dynamics. Final diagnosis was made based on clinical & laboratory findings/higher cross-sectional imaging/surgery & histopathology (as applicable). Diagnostic accuracy of ultrasonography was evaluated and compared with final diagnosis.<h4>Results</h4>The distinction between ocular and extraocular pathologies was made in 100% of cases. The overall sensitivity, specificity, NPV and accuracy of ultrasonography were 94.2%, 98.8%, 92.2% & 94.9% respectively for diagnosis of ocular pathologies and 94.2%, 99.2%, 95.9% & 95.2% respectively for extra ocular pathologies.<h4>Conclusion</h4>Ultrasonography is a readily available, simple, cost effective, non ionizing and non invasive modality with overall high diagnostic accuracy in localising and characterising orbital pathologies. It has higher spatial and temporal resolution compared to CT/MRI. However, CT/MRI may be indicated in certain cases for the evaluation of calcifications, bony involvement, extension to adjacent structures and intracranial extension.
Argyria is a condition characterized by pigmentary changes secondary to exposure to silver salts and its accumulation in skin, mucous membranes and annexes, which typically produces blue or gray-blue spots. A case of a male patient 62 years old, previously healthy, who has a blue-gray hyperpigmentation on the face, trunk and upper extremity, affecting sun-exposed areas is presented. He admitted having ingested silver nitrate for 5 years at a rate of 1 bottle per week, with the intent to kill microorganisms in his body.
Also flagged:virulence genescytolethal distending toxinShiga toxinstx 1stx 2virulence associated genes
Journal Article2015-09-01✓ 2 SnippetsOloomi M, Javadi M, Bouzari S.
In-Text Gene Mentions
Discussion)
…12 ]CDT-IIIwas cloned from…
Discussion)
…13 ]CDT-IIIis encoded by…
Show Full Abstract
<h4>Context</h4>Mobile genetic elements such as plasmids, bacteriophages, insertion elements, and genomic islands play a critical role in virulence of bacterial pathogens. These elements transfer horizontally and could play an important role in the evolution and virulence of many pathogens. A broad spectrum of gram-negative bacterial species has been shown to produce a cytolethal distending toxin (CDT). On the other hand, Shiga toxin producing Escherichia coli are the one carry virulence genes such as stx 1 and stx 2 (Shiga toxin) and these genes can be acquired by horizontal gene transfer.<h4>Aim</h4>The aim of this study was to investigate the presence of other virulence associated genes among CDT producing E. coli strains.<h4>Materials and methods</h4>Thirty CDT positive strains isolated from patients with diarrhea were characterized. Thereafter, the association with virulent genetic elements in known pathogenicity islands (PAIs) was assessed by polymerase chain reaction.<h4>Results</h4>In this study, it was shown that the most CDT producing E. coli isolates express Shiga toxin. Moreover, the presence of prophages framing cdt genes (like P2 phage) was also identified in each cdt-type genomic group. Flanked regions of cdt-I, cdt-IV, and cdt-V-type was similar to plasmid sequences while cdt-II and cdt-III-type regions similarity with hypothetical protein (orf3) was observed.<h4>Conclusion</h4>The occurrence of each cdt-type groups with specific virulence genes and PAI genetic elements is indicative of horizontal gene transfer by these mobile genetic elements, which could lead to diversity among the isolates.
Also flagged:Lupus Nephritisautoimmune diseaseautoantibodiespathogenesisautoantibodyinnate immunity
Journal Article2015-09-01No SnippetsMunroe ME, James JA.
Show Full Abstract
Systemic lupus erythematosus is a heterogeneous autoimmune disease marked by the presence of pathogenic autoantibodies, immune dysregulation, and chronic inflammation that may lead to increased morbidity and early mortality from end-organ damage. More than half of all systemic lupus erythematosus patients will develop lupus nephritis. Genetic-association studies have identified more than 50 polymorphisms that contribute to lupus nephritis pathogenesis, including genetic variants associated with altered programmed cell death and defective immune clearance of programmed cell death debris. These variants may support the generation of autoantibody-containing immune complexes that contribute to lupus nephritis. Genetic variants associated with lupus nephritis also affect the initial phase of innate immunity and the amplifying, adaptive phase of the immune response. Finally, genetic variants associated with the kidney-specific effector response may influence end-organ damage and the progression to end-stage renal disease and death. This review discusses genetic insights of key pathogenic processes and pathways that may lead to lupus nephritis, as well as the clinical implications of these findings as they apply to recent advances in biologic therapies.
Also flagged:SOX9gliomacancertumorreverse transcriptionCell growth
Journal Article2015-09-01✓ 1 SnippetGao J, Zhang JY, Li YH, Ren F.
In-Text Gene Mentions
Text
…SOX6…
Show Full Abstract
Deregulation of SOX9 expression has been detected in various human cancer tissues; however, the functional role of SOX9 expression has not been fully elucidated in glioma. SOX9 expression in glioma tissues was analyzed using public tumor datasets and quantitative reverse transcription polymerase chain reaction. The association of SOX9 expression with clinical prognosis in glioma patients was analyzed by examining publically available microarray profiling datasets. The functional roles of SOX9 in glioma were examined using gene set enrichment analysis (GSEA). Cell growth was measured using soft agar colony formation assay, and the cell cycle was analyzed using flow cytometry. Our data showed that SOX9 expression was commonly upregulated in glioma tissues, and patients with high SOX9 levels had shorter survival times. GSEA identified that the gene sets regulating cell proliferation and cell cycle progression were significantly enriched in glioma cells with high SOX9 expression. SOX9 downregulation decreased cyclin D1, CDK4 expression and Rb phosphorylation, which correlated with a reduced population of cells in the S phase and suppressed growth. SOX9, as an oncogene, is highly expressed in gliomas and may be potential indicators of a poor prognosis in glioma patients. SOX9 knockdown may suppress cancer cell growth by inducing cell cycle arrest, which suggests that SOX9 is a potential therapeutic target in glioma.
Also flagged:RKIPE-cadherinNF-kBp65esophageal squamous cell carcinomaESCC
Journal Article2015-09-01No SnippetsPing FM, Liu GJ, Liu ZJ, Li HB, Zhai JW, Li SX, Liu YM, Li BW, Wei H.
Show Full Abstract
To detect the expression of RKIP, E-cadherin and NF-kB p65 in esophageal squamous cell carcinoma (ESCC) and study their correlations. Steptavidin-peroxidase (S-P) method was employed to detect the expressions of RKIP, E-cadherin and NF-kB p65 in ESCC tissues from 77 cases and paracancerous tissues from 77 cases. The correlations between their expressions and clinicopathological indices and between the expressions of these proteins themselves were analyzed. The expressions of RKIP and E-cadherin in ESCC tissues were obviously lower than those in the paracancerous tissues (P<0.01); the expressions in ESCC tissues from cases with lymph node metastasis were lower than those from cases without lymph node metastasis (P<0.01); the expression of RKIP was positively correlated with the expression of E-cadherin in ESCC tissues (P<0.01). The expression of NF-kB p65 in ESCC tissues was correlated with clinical staging, lymph node metastasis and tumor differentiation (P<0.01); the expression of RKIP was negatively correlated with the expression of NF-kB p65 in ESCC tissues (P<0.05). Downregulation or depletion of RKIP was related to the onset and progression of ESCC, and facilitated the invasion and metastasis of ESCC by downregulating E-cadherin and upregulating NF-kB p65.
Also flagged:portal hypertensionhepatitis Bhepatocellular carcinomaportal vein thrombosisautoimmune hepatitispancreatitis
Journal Article2015-09-01✓ 1 SnippetGe W, Wang Y, Cao YJ, Xie M, Ding YT, Zhang M, Yu DC.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Goal</h4>To analyze the risk factors from radiological indices for hemorrhage in the patients with portal hypertension and weight risk factors.<h4>Method</h4>We retrospectively analyzed all cases of portal hypertension with hepatitis B from June 2008 to June 2014 in Nanjing Drum Tower hospital. Patients with hepatocellular carcinoma, portal vein thrombosis, or portal hypertension with other causes, such as autoimmune hepatitis, pancreatitis, or hematological diseases were excluded.<h4>Results</h4>Ninety-eight patients were recruited and divided into hemorrhage and non-hemorrhage groups. There were no statistical differences in clinical indexes such as age, prothrombin time, serum albumin, serum creatinine, serum sodium, hemameba, and blood platelet count. However, the differences were statistically significant in total bilirubin, hemoglobin, and liver function with the p values of 0.023, 0.000, and 0.039 respectively. For radiological indices, hemorrhage was correlated with diameter of inferior mesenteric vein (P=0.0528), posterior gastric vein (P=0.0283), and esophageal varices scores (P=0.0221). Logistic procedure was used to construct the model with stepwise selection and finally inferior mesenteric vein, posterior gastric vein, esophageal varices, and short gastric vein were enrolled into the model. These veins were scored according to the diameters and the rates of hemorrhage were increased with the score. We then validated the model with 26 patents from July 2014 to December 2014. The AUC value was 0.8849 in ROC curves for this radiological model.<h4>Conclusions</h4>A risk model was constructed including inferior mesenteric vein, esophageal varices, posterior gastric vein, and short gastric vein. This radiological scoring model may be a valuable indicator for hemorrhage of portal hypertension.
Also flagged:, foot and mouth diseasehand, foot and mouth diseaseCA6EV71 infection
Journal Article2015-09-01No SnippetsGe Y, Zheng Y, Pan H, Mao S, Li Y, Xia A, Zhu Q, Hu J, Zeng M.
Show Full Abstract
<h4>Objective</h4>To understand the epidemiological profiles of hand, foot and mouth disease (HFMD) and the major enteroviruses causing the epidemics of HFMD in Shanghai from 2010 to 2014.<h4>Method</h4>The city-wide surveillance data between 2010 and 2014 were used to analyze the epidemiologic characteristics of the HFMD outbreaks in Shanghai. The annual incidence of HFMD was estimated based on the 2010 Shanghai Census data.<h4>Result</h4>From 2010 to 2014, the reported HFMD cases were 41 080, 37 323, 51 172, 42 198, and 65 018, respectively; the severe cases (case-severity ratio) were 469 (1.14%), 456 (1.22%), 318 (0.62%), 104 (0.25%) and 248 (0.38%), respectively. Based on Shanghai census data by the end of 2010, the attack rates of HFMD in Shanghai were 0.16%-0.28% in the entire population. In terms of the proportion of HFMD cases and severe cases in the specific population, male accounted for 59.62%-61.48% and 62.26%-73.08%, migrant population accounted for 51.86%-62.40% and 72.01%-80.38%; children aged 1.0-1.9 years comprised the highest proportion, up to 22.70%-27.00% and 32.08%-36.40%. HFMD peaked from April to July, in parallel with the peak circulation of enterovirus (EV) 71, and a small peak usually occurred in autumn and winter. All the critically severe and fatal cases were caused by EV71. The detection rates of EV71 and Coxsackievirus A (CA) 16 were 73.08%-88.09% and 1.12%-2.90% in severe HFMD cases, 19.75%-48.74% and 2.02%-23.69% in uncomplicated inpatients, and 16.78%-40.08% and 8.36%-33.39% in mild community cases, respectively. The detection rates of CA6 and CA10 in the mild community cases in 2014 were 18.38% and 1.43%, respectively. In 2013 non-EV71 and non-CA16 enteroviruses comprised 74.86% in the community cases.<h4>Conclusion</h4>The annual HFMD outbreaks occurred in Shanghai during 2010-2014. Children under 5 years of age, migrant population and male were the major susceptible population. EV71 and CA16 were the predominant pathogens causing the epidemics of HFMD except in 2013, and CA6 was prevalent in the community cases in 2014. The major peak season of HFMD usually overlapped with the peak of EV71 circulation and the majority of severe HFMD cases were associated with EV71 infection.
<h4>Background</h4>The mean platelet volume (MPV) is the most commonly used measure of platelet size and is a potential marker of platelet reactivity. In this study, we aimed to explore the relationship between hepatic histopathology in viral hepatitis and MPV levels, which are associated with platelet count and activity.<h4>Materials and methods</h4>We performed a retrospective case-control study of baseline histological and clinical parameters in chronic hepatitis B and C patients in our tertiary reference center between January 2005 and January 2011. Two hundred and five chronic hepatitis B patients and 133 chronic hepatitis C patients who underwent liver biopsy were included in the study. The patients were divided into two groups: Chronic hepatitis B and chronic hepatitis C and were additionally divided into groups of two according to histological activity index (HAI) and fibrosis scores obtained by liver biopsy results (according to the Ishak scoring system). The clinical characteristics of chronic viral hepatitis patients, including demographics, laboratory (especially MPV), and liver biopsy findings, were reviewed.<h4>Results</h4>One hundred and forty-three patients were male (69.1%), and the mean age was 41.9 ± 12.75 with an age range of 18-71 years in hepatitis B patients. In the classification made according to HAI, 181 patients were in the low activity group (88.3%) and 24 in the high activity group (11.7%). In the evaluation made according to fibrosis score, 169 patients were found to have early fibrosis (82.4%) and 36 were found to have advanced fibrosis (17.6%). In patients with hepatitis B, there was no statistically significant difference in terms of their MPV values between the two groups, separated according to their degree of activity and fibrosis. Sixty-three patients were male (47.3%), and the mean age was 50.03 ± 12.75 with an age range of 19-75 years. In the classification made according to HAI, 109 patients were in low activity group (81.9%) and 24 in high activity group (18.1%). In the evaluation made according to fibrosis score, 101 patients were found to have early fibrosis (75.9%) and 32 have advanced fibrosis (24.1%). There was a statistically significant difference between the activity and fibrosis groups of the hepatitis C patients (P = 0.04 and P = 0.02, respectively).<h4>Conclusion</h4>MPV values are more reliable in hepatitis C patients than hepatitis B for predicting the advanced damage in liver histology. This finding might be useful for the detection of early fibrosis and also starting early treatment, which is important in hepatitis C.
Also flagged:tumor necrosis factor superfamily memberatherosclerotic cerebral infarctioncerebral infarctionTumor necrosis factor superfamily member 4atherosclerosiscerebral infarctions
Journal Article2015-09-01✓ 5 SnippetsHuang Q, Liu X, Feng J, Wen Y, He W, Liu Y.
In-Text Gene Mentions
Abstract)
…Tumor necrosis factor superfamily member 4 (TNFSF4) plays a key role in the process of atherosclerosis, a common risk factor for both myocardial and cerebral infarctions.…
Abstract)
…Studies have indicated that the single nucleotide polymorphism (SNP) rs3850641 in TNFSF4 is associated with higher risk of myocardial infarction and SNP rs3861950 in TNFSF4 is associated with higher risk of atherosclerosis cerebral infarction (ACI) ,but little is known about the association between TNFSF4 variations and vulnerable plaque of carotid artery.<h4>Methods</h4>A case-control study involving 510 patients with asymptomatic vulnerable plaque of carotid artery and 485 age and sex matched healthy subjects without vulnerable plaque of carotid artery was conducted in Hunan province.…
Abstract)
…However, there was no significant association between rs3850641 and asymptomatic vulnerable plaque of carotid artery (OR=1.16, 95%CI: 0.92-1.46; χ(2)=1.47, P=0.225).<h4>Conclusion</h4>TNFSF4 gene polymorphism rs3861950 was associated with the risk of vulnerable plaques of carotid artery in a Chinese population, which might be middle phenotype indicating higher risk of cerebral infarction.…
Abstract)
…superfamily member 4 (TNFSF4) plays a key…
Abstract)
…(SNP) rs3850641 inTNFSF4is associated with…
Show Full Abstract
<h4>Objective</h4>Vulnerable plaque of carotid artery is one of the risk factors of atherosclerotic cerebral infarction. Detection and treatment of vulnerable atherosclerotic plaque of carotid artery before symptoms of cerebral infarction is an effective way to prevent atherosclerotic cerebral infarction. Tumor necrosis factor superfamily member 4 (TNFSF4) plays a key role in the process of atherosclerosis, a common risk factor for both myocardial and cerebral infarctions. Studies have indicated that the single nucleotide polymorphism (SNP) rs3850641 in TNFSF4 is associated with higher risk of myocardial infarction and SNP rs3861950 in TNFSF4 is associated with higher risk of atherosclerosis cerebral infarction (ACI) ,but little is known about the association between TNFSF4 variations and vulnerable plaque of carotid artery.<h4>Methods</h4>A case-control study involving 510 patients with asymptomatic vulnerable plaque of carotid artery and 485 age and sex matched healthy subjects without vulnerable plaque of carotid artery was conducted in Hunan province. Asymptomatic vulnerable plaque of carotid artery means vulnerable plaque of carotid artery without cerebral infarction. Two SNPs of TNFSF4, rs3850641 and rs3861950, were genotyped by the TaqMan SNP genotyping method, and verified partly by Genomic DNA Sequencing.<h4>Results</h4>The results revealed a significant allelic association between rs3861950 and asymptomatic vulnerable plaque of carotid artery in case group (χ(2)=9.13, P=0.003; OR=1.41, 95%CI: 1.12-1.76). Compared with control subjects, the difference in genotype was significant in case group (χ(2)=25.28, P<0.000 1). However, there was no significant association between rs3850641 and asymptomatic vulnerable plaque of carotid artery (OR=1.16, 95%CI: 0.92-1.46; χ(2)=1.47, P=0.225).<h4>Conclusion</h4>TNFSF4 gene polymorphism rs3861950 was associated with the risk of vulnerable plaques of carotid artery in a Chinese population, which might be middle phenotype indicating higher risk of cerebral infarction.
Genetic studies in large outbred populations have documented a complex, highly polygenic basis for type 2 diabetes (T2D). Most of the variants currently known to be associated with T2D risk have been identified in large studies that included tens of thousands of individuals who are representative of a single major ethnic group such as European, Asian, or African. However, most of these variants have only modest effects on the risk for T2D; identification of definitive 'causal variant' or 'causative loci' is typically lacking. Studies in isolated populations offer several advantages over outbred populations despite being, on average, much smaller in sample size. For example, reduced genetic variability, enrichment of rare variants, and a more uniform environment and lifestyle, which are hallmarks of isolated populations, can reduce the complexity of identifying disease-associated genes. To date, studies in isolated populations have provided valuable insight into the genetic basis of T2D by providing both a deeper understanding of previously identified T2D-associated variants (e.g. demonstrating that variants in KCNQ1 have a strong parent-of-origin effect) or providing novel variants (e.g. ABCC8 in Pima Indians, TBC1D4 in the Greenlandic population, HNF1A in Canadian Oji-Cree). This review summarizes advancements in genetic studies of T2D in outbred and isolated populations, and provides information on whether the difference in the prevalence of T2D in different populations (Pima Indians vs. non-Hispanic Whites and non-Hispanic Whites vs. non-Hispanic Blacks) can be explained by the difference in risk allele frequencies of established T2D variants.
Also flagged:Type 2 DiabetesHemoglobin A1cglucosedysglycemiahereditary hemolytic anemiairon deficiency anemia
Journal Article2015-09-01✓ 1 SnippetLeong A, Meigs JB.
In-Text Gene Mentions
Text
…HFE…
Show Full Abstract
Hemoglobin A1c (HbA1c) is a biomarker used for population-level screening of type 2 diabetes (T2D) and risk stratification. Large-scale, genome-wide association studies have identified multiple genomic loci influencing HbA1c. We discuss the challenges of classifying these genomic loci as influencing HbA1c through glycemic or nonglycemic pathways, based on their probable biology and pleiotropic associations with erythrocyte traits. We show that putative nonglycemic genetic variants have a measurable, albeit small, impact on the classification of T2D status by HbA1c in white and Asian populations. Accounting for their effect on HbA1c may be relevant when screening populations with higher frequencies of nonglycemic HbA1c-altering alleles. As carriers of such HbA1c-altering alleles have HbA1c levels that may not accurately reflect overall glycemia, we describe how accounting for genotype may improve the performance of HbA1c in T2D prediction models and risk stratification, allowing for lifestyle intervention strategies to be directed towards those who are truly at elevated risk for developing T2D. In a Mendelian randomization framework, genetic variants can be used as instrumental variables to estimate causal relationships between HbA1c and T2D-related complications. This approach may help to support or refute HbA1c as an appropriate biomarker for long-term health outcomes in the general population.
…Huntington's disease (HD) is caused by an expansion of the CAG triplet repeat (encoding for the amino acid glutamine, Q) in the first exon of the IT15 gene, which encodes the protein huntingtin (Htt) [3].…
Many human diseases, particularly neurodegenerative diseases, are associated with protein misfolding. Cellular protein quality control includes all processes that ensure proper protein folding and thus prevent the toxic consequences of protein misfolding. The heat shock response (HSR) and the unfolded protein response (UPR) are major stress response pathways within protein quality control that antagonize protein misfolding in the cytosol and the endoplasmic reticulum, respectively. Huntington's disease is an inherited neurodegenerative disease caused by the misfolding of an abnormally expanded polyglutamine (polyQ) region in the protein huntingtin (Htt), polyQHtt. Using Huntington's disease as a paradigm, I review here the central role of both the HSR and the UPR in defining the toxicity associated with polyQHtt in Huntington's disease. These findings may begin to unravel a previously unappreciated cooperation between different stress response pathways in cells expressing misfolded proteins and consequently in neurodegenerative diseases.
The androgen receptor (AR), a ligand activated transcription factor plays a number of roles in reproduction, homeostasis and pathogenesis of disease. It has two major polymorphic sequences; a polyglutamine and a polyglycine repeat that determine the length of the protein and influence receptor folding, structure and function. Here, we review the role the folding of the AR plays in the pathogenesis of spinal-bulbar muscular atrophy (SBMA), a neuromuscular degenerative disease arising from expansion of the polyglutamine repeat. We discuss current management for SBMA patients and how research on AR structure function may lead to future drug treatments.
Also flagged:anaemia of prematurityEPOgestationHbanaemiasteroids
Journal Article2015-09-01No SnippetsAlan S, Arsan S.
Show Full Abstract
Despite recent advances in neonatal and perinatal medicine, extremely low birth weight infants (ELBW) are at high risk of developing anaemia of prematurity (AOP) requiring packed red blood cell (RBC) transfusions. The benefit of transfusing allogenic RBCs for AOP is a controversial issue, except for disturbances in tissue oxygenation. Although the role of erythropoietin (EPO) in the pathophysiology of AOP is well known, neither early nor late recombinant human EPO therapy alters the number or volume of RBC transfusions. It is also known that one-half of the feto-placental blood volume remains outside the newborn infant's circulation at 30 weeks of gestation if the umbilical cord is clamped immediately. Delayed cord clamping (DCC) and umbilical cord milking (UCM) are the main methods for enhancing placental transfusion. The basic principle of these approaches depends on providing high haemoglobin (Hb) levels to premature infants in the delivery room. The enhancement of placental transfusion clearly results in higher Hb levels at birth, reducing the need for RBC transfusions as well as creating a better haemodynamic status during the initial hours of life. To date, enhancement of placental transfusion in the delivery room by either DCC or UCM seems to be the best preventive measure for AOP. Yet, studies on the associated neurodevelopmental outcomes are insufficient to reach a conclusion. This review summarizes the pathophysiology, treatment and preventative strategies of anaemia of prematurity in light of the current literature.
Treatment of thalassemia depends on the clinical diagnosis. Almost all severe alpha thalassemia, Hb Bart’s hydrops fetalis, die intra utero or a few minute after birth. However, pregnant woman with Hb Bart’s hydrops fetus may develop toxemia of pregnancy and antepartum and postpartum hemorrhage. Those homozygous beta thalassemias (transfusion dependent thalassemia, TDT) are severely anemic after 6 months. At birth the baby is asymptomatic because Hb F level is high. As Hb F production waning off, replaced by inefficient beta globin chain production, at the age of 6 to 12 months, the baby begins to be anemic with hepatosplenomegaly. A group of non transfusion dependent thalassemia (NTDT) includes the majority of beta thalassemia/Hb E, Hb H disease and a few cases of homozygous beta thalassemias. The thalassemia minor including both alpha and beta thalassemia carriers and some homozygous state like homozygous alpha+ thalassemia, homozygous Hb E are asymptomatic and does not need any regular treatment. All thalassemia major, TDT, patients need regular blood transfusion, every 3-4 weeks, to maintain the hemoglobin around 10-12 g/dL. For those NTDT blood is given only when necessary. Usually patients with hemoglobin level higher than 6 g/dL require no blood transfusion. In infants and children if the hemoglobin levels can be maintained at 7 g/dL or above, defective physical development and bone changes can be prevented until they reached third or fourth decades of life that osteoporosis is almost always presented in those with low hemoglobin level. Iron overload occurs in moderate and severe case without exception. This will lead to dark skin, liver cirrhosis, cardiac arrhythmia and congestive heart failure. Diabetes mellitus secondary to iron deposition in the pancreas and other endocrine dysfunction does develop if the patients live long enough. Iron chelation with 1-2 gm/day of desferrioxamine intravenously or intramuscularly every day, at least 5 days a week, is recommended for those patients who have hemochromatosis. Oral iron chelator such as deferiprone and deferasirox is recently available. This helps patients to have better compliance with the iron chelator. Stem cell transplantation has been tried with a very good result in class I cases. Because some difficulty in finding appropriated HLA matched donor lately people try to perform haploidentical stem cell transplantation with some good results. Lupstaercept (ACE-536) and Sotatarcept (ACE-011), a recombinant fusion protein containing modified activin receptor type IIB and IgG Fc, is being developed for the treatment of anemia due to ineffective erythropoiesis. Preliminary data showed that the compound could increase hemoglobin levels 1.5 g/dL after two weeks of treatment in NTDT case and decrease blood transfusion in 60% of cases with TDT. Research is in progress to find better agents to enhance Hb F production.
Replicative analysis of genetic markers, previously identified in genome-wide association studies (GWAS) for neuropsychiatric diseases, in population of various origins may contribute to better understanding of genetic composition of the diseases. In this study 50 SNPs found in GWAS for schizophrenia (SZ), Alzheimer’s diseases (AD) and cognitive endophenotypes were genotyped in patients and control samples from Russian and Kazakh populations. Eight polymorphic markers (SNPs in regions of genes for APOЕ, APOJ, CSMD1, CCDC60, SNX29, PICALM, NOTCH4 and NRIP1) were associated with AD in Russian population. Associations of 10 genetic markers with SZ in Russian populations (markers in regions of genes for NRGN, KCNB2, NRIP1, CCDC60, LSM1, LOC100129100/LOC100509857, CSMD1, CPVL, POM121L2 and NDE1P1/PRMT6) and 8 genetic markers in Kazakh population (VRK2, KCNB2, CPVL, BRD1, PVRL2, ARHGAP1, CD33 u GPR89P/TRV-AAC1-5) were replicated. Multidimensional reduction methods revealed epistatic interaction of several genetic loci in formation of susceptibility to SZ in populations of various ethnic origins. Overlapping fields of genetic associations for AD and SZ, demonstrating some similarity in inherited background for both diseases, were found. This interaction may be implemented through common unknown levels in pathogenesis of AD and SZ, mediated by cognitive endophenotypes. Bioinformatic analysis of biological functions of associated genes revealed that among primary biological processes enriched by genes under study are the processes of lipid metabolism, cellular interactions, various regulatory and transport processes in neural cells, processes of immune response regulation. Substantial part of investigated genes forms an interacting network, which consisted of distinct clusters corresponding to major biological processes, were genes under study are involved, and to basic molecular functions of their products. In general, data obtained in the project, extend the understanding of genetic component in neuro-psychiatric diseases, as well as the biological processes and functions, implemented in the manifestation of genetic susceptibility to AD and SZ.
<h4>Background</h4> The 6-pyruvoyl-tetrahydropterin synthase (PTPS) deficiency is the most important type of BH4 deficiency related to hyperphenylalaninemia. It is also accompanied by various neurological signs and symptoms due to impaired synthesis of catecholamines and serotonin. In this report, we aimed to report the long-term results of early initiation of treatment PTPS. <h4>Methods</h4> Between 1988 and 2014, 23 newborns with PTPS deficiency who underwent early treatment at our hospital were identified. All patients received tetrahydrobiopterin replacement in a daily dosage between approximately 2 and 4 mg/kg. The dosages of levodopa replacement were 10 to 15 mg/kg/d, which is considerably higher than the typically recommended dosages of less than 7 mg/kg/d for patients aged younger than 2 years and 8 to 10 mg/kg/d for patients aged 2 years or older. Replacement with 5-hydroxytryptophan varied widely among patients. We examined the IQ score of the patients of age greater than 3 years. <h4>Results</h4> The overall incidence rate of PTPS according to the newborn screen result showed 1/115,000. The mean (SD) IQ score of our PTPS-deficient patients was 96.2 (range, 90-119), which is considerably higher than previous reports of other populations of PTPS-deficient patients (IQ: 76; range, 56-98). All patients reached a normal IQ on high daily dosages of levodopa replacement, without developing apparent long-term levodopa-induced adverse effects. We also observed a correlation between long-term IQ score and genotype, birth weight, and age at initiation of treatment. <h4>Conclusions</h4> An effective newborn screening referral program and early initiation of appropriate therapy preserved the IQ scores of PTPS-deficient patients.
A 45-year-old man with no significant past medical history was referred to gastroenterology for evaluation of a large hepatic mass and abnormal liver tests following laparoscopic cholecystectomy. Postoperative abdominal computed tomography (CT) scan was remarkable for a subcapsular mass in the left hepatic lobe, which was not present on preoperative CT. Over the course of three months, the patient had a total of five abdominal CT scans which revealed a gradual expansion of the mass to peak dimensions of 7.1 × 3.9 × 11.3 cm, followed by complete resolution approximately ten weeks after the mass was first noted. Portal vein thrombosis and massive splenomegaly were also discovered during these imaging studies. Upon further questioning, the patient endorsed years of painful breast enlargement and leg swelling. His family history was remarkable for a distant cousin with hemochromatosis, but negative for any other hepatic or renal disease. He denied excessive alcohol use. His physical exam was remarkable for painful gynecomastia, 1+ pedal edema, and splenomegaly, but lacked other typical stigmata of cirrhosis. The patient's laboratory values were remarkable for an elevated international normalized ratio 1.3, albumin 3.1 g/dL, alanine aminotransferase 68 U/L, aspartate aminotransferase 57 U/L, alkaline phosphatase 171 U/L, total bilirubin 2.5 mg/dL, direct bilirubin 0.9 mg/dL, and platelets 109,000/mm3. Of note, neither radiographic nor laboratory studies revealed evidence of cystic kidney disease. The patient was evaluated for common causes of cirrhosis including hemochromatosis, viral hepatitis, autoimmune hepatitis, and Wilson's disease. This workup returned negative except for H63D homozygosity. Liver biopsy was performed and revealed fibrosis, hepatocellular extinction, mild iron deposition, and numerous von Meyenburg complexes, consistent with PCLD. This case illustrates a previously undescribed presentation of PCLD. Typically asymptomatic, PCLD is most commonly discovered incidentally or due to compressive hepatomegaly, cyst infection, rupture, or hemorrhage. In our patient, PCLD presented as what was initially thought to be an evolving abscess or inflammatory fluid collection related to his cholecystectomy. Another unique aspect of this case is that it is very unusual for PCLD to present with decompensated cirrhosis. When significant liver disease does develop, it typically occurs in the setting of massive hepatomegaly due to cyst enlargement. This case highlights PCLD's ability to cause advanced liver dysfunction in the absence of these complications. PCLD should be considered in the differential when considering causes of unexplained cirrhosis and when there are hepatic fluid collections of unclear etiology.