Gene Literature Dashboard

Viewing January 2018 — 538 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← December 2017 February 2018 →
Also flagged:prostate cancercell proliferationtumorbromidebromodeoxyuridinesuppressor
Journal Article 2018-01-31 ✓ 5 Snippets Yu Y, Wang Z, Sun D, Zhou X, Wei X, Hou W, Ding Y, Ma Y, Hou Y.
In-Text Gene Mentions

Double knockdown of miR-671 and SOX6 promoted PC3 cell proliferation, suggesting that miR-671 promotes prostate cancer cell proliferation by inhibiting SOX6.

tumor suppressor SOX6

tumor suppressor SOX6 (encoding SRY

prostate cancer cell proliferation by targeting tumor suppressor SOX6

SOX6 promoted PC3 cell proliferation, suggesting that miR-671 promotes prostate cancer

Show Full Abstract

Prostate cancer is one of the most severe malignancies in men, and many genes and non-coding RNAs, included microRNAs (miRs), have been demonstrated to regulate prostate cancer progression. In the present study, we investigated the role of miR-671 in prostate cancer cell proliferation. We found that miR-671 was significantly upregulated in human prostate cancer tissues and cells. miR-671 overexpression promoted prostate cancer cell proliferation, while its downregulation inhibited prostate cancer cell proliferation, as determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays, colony formation assays, soft agar growth assays, and bromodeoxyuridine (BrdU) incorporation assays. miR-671 directly targets the 3' untranslated region (UTR) of the tumor suppressor SOX6 (encoding SRY (sex determining region Y)-box 6) to inhibit its expression. Double knockdown of miR-671 and SOX6 promoted PC3 cell proliferation, suggesting that miR-671 promotes prostate cancer cell proliferation by inhibiting SOX6.

Also flagged:TUBB3axon guidanceneuronal migrationaxonnetrin-1netrin receptor
Journal Article 2018-01-31 ✓ 5 Snippets Huang H, Yang T, Shao Q, Majumder T, Mell K, Liu G.
In-Text Gene Mentions

colorectal cancer (DCC

TUBB3 mutations impair netrin/DCC signaling in the developing nervous

DCC signaling in the developing nervous

…in colorectal cancer (DCC).…

…TUBB3 mutations impair netrin/DCCsignaling in the…

Show Full Abstract

Heterozygous missense mutations in human TUBB3 gene result in a spectrum of brain malformations associated with defects in axon guidance, neuronal migration and differentiation. However, the molecular mechanisms underlying mutation-related axon guidance abnormalities are unclear. Recent studies have shown that netrin-1, a canonical guidance cue, induced the interaction of TUBB3 with the netrin receptor deleted in colorectal cancer (DCC). Furthermore, TUBB3 is required for netrin-1-induced axon outgrowth, branching and pathfinding. Here, we provide evidence that TUBB3 mutations impair netrin/DCC signaling in the developing nervous system. The interaction of DCC with most TUBB3 mutants (eight out of twelve) is significantly reduced compared to the wild-type TUBB3. TUBB3 mutants R262C and A302V exhibit decreased subcellular colocalization with DCC in the growth cones of primary neurons. Netrin-1 increases the interaction of endogenous DCC with wild-type human TUBB3, but not R262C or A302V, in primary neurons. Netrin-1 also increases co-sedimentation of DCC with polymerized microtubules (MTs) in primary neurons expressing the wild-type TUBB3, but not R262C or A302V. Expression of either R262C or A302V not only suppresses netrin-1-induced neurite outgrowth, branching and attraction in vitro, but also causes defects in spinal cord commissural axon (CA) projection and pathfinding in ovo. Our study reveals that missense TUBB3 mutations specifically disrupt netrin/DCC-mediated attractive signaling.

Also flagged:-hydrogenasehydrideDithiolatemethylhydrogenasesH 2 ases
Journal Article 2018-01-31 No Snippets Carlson MR, Gray DL, Richers CP, Wang W, Zhao PH, Rauchfuss TB, Pelmenschikov V, Pham CC, Gee LB, Wang H, Cramer SP.
Show Full Abstract

The kinetically robust hydride [t-HFe<sub>2</sub>(Me<sub>2</sub>pdt)(CO)<sub>2</sub>(dppv)<sub>2</sub>]<sup>+</sup> ([t-H1]<sup>+</sup>) (Me<sub>2</sub>pdt<sup>2-</sup> = Me<sub>2</sub>C(CH<sub>2</sub>S<sup>-</sup>)<sub>2</sub>; dppv = cis-1,2-C<sub>2</sub>H<sub>2</sub>(PPh<sub>2</sub>)<sub>2</sub>) and related derivatives were prepared with <sup>57</sup>Fe enrichment for characterization by NMR, FT-IR, and NRVS. The experimental results were rationalized using DFT molecular modeling and spectral simulations. The spectroscopic analysis was aimed at supporting assignments of Fe-H vibrational spectra as they relate to recent measurements on [FeFe]-hydrogenase enzymes. The combination of bulky Me<sub>2</sub>pdt<sup>2-</sup> and dppv ligands stabilizes the terminal hydride with respect to its isomerization to the 5-16 kcal/mol more stable bridging hydride ([μ-H1]<sup>+</sup>) with t<sub>1/2</sub>(313.3 K) = 19.3 min. In agreement with the nOe experiments, the calculations predict that one methyl group in [t-H1]<sup>+</sup> interacts with the hydride with a computed CH···HFe distance of 1.7 Å. Although [t-H<sup>57</sup>1]<sup>+</sup> exhibits multiple NRVS features in the 720-800 cm<sup>-1</sup> region containing the bending Fe-H modes, the deuterated [t-D<sup>57</sup>1]<sup>+</sup> sample exhibits a unique Fe-D/CO band at ∼600 cm<sup>-1</sup>. In contrast, the NRVS spectra for [μ-H<sup>57</sup>1]<sup>+</sup> exhibit weaker bands near 670-700 cm<sup>-1</sup> produced by the Fe-H-Fe wagging modes coupled to Me<sub>2</sub>pdt<sup>2-</sup> and dppv motions.

Also flagged:CalcificationMelatoninAgingneuronal diseasesbone formationprimary insomnia
Journal Article 2018-01-31 No Snippets Tan DX, Xu B, Zhou X, Reiter RJ.
Show Full Abstract

The pineal gland is a unique organ that synthesizes melatonin as the signaling molecule of natural photoperiodic environment and as a potent neuronal protective antioxidant. An intact and functional pineal gland is necessary for preserving optimal human health. Unfortunately, this gland has the highest calcification rate among all organs and tissues of the human body. Pineal calcification jeopardizes melatonin's synthetic capacity and is associated with a variety of neuronal diseases. In the current review, we summarized the potential mechanisms of how this process may occur under pathological conditions or during aging. We hypothesized that pineal calcification is an active process and resembles in some respects of bone formation. The mesenchymal stem cells and melatonin participate in this process. Finally, we suggest that preservation of pineal health can be achieved by retarding its premature calcification or even rejuvenating the calcified gland.

Also flagged:nonalcoholic fatty liver diseaseNAFLDnonalcoholic steatohepatitisNASHhepatocellular carcinomaGATAD2A
Journal Article 2018-01-31 ✓ 1 Snippet Kawaguchi T, Shima T, Mizuno M, Mitsumoto Y, Umemura A, Kanbara Y, Tanaka S, Sumida Y, Yasui K, Takahashi M, Matsuo K, Itoh Y, Tokushige K, Hashimoto E, Kiyosawa K, Kawaguchi M, Itoh H, Uto H, Komorizono Y, Shirabe K, Takami S, Takamura T, Kawanaka M, Yamada R, Matsuda F, Okanoue T.
In-Text Gene Mentions

…, rs1799945 inHFE, and rs17883901…

Show Full Abstract

The genetic factors affecting the natural history of nonalcoholic fatty liver disease (NAFLD), including the development of nonalcoholic steatohepatitis (NASH) and NASH-derived hepatocellular carcinoma (NASH-HCC), are still unknown. In the current study, we sought to identify genetic factors related to the development of NAFLD, NASH, and NASH-HCC, and to establish risk-estimation models for them. For these purposes, 936 histologically proven NAFLD patients were recruited, and genome-wide association (GWA) studies were conducted for 902, including 476 NASH and 58 NASH-HCC patients, against 7,672 general-population controls. Risk estimations for NAFLD and NASH were then performed using the SNPs identified as having significant associations in the GWA studies. We found that rs2896019 in PNPLA3 [p = 2.3x10-31, OR (95%CI) = 1.85 (1.67-2.05)], rs1260326 in GCKR [p = 9.6x10-10, OR (95%CI) = 1.38(1.25-1.53)], and rs4808199 in GATAD2A [p = 2.3x10-8, OR (95%CI) = 1.37 (1.23-1.53)] were significantly associated with NAFLD. Notably, the number of risk alleles in PNPLA3 and GATAD2A was much higher in Matteoni type 4 (NASH) patients than in type 1, type 2, and type 3 NAFLD patients. In addition, we newly identified rs17007417 in DYSF [p = 5.2x10-7, OR (95%CI) = 2.74 (1.84-4.06)] as a SNP associated with NASH-HCC. Rs641738 in TMC4, which showed association with NAFLD in patients of European descent, was not replicated in our study (p = 0.73), although the complicated LD pattern in the region suggests the necessity for further investigation. The genetic variants of PNPLA3, GCKR, and GATAD2A were then used to estimate the risk for NAFLD. The obtained Polygenic Risk Scores showed that the risk for NAFLD increased with the accumulation of risk alleles [AUC (95%CI) = 0.65 (0.63-0.67)].<h4>Conclusions</h4>We demonstrated that NASH is genetically and clinically different from the other NAFLD subgroups. We also established risk-estimation models for NAFLD and NASH using multiple genetic markers. These models can be used to improve the accuracy of NAFLD diagnosis and to guide treatment decisions for patients.

Also flagged:type 2 diabetesgene expressionhistonechromatinbindingtranscription factors
Journal Article 2018-01-31 ✓ 5 Snippets Sun W, Yao S, Tang J, Liu S, Chen J, Deng D, Zeng C.
In-Text Gene Mentions

In addition, we indicated that T2D super enhancer SNPs may alter the transcription factor binding affinity of Tcf12, Sox6, JUNB, Myog, and Gata4, etc. For example, transcription factors Gata4 is critical for the regulation of T2D development and metabolism [49].

Transcription factors Sox6 and JUNB are involved in T2D metabolism, T2D-related cell development and differentiation [47, 48].

Sox6 and JUNB are involved in T2D metabolism, T2D-related cell development and differentiation [47, 48].

…factors are Tcf12,Sox6, JUNB, Myog, and…

Sox6and JUNB are…

Show Full Abstract

Clinical studies in type 2 diabetes (T2D) primarily focused on the single nucleotide polymorphisms (SNPs) located in protein-coding regions. Recently, the SNPs located in noncoding regions have also been recognized to play an important role in disease susceptibility. The super enhancer is a cluster of transcriptional enhancers located in noncoding regions. It plays a critical role in cell-type specific gene expression. However, the exact mechanism of the super enhancer SNPs for T2D remains unclear. In this study, we integrated genome-wide association studies (GWASs) and T2D cell/tissue-specific histone modification ChIP-seq data to identify T2D-associated SNPs in super enhancer, followed by comprehensive bioinformatics analyses to further explore the functional importance of these SNPs. We identified several interesting T2D super enhancer SNPs. Interesting, most of them were clustered within the same or neighboring super enhancers. A number of SNPs are involved in chromatin interactive regulation and/or potentially influence the binding affinity of transcription factors. Gene Ontology (GO) analysis showed a significant enrichment in several well-known signaling pathways and regulatory process, e.g. WNT signaling pathway, which plays a key role in T2D metabolism. Our results highlighted the potential functional importance of T2D super enhancer SNPs, which may yield novel insights into the pathogenesis of T2D.

Also flagged:sepsisdeathinfectionIRP BalfaIRP
Journal Article 2018-01-31 No Snippets Annane D, Mira JP, Ware LB, Gordon AC, Hinds CJ, Christiani DC, Sevransky J, Barnes K, Buchman TG, Heagerty PJ, Balshaw R, Lesnikova N, de Nobrega K, Wellman HF, Neira M, Mancini ADJ, Walley KR, Russell JA.
Show Full Abstract

<h4>Purpose</h4>To explore potential design for pharmacogenomics trials in sepsis, we investigate the interaction between pharmacogenomic biomarkers and response to drotrecogin alfa (activated) (DrotAA). This trial was designed to validate whether previously identified improved response polymorphisms (IRPs A and B) were associated with an improved response to DrotAA in severe sepsis.<h4>Methods</h4>Patients with severe sepsis at high risk of death, who received DrotAA or not, with DNA available were included and matched to controls adjusting for age, APACHE II or SAPS II, organ dysfunction, ventilation, medical/surgical status, infection site, and propensity score (probability that a patient would have received DrotAA given their baseline characteristics). Independent genotyping and two-phase data transfer mitigated bias. The primary analysis compared the effect of DrotAA in IRP+ and IRP- groups on in-hospital 28-day mortality. Secondary endpoints included time to death in hospital; intensive care unit (ICU)-, hospital-, and ventilator-free days; and overall DrotAA treatment effect on mortality.<h4>Results</h4>Six hundred and ninety-two patients treated with DrotAA were successfully matched to 1935 patients not treated with DrotAA. Genotyping was successful for 639 (DrotAA) and 1684 (nonDrotAA) matched patients. The primary hypothesis of a genotype-by-treatment interaction (assessed by conditional logistic regression analysis) was not significant (P = 0.30 IRP A; P = 0.78 IRP B), and there was no significant genotype by treatment interaction for any secondary endpoint.<h4>Conclusions</h4>Neither IRP A nor IRP B predicted differential response to DrotAA on in-hospital 28-day mortality. ClinicalTrials.gov registration NCT01486524.

Also flagged:Sleepcognitionmetabolic dysfunctiondeathbehavioralto
Journal Article 2018-01-31 No Snippets Ly S, Pack AI, Naidoo N.
Show Full Abstract

Sleep is a biological enigma that has raised numerous questions about the inner workings of the brain. The fundamental question of why our nervous systems have evolved to require sleep remains a topic of ongoing scientific deliberation. This question is largely being addressed by research using animal models of sleep. Drosophila melanogaster, also known as the common fruit fly, exhibits a sleep state that shares common features with many other species. Drosophila sleep studies have unearthed an immense wealth of knowledge about the neuroscience of sleep. Given the breadth of findings published on Drosophila sleep, it is important to consider how all of this information might come together to generate a more holistic understanding of sleep. This review provides a comprehensive summary of the neurobiology of Drosophila sleep and explores the broader insights and implications of how sleep is regulated across species and why it is necessary for the brain.

Also flagged:ATP7AMenkes diseaseneurodevelopmental disordercoppergenetic diseasesmitochondrial
Journal Article 2018-01-31 ✓ 1 Snippet Zlatic SA, Vrailas-Mortimer A, Gokhale A, Carey LJ, Scott E, Burch R, McCall MM, Rudin-Rush S, Davis JB, Hartwig C, Werner E, Li L, Petris M, Faundez V.
In-Text Gene Mentions

PTGIS

Show Full Abstract

Rare neurological diseases shed light onto universal neurobiological processes. However, molecular mechanisms connecting genetic defects to their disease phenotypes are elusive. Here, we obtain mechanistic information by comparing proteomes of cells from individuals with rare disorders with proteomes from their disease-free consanguineous relatives. We use triple-SILAC mass spectrometry to quantify proteomes from human pedigrees affected by mutations in ATP7A, which cause Menkes disease, a rare neurodegenerative and neurodevelopmental disorder stemming from systemic copper depletion. We identified 214 proteins whose expression was altered in ATP7A<sup>-/y</sup> fibroblasts. Bioinformatic analysis of ATP7A-mutant proteomes identified known phenotypes and processes affected in rare genetic diseases causing copper dyshomeostasis, including altered mitochondrial function. We found connections between copper dyshomeostasis and the UCHL1/PARK5 pathway of Parkinson disease, which we validated with mitochondrial respiration and Drosophila genetics assays. We propose that our genealogical "omics" strategy can be broadly applied to identify mechanisms linking a genomic locus to its phenotypes.

Also flagged:HeadacheLRP1migraineCRHR1neuroticismpsychological disorders
Journal Article 2018-01-31 ✓ 2 Snippets Meng W, Adams MJ, Hebert HL, Deary IJ, McIntosh AM, Smith BH.
In-Text Gene Mentions

…protein 2 (NUFIP2),butyrophilin subfamily 2 member A2subfamily 2 member…

…2 member A2 (BTN2A2), myosin IH (MYO1H),…

Show Full Abstract

<h4>Background</h4>Headache is the most common neurological symptom and a leading cause of years lived with disability. We sought to identify the genetic variants associated with a broadly-defined headache phenotype in 223,773 subjects from the UK Biobank cohort.<h4>Methods</h4>We defined headache based on a specific question answered by the UK Biobank participants. We performed a genome-wide association study of headache as a single entity, using 74,461 cases and 149,312 controls.<h4>Results</h4>We identified 3343 SNPs which reached the genome-wide significance level of P<5×10<sup>-8</sup>. The SNPs were located in 28 loci, with the top SNP of rs11172113 in the LRP1 gene having a P value of 4.92×10<sup>-47</sup>. Of the 28 loci, 14 have previously been associated with migraine. Among 14 new loci, rs77804065 with a P value of 5.87×10<sup>-15</sup> in the LINC02210-CRHR1 gene was the top SNP. Significant relationships between multiple brain tissues and genetic associations were identified through tissue expression analysis. We also identified significant positive genetic correlations between headache and many psychological traits.<h4>Conclusions</h4>Our results suggest that brain function is closely related to broadly-defined headache. In addition, we found that many psychological traits have genetic correlations with headache.

Also flagged:Dry Eye diseasenerve terminalsMitomycin Caxondry eyeaxon growth
Journal Article 2018-01-31 ✓ 5 Snippets Stepp MA, Pal-Ghosh S, Tadvalkar G, Williams A, Pflugfelder SC, de Paiva CS.
In-Text Gene Mentions

…33), NTN1(Qiagen #QT00128478),DCC(Qiagen #QT00135100), Unc5b(Qi…

…and it's receptorsDCC, Unc5b and Efna5.…

…24 months, Ntn1,DCC, Unc5b, and Efna5…

…include several integrins,Dcc, Unc5B, and Neo1…

…of Ntn1, Unc5b,DCC, Efna4, Efna5, and…

Show Full Abstract

Dry Eye disease causes discomfort and pain in millions of patients. Using a mouse acute desiccating stress (DS) model we show that DS induces a reduction in intraepithelial corneal nerve (ICN) density, corneal sensitivity, and apical extension of the intraepithelial nerve terminals (INTs) that branch from the subbasal nerves (SBNs). Topical application of 0.02% Mitomycin C (MMC) or vehicle alone has no impact on the overall loss of axon density due to acute DS. Chronic dry eye, which develops progressively as C57BL/6 mice age, is accompanied by significant loss of the ICNs and corneal sensitivity between 2 and 24 months of age. QPCR studies show that mRNAs for several proteins that regulate axon growth and extension are reduced in corneal epithelial cells by 24 months of age but those that regulate phagocytosis and autophagy are not altered. Taken together, these data demonstrate that dry eye disease is accompanied by alterations in intraepithelial sensory nerve morphology and function and by reduced expression in corneal epithelial cells of mRNAs encoding genes mediating axon extension. Précis: Acute and chronic mouse models of dry eye disease are used to evaluate the pathologic effects of dry eye on the intraepithelial corneal nerves (ICNs) and corneal epithelial cells. Data show reduced numbers of sensory nerves and alterations in nerve morphology, sensitivity, corneal epithelial cell proliferation, and expression of mRNAs for proteins mediating axon extension accompany the pathology induced by dry eye.

Also flagged:steroidhormonescorticosteroneantibodysteroidsdesoxycorticosterone
Journal Article 2018-01-31 No Snippets Wheaton CJ, Mylniczenko ND, Rimoldi JM, Gadepalli RSVS, Hart R, O'Hara BR, Evans AN.
Show Full Abstract

Sharks and rays are popular species used in wildlife ecotourism and aquariums to educate the public on the behavior, ecology and conservation challenges of elasmobranchs. To understand long-term physiological health and welfare under varying social and husbandry conditions, we developed and validated an enzyme immunoassay (EIA) to measure stress/ionoregulatory hormones in managed and semi-free range southern rays (Hypanus americanus). Banked serum and interrenal samples from 27 female rays managed at Disney's The Seas with Nemo and Friends® and Castaway Cay were used to evaluate measurement of 1α-hydroxycorticosterone (1αOHB) relative to corticosterone (B). Although commercial EIAs are available for B, those tested exhibit only low relative cross-reactivity to 1αOHB (3-5%). To improve measurement of 1αOHB, we developed a monoclonal antibody using a synthesized 1αOHB-derivative for evaluation using high-performance liquid chromatography (HPLC) and EIA. Relative displacements of cross-reactant compounds showed that the antibody had good sensitivity for the target antigen 1αOHB, and low sensitivity to related steroids (desoxycorticosterone and B), but greater sensitivity to 11-dehydrocorticosterone. Tests of competitive vs. noncompetitive EIA formats, reagent titration, and incubation times of the antibody and conjugate were used to optimize sensitivity, repeatability and precision of measured 1αOHB in standards and samples (4 ng/ml, 90% binding). Tests of sample pre-treatment (pH adjustment) and extraction with varying solvent polarity were used to optimize measurement of 1αOHB in <1 ml (serum) or 1 g (interrenal) samples. HPLC analysis revealed the 1αOHB EIA to be superior for measurement of 1αOHB compared to use of a B EIA with or without HPLC fractioning. Results may prove useful for extrapolation to guide best practices for 1αOHB measurement in other elasmobranch species. Improved measurement of stress/ionoregulatory hormones in sharks and rays will be important for many aspects of collection, transport, medical treatment in aquaria and conservation management of these charismatic and ecologically important species.

Also flagged:gene expressionwaterlacZSun1membraneCas9
Journal Article 2018-01-31 No Snippets Osterwalder M, Barozzi I, Tissières V, Fukuda-Yuzawa Y, Mannion BJ, Afzal SY, Lee EA, Zhu Y, Plajzer-Frick I, Pickle CS, Kato M, Garvin TH, Pham QT, Harrington AN, Akiyama JA, Afzal V, Lopez-Rios J, Dickel DE, Visel A, Pennacchio LA.
Show Full Abstract

Distant-acting tissue-specific enhancers, which regulate gene expression, vastly outnumber protein-coding genes in mammalian genomes, but the functional importance of this regulatory complexity remains unclear. Here we show that the pervasive presence of multiple enhancers with similar activities near the same gene confers phenotypic robustness to loss-of-function mutations in individual enhancers. We used genome editing to create 23 mouse deletion lines and inter-crosses, including both single and combinatorial enhancer deletions at seven distinct loci required for limb development. Unexpectedly, none of the ten deletions of individual enhancers caused noticeable changes in limb morphology. By contrast, the removal of pairs of limb enhancers near the same gene resulted in discernible phenotypes, indicating that enhancers function redundantly in establishing normal morphology. In a genetic background sensitized by reduced baseline expression of the target gene, even single enhancer deletions caused limb abnormalities, suggesting that functional redundancy is conferred by additive effects of enhancers on gene expression levels. A genome-wide analysis integrating epigenomic and transcriptomic data from 29 developmental mouse tissues revealed that mammalian genes are very commonly associated with multiple enhancers that have similar spatiotemporal activity. Systematic exploration of three representative developmental structures (limb, brain and heart) uncovered more than one thousand cases in which five or more enhancers with redundant activity patterns were found near the same gene. Together, our data indicate that enhancer redundancy is a remarkably widespread feature of mammalian genomes that provides an effective regulatory buffer to prevent deleterious phenotypic consequences upon the loss of individual enhancers.

Also flagged:transposonsreproductionhost cellinfectionhost genomeviral genome
Journal Article 2018-01-31 No Snippets Wallau GL, Vieira C, Loreto ÉLS.
Show Full Abstract

<h4>Background</h4>All living species contain genetic information that was once shared by their common ancestor. DNA is being inherited through generations by vertical transmission (VT) from parents to offspring and from ancestor to descendant species. This process was considered the sole pathway by which biological entities exchange inheritable information. However, Horizontal Transfer (HT), the exchange of genetic information by other means than parents to offspring, was discovered in prokaryotes along with strong evidence showing that it is a very important process by which prokaryotes acquire new genes.<h4>Main body</h4>For some time now, it has been a scientific consensus that HT events were rare and non-relevant for evolution of eukaryotic species, but there is growing evidence supporting that HT is an important and frequent phenomenon in eukaryotes as well.<h4>Conclusion</h4>Here, we will discuss the latest findings regarding HT among eukaryotes, mainly HT of transposons (HTT), establishing HTT once and for all as an important phenomenon that should be taken into consideration to fully understand eukaryotes genome evolution. In addition, we will discuss the latest development methods to detect such events in a broader scale and highlight the new approaches which should be pursued by researchers to fill the knowledge gaps regarding HTT among eukaryotes.

Also flagged:colon cancercolon cancersRCCgene expressionPCNATP53
Journal Article 2018-01-31 No Snippets Peng Q, Lin K, Chang T, Zou L, Xing P, Shen Y, Zhu Y.
Show Full Abstract

<h4>Introduction</h4>More and more findings have demonstrated that right-sided colon cancers (RCC) and left-sided colon cancers (LCC) are distinct clinical and biological entities and suggest that they should be treated as different diseases. However, the reasons why RCC and LCC harbor different clinical and biological features remain unclear.<h4>Materials and methods</h4>To identify the genomic expression differences between RCC and LCC and uncover the mechanisms underlying these differences, we chose the gene expression profiles of GSE14333 from the Gene Expression Omnibus (GEO) database as an object of study. Then, a systematic and integrative bioinformatics analysis was performed to research the possible mechanism of the differentially expressed (DE) genes from the Gene Expression Omnibus dataset including gene ontology (GO) analysis, pathway enrichment analysis, protein-protein interaction (PPI) network construction, and module analysis. Totally, we extracted 3,793 DE genes from samples of colon cancer including 1,961 genes upregulated in RCC and 1,832 genes upregulated in LCC from the selected dataset.<h4>Results</h4>The results of GO and pathway enrichment analysis indicated that RCC and LCC could predispose to different pathways regulated by different genes. Based on the PPI network, <i>PCNA</i>, <i>TP53</i>, <i>HSP90AA1</i>, <i>CSNK2A1</i>, <i>UBB</i>, <i>LRRK2</i>, <i>ABL1</i>, <i>PRKACA</i>, <i>CAV1</i>, and <i>JUN</i> were identified as the key hub genes. Also, significant modules were screened from the PPI network.<h4>Conclusion</h4>In conclusion, the present study indicated that the identified genes and pathways may promote new insights into the underlying molecular mechanisms contributing to the difference between RCC and LCC and might be used as specific therapeutic targets and prognostic markers for the personalized treatment of RCC and LCC.

Also flagged:Endometrial cancercancerPeroxiredoxinscell differentiationreverse transcriptionpolymerase
Journal Article 2018-01-31 ✓ 1 Snippet Byun JM, Kim SS, Kim KT, Kang MS, Jeong DH, Lee DS, Jung EJ, Kim YN, Han J, Song IS, Lee KB, Sung MS.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Endometrial cancer is the sixth most common cancer in women worldwide. Peroxiredoxins (PRDXs) are antioxidant enzymes that serve important roles in cell differentiation, proliferation, and apoptosis. In the present study, the potential associations between PRDX expression and endometrial cancer were investigated. The expression levels of various PRDX mRNAs were detected by semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) in endometrial cancer tissues (n=26) and normal endometrial tissues (n=10). Additionally, the expression of PRDX isoforms was immunohistochemically examined in endometrial cancer tissues and adjacent normal endometrial tissues from 42 patients. Finally, the associations between high PRDX expression levels and clinicopathological features were examined in patients with endometrial cancer. Analysis of PRDX expression in endometrial cancer tissues and normal endometrial tissues by semi-quantitative RT-PCR showed that all PRDX isoforms had increased expression in the endometrial cancer tissues compared with that in the normal endometrium, and the differences in the expression levels of PRDX1 and PRDX3 between cancer and normal tissues were statistically significant (P=0.0015 and P=0.0134, respectively). Additionally, analysis of PRDX expression in endometrial cancer and paired normal endometrial tissues by immunohistochemistry showed strong cytoplasmic staining of PRDX3 and PRDX5 in cancer tissues, with high PRDX3 (25/42, 59.5%) and PRDX5 (32/42, 76.2%) appearing more frequently in endometrial cancer than in normal endometrial tissues (P=0.0001 and P=0.0023, respectively). Furthermore, high expression of PRDX5 was associated with advanced-stage endometrial cancer (P=0.0399). Although the 5-year survival rate was marginally higher in patients with low expression of PRDX3 and PRDX5, this result was not statistically significant. In summary, PRDX3 and PRDX5 are highly expressed in endometrial cancer and could be associated with advanced stage and poor prognosis. Therefore, these proteins may potentially be used as prognostic markers for endometrial cancer.

Also flagged:NECpathogenesisinflammatory responsegene expressioninnate immunityNecrotizing Enterocolitis
Journal Article 2018-01-31 ✓ 5 Snippets Senger S, Ingano L, Freire R, Anselmo A, Zhu W, Sadreyev R, Walker WA, Fasano A.
In-Text Gene Mentions

…, 46 Interestingly,OLFM4and LYZ were…

…of the geneOLFM4, an intestinal stem…

…52OLFM4was previously found…

…we found thatOLFM4was significantly down-regulat…

…significant down-regulation ofOLFM4in all FEnS,…

Show Full Abstract

<h4>Background & aims</h4>Untreated necrotizing enterocolitis (NEC) can lead to massive inflammation resulting in intestinal necrosis with a high mortality rate in preterm infants. Limited access to human samples and relevant experimental models have hampered progress in NEC pathogenesis. Earlier evidence has suggested that bacterial colonization of an immature and developing intestine can lead to an abnormally high inflammatory response to bacterial bioproducts. The aim of our study was to use human fetal organoids to gain insights into NEC pathogenesis.<h4>Methods</h4>RNA sequencing analysis was performed to compare patterns of gene expression in human fetal-derived enterospheres (FEnS) and adult-derived enterospheres (AEnS). Differentially expressed genes were analyzed using computational techniques for dimensional reduction, clustering, and gene set enrichment. Unsupervised cluster analysis, Gene Ontology, and gene pathway analysis were used to predict differences between gene expression of samples. Cell monolayers derived from FEnS and AEnS were evaluated for epithelium function and responsiveness to lipopolysaccharide and commensal bacteria.<h4>Results</h4>Based on gene expression patterns, FEnS clustered according to their developmental age in 2 distinct groups: early and late FEnS, with the latter more closely resembling AEnS. Genes involved in maturation, gut barrier function, and innate immunity were responsible for these differences. FEnS-derived monolayers exposed to either lipopolysaccharide or commensal <i>Escherichia coli</i> showed that late FEnS activated gene expression of key inflammatory cytokines, whereas early FEnS monolayers did not, owing to decreased expression of nuclear factor-κB-associated machinery.<h4>Conclusions</h4>Our results provide insights into processes underlying human intestinal development and support the use of FEnS as a relevant human preclinical model for NEC. Accession number of repository for expression data: GSE101531.

Also flagged:polymerstosynthesiscancerPolymerdendrimers
Journal Article 2018-01-31 No Snippets Wagner AM, Spencer DS, Peppas NA, Peppas NA.
Show Full Abstract

In recent decades, nanoparticles have shown significant promise as an oncology treatment modality. Responsive polymers represent a promising class of nanoparticles that can trigger delivery through the exploitation of a specific stimuli. Response to a stimulus is one of the most basic processes found in living systems. As such, the desire to engineer dynamic and functional materials is becoming more prevalent in an effort to achieve precise control over our environment. The combination of controlled radical polymerization and high yielding chemistry strategies provide an excellent basis for the development of the next generation of drug delivery systems. The versatility of polymer chemistries available enables the synthesis of increasingly complex architectures with enhanced delivery specificity and control over the desired properties to interface with biological systems. This tutorial review highlights recent developments in polymer-based approaches to internally responsive nanoparticles for oncology. Presented are concise overviews of the current challenges and opportunities in cancer nanomedicine, common polymer-based architectures, and the basis for internally triggered stimuli-response relationships commonly employed in oncology applications. Examples of the chemistry used in the design of environmentally labile nanomaterials are discussed, and we outline recent advances in creating advanced bioresponsive drug delivery architectures.

Also flagged:paclitaxeltumorperfluoropentaneiron oxidepolymernanoparticles
Journal Article 2018-01-31 No Snippets Tang K, Niu C, Xu Y, Zhu Y, Tang S, Zhang M, Zhou Q.
Show Full Abstract

The existing approaches used to detect a tumor-induced sentinel lymph node and treat metastasis have limitations. In this study, by encapsulating perfluoropentane (PFP), magnetic iron oxide nanoparticles (Fe<sub>3</sub>O<sub>4</sub>) and the chemotherapy drug paclitaxel (PTX), we fabricated novel polymer nanoparticles (NPNs) that can effectively absorb heat after irradiation by near-infrared irradiation (NIR), thereby synergistically enhancing tumor therapy <i>via</i> a phase-shift thermoelastic expansion effect. These NPNs can be used for dual-modal ultrasound (US) and magnetic resonance (MR) imaging and to treat metastasis in lymph nodes under NIR irradiation-triggered drug delivery. The enhancement of US/MR imaging proved effective <i>in vitro</i> and <i>in vivo</i>, and NIR irradiation proved valid, promoting PTX release at the target site. A lower proliferation index and density and a higher tumor cell apoptotic index in the histopathology results confirmed the effectiveness of NPN chemotherapy for lymph nodes.

Preprints.org 2018-01-31 Preprint (No Snippets API) Xu X, Liao J, Shi Y.
Show Full Abstract

Using DCC-GARCH and EGARCH model, this paper finds that since 1990, the relationship between crude oil prices and the US dollar index is time-varying, demonstrating a process of &ldquo;very weak correlation&mdash;negative correlation&mdash;enhanced negative correlation&mdash;weakening negative correlation&rdquo;, but the existing research does not provide enough reasonable explanation. Therefore, this paper proposed a &ldquo;key mediating factors&rdquo; hypothesis which points out that whether there is a common &ldquo;key mediating factor&rdquo; is important source of the time-varying relationship between two assets. We argue that market trend and financial market sentiment undertook the role of &ldquo;key mediating factor&rdquo; during the period of &ldquo;2002 to the financial crisis&rdquo; and &ldquo;financial crisis to 2013&rdquo;, while other periods lack the &ldquo;key mediating factors&rdquo;.

Also flagged:Metabolismphosphorylationglucosecatabolismphotoncancer
Journal Article 2018-01-30 No Snippets Kolenc OI, Quinn KP.
Show Full Abstract

<h4>Significance</h4>Optical imaging using the endogenous fluorescence of metabolic cofactors has enabled nondestructive examination of dynamic changes in cell and tissue function both in vitro and in vivo. Quantifying NAD(P)H and FAD fluorescence through an optical redox ratio and fluorescence lifetime imaging (FLIM) provides sensitivity to the relative balance between oxidative phosphorylation and glucose catabolism. Since its introduction decades ago, the use of NAD(P)H imaging has expanded to include applications involving almost every major tissue type and a variety of pathologies. Recent Advances: This review focuses on the use of two-photon excited fluorescence and NAD(P)H fluorescence lifetime techniques in cancer, neuroscience, tissue engineering, and other biomedical applications over the last 5 years. In a variety of cancer models, NAD(P)H fluorescence intensity and lifetime measurements demonstrate a sensitivity to the Warburg effect, suggesting potential for early detection or high-throughput drug screening. The sensitivity to the biosynthetic demands of stem cell differentiation and tissue repair processes indicates the range of applications for this imaging technology may be broad.<h4>Critical issues</h4>As the number of applications for these fluorescence imaging techniques expand, identifying and characterizing additional intrinsic fluorophores and chromophores present in vivo will be vital to accurately measure and interpret metabolic outcomes. Understanding the full capabilities and limitations of FLIM will also be key to future advances.<h4>Future directions</h4>Future work is needed to evaluate whether a combination of different biochemical and structural outcomes using these imaging techniques can provide complementary information regarding the utilization of specific metabolic pathways.

Also flagged:cystatin Ccysteine proteaseCST3bindingcapacitationcholesterol
Journal Article 2018-01-30 ✓ 1 Snippet Lee RK, Tseng HC, Hwu YM, Fan CC, Lin MH, Yu JJ, Yeh LY, Li SH.
In-Text Gene Mentions

…[ 26 ],PEBP1[ 27 ],…

Show Full Abstract

<h4>Background</h4>Cystatin C (CST3), a cysteine protease inhibitor in seminal plasma, is expressed in animal uteri. However, its expression in the human female reproductive tract and its effect on human sperm capacitation are unclear.<h4>Methods</h4>The cellular localization of CST3 was observed using immunohistochemistry. The binding of CST3 to sperm was examined using immunocytochemistry. Sperm motility parameters were analyzed using computer-assisted sperm analysis. Sperm capacitation was evaluated by analyzing cholesterol content, protein tyrosine phosphorylation levels, and the acrosome reaction.<h4>Results</h4>Immunohistochemical staining demonstrated that CST3 is prominently expressed in the female reproductive tract, including the epithelial lining and cervix and endometrium fluids, particularly at times near ovulation. It can bind to human sperm on the post-acrosomal head region and the mid and principal piece of the tail. CST3 enhances sperm motility and inhibits the signal initiating sperm capacitation, i.e., efflux of cholesterol from the sperm plasma membrane and a late sperm capacitation event, i.e., the increase in the sperm protein tyrosine phosphorylation. The suppressive trend on sperm acrosome reaction further supports CST3's ability to inhibit sperm capacitation.<h4>Conclusions</h4>These findings suggest that cervical CST3 may prevent precocious capacitation and acrosome reaction, thus preserving sperm fertilizing ability before it reaches the fallopian tube. Additionally, CST3 may help sperm enter the upper reproductive tract by enhancing sperm motility.

Also flagged:glioblastomaGBMtumorNF-κBastrocyteLin28
Journal Article 2018-01-30 No Snippets Meares GP, Rajbhandari R, Gerigk M, Tien CL, Chang C, Fehling SC, Rowse A, Mulhern KC, Nair S, Gray GK, Berbari NF, Bredel M, Benveniste EN, Nozell SE.
Show Full Abstract

Previously, we determined microRNA-31 (miR-31) is a noncoding tumor suppressive gene frequently deleted in glioblastoma (GBM); miR-31 suppresses tumor growth, in part, by limiting the activity of NF-κB. Herein, we expand our previous studies by characterizing the role of miR-31 during neural precursor cell (NPC) to astrocyte differentiation. We demonstrate that miR-31 expression and activity is suppressed in NPCs by stem cell factors such as Lin28, c-Myc, SOX2 and Oct4. However, during astrocytogenesis, miR-31 is induced by STAT3 and SMAD1/5/8, which mediate astrocyte differentiation. We determined miR-31 is required for terminal astrocyte differentiation, and that the loss of miR-31 impairs this process and/or prevents astrocyte maturation. We demonstrate that miR-31 promotes astrocyte development, in part, by reducing the levels of Lin28, a stem cell factor implicated in NPC renewal. These data suggest that miR-31 deletions may disrupt astrocyte development and/or homeostasis.

Also flagged:nonalcoholic steatohepatitiscytokeratin 18NASHliver diseaseinfectionalcohol
Journal Article 2018-01-30 ✓ 1 Snippet Benmassaoud A, Ghali P, Cox J, Wong P, Szabo J, Deschenes M, Osikowicz M, Lebouche B, Klein MB, Sebastiani G.
In-Text Gene Mentions

…(e.g., auto-immune hepatitis,hemochromatosis, Wilson’s disease); (d)…

Show Full Abstract

<h4>Background and aim</h4>HIV-infected individuals are at high risk of developing nonalcoholic steatohepatitis (NASH), a leading cause of end-stage liver disease in Western countries. Nonetheless, due to the invasiveness of liver biopsy, NASH remains poorly understood in HIV mono-infection. We aimed to characterize the prevalence and predictors of NASH in unselected HIV mono-infected patients by means of non-invasive diagnostic tools.<h4>Methods</h4>HIV-infected adults without significant alcohol intake or co-infection with hepatitis B or C underwent a routine screening program employing transient elastography (TE) with controlled attenuation parameter (CAP) and the serum biomarker cytokeratin-18 (CK-18). NASH was diagnosed non-invasively as the coexistence of fatty liver (CAP ≥248 dB/m) and CK-18 >246 U/L. Identified cases of NASH were offered a diagnostic liver biopsy. Predictors of NASH were determined by multivariate logistic regression analysis.<h4>Results</h4>202 consecutive HIV mono-infected patients were included. NASH was non-invasively diagnosed in 23 cases (11.4%). Among them, 17 underwent a liver biopsy, and histology confirmed NASH in all cases. The prevalence of NASH was higher in patients with hypertriglyceridemia (17.1%), insulin resistance defined by homeostasis model for assessment of insulin resistance (HOMA-IR) (25%), those with detectable HIV viral load (42.9%) and those with elevated ALT (53.6%). After adjustment, higher HOMA-IR (adjusted odds ratio [aOR] = 1.20, 95% CI 1.01-1.43; p = 0.03) and ALT (aOR = 2.39, 95% CI 1.50-3.79; p<0.001) were independent predictors of NASH.<h4>Conclusions</h4>NASH, diagnosed by a non-invasive diagnostic approach employing CK-18 and TE with CAP, is common in unselected HIV mono-infected individuals, particularly in the presence of insulin resistance and elevated ALT.

Also flagged:Transglutaminase-2TG2extracellularmembranebindingureteric obstruction
Journal Article 2018-01-30 No Snippets Furini G, Schroeder N, Huang L, Boocock D, Scarpellini A, Coveney C, Tonoli E, Ramaswamy R, Ball G, Verderio C, Johnson TS, Verderio EAM.
Show Full Abstract

Increased export of transglutaminase-2 (TG2) by tubular epithelial cells (TECs) into the surrounding interstitium modifies the extracellular homeostatic balance, leading to fibrotic membrane expansion. Although silencing of extracellular TG2 ameliorates progressive kidney scarring in animal models of CKD, the pathway through which TG2 is secreted from TECs and contributes to disease progression has not been elucidated. In this study, we developed a global proteomic approach to identify binding partners of TG2 responsible for TG2 externalization in kidneys subjected to unilateral ureteric obstruction (UUO) using TG2 knockout kidneys as negative controls. We report a robust and unbiased analysis of the membrane interactome of TG2 in fibrotic kidneys relative to the entire proteome after UUO, detected by SWATH mass spectrometry. The data have been deposited to the ProteomeXchange with identifier PXD008173. Clusters of exosomal proteins in the TG2 interactome supported the hypothesis that TG2 is secreted by extracellular membrane vesicles during fibrosis progression. In established TEC lines, we found TG2 in vesicles of both endosomal (exosomes) and plasma membrane origin (microvesicles/ectosomes), and TGF-<i>β</i>1 stimulated TG2 secretion. Knockout of syndecan-4 (SDC4) greatly impaired TG2 exosomal secretion. TG2 coprecipitated with SDC4 from exosome lysate but not ectosome lysate. <i>Ex vivo</i>, EGFP-tagged TG2 accumulated in globular elements (blebs) protruding/retracting from the plasma membrane of primary cortical TECs, and SDC4 knockout impaired bleb formation, affecting TG2 release. Through this combined <i>in vivo</i> and <i>in vitro</i> approach, we have dissected the pathway through which TG2 is secreted from TECs in CKD.

Also flagged:Breast cancercanceralcoholESR1LSP1SGSM2
Journal Article 2018-01-30 No Snippets Lilyquist J, Ruddy KJ, Vachon CM, Couch FJ.
Show Full Abstract

Breast cancer is the most common cancer among women in the United States, with up to 30% of those diagnosed displaying a family history of breast cancer. To date, 18% of the familial risk of breast cancer can be explained by SNPs. This review summarizes the discovery of risk-associated SNPs using candidate gene and genome-wide association studies (GWAS), including discovery and replication in large collaborative efforts such as The Collaborative Oncologic Gene-environment Study and OncoArray. We discuss the evolution of GWAS studies, efforts to discover additional SNPs, and methods for identifying causal variants. We summarize findings associated with overall breast cancer, pathologic subtypes, and mutation carriers (<i>BRCA1, BRCA2</i>, and <i>CHEK2</i>). In addition, we summarize the development of polygenic risk scores (PRS) using the risk-associated SNPs and show how PRS can contribute to estimation of individual risks for developing breast cancer. <i>Cancer Epidemiol Biomarkers Prev; 27(4); 380-94. ©2018 AACR</i><b>See all articles in this <i>CEBP Focus</i> section, "Genome-Wide Association Studies in Cancer."</b>

Also flagged:movement disordercognitive impairmentsHuntingtinKCC2HDNKCC1
Journal Article 2018-01-30 ✓ 5 Snippets Dargaei Z, Bang JY, Mahadevan V, Khademullah CS, Bedard S, Parfitt GM, Kim JC, Woodin MA.
In-Text Gene Mentions

Two HD mouse models were used in this study: transgenic R6/2 mice containing the mutated Htt gene expressing exon 1 of the human Htt gene carrying ∼120 ± 5 CAG repeat expansions (31) and YAC128 mice containing full-length human Htt with 128 CAG repeats (37).

A prominent group of Htt interactors are proteins involved in synaptic transmission, and their altered interaction with mutant Htt (mHtt) is suggested to contribute to abnormal synaptic transmission in HD (24).

Based on the previous data linking (m)Htt and Cl− transporters (25, 26) and the important role of inhibition in learning and memory, we hypothesized that KCC2 function is dysregulated in the HD brain, resulting in weakened inhibitory GABAergic transmission, which contributes to the hippocampal-dependent learning and memory deficits that emerge early in HD.

Based on proteomic and bioinformatic data linking the Huntingtin protein (Htt) and KCC2, which is required for hyperpolarizing GABAergic inhibition, and the important role of inhibition in learning and memory, we hypothesized that aberrant KCC2 function contributes to the hippocampal-associated learning and memory deficits in HD.

R6/2 mice express the exon 1 human Htt with 120 CAG repeats (31) and develop a relatively fast progressing neurological phenotype similar to HD.

Show Full Abstract

Huntington's disease (HD) is classically characterized as a movement disorder, however cognitive impairments precede the motor symptoms by ∼15 y. Based on proteomic and bioinformatic data linking the Huntingtin protein (Htt) and KCC2, which is required for hyperpolarizing GABAergic inhibition, and the important role of inhibition in learning and memory, we hypothesized that aberrant KCC2 function contributes to the hippocampal-associated learning and memory deficits in HD. We discovered that Htt and KCC2 interact in the hippocampi of wild-type and R6/2-HD mice, with a decrease in KCC2 expression in the hippocampus of R6/2 and YAC128 mice. The reduced expression of the Cl<sup>-</sup>-extruding cotransporter KCC2 is accompanied by an increase in the Cl<sup>-</sup>-importing cotransporter NKCC1, which together result in excitatory GABA in the hippocampi of HD mice. NKCC1 inhibition by the FDA-approved NKCC1 inhibitor bumetanide abolished the excitatory action of GABA and rescued the performance of R6/2 mice on hippocampal-associated behavioral tests.

Also flagged:MVPCDH5SLC30A1chromosomesTAP1TAP2
Journal Article 2018-01-30 ✓ 3 Snippets Ribecco-Lutkiewicz M, Sodja C, Haukenfrers J, Haqqani AS, Ly D, Zachar P, Baumann E, Ball M, Huang J, Rukhlova M, Martina M, Liu Q, Stanimirovic D, Jezierski A, Bani-Yaghoub M.
In-Text Gene Mentions

SLC2A14

The expression of selected BBB transporters from SLC and ABC families has been confirmed in i-BECs by PCR and functional studies including a polarized transport of the P-gp substrate Cyclosporine A. Transcripts upregulated in i-BECs (compared to primary HBMECs) include several SLC transporters (SLC2A14, SLC38A2, SLC37A1, SLC2A1 and SLC17A3), ABC transporter (ABCC2) as well as transcripts of secreted IGF1-binding proteins (IGFBP5 and IGFBP3).

…SLC transporters (SLC2A14, SLC38A2 ,…

Show Full Abstract

We have developed a renewable, scalable and transgene free human blood-brain barrier model, composed of brain endothelial cells (BECs), generated from human amniotic fluid derived induced pluripotent stem cells (AF-iPSC), which can also give rise to syngeneic neural cells of the neurovascular unit. These AF-iPSC-derived BECs (i-BEC) exhibited high transendothelial electrical resistance (up to 1500 Ω cm<sup>2</sup>) inducible by astrocyte-derived molecular cues and retinoic acid treatment, polarized expression of functional efflux transporters and receptor mediated transcytosis triggered by antibodies against specific receptors. In vitro human BBB models enable pre-clinical screening of central nervous system (CNS)-targeting drugs and are of particular importance for assessing species-specific/selective transport mechanisms. This i-BEC human BBB model discriminates species-selective antibody- mediated transcytosis mechanisms, is predictive of in vivo CNS exposure of rodent cross-reactive antibodies and can be implemented into pre-clinical CNS drug discovery and development processes.

Also flagged:methylphenidateattention-deficit/hyperactivity disorderADHDneurological diseasespsychological disordersneurodevelopmental disorder
Journal Article 2018-01-30 ✓ 1 Snippet Pagerols M, Richarte V, Sánchez-Mora C, Rovira P, Soler Artigas M, Garcia-Martínez I, Calvo-Sánchez E, Corrales M, da Silva BS, Mota NR, Victor MM, Rohde LA, Grevet EH, Bau CHD, Cormand B, Casas M, Ramos-Quiroga JA, Ribasés M.
In-Text Gene Mentions

…binding protein, thePEBP160 – 62…

Show Full Abstract

Methylphenidate (MPH) is the most frequently used pharmacological treatment in children with attention-deficit/hyperactivity disorder (ADHD). However, a considerable interindividual variability exists in clinical outcome. Thus, we performed a genome-wide association study of MPH efficacy in 173 ADHD paediatric patients. Although no variant reached genome-wide significance, the set of genes containing single-nucleotide polymorphisms (SNPs) nominally associated with MPH response (P < 0.05) was significantly enriched for candidates previously studied in ADHD or treatment outcome. We prioritised the nominally significant SNPs by functional annotation and expression quantitative trait loci (eQTL) analysis in human brain, and we identified 33 SNPs tagging cis-eQTL in 32 different loci (referred to as eSNPs and eGenes, respectively). Pathway enrichment analyses revealed an over-representation of genes involved in nervous system development and function among the eGenes. Categories related to neurological diseases, psychological disorders and behaviour were also significantly enriched. We subsequently meta-analysed the association with clinical outcome for the 33 eSNPs across the discovery sample and an independent cohort of 189 ADHD adult patients (target sample) and we detected 15 suggestive signals. Following this comprehensive strategy, our results provide a better understanding of the molecular mechanisms implicated in MPH treatment effects and suggest promising candidates that may encourage future studies.

Also flagged:cardiometabolic disorderslipidobesitytype 2 diabetescoronary artery diseasemethylation
Journal Article 2018-01-30 ✓ 1 Snippet Ghanbari M, Peters MJ, de Vries PS, Boer CG, van Rooij JGJ, Lee YC, Kumar V, Uitterlinden AG, Ikram MA, Wijmenga C, Ordovas JM, Smith CE, van Meurs JBJ, Erkeland SJ, Franco OH, Dehghan A.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

Genome-wide association studies (GWAS) have identified many susceptibility loci for cardiometabolic disorders. Most of the associated variants reside in non-coding regions of the genome including long non-coding RNAs (lncRNAs), which are thought to play critical roles in diverse biological processes. Here, we leveraged data from the available GWAS meta-analyses on lipid and obesity-related traits, blood pressure, type 2 diabetes, and coronary artery disease and identified 179 associated single-nucleotide polymorphisms (SNPs) in 102 lncRNAs (p-value < 2.3 × 10<sup>-7</sup>). Of these, 55 SNPs, either the lead SNP or in strong linkage disequilibrium with the lead SNP in the related loci, were selected for further investigations. Our in silico predictions and functional annotations of the SNPs as well as expression and DNA methylation analysis of their lncRNAs demonstrated several lncRNAs that fulfilled predefined criteria for being potential functional targets. In particular, we found evidence suggesting that LOC157273 (at 8p23.1) is involved in regulating serum lipid-cholesterol. Our results showed that rs4841132 in the second exon and cg17371580 in the promoter region of LOC157273 are associated with lipids; the lncRNA is expressed in liver and associates with the expression of its nearby coding gene, PPP1R3B. Collectively, we highlight a number of loci associated with cardiometabolic disorders for which the association may act through lncRNAs.

Also flagged:acute kidney injuryinflammatory responsetranslationalsepsisToll-like receptorsTLRs
Journal Article 2018-01-30 No Snippets Han HI, Skvarca LB, Espiritu EB, Davidson AJ, Hukriede NA.
Show Full Abstract

Acute kidney injury (AKI) is defined by a rapid decline in renal function. Regardless of the initial cause of injury, the influx of immune cells is a common theme during AKI. While an inflammatory response is critical for the initial control of injury, a prolonged response can negatively affect tissue repair. In this review, we focus on the role of macrophages, from early inflammation to resolution, during AKI. These cells serve as the innate defense system by phagocytosing cellular debris and pathogenic molecules and bridge communication with the adaptive immune system by acting as antigen-presenting cells and secreting cytokines. While many immune cells function to initiate inflammation, macrophages play a complex role throughout AKI. This complexity is driven by their functional plasticity: the ability to polarize from a "pro-inflammatory" phenotype to a "pro-reparative" phenotype. Importantly, experimental and translational studies indicate that macrophage polarization opens the possibility to generate novel therapeutics to promote repair during AKI. A thorough understanding of the biological roles these phagocytes play during both injury and repair is necessary to understand the limitations while furthering the therapeutic application.

Also flagged:Soxtranscription factorsSRY-related box (Sox) transcription factorsdeterminationtestis differentiationSry
Journal Article 2018-01-30 ✓ 1 Snippet Roumaud P, Haché J, Martin LJ.
In-Text Gene Mentions

…cells, whereas Sox5,Sox6, and Sox30 were…

Show Full Abstract

SRY-related box (Sox) transcription factors are conserved among vertebrate species. These proteins regulate multiple processes including sex determination and testis differentiation of the male embryo. Members of the Sox family have been identified in pre- and postnatal testis and are known to play an important role in sex determination (Sry, Sox9), male gonadal development, and fertility (Sox4, Sox8, Sox30). However, their expression profiles per cell types remain elusive. The objectives of this research were to characterize the expression profiles of Sox family members within adult testes using publically available datasets and to determine whether these findings are consistent with literature as well as immunofluorescence and in situ hybridization results. We have found that Sox4, Sox8, Sox9, and Sox12 are highly expressed in Sertoli cells, whereas Sox5, Sox6, and Sox30 were typically expressed in spermatocytes and spermatids. Spermatogonia were characterized by the expressions of Sox3, Sox4, Sox12, Sox13, and Sox18. Hence, these results suggest that Sox transcription factors may play different roles according to cell types of the adult mammalian testis.

Also flagged:CTCFCCCTC-binding factorchromatinCTCFLtranscription factorBORIS
Journal Article 2018-01-30 ✓ 1 Snippet Jabbari K, Heger P, Sharma R, Wiehe T.
In-Text Gene Mentions

…its interactors, thepolycomb repressiverepressive complex subunit…

Show Full Abstract

The CCCTC-binding factor (CTCF) is multi-functional, ubiquitously expressed, and highly conserved from <i>Drosophila</i> to human. It has important roles in transcriptional insulation and the formation of a high-dimensional chromatin structure. CTCF has a paralog called "Brother of Regulator of Imprinted Sites" (BORIS) or "CTCF-like" (CTCFL). It binds DNA at sites similar to those of CTCF. However, the expression profiles of the two proteins are quite different. We investigated the evolutionary trajectories of the two proteins after the duplication event using a phylogenomic and interactomic approach. We find that CTCF has 52 direct interaction partners while CTCFL only has 19. Almost all interactors already existed before the emergence of CTCF and CTCFL. The unique secondary loss of CTCF from several nematodes is paralleled by a loss of two of its interactors, the polycomb repressive complex subunit SuZ12 and the multifunctional transcription factor TYY1. In contrast to earlier studies reporting the absence of BORIS from birds, we present evidence for a multigene synteny block containing CTCFL that is conserved in mammals, reptiles, and several species of birds, indicating that not the entire lineage of birds experienced a loss of CTCFL. Within this synteny block, BORIS and its genomic neighbors seem to be partitioned into two nested chromatin loops. The high expression of SPO11, RAE1, RBM38, and PMEPA1 in male tissues suggests a possible link between CTCFL, meiotic recombination, and fertility-associated phenotypes. Using the 65,700 exomes and the 1000 genomes data, we observed a higher number of intergenic, non-synonymous, and loss-of-function mutations in CTCFL than in CTCF, suggesting a reduced strength of purifying selection, perhaps due to less functional constraint.

Also flagged:milk allergysepsisLynch syndromevenous thromboembolismhereditary hemochromatosisHeritable Disorders
Journal Article 2018-01-30 ✓ 1 Snippet Rafiq M, Boccia S.
In-Text Gene Mentions

…hemochromatosis through HFE (hemochromatosisgene) mutation analysis.…

Show Full Abstract

A great deal of ambiguity exists in the development of guidelines for genomic applications used in clinical practice. The GRADE (Grading of Recommendations Assessment, Development and Evaluation) approach has the potential to be applied in the guidelines and recommendations development process in genomics. Here, we discuss whether and how GRADE can be applied to address the challenges posed by the evidence-based guidelines and recommendations development process in genomics. To see how GRADE can complement to the current guidelines development in genomics, we compare and contrast GRADE with other approaches. GRADE differed from other methods by incorporating patient values and preferences and balance of consequences. We conclude that the groups trying to implement genomics into practice may gleam more information from applying the GRADE framework. However, it is not clear yet whether GRADE can address the issue of timeliness in terms of the differences between the time required for guidelines development and the rapid pace of genomics.

Also flagged:Huntington's diseasespinocerebellar ataxiascytosineadenineguaninemismatch repair
Journal Article 2018-01-30 ✓ 4 Snippets Massey TH, Jones L.
In-Text Gene Mentions

In addition, wild-type HTT is phosphorylated by cyclin-dependent kinase (CDK) 5 on serines 1181 and 1201 in response to DNA damage, and this seems to have a protective role in inhibition of p53 (TP53)-induced cell death.

The N-terminus of HTT (particularly methionine 8) can act as a direct sensor of oxidative stress, leading to its phosphorylation at serines 13 and 16 and translocation from its usual cytoplasmic location to the nucleus (DiGiovanni et al., 2016).

Conversely, in a bacterial artificial chromosome mouse model of HD, a huntingtin (HTT) allele with 97 codons of alternating CAA/CAG is stable over 12 months in both germline and somatic cells, but the mice still develop a neurodegenerative pathology (Gray et al., 2008).

The development of somatic CAG repeat expansion in the striatum of mouse HD models (for example, R6/1 transgenic mice carrying exon 1 of the human HTT gene) (Mangiarini et al., 1997) correlates with symptom development.

Show Full Abstract

Diseases such as Huntington's disease and certain spinocerebellar ataxias are caused by the expansion of genomic cytosine-adenine-guanine (CAG) trinucleotide repeats beyond a specific threshold. These diseases are all characterised by neurological symptoms and central neurodegeneration, but our understanding of how expanded repeats drive neuronal loss is incomplete. Recent human genetic evidence implicates DNA repair pathways, especially mismatch repair, in modifying the onset and progression of CAG repeat diseases. Repair pathways might operate directly on repeat sequences by licensing or inhibiting repeat expansion in neurons. Alternatively, or in addition, because many of the genes containing pathogenic CAG repeats encode proteins that themselves have roles in the DNA damage response, it is possible that repeat expansions impair specific DNA repair pathways. DNA damage could then accrue in neurons, leading to further expansion at repeat loci, thus setting up a vicious cycle of pathology. In this review, we consider DNA damage and repair pathways in postmitotic neurons in the context of disease-causing CAG repeats. Investigating and understanding these pathways, which are clearly relevant in promoting and ameliorating disease in humans, is a research priority, as they are known to modify disease and therefore constitute prevalidated drug targets.

Also flagged:mild cognitive impairmentcognitioncognitive impairmentOxygencognitive declinedementia
Journal Article 2018-01-30 ✓ 1 Snippet McAuliffe L, Parfitt GC, Eston RG, Gray C, Keage HAD, Smith AE.
In-Text Gene Mentions

…However, as expectedACE-IIIscore was lower…

Show Full Abstract

<h4>Background</h4>Exercise adherence in already low-active older adults with and without mild cognitive impairment (MCI) remains low. Perceptual regulation and exergaming may facilitate future exercise behaviour by improving the affective experience, however evidence that this population can perceptually regulate is lacking. To explore this, we investigated 1) perceptual regulation of exercise intensity during either exergaming or regular ergometer cycling and 2) explored affective responses.<h4>Methods</h4>Thirty-two low active older adults (73.9 ± 7.3 years, <i>n</i> = 16, 8 females) with or without MCI (70.9 ± 5.5 years, <i>n</i> = 16, 11 females) participated in a sub-maximal fitness assessment to determine ventilatory threshold (VT) and two experimental sessions (counterbalanced: exergaming or regular ergometer cycling). Experimental sessions consisted 21-min of continuous cycling with 7-min at each: RPE 9, 11 and 13. Oxygen consumption (VO<sub>2</sub>), heart rate (HR), and affect (Feeling Scale) were obtained throughout the exercise.<h4>Results</h4>VO<sub>2</sub> (<i>p</i> < 0.01) and HR (<i>p</i> < 0.01) increased linearly with RPE, but were not significantly different between exercise modes or cognitive groups. At RPE 13, participants worked above VT in both modes (exergaming: 115.7 ± 27.3; non-exergaming 114.1 ± 24.3 VO<sub>2</sub> (%VT)). Regardless of cognitive group, affect declined significantly as RPE increased (<i>p</i> < 0.01). However on average, affect remained pleasant throughout and did not differ between exercise modes or cognitive groups.<h4>Conclusions</h4>These results suggest low-active older adults can perceptually regulate exercise intensity, regardless of cognition or mode. At RPE 13, participants regulated above VT, at an intensity that improves cardiorespiratory fitness long-term, and affect remained positive in the majority of participants, which may support long-term physical activity adherence.

Also flagged:Intrahepatic cholangiocarcinomaiCCAliver primary cancertransforming growth factor betaTGFβtumor
Journal Article 2018-01-30 ✓ 1 Snippet Merdrignac A, Angenard G, Allain C, Petitjean K, Bergeat D, Bellaud P, Fautrel A, Turlin B, Clément B, Dooley S, Sulpice L, Boudjema K, Coulouarn C.
In-Text Gene Mentions

…and negative (e.g.,baculoviral inhibitor of apoptosis protein repeat containing 3inhibitor of apoptosis…

Show Full Abstract

Intrahepatic cholangiocarcinoma (iCCA) is a deadly liver primary cancer associated with poor prognosis and limited therapeutic opportunities. Active transforming growth factor beta (TGFβ) signaling is a hallmark of the iCCA microenvironment. However, the impact of TGFβ on the transcriptome of iCCA tumor cells has been poorly investigated. Here, we have identified a specific TGFβ signature of genes commonly deregulated in iCCA cell lines, namely HuCCT1 and Huh28. Novel coding and noncoding TGFβ targets were identified, including a TGFβ-induced long noncoding RNA (TLINC), formerly known as cancer susceptibility candidate 15 (CASC15). TLINC is a general target induced by TGFβ in hepatic and nonhepatic cell types. In iCCA cell lines, the expression of a long and short TLINC isoform was associated with an epithelial or mesenchymal phenotype, respectively. Both isoforms were detected in the nucleus and cytoplasm. The long isoform of TLINC was associated with a migratory phenotype in iCCA cell lines and with the induction of proinflammatory cytokines, including interleukin 8, both <i>in vitro</i> and in resected human iCCA. TLINC was also identified as a tumor marker expressed in both epithelial and stroma cells. In nontumor livers, TLINC was only expressed in specific portal areas with signs of ductular reaction and inflammation. Finally, we provide experimental evidence of circular isoforms of TLINC, both in iCCA cells treated with TGFβ and in resected human iCCA. <i>Conclusion</i>: We identify a novel TGFβ-induced long noncoding RNA up-regulated in human iCCA and associated with an inflammatory microenvironment. (<i>Hepatology Communications</i> 2018;2:254-269).

Also flagged:gene expressiontranscriptional regulatorsbindinghistonetranscription factorsDNA binding proteins
Journal Article 2018-01-30 No Snippets Salviano-Silva A, Lobo-Alves SC, Almeida RC, Malheiros D, Petzl-Erler ML.
Show Full Abstract

A significant proportion of mammalian genomes corresponds to genes that transcribe long non-coding RNAs (lncRNAs). Throughout the last decade, the number of studies concerning the roles played by lncRNAs in different biological processes has increased considerably. This intense interest in lncRNAs has produced a major shift in our understanding of gene and genome regulation and structure. It became apparent that lncRNAs regulate gene expression through several mechanisms. These RNAs function as transcriptional or post-transcriptional regulators through binding to histone-modifying complexes, to DNA, to transcription factors and other DNA binding proteins, to RNA polymerase II, to mRNA, or through the modulation of microRNA or enzyme function. Often, the lncRNA transcription itself rather than the lncRNA product appears to be regulatory. In this review, we highlight studies identifying lncRNAs in the homeostasis of various cell and tissue types or demonstrating their effects in the expression of protein-coding or other non-coding RNA genes.

Also flagged:Primary hypertensionnucleotidesheart diseasesdiabetesautoimmune diseasespsychiatric disorders
Journal Article 2018-01-30 No Snippets Azam AB, Azizan EAB.
Show Full Abstract

Primary hypertension is widely believed to be a complex polygenic disorder with the manifestation influenced by the interactions of genomic and environmental factors making identification of susceptibility genes a major challenge. With major advancement in high-throughput genotyping technology, genome-wide association study (GWAS) has become a powerful tool for researchers studying genetically complex diseases. GWASs work through revealing links between DNA sequence variation and a disease or trait with biomedical importance. The human genome is a very long DNA sequence which consists of billions of nucleotides arranged in a unique way. A single base-pair change in the DNA sequence is known as a single nucleotide polymorphism (SNP). With the help of modern genotyping techniques such as chip-based genotyping arrays, thousands of SNPs can be genotyped easily. Large-scale GWASs, in which more than half a million of common SNPs are genotyped and analyzed for disease association in hundreds of thousands of cases and controls, have been broadly successful in identifying SNPs associated with heart diseases, diabetes, autoimmune diseases, and psychiatric disorders. It is however still debatable whether GWAS is the best approach for hypertension. The following is a brief overview on the outcomes of a decade of GWASs on primary hypertension.

Also flagged:avian necrotic enteritisα1-acid glycoproteinAGPcatalaseheme oxygenase 1superoxide dismutase
Journal Article 2018-01-30 ✓ 1 Snippet Oh S, Gadde UD, Bravo D, Lillehoj EP, Lillehoj HS.
In-Text Gene Mentions

…peroxiredoxin 6 (PRDX6), a thiol-specific…

Show Full Abstract

<h4>Background</h4>Magnolia tree bark has been widely used in traditional Asian medicine. However, to our knowledge, no studies have been reported investigating the effects of dietary supplementation with magnolia bark extract in chickens.<h4>Objective</h4>We tested the hypothesis that dietary supplementation of chickens with a <i>Magnolia officinalis</i> bark extract would increase growth performance in uninfected and <i>Eimeria maxima</i>/<i>Clostridium perfringens</i> co-infected chickens.<h4>Methods</h4>A total of 168 chickens were fed from hatch either a standard diet or a diet supplemented with 0.33 mg or 0.56 mg <i>M. officinalis</i> bark extract/kg (M/H low or M/H high, respectively) from days 1 to 35. At day 14, half of the chickens were orally infected with <i>E. maxima</i>, followed by <i>C. perfringens</i> infection at day 18 to induce experimental avian necrotic enteritis. Daily feed intake, feed conversion ratio, body weight gain, and final body weight were measured as indicators of growth performance. Serum α1-acid glycoprotein (AGP) concentrations were measured as an indicator of systemic inflammation, and intestinal lesion scores were determined as a marker of disease progression. Transcript levels for catalase, heme oxygenase 1, and superoxide dismutase in the intestine, liver, spleen, and skeletal muscle were measured as indicators of antioxidant status.<h4>Results</h4>Growth performance increased between days 1 and 35 in uninfected and <i>E. maxima</i>/<i>C. perfringens</i> co-infected chickens fed M/H-low or M/H-high diets compared with unsupplemented controls. Gut lesion scores were decreased, whereas AGP concentrations were unchanged, in co-infected chickens fed magnolia-supplemented diets compared with unsupplemented controls. In general, transcripts for antioxidant enzymes increased in chickens fed magnolia-supplemented diets compared with unsupplemented controls, and significant interactions between dietary supplementation and co-infection were observed for all antioxidant enzyme transcript levels.<h4>Conclusion</h4>Magnolia bark extract might be useful for future development of dietary strategies to improve poultry health, disease resistance, and productivity without the use of antibiotic growth promoters.

Also flagged:HIPK3autophagyneurodegenerative disordersHuntington diseaseHDHdh
Journal Article 2018-01-29 ✓ 2 Snippets Fu Y, Sun X, Lu B.
In-Text Gene Mentions

HIPK3 modulates autophagy and HTT protein levels in neuronal and mouse models of Huntington disease.

…modulates autophagy andHTTprotein levels in…

Show Full Abstract

Macroautophagy/autophagy is an important cellular protein quality control process that clears intracellular aggregate-prone proteins. These proteins may cause neurodegenerative disorders such as Huntington disease (HD), which is mainly caused by the cytotoxicity of the mutant HTT/Hdh protein (mHTT). Thus, autophagy modulators may regulate mHTT levels and provide potential drug targets for HD and similar diseases. Meanwhile, autophagy function is also impaired in HD and other neurodegenerative disorders via unknown mechanisms. In a recent study, we identified a positive feedback mechanism that may contribute to mHTT accumulation and autophagy impairment in HD. Through genome-scale screening, we identified a kinase gene, HIPK3, as a negative modulator of autophagy and a positive regulator of mHTT levels in HD cells. Knocking down or knocking out HIPK3 reduces mHTT levels via enhancing autophagy in HD cells and in vivo in an HD knock-in mouse model. Interestingly, mHTT positively regulates HIPK3 mRNA levels in both HD cells and HD mouse brains, and this forms a positive feedback loop between mHTT and HIPK3. This loop potentially contributes to autophagy inhibition, mHTT accumulation, and disease progression in HD. The modulation of mHTT by HIPK3 is dependent on its kinase activity and its known substrate DAXX, providing potential HD drug targets. Collectively, our data reveal a novel kinase modulator of autophagy in HD cells, providing therapeutic entry points for HD and similar diseases.

Also flagged:Foot-and-mouth disease virus capsid protein VP2EIF2S1ATF4FMDV infectionmacroautophagyautophagy
Journal Article 2018-01-29 ✓ 4 Snippets Sun P, Zhang S, Qin X, Chang X, Cui X, Li H, Zhang S, Gao H, Wang P, Zhang Z, Luo J, Li Z.
In-Text Gene Mentions

The expansion of a polyglutamine repeat in HTT (huntingtin) causes Huntington disease (HD).

…polyglutamine repeat inHTT(huntingtin) causes Huntington…

…MutantHTT(mHTT) forms aggregates…

…model of mutantHTTpolyglutamine expansion protei…

Show Full Abstract

Foot-and-mouth disease virus (FMDV) can result in economical destruction of cloven-hoofed animals. FMDV infection has been reported to induce macroautophagy/autophagy; however, the precise molecular mechanisms of autophagy induction and effect of FMDV capsid protein on autophagy remain unknown. In the present study, we report that FMDV infection induced a complete autophagy process in the natural host cells of FMDV, and inhibition of autophagy significantly decreased FMDV production, suggesting that FMDV-induced autophagy facilitates viral replication. We found that the EIF2S1-ATF4 pathway was activated and the AKT-MTOR signaling pathway was inhibited by FMDV infection. We also observed that ultraviolet (UV)-inactivated FMDV can induce autophagy. Importantly, our work provides the first piece of evidence that expression of FMDV capsid protein VP2 can induce autophagy through the EIF2S1-ATF4-AKT-MTOR cascade, and we found that VP2 interacted with HSPB1 (heat shock protein family B [small] member 1) and activated the EIF2S1-ATF4 pathway, resulting in autophagy and enhanced FMDV replication. In addition, we show that VP2 induced autophagy in a variety of mammalian cell lines and decreased aggregates of a model mutant HTT (huntingtin) polyglutamine expansion protein (HTT103Q). Overall, our results demonstrate that FMDV capsid protein VP2 induces autophagy through interaction with HSPB1 and activation of the EIF2S1-ATF4 pathway.

Also flagged:ciliogenesislocalizationcytoskeletoncell developmentchronic respiratory infectionhydrocephalus
Journal Article 2018-01-29 ✓ 1 Snippet Tu F, Sedzinski J, Ma Y, Marcotte EM, Wallingford JB.
In-Text Gene Mentions

Ankrd45

Show Full Abstract

Multiciliated cells (MCCs) drive fluid flow in diverse tubular organs and are essential for the development and homeostasis of the vertebrate central nervous system, airway and reproductive tracts. These cells are characterized by dozens or hundreds of motile cilia that beat in a coordinated and polarized manner. In recent years, genomic studies have not only elucidated the transcriptional hierarchy for MCC specification but also identified myriad new proteins that govern MCC ciliogenesis, cilia beating and cilia polarization. Interestingly, this burst of genomic data has also highlighted that proteins with no obvious role in cilia do, in fact, have important ciliary functions. Understanding the function of proteins with little prior history of study presents a special challenge, especially when faced with large numbers of such proteins. Here, we define the subcellular localization in MCCs of ∼200 proteins not previously implicated in cilia biology. Functional analyses arising from the screen provide novel links between actin cytoskeleton and MCC ciliogenesis.

Also flagged:epilepsygene expressioncell adhesionWntNotchStat
Journal Article 2018-01-29 ✓ 1 Snippet Azevedo H, Amato Khaled N, Santos P, Bernardi Bertonha F, Moreira-Filho CA.
In-Text Gene Mentions

…, Ubqln1 ,Rc3h1(greenyellow), Cml1 ,…

Show Full Abstract

Complex febrile seizures during infancy constitute an important risk factor for development of epilepsy. However, little is known about the alterations induced by febrile seizures that make the brain susceptible to epileptic activity. In this context, the use of animal models of hyperthermic seizures (HS) could allow the temporal analysis of brain molecular changes that arise after febrile seizures. Here, we investigated temporal changes in hippocampal gene coexpression networks during the development of rats submitted to HS. Total RNA samples were obtained from the ventral hippocampal CA3 region at four time points after HS at postnatal day (P) 11 and later used for gene expression profiling. Temporal endpoints were selected for investigating the acute (P12), latent (P30 and P60) and chronic (P120) stages of the HS model. A weighted gene coexpression network analysis was used to characterize modules of coexpressed genes, as these modules might contain genes with similar functions. The transcriptome analysis pipeline consisted of building gene coexpression networks, identifying network modules and hubs, performing gene-trait correlations and examining changes in module connectivity. Modules were functionally enriched to identify functions associated with HS. Our data showed that HS induce changes in developmental, cell adhesion and immune pathways, such as Wnt, Hippo, Notch, Jak-Stat and Mapk. Interestingly, modules involved in cell adhesion, neuronal differentiation and synaptic transmission were activated as early as 1 day after HS. These results suggest that HS trigger transcriptional alterations that could lead to persistent neurogenesis, tissue remodeling and inflammation in the CA3 hippocampus, making the brain prone to epileptic activity.

Also flagged:proteolysisN-recogninSQSTM1p62sequestosome 1degradation
Journal Article 2018-01-29 No Snippets Cha-Molstad H, Lee SH, Kim JG, Sung KW, Hwang J, Shim SM, Ganipisetti S, McGuire T, Mook-Jung I, Ciechanover A, Xie XQ, Kim BY, Kwon YT.
Show Full Abstract

In macroautophagy/autophagy, cargoes are collected by specific receptors, such as SQSTM1/p62 (sequestosome 1), and delivered to phagophores for lysosomal degradation. To date, little is known about how cells modulate SQSTM1 activity and autophagosome biogenesis in response to accumulating cargoes. In this study, we show that SQSTM1 is an N-recognin whose ZZ domain binds N-terminal arginine (Nt-Arg) and other N-degrons (Nt-Lys, Nt-His, Nt-Trp, Nt-Phe, and Nt-Tyr) of the N-end rule pathway. The substrates of SQSTM1 include the endoplasmic reticulum (ER)-residing chaperone HSPA5/GRP78/BiP. Upon N-end rule interaction with the Nt-Arg of arginylated HSPA5 (R-HSPA5), SQSTM1 undergoes self-polymerization via disulfide bonds of Cys residues including Cys113, facilitating cargo collection. In parallel, Nt-Arg-bound SQSTM1 acts as an inducer of autophagosome biogenesis and autophagic flux. Through this dual regulatory mechanism, SQSTM1 plays a key role in the crosstalk between the ubiquitin (Ub)-proteasome system (UPS) and autophagy. Based on these results, we employed 3D-modeling of SQSTM1 and a virtual chemical library to develop small molecule ligands to the ZZ domain of SQSTM1. These autophagy inducers accelerated the autophagic removal of mutant HTT (huntingtin) aggregates. We suggest that SQSTM1 can be exploited as a novel drug target to modulate autophagic processes in pathophysiological conditions.

Also flagged:Nrf2transcription factormetabolismdetoxificationorganellesmitochondrial
Journal Article 2018-01-29 ✓ 1 Snippet Dinkova-Kostova AT, Kostov RV, Kazantsev AG.
In-Text Gene Mentions

…in the huntingtin (HTT) protein 38 .…

Show Full Abstract

The transcription factor Nrf2 (nuclear factor-erythroid 2 p45-related factor 2) functions at the interface of cellular redox and intermediary metabolism. Nrf2 target genes encode antioxidant enzymes, and proteins involved in xenobiotic detoxification, repair and removal of damaged proteins and organelles, inflammation, and mitochondrial bioenergetics. The function of Nrf2 is altered in many neurodegenerative disorders, such as Huntington's disease, Alzheimer's disease, amyotrophic lateral sclerosis, and Friedreich's ataxia. Nrf2 activation mitigates multiple pathogenic processes involved in these neurodegenerative disorders through upregulation of antioxidant defenses, inhibition of inflammation, improvement of mitochondrial function, and maintenance of protein homeostasis. Small molecule pharmacological activators of Nrf2 have shown protective effects in numerous animal models of neurodegenerative diseases, and in cultures of human cells expressing mutant proteins. Targeting Nrf2 signaling may provide a therapeutic option to delay onset, slow progression, and ameliorate symptoms of neurodegenerative disorders.

Also flagged:gellan gumgellananacardic aciddecyl esternitrogenHIFs
Journal Article 2018-01-29 No Snippets Nishizuka H, Hashidoko Y.
Show Full Abstract

To establish a sensitive bioassay for Nostocean hormogonium induction, we compared the effectiveness of the morpho-differentiation induction on two gelled plates, agar and gellan gum, for anacardic acid C15:1-Δ<sup>8</sup> decyl ester (1) (100 nmol/disc). On BG-11<sub>0</sub> (nitrogen-free) medium-based 0.6 and 0.8% agar plates, Nostoc sp. strain Yaku-1 isolated from a coralloid root of Cycas revoluta in Yakushima Island showed clear morpho-differentiation from filamentous aggregates into hormogonia, and the induced hormogonia dispersed within 24 h; however, similar hormogonium formation was not observed at agar concentrations of 1.0% or higher. Conversely, hormogonium induction was considerably more pronounced on gellan gum plates than those on agar plates through concentrations ranging from 0.6 to 1.6% even after 12 h of incubation, particularly active on the 0.8-1.0% gellan gum plates. Thus, gellan gum plates can achieve clear results within 12 h and are thus highly useful for primary screening for hormogonium-inducing factors (HIFs).

Also flagged:membraneimmune responsesAlzheimer diseaseParkinson diseaseHuntington diseaseamyotrophic lateral sclerosis
Journal Article 2018-01-29 No Snippets Sweeney MD, Sagare AP, Zlokovic BV.
Show Full Abstract

The blood-brain barrier (BBB) is a continuous endothelial membrane within brain microvessels that has sealed cell-to-cell contacts and is sheathed by mural vascular cells and perivascular astrocyte end-feet. The BBB protects neurons from factors present in the systemic circulation and maintains the highly regulated CNS internal milieu, which is required for proper synaptic and neuronal functioning. BBB disruption allows influx into the brain of neurotoxic blood-derived debris, cells and microbial pathogens and is associated with inflammatory and immune responses, which can initiate multiple pathways of neurodegeneration. This Review discusses neuroimaging studies in the living human brain and post-mortem tissue as well as biomarker studies demonstrating BBB breakdown in Alzheimer disease, Parkinson disease, Huntington disease, amyotrophic lateral sclerosis, multiple sclerosis, HIV-1-associated dementia and chronic traumatic encephalopathy. The pathogenic mechanisms by which BBB breakdown leads to neuronal injury, synaptic dysfunction, loss of neuronal connectivity and neurodegeneration are described. The importance of a healthy BBB for therapeutic drug delivery and the adverse effects of disease-initiated, pathological BBB breakdown in relation to brain delivery of neuropharmaceuticals are briefly discussed. Finally, future directions, gaps in the field and opportunities to control the course of neurological diseases by targeting the BBB are presented.

Also flagged:Metastatic melanomaskin cancermalignant melanomaSPRR1AKRT78SFN
Journal Article 2018-01-29 No Snippets Wang LX, Li Y, Chen GZ.
Show Full Abstract

Metastatic melanoma is an aggressive skin cancer and is one of the global malignancies with high mortality and morbidity. It is essential to identify and verify diagnostic biomarkers of early metastatic melanoma. Previous studies have systematically assessed protein biomarkers and mRNA-based expression characteristics. However, molecular markers for the early diagnosis of metastatic melanoma have not been identified. To explore potential regulatory targets, we have analyzed the gene microarray expression profiles of malignant melanoma samples by co-expression analysis based on the network approach. The differentially expressed genes (DEGs) were screened by the EdgeR package of R software. A weighted gene co-expression network analysis (WGCNA) was used for the identification of DEGs in the special gene modules and hub genes. Subsequently, a protein-protein interaction network was constructed to extract hub genes associated with gene modules. Finally, twenty-four important hub genes (RASGRP2, IKZF1, CXCR5, LTB, BLK, LINGO3, CCR6, P2RY10, RHOH, JUP, KRT14, PLA2G3, SPRR1A, KRT78, SFN, CLDN4, IL1RN, PKP3, CBLC, KRT16, TMEM79, KLK8, LYPD3 and LYPD5) were treated as valuable factors involved in the immune response and tumor cell development in tumorigenesis. In addition, a transcriptional regulatory network was constructed for these specific modules or hub genes, and a few core transcriptional regulators were found to be mostly associated with our hub genes, including GATA1, STAT1, SP1, and PSG1. In summary, our findings enhance our understanding of the biological process of malignant melanoma metastasis, enabling us to identify specific genes to use for diagnostic and prognostic markers and possibly for targeted therapy.

Also flagged:royal jellycorticosteroneASTALPGGTSOD
Journal Article 2018-01-29 No Snippets Caixeta DC, Teixeira RR, Peixoto LG, Machado HL, Baptista NB, de Souza AV, Vilela DD, Franci CR, Salmen Espindola F.
Show Full Abstract

Restraint and cold stress increase both corticosterone and glycemia, which lead to oxidative damages in hepatic tissue. This study assessed the effect of royal jelly (RJ) supplementation on the corticosterone level, glycemia, plasma enzymes and hepatic antioxidant system in restraint and cold stressed rats. Wistar rats were allocated into no-stress, stress, no-stress supplemented with RJ and stress supplemented with RJ groups. Initially, RJ (200mg/Kg) was administered for fourteen days and stressed groups were submitted to chronic stress from the seventh day. The results showed that RJ supplementation decreases corticosterone levels and improves glycemia control after stress induction. RJ supplementation also decreased the body weight, AST, ALP and GGT. Moreover, RJ improved total antioxidant capacity, SOD activity and reduced GSH, GR and lipoperoxidation in the liver. Thus, RJ supplementation reestablished the corticosterone levels and the hepatic antioxidant system in stressed rats, indicating an adaptogenic and hepatoprotective potential of RJ.

Also flagged:Factor XThrombinAntithrombinThrombophiliaATAT deficiency
Journal Article 2018-01-29 No Snippets Rühl H, Reda S, Müller J, Oldenburg J, Pötzsch B.
Show Full Abstract

Antithrombin (AT) activity tests are used for diagnosing hereditary AT deficiency, a main genetic determinant of thrombophilia. They are either based on inhibition of thrombin (FIIa) or activated factor X (FXa). FXa-based assays have been suggested to be preferable to FIIa-based assays due to their higher sensitivity for certain AT deficiency causing mutations. To assess the performance of these two methods in a real-world scenario, 745 consecutively collected samples from patients referred to our institute during a 3-month period for thrombophilia testing were analysed. In samples from patients not receiving direct-acting oral anticoagulants or heparins (<i>n</i> = 485), both methods showed good agreement (<i>r</i> = 0.874, Bland-Altman limits of agreement 6.57%, -15.76%). While similar results were obtained in patients receiving low-molecular-weight heparin (LMWH, <i>n</i> = 76, <i>r</i> = 0.891, 4.09%, -14.35%), the agreement was lower in patients receiving rivaroxaban (<i>n</i> = 86, <i>r</i> = 0.570, 5.97%, -49.43%) and apixaban (<i>n</i> = 72, <i>r</i> = 0.735, 3.77%, -42.45%). Direct FXa inhibitors but not LMWH increased FXa-based assay results in a dose-dependent manner, while the FIIa-based test was unaffected. Both assay types were equally successful in detecting hereditary AT deficiency in our study population, as samples from 9 out of 10 patients with AT deficiency causing mutations were detected by each method. These data suggest that FXa-based AT testing can be preferred over FIIa-based methods only in the absence of direct FXa inhibitors. In patients receiving direct FXa inhibitors, AT activity testing should be performed using FIIa-based assays.

Also flagged:neurogenesisHuntington's diseaseHDneurodegenerative diseaseHuntingtincytokinesis
Journal Article 2018-01-29 ✓ 2 Snippets Ruzo A, Croft GF, Metzger JJ, Galgoczi S, Gerber LJ, Pellegrini C, Wang H, Fenner M, Tse S, Marks A, Nchako C, Brivanlou AH.
In-Text Gene Mentions

Huntington's disease (HD) is a fatal neurodegenerative disease caused by expansion of CAG repeats in the Huntingtin gene (HTT).

Huntington's disease (HD) is a fatal neurodegenerative disease caused by expansion of CAG repeats in the Huntingtin gene (<i>HTT</i>).

Show Full Abstract

Huntington's disease (HD) is a fatal neurodegenerative disease caused by expansion of CAG repeats in the Huntingtin gene (<i>HTT</i>). Neither its pathogenic mechanisms nor the normal functions of HTT are well understood. To model HD in humans, we engineered a genetic allelic series of isogenic human embryonic stem cell (hESC) lines with graded increases in CAG repeat length. Neural differentiation of these lines unveiled a novel developmental HD phenotype: the appearance of giant multinucleated telencephalic neurons at an abundance directly proportional to CAG repeat length, generated by a chromosomal instability and failed cytokinesis over multiple rounds of DNA replication. We conclude that disrupted neurogenesis during development is an important, unrecognized aspect of HD pathogenesis. To address the function of normal HTT protein we generated <i>HTT</i><sup>+/-</sup> and <i>HTT</i><sup>-/-</sup> lines. Surprisingly, the same phenotype emerged in <i>HTT</i><sup>-/-</sup> but not <i>HTT</i><sup>+/-</sup> lines. We conclude that HD is a developmental disorder characterized by chromosomal instability that impairs neurogenesis, and that HD represents a genetic dominant-negative loss of function, contrary to the prevalent gain-of-toxic-function hypothesis. The consequences of developmental alterations should be considered as a new target for HD therapies.

Also flagged:hydroxyAlantolactoneSesquiterpene lactonesetoposidemethylenecell cycle arrest
Journal Article 2018-01-29 No Snippets Tang JJ, He QR, Dong S, Guo X, Wang YG, Lei BL, Tian JM, Gao JM.
Show Full Abstract

Sesquiterpene lactones (STLs) are a class of plant secondary metabolites widely found in nature with potent antitumor activities. In this work, two isolated STLs 1β-hydroxy alantolactone (1) and ivangustin (2) were derivatized through diversity-oriented strategy, and in vitro cytotoxic activity assessments were conducted against six cell lines including HeLa, PC-3, HEp-2, HepG2, CHO and HUVEC. The cytotoxic structure-activity relationship showed that the double bond between C5 and C6 was beneficial to improve activity; C1-OH oxidized derivatives showed a slight stronger activity, comparable to the positive drug etoposide (VP-16). Yet, C1-OH esterified derivatives decreased the potency which were different from those of 1-O-acetylbritannilactone (ABL) reported previously by us, and C13-methylene reductive and spiro derivatives resulted in almost complete ablation of cytotoxic activity. Mechanistic basis of cytotoxicity of the representative compound 1i was assayed to relate with apoptosis and cell cycle arrest. Furthermore, 1i inhibited TNF-α-induced canonical NF-κB signaling in PC-3 cells. Molecular modeling studies exhibited additional hydrogen bond interaction between 1i and the residue Lys37 of p65, indicating that 1i could form covalent protein adducts with Cys38 on p65.

Also flagged:Airwayasthmaozoneviral infectionairway hyperreactivitybethanechol
Journal Article 2018-01-29 No Snippets Reznikov LR, Meyerholz DK, Kuan SP, Guevara MV, Atanasova KR, Abou Alaiwa MH.
Show Full Abstract

Airway hyperreactivity is a hallmark feature of asthma and can be precipitated by airway insults, such as ozone exposure or viral infection. A proposed mechanism linking airway insults to airway hyperreactivity is augmented cholinergic transmission. In the current study, we tested the hypothesis that acute potentiation of cholinergic transmission is sufficient to induce airway hyperreactivity. We atomized the cholinergic agonist bethanechol to neonatal piglets and forty-eight hours later measured airway resistance. Bethanechol-treated piglets displayed increased airway resistance in response to intravenous methacholine compared to saline-treated controls. In the absence of an airway insult, we expected to find no evidence of airway inflammation; however, transcripts for several asthma-associated cytokines, including IL17A, IL1A, and IL8, were elevated in the tracheas of bethanechol-treated piglets. In the lungs, prior bethanechol treatment increased transcripts for IFNγ and its downstream target CXCL10. These findings suggest that augmented cholinergic transmission is sufficient to induce airway hyperreactivity, and raise the possibility that cholinergic-mediated regulation of pro-inflammatory pathways might contribute.

Also flagged:SynthesisBis-NaphthalimidediaminebindingethylenediamineLysine
Journal Article 2018-01-29 No Snippets Huang Y, Wu CX, Song Y, Huang M, Tian DN, Yang XB, Fan YR.
Show Full Abstract

A series of bis-naphthalimide derivatives with different diamine linkers were designed and synthesized. All of the synthesized bis-naphthalimide derivatives were characterized by NMR and HRMS spectra. The binding ability between the compounds and CT DNA was evaluated by using UV-Vis titration experiments. The bis-naphthalimide compound with an ethylenediamine linker showed the largest binding constant with CT DNA. Hence, it was used as the model compound to study the DNA binding selectivity by UV-Vis titration aiming at different DNA duplexes. As a result, this compound showed binding preference to AT-rich duplexes. The DNA binding modes of the compounds were also measured by viscosity titration. The cytotoxicity of the compounds was evaluated by MTT assay. Compounds with 1,6-diaminohexane or 1,4-phenylenedimethanamine linkers showed higher cytotoxicity compared with other bis-naphthalimide derivatives.

Also flagged:Neural Cell Adhesion MoleculesNeural adhesion proteinsneural adhesion moleculesLSAMPNTMOPCML
Journal Article 2018-01-29 ✓ 5 Snippets Karis K, Eskla KL, Kaare M, Täht K, Tuusov J, Visnapuu T, Innos J, Jayaram M, Timmusk T, Weickert CS, Väli M, Vasar E, Philips MA.
In-Text Gene Mentions

Growing evidence suggests that the IgLON family of neural adhesion molecules LSAMP, NTM, NEGR1, and OPCML are important candidates in forming the susceptibility to schizophrenia (SCZ).

We detected significantly elevated levels of the NEGR1 transcript (1.33-fold increase) and the NTM 1b isoform transcript (1.47-fold increase) in the DLPFC of schizophrenia patients compared to healthy controls.

Based on Gwas meta-analysis from the Psychiatry Genomics Consortium (Ripke et al., 2014), there is strongest evidence for the association of OPCML and NEGR1 genes with schizophrenia, compared to other IgLONs.

Furthermore, Lsamp and NEGR1 proteins are significantly upregulated in the post-mortem anterior prefrontal cortex of the patients with schizophrenia compared to healthy controls (Cox et al., 2016).

According to the Kruskal–Wallis test, there was a statistically significant difference in NEGR1 protein level between the control group and the two subgroups of schizophrenia patients (H2 = 8.01, df = 2, p = 0.01) (Figures 4A,B).

Show Full Abstract

Neural adhesion proteins are crucial in the development and maintenance of functional neural connectivity. Growing evidence suggests that the IgLON family of neural adhesion molecules LSAMP, NTM, NEGR1, and OPCML are important candidates in forming the susceptibility to schizophrenia (SCZ). IgLON proteins have been shown to be involved in neurite outgrowth, synaptic plasticity and neuronal connectivity, all of which have been shown to be altered in the brains of patients with the diagnosis of schizophrenia. Here we optimized custom 5'-isoform-specific TaqMan gene-expression analysis for the transcripts of human IgLON genes to study the expression of IgLONs in the dorsolateral prefrontal cortex (DLPFC) of schizophrenic patients (<i>n</i> = 36) and control subjects (<i>n</i> = 36). Uniform 5'-region and a single promoter was confirmed for the human <i>NEGR1</i> gene by <i>in silico</i> analysis. IgLON5, a recently described family member, was also included in the study. We detected significantly elevated levels of the <i>NEGR1</i> transcript (1.33-fold increase) and the <i>NTM</i> 1b isoform transcript (1.47-fold increase) in the DLPFC of schizophrenia patients compared to healthy controls. Consequent protein analysis performed in male subjects confirmed the increase in NEGR1 protein content both in patients with the paranoid subtype and in patients with other subtypes. In-group analysis of patients revealed that lower expression of certain IgLON transcripts, mostly <i>LSAMP</i> 1a and 1b, could be related with concurrent depressive endophenotype in schizophrenic patients. Additionally, our study cohort provides further evidence that cannabis use may be a relevant risk factor associated with suicidal behaviors in psychotic patients. In conclusion, we provide clinical evidence of increased expression levels of particular IgLON family members in the DLPFC of schizophrenic patients. We propose that alterations in the expression profile of IgLON neural adhesion molecules are associated with brain circuit disorganization in neuropsychiatric disorders, such as schizophrenia. In the light of previously published data, we suggest that increased level of NEGR1 in the frontal cortex may serve as molecular marker for a wider spectrum of psychiatric conditions.

Also flagged:lysozymemucin 2synaptophysinchromogranin Aolfactomedin 4axis inhibition protein 2
Journal Article 2018-01-29 ✓ 2 Snippets Flores TJ, Nguyen VB, Widdop RE, Sutherland MR, Polglase GR, Abud HE, Black MJ.
In-Text Gene Mentions

…olfactomedin 4 (OLFM4), axis inhibition…

…cells ( AXIN2,OLFM4, and LGR5)…

Show Full Abstract

<h4>Background</h4>For infants born moderately/late preterm (32-37 weeks of gestation), immaturity of the intestine has the potential to impact both short- and long-term gastrointestinal function. The aim of this study conducted in sheep was to compare the morphology and smooth muscle contractility of the ileum in term and late preterm lambs.<h4>Materials and methods</h4>Lambs delivered preterm (132 days gestation; <i>n</i> = 7) or term (147 days gestation; <i>n</i> = 9) were milk-fed after birth and euthanased at 2 days of age. A segment of distal ileum was collected for analysis of the length and cellular composition of the villi and crypts, smooth muscle width and contractility, and mRNA expression of the cell markers Ki67, lysozyme, mucin 2, synaptophysin, chromogranin A, olfactomedin 4, axis inhibition protein 2, and leucine-rich repeat-containing G-protein coupled receptor 5 (LGR5).<h4>Results</h4>There was no difference in the proportion of inflammatory, proliferating, apoptotic, enterocyte, or goblet cells between groups, but preterm lambs exhibited a significant upregulation of the stem cell marker LGR5 (<i>p</i> = 0.01). Absolute villus height (term: 1,032 ± 147 µm, preterm: 651 ± 52 µm; <i>p</i> < 0.0001) and crypt depth (term: 153 ± 11 µm, preterm: 133 ± 17 µm; <i>p</i> = 0.01) were significantly shorter in the preterm ileums, with a trend (<i>p</i> = 0.06) for a reduction in muscularis externa width. There was no difference between groups in the contractile response to acetylcholine, but peak contractility in response to bradykinin (<i>p</i> = 0.02) and angiotensin II (<i>p</i> = 0.03) was significantly greater in the preterm lambs.<h4>Conclusion</h4>Findings demonstrate that the crypt-villus units are shorter in the ileum of late preterm offspring, but functionally mature with an equivalent cellular composition and normal contractile response to acetylcholine compared with term offspring. The exaggerated contractility to inflammatory mediators evident in the preterm ileum, however, may be of concern.

Also flagged:MID1peptidestauamyloid precursor proteinAPPprotein synthesis
Journal Article 2018-01-29 No Snippets Matthes F, Hettich MM, Schilling J, Flores-Dominguez D, Blank N, Wiglenda T, Buntru A, Wolf H, Weber S, Vorberg I, Dagane A, Dittmar G, Wanker E, Ehninger D, Krauss S.
Show Full Abstract

Alzheimer's disease (AD) is characterized by two neuropathological hallmarks: senile plaques, which are composed of amyloid-β (Aβ) peptides, and neurofibrillary tangles, which are composed of hyperphosphorylated tau protein. Aβ peptides are derived from sequential proteolytic cleavage of the amyloid precursor protein (APP). In this study, we identified a so far unknown mode of regulation of APP protein synthesis involving the MID1 protein complex: MID1 binds to and regulates the translation of APP mRNA. The underlying mode of action of MID1 involves the mTOR pathway. Thus, inhibition of the MID1 complex reduces the APP protein level in cultures of primary neurons. Based on this, we used one compound that we discovered previously to interfere with the MID1 complex, metformin, for in vivo experiments. Indeed, long-term treatment with metformin decreased APP protein expression levels and consequently Aβ in an AD mouse model. Importantly, we have initiated the metformin treatment late in life, at a time-point where mice were in an already progressed state of the disease, and could observe an improved behavioral phenotype. These findings together with our previous observation, showing that inhibition of the MID1 complex by metformin also decreases tau phosphorylation, make the MID1 complex a particularly interesting drug target for treating AD.

Also flagged:breast cancerdeathgene expressionCAPN2CDC73ASB13
Journal Article 2018-01-29 No Snippets Chi C, Murphy LC, Hu P.
Show Full Abstract

Breast cancer diagnosis in young women has emerged as an independent prognostic factor with higher recurrence risk and death than their older counterparts. We aim to find recurrent somatic copy number alteration (CNA) regions identified from breast cancer microarray data and associate the CNA status of the genes harbored in the regions to the survival of young women with breast cancer. By using the interval graph-based algorithm we developed, and the CNA data consisting of a Discovery set with 130 young women and a Validation set with 125 young women, we identified 38 validated recurrent CNAs containing 39 protein encoding genes. CNA gain regions encompassing genes <i>CAPN2</i>, <i>CDC73</i> and <i>ASB13</i> are the top 3 with the highest occurring frequencies in both the Discovery and Validation dataset, while gene <i>SGCZ</i> ranked top for the recurrent CNA loss regions. The mutation status of 9 of the 39 genes shows significant associations with breast cancer specific survival. Interestingly, the expression level of 2 of the 9 genes, <i>ASB13</i> and <i>SGCZ</i>, shows significant association with survival outcome. Patients with CNA mutations in both of these genes had a worse survival outcome when compared to patients without the gene mutations. The mutated CNA status in gene <i>ASB13</i> was associated with a higher gene expression, which predicted patient survival outcome. Together, identification of the CNA events with prognostic significance in young women with breast cancer may be used in genomic-guided treatment.

Also flagged:kinasekinasesHER2claudinbreast cancertumors
Journal Article 2018-01-29 ✓ 4 Snippets Collins KAL, Stuhlmiller TJ, Zawistowski JS, East MP, Pham TT, Hall CR, Goulet DR, Bevill SM, Angus SP, Velarde SH, Sciaky N, Oprea TI, Graves LM, Johnson GL, Gomez SM.
In-Text Gene Mentions

ADCK1, DAPK3, DMPK STK17A and VRK2 were found to be similarly amplified in other cancers including prostate adenocarcinoma, uterine carcinosarcoma and pancreatic adenocarcinoma.

…STK17A, DMPK andVRK2.…

…DNA repair) andVRK2(Vaccinia-related kinase 2…

…DMPK STK17A andVRK2were found to…

Show Full Abstract

Multiplexed small molecule inhibitors covalently bound to Sepharose beads (MIBs) were used to capture functional kinases in luminal, HER2-enriched and triple negative (basal-like and claudin-low) breast cancer cell lines and tumors. Kinase MIB-binding profiles at baseline without perturbation proteomically distinguished the four breast cancer subtypes. Understudied kinases, whose disease associations and pharmacology are generally unexplored, were highly represented in MIB-binding taxonomies and are integrated into signaling subnetworks with kinases that have been previously well characterized in breast cancer. Computationally it was possible to define subtypes using profiles of less than 50 of the more than 300 kinases bound to MIBs that included understudied as well as metabolic and lipid kinases. Furthermore, analysis of MIB-binding profiles established potential functional annotations for these understudied kinases. Thus, comprehensive MIBs-based capture of kinases provides a unique proteomics-based method for integration of poorly characterized kinases of the understudied kinome into functional subnetworks in breast cancer cells and tumors that is not possible using genomic strategies. The MIB-binding profiles readily defined subtype-selective differential adaptive kinome reprogramming in response to targeted kinase inhibition, demonstrating how MIB profiles can be used in determining dynamic kinome changes that result in subtype selective phenotypic state changes.

Also flagged:disulfideconotoxinconotoxin MConotoxinscysteineamino acid
Journal Article 2018-01-28 No Snippets Franco A, Dovell S, Möller C, Grandal M, Clark E, Marí F.
Show Full Abstract

The mini-M conotoxins are peptidic scaffolds found in the venom of cones snails. These scaffolds are tightly folded structures held together by three disulfide bonds with a CC-C-C-CC arrangement (conotoxin framework III) and belong to the M Superfamily of conotoxins. Here, we describe mini-M conotoxins from the venom of Conus regius, a Western Atlantic worm-hunting cone snail species using transcriptomic and peptidomic analyses. These C. regius conotoxins belong to three different subtypes: M1, M2, and M3. The subtypes show little sequence homology, and their loop sizes (intercysteine amino acid chains) vary significantly. The mini-Ms isolated from dissected venom contains preferentially hydroxylated proline residues, thus augmenting the structural reach of this conotoxin class. Using 2D-NMR methods, we have determined the 3D structure of reg3b, an M2 subtype conotoxin, which shows a constrained multi-turn scaffold. The structural diversity found within mini-M conotoxin scaffolds of C. regius is indicative of structural hypervariability of the conotoxin M superfamily that is not seen in other superfamilies. These stable minimalistic scaffolds may be investigated for the development of engineered peptides for therapeutic applications.<h4>Databases</h4>Sequences are available in GenBank under accession numbers MF588935-MF588952. Structural data are available in the RCSB protein database under the accession code 6BX9.

Also flagged:neurodegenerative diseasesneurodegenerative diseasecytokineautophagyendoplasmic reticulumglucose
Journal Article 2018-01-28 ✓ 1 Snippet Ting HC, Chang CY, Lu KY, Chuang HM, Tsai SF, Huang MH, Liu CA, Lin SZ, Harn HJ.
In-Text Gene Mentions

Sulforaphane, neferine, conophylline, and resveratrol eliminated mutant Huntingtin (Htt) aggregates [58,66,67,68], and cleared Htt protein and inclusions against mutant Htt or CAG repeats by activating AMPK-mTOR signaling.

Show Full Abstract

Traditional Chinese medicine has been practiced for centuries in East Asia. Herbs are used to maintain health and cure disease. Certain Chinese herbs are known to protect and improve the brain, memory, and nervous system. To apply ancient knowledge to modern science, some major natural therapeutic compounds in herbs were extracted and evaluated in recent decades. Emerging studies have shown that herbal compounds have neuroprotective effects or can ameliorate neurodegenerative diseases. To understand the mechanisms of herbal compounds that protect against neurodegenerative diseases, we summarize studies that discovered neuroprotection by herbal compounds and compound-related mechanisms in neurodegenerative disease models. Those compounds discussed herein show neuroprotection through different mechanisms, such as cytokine regulation, autophagy, endoplasmic reticulum (ER) stress, glucose metabolism, and synaptic function. The interleukin (IL)-1β and tumor necrosis factor (TNF)-α signaling pathways are inhibited by some compounds, thus attenuating the inflammatory response and protecting neurons from cell death. As to autophagy regulation, herbal compounds show opposite regulatory effects in different neurodegenerative models. Herbal compounds that inhibit ER stress prevent neuronal death in neurodegenerative diseases. Moreover, there are compounds that protect against neuronal death by affecting glucose metabolism and synaptic function. Since the progression of neurodegenerative diseases is complicated, and compound-related mechanisms for neuroprotection differ, therapeutic strategies may need to involve multiple compounds and consider the type and stage of neurodegenerative diseases.

Also flagged:rotavirus infectionInfectionWNTsecretionstem cell maintenancecell-surface
Journal Article 2018-01-28 ✓ 1 Snippet Zou WY, Blutt SE, Zeng XL, Chen MS, Lo YH, Castillo-Azofeifa D, Klein OD, Shroyer NF, Donowitz M, Estes MK.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Intestinal stem cells (ISCs) maintain and repair the intestinal epithelium. While regeneration after ISC-targeted damage is increasingly understood, injury-repair mechanisms that direct regeneration following injuries to differentiated cells remain uncharacterized. The enteric pathogen, rotavirus, infects and damages differentiated cells while sparing all ISC populations, thus allowing the unique examination of the response of intact ISC compartments during injury-repair. Upon rotavirus infection in mice, ISC compartments robustly expand and proliferating cells rapidly migrate. Infection results specifically in stimulation of the active crypt-based columnar ISCs, but not alternative reserve ISC populations, as is observed after ISC-targeted damage. Conditional ablation of epithelial WNT secretion diminishes crypt expansion and ISC activation, demonstrating a previously unknown function of epithelial-secreted WNT during injury-repair. These findings indicate a hierarchical preference of crypt-based columnar cells (CBCs) over other potential ISC populations during epithelial restitution and the importance of epithelial-derived signals in regulating ISC behavior.

Also flagged:serotoninmigrainepositron55-HT 4 receptorbinding
Journal Article 2018-01-28 ✓ 1 Snippet Deen M, Hansen HD, Hougaard A, Nørgaard M, Eiberg H, Lehel S, Ashina M, Knudsen GM.
In-Text Gene Mentions

…the 5-HT transporter (5-HTT) gene, which is…

Show Full Abstract

Migraine has been hypothesized to be a syndrome of chronic low serotonin (5-HT) levels, but investigations of brain 5-HT levels have given equivocal results. Here, we used positron emission tomography (PET) imaging of the 5-HT<sub>4</sub> receptor as a proxy for brain 5-HT levels. Given that the 5-HT<sub>4</sub> receptor is inversely related to brain 5-HT levels, we hypothesized that between attacks migraine patients would have higher 5-HT<sub>4</sub> receptor binding compared to controls. Eighteen migraine patients without aura (migraine free >48 h), and 16 age- and sex-matched controls underwent PET scans after injection of [<sup>11</sup>C]SB207145, a specific 5-HT<sub>4</sub> receptor radioligand. An investigator blinded to group calculated a neocortical mean [<sup>11</sup>C]SB207145 binding potential (BP<sub>ND</sub>). Three migraine patients reported a migraine attack within 48 h after the scan and were excluded from the primary analysis. Comparing 15 migraine patients and 16 controls, we found that migraine patients have significantly lower neocortical 5-HT<sub>4</sub> receptor binding than controls (0.60 ± 0.09 vs. 0.67 ± 0.05, p = .024), corrected for 5-HTTLPR genotype, sex and age. We found no association between 5-HT<sub>4</sub> receptor binding and attack frequency, years with migraine or time since last migraine attack. Our finding of lower 5-HT<sub>4</sub> receptor binding in migraine patients is suggestive of higher brain 5-HT levels. This is in contrast with the current belief that migraine is associated with low brain 5-HT levels. High brain 5-HT levels may represent a trait of the migraine brain or it could be a consequence of migraine attacks.

Also flagged:cell proliferationLATS1cancersgastric cancerLiver Hepatocellular carcinomaBladder cancer
Journal Article 2018-01-27 ✓ 1 Snippet Xu Y, Yu X, Wei C, Nie F, Huang M, Sun M.
In-Text Gene Mentions

…HuR, AGO2 andSTAU1(as the RF…

Show Full Abstract

<h4>Background</h4>Recently, the pesudogenes have emerged as critical regulators in human cancers tumorigenesis and progression, and been identified as a key revelation in post-genomic biology. However, the expression pattern, biological function and mechanisms responsible for these molecules in human gastric cancer (GC) are not fully understood.<h4>Methods</h4>In this study, we globally assessed the transcriptomic differences of pesudogenes in gastric cancer using publicly available microarray data. DUXAP10 expression levels in GC tissues and cells was detected using quantitative real-time PCR (qPCR). DUXAP10 siRNAs and over-expression vector were transfected into GC cells to down-regulate or up-regulate DUXAP10 expression. Loss- and gain-of function assays were performed to investigate the role of DUXAP10 in GC cells cell proliferation, and invasion. RIP, RNA pulldown, and ChIP assays were used to determine the mechanism of DUXAP10's regulation of underlying targets.<h4>Results</h4>The pesudogene DUXAP10 is the only pseudogene that significantly over-expressed in all four GEO datasets, and frequently over-expressed in many other cancers including Liver Hepatocellular carcinoma, Bladder cancer, and Esophageal Cancer. High DUXAP10 expression is associated with GC patients poor prognosis, and knockdown of DUXAP10 significantly inhibits cells proliferation, migration and invasion in GC. Mechanistic investigation shows that DUXAP10 can interact with PRC2 and LSD1 to repress LATS1 expression at transcriptional level, and bind with HuR to maintain the stability of β-catenin mRNA and increase its protein levels at post-transcriptional level.<h4>Conclusions</h4>Overall, our findings illuminate how increased DUXAP10 confers an oncogenic function in GC development and progression that may serve as a candidate prognostic biomarker and target for clinical management of GC.

Also flagged:fluoresceinSLC12A2HOPXSMOC2BMI1MSI1
Journal Article 2018-01-27 ✓ 5 Snippets Suzuki K, Murano T, Shimizu H, Ito G, Nakata T, Fujii S, Ishibashi F, Kawamoto A, Anzai S, Kuno R, Kuwabara K, Takahashi J, Hama M, Nagata S, Hiraguri Y, Takenaka K, Yui S, Tsuchiya K, Nakamura T, Ohtsuka K, Watanabe M, Okamoto R.
In-Text Gene Mentions

OLFM4

…comparable level ofOLFM4and SLC12A2 expression…

…Results ISC-marker genes,OLFM4and SLC12A2, were…

…as LGR5 ,OLFM4, SMOC2 or…

…, ASCL2 orOLFM4[ 11 ].…

Show Full Abstract

<h4>Background</h4>Intestinal stem cells (ISCs) play indispensable roles in the maintenance of homeostasis, and also in the regeneration of the damaged intestinal epithelia. However, whether the inflammatory environment of Crohn's disease (CD) affects properties of resident small intestinal stem cells remain uncertain.<h4>Methods</h4>CD patient-derived small intestinal organoids were established from enteroscopic biopsy specimens taken from active lesions (aCD-SIO), or from mucosa under remission (rCD-SIO). Expression of ISC-marker genes in those organoids was examined by immunohistochemistry, and also by microfluid-based single-cell multiplex gene expression analysis. The ISC-specific function of organoid cells was evaluated using a single-cell organoid reformation assay.<h4>Results</h4>ISC-marker genes, OLFM4 and SLC12A2, were expressed by an increased number of small intestinal epithelial cells in the active lesion of CD. aCD-SIOs, rCD-SIOs or those of non-IBD controls (NI-SIOs) were successfully established from 9 patients. Immunohistochemistry showed a comparable level of OLFM4 and SLC12A2 expression in all organoids. Single-cell gene expression data of 12 ISC-markers were acquired from a total of 1215 cells. t-distributed stochastic neighbor embedding analysis identified clusters of candidate ISCs, and also revealed a distinct expression pattern of SMOC2 and LGR5 in ISC-cluster classified cells derived from aCD-SIOs. Single-cell organoid reformation assays showed significantly higher reformation efficiency by the cells of the aCD-SIOs compared with that of cells from NI-SIOs.<h4>Conclusions</h4>aCD-SIOs harbor ISCs with modified marker expression profiles, and also with high organoid reformation ability. Results suggest modification of small intestinal stem cell properties by unidentified factors in the inflammatory environment of CD.

Also flagged:Major depressive disordermonoamineneurotrophic factors
Journal Article 2018-01-27 No Snippets Busch Y, Menke A.
Show Full Abstract

Major depressive disorder is a common, serious and in some cases, life-threatening condition and affects approximately 350 million people globally. Although there is effective treatment available for it, more than 50% of the patients fail to respond to the first antidepressant they receive. The selection of a distinct treatment is still exclusively based on clinical judgment without incorporating lab-derived objective measures. However, there is growing evidence of biomarkers that it helps to improve diagnostic processes and treatment algorithms. Here genetic markers and blood-based biomarkers of the monoamine pathways, inflammatory pathways and the hypothalamic-pituitary-adrenal (HPA) axis are reviewed. Promising findings arise from studies investigating inflammatory pathways and immune markers that may identify patients suitable for anti-inflammatory based treatment regimes. Next, an early normalization of a disturbed HPA axis or depleted neurotrophic factors may predict stable treatment response. Genetic markers within the serotonergic system may identify patients who are vulnerable because of stressful life events, but evidence for guiding treatment regimes still is inconsistent. Therefore, there is still a great need for studies investigating and validating biomarkers for the prediction of treatment response to facilitate the treatment selection and shorten the time to remission and thus provide personalized medicine in psychiatry.

Also flagged:ADC-reactive proteinCRPNLR
Journal Article 2018-01-27 No Snippets Walker PA, Kunjuraman B, Bartolo DCC.
Show Full Abstract

<h4>Background</h4>Anastomotic dehiscence (AD) is the most feared complication following colonic and rectal anastomosis. Multiple attempts have been made to correlate the levels of biomarkers to the risk of AD. This study attempts to compare C-reactive protein (CRP), procalcitonin (PCT) and neutrophil-to-lymphocyte ratio (NLR) as predictors of AD.<h4>Method</h4>This case-controlled study collected data on patients undergoing colonic and rectal anastomosis over an 18-month period. Levels of CRP, PCT and NLR were recorded daily for the first 5 days post-operatively. These results were then compared between those who developed AD and those who did not.<h4>Results</h4>A total of 136 patients were included; 11 (8.1%) patients developed AD. CRP and NLR were useful predictors of AD with an area under the curve of 0.81 and 0.78 on post-operative day 4. PCT was not found to be raised significantly higher in patients who developed AD compared to those who did not.<h4>Conclusion</h4>CRP and NLR are useful predictors of AD. PCT is not a useful predictor of AD.

Also flagged:Potassium channelHuntington's diseasemovement disorderscognitive impairmentglutaminepathogenesis
Journal Article 2018-01-27 ✓ 1 Snippet Zhang X, Wan JQ, Tong XP.
In-Text Gene Mentions

…the protein huntingtin (Htt), produces widespread neurona…

Show Full Abstract

Huntington's disease (HD) is a late-onset fatal neurodegenerative disease, characterized by progressive movement disorders, psychiatric symptoms, and cognitive impairment. The cytosine-adenine-guanine (CAG) triplet expansion encoding glutamine present in the protein huntingtin (Htt), produces widespread neuronal and glial pathology. Mutant huntingtin (mHtt) nuclear aggregates are the primary cause of cortical and striatal neuron degeneration, neuronal inflammation, apoptosis and eventual cell loss. The precise mechanisms underlying the pathogenesis of neurodegeneration in HD remain poorly understood and HD patients have no current cure. Potassium channels are widely expressed in most cell types. In neurons, they play a crucial role in setting the resting membrane potential, mediating the rapid repolarization phase of the action potential and controlling sub-threshold oscillations of membrane potentials. In glial cells, their major contributions are maintaining the resting membrane potential and buffering extracellular K<sup>+</sup> . Thus, potassium channels have an essential function in both physiological and pathological brain conditions. This review summarizes recent progress on potassium channels involved in the pathology of HD by using different HD mouse models. Exploring the dysfunction of potassium channels in the brain illustrates new approaches for targeting this channel for the treatment of HD.

Also flagged:Immune ResponsesDendrimermethyl methacrylateTSAantibodyleishmaniasis
Journal Article 2018-01-27 No Snippets Tabatabaie F, Samarghandi N, Zarrati S, Maleki F, Ardestani MS, Elmi T, Mosawi SH.
Show Full Abstract

<h4>Background</h4>Leishmaniasis is a parasitic disease induced by a protozoan from the genus <i>Leishmania</i>. No effective vaccine has yet been developed against the disease.<h4>Aim</h4>In this work, two nano-vaccines, TSA recombinant plasmid and dendrimer and poly (methyl methacrylate) (PMMA) nanoparticles (as adjuvants), were designed and tested for their immunogenicity in BALB/c mice.<h4>Methods</h4>After the plasmid construction and preparation of adjuvants, three intramuscular injections of the nano-vaccines (100 µg) and the recombinant TSA protein (20 µg) were subcutaneously performed. Eventually, the challenged animals were infected with the parasites (1*10<sup>6</sup> promastigotes). After the last injections of the nano-vaccines, the responses of their antibody subclasses and cytokines were assessed via ELISA method before and after the challenge.<h4>Results</h4>This study revealed that the new nano-vaccines were strong and effective in inducing specific antibody and cellular responses and reducing the parasite burden in the spleen compared to the control groups of <i>Leishmania major</i>-infected BALB/c mice.<h4>Conclusion</h4>Based on the results, we can suggest that the formulated vaccines are suitable candidates for further studies in the field of leishmaniasis control.

Also flagged:TPH1irritable bowel syndromeserotonin5-hydroxytryptamineDepressionIBS
Journal Article 2018-01-27 ✓ 5 Snippets Katsumata R, Shiotani A, Murao T, Ishii M, Fujita M, Matsumoto H, Haruma K.
In-Text Gene Mentions

The 5-HTTLPR l/l genotype has greater transcriptional activity, which results in a higher 5-HTT expression level in a synaptic cleft, than the 5-HTTLPR s/s genotype.(35) Therefore, the 5-HTTLPR l/s genotype associated with higher SERT expression level and lower 5-HT level at the synaptic cleft might have exacerbated the GERD symptoms, followed by QOL impairment, in our subjects.

…of 5-HT transporter (5-HTT) and tryptophan hydroxylase…

5-HTT, also known as…

…Several polymorphisms in5-HTT(SLC6A4) are reported…

…the regulation of5-HTTin the gut.…

Show Full Abstract

The gastrointestinal symptoms of irritable bowel syndrome are strongly related to impaired quality of life (QOL), especially in diarrhea-predominant. The gene polymorphisms associated with serotonin, or 5-hydroxytryptamine, alter gastrointestinal symptoms and mental status. We aimed to evaluate the effects of gene polymorphisms on gastrointestinal symptoms, psychological conditions, and QOL, and compare these between patients with diarrhea-predominant irritable bowel syndrome (<i>n</i> = 62) and healthy controls (<i>n</i> = 64). The gene polymorphisms of 5-HTTLPR, 5-HTTVNTR, TPH1 rs453773, and TPH1 rs211105 were evaluated. Gastrointestinal symptoms, depressive state, and QOL were assessed using the Gastrointestinal Symptom Rating Scale, Self-rating Depression Scale, and Short-Form-36. Gene polymorphisms did not significantly differ in frequency between the two groups. The scores for diarrhea, abdominal pain, and indigestion significantly correlated with the physical component summary score. Only the group of patients with diarrhea-predominant irritable bowel syndrome showed a significant correlation between the TPH1 rs211105 T/T genotype and lower scores for role physical and mental health, and higher scores for indigestion and diarrhea. 5-HTTLPR l/s was associated with lower score of role emotional in the diarrhea-predominant irritable bowel syndrome and higher scores in the controls. The gene polymorphisms of 5-hydroxytryptamine signaling effected gastrointestinal symptoms and QOL, especially of the patients with diarrhea-predominant irritable bowel syndrome.

Also flagged:hepatocellular carcinomastumorFIGNHedgehoghepatocellular carcinomaGli2
Journal Article 2018-01-26 No Snippets Riordan JD, Feddersen CR, Tschida BR, Beckmann PJ, Keng VW, Linden MA, Amin K, Stipp CS, Largaespada DA, Dupuy AJ.
Show Full Abstract

Most hepatocellular carcinomas (HCCs) develop in a chronically injured liver, yet the extent to which this microenvironment promotes neoplastic transformation or influences selective pressures for genetic drivers of HCC remains unclear. We sought to determine the impact of hepatic injury in an established mouse model of HCC induced by Sleeping Beauty transposon mutagenesis. Chemically induced chronic liver injury dramatically increased tumor penetrance and significantly altered driver mutation profiles, likely reflecting distinct selective pressures. In addition to established human HCC genes and pathways, we identified several injury-associated candidates that represent promising loci for further study. Among them, we found that FIGN is overexpressed in human HCC and promotes hepatocyte invasion. We also validated Gli2's oncogenic potential in vivo, providing direct evidence that Hedgehog signaling can drive liver tumorigenesis in the context of chronic injury. Finally, we show that a subset of injury-associated candidate genes identifies two distinct classes of human HCCs. Further analysis of these two subclasses revealed significant trends among common molecular classification schemes of HCC. The genes and mechanisms identified here provide functional insights into the origin of HCC in a chronic liver damage environment.<h4>Conclusion</h4>A chronically damaged liver microenvironment influences the genetic mechanisms that drive hepatocarcinogenesis. (Hepatology 2018;67:924-939).

Also flagged:TIMP3ironliver diseasestissue inhibitor of metalloproteinase 3MMP-2gelatinase
Journal Article 2018-01-26 ✓ 2 Snippets Zhabyeyev P, Das SK, Basu R, Shen M, Patel VB, Kassiri Z, Oudit GY.
In-Text Gene Mentions

…patients with genetichemochromatosisand secondary iron…

hemochromatosis

Show Full Abstract

Chronic iron overload results in heart and liver diseases and is a common cause of morbidity and mortality in patients with genetic hemochromatosis and secondary iron overload. We investigated the role of tissue inhibitor of metalloproteinase 3 (TIMP3) in iron overload-mediated tissue injury by subjecting male mice lacking Timp3 ( Timp3<sup>-/-</sup>) and wild-type (WT) mice to 12 wk of chronic iron overload. Whereas WT mice with iron overload developed diastolic dysfunction, iron-overloaded Timp3<sup>-/-</sup> mice showed worsened cardiac dysfunction coupled with systolic dysfunction. In the heart, loss of Timp3 was associated with increased myocardial fibrosis, greater Timp1, matrix metalloproteinase ( Mmp) 2, and Mmp9 expression, increased active MMP-2 levels, and gelatinase activity. Iron overload in Timp3<sup>-/-</sup> mice showed twofold higher iron accumulation in the liver compared with WT mice because of constituently lower levels of ferroportin. Loss of Timp3 enhanced the hepatic inflammatory response to iron overload, leading to greater neutrophil and macrophage infiltration and increased hepatic fibrosis. Expression of inflammation-related MMPs (MMP-12 and MMP-13) and inflammatory cytokines (IL-1β and monocyte chemoattractant protein-1) was elevated to a greater extent in iron-overloaded Timp3<sup>-/-</sup> livers. Gelatin zymography demonstrated equivalent increases in MMP-2 and MMP-9 levels in WT and Timp3<sup>-/-</sup> iron-overloaded livers. Loss of Timp3 enhanced the susceptibility to iron overload-mediated heart and liver injury, suggesting that Timp3 is a key protective molecule against iron-mediated pathology. NEW & NOTEWORTHY In mice, loss of tissue inhibitor of metalloproteinase 3 ( Timp3) was associated with systolic and diastolic dysfunctions, twofold higher hepatic iron accumulation (attributable to constituently lower levels of ferroportin), and increased hepatic inflammation. Loss of Timp3 enhanced the susceptibility to iron overload-mediated injury, suggesting that Timp3 plays a key protective role against iron-mediated pathology.

Also flagged:steroiddiethyl etherlipids assynthesistrifluoroacetic acidSun 1
Journal Article 2018-01-26 ✓ 1 Snippet Sheng R, Wang Z, Luo T, Cao A, Sun J, Kinsella JM.
In-Text Gene Mentions

DCC

Show Full Abstract

Using renewable and biocompatible natural-based resources to construct functional biomaterials has attracted great attention in recent years. In this work, we successfully prepared a series of steroid-based cationic lipids by integrating various steroid skeletons/hydrophobes with (<i>l</i>-)-arginine headgroups via facile and efficient synthetic approach. The plasmid DNA (pDNA) binding affinity of the steroid-based cationic lipids, average particle sizes, surface potentials, morphologies and stability of the steroid-based cationic lipids/pDNA lipoplexes were disclosed to depend largely on the steroid skeletons. Cellular evaluation results revealed that cytotoxicity and gene transfection efficiency of the steroid-based cationic lipids in H1299 and HeLa cells strongly relied on the steroid hydrophobes. Interestingly, the steroid lipids/pDNA lipoplexes inclined to enter H1299 cells mainly through caveolae and lipid-raft mediated endocytosis pathways, and an intracellular trafficking route of "lipid-raft-mediated endocytosis→lysosome→cell nucleic localization" was accordingly proposed. The study provided possible approach for developing high-performance steroid-based lipid gene carriers, in which the cytotoxicity, gene transfection capability, endocytosis pathways, and intracellular trafficking/localization manners could be tuned/controlled by introducing proper steroid skeletons/hydrophobes. Noteworthy, among the lipids, Cho-Arg showed remarkably high gene transfection efficacy, even under high serum concentration (50% fetal bovine serum), making it an efficient gene transfection agent for practical application.

Also flagged:ADneurl1CancerConnective tissue disorder-Nose-Throatprimary glioblastoma
Journal Article 2018-01-26 No Snippets Zhang Y, Shen F, Mojarad MR, Li D, Liu S, Tao C, Yu Y, Liu H.
Show Full Abstract

Recent scientific advances have accumulated a tremendous amount of biomedical knowledge providing novel insights into the relationship between molecular and cellular processes and diseases. Literature mining is one of the commonly used methods to retrieve and extract information from scientific publications for understanding these associations. However, due to large data volume and complicated associations with noises, the interpretability of such association data for semantic knowledge discovery is challenging. In this study, we describe an integrative computational framework aiming to expedite the discovery of latent disease mechanisms by dissecting 146,245 disease-gene associations from over 25 million of PubMed indexed articles. We take advantage of both Latent Dirichlet Allocation (LDA) modeling and network-based analysis for their capabilities of detecting latent associations and reducing noises for large volume data respectively. Our results demonstrate that (1) the LDA-based modeling is able to group similar diseases into disease topics; (2) the disease-specific association networks follow the scale-free network property; (3) certain subnetwork patterns were enriched in the disease-specific association networks; and (4) genes were enriched in topic-specific biological processes. Our approach offers promising opportunities for latent disease-gene knowledge discovery in biomedical research.

Also flagged:heart failureironhypogonadotropic hypogonadismdiabetes mellituscardiomyopathymembrane
Journal Article 2018-01-26 ✓ 5 Snippets Cooray SD, Heerasing NM, Selkrig LA, Subramaniam VN, Hamblin PS, McDonald CJ, McLean CA, McNamara E, Leet AS, Roberts SK.
In-Text Gene Mentions

Genetic testing revealed H63D heterozygosity for the HFE gene, which is inconsistent with hereditary hemochromatosis with iron overload.

…failure in juvenilehemochromatosiswith iron chelation…

…H63D variant inHFEhas a high…

…isolated SF forhemochromatosismay be as…

…in patients withhemochromatosis[ 13 ].…

Show Full Abstract

<h4>Background</h4>Juvenile hemochromatosis is the most severe form of iron overloading phenotype. Although rare, it should be suspected in patients who present with hypogonadotropic hypogonadism, diabetes mellitus, or cardiomyopathy without a clear cause.<h4>Case presentation</h4>A young Serbian male presenting with end-stage heart failure was referred for extracorporeal membrane oxygenation. An endomyocardial biopsy revealed cytoplasmic iron deposits in myocytes. His condition was stabilized with biventricular assist devices and he was listed for heart transplantation. Iron chelation therapy was commenced and resulted in rapid removal of iron burden. Serial outpatient echocardiograms demonstrated myocardial recovery such that a successful biventricular assist device explant occurred 131 days after initial implant. Targeted gene sequencing revealed a loss-of-function mutation within the HJV gene, which is consistent with juvenile hemochromatosis.<h4>Conclusions</h4>This rare case of a patient with juvenile hemochromatosis associated with a HJV mutation provides histologic evidence documenting the reversal of associated end-stage heart failure, requiring emergent mechanical circulatory support, with iron chelation therapy.

Also flagged:Kruppel-like factor 4Klf4zinc-finger-containingtranscription factorneurogenesisRNA-binding protein Staufen1
Journal Article 2018-01-26 ✓ 5 Snippets Moon BS, Moon BS, Bai J, Cai M, Liu C, Shi J, Lu W.
In-Text Gene Mentions

Our results highlight a novel molecular mechanism underlying stability of neurogenesis-associated mRNAs controlled by the Klf4/Ddx5/17/Stau1 axis during mammalian corticogenesis.

…RNA-binding protein Staufen1 (Stau1) and RNA helicase…

…that Klf4 promotesStau1recruitment to the…

…s-associated mRNAs, increasingStau1-mediated mRNA decay (SMD)…

Stau1depletion abrogated SMD…

Show Full Abstract

Kruppel-like factor 4 (Klf4) is a zinc-finger-containing protein that plays a critical role in diverse cellular physiology. While most of these functions attribute to its role as a transcription factor, it is postulated that Klf4 may play a role other than transcriptional regulation. Here we demonstrate that Klf4 loss in neural progenitor cells (NPCs) leads to increased neurogenesis and reduced self-renewal in mice. In addition, Klf4 interacts with RNA-binding protein Staufen1 (Stau1) and RNA helicase Ddx5/17. They function together as a complex to maintain NPC self-renewal. We report that Klf4 promotes Stau1 recruitment to the 3'-untranslated region of neurogenesis-associated mRNAs, increasing Stau1-mediated mRNA decay (SMD) of these transcripts. Stau1 depletion abrogated SMD of target mRNAs and rescued neurogenesis defects in Klf4-overexpressing NPCs. Furthermore, Ddx5/17 knockdown significantly blocked Klf4-mediated mRNA degradation. Our results highlight a novel molecular mechanism underlying stability of neurogenesis-associated mRNAs controlled by the Klf4/Ddx5/17/Stau1 axis during mammalian corticogenesis.

Also flagged:ruminationmetabolismmRNAALPIPCK1digestion
Journal Article 2018-01-26 No Snippets Hammon HM, Frieten D, Gerbert C, Koch C, Dusel G, Weikard R, Kühn C.
Show Full Abstract

There is increasing evidence that nutrition during early mammalian life has a strong influence on health and performance in later life. However, there are conflicting data concerning the appropriate milk diet. This discrepancy particularly applies to ruminants, a group of mammals that switch from monogastric status to rumination during weaning. Little is known regarding how the whole genome expression pattern in the juvenile ruminant gut is affected by alternative milk diets. Thus, we performed a next-generation-sequencing-based holistic whole transcriptome analysis of the jejunum in male pre-weaned German Holstein calves fed diets with restricted or unlimited access to milk during the first 8 weeks of life. Both groups were provided hay and concentrate ad libitum. The analysis of jejunal mucosa samples collected 80 days after birth and four weeks after the end of the feeding regimes revealed 275 differentially expressed loci. While the differentially expressed loci comprised 67 genes encoding proteins relevant to metabolism or metabolic adaptation, the most distinct difference between the two groups was the consistently lower activation of the immune system in calves that experienced restricted milk access compared to calves fed milk ad libitum. In conclusion, different early life milk diets had significant prolonged effects on the intestinal immune system.

Also flagged:extracellularregulation ofgene expressionpathogenesisTGFB2POLD1
Journal Article 2018-01-26 No Snippets Tu L, Huang Q, Fu S, Liu D.
Show Full Abstract

A hypertrophic scar is the result of abnormal repair of the body after trauma. Histopathologically, it is mostly the result of the excessive proliferation of fibroblasts and the accumulation of extracellular matrix. Accumulating evidence has demonstrated that long non‑coding RNAs (lncRNAs) have a critical role in the regulation of gene expression and in the pathogenesis of diseases. However, the roles of lncRNAs in hypertrophic scars have remained elusive. The present study investigated the profiles of differentially expressed lncRNAs between fibroblasts derived from a hypertrophic scar and normal skin, and explored the possible mechanisms underlying the development of hypertrophic scars. Microarray data indicated that 6,104 lncRNAs and 2,952 mRNAs were differentially expressed. A set of differentially expressed transcripts as confirmed by reverse transcription‑quantitative polymerase chain reaction. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were performed to determine the principal functions of the significantly deregulated genes. Furthermore, associated expression networks, including subgroup analysis, competing endogenous RNAs (ceRNAs) and coding‑noncoding co‑expression networks were constructed using bioinformatics methods. The homology between differentially expressed lncRNAs and mRNAs was assessed and two exon lncRNA were selected to explore their regulatory mechanisms. The ceRNA network inferred that NR_125715 acted as a competing endogenous RNA, bound to microRNA (miR)‑141‑3p, miR‑200a‑3p and miR‑29 to regulate the expression of the miRs' targets, including transforming growth factor β2 (TGFB2). Similarly, NR_046402 acted as a competing endogenous RNA, which bound to miR‑133a‑3p.1 and miR‑4469 to then regulate the expression of the miRs' targets, including DNA polymerase δ1, catalytic subunit (POLD1). In addition, co‑expression analysis indicated that the expression of lncRNAs NR_125715 and NR_046402 was correlated with that of TGFB2 and POLD1 mRNA. The identification of these differentially expressed lncRNAs in the hypertrophic scar‑derived fibroblasts in the present study, may provide novel insight into the functional interactions of lncRNA, miRNA and mRNA, and lead to novel theories for the pathogenesis and treatment of hypertrophic scars.

Also flagged:MYO1DSNX29lackAP5M1infectionsmelt
Journal Article 2018-01-26 ✓ 1 Snippet Armstrong C, Richardson DS, Hipperson H, Horsburgh GJ, Küpper C, Percival-Alwyn L, Clark M, Burke T, Spurgin LG.
In-Text Gene Mentions

CSE1L

Show Full Abstract

Island species provide excellent models for investigating how selection and drift operate in wild populations, and for determining how these processes act to influence local adaptation and speciation. Here, we examine the role of selection and drift in shaping genomic and phenotypic variation across recently separated populations of Berthelot's pipit (<i>Anthus berthelotii</i>), a passerine bird endemic to three archipelagos in the Atlantic. We first characterized genetic diversity and population structuring that supported previous inferences of a history of recent colonizations and bottlenecks. We then tested for regions of the genome associated with the ecologically important traits of bill length and malaria infection, both of which vary substantially across populations in this species. We identified a SNP associated with variation in bill length among individuals, islands, and archipelagos; patterns of variation at this SNP suggest that both phenotypic and genotypic variation in bill length is largely shaped by founder effects. Malaria was associated with SNPs near/within genes involved in the immune response, but this relationship was not consistent among archipelagos, supporting the view that disease resistance is complex and rapidly evolving. Although we found little evidence for divergent selection at candidate loci for bill length and malaria resistance, genome scan analyses pointed to several genes related to immunity and metabolism as having important roles in divergence and adaptation. Our findings highlight the utility and challenges involved with combining association mapping and population genetic analysis in nonequilibrium populations, to disentangle the effects of drift and selection on shaping genotypes and phenotypes.

Also flagged:carboxylic acidsulphonic acidbindingconjugationethylene glycolmethyl ether
Journal Article 2018-01-26 No Snippets Duong HTT, Chen Y, Tawfik SA, Wen S, Parviz M, Shimoni O, Jin D.
Show Full Abstract

Despite intense efforts on surface functionalization to generate hydrophilic upconversion nanoparticles (UCNPs), long-term colloidal stability in physiological buffers remains a major concern. Here we quantitatively investigate the competitive adsorption of phosphate, carboxylic acid and sulphonic acid onto the surface of UCNPs and study their binding strength to identify the best conjugation strategy. To achieve this, we designed and synthesized three di-block copolymers composed of poly(ethylene glycol) methyl ether acrylate and a polymer block bearing phosphate, carboxylic or sulphonic acid anchoring groups prepared by an advanced polymerization technique, Reversible Addition Fragmentation Chain Transfer (RAFT). Analytical tools provide the evidence that phosphate ligands completely replaced all the oleic acid capping molecules on the surface of the UCNPs compared with incomplete ligand exchange by carboxylic and sulphonic acid groups. Meanwhile, simulated quantitative adsorption energy measurements confirmed that among the three functional groups, the calculated adsorption strength for phosphate anchoring ligands is higher which is in good agreement with experimental results regarding the best colloidal stability, especially in phosphate buffer solution. This finding suggests that polymers with multiple anchoring negatively charged phosphate moieties provide excellent colloidal stability for lanthanide ion-doped luminescent nanoparticles for various potential applications.

Also flagged:metastatic diseasecell proliferationtumourTwist1histone deacetylase 1pancreatic cancer
Journal Article 2018-01-25 ✓ 5 Snippets Jiang W, Yuan Q, Jiang Y, Huang L, Chen C, Hu G, Wan R, Wang X, Yang L.
In-Text Gene Mentions

In vivo experiments showed that Sox6 overexpression inhibited tumour growth and liver metastasis from PC, confirming that Sox6 plays a tumour suppressor role in PC.

The results showed that Sox6 overexpression up‐regulated the epithelial marker E‐cadherin and down‐regulated the mesenchymal marker N‐cadherin in both PC cell lines, indicating that Sox6 overexpression inhibited EMT (Fig. 3A and B).

Sox6 inhibits the growth of human colorectal cancer and hepatocellular carcinoma, and decreased expression of SOX6 is associated with a poor prognosis in patients with hepatocellular carcinoma 16, 17.

Unlike the oncogenic roles of these Sox family members, Sox6 has been reported to play a tumour suppressive role in different cancers.

In a mouse model of PC, mice injected with Sox6 overexpressing PC cells developed smaller tumours than those receiving control vector‐transfected cells (Fig. 5A and B).

Show Full Abstract

Pancreatic cancer (PC) is an aggressive malignancy associated with a poor prognosis and low responsiveness to chemotherapy and radiotherapy. Most patients with PC have metastatic disease at diagnosis, which partly accounts for the high mortality from this disease. Here, we explored the role of the transcription factor sex-determining region Y-box (Sox) 6 in the invasiveness of PC cells. We showed that Sox6 is down-regulated in patients with PC in association with metastatic disease. Sox6 overexpression suppressed PC cell proliferation and migration in vitro and tumour growth and liver metastasis in vivo. Sox6 inhibited epithelial-mesenchymal transition (EMT), and Akt signalling. Sox6 was shown to interact with the promoter of Twist1, a helix-loop-helix transcription factor involved in the induction of EMT, and to modulate the expression of Twist1 by recruiting histone deacetylase 1 to the promoter of the Twist1 gene. Twist1 overexpression reversed the effect of Sox6 on inhibiting EMT, confirming that the effect of Sox6 on suppressing tumour invasiveness is mediated by the modulation of Twist1 expression. These results suggest a novel mechanism underlying the aggressive behaviour of PC cells and identify potential therapeutic targets for the treatment of PC.

Also flagged:cohesinStructural maintenance ofchromosomecanceradaptor proteinsorganization
Journal Article 2018-01-25 ✓ 3 Snippets Yuen KC, Gerton JL.
In-Text Gene Mentions

Condensinis an evolutionarily…

Condensinis now recognized…

…dosage compensation complex (DCC) in Caenorhabditis elegans…

Show Full Abstract

Structural maintenance of chromosome (SMC) protein complexes, including cohesin and condensin, are increasingly being recognized for their important role in cancer and development, making it critical that we understand how these evolutionarily conserved multi-subunit protein complexes associate with and organize the genome. We review adaptor proteins for SMC complexes and how these adaptors may capture SMC complexes following loop extrusion to provide a framework for chromosome organization.

Also flagged:DSTECIwatersunsixBehavior
Journal Article 2018-01-25 ✓ 1 Snippet Hagihara R, Jones RE, Sobtzick S, Cleguer C, Garrigue C, Marsh H.
In-Text Gene Mentions

ECI2

Show Full Abstract

The probability of an aquatic animal being available for detection is typically <1. Accounting for covariates that reduce the probability of detection is important for obtaining robust estimates of the population abundance and determining its status and trends. The dugong (Dugong dugon) is a bottom-feeding marine mammal and a seagrass community specialist. We hypothesized that the probability of a dugong being available for detection is dependent on water depth and that dugongs spend more time underwater in deep-water seagrass habitats than in shallow-water seagrass habitats. We tested this hypothesis by quantifying the depth use of 28 wild dugongs fitted with GPS satellite transmitters and time-depth recorders (TDRs) at three sites with distinct seagrass depth distributions: 1) open waters supporting extensive seagrass meadows to 40 m deep (Torres Strait, 6 dugongs, 2015); 2) a protected bay (average water depth 6.8 m) with extensive shallow seagrass beds (Moreton Bay, 13 dugongs, 2011 and 2012); and 3) a mixture of lagoon, coral and seagrass habitats to 60 m deep (New Caledonia, 9 dugongs, 2013). The fitted instruments were used to measure the times the dugongs spent in the experimentally determined detection zones under various environmental conditions. The estimated probability of detection was applied to aerial survey data previously collected at each location. In general, dugongs were least available for detection in Torres Strait, and the population estimates increased 6-7 fold using depth-specific availability correction factors compared with earlier estimates that assumed homogeneous detection probability across water depth and location. Detection probabilities were higher in Moreton Bay and New Caledonia than Torres Strait because the water transparency in these two locations was much greater than in Torres Strait and the effect of correcting for depth-specific detection probability much less. The methodology has application to visual survey of coastal megafauna including surveys using Unmanned Aerial Vehicles.

Also flagged:malariainfectious diseaseparasitemiafalciparum infectionprimaquinePolymerase
Journal Article 2018-01-25 No Snippets Komaki-Yasuda K, Vincent JP, Nakatsu M, Kato Y, Ohmagari N, Kano S.
Show Full Abstract

A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.

Also flagged:diphtheriairon-sensing transcription regulatordiphtheria toxinDTgene expressioniron
Journal Article 2018-01-25 No Snippets Wittchen M, Busche T, Gaspar AH, Lee JH, Ton-That H, Kalinowski J, Tauch A.
Show Full Abstract

<h4>Background</h4>The human pathogen Corynebacterium diphtheriae is the causative agent of diphtheria. In the 1990s a large diphtheria outbreak in Eastern Europe was caused by the strain C. diphtheriae NCTC 13129. Although the genome was sequenced more than a decade ago, not much is known about its transcriptome. Our aim was to use transcriptome sequencing (RNA-Seq) to close this knowledge gap and gain insights into the transcriptional landscape of a C. diphtheriae tox<sup>+</sup> strain.<h4>Results</h4>We applied two different RNA-Seq techniques, one to retrieve 5'-ends of primary transcripts and the other to characterize the whole transcriptional landscape in order to gain insights into various features of the C. diphtheriae NCTC 13129 transcriptome. By examining the data we identified 1656 transcription start sites (TSS), of which 1202 were assigned to genes and 454 to putative novel transcripts. By using the TSS data promoter regions recognized by the housekeeping sigma factor σ<sup>A</sup> and its motifs were analyzed in detail, revealing a well conserved -10 but an only weakly conserved -35 motif, respectively. Furthermore, with the TSS data 5'-UTR lengths were explored. The observed 5'-UTRs range from zero length (leaderless transcripts), which make up 20% of all genes, up to over 450 nt long leaders, which may harbor regulatory functions. The C. diphtheriae transcriptome consists of 471 operons which are further divided into 167 sub-operon structures. In a differential expression analysis approach, we discovered that genetic disruption of the iron-sensing transcription regulator DtxR, which controls expression of diphtheria toxin (DT), causes a strong influence on general gene expression. Nearly 15% of the genome is differentially transcribed, indicating that DtxR might have other regulatory functions in addition to regulation of iron metabolism and DT. Furthermore, our findings shed light on the transcriptional landscape of the DT encoding gene tox and present evidence for two tox antisense RNAs, which point to a new way of transcriptional regulation of toxin production.<h4>Conclusions</h4>This study presents extensive insights into the transcriptome of C. diphtheriae and provides a basis for future studies regarding gene characterization, transcriptional regulatory networks, and regulation of the tox gene in particular.

Also flagged:keratinizationkeratinkeratin-associated proteinsintermediate filament proteinsresponse to stressinnate immunity
Journal Article 2018-01-25 ✓ 1 Snippet Adav SS, Subbaiaih RS, Kerk SK, Lee AY, Lai HY, Ng KW, Sze SK, Schmidtchen A.
In-Text Gene Mentions

…into two groups:linker histoneshistones (histone H1),…

Show Full Abstract

Human hair is laminar-fibrous tissue and an evolutionarily old keratinization product of follicle trichocytes. Studies on the hair proteome can give new insights into hair function and lead to the development of novel biomarkers for hair in health and disease. Human hair proteins were extracted by detergent and detergent-free techniques. We adopted a shotgun proteomics approach, which demonstrated a large extractability and variety of hair proteins after detergent extraction. We found an enrichment of keratin, keratin-associated proteins (KAPs), and intermediate filament proteins, which were part of protein networks associated with response to stress, innate immunity, epidermis development, and the hair cycle. Our analysis also revealed a significant deamidation of keratin type I and II, and KAPs. The hair shafts were found to contain several types of histones, which are well known to exert antimicrobial activity. Analysis of the hair proteome, particularly its composition, protein abundances, deamidated hair proteins, and modification sites, may offer a novel approach to explore potential biomarkers of hair health quality, hair diseases, and aging.

Also flagged:cationextracellularvesiclesmetabolismcell growthresponses to stress
Journal Article 2018-01-25 No Snippets Nie S, Wang X, Sivakumaran P, Chong MMW, Liu X, Karnezis T, Bandara N, Takov K, Nowell CJ, Wilcox S, Shambrook M, Hill AF, Harris NC, Newcomb AE, Strappe P, Shayan R, Hernández D, Clarke J, Hanssen E, Davidson SM, Dusting GJ, Pébay A, Ho JWK, Williamson N, Lim SY.
Show Full Abstract

The benefits of adult stem cells for repair of the heart have been attributed to the repertoire of salutary paracrine activities they appear to exert. We previously isolated human W8B2<sup>+</sup> cardiac stem cells (CSCs) and found they powerfully influence cardiomyocytes and endothelial cells to collectively promote cardiac repair and regeneration. Here, the complexity of the W8B2<sup>+</sup> CSC secretomes was characterised and examined in more detail. Using ion exchange chromatography to separate soluble proteins based on their net surface charge, the secreted factors responsible for the pro-survival activity of W8B2<sup>+</sup> CSCs were found within the low and medium cation fractions. In addition to the soluble proteins, extracellular vesicles generated from W8B2<sup>+</sup> CSCs not only exhibited pro-survival and pro-angiogenic activities, but also promoted proliferation of neonatal cardiomyocytes. These extracellular vesicles contain a cargo of proteins, mRNA and primary microRNA precursors that are enriched in exosomes and are capable of modulating collectively many of the cellular pathways involved in protein metabolism, cell growth, as well as cellular responses to stress and organisation of the extracellular matrix. Thus the W8B2<sup>+</sup> CSC secretome contains a multitude of bioactive paracrine factors we have now characterised, that might well be harnessed for therapeutic application for cardiac repair and regeneration.

Also flagged:PMLPromyelocytic leukemia proteinretinoic acid receptor alphaacute promyelocytic leukemiatumorcell cycle
Journal Article 2018-01-25 ✓ 5 Snippets Hsu KS, Kao HY.
In-Text Gene Mentions

…CDK1/2 Increases inKLHL20-meidated PML ubiquitination a…

…/SCP3 Blockade of CDK1/2-Pin1-KLHL20-PML regulatory loop and…

…166 ] HypoxiaKLHL20PML degradation […

…factor HIF1α upregulatesKLHL20, an E3 subunit,…

…omotes Pin1-mediated, cullin3-KLHL20-dependent PML poly-ubiquitina…

Show Full Abstract

Promyelocytic leukemia protein (PML) was originally identified as a fusion partner of retinoic acid receptor alpha in acute promyelocytic leukemia patients with the (15;17) chromosomal translocation, giving rise to PML-RARα and RARα-PML fusion proteins. A body of evidence indicated that PML possesses tumor suppressing activity by regulating apoptosis, cell cycle, senescence and DNA damage responses. PML is enriched in discrete nuclear substructures in mammalian cells with 0.2-1 μm diameter in size, referred to as alternately Kremer bodies, nuclear domain 10, PML oncogenic domains or PML nuclear bodies (NBs). Dysregulation of PML NB formation results in altered transcriptional regulation, protein modification, apoptosis and cellular senescence. In addition to PML NBs, PML is also present in nucleoplasm and cytoplasmic compartments, including the endoplasmic reticulum and mitochondria-associated membranes. The role of PML in tumor suppression has been extensively studied but increasing evidence indicates that PML also plays versatile roles in stem cell renewal, metabolism, inflammatory responses, neural function, mammary development and angiogenesis. In this review, we will briefly describe the known PML regulation and function and include new findings.

Also flagged:HuntingtinRatHuntington DiseaseNickelformalinPrepulse inhibition
Journal Article 2018-01-25 ✓ 5 Snippets Plank AC, Canneva F, Raber KA, Urbach YK, Dobner J, Puchades M, Bjaalie JG, Gillmann C, Bäuerle T, Riess O, Nguyen HHP, von Hörsten S.
In-Text Gene Mentions

The transgenic rat model of Huntington disease expressing a fragment of mutant HTT (tgHD rat) has been thoroughly characterized and reproduces hallmark symptoms of human adult-onset HD.

Huntington disease (HD) is an autosomal dominantly inherited, neurodegenerative disorder caused by the expansion of a trinucleotide repeat (>36 CAG) in exon 1 of the huntingtin gene (HTT) on chromosome 4 (The Huntington's Disease Collaborative Research Group, 1993).

The F344tgHD congenic line was derived from a colony of Sprague-Dawley transgenic HD rats expressing 727 amino acids of the HD gene with 51 CAG repeats (cDNA position 324–2321, corresponding to 22% of full length) under the control of the rat Htt promoter (von Hörsten et al., 2003).

…huntingtin gene (HTT) on chromosome…

…of the humanHTTgene under the…

Show Full Abstract

The transgenic rat model of Huntington disease expressing a fragment of mutant HTT (tgHD rat) has been thoroughly characterized and reproduces hallmark symptoms of human adult-onset HD. Pursuing the optimization of this model for evaluation of translational therapeutic approaches, the F344 inbred rat strain was considered as advantageous genetic background for the expression of the HD transgenic construct. In the present study, a novel congenic line of the SPRDtgHD transgenic model of HD, carrying 51 CAG repeats, was generated on the F344 rat genetic background. To assess the behavioral phenotype, classical assays investigating motor function, emotion, and sensorimotor gating were applied, along with automated screening of metabolic and activity parameters as well as operant conditioning tasks. The neuropathological phenotype was analyzed by immunohistochemistry and <i>ex vivo</i> magnetic resonance imaging. F344tgHD rats displayed markedly reduced anxiety-like behavior in the social interaction test and elevated impulsivity traits already at 3 months of age. Neuropathologically, reduced striatal volume and pronounced aggregation of mutant huntingtin in several brain regions were detected at later disease stage. In conclusion, the congenic F344tgHD model reproduces key aspects of the human HD phenotype, substantiating its value for translational therapeutic approaches.

Also flagged:Gene ExpressionFabry diseaselysosomal storage disorderglycosphingolipidssmall-fiber neuropathyα-galactosidase A
Journal Article 2018-01-25 No Snippets Kummer KK, Kalpachidou T, Kress M, Langeslag M.
Show Full Abstract

Fabry disease is an X-linked lysosomal storage disorder with involvement of the nervous system. Accumulation of glycosphingolipids within peripheral nerves and/or dorsal root ganglia results in pain due to small-fiber neuropathy, which affects the majority of patients already in early childhood. The α-galactosidase A deficient mouse proved to be an adequate model for Fabry disease, as it shares many symptoms including altered temperature sensitivity and pain perception. To characterize the signatures of gene expression that might underlie Fabry disease-associated sensory deficits and pain, we performed one-color based hybridization microarray expression profiling of DRG explants from adult α-galactosidase A deficient mice and age-matched wildtype controls. Protein-protein interaction (PPI) and pathway analyses were performed for differentially regulated mRNAs. We found 812 differentially expressed genes between adult α-galactosidase A deficient mice and age-matched wildtype controls, 506 of them being upregulated, and 306 being downregulated. Among the enriched pathways and processes, the disease-specific pathways "lysosome" and "ceramide metabolic process" were identified, enhancing reliability of the current analysis. Novel pathways that we identified include "G-protein coupled receptor signaling" and "retrograde transport" for the upregulated genes. From the analysis of downregulated genes, immune-related pathways, autoimmune, and infection pathways emerged. The current analysis is the first to present a differential gene expression profile of DRGs from α-galactosidase A deficient mice, thereby providing knowledge on possible mechanisms underlying neuropathic pain related symptoms in Fabry patients. Therefore, the presented data provide new insights into the development of the pain phenotype and might lead to new treatment strategies.

Also flagged:carbonyl reductase 1tumorepithelial mesenchymal transitionuterine cervical squamous cell carcinomascanceruterine cervical cancer
Journal Article 2018-01-25 No Snippets Nishimoto Y, Murakami A, Sato S, Kajimura T, Nakashima K, Yakabe K, Sueoka K, Sugino N.
Show Full Abstract

<h4>Purpose</h4>Carbonyl reductase 1 (CBR1) is involved in cancer progression. Recently, the authors reported that the loss of CBR1 expression is associated with a poor prognosis in uterine cervical cancer. Here, we investigated whether the decreased CBR1 expression promotes cancer progression by inducing the epithelial mesenchymal transition (EMT).<h4>Methods</h4>Antisense constructs of <i>CBR1</i> complementary DNA (antisense clones) and the empty vectors (control clones) were transfected into human uterine cervical squamous cell carcinoma cell lines (SKG II and SiHa) and the proliferation and EMT marker expression of these clones were analyzed in vitro. In an in vivo study, 10<sup>7</sup> cells of the antisense and control clones were subcutaneously injected into nude mice and the tumorigenesis was observed for 8 weeks.<h4>Results</h4>With the decreased CBR1 expression, the proliferation of the antisense clones increased, accompanied by a decrease in epithelial markers (E-cadherin and cytokeratin) and an increase in mesenchymal markers (fibronectin, alpha-smooth muscle actin, and N-cadherin), which suggests EMT induction. In the in vivo study, the tumor volume in the antisense group was significantly larger than that in the control group.<h4>Conclusion</h4>Decreased CBR1 expression promotes tumor growth by inducing EMT in uterine cervical squamous cell carcinomas.

Also flagged:mitochondrialbiomineralizationtriphenylphosphoniumcationmitochondria-cancer
Journal Article 2018-01-25 No Snippets Kim S, Palanikumar L, Choi H, Jeena MT, Kim C, Ryu JH.
Show Full Abstract

The use of biomineralization that regulates cellular functions has emerged as a potential therapeutic tool. However, the lack of selectivity still limits its therapeutic efficacy. Here, we report a subcellular-targeting biomineralization system featuring a triphenylphosphonium cation (TPP) (the mitochondria-targeting moiety) and trialkoxysilane (the biomineralization moiety <i>via</i> silicification). The TPP-containing trialkoxysilane exhibited approximately seven times greater cellular uptake into cancer cells (SCC7) than into normal cells (HEK293T) due to the more negative mitochondrial membrane potentials of the cancer cells. In turn, its accumulation inside mitochondria (pH 8) induces specific silicification, leading to the formation of silica particles in the mitochondrial matrix and further activation of apoptosis. <i>In vivo</i> assessment confirmed that the biomineralization system efficiently inhibits tumor growth in a mouse xenograft cancer model. Exploiting both the subcellular specificity and the targeting strategy provides new insight into the use of intracellular biomineralization for targeted cancer therapy.

Also flagged:response to oxidative stressgene expressionPhen-DC3luciferasedeoxyguanosineoxygen
Journal Article 2018-01-24 ✓ 1 Snippet Fleming AM, Zhu J, Ding Y, Visser JA, Zhu J, Burrows CJ.
In-Text Gene Mentions

TAOK3

Show Full Abstract

The cellular response to oxidative stress includes transcriptional changes, particularly for genes involved in DNA repair. Recently, our laboratory demonstrated that oxidation of 2'-deoxyguanosine (G) to 8-oxo-7,8-dihydro-2'-deoxyguanosine (OG) in G-rich potential G-quadruplex sequences (PQSs) in gene promoters impacts the level of gene expression up or down depending on the position of the PQS in the promoter. In the present report, bioinformatic analysis found that the 390 human DNA repair genes in the genome ontology initiative harbor 2936 PQSs in their promoters and 5'-untranslated regions (5'-UTRs). The average density of PQSs in human DNA repair genes was found to be nearly 2-fold greater than the average density of PQSs in all coding and noncoding human genes (7.5 vs 4.3 per gene). The distribution of the PQSs in the DNA repair genes on the nontranscribed (coding) vs transcribed strands reflects that of PQSs in all human genes. Next, literature data were interrogated to select 30 PQSs to catalog their ability to adopt G-quadruplex (G4) folds in vitro using five different experimental tests. The G4 characterization experiments concluded that 26 of the 30 sequences could adopt G4 topologies in solution. Last, four PQSs were synthesized into the promoter of a luciferase plasmid and cotransfected with the G4-specific ligands pyridostatin, Phen-DC3, or BRACO-19 in human cells to determine whether the PQSs could adopt G4 folds. The cell studies identified changes in luciferase expression when the G4 ligands were present, and the magnitude of the expression changes dependent on the PQS and the coding vs template strand on which the sequence resided. Our studies demonstrate PQSs exist at a high density in human DNA repair gene promoters and a subset of the identified sequences may fold in vitro and in vivo.

Also flagged:cytokineTNF-αmethylationHuRTRBPhypomethylation
Journal Article 2018-01-24 ✓ 1 Snippet Wang Q, Roy B, Turecki G, Shelton RC, Dwivedi Y.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objective</h4>Proinflammatory cytokines have recently received considerable attention for their role in suicidal behavior; however, how the expression of cytokine genes is regulated is not clearly known. The authors examined underlying mechanisms of critical cytokine gene tumor necrosis factor-alpha (TNF-α) dysregulation in the brains of individuals who died by suicide.<h4>Method</h4>TNF-α expression was examined in the dorsolateral prefrontal cortex of the postmortem brains of persons with and without major depressive disorder who died by suicide and of persons with major depressive disorder who died of causes other than suicide. The role of putative microRNAs targeting TNF-α and RNA-binding protein Hu antigen R (HuR) was tested with in vitro and in vivo approaches and by examining expression of transactivation response RNA binding protein (TRBP). Genetic influence on TNF-α expression was determined by expression quantitative trait loci analysis and by genotyping three single-nucleotide polymorphisms in the promoter region of the TNF-α gene. Promoter methylation of TNF-α was determined by using methylated DNA immunoprecipitation assay. Expression of miR-19a-3p and TNF-α was also determined in the peripheral blood mononuclear cells of 12 healthy control subjects and 12 currently depressed patients with severe suicidal ideation.<h4>Results</h4>TNF-α expression was significantly higher in the dorsolateral prefrontal cortex of individuals who died by suicide, regardless of psychiatric diagnosis. Its expression level was also increased in individuals with major depressive disorder who died by causes other than suicide. On the other hand, expression of miR-19a-3p was upregulated specifically in individuals who died by suicide. In a preliminary observation, similar upregulation of TNF-α and miR-19a-3p was observed in the peripheral blood mononuclear cells of depressed patients with suicidal ideation. Despite its ability to directly target TNF-α in vitro, miR-19a-3p showed no interaction with TNF-α in the dorsolateral prefrontal cortex. HuR potentially stabilized TNF-α transcript, presumably by sequestering its 3' untranslated region from miR-19a-3p-mediated inhibition. Furthermore, decreased TRBP expression supported abnormality in the interaction between miR-19a-3p and TNF-α. Additionally, TNF-α transcriptional upregulation was associated with promoter hypomethylation, whereas no genetic influence on altered TNF-α or miR-19a-3p expression was observed in individuals who died by suicide.<h4>Conclusions</h4>The data in this study provide mechanistic insights into the dysregulation of the TNF-α gene in the brains of individuals who died by suicide, which could potentially be involved in suicidal behavior.

Also flagged:methylationinterstitial cystitisbladder pain syndromeICcytosine guanine dinucleotidemitogen-activated protein kinase
Journal Article 2018-01-24 No Snippets Bradley MS, Burke EE, Grenier C, Amundsen CL, Murphy SK, Siddiqui NY.
Show Full Abstract

<h4>Aims</h4>To assess the feasibility of using voided urine samples to perform a DNA methylation study in females with interstitial cystitis/bladder pain syndrome (IC/BPS) as compared to age- and race-matched controls. A unique methylation profile could lead to a non-invasive, reproducible, and objective biomarker that would aid clinicians in the diagnosis of IC/BPS.<h4>Methods</h4>Nineteen IC/BPS patients and 17 controls were included. IC/BPS patients had an Interstitial Cystitis Symptom Index score of >8; controls had no bladder symptoms. DNA was extracted from pelleted urine sediment. Samples with >500 ng of genomic DNA underwent quantitative DNA methylation assessment using the Illumina Infinium MethylationEPIC BeadChip. Age- and race-matching was applied prior to analysis. Linear regression models were used to compare average methylation between IC/BPS cases and controls at each cytosine guanine dinucleotide site (loci where methylation can occur).<h4>Results</h4>Sixteen participants (eight IC/BPS age- and race-matched to eight controls) had adequate DNA for methylation analysis. The median age was 43.5 years (interquartile range 33.8, 65.0), the median BMI was 27.1 (IQR 22.7, 31.4), and 14 were Caucasian (87.5%). A total of 688 417 CpG sites were analyzed. In exploratory pathway analysis utilizing the top 1000 differentially methylated CpG sites, the mitogen-activated protein kinase (MAPK) pathway was overrepresented by member genes.<h4>Conclusions</h4>The results demonstrate the feasibility of using voided urine specimens from women with IC/BPS to perform DNA methylation assessments. Additionally, the data suggest genes within or downstream of the MAPK pathway exhibit altered methylation in IC/BPS.

Also flagged:PROZhemostasiscoagulationabortionfactor Vfactor II
Journal Article 2018-01-24 ✓ 5 Snippets Xu Z, Zhang Y, Liu W, Liu Y, Su Y, Xing Q, He X, Wei Z, Cao Y, Xiang H.
In-Text Gene Mentions

…II (F2), antithrombin (SERPINC1), protein C (PROC),…

…such as antithrombin (SERPINC1), protein C (PROC),…

…of F5, F2,SERPINC1, PROC, PROS1, PROZ,…

…and rs941988) inSERPINC1; 3 tag SNPs…

…and rs941988 ofSERPINC1in the control…

Show Full Abstract

Mutations of hemostasis/coagulation-related genes have been speculated to cause recurrent spontaneous abortion (RSA). This study investigated the genetic association between the polymorphisms of factor V (F5), factor II (F2), antithrombin (SERPINC1), protein C (PROC), protein S (PROS1), protein Z (PROZ), factor XIII (F13A1), and carboxypeptidase B2 (CPB2) genes and RSA. The 426 patients with RSA and 444 controls were recruited in this study, and single-nucleotide polymorphisms (SNPs) were analyzed by using SNPscan technology. Genotype and allele frequencies of rs3136520 in F2, rs3024731 in PROZ, and rs1050782 in F13A1 showed statistically significant differences between the 2 groups. TT genotype of rs3136520 ( P = .031, odds ratio [OR] = 0.986, 95% confidence interval [CI] = 0.976-0.997) and AA genotype of rs2069906 in PROC ( P = .021, OR = 0.114, 95% CI = 0.014-0.902) in their recessive models and AG + GG variants of rs1050782 ( P = .007, OR = 0.681, 95% CI = 0.516-0.899) in the dominant model might be associated with the reduced risk of RSA. AT + TT variants of rs3024731 ( P = .010, OR = 1.479, 95% CI = 1.098-1.994) may increase disease susceptibility in dominant model. Haplotype analysis of rs3024731 and rs3024735 in PROZ displayed that the AA and TG haplotype were inclined to decrease and increase the risk of RSA, respectively. These results suggested that rs3136520, rs2069906, rs3024731, and rs1050782 may have a significant association with the genetic susceptibility of RSA in Chinese Han women.

Also flagged:major depressive disordernucleusDRNNucleiserotonin 1A5-HT 1A ) autoreceptor
Journal Article 2018-01-24 ✓ 1 Snippet Pillai RLI, Zhang M, Yang J, Boldrini M, Mann JJ, Oquendo MA, Parsey RV, DeLorenzo C.
In-Text Gene Mentions

5-HTT

Show Full Abstract

<h4>Background</h4>Positron emission tomography (PET) studies in major depressive disorder (MDD) have reported higher serotonin 1A (5-HT<sub>1A</sub> ) autoreceptor binding in the raphe. In males, the difference is so large that it can potentially be used as the first biological marker for MDD. However, the raphe includes several nuclei, which project to different regions of the brain and spinal cord and may be differentially involved in disease. We aimed to identify 5-HT<sub>1A</sub> differences in individual raphe nuclei using PET in order to determine whether use of subnuclei would provide greater sensitivity and specificity of diagnosing MDD.<h4>Methods</h4>We identified individual nuclei using a hybrid set-level technique on an average [<sup>11</sup> C]-WAY100635 PET image derived from 52 healthy volunteers (HV). We delineated three nuclei: dorsal raphe nucleus (DRN), median raphe nucleus (MRN), and raphe magnus (RMg). An atlas image of these nuclei was created and nonlinearly warped to each subject (through an associated MRI) in a separate sample of 41 males (25 HV, 16 MDD) who underwent [<sup>11</sup> C]-WAY100635 PET.<h4>Results</h4>5-HT<sub>1A</sub> binding was elevated in DRN in MDD (P < .01), and was not different in the RMg and MRN between groups. Receiver operating characteristic (ROC) curves showed that combining DRN and MRN produces highest sensitivity (94%) and specificity (84%) to identify MDD.<h4>Conclusion</h4>In agreement with postmortem studies, we found higher 5-HT<sub>1A</sub> autoreceptor binding in MDD selectively in the DRN. 5-HT<sub>1A</sub> autoreceptor binding in the combined DRN and MRN is a better biomarker for MDD than in the raphe as a whole.

Also flagged:Neurofilament light proteinHuntington diseaseHDbrain atrophyatrophyNeurofilament light
Journal Article 2018-01-24 No Snippets Johnson EB, Byrne LM, Gregory S, Gregory S, Rodrigues FB, Blennow K, Durr A, Leavitt BR, Roos RA, Zetterberg H, Tabrizi SJ, Scahill RI, Wild EJ, TRACK-HD Study Group.
Show Full Abstract

<h4>Objective</h4>Neurofilament light (NfL) protein in blood plasma has been proposed as a prognostic biomarker of neurodegeneration in a number of conditions, including Huntington disease (HD). This study investigates the regional distribution of NfL-associated neural pathology in HD gene expansion carriers.<h4>Methods</h4>We examined associations between NfL measured in plasma and regionally specific atrophy in cross-sectional (n = 198) and longitudinal (n = 177) data in HD gene expansion carriers from the international multisite TRACK-HD study. Using voxel-based morphometry, we measured associations between baseline NfL levels and both baseline gray matter and white matter volume; and longitudinal change in gray matter and white matter over the subsequent 3 years in HD gene expansion carriers.<h4>Results</h4>After controlling for demographics, associations between increased NfL levels and reduced brain volume were seen in cortical and subcortical gray matter and within the white matter. After also controlling for known predictors of disease progression (age and CAG repeat length), associations were limited to the caudate and putamen. Longitudinally, NfL predicted subsequent occipital gray matter atrophy and widespread white matter reduction, both before and after correction for other predictors of disease progression.<h4>Conclusions</h4>These findings highlight the value of NfL as a dynamic marker of brain atrophy and, more generally, provide further evidence of the strong association between plasma NfL level, a candidate blood biomarker, and pathologic neuronal change.

Also flagged:Non-alcoholic fatty liver diseaseNAFLDinflammatory bowel diseaseliver enzymessteatosisenzymes
Journal Article 2018-01-24 ✓ 1 Snippet Sartini A, Gitto S, Bianchini M, Verga MC, Di Girolamo M, Bertani A, Del Buono M, Schepis F, Lei B, De Maria N, Villa E.
In-Text Gene Mentions

…Wilson’s disease orhemochromatosis, according to European…

Show Full Abstract

Non-alcoholic fatty liver disease (NAFLD) can be detected in up to 33.6% of inflammatory bowel disease (IBD) patients, often in absence of metabolic risk factors. Nevertheless, most of previous studies on such issue were conducted within the IBD population only. The primary aim of this study was to compare clinical and metabolic features of NAFLD in patients with and without IBD (w/o IBD) and to identify specific NAFLD phenotypes within the IBD population. Among 223 NAFLD patients, 78 patients with IBD were younger compared to 145 without (w/o) IBD, were less likely to have altered liver enzymes, had lower mean body weight, smaller waist circumference and lower body mass index (BMI); at the same time, MetS was more prevalent among patients w/o IBD (56.6 vs. 23.1%, p < 0.001). Within IBD population, patients with severe IBD showed more often severe steatosis (S3) at ultrasound (US) (32.1 vs. 16.6%, p = 0.01), compared to mild-to-moderate disease. Independent risk factors for S3 US steatosis in IBD patients at the multivariate logistic regression analysis were: more than 1 IBD relapse per year during disease history (OR 17.3, 95% CI 3.6-84), surgery for IBD (OR 15.1, 95% CI 3.1-73.7) and more extensive intestinal involvement (OR 19.4, 95% CI 3.4-110.9); the ongoing anti-Tumor Necrosis Factor alpha (antiTNFα) therapy was the only independent factor which protect toward the presence of altered liver enzymes (OR 0.15, 95% CI 0-0.8, p = 0.02). In conclusion, NAFLD in IBD patients is different from that in patients w/o IBD, who seem to develop different NAFLD phenotypes according to intestinal disease clinical course. More severe IBD seem to predict the presence of more severe steatosis. Therapy with antiTNFα antibodies could prevent alteration of liver enzymes in such population.

Also flagged:dementiaADIL1βIL10STAT
Journal Article 2018-01-24 No Snippets Boza-Serrano A, Yang Y, Paulus A, Deierborg T.
Show Full Abstract

Alzheimer's disease (AD) is the most common form of dementia characterized by the formation of amyloid plaques (Aβ). Over the last decade, the important role of the innate immune system for the disease development has been established. Chronic activation of microglial cells creates a proinflammatory environment, which is believed to be central for the development of the disease as well as its progression. We used the AD mouse model 5xFAD to investigate if inflammatory alterations are present in microglial cells before plaque deposition. We applied mass spectrometry and bioinformation analysis to elucidate early microglial alterations. Interestingly, we found the cytokines IL1β and IL10 to be elevated in the 5xFAD brain after the formation of Aβ plaque at 10 weeks only. Using mass spectrometry analysis of microglial cells with bioinformation analysis, we found JAK/STAT, p38 MAPK and Interleukin pathways affected in microglial cells before plaque deposition at 6 weeks. At 10 weeks, GO analysis showed affected pathways related to interferon-gamma regulation and MAPK pathways. Our study points toward early inflammatory changes in microglial cells even before the accumulation of Aβ.

Also flagged:voltage sensitive fluorescent proteincalciumNMDA receptorspotassiumSeizureslocalization
Journal Article 2018-01-24 No Snippets Chiang CC, Wei X, Ananthakrishnan AK, Shivacharan RS, Gonzalez-Reyes LE, Zhang M, Durand DM.
Show Full Abstract

Fast and slow neural waves have been observed to propagate in the human brain during seizures. Yet the nature of these waves is difficult to study in a surgical setting. Here, we report an observation of two different traveling waves propagating in the in-vitro epileptic hippocampus at speeds similar to those in the human brain. A fast traveling spike and a slow moving wave were recorded simultaneously with a genetically encoded voltage sensitive fluorescent protein (VSFP Butterfly 1.2) and a high speed camera. The results of this study indicate that the fast traveling spike is NMDA-sensitive but the slow moving wave is not. Image analysis and model simulation demonstrate that the slow moving wave is moving slowly, generating the fast traveling spike and is, therefore, a moving source of the epileptiform activity. This slow moving wave is associated with a propagating neural calcium wave detected with calcium dye (OGB-1) but is independent of NMDA receptors, not related to ATP release, and much faster than those previously recorded potassium waves. Computer modeling suggests that the slow moving wave can propagate by the ephaptic effect like epileptiform activity. These findings provide an alternative explanation for slow propagation seizure wavefronts associated with fast propagating spikes.

Also flagged:Ischemic Strokestrokeacute cerebrovascular syndromestrokescoagulationatrial fibrillation
Journal Article 2018-01-24 No Snippets Penn AM, Saly V, Trivedi A, Lesperance ML, Votova K, Jackson AM, Croteau NS, Balshaw RF, Bibok MB, Smith DS, Lam KK, Morrison J, Lu L, Coutts SB, Borchers CH.
Show Full Abstract

A diagnostic blood test for stroke is desirable but will likely require multiple proteins rather than a single "troponin." Validating large protein panels requires large patient numbers. Mass spectrometry (MS) is a cost-effective tool for this task. We compared differences in the abundance of 147 protein markers to distinguish 20 acute cerebrovascular syndrome (ACVS) patients who presented to the Emergency Department of one urban hospital within < 24 h from onset) and from 20 control patients who were enrolled via an outpatient neurology clinic. We targeted proteins from the stroke literature plus cardiovascular markers previously studied in our lab. One hundred forty-one proteins were quantified using MS, 8 were quantified using antibody protein enrichment with MS, and 32 were measured using ELISA, with some proteins measured by multiple techniques. Thirty proteins (4 by ELISA and 26 by the MS techniques) were differentially abundant between mimic and stroke after adjusting for age in robust regression analyses (FDR < 0.20). A logistic regression model using the first two principal components of the proteins significantly improved discrimination between strokes and controls compared to a model based on age alone (p < 0.001, cross-validated AUC 0.93 vs. 0.78). Significant proteins included markers of inflammation (47%), coagulation (40%), atrial fibrillation (7%), neurovascular unit injury (3%), and other (3%). These results suggest the potential value of plasma proteins as biomarkers for ACVS diagnosis and the role of plasma-based MS in this area.

Also flagged:IDHlowgliomatemozolomidetumorsisocitrate dehydrogenase 1
Journal Article 2018-01-24 No Snippets Bady P, Kurscheid S, Delorenzi M, Gorlia T, van den Bent MJ, Hoang-Xuan K, Vauléon É, Gijtenbeek A, Enting R, Thiessen B, Chinot O, Dhermain F, Brandes AA, Reijneveld JC, Marosi C, Taphoorn MJB, Wick W, von Deimling A, French P, Stupp R, Baumert BG, Hegi ME.
Show Full Abstract

The optimal treatment for patients with low-grade glioma (LGG) WHO grade II remains controversial. Overall survival ranges from 2 to over 15 years depending on molecular and clinical factors. Hence, risk-adjusted treatments are required for optimizing outcome and quality of life. We aim at identifying mechanisms and associated molecular markers predictive for benefit from radiotherapy (RT) or temozolomide (TMZ) in LGG patients treated in the randomized phase III trial EORTC 22033. As candidate biomarkers for these genotoxic treatments, we considered the DNA methylome of 410 DNA damage response (DDR) genes. We first identified 62 functionally relevant CpG sites located in the promoters of 24 DDR genes, using the LGG data from The Cancer Genome Atlas. Then we tested their association with outcome [progression-free survival (PFS)] depending on treatment in 120 LGG patients of EORTC 22033, whose tumors were mutant for isocitrate dehydrogenase 1 or 2 (IDHmt), the molecular hallmark of LGG. The results suggested that seven CpGs of four DDR genes may be predictive for longer PFS in one of the treatment arms that comprised MGMT, MLH3, RAD21, and SMC4. Most interestingly, the two CpGs identified for MGMT are the same, previously selected for the MGMT-STP27 score that is used to determine the methylation status of the MGMT gene. This score was higher in the LGG with 1p/19q codeletion, in this and other independent LGG datasets. It was predictive for PFS in the TMZ, but not in the RT arm of EORTC 22033. The results support the hypothesis that a high score predicts benefit from TMZ treatment for patients with IDHmt LGG, regardless of the 1p/19q status. This MGMT methylation score may identify patients who benefit from first-line treatment with TMZ, to defer RT for long-term preservation of cognitive function and quality of life.

Also flagged:gene expressioninfectionJUNBIL1APPRV infectionEIF2AK3
Journal Article 2018-01-24 No Snippets Yang B, Qi X, Chen Z, Chen S, Xue Q, Jia P, Wang T, Wang J.
Show Full Abstract

Peste des petits ruminants virus (PPRV), the etiological agent of peste des petits ruminants (PPR), causes an acute or subacute disease in small ruminants. Although abortion is observed in an unusually large proportion of pregnant goats during outbreaks of PPR, the pathogenic mechanism underlying remains unclear. Here, the gene expression profile of caprine endometrial epithelial cells (EECs) infected with PPRV Nigeria 75/1 was determined by DNA microarray to investigate the cellular response immediately after viral entry. The microarray analysis revealed that a total of 146 genes were significantly dysregulated by PPRV internalization within 1 h post-infection (hpi). Of these, 85 genes were upregulated and 61 genes were downregulated. Most of these genes, including NFKB1A, JUNB, and IL1A, have not previously been reported in association with PPRV infection in goats. Following viral replication (24 hpi), the expression of 307 genes were significantly upregulated and that of 261 genes were downregulated. The data for the genes differentially expressed in EECs were subjected to a time sequence profile analysis, gene network analysis and pathway analysis. The gene network analysis showed that 13 genes (EIF2AK3, IL10, TLR4, ZO3, NFKBIB, RAC1, HSP90AA1, SMAD7, ARG2, JUNB, ZFP36, APP, and IL1A) were located in the core of the network. We clearly demonstrate that PPRV infection upregulates the expression of nectin-4 after 1 hpi, which peaked at 24 hpi in EECs. In conclusion, this study demonstrates the early cellular gene expression in the caprine endometrial epithelial cells after the binding and entry of PPRV.

Also flagged:SleepbehavioralClockExtracellularnucleusProk2
Journal Article 2018-01-24 ✓ 1 Snippet Blum ID, Bell B, Wu MN.
In-Text Gene Mentions

Fbxl4

Show Full Abstract

Sleep is an evolutionarily conserved behavior that is increasingly recognized as important for human health. While its precise function remains controversial, sleep has been suggested to play a key role in a variety of biological phenomena ranging from synaptic plasticity to metabolic clearance. Although it is clear that sleep is regulated by the circadian clock, how this occurs remains enigmatic. Here we examine the genetic mechanisms by which the circadian clock regulates sleep, drawing on recent work in fruit flies, zebrafish, mice, and humans. These studies reveal that central and local clocks utilize diverse mechanisms to regulate different aspects of sleep, and a better understanding of this multilayered regulation may lead to a better understanding of the functions of sleep.

Also flagged:synthesishydroxyapatitesodium alginateAdsorptionalginatecalcium phosphate
Journal Article 2018-01-24 No Snippets Manatunga DC, de Silva RM, Nalin de Silva KM, de Silva N, Premalal EVA.
Show Full Abstract

This study was focused on the preparation of metal and polymer-mediated porous crystalline hydroxyapatite (HAp) nanocomposites for environmental applications. Four different nano HAp systems were synthesized, namely, microwave irradiated HAp (M1), Zn doped HAp (M2), Mg-doped HAp (M3) and sodium alginate incorporated HAp (M4), and characterized using X-ray diffraction (XRD), Fourier transform infra-red spectroscopy, scanning electron microscopy, transmission electron microscopy, atomic force microscopy, nuclear magnetic resonance (NMR), X-ray fluorescence, thermogravimetric analysis and Brunauer-Emmett-Teller (BET) analyses. Systems M1-M4 showed morphologies similar to coral shapes, polymer-like interconnected structures, sponges and feathery mycelium assemblies. Using XRD, selected area electron diffraction patterns and <sup>1</sup>H and <sup>31</sup>P CP/MAS solid-state NMR studies, crystallinity variation was observed from highest to lowest in the order of M4 > M1 > M3 > M2. Surface area estimates using BET isotherm reflected the highest surface area for M3, and M1 > M2 > M4. Four systems of M1-M4 were used as potential adsorbent materials for the removal of metal containing azo dye from aqueous system. Adsorption data were correlated to Freundlich and Langmuir isotherm models. According to the results, the highest capacity of 212.8 mg g<sup>-1</sup> was exhibited by M4 having mycelium like morphology with alginate groups. This study highlights the possibility of developing HAp nanocomposites for the effective removal of dye contaminants in the environment.

Also flagged:colorectal cancerWntMAPKSTATgene expressionCDK1
Journal Article 2018-01-24 No Snippets Asghari M, Abazari MF, Bokharaei H, Aleagha MN, Poortahmasebi V, Askari H, Torabinejad S, Ardalan A, Negaresh N, Ataei A, Pazooki P, Poorebrahim M.
Show Full Abstract

<h4>Aim</h4>Until now, identification of drug targets for treatment of patients with specific stages of colorectal cancer (CRC) has remained a challenging field of research. Herein, we aimed to identify the key genes and regulatory networks involved in each stage of CRC.<h4>Results</h4>The results of gene expression profiles were integrated with protein-protein interaction networks, and topologically analyzed. The most important regulatory genes (e.g., <i>CDK1</i>, <i>UBC</i>, <i>ESR1</i> and <i>ATXN1</i>) and signaling pathways (e.g., Wnt, MAPK and JAK-STAT) in CRC initiation, progression and metastasis were identified. <i>In vitro</i> analysis confirmed some <i>in silico</i> findings.<h4>Conclusion</h4>Our study introduces functional hub genes, subnetworks, prioritizes signaling pathways and novel biomarkers in CRC that may guide further development of targeted therapy programs.

Also flagged:Neonatal mitochondrial leukoencephalopathylactateISCA2iron-sulfur cluster assembly 2mitochondrial disordernystagmus
Journal Article 2018-01-23 No Snippets Toldo I, Nosadini M, Boscardin C, Talenti G, Manara R, Lamantea E, Legati A, Ghezzi D, Perilongo G, Sartori S.
Show Full Abstract

A homoallelic missense founder mutation of the iron-sulfur cluster assembly 2 (ISCA2) gene has been recently reported in six cases affected by an autosomal recessive infantile neurodegenerative mitochondrial disorder. We documented a case of a 2-month-old girl presenting with severe hypotonia and nystagmus, who rapidly deteriorated and died at the age of three months. Increased cerebral spinal fluid level of lactate, documented also at the brain spectroscopy, involvement of the cortex, restricted diffusion of white and gray matter abnormalities, sparing of the corpus callosum and extensive involvement of the spinal cord were observed. Her clinical presenting features and course as well as some neuroradiological findings mimicked those of early-onset leukoencephalopathy with brainstem and spinal cord involvement and high brain lactate (LBSL). The analysis of the mitochondrial respiratory chain function showed a reduced activity of complexes II and IV. The girl harboured two heterozygous mutations in the ISCA2 gene. A comprehensive review of the literature and a comparison with the cases of early onset LBSL enabled us to highlight significant differences in the clinical, biochemical and neuroradiological phenotype between the two conditions, which also emerged from the comparison with the other 6 reported cases of ISCA2 gene mutation previously reported. In summary, this represents the second report ever published associating ISCA2 gene mutation with a mitochondrial leukoencephalopathy, with a different genetic mechanism to the previous cases. Molecular analysis of ISCA2 should be included in the genetic panel for the diagnosis of early onset mitochondrial leukoencephalopathies.

Also flagged:deathcolon cancercell growthcancertumourresponse to oxidative stress
Journal Article 2018-01-23 ✓ 4 Snippets Gomes SE, Pereira DM, Roma-Rodrigues C, Fernandes AR, Borralho PM, Rodrigues CMP.
In-Text Gene Mentions

…n-2 (PRDX2), peroxiredoxin-6 (PRDX6), heat shock protein…

…including SOD1, PRDX2,PRDX6, ANXA1, underexpressed in…

…SOD1, PRDX2 andPRDX6belong to the…

…SOD1, PRDX2 andPRDX6in these cells…

Show Full Abstract

MicroRNAs (miRNAs) regulate a wide variety of biological processes, including tumourigenesis. Altered miRNA expression is associated with deregulation of signalling pathways, which in turn cause abnormal cell growth and de-differentiation, contributing to cancer. miR-143 and miR-145 are anti-tumourigenic and influence the sensitivity of tumour cells to chemotherapy and targeted therapy. Comparative proteomic analysis was performed in HCT116 human colon cancer cells stably transduced with miR-143 or miR-145. Immunoblotting analysis validated the proteomic data in stable and transient miRNA overexpression conditions in human colon cancer cells. We show that approximately 100 proteins are differentially expressed in HCT116 human colon cancer cells stably transduced with miR-143 or miR-145 compared to Empty control cells. Further, Gene Ontology and pathway enrichment analysis indicated that proteins involved in specific cell signalling pathways such as cell death, response to oxidative stress, and protein folding might be modulated by these miRNAs. In particular, antioxidant enzyme superoxide dismutase 1 (SOD1) was downregulated by stable expression of either miR-143 or miR-145. Further, SOD1 gain-of-function experiments rescued cells from miR-143-induced oxidative stress. Moreover, miR-143 overexpression increased oxaliplatin-induced apoptosis associated with reactive oxygen species generation, which was abrogated by genetic and pharmacological inhibition of oxidative stress. Overall, miR-143 might circumvent resistance of colon cancer cells to oxaliplatin via increased oxidative stress in HCT116 human colon cancer cells.

Also flagged:ubiquitinneurodegenerative diseasesinclusion bodiesproteasomeschaperonesconjugation
Journal Article 2018-01-23 ✓ 5 Snippets Juenemann K, Jansen AHP, van Riel L, Merkx R, Mulder MPC, An H, Statsyuk A, Kirstein J, Ovaa H, Reits EA.
In-Text Gene Mentions

…expansion in theHttgene, leading to…

…the synthesis ofHttwith an extended…

…mutant variant ofHtt-exon1-97Q with an H4-…

Htt-exon1-97Q-H4 was cloned into…

…were screened forHttexpression by western…

Show Full Abstract

Many neurodegenerative diseases, such as Huntington's disease, are hallmarked by the formation of intracellular inclusion bodies (IBs) that are decorated with ubiquitin, proteasomes and chaperones. The apparent enrichment of ubiquitin and components involved in protein quality control at IBs suggests local ubiquitin-dependent enzymatic activity. In this study, we examine recruitment of ubiquitin to IBs of polyglutamine-expanded huntingtin fragments (mHtt) by using synthesized TAMRA-labeled ubiquitin moieties. We show that intracellular TAMRA-ubiquitin is dynamic at mHtt IBs and is incorporated into poly-ubiquitin chains of intracellular substrates, such as mHtt, in a conjugation-dependent manner. Furthermore, we report that mHtt IBs recruit catalytically active enzymes involved in (de)-ubiquitination processes based on novel activity-based probes. However, we also find that the overexpression of the GFP-ubiquitin reporter, unlike the endogenous ubiquitin and TAMRA-ubiquitin, becomes irreversibly sequestered as a ring-like structure around the mHtt IBs, suggesting a methodical disadvantage of GFP-tagged ubiquitin. Our data provide supportive evidence for dynamic recruitment of ubiquitin and ubiquitin (de)-conjugating activity at mHtt initiated IBs.

Also flagged:deathmitochondrialferroptosislysosomeautophagyprogrammed cell death
Journal Article 2018-01-23 No Snippets Galluzzi L, Vitale I, Aaronson SA, Abrams JM, Adam D, Agostinis P, Alnemri ES, Altucci L, Amelio I, Andrews DW, Annicchiarico-Petruzzelli M, Antonov AV, Arama E, Baehrecke EH, Barlev NA, Bazan NG, Bernassola F, Bertrand MJM, Bianchi K, Blagosklonny MV, Blomgren K, Borner C, Boya P, Brenner C, Campanella M, Candi E, Carmona-Gutierrez D, Cecconi F, Chan FK, Chandel NS, Cheng EH, Chipuk JE, Cidlowski JA, Ciechanover A, Cohen GM, Conrad M, Cubillos-Ruiz JR, Czabotar PE, D'Angiolella V, Dawson TM, Dawson VL, De Laurenzi V, De Maria R, Debatin KM, DeBerardinis RJ, Deshmukh M, Di Daniele N, Di Virgilio F, Dixit VM, Dixon SJ, Duckett CS, Dynlacht BD, El-Deiry WS, Elrod JW, Fimia GM, Fulda S, García-Sáez AJ, Garg AD, Garrido C, Gavathiotis E, Golstein P, Gottlieb E, Green DR, Greene LA, Gronemeyer H, Gross A, Hajnoczky G, Hardwick JM, Harris IS, Hengartner MO, Hetz C, Ichijo H, Jäättelä M, Joseph B, Jost PJ, Juin PP, Kaiser WJ, Karin M, Kaufmann T, Kepp O, Kimchi A, Kitsis RN, Klionsky DJ, Knight RA, Kumar S, Lee SW, Lemasters JJ, Levine B, Linkermann A, Lipton SA, Lockshin RA, López-Otín C, Lowe SW, Luedde T, Lugli E, MacFarlane M, Madeo F, Malewicz M, Malorni W, Manic G, Marine JC, Martin SJ, Martinou JC, Medema JP, Mehlen P, Meier P, Melino S, Miao EA, Molkentin JD, Moll UM, Muñoz-Pinedo C, Nagata S, Nuñez G, Oberst A, Oren M, Overholtzer M, Pagano M, Panaretakis T, Pasparakis M, Penninger JM, Pereira DM, Pervaiz S, Peter ME, Piacentini M, Pinton P, Prehn JHM, Puthalakath H, Rabinovich GA, Rehm M, Rizzuto R, Rodrigues CMP, Rubinsztein DC, Rudel T, Ryan KM, Sayan E, Scorrano L, Shao F, Shi Y, Silke J, Simon HU, Sistigu A, Stockwell BR, Strasser A, Szabadkai G, Tait SWG, Tang D, Tavernarakis N, Thorburn A, Tsujimoto Y, Turk B, Vanden Berghe T, Vandenabeele P, Vander Heiden MG, Villunger A, Virgin HW, Vousden KH, Vucic D, Wagner EF, Walczak H, Wallach D, Wang Y, Wells JA, Wood W, Yuan J, Zakeri Z, Zhivotovsky B, Zitvogel L, Melino G, Kroemer G.
Show Full Abstract

Over the past decade, the Nomenclature Committee on Cell Death (NCCD) has formulated guidelines for the definition and interpretation of cell death from morphological, biochemical, and functional perspectives. Since the field continues to expand and novel mechanisms that orchestrate multiple cell death pathways are unveiled, we propose an updated classification of cell death subroutines focusing on mechanistic and essential (as opposed to correlative and dispensable) aspects of the process. As we provide molecularly oriented definitions of terms including intrinsic apoptosis, extrinsic apoptosis, mitochondrial permeability transition (MPT)-driven necrosis, necroptosis, ferroptosis, pyroptosis, parthanatos, entotic cell death, NETotic cell death, lysosome-dependent cell death, autophagy-dependent cell death, immunogenic cell death, cellular senescence, and mitotic catastrophe, we discuss the utility of neologisms that refer to highly specialized instances of these processes. The mission of the NCCD is to provide a widely accepted nomenclature on cell death in support of the continued development of the field.

Also flagged:Ephexin1axonal growth conescytoskeletoncell surfaceguidance receptorsRho guanine nucleotide exchange factor
Journal Article 2018-01-23 ✓ 1 Snippet Chang CJ, Chang MY, Chou SY, Huang CC, Chuang JY, Hsu TI, Chang HF, Wu YH, Wu CC, Morales D, Kania A, Kao TJ.
In-Text Gene Mentions

Dcc

Show Full Abstract

The precise assembly of a functional nervous system relies on the guided migration of axonal growth cones, which is made possible by signals transmitted to the cytoskeleton by cell surface-expressed guidance receptors. We investigated the function of ephexin1, a Rho guanine nucleotide exchange factor, as an essential growth-cone guidance intermediary in the context of spinal lateral motor column (LMC) motor axon trajectory selection in the limb mesenchyme. Using <i>in situ</i> mRNA detection, we first show that ephexin1 is expressed in LMC neurons of chick and mouse embryos at the time of spinal motor axon extension into the limb. Ephexin1 loss of function and gain of function using <i>in ovo</i> electroporation in chick LMC neurons, of either sex, perturbed LMC axon trajectory selection, demonstrating an essential role of ephexin1 in motor axon guidance. In addition, ephexin1 loss in mice of either sex led to LMC axon trajectory selection errors. We also show that ephexin1 knockdown attenuates the growth preference of LMC neurites against ephrins <i>in vitro</i> and Eph receptor-mediated retargeting of LMC axons <i>in vivo</i>, suggesting that ephexin1 is required in Eph-mediated LMC motor axon guidance. Finally, both ephexin1 knockdown and ectopic expression of nonphosphorylatable ephexin1 mutant attenuated the retargeting of LMC axons caused by Src overexpression, implicating ephexin1 as an Src target in Eph signal relay in this context. In summary, our findings demonstrate that ephexin1 is essential for motor axon guidance and suggest an important role in relaying ephrin:Eph signals that mediate motor axon trajectory selection.<b>SIGNIFICANCE STATEMENT</b> The proper development of functioning neural circuits requires precise nerve connections among neurons or between neurons and their muscle targets. The Eph tyrosine kinase receptors expressed in neurons are important in many contexts during neural-circuit formation, such as axon outgrowth, axon guidance, and synaptic formation, and have been suggested to be involved in neurodegenerative disorders, including amyotrophic lateral sclerosis and Alzheimer's disease. To dissect the mechanism of Eph signal relay, we studied ephexin1 gain of function and loss of function and found ephexin1 essential for the development of limb nerves toward their muscle targets, concluding that it functions as an intermediary to relay Eph signaling in this context. Our work could thus shed new light on the molecular mechanisms controlling neuromuscular connectivity during embryonic development.

Also flagged:viral hepatitisimmune responsesubiquitinproteasomeironmetabolism
Journal Article 2018-01-23 No Snippets Subramani C, Nair VP, Anang S, Mandal SD, Pareek M, Kaushik N, Srivastava A, Saha S, Shalimar, Nayak B, Ranjith-Kumar CT, Surjit M.
Show Full Abstract

Comprehensive knowledge of host-pathogen interactions is central to understand the life cycle of a pathogen and devise specific therapeutic strategies. Protein-protein interactions (PPIs) are key mediators of host-pathogen interactions. Hepatitis E virus (HEV) is a major cause of viral hepatitis in humans. Recent reports also demonstrate its extrahepatic manifestations in the brain. Toward understanding the molecular details of HEV life cycle, we screened human liver and fetal brain cDNA libraries to identify the host interaction partners of proteins encoded by genotype 1 HEV and constructed the virus-host PPI network. Analysis of the network indicated a role of HEV proteins in modulating multiple host biological processes such as stress and immune responses, the ubiquitin-proteasome system, energy and iron metabolism, and protein translation. Further investigations revealed the presence of multiple host translation regulatory factors in the viral translation/replication complex. Depletion of host translation factors such as eIF4A2, eIF3A, and RACK1 significantly reduced the viral replication, whereas eIF2AK4 depletion had no effect. These findings highlight the ingenuity of the pathogen in manipulating the host machinery to its own benefit, a clear understanding of which is essential for the identification of strategic targets and development of specific antivirals against HEV. <b>IMPORTANCE</b> Hepatitis E virus (HEV) is a pathogen that is transmitted by the fecal-oral route. Owing to the lack of an efficient laboratory model, the life cycle of the virus is poorly understood. During the course of infection, interactions between the viral and host proteins play essential roles, a clear understanding of which is essential to decode the life cycle of the virus. In this study, we identified the direct host interaction partners of all HEV proteins and generated a PPI network. Our functional analysis of the HEV-human PPI network reveals a role of HEV proteins in modulating multiple host biological processes such as stress and immune responses, the ubiquitin-proteasome system, energy and iron metabolism, and protein translation. Further investigations revealed an essential role of several host factors in HEV replication. Collectively, the results from our study provide a vast resource of PPI data from HEV and its human host and identify the molecular components of the viral translation/replication machinery.

Also flagged:HydrazonePhenolL-lactideDoxorubicintumorcancer
Journal Article 2018-01-23 No Snippets Qi P, Wu X, Liu L, Yu H, Song S.
Show Full Abstract

In this study, the structure-activity relationship of amphiphilic block copolymer micelles as nanosized drug delivery system was revealed. Firstly, a biodegradable triblock polymers PEG-DiHyd-PLA containing hydrazone bond was synthesized through the ring-opening polymerization. In this method, PEG-DiHyd-Phenol was used as the initiator and L-lactide as the monomer. Then, the polymeric micelles were formed and used as nano-drug carriers with pH sensitivity. The structure and composition of the polymer were characterized by infrared (IR), nuclear magnetic resonance (<sup>1</sup>H-NMR), and gel permeation chromatography (GPC), we characterized the self-assembling process of the triblock polymers and the pH sensitivity of the micelles by the means of transmission electron microscopy (TEM), dynamic light scattering method (DLS). Doxorubicin (DOX) acts as the model drug, and we researched the capacities of drug loading and release <i>in vitro</i> of the micelles. MTT experiments showed that the blank micelles of PEG-DiHyd-PLA were not cytotoxic to tumor cells (HepG-2, MCF-7) and normal cell (L-02 cells), but the DOX loaded ones displayed more toxicity than the ones without hydrazone, which was consistent to the further confocal laser scanning microscopy and flow cytometry study.

Also flagged:methylationsquamous cervical cancersquamous intraepithelial lesionLSILE1E2
Journal Article 2018-01-23 No Snippets Liu L, Ying C, Zhao Z, Sui L, Zhang X, Qian C, Wang Q, Chen L, Guo Q, Wu J.
Show Full Abstract

<h4>Background</h4>The dynamic methylation of human papillomavirus (HPV) 16 DNA is thought to be associated with the progression of cervical lesions. Previous studies that did not consider the physical status of HPV 16 may have incorrectly mapped HPV 16 methylomes. In order to identify reliable biomarkers for squamous cervical cancer (SCC), we comprehensively evaluated the methylation of HPV 16 depending on the integration incidence of each sample.<h4>Methods</h4>Based on the integration status of 115 HPV 16-infected patients (50 SCC, 30 high-grade squamous intraepithelial lesion [HSIL], and 35 low-grade squamous intraepithelial lesion [LSIL]) and HPV 16-infected Caski cell lines by PCR detection of integrated papillomavirus sequences, we designed a series of primers that would not be influenced by breakpoints for a high-resolution melting (HRM) PCR method to detect the genome methylation.<h4>Results</h4>A few regions with recurrent interruptions were identified in E1, E2/E4, L1, and L2 despite scattering of breakpoints throughout all eight genes of HPV 16. Frequent integration sites often occurred concomitantly with methylated CpG sites. The HRM PCR method showed 100% agreement with pyrosequencing when 3% was set as the cutoff value. A panel of CpG sites such as nt5606, nt5609, nt5615, and nt5378 can be combined in reweighing calculations to distinguish SCC from HSIL and LSIL patients which have high sensitivity and specificity (88% and 92.31%, respectively).<h4>Conclusions</h4>Our research shows that combination of CpG sites nt5606, nt5609, nt5615, and nt5378 can be used as potential diagnosis biomarkers for SCC, and the HRM PCR method is suitable for clinical methylation analysis.

Also flagged:leukodystrophymetabolismmitochondrialelectron transport chainISCA2hyperglycinemia
Journal Article 2018-01-22 ✓ 2 Snippets Alaimo JT, Besse A, Alston CL, Pang K, Appadurai V, Samanta M, Smpokou P, McFarland R, Taylor RW, Bonnen PE.
In-Text Gene Mentions

…with recessively inheritedDARS2mutations though subtle…

…in subjects withDARS2mutations, though not…

Show Full Abstract

Iron-sulfur (Fe-S) clusters are essential cofactors for proteins that participate in fundamental cellular processes including metabolism, DNA replication and repair, transcriptional regulation, and the mitochondrial electron transport chain (ETC). ISCA2 plays a role in the biogenesis of Fe-S clusters and a recent report described subjects displaying infantile-onset leukodystrophy due to bi-allelic mutation of ISCA2. We present two additional unrelated cases, and provide a more complete clinical description that includes hyperglycinemia, leukodystrophy of the brainstem with longitudinally extensive spinal cord involvement, and mtDNA deficiency. Additionally, we characterize the role of ISCA2 in mitochondrial bioenergetics and Fe-S cluster assembly using subject cells and ISCA2 cellular knockdown models. Loss of ISCA2 diminished mitochondrial membrane potential, the mitochondrial network, basal and maximal respiration, ATP production, and activity of ETC complexes II and IV. We specifically tested the impact of loss of ISCA2 on 2Fe-2S proteins versus 4Fe-4S proteins and observed deficits in the functioning of 4Fe-4S but not 2Fe-2S proteins. Together these data indicate loss of ISCA2 impaired function of 4Fe-4S proteins resulting in a fatal encephalopathy accompanied by a relatively unusual combination of features including mtDNA depletion alongside complex II deficiency and hyperglycinemia that may facilitate diagnosis of ISCA2 deficiency patients.

Also flagged:apolipoprotein EMigraineserotonincalcitonin gene-related peptidenitric oxidepathogenesis
Journal Article 2018-01-22 No Snippets Yuasa N, Nagata E, Fujii N, Ito M, Tsukamoto H, Takizawa S.
Show Full Abstract

Migraine attacks alter various molecules that might be related to the pathophysiology of migraine, such as serotonin, calcitonin gene-related peptide, and nitric oxide. The underlying pathophysiology of migraine is as yet unclear. We explored key proteins related to the pathogenesis of migraine here. Serum was collected from two patients with migraine with aura (MA) and seven patients with migraine without aura (MO) during attack-free periods and migraine attacks. Samples were analyzed using 2-dimensional gel electrophoresis. Nineteen protein spots were altered between the attack-free versus migraine attack periods. Mass spectrometric analysis was performed to identify the proteins within each of the 19 altered spots. Thirty-six proteins were significantly altered in samples collected during attack-free periods versus migraine attacks. The protein with the statistically most significant MASCOT/Mowse score (268±112) among lipoproteins was apolipoprotein (ApoE). In the MA and MO groups, ApoE protein levels were significantly higher during migraine attack than during the attack-free period (p<0.05). ApoE protein levels were also significantly increased in the MA group during the attack-free period compared to healthy controls and patients with tension type headaches (p<0.01). Migraine alters ApoE levels, especially in MA. ApoE might play an important role in the pathophysiology of migraine, and may act as a diagnostic biomarker of migraine.

Also flagged:ProfilinbindingHuntingtinpolyglutamineHuntington's diseasefibrils
Journal Article 2018-01-22 ✓ 5 Snippets Posey AE, Ruff KM, Harmon TS, Crick SL, Li A, Diamond MI, Pappu RV.
In-Text Gene Mentions

Huntingtin N-terminal fragments (Htt-NTFs) with expanded polyglutamine tracts form a range of neurotoxic aggregates that are associated with Huntington's disease.

…tingtin N-terminal fragments (Htt-NTFs) with expanded polygluta…

…that aggregation ofHtt-NTFs, irrespective of polyglu…

…cellular protein, reducesHtt-NTF aggregation and toxicity…

…proline-rich region ofHtt-NTFs.…

Show Full Abstract

Huntingtin N-terminal fragments (Htt-NTFs) with expanded polyglutamine tracts form a range of neurotoxic aggregates that are associated with Huntington's disease. Here, we show that aggregation of Htt-NTFs, irrespective of polyglutamine length, yields at least three phases (designated M, S, and F) that are delineated by sharp concentration thresholds and distinct aggregate sizes and morphologies. We found that monomers and oligomers make up the soluble M phase, ∼25-nm spheres dominate in the soluble S phase, and long, linear fibrils make up the insoluble F phase. Previous studies showed that profilin, an abundant cellular protein, reduces Htt-NTF aggregation and toxicity in cells. We confirm that profilin achieves its cellular effects through direct binding to the C-terminal proline-rich region of Htt-NTFs. We show that profilin preferentially binds to Htt-NTF M-phase species and destabilizes aggregation and phase separation by shifting the concentration boundaries for phase separation to higher values through a process known as polyphasic linkage. Our experiments, aided by coarse-grained computer simulations and theoretical analysis, suggest that preferential binding of profilin to the M-phase species of Htt-NTFs is enhanced through a combination of specific interactions between profilin and polyproline segments and auxiliary interactions between profilin and polyglutamine tracts. Polyphasic linkage may be a general strategy that cells utilize to regulate phase behavior of aggregation-prone proteins. Accordingly, detailed knowledge of phase behavior and an understanding of how ligands modulate phase boundaries may pave the way for developing new therapeutics against a variety of aggregation-prone proteins.

Also flagged:waterosteosarcomananobeadsGFPcarbonnitrogen
Journal Article 2018-01-22 No Snippets Faoro R, Bassu M, Mejia YX, Stephan T, Dudani N, Boeker C, Jakobs S, Burg TP.
Show Full Abstract

Cryogenic fluorescent light microscopy of flash-frozen cells stands out by artifact-free fixation and very little photobleaching of the fluorophores used. To attain the highest level of resolution, aberration-free immersion objectives with accurately matched immersion media are required, but both do not exist for imaging below the glass-transition temperature of water. Here, we resolve this challenge by combining a cryoimmersion medium, HFE-7200, which matches the refractive index of room-temperature water, with a technological concept in which the body of the objective and the front lens are not in thermal equilibrium. We implemented this concept by replacing the metallic front-lens mount of a standard bioimaging water immersion objective with an insulating ceramic mount heated around its perimeter. In this way, the objective metal housing can be maintained at room temperature, while creating a thermally shielded cold microenvironment around the sample and front lens. To demonstrate the range of potential applications, we show that our method can provide superior contrast in <i>Escherichia coli</i> and yeast cells expressing fluorescent proteins and resolve submicrometer structures in multicolor immunolabeled human bone osteosarcoma epithelial (U2OS) cells at [Formula: see text]C.

Also flagged:PI3KPhosphoinositide-3 kinaseclass IA PI3Ktranscription factorPax5SLP-65
Journal Article 2018-01-22 ✓ 1 Snippet Abdelrasoul H, Werner M, Setz CS, Okkenhaug K, Jumaa H.
In-Text Gene Mentions

…gene encoding SLP-65;SH2-domain containing protein of 65 kDAcontaining protein of…

Show Full Abstract

Phosphoinositide-3 kinase (PI3K) signaling is important for the survival of numerous cell types and class IA of PI3K is specifically required for the development of B cells but not for T cell development. Here, we show that class IA PI3K-mediated signals induce the expression of the transcription factor Pax5, which plays a central role in B cell commitment and differentiation by activating the expression of central B cell-specific signaling proteins such as SLP-65 and CD19. Defective class IA PI3K function leads to reduction in Pax5 expression and prevents B cell development beyond the stage expressing the precursor B cell receptor (pre-BCR). Investigating the mechanism of PI3K-induced Pax5 expression revealed that it involves a network of transcription factors including FoxO1 and Irf4 that directly binds to the Pax5 gene. Together, our results suggest that PI3K signaling links survival and differentiation of developing B cells with B cell identity and that decreased PI3K activity in pre-B cells results in reduced Pax5 expression and lineage plasticity.

Also flagged:ChlorideFluorideDcSilicateGPFDH1
Journal Article 2018-01-22 No Snippets Chen X, Chen X, Pedone A, Apperley D, Hill RG, Karpukhina N.
Show Full Abstract

Adding fluoride into bioactive glasses leads to fluorapatite formation and a decrease in glass transition temperature. Recently, chloride has been introduced into glasses as an alternative to fluoride. The presence of the large chloride ion lowers glass crystallisation tendency and increases glass molar volume, which effectively facilitates glass degradation and bone-bonding apatite-like layer formation. However, there is no information regarding the effect of mixing fluoride and chloride on the glass structure and properties. This study aims to synthesize mixed fluoride and chloride containing bioactive glasses; investigate the structural role of fluoride and chloride and their effects on glass properties. The chloride content measurements reveal that 77-90% of chloride was retained in these Q<sup>2</sup> type glasses. Glass transition temperature reduced markedly with an increase in CaX<sub>2</sub> (X = F + Cl) content, while the glass molar volume increased. <sup>29</sup>Si MAS-NMR results show that the incorporation of mixed fluoride and chloride did not cause significant change in the polymerization of the silicate network and no detectable concentration of Si-F/Cl bands were present. This agrees with <sup>19</sup>F NMR spectra showing that F existed as F-Ca(n) species.

Also flagged:diaphragmatic herniadevelopmental disorderintellectual disabilitycongenital diaphragmatic herniagene expressioncells migration
Journal Article 2018-01-22 ✓ 1 Snippet Kammoun M, Brady P, De Catte L, Deprest J, Devriendt K, Vermeesch JR.
In-Text Gene Mentions

ARFGEF2

Show Full Abstract

Nance-Horan syndrome is a rare X-linked developmental disorder characterized by bilateral congenital cataract, dental anomalies, facial dysmorphism, and intellectual disability. Here, we identify a patient with Nance-Horan syndrome caused by a new nonsense NHS variant. In addition, the patient presented congenital diaphragmatic hernia. NHS gene expression in murine fetal diaphragm was demonstrated, suggesting a possible involvement of NHS in diaphragm development. Congenital diaphragmatic hernia could result from NHS loss of function in pleuroperitoneal fold or in somites-derived muscle progenitor cells leading to an impairment of their cells migration.

Also flagged:MethylationTumorHead and Neck Cancerhead and neck cancershypopharyngeal cancerlaryngeal cancer
Journal Article 2018-01-22 ✓ 3 Snippets Misawa K, Mochizuki D, Imai A, Mima M, Misawa Y, Mineta H.
In-Text Gene Mentions

The average β values for p16, COAL1A2, DAPK, CCBE1, DCC, SALL3, NPY, TAC1, SST, GALR1, GALR2, NPY1R, NPY2R, NPY4R, NPY5R, TACR1, HCRTR1, HCRTR2, SSTR1, NPDDR1, NPFFR2, VEGFR1, VEGFR2, and VEGFR3 methylation were significantly higher in the HNSCC samples than in the normal samples (p < 0.05).

…[ 53 ],DCC[ 54 ],…

…, CCBE1 ,DCC, SALL3 ,…

Show Full Abstract

Clarifying the epigenetic regulation of tumor-related genes (TRGs) can provide insights into the mechanisms of tumorigenesis and the risk for disease recurrence in HPV-negative head and neck cancers, originating in the hypopharynx, larynx, and oral cavity. We analyzed the methylation status of the promoters of 30 TRGs in 178 HPV-negative head and neck cancer patients using a quantitative methylation-specific PCR. Promoter methylation was correlated with various clinical characteristics and patient survival. The mean number of methylated TRGs was 14.2 (range, 2-25). In the multivariate Cox proportional hazards analysis, the methylation of <i>COL1A2</i> and <i>VEGFR1</i> was associated with poor survival for hypopharyngeal cancer, with hazard ratios: 3.19; <i>p</i> = 0.009 and 3.07; <i>p</i> = 0.014, respectively. The methylation of <i>p16</i> and <i>COL1A2</i> were independent prognostic factors for poor survival in laryngeal cancer (hazard ratio: 4.55; <i>p</i> = 0.013 and 3.12; <i>p</i> = 0.035, respectively). In patients with oral cancer, the methylation of <i>TAC1</i> and <i>SSTR1</i> best correlated with poor survival (hazard ratio: 4.29; <i>p</i> = 0.005 and 5.38; <i>p</i> = 0.029, respectively). Our findings suggest that methylation status of TRGs could serve as important site-specific biomarkers for prediction of clinical outcomes in patients with HPV-negative head and neck cancer.

Also flagged:Obesity-associated proteinFTOcardiometabolic diseaseschromosomechromosomalmitochondrial
Journal Article 2018-01-22 No Snippets Erzurumluoglu AM, Baird D, Richardson TG, Timpson NJ, Rodriguez S.
Show Full Abstract

Y-chromosomal (Y-DNA) haplogroups are more widely used in population genetics than in genetic epidemiology, although associations between Y-DNA haplogroups and several traits, including cardiometabolic traits, have been reported. In apparently homogeneous populations defined by principal component analyses, there is still Y-DNA haplogroup variation which will result from population history. Therefore, hidden stratification and/or differential phenotypic effects by Y-DNA haplogroups could exist. To test this, we hypothesised that stratifying individuals according to their Y-DNA haplogroups before testing for associations between autosomal single nucleotide polymorphisms (SNPs) and phenotypes will yield difference in association. For proof of concept, we derived Y-DNA haplogroups from 6537 males from two epidemiological cohorts, Avon Longitudinal Study of Parents and Children (ALSPAC) (<i>n</i> = 5080; 816 Y-DNA SNPs) and the 1958 Birth Cohort (<i>n</i> = 1457; 1849 Y-DNA SNPs), and studied the robust associations between 32 SNPs and body mass index (BMI), including SNPs in or near Fat Mass and Obesity-associated protein (<i>FTO</i>) which yield the strongest effects. Overall, no association was replicated in both cohorts when Y-DNA haplogroups were considered and this suggests that, for BMI at least, there is little evidence of differences in phenotype or SNP association by Y-DNA structure. Further studies using other traits, phenome-wide association studies (PheWAS), other haplogroups and/or autosomal SNPs are required to test the generalisability and utility of this approach.

Also flagged:Major depressive disorderdepressionanxietybehavioralovarian hormoneovarian hormones
Journal Article 2018-01-22 No Snippets Raghavan NS, Chen H, Schipma M, Luo W, Chung S, Wang L, Redei EE.
Show Full Abstract

Major depressive disorder (MDD) is a debilitating illness that affects twice as many women than men postpuberty. This female bias is thought to be caused by greater heritability of MDD in women and increased vulnerability induced by female sex hormones. We tested this hypothesis by removing the ovaries from prepubertal Wistar Kyoto (WKY) more immobile (WMI) females, a genetic animal model of depression, and its genetically close control, the WKY less immobile (WLI). In adulthood, prepubertally ovariectomized (PrePubOVX) animals and their Sham-operated controls were tested for depression- and anxiety-like behaviors, using the routinely employed forced swim and open field tests, respectively, and RNA-sequencing was performed on their hippocampal RNA. Our results confirmed that the behavioral and hippocampal expression changes that occur after prepubertal ovariectomy are the consequences of an interaction between genetic predisposition to depressive behavior and ovarian hormone-regulated processes. Lack of ovarian hormones during and after puberty in the WLIs led to increased depression-like behavior. In WMIs, both depression- and anxiety-like behaviors worsened by prepubertal ovariectomy. The unbiased exploration of the hippocampal transcriptome identified sets of differentially expressed genes (DEGs) between the strains and treatment groups. The relatively small number of hippocampal DEGs resulting from the genetic differences between the strains confirmed the genetic relatedness of these strains. Nevertheless, the differences in DEGs between the strains in response to prepubertal ovariectomy identified different molecular processes, including the importance of glucocorticoid receptor-mediated mechanisms, that may be causative of the increased depression-like behavior in the presence or absence of genetic predisposition. This study contributes to the understanding of hormonal maturation-induced changes in affective behaviors and the hippocampal transcriptome as it relates to genetic predisposition to depression.

Also flagged:Tumorregulation ofgene expressioncancersautoimmune diseasestumors
Journal Article 2018-01-22 No Snippets Xu Z, Li P, Fan L, Wu M.
Show Full Abstract

Non-coding RNAs (ncRNAs) can be divided into circular non-coding RNAs (circRNAs) and linear ncRNAs. ncRNAs exist in different cell types, including normal cells, tumor cells and immunocytes. Linear ncRNAs, such as long ncRNAs and microRNAs, have been found to play important roles in the regulation of tumor immunity and immunotherapy; however, the functions of circRNAs in tumor immunity and immunotherapy are less known. Here, we review the current status of ncRNAs in the regulation of tumor immunity and immunotherapy and emphatically discuss the potential roles of circRNAs as tumor antigens in the regulation of tumor immunity and immunotherapy.

Also flagged:primary lesiongastric cancerulcerationlymphangiogenesisgastric carcinomatubular adenocarcinoma
Journal Article 2018-01-22 No Snippets Ikari N, Aoyama S, Seshimo A, Suehiro Y, Motohashi T, Mitani S, Yoshina S, Tanji E, Serizawa A, Yamada T, Taniguchi K, Yamamoto M, Furukawa T.
Show Full Abstract

<h4>Background and aim</h4>Intramucosal gastric adenocarcinoma of the well-moderately differentiated type only exhibits lymph node metastasis in extremely rare cases. We encountered such case and investigated both the lymphangiogenic properties and somatic mutations in the cancer to understand the prometastatic features of early-stage gastric cancer.<h4>Methods</h4>We quantitatively measured the density of lymphatic vessels and identified mutations in 412 cancer-associated genes through next-generation target resequencing of DNA extracted from tumor cells in a formalin-fixed and paraffin-embedded tissue. Functional consequence of the identified mutation was examined <i>in vitro</i> by means of gene transfection, immunoblot, and the quantitative real-time polymerase chain reaction assay.<h4>Results</h4>The intramucosal carcinoma was accompanied by abundant lymphatic vessels. The metastatic tumor harbored somatic mutations in <i>NBN</i>, p.P6S, and <i>PAX8</i>, p.R49H. The <i>PAX8</i><sup>R49H</sup> showed significantly higher transactivation activity toward <i>E2F1</i> than the wild-type <i>PAX8</i> (P< 0.001).<h4>Conclusions</h4>Our data suggest that increased lymphangiogenesis and somatic mutations of <i>NBN</i> and/or <i>PAX8</i> could facilitate lymph node metastasis from an intramucosal gastric carcinoma. These findings may potentially inform evaluations of the risk of developing lymph node metastasis in patients with intramucosal gastric cancer.

Also flagged:Colorectal cancercancersmismatch repaircolorectal cancerstumorcancer
Journal Article 2018-01-22 ✓ 1 Snippet Nojadeh JN, Behrouz Sharif S, Sakhinia E.
In-Text Gene Mentions

In addition to APC mutation, other mutations, such as K-RAS, DCC, P53, COX-2, BCL-2 and etc. are required to develop cancer (Zeichner et al., 2012[57]).

Show Full Abstract

Colorectal cancer (CRC) is a heterogeneous disease that is caused by the interaction of genetic and environmental factors. Although it is one of the most common cancers worldwide, CRC would be one of the most curable cancers if it is detected in the early stages. Molecular changes that occur in colorectal cancer may be categorized into three main groups: 1) Chromosomal Instability (CIN), 2) Microsatellite Instability (MSI), and 3) CpG Island Methylator phenotype (CIMP). Microsatellites, also known as Short Tandem Repeats (STRs) are small (1-6 base pairs) repeating stretches of DNA scattered throughout the entire genome and account for approximately 3 % of the human genome. Due to their repeated structure, microsatellites are prone to high mutation rate. Microsatellite instability (MSI) is a unique molecular alteration and hyper-mutable phenotype, which is the result of a defective DNA mismatch repair (MMR) system, and can be defined as the presence of alternate sized repetitive DNA sequences which are not present in the corresponding germ line DNA. The presence of MSI is found in sporadic colon, gastric, sporadic endometrial and the majority of other cancers. Approximately, 15-20 % of colorectal cancers display MSI. Determination of MSI status in CRC has prognostic and therapeutic implications. As well, detecting MSI is used diagnostically for tumor detection and classification. For these reasons, microsatellite instability analysis is becoming more and more important in colorectal cancer patients. The objective of this review is to provide the comprehensive summary of the update knowledge of colorectal cancer classification and diagnostic features of microsatellite instability.

Also flagged:calcium phosphatedegradationethylene glycolsilicateMagnesiumcation
Journal Article 2018-01-22 No Snippets Gao D, Dou J, Hu C, Yu H, Yu H, Chen C.
Show Full Abstract

Microarc oxidized calcium phosphate (CaP) ceramic coatings were fabricated on Mg-2Sr alloy from silicate electrolytes with different concentration gradient poly(ethylene glycol) (PEG<sub>1000</sub>). The microstructure, phase and degradability of the ceramic coatings were evaluated by scanning electron microscopy (SEM), X-ray diffraction (XRD) and simulation body fluid (SBF) immersion tests respectively. An electrochemical workstation was used to investigate the electrochemical corrosion properties of the coatings. It is found that microstructure, thickness, adhesive strength and degradation rate are influenced by PEG<sub>1000</sub> incorporation through adjusting the electrolyte activity and then altering the coating growth mechanism. Similar thicknesses (39.0-42.2 μm) are observed in PEG<sub>1000</sub>-containing coatings while their PEG<sub>1000</sub>-free counterparts possess the maximum value (51.5 μm). The weight gain in the first two days of SBF immersion suggests that a new layer containing CaP apatites is generated. Results show that ceramic coatings prepared in the electrolyte containing 8 g L<sup>-1</sup> PEG<sub>1000</sub> exhibits the highest corrosion resistance and lowest degradation rate.

Also flagged:Synthesisavermectin B2aoximeesterdeoxyavermectin B2aoxime ester
Journal Article 2018-01-22 No Snippets Sun G, Zhang J, Jin S, Zhang J.
Show Full Abstract

Three series of avermectin B2a oxime ester derivatives were synthesized using avermectin B2a as starting material. All of the compounds were characterized by <sup>1</sup>H NMR, <sup>13</sup>C NMR, and HRMS. Bioassay results indicated that some of the derivatives (8b, 8c, 8d, 8f, 11k, 11l, 14c, 14j) showed potent insecticidal activities against <i>Myzus persicae</i>, <i>Caenorhabditis elegans</i>, or <i>Tetranychus cinnabarinus</i>. As shown by initial insecticidal activity data, compound 8d showed excellent activities (>90%) against <i>M. persicae</i> and <i>C. elegans</i>, which were more potent than that of avermectin B2a. Compound 8d might be a lead compound for designing new avermectin B2a derivatives.

Also flagged:Cdc14sister chromatidsmitosisPolo-like kinasecell cyclephosphatase
Journal Article 2018-01-21 ✓ 1 Snippet Matos-Perdomo E, Machín F.
In-Text Gene Mentions

Condensinis also a…

Show Full Abstract

Chromosome morphology in Saccharomyces cerevisiae is only visible at the microscopic level in the ribosomal DNA array (rDNA). The rDNA has been thus used as a model to characterize condensation and segregation of sister chromatids in mitosis. It has been established that the metaphase structure ("loop") depends, among others, on the condensin complex; whereas its segregation also depends on that complex, the Polo-like kinase Cdc5 and the cell cycle master phosphatase Cdc14. In addition, Cdc14 also drives rDNA hypercondensation in telophase. Remarkably, since all these components are essential for cell survival, their role on rDNA condensation and segregation was established by temperature-sensitive (ts) alleles. Here, we show that the heat stress (HS) used to inactivate ts alleles (25 ºC to 37 ºC shift) causes rDNA loop condensation in metaphase-arrested wild type cells, a result that can also be mimicked by other stresses that inhibit the TORC1 pathway. Because this condensation might challenge previous findings with ts alleles, we have repeated classical experiments of rDNA condensation and segregation, yet using instead auxin-driven degradation alleles (aid alleles). We have undertaken the protein degradation at lower temperatures (25 ºC) and concluded that the classical roles for condensin, Cdc5, Cdc14 and Cdc15 still prevailed. Thus, condensin degradation disrupts rDNA higher organization, Cdc14 and Cdc5 degradation precludes rDNA segregation and Cdc15 degradation still allows rDNA hypercompaction in telophase. Finally, we provide direct genetic evidence that this HS-mediated rDNA condensation is dependent on TORC1 but, unlike the one observed in anaphase, is independent of Cdc14.

Also flagged:KRAStumorRKIPMAPKERKpancreatic cancer
Journal Article 2018-01-21 No Snippets Yang K, Li Y, Lian G, Lin H, Shang C, Zeng L, Chen S, Li J, Huang C, Huang K, Chen Y.
Show Full Abstract

Oncogenic KRAS plays a crucial role in pancreatic ductal adenocarcinoma (PDAC) development and progression. However, the mechanism has not been clearly elucidated. RKIP is a tumor repressor, and loss of RKIP has been shown in PDAC. Here, we found that KRAS expression was inversely correlated with RKIP expression in PDAC fresh tissue regardless of the KRAS mutant status. The negative correlation between KRAS and RKIP was further confirmed in our PDAC tissue microarray. KRAS overexpression and RKIP downregulation were associated with poor clinical outcomes. Knockdown or overexpression of KRAS in PDAC cell lines robustly increased or decreased, respectively, RKIP protein and mRNA levels. Furthermore, the MAPK-ERK pathway was involved in the regulation of RKIP. KRAS-regulated RKIP expression, which in turn affected the expression of pivotal epithelial-mesenchymal transition (EMT) and apoptosis factors. The biological function of the KRAS-RKIP axis was demonstrated in human pancreatic cancer cells in vitro and in vivo. KRAS knockdown increased RKIP expression and inhibited metastasis and chemoresistance. Moreover, the feature of metastasis and chemoresistance was rescued in the KRAS-knockdown cells through the inhibition of RKIP by RNA interference. In conclusion, our studies demonstrate how KRAS inhibits the tumor suppressor RKIP, thus offering novel justification for targeting RKIP as a strategy to overcome KRAS-induced tumor metastasis and chemoresistance in PDAC.

Also flagged:Chondrosarcomabone tumorsosteosarcomasEwing sarcomaschondrosarcomasosteoarthritis
Journal Article 2018-01-21 No Snippets Boehme KA, Schleicher SB, Traub F, Rolauffs B.
Show Full Abstract

Unlike other malignant bone tumors including osteosarcomas and Ewing sarcomas with a peak incidence in adolescents and young adults, conventional and dedifferentiated chondrosarcomas mainly affect people in the 4th to 7th decade of life. To date, the cell type of chondrosarcoma origin is not clearly defined. However, it seems that mesenchymal stem and progenitor cells (MSPC) in the bone marrow facing a pro-proliferative as well as predominantly chondrogenic differentiation milieu, as is implicated in early stage osteoarthritis (OA) at that age, are the source of chondrosarcoma genesis. But how can MSPC become malignant? Indeed, only one person in 1,000,000 will develop a chondrosarcoma, whereas the incidence of OA is a thousandfold higher. This means a rare coincidence of factors allowing escape from senescence and apoptosis together with induction of angiogenesis and migration is needed to generate a chondrosarcoma. At early stages, chondrosarcomas are still assumed to be an intermediate type of tumor which rarely metastasizes. Unfortunately, advanced stages show a pronounced resistance both against chemo- and radiation-therapy and frequently metastasize. In this review, we elucidate signaling pathways involved in the genesis and therapeutic resistance of chondrosarcomas with a focus on MSPC compared to signaling in articular cartilage (AC).

Also flagged:osteoarthritischondrogenesistranscription factorsOCT4SOX2KLF4
Journal Article 2018-01-21 ✓ 4 Snippets Rim YA, Nam Y, Park N, Jung H, Jang Y, Lee J, Ju JH.
In-Text Gene Mentions

…SOX5 andSOX6are closely related…

…also shown inSOX6as well (…

…The expression ofSOX6was higher in…

…factors, SOX5 andSOX6, was also low,…

Show Full Abstract

Scientists have tried to reprogram various origins of primary cells into human induced pluripotent stem cells (hiPSCs). Every somatic cell can theoretically become a hiPSC and give rise to targeted cells of the human body. However, there have been debates on the controversy about the differentiation propensity according to the origin of primary cells. We reprogrammed hiPSCs from four different types of primary cells such as dermal fibroblasts (DF, <i>n</i> = 3), peripheral blood mononuclear cells (PBMC, <i>n</i> = 3), cord blood mononuclear cells (CBMC, <i>n</i> = 3), and osteoarthritis fibroblast-like synoviocytes (OAFLS, <i>n</i> = 3). Established hiPSCs were differentiated into chondrogenic pellets. All told, cartilage-specific markers tended to express more by the order of CBMC > DF > PBMC > FLS. Origin of primary cells may influence the reprogramming and differentiation thereafter. In the context of chondrogenic propensity, CBMC-derived hiPSCs can be a fairly good candidate cell source for cartilage regeneration. The differentiation of hiPSCs into chondrocytes may help develop "cartilage in a dish" in the future. Also, the ideal cell source of hiPSC for chondrogenesis may contribute to future application as well.

Also flagged:SeleniumSelenoproteinsredox homeostasisamino acidselenocysteineselenoprotein
Journal Article 2018-01-20 ✓ 1 Snippet Hammad G, Legrain Y, Touat-Hamici Z, Duhieu S, Cornu D, Bulteau AL, Chavatte L.
In-Text Gene Mentions

…1 (PGAM1), Peroxiredoxin-6 (PRDX6), and Endoplasmic reticulum…

Show Full Abstract

Selenoproteins are essential components of antioxidant defense, redox homeostasis, and cell signaling in mammals, where selenium is found in the form of a rare amino acid, selenocysteine. Selenium, which is often limited both in food intake and cell culture media, is a strong regulator of selenoprotein expression and selenoenzyme activity. Aging is a slow, complex, and multifactorial process, resulting in a gradual and irreversible decline of various functions of the body. Several cellular aspects of organismal aging are recapitulated in the replicative senescence of cultured human diploid fibroblasts, such as embryonic lung fibroblast WI-38 cells. We previously reported that the long-term growth of young WI-38 cells with high (supplemented), moderate (control), or low (depleted) concentrations of selenium in the culture medium impacts their replicative lifespan, due to rapid changes in replicative senescence-associated markers and signaling pathways. In order to gain insight into the molecular link between selenium levels and replicative senescence, in the present work, we have applied a quantitative proteomic approach based on 2-Dimensional Differential in-Gel Electrophoresis (2D-DIGE) to the study of young and presenescent cells grown in selenium-supplemented, control, or depleted media. Applying a restrictive cut-off (spot intensity ±50% and a <i>p</i> value < 0.05) to the 2D-DIGE analyses revealed 81 differentially expressed protein spots, from which 123 proteins of interest were identified by mass spectrometry. We compared the changes in protein abundance for three different conditions: (i) spots varying between young and presenescent cells, (ii) spots varying in response to selenium concentration in young cells, and (iii) spots varying in response to selenium concentration in presenescent cells. Interestingly, a 72% overlap between the impact of senescence and selenium was observed in our proteomic results, demonstrating a strong interplay between selenium, selenoproteins, and replicative senescence.

Also flagged:cytokineIL-2IL-12IL-15IL-21CD112
Journal Article 2018-01-19 ✓ 1 Snippet Najar M, Fayyad-Kazan M, Meuleman N, Bron D, Fayyad-Kazan H, Lagneaux L.
In-Text Gene Mentions

Serpin C1

Show Full Abstract

Bone marrow-derived mesenchymal stromal cells (BM-MSCs) are multipotent progenitor cells that have shown promise for several different therapeutic applications. As they are able to modulate the function of several types of immune cells, BM-MSCs are highly important in the field of cell-based immunotherapy. Understanding BM-MSC-natural killer (NK) cell interactions is crucial for improving their therapeutic efficiency. Here, we observed that the type of NK cell-activating cytokine (e.g., IL-2, IL-12, IL-15 and IL-21) strongly influenced the outcomes of their interactions with BM-MSCs. The expression patterns of the ligands (CD112, CD155, ULPB-3) and receptors (LAIR, NCR) mediating the cross-talk between BM-MSCs and NK cells were critically modulated following co-culture. BM-MSCs partially impaired NK cell proliferation but up-regulated their secretion of IFN-γ and TNF-α. As they are cytotoxic, activated NK cells induced the killing of BM-MSCs. Indeed, BM-MSCs triggered the degranulation of NK cells and increased their release of perforin and granzymes. Interestingly, activated NK cells induced ROS generation within BM-MSCs that caused their decreased viability and reduced expression of serpin B9. Collectively, our observations reveal that BM-MSC-NK cell interactions may impact the immunobiology of both cell types. The therapeutic potential of BM-MSCs will be significantly improved once these issues are well characterized.

Also flagged:glioblastomasmethylationglioblastomaGBMgliomastumors
Journal Article 2018-01-19 ✓ 1 Snippet Yin AA, Lu N, Etcheverry A, Aubry M, Barnholtz-Sloan J, Zhang LH, Mosser J, Zhang W, Zhang X, Liu YH, He YL.
In-Text Gene Mentions

TRIM38

Show Full Abstract

<h4>Aims</h4>We aimed to identify a clinically useful biomarker using DNA methylation-based information to optimize individual treatment of patients with glioblastoma (GBM).<h4>Methods</h4>A six-CpG panel was identified by incorporating genome-wide DNA methylation data and clinical information of three distinct discovery sets and was combined using a risk-score model. Different validation sets of GBMs and lower-grade gliomas and different statistical methods were implemented for prognostic evaluation. An integrative analysis of multidimensional TCGA data was performed to molecularly characterize different risk tumors.<h4>Results</h4>The six-CpG risk-score signature robustly predicted overall survival (OS) in all discovery and validation cohorts and in a treatment-independent manner. It also predicted progression-free survival (PFS) in available patients. The multimarker epigenetic signature was demonstrated as an independent prognosticator and had better performance than known molecular indicators such as glioma-CpG island methylator phenotype (G-CIMP) and proneural subtype. The defined risk subgroups were molecularly distinct; high-risk tumors were biologically more aggressive with concordant activation of proangiogenic signaling at multimolecular levels. Accordingly, we observed better OS benefits of bevacizumab-contained therapy to high-risk patients in independent sets, supporting its implication in guiding usage of antiangiogenic therapy. Finally, the six-CpG signature refined the risk classification based on G-CIMP and MGMT methylation status.<h4>Conclusions</h4>The novel six-CpG signature is a robust and independent prognostic indicator for GBMs and is of promising value to improve personalized management.

Also flagged:exocytosisSNAP25S21microtubuleGFPhow
Journal Article 2018-01-19 ✓ 3 Snippets Urbina FL, Gomez SM, Gupton SL.
In-Text Gene Mentions

…pcDNA3.1-HA ratDCCwas acquired from…

…were transfected with HA-DCC, FLAG-ubiquitin, and SNAP25-G…

…the netrin receptorDCC( Winkle et…

Show Full Abstract

Neurite elongation and branching in developing neurons requires plasmalemma expansion, hypothesized to occur primarily via exocytosis. We posited that exocytosis in developing neurons and nonneuronal cells would exhibit distinct spatiotemporal organization. We exploited total internal reflection fluorescence microscopy to image vesicle-associated membrane protein (VAMP)-pHluorin-mediated exocytosis in mouse embryonic cortical neurons and interphase melanoma cells, and developed computer-vision software and statistical tools to uncover spatiotemporal aspects of exocytosis. Vesicle fusion behavior differed between vesicle types, cell types, developmental stages, and extracellular environments. Experiment-based mathematical calculations indicated that VAMP2-mediated vesicle fusion supplied excess material for the plasma membrane expansion that occurred early in neuronal morphogenesis, which was balanced by clathrin-mediated endocytosis. Spatial statistics uncovered distinct spatiotemporal regulation of exocytosis in the soma and neurites of developing neurons that was modulated by developmental stage, exposure to the guidance cue netrin-1, and the brain-enriched ubiquitin ligase tripartite motif 9. In melanoma cells, exocytosis occurred less frequently, with distinct spatial clustering patterns.

Also flagged:neurologic disorderstoATMkinasesPARP1Huntington disease
Journal Article 2018-01-19 No Snippets Coon EA, Benarroch EE.
Show Full Abstract

No abstract available.

Also flagged:NUFIP2RNA-binding proteinsRoquin-2Roquinbindingdegradation
Journal Article 2018-01-19 ✓ 5 Snippets Rehage N, Davydova E, Conrad C, Behrens G, Maiser A, Stehklein JE, Brenner S, Klein J, Jeridi A, Hoffmann A, Lee E, Dianzani U, Willemsen R, Feederle R, Reiche K, Hackermüller J, Leonhardt H, Sharma S, Niessing D, Heissmeyer V.
In-Text Gene Mentions

A stable Rc3h1/2−/− MEF cell line allowing doxycycline-inducible co-expression of Roquin-1 and mCherry was generated similarly by transduction with plentiCMVtight Roquin-P2A-mCherry and the reverse transactivator (rtTA3).

Rc3h1/2−/− MEFs with doxycycline-inducible Roquin-1-P2A-mCherry expression (described above) were employed for functional assays upon retroviral transduction with different ICOS reporters.

Rc3h1/2−/− and Nufip2−/− MEF cells with doxycycline-inducible Roquin-1 overexpression were generated by co-transduction with plentiCMVtight Roquin and the reverse transactivator (rtTA3) as described above.

Rc3h1/2−/− MEF cells lacking the cassette for doxycycline-inducible Roquin-1 expression were transduced with GFP-NUFIP2 for studying Nufip2 localization in the absence of endogenous Roquin expression.

For colocalization experiments, Rc3h1/2−/− MEF with doxycycline-inducible Roquin-1 expression were transduced with GFP-Nufip2 by retroviral infection.

Show Full Abstract

The ubiquitously expressed RNA-binding proteins Roquin-1 and Roquin-2 are essential for appropriate immune cell function and postnatal survival of mice. Roquin proteins repress target mRNAs by recognizing secondary structures in their 3'-UTRs and by inducing mRNA decay. However, it is unknown if other cellular proteins contribute to target control. To identify cofactors of Roquin, we used RNA interference to screen ~1500 genes involved in RNA-binding or mRNA degradation, and identified NUFIP2 as a cofactor of Roquin-induced mRNA decay. NUFIP2 binds directly and with high affinity to Roquin, which stabilizes NUFIP2 in cells. Post-transcriptional repression of human ICOS by endogenous Roquin proteins requires two neighboring non-canonical stem-loops in the ICOS 3'-UTR. This unconventional cis-element as well as another tandem loop known to confer Roquin-mediated regulation of the Ox40 3'-UTR, are bound cooperatively by Roquin and NUFIP2. NUFIP2 therefore emerges as a cofactor that contributes to mRNA target recognition by Roquin.

Also flagged:pyroptosisethyl acetatelungcancercell proliferationacid
Journal Article 2018-01-19 ✓ 1 Snippet Sannino F, Sansone C, Galasso C, Kildgaard S, Tedesco P, Fani R, Marino G, de Pascale D, Ianora A, Parrilli E, Larsen TO, Romano G, Tutino ML.
In-Text Gene Mentions

…1 (ESR1), Huntingtin (HTT), Insulin-like growth factor…

Show Full Abstract

In order to exploit the rich reservoir of marine cold-adapted bacteria as a source of bioactive metabolites, ethyl acetate crude extracts of thirteen polar marine bacteria were tested for their antiproliferative activity on A549 lung epithelial cancer cells. The crude extract from Pseudoalteromonas haloplanktis TAC125 was the most active in inhibiting cell proliferation. Extensive bioassay-guided purification and mass spectrometric characterization allowed the identification of 4-hydroxybenzoic acid (4-HBA) as the molecule responsible for this bioactivity. We further demonstrate that 4-HBA inhibits A549 cancer cell proliferation with an IC<sub>50</sub> value ≤ 1 μg ml<sup>-1</sup>, and that the effect is specific, since the other two HBA isomers (i.e. 2-HBA and 3-HBA) were unable to inhibit cell proliferation. The effect of 4-HBA is also selective since treatment of normal lung epithelial cells (WI-38) with 4-HBA did not affect cell viability. Finally, we show that 4-HBA is able to activate, at the gene and protein levels, a specific cell death signaling pathway named pyroptosis. Accordingly, the treatment of A549 cells with 4-HBA induces the transcription of (amongst others) caspase-1, IL1β, and IL18 encoding genes. Studies needed for the elucidation of mode of action of 4-HBA will be instrumental in depicting novel details of pyroptosis.

Also flagged:gene expressioninterferonimmune responsecytoskeletonorganizationnitric oxide
Journal Article 2018-01-19 ✓ 1 Snippet Zhang J, Kaiser MG, Deist MS, Gallardo RA, Bunn DA, Kelly TR, Dekkers JCM, Zhou H, Lamont SJ.
In-Text Gene Mentions

…, Mx andZNFX113 ; and…

Show Full Abstract

Enhancing genetic resistance of chickens to Newcastle Disease Virus (NDV) provides a promising way to improve poultry health, and to alleviate poverty and food insecurity in developing countries. In this study, two inbred chicken lines with different responses to NDV, Fayoumi and Leghorn, were challenged with LaSota NDV strain at 21 days of age. Through transcriptome analysis, gene expression in spleen at 2 and 6 days post-inoculation was compared between NDV-infected and control groups, as well as between chicken lines. At a false discovery rate <0.05, Fayoumi chickens, which are relatively more resistant to NDV, showed fewer differentially expressed genes (DEGs) than Leghorn chickens. Several interferon-stimulated genes were identified as important DEGs regulating immune response to NDV in chicken. Pathways predicted by IPA analysis, such as "EIF-signaling", "actin cytoskeleton organization nitric oxide production" and "coagulation system" may contribute to resistance to NDV in Fayoumi chickens. The identified DEGs and predicted pathways may contribute to differential responses to NDV between the two chicken lines and provide potential targets for breeding chickens that are more resistant to NDV.

Also flagged:cysteinyl proteaseCaspase-6AlzheimerHuntington diseasesaxonalmemory impairment
Journal Article 2018-01-19 ✓ 1 Snippet Noël A, Zhou L, Foveau B, Sjöström PJ, LeBlanc AC.
In-Text Gene Mentions

HTT

Show Full Abstract

Active cysteinyl protease Caspase-6 is associated with early Alzheimer and Huntington diseases. Higher entorhinal cortex and hippocampal Caspase-6 levels correlate with lower cognitive performance in aged humans. Caspase-6 induces axonal degeneration in human primary neuron cultures and causes inflammation and neurodegeneration in mouse hippocampus, and age-dependent memory impairment. To assess whether Caspase-6 causes damage to another neuronal system, a transgenic knock-in mouse overexpressing a self-activated form of Caspase-6 five-fold in the striatum, the area affected in Huntington disease, and 2.5-fold in the hippocampus and cortex, was generated. Detection of Tubulin cleaved by Caspase-6 confirmed Caspase-6 activity. The Caspase-6 expressing mice and control littermates were subjected to behavioral tests to assess Huntington disease-relevant psychiatric, motor, and cognitive deficits. Depression was excluded with the forced swim and sucrose consumption tests. Motor deficits were absent in the nesting, clasping, rotarod, vertical pole, gait, and open field analyzes. However, Caspase-6 mice developed age-dependent episodic and spatial memory deficits identified by novel object recognition, Barnes maze and Morris water maze assays. Neuron numbers were maintained in the striatum, hippocampus, and cortex. Microglia and astrocytes were increased in the hippocampal stratum lacunosum molecular and in the cortex, but not in the striatum. Synaptic mRNA profiling identified two differentially expressed genes in transgenic hippocampus, but none in striatum. Caspase-6 impaired synaptic transmission and induced neurodegeneration in hippocampal CA1 neurons, but not in striatal medium spiny neurons. These data revealed that active Caspase-6 in the striatal medium spiny neurons failed to induce inflammation, neurodegeneration or behavioral abnormalities, whereas active Caspase-6 in the cortex and hippocampus impaired episodic and spatial memories, and induced inflammation, neuronal dysfunction, and neurodegeneration. The results indicate age and neuronal subtype-dependent Caspase-6 toxicity and highlight the importance of targeting the correct neuronal subtype to identify underlying molecular mechanisms of neurodegenerative diseases.

Also flagged:histone H1Histones H1cell nucleuschromatinbindingorganization
Journal Article 2018-01-19 ✓ 1 Snippet Contreras C, Villasana M, Hendzel MJ, Carrero G.
In-Text Gene Mentions

…Histones H1 orlinker histoneshistones are highly…

Show Full Abstract

Histones H1 or linker histones are highly dynamic proteins that diffuse throughout the cell nucleus and associate with chromatin (DNA and associated proteins). This binding interaction of histone H1 with the chromatin is thought to regulate chromatin organization and DNA accessibility to transcription factors and has been proven to involve a kinetic process characterized by a population that associates weakly with chromatin and rapidly dissociates and another population that resides at a binding site for up to several minutes before dissociating. When considering differences between these two classes of interactions in a mathematical model for the purpose of describing and quantifying the dynamics of histone H1, it becomes apparent that there could be several assembly pathways that explain the kinetic data obtained in living cells. In this work, we model these different pathways using systems of reaction-diffusion equations and carry out a model comparison analysis using FRAP (fluorescence recovery after photobleaching) experimental data from different histone H1 variants to determine the most feasible mechanism to explain histone H1 binding to chromatin. The analysis favors four different chromatin assembly pathways for histone H1 which share common features and provide meaningful biological information on histone H1 dynamics. We show, using perturbation analysis, that the explicit consideration of high- and low-affinity associations of histone H1 with chromatin in the favored assembly pathways improves the interpretation of histone H1 experimental FRAP data. To illustrate the results, we use one of the favored models to assess the kinetic changes of histone H1 after core histone hyperacetylation, and conclude that this post-transcriptional modification does not affect significantly the transition of histone H1 from a weakly bound state to a tightly bound state.

Also flagged:TsukushiTSKBMPFGFTGF-βWnt
Journal Article 2018-01-19 No Snippets Ahmad SAI, Anam MB, Ito N, Ohta K.
Show Full Abstract

Tsukushi (TSK) is a small signaling molecule which takes part in different developmental processes of multiple vertebrate organisms. The diverse activity of TSK depends on its ability to bind various intermediate molecules from different major signaling pathways. Interactions of TSK with BMP, FGF, TGF-β and Wnt pathways have already been confirmed. In this review, we will introduce the latest information regarding the involvement of TSK in developmental events. We suggest a fine tuning role for TSK in multiple signaling cascades. Also, we recommend further studies on the developmental role of TSK to fully reveal its potential.

Also flagged:Neurodegenerative Diseasesamyotrophic lateral sclerosisfronto-temporal dementiaenergy homeostasisALSAD
Journal Article 2018-01-19 ✓ 3 Snippets Vercruysse P, Vieau D, Blum D, Petersén Å, Dupuis L.
In-Text Gene Mentions

The commonly used R6/2 mouse model of HD that expresses around 150 CAG repeats in the exon 1 of human HTT gene (Mangiarini et al., 1996), reproduces the clinical findings of higher caloric intake, weight loss and hypermetabolism (Goodman et al., 2008; van der Burg et al., 2008).

…of the Huntingtin (HTT) gene which leads…

…1 of humanHTTgene (Mangiarini et…

Show Full Abstract

Neurodegenerative diseases (NDDs) are disorders characterized by progressive deterioration of brain structure and function. Selective neuronal populations are affected leading to symptoms which are prominently motor in amyotrophic lateral sclerosis (ALS) or Huntington's disease (HD), or cognitive in Alzheimer's disease (AD) and fronto-temporal dementia (FTD). Besides the common existence of neuronal loss, NDDs are also associated with metabolic changes such as weight gain, weight loss, loss of fat mass, as well as with altered feeding behavior. Importantly, preclinical research as well as clinical studies have demonstrated that altered energy homeostasis influences disease progression in ALS, AD and HD, suggesting that identification of the pathways leading to perturbed energy balance might provide valuable therapeutic targets Signals from both the periphery and central inputs are integrated in the hypothalamus, a major hub for the control of energy balance. Recent research identified major hypothalamic changes in multiple NDDs. Here, we review these hypothalamic alterations and seek to identify commonalities and differences in hypothalamic involvement between the different NDDs. These hypothalamic defects could be key in the development of perturbations in energy homeostasis in NDDs and further understanding of the underlying mechanisms might open up new avenues to not only treat weight loss but also to ameliorate overall neurological symptoms.

Also flagged:SOX2SOX12clear cell renal cell carcinomaSex-determining region Y-box proteinSOXcancer
Journal Article 2018-01-19 ✓ 5 Snippets Gu W, Wang B, Wan F, Wu J, Lu X, Wang H, Zhu Y, Zhang H, Shi G, Dai B, Ye D.
In-Text Gene Mentions

SOX2, SOX6, SOX11, SOX12, SOX13, SOX15, SOX17 and SOX30 expression were predictive in the prognosis of clear cell RCC

SOX6, SOX11, SOX12, SOX13, SOX15, SOX17 and SOX30 expression were predictive in the prognosis of clear cell RCC

SOX1, SOX2, SOX6, SOX11, SOX12, SOX13, SOX15, SOX17 and SOX30 expression were predictive in the prognosis of clear cell RCC

…model, SOX1, SOX2,SOX6, SOX11, SOX12, SOX13,…

SOX6

Show Full Abstract

Sex-determining region Y-box protein (SOX) genes serve an important role in cancer growth and metastasis. The present study aimed to determine the predictive ability of SOX and associated genes identified through molecular network in clear cell renal cell carcinoma (RCC). A total of 505 patients with clear cell RCC from The Cancer Genome Atlas (TCGA) cohorts were collected in this study. The expression profile of SOX and associated genes were obtained from the TCGA RNAseq database. Clinicopathological characteristics, including age, gender, tumor grade, stage, laterality disease-free-survival and overall survival (OS) were collected. Cox's proportional hazards regression model, as well as Kaplan-Meier curves were used to assess the relative factors. Selected genes of SOXs that demonstrated significant associations with OS were further validated in 192 patients from the validation cohort. In the univariate Cox regression model, SOX1, SOX2, SOX6, SOX11, SOX12, SOX13, SOX15, SOX17 and SOX30 expression were predictive in the prognosis of clear cell RCC. Following adjustment for clinical factors, SOX2 [hazard ratio (HR), 1.130; 95% confidence interval (CI), 1.002-1.275), SOX12 (HR, 1.379; 95% CI, 1.060-1.793) and SOX15 (HR, 1.245; 95% CI, 1.063-1.459) remained statistically significant. Furthermore, POU class 5 homeobox 1 (POU5F1), POU2F1 and nuclear receptor subfamily 5 group A member 1 in the gene cluster network analysis associated with SOX2 did not reduce the statistical significance when added to the multivariate analysis. The findings were extended to the Fudan University Shanghai Cancer Center cohort. The results revealed that high SOX2 and SOX12 expression were associated with poor prognosis for OS (log-rank test, all P<0.05). SOX2 and SOX12 were identified as independent prognostic factors of OS in clear cell RCC.

Also flagged:meningitisEphA2 receptorantibodyEPHtyrosine kinaseCD44
Journal Article 2018-01-18 No Snippets Aaron PA, Jamklang M, Uhrig JP, Gelli A.
Show Full Abstract

Cryptococcus neoformans is an opportunistic fungal pathogen that causes life-threatening meningitis most commonly in populations with impaired immunity. Here, we resolved the transcriptome of the human brain endothelium challenged with C. neoformans to establish whether C. neoformans invades the CNS by co-opting particular signalling pathways as a means to promote its own entry. Among the 5 major pathways targeted by C. neoformans, the EPH-EphrinA1 (EphA2) tyrosine kinase receptor-signalling pathway was examined further. Silencing the EphA2 receptor transcript in a human brain endothelial cell line or blocking EphA2 activity with an antibody or chemical inhibitor prevented transmigration of C. neoformans in an in vitro model of the blood-brain barrier (BBB). In contrast, treating brain endothelial cells with an EphA2 chemical agonist or an EphA2 ligand promoted greater migration of fungal cells across the BBB. C. neoformans activated the EPH-tyrosine kinase pathway through a CD44-dependent phosphorylation of EphA2, promoting clustering and internalisation of EphA2 receptors. Moreover, HEK293T cells expressing EphA2 revealed an association between EphA2 and C. neoformans that boosted internalisation of C. neoformans. Collectively, the results suggest that C. neoformans promotes EphA2 activity via CD44, and this in turn creates a permeable barrier that facilitates the migration of C. neoformans across the BBB.

Also flagged:immune responseinfectionsRSV infectionbindingCD43interferon gamma
Journal Article 2018-01-18 No Snippets Jans J, Unger WWJ, Vissers M, Ahout IML, Schreurs I, Wickenhagen A, de Groot R, de Jonge MI, Ferwerda G.
Show Full Abstract

Interferon gamma (IFN-γ) plays an important role in the antiviral immune response during respiratory syncytial virus (RSV) infections. Monocytes and T cells are recruited to the site of RSV infection, but it is unclear whether cell-cell interactions between monocytes and T cells regulate IFN-γ production. In this study, micro-array data identified the upregulation of sialic acid-binding immunoglobulin-type lectin 1 (Siglec-1) in human RSV-infected infants. In vitro, RSV increased expression of Siglec-1 on healthy newborn and adult monocytes. RSV-induced Siglec-1 on monocytes inhibited IFN-γ production by adult CD4<sup>+</sup> T cells. In contrast, IFN-γ production by RSV in newborns was not affected by Siglec-1. The ligand for Siglec-1, CD43, is highly expressed on adult CD4<sup>+</sup> T cells compared to newborns. Our data show that Siglec-1 reduces IFN-γ release by adult T cells possibly by binding to the highly expressed CD43. The Siglec-1-dependent inhibition of IFN-γ in adults and the low expression of CD43 on newborn T cells provides a better understanding of the immune response against RSV in early life and adulthood.

Also flagged:OX40OX40LOX40 ligandAsthmaOVAcell proliferation
Journal Article 2018-01-18 No Snippets Lei W, Lei W, Zeng D, Liu G, Zhu Y, Wang J, Wu H, Jiang J, Huang J.
Show Full Abstract

The aim of the present study was to explore the roles of OX40/OX40 ligand (OX40L) signaling and OX40+ T cells in ovalbumin (OVA)‑induced mouse asthma model. Asthma was induced by OVA exposure and subsequent co‑treatment with OX40L protein, neutralizing anti‑OX40L blocking antibody, OX40+ T cells or PBS. The protein expression levels of interleukin (IL)‑4, IL‑6, IL‑13, IL‑17, tumor necrosis factor (TNF)‑α and interferon (IFN)‑γ in bronchoalveolar lavage fluid (BALF) were examined using murine cytokine‑specific ELISA. Eosinophil accumulation as well as proliferation and apoptosis of T cells in BALF were detected by Cell Counting kit‑8 and flow cytometric assays. Expression of the apoptosis‑related protein cleaved caspase‑3 was examined in OX40+ T cells using western blot assay. Flow cytometric analysis revealed that OVA‑treated mice that were co‑treated with OX40L or OX40+ T cells exhibited higher eosinophil infiltration compared with control mice treated only with OVA, whereas neutralizing anti‑OX40L blocking antibody inhibited eosinophil infiltration. ELISA assays demonstrated that the expression of IL‑4, IL‑6, IL‑13, IL‑17, TNF‑α and IFN‑γ in BALF in OX40L‑treated and OX40+ T cell‑treated mice was increased compared with expression levels in control mice. Treatment with OX40L protein effectively reduced apoptosis of T cells and the expression of cleaved caspase‑3 in T cells. OX40L‑treated and OX40+ T cell‑treated mice exhibited increased asthma through OX40/OX40L signaling, which probably promoted inflammatory factor expression, eosinophil infiltration and T cell proliferation.

Also flagged:heat-shock proteinsHeat shock proteinsHSPsmolecular chaperonesdegradationHuntingtin
Journal Article 2018-01-18 ✓ 5 Snippets Higgins R, Kabbaj MH, Hatcher A, Wang Y.
In-Text Gene Mentions

Trinucleotide (CAG) repeat expansion in the Huntingtin gene (HTT) results in the expression of misfolded Huntingtin protein (Htt), which contributes to the development of Huntington’s disease.

Huntington’s disease (HD) is a dominant neurodegenerative disorder caused by a trinucleotide (CAG) repeat expansion in exon I of the HTT gene, which results in terminal misfolding and aggregation of Htt proteins.

…misfolded Huntingtin protein (Htt), which contributes to…

…degradation of mutatedHttwith polyQ expansion…

…clearance of mutatedHttremains poorly understood.…

Show Full Abstract

The functionality of a protein depends on its correct folding, but newly synthesized proteins are susceptible to aberrant folding and aggregation. Heat shock proteins (HSPs) function as molecular chaperones that aid in protein folding and the degradation of misfolded proteins. Trinucleotide (CAG) repeat expansion in the Huntingtin gene (HTT) results in the expression of misfolded Huntingtin protein (Htt), which contributes to the development of Huntington's disease. We previously found that the degradation of mutated Htt with polyQ expansion (Htt103QP) depends on both ubiquitin proteasome system and autophagy. However, the role of heat shock proteins in the clearance of mutated Htt remains poorly understood. Here, we report that cytosolic Hsp70 (Ssa family), its nucleotide exchange factors (Sse1 and Fes1), and a Hsp40 co-chaperone (Ydj1) are required for inclusion body formation of Htt103QP proteins and their clearance via autophagy. Extended induction of Htt103QP-GFP leads to the formation of a single inclusion body in wild-type yeast cells, but mutant cells lacking these HSPs exhibit increased number of Htt103QP aggregates. Most notably, we detected more aggregated forms of Htt103QP in sse1Δ mutant cells using an agarose gel assay. Increased protein aggregates are also observed in these HSP mutants even in the absence Htt103QP overexpression. Importantly, these HSPs are required for autophagy-mediated Htt103QP clearance, but are less critical for proteasome-dependent degradation. These findings suggest a chaperone network that facilitates inclusion body formation of misfolded proteins and the subsequent autophagic clearance.

Also flagged:Cancerinvasive breast tumorsPELP1nucleuscytoplasmlocalization
Journal Article 2018-01-18 ✓ 1 Snippet Truong TH, Hu H, Temiz NA, Hagen KM, Girard BJ, Brady NJ, Schwertfeger KL, Lange CA, Ostrander JH.
In-Text Gene Mentions

DCC

Show Full Abstract

Proline, glutamic acid, leucine-rich protein 1 (PELP1) is overexpressed in approximately 80% of invasive breast tumors. PELP1 dynamically shuttles between the nucleus and cytoplasm, but is primarily nuclear in normal breast tissue. However, altered localization of PELP1 to the cytoplasm is an oncogenic event that promotes breast cancer initiation and progression. Herein, interacting partners unique to cytoplasmic PELP1 and the mechanisms by which these interactions promote oncogenic PELP1 signaling were sought. AIB1 (amplified in breast cancer 1; also known as SRC-3 or NCOA3) was identified as a novel binding partner of cytoplasmic PELP1 in both estrogen receptor-positive (ER<sup>+</sup>) and ER-negative cell lines. Cytoplasmic PELP1 expression elevated basal phosphorylation levels (i.e., activation) of AIB1 at Thr24, enhanced ALDH<sup>+</sup> tumorsphere formation, and upregulated specific target genes independently of hormone stimulation. Direct manipulation of AIB1 levels using shRNA abrogated cytoplasmic PELP1-induced tumorsphere formation and downregulated cytoplasmic PELP1-specific target genes. SI-2, an AIB1 inhibitor, limited the PELP1/AIB1 interaction and decreased cytoplasmic PELP1-induced tumorsphere formation. Similar results were observed in a murine-derived MMTV-AIB1 tumor cell line. Furthermore, <i>in vivo</i> syngeneic tumor studies revealed that PELP1 knockdown resulted in increased survival of tumor-bearing mice as compared with mice injected with control cells.<b>Implications:</b> These data demonstrate that cytoplasmic PELP1/AIB1-containing complexes function to promote advanced cancer phenotypes, including outgrowth of stem-like cells, associated with estrogen-independent breast cancer progression. <i>Mol Cancer Res; 16(4); 707-19. ©2018 AACR</i>.

Also flagged:chromosomeschromatinchromosomeorganizationcondensin Icondensins
Journal Article 2018-01-18 No Snippets Gibcus JH, Samejima K, Goloborodko A, Samejima I, Naumova N, Nuebler J, Kanemaki MT, Xie L, Paulson JR, Earnshaw WC, Mirny LA, Dekker J.
Show Full Abstract

Mitotic chromosomes fold as compact arrays of chromatin loops. To identify the pathway of mitotic chromosome formation, we combined imaging and Hi-C analysis of synchronous DT40 cell cultures with polymer simulations. Here we show that in prophase, the interphase organization is rapidly lost in a condensin-dependent manner, and arrays of consecutive 60-kilobase (kb) loops are formed. During prometaphase, ~80-kb inner loops are nested within ~400-kb outer loops. The loop array acquires a helical arrangement with consecutive loops emanating from a central "spiral staircase" condensin scaffold. The size of helical turns progressively increases to ~12 megabases during prometaphase. Acute depletion of condensin I or II shows that nested loops form by differential action of the two condensins, whereas condensin II is required for helical winding.

Also flagged:ecstasyserotonin transportertransporteranxietyDepression5
Journal Article 2018-01-18 ✓ 5 Snippets Kuypers KPC, de la Torre R, Farre M, Xicota L, de Sousa Fernandes Perna EB, Theunissen EL, Ramaekers JG.
In-Text Gene Mentions

…serotonin transporter (SERT,5-HTT) is a major…

…blocking of the5-HTT6 .…

…activity and regulates5-HTTexpression and density…

…associated with lower5-HTTexpression and function…

…methylation of the5-HTTwere for example…

Show Full Abstract

MDMA exerts its main effects via the serotonergic system and the serotonin transporter. The gene coding for this transporter determines the expression rate of the transporter. Previously it was shown that healthy individuals with the short allelic variant ('s-group') of the 5-HTTLPR-polymorphism displayed more anxiety and negative mood, and had a lower transcriptional efficiency compared to individuals who are homozygous for the l-allele ('l-group'). The present study aimed to investigate the role of the 5-HTTLPR polymorphism in MDMA-induced mood effects. Four placebo-controlled, within-subject studies were pooled, including in total 63 polydrug ecstasy users (N<sub>s-group</sub> = 48; N<sub>l-group</sub> = 15) receiving MDMA 75 mg and placebo on two test days, separated by minimally 7 days. Mood was assessed by means of the Profile of Mood States. Findings showed that MDMA induced -independent of sex- a positive mood state, and as a side effect also increased two negative affect states, anxiety and confusion. Anxiety ratings were higher in the l-group and independent of treatment or sex. Depression ratings were lowered by MDMA in the female l-group. Findings indicate that the MDMA-induced reduction in self-rated depressive feelings is sex- and genotype-dependent, with females homozygous for the l-allele showing this beneficial effect.

Also flagged:Chromosomereplication forksnucleoid-associated proteinNAPnucleoidorganization
Journal Article 2018-01-18 ✓ 1 Snippet Lioy VS, Cournac A, Marbouty M, Duigou S, Mozziconacci J, Espéli O, Boccard F, Koszul R.
In-Text Gene Mentions

…by Nucleoid-Associated andCondensinProteins.…

Show Full Abstract

As in eukaryotes, bacterial genomes are not randomly folded. Bacterial genetic information is generally carried on a circular chromosome with a single origin of replication from which two replication forks proceed bidirectionally toward the opposite terminus region. Here, we investigate the higher-order architecture of the Escherichia coli genome, showing its partition into two structurally distinct entities by a complex and intertwined network of contacts: the replication terminus (ter) region and the rest of the chromosome. Outside of ter, the condensin MukBEF and the ubiquitous nucleoid-associated protein (NAP) HU promote DNA contacts in the megabase range. Within ter, the MatP protein prevents MukBEF activity, and contacts are restricted to ∼280 kb, creating a domain with distinct structural properties. We also show how other NAPs contribute to nucleoid organization, such as H-NS, which restricts short-range interactions. Combined, these results reveal the contributions of major evolutionarily conserved proteins in a bacterial chromosome organization.

Also flagged:MHC class Iadaptive immunityimmune responsesantigen presentationantimicrobial responsestissue homeostasis
Journal Article 2018-01-18 ✓ 1 Snippet Linehan JL, Harrison OJ, Han SJ, Byrd AL, Vujkovic-Cvijin I, Villarino AV, Sen SK, Shaik J, Smelkinson M, Tamoutounour S, Collins N, Bouladoux N, Dzutsev A, Rosshart SP, Arbuckle JH, Wang CR, Kristie TM, Rehermann B, Trinchieri G, Brenchley JM, O'Shea JJ, Belkaid Y.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

Mammalian barrier surfaces are constitutively colonized by numerous microorganisms. We explored how the microbiota was sensed by the immune system and the defining properties of such responses. Here, we show that a skin commensal can induce T cell responses in a manner that is restricted to non-classical MHC class I molecules. These responses are uncoupled from inflammation and highly distinct from pathogen-induced cells. Commensal-specific T cells express a defined gene signature that is characterized by expression of effector genes together with immunoregulatory and tissue-repair signatures. As such, non-classical MHCI-restricted commensal-specific immune responses not only promoted protection to pathogens, but also accelerated skin wound closure. Thus, the microbiota can induce a highly physiological and pleiotropic form of adaptive immunity that couples antimicrobial function with tissue repair. Our work also reveals that non-classical MHC class I molecules, an evolutionarily ancient arm of the immune system, can promote homeostatic immunity to the microbiota.

Also flagged:strontiumhydroxyapatitebone formationsodium alginateinfectionsdegradation
Journal Article 2018-01-18 No Snippets Carmo ABXD, Sartoretto SC, Alves ATNN, Granjeiro JM, Miguel FB, Calasans-Maia J, Calasans-Maia MD.
Show Full Abstract

This study aimed to evaluate bone repair in rat dental sockets after implanting nanostructured carbonated hydroxyapatite/sodium alginate (CHA) and nanostructured carbonated hydroxyapatite/sodium alginate containing 5% strontium microspheres (SrCHA) as bone substitute materials. Twenty male Wistar rats were randomly divided into two experimental groups: CHA and SrCHA (n=5/period/group). After one and 6 weeks of extraction of the right maxillary central incisor and biomaterial implantation, 5 μm bone blocks were obtained for histomorphometric evaluation. The parameters evaluated were remaining biomaterial, loose connective tissue and newly formed bone in a standard area. Statistical analysis was performed by Mann-Withney and and Wilcoxon tests at 95% level of significance. The histomorphometric results showed that the microspheres showed similar fragmentation and bio-absorbation (p>0.05). We observed the formation of new bones in both groups during the same experimental periods; however, the new bone formation differed significantly between the weeks 1 and 6 (p=0.0039) in both groups. The CHA and SrCHA biomaterials were biocompatible, osteoconductive and bioabsorbable, indicating their great potential for clinical use as bone substitutes.

Also flagged:estrogen receptorprogesterone receptorPRcancerestrogen receptor-alphatriterpene glycosides
Journal Article 2018-01-18 No Snippets Szmyd M, Lloyd V, Hallman K, Aleck K, Mladenovik V, McKee C, Morse M, Bedgood T, Dinda S.
Show Full Abstract

The North American plant <i>Cimicifuga racemosa</i>, also known as black cohosh (BC), is a herb that recently has gained attention for its hormonal effects. As the usage of hormone replacement therapy is declining due to its adverse effects in women with cancer, many are turning to herbal remedies like BC to treat menopausal symptoms. It is crucial to determine whether the effects of BC involve estrogen receptor-alpha (ERα). Previous studies from our laboratory have shown ERα to be a possible molecular target for BC. In this study, we examined the effects of BC (8% triterpene glycosides) alone and in combination with hormones and antihormones on the cellular viability, expression of ERα and progesterone receptor (PR)-A/B, and cytolocalization of ERα in ER (+) and PR-A/B (+) T-47D breast cancer cells. Cells were cultured and proteins were extracted and quantified. Western blot analysis revealed alterations in the expression of ERα and PR after treatment with BC (5-100 µM). BC induced a concentration-dependent decrease in ERα and PR protein levels when compared to the control. Image cytometric analysis with propidium iodide staining was used to enumerate changes in T-47D cell number and viability. A decrease in T-47D cell viability was observed upon treatment with 5-100 µM BC. The ideal concentration of BC (100 µM) was used in combination with hormones and antihormones in an effort to further understand the possible similarities between this compound and other known effectors of ERα and PR. After a 24-hour concomitant treatment with and/or in combination of BC, estradiol, ICI 182, 780, and Tamoxifen, downregulation of ERα and PR protein levels was observed. Delineating the role of BC in the regulation of ERα, PR, as well as its mechanisms of action, may be important in understanding the influence of BC on hormone receptors in breast cancer.

Also flagged:cirrhosisportal hypertensioninfectionsliver diseaseStage Liver Diseaseesophageal varices
Journal Article 2018-01-18 ✓ 1 Snippet Chirapongsathorn S, Krittanawong C, Enders FT, Pendegraft R, Mara KC, Borah BJ, Visscher SL, Loftus CG, Shah VH, Talwalkar JA, Kamath PS.
In-Text Gene Mentions

…other (such ashemochromatosis, α‐1 antitrypsin deficiency,…

Show Full Abstract

We examined risks for first hospitalization and the rate, risk factors, costs, and 1-year outcome of 30-day readmission among patients admitted for complications of cirrhosis. Data were retrospectively analyzed for adult patients with cirrhosis residing in Minnesota, Iowa, or Wisconsin and admitted from 2010 through 2013 at both campuses of the Mayo Clinic Hospital in Rochester, MN. Readmission was captured at the two hospitals as well as at community hospitals in the tristate area within the Mayo Clinic Health System. The incidence of hospitalization for complications of cirrhosis was 100/100,000 population, with increasing age and male sex being the strongest risks for hospitalization. For the 2,048 hospitalized study patients, the overall 30-day readmission rate was 32%; 498 (24.3%) patients were readmitted to Mayo Clinic hospitals and 157 (7.7%) to community hospitals, mainly for complications of portal hypertension (52%) and infections (30%). Readmission could not be predicted accurately. There were 146 deaths during readmission and an additional 105 deaths up to 1 year of follow-up (50.4% total mortality). Annual postindex hospitalization costs for those with a 30-day readmission were substantially higher ($73,252) than those readmitted beyond 30 days ($62,053) or those not readmitted ($5,719). At 1-year follow-up, only 20.4% of patients readmitted within 30 days were at home. In conclusion, patients with cirrhosis have high rates of hospitalization, especially among men over 65 years, and of unscheduled 30-day readmission. Readmission cannot be accurately predicted. Postindex hospitalization costs are high; nationally, the annual costs are estimated to be more than $4.45 billion. Only 20% of patients readmitted within 30 days are home at 1 year. (<i>Hepatology Communications</i> 2018;2:188-198).

Also flagged:Toll-like receptorsautosomal dominant neurodegenerative disordercortical atrophyinnate immune receptorsTLRsHD
Journal Article 2018-01-18 ✓ 2 Snippets Griffioen K, Mattson MP, Okun E.
In-Text Gene Mentions

Indeed, the N171-82Q HD mouse model utilized in this study expresses exons 1 and 2 of the huntingtin gene (with expanded polyQ82) under the control of a mouse prion promoter, resulting in neuronal-only transgene expression and at a level distinct from that of the endogenous Htt gene.

…of the endogenousHttgene.…

Show Full Abstract

Huntington's disease (HD), an autosomal dominant neurodegenerative disorder characterized by progressive striatal and cortical atrophy, has been strongly linked with neuroinflammation. Toll-like receptors, a family of innate immune receptors, are a major pathway for neuroinflammation with pleiotropic effects on neuronal plasticity and neurodevelopment. We assessed whether deficiency for TLRs 2, 3 or 4 affects life expectancy in the N171-82Q mouse model of HD. Our data indicate that homozygous TLRs 2 and 3 as well as heterozygous TLR4 deficiency significantly extends the life expectancy of HD mice. Our data suggest that multiple TLR pathways may be involved in the neuroinflammatory and degenerative processes during HD.

Also flagged:cell proliferationcolorectal cancertumorsHelicobacter pylori infectioncellsluciferase
Journal Article 2018-01-17 ✓ 1 Snippet Xie S, Ge Q, Wang X, Sun X, Kang Y.
In-Text Gene Mentions

Znfx1

Show Full Abstract

The incidence and mortality rate of colorectal cancer (CRC) have been significantly increasing. However, mechanisms involved in CRC progression are still unclear. LncRNA ZFAS1 has been verified as oncogenic molecular in a series of tumors, including CRC. However, the underlying mechanism of ZFAS1 in CRC carcinogenesis remains unclear. In the present study, our data showed that ZFAS1 expression was significantly upregulated in CRC tissues and cell lines. Correlation analysis showed that high ZFAS1 expression was significantly associated with Helicobacter pylori infection, lymph nodes metastasis, advanced TNM stage and poor overall survival of CRC patients. Loss-of-function experiments revealed that ZFAS1 inhibition could markedly suppress CRC cells proliferation and invasion both in vitro and in vivo. Bioinformatics analysis and luciferase reporter assay revealed that ZFAS1 directly interacted with miR-484. Rescue experiments showed that miR-484 inhibitor reversed the tumor suppressing roles of ZFAS1 knockdown on CRC cells. Therefore, our study suggested that ZFAS1 could act as an oncogene in CRC tumorigenesis, and discovered the functional regulatory pathway of ZFAS1 sponging miR-484.

Also flagged:defectseclosionnubFLPMhcHuntingtin
Journal Article 2018-01-17 ✓ 5 Snippets Calpena E, López Del Amo V, Chakraborty M, Llamusí B, Artero R, Espinós C, Galindo MI.
In-Text Gene Mentions

To model HD in Drosophila, we used a construct for the expression of human HTT exon 1 containing expanded polyglutamine repeats (Htt-Ex1-pQ93) that has been demonstrated to induce neurodegeneration (Steffan et al., 2001).

HD is a fatal neurodegenerative condition caused by expansion of the polyglutamine tract in the Huntingtin (Htt) protein, and the precise disease manifestations and their timing are affected by modifier genes (Gusella and MacDonald, 2009).

The Htt-Ex1-pQ93 corresponds to a truncated version of the gene coding for only a few endogenous amino acids, so it is possible that jp functions as a modifier for other types of pathogenic poly-Q expansions.

…al., 2002 ), UAS-Htt-ex1-pQ93 ( Steffan et…

…TheHtt-related neurodegeneration is …

Show Full Abstract

Members of the Junctophilin (JPH) protein family have emerged as key actors in all excitable cells, with crucial implications for human pathophysiology. In mammals, this family consists of four members (JPH1-JPH4) that are differentially expressed throughout excitable cells. The analysis of knockout mice lacking JPH subtypes has demonstrated their essential contribution to physiological functions in skeletal and cardiac muscles and in neurons. Moreover, mutations in the human <i>JPH2</i> gene are associated with hypertrophic and dilated cardiomyopathies; mutations in <i>JPH3</i> are responsible for the neurodegenerative Huntington's disease-like-2 (HDL2), whereas <i>JPH1</i> acts as a genetic modifier in Charcot-Marie-Tooth 2K peripheral neuropathy. <i>Drosophila melanogaster</i> has a single <i>junctophilin</i> (<i>jp</i>) gene, as is the case in all invertebrates, which might retain equivalent functions of the four homologous JPH genes present in mammalian genomes. Therefore, owing to the lack of putatively redundant genes, a <i>jp</i><i>Drosophila</i> model could provide an excellent platform to model the Junctophilin-related diseases, to discover the ancestral functions of the JPH proteins and to reveal new pathways. By up- and downregulation of Jp in a tissue-specific manner in <i>Drosophila</i>, we show that altering its levels of expression produces a phenotypic spectrum characterized by muscular deficits, dilated cardiomyopathy and neuronal alterations. Importantly, our study has demonstrated that Jp modifies the neuronal degeneration in a <i>Drosophila</i> model of Huntington's disease, and it has allowed us to uncover an unsuspected functional relationship with the Notch pathway. Therefore, this <i>Drosophila</i> model has revealed new aspects of Junctophilin function that can be relevant for the disease mechanisms of their human counterparts.

Also flagged:chronic mental illnessesmovement disordersVitamin Eschizophreniachronic mental illnesspsychiatric disorders
Journal Article 2018-01-17 No Snippets Soares-Weiser K, Maayan N, Bergman H.
Show Full Abstract

<h4>Background</h4>Antipsychotic (neuroleptic) medication is used extensively to treat people with chronic mental illnesses. Its use, however, is associated with adverse effects, including movement disorders such as tardive dyskinesia (TD) - a problem often seen as repetitive involuntary movements around the mouth and face. Vitamin E has been proposed as a treatment to prevent or decrease TD.<h4>Objectives</h4>The primary objective was to determine the clinical effects of vitamin E in people with schizophrenia or other chronic mental illness who had developed antipsychotic-induced TD.The secondary objectives were:1. to examine whether the effect of vitamin E was maintained as duration of follow-up increased;2. to test the hypothesis that the use of vitamin E is most effective for those with early onset TD (less than five years) SEARCH METHODS: We searched the Cochrane Schizophrenia Group Trials Register (July 2015 and April 2017), inspected references of all identified studies for further trials and contacted authors of trials for additional information.<h4>Selection criteria</h4>We included reports if they were controlled trials dealing with people with antipsychotic-induced TD and schizophrenia who remained on their antipsychotic medication and had been randomly allocated to either vitamin E or to a placebo, no intervention, or any other intervention.<h4>Data collection and analysis</h4>We independently extracted data from these trials and we estimated risk ratios (RR) or mean differences (MD), with 95% confidence intervals (CI). We assumed that people who left early had no improvement. We assessed risk of bias and created a 'Summary of findings' table using GRADE.<h4>Main results</h4>The review now includes 13 poorly reported randomised trials (total 478 people), all participants were adults with chronic psychiatric disorders, mostly schizophrenia, and antipsychotic-induced TD. There was no clear difference between vitamin E and placebo for the outcome of TD: not improved to a clinically important extent (6 RCTs, N = 264, RR 0.95, 95% CI 0.89 to 1.01, low-quality evidence). However, people allocated to placebo may show more deterioration of their symptoms compared with those given vitamin E (5 RCTs, N = 85, RR 0.23, 95% CI 0.07 to 0.76, low-quality evidence). There was no evidence of a difference in the incidence of any adverse effects (9 RCTs, N = 205, RR 1.21, 95% CI 0.35 to 4.15, very low-quality evidence), extrapyramidal adverse effects (1 RCT, N = 104, MD 1.10, 95% CI -1.02 to 3.22, very low-quality evidence), or acceptability of treatment (measured by participants leaving the study early) (medium term, 8 RCTs, N = 232, RR 1.07, 95% CI 0.64 to 1.80, very low-quality evidence). No trials reported on social confidence, social inclusion, social networks, or personalised quality of life, outcomes designated important to patients. There is no trial-based information regarding the effect of vitamin E for those with early onset of TD.<h4>Authors' conclusions</h4>Small trials of limited quality suggest that vitamin E may protect against deterioration of TD. There is no evidence that vitamin E improves symptoms of this problematic and disfiguring condition once established. New and better trials are indicated in this under-researched area, and, of the many adjunctive treatments that have been given for TD, vitamin E would be a good choice for further evaluation.

Also flagged:cancerscardiovascular diseasesChromatinneurodegenerative diseasesspliceosomeoligonucleotide
Journal Article 2018-01-17 ✓ 1 Snippet Wanowska E, Kubiak MR, Rosikiewicz W, Makałowska I, Szcześniak MW.
In-Text Gene Mentions

A dicer‐dependent mechanism was also suggested in Huntington’s disease (Chung, Rudnicki, Yu, & Margolis, 2011), a neurodegenerative disorder caused by CAG trinucleotide repeat expansion within the first exon of the Huntingtin (HTT) gene.

Show Full Abstract

Antisense transcription is a widespread phenomenon in mammalian genomes, leading to production of RNAs molecules referred to as natural antisense transcripts (NATs). NATs apply diverse transcriptional and post-transcriptional regulatory mechanisms to carry out a wide variety of biological roles that are important for the normal functioning of living cells, but their dysfunctions can be associated with human diseases. In this review, we attempt to provide a molecular basis for the involvement of NATs in the etiology of human disorders such as cancers and neurodegenerative and cardiovascular diseases. We also discuss the pros and cons of oligonucleotide-based therapies targeted against NATs, and we comment on state-of-the-art progress in this promising area of clinical research. WIREs RNA 2018, 9:e1461. doi: 10.1002/wrna.1461 This article is categorized under: RNA in Disease and Development > RNA in Disease Regulatory RNAs/RNAi/Riboswitches > Regulatory RNAs RNA Interactions with Proteins and Other Molecules > Small Molecule-RNA Interactions.

Also flagged:polymerasedifferentiationMYF6SOX9SHOXCCND1
Journal Article 2018-01-17 ✓ 5 Snippets Lin S, Lin X, Zhang Z, Jiang M, Rao Y, Nie Q, Zhang X.
In-Text Gene Mentions

The SOX6 amino acid sequence was analyzed by GlobPlot online software [20] to predict the disordered region.

In this study, from the GlobPlot analysis of the SOX6 amino acid sequence, we found that the 300–580 aa region is a disorder region.

From the GlobPlot analysis of the SOX6 amino acid sequence, we found that the 307–508 aa was located in the disordered region and consistent with the prediction results of the Swiss model (Figure 7c).

…Number Variation inSOX6Contributes to Chicken…

…expression level ofSOX6mRNA was positively…

Show Full Abstract

Copy number variations (CNVs), which cover many functional genes, are associated with complex diseases, phenotypic diversity and traits that are economically important to raising chickens. The sex-determining region Y-box 6 (<i>Sox6</i>) plays a key role in fast-twitch muscle fiber differentiation of zebrafish and mice, but it is still unknown whether <i>SOX6</i> plays a role in chicken skeletal muscle development. We identified two copy number polymorphisms (CNPs) which were significantly related to different traits on the genome level in chickens by AccuCopy<sup>®</sup> and CNVplex<sup>®</sup> analyses. Notably, five white recessive rock (CN = 1, CN = 3) variant individuals and two Xinghua (CN = 3) variant individuals contain a CNP13 (chromosome5: 10,500,294-10,675,531) which overlaps with <i>SOX6</i>. There is a disordered region in SOX6 proteins 265-579 aa coded by a partial CNV overlapping region. A quantitative real-time polymerase chain reaction showed that the expression level of SOX6 mRNA was positively associated with CNV and highly expressed during the skeletal muscle cell differentiation in chickens. After the knockdown of the SOX6, the expression levels of IGFIR1, MYF6, SOX9, SHOX and CCND1 were significantly down-regulated. All of them directly linked to muscle development. These results suggest that the number of CNVs in the CNP13 is positively associated with the expression level of SOX6, which promotes the proliferation and differentiation of skeletal muscle cells by up-regulating the expression levels of the muscle-growth-related genes in chickens as in other animal species.

Also flagged:IAintracranial aneurysmIntracranialintracranial aneurysmsaneurysmsvascular diseases
Journal Article 2018-01-17 No Snippets Tutino VM, Poppenberg KE, Jiang K, Jarvis JN, Sun Y, Sonig A, Siddiqui AH, Snyder KV, Levy EI, Kolega J, Meng H.
Show Full Abstract

<h4>Background</h4>Unruptured intracranial aneurysms (IAs) are typically asymptomatic and undetected except for incidental discovery on imaging. Blood-based diagnostic biomarkers could lead to improvements in IA management. This exploratory study examined circulating neutrophils to determine whether they carry RNA expression signatures of IAs.<h4>Methods</h4>Blood samples were collected from patients receiving cerebral angiography. Eleven samples were collected from patients with IAs and 11 from patients without IAs as controls. Samples from the two groups were paired based on demographics and comorbidities. RNA was extracted from isolated neutrophils and subjected to next-generation RNA sequencing to obtain differential expressions for identification of an IA-associated signature. Bioinformatics analyses, including gene set enrichment analysis and Ingenuity Pathway Analysis, were used to investigate the biological function of all differentially expressed transcripts.<h4>Results</h4>Transcriptome profiling identified 258 differentially expressed transcripts in patients with and without IAs. Expression differences were consistent with peripheral neutrophil activation. An IA-associated RNA expression signature was identified in 82 transcripts (p<0.05, fold-change ≥2). This signature was able to separate patients with and without IAs on hierarchical clustering. Furthermore, in an independent, unpaired, replication cohort of patients with IAs (n = 5) and controls (n = 5), the 82 transcripts separated 9 of 10 patients into their respective groups.<h4>Conclusion</h4>Preliminary findings show that RNA expression from circulating neutrophils carries an IA-associated signature. These findings highlight a potential to use predictive biomarkers from peripheral blood samples to identify patients with IAs.

Also flagged:Hsp70membranemembranesendoplasmic reticulummitochondriamolecular chaperones
Journal Article 2018-01-17 No Snippets Craig EA.
Show Full Abstract

Efficient movement of proteins across membranes is required for cell health. The translocation process is particularly challenging when the channel in the membrane through which proteins must pass is narrow-such as those in the membranes of the endoplasmic reticulum and mitochondria. Hsp70 molecular chaperones play roles on both sides of these membranes, ensuring efficient translocation of proteins synthesized on cytosolic ribosomes into the interior of these organelles. The "import motor" in the mitochondrial matrix, which is essential for driving the movement of proteins across the mitochondrial inner membrane, is arguably the most complex Hsp70-based system in the cell.

Also flagged:non-communicable diseasehypertensionNOS1APCardiovascular diseasesMYRFPOC1B
Journal Article 2018-01-17 No Snippets Hendry LM, Sahibdeen V, Choudhury A, Norris SA, Ramsay M, Lombard Z, of the AWI-Gen study and as members of the H3Africa Consortium.
Show Full Abstract

<h4>Background</h4>Cardiovascular diseases (CVDs) are the leading cause of non-communicable disease deaths globally, with hypertension being a major risk factor contributing to CVDs. Blood pressure is a heritable trait, with relatively few genetic studies having been performed in Africans. This study aimed to identify genetic variants associated with variance in systolic (SBP) and diastolic (DBP) blood pressure in black South Africans.<h4>Methods</h4>Genotyping was performed using the Metabochip in a subset of participants (mixed sex; median age 17.9) and their adult female caregivers (median age 41.0) from the Birth to Twenty cohort (n = 1947). Data were analysed as a merged dataset (all participants and caregivers together) in GEMMA (v0.94.1) using univariate linear mixed models, incorporating a centered relatedness matrix to account for the relatedness between individuals and with adjustments for age, sex, BMI and principal components of the genotype information.<h4>Results</h4>Association analysis identified regions of interest in the NOS1AP (DBP: rs112468105 - p = 7.18 × 10<sup>-5</sup> and SBP: rs4657181 - p = 4.04 × 10<sup>-5</sup>), MYRF (SBP: rs11230796 - p = 2.16 × 10<sup>-7</sup>, rs400075 - p = 2.88 × 10<sup>-7</sup>) and POC1B (SBP: rs770373 - p = 7.05 × 10<sup>-5</sup>, rs770374 - p = 9.05 × 10<sup>-5</sup>) genes and some intergenic regions (DACH1|LOC440145 (DBP: rs17240498 - p = 4.91 × 10<sup>-6</sup> and SBP: rs17240498 - p = 2.10 × 10<sup>-5</sup>) and INTS10|LPL (SBP: rs55830938 - p = 1.30 × 10<sup>-5</sup>, rs73599609 - p = 5.78 × 10<sup>-5</sup>, rs73667448 - p = 6.86 × 10<sup>-5</sup>)).<h4>Conclusions</h4>The study provided further insight into the contribution of genetic variants to blood pressure in black South Africans. Future functional and replication studies in larger samples are required to confirm the role of the identified loci in blood pressure regulation and whether or not these variants are African-specific.

Also flagged:netrin 1axonsNtn1
Journal Article 2018-01-17 No Snippets Moreno-Bravo JA, Roig Puiggros S, Blockus H, Dominici C, Zelina P, Mehlen P, Chédotal A.
Show Full Abstract

During the development of the central nervous system (CNS), only motor axons project into peripheral nerves. Little is known about the cellular and molecular mechanisms that control the development of a boundary at the CNS surface and prevent CNS neuron emigration from the neural tube. It has previously been shown that a subset of spinal cord commissural axons abnormally invades sensory nerves in <i>Ntn1</i> hypomorphic embryos and <i>Dcc</i> knockouts. However, whether netrin 1 also plays a similar role in the brain is unknown. In the hindbrain, precerebellar neurons migrate tangentially under the pial surface, and their ventral migration is guided by netrin 1. Here, we show that pontine neurons and inferior olivary neurons, two types of precerebellar neurons, are not confined to the CNS in <i>Ntn1</i> and <i>Dcc</i> mutant mice, but that they invade the trigeminal, auditory and vagus nerves. Using a <i>Ntn1</i> conditional knockout, we show that netrin 1, which is released at the pial surface by ventricular zone progenitors is responsible for the CNS confinement of precerebellar neurons. We propose, that netrin 1 distribution sculpts the CNS boundary by keeping CNS neurons in netrin 1-rich domains.

Also flagged:C1sglycerolextracellularDanazolooC1-Inh
Journal Article 2018-01-17 ✓ 2 Snippets Caccia S, Suffritti C, Carzaniga T, Berardelli R, Berra S, Martorana V, Fra A, Drouet C, Cicardi M.
In-Text Gene Mentions

…a mutant serpin,antithrombin-III, was found in…

…been demonstrated forantithrombin-III51 and AAT…

Show Full Abstract

C1-inhibitor is a serine protease inhibitor (serpin) controlling complement and contact system activation. Gene mutations result in reduced C1-inhibitor functional plasma level causing hereditary angioedema, a life-threatening disorder. Despite a stable defect, the clinical expression of hereditary angioedema is unpredictable, and the molecular mechanism underlying this variability remains undisclosed. Here we report functional and structural studies on the Arg378Cys C1-inhibitor mutant found in a patient presenting reduced C1-inhibitor levels, episodically undergoing normalization. Expression studies resulted in a drop in mutant C1-innhibitor secretion compared to wild-type. Notwithstanding, the purified proteins had similar features. Thermal denaturation experiments showed a comparable denaturation profile, but the mutant thermal stability decays when tested in conditions reproducing intracellular crowding.Our findings suggest that once correctly folded, the Arg378Cys C1-inhibitor is secreted as an active, although quite unstable, monomer. However, it could bear a folding defect, occasionally promoting protein oligomerization and interfering with the secretion process, thus accounting for its plasma level variability. This defect is exacerbated by the nature of the mutation since the acquired cysteine leads to the formation of non-functional homodimers through inter-molecular disulphide bonding. All the proposed phenomena could be modulated by specific environmental conditions, rendering this mutant exceptionally vulnerable to mild stress.

Also flagged:membranePDchronic kidney diseaseglucoseperitonitissialic acid
Journal Article 2018-01-17 ✓ 1 Snippet Ferrantelli E, Farhat K, Ederveen ALH, Reiding KR, Beelen RHJ, van Ittersum FJ, Wuhrer M, Dotz V.
In-Text Gene Mentions

…whereas haptoglobin andantithrombin-IIIwere upregulated 46…

Show Full Abstract

Mass spectrometric glycomics was used as an innovative approach to identify biomarkers in serum and dialysate samples from peritoneal dialysis (PD) patients. PD is a life-saving treatment worldwide applied in more than 100,000 patients suffering from chronic kidney disease. PD treatment uses the peritoneum as a natural membrane to exchange waste products from blood to a glucose-based solution. Daily exposure of the peritoneal membrane to these solutions may cause complications such as peritonitis, fibrosis and inflammation which, in the long term, lead to the failure of the treatment. It has been shown in the last years that protein N-glycosylation is related to inflammatory and fibrotic processes. Here, by using a recently developed MALDI-TOF-MS method with linkage-specific sialic acid derivatisation, we showed that alpha2,6-sialylation, especially in triantennary N-glycans from peritoneal effluents, is associated with critical clinical outcomes in a prospective cohort of 94 PD patients. Moreover, we found an association between the levels of presumably immunoglobulin-G-related glycans as well as galactosylation of diantennary glycans with PD-related complications such as peritonitis and loss of peritoneal mesothelial cell mass. The observed glycomic changes point to changes in protein abundance and protein-specific glycosylation, representing candidate functional biomarkers of PD and associated complications.

Also flagged:NUDT5nucleotide-metabolizing enzymesNUDIX5ADPribose
Journal Article 2018-01-17 No Snippets Page BDG, Valerie NCK, Wright RHG, Wallner O, Isaksson R, Carter M, Rudd SG, Loseva O, Jemth AS, Almlöf I, Font-Mateu J, Llona-Minguez S, Baranczewski P, Jeppsson F, Homan E, Almqvist H, Axelsson H, Regmi S, Gustavsson AL, Lundbäck T, Scobie M, Strömberg K, Stenmark P, Beato M, Helleday T.
Show Full Abstract

With a diverse network of substrates, NUDIX hydrolases have emerged as a key family of nucleotide-metabolizing enzymes. NUDT5 (also called NUDIX5) has been implicated in ADP-ribose and 8-oxo-guanine metabolism and was recently identified as a rheostat of hormone-dependent gene regulation and proliferation in breast cancer cells. Here, we further elucidate the physiological relevance of known NUDT5 substrates and underscore the biological requirement for NUDT5 in gene regulation and proliferation of breast cancer cells. We confirm the involvement of NUDT5 in ADP-ribose metabolism and dissociate a relationship to oxidized nucleotide sanitation. Furthermore, we identify potent NUDT5 inhibitors, which are optimized to promote maximal NUDT5 cellular target engagement by CETSA. Lead compound, TH5427, blocks progestin-dependent, PAR-derived nuclear ATP synthesis and subsequent chromatin remodeling, gene regulation and proliferation in breast cancer cells. We herein present TH5427 as a promising, targeted inhibitor that can be used to further study NUDT5 activity and ADP-ribose metabolism.

Also flagged:peroxidaseHistone modificationRatgene expressionDNaseIhypersensitivity
Journal Article 2018-01-17 ✓ 1 Snippet Li IMH, Liu K, Neal A, Clegg PD, De Val S, Bou-Gharios G.
In-Text Gene Mentions

…of L-SOX5 andSOX620 .…

Show Full Abstract

The transcriptional mechanism through which chondrocytes control the spatial and temporal composition of the cartilage tissue has remained largely elusive. The central aim of this study was to identify whether transcriptional enhancers played a role in the organisation of the chondrocytes in cartilaginous tissue. We focused on the Aggrecan gene (Acan) as it is essential for the normal structure and function of cartilage and it is expressed developmentally in different stages of chondrocyte maturation. Using transgenic reporter studies in mice we identified four elements, two of which showed individual chondrocyte developmental stage specificity. In particular, one enhancer (-80) distinguishes itself from the others by being predominantly active in adult cartilage. Furthermore, the -62 element uniquely drove reporter activity in early chondrocytes. The remaining chondrocyte specific enhancers, +28 and -30, showed no preference to chondrocyte type. The transcription factor SOX9 interacted with all the enhancers in vitro and mutation of SOX9 binding sites in one of the enhancers (-30) resulted in a loss of its chondrocyte specificity and ectopic enhancer reporter activity. Thus, the Acan enhancers orchestrate the precise spatiotemporal expression of this gene in cartilage types at different stages of development and adulthood.

Also flagged:oligodendrocyte precursor cell differentiationmyelindemyelination diseasesion channelsmyelinationmyelin basic protein
Journal Article 2018-01-17 ✓ 1 Snippet Hou X, Zhang R, Wang J, Li Y, Li F, Zhang Y, Zheng X, Shen Y, Wang Y, Zhou L.
In-Text Gene Mentions

…Y-box (Sox)10, Sox2,Sox6, inhibitor of DNA…

Show Full Abstract

Oligodendrocytes (OLs) are myelin-forming cells that are present within the central nervous system. Impaired oligodendrocyte precursor cell (OPC) differentiation into mature OLs is a major cause of demyelination diseases. Therefore, identifying the underlying molecular mechanisms of OPC differentiation is crucial to understand the processes of myelination and demyelination. It has been acknowledged that various extrinsic and intrinsic factors are involved in the control of OPC differentiation; however, the function of ion channels, particularly the voltage‑gated chloride channel (CLC), in OPC differentiation and myelination are not fully understood. The present study demonstrated that CLC‑2 may be a positive modulator of OPC differentiation and myelination. Western blotting results revealed that CLC‑2 was expressed in both OPCs and OLs. Furthermore, CLC‑2 currents (ICLC‑2) were recorded in both types of cells. The inhibition of ICLC‑2 by GaTx2, a blocker of CLC‑2, was demonstrated to be higher in OPCs compared with OLs, indicating that CLC‑2 may serve a role in OL differentiation. The results of western blotting and immunofluorescence staining also demonstrated that the expression levels of myelin basic protein were reduced following GaTx2 treatment, indicating that the differentiation of OPCs into OLs was inhibited following CLC‑2 inhibition. In addition, following western blot analysis, it was also demonstrated that the protein expression of the myelin proteins yin yang 1, myelin regulatory factor, Smad‑interacting protein 1 and sex‑determining region Y‑box 10 were regulated by CLC‑2 inhibition. Taken together, the results of the present study indicate that CLC‑2 may be a positive regulator of OPC differentiation and able to contribute to myelin formation and repair in myelin‑associated diseases by controlling the number and open state of CLC-2 channels.

Also flagged:systemic sclerosislipopolysaccharideinterferon gammaIFNγmTORGSDMA
Journal Article 2018-01-17 ✓ 2 Snippets Moreno-Moral A, Bagnati M, Koturan S, Ko JH, Fonseca C, Harmston N, Game L, Martin J, Ong V, Abraham DJ, Denton CP, Behmoaras J, Petretto E.
In-Text Gene Mentions

We also found RASAL1, a gene identified by WES that is enriched for deleterious variants in dcSSc.4 The set of downregulated genes included IKZF3 and TNFSF4, both identified in a meta-GWAS SSc study,18 as well as TERT and TMPRSS3, candidate genes for dcSSc identified by WES.4 Therefore our DE analysis from patients with SSc and controls revealed hundreds of genes associated with SSc in MDMs, including genes previously implicated in the genetic aetiology of the disease.

…included IKZF3 andTNFSF4, both identified…

Show Full Abstract

<h4>Objectives</h4>Several common and rare risk variants have been reported for systemic sclerosis (SSc), but the effector cell(s) mediating the function of these genetic variants remains to be elucidated. While innate immune cells have been proposed as the critical targets to interfere with the disease process underlying SSc, no studies have comprehensively established their effector role. Here we investigated the contribution of monocyte-derived macrophages (MDMs) in mediating genetic susceptibility to SSc.<h4>Methods</h4>We carried out RNA sequencing and genome-wide genotyping in MDMs from 57 patients with SSc and 15 controls. Our differential expression and expression quantitative trait locus (eQTL) analysis in SSc was further integrated with epigenetic, expression and eQTL data from skin, monocytes, neutrophils and lymphocytes.<h4>Results</h4>We identified 602 genes upregulated and downregulated in SSc macrophages that were significantly enriched for genes previously implicated in SSc susceptibility (P=5×10<sup>-4</sup>), and 270 <i>cis</i>-regulated genes in MDMs. Among these, <i>GSDMA</i> was reported to carry an SSc risk variant (rs3894194) regulating expression of neighbouring genes in blood. We show that <i>GSDMA</i> is upregulated in SSc MDMs (P=8.4×10<sup>-4</sup>) but not in the skin, and is a significant eQTL in SSc macrophages and lipopolysaccharide/interferon gamma (IFNγ)-stimulated monocytes. Furthermore, we identify an SSc macrophage transcriptome signature characterised by upregulation of glycolysis, hypoxia and mTOR signalling and a downregulation of IFNγ response pathways.<h4>Conclusions</h4>Our data further establish the link between macrophages and SSc, and suggest that the contribution of the rs3894194 risk variant to SSc susceptibility can be mediated by <i>GSDMA</i> expression in macrophages.

Also flagged:myelinneurogliosischolesterolCyp51lanosterol 14-α-demethylaseSrebf1
Journal Article 2018-01-17 ✓ 1 Snippet Moyano AL, Steplowski J, Wang H, Son KN, Rapolti DI, Marshall J, Elackattu V, Marshall MS, Hebert AK, Reiter CR, Ulloa V, Pituch KC, Givogri MI, Lu QR, Lipton HL, Bongarzone ER.
In-Text Gene Mentions

Sox6

Show Full Abstract

Analysis of microRNA (miR) expression in the central nervous system white matter of SJL mice infected with the BeAn strain of Theiler's murine encephalomyelitis virus (TMEV) revealed a significant reduction of miR-219, a critical regulator of myelin assembly and repair. Restoration of miR-219 expression by intranasal administration of a synthetic miR-219 mimic before disease onset ameliorates clinical disease, reduces neurogliosis, and partially recovers motor and sensorimotor function by negatively regulating proinflammatory cytokines and virus RNA replication. Moreover, RNA sequencing of host lesions showed that miR-219 significantly downregulated two genes essential for the biosynthetic cholesterol pathway, Cyp51 (lanosterol 14-α-demethylase) and Srebf1 (sterol regulatory element-binding protein-1), and reduced cholesterol biosynthesis in infected mice and rat CG-4 glial precursor cells in culture. The change in cholesterol biosynthesis had both anti-inflammatory and anti-viral effects. Because RNA viruses hijack endoplasmic reticulum double-layered membranes to provide a platform for RNA virus replication and are dependent on endogenous pools of cholesterol, miR-219 interference with cholesterol biosynthesis interfered virus RNA replication. These findings demonstrate that miR-219 inhibits TMEV-induced demyelinating disease through its anti-inflammatory and anti-viral properties.

Also flagged:lumenextracellularWntNotchR-spondinR-spondin 1
Journal Article 2018-01-17 ✓ 2 Snippets Wang Y, Kim R, Hinman SS, Zwarycz B, Magness ST, Allbritton NL.
In-Text Gene Mentions

…cence staining (olfactomedin [Olfm4]/keratin 20 [KRT20]) of…

…KRT20 (red) andOlfm4(green).…

Show Full Abstract

The relationship between intestinal stem cells (ISCs) and the surrounding niche environment is complex and dynamic. Key factors localized at the base of the crypt are necessary to promote ISC self-renewal and proliferation, to ultimately provide a constant stream of differentiated cells to maintain the epithelial barrier. These factors diminish as epithelial cells divide, migrate away from the crypt base, differentiate into the postmitotic lineages, and end their life span in approximately 7 days when they are sloughed into the intestinal lumen. To facilitate the rapid and complex physiology of ISC-driven epithelial renewal, in vivo gradients of growth factors, extracellular matrix, bacterial products, gases, and stiffness are formed along the crypt-villus axis. New bioengineered tools and platforms are available to recapitulate various gradients and support the stereotypical cellular responses associated with these gradients. Many of these technologies have been paired with primary small intestinal and colonic epithelial cells to re-create select aspects of normal physiology or disease states. These biomimetic platforms are becoming increasingly sophisticated with the rapid discovery of new niche factors and gradients. These advancements are contributing to the development of high-fidelity tissue constructs for basic science applications, drug screening, and personalized medicine applications. Here, we discuss the direct and indirect evidence for many of the important gradients found in vivo and their successful application to date in bioengineered in vitro models, including organ-on-chip and microfluidic culture devices.

Also flagged:Food allergiesallergiessilicaimmunoglobulin Efood allergyanaphylaxis
Journal Article 2018-01-17 No Snippets Yun J, Duan F, Liu L, Chen X, Liu J, Luo Q, Wu J.
Show Full Abstract

Food allergies are increasingly recognized as a major healthcare concern. In order to sensitively and specifically detect allergies from blood samples of at-risk allergic patients, an effective magnetic fluorescence sensing platform (EMFP) was constructed. The EMFP incorporated hollow mesoporous silica nanospheres (HMNs) to amplify signal from the target IgE in addition to magnetic nanoparticles (MNPs) to capture and separate the target IgE. The application of EMFP to immunoassays indicated a detection limit of 0.0159 ng mL<sup>-1</sup> for low concentration specific immunoglobulin E (sIgE) against purified shellfish <i>Metapenaeus ensis</i> (Meta. E.) allergens, which is 15 fold more sensitive than the commercially available Food and Drug Administration-approved analyzers. Notably, EMFP was specific for the targeted sIgE even with interference by other sIgEs. In addition, the detection time is only 75 min, considerably faster than current commercial ELISA kits for IgE assays. Together, these results demonstrated that EMFP has excellent sensitivity and selectivity for the rapid detection of sIgE. The method thus exhibits potential toward the rapid monitoring of sIgE against Meta. E. allergens in clinical application.

Also flagged:chromosometrans -splicing-genetic diseasestumorsnucleotides
Journal Article 2018-01-16 No Snippets He Y, Yuan C, Chen L, Lei M, Zellmer L, Huang H, Liao DJ.
Show Full Abstract

Tens of thousands of chimeric RNAs, i.e., RNAs with sequences of two genes, have been identified in human cells. Most of them are formed by two neighboring genes on the same chromosome and are considered to be derived via transcriptional readthrough, but a true readthrough event still awaits more evidence and <i>trans</i>-splicing that joins two transcripts together remains as a possible mechanism. We regard those genomic loci that are transcriptionally read through as unannotated genes, because their transcriptional and posttranscriptional regulations are the same as those of already-annotated genes, including fusion genes formed due to genetic alterations. Therefore, readthrough RNAs and fusion-gene-derived RNAs are not chimeras. Only those two-gene RNAs formed at the RNA level, likely via <i>trans</i>-splicing, without corresponding genes as genomic parents, should be regarded as authentic chimeric RNAs. However, since in human cells, procedural and mechanistic details of <i>trans</i>-splicing have never been disclosed, we doubt the existence of <i>trans</i>-splicing. Therefore, there are probably no authentic chimeras in humans, after readthrough and fusion-gene derived RNAs are all put back into the group of ordinary RNAs. Therefore, it should be further determined whether in human cells all two-neighboring-gene RNAs are derived from transcriptional readthrough and whether <i>trans</i>-splicing truly exists.

Also flagged:hepatitis C virus infectionsliver diseasesliver diseaseregulation of gene expressionchronic liver diseasesoncogenes
Journal Article 2018-01-16 No Snippets Schueller F, Roy S, Vucur M, Trautwein C, Luedde T, Roderburg C.
Show Full Abstract

Both acute and chronic liver toxicity represents a major global health burden and an important cause of morbidity and lethality worldwide. Despite epochal progress in the treatment of hepatitis C virus infections, pharmacological treatment strategies for most liver diseases are still limited and new targets for prevention or treatment of liver disease are urgently needed. MicroRNAs (miRNAs) represent a new class of highly conserved small non-coding RNAs that are involved in the regulation of gene expression by targeting whole networks of so called "targets". Previous studies have shown that the expression of miRNAs is specifically altered in almost all acute and chronic liver diseases. In this context, it was shown that miRNA can exert causal roles, being pro- or anti-inflammatory, as well as pro- or antifibrotic mediators or being oncogenes as well as tumor suppressor genes. Recent data suggested a potential therapeutic use of miRNAs by targeting different steps in the hepatic pathophysiology. Here, we review the function of miRNAs in the context of acute and chronic liver diseases. Furthermore, we highlight the potential role of circulating microRNAs in diagnosis of liver diseases and discuss the major challenges and drawbacks that currently prevent the use of miRNAs in clinical routine.

Also flagged:BTNbutyrophilin-likeBtnl1BTNL3BTNL8BTN3A1
Journal Article 2018-01-16 ✓ 5 Snippets Vantourout P, Laing A, Woodward MJ, Zlatareva I, Apolonia L, Jones AW, Snijders AP, Malim MH, Hayday AC.
In-Text Gene Mentions
⭐ same-sentence co-mention

…Wild-type BTN1A1,BTN2A1, BTN2A2, BTN3A1, BTN3A2,…

⭐ same-sentence co-mention

…Wild-type BTN1A1, BTN2A1,BTN2A2, BTN3A1, BTN3A2, and…

…BTN3A1, BTN3A2, andBTN3A3were cloned from…

…BTN3A1, BTN3A2, and/orBTN3A3with Vγ9Vδ2 +…

…(CRA1), BTN3A2 (CRA2),BTN3A3(CRA3), all three…

Show Full Abstract

The long-held view that gamma delta (γδ) T cells in mice and humans are fundamentally dissimilar, as are γδ cells in blood and peripheral tissues, has been challenged by emerging evidence of the cells' regulation by butyrophilin (BTN) and butyrophilin-like (BTNL) molecules. Thus, murine <i>Btnl1</i> and the related gene, <i>Skint1</i>, mediate T cell receptor (TCR)-dependent selection of murine intraepithelial γδ T cell repertoires in gut and skin, respectively; <i>BTNL3</i> and <i>BTNL8</i> are TCR-dependent regulators of human gut γδ cells; and <i>BTN3A1</i> is essential for TCR-dependent activation of human peripheral blood Vγ9Vδ2<sup>+</sup> T cells. However, some observations concerning BTN/Btnl molecules continue to question the extent of mechanistic conservation. In particular, murine and human gut γδ cell regulation depends on pairings of Btnl1 and Btnl6 and BTNL3 and BTNL8, respectively, whereas blood γδ cells are reported to be regulated by BTN3A1 independent of other BTNs. Addressing this paradox, we show that BTN3A2 regulates the subcellular localization of BTN3A1, including functionally important associations with the endoplasmic reticulum (ER), and is specifically required for optimal BTN3A1-mediated activation of Vγ9Vδ2<sup>+</sup> T cells. Evidence that BTNL3/BTNL8 and Btnl1/Btnl6 likewise associate with the ER reinforces the prospect of broadly conserved mechanisms underpinning the selection and activation of γδ cells in mice and humans, and in blood and extralymphoid sites.

Also flagged:UPF1metabolismSMDgene expressionregulationantibody
Journal Article 2018-01-16 ✓ 2 Snippets Lucas BA, Lavi E, Shiue L, Cho H, Katzman S, Miyoshi K, Siomi MC, Carmel L, Ares M, Maquat LE.
In-Text Gene Mentions

…SMD factors, Staufen1 (STAU1) and UPF1, in…

STAU1

Show Full Abstract

Primate-specific <i>Alu</i> short interspersed elements (SINEs) as well as rodent-specific B and ID (B/ID) SINEs can promote Staufen-mediated decay (SMD) when present in mRNA 3'-untranslated regions (3'-UTRs). The transposable nature of SINEs, their presence in long noncoding RNAs, their interactions with Staufen, and their rapid divergence in different evolutionary lineages suggest they could have generated substantial modification of posttranscriptional gene-control networks during mammalian evolution. Some of the variation in SMD regulation produced by SINE insertion might have had a similar regulatory effect in separate mammalian lineages, leading to parallel evolution of the Staufen network by independent expansion of lineage-specific SINEs. To explore this possibility, we searched for orthologous gene pairs, each carrying a species-specific 3'-UTR SINE and each regulated by SMD, by measuring changes in mRNA abundance after individual depletion of two SMD factors, Staufen1 (STAU1) and UPF1, in both human and mouse myoblasts. We identified and confirmed orthologous gene pairs with 3'-UTR SINEs that independently function in SMD control of myoblast metabolism. Expanding to other species, we demonstrated that SINE-directed SMD likely emerged in both primate and rodent lineages >20-25 million years ago. Our work reveals a mechanism for the convergent evolution of posttranscriptional gene regulatory networks in mammals by species-specific SINE transposition and SMD.

Also flagged:cDNAbehavioralantimicrobial peptidesgene expressionpollinationColony Collapse Disorder
Journal Article 2018-01-16 ✓ 2 Snippets Diao Q, Sun L, Zheng H, Zeng Z, Wang S, Xu S, Zheng H, Chen Y, Shi Y, Wang Y, Meng F, Sang Q, Cao L, Liu F, Zhu Y, Li W, Li Z, Dai C, Yang M, Chen S, Chen R, Zhang S, Evans JD, Huang Q, Liu J, Hu F, Su S, Wu J.
In-Text Gene Mentions

…dosage compensation complex (DCC) in Drosophila 30…

…the components ofDCC.…

Show Full Abstract

The Asian honeybee Apis cerana is one of two bee species that have been commercially kept with immense economic value. Here we present the analysis of genomic sequence and transcriptomic exploration for A. cerana as well as the comparative genomic analysis of the Asian honeybee and the European honeybee A. mellifera. The genome and RNA-seq data yield new insights into the behavioral and physiological resistance to the parasitic mite Varroa the evolution of antimicrobial peptides, and the genetic basis for labor division in A. cerana. Comparison of genes between the two sister species revealed genes specific to A. cerana, 54.5% of which have no homology to any known proteins. The observation that A. cerana displayed significantly more vigilant grooming behaviors to the presence of Varroa than A. mellifera in conjunction with gene expression analysis suggests that parasite-defensive grooming in A. cerana is likely triggered not only by exogenous stimuli through visual and olfactory detection of the parasite, but also by genetically endogenous processes that periodically activates a bout of grooming to remove the ectoparasite. This information provides a valuable platform to facilitate the traits unique to A. cerana as well as those shared with other social bees for health improvement.

Also flagged:Draxinneurogenesiscell proliferationTbr2NeuroD1colorectal cancer
Journal Article 2018-01-16 ✓ 5 Snippets Tawarayama H, Yamada H, Amin R, Morita-Fujimura Y, Cooper HM, Shinmyo Y, Kawata M, Ikawa S, Tanaka H.
In-Text Gene Mentions

Taken together, we believe that draxin regulates the proapoptotic activity of DCC in the SGZ by directly interacting with the DCC dependence receptor and not by preventing the interaction between prosurvival Netrin-1 and DCC.

We next investigated the relevance of caspases to DCC-induced apoptosis in the absence of draxin by substituting the amino acid at position 1290 from aspartic acid to asparagine, which is a cleavage target for caspases.

To substitute aspartic acid for asparagine at the 1290th amino acid residue of DCC, a PCR-based site-direct mutagenesis was performed on pMX-CAG-rat DCC-HA using KOD Plus Mutagenesis Kit (Toyobo) according to the instruction.

…of its receptorDCC(deleted in colorectal…

…enhanced apoptosis ofDCC-expressing neuroblasts in the…

Show Full Abstract

Hippocampal neurogenesis in the dentate gyrus (DG) is controlled by diffusible molecules that modulate neurogenic processes, including cell proliferation, differentiation and survival. To elucidate the mechanisms underlying hippocampal neurogenesis, we investigated the function of draxin, originally identified as a neural chemorepellent, in the regulation of neuronal survival in the DG. Draxin was expressed in Tbr2 (+) late progenitors and NeuroD1 (+) neuroblasts in the dentate granule cell lineage, whereas expression of its receptor DCC (deleted in colorectal cancer) was mainly detectable in neuroblasts. Our phenotypic analysis revealed that draxin deficiency led to enhanced apoptosis of DCC-expressing neuroblasts in the neurogenic areas. Furthermore, in vitro assays using a hippocampal neural stem/progenitor cell (HNSPC) line indicated that draxin inhibited apoptosis in differentiating HNSPCs, which express DCC. Taken together, we postulate that draxin plays a pivotal role in postnatal DG neurogenesis as a dependence receptor ligand for DCC to maintain and promote survival of neuroblasts.

Also flagged:Cilia-related protein SPEF2Sperm flagellar protein 2SPEF2male infertilityprimary ciliary dyskinesiacell surface
Journal Article 2018-01-16 ✓ 1 Snippet Lehti MS, Henriksson H, Rummukainen P, Wang F, Uusitalo-Kylmälä L, Kiviranta R, Heino TJ, Kotaja N, Sironen A.
In-Text Gene Mentions

…), Sox5 andSox6are involved in…

Show Full Abstract

Sperm flagellar protein 2 (SPEF2) is essential for motile cilia, and lack of SPEF2 function causes male infertility and primary ciliary dyskinesia. Cilia are pointing out from the cell surface and are involved in signal transduction from extracellular matrix, fluid flow and motility. It has been shown that cilia and cilia-related genes play essential role in commitment and differentiation of chondrocytes and osteoblasts during bone formation. Here we show that SPEF2 is expressed in bone and cartilage. The analysis of a Spef2 knockout (KO) mouse model revealed hydrocephalus, growth retardation and death prior to five weeks of age. To further elucidate the causes of growth retardation we analyzed the bone structure and possible effects of SPEF2 depletion on bone formation. In Spef2 KO mice, long bones (tibia and femur) were shorter compared to wild type, and X-ray analysis revealed reduced bone mineral content. Furthermore, we showed that the in vitro differentiation of osteoblasts isolated from Spef2 KO animals was compromised. In conclusion, this study reveals a novel function for SPEF2 in bone formation through regulation of osteoblast differentiation and bone growth.

Also flagged:Endocannabinoidanandamidesynthesiscannabinoid receptorsCB 1CB 2
Journal Article 2018-01-16 No Snippets Gao YR, Wang YQ.
Show Full Abstract

Endocannabinoid system is related with various physiological and cognitive processes including fertility, pregnancy, during pre- and postnatal development, pain-sensation, mood, appetite, and memory. In the latest decades, an important milestone concerning the endocannabinoid system was the discovery of the existence of the cannabinoid receptors CB<sub>1</sub> and CB<sub>2</sub>. Anandamide was the first reported endogenous metabolite, which adjusted the release of some neurotransmitters through binding to the CB<sub>1</sub> or CB<sub>2</sub> receptors. Then a series of cannabinomimetric lipids were extracted from marine organisms, which possessed similar structure with anandamide. This review will provide a short account about cannabinomimetric lipids for their extraction and synthesis.

Also flagged:HSF1Heat shock factor 1transcriptional factorpos-translational modificationsphosphorylationneurodegenerative disorders
Journal Article 2018-01-16 ✓ 2 Snippets Huang C, Wu J, Xu L, Wang J, Chen Z, Yang R.
In-Text Gene Mentions

Here, we summarize the regulation of the monomeric HSF1 by some previously reported factors, such as synuclein, Huntingtin (Htt), TDP-43, unfolded protein response (UPR), MB and doxorubicin (DOX), as well as their possible mechanisms, aiming to push the understanding about HSF1 protein stabilization.

…as synuclein, Huntingtin (Htt), TDP-43, unfolded protein…

Show Full Abstract

Heat shock factor 1 (HSF1) is a transcriptional factor that determines the efficiency of heat shock responses (HSRs) in the cell. Given its function has been extensively studied in recent years, HSF1 is considered a potential target for the treatment of disorders associated with protein aggregation. The activity of HSF1 is traditionally regulated at the transcriptional level in which the transactivation domain of HSF1 is modified by extensive array of pos-translational modifications, such as phosphorylation, sumoylation, and acetylation. Recently, HSF1 is also reported to be regulated at the monomeric level. For example, in neurodegenerative disorders such as Huntington's disease and Alzheimer's disease the expression levels of the monomeric HSF1 are found to be reduced markedly. Methylene blue (MB) and riluzole, two clinical available drugs, increase the amount of the monomeric HSF1 in both cells and animals. Since the monomeric HSF1 not only determines the efficiency of HSRs, but exerts protective effects in a trimerization-independent manner, increasing the amount of the monomeric HSF1 via stabilization of HSF1 may be an alternative strategy for the amplification of HSR. However, to date we have no outlined knowledges about HSF1 protein stabilization, though studies regarding the regulation of the monomeric HSF1 have been documented in recent years. Here, we summarize the regulation of the monomeric HSF1 by some previously reported factors, such as synuclein, Huntingtin (Htt), TDP-43, unfolded protein response (UPR), MB and doxorubicin (DOX), as well as their possible mechanisms, aiming to push the understanding about HSF1 protein stabilization.

Also flagged:NanogelDeferoxamineirondegradationIOThalassemia
Journal Article 2018-01-16 ✓ 1 Snippet Wang Y, Liu Z, Lin TM, Chanana S, Xiong MP.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Deferoxamine (DFO) to treat iron overload (IO) has been limited by toxicity issues and short circulation times and it would be desirable to prolong circulation to improve non-transferrin bound iron (NTBI) chelation. In addition, DFO is currently unable to efficiently target the large pool of iron in the liver and spleen. Nanogel-Deferoxamine conjugates (NG-DFO) can prove useful as a model to investigate the pharmacokinetic (PK) properties and biodistribution (BD) behavior of iron-chelating macromolecules and their overall effect on serum ferritin levels. NG-DFO reduced the cytotoxicity of DFO and significantly reduced cellular ferritin levels in IO macrophages in vitro. PK/BD studies in normal rats revealed that NG-DFO displayed prolonged circulation and preferential accumulation into the liver and spleen. IO mice treated with NG1-DFO presented significantly lower levels of serum ferritin compared to DFO. Total renal and fecal elimination data point to the need to balance prolonged circulation with controlled degradation to accelerate clearance of iron-chelating macromolecules.

Also flagged:Cardiovascular DiseasesCardiovascular diseaseCVDcongenital heart diseaseCoronary Heart DiseaseCoronary artery disease
Journal Article 2018-01-16 ✓ 1 Snippet Capotosto L, Massoni F, De Sio S, Ricci S, Vitarelli A.
In-Text Gene Mentions

…myocardial amyloidosis andhemochromatosis.…

Show Full Abstract

Cardiovascular disease (CVD) still remains the main cause of morbidity and mortality and consequently early diagnosis is of paramount importance. Working conditions can be regarded as an additional risk factor for CVD. Since different aspects of the job may affect vascular health differently, it is important to consider occupation from multiple perspectives to better assess occupational impacts on health. Standard echocardiography has several targets in the cardiac population, as the assessment of myocardial performance, valvular and/or congenital heart disease, and hemodynamics. Three-dimensional echocardiography gained attention recently as a viable clinical tool in assessing left ventricular (LV) and right ventricular (RV) function, volume, and shape. Two-dimensional (2DSTE) and, more recently, three-dimensional speckle tracking echocardiography (3DSTE) have also emerged as methods for detection of global and regional myocardial dysfunction in various cardiovascular diseases and applied to the diagnosis of subtle LV and RV dysfunction. Although these novel echocardiographic imaging modalities have advanced our understanding of LV and RV mechanics, overlapping patterns often show challenges that limit their clinical utility. This review will describe the current state of standard and advanced echocardiography in early detection (secondary prevention) of CVD and address future directions for this potentially important diagnostic strategy.

Also flagged:lipidNAFLDinsulinHCLobesityinsulin resistance
Journal Article 2018-01-15 ✓ 1 Snippet Hong BS, Liu J, Zheng J, Ke W, Huang Z, Wan X, He X, Xiao H, Li Y, Li Y.
In-Text Gene Mentions

…C, autoimmune hepatitis,hemochromatosis, Wilson's disease or…

Show Full Abstract

<h4>Aims/introduction</h4>To explore angiopoietin-like protein 8 (ANGPTL-8) levels, and its association with hepatocellular lipid content (HCL) and insulin resistance in patients with different extents of non-alcoholic fatty liver disease (NAFLD).<h4>Materials and methods</h4>In 48 adults were recruited, of which 12 had no NAFLD (HCL < 5.5%; group 1), 18 had mild NAFLD (5.5% ≤ HCL < 10.0%; group 2) and 18 had moderate-to-severe NAFLD (HCL ≥ 10.0%; group 3). The peripheral insulin sensitivity of all participants was monitored by a hyperinsulinemic-euglycemic clamp (M value), as well as the magnetic resonance image of HCL. Serum ANGPTL-8, blood glucose levels and lipid profiles were also recorded in the study.<h4>Results</h4>Group 3 had a worse metabolic profile, and had the highest ANGPTL-8 level (1,129 ± 351 pg/mL vs 742 ± 252 pg/mL, 765 ± 301 pg/mL, P = 0.001) compared with those in group 1 and group 2. In all metabolic profiles, HCL positively correlated the strongest with ANGPTL-8 (r = 0.436, P = 0.042). Multivariate stepwise linear regression analysis showed ANGPTL-8 and alanine aminotransferase were independent determinants of HCL (P = 0.002, P < 0.001, respectively), and these two indexes explained 67.4% of the variation of HCL (P < 0.001).<h4>Conclusions</h4>ANGPTL-8 was positively correlated with hepatocellular lipid content independent of obesity and insulin resistance, indicating that ANGPTL-8 might be a new and important important predictor of the severity of NAFLD.

Also flagged:hematopoiesismyelodysplastic syndromeironhepatic neoplasmsdiffuse hepatic hemochromatosishematoma
Journal Article 2018-01-15 ✓ 4 Snippets Belay AA, Bellizzi AM, Stolpen AH.
In-Text Gene Mentions

…in diffuse secondaryhemochromatosisexcess iron is…

…When diffuse hepatichemochromatosisis present and…

…of diffuse secondaryhemochromatosis.…

…diffuse secondary hepatichemochromatosis.…

Show Full Abstract

<h4>Background</h4>Extramedullary hematopoiesis is the proliferation of hematopoietic cells outside bone marrow secondary to marrow hematopoiesis failure. Extramedullary hematopoiesis rarely presents as a mass-forming hepatic lesion; in this case, imaging-based differentiation from primary and metastatic hepatic neoplasms is difficult, often leading to biopsy for definitive diagnosis. We report a case of tumefactive hepatic extramedullary hematopoiesis in the setting of myelodysplastic syndrome with concurrent hepatic iron overload, and the role of T2*-weighted gradient-echo magnetic resonance imaging in differentiating extramedullary hematopoiesis from primary and metastatic hepatic lesions. To the best of our knowledge, T2*-weighted gradient-echo evaluation of extramedullary hematopoiesis in the setting of diffuse hepatic hemochromatosis has not been previously described.<h4>Case presentation</h4>A 52-year-old white man with myelodysplastic syndrome and marrow fibrosis was found to have a 4 cm hepatic lesion on ultrasound during workup for bone marrow transplantation. Magnetic resonance imaging revealed diffuse hepatic iron overload and non-visualization of the lesion on T2* gradient-echo sequence suggesting the presence of iron deposition within the lesion similar to that in background hepatic parenchyma. Subsequent ultrasound-guided biopsy of the lesion revealed extramedullary hematopoiesis. Six months later, while still being evaluated for bone marrow transplant, our patient was found to have poor pulmonary function tests. Follow-up computed tomography angiogram showed a mass within his right main pulmonary artery. Bronchoscopic biopsy of this mass once again revealed extramedullary hematopoiesis. He received radiation therapy to his chest. However, 2 weeks later, he developed mediastinal hematoma and died shortly afterward, secondary to respiratory arrest.<h4>Conclusions</h4>Mass-forming extramedullary hematopoiesis is rare; however, our report emphasizes that it needs to be considered in the initial differential diagnosis of hepatic lesions arising in the setting of bone marrow disorders. We also show that in the setting of diffuse hepatic iron overload, tumefactive extramedullary hematopoiesis appeared isointense to background liver on T2* gradient-echo sequence, while adenoma, hepatoma, and hepatic metastasis appear hyperintense. Thus, T2*-weighted gradient-echo sequence may have a potential role in the imaging diagnosis of mass-forming hepatic extramedullary hematopoiesis arising in the setting of diffuse iron overload.

Also flagged:opioid dependencemethadonebuprenorphinenaloxonemetabolismSLC6A4
Journal Article 2018-01-15 ✓ 1 Snippet Crist RC, Li J, Doyle GA, Gilbert A, Dechairo BM, Berrettini WH.
In-Text Gene Mentions

5-HTT

Show Full Abstract

<h4>Background</h4>Currently, no pharmacogenetic tests for selecting an opioid-dependence pharmacotherapy have been approved by the US Food and Drug Administration.<h4>Objectives</h4>Determine the effects of variants in 11 genes on dropout rate and dose in patients receiving methadone or buprenorphine/naloxone (ClinicalTrials.gov Identifier: NCT00315341).<h4>Methods</h4>Variants in six pharmacokinetic genes (CYP1A2, CYP2B6, CYP2C19, CYP2C9, CYP2D6, CYP3A4) and five pharmacodynamic genes (HTR2A, OPRM1, ADRA2A, COMT, SLC6A4) were genotyped in samples from a 24-week, randomized, open-label trial of methadone and buprenorphine/naloxone for the treatment of opioid dependence (n = 764; 68.7% male). Genotypes were then used to determine the metabolism phenotype for each pharmacokinetic gene. Phenotypes or genotypes for each gene were analyzed for association with dropout rate and mean dose.<h4>Results</h4>Genotype for 5-HTTLPR in the SLC6A4 gene was nominally associated with dropout rate when the methadone and buprenorphine/naloxone groups were combined. When the most significant variants associated with dropout rate were analyzed using pairwise analyses, SLC6A4 (5-HTTLPR) and COMT (Val158Met; rs4860) had nominally significant associations with dropout rate in methadone patients. None of the genes analyzed in the study was associated with mean dose of methadone or buprenorphine/naloxone.<h4>Conclusions</h4>This study suggests that functional polymorphisms related to synaptic dopamine or serotonin levels may predict dropout rates during methadone treatment. Patients with the S/S genotype at 5-HTTLPR in SLC6A4 or the Val/Val genotype at Val158Met in COMT may require additional treatment to improve their chances of completing addiction treatment. Replication in other methadone patient populations will be necessary to ensure the validity of these findings.

Also flagged:polyglycerolLDHhCGmembranesecretiongestation
Journal Article 2018-01-15 No Snippets Juch H, Nikitina L, Reimann S, Gauster M, Dohr G, Obermayer-Pietsch B, Hoch D, Kornmueller K, Haag R.
Show Full Abstract

A thorough understanding of nanoparticle bio-distribution at the feto-maternal interface will be a prerequisite for their diagnostic or therapeutic application in women of childbearing age and for teratologic risk assessment. Therefore, the tissue interaction of biocompatible dendritic polyglycerol nanoparticles (dPG-NPs) with first- trimester human placental explants were analyzed and compared to less sophisticated trophoblast-cell based models. First-trimester human placental explants, BeWo cells and primary trophoblast cells from human term placenta were exposed to fluorescence labeled, ∼5 nm dPG-NPs, with differently charged surfaces, at concentrations of 1 µM and 10 nM, for 6 and 24 h. Accumulation of dPGs was visualized by fluorescence microscopy. To assess the impact of dPG-NP on trophoblast integrity and endocrine function, LDH, and hCG releases were measured. A dose- and charge-dependent accumulation of dPG-NPs was observed at the early placental barrier and in cell lines, with positive dPG-NP-surface causing deposits even in the mesenchymal core of the placental villi. No signs of plasma membrane damage could be detected. After 24 h we observed a significant reduction of hCG secretion in placental explants, without significant changes in trophoblast apoptosis, at low concentrations of charged dPG-NPs. In conclusion, dPG-NP's surface charge substantially influences their bio-distribution at the feto-maternal interface, with positive charge facilitating trans-trophoblast passage, and in contrast to more artificial models, the first-trimester placental explant culture model reveals potentially hazardous influences of charged dPG-NPs on early placental physiology.

Also flagged:tuberculosisTBMtb infectionCD4CD8immune response
Journal Article 2018-01-15 No Snippets Hansen SG, Zak DE, Xu G, Ford JC, Marshall EE, Malouli D, Gilbride RM, Hughes CM, Ventura AB, Ainslie E, Randall KT, Selseth AN, Rundstrom P, Herlache L, Lewis MS, Park H, Planer SL, Turner JM, Fischer M, Armstrong C, Zweig RC, Valvo J, Braun JM, Shankar S, Lu L, Sylwester AW, Legasse AW, Messerle M, Jarvis MA, Amon LM, Aderem A, Alter G, Laddy DJ, Stone M, Bonavia A, Evans TG, Axthelm MK, Früh K, Edlefsen PT, Picker LJ.
Show Full Abstract

Despite widespread use of the bacille Calmette-Guérin (BCG) vaccine, tuberculosis (TB) remains a leading cause of global mortality from a single infectious agent (Mycobacterium tuberculosis or Mtb). Here, over two independent Mtb challenge studies, we demonstrate that subcutaneous vaccination of rhesus macaques (RMs) with rhesus cytomegalovirus vectors encoding Mtb antigen inserts (hereafter referred to as RhCMV/TB)-which elicit and maintain highly effector-differentiated, circulating and tissue-resident Mtb-specific CD4<sup>+</sup> and CD8<sup>+</sup> memory T cell responses-can reduce the overall (pulmonary and extrapulmonary) extent of Mtb infection and disease by 68%, as compared to that in unvaccinated controls, after intrabronchial challenge with the Erdman strain of Mtb at ∼1 year after the first vaccination. Fourteen of 34 RhCMV/TB-vaccinated RMs (41%) across both studies showed no TB disease by computed tomography scans or at necropsy after challenge (as compared to 0 of 17 unvaccinated controls), and ten of these RMs were Mtb-culture-negative for all tissues, an exceptional long-term vaccine effect in the RM challenge model with the Erdman strain of Mtb. These results suggest that complete vaccine-mediated immune control of highly pathogenic Mtb is possible if immune effector responses can intercept Mtb infection at its earliest stages.

Also flagged:clotting disordersvenous thrombosisnucleotidethrombophiliapulmonary embolismischemic heart disease
Journal Article 2018-01-15 ✓ 1 Snippet Koko M, Abdallah MOE, Amin M, Ibrahim M.
In-Text Gene Mentions

…PROC, PROS1, RAPGEF1,SERPINC1, SERPIND1, SERPINE1, TFPI,…

Show Full Abstract

<h4>Background</h4>The conventional variant calling of pathogenic alleles in exome and genome sequencing requires the presence of the non-pathogenic alleles as genome references. This hinders the correct identification of variants with minor and/or pathogenic reference alleles warranting additional approaches for variant calling.<h4>Results</h4>More than 26,000 Exome Aggregation Consortium (ExAC) variants have a minor reference allele including variants with known ClinVar disease alleles. For instance, in a number of variants related to clotting disorders, the phenotype-associated allele is a human genome reference allele (rs6025, rs6003, rs1799983, and rs2227564 using the assembly hg19). We highlighted how the current variant calling standards miss homozygous reference disease variants in these sites and provided a bioinformatic panel that can be used to screen these variants using commonly available variant callers. We present exome sequencing results from an individual with venous thrombosis to emphasize how pathogenic alleles in clinically relevant variants escape variant calling while non-pathogenic alleles are detected.<h4>Conclusions</h4>This article highlights the importance of specialized variant calling strategies in clinical variants with minor reference alleles especially in the context of personal genomes and exomes. We provide here a simple strategy to screen potential disease-causing variants when present in homozygous reference state.

Also flagged:alcoholdrug addictionfertility disordersaddictionmaledrug abuse
Journal Article 2018-01-15 ✓ 2 Snippets Sansone A, Di Dato C, de Angelis C, Menafra D, Pozza C, Pivonello R, Isidori A, Gianfrilli D.
In-Text Gene Mentions

…sites for thePEBP1gene.…

…Expression ofPEBP1results in production…

Show Full Abstract

In recent decades, the decline in human fertility has become increasingly more worrying: while therapeutic interventions might help, they are vexing for the couple and often burdened with high failure rates and costs. Prevention is the most successful approach to fertility disorders in males and females alike. We performed a literature review on three of the most common unhealthy habits - tobacco, alcohol and drug addiction - and their reported effects on male fertility. Tobacco smoking is remarkably common in most first-world countries; despite a progressive decline in the US, recent reports suggest a prevalence of more than 30% in subjects of reproductive age - a disturbing perspective, given the well-known ill-effects on reproductive and sexual function as well as general health. Alcohol consumption is often considered socially acceptable, but its negative effects on gonadal function have been consistently reported in the last 30 years. Several studies have reported a variety of negative effects on male fertility following drug abuse - a worrying phenomenon, as illicit drug consumption is on the rise, most notably in younger subjects. While evidence in these regards is still far from solid, mostly as a result of several confounding factors, it is safe to assume that cessation of tobacco smoking, alcohol consumption and recreational drug addiction might represent the best course of action for any couple trying to achieve pregnancy.

Also flagged:placental diseasegene expressionchromosomehistonedosage compensationcell growth
Journal Article 2018-01-15 No Snippets Gonzalez TL, Sun T, Koeppel AF, Lee B, Wang ET, Farber CR, Rich SS, Sundheimer LW, Buttle RA, Chen YI, Rotter JI, Turner SD, Williams J, Goodarzi MO, Pisarska MD.
Show Full Abstract

<h4>Background</h4>Development of the placenta during the late first trimester is critical to ensure normal growth and development of the fetus. Developmental differences in this window such as sex-specific variation are implicated in later placental disease states, yet gene expression at this time is poorly understood.<h4>Methods</h4>RNA-sequencing was performed to characterize the transcriptome of 39 first trimester human placentas using chorionic villi following genetic testing (17 females, 22 males). Gene enrichment analysis was performed to find enriched canonical pathways and gene ontologies in the first trimester. DESeq2 was used to find sexually dimorphic gene expression. Patient demographics were analyzed for sex differences in fetal weight at time of chorionic villus sampling and birth.<h4>Results</h4>RNA-sequencing analyses detected 14,250 expressed genes, with chromosome 19 contributing the greatest proportion (973/2852, 34.1% of chromosome 19 genes) and Y chromosome contributing the least (16/568, 2.8%). Several placenta-enriched genes as well as histone-coding genes were identified to be unique to the first trimester and common to both sexes. Further, we identified 58 genes with significantly different expression between males and females: 25 X-linked, 15 Y-linked, and 18 autosomal genes. Genes that escape X inactivation were highly represented (59.1%) among X-linked genes upregulated in females. Many genes differentially expressed by sex consisted of X/Y gene pairs, suggesting that dosage compensation plays a role in sex differences. These X/Y pairs had roles in parallel, ancient canonical pathways important for eukaryotic cell growth and survival: chromatin modification, transcription, splicing, and translation.<h4>Conclusions</h4>This study is the first characterization of the late first trimester placenta transcriptome, highlighting similarities and differences among the sexes in ongoing human pregnancies resulting in live births. Sexual dimorphism may contribute to pregnancy outcomes, including fetal growth and birth weight, which was seen in our cohort, with males significantly heavier than females at birth. This transcriptome provides a basis for development of early diagnostic tests of placental function that can indicate overall pregnancy heath, fetal-maternal health, and long-term adult health.

Also flagged:Scn3blacosamideCrmp2opioid receptorsodium channelNa V 1.7
Journal Article 2018-01-15 ✓ 2 Snippets Kanellopoulos AH, Koenig J, Huang H, Pyrski M, Millet Q, Lolignier S, Morohashi T, Gossage SJ, Jay M, Linley JE, Baskozos G, Kessler BM, Cox JJ, Dolphin AC, Zufall F, Wood JN, Zhao J.
In-Text Gene Mentions

…(Santa Cruz, SC‐28538),PEBP1(Thermo fisher, 36‐0700),…

…hanolamine‐binding protein 1 (Pebp1), were chosen from…

Show Full Abstract

The voltage-gated sodium channel Na<sub>V</sub>1.7 plays a critical role in pain pathways. We generated an epitope-tagged Na<sub>V</sub>1.7 mouse that showed normal pain behaviours to identify channel-interacting proteins. Analysis of Na<sub>V</sub>1.7 complexes affinity-purified under native conditions by mass spectrometry revealed 267 proteins associated with Nav1.7 <i>in vivo</i> The sodium channel β3 (Scn3b), rather than the β1 subunit, complexes with Nav1.7, and we demonstrate an interaction between collapsing-response mediator protein (Crmp2) and Nav1.7, through which the analgesic drug lacosamide regulates Nav1.7 current density. Novel Na<sub>V</sub>1.7 protein interactors including membrane-trafficking protein synaptotagmin-2 (Syt2), L-type amino acid transporter 1 (Lat1) and transmembrane P24-trafficking protein 10 (Tmed10) together with Scn3b and Crmp2 were validated by co-immunoprecipitation (Co-IP) from sensory neuron extract. Nav1.7, known to regulate opioid receptor efficacy, interacts with the G protein-regulated inducer of neurite outgrowth (Gprin1), an opioid receptor-binding protein, demonstrating a physical and functional link between Nav1.7 and opioid signalling. Further information on physiological interactions provided with this normal epitope-tagged mouse should provide useful insights into the many functions now associated with the Na<sub>V</sub>1.7 channel.

Also flagged:Sox2myelinationataxianeurological disordersperiventricular leukomalaciamyelin formation
Journal Article 2018-01-15 No Snippets Zhang S, Zhu X, Gui X, Croteau C, Song L, Xu J, Wang A, Bannerman P, Guo F.
Show Full Abstract

In the CNS, myelination and remyelination depend on the successful progression and maturation of oligodendroglial lineage cells, including proliferation and differentiation of oligodendroglial progenitor cells (OPCs). Previous studies have reported that Sox2 transiently regulates oligodendrocyte (OL) differentiation in the embryonic and perinatal spinal cord and appears dispensable for myelination in the postnatal spinal cord. However, the role of Sox2 in OL development in the brain has yet to be defined. We now report that Sox2 is an essential positive regulator of developmental myelination in the postnatal murine brain of both sexes. Stage-specific paradigms of genetic disruption demonstrated that Sox2 regulated brain myelination by coordinating upstream OPC population supply and downstream OL differentiation. Transcriptomic analyses further supported a crucial role of Sox2 in brain developmental myelination. Consistently, oligodendroglial Sox2-deficient mice developed severe tremors and ataxia, typical phenotypes indicative of hypomyelination, and displayed severe impairment of motor function and prominent deficits of brain OL differentiation and myelination persisting into the later CNS developmental stages. We also found that Sox2 was required for efficient OPC proliferation and expansion and OL regeneration during remyelination in the adult brain and spinal cord. Together, our genetic evidence reveals an essential role of Sox2 in brain myelination and CNS remyelination, and suggests that manipulation of Sox2 and/or Sox2-mediated downstream pathways may be therapeutic in promoting CNS myelin repair.<b>SIGNIFICANCE STATEMENT</b> Promoting myelin formation and repair has translational significance in treating myelin-related neurological disorders, such as periventricular leukomalacia and multiple sclerosis in which brain developmental myelin formation and myelin repair are severely affected, respectively. In this report, analyses of a series of genetic conditional knock-out systems targeting different oligodendrocyte stages reveal a previously unappreciated role of Sox2 in coordinating upstream proliferation and downstream differentiation of oligodendroglial lineage cells in the mouse brain during developmental myelination and CNS remyelination. Our study points to the potential of manipulating Sox2 and its downstream pathways to promote oligodendrocyte regeneration and CNS myelin repair.

Also flagged:CTCFchromatinorganizationnucleusCCCTC-binding factorcohesin
Journal Article 2018-01-15 ✓ 1 Snippet Ramírez F, Bhardwaj V, Arrigoni L, Lam KC, Grüning BA, Villaveces J, Habermann B, Akhtar A, Manke T.
In-Text Gene Mentions

Condensinscan also remain…

Show Full Abstract

Despite an abundance of new studies about topologically associating domains (TADs), the role of genetic information in TAD formation is still not fully understood. Here we use our software, HiCExplorer (hicexplorer.readthedocs.io) to annotate >2800 high-resolution (570 bp) TAD boundaries in Drosophila melanogaster. We identify eight DNA motifs enriched at boundaries, including a motif bound by the M1BP protein, and two new boundary motifs. In contrast to mammals, the CTCF motif is only enriched on a small fraction of boundaries flanking inactive chromatin while most active boundaries contain the motifs bound by the M1BP or Beaf-32 proteins. We demonstrate that boundaries can be accurately predicted using only the motif sequences at open chromatin sites. We propose that DNA sequence guides the genome architecture by allocation of boundary proteins in the genome. Finally, we present an interactive online database to access and explore the spatial organization of fly, mouse and human genomes, available at http://chorogenome.ie-freiburg.mpg.de .

Also flagged:Methylilemembranebeta-cyclodextrinCholesterol depletionplasma membrane
Journal Article 2018-01-15 ✓ 2 Snippets Sameni S, Malacrida L, Tan Z, Digman MA.
In-Text Gene Mentions

The stabilized inducible cell model of HD, previously established Htt14A2.6 PC12 cells, as well as newly generated PC12 cells that inducibly express HTT exon 1 containing either 25Q or 97Q repeats fused at C-terminus to EGFP or mRuby were propagated as previously described31,32.

…with EGFP labeledHTTprotein stained with…

Show Full Abstract

Huntington disease (HD) is a late-onset genetic neurodegenerative disorder caused by expansion of cytosine-adenine-guanine (CAG) trinucleotide in the exon 1 of the gene encoding the polyglutamine (polyQ). It has been shown that protein degradation and lipid metabolism is altered in HD. In many neurodegenerative disorders, impaired lipid homeostasis is one of the early events in the disease onset. Yet, little is known about how mutant huntingtin may affect phospholipids membrane fluidity. Here, we investigated how membrane fluidity in the living cells (differentiated PC12 and HEK293 cell lines) are affected using a hyperspectral imaging of widely used probes, LAURDAN. Using phasor approach, we characterized the fluorescence of LAURDAN that is sensitive to the polarity of the immediate environment. LAURDAN is affected by the physical order of phospholipids (lipid order) and reports the membrane fluidity. We also validated our results using a different fluorescent membrane probe, Nile Red (NR). The plasma membrane in the cells expressing expanded polyQ shows a shift toward increased membrane fluidity revealed by both LAURDAN and NR spectral phasors. This finding brings a new perspective in the understanding of the early stages of HD that can be used as a target for drug screening.

Also flagged:Liver Steatosishepatic steatosisalcoholalcoholic fatty liver diseasenon-alcoholic fatty liver diseaseNAFLD
Journal Article 2018-01-15 ✓ 1 Snippet Veronese N, Notarnicola M, Cisternino AM, Reddavide R, Inguaggiato R, Guerra V, Rotolo O, Zinzi I, Leandro G, Correale M, Tutino V, Misciagna G, Osella AR, Bonfiglio C, Giannelli G, Caruso MG, MICOL Group.
In-Text Gene Mentions

…hepatitis, cirrhosis, orhemochromatosiswere excluded from…

Show Full Abstract

Coffee drinking seems to have several beneficial effects on health outcomes. However, the effect on hepatic steatosis, depending on a high alcohol consumption (AFLD, alcoholic fatty liver disease) or on metabolic factors (non-alcoholic fatty liver disease, NAFLD), is still equivocal. Thus, we aimed to explore the potential association between coffee consumption and the presence and severity of hepatic steatosis in people with NAFLD or AFLD. In this cross-sectional study, coffee drinking was recorded using a semi-quantitative food frequency questionnaire, and categorized as yes vs. no and as 0, 1, 2, ≥3. The degree of fatty liver was assessed through a standardized ultrasound examination (score 0 to 6, with higher values reflecting higher severity). Liver steatosis was classified as NAFLD or AFLD on daily alcohol intake >30 g/day for men and >20 g/day for women. This study included 2819 middle-aged participants; the great majority were coffee drinkers (86.1%). After adjusting for 12 potential confounders, drinking coffee was not associated with decreased odds for NAFLD (<i>n</i> = 916) (odds ratio, OR = 0.93; 95% confidence intervals, CI: 0.72-1.20) or AFLD (<i>n</i> = 276) (OR = 1.20; 95% CI: 0.66-2.0). The consumption of coffee (categorized as yes vs. no), or an increased consumption of coffee were not associated with the presence of mild, moderate or severe liver steatosis in either NAFLD or AFLD. In conclusion, coffee intake was not associated with any lower odds of hepatic steatosis in either non-alcoholic or alcoholic forms in this large cohort of South Italian individuals.

Also flagged:cancerTumorsInsulin-like growth factor 1 receptordertermIGF-1
Journal Article 2018-01-15 ✓ 2 Snippets Yang W, Schwartz GN, Marotti JD, Chen V, Traphagen NA, Gui J, Miller TW.
In-Text Gene Mentions

DCC

Cells were treated with phenol red-free DMEM containing 10% dextran-charcoal-treated FBS (DCC-FBS; Hyclone), RAD001, OSI-906 (Selleck Chemicals), fulv (Tocris Bioscience), IGF-1 (R&D Systems), or 17β-estradiol (E2; Sigma) as indicated.

Show Full Abstract

The mTORC1 inhibitor RAD001 (everolimus) is approved for treatment of recurrent/metastatic estrogen receptor (ER)-positive breast cancer in combination with the aromatase inhibitor (AI) exemestane. The benefits of A) continued anti-estrogen therapy for anti-estrogen-resistant disease in the context of mTORC1 inhibition, and B) adjuvant everolimus in combination with anti-estrogen therapy for early-stage disease are being tested clinically, but molecular rationale remains unclear. We hypothesized that mTORC1 inhibition activates the IGF-1R/InsR/IRS-1/2 axis in an ER-dependent manner to drive PI3K/AKT and promote cancer cell survival, implicating ER in survival signaling induced by mTORC1 inhibition. Anti-estrogen treatment synergized with RAD001 to inhibit ER+ breast cancer cell growth. Inhibition of ER, IGF-1R/InsR, or IRS-1/2 suppressed AKT activation induced by mTORC1 inhibition. RAD001 primed IGF-1R/InsR for activation, which was enhanced by ER signaling. Post-menopausal patients with early-stage ER+ breast cancer were treated presurgically +/- the AI letrozole. Viable tumor fragments from surgical specimens were treated with RAD001 and/or OSI-906 <i>ex vivo</i>; RAD001 increased AKT activation, which was abrogated by presurgical letrozole. Letrozole decreased IGF-1R and IRS-1/2 tumor levels. These data suggest that ER drives PI3K/AKT activation in response to mTORC1 inhibition, providing molecular rationale for therapeutic combinations of anti-estrogens and mTORC1 inhibitors in endocrine-sensitive disease.

Also flagged:PolyphenolsColorectal Cancercancerprostate cancerbreast cancerhereditary nonpolyposis colorectal cancer
Journal Article 2018-01-15 No Snippets Alam MN, Almoyad M, Huq F.
Show Full Abstract

Polyphenols have been reported to have wide spectrum of biological activities including major impact on initiation, promotion, and progression of cancer by modulating different signalling pathways. Colorectal cancer is the second most major cause of mortality and morbidity among females and the third among males. The objective of this review is to describe the activity of a variety of polyphenols in colorectal cancer in clinical trials, preclinical studies, and primary research. The molecular mechanisms of major polyphenols related to their beneficial effects on colorectal cancer are also addressed. Synthetic modifications and other future directions towards exploiting of natural polyphenols against colorectal cancer are discussed in the last section.

Also flagged:curcuminBeclin-lautophagosomesBeclin-1MYCCdh1
Journal Article 2018-01-15 No Snippets Zhang L, Fang Y, Cheng X, Lian Y, Zeng Z, Wu C, Zhu H, Xu H.
Show Full Abstract

<h4>Background</h4>We aimed to investigate the effect and mechanism of curcumin (CUR) in Alzheimer's disease (AD).<h4>Methods</h4>Mouse hippocampal neuronal cell line HT-22 was treated with A<i>β</i>1-42 and/or CUR, and then cell viability was evaluated by cell counting kit 8, Beclin-l level was detected using western blotting, and the formation of autophagosomes was observed by transmission electron microscopy (TEM). Furthermore, transcriptome sequencing and analysis were performed in cells with A<i>β</i>1-42 alone or A<i>β</i>1-42 + CUR.<h4>Results</h4>A<i>β</i>1-42 treatment significantly inhibited cell viability compared with untreated cells (<i>P</i> < 0.01). After treatment for 48 h, CUR remarkably promoted cell viability compared with cell treated with A<i>β</i>1-42 alone (<i>P</i> < 0.01). Compared with cells treated with A<i>β</i>1-42 alone, the expression of Beclin-1 was slightly reduced in cells with combined treatment of A<i>β</i>1-42 with CUR (<i>P</i> < 0.05). Consistently, TEM results showed that CUR inhibited the formation of autophagosomes in cells treated with A<i>β</i>1-42. Furthermore, the protein-protein interaction network showed five key genes, including MYC, Cdh1, Acaca, Egr1, and CCnd1, likely involved in CUR effects.<h4>Conclusions</h4>CUR might have a potential neuroprotective effect by promoting cell viability in AD, which might be associated with cell autophagy. Furthermore, MYC, Cdh1, and Acaca might be involved in the progression of AD.

Also flagged:Chronic Hepatitis Binterferonhepatitis B e antigenHBeAghepatitis B surface antigenChronic infection
Journal Article 2018-01-15 ✓ 1 Snippet Liu Y, Li W, Jia T, Peng D, Li H, Li X, Lv S.
In-Text Gene Mentions

…viral hepatitis (e.g.,hemochromatosis, autoimmune hepatitis, metabo…

Show Full Abstract

<b><i>Background and Aims:</i></b> The use of additional nucleos(t)ide analogues (NAs) without cross-resistance to previously used NAs as a rescue therapy is recommended by most international guidelines for chronic hepatitis B patients with NA-resistance. We aimed to investigate the efficacy and safety of combination therapy of peg-interferon (PegIFN) alfa-2a and NA in these patients, comparing to those who switch to an alternative NA therapy without cross-resistance. <b><i>Methods:</i></b> In this prospective, comparative and cohort study, data were collected from the patients' hospital records. Eligible patients were those with hepatitis B e antigen (HBeAg) positivity and resistance to one or more NAs. All patients were treated with alternative NA alone or in combination with PegIFN alfa-2a for 52 weeks or 72 weeks, respectively. HBeAg seroconversion was measured at the end of follow-up (EOF; more than 104 weeks after the end of treatment). <b><i>Results:</i></b> Sixty-three patients were recruited to the cohort study (NA-therapy group = 31 patients; combination therapy group of NA and PegIFN alfa-2a = 32 patients). At the EOF, significantly more patients in the combination therapy group (13/27, 48.2%) achieved primary outcome of HBeAg seroconversion than those in the NA therapy group (4/32, 12.5%) (<i>p</i> = 0.003). Four patients (14.8%) in the combination therapy group achieved hepatitis B surface antigen (HBsAg) loss and HBsAg seroconversion, but none in the NA therapy group did (<i>p</i> = 0.039). In the combination therapy group, 16 patients (51.6%) achieved HBeAg seroconversion at the end of treatment, of which, 11 patients (68.8%) maintained the response until EOF. <b><i>Conclusions:</i></b> Adding on PegIFN alfa-2a in combination with NA therapy might be an appropriate rescue treatment option for patients who have prior NA resistance. In addition, combination therapy induced sustained off-treatment biochemical responses in these patients.

Also flagged:hydrocarbonhydroxyl-groupsDicyclohexylcarbodiimideEthanolAFMsodium
Journal Article 2018-01-15 ✓ 1 Snippet Madsen J, Ducker RE, Al Jaf O, Cartron ML, Alswieleh AM, Smith CH, Hunter CN, Armes SP, Leggett GJ.
In-Text Gene Mentions

DCC

Show Full Abstract

Binary brush structures consisting of poly(cysteine methacrylate) (PCysMA) "corrals" enclosed within poly(oligoethylene glycol methyl ether methacrylate) (POEGMA) "walls" are fabricated simply and efficiently using a two-step photochemical process. First, the C-Cl bonds of 4-(chloromethyl)phenylsilane monolayers are selectively converted into carboxylic acid groups by patterned exposure to UV light through a mask and POEGMA is grown from unmodified chlorinated regions by surface-initiated atom-transfer radical polymerisation (ATRP). Incorporation of a ratiometric fluorescent pH indicator, Nile Blue 2-(methacryloyloxy)ethyl carbamate (NBC), into the polymer brushes facilitates assessment of local changes in pH using a confocal laser scanning microscope with spectral resolution capability. Moreover, the dye label acts as a radical spin trap, enabling removal of halogen end-groups from the brushes <i>via in situ</i> dye addition during the polymerisation process. Second, an initiator is attached to the carboxylic acid-functionalised regions formed by UV photolysis in the patterning step, enabling growth of PCysMA brushes by ATRP. Transfer of the system to THF, a poor solvent for PCysMA, causes collapse of the PCysMA brushes. At the interface between the collapsed brush and solvent, selective derivatisation of amine groups is achieved by reaction with excess glutaraldehyde, facilitating attachment of aminobutyl(nitrile triacetic acid) (NTA). The PCysMA brush collapse is reversed on transfer to water, leaving it fully expanded but only functionalized at the brush-water interface. Following complexation of NTA with Ni<sup>2+</sup>, attachment of histidine-tagged proteorhodopsin and lipid deposition, light-activated transport of protons into the brush structure is demonstrated by measuring the ratiometric response of NBC in the POEGMA walls.

Also flagged:Chronic Liver DiseaseZincchronic liver diseaseschronic hepatitisliver cirrhosisfatty liver
Journal Article 2018-01-14 No Snippets Himoto T, Masaki T.
Show Full Abstract

Zinc (Zn) is an essential trace element which has favorable antioxidant, anti-inflammatory, and apoptotic effects. The liver mainly plays a crucial role in maintaining systemic Zn homeostasis. Therefore, the occurrence of chronic liver diseases, such as chronic hepatitis, liver cirrhosis, or fatty liver, results in the impairment of Zn metabolism, and subsequently Zn deficiency. Zn deficiency causes plenty of metabolic abnormalities, including insulin resistance, hepatic steatosis and hepatic encephalopathy. Inversely, metabolic abnormalities like hypoalbuminemia in patients with liver cirrhosis often result in Zn deficiency. Recent studies have revealed the putative mechanisms by which Zn deficiency evokes a variety of metabolic abnormalities in chronic liver disease. Zn supplementation has shown beneficial effects on such metabolic abnormalities in experimental models and actual patients with chronic liver disease. This review summarizes the pathogenesis of metabolic abnormalities deriving from Zn deficiency and the favorable effects of Zn administration in patients with chronic liver disease. In addition, we also highlight the interactions between Zn and other trace elements, vitamins, amino acids, or hormones in such patients.

Also flagged:cytochrome P450sGSTdetoxificationGene expressionresponse to toxic insultinflammatory responses
Journal Article 2018-01-13 ✓ 2 Snippets Reed KM, Mendoza KM, Abrahante JE, Coulombe RA.
In-Text Gene Mentions

…member 1 (SERPINC1)).…

…SERPINA10 , andSERPINC1) were expressed…

Show Full Abstract

The food-borne mycotoxin aflatoxin B₁ (AFB₁) poses a significant risk to poultry, which are highly susceptible to its hepatotoxic effects. Domesticated turkeys (<i>Meleagris gallopavo</i>) are especially sensitive, whereas wild turkeys (<i>M. g. silvestris</i>) are more resistant. AFB₁ toxicity entails bioactivation by hepatic cytochrome P450s to the electrophilic exo-AFB₁-8,9-epoxide (AFBO). Domesticated turkeys lack functional hepatic GST-mediated detoxification of AFBO, and this is largely responsible for the differences in resistance between turkey types. This study was designed to characterize transcriptional changes induced in turkey livers by AFB₁, and to contrast the response of domesticated (susceptible) and wild (more resistant) birds. Gene expression responses to AFB₁ were examined using RNA-sequencing. Statistically significant differences in gene expression were observed among treatment groups and between turkey types. Expression analysis identified 4621 genes with significant differential expression (DE) in AFB₁-treated birds compared to controls. Characterization of DE transcripts revealed genes dis-regulated in response to toxic insult with significant association of Phase I and Phase II genes and others important in cellular regulation, modulation of apoptosis, and inflammatory responses. Constitutive expression of <i>GSTA3</i> was significantly higher in wild birds and was significantly higher in AFB₁-treated birds when compared to controls for both genetic groups. This pattern was also observed by qRT-PCR in other wild and domesticated turkey strains. Results of this study emphasize the differential response of these genetically distinct birds, and identify genes and pathways that are differentially altered in aflatoxicosis.

Also flagged:serotonin transporter
Journal Article 2018-01-12 No Snippets Stevenson JM.
Show Full Abstract

No abstract available.

Also flagged:Chromosomeorganizationmaintenance of chromosomesCohesinSMC5sister chromatid
Journal Article 2018-01-12 ✓ 1 Snippet Diaz M, Pecinka A.
In-Text Gene Mentions

Condensincomplex (containing SMC2…

Show Full Abstract

Chromosome organization, dynamics and stability are required for successful passage through cellular generations and transmission of genetic information to offspring. The key components involved are Structural maintenance of chromosomes (SMC) complexes. Cohesin complex ensures proper chromatid alignment, condensin complex chromosome condensation and the SMC5/6 complex is specialized in the maintenance of genome stability. Here we summarize recent knowledge on the composition and molecular functions of SMC5/6 complex. SMC5/6 complex was originally identified based on the sensitivity of its mutants to genotoxic stress but there is increasing number of studies demonstrating its roles in the control of DNA replication, sister chromatid resolution and genomic location-dependent promotion or suppression of homologous recombination. Some of these functions appear to be due to a very dynamic interaction with cohesin or other repair complexes. Studies in Arabidopsis indicate that, besides its canonical function in repair of damaged DNA, the SMC5/6 complex plays important roles in regulating plant development, abiotic stress responses, suppression of autoimmune responses and sexual reproduction.

Also flagged:solid tumoursCKIhepatocellular carcinomacancermatrineoxymatrine
Journal Article 2018-01-12 No Snippets Gao L, Wang KX, Zhou YZ, Fang JS, Qin XM, Du GH.
Show Full Abstract

Compound Kushen Injection (CKI) is a Traditional Chinese Medicine (TCM) preparation that has been clinically used in China to treat various types of solid tumours. Although several studies have revealed that CKI can inhibit the proliferation of hepatocellular carcinoma (HCC) cell lines, the active compounds, potential targets and pathways involved in these effects have not been systematically investigated. Here, we proposed a novel idea of "main active compound-based network pharmacology" to explore the anti-cancer mechanism of CKI. Our results showed that CKI significantly suppressed the proliferation and migration of SMMC-7721 cells. Four main active compounds of CKI (matrine, oxymatrine, sophoridine and N-methylcytisine) were confirmed by the integration of ultra-performance liquid chromatography/mass spectrometry (UPLC-MS) with cell proliferation assays. The potential targets and pathways involved in the anti-HCC effects of CKI were predicted by a network pharmacology approach, and some of the crucial proteins and pathways were further validated by western blotting and metabolomics approaches. Our results indicated that CKI exerted anti-HCC effects via the key targets MMP2, MYC, CASP3, and REG1A and the key pathways of glycometabolism and amino acid metabolism. These results provide insights into the mechanism of CKI by combining quantitative analysis of components, network pharmacology and experimental validation.

Also flagged:methylationprostate cancerprostatecancerprostate tumorsadenocarcinoma
Journal Article 2018-01-12 No Snippets Li W, Huang Y, Sargsyan D, Khor TO, Guo Y, Shu L, Yang AY, Zhang C, Paredes-Gonzalez X, Verzi M, Hart RP, Kong AN.
Show Full Abstract

<h4>Purpose</h4>We investigated the genomic DNA methylation profile of prostate cancer in transgenic adenocarcinoma of the mouse prostate (TRAMP) cancer model and to analyze the crosstalk among targeted genes and the related functional pathways.<h4>Methods</h4>Prostate DNA samples from 24-week-old TRAMP and C57BL/6 male mice were isolated. The DNA methylation profiles were analyzed by methylated DNA immunoprecipitation (MeDIP) followed by next-generation sequencing (MeDIP-seq). Canonical pathways, diseases and function and network analyses of the different samples were then performed using the Ingenuity<sup>®</sup> Pathway Analysis (IPA) software. Some target genes with significant difference in methylation were selected for validation using methylation specific primers (MSP) and qPCR.<h4>Results</h4>TRAMP mice undergo extensive aberrant CpG hyper- and hypo-methylation. There were 2147 genes with a significant (log2-change ≥ 2) change in CpG methylation between the two groups, as mapped by the IPA software. Among these genes, the methylation of 1105 and 1042 genes was significantly decreased and increased, respectively, in TRAMP prostate tumors. The top associated disease identified by IPA was adenocarcinoma; however, the cAMP response element-binding protein (CREB)-, histone deacetylase 2 (HDAC2)-, glutathione S-transferase pi (GSTP1)- and polyubiquitin-C (UBC)-related pathways showed significantly altered methylation profiles based on the canonical pathway and network analyses. MSP and qPCR results of genes of interests corroborated with MeDIP-seq findings.<h4>Conclusions</h4>This is the first MeDIP-seq with IPA analysis of the TRAMP model to provide novel insight into the genome-wide methylation profile of prostate cancer. Studies on epigenetics, such as DNA methylation, will potentially provide novel avenues and strategies for further development of biomarkers targeted for treatment and prevention approaches for prostate cancer.

Also flagged:DegradationIAPHuntington's diseaseHDautosomal dominant neurodegenerative disorderubiquitin ligase
Journal Article 2018-01-12 ✓ 5 Snippets Tomoshige S, Nomura S, Ohgane K, Hashimoto Y, Ishikawa M.
In-Text Gene Mentions

…protein knockdown ofHttby using hybrid…

…hybrid small molecules (Httdegraders) consisting of…

…synthesized a similarHttdegrader utilizing MV1,…

…induced interaction betweenHttaggregates and IAP,…

…the efficacy ofHttdegradation by the…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by aggregation of mutant huntingtin (mHtt), and removal of mHtt is expected as a potential therapeutic option. We previously reported protein knockdown of Htt by using hybrid small molecules (Htt degraders) consisting of BE04, a ligand of ubiquitin ligase (E3), linked to probes for protein aggregates. Here, in order to examine the effect of changing the ligand, we synthesized a similar Htt degrader utilizing MV1, an antagonist of the inhibitor of apoptosis protein (IAP) family (a subgroup of ubiquitin E3 ligases), which is expected to have a higher affinity and specificity for IAP, as compared with BE04. The MV1-based hybrid successfully induced interaction between Htt aggregates and IAP, and reduced mHtt levels in living cells. Its mode of action was confirmed to be the same as that of the BE04-based hybrid. However, although the affinity of MV1 for IAP is greater than that of BE04, the efficacy of Htt degradation by the MV1-based molecule was lower, suggesting that linker length between the ligand and probe might be an important determinant of efficacy.

Also flagged:pyrrolinesixNACMexiletineSodium Channelmyotonic-syndromes
Journal Article 2018-01-12 ✓ 2 Snippets De Bellis M, Sanarica F, Carocci A, Lentini G, Pierno S, Rolland JF, Conte Camerino D, De Luca A.
In-Text Gene Mentions

The work has been supported by a grant to ADB from Dutch Duchenne Parent Project (DPP_NL) 2015, entitled “Pre-clinical studies to validate c-Src tyrosine kinase as therapeutic target in Duchenne muscular dystrophy and by Telethon-Italy (Grant # GGP14096 to DCC).

…# GGP14096 toDCC).…

Show Full Abstract

Mexiletine (Mex) has been recently appointed as an orphan-drug in myotonic-syndromes, being a potent use-dependent blocker of skeletal-muscle sodium channels (Na<sub>V</sub>1.4). Available evidences about a potential anti-oxidant effect of Mex and its tetramethyl-pyrroline-derivatives <i>in vivo</i>, suggest the possibility to further enlarge the therapeutic potential of Mex-like compounds in myopathies in which alteration of excitation-contraction coupling is paralleled by oxidative stress. In line with this and based on our previous structure-activity-relationship studies, we synthesized new compounds with a tetramethyl-pyrroline-ring on the amino-group of both Mex (VM11) and of its potent use-dependent isopropyl-derivative (CI16). The compounds were tested for their ability to block native Na<sub>V</sub>1.4 and to exert cyto-protective effects against oxidative-stress injury in myoblasts. Voltage-clamp-recordings on adult myofibers were performed to assess the tonic and use-dependent block of peak sodium-currents (I<sub>Na</sub>) by VM11 and CI16, as well as Mex, VM11 and CI16 were 3 and 6-fold more potent than Mex in producing a tonic-block of peak sodium-currents (I<sub>Na</sub>), respectively. Interestingly, CI16 showed a 40-fold increase of potency with respect to Mex during high-frequency stimulation (10-Hz), resulting the strongest use-dependent Mex-like compound so far. The derivatives also behaved as inactivated channel blockers, however the voltage dependent block was modest. The experimental data fitted with the molecular-modeling simulation based on previously proposed interaction of main pharmacophores with Na<sub>V</sub>1.4 binding-site. CI16 and VM11 were then compared to Mex and its isopropyl derivative (Me5) for the ability to protect C<sub>2</sub>C<sub>12</sub>-cells from H<sub>2</sub>O<sub>2</sub>-cytotoxicity in the concentration range effective on Na<sub>v</sub>1.4. Mex and Me5 showed a moderate cyto-protective effect in the presence of H<sub>2</sub>O<sub>2</sub>, Importantly, CI16 and VM11 showed a remarkable cyto-protection at concentrations effective for use-dependent block of Na<sub>V</sub>1.4. This effect was comparable to that of selected anti-oxidant drugs proved to exert protective effect in preclinical models of progressive myopathies such as muscular dystrophies. Then, the tetramethyl-pyrroline compounds have increased therapeutic profile as sodium channel blockers and an interesting cyto-protective activity. The overall profile enlarges therapeutic potential from channelopathies to myopathies in which alteration of excitation-contraction coupling is paralleled by oxidative-stress, i.e., muscular dystrophies.

Also flagged:TNFαfolatechitosanpro-inflammatory cytokinerheumatoid arthritisfolic acid
Journal Article 2018-01-12 No Snippets Shi Q, Rondon-Cavanzo EP, Dalla Picola IP, Tiera MJ, Zhang X, Dai K, Benabdoune HA, Benderdour M, Fernandes JC.
Show Full Abstract

<h4>Background</h4>Tumor necrosis factor-alpha (TNFα), a pro-inflammatory cytokine, has been shown to play a role in the pathophysiology of rheumatoid arthritis. Silencing TNFα expression with small interfering RNA (siRNA) is a promising approach to treatment of the condition.<h4>Methods</h4>Towards this end, our team has developed a modified chitosan (CH) nanocarrier, deploying folic acid, diethylethylamine (DEAE) and polyethylene glycol (PEG) (folate-PEG-CH-DEAE<sub>15</sub>). The gene carrier protects siRNA against nuclease destruction, its ligands facilitate siRNA uptake via cell surface receptors, and it provides improved solubility at neutral pH with transport of its load into target cells. In the present study, nanoparticles were prepared with siRNA-TNFα, DEAE, and folic acid-CH derivative. Nanoparticle size and zeta potential were verified by dynamic light scattering. Their TNFα-knockdown effects were tested in a murine collagen antibody-induced arthritis model. TNFα expression was examined along with measurements of various cartilage and bone turnover markers by performing histology and microcomputed tomography analysis.<h4>Results</h4>We demonstrated that folate-PEG-CH-DEAE<sub>15</sub>/siRNA nanoparticles did not alter cell viability, and significantly decreased inflammation, as demonstrated by improved clinical scores and lower TNFα protein concentrations in target tissues. This siRNA nanocarrier also decreased articular cartilage destruction and bone loss.<h4>Conclusion</h4>The results indicate that folate-PEG-CH-DEAE<sub>15</sub> nanoparticles are a safe and effective platform for nonviral gene delivery of siRNA, and their potential clinical applications warrant further investigation.

Also flagged:cancernon-small cell lung cancernucleotidegene expressiontranslationalmetabolism
Journal Article 2018-01-12 ✓ 1 Snippet Jiang M, Li X, Quan X, Yang X, Zheng C, Hao X, Qu R, Zhou B.
In-Text Gene Mentions

…regulate expression ofOLFM4in ovarian cancer…

Show Full Abstract

<h4>Purpose</h4>MiR-486 was found to be associated with cancer's diagnosis and prognosis. This meta-analysis aimed to investigate the potential effect of miR-486 on cancer detection and prognosis.<h4>Materials and methods</h4>We searched PubMed, Cochrane library, Embase, Chinese National Knowledge Infrastructure (CNKI) and Wanfang databases to find all correlated articles. The STATA 11.0 was applied to estimate the pooled effects, heterogeneity and publication bias.<h4>Results</h4>The pooled sensitivity (SEN), specificity (SPE) and Area under the curve (AUC) were 82% (95% CI: 78-85%), 88% (95% CI: 83-92%) and 0.91 (95% CI: 0.88-0.93). Subgroup analysis indicated miR-486 from circulating samples exhibited higher diagnostic accuracy with the AUC was 0.90 (95% CI: 0.87-0.92) than miR-486 from other specimen with the AUC of 0.78 (95% CI: 0.75-0.82) and miR-486 obtained a better diagnostic value in the Asian population with the AUC of 0.94 (95% CI: 0.91-0.95) than the Caucasian and Caucasian/African population with the AUC of 0.80 (95% CI: 0.76-0.83) and 0.89 (95% CI: 0.86-0.91) respectively. MiR-486 obtained high value for the diagnosis of non-small cell lung cancer with SEN, SPE and AUC were 0.82 (95% CI: 0.0.77-0.87), 0.90 (95% CI: 0.84-0.94) as well as 0.92 (95% CI: 0.89-0.94) respectively. For the 7 prognostic tests, the pooled hazard ratio (HR) was 0.48 (95% CI: -0.13-1.08) for low versus high miR-486 expression.<h4>Conclusions</h4>This meta-analysis indicated that miR-486 can be used as ideal biomarkers in the cancer's diagnosis. However, Low miR-486 expression did not increase the risk of poor outcome.

Also flagged:triacylglycerolhydroperoxidelipiddioleoylhydroperoxyperoxide
Journal Article 2018-01-12 No Snippets Kato S, Shimizu N, Hanzawa Y, Otoki Y, Ito J, Kimura F, Takekoshi S, Sakaino M, Sano T, Eitsuka T, Miyazawa T, Nakagawa K.
Show Full Abstract

Triacylglycerol (TG), the main component of edible oil, is oxidized by thermal- or photo- oxidation to form TG hydroperoxide (TGOOH) as the primary oxidation product. Since TGOOH and its subsequent oxidation products cause not only the deterioration of oil quality but also various toxicities, preventing the oxidation of edible oils is essential. Therefore understanding oxidation mechanisms that cause the formation of TGOOH is necessary. Since isomeric information of lipid hydroperoxide provides insights about oil oxidation mechanisms, we focused on dioleoyl-(hydroperoxy octadecadienoyl)-TG (OO-HpODE-TG) isomers, which are the primary oxidation products of the most abundant TG molecular species (dioleoyl-linoleoyl-TG) in canola oil. To secure highly selective and sensitive analysis, authentic OO-HpODE-TG isomer references (i.e., hydroperoxide positional/geometrical isomers) were synthesized and analyzed with HPLC-MS/MS. With the use of the method, photo- or thermal- oxidized edible oils were analyzed. While dioleoyl-(10-hydroperoxy-8<i>E</i>,12<i>Z</i>-octadecadienoyl)-TG (OO-(10-HpODE)-TG) and dioleoyl-(12-hydroperoxy-9<i>Z</i>,13<i>E</i>-octadecadienoyl)-TG (OO-(12-HpODE)-TG) were characteristically detected in photo-oxidized oils, dioleoyl-(9-hydroperoxy-10<i>E</i>,12<i>E</i>-octadecadienoyl)-TG and dioleoyl-(13-hydroperoxy-9<i>E</i>,11<i>E</i>-octadecadienoyl)-TG were found to increase depending on temperature in thermal-oxidized oils. These results prove that our methods not only evaluate oil oxidation in levels that are unquantifiable with peroxide value, but also allows for the determination of oil oxidation mechanisms. From the analysis of marketed canola oils, photo-oxidized products (i.e., OO-(10-HpODE)-TG and OO-(12-HpODE)-TG) were characteristically accumulated compared to the oil analyzed immediately after production. The method described in this paper is valuable in the understanding of oil and food oxidation mechanisms, and may be applied to the development of preventive methods against food deterioration.

Also flagged:Adsorptioncellulasewatercholesterolnitritecoronary heart disease
Journal Article 2018-01-12 ✓ 1 Snippet Zheng Y, Li Y, Xu J, Gao G, Niu F.
In-Text Gene Mentions

…SEM images ofDCCand the DFs…

Show Full Abstract

The effects of acidic treatment, cellulase hydrolysis, particle size distribution and pH on the adsorption capacity of defatted coconut cake dietary fibers (DCCDF) were studied. The results demonstrated that cellulase hydrolysis could significantly improve the soluble dietary fiber content, water holding ability and adsorption ability of DCCDF on cholesterol, bile and nitrite ions. Acidic treatment enhanced the oil holding capacity and adsorption ability in cholesterol and nitrite ions. Moreover, the adsorption ability of DFs in cholesterol, nitrite and bile all increased with reduced particle size (250 to 167 μm), and DCCDF demonstrated a higher adsorption capacity at pH 2.0 than at pH 7.0. The change in adsorption capacity of DCCDF might be suitable for application in the food industry as a low-calorie and cholesterol lowering functional ingredient.

bioRxiv 2018-01-12 Preprint (No Snippets API) Murmann AE, Gao QQ, Putzbach W, Patel M, Bartom ET, Law C, Bridgeman B, Chen S, McMahon KM, Thaxton CS, Peter ME.
Show Full Abstract

Trinucleotide repeat (TNR) expansions in the genome cause a number of degenerative diseases. A prominent TNR expansion involves the triplet CAG in the huntingtin (HTT) gene responsible for Huntington’s disease (HD). Pathology is caused by protein and RNA generated from the TNR regions including small siRNA-sized repeat fragments. An inverse correlation between the length of the repeats in HTT and cancer incidence has been reported for HD patients. We now show that siRNAs based on the CAG TNR are toxic to cancer cells by targeting genes that contain long reverse complimentary TNRs in their open reading frames. Of the 60 siRNAs based on the different TNRs, the 6 members in the CAG/CUG family of related TNRs are the most toxic to both human and mouse cancer cells. siCAG/CUG TNR-based siRNAs induce cell death in vitro in all tested cancer cell lines and slow down tumor growth in a preclinical mouse model of ovarian cancer with no signs of toxicity to the mice. We propose to explore TNR-based siRNAs as a novel form of anti-cancer reagents.

Also flagged:oligonucleotidegene expressionoligonucleotidesribonucleasesRNasesalanine
Journal Article 2018-01-11 ✓ 1 Snippet Angelbello AJ, Chen JL, Childs-Disney JL, Zhang P, Wang ZF, Disney MD.
In-Text Gene Mentions

HTT

Show Full Abstract

Rapid progress in genome sequencing technology has put us firmly into a postgenomic era. A key challenge in biomedical research is harnessing genome sequence to fulfill the promise of personalized medicine. This Review describes how genome sequencing has enabled the identification of disease-causing biomolecules and how these data have been converted into chemical probes of function, preclinical lead modalities, and ultimately U.S. Food and Drug Administration (FDA)-approved drugs. In particular, we focus on the use of oligonucleotide-based modalities to target disease-causing RNAs; small molecules that target DNA, RNA, or protein; the rational repurposing of known therapeutic modalities; and the advantages of pharmacogenetics. Lastly, we discuss the remaining challenges and opportunities in the direct utilization of genome sequence to enable design of medicines.

Also flagged:ITS1-58S-ITS2 rRNAguaianeslipopolysaccharidenitric oxideaminoguanidine
Journal Article 2018-01-11 ✓ 1 Snippet Niu S, Xie CL, Xia JM, Luo ZH, Shao Z, Yang XW.
In-Text Gene Mentions

…Then (R)-MPA (2.5 mg), DCC (2.5 mg), and DMAP (2.5 mg) were added.…

Show Full Abstract

Nine new guaianes (graphostromanes A-I, 1-9) were isolated from the deep-sea-derived fungus Graphostroma sp. MCCC 3A00421, along with four known ones (10-13). The relative configurations were established mainly by detailed analysis of the NMR and HRESIMS data, while the absolute configurations were assigned using the X-ray crystallography and modified Mosher's method. All isolates were evaluated for their inhibitory effects against lipopolysaccharide (LPS)-induced nitric oxide (NO) production in RAW264.7 macrophages. Graphostromanes F (6) showed remarkable inhibitory effect with an IC<sub>50</sub> value of 14.2 μM, which was even stronger than that of aminoguanidine, a positive control with an IC<sub>50</sub> value of 23.4 μM.

Also flagged:Gene expressionresponse to oxidative stressimmune responselipidmetabolismheat shock proteins
Journal Article 2018-01-11 No Snippets Ramayo-Caldas Y, Ballester M, Sánchez JP, González-Rodríguez O, Revilla M, Reyer H, Wimmers K, Torrallardona D, Quintanilla R.
Show Full Abstract

This study aims identifying candidate genes and pathways associated with feed efficiency (FE) in pigs. Liver and duodenum transcriptomes of 37 gilts showing high and low residual feed intake (RFI) were analysed by RNA-Seq. Gene expression data was explored through differential expression (DE) and weighted gene co-expression network analyses. DE analysis revealed 55 and 112 differentially regulated genes in liver and duodenum tissues, respectively. Clustering genes according to their connectivity resulted in 23 (liver) and 25 (duodenum) modules of genes with a co-expression pattern. Four modules, one in liver (with 444 co-expressed genes) and three in duodenum (gathering 37, 126 and 41 co-expressed genes), were significantly associated with FE indicators. Intra-module analyses revealed tissue-specific candidate genes; 12 of these genes were also identified as DE between individuals with high and low RFI. Pathways enriched by the list of genes showing DE and/or belonging to FE co-expressed modules included response to oxidative stress, inflammation, immune response, lipid metabolism and thermoregulation. Low overlapping between genes identified in duodenum and liver tissues was observed but heat shock proteins were associated to FE in both tissues. Our results suggest tissue-specific rather than common transcriptome regulatory processes associated with FE in pigs.

Also flagged:HuntingtinHuntington's diseaseHDpathogenesisneurodegenerative disordermovement disorder
Journal Article 2018-01-11 ✓ 5 Snippets Langfelder P, Gao F, Wang N, Howland D, Kwak S, Vogt TF, Aaronson JS, Rosinski J, Coppola G, Horvath S, Yang XW.
In-Text Gene Mentions

HD is caused by a CAG trinucleotide repeat expansion encoding an elongated polyglutamine (polyQ) stretch near the N-terminus of Huntingtin (HTT) [3].

These numbers are consistent with striatum being the brain region most affected by the Htt mutation in HD.

…N-terminus of Huntingtin (HTT) [ 3 ].…

…dysregulated in anHttCAG length- and…

…murine huntingtin (Htt) knock-in (KI)…

Show Full Abstract

In Huntington's disease (HD) patients and in model organisms, messenger RNA transcriptome has been extensively studied; in contrast, comparatively little is known about expression and potential role of microRNAs. Using RNA-sequencing, we have quantified microRNA expression in four brain regions and liver, at three different ages, from an allelic series of HD model mice with increasing CAG length in the endogenous Huntingtin gene. Our analyses reveal CAG length-dependent microRNA expression changes in brain, with 159 microRNAs selectively altered in striatum, 102 in cerebellum, 51 in hippocampus, and 45 in cortex. In contrast, a progressive CAG length-dependent microRNA dysregulation was not observed in liver. We further identify microRNAs whose transcriptomic response to CAG length expansion differs significantly among the brain regions and validate our findings in data from a second, independent cohort of mice. Using existing mRNA expression data from the same animals, we assess the possible relationships between microRNA and mRNA expression and highlight candidate microRNAs that are negatively correlated with, and whose predicted targets are enriched in, CAG-length dependent mRNA modules. Several of our top microRNAs (Mir212/Mir132, Mir218, Mir128 and others) have been previously associated with aspects of neuronal development and survival. This study provides an extensive resource for CAG length-dependent changes in microRNA expression in disease-vulnerable and -resistant brain regions in HD mice, and provides new insights for further investigation of microRNAs in HD pathogenesis and therapeutics.

Also flagged:MAFBtranscription factorretinoic acidspermatogenesislocalizationc-MAF
Journal Article 2018-01-11 No Snippets Shawki HH, Oishi H, Usui T, Kitadate Y, Basha WA, Abdellatif AM, Hasegawa K, Okada R, Mochida K, El-Shemy HA, Muratani M, Ogura A, Yoshida S, Takahashi S.
Show Full Abstract

The transcription factor MAFB is an important regulator of the development and differentiation of various organs and tissues. Previous studies have shown that MAFB is expressed in embryonic and adult mouse testes and is expected to act as the downstream target of retinoic acid (RA) to initiate spermatogenesis. However, its exact localization and function remain unclear. Here, we localized MAFB expression in embryonic and adult testes and analyzed its gene function using Mafb-deficient mice. We found that MAFB and c-MAF are the only large MAF transcription factors expressed in testes, while MAFA and NRL are not. MAFB was localized in Leydig and Sertoli cells at embryonic day (E) 18.5 but in Leydig cells, Sertoli cells, and pachytene spermatocytes in adults. Mafb-deficient testes at E18.5 showed fully formed seminiferous tubules with no abnormal structure or differences in testicular somatic cell numbers compared with those of control wild-type mice. Additionally, the expression levels of genes related to development and function of testicular cells were unchanged between genotypes. In adults, the expression of MAFB in Sertoli cells was shown to be stage specific and induced by RA. By generating Mafbfl/fl CAG-CreER™ (Mafb-cKO) mice, in which Cre recombinase was activated upon tamoxifen treatment, we found that the neonatal cKO mice died shortly upon Mafb deletion, but adult cKO mice were alive upon deletion. Adult cKO mice were fertile, and spermatogenesis maintenance was normal, as indicated by histological analysis, hormone levels, and germ cell stage-specific markers. Moreover, there were no differences in the proportion of seminiferous stages between cKO mice and controls. However, RNA-Seq analysis of cKO Sertoli cells revealed that the down-regulated genes were related to immune function and phagocytosis activity but not spermatogenesis. In conclusion, we found that MAFB is dispensable for fetal testis morphogenesis and spermatogenesis maintenance in adult mice, despite the significant gene expression in different cell types, but MAFB might be critical for phagocytosis activity of Sertoli cells.

Also flagged:HepcidinirondeficiencytuberculosisTBinfectious disease
Journal Article 2018-01-11 ✓ 3 Snippets Harrington-Kandt R, Stylianou E, Eddowes LA, Lim PJ, Stockdale L, Pinpathomrat N, Bull N, Pasricha J, Ulaszewska M, Beglov Y, Vaulont S, Drakesmith H, McShane H.
In-Text Gene Mentions

Humans with HFE-linked haemochromatosis (caused by a relative insufficiency of hepcidin) are also susceptible to severe V. vulnificus[45], but not it seems, to tuberculosis[3], although definitive evidence is lacking.

…Humans withHFE-linked haemochromatosis (caus…

…Humans withHFE-linked haemochromatosis(caused by a relative insufficiency of hepcidin) are also susceptible to severe V .…

Show Full Abstract

Tuberculosis (TB), caused by the macrophage-tropic pathogen Mycobacterium tuberculosis (M.tb) is a highly prevalent infectious disease. Since an immune correlate of protection or effective vaccine have yet to be found, continued research into host-pathogen interactions is important. Previous literature reports links between host iron status and disease outcome for many infections, including TB. For some extracellular bacteria, the iron regulatory hormone hepcidin is essential for protection against infection. Here, we investigated hepcidin (encoded by Hamp1) in the context of murine M.tb infection. Female C57BL/6 mice were infected with M.tb Erdman via aerosol. Hepatic expression of iron-responsive genes was measured by qRT-PCR and bacterial burden determined in organ homogenates. We found that hepatic Hamp1 mRNA levels decreased post-infection, and correlated with a marker of BMP/SMAD signalling pathways. Next, we tested the effect of Hamp1 deletion, and low iron diets, on M.tb infection. Hamp1 knockout mice did not have a significantly altered M.tb mycobacterial load in either the lungs or spleen. Up to 10 weeks of dietary iron restriction did not robustly affect disease outcome despite causing iron deficiency anaemia. Taken together, our data indicate that unlike with many other infections, hepcidin is decreased following M.tb infection, and show that hepcidin ablation does not influence M.tb growth in vivo. Furthermore, because even severe iron deficiency did not affect M.tb mycobacterial load, we suggest that the mechanisms M.tb uses to scavenge iron from the host must be extremely efficient, and may therefore represent potential targets for drugs and vaccines.

Also flagged:ProhibitinFoot and Mouth DiseaseEV71 infectionjunctionsneuroblastomaPHB
Journal Article 2018-01-11 ✓ 3 Snippets Too IHK, Bonne I, Tan EL, Chu JJH, Alonso S.
In-Text Gene Mentions

…binding protein 1 (PEBP1), enolase-1 (ENO1), stomatin-…

…hanolamine-binding protein 1 (PEBP1), prohibitin (PHB), stomatin-…

…titers, whereas PDIA-,PEBP1- and ENO1-knocked down…

Show Full Abstract

A close relative of poliovirus, enterovirus 71 (EV71) is regarded as an important neurotropic virus of serious public health concern. EV71 causes Hand, Foot and Mouth Disease and has been associated with neurological complications in young children. Our limited understanding of the mechanisms involved in its neuropathogenesis has hampered the development of effective therapeutic options. Here, using a two-dimensional proteomics approach combined with mass spectrometry, we have identified a unique panel of host proteins that were differentially and dynamically modulated during EV71 infection of motor-neuron NSC-34 cells, which are found at the neuromuscular junctions where EV71 is believed to enter the central nervous system. Meta-analysis with previously published proteomics studies in neuroblastoma or muscle cell lines revealed minimal overlapping which suggests unique host-pathogen interactions in NSC-34 cells. Among the candidate proteins, we focused our attention on prohibitin (PHB), a protein that is involved in multiple cellular functions and the target of anti-cancer drug Rocaglamide (Roc-A). We demonstrated that cell surface-expressed PHB is involved in EV71 entry into neuronal cells specifically, while membrane-bound mitochondrial PHB associates with the virus replication complex and facilitates viral replication. Furthermore, Roc-A treatment of EV71-infected neuronal cells reduced significantly virus yields. However, the inhibitory effect of Roc-A on PHB in NSC-34 cells was not through blocking the CRAF/MEK/ERK pathway as previously reported. Instead, Roc-A treated NSC-34 cells had lower mitochondria-associated PHB and lower ATP levels that correlated with impaired mitochondria integrity. In vivo, EV71-infected mice treated with Roc-A survived longer than the vehicle-treated animals and had significantly lower virus loads in their spinal cord and brain, whereas virus titers in their limb muscles were comparable to controls. Together, this study uncovers PHB as the first host factor that is specifically involved in EV71 neuropathogenesis and a potential drug target to limit neurological complications.

Also flagged:HOTAIRcancertumorCytokineantibodychemokines
Journal Article 2018-01-11 ✓ 5 Snippets Ren Y, Jia HH, Xu YQ, Zhou X, Zhao XH, Wang YF, Song X, Zhu ZY, Sun T, Dou Y, Tian WP, Zhao XL, Kang CS, Mei M.
In-Text Gene Mentions

…the promoter ofCDK5RAP1and EGR-1.…

…against human CDK5,CDK5RAP1, H3K27me3, EZH2 (1:1000…

…of EGR-1 andCDK5RAP1were greatly decreased…

…marks on theCDK5RAP1and EGR-1 promoter…

…levels at theCDK5RAP1and EGR-1 promoter…

Show Full Abstract

<h4>Background</h4>The communication between carcinoma associated fibroblasts (CAFs) and cancer cells facilitate tumor metastasis. In this study, we further underlying the epigenetic mechanisms of CAFs feed the cancer cells and the molecular mediators involved in these processes.<h4>Methods</h4>MCF-7 and MDA-MB-231 cells were treated with CAFs culture conditioned medium, respectively. Cytokine antibody array, enzyme-linked immunosorbent assay, western blotting and immunofluorescence were used to identify the key chemokines. Chromatin immunoprecipitation and luciferase reporter assay were performed to explore the transactivation of target LncRNA by CAFs. A series of in vitro assays was performed with RNAi-mediated knockdown to elucidate the function of LncRNA. An orthotopic mouse model of MDA-MB-231 was conducted to confirm the mechanism in vivo.<h4>Results</h4>Here we reported that TGF-β1 was top one highest level of cytokine secreted by CAFs as revealed by cytokine antibody array. Paracrine TGF-β1 was essential for CAFs induced EMT and metastasis in breast cancer cells, which is a crucial mediator of the interaction between stromal and cancer cells. CAF-CM significantly enhanced the HOTAIR expression to promote EMT, whereas treatment with small-molecule inhibitors of TGF-β1 attenuated the activation of HOTAIR. Most importantly, SMAD2/3/4 directly bound the promoter site of HOTAIR, located between nucleotides -386 and -398, -440 and -452, suggesting that HOTAIR was a directly transcriptional target of SMAD2/3/4. Additionally, CAFs mediated EMT by targeting CDK5 signaling through H3K27 tri-methylation. Depletion of HOTAIR inhibited CAFs-induced tumor growth and lung metastasis in MDA-MB-231 orthotopic animal model.<h4>Conclusions</h4>Our findings demonstrated that CAFs promoted the metastatic activity of breast cancer cells by activating the transcription of HOTAIR via TGF-β1 secretion, supporting the pursuit of the TGF-β1/HOTAIR axis as a target in breast cancer treatment.

Also flagged:retinoic acidbone morphogenetic protein 4BMP4RAnociceptionproprioception
Journal Article 2018-01-11 ✓ 5 Snippets Gupta S, Sivalingam D, Hain S, Makkar C, Sosa E, Clark A, Butler SJ.
In-Text Gene Mentions

…of ROBO3 andDCC.…

DCC( Keino-Masu et…

…of ROBO3 andDCCin the spinal…

…While bothDccand Robo3 are…

…A and 6C),Dccand Robo3 have…

Show Full Abstract

Cellular replacement therapies for neurological conditions use human embryonic stem cell (hESC)- or induced pluripotent stem cell (hiPSC)-derived neurons to replace damaged or diseased populations of neurons. For the spinal cord, significant progress has been made generating the in-vitro-derived motor neurons required to restore coordinated movement. However, there is as yet no protocol to generate in-vitro-derived sensory interneurons (INs), which permit perception of the environment. Here, we report on the development of a directed differentiation protocol to derive sensory INs for both hESCs and hiPSCs. Two developmentally relevant factors, retinoic acid in combination with bone morphogenetic protein 4, can be used to generate three classes of sensory INs: the proprioceptive dI1s, the dI2s, and mechanosensory dI3s. Critical to this protocol is the competence state of the neural progenitors, which changes over time. This protocol will facilitate developing cellular replacement therapies to reestablish sensory connections in injured patients.

Also flagged:digestionsecretionaganglionosisChagas diseaseinfectionzoster
Journal Article 2018-01-11 ✓ 1 Snippet Gershon MD.
In-Text Gene Mentions

Sox6

Show Full Abstract

No abstract available.

Also flagged:Huntington diseaseHDneurodegenerative disorderchromosomeneurodegenerative diseaseautosomal-dominant disorders
Journal Article 2018-01-11 ✓ 5 Snippets Barboza LA, Ghisi NC.
In-Text Gene Mentions

The CAG repeat in the HD gene encodes an expansion of glutamine residues in the N-terminus of HTT, beginning after the 17th amino acid (21).

…protein called huntingtin (HTT), a protein of…

HTTis a ubiquitously…

…loss of wild-typeHTTfunction contributes to…

…viously explained huntingtin (HTT), which plays numerous…

Show Full Abstract

Huntington disease (HD) is an incurable neurodegenerative disorder caused by a dominant mutation on the 4th chromosome. We aim to present a scientometric analysis of the extant scientific undertakings devoted to better understanding HD. Therefore, a quantitative study was performed to examine the current state-of-the-art approaches that foster researchers' understandings of the current knowledge, research trends, and research gaps regarding this disorder. We performed literature searches of articles that were published up to September 2016 in the "ISI Web of Science™" (http://apps.webofknowledge.com/). The keyword used was "Huntington disease". Of the initial 14,036 articles that were obtained, 7732 were eligible for inclusion in the study according to their relevance. Data were classified according to language, country of publication, year, and area of concentration. The country leader regarding the number of studies published on HD is the United States, accounting for nearly 30% of all publications, followed by England and Germany, who have published 10 and 7% of all publications, respectively. Regarding the language in which the articles were written, 98% of publications were in English. The first publication to be found on HD was published in 1974. A surge of publications on HD can be seen from 1996 onward. In relation to the various knowledge areas that emerged, most publications were in the fields of neuroscience and neurology, likely because HD is a neurodegenerative disorder. Publications written in areas such as psychiatry, genetics, and molecular biology also predominated.

Also flagged:PARAGestationWaterinfectionyoulung infections
Journal Article 2018-01-11 No Snippets Nguyen PTK, Tran HT, Thai TTT, Foster K, Roberts CL, Marais BJ.
Show Full Abstract

<h4>Background</h4>Breastfeeding is recognized as the single most cost-effective intervention to reduce child morbidity and mortality. However, few studies have explored perceived barriers to breastfeeding and factors associated with breastfeeding intent among mothers of newborn babies in Viet Nam. We conducted a study to assess breastfeeding initiation rates, intent to breastfeed exclusively for 6 months or more and perceived barriers to breastfeed among mothers of newborn babies in Da Nang, Viet Nam.<h4>Methods</h4>We conducted a cross-sectional questionnaire survey of mothers in the postnatal wards of Da Nang Hospital for Women and Children in central Viet Nam from 10 February 2017 to 24 February 2017, following implementation of the World Health Organization (WHO) Essential Newborn Care (ENC) package.<h4>Results</h4>Of 286 mothers surveyed, 259 (90.6%) initiated breastfeeding; 203/258 (78.7%) within 1 hour (h) of birth. Most (207, 72.4%) mothers indicated intent to breastfeed exclusively for 6 months or more, but this was lower among mothers of preterm babies (82.2% versus 20.0%, <i>p</i> < 0.001) and those without post-secondary school education (74.8% versus 55.6%, <i>p</i> = 0.02). Amongst mothers struggling to establish breastfeeding, 18/27 (66.7%) had a Cesarean section. Planned non-exclusive breastfeeding was mostly (39, 60.9%) motivated by mothers' concern that their milk supply would be insufficient for their baby's growth requirements. Most mothers had good knowledge about the benefits of breastfeeding and indicated strong decision autonomy.<h4>Conclusions</h4>We documented high rates of early breastfeeding establishment and intent to breastfeed exclusively for 6 months or more. This probably reflects high levels of maternal education and successful implementation of the WHO ENC package. Mothers of premature babies may benefit from additional support.

Also flagged:ICPIHHdefectgene expressionidiopathic intracranial hypertensionpseudotumor cerebri
Journal Article 2018-01-11 No Snippets Zanello SB, Tadigotla V, Hurley J, Skog J, Stevens B, Calvillo E, Bershad E.
Show Full Abstract

The visual impairment and intracranial pressure (VIIP) syndrome is a neuro-ophthalmologic condition described in astronauts returning from long duration space missions. Idiopathic intracranial hypertension (IIH), also known as pseudotumor cerebri, is characterized by a chronic elevation of intracranial pressure (ICP) in the absence of an intracranial mass lesion. Because VIIP and IIH share some neurologic and ophthalmologic manifestations, the latter might be used as a model to study some of the processes underlying VIIP. This work constitutes a preliminary investigation of the molecular pathways associated with the elevation of ICP in IIH. Gene expression signatures were obtained from exosomes collected from CSF and plasma in patients with possible signs of IIH. The gene expression targets focused on inflammatory genes and miRNAs. The results suggest that inflammatory cytokine-driven processes and immune cell migration are activated when ICP is elevated in IIH patients, either as a cause or effect of the ICP increase. Several miRNAs appear to be involved in this response, among which miR-9 and miR-16 are upregulated in CSF and plasma of higher ICP subjects. This study provides evidence in support of neurophysiological alterations and neuro-immunomodulation in this condition. If similar changes are seen in astronauts manifesting with the VIIP syndrome, an underlying pathophysiological basis may be discovered.

Also flagged:Netrin-1Brain Injuryextracellulardeleted incolorectaluncoordinated gene 5H2
Journal Article 2018-01-11 ✓ 5 Snippets Wang J, Zhai W, Yu Z, Sun L, Li H, Shen H, Li X, Liu C, Chen G.
In-Text Gene Mentions

Immunofluorescence staining of DCC and UNC5H2 was also performed to assess further the upregulated protein levels in neurons in the peri-hematoma cortex.

Netrin-1/DCC and netrin-1/UNC5H2 interactions in the peri-hematoma cortex were assessed by a co-immunoprecipitation assay.

Twenty-four hours after ICH, both DCC and UNC5H2 were upregulated in the peri-hematoma cortex, and DCC was elevated more significantly (Figure 3A).

…in colorectal cancer (DCC) and uncoordinated gene…

…levels of netrin-1,DCC, and UNC5H2 increased,…

Show Full Abstract

Binding of extracellular netrin-1 to its receptors, deleted in colorectal cancer (DCC) and uncoordinated gene 5H2 (UNC5H2), inhibits apoptosis mediated by these receptors. A neuron-specific kinesin motor protein, KIF1A, has been shown to participate in netrin-1 secretion. This study aimed to identify the roles of netrin-1 and KIF1A in secondary brain injury after intracerebral hemorrhage (ICH) and the potential mechanisms. An autologous blood ICH model was established in adult male Sprague-Dawley rats, and cultured neurons were exposed to OxyHb to mimic ICH conditions <i>in vitro</i>. Mouse recombinant netrin-1, expression vectors encoding KIF1A, and KIF1A-specific siRNAs were administered intracerebroventricularly. After ICH, protein levels of netrin-1, DCC, and UNC5H2 increased, while protein levels of KIF1A decreased. Levels of UNC5H2 and DCC bound to netrin-1 increased after ICH but were significantly lower than the increase in total amount of protein. Administration of recombinant netrin-1 attenuated neuronal apoptosis and degeneration in ICH rats. Moreover, KIF1A overexpression increased concentrations of netrin-1 in cerebrospinal fluid and cell culture supernatant and exerted neuroprotective effects via netrin-1 and its receptor pathways. KIF1A plays a critical role in netrin-1 secretion by neurons. An increase in protein levels of netrin-1 may be a neuroprotective strategy after ICH. However, this process is almost completely abolished by ICH-induced loss of KIF1A. An exogenous increase of KIF1A may be a potential strategy for neuroprotection via the netrin-1 pathway.

Also flagged:ataxin-3ubiquitinhHR23BUBQLN2proteasomeataxin
Journal Article 2018-01-11 ✓ 4 Snippets Yang H, Yue HW, He WT, Hong JY, Jiang LL, Hu HY.
In-Text Gene Mentions

Moreover, polyQ-expanded Htt-N552 and Atx-3 reduce the protein level of xeroderma pigmentosum group C (XPC) by sequestration of hHR23B, suggesting that this process may cut down the available quantity of hHR23B and thus affect its normal function in stabilizing XPC.

…Using N-terminal huntingtin (Htt-N552) and ataxin (Atx)-3…

…found that polyQ-expandedHtt-N552 and Atx-3 sequester…

…Moreover, polyQ-expandedHtt-N552 and Atx-3 reduce…

Show Full Abstract

The components of ubiquitin (Ub)-proteasome system, such as Ub, Ub adaptors, or proteasome subunits, are commonly accumulated with the aggregated proteins in inclusions, but how protein aggregates sequester Ub-related proteins remains elusive. Using N-terminal huntingtin (Htt-N552) and ataxin (Atx)-3 as model proteins, we investigated the molecular mechanism underlying sequestration of Ub adaptors by polyQ-expanded proteins. We found that polyQ-expanded Htt-N552 and Atx-3 sequester endogenous Ub adaptors, human RAD23 homolog B (hHR23B) and ubiquilin (UBQLN)-2, into inclusions. This sequestration effect is dependent on the UBA domains of Ub adaptors and the conjugated Ub of the aggregated proteins. Moreover, polyQ-expanded Htt-N552 and Atx-3 reduce the protein level of xeroderma pigmentosum group C (XPC) by sequestration of hHR23B, suggesting that this process may cut down the available quantity of hHR23B and thus affect its normal function in stabilizing XPC. Our findings demonstrate that polyQ-expanded proteins sequester Ub adaptors or other Ub-related proteins into aggregates or inclusions through ubiquitination of the pathogenic proteins. This study may also provide a common mechanism for the formation of Ub-positive inclusions in cells.-Yang, H., Yue, H.-W., He, W.-T., Hong, J.-Y., Jiang, L.-L., Hu, H.-Y. PolyQ-expanded huntingtin and ataxin-3 sequester ubiquitin adaptors hHR23B and UBQLN2 into aggregates via conjugated ubiquitin.

Also flagged:tryptophan hydroxylasestrokepathogenesisPSAPpoststroke emotional dysfunctiontryptophan hydroxylase 2
Journal Article 2018-01-11 No Snippets Ko M, Choi-Kwon S, Jun SE, Kim JH, Cho KH, Nah HW, Song H, Kim JS.
Show Full Abstract

<h4>Objectives</h4>Emotional dysfunction is a common finding in stroke patients. Despite reports on serotonergic involvement in the etiology of poststroke emotional dysfunction (PSED), the role of serotonin synthesizing tryptophan hydroxylase 2 (TPH2) genes in the development of PSED remains unclear.<h4>Methods</h4>Genotyping of <i>TPH2</i> rs4641528 and rs10879355 was performed from genomic DNA of 383 stroke patients collected previously and stored at -70°C. Potential associations between <i>TPH</i>2 genes and poststroke depression (PSD), poststroke emotional incontinence (PSEI), and poststroke anger proneness (PSAP) were investigated 3 months poststroke.<h4>Results</h4>Among the 383 patients, 69 (18%) had PSD, 41 (11%) had PSEI, and 93 (24%) had PSAP. The <i>TPH2</i> rs4641528 genotype frequencies differed significantly between patients with and without either PSD or PSEI, although no significant differences were found between the patients with and without PSAP. In multiple logistic regression analysis, PSD was related to the National Institutes of Health Stroke Scale (NIHSS) score at admission (95% confidence interval [CI]: 1.047-1.230, <i>p </i><<i> </i>.01), modified Rankin scale score at 3 months (95% CI: 0.135-0.848, <i>p </i><<i> </i>.05), and <i>TPH2</i> rs4641528 C allele (95% CI: 1.039-5.631, <i>p </i><<i> </i>.05), whereas PSEI was associated only with the NIHSS score at admission (95% CI: 1.053-1.259, <i>p </i><<i> </i>.01) and the <i>TPH2</i> rs4641528 C allele (95% CI: 1.029-11.678, <i>p </i><<i> </i>.05).<h4>Conclusions</h4>Our findings suggest that the <i>TPH2</i> rs4641528 C allele may play a role in the pathogenesis of PSD and PSEI but not PSAP in Korean stroke patients.

Also flagged:Barrett's esophagusEsophageal adenocarcinomaBEintestinal metaplasiacancerHedgehog
Journal Article 2018-01-11 No Snippets Clark RJ, Craig MP, Agrawal S, Kadakia M.
Show Full Abstract

Esophageal adenocarcinoma (EAC) is a highly aggressive malignancy that develops from Barrett's esophagus (BE), an intestinal metaplasia of the distal esophagus. microRNAs (miRNAs), short non-coding regulatory RNAs, are frequently dysregulated in BE and are thought to play key roles in the onset of BE and its progression to EAC. miRNAs thus have potential diagnostic and prognostic value and are increasingly being used as cancer biomarkers. This review summarizes the current literature related to miRNAs that are dysregulated in BE within the context of Hedgehog, Notch, MAPK, NF kappa-B, Wnt and epithelial-mesenchymal transition (EMT) signaling which are thought to drive BE onset and progression. This comprehensive analysis of miRNAs and their associated signaling in the regulation of BE provides an overview of vital discoveries in this field and highlights gaps in our understanding of BE pathophysiology that warrant further investigation.

Also flagged:Synthesiswaterphotoactive yellow proteincysteinethiophenyl estersethanol
Journal Article 2018-01-11 No Snippets Mallick T, Karmakar A, Batuta S, Ahamed G, Das S, Alam MN, Mukherjee M, Das N, Mandal D, Begum NA.
Show Full Abstract

The visible fluorescent chromophoric moiety present in the water-soluble photoactive yellow protein (PYP) of <i>Ectothiorhodospira halophila</i> is <i>p</i>-hydroxycinnamic acid linked to the cysteine residue (Cys-69) by a thioester bond and it controls the key photoinduced biological processes of the host organism. In the present work, we have synthesized and characterized three structurally different thiophenyl esters [viz., <i>p-</i>hydroxycinnamic-thiophenyl ester (<b>1</b>), <i>p</i>-<i>N</i>,<i>N</i>-dimethylaminocinnamic-thiophenyl ester (<b>2</b>), and <i>S</i>-phenyl-3-(4-chlorophenyl)-3-(phenylthio)propanethioate (<b>3</b>)] in addition to a novel (to the best of our knowledge) stilbene-type olefinic compound, <i>N</i><sup>1</sup>,<i>N</i><sup>1</sup>,<i>N</i><sup>2</sup>,<i>N</i><sup>2</sup>-tetramethyl-1,2-bis(phenylthio)ethene-1,2-diamine (<b>4</b>), under the same reaction condition. All of these four compounds showed characteristic and distinguishable chromophoric/fluorophoric behavior in ethanol and also at pH 7.4. However, we have observed that the intrinsic chromophoric/fluorophoric activities of (<b>1</b>) and (<b>2</b>) were greatly influenced during their interactions with calf-thymus DNA, studied by a range of spectroscopic and physicochemical measurements. We have also applied density functional theory [B3LYP, 6-311G<sup>+</sup>(d,p)]-based method to get optimized structures of (<b>1</b>) and (<b>2</b>), which were explored further for molecular docking studies to understand their mode of interaction with DNA. The present study opens up their possible applications as fluorescence probes for biomacromolecules like DNA in future.

Also flagged:5-aminosalicylic acidbutyrateulcerative colitismyeloperoxidasesuperoxide dismutaseglutathione
Journal Article 2018-01-11 No Snippets Yan Y, Sun J, Xie X, Wang P, Sun Y, Dong Y, Xing J.
Show Full Abstract

The aim of this study was to design and synthesize four colon-targeting mutual prodrugs of 5-aminosalicylic acid (5-ASA) and butyrate, and evaluate their therapeutic effects on ulcerative colitis. Herein, 5-ASB, 5-ASDB, Ols-DB and Ols-DBP were prepared and characterized, and their lipophilicity, solubility, <i>in vitro</i> and <i>in vivo</i> stability were investigated. Finally, the ameliorative effects of the prodrugs on experimental colitis were evaluated <i>via</i> a series of indicators, including the body weight and survival rates of mice, the colon index and colonic damage score, the disease activity index, the myeloperoxidase activity and levels of superoxide dismutase, malondialdehyde, glutathione and glutathione peroxidase in colonic tissues. As a result, 5-ASB was very stable but Ols-DB showed extreme instability in the environment of the gastrointestinal tract, while 5-ASDB and Ols-DBP showed desirable colon-targeting properties. The four prodrugs all had certain therapeutic effects on the experimental colitis. When orally administered to mice, 5-ASDB and Ols-DBP had significantly greater effects than the mixture of 5-ASA and sodium butyrate. Ols-DB was used as an enema and could be as effective as 5-ASDB and Ols-DBP. In addition, the therapeutic effects of the synthesized prodrugs might be associated with their anti-oxidative damage ability.

Also flagged:peroxisome proliferator-activated receptor-γ2peroxisome proliferator-activated receptor γluciferasetype X collagenCol10a1matrix metalloproteinase 13
Journal Article 2018-01-10 ✓ 2 Snippets Xu J, Lv S, Hou Y, Xu K, Sun D, Zheng Y, Zhang Z, Li X, Li Y, Chi G.
In-Text Gene Mentions

…transcription factors Sox5,Sox6, and Sox9, and…

…expression of Sox5,Sox6, and Sox9 gradually…

Show Full Abstract

MicroRNAs (miRNAs) play an essential role in articular cartilage development and growth. However, the exact mechanisms involved in this process remain unknown. In the present study, we investigated the biological functions of <i>miR-27b</i> during hypertrophic differentiation of rat articular chondrocytes. Based on <i>in situ</i> hybridization and immunohistochemistry, we report that <i>miR-27b</i> expression is reduced in the hypertrophic zone of articular cartilage, but expression of peroxisome proliferator-activated receptor γ (Pparγ) is increased. Dual-luciferase reporter gene assay and Western blot analysis demonstrated that Pparγ2 is a target of <i>miR-27b</i> Overexpression of <i>miR-27b</i> inhibited expression of Pparγ2, as well as type X collagen (Col10a1) and matrix metalloproteinase 13 (Mmp13), while significantly promoting the expression of Sex-determining Region-box 9 (Sox9) and type II collagen (Col2a1) at both the mRNA and protein levels. Rosiglitazone, a Pparγ agonist, suppressed Col2a1 expression, while promoting expression of runt-related transcription factor 2 (Runx2) and Col10a1 in a concentration-dependent manner. siRNA-mediated knockdown of Pparγ2 caused an increase in protein levels of Col2a1. The present study demonstrates that <i>miR-27b</i> regulates chondrocyte hypertrophy in part by targetting Pparγ2, and that <i>miR-27b</i> may have important therapeutic implications in cartilage diseases.

Also flagged:Alpha-defensinsα-DefsCrohn's diseasemethylationα-defensinsileitis
Journal Article 2018-01-10 No Snippets Cerrillo E, Moret I, Iborra M, Ramos D, Busó E, Tortosa L, Sáez-González E, Nos P, Beltrán B.
Show Full Abstract

An impaired expression of α-defensins (α-Defs) in the ileal mucosa and, conversely, increased levels in plasma, have been reported in Crohn's disease (CD). However, the specificity and correlation of these findings with the degree of inflammation are unclear. We aimed to characterize the concentration and utility of ileal and plasma α-Defs in CD and to analyse a potential epigenetic mechanism of α-Def expression. Peripheral blood samples and ileal biopsies were obtained from patients at disease onset (aCD), from those who achieved remission (iCD) and from two control groups (healthy controls and non-CD-aetiology ileitis patients). Plasma α-Defs 1-3 and 4 were detected by enzyme-linked immunosorbent assay (ELISA); α-Def 5 by immunolocalization. Methylation analysis of the α-Def 5 gene was performed using the MassARRAY EpiTYPER system. Plasma α-Defs 1-3 concentrations were significantly higher in aCD with ileal involvement (L1, L3) versus iCD or the control groups. The α-Defs 1-3 concentrations were also similar to healthy controls in patients with non-CD ileitis. There was a significant positive correlation between plasma α-Defs 1-3 levels in aCD and the endoscopic index, as well as with C-reactive protein (CRP) levels. The immunopositivity scoring showed significantly reduced α-Def 5 expression in ileal inflamed (aCD) versus non-inflamed mucosa (iCD and healthy controls). The α-Def 5 gene showed a higher methylation status in CD patients than controls, regardless of the inflammation. Plasma α-Defs 1-3 concentrations correlate with the degree of inflammation and appear to be specific biomarkers of ileal-CD at diagnosis. Ileal α-Def 5 expression is down-regulated permanently by methylation.

Also flagged:iron-overload cardiomyopathyironHJVbone morphogenetic co-receptor proteinresponse tomyocardial fibrosis
Journal Article 2018-01-10 ✓ 2 Snippets Das SK, Zhabyeyev P, Basu R, Patel VB, Dyck JRB, Kassiri Z, Oudit GY.
In-Text Gene Mentions

…patients with genetichemochromatosisand secondary iron…

…Hereditary (genetic)hemochromatosisand secondary iron-overload…

Show Full Abstract

Iron-overload cardiomyopathy is prevalent on a worldwide basis and is a major comorbidity in patients with genetic hemochromatosis and secondary iron overload. Therapies are limited in part due to lack of a valid preclinical model, which recapitulates advanced iron-overload cardiomyopathy. Male hemojuvelin (HJV) knockout (HJVKO) mice, which lack HJV, a bone morphogenetic co-receptor protein required for hepcidin expression and systemic iron homeostasis, were fed a high-iron diet starting at 4 weeks of age for a duration of 1 year. Aged HJVKO mice in response to iron overload showed increased myocardial iron deposition and mortality coupled with oxidative stress and myocardial fibrosis culminating in advanced iron-overload cardiomyopathy. In a parallel group, iron-overloaded HJVKO mice received resveratrol (240 mg/day) at 9 months of age until 1 year of age. Echocardiography and invasive pressure-volume (PV) loop analyses revealed a complete normalization of iron-overload mediated diastolic and systolic dysfunction in response to resveratrol therapy. In addition, myocardial sarcoplasmic reticulum Ca<sup>2+</sup> ATPase (SERCa2a) levels were reduced in iron-overloaded hearts and resveratrol therapy restored SERCa2a levels and suppressed up-regulation of the sodium-calcium exchanger (NCX1). Further, iron-mediated oxidative stress and myocardial fibrosis were suppressed by resveratrol treatment with concomitant activation of the p-Akt and p-AMP-activated protein kinase (AMPK) signaling pathways. A combination of ageing and high-iron diet in male HJVKO mice results in a valid preclinical model that recapitulates iron-overload cardiomyopathy in humans. Resveratrol therapy resulted in normalization of cardiac function demonstrating that resveratrol represents a feasible therapeutic intervention to reduce the burden of iron-overload cardiomyopathy.

Also flagged:extracellular matrixsynthesisDegenerative disk disease of thedegenerative disk diseaseextracellularnucleus
Journal Article 2018-01-10 No Snippets Riester SM, Lin Y, Wang W, Cong L, Mohamed Ali AM, Peck SH, Smith LJ, Currier BL, Clark M, Huddleston P, Krauss W, Yaszemski MJ, Morrey ME, Abdel MP, Bydon M, Qu W, Larson AN, van Wijnen AJ, Nassr A.
Show Full Abstract

Degenerative disk disease of the spine is a major cause of back pain and disability. Optimization of regenerative medical therapies for degenerative disk disease requires a deep mechanistic understanding of the factors controlling the structural integrity of spinal tissues. In this investigation, we sought to identify candidate regulatory genes controlling extracellular matrix synthesis in spinal tissues. To achieve this goal we performed high throughput next generation RNA sequencing on 39 annulus fibrosus and 21 nucleus pulposus human tissue samples. Specimens were collected from patients undergoing surgical discectomy for the treatment of degenerative disk disease. Our studies identified associations between extracellular matrix genes, growth factors, and other important regulatory molecules. The fibrous matrix characteristic of annulus fibrosus was associated with expression of the growth factors platelet derived growth factor beta (PDGFB), vascular endothelial growth factor C (VEGFC), and fibroblast growth factor 9 (FGF9). Additionally we observed high expression of multiple signaling proteins involved in the NOTCH and WNT signaling cascades. Nucleus pulposus extracellular matrix related genes were associated with the expression of numerous diffusible growth factors largely associated with the transforming growth signaling cascade, including transforming factor alpha (TGFA), inhibin alpha (INHA), inhibin beta A (INHBA), bone morphogenetic proteins (BMP2, BMP6), and others.<h4>Clinical significance</h4>this investigation provides important data on extracellular matrix gene regulatory networks in disk tissues. This information can be used to optimize pharmacologic, stem cell, and tissue engineering strategies for regeneration of the intervertebral disk and the treatment of back pain. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 36:1356-1369, 2018.

Also flagged:gene expressiondeathAgingcognitive declineADCancer
Journal Article 2018-01-10 ✓ 3 Snippets Canli T, Yu L, Yu X, Zhao H, Fleischman D, Wilson RS, De Jager PL, Bennett DA.
In-Text Gene Mentions

…CD86, CTSH, GTPBP1,HFE, IFNA16, IL18, MASP1,…

…MR1, PLCG2, TAPBP,TRIM38.…

…factors GTPBP1 andTRIM38, protein kinases ABL1…

Show Full Abstract

Subjective social isolation, loneliness, is associated with poor mental and physical health, but the underlying molecular mechanisms are poorly understood. Here we analyzed loneliness data collected on average 5 years ante-mortem and RNA gene expression at death in postmortem dorsolateral prefrontal cortex (DLPFC) from 181 participants in the Rush Memory and Aging Project (MAP), a longitudinal, prospective cohort study of common chronic conditions of aging. Our analytic protocol controlled for biographical variables (age, sex, education), psychological and health variables (depressive symptoms, interval between assessment and autopsy, slope of cognitive decline, AD pathology, presence of infarcts) and RNA integrity. Our results are based on a pre-ranked Gene Set Enrichment Analysis (GSEA) at FDR-corrected q-values <0.05, using these collections from the Molecular Signatures Database (v6.0 MSigDB): (1) Hallmarks, (2) Canonical, (3) Gene Ontology (GO), (4) Chemical and Genetic Perturbations, (5) Immunologic Signatures, (6) Oncogenic Signatures, and (7) Cancer Modules. We now report on 337 up-regulated and 43 down-regulated gene sets, among which the most significant ones were associated with Alzheimer's disease, psychiatric illness, immune dysfunction, and cancer. These gene sets constitute attractive targets for future studies into the molecular mechanisms by which loneliness exacerbates a wide range of neurodegenerative, psychiatric, and somatic illnesses.

Also flagged:H41ketoesterChalconeHoodH28H29
Journal Article 2018-01-10 No Snippets Liu R, Liu M, Hood D, Chen CY, MacNevin CJ, Holten D, Lindsey JS.
Show Full Abstract

Fluorophores that absorb and emit in the red spectral region (600-700 nm) are of great interest in photochemistry and photomedicine. Eight new target chlorins (and 19 new chlorins altogether)-analogues of chlorophyll-of different polarities have been designed and synthesized for various applications; seven of the chlorins are equipped with a bioconjugatable tether. Hydrophobic or amphiphilic chlorins in a non-polar organic solvent (toluene), polar organic solvent (DMF), and aqueous or aqueous micellar media show a sharp emission band in the red region and modest fluorescence quantum yield (Φ<sub>f</sub> = 0.2-0.3). A Poisson analysis implies most micelles are empty and few contain >1 chlorin. Water-soluble chlorins each bearing three PEG (oligoethyleneglycol) groups exhibit narrow emission bands (full-width-at-half maximum <25 nm). The lifetime of the lowest singlet excited state and the corresponding yields and rate constants for depopulation pathways (fluorescence, intersystem crossing, internal conversion) are generally little affected by the PEG groups or dissolution in aqueous or organic media. A set of chlorin-avidin conjugates revealed a 2-fold increase in Φ<sub>f</sub> with increased average chlorin/avidin ratio (2.3-12). In summary, the chlorins of various polarities described herein are well suited as red-emitting fluorophores for applications in aqueous or organic media.

Also flagged:TMEM199liver diseasesteatosistransaminasescholesterolalkaline phosphatase
Journal Article 2018-01-10 ✓ 1 Snippet Vajro P, Zielinska K, Ng BG, Maccarana M, Bengtson P, Poeta M, Mandato C, D'Acunto E, Freeze HH, Eklund EA.
In-Text Gene Mentions

…were normal exceptantithrombin-IIIactivity of 68%…

Show Full Abstract

<h4>Background</h4>TMEM199 deficiency was recently shown in four patients to cause liver disease with steatosis, elevated serum transaminases, cholesterol and alkaline phosphatase and abnormal protein glycosylation. There is no information on the long-term outcome in this disorder.<h4>Results</h4>We here present three novel patients with TMEM199-CDG. All three patients carried the same set of mutations (c.13-14delTT (p.Ser4Serfs*30) and c.92G > C (p.Arg31Pro), despite only two were related (siblings). One mutation (c.92G > C) was described previously whereas the other was deemed pathogenic due to its early frameshift. Western Blot analysis confirmed a reduced level of TMEM199 protein in patient fibroblasts and all patients showed a similar glycosylation defect. The patients presented with a very similar clinical and biochemical phenotype to the initial publication, confirming that TMEM199-CDG is a non-encephalopathic liver disorder. Two of the patients were clinically assessed over two decades without deterioration.<h4>Conclusion</h4>A rising number of disorders affecting Golgi homeostasis have been published over the last few years. A hallmark finding is deficiency in protein glycosylation, both in N- and O-linked types. Most of these disorders have signs of both liver and brain involvement. However, the present and the four previously reported patients do not show encephalopathy but a chronic, non-progressive (over decades) liver disease with hypertransaminasemia and steatosis. This information is crucial for the patient/families and clinician at diagnosis, as it distinguishes it from other Golgi homeostasis disorders, in having a much more favorable course.

Also flagged:BMPSMADNeurogenesisParkinson's diseaseBone morphogenetic proteinstem cell differentiation
Journal Article 2018-01-10 ✓ 2 Snippets Jovanovic VM, Salti A, Tilleman H, Zega K, Jukic MM, Zou H, Friedel RH, Prakash N, Blaess S, Edenhofer F, Brodski C.
In-Text Gene Mentions

…of TH +SOX6+ (tyrosine hydroxylase,…

SOX6

Show Full Abstract

The embryonic formation of midbrain dopaminergic (mDA) neurons <i>in vivo</i> provides critical guidelines for the <i>in vitro</i> differentiation of mDA neurons from stem cells, which are currently being developed for Parkinson's disease cell replacement therapy. Bone morphogenetic protein (BMP)/SMAD inhibition is routinely used during early steps of stem cell differentiation protocols, including for the generation of mDA neurons. However, the function of the BMP/SMAD pathway for <i>in vivo</i> specification of mammalian mDA neurons is virtually unknown. Here, we report that BMP5/7-deficient mice (<i>Bmp5</i><sup>-/-</sup>; <i>Bmp7</i><sup>-/-</sup>) lack mDA neurons due to reduced neurogenesis in the mDA progenitor domain. As molecular mechanisms accounting for these alterations in <i>Bmp5</i><sup>-/-</sup>; <i>Bmp7</i><sup>-/-</sup> mutants, we have identified expression changes of the BMP/SMAD target genes MSX1/2 (msh homeobox 1/2) and SHH (sonic hedgehog). Conditionally inactivating SMAD1 in neural stem cells of mice <i>in vivo</i> (<i>Smad1</i><sup>Nes</sup>) hampered the differentiation of progenitor cells into mDA neurons by preventing cell cycle exit, especially of TH<sup>+</sup>SOX6<sup>+</sup> (tyrosine hydroxylase, SRY-box 6) and TH<sup>+</sup>GIRK2<sup>+</sup> (potassium voltage-gated channel subfamily-J member-6) substantia nigra neurons. BMP5/7 robustly increased the <i>in vitro</i> differentiation of human induced pluripotent stem cells and induced neural stem cells to mDA neurons by up to threefold. In conclusion, we have identified BMP/SMAD signaling as a novel critical pathway orchestrating essential steps of mammalian mDA neurogenesis <i>in vivo</i> that balances progenitor proliferation and differentiation. Moreover, we demonstrate the potential of BMPs to improve the generation of stem-cell-derived mDA neurons <i>in vitro</i>, highlighting the importance of sequential BMP/SMAD inhibition and activation in this process.<b>SIGNIFICANCE STATEMENT</b> We identify bone morphogenetic protein (BMP)/SMAD signaling as a novel essential pathway regulating the development of mammalian midbrain dopaminergic (mDA) neurons <i>in vivo</i> and provide insights into the molecular mechanisms of this process. BMP5/7 regulate MSX1/2 (msh homeobox 1/2) and SHH (sonic hedgehog) expression to direct mDA neurogenesis. Moreover, the BMP signaling component SMAD1 controls the differentiation of mDA progenitors, particularly to substantia nigra neurons, by directing their cell cycle exit. Importantly, BMP5/7 increase robustly the differentiation of human induced pluripotent and induced neural stem cells to mDA neurons. BMP/SMAD are routinely inhibited in initial stages of stem cell differentiation protocols currently being developed for Parkinson's disease cell replacement therapies. Therefore, our findings on opposing roles of the BMP/SMAD pathway during <i>in vitro</i> mDA neurogenesis might improve these procedures significantly.

Also flagged:OX40OX40LAcute Myeloid LeukemiaTNF receptorleukemiacancer
Journal Article 2018-01-10 No Snippets Nuebling T, Schumacher CE, Hofmann M, Hagelstein I, Schmiedel BJ, Maurer S, Federmann B, Rothfelder K, Roerden M, Dörfel D, Schneider P, Jung G, Salih HR.
Show Full Abstract

The TNF receptor family member OX40 promotes activation and proliferation of T cells, which fuels efforts to modulate this immune checkpoint to reinforce antitumor immunity. Besides T cells, NK cells are a second cytotoxic lymphocyte subset that contributes to antitumor immunity, particularly in leukemia. Accordingly, these cells are being clinically evaluated for cancer treatment through multiple approaches, such as adoptive transfer of <i>ex vivo</i> expanded polyclonal NK cells (pNKC). Here, we analyzed whether and how OX40 and its ligand (OX40L) influence NK-cell function and antileukemia reactivity. We report that OX40 is expressed on leukemic blasts in a substantial percentage of patients with acute myeloid leukemia (AML) and that OX40 can, after stimulation with agonistic OX40 antibodies, mediate proliferation and release of cytokines that act as growth and survival factors for the leukemic cells. We also demonstrate that pNKC differentially express OX40L, depending on the protocol used for their generation. OX40L signaling promoted NK-cell activation, cytokine production, and cytotoxicity, and disruption of OX40-OX40L interaction impaired pNKC reactivity against primary AML cells. Together, our data implicate OX40/OX40L in disease pathophysiology of AML and in NK-cell immunosurveillance. Our findings indicate that effects of the OX40-OX40L receptor-ligand system in other immune cell subsets and also malignant cells should be taken into account when developing OX40-targeted approaches for cancer immunotherapy. <i>Cancer Immunol Res; 6(2); 209-21. ©2018 AACR</i>.

Also flagged:Keshan diseaseendemic cardiomyopathypathogenesisIDH2FEM1ASSBP1
Journal Article 2018-01-10 No Snippets Wang S, Yan R, Wang B, Du P, Tan W, Lammi MJ, Guo X.
Show Full Abstract

Keshan disease (KD) is a kind of endemic cardiomyopathy which has a high mortality. However, molecular mechanism in the pathogenesis of KD remains poorly understood. Serum samples were collected from 112 KD patients and 112 normal controls. Gene microarray was used to screen differently expressed genes. Genevestigator was applied to forecast co-expression genes of significant gene. iTRAQ proteomics analysis was used to verify significant genes and their co-expression genes. GO, COG, IPA and STRING were applied to undertake function categorization, pathway and network analysis separately. We identified 32 differentially expressed genes; IDH2, FEM1A, SSPB1 and their respective 30 co-expression genes; 68 differential proteins in KD. Significant proteins were categorized into 23 biological processes, 16 molecular functions, 16 cellular components, 15 function classes, 13 KD pathways and 1 network. IDH2, FEM1A, SSBP1, CALR, NDUFS2, IDH3A, GAPDH, TCA Cycle II (Eukaryotic) pathway and NADP repair pathway may play important roles in the pathogenesis of KD.

Also flagged:acetaldoximemethyl alcoholcarbon dioxidemineralsdimethylsynthesis
Journal Article 2018-01-10 No Snippets Adam ZR, Hongo Y, Cleaves HJ, Yi R, Fahrenbach AC, Yoda I, Aono M.
Show Full Abstract

Water creates special problems for prebiotic chemistry, as it is thermodynamically favorable for amide and phosphodiester bonds to hydrolyze. The availability of alternative solvents with more favorable properties for the formation of prebiotic molecules on the early Earth may have helped bypass this so-called "water paradox". Formamide (FA) is one such solvent, and can serve as a nucleobase precursor, but it is difficult to envision how FA could have been generated in large quantities or accumulated in terrestrial surface environments. We report here the conversion of aqueous acetonitrile (ACN) via hydrogen cyanide (HCN) as an intermediate into FA by γ-irradiation under conditions mimicking exposure to radioactive minerals. We estimate that a radioactive placer deposit could produce 0.1‒0.8 mol FA km<sup>-2</sup> year<sup>-1</sup>. A uraninite fission zone comparable to the Oklo reactors in Gabon can produce 0.1‒1 mol m<sup>-2</sup> year<sup>-1</sup>, orders of magnitude greater than other scenarios of FA production or delivery for which reaching sizeable concentrations of FA are problematic. Radioactive mineral deposits may be favorable settings for prebiotic compound formation through emergent geologic processes and FA-mediated organic chemistry.

Also flagged:endothelialdysfunctionlacktype 2 diabetesaillipoprotein cholesterolvaccenic acids
Journal Article 2018-01-10 ✓ 1 Snippet Huang LL, Dou DM, Liu N, Wang XX, Fu LY, Wu X, Wang P.
In-Text Gene Mentions

…that insulin andinsulin growth factors Igrowth factors I…

Show Full Abstract

<h4>Objective</h4>Increasing studies have reported that erythrocyte parameters, including red blood cells (RBCs), haematocrit (HCT), haemoglobin (Hb) and red blood cell distribution width (RDW), are associated with metabolic syndrome (MetS) in adults worldwide. However, the association, stratified by sex, remains to be elucidated, particularly in the Pearl River Delta region of China. Therefore, our aim was to explore the association of erythrocyte parameters with MetS, stratified by sex, in the Pearl River Delta region of China.<h4>Methods</h4>In this cross sectional study, 2161 men and 2511 women were enrolled. MetS was diagnosed using a modified version of the Adult Treatment Panel III criteria. Logistic regression analyses were performed to calculate adjusted ORs of erythrocyte parameters associated with MetS stratified by sex.<h4>Results</h4>The prevalence of MetS was higher in women than in men (35.2%vs26.7%). RBC, HCT, Hb and RDW values increased linearly with the number of MetS components from 0 to 5 identified in both men and women. Among men, the ORs of MetS risk increased across the tertiles of Hb (Q2: OR=1.921, 95% CI=1.170 to 3.151; Q3: OR=1.992, 95%CI=1.198 to 3.312). Men in the highest tertiles of RDW had a 2.752-fold increased risk of suffering from MetS compared with those in the reference group. Among women, the ORs of MetS risk also increased across the tertiles of Hb (Q2: OR=1.538, 95%CI=1.008 to 2.348; Q3: OR=1.665, 95%CI=1.075 to 2.578). Women in the highest tertiles of RBC had a 1.718-fold increased risk of experiencing MetS compared with those in the reference group.<h4>Conclusions</h4>MetS was more prevalent in women than in men. The association between erythrocyte parameters and MetS differed between the sexes. RBC and Hb were identified as risk factors for MetS in women and Hb and RDW as risk factors in men.

Also flagged:MethanolSykJNKpostpartum infectionnitric oxideinducible NO synthase
Journal Article 2018-01-10 No Snippets Le HTT, Cho YC, Cho S.
Show Full Abstract

Guettarda speciosa Linn. (G. speciosa, Rubiaceae) has been used as a traditional medicinal plant in Asia for the treatment of various inflammatory conditions, including cough, fever and maternal postpartum infection. However, the mechanisms underlying the anti‑inflammatory action of G. speciosa extracts have remained elusive. In the present study, the anti‑inflammatory effects of the methanol extract of G. speciosa (MGS) were investigated in murine macrophages by measuring the production of inflammatory mediators and the underlying mechanisms of action by performing immunoblotting analysis of proteins that are potentially involved. MGS reduced nitric oxide (NO) production through regulation of the expression of inducible NO synthase (iNOS) in lipopolysaccharide‑activated RAW 264.7 cells; however, cyclooxygenase‑2, the enzyme responsible for prostaglandin E2 production, was not affected at the mRNA or protein level. MGS reduced interleukin‑6 (IL‑6) production, but had no effect on tumor necrosis factor (TNF)‑α production. In addition, MGS suppressed the transcription of IL‑6, but not that of IL‑1β and TNF‑α. The effect of MGS on proinflammatory mediators resulted from the inhibition of the activation of spleen tyrosine kinase and c‑Jun N‑terminal kinase. In conclusion, the present study suggested that MGS may be a potential candidate for development as a therapeutic for alleviating inflammation.

Also flagged:thyroid carcinomapapillary thyroid cancerPTCRBMS3ZFXThyroid cancer
Journal Article 2018-01-10 No Snippets Zhao Y, Wang H, Wu C, Yan M, Wu H, Wang J, Yang X, Shao Q.
Show Full Abstract

Increasing evidence has experimentally proved the competitive endogenous RNA (ceRNA) hypothesis that long non-coding RNA (lncRNA) can affect the expression of RNA targets by competitively combining microRNA (miRNA) via miRNA response elements. However, an extensive ceRNA network of thyroid carcinoma in a large cohort has not been evaluated. We analyzed the RNAseq and miRNAseq data of 348 cases of primary papillary thyroid cancer (PTC) patients with clinical information downloaded from The Cancer Genome Atlas (TCGA) project to search for potential biomarkers or therapeutic targets. A computational approach was applied to build an lncRNA-miRNA-mRNA regulatory network of PTC. In total, 780 lncRNAs were detected as collectively dysregulated lncRNAs in all 3 PTC variants compared with normal tissues (fold change >2 and false discovery rate <0.05). The interactions among 45 lncRNAs, 13 miRNAs and 86 mRNAs constituted a ceRNA network of PTC. Nine out of the 45 aberrantly expressed lncRNAs were related to the clinical features of PTC patients. However, the expression levels of 3 lncRNAs (LINC00284, RBMS3-AS1 and ZFX-AS1) were identified to be tightly correlated with the patients overall survival (log-rank, P<0.05). The present study identified a list of specific lncRNAs associated with PTC progression and prognosis. This complex ceRNA interaction network in PTC may provide guidance for better understanding the molecular mechanisms underlying PTC.

Also flagged:Dopamineaxonsnucleusinnervationaxonamphetamine
Journal Article 2018-01-10 ✓ 5 Snippets Hoops D, Reynolds LM, Restrepo-Lozano JM, Flores C.
In-Text Gene Mentions

Reducing DCC expression on ventral tegmental neurons in adolescence induces structural deficiencies in mPFC dopamine axons (Reynolds et al., 2017), and amphetamine in adolescence reduces DCC expression on these neurons (Yetnikoff et al., 2010, 2011).

Our results suggest that amphetamine in adolescence is reducing DCC expression on ventral tegmental dopamine neurons that project to the oPFC, resulting in denuded dopamine axons in this region.

The Netrin-1 receptor DCC (deleted in colorectal cancer) is responsible for coordinating dopamine axon structure and function in the mPFC (Hoops and Flores, 2017).

…The Netrin-1 receptorDCC(deleted in colorectal…

…ReducingDCCexpression on ventral…

Show Full Abstract

The prefrontal cortex (PFC) is divided into subregions, including the medial and orbital prefrontal cortices. Dopamine connectivity in the medial PFC (mPFC) continues to be established throughout adolescence as the result of the continuous growth of axons that innervated the nucleus accumbens (NAcc) prior to adolescence. During this period, dopamine axons remain vulnerable to environmental influences, such as drugs used recreationally by humans. The developmental trajectory of the orbital prefrontal dopamine innervation remains almost completely unstudied. Nonetheless, the orbital PFC (oPFC) is critical for some of the most complex functions of the PFC and is disrupted by drugs of abuse, both in adolescent humans and rodents. Here, we use quantitative neuroanatomy, axon-initiated viral-vector recombination, and pharmacology in mice to determine the spatiotemporal development of the dopamine innervation to the oPFC and its vulnerability to amphetamine in adolescence. We find that dopamine innervation to the oPFC also continues to increase during adolescence and that this increase is due to the growth of new dopamine axons to this region. Furthermore, amphetamine in adolescence dramatically reduces the number of presynaptic sites on oPFC dopamine axons. In contrast, dopamine innervation to the piriform cortex is not protracted across adolescence and is not impacted by amphetamine exposure during adolescence, indicating that dopamine development during adolescence is a uniquely prefrontal phenomenon. This renders these fibers, and the PFC in general, particularly vulnerable to environmental risk factors during adolescence, such as recreational drug use.

Also flagged:PreeclampsiaPEhypertensiongestationfetal growth restrictionendothelial dysfunction
Journal Article 2018-01-10 No Snippets Cornelius DC.
Show Full Abstract

Preeclampsia (PE) affects 5% to 7% of pregnant women each year worldwide, accounts for up to 18% of maternal deaths in the United States each year, and is the number 1 cause of premature births. Preeclampsia is associated with hypertension after the 20th week of gestation with or without proteinuria, in conjunction with fetal growth restriction, maternal endothelial dysfunction, and chronic immune activation. The mechanisms leading to the development of PE are unclear. However, it is thought that shallow trophoblast invasion and insufficient remodeling of uterine spiral arteries result in placental ischemia. Consequently, an immune imbalance characterized by increases in proinflammatory CD4<sup>+</sup> T cells and cytokines along with decreases in regulatory T cells and anti-inflammatory cytokines occurs. This imbalance leads to chronic inflammation and ensuing oxidative stress, proinflammatory cytokines, and autoantibodies. Studies performed in our laboratories, using the <i>R</i>educed <i>U</i>terine <i>P</i>erfusion <i>P</i>ressure (RUPP) rat model of placental ischemia, have demonstrated a role for this immune imbalance to mediate PE pathophysiology and identified potential mechanisms of immunoregulation that may be of benefit in the treatment of PE. Therefore, the purpose of this commentary is to review studies demonstrating the positive effects of immunoregulatory factors in the RUPP rat model of PE. Restoration of the immune balance in PE may be a potential strategy for the development of therapeutic interventions that could improve maternal and fetal outcomes associated with this maternal syndrome.

Also flagged:PyrimidinesDihydrotriazinesHormoneprostate tumorstumorssteroids
Journal Article 2018-01-10 No Snippets Scherbakov AM, Komkov AV, Komendantova AS, Yastrebova MA, Andreeva OE, Shirinian VZ, Hajra A, Zavarzin IV, Volkova YA.
Show Full Abstract

Most breast and prostate tumors are hormone-dependent, making it possible to use hormone therapy in patients with these tumors. The design of effective endocrine drugs that block the growth of tumors and have no severe side effects is a challenge. Thereupon, synthetic steroids are promising therapeutic drugs for the treatment of diseases such as hormone-dependent breast and prostate cancers. Here, we describe novel series of steroidal pyrimidines and dihydrotriazines with anticancer activities. A flexible approach to unknown pyrimidine and dihydrotriazine derivatives of steroids with selective control of the heterocyclization pattern is disclosed. A number of 18-nor-5α-androsta-2,13-diene[3,2-d]pyrimidine, androsta-2-ene[3,2-d]pyrimidine, Δ<sup>1, 3, 5(10)</sup>-estratrieno[16,17-d]pyrimidine, and 17-chloro-16-dihydrotriazine steroids were synthesized by condensations of amidines with β-chlorovinyl aldehydes derived from natural hormones. The synthesized compounds were screened for cytotoxicity against breast cancer cells and showed IC<sub>50</sub> values of 7.4 μM and higher. Compounds were tested against prostate cancer cells and exhibited antiproliferative activity with IC<sub>50</sub> values of 9.4 μM and higher comparable to that of cisplatin. Lead compound <b>4a</b> displayed selectivity in ERα-positive breast cancer cells. At 10 μM concentration, this heterosteroid inhibited 50% of the E2-mediated ERα activity and led to partial ERα down-regulation. The ERα reporter assay and immunoblotting were supported by the docking study, which showed the probable binding mode of compound <b>4a</b> to the estrogen receptor pocket. Thus, heterosteroid <b>4a</b> proved to be a selective ERα modulator with the highest antiproliferative activity against hormone-dependent breast cancer and can be considered as a candidate for further anticancer drug development. In total, the synthesized heterosteroids may be considered as new promising classes of active anticancer agents.

Also flagged:ossificationhypoparathyroidismspinal stenosisPrimary hypoparathyroidismmyelopathythoracic myelopathy
Journal Article 2018-01-10 ✓ 1 Snippet Sohail AH, Maan MAA, Khan MS, Masood Q.
In-Text Gene Mentions

…ors, insulin, hyperthyroidism,hemochromatosis) [ Table 1…

Show Full Abstract

<h4>Background</h4>The ligamenta flava can undergo ossification and calcification resulting in myelopathy. Only seven cases of ligamentum flavum ossification in association with hypoparathyroidism have been reported, most of which had concurrent osseous changes in other spinal ligaments. Here, we report a patient with hypoparathyroidism who presented with ligamentum flavum ossification causing both cervical and thoracic myelopathy.<h4>Case description</h4>A 43-year-old male presented with backache, urinary retention, and lower limb weakness for the last few days. Magnetic resonance imaging scan showed ossification of the ligamentum flavum in the cervical and thoracic regions, with severe spinal stenosis. Following spinal decompressive surgery, the patient made a complete recovery. Primary hypoparathyroidism was found to be the underlying cause for ligamentum flavum ossification.<h4>Conclusion</h4>Ossification of ligamentum flavum secondary to hypoparathyroidism should be considered as a possible cause of myelopathy in all patients presenting with symptoms of spinal cord compression.

Also flagged:SphingomyelinHuntingtinLipidMembranesHuntington diseaseHD
Journal Article 2018-01-10 ✓ 5 Snippets Chaibva M, Gao X, Jain P, Campbell WA, Frey SL, Legleiter J.
In-Text Gene Mentions

The expansion of a polyglutamine (polyQ)tract near the N-terminusof the huntingtin (htt) protein is the primary cause of Huntington’sdisease (HD), a fatal neurodegenerative disorder.1 Expanded polyQ domains in htt are directly correlated witha propensity to aggregate into a variety of proteinacious structuresranging from small oligomers to fibrils.2−7 There is also a strong correlation of the age of onset and diseaseseverity with the length of the polyQ domain, with ∼35 repeatglutamines being the critical threshold required for the disease.8−10 The exact mass of htt depends on the size of the polyQ domain, butfull-length htt is approximately 350 kDa and 3144 amino acids in size,based on a polyQ domain of 23.

Previously, we reported thatenriching TBLE bilayers with cholesterol resulted in large plateau-likedomains upon exposure to htt-exon1(51Q) of the bilayer, similar tothose seen in SM-doped membranes; however, these cholesterol-enrichedmembranes were resistant to htt-induced permeabilization in contrastto SM-enriched ones.45 One key differencebetween these two systems is that the plateau-like regions that developedin the bilayers enriched with SM grew to be thicker and mechanicallydifferent (based on phase imaging) compared to the unaffected regionsof the bilayer.

Beyond these normal functions of htt, there is increasingevidencethat lipid interactions may play a role in the toxic gain of functionsassociated with the expansion of polyQ in htt, as membrane-relatedchanges (including mutant htt membrane association and induced disruptionas well as altered membrane composition) are observed in HD.27,29,34−36 Whereas mutanthtt is primarily associated with the formation of microscopic inclusionbodies in the cytoplasm and nucleus,13 aboutone-half of the endogenous htt partitions with the membranes aftersubcellular fractionation of neuronlike clonal striatal cells.25 Furthermore, htt associates with a variety ofmembranous organelles, including mitochondria, ER, tubulovesicles,endosomes, lysosomes, and synaptic vesicles.37−39 Lipids areeven incorporated within htt aggregates observed in mouse models,and the surface of htt inclusion bodies contain membranous structuralelements.24,40 A variety of amino-terminal mutant htt fragmentsdirectly bind the lipid membranes, aggregate and alter the mechanicalproperties of the membrane, and ultimately cause membrane leakagein vitro.41−46 Perinuclear inclusions of htt have been linked to disruption ofthe nuclear envelope in HD mouse models,36 and expanded polyQ can embed into ER, resulting in membrane distortion.47

Huntington disease (HD) is an inheritedneurodegenerative diseasecaused by the expansion beyond a critical threshold of a polyglutamine(polyQ) tract near the N-terminus of the huntingtin (htt) protein.Expanded polyQ promotes the formation of a variety of oligomeric andfibrillar aggregates of htt that accumulate into the hallmark proteinaceousinclusion bodies associated with HD.

The interactionsbetween htt and vesicles enriched with 20 or 30% SM were indistinguishable.The enhanced % CR associated with the addition of SM at 20% or higheris consistent with the increased leakage measured by the calcein dyeassay, suggesting that the PDA assay detects an induced change inthe membrane associated with disruption.

Show Full Abstract

Huntington disease (HD) is an inherited neurodegenerative disease caused by the expansion beyond a critical threshold of a polyglutamine (polyQ) tract near the N-terminus of the huntingtin (htt) protein. Expanded polyQ promotes the formation of a variety of oligomeric and fibrillar aggregates of htt that accumulate into the hallmark proteinaceous inclusion bodies associated with HD. htt is also highly associated with numerous cellular and subcellular membranes that contain a variety of lipids. As lipid homeostasis and metabolism abnormalities are observed in HD patients, we investigated how varying both the sphingomyelin (SM) and ganglioside (GM1) contents modifies the interactions between htt and lipid membranes. SM composition is altered in HD, and GM1 has been shown to have protective effects in animal models of HD. A combination of Langmuir trough monolayer techniques, vesicle permeability and binding assays, and in situ atomic force microscopy (AFM) were used to directly monitor the interaction of a model, synthetic htt peptide and a full-length htt-exon1 recombinant protein with model membranes comprised of total brain lipid extract (TBLE) and varying amounts of exogenously added SM or GM1. The addition of either SM or GM1 decreased htt insertion into the lipid monolayers. However, TBLE vesicles with an increased SM content were more susceptible to htt-induced permeabilization, whereas GM1 had no effect on permeablization. Pure TBLE bilayers and TBLE bilayers enriched with GM1 developed regions of roughened, granular morphologies upon exposure to htt-exon1, but plateau-like domains with a smoother appearance formed in bilayers enriched with SM. Oligomeric aggregates were observed on all bilayer systems regardless of induced morphology. Collectively, these observations suggest that the lipid composition and its subsequent effects on membrane material properties strongly influence htt binding and aggregation on lipid membranes.

Also flagged:endoplasmic reticulumMAPKcoagulationhair growthDSG1ILK
Journal Article 2018-01-10 ✓ 3 Snippets Ji D, Yang B, Li Y, Cai M, Zhang W, Cheng G, Guo H.
In-Text Gene Mentions

…(heat shock proteins),SERPINC1(the gene encoding…

…of anticoagulation factors (SERPINC1).…

…and Hsp110 ),SERPINC1(F2, or antithrombin),…

Show Full Abstract

The high-quality brush hair, or Type III brush hair, is coarse hair but with a tip and little medulla, which uniquely grows in the cervical carina of Chinese Haimen goat (<i>Capra hircus</i>). To unveil the mechanism of the formation of Type III brush hair in Haimen goats, transcriptomic RNAseq technology was used for screening of differentially expressed genes (DEGs) in the skin samples of the Type III and the non-Type III hair goats, and these DEGs were analysed by KEGG pathway analysis. The results showed that a total of 295 DEGs were obtained, mainly from three main functional types: cellular component, molecular function and biological process. These DEGs were mainly enriched in three KEGG pathways, such as protein processing in endoplasmic reticulum, MAPK, and complement and coagulation cascades. These DEGs gave hints to a possible mechanism, under which heat stress possibly initiated the formation. The study provided some useful biological information, which could give a new view about the roles of certain factors in hair growth and give hints on the mechanism of the formation of the Type III brush hair in Chinese Haimen goat.

Also flagged:ERβ2AdriamycinERβ1glutaraldehydePDXERβ
Journal Article 2018-01-10 No Snippets Faria M, Karami S, Granados-Principal S, Dey P, Verma A, Choi DS, Elemento O, Bawa-Khalfe T, Chang JC, Strom AM, Gustafsson JÅ.
Show Full Abstract

Triple negative breast cancer (TNBC) still remains a challenge to treat in the clinic due to a lack of good targets for treatment. Although TNBC lacks expression of ERα, the expression of ERβ and its variants are detected quite frequently in this cancer type and can represent an avenue for treatment. We show that two of the variants of ERβ, namely ERβ2 and ERβ5, control aggressiveness of TNBC by regulating hypoxic signaling through stabilization of HIF-1α. RNA-seq of patient derived xenografts (PDX) from TNBC shows expression of ERβ2, ERβ4 and ERβ5 variants in more than half of the samples. Furthermore, expression of ERβ4 in the immortalized, normal mammary epithelial cell line MCF-10A that is resistant to tumorsphere formation caused transformation and development of tumorspheres. By contrast, ERβ1, ERβ2 or ERβ5 were unable to support tumorsphere formation. We have previously shown that all variants except ERβ1 stabilize HIF-1α but only ERβ4 appears to have the ability to transform normal mammary epithelial cells, pointing towards a unique property of ERβ4. We propose that ERβ variants may be good diagnostic tools and also serve as novel targets for treatment of breast cancer.

Also flagged:nucleotideRHDhemolytic diseasephenolchloroformRHCE
Journal Article 2018-01-10 No Snippets Kulkarni SS, Gogri H, Parchure D, Mishra G, Ghosh K, Rajadhyaksha S, Madkaikar M, Férec C, Fichou Y.
Show Full Abstract

<h4>Background</h4>Molecular bases of blood group systems, including Rh blood group, have been poorly studied in the Indian population so far, while specificities of Europeans, East Asians and Africans have been well known for years. In order to gain insights into the molecular bases of this population, we sought to characterize the <i>RHD</i> allele in D- Indian donors expressing C and/or E antigen(s).<h4>Methods</h4><i>RHD</i> gene was analyzed in 171 serologically D-, C/E+ samples by standard molecular methods such as quantitative, multiplex PCR of short fluorescent fragments (QMPSF) and direct sequencing when necessary.<h4>Results</h4><i>RHD</i> whole gene deletion at the homozygous state was found to be the most common genotype associated with D- phenotype (118/171, 69.0%). Nonfunctional, negative hybrid genes with reported molecular backgrounds were observed in approximately one-third of the samples, while only four samples carry single-nucleotide variations, including one novel nonsense (<i>RHD</i>(Y243X)), one novel frameshift (<i>RHD</i>(c.701delG)), and two missense (<i>RHD</i>(T148R) and <i>RHD</i>(T148R, T195M)) alleles.<h4>Conclusion</h4>Overall we report for the first time the molecular bases of D antigen negativity in the D-, C/E+ Indian population, which appears to be qualitatively similar to other populations, but with a population-specific, quantitative distribution of <i>D-</i>- alleles.

Also flagged:gelatinhydroxyapatitegene expressionPI3KAktneural transcription factors
Journal Article 2018-01-10 ✓ 1 Snippet Kantawong F, Saksiriwisitkul C, Riyapa C, Limpakdee S, Wanachantararak P, Kuboki T.
In-Text Gene Mentions

…transcription factors (i.e.,Pou3f2, Pax6, Sox2, Pou5f1,…

Show Full Abstract

<i><b>Introduction:</b></i> Induced neural stem cells (iNSCs) have the ability of differentiation into neurons, astrocytes and oligodendrocytes. iNSCs are very useful in terms of research and treatment. The present study offers an idea that biomaterials could be one of the tools that could modulate reprogramming process in the fibroblasts. <i><b>Methods:</b></i> Gelatin biomaterials were fabricated into 3 types, including (i) gelatin, (ii) gelatin with 1 mg/mL hydroxyapatite, and (iii) gelatin with hydroxyapatite and pig brain. NIH/3T3 fibroblasts were cultured on each type of biomaterial for 7, 9 and 14 days. RT-PCR was performed to investigate the gene expression of the fibroblasts on biomaterials compared to the fibroblasts on tissue culture plates. PI3K/Akt signaling was performed by flow cytometry after 24 hours seeding on the biomaterials. The biomaterials were also tested with the human APCs and PDL cells. <i><b>Results:</b></i> The fibroblasts exhibited changes in the expression of the reprogramming factor; Klf‫4 and the neural transcription factors; NFIa, NFIb and Ptbp1 after 9 days culture. The cultivation of fibroblasts on the biomaterials for 7 days showed a higher expression of the transcription factor SOX9. The expression of epigenetic genes; Kat2a and HDAC3 were changed upon the cultivation on the biomaterials for 9 days. The fibroblasts cultured on the biomaterials showed an activation of PI3K/Akt signaling. The human APCs and human PDL cells developed mineralization process on biomaterials <b><i>Conclusion:</i></b> Changes in the expression of Klf4, NFIa, NFIb, Ptbp1 and SOX9 indicated that fibroblasts were differentiated into an astrocytic lineage. It is possible that the well-designed biomaterials could work as powerful tools in the reprogramming process of fibroblasts into iNSCs.

Also flagged:Recurrent pregnancy lossreproductive disordergestationIdiopathic recurrent pregnancy losspregnancy losschromosome
Journal Article 2018-01-09 No Snippets Arias-Sosa LA, Acosta ID, Lucena-Quevedo E, Moreno-Ortiz H, Esteban-Pérez C, Forero-Castro M.
Show Full Abstract

Recurrent pregnancy loss (RPL) is a reproductive disorder defined as two or more successive and spontaneous pregnancy losses (before 20 weeks of gestation), which affects approximately 1-2% of couples. At present, the causes of RPL remain unknown in a considerable number of cases, leading to complications in treatment and high levels of stress in couples. Idiopathic recurrent pregnancy loss (iRPL) has become one of the more complicated reproductive problems worldwide due to the lack of information about its etiology, which limits the counseling and treatment of patients. For that reason, iRPL requires further study of novel factors to provide scientific information for determining clinical prevention and targeted strategies. The aim of this study is to describe the most recent and promising progress in the identification of potential genetic and epigenetic risk factors for iRPL, expanding the genetic etiology of the disease.

Also flagged:depressionanxietycardiovascular diseaseSLC6A4
Journal Article 2018-01-09 ✓ 4 Snippets Jacobsen DP, Nielsen MB, Einarsen S, Gjerstad J.
In-Text Gene Mentions

pain was modified by the 5-HTT genotype, ie, genetic variation in SLC6A4

…workplace bullying and5-HTTgenotype interaction.…

…variability in the5-HTTgene SLC6A4 and…

…modified by the5-HTTgenotype, ie, genetic…

Show Full Abstract

Objectives Long-term exposure to systematic negative acts at work, usually labeled workplace bullying, is a prevalent problem at many workplaces. The adverse effects of such exposure may range from psychological symptoms, such as depression and anxiety to somatic ailments like cardiovascular disease and musculoskeletal complaints. In this study, we examined the relationships among exposure to negative acts, genetic variability in the 5-HTT gene SLC6A4 and pain. Methods The study was based on a nationally representative survey of 987 Norwegian employees drawn from the Norwegian Central Employee Register by Statistics Norway. Exposure to bullying in the workplace was measured with the 9-item version of the Negative Acts Questionnaire - Revised (NAQ-R) inventory. Pain was rated using an 11-point (0-10) numeric rating scale (NRS). Genotyping with regard to SLC6A4 was carried out using a combination of gel-electrophoresis and TaqMan assay. Results The data revealed a significant interaction between exposure to negative acts and the SLC6A4 genotype with regard to pain (linear regression with 5000 resamples; age, sex, tobacco use and education were included as covariates). The relationship between negative acts and pain intensity was significantly stronger for subjects with the LALA genotype than for subjects with the SLA/LALG/SLG genotype. No significant difference between subjects with the LALA genotype and SS genotype was observed. Conclusions Our data demonstrated that the relationship between bullying and pain was modified by the 5-HTT genotype, ie, genetic variation in SLC6A4. The association between negative acts and health among vulnerable individuals appeared more potent than previously reported.

Also flagged:NeuroblastomaNBcancerchromosomeNeurogenesistumour
Journal Article 2018-01-09 No Snippets Zammit V, Baron B, Ayers D.
Show Full Abstract

Neuroblastoma (NB) is the most common occurring solid paediatric cancer in children under the age of five years. Whether of familial or sporadic origin, chromosome abnormalities contribute to the development of NB and cause dysregulation of microRNAs (miRNAs). MiRNAs are small non-coding, single stranded RNAs that target messenger RNAs at the post-transcriptional levels by repressing translation within all facets of human physiology. Such gene 'silencing' activities by miRNAs allows the development of regulatory feedback loops affecting multiple functions within the cell, including the possible differentiation of neural stem cell (NSC) lineage selection. Neurogenesis includes stages of self-renewal and fate specification of NSCs, migration and maturation of young neurones, and functional integration of new neurones into the neural circuitry, all of which are regulated by miRNAs. The role of miRNAs and their interaction in cellular processes are recognised aspects of cancer genetics, and miRNAs are currently employed as biomarkers for prognosis and tumour characterisation in multiple cancer models. Consequently, thorough understanding of the mechanisms of how these miRNAs interplay at the transcriptomic level will definitely lead to the development of novel, bespoke and efficient therapeutic measures, with this review focusing on the influences of miRNAs on neuroblast modulations leading to neuroblastoma.

Also flagged:frontotemporal dementiapathogenesisprogressive supranuclear palsyCrohn diseaseulcerative colitisrheumatoid arthritis
Journal Article 2018-01-09 ✓ 1 Snippet Broce I, Karch CM, Wen N, Fan CC, Wang Y, Tan CH, Kouri N, Ross OA, Höglinger GU, Muller U, Hardy J, International FTD-Genomics Consortium, Momeni P, Hess CP, Dillon WP, Miller ZA, Bonham LW, Rabinovici GD, Rosen HJ, Schellenberg GD, Franke A, Karlsen TH, Veldink JH, Ferrari R, Yokoyama JS, Miller BL, Andreassen OA, Dale AM, Desikan RS, Sugrue LP.
In-Text Gene Mentions

…nearest gene =DCC) (see Table…

Show Full Abstract

<h4>Background</h4>Converging evidence suggests that immune-mediated dysfunction plays an important role in the pathogenesis of frontotemporal dementia (FTD). Although genetic studies have shown that immune-associated loci are associated with increased FTD risk, a systematic investigation of genetic overlap between immune-mediated diseases and the spectrum of FTD-related disorders has not been performed.<h4>Methods and findings</h4>Using large genome-wide association studies (GWASs) (total n = 192,886 cases and controls) and recently developed tools to quantify genetic overlap/pleiotropy, we systematically identified single nucleotide polymorphisms (SNPs) jointly associated with FTD-related disorders-namely, FTD, corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), and amyotrophic lateral sclerosis (ALS)-and 1 or more immune-mediated diseases including Crohn disease, ulcerative colitis (UC), rheumatoid arthritis (RA), type 1 diabetes (T1D), celiac disease (CeD), and psoriasis. We found up to 270-fold genetic enrichment between FTD and RA, up to 160-fold genetic enrichment between FTD and UC, up to 180-fold genetic enrichment between FTD and T1D, and up to 175-fold genetic enrichment between FTD and CeD. In contrast, for CBD and PSP, only 1 of the 6 immune-mediated diseases produced genetic enrichment comparable to that seen for FTD, with up to 150-fold genetic enrichment between CBD and CeD and up to 180-fold enrichment between PSP and RA. Further, we found minimal enrichment between ALS and the immune-mediated diseases tested, with the highest levels of enrichment between ALS and RA (up to 20-fold). For FTD, at a conjunction false discovery rate < 0.05 and after excluding SNPs in linkage disequilibrium, we found that 8 of the 15 identified loci mapped to the human leukocyte antigen (HLA) region on Chromosome (Chr) 6. We also found novel candidate FTD susceptibility loci within LRRK2 (leucine rich repeat kinase 2), TBKBP1 (TBK1 binding protein 1), and PGBD5 (piggyBac transposable element derived 5). Functionally, we found that the expression of FTD-immune pleiotropic genes (particularly within the HLA region) is altered in postmortem brain tissue from patients with FTD and is enriched in microglia/macrophages compared to other central nervous system cell types. The main study limitation is that the results represent only clinically diagnosed individuals. Also, given the complex interconnectedness of the HLA region, we were not able to define the specific gene or genes on Chr 6 responsible for our pleiotropic signal.<h4>Conclusions</h4>We show immune-mediated genetic enrichment specifically in FTD, particularly within the HLA region. Our genetic results suggest that for a subset of patients, immune dysfunction may contribute to FTD risk. These findings have potential implications for clinical trials targeting immune dysfunction in patients with FTD.

Also flagged:ethanolalcoholalcohol dependencenucleusERK1Mapk3
Journal Article 2018-01-09 No Snippets Osterndorff-Kahanek EA, Tiwari GR, Lopez MF, Becker HC, Harris RA, Mayfield RD.
Show Full Abstract

Long-term alcohol use can result in lasting changes in brain function, ultimately leading to alcohol dependence. These functional alterations arise from dysregulation of complex gene networks, and growing evidence implicates microRNAs as key regulators of these networks. We examined time- and brain region-dependent changes in microRNA expression after chronic intermittent ethanol (CIE) exposure in C57BL/6J mice. Animals were sacrificed at 0, 8, and 120h following the last exposure to four weekly cycles of CIE vapor and we measured microRNA expression in prefrontal cortex (PFC), nucleus accumbens (NAC), and amygdala (AMY). The number of detected (395-419) and differentially expressed (DE, 42-47) microRNAs was similar within each brain region. However, the DE microRNAs were distinct among brain regions and across time within each brain region. DE microRNAs were linked with their DE mRNA targets across each brain region. In all brain regions, the greatest number of DE mRNA targets occurred at the 0 or 8h time points and these changes were associated with microRNAs DE at 0 or 8h. Two separate approaches (discrete temporal association and hierarchical clustering) were combined with pathway analysis to further characterize the temporal relationships between DE microRNAs and their 120h DE targets. We focused on targets dysregulated at 120h as this time point represents a state of protracted withdrawal known to promote an increase in subsequent ethanol consumption. Discrete temporal association analysis identified networks with highly connected genes including ERK1/2 (mouse equivalent Mapk3, Mapk1), Bcl2 (in AMY networks) and Srf (in PFC networks). Similarly, the cluster-based analysis identified hub genes that include Bcl2 (in AMY networks) and Srf in PFC networks, demonstrating robust microRNA-mRNA network alterations in response to CIE exposure. In contrast, datasets utilizing targets from 0 and 8h microRNAs identified NF-kB-centered networks (in NAC and PFC), and Smad3-centered networks (in AMY). These results demonstrate that CIE exposure results in dynamic and complex temporal changes in microRNA-mRNA gene network structure.

Also flagged:breast cancerBRCA1BRCA2cancerZNF283CASP8
Journal Article 2018-01-09 ✓ 1 Snippet Li N, Rowley SM, Thompson ER, McInerny S, Devereux L, Amarasinghe KC, Zethoven M, Lupat R, Goode D, Li J, Trainer AH, Gorringe KL, James PA, Campbell IG.
In-Text Gene Mentions

…including UNC13A andDNAJC1, in the…

Show Full Abstract

<h4>Background</h4>Genome-wide association studies (GWASs) have identified numerous single-nucleotide polymorphisms (SNPs) associated with small increases in breast cancer risk. Studies to date suggest that some SNPs alter the expression of the associated genes, which potentially mediates risk modification. On this basis, we hypothesised that some of these genes may be enriched for rare coding variants associated with a higher breast cancer risk.<h4>Methods</h4>The coding regions and exon-intron boundaries of 56 genes that have either been proposed by GWASs to be the regulatory targets of the SNPs and/or located < 500 kb from the risk SNPs were sequenced in index cases from 1043 familial breast cancer families that previously had negative test results for BRCA1 and BRCA2 mutations and 944 population-matched cancer-free control participants from an Australian population. Rare (minor allele frequency ≤ 0.001 in the Exome Aggregation Consortium and Exome Variant Server databases) loss-of-function (LoF) and missense variants were studied.<h4>Results</h4>LoF variants were rare in both the cases and control participants across all the candidate genes, with only 38 different LoF variants observed in a total of 39 carriers. For the majority of genes (n = 36), no LoF variants were detected in either the case or control cohorts. No individual gene showed a significant excess of LoF or missense variants in the cases compared with control participants. Among all candidate genes as a group, the total number of carriers with LoF variants was higher in the cases than in the control participants (26 cases and 13 control participants), as was the total number of carriers with missense variants (406 versus 353), but neither reached statistical significance (p = 0.077 and p = 0.512, respectively). The genes contributing most of the excess of LoF variants in the cases included TET2, NRIP1, RAD51B and SNX32 (12 cases versus 2 control participants), whereas ZNF283 and CASP8 contributed largely to the excess of missense variants (25 cases versus 8 control participants).<h4>Conclusions</h4>Our data suggest that rare LoF and missense variants in genes associated with low-penetrance breast cancer risk SNPs may contribute some additional risk, but as a group these genes are unlikely to be major contributors to breast cancer heritability.

Also flagged:G007-LKpoly-ADP ribosyltransferaseLGR5WNTstem cell proliferationadenomas
Journal Article 2018-01-09 ✓ 1 Snippet Norum JH, Skarpen E, Brech A, Kuiper R, Waaler J, Krauss S, Sørlie T.
In-Text Gene Mentions

…Mki67 (Mm01278617_m1) andOLFM4(Mm01320260_m1).…

Show Full Abstract

<h4>Background</h4>The WNT pathway regulates intestinal stem cells and is frequently disrupted in intestinal adenomas. The pathway contains several potential biotargets for interference, including the poly-ADP ribosyltransferase enzymes tankyrase1 and 2. LGR5 is a known WNT pathway target gene and marker of intestinal stem cells. The LGR5<sup>+</sup> stem cells are located in the crypt base and capable of regenerating all intestinal epithelial cell lineages.<h4>Results</h4>We treated Lgr5-EGFP-Ires-CreERT2;R26R-Confetti mice with the tankyrase inhibitor G007-LK for up to 3 weeks to assess the effect on duodenal stem cell homeostasis and on the integrity of intestinal epithelium. At the administered doses, G007-LK treatment inhibited WNT signalling in LGR5<sup>+</sup> stem cells and reduced the number and distribution of cells traced from duodenal LGR5<sup>+</sup> stem cells. However, the gross morphology of the duodenum remained unaltered and G007-LK-treated mice showed no signs of weight loss or any other visible morphological changes. The inhibitory effect on LGR5<sup>+</sup> stem cell proliferation was reversible.<h4>Conclusion</h4>We show that the tankyrase inhibitor G007-LK is well tolerated by the mice, although proliferation of the LGR5<sup>+</sup> intestinal stem cells was inhibited. Our observations suggest the presence of a tankyrase inhibitor-resistant cell population in the duodenum, able to rescue tissue integrity in the presence of G007-LK-mediated inhibition of the WNT signalling dependent LGR5<sup>+</sup> intestinal epithelial stem cells.

Also flagged:16S rDNAchainfatty acidshistonetranslationalmetabolism
Journal Article 2018-01-09 ✓ 1 Snippet Fellows R, Denizot J, Stellato C, Cuomo A, Jain P, Stoyanova E, Balázsi S, Hajnády Z, Liebert A, Kazakevych J, Blackburn H, Corrêa RO, Fachi JL, Sato FT, Ribeiro WR, Ferreira CM, Perée H, Spagnuolo M, Mattiuz R, Matolcsi C, Guedes J, Clark J, Veldhoen M, Bonaldi T, Vinolo MAR, Varga-Weisz P.
In-Text Gene Mentions

…histones, together withlinker histoneshistones protein, were…

Show Full Abstract

The recently discovered histone post-translational modification crotonylation connects cellular metabolism to gene regulation. Its regulation and tissue-specific functions are poorly understood. We characterize histone crotonylation in intestinal epithelia and find that histone H3 crotonylation at lysine 18 is a surprisingly abundant modification in the small intestine crypt and colon, and is linked to gene regulation. We show that this modification is highly dynamic and regulated during the cell cycle. We identify class I histone deacetylases, HDAC1, HDAC2, and HDAC3, as major executors of histone decrotonylation. We show that known HDAC inhibitors, including the gut microbiota-derived butyrate, affect histone decrotonylation. Consistent with this, we find that depletion of the gut microbiota leads to a global change in histone crotonylation in the colon. Our results suggest that histone crotonylation connects chromatin to the gut microbiota, at least in part, via short-chain fatty acids and HDACs.

Also flagged:mineralFracturesOsteoporotic Fracturesautosomeschromosomeschromosome
Journal Article 2018-01-09 ✓ 1 Snippet Sun J, Oualkacha K, Forgetta V, Zheng HF, Richards JB, Evans DS, Orwoll E, Greenwood CMT.
In-Text Gene Mentions

…ESR1, WNT16, DKK1,SOX6, LRP5, SP7, TNFSF11…

Show Full Abstract

Performance of a recently developed test for association between multivariate phenotypes and sets of genetic variants (MURAT) is demonstrated using measures of bone mineral density (BMD). By combining individual-level whole genome sequenced data from the UK10K study, and imputed genome-wide genetic data on individuals from the Study of Osteoporotic Fractures (SOF) and the Osteoporotic Fractures in Men Study (MrOS), a data set of 8810 individuals was assembled; tests of association were performed between autosomal gene-sets of genetic variants and BMD measured at lumbar spine and femoral neck. Distributions of p-values obtained from analyses of a single BMD phenotype are compared to those from the multivariate tests, across several region definitions and variant weightings. There is evidence of increased power with the multivariate test, although no new loci for BMD were identified. Among 17 genes highlighted either because there were significant p-values in region-based association tests or because they were in well-known BMD genes, 4 windows in 2 genes as well as 6 single SNPs in one of these genes showed association at genome-wide significant thresholds with the multivariate phenotype test but not with the single-phenotype test, Sequence Kernel Association Test (SKAT).

Also flagged:DivalproexsodiumSCA3neurodegenerative disorderpolyglutaminelocalization
Journal Article 2018-01-09 ✓ 1 Snippet Wang ZJ, Hanet A, Weishäupl D, Martins IM, Sowa AS, Riess O, Schmidt T.
In-Text Gene Mentions

Htt

Show Full Abstract

<h4>Background & aims</h4>Spinocerebellar ataxia type 3 (SCA3), also known as Machado-Joseph disease (MJD), is an autosomal dominantly inherited neurodegenerative disorder and the most common form of SCA worldwide. It is caused by the expansion of a polyglutamine (polyQ) tract in the ataxin-3 protein. Nuclear localization of the affected protein is a key event in the pathology of SCA3 via affecting nuclear organization, transcriptional dysfunction, and seeding aggregations, finally causing neurodegeneration and cell death. So far, there is no effective therapy to prevent or slow the progression of SCA3.<h4>Methods</h4>In this study, we explored the effect of divalproex sodium as an HDACi in SCA3 cell models and explored how divalproex sodium interferes with pathogenetic processes causing SCA3.<h4>Results</h4>We found that divalproex sodium rescues the hypoacetylation levels of histone H3 and attenuates cellular cytotoxicity induced by expanded ataxin-3 partly via preventing nuclear transport of ataxin-3 (particularly heat shock-dependent).<h4>Conclusion</h4>Our study provides novel insights into the mechanisms of action of divalproex sodium as a possible treatment for SCA3, beyond the known regulation of transcription.

Also flagged:metastatic breast cancerGene ExpressionNuclear RNA Export Factor 1CDK2Cell cyclebreast cancer
Journal Article 2018-01-09 No Snippets Tuo Y, An N, Zhang M.
Show Full Abstract

The aim of the present study was to investigate the feature genes in metastatic breast cancer samples. A total of 5 expression profiles of metastatic breast cancer samples were downloaded from the Gene Expression Omnibus database, which were then analyzed using the MetaQC and MetaDE packages in R language. The feature genes between metastasis and non‑metastasis samples were screened under the threshold of P<0.05. Based on the protein‑protein interactions (PPIs) in the Biological General Repository for Interaction Datasets, Human Protein Reference Database and Biomolecular Interaction Network Database, the PPI network of the feature genes was constructed. The feature genes identified by topological characteristics were then used for support vector machine (SVM) classifier training and verification. The accuracy of the SVM classifier was then evaluated using another independent dataset from The Cancer Genome Atlas database. Finally, function and pathway enrichment analyses for genes in the SVM classifier were performed. A total of 541 feature genes were identified between metastatic and non‑metastatic samples. The top 10 genes with the highest betweenness centrality values in the PPI network of feature genes were Nuclear RNA Export Factor 1, cyclin‑dependent kinase 2 (CDK2), myelocytomatosis proto‑oncogene protein (MYC), Cullin 5, SHC Adaptor Protein 1, Clathrin heavy chain, Nucleolin, WD repeat domain 1, proteasome 26S subunit non‑ATPase 2 and telomeric repeat binding factor 2. The cyclin‑dependent kinase inhibitor 1A (CDKN1A), E2F transcription factor 1 (E2F1), and MYC interacted with CDK2. The SVM classifier constructed by the top 30 feature genes was able to distinguish metastatic samples from non‑metastatic samples [correct rate, specificity, positive predictive value and negative predictive value >0.89; sensitivity >0.84; area under the receiver operating characteristic curve (AUROC) >0.96]. The verification of the SVM classifier in an independent dataset (35 metastatic samples and 143 non‑metastatic samples) revealed an accuracy of 94.38% and AUROC of 0.958. Cell cycle associated functions and pathways were the most significant terms of the 30 feature genes. A SVM classifier was constructed to assess the possibility of breast cancer metastasis, which presented high accuracy in several independent datasets. CDK2, CDKN1A, E2F1 and MYC were indicated as the potential feature genes in metastatic breast cancer.

Also flagged:Huntington's diseaseHDneurodegenerative diseasepathogenesisgene expressionribonuclease A family member 4
Journal Article 2018-01-09 ✓ 5 Snippets Dong X, Cong S.
In-Text Gene Mentions

HD is caused by a CAG trinucleotide expansion in exon 1 of the huntingtin gene (HTT) (1).

Huntington's disease (HD) is an inherited, progressive neurodegenerative disease caused by a CAG expansion in the huntingtin (HTT) gene; various dysfunctions of biological processes in HD have been proposed.

…in the huntingtin (HTT) gene; various dysfunctions…

…the huntingtin gene (HTT) ( 1 ).…

…Furthermore,HTTand mHTT are…

Show Full Abstract

Huntington's disease (HD) is an inherited, progressive neurodegenerative disease caused by a CAG expansion in the huntingtin (HTT) gene; various dysfunctions of biological processes in HD have been proposed. However, at present the exact pathogenesis of HD is not fully understood. The present study aimed to explore the pathogenesis of HD using a computational bioinformatics analysis of gene expression. GSE11358 was downloaded from the Gene Expression Omnibus andthe differentially expressed genes (DEGs) in the mutant HTT knock‑in cell model STHdhQ111/Q111 were predicted. DEGs between the HD and control samples were screened using the limma package in R. Functional and pathway enrichment analyses were conducted using the database for annotation, visualization and integrated discovery software. A protein‑protein interaction (PPI) network was established by the search tool for the retrieval of interacting genes and visualized by Cytoscape. Module analysis of the PPI network was performed utilizing MCODE. A total of 471 DEGs were identified, including ribonuclease A family member 4 (RNASE4). In addition, 41 significantly enriched Kyoto Encyclopedia of Genes and Genomes pathways, as well as several significant Gene Ontology terms (including cytokine‑cytokine receptor interaction and cytosolic DNA‑sensing) were identified. A total of 18 significant modules were identified from the PPI network. Furthermore, a novel transcriptional regulatory relationship was identified, namely signal transducer and activator of transcription 3 (STAT3), which is regulated by miRNA‑124 in HD. In conclusion, deregulation of 18 critical genes may contribute to the occurrence of HD. RNASE4, STAT3, and miRNA‑124 may have a regulatory association with the pathological mechanisms in HD.

Also flagged:Huntington DiseaseHDautosomal dominant disorderbehavioralautistic spectrum disorderdystonia
Journal Article 2018-01-09 ✓ 1 Snippet Rosati J, Bidollari E, Rotundo G, Ferrari D, Torres B, Bernardini L, Consoli F, De Luca A, Santimone I, Lamorte G, Squitieri F, Vescovi AL.
In-Text Gene Mentions

…expansion in theHTTgene beyond 35…

Show Full Abstract

Huntington Disease (HD) is an autosomal dominant disorder characterized by motor, cognitive and behavioral features caused by a CAG expansion in the HTT gene beyond 35 repeats. The juvenile form (JHD) may begin before the age of 20years and is associated with expanded alleles as long as 60 or more CAG repeats. In this study, induced pluripotent stem cells were generated from skin fibroblasts of a 8-year-old child carrying a large size mutation of 84 CAG repeats in the HTT gene. HD appeared at age 3 with mixed psychiatric (i.e. autistic spectrum disorder) and motor (i.e. dystonia) manifestations.

Also flagged:ovarian cancerGene Expressionovarian tumorSTATcancerSTAT3
Journal Article 2018-01-09 ✓ 4 Snippets Ruan L, Xie Y, Liu F, Chen X.
In-Text Gene Mentions

GRWD1, IP6K1, and NEGR1 were targeted by hsa-miR-4314; GRWD1, IP6K1, and NEGR1 were down-regulated in ovarian tumor.<h4>Conclusion</h4>MiR-1181 and miR-4314 might promote ovarian tumorigenesis via down-regulating FOXP1 and GRWD1/IP6K1/NEGR1, respectively.

…GRWD1, IP6K1, andNEGR1were targeted by…

…GRWD1, IP6K1, andNEGR1were down-regulated in…

…ulating FOXP1 and GRWD1/IP6K1/NEGR1, respectively.…

Show Full Abstract

<h4>Objective</h4>This study aims to identify serum microRNAs (miRNAs) related to ovarian cancer.<h4>Study design</h4>MiRNA profiling data (GSE79943) were generated from the Gene Expression Omnibus, including 3 serum samples from healthy individuals and 4/3/16/6 serum samples from patients with ovarian cancer stage I/II/III/IV. Differentially expressed miRNAs (DEmiRNAs) were identified between controls and ovarian cancer stage I/II/III/IV by using limma package (p-value <0.05 and |log<sub>2</sub> fold change| ≥0.5). miRWALK2.0 database was used to find experiment-validated targets of DEmiRNAs, and CTD database was utilized to screen known genes related to ovarian cancer. clusterProfiler package was used to perform pathway enrichment analysis of DEmiRNAs. Targets of DEmiRNAs were validated by using GSE40595, involving 8 normal ovarian stroma, 31 ovarian cancer stroma, 6 human ovarian surface epthelium, and 32 ovarian tumor epthelial component.<h4>Results</h4>Between stage I/II/III/IV and control, 39/143/29/39 DEmiRNAs were identified, which were regarded as key miRNAs. Between 4 DEmiRNA sets, 15 common DEmiRNAs were identified (e.g. up-regulated hsa-miR-1181 and hsa-miR-4314). Hsa-miR-1181 participated in "Jak-STAT signaling pathway" and "miRNAs in cancer"; hsa-miR-4314 took part in cancer-related pathways. STAT3 and KRAS, known marker genes of ovarian cancer, were targeted by hsa-miR-1181 and hsa-miR-4314, respectively. Besides, FOXP1 was targeted by hsa-miR-1181; FOXP1-AS1 and FOXP1-IT1 were down-regulated in ovarian cancer. GRWD1, IP6K1, and NEGR1 were targeted by hsa-miR-4314; GRWD1, IP6K1, and NEGR1 were down-regulated in ovarian tumor.<h4>Conclusion</h4>MiR-1181 and miR-4314 might promote ovarian tumorigenesis via down-regulating FOXP1 and GRWD1/IP6K1/NEGR1, respectively. In addition, the 15 common DEmiRNAs might provide directions for ovarian cancer diagnosis.

Also flagged:calcium phosphateBone defectscalciumhydroxyapatitetricalcium phosphateinfections
Journal Article 2018-01-09 No Snippets Lu J, Yu H, Chen C.
Show Full Abstract

Bone defects are a common disease threatening the health of many people. Calcium phosphate (CaP) is an ideal bone substitutive material that is widely used for bone repair due to its excellent biological properties including osteoinductivity, osteoconductivity and biodegradability. For this reason, investigation of these properties and the effects of various influencing factors is vital for modulating calcium phosphate during the design process to maximally satisfy clinical requirements. In this study, the latest studies on the biological properties of CaP biomaterials, including hydroxyapatite (HA), tricalcium phosphate (TCP), and biphasic calcium phosphate (BCP), have been summarized. Moreover, recent advances on how these properties are altered by different factors are reviewed. Considering the limited mechanical strength of CaP materials, this study also reviews CaP composites with different materials as improvement measures. Finally, perspectives regarding future developments of CaP materials are also provided.

bioRxiv 2018-01-09 Preprint (No Snippets API) Walther N, Hossain MJ, Politi AZ, Koch B, Kueblbeck M, Ødegård-Fougner Ø, Lampe M, Ellenberg J.
Show Full Abstract

The two Condensin complexes in human cells are essential for mitotic chromosome structure. We used homozygous genome editing to fluorescently tag Condensin I and II subunits and mapped their absolute abundance, spacing and dynamic localization during mitosis by fluorescence correlation spectroscopy-calibrated live cell imaging and super-resolution microscopy. While ∼35,000 Condensin II complexes are stably bound to chromosomes throughout mitosis, ∼195,000 Condensin I complexes dynamically bind in two steps, in prometaphase and early anaphase. The two Condensins rarely co-localize at the chromatid axis, where Condensin II is centrally confined but Condensin I reaches ∼50% of the chromatid diameter from its center. Based on our comprehensive quantitative data, we propose a three-step hierarchical loop model of mitotic chromosome compaction: Condensin II initially fixes loops of a maximum size of ∼450 kb at the chromatid axis whose size is then reduced by Condensin I binding to ∼90 kb in prometaphase and ∼70 kb in anaphase, achieving maximum chromosome compaction upon sister chromatid segregation.

Also flagged:heparinbindingATcell adhesion moleculesAntithrombinthrombosis
Journal Article 2018-01-08 No Snippets Dinarvand P, Yang L, Villoutreix BO, Rezaie AR.
Show Full Abstract

Essentials Heparin-binding site (HBS) variants of antithrombin (AT) are associated with thrombosis risk. HSB variants have, in general, normal progressive inhibitory activity but reduced heparin affinity. Thrombosis in HSB carriers has been primarily attributed to the loss of heparin cofactor activity. Results here demonstrate that HSB variants of AT also lack anti-inflammatory signaling functions.<h4>Summary</h4>Background Several heparin-binding site (HBS) variants of antithrombin (AT) have been identified that predispose carriers to a higher incidence of thrombosis. Thrombosis in carriers of HBS variants has been primarily attributed to a loss in their heparin-dependent anticoagulant function. Objective The objective of this study was to determine whether HSB mutations affect the anti-inflammatory functions of variants. Methods Two HBS variants of AT (AT-I7N and AT-L99F), which are known to be associated with a higher incidence of thrombosis, were expressed in mammalian cells and purified to homogeneity. These variants were characterized by kinetic assays followed by analysis of their activities in established cellular and/or in vivo inflammatory models. The possible effects of mutations on AT structure were also evaluated by molecular modeling. Results The results indicated that, whereas progressive inhibitory activities of variants were minimally affected, their heparin affinity and inhibitory activity in the presence of heparin were markedly decreased. Unlike wild-type AT, neither AT variant was capable of inhibiting activation of nuclear factor-κB or downregulation of expression of cell adhesion molecules in response to lipopolysaccharide (LPS). Similarly, neither variant elicited barrier protective activity in response to LPS. Structural analysis suggested that the L99F substitution locally destabilizes AT structure. Conclusions It is concluded that the L99F mutation of AT is associated with destabilization of the serpin structure, and that the loss of anti-inflammatory signaling function of the HBS variants may also contribute to enhanced thrombosis in carriers of HBS mutations.

Also flagged:calcium phosphatecell proliferationosteosarcomabone morphogenic protein-2BMP-2hydroxyapatite
Journal Article 2018-01-08 No Snippets Sa MW, Nguyen BB, Moriarty RA, Kamalitdinov T, Fisher JP, Kim JY.
Show Full Abstract

Fused deposition modeling (FDM) is a promising 3D printing and manufacturing step to create well interconnected porous scaffold designs from the computer-aided design (CAD) models for the next generation of bone scaffolds. The purpose of this study was to fabricate and evaluate a new biphasic calcium phosphate (BCP) scaffold reinforced with zirconia (ZrO<sub>2</sub> ) by a FDM system for bone tissue engineering. The 3D slurry foams with blending agents were successfully fabricated by a FDM system. Blending materials were then removed after the sintering process at high temperature to obtain a targeted BCP/ZrO<sub>2</sub> scaffold with the desired pore characteristics, porosity, and dimension. Morphology of the sintered scaffold was investigated with SEM/EDS mapping. A cell proliferation test was carried out and evaluated with osteosarcoma MG-63 cells. Mechanical testing and cell proliferation evaluation demonstrated that 90% BCP and 10% ZrO<sub>2</sub> scaffold had a significant effect on the mechanical properties maintaining a structure compared that of only 100% BCP with no ZrO<sub>2</sub> . Additionally, differentiation studies of human mesenchymal stem cells (hMSCs) on BCP/ZrO<sub>2</sub> scaffolds in static and dynamic culture conditions showed increased expression of bone morphogenic protein-2 (BMP-2) when cultured on BCP/ZrO<sub>2</sub> scaffolds under dynamic conditions compared to on BCP control scaffolds. The manufacturing of BCP/ZrO<sub>2</sub> scaffolds through this innovative technique of a FDM may provide applications for various types of tissue regeneration, including bone and cartilage.

Also flagged:chromatindecidualizationtoprogesteronetransposasegene expression
Journal Article 2018-01-08 No Snippets Vrljicak P, Lucas ES, Lansdowne L, Lucciola R, Muter J, Dyer NP, Brosens JJ, Ott S.
Show Full Abstract

Spontaneous decidualization of the endometrium in response to progesterone signaling is confined to menstruating species, including humans and other higher primates. During this process, endometrial stromal cells (EnSCs) differentiate into specialized decidual cells that control embryo implantation. We subjected undifferentiated and decidualizing human EnSCs to an assay for transposase accessible chromatin with sequencing (ATAC-seq) to map the underlying chromatin changes. A total of 185,084 open DNA loci were mapped accurately in EnSCs. Altered chromatin accessibility upon decidualization was strongly associated with differential gene expression. Analysis of 1533 opening and closing chromatin regions revealed over-representation of DNA binding motifs for known decidual transcription factors (TFs) and identified putative new regulators. ATAC-seq footprint analysis provided evidence of TF binding at specific motifs. One of the largest footprints involved the most enriched motif-basic leucine zipper-as part of a triple motif that also comprised the estrogen receptor and Pax domain binding sites. Without exception, triple motifs were located within Alu elements, which suggests a role for this primate-specific transposable element (TE) in the evolution of decidual genes. Although other TEs were generally under-represented in open chromatin of undifferentiated EnSCs, several classes contributed to the regulatory DNA landscape that underpins decidual gene expression.-Vrljicak, P., Lucas, E. S., Lansdowne, L., Lucciola, R., Muter, J., Dyer, N. P., Brosens, J. J., Ott, S. Analysis of chromatin accessibility in decidualizing human endometrial stromal cells.

Also flagged:AMPKglucoseinsulinsecretiongene expressiondiabetes
Journal Article 2018-01-08 ✓ 2 Snippets Martinez-Sanchez A, Nguyen-Tu MS, Cebola I, Yavari A, Marchetti P, Piemonti L, de Koning E, Shapiro AMJ, Johnson P, Sakamoto K, Smith DM, Leclerc I, Ashrafian H, Ferrer J, Rutter GA.
In-Text Gene Mentions

Other miRNA–target pathways that may contribute to the loss of β-cell identity after AMPK deletion are the up-regulated Ldha, a validated target of miR-34a/b/c in other cell types (34, 35), and Sox6, which can lower Pdx-1 activity to attenuate glucose stimulated insulin secretion (36) and is targeted by miR-96 in hepatocellular carcinoma (37).

…35 ), andSox6, which can…

Show Full Abstract

AMPK is a critical energy sensor and target for widely used antidiabetic drugs. In β cells, elevated glucose concentrations lower AMPK activity, and the ablation of both catalytic subunits [β-cell-specific AMPK double-knockout (βAMPKdKO) mice] impairs insulin secretion in vivo and β-cell identity. MicroRNAs (miRNAs) are small RNAs that silence gene expression that are essential for pancreatic β-cell function and identity and altered in diabetes. Here, we have explored the miRNAs acting downstream of AMPK in mouse and human β cells. We identified 14 down-regulated and 9 up-regulated miRNAs in βAMPKdKO vs. control islets. Gene ontology analysis of targeted transcripts revealed enrichment in pathways important for β-cell function and identity. The most down-regulated miRNA was miR-184 (miR-184-3p), an important regulator of β-cell function and compensatory expansion that is controlled by glucose and reduced in diabetes. We demonstrate that AMPK is a potent regulator and an important mediator of the negative effects of glucose on miR-184 expression. Additionally, we reveal sexual dimorphism in miR-184 expression in mouse and human islets. Collectively, these data demonstrate that glucose-mediated changes in AMPK activity are central for the regulation of miR-184 and other miRNAs in islets and provide a link between energy status and gene expression in β cells.-Martinez-Sanchez, A., Nguyen-Tu, M.-S., Cebola, I., Yavari, A., Marchetti, P., Piemonti, L., de Koning, E., Shapiro, A. M. J., Johnson, P., Sakamoto, K., Smith, D. M., Leclerc, I., Ashrafian, H., Ferrer, J., Rutter, G. A. MiR-184 expression is regulated by AMPK in pancreatic islets.

Also flagged:preeclampsiaPEhypertensive disorder of pregnancydecidualizationplacentopathiescomplement factor 3
Journal Article 2018-01-08 No Snippets Sones JL, Merriam AA, Seffens A, Brown-Grant DA, Butler SD, Zhao AM, Xu X, Shawber CJ, Grenier JK, Douglas NC.
Show Full Abstract

Preeclampsia (PE), a hypertensive disorder of pregnancy, is a leading cause of maternal and fetal morbidity and mortality. Although the etiology is unknown, PE is thought to be caused by defective implantation and decidualization in pregnancy. Pregnant blood pressure high (BPH)/5 mice spontaneously develop placentopathies and maternal features of human PE. We hypothesized that BPH/5 implantation sites have transcriptomic alterations. Next-generation RNA sequencing of implantation sites at peak decidualization, embryonic day (E)7.5, revealed complement gene up-regulation in BPH/5 vs. controls. In BPH/5, expression of complement factor 3 was increased around the decidual vasculature of E7.5 implantation sites and in the trophoblast giant cell layer of E10.5 placentae. Altered expression of VEGF pathway genes in E5.5 BPH/5 implantation sites preceded complement dysregulation, which correlated with abnormal vasculature and increased placental growth factor mRNA and VEGF<sub>164</sub> expression at E7.5. By E10.5, proangiogenic genes were down-regulated, whereas antiangiogenic sFlt-1 was up-regulated in BPH/5 placentae. We found that early local misexpression of VEGF genes and abnormal decidual vasculature preceded sFlt-1 overexpression and increased complement deposition in BPH/5 placentae. Our findings suggest that abnormal decidual angiogenesis precedes complement activation, which in turn contributes to the aberrant trophoblast invasion and poor placentation that underlie PE.-Sones, J. L., Merriam, A. A., Seffens, A., Brown-Grant, D.-A., Butler, S. D., Zhao, A. M., Xu, X., Shawber, C. J., Grenier, J. K., Douglas, N. C. Angiogenic factor imbalance precedes complement deposition in placentae of the BPH/5 model of preeclampsia.

Also flagged:cartilage developmentTranscription factorsdevelopmentSox9Sox5Runx2
Journal Article 2018-01-08 ✓ 1 Snippet Nishimura R, Hata K, Nakamura E, Murakami T, Takahata Y.
In-Text Gene Mentions

…have revealed that Sox9/Sox5/Sox6, Runx2/Runx3 and Osterix…

Show Full Abstract

Transcription factors play important roles in the regulation of cartilage development by controlling the expression of chondrogenic genes. Genetic studies have revealed that Sox9/Sox5/Sox6, Runx2/Runx3 and Osterix in particular are essential for the sequential steps of cartilage development. Importantly, these transcription factors form network systems that are also required for appropriate cartilage development. Molecular cloning approaches have largely contributed to the identification of several transcriptional partners for Sox9 and Runx2 during cartilage development. Although the importance of a negative-feedback loop between Indian hedgehog (Ihh) and parathyroid hormone-related protein (PTHrP) in chondrocyte hypertrophy has been well established, recent studies indicate that several transcription factors interact with the Ihh-PTHrP loop and demonstrated that Ihh has multiple functions in the regulation of cartilage development. The most common cartilage disorder, osteoarthritis, has been reported to result from the pathological action of several transcription factors, including Runx2, C/EBPβ and HIF-2α. On the other hand, NFAT family members appear to play roles in the protection of cartilage from osteoarthritis. It is also becoming important to understand the homeostasis and regulation of articular chondrocytes, because they have different cellular and molecular features from chondrocytes of the growth plate. This review summarizes the regulation and roles of transcriptional network systems in cartilage development and their pathological roles in osteoarthritis.

The LRRK2 signalling system.

Also flagged:LRRK2leucine-rich repeat kinase 2signal transductionParkinsonROCO GTPaseRas
Journal Article 2018-01-08 No Snippets Price A, Manzoni C, Cookson MR, Lewis PA.
Show Full Abstract

The LRRK2 gene is a major contributor to genetic risk for Parkinson's disease and understanding the biology of the leucine-rich repeat kinase 2 (LRRK2, the protein product of this gene) is an important goal in Parkinson's research. LRRK2 is a multi-domain, multi-activity enzyme and has been implicated in a wide range of signalling events within the cell. Because of the complexities of the signal transduction pathways in which LRRK2 is involved, it has been challenging to generate a clear idea as to how mutations and disease associated variants in this gene are altered in disease. Understanding the events in which LRRK2 is involved at a systems level is therefore critical to fully understand the biology and pathobiology of this protein and is the subject of this review.

Also flagged:obesitymetabolismhatchingfatty aciddegradationACAA2
Journal Article 2018-01-08 ✓ 1 Snippet Peng M, Li S, He Q, Zhao J, Li L, Ma H.
In-Text Gene Mentions

…ALDH7A1, ALDH9A1, CPT1A,ECI2, and EHHADH), glycolysis/gluc…

Show Full Abstract

<h4>Background</h4>Chicken embryos are widely used as a model for studies of obesity; however, no detailed information is available about the dynamic changes of proteins during the regulation of adipose biology and metabolism. Thus, the present study used an isobaric tags for relative and absolute quantitation (iTRAQ)-based proteomic approach to identify the changes in protein abundance at different stages of chicken embryonic development.<h4>Results</h4>In this study, the abundances of 293 hepatic proteins in 19-day old of chicken embryos compared with 14-day old and 160 hepatic proteins at hatching compared with 19-day old embryos were significantly changed. Pathway analysis showed that fatty acid degradation (upregulated ACAA2, CPT1A, and ACOX1), protein folding (upregulated PDIs, CALR3, LMAN1, and UBQLN1) and gluconeogenesis (upregulated ACSS1, AKR1A1, ALDH3A2, ALDH7A1, and FBP2) were enhanced from embryonic day 14 (E14) to E19 of chicken embryo development. Analysis of the differentially abundant proteins indicated that glycolysis was not the main way to produce energy from E19 to hatching day during chicken embryo development. In addition, purine metabolism was enhanced, as deduced from increased IMPDH2, NT5C, PGM2, and XDH abundances, and the decrease of growth rate could be overcome by increasing the abundance of ribosomal proteins from E19 to the hatching day.<h4>Conclusion</h4>The levels of certain proteins were coordinated with each other to regulate the changes in metabolic pathways to satisfy the requirement for growth and development at different stages of chicken embryo development. Importantly, ACAA2, CPT1A, and ACOX1 might be key factors to control fat deposition during chicken embryonic development. These results provided information showing that chicken is a useful model to further investigate the mechanism of obesity and insulin resistance in humans.

Also flagged:infectionlatent infectionlymphomasCD4LMP1CD8
Journal Article 2018-01-08 No Snippets Choi IK, Wang Z, Ke Q, Hong M, Qian Y, Zhao X, Liu Y, Kim HJ, Ritz J, Cantor H, Rajewsky K, Wucherpfennig KW, Zhang B.
Show Full Abstract

The B-lymphotropic Epstein-Barr virus (EBV), pandemic in humans, is rapidly controlled on initial infection by T cell surveillance; thereafter, the virus establishes a lifelong latent infection in the host. If surveillance fails, fatal lymphoproliferation and lymphomagenesis ensue. The initial T cell response consists of predominantly CD8<sup>+</sup> cytotoxic T cells and a smaller expansion of CD4<sup>+</sup> cells. A major approach to treating EBV-associated lymphomas is adoptive transfer of autologous or allogeneic T cells that are stimulated/expanded on EBV-transformed B cells. Strikingly, the clinical response correlates with the frequency of CD4 cells in the infused T cells. Although in vitro studies suggested that EBV-specific CD4 cells develop cytotoxicity, they have not been comprehensively characterized and the molecular mechanism underlying their formation remains unknown. Our recent work, using a transgenic approach in mice, has revealed a central role for the EBV signaling molecule LMP1 in immune surveillance and transformation of EBV-infected B cells. The mouse model offers a unique tool for uncovering basic features of EBV immunity. Here, we show that LMP1 expression in B cells induces potent cytotoxic CD4 and CD8 T cell responses, by enhancing antigen presentation and costimulation by CD70, OX40 ligand, and 4-1BB ligand. Our data further suggest that cytotoxic CD4 cells hold superior therapeutic value for LMP1 (EBV)-driven lymphomas. These findings provide insights into EBV immunity, demonstrating that LMP1 signaling alone is sufficient to induce a prominent cytotoxic CD4 response, and suggest strategies for immunotherapy in EBV-related and other cancers.

Also flagged:HDrosette formationGene-expressionorganizationADAM10ROCK
Journal Article 2018-01-08 ✓ 1 Snippet Conforti P, Besusso D, Bocchi VD, Faedo A, Cesana E, Rossetti G, Ranzani V, Svendsen CN, Thompson LM, Toselli M, Biella G, Pagani M, Cattaneo E.
In-Text Gene Mentions

HTT

Show Full Abstract

Increasing evidence suggests that early neurodevelopmental defects in Huntington's disease (HD) patients could contribute to the later adult neurodegenerative phenotype. Here, by using HD-derived induced pluripotent stem cell lines, we report that early telencephalic induction and late neural identity are affected in cortical and striatal populations. We show that a large CAG expansion causes complete failure of the neuro-ectodermal acquisition, while cells carrying shorter CAGs repeats show gross abnormalities in neural rosette formation as well as disrupted cytoarchitecture in cortical organoids. Gene-expression analysis showed that control organoid overlapped with mature human fetal cortical areas, while HD organoids correlated with the immature ventricular zone/subventricular zone. We also report that defects in neuroectoderm and rosette formation could be rescued by molecular and pharmacological approaches leading to a recovery of striatal identity. These results show that mutant huntingtin precludes normal neuronal fate acquisition and highlights a possible connection between mutant huntingtin and abnormal neural development in HD.

Also flagged:BiomineralizationPeriodontal diseasechitosangelatinglycerolBMP-6
Journal Article 2018-01-08 ✓ 1 Snippet Chien KH, Chang YL, Wang ML, Chuang JH, Yang YC, Tai MC, Wang CY, Liu YY, Li HY, Chen JT, Kao SY, Chen HL, Lo WL.
In-Text Gene Mentions

…the up-regulation ofSOX6and RUNX2 ,…

Show Full Abstract

Periodontal disease may cause considerable destruction of alveolar bone, periodontal ligaments (PDLs) and cementum and even lead to progressive oral dysfunction. Periodontal tissue regeneration is the ultimate goal of periodontal disease treatment to reconstruct both structures and functions. However, the regenerative efficiency is low, possibly due to the lack of a proper periodontal microenvironment. In this study, we applied an injectable and thermosensitive chitosan/gelatin/glycerol phosphate hydrogel to provide a 3D environment for transplanted stem cells and to enhance stem cell delivery and engraftment. The iPSCs-BMP-6-hydrogel complex promoted osteogenesis and the differentiation of new connective tissue and PDL formation. In animal models of maxillary-molar defects, the iPSCs-BMP-6-hydrogel-treated group showed significant mineralization with increased bone volume, trabecular number and trabecular thickness. Synergistic effects of iPSCs and BMP-6 increased both bone and cementum formation. IPSCs-BMP-6-hydrogel-treated animals showed new bone synthesis (increased ALP- and TRAP-positive cells), new PDL regeneration (shown through Masson's trichrome staining and a qualification assay), and reduced levels of inflammatory cytokines. These findings suggest that hydrogel-encapsulated iPSCs combined with BMP-6 provide a new strategy to enhance periodontal regeneration. This combination not only promoted stem cell-derived graft engraftment but also minimized the progress of inflammation, which resulted in highly possible periodontal regeneration.

Also flagged:histone deacetylasevorinostatentinostathistone deacetylasesHDACsacute lymphocytic leukemia
Journal Article 2018-01-08 ✓ 1 Snippet Rivera-Del Valle N, Cheng T, Irwin ME, Donnella H, Singh MM, Chandra J.
In-Text Gene Mentions

PRDX6

Show Full Abstract

<h4>Purpose</h4>Amongst the epigenetically targeted therapies, targeting of the histone deacetylases (HDACs) has yielded numerous drugs for clinical use in hematological malignancies, but none as yet for acute lymphocytic leukemia (ALL). Single agent activity of HDAC inhibitors (HDACi) has been elusive in ALL, and has prompted study of combinatorial strategies. Because several HDACi raise levels of intracellular oxidative stress, we evaluated combinations of two structurally distinct HDACi with the redox active compound adaphostin in ALL.<h4>Methods</h4>The HDACi vorinostat and entinostat were tested in combination with adaphostin in human ALL cell lines. DNA fragmentation, caspase activation, mitochondrial disruption and levels of  intracellular peroxides, superoxide and glutathione were measured in cells treated with the HDACi/adaphostin combinations. Antioxidant blockade of cell death induction and gene expression profiling of cells treated with vorinostat/adaphostin versus entinostat/adaphostin combinations were evaluated.<h4>Results</h4>Both combinations synergistically induced apoptotic DNA fragmentation, which was preceded by an increase in superoxide levels, a reduction in mitochondrial membrane potential, and an increase in caspase-9 activation. The antioxidant N-acetylcysteine (NAC) blocked superoxide generation and prevented reduction of mitochondrial membrane potential. NAC decreased DNA fragmentation and caspase activity in cells treated with adaphostin and vorinostat, but not in those treated with adaphostin and entinostat. Gene expression arrays revealed differential regulation of several redox genes prior to cell death induction.<h4>Conclusions</h4>A redox modulatory agent, adaphostin, enhances efficacy of two HDACi, vorinostat or entinostat, but via different mechanisms indicating a point of divergence in the mechanisms of synergy between the two distinct HDACi and adaphostin.

Also flagged:WntR-Spondincolorectal cancerneoplasiaRSPO-binding transmembrane proteinsleucine-rich-repeat-containing G-protein-coupled receptors
Journal Article 2018-01-08 No Snippets Kriz V, Korinek V.
Show Full Abstract

In this review, we address aspects of Wnt, R-Spondin (RSPO) and Hippo signalling, in both healthy and transformed intestinal epithelium. In intestinal stem cells (ISCs), the Wnt pathway is essential for intestinal crypt formation and renewal, whereas RSPO-mediated signalling mainly affects ISC numbers. In human colorectal cancer (CRC), aberrant Wnt signalling is the driving mechanism initiating this type of neoplasia. The signalling role of the RSPO-binding transmembrane proteins, the leucine-rich-repeat-containing G-protein-coupled receptors (LGRs), is possibly more pleiotropic and not only limited to the enhancement of Wnt signalling. There is growing evidence for multiple crosstalk between Hippo and Wnt/β-catenin signalling. In the <i>ON</i> state, Hippo signalling results in serine/threonine phosphorylation of Yes-associated protein (YAP1) and tafazzin (TAZ), promoting formation of the β-catenin destruction complex. In contrast, YAP1 or TAZ dephosphorylation (and YAP1 methylation) results in β-catenin destruction complex deactivation and β-catenin nuclear localization. In the Hippo <i>OFF</i> state, YAP1 and TAZ are engaged with the nuclear β-catenin and participate in the β-catenin-dependent transcription program. Interestingly, YAP1/TAZ are dispensable for intestinal homeostasis; however, upon Wnt pathway hyperactivation, the proteins together with TEA domain (TEAD) transcription factors drive the transcriptional program essential for intestinal cell transformation. In addition, in many CRC cells, YAP1 phosphorylation by YES proto-oncogene 1 tyrosine kinase (YES1) leads to the formation of a transcriptional complex that includes YAP1, β-catenin and T-box 5 (TBX5) DNA-binding protein. YAP1/β-catenin/T-box 5-mediated transcription is necessary for CRC cell proliferation and survival. Interestingly, dishevelled (DVL) appears to be an important mediator involved in both Wnt and Hippo (YAP1/TAZ) signalling and some of the DVL functions were assigned to the nuclear DVL pool. Wnt ligands can trigger alternative signalling that directly involves some of the Hippo pathway components such as YAP1, TAZ and TEADs. By upregulating Wnt pathway agonists, the alternative Wnt signalling can inhibit the canonical Wnt pathway activity.

Also flagged:insulin resistanceobesitygene expressioninsulinserine protease inhibitorimmune response
Journal Article 2018-01-08 ✓ 1 Snippet Chen K, Jih A, Osborn O, Kavaler ST, Fu W, Sasik R, Saito R, Kim JJ.
In-Text Gene Mentions

Serpinc1

Show Full Abstract

Highly inbred C57BL/6 mice show wide variation in their degree of insulin resistance in response to diet-induced obesity even though they are almost genetically identical. Here we employed transcriptional profiling by RNA sequencing (RNA-Seq) of visceral adipose tissue (VAT) and liver in young mice to determine how gene expression patterns correlate with the later development of high-fat diet (HFD)-induced insulin resistance in adulthood. To accomplish this goal, we partially removed and banked tissues from pubertal mice. Mice subsequently received HFD followed by metabolic phenotyping to identify two well-defined groups of mice with either severe or mild insulin resistance. The remaining tissues were collected at study termination. We then applied RNA-Seq to generate transcriptome profiles associated with worsened insulin resistance before and after the initiation of HFD. We found 244 up- and 109 downregulated genes in VAT of the most insulin-resistant mice even before HFD exposure. Downregulated genes included serine protease inhibitor, major urinary protein, and complement genes; upregulated genes represented mostly muscle constituents. These gene families were also differentially expressed in VAT of mice with high or low insulin resistance after HFD. Inflammatory genes predicted insulin resistance in liver, but not in VAT. In contrast, when we compared VAT of all mice before and after HFD, differentially expressed genes were predominantly composed of immune response genes. These data show a distinct set of gene transcripts in young mice correlates with the severity of insulin resistance in adulthood, providing insight into the pathogenesis of insulin resistance in early life.

Also flagged:Primary hypoparathyroidismhypocalcemiaHypoparathyroidismendocrine disordercalciumparathyroid hormone
Journal Article 2018-01-08 ✓ 1 Snippet Mendes EM, Meireles-Brandão L, Meira C, Morais N, Ribeiro C, Guerra D.
In-Text Gene Mentions

…disease (Wilson’s disease,hemochromatosis, metastatic cancer).…

Show Full Abstract

No abstract available.

Also flagged:BoronBelinostathistone deacetylasesolid tumorscancertumor
Journal Article 2018-01-08 ✓ 1 Snippet Zheng S, Guo S, Zhong Q, Zhang C, Liu J, Yang L, Zhang Q, Wang G.
In-Text Gene Mentions

DCC

Show Full Abstract

Despite promising therapeutic utilities for treatment of hematological malignancies, histone deacetylase inhibitor (HDACi) drugs have not proven as effective in the treatment of solid tumors. To expand the clinical indications of HDACi drugs, we developed novel boron-containing prodrugs of belinostat (<b>2</b>), one of which efficiently releases active <b>2</b> through a cascade of reactions in cell culture and demonstrates activities comparable to <b>2</b> against a panel of cancer cell lines. Importantly, prodrug <b>7</b> is more efficacious than belinostat in vivo, not only inhibiting the growth of tumor but also reducing tumor volumes in an MCF-7 xenograft tumor model owing to its superior biocompatibility, which suggests its clinical potential in the treatment of solid tumors.

Also flagged:lung adenocarcinomacancerschromosomal regionsnon-small-cell lung cancerNSCLCLUAD
Journal Article 2018-01-08 ✓ 2 Snippets Tokar T, Pastrello C, Ramnarine VR, Zhu CQ, Craddock KJ, Pikor LA, Vucic EA, Vary S, Shepherd FA, Tsao MS, Lam WL, Jurisica I.
In-Text Gene Mentions

Moreover, several enriched guidance molecule pathways (ephrin signaling, semaphorin interactions, integrin, DCC-mediated attractive signaling) are noted as cancer-drug targets [29].

…phorin interactions, integrin,DCC-mediated attractive signaling…

Show Full Abstract

In many cancers, significantly down- or upregulated genes are found within chromosomal regions with DNA copy number alteration opposite to the expression changes. Generally, this paradox has been overlooked as noise, but can potentially be a consequence of interference of epigenetic regulatory mechanisms, including microRNA-mediated control of mRNA levels. To explore potential associations between microRNAs and paradoxes in non-small-cell lung cancer (NSCLC) we curated and analyzed lung adenocarcinoma (LUAD) data, comprising gene expressions, copy number aberrations (CNAs) and microRNA expressions. We integrated data from 1,062 tumor samples and 241 normal lung samples, including newly-generated array comparative genomic hybridization (aCGH) data from 63 LUAD samples. We identified 85 "paradoxical" genes whose differential expression consistently contrasted with aberrations of their copy numbers. Paradoxical status of 70 out of 85 genes was validated on sample-wise basis using The Cancer Genome Atlas (TCGA) LUAD data. Of these, 41 genes are prognostic and form a clinically relevant signature, which we validated on three independent datasets. By meta-analysis of results from 9 LUAD microRNA expression studies we identified 24 consistently-deregulated microRNAs. Using TCGA-LUAD data we showed that deregulation of 19 of these microRNAs explains differential expression of the paradoxical genes. Our results show that deregulation of paradoxical genes is crucial in LUAD and their expression pattern is maintained epigenetically, defying gene copy number status.

Also flagged:carbohydratemonosaccharidespolysaccharidesalginatechitosanhyaluronic acid
Journal Article 2018-01-08 No Snippets Miao T, Wang J, Zeng Y, Liu G, Chen X.
Show Full Abstract

Polysaccharides or polymeric carbohydrate molecules are long chains of monosaccharides that are linked by glycosidic bonds. The naturally based structural materials are widely applied in biomedical applications. This article covers four different types of polysaccharides (i.e., alginate, chitosan, hyaluronic acid, and dextran) and emphasizes their chemical modification, preparation approaches, preclinical studies, and clinical translations. Different cargo fabrication techniques are also presented in the third section. Recent progresses in preclinical applications are then discussed, including tissue engineering and treatment of diseases in both therapeutic and monitoring aspects. Finally, clinical translational studies with ongoing clinical trials are summarized and reviewed. The promise of new development in nanotechnology and polysaccharide chemistry helps clinical translation of polysaccharide-based drug delivery systems.

Also flagged:FibrosisLiver DiseaseNAFLDhepatic steatosisalcoholNon-alcoholic steatohepatitis
Journal Article 2018-01-08 ✓ 1 Snippet Pattnaik K, Bhuyan P, Singh A, Singh SP, Nath P, Kar S, Misra B, Rath J.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Background</h4>Non-alcoholic fatty liver disease (NAFLD) is emerging as an important cause of liver disease in India. NAFLD is characterized by hepatic steatosis in absence of a significant alcohol use or other known liver disease. Non-alcoholic steatohepatitis (NASH) is a progressive form of NAFLD which deserves particular attention because it is more prone for development of fibrosis. Liver biopsy is the gold standard for diagnosis of NASH by evaluating necroinflammatory activity and stages of fibrosis. The aim of the study was to analyze liver biopsy specimens and identify risk factors associated with fibrosis in patients of NAFLD in eastern coastal India.<h4>Methods</h4>A total of 216 subjects with fatty liver in ultrasonography (USG) were selected for needle biopsy. Those NAFLD cases showing fibrosis in biopsy were analyzed for risk factors association.<h4>Results</h4>Definite NASH was diagnosed in 50 (23.14%), borderline NASH in 66 (30.55%) and not NASH in 100 (46.39%) of cases. Those patients with fibrosis (22%) were taken as cases and those without fibrosis (78%) were taken as controls for risk factor analysis. Age > 40 [odds ratio (OR) 2.01 (1.09-4.04)], female gender [OR 2.74 (1.24-6.05)], body mass index (BMI) > 23 [OR 15.36 (4.59-51.37)] and moderate fatty change in USG [OR 1.89 (1.01-3.62)] were observed as risk factors for progression to fibrosis in NAFLD cases.<h4>Conclusion</h4>Older age, females, obesity and moderate fatty liver on USG are risk factors for development of fibrosis in patients with NAFLD. Patients with these risk factors should be selected for liver biopsy and to be kept for close follow-up.

bioRxiv 2018-01-08 Preprint (No Snippets API) Suri P, Palmer MR, Tsepilov YA, Freidin MB, Boer CG, Yau MS, Evans DS, Gelemanovic A, Bartz TM, Nethander M, Arbeeva L, Karssen L, Neogi T, Campbell A, Mellstrom D, Ohlsson C, Marshall LM, Orwoll E, Uitterlinden A, Rotter JI, Lauc G, Psaty BM, Karlsson MK, Lane NE, Jarvik G, Polasek O, Hochberg M, Jordan JM, Van Meurs JBJ, Jackson R, Nielson CM, Mitchell BD, Smith BH, Hayward C, Smith NL, Aulchenko YS, Williams FM.
Show Full Abstract

<h4>ABSTRACT</h4> <h4>OBJECTIVES</h4> To conduct a genome-wide association study (GWAS) meta-analysis of chronic back pain (CBP). <h4>METHODS</h4> Adults of European ancestry were included from 16 cohorts in Europe and North America. CBP cases were defined as those reporting back pain present for >3-6 months; non-cases were included as comparisons (“controls”). Each cohort conducted genotyping using commercially available arrays followed by imputation. GWAS used logistic regression models with additive genetic effects, adjusting for age, sex, study-specific covariates, and population substructure. The threshold for genome-wide significance in the fixed-effect inverse-variance weighted meta-analysis was p<5×10 −8 . Suggestive (p<5×10 −7 ) and genome-wide significant (p<5×10 −8 ) variants were carried forward for replication or further investigation in an independent sample. <h4>RESULTS</h4> The discovery sample was comprised of 158,025 individuals, including 29,531 CBP cases. A genome-wide significant association was found for the intronic variant rs12310519 in SOX5 (OR 1.08, p=7.2×10 −10 ). This was subsequently replicated in an independent sample of 283,752 subjects, including 50,915 cases (OR 1.06, p =5.3×10 −11 ), and exceeded genome-wide significance in joint meta-analysis (OR=1.07, p =4.5×10 −19 ). We found suggestive associations at three other loci in the discovery sample, two of which exceeded genome-wide significance in joint meta-analysis: an intergenic variant, rs7833174, located between CCDC26 and GSDMC (OR 1.05, p=4.4×10 −13 ), and an intronic variant, rs4384683, in DCC (OR 0.97, p=2.4×10 −10 ). <h4>DISCUSSION</h4> In this first reported meta-analysis of GWAS for CBP, we identified and replicated a genetic locus associated with CBP ( SOX5 ). We also identified 2 other loci that reached genome-wide significance in a 2-stage joint meta-analysis ( CCDC26/GSDMC and DCC ).

Also flagged:NPY-Y2 receptorsHuntington's diseaseHDneurodegenerative disorderNeuropeptide YNPY
Journal Article 2018-01-06 No Snippets Fatoba O, Kloster E, Reick C, Saft C, Gold R, Epplen JT, Arning L, Ellrichmann G.
Show Full Abstract

Huntington's disease (HD) is a monogenic inherited polyglutamine-mediated neurodegenerative disorder for which effective therapies are currently unavailable. Neuropeptide Y (NPY) has been implicated as a potential therapeutic target in several neurodegenerative diseases, including HD. However, its mechanisms of action in the context of HD pathology remain unknown. Here, we investigated the beneficial effects of Y2 receptor (Y2R) activation with NPY or Y2R selective agonist NPY<sub>13-36</sub> in the R6/2 mouse and PC12 cell models of HD. Also, we explored the effects of selective pharmacological blockage of Y2R using selective non-peptide small molecule Y2R antagonist SF31 in vivo and in vitro. Our results showed that activation of Y2R with intranasal NPY or NPY<sub>13-36</sub> led to an improved motor function in R6/2 mice as revealed by rotarod performance, vertical pole test, and hindlimb clasping behaviour. Also, intranasal NPY or NPY<sub>13-36</sub> led to a decrease in aggregated mHtt and mediated increase in dopamine and cAMP-regulated phosphoprotein, 32kDa (DARPP-32), brain-derived neurotrophic factor (BDNF), and activated extracellular signal-regulated protein kinases (pERK1/2) levels in R6/2 mice. Intranasal NPY or NPY<sub>13-36</sub> had no effect on body weight but showed positive effects on survival in R6/2 mice. Furthermore, intranasal NPY or NPY<sub>13-36</sub> attenuated induction of proinflammatory cytokine and inflammatory mediators in R6/2 mice. In contrast, antagonizing by using SF31 exacerbates phenotypic severity in R6/2 mice and treatment effects with either intranasal NPY or NPY<sub>13-36</sub> were significantly blocked<sub>.</sub>In vitro, using inducible PC12/Htt<sup>Q103-EGFP</sup> cells, treatment with NPY or NPY<sub>13-36</sub> protected against mHtt-mediated neuromorphological defects (neurite length and soma area) and neurotoxicity but had no effect on mHtt inclusion body formation. Conversely, co-treatment with SF31 significantly inhibited these effects. Together, our findings extend previous evidence of the beneficial effects of NPY in R6/2 mice, and more importantly, suggest that targeted activation of Y2R receptor might be a promising disease-modifying target for HD and other neurodegenerative diseases.

Also flagged:cardiac arrestHypothermiaadrenalinelactatemembranearrest
Journal Article 2018-01-06 No Snippets Meert K, Telford R, Holubkov R, Slomine BS, Christensen JR, Berger J, Ofori-Amanfo G, Newth CJL, Dean JM, Moler FW.
Show Full Abstract

<h4>Objective</h4>To investigate clinical characteristics associated with 12-month survival and neurobehavioural function among children recruited to the Therapeutic Hypothermia after Paediatric Cardiac Arrest In-Hospital trial.<h4>Methods</h4>Children (n = 329) with in-hospital cardiac arrest who received chest compressions for ≥2 min, were comatose, and required mechanical ventilation after return of circulation were included. Neurobehavioural function was assessed using the Vineland Adaptive Behaviour Scales, second edition (VABS-II) at baseline (reflecting pre-arrest status) and 12 months post-arrest. Norms for VABS-II are 100 (mean) ±15 (SD). Higher scores indicate better functioning. Outcomes included 12-month survival, 12-month survival with VABS-II decreased by ≤15 points from baseline, and 12-month survival with VABS-II ≥70.<h4>Results</h4>Asystole as the initial arrest rhythm, administration of >4 adrenaline doses, and higher post-arrest blood lactate concentration were independently associated with lower 12-month survival; an adrenaline dosing interval of 3-<5 min and open chest compressions were independently associated with greater 12-month survival. Use of extracorporeal membrane oxygenation (ECMO) and higher blood lactate were independently associated with lower 12-month survival with VABS-II decreased by ≤15 points from baseline; open chest compressions was independently associated with greater 12-month survival with VABS-II decreased by ≤15 points. Asystole as the initial rhythm, use of ECMO, and higher blood lactate were independently associated with lower 12-month survival with VABS-II ≥70; open chest compressions was independently associated with greater 12-month survival with VABS-II ≥70.<h4>Conclusions</h4>Cardiac arrest and resuscitation factors are associated with long-term survival and neurobehavioural function among children who are comatose after in-hospital arrest.

Also flagged:gene expressionArid5bchondrogenesisprostanoidCOX-1PGI synthase
Journal Article 2018-01-05 ✓ 5 Snippets Murray J, Whitson RH, Itakura K.
In-Text Gene Mentions

…(PG)I synthase (Ptgis).…

…PGI synthase (Ptgis, −2.800 fold)…

…that expression ofPtgiswas down-regulated in…

Ptgisexpression was reduced…

…the down-regulation ofPtgisexpression in Arid5b…

Show Full Abstract

The AT-rich interaction domain (ARID) family of proteins regulates gene expression, development, and differentiation. Although Arid5b has important functions in adipogenesis and chondrogenesis, the role of Arid5b in skeletal muscle myogenesis has not been investigated. Therefore, we isolated primary skeletal muscle cells from Arid5b<sup>+/+</sup> and Arid5b<sup>-/-</sup> mice and characterized differentiation in these cells. We found that Arid5b<sup>-/-</sup> primary skeletal muscle cells showed differentiation defects and impaired sarcomeric assembly. Microarray analysis revealed down-regulation of the prostanoid biosynthesis pathway in Arid5b<sup>-/-</sup> myoblasts, including the genes encoding cyclooxygenase (COX)-1 ( Ptgs1) and prostaglandin (PG)I synthase ( Ptgis). Down-regulation of COX-1 and PGI synthase was confirmed by real-time PCR and Western blot analyses. Correspondingly, the production of PGI<sub>2</sub>, as measured by ELISA, was reduced in Arid5b<sup>-/-</sup> cells relative to Arid5b<sup>+/+</sup> cells. Boyden chamber assays showed that migration was increased but chemotaxis was impaired in Arid5b<sup>-/-</sup> cells. Myoblast fusion was also inhibited in Arid5b<sup>-/-</sup> cells compared with Arid5b<sup>+/+</sup> cells. Treatment with the PGI<sub>2</sub> analog iloprost rescued the defects in myotube formation, migration, and fusion. These results demonstrate that Arid5b has a novel and essential role in skeletal muscle differentiation by regulating PGI<sub>2</sub> production.-Murray, J., Whitson, R. H., Itakura, K. Reduced prostaglandin I<sub>2</sub> signaling in Arid5b<sup>-/-</sup> primary skeletal muscle cells attenuates myogenesis.

Also flagged:extracellulartransmembranecell surface receptorsaxoncytoskeletonmembrane
Journal Article 2018-01-05 ✓ 1 Snippet Russell SA, Bashaw GJ.
In-Text Gene Mentions

Dcc

Show Full Abstract

Axons need to be properly guided to their targets to form synaptic connections, and this requires interactions between highly conserved extracellular and transmembrane ligands and their cell surface receptors. The majority of studies on axon guidance signaling pathways have focused on the role of these pathways in rearranging the local cytoskeleton and plasma membrane in growth cones and axons. However, a smaller body of work has demonstrated that axon guidance signaling pathways also control gene expression via local translation and transcription. Recent studies on axon guidance ligands and receptors have begun to uncover the requirements for these alternative mechanisms in processes required for neural circuit formation: axon guidance, synaptogenesis, and cell migration. Understanding the mechanisms by which axon guidance signaling regulates local translation and transcription will create a more complete picture of neural circuit formation, and they may be applied more broadly to other tissues where axon guidance ligands and receptors are required for morphogenesis. Developmental Dynamics 247:571-580, 2018. © 2017 Wiley Periodicals, Inc.

Also flagged:ironHHhereditary hemochromatosisoverloadpigmentationdiabetes
Journal Article 2018-01-05 ✓ 5 Snippets Fonseca PFS, Cançado RD, Naoum FA, Dinardo CL, Fonseca GHH, Gualandro SFM, Krieger JE, Pereira AC, Brissot P, Santos PCJL.
In-Text Gene Mentions

…genotype for theHFEp.Cys282Tyr mutation; group…

…is related toHFEmutations, especially by…

…are named non-HFE hemochromatosishemochromatosis: type 2…

…sequences of theHFEexons 2 and…

…of HH isHFE-related HH, associated…

Show Full Abstract

<h4>Background</h4>Hereditary hemochromatosis (HH) encompasses a group of autosomal recessive disorders mainly characterized by enhanced intestinal absorption of iron and its accumulation in parenchymal organs. HH diagnosis is based on iron biochemical and magnetic resonance imaging (MRI) assessment, and genetic testing. Questionnaires, such as SF-36 (short form health survey), have been increasingly used to assess the impact of diseases on the patient's quality of life (QL). In addition, different genotypes are identified as results of genetic tests in patients with suspected primary iron overload. In the present study, our aim was to evaluate whether domains of QL are different according to genotypic groups in patients suspected of HH.<h4>Methods</h4>Seventy-nine patients with primary iron overload were included and two genotypic groups were formed (group 1: homozygous genotype for the HFE p.Cys282Tyr mutation; group 2: other genotypes).<h4>Results</h4>Group 1 had higher means of plasma transferrin saturation (86 ± 19%) and serum ferritin (1669 ± 1209 ng/mL) compared to group 2 (71 ± 12%, 1252 ± 750 ng/mL, respectively; p = 0.001). Four domains were significantly different among groups 1 and 2: physical functioning (p = 0.03), bodily pain (p = 0.03), vitality (p = 0.02) and social functioning (p = 0.01).<h4>Conclusions</h4>Our main finding was that patients with p.Cys282Tyr homozygosity had a worse QL scenario assessed by SF-36, compared with patients with iron overload without the same genotype. Being aware of this relationship between genotypes and QL might be helpful in the overall management of patients suspected of hereditary hemochromatosis.

Also flagged:translationalcholesterolcytochrome P450 46A1CYP46A1
Journal Article 2018-01-05 No Snippets PLOS ONE Staff.
Show Full Abstract

[This corrects the article DOI: 10.1371/journal.pone.0187168.].

Journal Article 2018-01-05 ✓ 1 Snippet Bin L, Deng L, Yang H, Zhu L, Wang X, Edwards MG, Richers B, Leung DYM.
In-Text Gene Mentions

…Correction:Forkhead Box C1Box C1 Regulates…

Show Full Abstract

[This corrects the article DOI: 10.1371/journal.pone.0167392.].

Also flagged:ironmetabolismGaucher diseaseglucocerebrosidaseglucosylceramidelipid
Journal Article 2018-01-05 ✓ 2 Snippets Lefebvre T, Reihani N, Daher R, de Villemeur TB, Belmatoug N, Rose C, Colin-Aronovicz Y, Puy H, Le Van Kim C, Franco M, Karim Z.
In-Text Gene Mentions

…complex of integralhemochromatosisproteins, i.e. HFE,…

…hemochromatosis proteins, i.e.HFE, HJV (hemojuvelin) and…

Show Full Abstract

Gaucher disease (GD) is an inherited deficiency of glucocerebrosidase leading to accumulation of glucosylceramide in tissues such as the spleen, liver, and bone marrow. The resulting lipid-laden macrophages lead to the appearance of "Gaucher cells". Anemia associated with an unexplained hyperferritinemia is a frequent finding in GD, but whether this pathogenesis is related to an iron metabolism disorder has remained unclear. To investigate this issue, we explored the iron status of a large cohort of 90 type I GD patients, including 66 patients treated with enzyme replacement therapy. Ten of the patients treated with enzyme replacement were followed up before and during treatment. Serum levels of hepcidin, the iron regulatory peptide, remained within the physiological range, while the transferrin saturation was slightly decreased in children. Inflammation-independent hyperferritinemia was found in 65% of the patients, and Perl's staining of the spleen and marrow smear revealed iron accumulation in Gaucher cells. Treated patients exhibited reduced hyperferritinemia, increased transferrin saturation and transiently increased systemic hepcidin. In addition, the hepcidin and ferritin correlation was markedly improved, and, in most patients, the hemoglobin level was normalized. To further explore eventual iron sequestration in macrophages, we produce a Gaucher cells model by treating the J774 macrophage cell line with a glucocerebrosidase inhibitor and showed induced local hepcidin and membrane retrieval of the iron exporter, ferroportin. These data reveal the involvement of Gaucher cells in abnormal iron sequestration, which may explain the mechanism of hyperferritinemia in GD patients. Local hepcidin-ferroportin interaction was involved in this pathogenesis.

Also flagged:DocetaxelCyclopaminePancreatic CancerhedgehogHhCYP
Journal Article 2018-01-05 No Snippets Almawash SA, Mondal G, Mahato RI.
Show Full Abstract

<h4>Purpose</h4>The aim of this study was to determine whether co-administration of hedgehog (Hh) pathway inhibitor cyclopamine (CYP) and microtubule stabilizer docetaxel (DTX) as polymer-drug conjugates, methoxy poly(ethylene glycol)-block-poly(2-methyl-2-carboxyl-propylenecarbonate-graft-dodecanol-graft-cyclopamine) (P-CYP) and methoxy poly(ethylene glycol)-block-poly(2-methyl-2-carboxyl-propylene carbonate-graft-dodecanol-graft-docetaxel) (P-DTX) could synergistically inhibit orthotopic pancreatic tumor growth in NSG mice.<h4>Methods</h4>P-DTX and P-CYP were synthesized from mPEG-b-PCC through carbodiimide coupling reaction and characterized by <sup>1</sup>H-NMR. The micelles were prepared by film hydration and particle size was measured by dynamic light scattering (DLS). Cytotoxicity, apoptosis and cell cycle analysis of P-DTX and P-CYP were evaluated in MIA PaCa-2 cells. In vivo efficacy of P-DTX and P-CYP were evaluated in NSG mice bearing MIA PaCa-2 cells derived orthotopic pancreatic tumor.<h4>Results</h4>P-CYP and P-DTX self-assembled into micelles of <90 nm and their combination therapy efficiently inhibited the proliferation of MIA PaCa-2 cells, induced apoptosis and cell cycle arrest at M-phase more efficiently than P-CYP and P-DTX monotherapies. Furthermore, the combination therapy of P-CYP and P-DTX significantly reduced Hh component expression compared to P-CYP alone as determined by Western blot analysis. Lastly, the combination therapy induced greater inhibition of orthotopic pancreatic tumor growth in NSG mice compared to their monotherapies.<h4>Conclusion</h4>Combination of polymer conjugated anticancer drug (P-DTX) with polymer conjugated Hh inhibitor (P-CYP) enhanced pancreatic cancer cell killing, apoptosis as well as in vivo tumor growth inhibition with no obvious toxicities.

Also flagged:liver diseaseGene Expressionfibroblast growth factor 2FGF2bone morphogenetic protein 2BMP2
Journal Article 2018-01-05 No Snippets Lin R, Wang Y, Ji K, Liu Z, Xiao S, Zhou D, Chen Q, Shi B.
Show Full Abstract

Due to the lack of potential organs, hepatocellular transplantation has been considered for treating end-stage liver disease. Induced pluripotent stem cells (iPSCs) are reverted from somatic cells and are able to differentiate into hepatocytes. The present study aimed to investigate the mechanisms underlying iPSC differentiation to hepatocytes. GSE66076 was downloaded from the Gene Expression Omnibus; this database includes data from 3 undifferentiated (T0), 3 definitive endoderm (T5), and 3 early hepatocyte (T24) samples across hepatic‑directed differentiation of iPSCs. Differentially expressed genes (DEGs) between T0 and T5 or T24 samples were identified using the linear models for microarray data package in Bioconductor, and enrichment analyses were performed. Using the weighted correlation network analysis package in R, clusters were identified for the merged DEGs. Cytoscape was used to construct protein‑protein interaction (PPI) networks for DEGs identified to belong to significant clusters. Using the ReactomeFI plugin in Cytoscape, functional interaction (FI) networks were constructed for the common genes. A total of 433 and 1,342 DEGs were identified in the T5 and T24 samples respectively, compared with the T0 samples. Blue and turquoise clusters were identified as significant gene clusters. In the PPI network for DEGs in the blue cluster, the key node fibroblast growth factor 2 (FGF2) could interact with bone morphogenetic protein 2 (BMP2). Cyclin‑dependent kinase 1 (CDK1) was demonstrated to have the highest degree (degree=71) in the PPI network for DEGs in the turquoise cluster. Enrichment analysis for the common genes, including hepatocyte nuclear factor 4α (HNF4A) and epidermal growth factor (EGF), in the FI network indicated that EGF and FGF2 were enriched in the Ras and Rap1 signaling pathways. The present results suggest that FGF2, BMP2, CDK1, HNF4A and EGF may participate in the differentiation of iPSCs into hepatocytes.

Also flagged:immune responsecancerrheumatoid arthritisImmunityArthritisgene expression
Journal Article 2018-01-05 No Snippets Alivernini S, Gremese E, McSharry C, Tolusso B, Ferraccioli G, McInnes IB, Kurowska-Stolarska M.
Show Full Abstract

MicroRNAs (miRNAs) are small non-coding RNAs that fine-tune the cell response to a changing environment by modulating the cell transcriptome. miR-155 is a multifunctional miRNA enriched in cells of the immune system and is indispensable for the immune response. However, when deregulated, miR-155 contributes to the development of chronic inflammation, autoimmunity, cancer, and fibrosis. Herein, we review the evidence for the pathogenic role of miR-155 in driving aberrant activation of the immune system in rheumatoid arthritis, and its potential as a disease biomarker and therapeutic target.

Also flagged:wound infectionssepticemiachromosomevibriosiswatergastroenteritis
Journal Article 2018-01-05 ✓ 1 Snippet Roig FJ, González-Candelas F, Sanjuán E, Fouz B, Feil EJ, Llorens C, Baker-Austin C, Oliver JD, Danin-Poleg Y, Gibas CJ, Kashi Y, Gulig PA, Morrison SS, Amaro C.
In-Text Gene Mentions

…multiple pathologies (e.g.,hemochromatosis, diabetes, cirrhosis, and…

Show Full Abstract

<i>Vibrio vulnificus</i> (Vv) is a multi-host pathogenic species currently subdivided into three biotypes (Bts). The three Bts are human-pathogens, but only Bt2 is also a fish-pathogen, an ability that is conferred by a transferable virulence-plasmid (pVvbt2). Here we present a phylogenomic analysis from the core genome of 80 Vv strains belonging to the three Bts recovered from a wide range of geographical and ecological sources. We have identified five well-supported phylogenetic groups or lineages (L). L1 comprises a mixture of clinical and environmental Bt1 strains, most of them involved in human clinical cases related to raw seafood ingestion. L2 is formed by a mixture of Bt1 and Bt2 strains from various sources, including diseased fish, and is related to the aquaculture industry. L3 is also linked to the aquaculture industry and includes Bt3 strains exclusively, mostly related to wound infections or secondary septicemia after farmed-fish handling. Lastly, L4 and L5 include a few strains of Bt1 associated with specific geographical areas. The phylogenetic trees for ChrI and II are not congruent to one another, which suggests that inter- and/or intra-chromosomal rearrangements have been produced along Vv evolution. Further, the phylogenetic trees for each chromosome and the virulence plasmid were also not congruent, which also suggests that pVvbt2 has been acquired independently by different clones, probably in fish farms. From all these clones, the one with zoonotic capabilities (Bt2-Serovar E) has successfully spread worldwide. Based on these results, we propose a new updated classification of the species based on phylogenetic lineages rather than on Bts, as well as the inclusion of all Bt2 strains in a pathovar with the particular ability to cause fish vibriosis, for which we suggest the name "piscis."

Also flagged:cholesterolapolipoprotein(apo) A-IapoA-Iglucoseamino acid
Journal Article 2018-01-04 ✓ 1 Snippet Rebholz SL, Melchior JT, Davidson WS, Jones HN, Welge JA, Prentice AM, Moore SE, Woollett LA.
In-Text Gene Mentions

antithrombin-III

Show Full Abstract

Studies in humans have shown a direct association between maternal plasma cholesterol concentrations and infant birthweight. Similarly, previous studies in our laboratory have shown that chow-fed mice lacking apolipoprotein (apo) A-I, the major protein in HDL, have low HDL-cholesterol (HDL-C) concentrations and smaller fetuses in midgestation. In the current study, we measured fetal weights in mice with varying levels of apoA-I gene dose (knockout, wild-type, and transgenic) and examined metabolic pathways known to affect fetal growth. As expected, we found the differences in apoA-I expression led to changes in HDL particle size and protein cargo as well as plasma cholesterol concentrations. Fetal masses correlated directly with maternal plasma cholesterol and apoA-I concentrations, but placental masses and histology did not differ between groups of mice. There was no significant difference in glucose or amino acid transport to the fetus or in expression levels of the glucose (glucose transporter 1 and 2) or amino acid (sodium-coupled neutral amino acid transporter 1 and 2) transporters in whole placentas, although there was a trend for greater uptake of both nutrients in the whole fetal unit (fetus + placenta) of mice with greater apoA-I levels; significant differences in transport rates occurred when mice without apoA-I (knockout) vs. mice with apoA-I (wild-type and transgenic) were compared. Glucose tolerance tests were improved in the mice with the highest level of apoA-I, suggesting increased insulin-induced uptake of glucose by tissues of apoA-I transgenic mice. Thus, maternal HDL is associated with fetal growth, an effect that is likely mediated by plasma cholesterol or other HDL-cargo, including apolipoproteins or complement system proteins. A direct role of enhanced glucose and/or amino acid transport cannot be excluded.-Rebholz, S. L., Melchior, J. T., Davidson, W. S., Jones, H. N., Welge, J. A., Prentice, A. M., Moore, S. E., Woollett, L. A. Studies in genetically modified mice implicate maternal HDL as a mediator of fetal growth.

Also flagged:ChromosomeAac11CG8213Orc1chromosomal regions
Journal Article 2018-01-04 No Snippets Kahsai L, Cook KR.
Show Full Abstract

Hundreds of <i>Drosophila melanogaster</i> stocks are currently maintained at the Bloomington <i>Drosophila</i> Stock Center with mutations that have not been associated with sequence-defined genes. They have been preserved because they have interesting loss-of-function phenotypes. The experimental value of these mutations would be increased by tying them to specific genomic intervals so that geneticists can more easily associate them with annotated genes. Here, we report the mapping of 85 second chromosome complementation groups in the Bloomington collection to specific, small clusters of contiguous genes or individual genes in the sequenced genome. This information should prove valuable to <i>Drosophila</i> geneticists interested in processes associated with particular phenotypes and those searching for mutations affecting specific sequence-defined genes.

Also flagged:Obesitycardiovascular diseasetype-2 diabetessugarglucosetriglyceride
Journal Article 2018-01-04 ✓ 4 Snippets Hemphill W, Rivera O, Talbert M.
In-Text Gene Mentions

Several genes upregulated in both obesogenic diet groups (Dpt, PGRP-SC2, and Pebp1) have functions relating to immunity or response to infection (Bischoff et al. 2006; Lemaitre et al. 1997; Wicker et al. 1990; Cronin et al. 2009; Reumer et al. 2009).

Pebp1 binds phosphatidylethanolamine, and overexpression of this gene is associated with protection against both gram-positive and gram-negative bacterial infection in the fly via release of various immunity-related proteins into their hemolymph (Reumer et al. 2009).

…Dpt, PGRP-SC2, andPebp1) have functions…

Pebp1binds phosphatidylethanolamine…

Show Full Abstract

Obesity has been shown to increase risk for cardiovascular disease and type-2 diabetes. In addition, it has been implicated in aggravation of neurological conditions such as Alzheimer's. In the model organism <i>Drosophila melanogaster</i>, a physiological state mimicking diet-induced obesity can be induced by subjecting fruit flies to a solid medium disproportionately higher in sugar than protein, or that has been supplemented with a rich source of saturated fat. These flies can exhibit increased circulating glucose levels, increased triglyceride content, insulin-like peptide resistance, and behavior indicative of neurological decline. We subjected flies to variants of the high-sugar diet, high-fat diet, or normal (control) diet, followed by a total RNA extraction from fly heads of each diet group for the purpose of Poly-A selected RNA-Sequencing. Our objective was to identify the effects of obesogenic diets on transcriptome patterns, how they differed between obesogenic diets, and identify genes that may relate to pathogenesis accompanying an obesity-like state. Gene ontology analysis indicated an overrepresentation of affected genes associated with immunity, metabolism, and hemocyanin in the high-fat diet group, and CHK, cell cycle activity, and DNA binding and transcription in the high-sugar diet group. Our results also indicate differences in the effects of the high-fat diet and high-sugar diet on expression profiles in head tissue of flies, despite the reportedly similar phenotypic impacts of the diets. The impacted genes, and how they may relate to pathogenesis in the <i>Drosophila</i> obesity-like state, warrant further experimental investigation.

Also flagged:ALKCrizotinibanaplastic lymphoma kinasenon-small-cell lung cancerNSCLCtumors
Journal Article 2018-01-04 ✓ 1 Snippet Wei J, van der Wekken AJ, Saber A, Terpstra MM, Schuuring E, Timens W, Hiltermann TJN, Groen HJM, van den Berg A, Kok K.
In-Text Gene Mentions

…( ITGAM ,CACNA1E, and RUVBL1 ).…

Show Full Abstract

Crizotinib is an effective drug for patients with anaplastic lymphoma kinase (ALK)-positive non-small-cell lung cancer (NSCLC), but upon treatment, the tumors inevitably become crizotinib resistant in time. The resistance mechanisms are only partly understood. In this study, we aim to identify gene mutations associated with resistance in ALKpositive advanced non-squamous NSCLC treated with crizotinib. Four ALK positive patients with progressive disease following crizotinib treatment were identified with paired pre- and post-crizotinib tumor tissue from our previously published cohort. Somatic variants in these samples were detected by whole exome sequencing. In one of the four patients, an ALK-resistance associated mutation was identified. In the other three patients, no ALK-resistance associated mutations were present. In these patients we identified 89 relevant somatic mutations in 74 genes that were specific to the resistant tumors. These genes were enriched in 15 pathways. Four pathways, were related to epithelial-mesenchymal transition (EMT): proteoglycans in cancer, HIF-1 signaling, FoxO signaling pathway, and ECM-receptor interaction. Analysis of other EMT-related pathways revealed three additional genes with mutations specific to the crizotinib-resistant tumor samples. The enrichment of mutations in genes associated with EMT-related pathways indicates that loss of epithelial differentiation may represent a relevant resistance mechanism for crizotinib.

Also flagged:Methotrexatefolic acidbreast cancerfolate receptorsdiethyl esterbreast carcinoma
Journal Article 2018-01-04 No Snippets de Oliveira CP, Büttenbender SL, Prado WA, Beckenkamp A, Asbahr AC, Buffon A, Guterres SS, Pohlmann AR.
Show Full Abstract

Methotrexate is a folic acid antagonist and its incorporation into nanoformulations is a promising strategy to increase the drug antiproliferative effect on human breast cancer cells by overexpressing folate receptors. To evaluate the efficiency and selectivity of nanoformulations containing methotrexate and its diethyl ester derivative, using two mechanisms of drug incorporation (encapsulation and surface functionalization) in the in vitro cellular uptake and antiproliferative activity in non-tumoral immortalized human keratinocytes (HaCaT) and in human breast carcinoma cells (MCF-7). Methotrexate and its diethyl ester derivative were incorporated into multiwall lipid-core nanocapsules with hydrodynamic diameters lower than 160 nm and higher drug incorporation efficiency. The nanoformulations were applied to semiconfluent HaCaT or MCF-7 cells. After 24 h, the nanocapsules were internalized into HaCaT and MCF-7 cells; however, no significant difference was observed between the nanoformulations in HaCaT (low expression of folate receptors), while they showed significantly higher cellular uptakes than the blank-nanoformulation in MCF-7, which was the highest uptakes observed for the drug functionalized-nanocapsules. No antiproliferative activity was observed in HaCaT culture, whereas drug-containing nanoformulations showed antiproliferative activity against MCF-7 cells. The effect was higher for drug-surface functionalized nanocapsules. In conclusion, methotrexate-functionalized-nanocapsules showed enhanced and selective antiproliferative activity to human breast cancer cells (MCF-7) being promising products for further in vivo pre-clinical evaluations.

Also flagged:proteoglycanbindingProteoglycansMultiple SclerosisMSimmune response
Journal Article 2018-01-04 ✓ 1 Snippet Warford JR, Lamport AC, Clements DR, Malone A, Kennedy BE, Kim Y, Gujar SA, Hoskin DW, Easton AS.
In-Text Gene Mentions

…1640 medium (RPMI),heparinase-III, ionomycin, bacterial lipopol…

Show Full Abstract

Proteoglycans are promising therapeutic targets in Multiple Sclerosis (MS), because they regulate many aspects of the immune response. This was studied using surfen, an agent that binds both heparan sulphate proteoglycans (HSPGs) and chondroitin sulphate proteoglycans (CSPGs). Initial cell culture work on bone marrow derived macrophages (BMDMs) found that surfen reduced concentrations of the chemokines CCL2, CCL4 and CCL5, with reduced messenger (m)RNA expression for Tumor Necrosis Factor, IL-6, IL-1β and inducible nitric oxide synthase. These data were further explored using Experimental Autoimmune Encephalomyelitis (EAE) in mice. Surfen reduced clinical signs during EAE when administered from disease onset, and reduced infiltration by CD4 positive T cells and macrophages into the central nervous system. These mice also showed reduced mRNA expression for the chemokines CCL3 and CCL5, with reduced concentrations of CCL2, CCL3 and CCL5. During EAE, surfen treatment induced a persistent increase in Interleukin (IL)-4 concentrations which may enhance T helper 2 responses. During EAE, surfen treatment reduced mRNA expression for HSPGs (NDST1, agrin, syndecan-4, perlecan, serglycin, syndecan-1) and the CSPG versican. By contrast, surfen increased mRNA expression for the CSPG aggrecan, with no effect on neurocan. During EAE, significant positive correlations were found between mRNA expression and clinical score for syndecan-4, serglycin and syndecan-1 and a significant negative correlation for aggrecan. These correlations were absent in surfen treated mice. Repair in the later stages of MS involves remyelination, which was modeled by injecting lysolecithin (lysophosphatidylcholine, LPC) into mouse corpus callosum to create regions of demyelination. When surfen was injected 2 days after LPC, it delayed remyelination of the lesions, but had no effect when injected 7 days after LPC. The delayed remyelination was associated with local increases in CSPG expression. Therefore surfen suppresses inflammation but inhibits remyelination in these models. A mechanism in common may be increased CSPG expression.

Also flagged:corticosteroidasthmacorticosteroidssteroidnitric oxidegene expression
Journal Article 2018-01-04 No Snippets Hanratty CE, Matthews JG, Arron JR, Choy DF, Pavord ID, Bradding P, Brightling CE, Chaudhuri R, Cowan DC, Djukanovic R, Gallagher N, Fowler SJ, Hardman TC, Harrison T, Holweg CT, Howarth PH, Lordan J, Mansur AH, Menzies-Gow A, Mosesova S, Niven RM, Robinson DS, Shaw DE, Walker S, Woodcock A, Heaney LG, RASP-UK (Refractory Asthma Stratification Programme) Consortium.
Show Full Abstract

<h4>Background</h4>Patients with difficult-to-control asthma consume 50-60% of healthcare costs attributed to asthma and cost approximately five-times more than patients with mild stable disease. Recent evidence demonstrates that not all patients with asthma have a typical type 2 (T2)-driven eosinophilic inflammation. These asthmatics have been called 'T2-low asthma' and have a minimal response to corticosteroid therapy. Adjustment of corticosteroid treatment using sputum eosinophil counts from induced sputum has demonstrated reduced severe exacerbation rates and optimized corticosteroid dose. However, it has been challenging to move induced sputum into the clinical setting. There is therefore a need to examine novel algorithms to target appropriate levels of corticosteroid treatment in difficult asthma, particularly in T2-low asthmatics. This study examines whether a composite non-invasive biomarker algorithm predicts exacerbation risk in patients with asthma on high-dose inhaled corticosteroids (ICS) (± long-acting beta agonist) treatment, and evaluates the utility of this composite score to facilitate personalized biomarker-specific titration of corticosteroid therapy.<h4>Methods/design</h4>Patients recruited to this pragmatic, multi-centre, single-blinded randomised controlled trial are randomly allocated into either a biomarker controlled treatment advisory algorithm or usual care group in a ratio of 4:1. The primary outcome measure is the proportion of patients with any reduction in ICS or oral corticosteroid dose from baseline to week 48. Secondary outcomes include the rate of protocol-defined severe exacerbations per patient per year, time to first severe exacerbation from randomisation, dose of inhaled steroid at the end of the study, cumulative dose of inhaled corticosteroid during the study, proportion of patients on oral corticosteroids at the end of the study, proportion of patients who decline to progress to oral corticosteroids despite composite biomarker score of 2, frequency of hospital admission for asthma, change in the 7-item Asthma Control Questionnaire (ACQ-7), Asthma Quality of Life Questionnaire (AQLQ), forced expiratory volume in 1 s (FEV1), exhaled nitric oxide, blood eosinophil count, and periostin levels from baseline to week 48. Blood will also be taken for whole blood gene expression; serum, plasma, and urine will be stored for validation of additional biomarkers.<h4>Discussion</h4>Multi-centre trials present numerous logistical issues that have been addressed to ensure minimal bias and robustness of study conduct.<h4>Trial registration</h4>ClinicalTrials.gov, NCT02717689 . Registered on 16 March 2016.

Also flagged:haemochromatosisalpha-thalassaemiairon-deficiency anaemiaironanaemiahereditary haemochromatosis
Journal Article 2018-01-04 ✓ 1 Snippet Al Qasem MA, Hanna F, Vithanarachchi US, Khalafallah AA.
In-Text Gene Mentions

HFE

Show Full Abstract

A Caucasian 24-year-old female patient suffers from two hereditary disorders: alpha-thalassaemia, which is prevalent in Asia and rare in Europe, and haemochromatosis, which is prevalent among northern Europe and rare in Asia. The clinical presentation and management of one of these diseases is controversial for the other. She presented 5 years ago with a clinical picture of refractory iron-deficiency anaemia secondary to menorrhagia. On treating her with the standard iron therapy, her anaemia persists although with adquate iron stores. This prompted further investigations that revealed in addition to hereditary haemochromatosis, alpha-thalassaemia because of abnormal blood indices. The treatment of thalassaemia with either iron or blood transfusion is not advisable in haemochromatosis, while standard treatment of haemochromatosis with venesection will worsen the anaemia. As iron chelating agents were not approved in Australia for haemochromatosis, haematinics support was commenced with a satisfactory improvement of anaemia thus allowing for further venesection.

Also flagged:Breast TumorsDuctal carcinoma in situDCISbreast cancerinvasive ductal carcinomatumor
Journal Article 2018-01-04 ✓ 1 Snippet Casasent AK, Schalck A, Gao R, Sei E, Long A, Pangburn W, Casasent T, Meric-Bernstam F, Edgerton ME, Navin NE.
In-Text Gene Mentions

PCDH17

Show Full Abstract

Ductal carcinoma in situ (DCIS) is an early-stage breast cancer that infrequently progresses to invasive ductal carcinoma (IDC). Genomic evolution has been difficult to delineate during invasion due to intratumor heterogeneity and the low number of tumor cells in the ducts. To overcome these challenges, we developed Topographic Single Cell Sequencing (TSCS) to measure genomic copy number profiles of single tumor cells while preserving their spatial context in tissue sections. We applied TSCS to 1,293 single cells from 10 synchronous patients with both DCIS and IDC regions in addition to exome sequencing. Our data reveal a direct genomic lineage between in situ and invasive tumor subpopulations and further show that most mutations and copy number aberrations evolved within the ducts prior to invasion. These results support a multiclonal invasion model, in which one or more clones escape the ducts and migrate into the adjacent tissues to establish the invasive carcinomas.

Also flagged:Chromatinneuropsychiatric diseasesneurogenesisgene expressionneuropsychiatric diseaseFGFR2
Journal Article 2018-01-04 ✓ 1 Snippet de la Torre-Ubieta L, Stein JL, Won H, Opland CK, Liang D, Lu D, Geschwind DH.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Non-coding regions comprise most of the human genome and harbor a significant fraction of risk alleles for neuropsychiatric diseases, yet their functions remain poorly defined. We created a high-resolution map of non-coding elements involved in human cortical neurogenesis by contrasting chromatin accessibility and gene expression in the germinal zone and cortical plate of the developing cerebral cortex. We link distal regulatory elements (DREs) to their cognate gene(s) together with chromatin interaction data and show that target genes of human-gained enhancers (HGEs) regulate cortical neurogenesis and are enriched in outer radial glia, a cell type linked to human cortical evolution. We experimentally validate the regulatory effects of predicted enhancers for FGFR2 and EOMES. We observe that common genetic variants associated with educational attainment, risk for neuropsychiatric disease, and intracranial volume are enriched within regulatory elements involved in cortical neurogenesis, demonstrating the importance of this early developmental process for adult human cognitive function.

Also flagged:Alcoholic hepatitisnon-alcoholic steatohepatitisNASHobesitytype 2 diabeteshypertriglyceridemia
Journal Article 2018-01-04 No Snippets Nguyen L, Masouminia M, Mendoza A, Samadzadeh S, Tillman B, Morgan T, French B, French S.
Show Full Abstract

Non-alcoholic steatohepatitis (NASH) is commonly associated with obesity, type 2 diabetes, and/or hypertriglyceridemia, while alcoholic steatohepatitis (ASH) is associated with alcohol abuse. Both NASH and ASH patients can develop cirrhosis and hepatocellular carcinoma (HCC) if left untreated. However, the rate of tumorigenesis in NASH and ASH appears to be different. Individuals with NASH progress to HCC at a rate of 0.5% annually (Lindenmeyer and McCullough, 2018), when individuals with ASH progress to HCC at a rate of 3-10% annually (Schwartz and Reinus, 2012). Thus, the objective of our study is to determine if there are differences in NASH versus ASH in the levels of different proteins expressed involved in cancer development. The method used was measuring the proteins expressed in liver biopsied sections from NASH and ASH patients using immunohistochemical staining with fluorescent antibodies and then quantitating the fluorescence intensity morphometrically. The 20 proteins tested are parts of the Ingenuity Canonical Pathway of Molecular Mechanisms of Cancer and include: RAP2B, NAIP, FYN, PAK6, SUV39H1, GNAI1, BAX, E2F3, CKDN2B, BAK1, BCL2, DIABLO, RASGRF2, GNA15, PIK3CB, BRCA1, MAP2K1, BIRC3, CDK2, and ATM. In ASH, the proteins that showed upregulated levels of expression were SUV39H1, E2F3, BCL2, BAK1, BIRC3, and GNAI1. In NASH, the proteins that showed upregulated levels of expression were BAK1 and GNAI1 and the protein that showed downregulated level of expression was BCL2. Additionally, levels of expression for SUV39H1, E2F3, BCL2, BAK1, BIRC3, and GNAI1 were significant upregulated in ASH compared to NASH. These results showed significant differences in ASH compared to normal liver, and significant differences in ASH compared to NASH. Thus, we conclude that there are more proteins involved in tumorigenesis in ASH compared to NASH and in ASH compared to normal liver, which is consistent with the known tumor development rate in ASH and NASH.

Also flagged:ironiron oxideIron oxide nanoparticlesoxygenmitochondrialbinding
Journal Article 2018-01-04 ✓ 1 Snippet Lu X, Ma Y, Chang EY, He Q, Searleman A, von Drygalski A, Du J.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Purpose</h4>To evaluate the echo dependence of 3D ultrashort echo time (TE) quantitative susceptibility mapping (3D UTE-QSM) and effective transverse relaxation rate ( R2*) measurement in the setting of high concentrations of iron oxide nanoparticles.<h4>Methods</h4>A phantom study with iron concentrations ranging from 2 to 22 mM was performed using a 3D UTE Cones sequence. Simultaneous QSM processing with morphology-enabled dipole inversion (MEDI) and R2* single exponential fitting was conducted offline with the acquired 3D UTE data. The dependence of UTE-QSM and R2* on echo spacing (ΔTE) and first TE (TE<sub>1</sub> ) was investigated.<h4>Results</h4>A linear relationship was observed between UTE-QSM measurement and iron concentration up to 22 mM only, with the minimal TE<sub>1</sub> of 0.032 ms and ΔTE of less than 0.1 ms. A linear relationship was observed between R2* and iron concentration up to 22 mM only when TE<sub>1</sub> was less than 0.132 ms and ΔTE was less than 1.2 ms. UTE-QSM with MEDI processing showed strong dependence on ΔTE and TE<sub>1</sub> , especially at high iron concentrations.<h4>Conclusion</h4>UTE-QSM is more sensitive than R2* measurement to TE selection. Both an ultrashort TE<sub>1</sub> and a small ΔTE are needed to achieve accurate QSM for high iron concentrations. Magn Reson Med 79:2315-2322, 2018. © 2018 International Society for Magnetic Resonance in Medicine.

Also flagged:extracellulartransductionneuron differentiation-glycocalyxmembrane
Journal Article 2018-01-04 ✓ 1 Snippet Maffioli E, Schulte C, Nonnis S, Grassi Scalvini F, Piazzoni C, Lenardi C, Negri A, Milani P, Tedeschi G.
In-Text Gene Mentions

12-hydroxyeicosatetraenoic acid, ADGRB2, AMT, ATP6V1A, C1QBP, Ca2+, CHAT, CNBP, CYP2D6, DLD, EGF, FAM136A, FFAR4, GCSH, GPX3, growth factor receptor, Hmgb2 (includes others), HNF4A, HTT, ILK, MGST3, MYC, Nefm, Neurotrophin, Ntrk1 dimer, PNPLA6, potassium channel, quinolinic acid, S1PR2, SCG2,SHC1, SLC24A3, sn-glycero-3-phosphocholine, TUBAL3, VGF

Show Full Abstract

Neuronal cells are competent in precisely sensing nanotopographical features of their microenvironment. The perceived microenvironmental information will be "interpreted" by mechanotransductive processes and impacts on neuronal functioning and differentiation. Attempts to influence neuronal differentiation by engineering substrates that mimic appropriate extracellular matrix (ECM) topographies are hampered by the fact that profound details of mechanosensing/-transduction complexity remain elusive. Introducing omics methods into these biomaterial approaches has the potential to provide a deeper insight into the molecular processes and signaling cascades underlying mechanosensing/-transduction but their exigence in cellular material is often opposed by technical limitations of major substrate top-down fabrication methods. Supersonic cluster beam deposition (SCBD) allows instead the bottom-up fabrication of nanostructured substrates over large areas characterized by a quantitatively controllable ECM-like nanoroughness that has been recently shown to foster neuron differentiation and maturation. Exploiting this capacity of SCBD, we challenged mechanosensing/-transduction and differentiative behavior of neuron-like PC12 cells with diverse nanotopographies and/or changes of their biomechanical status, and analyzed their phosphoproteomic profiles in these settings. Versatile proteins that can be associated to significant processes along the mechanotransductive signal sequence, i.e., cell/cell interaction, glycocalyx and ECM, membrane/f-actin linkage and integrin activation, cell/substrate interaction, integrin adhesion complex, actomyosin organization/cellular mechanics, nuclear organization, and transcriptional regulation, were affected. The phosphoproteomic data suggested furthermore an involvement of ILK, mTOR, Wnt, and calcium signaling in these nanotopography- and/or cell mechanics-related processes. Altogether, potential nanotopography-sensitive mechanotransductive signaling hubs participating in neuronal differentiation were dissected.

Also flagged:Aminosugarimmune responseinfectionlipopolysaccharideglycolipidmembrane
Journal Article 2018-01-04 No Snippets Zamyatina A.
Show Full Abstract

The immediate immune response to infection by Gram-negative bacteria depends on the structure of a lipopolysaccharide (LPS, also known as endotoxin), a complex glycolipid constituting the outer leaflet of the bacterial outer membrane. Recognition of picomolar quantities of pathogenic LPS by the germ-line encoded Toll-like Receptor 4 (TLR4) complex triggers the intracellular pro-inflammatory signaling cascade leading to the expression of cytokines, chemokines, prostaglandins and reactive oxygen species which manifest an acute inflammatory response to infection. The "endotoxic principle" of LPS resides in its amphiphilic membrane-bound fragment glycophospholipid lipid A which directly binds to the TLR4·MD-2 receptor complex. The lipid A content of LPS comprises a complex mixture of structural homologs varying in the acylation pattern, the length of the (<i>R</i>)-3-hydroxyacyl- and (<i>R</i>)-3-acyloxyacyl long-chain residues and in the phosphorylation status of the β(1→6)-linked diglucosamine backbone. The structural heterogeneity of the lipid A isolates obtained from bacterial cultures as well as possible contamination with other pro-inflammatory bacterial components makes it difficult to obtain unambiguous immunobiological data correlating specific structural features of lipid A with its endotoxic activity. Advanced understanding of the therapeutic significance of the TLR4-mediated modulation of the innate immune signaling and the central role of lipid A in the recognition of LPS by the innate immune system has led to a demand for well-defined materials for biological studies. Since effective synthetic chemistry is a prerequisite for the availability of homogeneous structurally distinct lipid A, the development of divergent and reproducible approaches for the synthesis of various types of lipid A has become a subject of considerable importance. This review focuses on recent advances in synthetic methodologies toward LPS substructures comprising lipid A and describes the synthesis and immunobiological properties of representative lipid A variants corresponding to different bacterial species. The main criteria for the choice of orthogonal protecting groups for hydroxyl and amino functions of synthetically assembled β(1→6)-linked diglucosamine backbone of lipid A which allows for a stepwise introduction of multiple functional groups into the molecule are discussed. Thorough consideration is also given to the synthesis of 1,1'-glycosyl phosphodiesters comprising partial structures of 4-amino-4-deoxy-β-L-arabinose modified <i>Burkholderia</i> lipid A and galactosamine-modified <i>Francisell</i>a lipid A. Particular emphasis is put on the stereoselective construction of binary glycosyl phosphodiester fragments connecting the anomeric centers of two aminosugars as well as on the advanced P(III)-phosphorus chemistry behind the assembly of zwitterionic double glycosyl phosphodiesters.

Also flagged:PSMAmalignant neoplasms of the thyroidprostate cancerantibodythyroidmalignant tumors
Journal Article 2018-01-04 ✓ 2 Snippets Heitkötter B, Steinestel K, Trautmann M, Grünewald I, Barth P, Gevensleben H, Bögemann M, Wardelmann E, Hartmann W, Rahbar K, Huss S.
In-Text Gene Mentions

(Neo-)vascular PSMA expression in different thyroid cancer subtypes and benign thyroid disease (PTC, papillary thyroid cancer; FTC: follicular thyroid cancer; MTC, medullary thyroid cancer; PDTC, poorly differentiated thyroid cancer; DTC, dedifferentiated (anaplastic) thyroid cancer; SNG, sporadic nodular goiter; FA, follicular adenoma; HTT, hyalinising trabecular thyroid tumor; GD, Grave ́s disease; LT, lymphocytic thyroiditis).

Histograms of malignant tumors and benign thyroid diseases according to their biological potential and PSMA labelling index (PTC, papillary thyroid cancer; FTC: follicular thyroid cancer; MTC, medullary thyroid cancer; PDTC, poorly differentiated thyroid cancer; DTC, dedifferentiated (anaplastic) thyroid cancer; SNG, sporadic nodular goiter; FA, follicular adenoma; HTT, hyalinising trabecular thyroid tumor; INF, inflammatory diseases).

Show Full Abstract

<h4>Aim</h4>PSMA (prostate-specific membrane antigen) is physiologically expressed in normal prostate tissue and over expressed in prostate cancer cells, therefore constituting a potential target for antibody-based radioligand therapy. Very recent imaging findings reported PSMA-PET/CT uptake in various thyroid lesions. We were therefore encouraged to systematically analyse PSMA expression in different benign and malignant thyroid lesions.<h4>Methods</h4>Immunohistochemistry was used to detect PSMA expression in 101 thyroid lesions, while neovasculature was identified by CD34 immunostaining.<h4>Results</h4>PSMA expression in the neovasculature was significantly more frequent in malignant tumors (36/63; 57.1%) compared to benign diseases (5/38; 13.2%; <i>p</i> = 0.0001). In addition, PSMA expression levels in the neovasculature of poorly and undifferentiated thyroid cancers were significantly higher compared to differentiated thyroid tumors (<i>p</i> = 0.021). However, one case with a strong expression in follicular adenoma was identified.<h4>Conclusions</h4>We conclude that neovascular PSMA expression is common in thyroid cancer but may also rarely be found in benign thyroid diseases, such as follicular adenoma. High expression in the tumor-associated neovasculature is predominantly found in poorly differentiated and undifferentiated (anaplastic) thyroid cancer. This knowledge is highly relevant when interpreting PSMA/PET-CT scans from patients with prostate cancer. In addition, our findings might provide a rationale for further evaluation of PSMA-targeted anti-neovascular or radioligand therapy in metastatic dedifferentiated thyroid cancer.

Also flagged:Heme Oxygenases 1Heme oxygenase-1HO-1Hmox1hemebiliverdin
Journal Article 2018-01-03 ✓ 1 Snippet Nowak WN, Taha H, Kachamakova-Trojanowska N, Stępniewski J, Markiewicz JA, Kusienicka A, Szade K, Szade A, Bukowska-Strakova K, Hajduk K, Klóska D, Kopacz A, Grochot-Przęczek A, Barthenheier K, Cauvin C, Dulak J, Józkowicz A.
In-Text Gene Mentions

Prdx6

Show Full Abstract

<h4>Aims</h4>Mesenchymal stromal cells (MSCs) are heterogeneous cells from adult tissues that are able to differentiate in vitro into adipocytes, osteoblasts, or chondrocytes. Such cells are widely studied in regenerative medicine. However, the success of cellular therapy depends on the cell survival. Heme oxygenase-1 (HO-1, encoded by the Hmox1 gene), an enzyme converting heme to biliverdin, carbon monoxide, and Fe<sup>2+</sup>, is cytoprotective and can affect stem cell performance. Therefore, our study aimed at assessing whether Hmox1 is critical for survival and functions of murine bone marrow MSCs.<h4>Results</h4>Both MSC Hmox1<sup>+/+</sup> and Hmox1<sup>-/-</sup> showed similar phenotype, differentiation capacities, and production of cytokines or growth factors. Hmox1<sup>+/+</sup> and Hmox1<sup>-/-</sup> cells showed similar survival in response to 50 μmol/L hemin even in increased glucose concentration, conditions that were unfavorable for Hmox1<sup>-/-</sup> bone marrow-derived proangiogenic cells (BDMC). Hmox1<sup>+/+</sup> MSCs but not fibroblasts retained low ROS levels even after prolonged incubation with 50 μmol/L hemin, although both cell types have a comparable Hmox1 expression and similarly increase its levels in response to hemin. MSCs Hmox1<sup>-/-</sup> treated with hemin efficiently induced expression of a vast panel of antioxidant genes, especially enzymes of the glutathione pathway. Innovation and Conclusion: Hmox1 overexpression is a popular strategy to enhance viability and performance of MSCs after the transplantation. However, murine MSCs Hmox1<sup>-/-</sup> do not differ from wild-type MSCs in phenotype and functions. MSC Hmox1<sup>-/-</sup> show better resistance to hemin than fibroblasts and BDMCs and rapidly react to the stress by upregulation of quintessential genes in antioxidant response. Antioxid. Redox Signal. 00, 000-000.

Also flagged:spinal cord injurycyclic adenosine monophosphaterolipramphosphodiesterase IVdeathinflammatory cytokine
Journal Article 2018-01-03 No Snippets Macks C, Gwak SJ, Lynn M, Lee JS.
Show Full Abstract

Among the complex pathophysiological events following spinal cord injury (SCI), one of the most important molecular level consequences is a dramatic reduction in neuronal cyclic adenosine monophosphate (cAMP) levels. Many studies shown that rolipram (Rm), a phosphodiesterase IV inhibitor, can protect against secondary cell death, reduce inflammatory cytokine levels and immune cell infiltration, and increase white matter sparing and functional improvement. Previously, we developed a polymeric micelle nanoparticle, poly(lactide-co-glycolide)-graft-polyethylenimine (PgP), for combinatorial delivery of therapeutic nucleic acids and drugs for SCI repair. In this study, we evaluated PgP as an Rm delivery carrier for SCI repair. Rolipram's water solubility was increased ∼6.8 times in the presence of PgP, indicating drug solubilization in the micelle hydrophobic core. Using hypoxia as an in vitro SCI model, Rm-loaded PgP (Rm-PgP) restored cAMP levels and increased neuronal cell survival of cerebellar granular neurons. The potential efficacy of Rm-PgP was evaluated in a rat compression SCI model. After intraspinal injection, 1,1'-dioctadecyl-3,3,3',3'-tetramethyl indotricarbocyanine Iodide-loaded PgP micelles were retained at the injection site for up to 5 days. Finally, we show that a single injection of Rm-PgP nanoparticles restored cAMP in the SCI lesion site and reduced apoptosis and the inflammatory response. These results suggest that PgP may offer an efficient and translational approach to delivering Rm as a neuroprotectant following SCI.

Also flagged:reverse transcriptionpolymerasegene expressioncancerdegradationacids
Journal Article 2018-01-03 No Snippets Kim SC, Clark IC, Shahi P, Abate AR.
Show Full Abstract

Droplet microfluidics can identify and sort cells using digital reverse transcription polymerase chain reaction (RT-PCR) signals from individual cells. However, current methods require multiple microfabricated devices for enzymatic cell lysis and PCR reagent addition, making the process complex and prone to failure. Here, we describe a new approach that integrates all components into a single device. The method enables controlled exposure of isolated single cells to a high pH buffer, which lyses cells and inactivates reaction inhibitors but can be instantly neutralized with RT-PCR buffer. Using our chemical lysis approach, we distinguish individual cells' gene expression with data quality equivalent to more complex two-step workflows. Our system accepts cells and produces droplets ready for amplification, making single-cell droplet RT-PCR faster and more reliable.

Also flagged:tumorsgastric cancertumorpathogenesiscancerdeath
Journal Article 2018-01-03 ✓ 2 Snippets Li F, Huang C, Li Q, Wu X.
In-Text Gene Mentions

We found that most of them are tumor-related genes, such as HMGA2, HOXA9, CDK6, EZH2, E2F3, FSCN1, CSE1L, BCL2, CDKN1A, AKAP12, CHL1, KIT, KLF4, EGR1, MXD1, MEIS1, and SOX4, all retrieved from the Onco database (http://www.bushmanlab.org/links/genelists).

…EZH2, E2F3, FSCN1,CSE1L, BCL2, CDKN1A, AKAP12,…

Show Full Abstract

Long non-coding RNA (lncRNA) is a kind of non-coding RNA with transcripts more than 200 bp in length. LncRNA can interact with the miRNA as a competing endogenous RNA (ceRNA) to regulate the expression of target genes, which play a significant role in the initiation and progression of tumors. In this study, we explored the functional roles and regulatory mechanisms of lncRNAs as ceRNAs in gastric cancer, and their potential implications for prognosis. The lncRNAs, miRNAs, and mRNAs expression profiles of 375 gastric cancer tissues and 32 non-tumor gastric tissues were downloaded from The Cancer Genome Atlas (TCGA) database. Differential expression of RNAs was identified using the DESeq package. Survival analysis was estimated based on Kaplan-Meier curve analysis. KEGG pathway analysis was performed using KOBAS 3.0. The dysregulated lncRNA-associated ceRNA network was constructed in gastric cancer based on bioinformatics generated from miRcode and miRTarBase. A total of 237 differentially expressed lncRNAs and 198 miRNAs between gastric cancer and matched normal tissues were screened in our study with thresholds of |log2FC| >2 and adjusted P value <0.01. Eleven discriminatively expressed lncRNAs may be correlated with tumorigenesis of gastric cancer. Seven out of 11 dysregulated lncRNA were found to be significantly associated with overall survival in gastric cancer (P value <0.05). The newly identified ceRNA network includes 11 gastric cancer-specific lncRNAs, 9 miRNAs, and 41 mRNAs. Collectively, our study will contribute to improving the understanding of the lncRNA-associated ceRNA network regulatory mechanisms in the pathogenesis of gastric cancer and provide and identify novel lncRNAs as candidate prognostic biomarkers or potential therapeutic targets.

Also flagged:caffeineneurodegenerative disordercytosineadenineguanineneurodegenerative disorders
Journal Article 2018-01-03 No Snippets Tanner C, Marder K, Eberly S, Biglan K, Oakes D, Shoulson I, Huntington Study Group Prospective Huntington At-Risk Observational Study Investigators.
Show Full Abstract

<h4>Background</h4>In Huntington's disease, 60% of the variance in onset age is not explained by the huntingtin gene mutation. Huntington's disease onset was earlier in caffeine users.<h4>Objective</h4>The objective of this study was to assess the relationship of lifestyle factors with motor phenoconversion among persons at risk for Huntington's disease.<h4>Methods</h4>The associations of motor phenoconversion and exposure to selected lifestyle and health factors were examined using Cox proportional hazards analyses adjusted for age, gender, and repeat length.<h4>Results</h4>Of 247 participants, 36 (14.6%) phenoconverted. Mean follow-up was 4.2 years. Greater caffeinated soda use was associated with an increased hazard of phenoconversion: moderate use hazard ratio 2.26 (95% confidence interval 0.59-8.71), high use hazard ratio 4.05 (95% confidence interval 1.18-13.96).<h4>Conclusions</h4>Huntington's disease onset was earlier among consumers of caffeinated soda, but not other caffeinated beverages. This finding may be spurious or not related to caffeine. © 2018 International Parkinson and Movement Disorder Society.

Also flagged:exonucleasesagingRNA binding proteinssplicing factorsbindingantiviral immunity
Journal Article 2018-01-03 No Snippets Cortés-López M, Gruner MR, Cooper DA, Gruner HN, Voda AI, van der Linden AM, Miura P.
Show Full Abstract

<h4>Background</h4>Circular RNAs (CircRNAs) are a newly appreciated class of RNAs that lack free 5' and 3' ends, are expressed by the thousands in diverse forms of life, and are mostly of enigmatic function. Ostensibly due to their resistance to exonucleases, circRNAs are known to be exceptionally stable. Previous work in Drosophila and mice have shown that circRNAs increase during aging in neural tissues.<h4>Results</h4>Here, we examined the global profile of circRNAs in C. elegans during aging by performing ribo-depleted total RNA-seq from the fourth larval stage (L4) through 10-day old adults. Using stringent bioinformatic criteria and experimental validation, we annotated a high-confidence set of 1166 circRNAs, including 575 newly discovered circRNAs. These circRNAs were derived from 797 genes with diverse functions, including genes involved in the determination of lifespan. A massive accumulation of circRNAs during aging was uncovered. Many hundreds of circRNAs were significantly increased among the aging time-points and increases of select circRNAs by over 40-fold during aging were quantified by RT-qPCR. The expression of 459 circRNAs was determined to be distinct from the expression of linear RNAs from the same host genes, demonstrating host gene independence of circRNA age-accumulation.<h4>Conclusions</h4>We attribute the global scale of circRNA age-accumulation to the high composition of post-mitotic cells in adult C. elegans, coupled with the high resistance of circRNAs to decay. These findings suggest that the exceptional stability of circRNAs might explain age-accumulation trends observed from neural tissues of other organisms, which also have a high composition of post-mitotic cells. Given the suitability of C. elegans for aging research, it is now poised as an excellent model system to determine whether there are functional consequences of circRNA accumulation during aging.

Also flagged:phosphatidylinositide 3-kinasePI3Kzileutonleukotrieneasthmaethanol
Journal Article 2018-01-03 No Snippets Dahlin A, Qiu W, Litonjua AA, Lima JJ, Tamari M, Kubo M, Irvin CG, Peters SP, Wu AC, Weiss ST, Tantisira KG.
Show Full Abstract

Variable responsiveness to zileuton, a leukotriene antagonist used to treat asthma, may be due in part to genetic variation. While individual SNPs were previously associated with zileuton-related lung function changes, specific quantitative trait loci (QTLs) and biological pathways that may contribute have not been identified. In this study, we investigated the hypothesis that genetic variation within biological pathways is associated with zileuton response. We performed an integrative QTL mapping and pathway enrichment study to investigate data from a GWAS of zileuton response, in addition to mRNA expression profiles and leukotriene production data from lymphoblastoid cell lines (LCLs) (derived from asthmatics) that were treated with zileuton or ethanol (control). We identified 1060 QTLs jointly associated with zileuton-related differential LTB<sub>4</sub> production in LCLs and lung function change in patients taking zileuton, of which eight QTLs were also significantly associated with persistent LTB<sub>4</sub> production in LCLs following zileuton treatment (i.e., 'poor' responders). Four nominally significant trans-eQTLs were predicted to regulate three candidate genes (SELL, MTF2, and GAL), the expression of which was significantly reduced in LCLs following zileuton treatment. Gene and pathway enrichment analyses of QTL associations identified multiple genes and pathways, predominantly related to phosphatidyl inositol signaling via PI3K. We validated the PI3K pathway activation status in a subset of LCLs demonstrating variable zileuton-related LTB<sub>4</sub> production, and show that in contrast to LCLs that responded to zileuton, the PI3K pathway was activated in poor responder LCLs. Collectively, these findings demonstrate a role for the PIK3 pathway and its targets as important determinants of differential responsiveness to zileuton.

Also flagged:Osteoporosismetabolism16S rRNApattern recognition receptorsNOD-likeantimicrobial peptides
Journal Article 2018-01-03 ✓ 2 Snippets Quach D, Collins F, Parameswaran N, McCabe L, Britton RA.
In-Text Gene Mentions

…The primer sequences used are as follows: HPRT forward, 5′ GCTATAAATTCTTTGCTGACCTGCT 3′; HPRT reverse, 5′ AATTACTTTTATGTCCCCTGTTGACTG 3′; TNF-α forward, 5′ AGGCTGCCCCGACTACGT 3′; TNF-α reverse, 5′ GACTTTCTCCTGGTATGAGATAGCAA 3′; IL-1 forward, 5′ TCCCCGTCCCTATCGACAAAC 3′; IL-1 reverse, 5′ GCGGTGATGTGGCATTTTCTG 3′; IL-6 forward, 5′ ATCCAGTTGCCTTCTTGGGACTGA 3′; IL-6 reverse, 5′ TAAGCCTCCGACTTGTGAAGTGGT 3′;5-HTTforward, 5′ ATTTCCGTTGGTGTTTCAGG 3′; 5-HTT reverse, 5′ CGTCTGTCATCTGCATCCCT 3′; IFN-γ forward, 5′ GGCTGTCCCTGAAAGAAAGC 3′; IFN-γ reverse, 5′ GAGCGAGTTATTTGTCATTCGG 3′; IL-17 forward, 5′ TGAGCTTCCCAGATCACAGA 3′; IL-17 reverse, 5′ TCCAGAAGGCCCTCAGACTA 3′; IL-10 forward, 5′ GGTTGCCAAGCCTTATCGGA 3′; and IL-10 reverse, 5′ ACCTGCTCCACTGCCTTGCT 3′.…

…The primer sequences used are as follows: HPRT forward, 5′ GCTATAAATTCTTTGCTGACCTGCT 3′; HPRT reverse, 5′ AATTACTTTTATGTCCCCTGTTGACTG 3′; TNF-α forward, 5′ AGGCTGCCCCGACTACGT 3′; TNF-α reverse, 5′ GACTTTCTCCTGGTATGAGATAGCAA 3′; IL-1 forward, 5′ TCCCCGTCCCTATCGACAAAC 3′; IL-1 reverse, 5′ GCGGTGATGTGGCATTTTCTG 3′; IL-6 forward, 5′ ATCCAGTTGCCTTCTTGGGACTGA 3′; IL-6 reverse, 5′ TAAGCCTCCGACTTGTGAAGTGGT 3′; 5-HTT forward, 5′ ATTTCCGTTGGTGTTTCAGG 3′;5-HTTreverse, 5′ CGTCTGTCATCTGCATCCCT 3′; IFN-γ forward, 5′ GGCTGTCCCTGAAAGAAAGC 3′; IFN-γ reverse, 5′ GAGCGAGTTATTTGTCATTCGG 3′; IL-17 forward, 5′ TGAGCTTCCCAGATCACAGA 3′; IL-17 reverse, 5′ TCCAGAAGGCCCTCAGACTA 3′; IL-10 forward, 5′ GGTTGCCAAGCCTTATCGGA 3′; and IL-10 reverse, 5′ ACCTGCTCCACTGCCTTGCT 3′.…

Show Full Abstract

Annually, an estimated 2 million osteoporotic fractures occur in the United States alone. Osteoporosis imparts a great burden on the health care system. The identification of novel regulators of bone health is critical for developing more effective therapeutics. A previous study on the colonization of germ-free (GF) mice with a microbial community has demonstrated that bacterial colonization dramatically increases bone loss. We therefore investigated the impact of multiple microbial communities in different mice to understand how generalizable the impact of bacterial colonization is on bone health. To investigate the impact of different microbial communities on bone health in outbred and inbred mouse strains, gavage was performed on GF Swiss Webster and GF C57BL/6 mice to introduce distinct microbiotas that originated from either humans or mice. GF mice displayed a high degree of colonization, as indicated by more than 90% of the operational taxonomic units present in the starting inoculum being successfully colonized in the mice when they were examined at the end of the experiment. In spite of the successful colonization of GF mice with gut microbiota of either mouse or human origin, bone mass did not change significantly in any of the groups tested. Furthermore, static and dynamic bone parameters and osteoclast precursor and T cell populations, as well as the expression of several inflammatory markers, were mostly unchanged following microbial colonization of GF mice. <b>IMPORTANCE</b> The microbiota has been shown to be an important regulator of health and development. With regard to its effect on bone health, a previous study has suggested that gut microbes negatively impact bone density. However, we show here that this is not generalizable to all microbial communities and mouse strain backgrounds. Our results demonstrate that colonization of mice, both outbred and inbred strains, did not have a major impact on bone health. The identification of microbial communities that do not negatively impact bone health may provide a foundation for future investigations that seek to identify microbes that are either beneficial or detrimental to bone metabolism.

Also flagged:ADtransporterCYPmetabolismlipidcholesterol
Journal Article 2018-01-03 No Snippets Cacabelos R, Meyyazhagan A, Carril JC, Cacabelos P, Teijido Ó.
Show Full Abstract

Alzheimer's disease (AD) is a polygenic/complex disorder in which genomic, epigenomic, cerebrovascular, metabolic, and environmental factors converge to define a progressive neurodegenerative phenotype. Pharmacogenetics is a major determinant of therapeutic outcome in AD. Different categories of genes are potentially involved in the pharmacogenetic network responsible for drug efficacy and safety, including pathogenic, mechanistic, metabolic, transporter, and pleiotropic genes. However, most drugs exert pleiotropic effects that are promiscuously regulated for different gene products. Only 20% of the Caucasian population are extensive metabolizers for tetragenic haplotypes integrating <i>CYP2D6-CYP2C19-CYP2C9-CYP3A4/5</i> variants. Patients harboring CYP-related poor (PM) and/or ultra-rapid (UM) geno-phenotypes display more irregular profiles in drug metabolism than extensive (EM) or intermediate (IM) metabolizers. Among 111 pentagenic (<i>APOE-APOB-APOC3-CETP-LPL</i>) haplotypes associated with lipid metabolism, carriers of the H26 haplotype (23-TT-CG-AG-CC) exhibit the lowest cholesterol levels, and patients with the H104 haplotype (44-CC-CC-AA-CC) are severely hypercholesterolemic. Furthermore, <i>APOE</i>, <i>NOS3</i>, <i>ACE</i>, <i>AGT</i>, and <i>CYP</i> variants influence the therapeutic response to hypotensive drugs in AD patients with hypertension. Consequently, the implementation of pharmacogenetic procedures may optimize therapeutics in AD patients under polypharmacy regimes for the treatment of concomitant vascular disorders.

Also flagged:sleepHDcircadianautonomic nervous system dysfunctiongene expressionHuntingtin
Journal Article 2018-01-03 ✓ 5 Snippets Wang HB, Loh DH, Whittaker DS, Cutler T, Howland D, Colwell CS.
In-Text Gene Mentions

Huntington’s disease (HD) is caused by an expanded CAG repeat within the first exon of the Huntingtin (Htt) gene.

…the Huntingtin (Htt) gene.…

…The mutatedHTTprotein leads to…

…BDNF, CREB1, andHTT.…

…levels of mutantHtt( Table 6…

Show Full Abstract

Huntington's disease (HD) patients suffer from a progressive neurodegeneration that results in cognitive, psychiatric, cardiovascular, and motor dysfunction. Disturbances in sleep/wake cycles are common among HD patients with reports of delayed sleep onset, frequent bedtime awakenings, and fatigue during the day. The heterozygous Q175 mouse model of HD has been shown to phenocopy many HD core symptoms including circadian dysfunctions. Because circadian dysfunction manifests early in the disease in both patients and mouse models, we sought to determine if early intervention that improve circadian rhythmicity can benefit HD and delay disease progression. We determined the effects of time-restricted feeding (TRF) on the Q175 mouse model. At six months of age, the animals were divided into two groups: ad libitum (ad lib) and TRF. The TRF-treated Q175 mice were exposed to a 6-h feeding/18-h fasting regimen that was designed to be aligned with the middle of the time when mice are normally active. After three months of treatment (when mice reached the early disease stage), the TRF-treated Q175 mice showed improvements in their locomotor activity rhythm and sleep awakening time. Furthermore, we found improved heart rate variability (HRV), suggesting that their autonomic nervous system dysfunction was improved. Importantly, treated Q175 mice exhibited improved motor performance compared to untreated Q175 controls, and the motor improvements were correlated with improved circadian output. Finally, we found that the expression of several HD-relevant markers was restored to WT levels in the striatum of the treated mice using NanoString gene expression assays.

Also flagged:nucleotidescancerColorectal cancerpathogenesiscancersdeath
Journal Article 2018-01-03 ✓ 1 Snippet Kim T, Croce CM.
In-Text Gene Mentions

…as Kras, p53,DCCand APC should…

Show Full Abstract

Long noncoding RNAs are non-protein coding transcripts longer than 200 nucleotides in length. By the advance in genetic and bioinformatic technologies, the new genomic landscape including noncoding transcripts has been revealed. Despite their non-capacity to be translated into proteins, lncRNAs have a versatile functions through various mechanisms interacting with other cellular molecules including DNA, protein, and RNA. Recent research interest and endeavor have identified the functional role of lncRNAs in various diseases including cancer. Colorectal cancer (CRC) is not only one of the most frequent cancer but also one of the cancer types with remarkable achievements in lncRNA research. Of the numerous notable lncRNAs identified and characterized in CRC, we will focus on key lncRNAs with the high potential as CRC-specific biomarkers in this review.

Also flagged:contractile proteinpulmonary hypertensionright ventricular hypertrophyventricular septaloxygencalmodulin
Journal Article 2018-01-03 No Snippets Bond AR, Iacobazzi D, Abdul-Ghani S, Ghorbel M, Heesom K, Wilson M, Gillett C, George SJ, Caputo M, Suleiman S, Tulloh RMR.
Show Full Abstract

<h4>Background</h4>The right ventricle (RV) is not designed to sustain high pressure leading to failure. There are no current medications to help RV contraction, so further information is required on adaption of the RV to such hypertension.<h4>Methods</h4>The Right Ventricle in Children (RVENCH) study assessed infants with congenital heart disease undergoing cardiac surgery with hypertensive RV. Clinical and echocardiographic data were recorded, and samples of RV were taken from matched infants, analysed for proteomics and compared between pathologies and with clinical and echocardiographic outcome data.<h4>Results</h4>Those with tetralogy of Fallot (TOF) were significantly more cyanosed than those with ventricular septal defect (median oxygen saturation 83% vs 98%, P=0.0038), had significantly stiffer RV (tricuspid E wave/A wave ratio 1.95 vs 0.84, P=0.009) and had most had restrictive physiology. Gene ontology in TOF, with enrichment analysis, demonstrated significant increase in proteins of contractile mechanisms and those of calmodulin, actin binding and others associated with contractility than inventricular septal defect. Structural proteins were also found to be higher in association with sarcomeric function: Z-disc, M-Band and thin-filament proteins. Remaining proteins associated with actin binding, calcium signalling and myocyte cytoskeletal development. Phosphopeptide enrichment led to higher levels of calcium signalling proteins in TOF.<h4>Conclusion</h4>This is the first demonstration that those with an RV, which is stiff and hypertensive in TOF, have a range of altered proteins, often in calcium signalling pathways. Information about these alterations might guide treatment options both in terms of individualised therapy or inotropic support for the Right ventricle when hypertensive due to pulmoanry hypertension or congenital heart disease.

Also flagged:cellulasefermentationendoglucanasesexoglucanasesβ-glucosidasescellulose
Journal Article 2018-01-03 No Snippets Cardoso WS, Soares FEF, Queiroz PV, Tavares GP, Santos FA, Sufiate BL, Kasuya MCM, de Queiroz JH.
Show Full Abstract

The objective of this work was to optimize the total cellulase activity of the crude extract cocktails from five white rot fungi produced by solid-state fermentation, by means of the central composite design. The white rot fungi <i>Pleurotus ostreatus</i> PLO 06, <i>Pleurotus eryngii</i> PLE 04, <i>Trametes versicolor</i> TRAM 01, <i>Pycnosporus sanguineus</i> PYC 02 and <i>Phanerochaete chrysosporium</i> PC were tested. For optimization process aiming at the maximum value of total cellulase activity (FPAse), the multi-enzyme cellulase complexes (crude extracts) of each fungus were mixed simultaneously in different proportions. There was increase in FPAse activity for the cocktails formed by the extracts of the five fungi together, compared to the extracts of each fungus alone. The model presented the minimum cocktail of enzymes for maximum total cellulase activity, with 100.00 μL PYC; 100.00 μL PC; 100.00 μL PLO06; 100.00 μL PLE04 and 200 μL TRAM01. The maximum value found was of 304.86 U/L. The result of the cocktails was very relevant, showing that there is an enzymatic complementation in the extracts that should be further studied. Concentrated extract cocktails should also be evaluated for biomass saccharification.

Also flagged:Pancreatic ductal adenocarcinomaPDACFAM96ACDH1CDH17TP53
Journal Article 2018-01-03 ✓ 1 Snippet Hu D, Ansari D, Pawłowski K, Zhou Q, Sasor A, Welinder C, Kristl T, Bauden M, Rezeli M, Jiang Y, Marko-Varga G, Andersson R.
In-Text Gene Mentions

…that ECH1, GLUT1,OLFM4and STML2 were…

Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) is a highly aggressive malignancy. Here we show that shotgun and targeted protein sequencing can be used to identify potential prognostic biomarkers in formalin-fixed paraffin-embedded specimens from 9 patients with PDAC with "short" survival (<12 months) and 10 patients with "long" survival (>45 months) undergoing surgical resection. A total of 24 and 147 proteins were significantly upregulated [fold change ≥2 or ≤0.5 and P<0.05; or different detection frequencies (≥5 samples)] in patients with "short" survival (including GLUT1) and "long" survival (including C9orf64, FAM96A, CDH1 and CDH17), respectively. STRING analysis of these proteins indicated a tight protein-protein interaction network centered on TP53. Ingenuity pathway analysis linked proteins representing "activated stroma factors" and "basal tumor factors" to poor prognosis of PDAC. It also highlighted TCF1 and CTNNB1 as possible upstream regulators. Further parallel reaction monitoring verified that seven proteins were upregulated in patients with "short" survival (MMP9, CLIC3, MMP8, PRTN3, P4HA2, THBS1 and FN1), while 18 proteins were upregulated in patients with "long" survival, including EPCAM, LGALS4, VIL1, CLCA1 and TPPP3. Thus, we verified 25 protein biomarker candidates for PDAC prognosis at the tissue level. Furthermore, an activated stroma status and protein-protein interactions with TP53 might be linked to poor prognosis of PDAC.

Also flagged:acute leukemiaCEBPAmyeloid neoplasmsacute myeloid leukemiaAMLCSF3R
Journal Article 2018-01-03 No Snippets Su L, Tan Y, Lin H, Liu X, Yu L, Yang Y, Liu S, Bai O, Yang Y, Jin F, Sun J, Liu C, Liu Q, Gao S, Li W.
Show Full Abstract

The aim of this study was to profile the spectrum of genetic mutations in acute myeloid leukemia (AML) patients co-occurring with <i>CEBPA</i> double mutation (<i>CEBPA</i><sup>dm</sup>). Between January 1, 2012, and June 30, 2017, 553 consecutive patients with <i>de novo</i> AML were screened for <i>CEBPA</i> mutations. Out of these, 81 patients classified as <i>CEBPA</i><sup>dm</sup> were analyzed further by a sensitive next-generation sequencing assay for mutations in 112 candidate genes. Within the <i>CEBPA</i> gene itself, we found 164 mutations. The most common mutated sites were c.936_937insGAG (n = 11/164, 6.71%) and c.939_940insAAG (n = 11/164, 6.71%), followed by c.68dupC (n = 10/164, 6.10%). The most common co-occurring mutations were found in the <i>CSF3R</i> (n = 16/81, 19.75%), <i>WT1</i> (n = 15/81, 18.52%), and <i>GATA2</i> (n = 13/81, 16.05%) genes. Patients with <i>CSF3R</i> mutations had an inferior four-year relapse-free survival (RFS) than those with the wild-type gene (15.3% versus 46.8%, respectively; <i>P</i> = 0.021). Patients with <i>WT1</i> mutations had an inferior five-year RFS compared with those without such mutations (0% versus 26.6%, respectively, <i>P</i> = 0.003). However, <i>GATA2</i>, <i>CSF3R</i>, <i>WT1</i> mutations had no significant influence on the overall survival. There were some differences in the location of mutational hotspots within the <i>CEBPA</i> gene, as well as hotspots of other co-occurring genetic mutations, between AML patients from Chinese and Caucasian populations. Some co-occurring mutations may be potential candidates for refining the prognoses of AML patients with <i>CEBPA</i><sup>dm</sup> in the Chinese population.

Also flagged:hypertensionEssential HypertensionhydrochlorothiazideVerapamilDiltiazem
Journal Article 2018-01-03 No Snippets Eadon MT, Kanuri SH, Chapman AB.
Show Full Abstract

<h4>Introduction</h4>Increasing clinical evidence supports the implementation of genotyping for anti-hypertensive drug dosing and selection. Despite robust evidence gleaned from clinical trials, the translation of genotype guided therapy into clinical practice faces significant challenges. Challenges to implementation include the small effect size of individual variants and the polygenetic nature of antihypertensive drug response, a lack of expert consensus on dosing guidelines even without genetic information, and proper definition of major antihypertensive drug toxicities. Balancing clinical benefit with cost, while overcoming these challenges, remains crucial.<h4>Areas covered</h4>This review presents the most impactful clinical trials and cohorts which continue to inform and guide future investigation. Variants were selected from among those identified in the Pharmacogenomic Evaluation of Antihypertensive Responses (PEAR), the Genetic Epidemiology of Responses to Antihypertensives study (GERA), the Genetics of Drug Responsiveness in Essential Hypertension (GENRES) study, the SOPHIA study, the Milan Hypertension Pharmacogenomics of hydro-chlorothiazide (MIHYPHCTZ), the Campania Salute Network, the International Verapamil SR Trandolapril Study (INVEST), the Nordic Diltiazem (NORDIL) Study, GenHAT, and others.<h4>Expert commentary</h4>The polygenic nature of antihypertensive drug response is a major barrier to clinical implementation. Further studies examining clinical effectiveness are required to support broad-based implementation of genotype-based prescribing in medical practice.

Also flagged:Hyalinizingtrabecular tumorbenign tumor of thethyroid glandpapillary thyroid carcinomatumor
Journal Article 2018-01-03 No Snippets Ergün S, Akıncı O, Öztürk T, Karataş A.
Show Full Abstract

Hyalinizing trabecular tumor was first described by Carney et al. (1) in 1987 and is a rare benign tumor of the thyroid gland that shares some of the microscopic features of medullary and papillary thyroid carcinoma. Hyalinizing trabecular tumor derives from follicular cells, and it is characterized by an apparent trabecular pattern and intratrabecular hyalinization. In this study, we present the case of a 40-year-old female patient with thyroid gland nodules, whose ultrasound results, clinical behavior, and fine-needle aspiration biopsy results were suspicious; the pathology after thyroidectomy indicated hyalinizing trabecular tumor. We aimed to show the role of clinical behavior, radiology, fine-needle aspiration, and histological and immunohistochemical analysis in the differential diagnosis of hyalinizing trabecular tumor. Hyalinizing trabecular tumor which can be confused with papillary and medullar carcinoma of the thyroid gland, is mostly benign but some malignant and metastatic cases have been reported. Therefore, diagnosis, treatment, and follow-up steps of Hyalinizing trabecular tumor should be planned in consideration of a malignant potential.

Also flagged:Peroxiredoxin6PathophysiologyChronic Noncommunicable Diseasesdeathdiabetes mellituscardiovascular diseases
Journal Article 2018-01-02 ✓ 4 Snippets Pacifici F, Della Morte D, Capuani B, Pastore D, Bellia A, Sbraccia P, Di Daniele N, Lauro R, Lauro D.
In-Text Gene Mentions

…Through these activities,Prdx6has been shown…

…diabetes mellitus inPrdx6knockout mice, suggesting…

…pivotal role ofPrdx6in the pathogenesis…

…the role ofPrdx6in NCD prevention…

Show Full Abstract

<h4>Significance</h4>Chronic noncommunicable diseases (NCDs) are the leading causes of disability and death worldwide. NCDs mainly comprise diabetes mellitus, cardiovascular diseases, chronic obstructive pulmonary disease, cancer, and neurological degenerative diseases, which kill more than 80% of population, especially the elderly, worldwide. Recent Advances: Several recent theories established NCDs as multifactorial diseases, where a combination of genetic, epigenetic, and environmental factors contributes to their pathogenesis. Nevertheless, recent findings suggest that the common factor linking all these pathologies is an increase in oxidative stress and the age-related loss of the antioxidant mechanisms of defense against it. Impairment in mitochondrial homeostasis with consequent deregulation in oxidative stress balance has also been suggested.<h4>Critical issues</h4>Therefore, antioxidant proteins deserve particular attention for their potential role against NCDs. In particular, peroxiredoxin(Prdx)6 is a unique antioxidant enzyme, belonging to the Prdx family, with double properties, peroxidase and phospholipase activities. Through these activities, Prdx6 has been shown to be a powerful antioxidant enzyme, implicated in the pathogenesis of different NCDs. Recently, we described a phenotype of diabetes mellitus in Prdx6 knockout mice, suggesting a pivotal role of Prdx6 in the pathogenesis of cardiometabolic diseases.<h4>Future directions</h4>Increasing awareness on the role of antioxidant defenses in the pathogenesis of NCDs may open novel therapeutic approaches to reduce the burden of this pandemic phenomenon. However, knowledge of the role of Prdx6 in NCD prevention and pathogenesis is still not clarified.

Also flagged:chromatin53BP1BRCA1G1 phasecell cycleRIF1
Journal Article 2018-01-02 ✓ 1 Snippet Simonetta M, de Krijger I, Serrat J, Moatti N, Fortunato D, Hoekman L, Bleijerveld OB, Altelaar AFM, Jacobs JJL.
In-Text Gene Mentions

MMS22L

Show Full Abstract

The main pathways for the repair of DNA double strand breaks (DSBs) are non-homologous end-joining (NHEJ) and homologous recombination directed repair (HDR). These operate mutually exclusive and are activated by 53BP1 and BRCA1, respectively. As HDR can only succeed in the presence of an intact copy of replicated DNA, cells employ several mechanisms to inactivate HDR in the G1 phase of cell cycle. As cells enter S-phase, these inhibitory mechanisms are released and HDR becomes active. However, during DNA replication, NHEJ and HDR pathways are both functional and non-replicated and replicated DNA regions co-exist, with the risk of aberrant HDR activity at DSBs in non-replicated DNA. It has become clear that DNA repair pathway choice depends on inhibition of DNA end-resection by 53BP1 and its downstream factors RIF1 and MAD2L2. However, it is unknown how MAD2L2 accumulates at DSBs to participate in DNA repair pathway control and how the NHEJ and HDR repair pathways are appropriately activated at DSBs with respect to the replication status of the DNA, such that NHEJ acts at DSBs in pre-replicative DNA and HDR acts on DSBs in post-replicative DNA. Here we show that MAD2L2 is recruited to DSBs in H4K20 dimethylated chromatin by forming a protein complex with 53BP1 and RIF1 and that MAD2L2, similar to 53BP1 and RIF1, suppresses DSB accumulation of BRCA1. Furthermore, we show that the replication status of the DNA locally ensures the engagement of the correct DNA repair pathway, through epigenetics. In non-replicated DNA, saturating levels of the 53BP1 binding site, di-methylated lysine 20 of histone 4 (H4K20me2), lead to robust 53BP1-RIF1-MAD2L2 recruitment at DSBs, with consequent exclusion of BRCA1. Conversely, replication-associated 2-fold dilution of H4K20me2 promotes the release of the 53BP1-RIF1-MAD2L2 complex and favours the access of BRCA1. Thus, the differential H4K20 methylation status between pre-replicative and post-replicative DNA represents an intrinsic mechanism that locally ensures appropriate recruitment of the 53BP1-RIF1-MAD2L2 complex at DNA DSBs, to engage the correct DNA repair pathway.

Also flagged:serotonin transportercocainesucrose
Journal Article 2018-01-02 ✓ 2 Snippets Karel P, Almacellas-Barbanoj A, Prijn J, Kaag AM, Reneman L, Verheij MMM, Homberg JR.
In-Text Gene Mentions

Here, we set out to investigate the influence of serotonin transporter (5-HTT) genotype on the effectiveness of counter-conditioning after extended access to cocaine self-administration.

…of serotonin transporter (5-HTT) genotype on the…

Show Full Abstract

Counter-conditioning can be a valid strategy to reduce reinstatement of reward-seeking behavior. However, this has not been tested in laboratory animals with extended cocaine-taking backgrounds nor is it well understood, which individual differences may contribute to its effects. Here, we set out to investigate the influence of serotonin transporter (5-HTT) genotype on the effectiveness of counter-conditioning after extended access to cocaine self-administration. To this end, 5-HTT<sup>+/+</sup> and 5-HTT<sup>-/-</sup> rats underwent a touch screen-based approach to test if reward-induced reinstatement of responding to a previously counter-conditioned cue is reduced, compared with a non-counter-conditioned cue, in a within-subject manner. We observed an overall extinction deficit of cocaine-seeking behavior in 5-HTT<sup>-/-</sup> rats and a resistance to punishment during the counter-conditioning session. Furthermore, we observed a significant decrease in reinstatement to cocaine and sucrose associated cues after counter-conditioning but only in 5-HTT<sup>+/+</sup> rats. In short, we conclude that the paradigm we used was able to produce effects of counter-conditioning of sucrose seeking behavior in line with what is described in literature, and we demonstrate that it can be effective even after long-term exposure to cocaine, in a genotype-dependent manner.

Also flagged:Lipidationcysteineglycineserinelysinefatty
Journal Article 2018-01-02 No Snippets Jiang H, Zhang X, Chen X, Aramsangtienchai P, Tong Z, Lin H.
Show Full Abstract

Protein lipidation, including cysteine prenylation, N-terminal glycine myristoylation, cysteine palmitoylation, and serine and lysine fatty acylation, occurs in many proteins in eukaryotic cells and regulates numerous biological pathways, such as membrane trafficking, protein secretion, signal transduction, and apoptosis. We provide a comprehensive review of protein lipidation, including descriptions of proteins known to be modified and the functions of the modifications, the enzymes that control them, and the tools and technologies developed to study them. We also highlight key questions about protein lipidation that remain to be answered, the challenges associated with answering such questions, and possible solutions to overcome these challenges.

Also flagged:Cancercell proliferationprimary tumorsbreast cancerAdherens junctionABCA13
Journal Article 2018-01-02 ✓ 5 Snippets Krøigård AB, Larsen MJ, Lænkholm AV, Knoop AS, Jensen JD, Bak M, Mollenhauer J, Thomassen M, Kruse TA.
In-Text Gene Mentions

Studies in Drosophila have suggested that the DCC gene functions as an invasive tumor suppressor [32,33].

In a murine model of p53 deficient mammary carcinoma cells it has been reported that additional loss of DCC promotes metastasis formation without affecting the primary tumor phenotype [34] suggesting that the gene limits survival of disseminated tumor cells.

…notable are theDCC, ABCA13 ,…

…the ABCA13 ,DCCand TIAM2 genes…

…TheDCCgene, mutated exclusively…

Show Full Abstract

Cancer results from alterations at essential genomic sites and is characterized by uncontrolled cell proliferation, invasion and metastasis. Identification of driver genes of metastatic progression is essential, as metastases, not primary tumors, are fatal. To gain insight into the mutational concordance between different steps of malignant progression we performed exome sequencing and validation with targeted deep sequencing of successive steps of malignant progression from pre-invasive stages to asynchronous distant metastases in six breast cancer patients. Using the ratio of non-synonymous to synonymous mutations, a surprisingly large number of cancer driver genes, ranging between 3 and 145, were estimated to confer a selective advantage in the studied primary tumors. We report a substantial amount of metastasis specific mutations and a number of novel putative metastasis driver genes. Most notable are the DCC, ABCA13, TIAM2, CREBBP, BCL6B and ZNF185 genes, mainly mutated exclusively in metastases and highly likely driver genes of metastatic progression. We find different genes and pathways to be affected at different steps of malignant progression. The Adherens junction pathway is affected in four of the six studied patients and this pathway most likely plays a vital role in the metastatic process.

Also flagged:MID1ubiquitin ligasemTORmidline malformation syndromescancerneurodegenerative diseases
Journal Article 2018-01-02 ✓ 3 Snippets Unterbruner K, Matthes F, Schilling J, Nalavade R, Weber S, Winter J, Krauß S.
In-Text Gene Mentions

These include APP and BACE1, which play an important role in Alzheimer’s disease, mutant HTT, which causes Huntington’s disease, as we as that androgen receptor (AR), which is involved in prostate cancer.

…such as huntingtin (HTT) mRNA [ 5…

…significant reduction ofHTTprotein ( Fig…

Show Full Abstract

The MID1 ubiquitin ligase activates mTOR signaling and regulates mRNA translation. Misregulation of MID1 expression is associated with various diseases including midline malformation syndromes, cancer and neurodegenerative diseases. While this indicates that MID1 expression must be tightly regulated to prevent disease states specific mechanisms involved have not been identified. We examined miRNAs to determine mechanisms that regulate MID1 expression. MicroRNAs (miRNA) are small non-coding RNAs that recognize specific sequences in their target mRNAs. Upon binding, miRNAs typically downregulate expression of these targets. Here, we identified four miRNAs, miR-19, miR-340, miR-374 and miR-542 that bind to the 3'-UTR of the MID1 mRNA. These miRNAs not only regulate MID1 expression but also mTOR signaling and translation of disease associated mRNAs and could therefore serve as potential drugs for future therapy development.

Also flagged:aspartate aminotransferaseinterferonchronic hepatitis CLSribavirincirrhosis
Journal Article 2018-01-02 ✓ 1 Snippet Chen SH, Lai HC, Chiang IP, Su WP, Lin CH, Kao JT, Chuang PH, Hsu WF, Wang HW, Chen HY, Huang GT, Peng CY.
In-Text Gene Mentions

…disease, autoimmune hepatitis,hemochromatosis, extrahepatic cholestasis, al…

Show Full Abstract

<h4>Background</h4>To compare on-treatment and off-treatment parameters acquired using acoustic radiation force impulse elastography, the Fibrosis-4 (FIB-4) index, and aspartate aminotransferase-to-platelet ratio index (APRI) in patients with chronic hepatitis C (CHC).<h4>Methods</h4>Patients received therapies based on pegylated interferon or direct-acting antiviral agents. The changes in paired patient parameters, including liver stiffness (LS) values, the FIB-4 index, and APRI, from baseline to sustained virologic response (SVR) visit (24 weeks after the end of treatment) were compared. Multiple regression models were used to identify significant factors that explained the correlations with LS, FIB-4, and APRI values and SVR.<h4>Results</h4>A total of 256 patients were included, of which 219 (85.5%) achieved SVR. The paired LS values declined significantly from baseline to SVR visit in all groups and subgroups except the nonresponder subgroup (n = 10). Body mass index (P = 0.0062) and baseline LS (P < 0.0001) were identified as independent factors that explained the LS declines. Likewise, the baseline FIB-4 (P < 0.0001) and APRI (P < 0.0001) values independently explained the declines in the FIB-4 index and APRI, respectively. Moreover, interleukin-28B polymorphisms, baseline LS, and rapid virologic response were identified as independent correlates with SVR.<h4>Conclusions</h4>Paired LS measurements in patients treated for CHC exhibited significant declines comparable to those in FIB-4 and APRI values. These declines may have correlated with the resolution of necroinflammation. Baseline LS values predicted SVR.

Also flagged:PeriodontitisCPperiodontal infectionchromosomal regionsaggressive periodontitischronic periodontitis
Journal Article 2018-01-02 ✓ 1 Snippet Nashef A, Qabaja R, Salaymeh Y, Botzman M, Munz M, Dommisch H, Krone B, Hoffmann P, Wellmann J, Laudes M, Berger K, Kocher T, Loos B, van der Velde N, Uitterlinden AG, de Groot LCPGM, Franke A, Offenbacher S, Lieb W, Divaris K, Mott R, Gat-Viks I, Wiess E, Schaefer A, Iraqi FA, Haddad YH.
In-Text Gene Mentions

…( CAPN8, DUSP23,PCDH17, SNORA17, PCDH9, LECT1…

Show Full Abstract

Periodontitis is one of the most common inflammatory human diseases with a strong genetic component. Due to the limited sample size of available periodontitis cohorts and the underlying trait heterogeneity, genome-wide association studies (GWASs) of chronic periodontitis (CP) have largely been unsuccessful in identifying common susceptibility factors. A combination of quantitative trait loci (QTL) mapping in mice with association studies in humans has the potential to discover novel risk loci. To this end, we assessed alveolar bone loss in response to experimental periodontal infection in 25 lines (286 mice) from the Collaborative Cross (CC) mouse population using micro-computed tomography (µCT) analysis. The orthologous human chromosomal regions of the significant QTL were analyzed for association using imputed genotype data (OmniExpress BeadChip arrays) derived from case-control samples of aggressive periodontitis (AgP; 896 cases, 7,104 controls) and chronic periodontitis (CP; 2,746 cases, 1,864 controls) of northwest European and European American descent, respectively. In the mouse genome, QTL mapping revealed 2 significant loci (-log P = 5.3; false discovery rate = 0.06) on chromosomes 1 ( Perio3) and 14 ( Perio4). The mapping resolution ranged from ~1.5 to 3 Mb. Perio3 overlaps with a previously reported QTL associated with residual bone volume in F2 cross and includes the murine gene Ccdc121. Its human orthologue showed previously a nominal significant association with CP in humans. Use of variation data from the genomes of the CC founder strains further refined the QTL and suggested 7 candidate genes ( CAPN8, DUSP23, PCDH17, SNORA17, PCDH9, LECT1, and LECT2). We found no evidence of association of these candidates with the human orthologues. In conclusion, the CC populations enabled mapping of confined QTL that confer susceptibility to alveolar bone loss in mice and larger human phenotype-genotype samples and additional expression data from gingival tissues are likely required to identify true positive signals.

Also flagged:RKIPmyeloid sarcomaCancerTNFSF10solid tumorsHematoxylin
Journal Article 2018-01-02 No Snippets Caraffini V, Perfler B, Berg JL, Uhl B, Schauer S, Kashofer K, Ghaffari-Tabrizi-Wizsy N, Strobl H, Wölfler A, Hoefler G, Sill H, Zebisch A.
Show Full Abstract

No abstract available.

Also flagged:Polyglutamine (polyQ) diseasesneurodegenerative disorderspolyQ diseasesamino aciddeathlocalization
Journal Article 2018-01-02 ✓ 5 Snippets Zhang Q, Chen ZS, An Y, Liu H, Hou Y, Li W, Lau KF, Koon AC, Ngo JCK, Chan HYE.
In-Text Gene Mentions

The expression of flMJDQ84 (Fig. 6D) or Htt-exon1Q93 (Supplemental Fig. S8A) using gmr-GAL4 driver resulted in severe retinal degeneration.

…y. The gmr-GAL4, elav-GAL4, andUAS-Htt-exon1Q93(Chan et al. 2011) fly lines we…

…elav-GAL4 , and UAS-Htt-exon1 Q93 ( Chan…

…Q27/84 , and UAS-Htt-exon1 Q93 were raised…

…BesidesHtt-exon1 Q93 , in…

Show Full Abstract

Polyglutamine (polyQ) diseases are a class of progressive neurodegenerative disorders characterized by the expression of both expanded <i>CAG</i> RNA and misfolded polyQ protein. We previously reported that the direct interaction between expanded <i>CAG</i> RNA and nucleolar protein nucleolin (NCL) impedes <i>preribosomal</i> RNA (<i>pre-rRNA</i>) transcription, and eventually triggers nucleolar stress-induced apoptosis in polyQ diseases. Here, we report that a 21-amino acid peptide, named "beta-structured inhibitor for neurodegenerative diseases" (BIND), effectively suppresses toxicity induced by expanded <i>CAG</i> RNA. When administered to a cell model, BIND potently inhibited cell death induced by expanded <i>CAG</i> RNA with an IC<sub>50</sub> value of ∼0.7 µM. We showed that the function of BIND is dependent on Glu2, Lys13, Gly14, Ile18, Glu19, and Phe20. BIND treatment restored the subcellular localization of nucleolar marker protein and the expression level of <i>pre-45s rRNA</i> Through isothermal titration calorimetry analysis, we demonstrated that BIND suppresses nucleolar stress via a direct interaction with <i>CAG</i> RNA in a length-dependent manner. The mean binding constants (<i>K</i><sub>D</sub>) of BIND to <i>SCA2</i><sub><i>CAG22</i></sub> , <i>SCA2</i><sub><i>CAG42</i></sub> , <i>SCA2</i><sub><i>CAG55</i></sub> , and <i>SCA2</i><sub><i>CAG72</i></sub> RNA are 17.28, 5.60, 4.83, and 0.66 µM, respectively. In vivo, BIND ameliorates retinal degeneration and climbing defects, and extends the lifespan of <i>Drosophila</i> expressing expanded <i>CAG</i> RNA. These effects suggested that BIND can suppress neurodegeneration in diverse polyQ disease models in vivo and in vitro without exerting observable cytotoxic effect. Our results collectively demonstrated that BIND is an effective inhibitor of expanded <i>CAG</i> RNA-induced toxicity in polyQ diseases.

Also flagged:breast cancerCancerCCL2Wnt-1E-cadherintumor
Journal Article 2018-01-02 ✓ 5 Snippets Linde N, Casanova-Acebes M, Sosa MS, Mortha A, Rahman A, Farias E, Harper K, Tardio E, Reyes Torres I, Jones J, Condeelis J, Merad M, Aguirre-Ghiso JA.
In-Text Gene Mentions

This inhibitory effect of DCC burden and metastasis was detected even after macrophage depletion had been stopped in average for 1 month and animals had carried fast-growing tumors.

…than the lateDCCcounterparts 4 ,…

…ForDCCanalysis in lungs,…

…also reduced earlyDCCburden in target…

…0.028) decreased solitaryDCCburden in lungs…

Show Full Abstract

Cancer cell dissemination during very early stages of breast cancer proceeds through poorly understood mechanisms. Here we show, in a mouse model of HER2<sup>+</sup> breast cancer, that a previously described sub-population of early-evolved cancer cells requires macrophages for early dissemination. Depletion of macrophages specifically during pre-malignant stages reduces early dissemination and also results in reduced metastatic burden at end stages of cancer progression. Mechanistically, we show that, in pre-malignant lesions, CCL2 produced by cancer cells and myeloid cells attracts CD206<sup>+</sup>/Tie2<sup>+</sup> macrophages and induces Wnt-1 upregulation that in turn downregulates E-cadherin junctions in the HER2<sup>+</sup> early cancer cells. We also observe macrophage-containing tumor microenvironments of metastasis structures in the pre-malignant lesions that can operate as portals for intravasation. These data support a causal role for macrophages in early dissemination that affects long-term metastasis development much later in cancer progression. A pilot analysis on human specimens revealed intra-epithelial macrophages and loss of E-cadherin junctions in ductal carcinoma in situ, supporting a potential clinical relevance.

Also flagged:transcription factorbindingmethylationDNase-IhypersensitivityDNase I
Journal Article 2018-01-02 ✓ 1 Snippet Bell CG, Gao F, Yuan W, Roos L, Acton RJ, Xia Y, Bell J, Ward K, Mangino M, Hysi PG, Wang J, Spector TD.
In-Text Gene Mentions

…near the obesity-locusNEGR119 (green, Fig.…

Show Full Abstract

Integrating epigenetic data with genome-wide association study (GWAS) results can reveal disease mechanisms. The genome sequence itself also shapes the epigenome, with CpG density and transcription factor binding sites (TFBSs) strongly encoding the DNA methylome. Therefore, genetic polymorphism impacts on the observed epigenome. Furthermore, large genetic variants alter epigenetic signal dosage. Here, we identify DNA methylation variability between GWAS-SNP risk and non-risk haplotypes. In three subsets comprising 3128 MeDIP-seq peripheral-blood DNA methylomes, we find 7173 consistent and functionally enriched Differentially Methylated Regions. 36.8% can be attributed to common non-SNP genetic variants. CpG-SNPs, as well as facilitative TFBS-motifs, are also enriched. Highlighting their functional potential, CpG-SNPs strongly associate with allele-specific DNase-I hypersensitivity sites. Our results demonstrate strong DNA methylation allelic differences driven by obligatory or facilitative genetic effects, with potential direct or regional disease-related repercussions. These allelic variations require disentangling from pure tissue-specific modifications, may influence array studies, and imply underestimated population variability in current reference epigenomes.

Also flagged:gene expressionbreast cancersoligonucleotidesBC1amino-acidsstem cell
Journal Article 2018-01-02 No Snippets Latgé G, Poulet C, Bours V, Josse C, Jerusalem G.
Show Full Abstract

Natural antisense transcripts are RNA sequences that can be transcribed from both DNA strands at the same locus but in the opposite direction from the gene transcript. Because strand-specific high-throughput sequencing of the antisense transcriptome has only been available for less than a decade, many natural antisense transcripts were first described as long non-coding RNAs. Although the precise biological roles of natural antisense transcripts are not known yet, an increasing number of studies report their implication in gene expression regulation. Their expression levels are altered in many physiological and pathological conditions, including breast cancers. Among the potential clinical utilities of the natural antisense transcripts, the non-coding|coding transcript pairs are of high interest for treatment. Indeed, these pairs can be targeted by antisense oligonucleotides to specifically tune the expression of the coding-gene. Here, we describe the current knowledge about natural antisense transcripts, their varying molecular mechanisms as gene expression regulators, and their potential as prognostic or predictive biomarkers in breast cancers.

Also flagged:carbohydratesglycolipidsynthesisglycoconjugatesimplesugars
Journal Article 2018-01-02 No Snippets Latxague L, Gaubert A, Barthélémy P.
Show Full Abstract

Glyconanoparticles essentially result from the (covalent or noncovalent) association of nanometer-scale objects with carbohydrates. Such glyconanoparticles can take many different forms and this mini review will focus only on soft materials (colloids, liposomes, gels etc.) with a special emphasis on glycolipid-derived nanomaterials and the chemistry involved for their synthesis. Also this contribution presents Low Molecular Weight Gels (LMWGs) stabilized by glycoconjugate amphiphiles. Such soft materials are likely to be of interest for different biomedical applications.

Also flagged:calciumglucosemastitislipopolysaccharideN-acetyl-beta-D-glucosaminidasehypoglycemia
Journal Article 2018-01-02 No Snippets Shinozuka Y, Kawai K, Sato R, Higashitani A, Hamamoto Y, Okita M, Isobe N.
Show Full Abstract

The aim of this study was to determine the blood ionized calcium (Ca) levels and acute-phase blood glucose kinetics in goats with mastitis induced by an intramammary challenge of lipopolysaccharide (LPS). Five goats were subjected to intramammary challenge of either LPS (10 µg) or saline (control). Some clinical manifestations (rectal temperature, pulse rate, respiration rate, ruminal motility, physical activity, and dehydration) were observed, and blood was collected for the measurement of several parameters [ionized and total Ca levels, blood glucose level, pH, and white blood count (WBC)] at 0 (just before challenge), 1-4, 6, 8, 12 and 24 hr post-challenge in both the LPS and control phases. Milk was collected at 0 (just before challenge), 4, 8, 12 and 24 hr post-challenge to measure the somatic cell count (SCC) and N-acetyl-beta-D-glucosaminidase (NAGase) activity. In the LPS phase, increased rectal temperature, significantly decreased ionized Ca and total Ca levels and WBCs were observed compared with those at 0 hr, although there were no differences in all parameters between phases. LPS infusion significantly increased SCCs in milk and NAGase activity. The present results demonstrated that, during the acute phase of mastitis induced by intramammary challenge by LPS at a concentration sufficient to cause general symptoms in goats, a decreased blood ionized Ca level occurs, but not hypoglycemia.

Also flagged:U618S rRNAstomach adenocarcinomaSTADcancerdeath
Journal Article 2018-01-02 No Snippets Liu J, Liu F, Shi Y, Tan H, Zhou L.
Show Full Abstract

Stomach adenocarcinoma (STAD) is the second leading cause of cancer death and a fuller understanding of its molecular basis is needed to develop new therapeutic targets. miRNA and mRNA data were downloaded from The Cancer Genome Atlas database, and the differentially expressed miRNAs and genes were identified. The target genes of differentially expressed miRNAs were screened by prediction tools. Furthermore, the biological function of these target genes was investigated. Several key miRNAs and their target genes were selected for validation using quantitative real-time polymerase chain reaction (qRT-PCR). The Gene Expression Omnibus (GEO) dataset was used to verify the expression of selected miRNAs and target genes. The diagnostic value of identified miRNAs and genes was accessed by receiver operating characteristic analysis. A total of 1248 differentially expressed genes were identified in STAD. Additionally, nine differentially expressed miRNAs were identified and 160 target genes of these nine miRNAs were identified via target gene detection. Interestingly, they were remarkably enriched in the calcium signaling pathway and bile secretion. qRT-PCR confirmed the expression of several key miRNAs and their target genes. The expression levels of hsa-miR-145-3p, hsa-miR-145-5p, <i>ADAM12</i>,<i>ACAN</i>,<i>HOXC11</i> and <i>MMP11</i> in the GEO database were compatible with the bioinformatics results. hsa-miR-139-5p, hsa-miR-145-3p and <i>MMP11</i> have a potential diagnostic value for STAD. Differential expression of the mature form of miRNAs (hsa-miR-139-5p, hsa-miR-145-3p, hsa-miR-145-5p and hsa-miR-490-3p) and genes including <i>ADAM12</i>,<i>ACAN</i>,<i>HOXC11</i> and <i>MMP11</i> and calcium and bile secretion signaling pathways may play important roles in the development of STAD.

Also flagged:Insulinomasneuroendocrine tumorshypoglycemiainsulinomatumorstumor
Journal Article 2018-01-02 No Snippets Qi C, Duan J, Shi Q, Wang M, Yan C.
Show Full Abstract

Insulinomas are functional pancreatic neuroendocrine tumors that cause hypoglycemia and severe morbidity. The aim of our study was to identify gene mutations responsible for tumorigenesis of sporadic insulinoma. Whole exome sequencing analysis was performed on tumors and paired peripheral blood from three patients with insulinomas. After initial analysis, somatic mutations were obtained and a deleterious protein product was further predicted by various bioinformatic programs. Whole exome sequencing identified 55 rare somatic mutations among three insulinoma patients, including <i>MEN1</i> gene nonsense mutations (c. 681C>G; p.Tyr227* in exon 4 of <i>MEN1</i> and c. 346G>T; p.Glu116* in exon 2 of <i>MEN1</i>) in two different tumor samples. The mutations resulted in a significant truncation of the protein and a non-functional gene product, which was involved in defective binding of menin to proteins implicated in genetic and epigenetic mechanisms. Our results extend the growing list of pathogenic <i>MEN1</i> mutations in sporadic cases of insulinoma.

Also flagged:SLC6A4MethylationOXTRsubstance useserotonin transporter5
Journal Article 2018-01-01 ✓ 1 Snippet Beach SRH, Lei MK, Brody GH, Philibert RA.
In-Text Gene Mentions

5-HTT

Show Full Abstract

The Strong African American Family (SAAF) program has been shown to have a variety of short and long-term benefits for participating youth and families. However, biological mechanisms potentially influencing long-term effects on resilience in young adulthood have not been examined. In the current investigation, we examine the effects of SAAF on methylation of the OXTR gene in young adulthood, focusing on a regulatory region previously identified to be both responsive to stress and implicated in resilience. Using the subsample of participants from the original study for whom methylation data was available (N = 388), we replicated the previously reported G × E effect on prevention of early substance use and then examined whether there would also be a moderated effect on OXTR methylation in early adulthood, with "s" allele carriers, but not "LL" participants, showing a significant indirect effect of SAAF on OXTR methylation. Results suggest that for susceptible youth (i.e., "s" allele carriers), preventive intervention may "get under the skin," in a manner potentially beneficial for long-term outcomes. Implications for examination of OXTR methylation in future prevention research are discussed.

Also flagged:serotonin transporterejaculation
Journal Article 2018-01-01 No Snippets Peng DW, Gao JJ, Huang YY, Tang DD, Gao P, Li C, Liu WQ, Dou XM, Mao J, Zhang Y, Geng H, Zhang XS.
Show Full Abstract

No abstract available.

Also flagged:EzrinSignal Transductionepidermal growth factor receptorEGFRCD44vascular cell adhesion molecule
Journal Article 2018-01-01 ✓ 1 Snippet Yin LM, Duan TT, Ulloa L, Yang YQ.
In-Text Gene Mentions

…in colorectal cancer (DCC) receptor.…

Show Full Abstract

Ezrin is a critical structural protein that organizes receptor complexes and orchestrates their signal transduction. In this study, we review the ezrin-meditated regulation of critical receptor complexes, including the epidermal growth factor receptor (EGFR), CD44, vascular cell adhesion molecule (VCAM), and the deleted in colorectal cancer (DCC) receptor. We also analyze the ezrin-meditated regulation of critical pathways associated with asthma, such as the RhoA, Rho-associated protein kinase (ROCK), and protein kinase A (cAMP/PKA) pathways. Mounting evidence suggests that ezrin plays a role in controlling airway cell function and potentially contributes to respiratory diseases. Ezrin can participate in asthma pathogenesis by affecting bronchial epithelium repair, T lymphocyte regulation, and the contraction of the airway smooth muscle cells. These studies provide new insights for the design of novel therapeutic strategies for asthma treatment.

Also flagged:gene expressionsarcoidosisimmune responsesgranulomasgranulomatous diseasesguanidinium
Journal Article 2018-01-01 ✓ 1 Snippet Ascoli C, Huang Y, Schott C, Turturice BA, Metwally A, Perkins DL, Finn PW, ACCESS Research Group.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

MicroRNAs (miRNAs) act as post-transcriptional regulators of gene expression. In sarcoidosis, aberrant miRNA expression may enhance immune responses mounted against an unknown antigenic agent. We tested whether a distinct miRNA signature functions as a diagnostic biomarker and explored its role as an immune modulator in sarcoidosis. The expression of miRNAs in peripheral blood mononuclear cells from subjects who met clinical and histopathologic criteria for sarcoidosis was compared with that observed in matched controls in the ACCESS (A Case Controlled Etiologic Study of Sarcoidosis) study. Signature miRNAs were determined by miRNA microarray analysis and validated by quantitative RT-PCR. Microarray analysis identified 54 mature, human feature miRNAs that were differentially expressed between the groups. Significant feature miRNAs that distinguished subjects with sarcoidosis from controls were selected by means of probabilistic models adjusted for clinical variables. Eight signature miRNAs were chosen to verify the diagnosis of sarcoidosis in a validation cohort, and distinguished subjects with sarcoidosis from controls with a positive predictive value of 88%. We identified both novel and previously described genes and molecular pathways associated with sarcoidosis as targets of these signature miRNAs. Additionally, we demonstrate that signature miRNAs (hsa-miR-150-3p and hsa-miR-342-5p) are significantly associated with reduced lymphocytes and airflow limitations, both of which are known markers of a poor prognosis. Together, these findings suggest that a circulating miRNA signature serves as a noninvasive biomarker that supports the diagnosis of sarcoidosis. Future studies will test the miRNA signature as a prognostication tool to identify unfavorable changes associated with poor clinical outcomes in sarcoidosis.

Also flagged:Alzheimer's diseaseADamyotrophic lateral sclerosisParkinson's diseasePDbulbar muscular atrophy
Journal Article 2018-01-01 ✓ 1 Snippet Makhouri FR, Ghasemi JB.
In-Text Gene Mentions

…to identify huntingtin (HTT) mimetics, a group…

Show Full Abstract

<h4>Background</h4>Neurodegenerative diseases such as Alzheimer's disease (AD), amyotrophic lateral sclerosis, Parkinson's disease (PD), spinal cerebellar ataxias, and spinal and bulbar muscular atrophy are described by slow and selective degeneration of neurons and axons in the central nervous system (CNS) and constitute one of the major challenges of modern medicine. Computeraided or in silico drug design methods have matured into powerful tools for reducing the number of ligands that should be screened in experimental assays.<h4>Methods</h4>In the present review, the authors provide a basic background about neurodegenerative diseases and in silico techniques in the drug research. Furthermore, they review the various in silico studies reported against various targets in neurodegenerative diseases, including homology modeling, molecular docking, virtual high-throughput screening, quantitative structure activity relationship (QSAR), hologram quantitative structure activity relationship (HQSAR), 3D pharmacophore mapping, proteochemometrics modeling (PCM), fingerprints, fragment-based drug discovery, Monte Carlo simulation, molecular dynamic (MD) simulation, quantum-mechanical methods for drug design, support vector machines, and machine learning approaches.<h4>Results</h4>Detailed analysis of the recently reported case studies revealed that the majority of them use a sequential combination of ligand and structure-based virtual screening techniques, with particular focus on pharmacophore models and the docking approach.<h4>Conclusion</h4>Neurodegenerative diseases have a multifactorial pathoetiological origin, so scientists have become persuaded that a multi-target therapeutic strategy aimed at the simultaneous targeting of multiple proteins (and therefore etiologies) involved in the development of a disease is recommended in future.

Also flagged:depressionmood disordersADmetabolismserotoninreuptake
Journal Article 2018-01-01 No Snippets Adzic M, Brkic Z, Mitic M, Francija E, Jovicic MJ, Radulovic J, Maric NP.
Show Full Abstract

<h4>Background</h4>Mounting evidence demonstrates enhanced systemic levels of inflammatory mediators in depression, indicating that inflammation may play a role in the etiology and course of mood disorders. Indeed, proinflammatory cytokines induce a behavioral state of conservation- withdrawal resembling human depression, characterized by negative mood, fatigue, anhedonia, psychomotor retardation, loss of appetite, and cognitive deficits. Neuroinflammation also contributes to non-responsiveness to current antidepressant (AD) therapies. Namely, response to conventional AD medications is associated with a decrease in inflammatory biomarkers, whereas resistance to treatment is accompanied by increased inflammation.<h4>Methods</h4>In this review, we will discuss the utility and shortcomings of pharmacologic AD treatment strategies focused on inflammatory pathways, applied alone or as an adjuvant component to current AD therapies.<h4>Results</h4>Mechanisms of cytokine actions on behavior involve activation of inflammatory pathways in the brain, resulting in changes of neurotransmitter metabolism, neuroendocrine function, and neuronal plasticity. Selective serotonin reuptake inhibitors exhibit the most beneficial effects in restraining the inflammation markers in depression. Different anti-inflammatory agents exhibit AD effects via modulating neurotransmitter systems, neuroplasticity markers and glucocorticoid receptor signaling. Anti-inflammatory add-on therapy in depression highlights such treatment as a candidate for enhancement strategy in patients with moderate-to-severe depression.<h4>Conclusion</h4>The interactions between the immune system and CNS are not only involved in shaping behavior, but also in responding to therapeutics. Even though, substantial evidence from animal and human research support a beneficial effect of anti-inflammatory add-on therapy in depression, further research with special attention on safety, particularly during prolonged periods of antiinflammatory co-treatments, is required.

Also flagged:Cystic Fibrosis Lung DiseaseCFlung diseasecystic fibrosis transmembrane conductance regulatorgene expressionhost
Journal Article 2018-01-01 No Snippets Polineni D, Dang H, Gallins PJ, Jones LC, Pace RG, Stonebraker JR, Commander LA, Krenicky JE, Zhou YH, Corvol H, Cutting GR, Drumm ML, Strug LJ, Boyle MP, Durie PR, Chmiel JF, Zou F, Wright FA, O'Neal WK, Knowles MR.
Show Full Abstract

<h4>Rationale</h4>The severity of cystic fibrosis (CF) lung disease varies widely, even for Phe508del homozygotes. Heritability studies show that more than 50% of the variability reflects non-cystic fibrosis transmembrane conductance regulator (CFTR) genetic variation; however, the full extent of the pertinent genetic variation is not known.<h4>Objectives</h4>We sought to identify novel CF disease-modifying mechanisms using an integrated approach based on analyzing "in vivo" CF airway epithelial gene expression complemented with genome-wide association study (GWAS) data.<h4>Methods</h4>Nasal mucosal RNA from 134 patients with CF was used for RNA sequencing. We tested for associations of transcriptomic (gene expression) data with a quantitative phenotype of CF lung disease severity. Pathway analysis of CF GWAS data (n = 5,659 patients) was performed to identify novel pathways and assess the concordance of genomic and transcriptomic data. Association of gene expression with previously identified CF GWAS risk alleles was also tested.<h4>Measurements and main results</h4>Significant evidence of heritable gene expression was identified. Gene expression pathways relevant to airway mucosal host defense were significantly associated with CF lung disease severity, including viral infection, inflammation/inflammatory signaling, lipid metabolism, apoptosis, ion transport, Phe508del CFTR processing, and innate immune responses, including HLA (human leukocyte antigen) genes. Ion transport and CFTR processing pathways, as well as HLA genes, were identified across differential gene expression and GWAS signals.<h4>Conclusions</h4>Transcriptomic analyses of CF airway epithelia, coupled to genomic (GWAS) analyses, highlight the role of heritable host defense variation in determining the pathophysiology of CF lung disease. The identification of these pathways provides opportunities to pursue targeted interventions to improve CF lung health.

Also flagged:Cystathionine β-synthaseironCBShydrogensulfidehydrogen sulfide
Journal Article 2018-01-01 ✓ 2 Snippets Zhou YF, Wu XM, Zhou G, Mu MD, Zhang FL, Li FM, Qian C, Du F, Yung WH, Qian ZM, Ke Y.
In-Text Gene Mentions

…liver, displaying ahemochromatosis-like phenotype.…

…likely that ahemochromatosis-like phenotype in patients…

Show Full Abstract

Cystathionine β-synthase (CBS) catalyzes the transsulfuration pathway and contributes, among other functions, to the generation of hydrogen sulfide. In view of the exceptionally high expression of CBS in the liver and the common interleukin-6 pathway used in the regulatory systems of hydrogen sulfide and hepcidin, we speculate that CBS is involved in body iron homeostasis. We found that CBS knockout (CBS<sup>-/-</sup> ) mice exhibited anemia and a significant increase in iron content in the serum, liver, spleen, and heart, along with severe damage to the liver, displaying a hemochromatosis-like phenotype. A high level of hepatic and serum hepcidin was also found. A major cause of the systemic iron overload is the reduced iron usage due to suppressed erythropoiesis, which is consistent with an increase in interleukin-6 and reduced expression of erythropoietin. Importantly, in the liver, absence of CBS caused both a reduction in the transcriptional factor nuclear factor erythroid 2-related factor-2 and an up-regulation of hepcidin that led to a decrease in the iron export protein ferroportin 1. The resulting suppression of iron export exacerbates iron retention, causing damage to hepatocytes. Finally, administration of CBS-overexpressing adenovirus into CBS mutant mice could partially reverse the iron-related phenotype.<h4>Conclusion</h4>Our findings point to a critical role of CBS in iron homeostasis of the body, and the liver in particular; it is likely that a hemochromatosis-like phenotype in patients can be induced by aberration not only in the expression of key molecules in the hepcidin pathway but also of those related to CBS. (Hepatology 2018;67:21-35).

Also flagged:SynthesisALPOsteoporosisOPbone diseasealkaline phosphatase
Journal Article 2018-01-01 No Snippets Hou S, Xu H, Hu J, Hou J, Wang Y, Jin Z, Wan DCC, Hu C.
Show Full Abstract

<h4>Background</h4>Osteoporosis (OP) is a common bone disease, most often diagnosed in post-menopausal women. The majority of OP treatments are focused on manipulation of the patient's hormone levels, therefore, they are associated with significant adverse effects.<h4>Objective</h4>The study aimed to design, synthesize and evaluate the β-catenin translocation capability and the alkaline phosphatase (ALP) activation activity of 7H-thiazolo[3,2-b]-1,2,4-triazin-7-one derivatives.<h4>Method</h4>The styrene derivatives were synthesized as raw materials, followed by oxidation and condensation reactions, in which 6-aryl-3-thioxo-3,4-dihydro-1,2,4-triazin-5(2H)-one derivatives (1) were obtained. The 3,6-diaryl-7H-thiazolo[3,2-b]-1,2,4-triazin-7-ones (2) were obtained by a condensation reaction of compound 1 with substituted phenacyl chlorides in acetic acid. The target compounds 3,6-diaryl-7H-thiazolo[3,2-b]-1,2,4-triazin-7-ones (3a-3c) were prepared by compound 2 with substituted alkyl chloride by Williamson reaction. As to 6-benzyl-3-aryl-7H-thiazolo[3,2- b]-1,2,4-triazin-7-one derivatives as the target compounds, the benzaldehyde and acetylglycine used as raw materials, followed by Erlenmeyer-Plochl reaction, condensation reaction, hydrolysis reaction, condensation reaction, 6-benzyl-3-thioxo-3,4-dihydro-1,2,4-triazin-5(2H)-one derivatives were obtained, and were converted to the target compounds 6-benzyl-3-(hydroxylaryl)-7Hthiazolo[ 3,2-b]-1,2,4-triazin-7-one derivatives (5a-5d) using reaction with substituted α-phenacyl chlorides. Finally, Williamson reaction were used to yield 6-benzyl-3-aryl-7H-thiazolo[3,2-b]- 1,2,4-triazin-7-ones as target compounds (6a-6e). The β-catenin translocation capability and the ALP activation activity were tested, and the glycogen synthase kinase-3 (GSK-3) inhibition was simulated by molecular docking.<h4>Results</h4>Fourteen 7H-thiazolo[3,2-b]-1,2,4-triazin-7-one derivatives were synthesized and characterized by mass spectra, proton NMR and infrared spectra, the β-catenin translocation capability and the ALP activation activities of the target compounds were tested and calculated. The EC50 value of the ALP activation activity of 6-(4-chlorobenzyl)-3-{4-[(2-dimethylamino)-2- oxoethoxy]phenyl}-7H-thiazolo[3,2-b]-1,2,4-triazin-7-one (6b) was 11.283 µM. The molecular docking results have showed that the target compounds would be GSK-3 inhibitors.<h4>Conclusion</h4>Based on the results of the biological activity test, the target compounds have exhibited the β-catenin translocation capability and the ALP activation activity.

Also flagged:biosynthesisIron-sulfur clusterselectron transportregulation ofgene expressionbinding
Journal Article 2018-01-01 No Snippets Wachnowsky C, Fidai I, Cowan JA.
Show Full Abstract

Iron-sulfur clusters (Fe-S) are one of the most ancient, ubiquitous and versatile classes of metal cofactors found in nature. Proteins that contain Fe-S clusters constitute one of the largest families of proteins, with varied functions that include electron transport, regulation of gene expression, substrate binding and activation, radical generation, and, more recently discovered, DNA repair. Research during the past two decades has shown that mitochondria are central to the biogenesis of Fe-S clusters in eukaryotic cells via a conserved cluster assembly machinery (ISC assembly machinery) that also controls the synthesis of Fe-S clusters of cytosolic and nuclear proteins. Several key steps for synthesis and trafficking have been determined for mitochondrial Fe-S clusters, as well as the cytosol (CIA - cytosolic iron-sulfur protein assembly), but detailed mechanisms of cluster biosynthesis, transport, and exchange are not well established. Genetic mutations and the instability of certain steps in the biosynthesis and maturation of mitochondrial, cytosolic and nuclear Fe-S cluster proteins affects overall cellular iron homeostasis and can lead to severe metabolic, systemic, neurological and hematological diseases, often resulting in fatality. In this review we briefly summarize the current molecular understanding of both mitochondrial ISC and CIA assembly machineries, and present a comprehensive overview of various associated inborn human disease states.

Also flagged:Transmissible spongiform encephalopathiesneurodegenerative disordersprionfibrilsconcanavalin Aagglutinin
Journal Article 2018-01-01 ✓ 5 Snippets Lamoureux L, Simon SLR, Waitt B, Knox JD.
In-Text Gene Mentions

Our lab is the first to associate the glycosylated NEGR1 protein with prion disease pathology.

The abundance of three of the four proteins increases significantly during later stages of prion disease whereas NEGR1 decreases in abundance.

…two different glycoproteomes:Neuronal growth regulator 1growth regulator 1…

…growth regulator 1 (NEGR1), calponin-3 (CNN3), peroxire…

…in-3 (CNN3), peroxiredoxin-6 (Prdx6), and glial fibrillary…

Show Full Abstract

Transmissible spongiform encephalopathies (TSEs) are neurodegenerative disorders caused by the presence of an infectious prion protein. The primary site of pathology is the brain characterized by neuroinflammation, astrogliosis, prion fibrils, and vacuolation. The events preceding the observed pathology remain in question. We sought to identify biomarkers in the brain of TSE-infected and aged-matched control mice using two-dimensional fluorescence difference gel electrophoresis (2D-DIGE). Since the brain proteome is too complex to resolve all proteins using 2D-DIGE, protein samples are initially filtered through either concanavalin A (ConA) or wheat-germ agglutinin (WGA) columns. Four differentially abundant proteins are identified through screening of the two different glycoproteomes: Neuronal growth regulator 1 (NEGR1), calponin-3 (CNN3), peroxiredoxin-6 (Prdx6), and glial fibrillary acidic protein (GFAP). Confirmatory Western blots are performed with samples from TSE-infected and comparative Alzheimer's disease (AD) affected brains and their respective controls from time points throughout the disease courses. The abundance of three of the four proteins increases significantly during later stages of prion disease whereas NEGR1 decreases in abundance. Comparatively, no significant changes are observed in later stages of AD. Our lab is the first to associate the glycosylated NEGR1 protein with prion disease pathology.

Also flagged:OxygenChronic Obstructive Pulmonary DiseasedeathoxyhemoglobinCOPDpathogenesis
Journal Article 2018-01-01 No Snippets Yusen RD, Criner GJ, Sternberg AL, Au DH, Fuhlbrigge AL, Albert RK, Casaburi R, Stoller JK, Harrington KF, Cooper JAD, Diaz P, Gay S, Kanner R, MacIntyre N, Martinez FJ, Piantadosi S, Sciurba F, Shade D, Stibolt T, Tonascia J, Wise R, Bailey WC, LOTT Research Group *, LOTT Research Group.
Show Full Abstract

The Long-Term Oxygen Treatment Trial demonstrated that long-term supplemental oxygen did not reduce time to hospital admission or death for patients who have stable chronic obstructive pulmonary disease and resting and/or exercise-induced moderate oxyhemoglobin desaturation, nor did it provide benefit for any other outcome measured in the trial. Nine months after initiation of patient screening, after randomization of 34 patients to treatment, a trial design amendment broadened the eligible population, expanded the primary outcome, and reduced the goal sample size. Within a few years, the protocol underwent minor modifications, and a second trial design amendment lowered the required sample size because of lower than expected treatment group crossover rates. After 5.5 years of recruitment, the trial met its amended sample size goal, and 1 year later, it achieved its follow-up goal. The process of publishing the trial results brought renewed scrutiny of the study design and the amendments. This article expands on the previously published design and methods information, provides the rationale for the amendments, and gives insight into the investigators' decisions about trial conduct. The story of the Long-Term Oxygen Treatment Trial may assist investigators in future trials, especially those that seek to assess the efficacy and safety of long-term oxygen therapy. Clinical trial registered with clinicaltrials.gov (NCT00692198).

Also flagged:α-ThalassemiaAlpha-thalassemiaα-thalthalassemiahemoglobinopathiesα-globin
Journal Article 2018-01-01 ✓ 3 Snippets Valaei A, Karimipoor M, Kordafshari A, Zeinali S.
In-Text Gene Mentions

The impact of hemochromatosis (HFE)[68], glucuronosyltransferase family 1 member A1 (UGT1)[69], and α-hemoglobin stabilizing protein (AHSP)[70] variants needs to be clarified on the phenotype of HbH disease.

…The impact ofhemochromatosis(HFE)[ 68 ],…

…impact of hemochromatosis (HFE)[ 68 ], glucuronosyltransfera…

Show Full Abstract

Alpha-thalassemia (α-thal) is probably the most prevalent monogenic condition in the world. Deletions are the most common types of mutations in α-thal, followed by point mutations and small insertion/deletion. In the context of national screening program for prevention of thalassemia and hemoglobinopathies in Iran, α-thal carriers have come to more attention. Therefore, the frequency and distribution of α-globin mutations in various regions of the country have been studied in recent years. A comprehensive search was performed in PubMed, Scopus, and national databases for finding reports on mutation detection in α-thal carriers and HbH disease with Iranian origin. The mutation data of 10849 α-thal carriers showed that -α3.7 and α-5NT were the most common deletional and nondeletional mutations, respectively. In HbH disease cases, the -α3.7/--MED was the most prevalent genotype. Overall, 42 different mutations have been identified in α-globin cluster reflecting the high heterogeneity of the mutations in Iranian populations.

Also flagged:Cannabinoid CB1 Receptorsdopamine D1 receptorD1Rdopamine D2 receptorD2Rbehavioral
Journal Article 2018-01-01 No Snippets Ruiz-Calvo A, Maroto IB, Bajo-Grañeras R, Chiarlone A, Gaudioso Á, Ferrero JJ, Resel E, Sánchez-Prieto J, Rodríguez-Navarro JA, Marsicano G, Galve-Roperh I, Bellocchio L, Guzmán M.
Show Full Abstract

The vast majority of neurons within the striatum are GABAergic medium spiny neurons (MSNs), which receive glutamatergic input from the cortex and thalamus, and form two major efferent pathways: the direct pathway, expressing dopamine D1 receptor (D1R-MSNs), and the indirect pathway, expressing dopamine D2 receptor (D2R-MSNs). While molecular mechanisms of MSN degeneration have been identified in animal models of striatal damage, the molecular factors that dictate a selective vulnerability of D1R-MSNs or D2R-MSNs remain unknown. Here, we combined genetic, chemogenetic, and pharmacological strategies with behavioral and neurochemical analyses, and show that the pool of cannabinoid CB1 receptor (CB1R) located on corticostriatal terminals efficiently safeguards D1R-MSNs, but not D2R-MSNs, from different insults. This cell-specific response relies on the regulation of glutamatergic signaling, and is independent from the CB1R-dependent control of astroglial activity in the striatum. These findings define cortical CB1R as a pivotal synaptic player in dictating a differential vulnerability of D1R-MSNs versus D2R-MSNs, and increase our understanding of the role of coordinated cannabinergic-glutamatergic signaling in establishing corticostriatal circuits and its dysregulation in neurodegenerative diseases.

Also flagged:HACE1mitochondrialHuntington diseaseHDpathogenesisNrf2
Journal Article 2018-01-01 ✓ 1 Snippet Ehrnhoefer DE, Southwell AL, Sivasubramanian M, Qiu X, Villanueva EB, Xie Y, Waltl S, Anderson L, Fazeli A, Casal L, Felczak B, Tsang M, Hayden MR.
In-Text Gene Mentions

HTT

Show Full Abstract

Oxidative stress is a prominent feature of Huntington disease (HD), and we have shown previously that reduced levels of hace1 (HECT domain and Ankyrin repeat containing E3 ubiquitin protein ligase 1) in patient striatum may contribute to the pathogenesis of HD. Hace1 promotes the stability of Nrf2 and thus plays an important role in antioxidant response mechanisms, which are dysfunctional in HD. Moreover, hace1 overexpression mitigates mutant huntingtin (mHTT)-induced oxidative stress in vitro through promotion of the Nrf2 antioxidant response. Here, we show that the genetic ablation of hace1 in the YAC128 mouse model of HD accelerates motor deficits and exacerbates cognitive and psychiatric phenotypes in vivo. We find that both the expression of mHTT and the ablation of hace1 alone are sufficient to cause deficits in astrocytic mitochondrial respiration. We confirm the crucial role of hace1 in astrocytes in vivo, since its ablation is sufficient to cause dramatic astrogliosis in wild-type FVB/N mice. Astrogliosis is not observed in the presence of mHTT but a strong dysregulation in the expression of astrocytic markers in HACE1-/- x YAC128 striatum suggests an additive effect of mHTT expression and hace1 loss on this cell type. HACE1-/- x YAC128 mice and primary cells derived from these animals therefore provide model systems that will allow for the further dissection of Nrf2 pathways and astrocyte dysfunction in the context of HD.

Also flagged:chromatinTranscription FactorsHistoneDNaseRNA-binding proteinantibodies
Journal Article 2018-01-01 No Snippets Davis CA, Hitz BC, Sloan CA, Chan ET, Davidson JM, Gabdank I, Hilton JA, Jain K, Baymuradov UK, Narayanan AK, Onate KC, Graham K, Miyasato SR, Dreszer TR, Strattan JS, Jolanki O, Tanaka FY, Cherry JM.
Show Full Abstract

The Encyclopedia of DNA Elements (ENCODE) Data Coordinating Center has developed the ENCODE Portal database and website as the source for the data and metadata generated by the ENCODE Consortium. Two principles have motivated the design. First, experimental protocols, analytical procedures and the data themselves should be made publicly accessible through a coherent, web-based search and download interface. Second, the same interface should serve carefully curated metadata that record the provenance of the data and justify its interpretation in biological terms. Since its initial release in 2013 and in response to recommendations from consortium members and the wider community of scientists who use the Portal to access ENCODE data, the Portal has been regularly updated to better reflect these design principles. Here we report on these updates, including results from new experiments, uniformly-processed data from other projects, new visualization tools and more comprehensive metadata to describe experiments and analyses. Additionally, the Portal is now home to meta(data) from related projects including Genomics of Gene Regulation, Roadmap Epigenome Project, Model organism ENCODE (modENCODE) and modERN. The Portal now makes available over 13000 datasets and their accompanying metadata and can be accessed at: https://www.encodeproject.org/.

Also flagged:transcriptional regulatorstranscription factorschromatinbindingco-activatorstranscriptional coactivators
Journal Article 2018-01-01 No Snippets Chèneby J, Gheorghe M, Artufel M, Mathelier A, Ballester B.
Show Full Abstract

With this latest release of ReMap (http://remap.cisreg.eu), we present a unique collection of regulatory regions in human, as a result of a large-scale integrative analysis of ChIP-seq experiments for hundreds of transcriptional regulators (TRs) such as transcription factors, transcriptional co-activators and chromatin regulators. In 2015, we introduced the ReMap database to capture the genome regulatory space by integrating public ChIP-seq datasets, covering 237 TRs across 13 million (M) peaks. In this release, we have extended this catalog to constitute a unique collection of regulatory regions. Specifically, we have collected, analyzed and retained after quality control a total of 2829 ChIP-seq datasets available from public sources, covering a total of 485 TRs with a catalog of 80M peaks. Additionally, the updated database includes new search features for TR names as well as aliases, including cell line names and the ability to navigate the data directly within genome browsers via public track hubs. Finally, full access to this catalog is available online together with a TR binding enrichment analysis tool. ReMap 2018 provides a significant update of the ReMap database, providing an in depth view of the complexity of the regulatory landscape in human.

Also flagged:transcription factorsgene expressiondilated cardiomyopathyheart failureagingmetabolism
Journal Article 2018-01-01 ✓ 3 Snippets Haas J, Mester S, Lai A, Frese KS, Sedaghat-Hamedani F, Kayvanpour E, Rausch T, Nietsch R, Boeckel JN, Carstensen A, Völkers M, Dietrich C, Pils D, Amr A, Holzer DB, Martins Bordalo D, Oehler D, Weis T, Mereles D, Buss S, Riechert E, Wirsz E, Wuerstle M, Korbel JO, Keller A, Katus HA, Posch AE, Meder B.
In-Text Gene Mentions

…Primary antibody forSERPINC1(ThermoFisher Scientific, cat#…

…member 1 (SERPINC1), involved in…

…mRNA transcript forSERPINC1detected in SV…

Show Full Abstract

The transcriptome needs to be tightly regulated by mechanisms that include transcription factors, enhancers, and repressors as well as non-coding RNAs. Besides this dynamic regulation, a large part of phenotypic variability of eukaryotes is expressed through changes in gene transcription caused by genetic variation. In this study, we evaluate genome-wide structural genomic variants (SVs) and their association with gene expression in the human heart. We detected 3,898 individual SVs affecting all classes of gene transcripts (e.g., mRNA, miRNA, lncRNA) and regulatory genomic regions (e.g., enhancer or TFBS). In a cohort of patients (<i>n</i> = 50) with dilated cardiomyopathy (DCM), 80,635 non-protein-coding elements of the genome are deleted or duplicated by SVs, containing 3,758 long non-coding RNAs and 1,756 protein-coding transcripts. 65.3% of the SV-eQTLs do not harbor a significant SNV-eQTL, and for the regions with both classes of association, we find similar effect sizes. In case of deleted protein-coding exons, we find downregulation of the associated transcripts, duplication events, however, do not show significant changes over all events. In summary, we are first to describe the genomic variability associated with SVs in heart failure due to DCM and dissect their impact on the transcriptome. Overall, SVs explain up to 7.5% of the variation of cardiac gene expression, underlining the importance to study human myocardial gene expression in the context of the individual genome. This has immediate implications for studies on basic mechanisms of cardiac maladaptation, biomarkers, and (gene) therapeutic studies alike.

Also flagged:OsteoporosisObesitymineralPUM1ZNF423MARK3
Journal Article 2018-01-01 ✓ 1 Snippet Hu Y, Tan LJ, Chen XD, Liu Z, Min SS, Zeng Q, Shen H, Deng HW.
In-Text Gene Mentions

SOX6

Show Full Abstract

<h4>Context</h4>Genome-wide association studies (GWASs) have been successful in identifying loci associated with osteoporosis and obesity. However, the findings explain only a small fraction of the total genetic variance.<h4>Objective</h4>The aim of this study was to identify novel pleiotropic genes important in osteoporosis and obesity.<h4>Design and setting</h4>A pleiotropic conditional false discovery rate method was applied to three independent GWAS summary statistics of femoral neck bone mineral density, body mass index, and waist-to-hip ratio. Next, differential expression analysis was performed for the potentially pleiotropic genes, and weighted genes coexpression network analysis (WGCNA) was conducted to identify functional connections between the suggested pleiotropic genes and known osteoporosis/obesity genes using transcriptomic expression data sets in osteoporosis/obesity-related cells.<h4>Results</h4>We identified seven potentially pleiotropic loci-rs3759579 (MARK3), rs2178950 (TRPS1), rs1473 (PUM1), rs9825174 (XXYLT1), rs2047937 (ZNF423), rs17277372 (DNM3), and rs335170 (PRDM6)-associated with osteoporosis and obesity. Of these loci, the PUM1 gene was differentially expressed in osteoporosis-related cells (B lymphocytes) and obesity-related cells (adipocytes). WGCNA showed that PUM1 positively interacted with several known osteoporosis genes (AKAP11, JAG1, and SPTBN1). ZNF423 was the highly connected intramodular hub gene and interconnected with 21 known osteoporosis-related genes, including JAG1, EN1, and FAM3C.<h4>Conclusions</h4>Our study identified seven potentially pleiotropic genes associated with osteoporosis and obesity. The findings may provide new insights into a potential genetic determination and codetermination mechanism of osteoporosis and obesity.

Also flagged:betainepolyelectrolytesheparinchitosanpolycationpolyester
Journal Article 2018-01-01 No Snippets Hwang MP, Ding X, Gao J, Acharya AP, Little SR, Wang Y.
Show Full Abstract

The aqueous nature of complex coacervates provides a biologically-relevant context for various therapeutic applications. In this sense, biological applications demand a corresponding level of biocompatibility from the polyelectrolytes that participate in complex coacervation. Continued development with naturally-occurring polyelectrolytes such as heparin and chitosan underscore such aims. Herein, we design a synthetic polycation, in which betaine is conjugated to a biodegradable polyester backbone. Betaine is a naturally-occurring methylated amino acid that is ubiquitously present in human plasma. Inspired by its vast range of benefits - including but not limited to anti-inflammation, anti-cancer, anti-bacterial, anti-oxidant, protein stabilization, and cardiovascular health - we aim to impart additional functionality to a polycation for eventual use in a complex coacervate with heparin. We report on its in vitro and in vivo biocompatibility, in vitro and in vivo effect on angiogenesis, in vitro effect on microbial growth, and ability to form complex coacervates with heparin.

Also flagged:behavioralanxiety-related disordersacute-phase proteinsmajor depressive disorderbipolar disorderanxiety disorders
Journal Article 2018-01-01 ✓ 1 Snippet Felger JC.
In-Text Gene Mentions

…the 5-HT transporter (5-HTT) [ 291 -…

Show Full Abstract

<h4>Background</h4>Studies investigating the impact of a variety of inflammatory stimuli on the brain and behavior have reported evidence that inflammation and release of inflammatory cytokines affect circuitry relevant to both reward and threat sensitivity to contribute to behavioral change. Of relevance to mood and anxiety-related disorders, biomarkers of inflammation such as inflammatory cytokines and acute-phase proteins are reliably elevated in a significant proportion of patients with major depressive disorder (MDD), bipolar disorder, anxiety disorders and post-traumatic stress disorder (PTSD).<h4>Methods</h4>This review summarized clinical and translational work demonstrating the impact of peripheral inflammation on brain regions and neurotransmitter systems relevant to both reward and threat sensitivity, with a focus on neuroimaging studies involving administration of inflammatory stimuli. Recent translation of these findings to further understand the role of inflammation in mood and anxiety-related disorders is also discussed.<h4>Results</h4>Inflammation was consistently found to affect basal ganglia and cortical reward and motor circuits to drive reduced motivation and motor activity, as well as anxiety-related brain regions including amygdala, insula and anterior cingulate cortex, which may result from cytokine effects on monoamines and glutamate. Similar relationships between inflammation and altered neurocircuitry have been observed in MDD patients with increased peripheral inflammatory markers, and such work is on the horizon for anxiety disorders and PTSD.<h4>Conclusion</h4>Neuroimaging effects of inflammation on reward and threat circuitry may be used as biomarkers of inflammation for future development of novel therapeutic strategies to better treat mood and anxiety-related disorders in patients with high inflammation.

Also flagged:transcription factorsCdx2EomesSox2NanogNotch
Journal Article 2018-01-01 No Snippets Cui W, Mager J.
Show Full Abstract

The successful development from a single-cell zygote into a complex multicellular organism requires precise coordination of multiple cell-fate decisions. The very first of these is lineage specification into the inner cell mass (ICM) and trophectoderm (TE) during mammalian preimplantation development. In mouse embryos, transcription factors (TFs) such as Oct4, Sox2, and Nanog are enriched in cells of ICM, which gives rise to the fetus and yolk sac. Conversely, TFs such as Cdx2 and Eomes become highly upregulated in TE, which contribute to the placenta. Here, we review the current understanding of key transcriptional control mechanisms and genes responsible for these distinct differences during the first cell lineage specification. In particular, we highlight recent insights gained through advances in genome manipulation, live imaging, single-cell transcriptomics, and loss-of-function studies.

Also flagged:mucopolysaccharidosis IIIBlysosomal storage diseaseα-N-acetylglucosaminidaseNAGLUdegradationglycosaminoglycan
Journal Article 2018-01-01 No Snippets Holley RJ, Ellison SM, Fil D, O'Leary C, McDermott J, Senthivel N, Langford-Smith AWW, Wilkinson FL, D'Souza Z, Parker H, Liao A, Rowlston S, Gleitz HFE, Kan SH, Dickson PI, Bigger BW.
Show Full Abstract

Mucopolysaccharidosis IIIB is a paediatric lysosomal storage disease caused by deficiency of the enzyme α-N-acetylglucosaminidase (NAGLU), involved in the degradation of the glycosaminoglycan heparan sulphate. Absence of NAGLU leads to accumulation of partially degraded heparan sulphate within lysosomes and the extracellular matrix, giving rise to severe CNS degeneration with progressive cognitive impairment and behavioural problems. There are no therapies. Haematopoietic stem cell transplant shows great efficacy in the related disease mucopolysaccharidosis I, where donor-derived monocytes can transmigrate into the brain following bone marrow engraftment, secrete the missing enzyme and cross-correct neighbouring cells. However, little neurological correction is achieved in patients with mucopolysaccharidosis IIIB. We have therefore developed an ex vivo haematopoietic stem cell gene therapy approach in a mouse model of mucopolysaccharidosis IIIB, using a high-titre lentiviral vector and the myeloid-specific CD11b promoter, driving the expression of NAGLU (LV.NAGLU). To understand the mechanism of correction we also compared this with a poorly secreted version of NAGLU containing a C-terminal fusion to IGFII (LV.NAGLU-IGFII). Mucopolysaccharidosis IIIB haematopoietic stem cells were transduced with vector, transplanted into myeloablated mucopolysaccharidosis IIIB mice and compared at 8 months of age with mice receiving a wild-type transplant. As the disease is characterized by increased inflammation, we also tested the anti-inflammatory steroidal agent prednisolone alone, or in combination with LV.NAGLU, to understand the importance of inflammation on behaviour. NAGLU enzyme was substantially increased in the brain of LV.NAGLU and LV.NAGLU-IGFII-treated mice, with little expression in wild-type bone marrow transplanted mice. LV.NAGLU treatment led to behavioural correction, normalization of heparan sulphate and sulphation patterning, reduced inflammatory cytokine expression and correction of astrocytosis, microgliosis and lysosomal compartment size throughout the brain. The addition of prednisolone improved inflammatory aspects further. Substantial correction of lysosomal storage in neurons and astrocytes was also achieved in LV.NAGLU-IGFII-treated mice, despite limited enzyme secretion from engrafted macrophages in the brain. Interestingly both wild-type bone marrow transplant and prednisolone treatment alone corrected behaviour, despite having little effect on brain neuropathology. This was attributed to a decrease in peripheral inflammatory cytokines. Here we show significant neurological disease correction is achieved using haematopoietic stem cell gene therapy, suggesting this therapy alone or in combination with anti-inflammatories may improve neurological function in patients.

Also flagged:transglutaminase 2pathogenesisneurodegenerative diseasesamyotrophic lateral sclerosisTG2GTPase
Journal Article 2018-01-01 ✓ 5 Snippets Min B, Chung KC.
In-Text Gene Mentions

A part of this HTT (IT15) gene product contains the characteristic cytosine-adenine-guanine (CAG) sequence, which is repeated about 40 times or more and so, it is called to as a trinucleotide repeat.

Studies in a R6/2-HD transgenic mouse model expressing exon 1 of the human HTT gene with an increased CAG repeat length and an additional TG2-knockout (R6/2-TG2−/−) models show a large decrease in cell death and prolongation of survival (15–20%) (70).

The HD-causing mutation gene, huntingtin (HTT), is located on the chromosome 4.

…part of thisHTT(IT15) gene product…

…that the mutantHTTprotein colocalizes with…

Show Full Abstract

Formation of toxic protein aggregates is a common feature and mainly contributes to the pathogenesis of neurodegenerative diseases (NDDs), which include amyotrophic lateral sclerosis (ALS), Alzheimer's, Parkinson's, Huntington's, and prion diseases. The transglutaminase 2 (TG2) gene encodes a multifunctional enzyme, displaying four types of activity, such as transamidation, GTPase, protein disulfide isomerase, and protein kinase activities. Many studies demonstrated that the calcium-dependent transamidation activity of TG2 affects the formation of insoluble and toxic amyloid aggregates that mainly consisted of NDD-related proteins. So far, many important and NDD-related substrates of TG2 have been identified, including amlyoid-β, tau, α-synuclein, mutant huntingtin, and ALS-linked trans-activation response (TAR) DNA-binding protein 43. Recently, the formation of toxic inclusions mediated by several TG2 substrates were efficiently inhibited by TG2 inhibitors. Therefore, the development of highly specific TG2 inhibitors would be an important tool in alleviating the progression of TG2-related brain disorders. In this review, the authors discuss recent advances in TG2 biochemistry, several mechanisms of molecular regulation and pleotropic signaling functions, and the presumed role of TG2 in the progression of many NDDs. [BMB Reports 2018; 51(1): 5-13].

Also flagged:Orphan GPCRsGPCRsGPR34
Journal Article 2018-01-01 ✓ 1 Snippet Diaz C, Angelloz-Nicoud P, Pihan E.
In-Text Gene Mentions

…for two oGPCRs,GPR52and GPR34.…

Show Full Abstract

Despite tremendous efforts, approximately 120 GPCRs remain orphan. Their physiological functions and their potential roles in diseases are poorly understood. Orphan GPCRs are extremely important because they may provide novel therapeutic targets for unmet medical needs. As a complement to experimental approaches, molecular modeling and virtual screening are efficient techniques to discover synthetic surrogate ligands which can help to elucidate the role of oGPCRs. Constitutively activated mutants and recently published active structures of GPCRs provide stimulating opportunities for building active molecular models for oGPCRs and identifying activators using virtual screening of compound libraries. We describe the molecular modeling and virtual screening process we have applied in the discovery of surrogate ligands, and provide examples for CCKA, a simulated oGPCR, and for two oGPCRs, GPR52 and GPR34.

Also flagged:TGF-βembryogenesistissue homeostasisascancerimmune diseases
Journal Article 2018-01-01 No Snippets Kashima R, Hata A.
Show Full Abstract

The TGF-β superfamily signaling is involved in a variety of biological processes during embryogenesis and in adult tissue homeostasis. Faulty regulation of the signaling pathway that transduces the TGF-β superfamily signals accordingly leads to a number of ailments, such as cancer and cardiovascular, metabolic, urinary, intestinal, skeletal, and immune diseases. In recent years, a number of studies have elucidated the essential roles of TGF-βs and BMPs during neuronal development in the maintenance of appropriate innervation and neuronal activity. The new advancement implicates significant roles of the aberrant TGF-β superfamily signaling in the pathogenesis of neurological disorders. In this review, we compile a number of reports implicating the deregulation of TGF-β/BMP signaling pathways in the pathogenesis of cognitive and neurodegenerative disorders in animal models and patients. We apologize in advance that the review falls short of providing details of the role of TGF-β/BMP signaling or mechanisms underlying the pathogenesis of neurological disorders. The goal of this article is to reveal a gap in our knowledge regarding the association between TGF-β/BMP signaling pathways and neuronal tissue homeostasis and development and facilitate the research with a potential to develop new therapies for neurological ailments by modulating the pathways.

Also flagged:Amyotrophic lateral sclerosisALSfrontotemporal dementiaC9orf72RNA binding proteinssynaptic transmission
Journal Article 2018-01-01 ✓ 1 Snippet Umoh ME, Dammer EB, Dai J, Duong DM, Lah JJ, Levey AI, Gearing M, Glass JD, Seyfried NT.
In-Text Gene Mentions

…and peroxiredoxin 6 (PRDX6).…

Show Full Abstract

Amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are neurodegenerative diseases with overlap in clinical presentation, neuropathology, and genetic underpinnings. The molecular basis for the overlap of these disorders is not well established. We performed a comparative unbiased mass spectrometry-based proteomic analysis of frontal cortical tissues from postmortem cases clinically defined as ALS, FTD, ALS and FTD (ALS/FTD), and controls. We also included a subset of patients with the C9orf72 expansion mutation, the most common genetic cause of both ALS and FTD Our systems-level analysis of the brain proteome integrated both differential expression and co-expression approaches to assess the relationship of these differences to clinical and pathological phenotypes. Weighted co-expression network analysis revealed 15 modules of co-expressed proteins, eight of which were significantly different across the ALS-FTD disease spectrum. These included modules associated with RNA binding proteins, synaptic transmission, and inflammation with cell-type specificity that showed correlation with TDP-43 pathology and cognitive dysfunction. Modules were also examined for their overlap with TDP-43 protein-protein interactions, revealing one module enriched with RNA-binding proteins and other causal ALS genes that increased in FTD/ALS and FTD cases. A module enriched with astrocyte and microglia proteins was significantly increased in ALS cases carrying the C9orf72 mutation compared to sporadic ALS cases, suggesting that the genetic expansion is associated with inflammation in the brain even without clinical evidence of dementia. Together, these findings highlight the utility of integrative systems-level proteomic approaches to resolve clinical phenotypes and genetic mechanisms underlying the ALS-FTD disease spectrum in human brain.

Also flagged:nucleotidesRNA polymerase IIbiosynthesisbindingchromatinRNA-binding proteins
Journal Article 2018-01-01 ✓ 1 Snippet Wu SM, Liu H, Huang PJ, Chang IY, Lee CC, Yang CY, Tsai WS, Tan BC.
In-Text Gene Mentions

…RNA-binding proteins andchromatin modifiersmodifiers).…

Show Full Abstract

<h4>Background</h4>Despite their lack of protein-coding potential, long noncoding RNAs (lncRNAs) and circular RNAs (circRNAs) have emerged as key determinants in gene regulation, acting to fine-tune transcriptional and signaling output. These noncoding RNA transcripts are known to affect expression of messenger RNAs (mRNAs) via epigenetic and post-transcriptional regulation. Given their widespread target spectrum, as well as extensive modes of action, a complete understanding of their biological relevance will depend on integrative analyses of systems data at various levels.<h4>Findings</h4>While a handful of publicly available databases have been reported, existing tools do not fully capture, from a network perspective, the functional implications of lncRNAs or circRNAs of interest. Through an integrated and streamlined design, circlncRNAnet aims to broaden the understanding of ncRNA candidates by testing in silico several hypotheses of ncRNA-based functions, on the basis of large-scale RNA-seq data. This web server is implemented with several features that represent advances in the bioinformatics of ncRNAs: (1) a flexible framework that accepts and processes user-defined next-generation sequencing-based expression data; (2) multiple analytic modules that assign and productively assess the regulatory networks of user-selected ncRNAs by cross-referencing extensively curated databases; (3) an all-purpose, information-rich workflow design that is tailored to all types of ncRNAs. Outputs on expression profiles, co-expression networks and pathways, and molecular interactomes, are dynamically and interactively displayed according to user-defined criteria.<h4>Conclusions</h4>In short, users may apply circlncRNAnet to obtain, in real time, multiple lines of functionally relevant information on circRNAs/lncRNAs of their interest. In summary, circlncRNAnet provides a "one-stop" resource for in-depth analyses of ncRNA biology. circlncRNAnet is freely available at http://app.cgu.edu.tw/circlnc/.

Also flagged:thiazolebindingpolyamidesalkylpolyamideimidazole
Journal Article 2018-01-01 No Snippets Padroni G, Parkinson JA, Fox KR, Burley GA.
Show Full Abstract

This manuscript reports the molecular basis for double-stranded DNA (dsDNA) binding of hairpin polyamides incorporating a 5-alkyl thiazole (Nt) unit. Hairpin polyamides containing an N-terminal Nt unit induce higher melting stabilisation of target dsDNA sequences relative to an archetypical hairpin polyamide incorporating an N-terminal imidazole (Im) unit. However, modification of the N-terminus from Im to Nt-building blocks results in an increase in dsDNA binding affinity but lower G-selectivity. A general G-selectivity trend is observed for Nt-containing polyamide analogues. G-selectivity increases as the steric bulk in the Nt 5-position increases. Solution-based NMR structural studies reveal differences in the modulation of the target DNA duplex of Nt-containing hairpin polyamides relative to the Im-containing archetype. A structural hallmark of an Nt polyamide•dsDNA complex is a more significant degree of major groove compression of the target dsDNA sequence relative to the Im-containing hairpin polyamide.

Also flagged:NTN1congenital hypogonadotropic hypogonadismGnRHgenetic diseasepubertyinfertility
Journal Article 2018-01-01 ✓ 5 Snippets Bouilly J, Messina A, Papadakis G, Cassatella D, Xu C, Acierno JS, Tata B, Sykiotis G, Santini S, Sidis Y, Elowe-Gruau E, Phan-Hug F, Hauschild M, Bouloux PM, Quinton R, Lang-Muritano M, Favre L, Marino L, Giacobini P, Dwyer AA, Niederländer NJ, Pitteloud N.
In-Text Gene Mentions

This study implicates DCC and NTN1 mutations in the pathophysiology of CHH consistent with the role of these two genes in the ontogeny of GnRH neurons in mice.

DCC/NTN1 complex mutations in patients with congenital hypogonadotropic hypogonadism impair GnRH neuron development.

DCC/NTN1 complex mutations in…

…in colorectal cancer (DCC) and its ligand…

…confirmed five heterozygousDCCmutations in 6…

Show Full Abstract

Congenital hypogonadotropic hypogonadism (CHH) is a rare genetic disease characterized by absent puberty and infertility due to GnRH deficiency, and is often associated with anosmia [Kallmann syndrome (KS)]. The genetic etiology of CHH is heterogeneous, and more than 30 genes have been implicated in approximately 50% of patients with CHH. We hypothesized that genes encoding axon-guidance proteins containing fibronectin type-III (FN3) domains (similar to ANOS1, the first gene associated with KS), are mutated in CHH. We performed whole-exome sequencing in a cohort of 133 CHH probands to test this hypothesis, and identified rare sequence variants (RSVs) in genes encoding for the FN3-domain encoding protein deleted in colorectal cancer (DCC) and its ligand Netrin-1 (NTN1). In vitro studies of these RSVs revealed altered intracellular signaling associated with defects in cell morphology, and confirmed five heterozygous DCC mutations in 6 probands-5 of which presented as KS. Two KS probands carry heterozygous mutations in both DCC and NTN1 consistent with oligogenic inheritance. Further, we show that Netrin-1 promotes migration in immortalized GnRH neurons (GN11 cells). This study implicates DCC and NTN1 mutations in the pathophysiology of CHH consistent with the role of these two genes in the ontogeny of GnRH neurons in mice.

Also flagged:Neurodegenerative diseasespolyglutamine expansion disordersHuntington's diseasespinocerebellar ataxiaAlzheimer's diseasefronto-temporal dementia
Journal Article 2018-01-01 No Snippets Zarouchlioti C, Parfitt DA, Li W, Gittings LM, Cheetham ME.
Show Full Abstract

Maintenance of protein homeostasis is vitally important in post-mitotic cells, particularly neurons. Neurodegenerative diseases such as polyglutamine expansion disorders-like Huntington's disease or spinocerebellar ataxia (SCA), Alzheimer's disease, fronto-temporal dementia (FTD), amyotrophic lateral sclerosis (ALS) and Parkinson's disease-are often characterized by the presence of inclusions of aggregated protein. Neurons contain complex protein networks dedicated to protein quality control and maintaining protein homeostasis, or proteostasis. Molecular chaperones are a class of proteins with prominent roles in maintaining proteostasis, which act to bind and shield hydrophobic regions of nascent or misfolded proteins while allowing correct folding, conformational changes and enabling quality control. There are many different families of molecular chaperones with multiple functions in proteostasis. The DNAJ family of molecular chaperones is the largest chaperone family and is defined by the J-domain, which regulates the function of HSP70 chaperones. DNAJ proteins can also have multiple other protein domains such as ubiquitin-interacting motifs or clathrin-binding domains leading to diverse and specific roles in the cell, including targeting client proteins for degradation via the proteasome, chaperone-mediated autophagy and uncoating clathrin-coated vesicles. DNAJ proteins can also contain ER-signal peptides or mitochondrial leader sequences, targeting them to specific organelles in the cell. In this review, we discuss the multiple roles of DNAJ proteins and in particular focus on the role of DNAJ proteins in protecting against neurodegenerative diseases caused by misfolded proteins. We also discuss the role of DNAJ proteins as direct causes of inherited neurodegeneration via mutations in <i>DNAJ</i> family genes.This article is part of the theme issue 'Heat shock proteins as modulators and therapeutic targets of chronic disease: an integrated perspective'.

Also flagged:InsulinSecretionglucosesecretory granulesion channelscytoplasmic
Journal Article 2018-01-01 No Snippets Rorsman P, Ashcroft FM.
Show Full Abstract

The pancreatic β-cell plays a key role in glucose homeostasis by secreting insulin, the only hormone capable of lowering the blood glucose concentration. Impaired insulin secretion results in the chronic hyperglycemia that characterizes type 2 diabetes (T2DM), which currently afflicts >450 million people worldwide. The healthy β-cell acts as a glucose sensor matching its output to the circulating glucose concentration. It does so via metabolically induced changes in electrical activity, which culminate in an increase in the cytoplasmic Ca<sup>2+</sup> concentration and initiation of Ca<sup>2+</sup>-dependent exocytosis of insulin-containing secretory granules. Here, we review recent advances in our understanding of the β-cell transcriptome, electrical activity, and insulin exocytosis. We highlight salient differences between mouse and human β-cells, provide models of how the different ion channels contribute to their electrical activity and insulin secretion, and conclude by discussing how these processes become perturbed in T2DM.

Also flagged:chromosomechromatinchromosomestype 2 diabetesobesitycoronary artery disease
Journal Article 2018-01-01 No Snippets Fish AE, Crawford DC, Capra JA, Bush WS.
Show Full Abstract

Genomic maps of local ancestry identify ancestry transitions - points on a chromosome where recent recombination events in admixed individuals have joined two different ancestral haplotypes. These events bring together alleles that evolved within separate continential populations, providing a unique opportunity to evaluate the joint effect of these alleles on health outcomes. In this work, we evaluate the impact of genetic variants in the context of nearby local ancestry transitions within a sample of nearly 10,000 adults of African ancestry with traits derived from electronic health records. Genetic data was located using the Metabochip, and used to derive local ancestry. We develop a model that captures the effect of both single variants and local ancestry, and use it to identify examples where local ancestry transitions significantly interact with nearby variants to influence metabolic traits. In our most compelling example, we find that the minor allele of rs16890640 occuring on a European background with a downstream local ancestry transition to African ancestry results in significantly lower mean corpuscular hemoglobin and volume. This finding represents a new way of discovering genetic interactions, and is supported by molecular data that suggest changes to local ancestry may impact local chromatin looping.

Also flagged:Colorectal Adenomametabolic syndromecolorectal cancernonalcoholic fatty liver diseasecolorectal adenomasglucose
Journal Article 2018-01-01 ✓ 1 Snippet Ze EY, Kim BJ, Jun DH, Kim JG, Kang H, Lee DY.
In-Text Gene Mentions

…disease, such ashemochromatosis, α-1 antitrypsin deficiency,…

Show Full Abstract

<h4>Background</h4>Nonalcoholic fatty liver disease, the hepatic manifestation of metabolic syndrome, is associated with increased risk of colorectal adenoma, a precursor of colorectal cancer. Because nonalcoholic fatty liver disease and colorectal adenoma share many common risk factors of metabolic syndrome, the association between these 2 pathological findings has been investigated in multiple studies, but the results have been conflicting.<h4>Objective</h4>The present study aimed to assess the relationship between the fatty liver index, a predictor of nonalcoholic fatty liver disease, and the prevalence of colorectal adenomas.<h4>Design</h4>This is a retrospective observational study.<h4>Settings</h4>This study was conducted at a single expert center.<h4>Patients</h4>A total of 2976 consecutive subjects over 40 years of age undergoing routine checkups including abdominal ultrasonography and colonoscopy at Chung-Ang University Hospital Health Care Center were included.<h4>Main outcome measures</h4>The primary outcome measured was the prevalence of colorectal adenomas according to fatty liver index.<h4>Results</h4>Among these subjects, 932 (31.3%) had colorectal adenoma, 691 (23.2%) had metabolic syndrome, and 1512 (50.8%) had fatty liver on ultrasonography. In multivariate analysis, fatty liver index ≥30 was associated with an increased risk of colorectal adenoma (OR, 1.269; 95% CI, 1.06-1.49; p = 0.008). The fatty liver index-high group (fatty liver index ≥30) had more colorectal adenomas and more advanced colorectal adenomas than the fatty liver index-low group (fatty liver index <30) (p < 0.001 and p = 0.042). The prevalence of colorectal adenomas increased with increasing quartile of fatty liver index (p < 0.05).<h4>Limitations</h4>The study was limited by a relatively healthy Asian population.<h4>Conclusion</h4>The high fatty liver index may be a useful predictor of colorectal adenoma. See Video Abstract at http://links.lww.com/DCR/A478.

Also flagged:mitochondriaamino acidsaminoacyl-tRNA synthetasescytoplasmicalanyl-tRNA synthetaseAlaRS
Journal Article 2018-01-01 ✓ 1 Snippet Hilander T, Zhou XL, Konovalova S, Zhang FP, Euro L, Chilov D, Poutanen M, Chihade J, Wang ED, Tyynismaa H.
In-Text Gene Mentions

…for mtAspRS byDars2knockout mouse (…

Show Full Abstract

Accuracy of protein synthesis is enabled by the selection of amino acids for tRNA charging by aminoacyl-tRNA synthetases (ARSs), and further enhanced by the proofreading functions of some of these enzymes for eliminating tRNAs mischarged with noncognate amino acids. Mouse models of editing-defective cytoplasmic alanyl-tRNA synthetase (AlaRS) have previously demonstrated the importance of proofreading for cytoplasmic protein synthesis, with embryonic lethal and progressive neurodegeneration phenotypes. Mammalian mitochondria import their own set of nuclear-encoded ARSs for translating critical polypeptides of the oxidative phosphorylation system, but the importance of editing by the mitochondrial ARSs for mitochondrial proteostasis has not been known. We demonstrate here that the human mitochondrial AlaRS is capable of editing mischarged tRNAs in vitro, and that loss of the proofreading activity causes embryonic lethality in mice. These results indicate that tRNA proofreading is essential in mammalian mitochondria, and cannot be overcome by other quality control mechanisms.

Also flagged:Traumatic Brain InjurydeathbehavioralplasminogenPLGantithrombin III
Journal Article 2018-01-01 ✓ 2 Snippets Cheng SX, Xu ZW, Yi TL, Sun HT, Yang C, Yu ZQ, Yang XS, Jin XH, Tu Y, Zhang S.
In-Text Gene Mentions

SERPINC1

ATIII

Show Full Abstract

This study aimed to investigate the effects of targeted temperature management (TTM) modulation on traumatic brain injury (TBI) and the involved mechanisms using quantitative proteomics technology. SH-SY5Y and HT-22 cells were subjected to moderate stretch injury using the cell injury controller (CIC), followed by incubation at TTM (mild hypothermia, 32°C), or normothermia (37°C). The real-time morphological changes, cell cycle phase distribution, death, and cell viability were evaluated. Moderate TBI was produced by the controlled cortical impactor (CCI), and the effects of TTM on the neurological damage, neurodegeneration, cerebrovascular histopathology, and behavioral outcome were determined in vivo. Results showed that TTM treatment prevented TBI-induced neuronal necrosis in the brain, achieved a substantial reduction in neuronal death both in vitro and in vivo, reduced cortical lesion volume and neuronal loss, attenuated cerebrovascular histopathological damage, brain edema, and improved behavioral outcome. Using an iTRAQ proteomics approach, proteins that were significantly associated with TTM in experimental TBI were identified. Importantly, changes in four candidate molecules (plasminogen [PLG], antithrombin III [AT III], fibrinogen gamma chain [FGG], transthyretin [TTR]) were verified using TBI rat brain tissues and TBI human cerebrospinal fluid (CSF) samples. This study is one of the first to investigate the neuroprotective effects of TTM on the proteome of human and experimental models of TBI, providing an overall landscape of the TBI brain proteome and a scientific foundation for further assessment of candidate molecules associated with TTM for the promotion of reparative strategies post-TBI.

Also flagged:PeptidesHydroxyapatitebiomineralizationmineralizationcollagenamelogenin
Journal Article 2018-01-01 No Snippets Iijima K, Hashizume M.
Show Full Abstract

<h4>Background</h4>Various types of proteins play important roles in the biomineralization of hydroxyapatite (HAp, Ca10(PO4)6(OH)2). The resulting organic-HAp nanohybrids have highlyorganized hierarchical structures that show unique morphological, structural, and mechanical properties. By mimicking the biomineralization process, organic-HAp hybrid materials have been created by utilizing proteins and peptides.<h4>Objectives</h4>In this review, firstly the roles of proteins in HAp mineralization in vivo are briefly explained. Recent progresses in the creation of organic-HAp hybrids through the utilization of proteins and peptides are then described.<h4>Results</h4>Roles of collagen and amelogenin on the formation of bones and teeth were explained. Then, recent advances, including those by the authors, in the creation of organic-HAp hybrids through the utilization of these proteins, their derivatives, and synthetic peptides, including engineering- isolated ones, were reviewed.<h4>Conclusion</h4>Organic-HAp hybrid materials have been intensively created by utilizing proteins and peptides. Among them, engineering-isolated or rationally designed peptides and their derivatives represent future promising building components for organic-HAp hybrids with precise hierarchical structures. Not only the excellent functions of the resultant hybrids materials, but also the creation of materials by biomimetic synthetic processes at a low cost and environmental burden are important for sustainable industrial development.

Also flagged:NEDD4-1phosphatase and tensin homolog deleted on chromosome 10PTENproteolysislung cancertumor
Journal Article 2018-01-01 ✓ 1 Snippet Song YH, Zhang CQ, Chen FF, Lin XY.
In-Text Gene Mentions

Tumor suppressor gene PTENsuppressor gene PTEN…

Show Full Abstract

<h4>Background</h4>The E3 ubiquitin ligase neural precursor cell expressed developmentally downregulated 4-1 (NEDD4-1) negatively regulates phosphatase and tensin homolog deleted on chromosome 10 (PTEN) protein levels through polyubiquitination and proteolysis, but its significance in lung cancer is still unclear. This study investigated the expression and the role of NEDD4-1 in tumor development and chemosensitivity of lung adenocarcinoma (ADC).<h4>Methods</h4>We retrospectively investigated the expression and significance of NEDD4-1, PTEN, and p-Akt proteins in 135 paired ADC and adjacent noncancerous tissue specimens using immunohistochemistry. Furthermore, we evaluated the relationship between NEDD4-1 expression and clinicopathologic characteristics and prognosis. The effects of small interfering RNA against NEDD4-1 on proliferation and chemosensitivity were examined in A549 cells in vitro using 3- (4,5-dimethylthiazol-2-yl) -5-(3-carboxymethoxyphenyl) -2-(4-sulfophenyl)- 2H-tetrazolium method. The ability of migration and invasion of A549 cells was tested by transwell assay. Moreover, reverse-transcription quantitative polymerase chain reaction and Western blotting analyses were used to determine the expression of NEDD4-1, PTEN, phosphoinositide 3-kinase (PI3K)/Akt activity, and its downstream target proteins.<h4>Results</h4>NEDD4-1 protein was significantly upregulated in lung ADC tissues, whereas it was weak or negative in normal lung epithelial cells. The expression of NEDD4-1 in ADC (78.5%, 106/135) was significantly much higher than that in adjacent normal lung tissue (13.3%, 29/135, P < 0.01), and it was associated with lymph node metastasis, tumor-node-metastasis (TNM) stage, and chemotherapy resistance. PTEN expression was downregulated in lung ADC (60.7% vs. 100.0% in noncancerous specimens, P = 0.007), and was negatively correlated with lymph node metastasis, histological variants, clinical stage, chemoresistance. In addition, expression of p-Akt in ADC tissues (71.1% 96/135) was much higher than that in adjacent lung epithelial cells (6.7%, 9/135, P < 0.01). Kaplan-Meier and multivariate analysis demonstrated that expressions of NEDD4-1 and PTEN were both independent risk factors for survival in patients with lung ADC. NEDD4-1 knockdown in vivo decreased proliferation, migration, and invasion and improved chemosensitivity to cisplatin and paclitaxel in A549 cells. NEDD4-1 knockdown also significantly enhanced PTEN expression and inhibited p-Akt activity and downstream target proteins.<h4>Conclusions</h4>NEDD4-1 upregulation may contribute to the progression of lung ADC. NEDD4-1 may regulate the proliferation, invasion, migration, and chemoresistance of lung ADC cells through the PI3K/Akt pathway, suggesting that it may be regarded as a therapeutic target for the treatment of lung ADC.

Also flagged:chromosomemyeloproliferative neoplasmsMPLSTATJAK1ruxolitinib
Journal Article 2018-01-01 No Snippets Bose P, Gotlib J, Harrison CN, Verstovsek S.
Show Full Abstract

The discovery of the activating Janus kinase (JAK)2<sup>V617F</sup> mutation in 2005 in most patients with the classic Philadelphia chromosome-negative myeloproliferative neoplasms (MPN) spurred intense interest in research into these disorders, culminating in the identification of activating mutations in MPL in 2006 and indels in the gene encoding calreticulin (CALR) in 2013, thus providing additional mechanistic explanations for the universal activation of JAK-signal transducer and activator of transcription (JAK-STAT) observed in these conditions, and the success of the JAK1/2 inhibitor ruxolitinib, which first received regulatory approval in 2011. The field has continued to advance rapidly since then, and the past 2 years have witnessed important changes to the classification of MPN and diagnostic criteria for polycythemia vera (PV), novel insights into the mechanisms of bone marrow fibrosis in primary myelofibrosis (PMF), increasing appreciation of the biologic differences between essential thrombocythemia (ET), prefibrotic and overt PMF, and between primary and post-PV/ET myelofibrosis (MF). Additionally, the mechanisms through which mutant CALR drives JAK-STAT pathway activation and oncogenic transformation are now better understood. Although mastocytosis is no longer included under the broad heading of MPN in the 2016 revision to the World Health Organization classification, an important milestone in mastocytosis research was reached in 2017 with the regulatory approval of midostaurin for patients with advanced systemic mastocytosis (AdvSM). In this article, we review the major recent developments in the areas of PV, ET, and MF, and also briefly summarize the literature on midostaurin and other KIT inhibitors for patients with AdvSM.

Also flagged:autoimmune hemolytic anemiathrombosiscavernous sinus thrombosisinfectious diseasesorbital cellulitisparanasal sinusitis
Journal Article 2018-01-01 ✓ 1 Snippet Rao R, Ali Y, Nagesh CP, Nair U.
In-Text Gene Mentions

…factor, protein-C, protein-S,antithrombin-III, elevated homocysteine level,…

Show Full Abstract

Superior ophthalmic vein (SOV) thrombosis is an uncommon orbital pathology that can present with sudden onset proptosis, conjunctival injection, and visual disturbance. SOV thrombosis is frequently secondary to a cavernous sinus pathology. A 32-year-old female with a known history of autoimmune hemolytic anemia presented with sudden painful proptosis left eye, and on imaging, she was found to have SOV thrombosis without cavernous sinus involvement. She was diagnosed with unilateral isolated SOV thrombosis and was managed conservatively. A careful history and clinical evaluation can help diagnose such rare disorders and initiate appropriate therapy.

Also flagged:cancerhistidinetumormethotrexategraphene oxidecopper sulfide nanocrystals
Journal Article 2018-01-01 No Snippets Zhang Q, Shan W, Ai C, Chen Z, Zhou T, Lv X, Zhou X, Ye S, Ren L, Wang X.
Show Full Abstract

To accomplish effective cancer imaging and integrated therapy, the multifunctional nanotheranostic Fe<sub>3</sub>O<sub>4</sub>-MTX@HBc core-shell nanoparticles (NPs) were designed. A straightforward method was demonstrated for efficient encapsulation of magnetic NPs into the engineered virus-like particles (VLPs) through the affinity of histidine tags for the methotrexate (MTX)-Ni<sup>2+</sup> chelate. HBc<sub>144</sub>-His VLPs shell could protect Fe<sub>3</sub>O<sub>4</sub>-MTX NPs from the recognition by the reticuloendothelial system as well as could increase their cellular uptake efficiency. Through our well-designed tactic, the photothermal efficiency of Fe<sub>3</sub>O<sub>4</sub> NPs were obviously improved <i>in vitro</i> and <i>in vivo</i> upon near-infrared (NIR) laser irradiation. Moreover, Magnetic resonance imaging (MRI) results showed that the Fe<sub>3</sub>O<sub>4</sub>-MTX@HBc core-shell NPs were reliable T<sub>2</sub>-type MRI contrast agents for tumor imaging. Hence the Fe<sub>3</sub>O<sub>4</sub>-MTX@HBc core-shell NPs may act as a promising theranostic platform for multimodal cancer treatment.

Also flagged:neuroticismchromosomeDepressionsynapsesynaptic transmissionmembrane
Journal Article 2018-01-01 ✓ 1 Snippet Turley P, Walters RK, Maghzian O, Okbay A, Lee JJ, Fontana MA, Nguyen-Viet TA, Wedow R, Zacher M, Furlotte NA, 23andMe Research Team, Social Science Genetic Association Consortium, Magnusson P, Oskarsson S, Johannesson M, Visscher PM, Laibson D, Cesarini D, Neale BM, Benjamin DJ.
In-Text Gene Mentions

…SNAP25 , andCACNA1Eall encode important…

Show Full Abstract

We introduce multi-trait analysis of GWAS (MTAG), a method for joint analysis of summary statistics from genome-wide association studies (GWAS) of different traits, possibly from overlapping samples. We apply MTAG to summary statistics for depressive symptoms (N <sub>eff</sub> = 354,862), neuroticism (N = 168,105), and subjective well-being (N = 388,538). As compared to the 32, 9, and 13 genome-wide significant loci identified in the single-trait GWAS (most of which are themselves novel), MTAG increases the number of associated loci to 64, 37, and 49, respectively. Moreover, association statistics from MTAG yield more informative bioinformatics analyses and increase the variance explained by polygenic scores by approximately 25%, matching theoretical expectations.

Also flagged:Serotonin TransporterRASAphthous StomatitisRecurrentdiseases of the oral cavityserotonin-transporter
Journal Article 2018-01-01 ✓ 5 Snippets Najafi S, Mohammadzadeh M, Zahedi A, Heidari M, Rezaei N.
In-Text Gene Mentions

The 5-HTT gene modulates the intensity and duration of serotonergic neurotransmission, thus, this gene polymorphism can influence the anxiety related behaviors 24,25.

The 5-HTT gene modulates the intensity and duration of serotonergic neurotransmission.Thus, this gene polymorphism can influence the anxiety related behaviors 21–24.

…serotonin-transporter gene (5-HTT) may affect…

…serotonin-transporter gene (5-HTT) 18 –…

…The5-HTTgene modulates the…

Show Full Abstract

<h4>Background</h4>Recurrent Aphthous Stomatitis (RAS) is one of the most common diseases of the oral cavity all over the world (5-66%). RAS has a multifactorial etiology, while psychological factors such as stress and anger play a role in its manifestation. The serotonergic mechanisms particularly the serotonin-transporter gene (<i>5-HTT</i>) may affect the risk of psychological alterations and stress response. The aim of the present study was to evaluate the polymorphism of the promoter region of <i>5-HTT</i> (<i>5-HTTLPR</i>) in the patients with RAS, compared to that in the control subjects.<h4>Methods</h4>In this case-control study, 100 patients with RAS and 100 healthy subjects were enrolled. PCR was performed on DNA of the samples, using a pair of primers capable of distinguishing S/L alleles and replicating <i>5-HTTLPR</i>.<h4>Results</h4>No statistically significant difference existed between LL and LS genotype frequencies in the case and control groups. However, SS genotype frequency was significantly higher in the case group, as compared to the control group (p=0.001).<h4>Conclusion</h4>The conclusion of the present study demonstrated that S allele could approximately double the risk of RAS.

Also flagged:antibodiescancersbreast cancersantibodycell surfacebreast cancer
Journal Article 2018-01-01 No Snippets Zhou Y, Zou H, Yau C, Zhao L, Hall SC, Drummond DC, Farr-Jones S, Park JW, Benz CC, Marks JD.
Show Full Abstract

We present a strategy to discover recombinant monoclonal antibodies (mAbs) to specific cancers and demonstrate this approach using basal subtype breast cancers. A phage antibody library was depleted of antibodies to common cell surface molecules by incubation with luminal breast cancer cell lines, and then selected on a single basal-like breast cancer cell line (MDA-MB-231) for binding associated receptor-mediated endocytosis. Additional profiling against two luminal and four basal-like cell lines revealed 61 unique basal-specific mAbs from a pool of 1440 phage antibodies. The unique mAbs were further screened on nine basal and seven luminal cell lines to identify those with the greatest affinity, specificity, and internalizing capability for basal-like breast cancer cells. Among the internalizing basal-specific mAbs were those recognizing four transmembrane receptors (EphA2, CD44, CD73 and EGFR), identified by immunoprecipitation-mass spectrometry and yeast-displayed antigen screening. Basal-like breast cancer expression of these four receptors was confirmed using a bioinformatic approach, and expression microarray data on 683 intrinsically subtyped primary breast tumors. This overall approach, which sequentially employs phage display antibody library selection, antigen identification and bioinformatic confirmation of antigen expression by cancer subtypes, offers efficient production of high-affinity mAbs with diagnostic and therapeutic utility against specific cancer subtypes.

Also flagged:mineralosteoporosisTBofcell growthSMAD
Journal Article 2018-01-01 ✓ 2 Snippets Medina-Gomez C, Kemp JP, Trajanoska K, Luan J, Chesi A, Ahluwalia TS, Mook-Kanamori DO, Ham A, Hartwig FP, Evans DS, Joro R, Nedeljkovic I, Zheng HF, Zhu K, Atalay M, Liu CT, Nethander M, Broer L, Porleifsson G, Mullin BH, Handelman SK, Nalls MA, Jessen LE, Heppe DHM, Richards JB, Wang C, Chawes B, Schraut KE, Amin N, Wareham N, Karasik D, Van der Velde N, Ikram MA, Zemel BS, Zhou Y, Carlsson CJ, Liu Y, McGuigan FE, Boer CG, Bønnelykke K, Ralston SH, Robbins JA, Walsh JP, Zillikens MC, Langenberg C, Li-Gao R, Williams FMK, Harris TB, Akesson K, Jackson RD, Sigurdsson G, den Heijer M, van der Eerden BCJ, van de Peppel J, Spector TD, Pennell C, Horta BL, Felix JF, Zhao JH, Wilson SG, de Mutsert R, Bisgaard H, Styrkársdóttir U, Jaddoe VW, Orwoll E, Lakka TA, Scott R, Grant SFA, Lorentzon M, van Duijn CM, Wilson JF, Stefansson K, Psaty BM, Kiel DP, Ohlsson C, Ntzani E, van Wijnen AJ, Forgetta V, Ghanbari M, Logan JG, Williams GR, Bassett JHD, Croucher PI, Evangelou E, Uitterlinden AG, Ackert-Bicknell CL, Tobias JH, Evans DM, Rivadeneira F.
In-Text Gene Mentions

SOX6

PLCL1

Show Full Abstract

Bone mineral density (BMD) assessed by DXA is used to evaluate bone health. In children, total body (TB) measurements are commonly used; in older individuals, BMD at the lumbar spine (LS) and femoral neck (FN) is used to diagnose osteoporosis. To date, genetic variants in more than 60 loci have been identified as associated with BMD. To investigate the genetic determinants of TB-BMD variation along the life course and test for age-specific effects, we performed a meta-analysis of 30 genome-wide association studies (GWASs) of TB-BMD including 66,628 individuals overall and divided across five age strata, each spanning 15 years. We identified variants associated with TB-BMD at 80 loci, of which 36 have not been previously identified; overall, they explain approximately 10% of the TB-BMD variance when combining all age groups and influence the risk of fracture. Pathway and enrichment analysis of the association signals showed clustering within gene sets implicated in the regulation of cell growth and SMAD proteins, overexpressed in the musculoskeletal system, and enriched in enhancer and promoter regions. These findings reveal TB-BMD as a relevant trait for genetic studies of osteoporosis, enabling the identification of variants and pathways influencing different bone compartments. Only variants in ESR1 and close proximity to RANKL showed a clear effect dependency on age. This most likely indicates that the majority of genetic variants identified influence BMD early in life and that their effect can be captured throughout the life course.

Also flagged:polystyrenecyclicolefinpolypropylenenickelaluminium
Journal Article 2018-01-01 No Snippets Lee UN, Su X, Guckenberger DJ, Dostie AM, Zhang T, Berthier E, Theberge AB.
Show Full Abstract

Microscale cell-based assays have demonstrated unique capabilities in reproducing important cellular behaviors for diagnostics and basic biological research. As these assays move beyond the prototyping stage and into biological and clinical research environments, there is a need to produce microscale culture platforms more rapidly, cost-effectively, and reproducibly. 'Rapid' injection molding is poised to meet this need as it enables some of the benefits of traditional high volume injection molding at a fraction of the cost. However, rapid injection molding has limitations due to the material and methods used for mold fabrication. Here, we characterize advantages and limitations of rapid injection molding for microfluidic device fabrication through measurement of key features for cell culture applications including channel geometry, feature consistency, floor thickness, and surface polishing. We demonstrate phase contrast and fluorescence imaging of cells grown in rapid injection molded devices and provide design recommendations to successfully utilize rapid injection molding methods for microscale cell-based assay development in academic laboratory settings.

Also flagged:gene expressionmethylationhistoneposttranslational modificationsnucleosomechromatin
Journal Article 2018-01-01 ✓ 1 Snippet Qureshi IA, Mehler MF.
In-Text Gene Mentions

HTT

Show Full Abstract

Epigenetic mechanisms act as control systems for modulating genomic structure and activity in response to evolving profiles of cell-extrinsic, cell-cell, and cell-intrinsic signals. These dynamic processes are responsible for mediating cell- and tissue-specific gene expression and function and gene-gene and gene-environmental interactions. The major epigenetic mechanisms include DNA methylation and hydroxymethylation; histone protein posttranslational modifications, nucleosome remodeling/repositioning, and higher-order chromatin reorganization; noncoding RNA regulation; and RNA editing. These mechanisms are intimately involved in executing fundamental genomic programs, including gene transcription, posttranscriptional RNA processing and transport, translation, X-chromosome inactivation, genomic imprinting, retrotransposon regulation, DNA replication, and DNA repair and the maintenance of genomic stability. For the nervous system, epigenetics offers a novel and robust framework for explaining how brain development and aging occur, neural cellular diversity is generated, synaptic and neural network connectivity and plasticity are mediated, and complex cognitive and behavioral phenotypes are inherited transgenerationally. Epigenetic factors and processes are, not surprisingly, implicated in nervous system disease pathophysiology through several emerging paradigms - mutations and genetic variation in genes encoding epigenetic factors; impairments in epigenetic factor expression, localization, and function; epigenetic mechanisms modulating disease-associated factors and pathways; and the presence of deregulated epigenetic profiles in central and peripheral tissues.

Also flagged:HuntingtinSecretionalbuminBSAextracellularGolgi
Journal Article 2018-01-01 ✓ 1 Snippet Trajkovic K, Jeong H, Krainc D.
In-Text Gene Mentions

Htt

Show Full Abstract

Quantitative analysis of proteins secreted from the cells poses a challenge due to their low abundance and the interfering presence of a large amount of bovine serum albumin (BSA) in the cell culture media. We established assays for detection of mutant huntingtin (mHtt) secreted from Neuro2A cell line stably expressing mHtt and rat primary cortical neurons by Western blotting. Our protocol is based on reducing the amounts of BSA in the media while maintaining cell viability and secretory potential, and concentrating the media prior to analysis by means of ultrafiltration.

Also flagged:Cell MigrationBRCA1breast cancerscancersMethylbreast cancer
Journal Article 2018-01-01 No Snippets Privat M, Rudewicz J, Sonnier N, Tamisier C, Ponelle-Chachuat F, Bignon YJ.
Show Full Abstract

Basal-like breast cancers are among the most aggressive cancers and effective targeted therapies are still missing. In order to identify new therapeutic targets, we performed Methyl-Seq and RNA-Seq of 10 breast cancer cell lines with different phenotypes. We confirmed that breast cancer subtypes cluster the RNA-Seq data but not the Methyl-Seq data. Basal-like tumor hypermethylated phenotype was not confirmed in our study but RNA-Seq analysis allowed to identify 77 genes significantly overexpressed in basal-like breast cancer cell lines. Among them, 48 were overexpressed in triple negative breast cancers of TCGA data. Some molecular functions were overrepresented in this candidate gene list. Genes involved in antioxydation, such as SOD1, MGST3 and PRDX or cadherin-binding genes, such as PFN1, ITGB1 and ANXA1, could thus be considered as basal like breast cancer biomarkers. We then sought if these genes were linked to BRCA1, since this gene is often inactivated in basal-like breast cancers. Nine genes were identified overexpressed in both basal-like breast cancer cells and BRCA1 mutated cells. Amongst them, at least 3 genes code for proteins implicated in epithelial cell migration and epithelial to mesenchymal transition (VIM, ITGB1 and RhoA). Our study provided several potential therapeutic targets for triple negative and BRCA1 mutated breast cancers. It seems that migration and mesenchymal properties acquisition of basal-like breast cancer cells is a key functional pathway in these tumors with a high metastatic potential.

Also flagged:PhototoxicityureaES2Cancerimmunodeficienttumors
Journal Article 2018-01-01 No Snippets Li X, Schumann C, Albarqi HA, Lee CJ, Alani AWG, Bracha S, Milovancev M, Taratula O, Taratula O.
Show Full Abstract

Fluorescence image-guided surgery combined with intraoperative therapeutic modalities has great potential for intraoperative detection of oncologic targets and eradication of unresectable cancer residues. Therefore, we have developed an activatable theranostic nanoplatform that can be used concurrently for two purposes: (1) tumor delineation with real-time near infrared (NIR) fluorescence signal during surgery, and (2) intraoperative targeted treatment to further eliminate unresected disease sites by non-toxic phototherapy. <b>Methods:</b> The developed nanoplatform is based on a single agent, silicon naphthalocyanine (SiNc), encapsulated in biodegradable PEG-PCL (poly (ethylene glycol)-<i>b</i>-poly(ɛ-caprolactone)) nanoparticles. It is engineered to be non-fluorescent initially via dense SiNc packing within the nanoparticle's hydrophobic core, with NIR fluorescence activation after accumulation at the tumor site. The activatable nanoplatform was evaluated <i>in vitro</i> and in two different murine cancer models, including an ovarian intraperitoneal metastasis-mimicking model. Furthermore, fluorescence image-guided surgery mediated by this nanoplatform was performed on the employed animal models using a Fluobeam<sup>®</sup> 800 imaging system. Finally, the phototherapeutic efficacy of the developed nanoplatform was demonstrated <i>in vivo</i>. <b>Results:</b> Our <i>in vitro</i> data suggest that the intracellular environment of cancer cells is capable of compromising the integrity of self-assembled nanoparticles and thus causes disruption of the tight dye packing inside the hydrophobic cores and activation of the NIR fluorescence. Animal studies demonstrated accumulation of activatable nanoparticles at the tumor site following systemic administration, as well as release and fluorescence recovery of SiNc from the polymeric carrier. It was also validated that the developed nanoparticles are compatible with the intraoperative imaging system Fluobeam® 800, and nanoparticle-mediated image-guided surgery provides successful resection of cancer tumors. Finally, <i>in vivo</i> studies revealed that combinatorial phototherapy mediated by the nanoparticles could efficiently eradicate chemoresistant ovarian cancer tumors. <b>Conclusion:</b> The revealed properties of the activatable nanoplatform make it highly promising for further application in clinical image-guided surgery and combined phototherapy, facilitating a potential translation to clinical studies.

Also flagged:myopiarefractive errorssyndromic myopiarefractivehyperopiarefractive error
Journal Article 2018-01-01 ✓ 3 Snippets Flitcroft DI, Loughman J, Wildsoet CF, Williams C, Guggenheim JA, CREAM Consortium.
In-Text Gene Mentions

While none of these genes showed a significant association with refractive error in the VEGAS analysis of the CREAM GWAS dataset, ZNF644 at the MYP21 locus is a member of the Krüppel C2H2-type zinc-finger protein family, and another member of this family, ZNF469, causes type 1 brittle cornea syndrome, which features blue sclera and myopia.

…), MYP21 (gene:ZNF644), MYP22 (gene:…

…CREAM GWAS dataset,ZNF644at the MYP21…

Show Full Abstract

<h4>Purpose</h4>To test the hypothesis that genes known to cause clinical syndromes featuring myopia also harbor polymorphisms contributing to nonsyndromic refractive errors.<h4>Methods</h4>Clinical phenotypes and syndromes that have refractive errors as a recognized feature were identified using the Online Mendelian Inheritance in Man (OMIM) database. One hundred fifty-four unique causative genes were identified, of which 119 were specifically linked with myopia and 114 represented syndromic myopia (i.e., myopia and at least one other clinical feature). Myopia was the only refractive error listed for 98 genes and hyperopia and the only refractive error noted for 28 genes, with the remaining 28 genes linked to phenotypes with multiple forms of refractive error. Pathway analysis was carried out to find biological processes overrepresented within these sets of genes. Genetic variants located within 50 kb of the 119 myopia-related genes were evaluated for involvement in refractive error by analysis of summary statistics from genome-wide association studies (GWAS) conducted by the CREAM Consortium and 23andMe, using both single-marker and gene-based tests.<h4>Results</h4>Pathway analysis identified several biological processes already implicated in refractive error development through prior GWAS analyses and animal studies, including extracellular matrix remodeling, focal adhesion, and axon guidance, supporting the research hypothesis. Novel pathways also implicated in myopia development included mannosylation, glycosylation, lens development, gliogenesis, and Schwann cell differentiation. Hyperopia was found to be linked to a different pattern of biological processes, mostly related to organogenesis. Comparison with GWAS findings further confirmed that syndromic myopia genes were enriched for genetic variants that influence refractive errors in the general population. Gene-based analyses implicated 21 novel candidate myopia genes (ADAMTS18, ADAMTS2, ADAMTSL4, AGK, ALDH18A1, ASXL1, COL4A1, COL9A2, ERBB3, FBN1, GJA1, GNPTG, IFIH1, KIF11, LTBP2, OCA2, POLR3B, POMT1, PTPN11, TFAP2A, ZNF469).<h4>Conclusions</h4>Common genetic variants within or nearby genes that cause syndromic myopia are enriched for variants that cause nonsyndromic, common myopia. Analysis of syndromic forms of refractive errors can provide new insights into the etiology of myopia and additional potential targets for therapeutic interventions.

Also flagged:Primary Liver CancersHepatocellular carcinomaintrahepatic cholangiocarcinomacancerdeathcarcinomas
Journal Article 2018-01-01 ✓ 5 Snippets Jiang K, Centeno BA.
In-Text Gene Mentions

The most frequent are the Wnt/β-catenin pathway16,17 and mutations in tumor protein 53 (TP53),14,18,19 Phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K)/Protein kinase B (AKT),20 suppressor of cytokine signaling-3 (SOCS3),21NF-κB,22,23 NF-κB essential-modulator (NEMO)/Inhibitor of nuclear factor kappa-B kinase subunit gamma (IKK-γ)24, P16,25,26 Myelocytomatosis Viral Oncogene Homolog (MYC),27,28 and human hemochromatosis (HFE).29,30 Abnormally activated Wnt-β-catenin and Hedgehog pathways are causes of altered cellular proliferation in HCC, with aberrant accumulation of β-catenin in HCC cell nuclei.17 Furthermore, aberrant Wnt signaling has been implicated in the malignant transformation of preneoplastic hepatic adenomas.

Deletion or silencing of the SOCS3 gene in the hepatocytes protects against hepatocellular apoptosis and promotes the activation of Signal transducer and activator of transcription 3 (STAT3), contributing to enhanced hepatitis-induced carcinogenesis.21 Moreover, signal transducer NF-κB enhances chemical exposure–related hepatocarcinogenesis via sustained c-Jun N-terminal kinase-1 (JNK1) activation and acts as a tumor promoter in inflammation-associated carcinogenesis.22 In hereditary hemochromatosis patients, penetrance of the HFE C282Y homozygous genotype has been determined to contribute to HCC development in male patients.29

…28 and humanhemochromatosis( HFE ).…

…human hemochromatosis (HFE).…

…penetrance of theHFEC282Y homozygous genotype…

Show Full Abstract

Hepatocellular carcinoma (HCC) and primary intrahepatic cholangiocarcinoma (ICC) have been increasing in incidence worldwide and are leading causes of cancer death. Studies of the molecular alterations leading to these carcinomas provide insights into the key mechanisms involved. A literature review was conducted to identify articles with information relevant to current understanding of the etiologies and molecular pathogenesis of HCC and ICC. Chronic inflammatory diseases are the key etiological risk factors for both HCC and ICC, although other diseases play a role, and for many ICCs, an underlying risk factor is not identified. Mutations in catenin beta 1 ( CTNBB1) and tumor protein 53 (P53) are the main genetic alterations in HCC. Isocitrate dehydrogenases 1 and 2 (IDH1/2), KRAS protooncogene GTPase (KRAS), a RAS Viral Oncogene Homolog in neoroblastoma (NRAS) and P53 are primary genetic alterations in ICC. In both diseases, the mutational landscape is dependent on the underlying etiology. The most significant etiologies and genetic processes involved in the carcinogenesis of HCC and ICC are reviewed.

Also flagged:solid tumourchromosomeneuroblastomatumourMYCNoncogenes
Journal Article 2018-01-01 No Snippets Ho N, Peng H, Mayoh C, Liu PY, Atmadibrata B, Marshall GM, Li J, Liu T.
Show Full Abstract

Neuroblastoma, the most common solid tumour in early childhood, is characterized by very frequent chromosomal copy number variations (CNVs). While chromosome 2p amplification, 17q gain, 1p and 11q deletion in human neuroblastoma tissues are well-known, the exact frequencies and boundaries of the chromosomal CNVs have not been delineated. We analysed the publicly available single nucleotide polymorphism (SNP) array data which were originally generated by the Therapeutically Applicable Research to Generate Effective Treatments (TARGET) initiative, defined the frequencies and boundaries of chromosomes 2p11.2 - 2p25.3 amplification, 17q11.1-17q25.3 gain, 1p13.3-1p36.33 deletion and 11q13.3-11q25 deletion in neuroblastoma tissues, and identified chromosome 7q14.1 (Chr7:38254795-38346971) and chromosome 14q11.2 (Chr14:21637401-22024617) deletion in blood and bone marrow samples from neuroblastoma patients, but not in tumour tissues. Kaplan Meier analysis showed that double deletion of Chr7q14.1 and Chr14q11.2 correlated with poor prognosis in MYCN gene amplified neuroblastoma patients. In conclusion, the oncogenes amplified or gained and tumour suppressor genes deleted within the boundaries of chromosomal CNVs in tumour tissues should be studied for their roles in tumourigenesis and as therapeutic targets. Focal deletions of Chr7q14.1 and Chr14q11.2 together in blood and bone marrow samples from neuroblastoma patients can be used as a marker for poorer prognosis and more aggressive therapies.

Also flagged:Nociceptive Topognosisorganizationnetrin1 receptor
Journal Article 2018-01-01 ✓ 5 Snippets da Silva RV, Johannssen HC, Wyss MT, Roome RB, Bourojeni FB, Stifani N, Marsh APL, Ryan MM, Lockhart PJ, Leventer RJ, Richards LJ, Rosenblatt B, Srour M, Weber B, Zeilhofer HU, Kania A.
In-Text Gene Mentions

Furthermore, spinal cord-specific Dcc knockout animals displayed mislocalized licking responses to formalin injection, indicating impaired topognosis.

DCCIs Required for…

…the netrin1 receptorDCCin the spinal…

…thermore, spinal cord-specificDccknockout animals displayed…

…Similarly, humans withDCCmutations experience bilateral…

Show Full Abstract

Avoidance of environmental dangers depends on nociceptive topognosis, or the ability to localize painful stimuli. This is proposed to rely on somatotopic maps arising from topographically organized point-to-point connections between the body surface and the CNS. To determine the role of topographic organization of spinal ascending projections in nociceptive topognosis, we generated a conditional knockout mouse lacking expression of the netrin1 receptor DCC in the spinal cord. These mice have an increased number of ipsilateral spinothalamic connections and exhibit aberrant activation of the somatosensory cortex in response to unilateral stimulation. Furthermore, spinal cord-specific Dcc knockout animals displayed mislocalized licking responses to formalin injection, indicating impaired topognosis. Similarly, humans with DCC mutations experience bilateral sensation evoked by unilateral somatosensory stimulation. Collectively, our results constitute functional evidence of the importance of topographic organization of spinofugal connections for nociceptive topognosis.

Also flagged:primary liver diseaseLiver Cancerhepatocellular carcinomaViral hepatitistumorAFP
Journal Article 2018-01-01 ✓ 2 Snippets Ekinci O, Baran B, Ormeci AC, Soyer OM, Gokturk S, Evirgen S, Poyanli A, Gulluoglu M, Akyuz F, Karaca C, Demir K, Besisik F, Kaymakoglu S.
In-Text Gene Mentions

…alcoholic liver disease,hemochromatosis, Budd-Chiari syndrome, non-al…

…1 patient withhemochromatosis.…

Show Full Abstract

<h4>Aim</h4>To investigate clinical, etiological, and prognostic features in patients with hepatocellular carcinoma.<h4>Methods</h4>Patients with hepatocellular carcinoma who were followed-up from 2001 to 2011 were included in the study. The diagnosis was established by histopathological and/or radiological criteria. We retrospectively reviewed clinical and laboratory data, etiology of primary liver disease, imaging characteristics and treatments. Child-Pugh and Barcelona Clinic Liver Cancer stage was determined at initial diagnosis. Kaplan-Meier survival analysis was done to find out treatment effect on survival. Risk factors for vascular invasion and overall survival were investigated by multivariate Cox regression analyses.<h4>Results</h4>Five hundred and forty-five patients with hepatocellular carcinoma were included in the study. Viral hepatitis was prevalent and 68 patients either had normal liver or were non-cirrhotic. Overall median survival was 16 (13-19) mo. Presence of extrahepatic metastasis was associated with larger tumor size (OR = 3.19, 95%CI: 1.14-10.6). Independent predictor variables of vascular invasion were AFP (OR = 2.95, 95%CI: 1.38-6.31), total tumor diameter (OR = 3.14, 95%CI: 1.01-9.77), and hepatitis B infection (OR = 5.37, 95%CI: 1.23-23.39). Liver functional reserve, tumor size/extension, AFP level and primary treatment modality were independent predictors of overall survival. Transarterial chemoembolization (HR = 0.38, 95%CI: 0.28-0.51) and radioembolization (HR = 0.36, 95%CI: 0.18-0.74) provided a comparable survival benefit in the real life setting. Surgical treatments as resection and transplantation were found to be associated with the best survival compared with loco-regional treatments (log-rank, <i>P</i> < 0.001).<h4>Conclusion</h4>Baseline liver function, oncologic features including AFP level and primary treatment modality determines overall survival in patients with hepatocellular carcinoma.

Also flagged:Dual Binding Receptorautophagyendoplasmic reticulumER membrane proteinER-phagy receptorautophagy-related proteins
Journal Article 2018-01-01 ✓ 1 Snippet Mizushima N.
In-Text Gene Mentions

…ER membrane proteinCCPG1as an ER-phagy…

Show Full Abstract

Selective autophagy of the endoplasmic reticulum (ER)-ER-phagy-is mediated by multiple receptors. In this issue of Developmental Cell, Smith et al. (2018) identify ER membrane protein CCPG1 as an ER-phagy receptor that interacts with autophagy-related proteins GABARAPs and FIP200 and ensures ER protein homeostasis, especially in pancreatic acinar cells.

Also flagged:Huntington's DiseaseHDneurodegenerative diseasegenetic dementiaHuntingtinpolyglutamine
Journal Article 2018-01-01 No Snippets Ghosh R, Tabrizi SJ.
Show Full Abstract

Huntington's disease (HD) is the most common monogenic neurodegenerative disease and the commonest genetic dementia in the developed world. With autosomal dominant inheritance, typically mid-life onset, and unrelenting progressive motor, cognitive and psychiatric symptoms over 15-20 years, its impact on patients and their families is devastating. The causative genetic mutation is an expanded CAG trinucleotide repeat in the gene encoding the Huntingtin protein, which leads to a prolonged polyglutamine stretch at the N-terminus of the protein. Since the discovery of the gene over 20 years ago much progress has been made in HD research, and although there are currently no disease-modifying treatments available, there are a number of exciting potential therapeutic developments in the pipeline. In this chapter we discuss the epidemiology, genetics and pathogenesis of HD as well as the clinical presentation and management of HD, which is currently focused on symptomatic treatment. The principles of genetic testing for HD are also explained. Recent developments in therapeutics research, including gene silencing and targeted small molecule approaches are also discussed, as well as the search for HD biomarkers that will assist the validation of these potentially new treatments.

Also flagged:Acute respiratory distress syndromeARDScoagulationfibrinolysisacute respiratory failurepneumonia
Journal Article 2018-01-01 ✓ 1 Snippet Camprubí-Rimblas M, Tantinyà N, Bringué J, Guillamat-Prats R, Artigas A.
In-Text Gene Mentions

ATIII

Show Full Abstract

Acute respiratory distress syndrome (ARDS) presents a complex pathophysiology characterized by pulmonary activated coagulation and reduced fibrinolysis. Despite advances in supportive care of this syndrome, morbidity and mortality remains high, leading to the need of novel therapies to combat this disease. Focus these therapies in the inhibition of ARDS development pathophysiology is essential. Beneficial effects of anticoagulants in ARDS have been proved in preclinical and clinical trials, thanks to its anticoagulant and anti-inflammatory properties. Moreover, local administration by nebulization in the alveolar compartment increases local efficacy and does not produce systemic bleeding. In this review the coagulation and fibrinolytic pathway and its pharmacological targets to treat ARDS are summarized.

Also flagged:serotonin transporterPrader-Willi syndromeAffective psychosisphoton
Journal Article 2018-01-01 ✓ 2 Snippets Krishnadas R, Cooper SA, Nicol A, Pimlott S, Soni S, Holland AJ, McArthur L, Cavanagh J.
In-Text Gene Mentions

…n-stem serotonin transporter (5-HTT) availability in adult…

…genotype and brain-stem5-HTTavailability, implicating a…

Show Full Abstract

Prader-Willi syndrome (PWS) is a rare condition because of the deletion of paternal chromosomal material (del PWS), or a maternal uniparental disomy (mUPD PWS), at 15q11-13. Affective psychosis is more prevalent in mUPD PWS. We investigated the relationship between the two PWS genetic variants and brain-stem serotonin transporter (5-HTT) availability in adult humans. Mean brain-stem 5-HTT availability determined by [123I]-beta-CIT single photon emission tomography was lower in eight adults with mUPD PWS compared with nine adults with del PWS (mean difference -0.93, t = -2.85, P = 0.014). Our findings confirm an association between PWS genotype and brain-stem 5-HTT availability, implicating a maternally expressed/paternally imprinted gene, that is likely to account for the difference in psychiatric phenotypes between the PWS variants. Declaration of interest None.

Also flagged:Down syndromechromosomal disorderintellectual disabilitychromosomedementiatau
Journal Article 2018-01-01 ✓ 1 Snippet Lanzillotta C, Tramutola A, Meier S, Schmitt F, Barone E, Perluigi M, Di Domenico F, Abisambra JF.
In-Text Gene Mentions

Mrpl39

Show Full Abstract

Down syndrome (DS) is the most common chromosomal disorder and the leading genetic cause of intellectual disability in humans, which results from the triplication of chromosome 21. DS individuals have an increased risk of developing Alzheimer's disease (AD)-like pathology and dementia by the age of 40 due to the triplication of several genes involved in the formation of amyloid plaques and tau tangles. Further, DS and AD are characterized by the aberrant accumulation of unfolded/misfolded proteins resulting from over-burdened protein quality control systems. The accumulation of misfolded proteins in the endoplasmic reticulum (ER) triggers a cellular stress response called the unfolded protein response (UPR). Long-term activation of the UPR mediates neuronal dysfunction in AD. We hypothesized that the UPR is impacted in a mouse model of DS. To test this, we performed gene and protein expression analysis of ER stress markers in the Ts65Dn mouse model of DS at 3, 9, and 18 months. We identified activation of the PERK pathway in Ts65Dn DS mice at 3 months of age compared to euploid controls. We also determined that the early and overt UPR activation decreased with age, the UPR signal was significantly reduced by 18 months. Our data suggest that UPR activation in DS mouse models occurs early before consistent brain neurodegeneration and might be an essential contributor to dys-proteostasis.

Also flagged:malignanthemoglobinshemoglobinopathiesthrombophiliafamilial Mediterranean feverhereditary hemochromatosis
Journal Article 2018-01-01 ✓ 1 Snippet Sukarova-Angelovska E, Petlichkovski A.
In-Text Gene Mentions

…‐A, ‐B ‐hemochromatosis‐ Fanconi anemia…

Show Full Abstract

Genetics in Macedonia-Following the international trends.

Also flagged:proliferative vitreoretinopathydiabetic retinopathymacular edemasiliconvascular endothelial growth factorVEGF
Journal Article 2018-01-01 No Snippets Moon SW, Sun Y, Warther D, Huffman K, Freeman WR, Sailor MJ, Cheng L.
Show Full Abstract

Blinding retinal diseases become more epidemic as the population ages. These diseases, such as diabetic retinopathy and macular edema, are of chronic nature and require protracted drug presence at the disease site. A sustained intravitreal porous silicon delivery system with dexamethasone (pSiO<sub>2</sub>-COO-DEX) was evaluated in a new rabbit model of proliferative vitreoretinopathy (PVR) in a real treatment design. In contrast to the pretreatment design model, pSiO<sub>2</sub>-COO-DEX was intravitreally injected into the eyes with active inflammation. Subretinal injection of vascular endothelial growth factor (VEGF) and Matrigel induced a late-onset vitreoretinal inflammation that gradually developed into PVR. This method mimics the human disease better than PVR induced by either intravitreal cell injection or trauma. The pSiO<sub>2</sub>-COO-DEX intervened eyes had minimal PVR, while balanced saline solution or free dexamethasone intervened eyes had significantly more PVR formation. In addition, adding VEGF to the Matrigel for subretinal injection induced greater inflammation and retinal neovascularization in comparison to only Matrigel injected under the medullary ray. Clinical and pathological examinations, including fundus fluorescein angiography and optical coherence tomography, confirmed these changes. In the current study, neither subretinal injection of Matrigel or subretinal injection of VEGF and Matrigel induced choroidal neovascularization. However, the current PVR model demonstrates a chronic course with moderate severity, which may be useful for drug screening studies.

Also flagged:Hepatic HemosiderosisFerritinironbeta thalassemia majorpolymeraseBeta Thalassemia
Journal Article 2018-01-01 ✓ 5 Snippets Soltanpour MS, Davari K.
In-Text Gene Mentions

HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications and assessed the correlation of cardiac and hepatic hemosiderosis

HFE H63D and C282Y mutation did not differ significantly between patients with and without hepatic or cardiac hemosiderosis

HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications

…Ferritin Levels andHemochromatosisGene Mutations in…

…whether coinheritance ofHFEH63D or C282Y…

Show Full Abstract

<h4>Objectives</h4>Organ-specific hemosiderosis and iron overload complications are more serious and more frequent in some patients with beta thalassemia major (BTM) compared with others. We investigated whether coinheritance of HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications and assessed the correlation of cardiac and hepatic hemosiderosis with plasma ferritin levels.<h4>Methods</h4>We studied 60 patients with BTM with a mean age of 17.5±9.1 years from the Northwest of Iran. HFE gene mutations were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. Cardiac and hepatic hemosiderosis was assessed using T2*magnetic resonance imaging (MRI). Ferritin levels were measured using the enzyme immunoassay method.<h4>Results</h4>Ferritin levels showed a strong inverse correlation with hepatic T2*MRI values (r = -0.631, <i>p</i> = 0.001) but a poor correlation with cardiac T2*MRI values (r = -0.297, <i>p</i> = 0.044). The correlation between cardiac T2*MRI values and hepatic T2*MRI values was poor and insignificant (r = 0.287, <i>p</i> = 0.058). Genotype and allele distribution of HFE H63D and C282Y mutation did not differ significantly between patients with and without hepatic or cardiac hemosiderosis (<i>p</i> > 0.050). However, carriers of HFE 63D allele had significantly higher ferritin levels compared with non-carriers (1 903±993 vs. 992±683, <i>p</i> < 0.001).<h4>Conclusions</h4>Cardiac T2*MRI values showed a poor correlation with hepatic T2*MRI values and ferritin levels. Accurate assessment of cardiac iron overload in patients with BTM can only be done using the T2*MRI technique. Additionally, HFE H63D is a significant determinant factor for elevated ferritin levels in BTM patients.

Also flagged:DyslexiaDYX1C1transcription factorbindingDCDC2Doublecortin Domain Containing 2
Journal Article 2018-01-01 ✓ 1 Snippet Müller B, Boltze J, Czepezauer I, Hesse V, LEGASCREEN Consortium, Wilcke A, Kirsten H.
In-Text Gene Mentions

…expression levels ofCCPG1and PIGB in…

Show Full Abstract

An increasing number of genetic variants involved in dyslexia development were discovered during the last years, yet little is known about the molecular functional mechanisms of these SNPs. In this study we investigated whether dyslexia candidate SNPs have a direct, disease-specific effect on local expression levels of the assumed target gene by using a differential allelic expression assay. In total, 12 SNPs previously associated with dyslexia and related phenotypes were suitable for analysis. Transcripts corresponding to four SNPs were sufficiently expressed in 28 cell lines originating from controls and a family affected by dyslexia. We observed a significant effect of rs600753 on expression levels of DYX1C1 in forward and reverse sequencing approaches. The expression level of the rs600753 risk allele was increased in the respective seven cell lines from members of the dyslexia family which might be due to a disturbed transcription factor binding sites. When considering our results in the context of neuroanatomical dyslexia-specific findings, we speculate that this mechanism may be part of the pathomechanisms underlying the dyslexia-specific brain phenotype. Our results suggest that allele-specific DYX1C1 expression levels depend on genetic variants of rs600753 and contribute to dyslexia. However, these results are preliminary and need replication.

Also flagged:Huntington's DiseaseHDbrain atrophybehavioural
Journal Article 2018-01-01 ✓ 1 Snippet Kielar C, Morton AJ.
In-Text Gene Mentions

…expansion in theHTTgene that causes…

Show Full Abstract

The threshold of CAG repeat expansion in the HTT gene that causes HD is 36 CAG repeats, although 'superlong' expansions are found in individual neurons in postmortem brains. Previously, we showed that, compared to mice with <250 CAG repeats, onset of disease in R6/2 mice carrying superlong (>440) CAG repeat expansions was delayed, and disease progression was slower. Inclusion pathology also differed from 250 CAG repeat mice, being dominated by a novel kind of extranuclear neuronal inclusion (nENNI) that resembles a class of aggregate seen in patients with the adult onset form of HD. Here, we characterised neuropathology in R6/2 mice with >400 CAG repeats using light and electron microscopy. nENNIs were found with increased frequency and wider distribution with age. Some nENNIs appear to 'mature' as the disease develops, developing a multi-layered cored structure. Mice with superlong CAG repeats do not develop clinical signs until they are around 30-40 weeks of age, and they attain a normal life span (>2 years). Nevertheless, they show brain atrophy and unequivocal neuron loss from the striatum and cortex by 22 weeks of age, an age at which similar pathology is seen in 250 CAG repeat mice. Since this time-point is 'end stage' for a 250 CAG mouse, but very far (at least 18 months) from end stage for a >  440 CAG repeat mouse, our data confirm that the appearance of clinical signs, the formation of inclusions, and neurodegeneration are processes that progress independently. A better understanding of the relationship between CAG repeat length, neurodegenerative pathways, and clinical behavioural signs is essential, if we are to find strategies to delay or reverse the course of this disease.

Also flagged:TRPC1Calciumneurodegenerative disorderHuntingtintype 1 inositol 1,4,5-trisphosphate receptorendoplasmic reticulum
Journal Article 2018-01-01 ✓ 1 Snippet Wu J, Ryskamp D, Birnbaumer L, Bezprozvanny I.
In-Text Gene Mentions

Htt

Show Full Abstract

<h4>Background</h4>Huntington disease (HD) is a dominantly inherited neurodegenerative disorder caused by a CAG repeat expansion in the huntingtin gene. We previously discovered that mutant Huntingtin sensitizes type 1 inositol 1,4,5-trisphosphate receptor (InsP3R1) to InsP3. This causes calcium leakage from the endoplasmic reticulum (ER) and a compensatory increase in neuronal store-operated calcium (nSOC) entry. We previously demonstrated that supranormal nSOC leads to synaptic loss in striatal medium spiny neurons (MSNs) in YAC128 HD mice.<h4>Objective</h4>We sought to identify calcium channels supporting supranormal nSOC in HD MSNs and to validate these channels as potential therapeutic targets for HD.<h4>Methods</h4>Cortico-striatal cultures were established from wild type and YAC128 HD mice and the density of MSN spines was quantified. The expression of candidate nSOC components was suppressed by RNAi knockdown and by CRISPR/Cas9 knockout. TRPC1 knockout mice were crossed with YAC128 HD mice for evaluation of motor performance in a beamwalk assay.<h4>Results</h4>RNAi-mediated knockdown of TRPC1, TRPC6, Orai1, or Orai2, but not other TRPC isoforms or Orai3, rescued the density of YAC128 MSN spines. Knockdown of stromal interaction molecule 1 (STIM1), an ER calcium sensor and nSOC activator, also rescued YAC128 MSN spines. Knockdown of the same targets suppressed supranormal nSOC in YAC128 MSN spines. These channel subunits co-immunoprecipitated with STIM1 and STIM2 in synaptosomal lysates from mouse striata. Crossing YAC128 mice with TRPC1 knockout mice improved motor performance and rescued MSN spines in vitro and in vivo, indicating that inhibition of TRPC1 may serve as a neuroprotective strategy for HD treatment.<h4>Conclusions</h4>TRPC1 channels constitute a potential therapeutic target for treatment of HD.

Also flagged:Pridopidineneurodegenerative disorderHDgene expressionbehaviouraldopamine
Journal Article 2018-01-01 ✓ 4 Snippets Waters S, Tedroff J, Ponten H, Klamer D, Sonesson C, Waters N.
In-Text Gene Mentions

Animal studies exploiting regionally specific expression of mutant huntingtin suggest that cortical expression of htt is required for the complete HD phenotype to develop.

The pathogenetic impact of disrupted cortico-striatal connectivity for the HD phenotype has further been demonstrated in pre-clinical HD models, showing that expression of mutant htt in both the cortex and the striatum is required to develop the full pathological phenotype [115].

…the huntingtin (HTT) gene on…

…cortical expression ofhttis required for…

Show Full Abstract

Despite advances in understanding the pathophysiology of Huntington's disease (HD), there are currently no effective pharmacological agents available to treat core symptoms or to stop or prevent the progression of this hereditary neurodegenerative disorder. Pridopidine, a novel small molecule compound, has demonstrated potential for both symptomatic treatment and disease modifying effects in HD. While pridopidine failed to achieve its primary efficacy outcomes (Modified motor score) in two trials (MermaiHD and HART) there were consistent effects on secondary outcomes (TMS). In the most recent study (PrideHD) pridiopidine did not differ from placebo on TMS, possibly due to a large enduring placebo effect.This review describes the process, based on in vivo systems response profiling, by which pridopidine was discovered and discusses its pharmacological profile, aiming to provide a model for the system-level effects, and a rationale for the use of pridopidine in patients affected by HD. Considering the effects on brain neurochemistry, gene expression and behaviour in vivo, pridopidine displays a unique effect profile. A hallmark feature in the behavioural pharmacology of pridopidine is its state-dependent inhibition or activation of dopamine-dependent psychomotor functions. Such effects are paralleled by strengthening of synaptic connectivity in cortico-striatal pathways suggesting pridopidine has potential to modify phenotypic expression as well as progression of HD. The preclinical pharmacological profile is discussed with respect to the clinical results for pridopidine, and proposals are made for further investigation, including preclinical and clinical studies addressing disease progression and effects at different stages of HD.

Also flagged:synapsesDARPP-32HDsynapsesynaptic cleftAMPA receptor
Journal Article 2018-01-01 ✓ 5 Snippets Kovalenko M, Milnerwood A, Giordano J, St Claire J, Guide JR, Stromberg M, Gillis T, Sapp E, DiFiglia M, MacDonald ME, Carroll JB, Lee JM, Tappan S, Raymond L, Wheeler VC.
In-Text Gene Mentions

HttQ111 /+ Huntington’s…

…Objective: To useHttCAG knock-in mice,…

HttQ 111 /+…

…that a singleHttQ 111 allele…

…the creation ofHtt(formerly Hdh )…

Show Full Abstract

<h4>Background</h4>Successful disease-modifying therapy for Huntington's disease (HD) will require therapeutic intervention early in the pathogenic process. Achieving this goal requires identifying phenotypes that are proximal to the HTT CAG repeat expansion.<h4>Objective</h4>To use Htt CAG knock-in mice, precise genetic replicas of the HTT mutation in patients, as models to study proximal disease events.<h4>Methods</h4>Using cohorts of B6J.HttQ111/+ mice from 2 to 18 months of age, we analyzed pathological markers, including immunohistochemistry, brain regional volumes and cortical thickness, CAG instability, electron microscopy of striatal synapses, and acute slice electrophysiology to record glutamatergic transmission at striatal synapses. We also incorporated a diet perturbation paradigm for some of these analyses.<h4>Results</h4>B6J.HttQ111/+ mice did not exhibit significant neurodegeneration or gliosis but revealed decreased striatal DARPP-32 as well as subtle but regional-specific changes in brain volumes and cortical thickness that parallel those in HD patients. Ultrastructural analyses of the striatum showed reduced synapse density, increased postsynaptic density thickness and increased synaptic cleft width. Acute slice electrophysiology showed alterations in spontaneous AMPA receptor-mediated postsynaptic currents, evoked NMDA receptor-mediated excitatory postsynaptic currents, and elevated extrasynaptic NMDA currents. Diet influenced cortical thickness, but did not impact somatic CAG expansion, nor did it show any significant interaction with genotype on immunohistochemical, brain volume or cortical thickness measures.<h4>Conclusions</h4>These data show that a single HttQ111 allele is sufficient to elicit brain region-specific morphological changes and early neuronal dysfunction, highlighting an insidious disease process already apparent in the first few months of life.

Also flagged:HyperbilirubinemiaAcute Hepatocellular Jaundicedeferasiroximpairmentliver cirrhosisfailure
Journal Article 2018-01-01 ✓ 1 Snippet Feldman EA, Miller CD, Wojnowicz S, Seabury R.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Despite a boxed warning, postmarketing reports of deferasirox-associated hepatic injury in patients with chronic transfusions are not well described. Hepatic impairment, including failure, has been reported to occur more frequently in patients older than 55 years and in those with significant comorbidities, including liver cirrhosis and multiorgan failure. In this case report, we describe significant hyperbilirubinemia and acute hepatocellular jaundice related to deferasirox in a 7-year-old female being treated for iron overload secondary to chronic transfusions. This report outlines a unique case without preexisting risk factors in which other causes of liver injury are excluded as defined by the Roussel Uclaf Causality Assessment Method, which indicates a probable score of deferasirox causing the injury.

Also flagged:β-Thalassemiathalassemiapolymeraseβ-thalHb Echromosomes
Journal Article 2018-01-01 No Snippets Vo LTT, Nguyen TT, Le HX, Le HTT.
Show Full Abstract

Available and flexible choice of methods for screening and detecting β-thalassemia (β-thal) can promote control of thalassemia in developing countries. In this study, two methods, the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) and reverse dot-blot hybridization assays were developed to detect common β-thal mutations in 244 thalassemia patients and 152 healthy people in North Vietnam. The most common mutation was codon 26 (G>A), also known as Hb E (HBB: c.79G>A), accounting for 26.4% of the total studied chromosomes, followed by codons 41/42 (-TCTT) (HBB: c.126_129delCTTT) and codon 17 (A>T) (HBB: c.c.52A>T), accounting for 19.4 and 16.4%, respectively. In addition, codon 95 (+A) (HBB: c.c.287_288insA) that is known as the Vietnamese mutation, accounted for 0.6%. Moreover, the heterozygous state of the four mutations was also found in healthy people, of which Hb E was again the most common mutation with a frequency 3.0%. The results of this study provide available methods and indicative data for preventive and control strategies concerning the genetic diagnosis of thalassemia.

Also flagged:malignant pleural mesotheliomacancergene expressionmesotheliomacancersMSLN
Journal Article 2018-01-01 No Snippets Barone E, Gemignani F, Landi S.
Show Full Abstract

Malignant pleural mesothelioma (MPM) is a very aggressive cancer poorly responsive to current therapies. MPM patients have a very poor prognosis with a median survival of less than one year from the onset of symptoms. The biomarkers proposed so far do not lead to a sufficiently early diagnosis for a radical treatment of the disease. Thus, the finding of novel diagnostic and prognostic biomarkers and therapeutic targets is needed. Gene overexpression has been frequently associated with a malignant phenotype in several cancer types; therefore the identification of overexpressed genes may lead to the detection of novel prognostic or diagnostic marker and to the development of novel therapeutic approaches, based on their inhibition. In the last years, several overexpressed genes have been identified in MPM through gene expression profiling techniques: among them it has been found a group of 51 genes that resulted overexpressed in more than one independent study, revealing their consistency among studies. This article reviews the clinical implications of confirmed overexpressed genes in MPM described so far in literature.

Also flagged:cell cycletranscription factorsgene expressionEpcamPecam1housekeeping genes
Journal Article 2018-01-01 No Snippets Guo M, Xu Y.
Show Full Abstract

Genome-scale single-cell biology has recently emerged as a powerful technology with important implications for both basic and medical research. There are urgent needs for the development of computational methods or analytic pipelines to facilitate large amounts of single-cell RNA-Seq data analysis. Here, we present a detailed protocol for SINCERA (SINgle CEll RNA-Seq profiling Analysis), a generally applicable analytic pipeline for processing single-cell data from a whole organ or sorted cells. The pipeline supports the analysis for the identification of major cell types, cell type-specific gene signatures, and driving forces of given cell types. In this chapter, we provide step-by-step instructions for the functions and features of SINCERA together with application examples to provide a practical guide for the research community. SINCERA is implemented in R, licensed under the GNU General Public License v3, and freely available from CCHMC PBGE website, https://research.cchmc.org/pbge/sincera.html .

Neuroepigenetic Editing.

Also flagged:gene expressionneurological diseasechromatin-modifying enzymeschromatinRegulation ofregulation of neuronal gene expression
Journal Article 2018-01-01 ✓ 1 Snippet Hamilton PJ, Lim CJ, Nestler EJ, Heller EA.
In-Text Gene Mentions

HTT

Show Full Abstract

Studies of the mammalian nervous system have revealed widespread epigenetic regulation underlying gene expression intrinsic to basic neurobiological function as well as neurological disease. Over the past decade, a critical role has emerged for the neural regulation of chromatin-modifying enzymes during both development and adulthood, and in response to external stimuli. These biochemical data are complemented by numerous next generation sequencing (NGS) studies that quantify the extent of chromatin and DNA modifications in neurons. Neuroepigenetic editing tools can be applied to distinguish between the mere presence and functional relevance of such modifications to neural transcription and animal behavior. This review discusses current advances in neuroepigenetic editing, highlighting methodological considerations pertinent to neuroscience, such as delivery methods and the spatiotemporal specificity of editing. Although neuroepigenetic editing is a nascent field, the studies presented in this review demonstrate the enormous potential of this approach for basic neurobiological research and therapeutic application.

Also flagged:Tumor suppressorRKIPprostate cancerdocetaxelRaf kinase inhibitory proteincancers
Journal Article 2018-01-01 No Snippets Zhu CX, Li WZ, Guo YL, Chen L, Li GH, Yu JJ, Shu B, Peng S.
Show Full Abstract

Raf kinase inhibitory protein (RKIP) is a well-established metastasis suppressor that is frequently down-regulated in aggressive cancers. However, the impact of RKIP on cancer cell invasion and metastasis in prostate cancer is still elusive. To this end, we overexpressed RKIP in two prostate cancer cell lines. We found that overexpression of RKIP inhibited prostate cancer cells proliferation, migration and invasion. Mechanistically, we found that RKIP overexpression led to down-regula- tion of the NF-kB signaling pathway and inhibition of the epithelial-to-mesenchymal transition, which is important step for cancer metastasis. In addition, overexpression of RKIP can promote drug effects of docetaxel on prostate cancer cell lines. In conclusion, overexpression of RKIP significantly inhibits prostate cancer cell migration and metastasis, and overexpression of RKIP could aid prostate cancer treatment and therapy.

Also flagged:sugardiabeteshyperglycemiaexocrine pancreatic insufficiencyExocrineType 2 Diabetes Mellitus
Journal Article 2018-01-01 ✓ 1 Snippet Prasanna Kumar HR, Gowdappa HB, Hosmani T, Urs T.
In-Text Gene Mentions

…pancreatitis, cystic fibrosis,hemochromatosis, and pancreatic carcinomas.…

Show Full Abstract

<h4>Background</h4>Diabetes mellitus (DM) is a chronic abnormal metabolic condition, which manifests elevated blood sugar level over a prolonged period. The pancreatic endocrine system generally gets affected during diabetes, but often abnormal exocrine functions are also manifested due to its proximity to the endocrine system. Fecal elastase-1 (FE-1) is found to be an ideal biomarker to reflect the exocrine insufficiency of the pancreas.<h4>Aim</h4>The aim of this study was conducted to assess exocrine dysfunction of the pancreas in patients with type-2 DM (T2DM) by measuring FE levels and to associate the level of hyperglycemia with exocrine pancreatic dysfunction.<h4>Methodology</h4>A prospective, cross-sectional comparative study was conducted on both T2DM patients and healthy nondiabetic volunteers. FE-1 levels were measured using a commercial kit (Human Pancreatic Elastase ELISA BS 86-01 from Bioserv Diagnostics). Data analysis was performed based on the important statistical parameters such as mean, standard deviation, standard error, <i>t</i>-test-independent samples, and Chi-square test/cross tabulation using SPSS for Windows version 20.0.<h4>Results</h4>Statistically nonsignificant (<i>P</i> = 0.5051) relationship between FE-1 deficiency and age was obtained, which implied age as a noncontributing factor toward exocrine pancreatic insufficiency among diabetic patients. Statistically significant correlation (<i>P</i> = 0.003) between glycated hemoglobin and FE-1 levels was also noted. The association between retinopathy (<i>P</i> = 0.001) and peripheral pulses (<i>P</i> = 0.001) with FE-1 levels were found to be statistically significant.<h4>Conclusion</h4>This study validates the benefit of FE-1 estimation, as a surrogate marker of exocrine pancreatic insufficiency, which remains unmanifest and subclinical.

Also flagged:Neurodegenerative DiseasesAmyotrophic Lateral SclerosisAmyotrophic Lateral Sclerosis ALSAlzheimerParkinsonDegenerative nerve diseases
Journal Article 2018-01-01 ✓ 5 Snippets Sehgal SA, Hammad MA, Tahir RA, Akram HN, Ahmad F.
In-Text Gene Mentions

In ALS, genetic association studies reveal other risk factors including insertions or deletions in paraoxonase-1 (PON1), neurofilament heavy chain genes, and hetereochromatosis genes (HFE) [163, 169].

…studies that theHTTgene presents dynamic…

…proteins involved withHTTproteins, and interestingly…

…Currently, knownHTTprotein interacting partners…

…interacting partners areHTT-interacting protein 1protein 1, SRC…

Show Full Abstract

<h4>Background</h4>As the number of elderly persons increases, neurodegenerative diseases are becoming ubiquitous. There is currently a great need for knowledge concerning management of oldage neurodegenerative diseases; the most important of which are: Alzheimer's disease, Parkinson's disease, Amyotrophic Lateral Sclerosis, and Huntington's disease.<h4>Objective</h4>To summarize the potential of computationally predicted molecules and targets against neurodegenerative diseases.<h4>Method</h4>Review of literature published since 1997 against neurodegenerative diseases, utilizing as keywords: in silico, Alzheimer's disease, Parkinson's disease, Amyotrophic Lateral Sclerosis ALS, and Huntington's disease was conducted.<h4>Results and conclusion</h4>Due to the costs associated with experimentation and current ethical law, performing experiments directly on living organisms has become much more difficult. In this scenario, in silico techniques have been successful and have become powerful tools in the search to cure disease. Researchers use the Computer Aided Drug Design pipeline which: 1) generates 3- dimensional structures of target proteins through homology modeling 2) achieves stabilization through molecular dynamics simulation, and 3) exploits molecular docking through large compound libraries. Next generation sequencing is continually producing enormous amounts of raw sequence data while neuroimaging is producing a multitude of raw image data. To solve such pressing problems, these new tools and algorithms are required. This review elaborates precise in silico tools and techniques for drug targets, active molecules, and molecular docking studies, together with future prospects and challenges concerning possible breakthroughs in Alzheimer's, Parkinson's, Amyotrophic Lateral Sclerosis, and Huntington's disease.

Also flagged:Neurodegenerative DiseasesAlzheimer's diseaseADParkinson's diseasePDHuntington's disease
Journal Article 2018-01-01 ✓ 1 Snippet Chia KY, Ng KY, Koh RY, Chye SM.
In-Text Gene Mentions

…(α-syn) and Huntingtin (Htt).…

Show Full Abstract

<h4>Background & objective</h4>Protein misfolding and aggregation have been considered the common pathological hallmarks for a number of neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD) and Huntington's disease (HD). These abnormal proteins aggregates damage mitochondria and induce oxidative stress, resulting in neuronal cell death. Prolonged neuronal damage activates microglia and astrocytes, development of inflammation reaction and further promotes neurodegeneration. Thus, elimination of abnormal protein aggregates without eliciting any adverse effects are the main treatment strategies. To overcome this, recent studies have deployed single- chain fragment variable antibodies (scFvs) to target the pathological protein aggregates, such as amyloid-beta (Aβ) peptides, α-synuclein (α-syn) and Huntingtin (Htt). To date scFv has been effective at inhibiting abnormal protein aggregates formation in both in vitro and in vivo model system of AD, PD and HD.<h4>Conclusion</h4>Currently active research is still ongoing to improve the scFv gene delivery technology, to further enhance brain penetration, intracellular stability, solubility and efficacy of scFv intrabody.

Also flagged:Primary HemochromatosisType 2 Diabetes Mellitusgenetic disorderironinsulinsynthesis
Journal Article 2018-01-01 ✓ 5 Snippets Raju K, Venkataramappa SM.
In-Text Gene Mentions

Hemochromatosisis an autosomal…

…patients diagnosed withhemochromatosiswill have either…

…and treatment ofhemochromatosisprevents the development…

…by mutation ofHFEor non-HFE genes.[…

…of HFE or non-HFEgenes.[…

Show Full Abstract

Hemochromatosis is an autosomal recessive genetic disorder resulting in increased intestinal absorption of iron and eventually to iron overload. The onset of symptoms is usually seen around 40 years of age. Iron overload causes tissue damage in liver, pancreas, skin, joints, heart, and gonads. Approximately 50% of patients diagnosed with hemochromatosis will have either type 1 or type 2 diabetes mellitus (DM) because of selective beta-cell damage due to iron overload and leads to impaired insulin synthesis, release, and insulin resistance. Early diagnosis and treatment of hemochromatosis prevents the development of diabetes. We present a case in a 48-year-old male with a history of DM for 6 months and skin pigmentation over face for 1 year.

Also flagged:DeferoxamineIroncancerbreast cancermetabolismtransferrin receptors
Journal Article 2018-01-01 ✓ 1 Snippet Bajbouj K, Shafarin J, Hamad M.
In-Text Gene Mentions

…release of humanhemochromatosisprotein from TfR1…

Show Full Abstract

Mounting evidence suggest that iron overload enhances cancer growth and metastasis; hence, iron chelation is being increasingly used as part of the treatment regimen in patients with cancer. Now whether iron chelation depletes intracellular iron and/or disrupts intracellular iron homeostasis is yet to be fully addressed. MCF-7 and MDA-MB-231 breast cancer cells treated with increasing concentrations of the iron chelator deferoxamine were assessed for intracellular iron status, the expression of key proteins involved in iron metabolism, cell viability, growth potential, and apoptosis at different time points following treatment. Treatment with deferoxamine at 1, 5, or 10 μM for 24 or 48 hours, while not leading to significant changes in intracellular labile iron content, upregulated the expression of hepcidin, ferroportin, and transferrin receptors 1 and 2. In contrast, deferoxamine at 30, 100, or 300 μM for 24 hours induced a significant decrease in intracellular labile iron, which was associated with increased expression of hepcidin, ferritin, and transferrin receptors 1 and 2. At 48 hours, there was an increase in intracellular labile iron, which was associated with a significant reduction in hepcidin and ferritin expression and a significant increase in ferroportin expression. Although low-dose deferoxamine treatment resulted in a low to moderate decrease in MCF-7 cell growth, high-dose treatment resulted in a significant and precipitous decrease in cell viability and growth, which was associated with increased expression of phosphorylated Histone 2A family member X and near absence of survivin. High-dose deferoxamine treatment also resulted in a very pronounced reduction in wound healing and growth in MDA-MB-231 cells. These findings suggest that high-dose deferoxamine treatment disrupts intracellular iron homeostasis, reduces cell viability and growth, and enhances apoptosis in breast cancer cells. This is further evidence to the potential utility of iron chelation as an adjunctive therapy in iron-overloaded cancers.

Also flagged:sepsispatent ductus arteriosusbronchopulmonary dysplasiadisseminated intravascularcoagulationhematopoiesis
Journal Article 2018-01-01 No Snippets Shanmugha Priya RA, Krishnamoorthy R, Panicker VK, Ninan B.
Show Full Abstract

<h4>Background</h4>Lack of recent studies focusing on indications, pattern, and benefits of transfusions in low birth weight (B.Wt) and low gestational age (GA) preterm neonates prompted us to undertake this study.<h4>Aim</h4>To estimate the transfusion requirements and outcomes in preterm neonates <1500 g and/or <32 weeks.<h4>Settings and design</h4>This is a cross-sectional study conducted over a period of 2 years in a tertiary care center.<h4>Materials and methods</h4>This study was conducted with 101 preterm neonates <1500 g and/or <32 weeks who received blood transfusions in the Neonatal Intensive Care Unit. Restrictive pattern of transfusion was followed. Demographic details and antenatal, neonatal, laboratory, and transfusion parameters were collected.<h4>Statistical analysis used</h4>Statistical analyses were performed using SPSS 16.<h4>Results</h4>The study participants received 311 transfusions. Transfusion requirements decreased with increasing GA and B.Wt. Majority of blood transfusions occurred during the first 2 weeks of life. Packed red blood cells (PRBCs) were the most frequent blood components transfused. Ninety-six percent of the study population had an uneventful transfusion. Mean hemoglobin improvement after PRBC transfusions was 2.3 ± 2.1 g/dl. Improvement in apnea occurred in 76% PRBC transfusions. Infants with sepsis, patent ductus arteriosus, bronchopulmonary dysplasia, disseminated intravascular coagulation, and dyselectrolytemia received more number of transfusions.<h4>Conclusion</h4>This study would serve as an audit for neonatal blood transfusion therapy. Close adherence to neonatal transfusion policy and restrictive transfusion guidelines helps reduce inappropriate use of blood products and adverse transfusion reactions.

Also flagged:fatty liverNAFLDsteatosisalcoholnon-alcoholic steatohepatitisnonalcoholic fatty liver
Journal Article 2018-01-01 ✓ 1 Snippet Ghaffarifar S, Khoshbaten M, Dordaei F, Zareh Nahandi M, Javad-Rashid R, Shahnazi T.
In-Text Gene Mentions

…Wilson disease orhemochromatosis.…

Show Full Abstract

<h4>Aim</h4>This study was intended to explore the effect of various drugs used to treat fatty liver on intimal-media thickness in patients with NAFLD.<h4>Background</h4>Nonalcoholic fatty liver disease (NAFLD) is an indicator of a broad spectrum of pathologic disorders, which is characterized with macro vesicular steatosis in the absent of alcohol use. It has a wide range of laboratory, clinical and pathological presentations such as simple steatosis to the diseases like non-alcoholic steatohepatitis, fibrosis, and cirrhosis and hepatocellular cancer.<h4>Methods</h4>In this cross - sectional study, as a part of a 10-year cohort study (from 2007-2017) at Tabriz University of Medical Sciences, a group of 100 patients with NAFLD were studied. They were examined by color doppler sonography of the carotid arteries to detect any carotid intima- media thickness, before and one year after treatment with various drugs. The effect of treatment on right and left carotid intima- media thickness (IMT) was examined by using SPSS. V21.<h4>Results</h4>Over all, 36 (36%) patients were male and 64 (64%) were female. The mean age of the patients was a 43.5±10.3 year, ranging from 16 to 64. The decrease in patients' intima- media thickness in both right and left carotids was statistically significant (P<0.0001).<h4>Conclusion</h4>Treatment of patients with nonalcoholic fatty liver has a significant role in reduction of their carotid intima -media thickness and consequently in reducing cerebrovascular events such as stroke.

Also flagged:Alzheimer`s diseaseNAFLDAlzheimer`s diseasescarbohydratemetabolismfatty acid
Journal Article 2018-01-01 No Snippets Karbalaei R, Allahyari M, Rezaei-Tavirani M, Asadzadeh-Aghdaei H, Zali MR.
Show Full Abstract

<h4>Aim</h4>Analysis reconstruction networks from two diseases, NAFLD and Alzheimer`s diseases and their relationship based on systems biology methods.<h4>Background</h4>NAFLD and Alzheimer`s diseases are two complex diseases, with progressive prevalence and high cost for countries. There are some reports on relation and same spreading pathways of these two diseases. In addition, they have some similar risk factors, exclusively lifestyle such as feeding, exercises and so on. Therefore, systems biology approach can help to discover their relationship.<h4>Methods</h4>DisGeNET and STRING databases were sources of disease genes and constructing networks. Three plugins of Cytoscape software, including ClusterONE, ClueGO and CluePedia, were used to analyze and cluster networks and enrichment of pathways. An R package used to define best centrality method. Finally, based on degree and Betweenness, hubs and bottleneck nodes were defined.<h4>Results</h4>Common genes between NAFLD and Alzheimer`s disease were 190 genes that used construct a network with STRING database. The resulting network contained 182 nodes and 2591 edges and comprises from four clusters. Enrichment of these clusters separately lead to carbohydrate metabolism, long chain fatty acid and regulation of JAK-STAT and IL-17 signaling pathways, respectively. Also seven genes selected as hub-bottleneck include: IL6, AKT1, TP53, TNF, JUN, VEGFA and PPARG. Enrichment of these proteins and their first neighbors in network by OMIM database lead to diabetes and obesity as ancestors of NAFLD and AD.<h4>Conclusion</h4>Systems biology methods, specifically PPI networks, can be useful for analyzing complicated related diseases. Finding Hub and bottleneck proteins should be the goal of drug designing and introducing disease markers.

Also flagged:gene expressioncolon cancerethercancerscancerBcl-2
Journal Article 2018-01-01 ✓ 1 Snippet Fatourachi P, Faramarziyan Azimi Maragheh B, Mohammadi SM, Valipour B, Dehnad A, Nozad Charoudeh H.
In-Text Gene Mentions

…loss of theDCCgene on chromosome…

Show Full Abstract

<h4>Aim</h4>In this study we attempt to indicate anti-carcinogenic influence of ether extracted metabolites of <i>Streptomyces Levis</i> sp. on gene expression in colon cancer.<h4>Background</h4>Colon cancer is one of the most prevalent cancers worldwide. In recent decades, researchers have been seeking the treatment for cancer. Natural products are valuable compounds with fewer side effects in comparison to chemotherapy drugs.<h4>Methods</h4>Secondary metabolites were extracted with the inoculation of bacterial sample in Mueller Hinton Broth. MTT assay was done to evaluate the cytotoxicity effect of metabolites on SW480 cells. qRT-PCR was performed to observe effects of metabolites on Bcl-2, P53, SOX2, KLF4, β-Catenin, SMAD4, K-ras, BRAF genes expression in colon cancer.<h4>Results</h4>The metabolites exhibited cytotoxic effects on colon cancer in a dose/time dependent manner (P < 0.001). After 48 h treatment, fold expression of Bcl-2, SOX2, β-catenin, K-ras, BRAF genes fold of expression were decreased, whereas P53, KLF4, SMAD4 genes were increased in treated cells (P < 0.001).<h4>Conclusion</h4>These findings indicate that ether extracted metabolites of <i>Streptomyces Levis</i> ABRIINW111 have anti-carcinogenic effects on colon cancer.

Also flagged:chromosomescancercancerschronic lymphocytic leukemiachromosomechromothripsis
Journal Article 2018-01-01 No Snippets Hancks DC.
Show Full Abstract

Chromothripsis is a mutational event driven by tens to hundreds of double-stranded DNA breaks which occur in a single event between a limited number of chromosomes. Following chromosomal shattering, DNA fragments are stitched together in a seemingly random manner resulting in complex genomic rearrangements including sequence shuffling, deletions, and inversions of varying size. This genomic catastrophe has been observed in cancer genomes and the genomes of patients harboring developmental and congenital defects. The mechanisms catalyzing DNA breakage and coordinating the "random" assembly of genomic fragments are actively being investigated. Recently, retrotransposons-a type of "jumping gene"-have been implicated as one means to generate double-stranded DNA breaks during chromothripsis and as sequences which can contribute to the final configuration of the derived chromosomes. In this methods chapter, I discuss how to apply available bioinformatic tools and the hallmarks of retrotransposon mobilization to breakpoint junctions to assess the role for active and inactive retrotransposon sequences in chromothriptic events.

Also flagged:Frontotemporal Dementia andChoreaTREM2Frontotemporal dementiabehavioralexecutive dysfunction
Journal Article 2018-01-01 No Snippets Redaelli V, Salsano E, Colleoni L, Corbetta P, Tringali G, Del Sole A, Giaccone G, Rossi G.
Show Full Abstract

Frontotemporal dementia (FTD) is clinically characterized by behavioral changes, language impairment, and executive dysfunction. FTD usually belongs to the frontotemporal lobar degeneration (FTLD) disease group, and its familial forms are dominantly inherited and linked to a group of genes relevant to frontal and temporal brain pathology, such as MAPT, GRN, C9ORF72, TARDBP, CHMP2B, VCP, and FUS. However, FTD can also be associated with different clinical or pathological phenotypes caused by mutations in other genes, whose heredity can be dominant or recessive. In this work we report on a familial case of FTD characterized by behavioral changes and aphasia, very early onset and very long duration, choreic movements, and white matter lesions at magnetic resonance imaging. We performed a wide-range genetic analysis, using a next generation sequencing approach, to evaluate a number of genes involved in neurodegeneration. We found a previously unreported compound heterozygous mutation in TREM2, that is commonly associated with the recessively inherited Nasu-Hakola disease. We discuss the differential diagnosis to be taken into account in cases of FTD presenting with atypical features.

Also flagged:Thalassemiareverse transcriptionmajor thalassemiaHepatitisantibodypolymerase
Journal Article 2018-01-01 ✓ 1 Snippet Hooshmand B, Alavian SM, Kouhestani F, Firouzmandi M, Motamedian SR.
In-Text Gene Mentions

…metabolic hepatic diseases,hemochromatosis, severe psoriasis, scleroderm…

Show Full Abstract

<h4>Background</h4>The aim of the current study was to detect hepatitis C virus (HCV) RNA in blood and saliva of a population of patients with thalassemia who have HCV antibody in their serum.<h4>Materials and methods</h4>In this cross-sectional study, blood and saliva samples were collected and were analyzed with quantitative reverse transcription polymerase chain reaction (RT-PCR) for the detection of HCV RNA. In addition, liver-related blood tests were performed, and patients' medical history was recorded. Data were analyzed by independent samples <i>t</i>-test and Chi-square with a significant level of 0.05.<h4>Results</h4>Overall, 62 adult patients (29 males and 33 females) were included. Most (87%) of the patients had major thalassemia and genotype 1a was the most common (42%) type. HCV RNA was detected in 71 and 16% of blood and saliva samples, respectively. HCV RNA was detected more in female patients (31%) (<i>P</i> = 0.003) and in intermediate thalassemia (50%) (<i>P</i> < 0.005). The mean age of the patients with positive saliva was almost 10 years older (<i>P</i> < 0.001), and the mean number of blood transfusion was fewer in positive saliva group (<i>P</i> = 0.037). The sensitivity, specificity, and positive and negative predictive values of saliva PCR was calculated to be 18%, 88%, 80%, and 69%, respectively.<h4>Conclusion</h4>Saliva contained HCV RNA in 16% of the assessed population. The probability of detection of HCV RNA in saliva increased in older patients, less number of blood transfusions, females and intermediate thalassemia. Saliva RT-PCR demonstrated low sensitivity and high specificity with high positive predictive value in the assessed population.

Also flagged:transcription factorsEsophageal squamous cell carcinomaESCCGene Expressionpolymerasecell cycle
Journal Article 2018-01-01 No Snippets Zhang Y, Xu Y, Li Z, Zhu Y, Wen S, Wang M, Lv H, Zhang F, Tian Z.
Show Full Abstract

<h4>Background</h4>Esophageal cancer (EC) is a common human malignancy worldwide. Esophageal squamous cell carcinoma (ESCC) is the predominant subtype in China. The tumorigenesis mechanism in ESCC is unclear. The aim of this study was to identify key transcription factors (TFs) in ESCC and elucidate the mechanism of it.<h4>Methods</h4>A total of ten published microarray datasets of ESCC was downloaded from the Gene Expression Omnibus (GEO). Then, bioinformatics analyses including differentially expressed genes (DEGs) analysis, gene ontology (GO) annotation, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment, TFs-genes regulatory network construction was performed. Quantitative real-time polymerase chain reactions (qRT-PCR) were used to detect the expression levels of TFs and DEGs in ESCC. The association between stage and TFs and the association between survival and TFs were evaluated based on The Cancer Genome Atlas (TCGA), respectively.<h4>Results</h4>A total of 1,248 dysregulated genes were selected as DEGs in ESCC. A total of 26 TFs and corresponding target-genes were identified. The ESCC-specific transcriptional regulatory network was constructed. The network was consisted of 882 edges and 631 nodes. <i>BRCA1</i>, <i>SOX10</i>, <i>ARID3A</i>, <i>ZNF354C</i> and <i>NFIC</i> had the highest connectivity with DEGs, and regulated 92, 89, 82, 79 and 78 DEGs in the network, respectively. All these 1,248 DEGs were significantly enriched in cell cycle, DNA replication and oocyte meiosis pathways. The qRT-PCR results were consistent with our microarray analysis. High expression of <i>SREBF1</i> and <i>TFAP2A</i> were significantly correlated with the longer overall survival time of patients with ESCC.<h4>Conclusions</h4><i>BRCA1</i>, <i>SOX10</i>, <i>ARID3A</i>, <i>ZNF354C</i> and <i>NFIC</i> might be the key TFs in carcinogenesis and development of ESCC by regulating their corresponding target-genes involved in cell cycle, DNA replication and oocyte meiosis pathways. <i>SREBF1</i> and <i>TFAP2A</i> may be two potential prognostic biomarkers of ESCC.

Also flagged:tumorfollicular thyroid carcinomaiodinethyroid tumoramino acidmetastatic tumors
Journal Article 2018-01-01 No Snippets Song J, Yang Z.
Show Full Abstract

Metastatic follicular thyroid carcinoma (FTC), unresectable or resistance to radioactive iodine, is associated with poor survival. It is believed that this kind of FTC is driven by mutated genes. However, what kind of changes of genome and underlying mechanisms are elusive. The aim of this article is to understand whether there are somatic mutations in circulating cell-free tumor DNA (cfDNA) in a FTC patient with lung and bone metastases. A 55-year-old woman was diagnosed with FTC with bone and lung metastases. Appropriate amounts of DNA were extracted from formalin-fixed, paraffin-embedded thyroid tumor, peripheral cell-free plasma, and peripheral blood leukocytes and then sequenced. The significance of DNA sequencing was evaluated. There were 13,519 common variants in both tissue DNA and cfDNA. Fifty-five somatic mutations were identified in tumor, with 5 of them nonsynonymous. Seventy-two somatic mutations were found in cfDNA, with 2 of them causing amino acid change. Sixteen common alterations existed in both samples, that is, 31.3% of all the tissue somatic mutations. This pilot study provided proof that cfDNA represents the genomic characteristics of FTC primary tissue DNA well, but also metastatic tumors. Further studies are needed to better prove the effectiveness of cfDNA in the field of thyroid cancer metastatic mechanism research and real-time monitoring.

Also flagged:torsion dystonia type 1primary dystoniatorsin 1Achaperonepolypeptidestorsion dystonia
Journal Article 2018-01-01 ✓ 1 Snippet Jurek M, Obersztyn E, Milewski M.
In-Text Gene Mentions

Exemplary HT-22 (A) and HeLa (B) cells expressing wild-type (WT) or mutated (ΔE302/303) torsin 1A fused with GFP (GFP-TOR1A) and the c-Myc-tagged N-terminal 64 amino-acid fragment of huntingtin containing the pathogenically elongated polyQ tract (HTT M64-Q146).

Show Full Abstract

<h4>Objective</h4>Introduction: Torsion dystonia type 1 is the most common form of early-onset primary dystonia. Previous reports have suggested that torsin 1A, a protein mutated in this disease, might function as a chaperone that prevents the toxic aggregation of misfolded polypeptides. The aim of the study: The aim of this study was to verify the chaperone function of torsin 1A by investigating its ability to prevent the aggregation of huntingtin model peptides.<h4>Patients and methods</h4>Materials and methods: N-terminal mutant huntingtin fragments of different length were co-expressed in neuronal HT-22 and non-neuronal HeLa cells with either the wild-type or mutant (ΔE302/303) torsin 1A protein. The transfected cells were immunostained and analyzed for the presence of huntingtin aggregates using fluorescence microscopy.<h4>Results</h4>Results: The immunofluorescence analysis of huntingtin subcellular distribution within the transfected cells showed no significant difference between the huntingtin aggregation levels in cells co-expressing the wild-type torsin 1A and in control cells co-transfected with an empty vector. Instead, it was the increased level of huntingtin aggregation in the presence of the torsion dystonia-causing ΔE302/303 mutant that reached statistical significance in both neuronal and non-neuronal cells.<h4>Conclusion</h4>Conclusions: Either torsin 1A does not function as a chaperone protein or huntingtin is not an efficient substrate for such a hypothetical chaperone activity. However, the ability of mutant torsin 1A to stimulate the accumulation of aggregation-prone polypeptides might constitute an important source of ΔE302/303 pathogenicity and thus a potential target for future therapy.

Also flagged:UCHL1lipidmetabolismorganizationAPODLXRA
Journal Article 2018-01-01 ✓ 5 Snippets Piórkowska K, Żukowski K, Ropka-Molik K, Tyra M, Gurgul A.
In-Text Gene Mentions

…CDH11, SSX2IP andPCDH17), actin cytoskeletal…

…( PVALB, CIB2,PCDH17, VCAN and CDH11…

…SFRP2, CDH11, SSX2IP,PCDH17), calcium ion…

…PVALB, CIB2 ,PCDH17and CDH11 )…

…turn, the cadherinsPCDH17and CDH11 promote…

Show Full Abstract

Pork is the most popular meat in the world. Unfortunately, the selection pressure focused on high meat content led to a reduction in pork quality. The present study used RNA-seq technology to identify metabolic process genes related to pork quality traits and fat deposition. Differentially expressed genes (DEGs) were identified between pigs of Pulawska and Polish Landrace breeds for two the most important muscles (semimembranosus and longissimus dorsi). A total of 71 significant DEGs were reported: 15 for longissimus dorsi and 56 for semimembranosus muscles. The genes overexpressed in Pulawska pigs were involved in lipid metabolism (APOD, LXRA, LIPE, AP2B1, ENSSSCG00000028753 and OAS2) and proteolysis (CST6, CTSD, ISG15 and UCHL1). In Polish Landrace pigs, genes playing a role in biological adhesion (KIT, VCAN, HES1, SFRP2, CDH11, SSX2IP and PCDH17), actin cytoskeletal organisation (FRMD6, LIMK1, KIF23 and CNN1) and calcium ion binding (PVALB, CIB2, PCDH17, VCAN and CDH11) were transcriptionally more active. The present study allows for better understanding of the physiological processes associated with lipid metabolism and muscle fiber organization. This information could be helpful in further research aiming to estimate the genetic markers.

Also flagged:behavioralschizophrenianeurodevelopmental disorderspsychiatric diseasesmajor histocompatibility complexMHC
Journal Article 2018-01-01 No Snippets Viscardi LH, Paixão-Côrtes VR, Comas D, Salzano FM, Rovaris D, Bau CD, Amorim CEG, Bortolini MC.
Show Full Abstract

Hominin evolution is characterized by adaptive solutions often rooted in behavioral and cognitive changes. If balancing selection had an important and long-lasting impact on the evolution of these traits, it can be hypothesized that genes associated with them should carry an excess of shared polymorphisms (trans- SNPs) across recent Homo species. In this study, we investigate the role of balancing selection in human evolution using available exomes from modern (Homo sapiens) and archaic humans (H. neanderthalensis and Denisovan) for an excess of trans-SNP in two gene sets: one associated with the immune system (IMMS) and another one with behavioral system (BEHS). We identified a significant excess of trans-SNPs in IMMS (N=547), of which six of these located within genes previously associated with schizophrenia. No excess of trans-SNPs was found in BEHS, but five genes in this system harbor potential signals for balancing selection and are associated with psychiatric or neurodevelopmental disorders. Our approach evidenced recent Homo trans-SNPs that have been previously implicated in psychiatric diseases such as schizophrenia, suggesting that a genetic repertoire common to the immune and behavioral systems could have been maintained by balancing selection starting before the split between archaic and modern humans.

Also flagged:IRE1endoplasmic reticulumlumenInositol-requiring enzyme 1Ser/Thr kinaseRNase
Journal Article 2018-01-01 ✓ 1 Snippet Ni H, Rui Q, Li D, Gao R, Chen G.
In-Text Gene Mentions

The mutation responsible for HD leads to an abnormally long polyglutamine (polyQ) expansion in the huntingtin (Htt) protein, which confers one or more toxic functions to mutant Htt leading to neuronal loss in the striatum [43].

Show Full Abstract

The accumulation of misfolded or unfolded proteins in endoplasmic reticulum (ER) lumen results in the activation of an adaptive stress process called the unfolded protein response (UPR). As the most conserved signaling branch of the UPR, Inositol-requiring enzyme 1 (IRE1) possesses both Ser/Thr kinase and RNase activities operating as major stress sensors, mediating both adaptive and pro-apoptotic pathways under ER stress. Over the last three decades, a mounting body of evidence has shown that IRE1 signaling dysfunction is involved in the pathology of various neurological disorders. Targeting this pathway has emerged as a promising therapeutic strategy against these diseases. In this review, we provide a general overview about the expression and physiological function of IRE1 signaling and its pathophysiological roles in the central nervous system diseases.

Also flagged:methylationgene expressionaryl hydrocarbon receptortranscription factorwatermetabolism
Journal Article 2018-01-01 No Snippets Aluru N, Karchner SI, Krick KS, Zhu W, Liu J.
Show Full Abstract

There is growing evidence that environmental toxicants can affect various physiological processes by altering DNA methylation patterns. However, very little is known about the impact of toxicant-induced DNA methylation changes on gene expression patterns. The objective of this study was to determine the genome-wide changes in DNA methylation concomitant with altered gene expression patterns in response to 3, 3', 4, 4', 5-pentachlorobiphenyl (PCB126) exposure. We used PCB126 as a model environmental chemical because the mechanism of action is well-characterized, involving activation of aryl hydrocarbon receptor, a ligand-activated transcription factor. Adult zebrafish were exposed to 10 nM PCB126 for 24 h (water-borne exposure) and brain and liver tissues were sampled at 7 days post-exposure in order to capture both primary and secondary changes in DNA methylation and gene expression. We used enhanced Reduced Representation Bisulfite Sequencing and RNAseq to quantify DNA methylation and gene expression, respectively. Enhanced reduced representation bisulfite sequencing analysis revealed 573 and 481 differentially methylated regions in the liver and brain, respectively. Most of the differentially methylated regions are located more than 10 kilobases upstream of transcriptional start sites of the nearest neighboring genes. Gene Ontology analysis of these genes showed that they belong to diverse physiological pathways including development, metabolic processes and regeneration. RNAseq results revealed differential expression of genes related to xenobiotic metabolism, oxidative stress and energy metabolism in response to polychlorinated biphenyl exposure. There was very little correlation between differentially methylated regions and differentially expressed genes suggesting that the relationship between methylation and gene expression is dynamic and complex, involving multiple layers of regulation.

Also flagged:organizationantibodiesantibody
Journal Article 2018-01-01 No Snippets Gabdank I, Chan ET, Davidson JM, Hilton JA, Davis CA, Baymuradov UK, Narayanan A, Onate KC, Graham K, Miyasato SR, Dreszer TR, Strattan JS, Jolanki O, Tanaka FY, Hitz BC, Sloan CA, Cherry JM.
Show Full Abstract

<h4>Database url</h4>https://www.encodeproject.org/.

Also flagged:NeurodegenerativeNeurodegenerative diseasesneurodegenerative disordersAmyotrophic lateral sclerosisneurodegenerative diseasepathogenesis
Journal Article 2018-01-01 No Snippets Yang Y, Xu C, Liu X, Xu C, Zhang Y, Shen L, Vihinen M, Shen B.
Show Full Abstract

<h4>Url</h4>: http://bioinf.suda.edu.cn/NDDvarbase/LOVDv.3.0.

Also flagged:EGFRepidermal growth factor receptorsnon-small cell lung cancerNSCLCPeroxiredoxin 6gefitinib
Journal Article 2018-01-01 ✓ 5 Snippets Hughes NP, Xu L, Nielsen CH, Chang E, Hori SS, Natarajan A, Lee S, Kjær A, Kani K, Wang SX, Mallick P, Gambhir SS.
In-Text Gene Mentions

<h4>Background and objective</h4>To monitor therapies targeted to epidermal growth factor receptors (EGFR) in non-small cell lung cancer (NSCLC), we investigated Peroxiredoxin 6 (PRDX6) as a biomarker of response to anti-EGFR agents.<h4>Methods</h4>We studied cells that are sensitive (H3255, HCC827) or resistant (H1975, H460) to gefitinib.

PRDX6 accumulation over time correlated positively with gefitinib sensitivity.

Differences in serum PRDX6 levels between vehicle and gefitinib-treated animals could not be explained by differences in tumor burden.<h4>Conclusions</h4>Our results show that changes in serum PRDX6 during the course of gefitinib treatment of xenograft models provide insight into tumor response and such an approach offers several advantages over imaging-based strategies for monitoring response to anti-EGFR agents.

…investigated Peroxiredoxin 6 (PRDX6) as a biomarker…

…RESULTS:PRDX6levels in cell…

Show Full Abstract

<h4>Background and objective</h4>To monitor therapies targeted to epidermal growth factor receptors (EGFR) in non-small cell lung cancer (NSCLC), we investigated Peroxiredoxin 6 (PRDX6) as a biomarker of response to anti-EGFR agents.<h4>Methods</h4>We studied cells that are sensitive (H3255, HCC827) or resistant (H1975, H460) to gefitinib. PRDX6 was examined with either gefitinib or vehicle treatment using enzyme-linked immunosorbent assays. We created xenograft models from one sensitive (HCC827) and one resistant cell line (H1975) and monitored serum PRDX6 levels during treatment.<h4>Results</h4>PRDX6 levels in cell media from sensitive cell lines increased significantly after gefitinib treatment vs. vehicle, whereas there was no significant difference for resistant lines. PRDX6 accumulation over time correlated positively with gefitinib sensitivity. Serum PRDX6 levels in gefitinib-sensitive xenograft models increased markedly during the first 24 hours of treatment and then decreased dramatically during the following 48 hours. Differences in serum PRDX6 levels between vehicle and gefitinib-treated animals could not be explained by differences in tumor burden.<h4>Conclusions</h4>Our results show that changes in serum PRDX6 during the course of gefitinib treatment of xenograft models provide insight into tumor response and such an approach offers several advantages over imaging-based strategies for monitoring response to anti-EGFR agents.

Also flagged:uptake
Journal Article 2018-01-01 ✓ 1 Snippet Leslie MS, Greene J, Schulkin J, Jelin AC.
In-Text Gene Mentions

…espondents reported DCC by one minute or mo…

Show Full Abstract

<h4>Background</h4>Delayed umbilical cord clamping is associated with significant benefits to preterm and term newborns and is recommended for all infants by the World Health Organization and the American College of Obstetricians and Gynecologists (ACOG). Little is known about the cord management practices of U.S. obstetricians.<h4>Objective</h4>The objective of this study was to describe current cord clamping practices by U.S. obstetricians and investigate factors associated with delayed cord clamping.<h4>Study design</h4>A cross-sectional survey was sent to 500 members of the American College of Obstetricians and Gynecologists. Umbilical cord practices were assessed, and factors related to delaying cord clamping were examined using Chi-square tests and multivariate logistic regression models.<h4>Results</h4>The overall response rate was 37% with 74% of those opening the email responding. Sixty-seven percent of respondents reported DCC by one minute or more after vaginal births at term. After preterm and near-term vaginal births, 73% and 79% said they waited at least 30 seconds before clamping. The factor most consistently and strongly related to delaying cord clamping in both bivariate and multivariate analyses was having the belief that the timing of clamping was important. Additional analysis revealed that believing the timing was important was positively associated with the physician's institution having a written policy on the cord clamping.<h4>Conclusions</h4>In this study, a majority of respondents reported delaying cord clamping and indicated that employing strategies to implement the full uptake of this practice could be valuable. Findings suggest that institutional policies may influence attitudes on cord clamping.

Also flagged:transcription factorscancertumormultiple myelomasMGUSMonoclonal Gammopathy
Journal Article 2018-01-01 ✓ 5 Snippets Herrero MJ, Gitton Y.
In-Text Gene Mentions

Indeed, POU3F2/OCT3 overexpression has been correlated with neuroblastoma and glioblastoma in both human brain and neuroblastoma-derived cell lines (SH-SY5Y) [12,45,46].

…-specific transcription factorPOU3F2/OCT3, which promoted FOXP2…

…ancestral allele, wherePOU3F2/OCT3 binding was inefficient.…

…the control ofPOU3F2/OCT3.…

…that it involvesPOU3F2/OCT3 activity bears some…

Show Full Abstract

<i>FOXP2</i> encodes a transcription factor involved in speech and language acquisition. Growing evidence now suggests that dysregulated <i>FOXP2</i> activity may also be instrumental in human oncogenesis, along the lines of other cardinal developmental transcription factors such as <i>DLX5</i> and <i>DLX6</i> [1-4]. Several <i>FOXP</i> familymembers are directly involved during cancer initiation, maintenance and progression in the adult [5-8]. This may comprise either a pro-oncogenic activity or a deficient tumor-suppressor role, depending upon cell types and associated signaling pathways. While <i>FOXP2</i> is expressed in numerous cell types, its expression has been found to be down-regulated in breast cancer [9], hepatocellular carcinoma [8] and gastric cancer biopsies [10]. Conversely, overexpressed <i>FOXP2</i> has been reported in multiple myelomas, MGUS (Monoclonal Gammopathy of Undetermined Significance), several subtypes of lymphomas [5,11], as well as in neuroblastomas [12] and ERG fusion-negative prostate cancers [13]. According to functional evidences reported in breast cancer [9] and survey of recent transcriptomic and proteomic analyses of different tumor biopsies, we postulate that <i>FOXP2</i> dysregulation may play a main role throughout cancer initiation and progression. In some cancer conditions, <i>FOXP2</i> levels are now considered as a critical diagnostic marker of neoplastic cells, and in many situations, they even bear strong prognostic value [5]. Whether <i>FOXP2</i> may further become a therapeutic target is an actively explored lead. Knowledge reviewed here may help improve our understanding of <i>FOXP2</i> roles during oncogenesis and provide cues for diagnostic, prognostic and therapeutic analyses.

Also flagged:sideroblastic anemiaALAS2vitamin Bmicrocytic anemiacirrhosisX-linked sideroblastic anemia
Journal Article 2018-01-01 ✓ 1 Snippet Kawakami T, Nakazawa H, Kawakami F, Matsuzawa S, Sudo Y, Sakai H, Nishina S, Senoo N, Senoo Y, Komatsu M, Umemura T, Yamaguchi T, Kosho T, Fujiwara T, Harigae H, Ishida F.
In-Text Gene Mentions

…liver biopsy revealedhemochromatosisand cirrhosis.…

Show Full Abstract

A 45-year-old man presented with fatigue and pain in the finger joints. Despite having a history of suspected sideroblastic anemia since the age of 18 years, he had not been followed up for years. Upon presentation, laboratory data revealed microcytic anemia and elevated serum ferritin levels. In addition, ringed sideroblasts were increased in the bone marrow. A liver biopsy revealed hemochromatosis and cirrhosis. Furthermore, genetic analysis revealed that he harbored the ALAS2 R452H mutation, leading to the diagnosis of X-linked sideroblastic anemia (XLSA). Accordingly, oral folate or vitamin (Vit) B<sub>12</sub> was administered, but his anemia did not respond. However, his hemoglobin level increased from 7 to 11 g/dl with an additional prescription of oral VitB<sub>6</sub>, which facilitated the patient to undergo phlebotomy to ameliorate organ dysfunctions caused by iron overload. Previous research has revealed that ALAS2 R452 mutations confer poor responses to VitB<sub>6</sub> therapy. Hence, accrual of patients with an unexpectedly better response, which was observed in our case, may help elucidate the pathogenesis of and therapies for XLSA.

Also flagged:pulmonary vascular diseasepulmonary hypertensionPulmonary Vascular DiseasesGene ExpressionPHmonocrotaline
Journal Article 2018-01-01 No Snippets Fraidenburg DR, Machado RF.
Show Full Abstract

Transcriptome analysis is a powerful tool in the study of pulmonary vascular disease and pulmonary hypertension. Pulmonary hypertension is a disease process that consists of several unique pathologies sharing a common clinical definition, that of elevated pressure within the pulmonary circulation. As such, it has become increasingly important to identify both similarities and differences among the different classes of pulmonary hypertension. Transcriptome analysis has been an invaluable tool both in the basic science research on animal models as well as clinical research among the various different groups of pulmonary hypertension. This work has identified new potential candidate genes, implicated numerous biochemical and molecular pathways in diseased onset and progression, developed gene signatures to appropriately classify types of pulmonary hypertension and severity of illness, and identified novel gene mutations leading to hereditary forms of the disease.

Also flagged:Phosphoramidatesphosphonamidatesnucleoside phosphoramidatenucleosidehydroxylamino acid
Journal Article 2018-01-01 No Snippets Slusarczyk M, Serpi M, Pertusati F.
Show Full Abstract

Following the first report on the nucleoside phosphoramidate (ProTide) prodrug approach in 1990 by Chris McGuigan, the extensive investigation of ProTide technology has begun in many laboratories. Designed with aim to overcome limitations and the key resistance mechanisms associated with nucleoside analogues used in the clinic (poor cellular uptake, poor conversion to the 5'-monophosphate form), the ProTide approach has been successfully applied to a vast number of nucleoside analogues with antiviral and anticancer activity. ProTides consist of a 5'-nucleoside monophosphate in which the two hydroxyl groups are masked with an amino acid ester and an aryloxy component which once in the cell is enzymatically metabolized to deliver free 5'-monophosphate, which is further transformed to the active 5'-triphosphate form of the nucleoside analogue. In this review, the seminal contribution of Chris McGuigan's research to this field is presented. His technology proved to be extremely successful in drug discovery and has led to two Food and Drug Administration-approved antiviral agents.

Also flagged:chronic kidney diseasemineralbone disorderintact parathyroid hormoneiPTHHyperphosphatemia
Journal Article 2018-01-01 No Snippets Abrita RR, Pereira BDS, Fernandes NDS, Abrita R, Huaira RMNH, Bastos MG, Fernandes NMDS.
Show Full Abstract

<h4>Introduction</h4>The diagnosis and treatment of mineral and bone disorder of chronic kidney disease (CKD-MBD) is a challenge for nephrologists and health managers. The aim of this study was to evaluate the prevalence, biochemical profile, and drugs associated with CKD-MBD.<h4>Methods</h4>Cross-sectional study between July and November 2013, with 1134 patients on dialysis. Sociodemographic, clinical, and laboratory data were compared between groups based on levels of intact parathyroid hormone (iPTH) (< 150, 150-300, 301-600, 601-1000, and > 1001 pg/mL).<h4>Results</h4>The mean age was 57.3 ± 14.4 years. The prevalence of iPTH < 150 pg/mL was 23.4% and iPTH > 601 pg/mL was 27.1%. The comparison between the groups showed that the level of iPTH decreased with increasing age. Diabetic patients had a higher prevalence of iPTH < 150 pg/mL (27.6%). Hyperphosphatemia (> 5.5 mg/dL) was observed in 35.8%. Calcium carbonate was used by 50.5%, sevelamer by 14.7%, 40% of patients had used some form of vitamin D and 3.5% used cinacalcet. Linear regression analysis showed a significant negative association between iPTH, age, and diabetes mellitus and a significant positive association between iPTH and dialysis time.<h4>Conclusion</h4>The prevalence of patients outside the target for iPTH was 50.5%. There was a high prevalence of hyperphosphatemia (35.8%), and the minority of patients were using active vitamin D, vitamin D analogs, selective vitamin D receptor activators, and cinacalcet. These data indicate the need for better compliance with clinical guidelines and public policies on the supply of drugs associated with CKD-MBD.

Also flagged:Thrombotic stormTSpulmonary embolismthrombosisrivaroxabanheparin
Journal Article 2018-01-01 ✓ 1 Snippet Ma JY, Zhang X, Li XF, He LJ, Ma N, Wei YY, Wu RH, Wang FY.
In-Text Gene Mentions

…0.05 mg/L, andantithrombin-IIIof 100%−108%.…

Show Full Abstract

Thrombotic storm (TS) is a rare disease, especially with thrombus in the heart of pediatric patient. We present a case of a 4-year-old boy, who was diagnosed with TS during his first hospitalization due to lower extremity deep venous thrombosis, pulmonary embolism, and thrombosis of the inferior vena cava, cerebral, left internal jugular, portal, renal, and iliac veins. He was eventually prescribed with rivaroxaban to control thrombosis after 30 days of successive use of low-molecular-weight heparin, unfractionated heparin, and warfarin, which were demonstrating little effect on preventing thrombosis, and the patient was intolerant to argatroban. While his lupus anticoagulant ratio was slightly above the normal range and no other potential causes such as congenital thrombophilia, severe infection, malignancy, and trauma were confirmed, we suspected antiphospholipid antibody syndrome and prescribed glucocorticoid and rituximab to control the disease. After 36 days of admission, ultrasonography showed recanalization of the former thrombus. One month after discharge, a tumor embolus resembling a mass emerged in his right atrium under effective anticoagulant therapy. During his second admission, he underwent surgical thrombectomy, and pathological examination confirmed the mass to be a platelet-rich thrombus rather than tumor embolus or infection. Considering the suspected antiphospholipid antibody syndrome as the cause of the TS, we prescribed aspirin combined with rivaroxaban to prevent thrombosis. In this case, surgery and pathology shed light on the type of thrombus that emerged from the inferior vena cava and traveled to the heart, which is the possible potential cause of TS. It also changed our therapeutic strategy to antiplatelet therapy combined with anticoagulant therapy to control the disease.

Also flagged:Huntingtinneurodegenerative disorderagingHDtransglutaminase 2autosomal dominant progressive neurodegenerative disorder
Journal Article 2018-01-01 ✓ 5 Snippets Franich NR, Basso M, André EA, Ochaba J, Kumar A, Thein S, Fote G, Kachemov M, Lau AL, Yeung SY, Osmand A, Zeitlin SO, Ratan RR, Thompson LM, Steffan JS.
In-Text Gene Mentions

To visualize both soluble 350kD HTT full-length (FL) monomer and a high molecular weight (HMW) transglutaminase 2 (TG2)-modulated species of WT and of mutant HTT, we used unique SDS-PAGE gels and western analysis designed to measure total HTT abundance in brain tissue from HD and WT mice using a panel of HTT antibodies.

As expression of autophagy proteins is increased by cellular stress [16], the high levels of mutant HTT we observe using anti-HTT VB3130 in brain at 3 months in homozygous HD knock-in models compared to WT HTT in controls could reflect an early, potentially compensatory, upregulation of autophagy caused by mutant HTT exon 1 protein-induced stress due to incomplete HTT RNA splicing.

We measured abundance of HTT protein over time in striatum, cortex and cerebellum in two fully backcrossed homozygous knock-in HD mouse models and WT littermate controls.

In both homozygous mutant KI models, FL and HMW mutant HTT were detected using 3 separate anti-HTT antibodies that recognize different domains of HTT; VB3130 (amino acids 1–17), D7F7 (amino acids surrounding P1220), and HDB4E10 (amino acids 1844 – 2131).

Based on the data here and in published literature, we propose that HD may be modulated by a delicate balance between the deleterious effects of the chronic expression of mutant exon 1 HTT protein on one hand [64, 65], and HTT’s normal function on the other [9, 19], that alone is ultimately not sufficient to prevent onset of HD but may serve as a modifier of disease onset and progression.

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is a progressive neurodegenerative disorder associated with aging, caused by an expanded polyglutamine (polyQ) repeat within the Huntingtin (HTT) protein. In HD, degeneration of the striatum and atrophy of the cortex are observed while cerebellum is less affected.<h4>Objective</h4>To test the hypothesis that HTT protein levels decline with age, which together with HTT mutation could influence disease progression.<h4>Methods</h4>Using whole brain cell lysates, a unique method of SDS-PAGE and western analysis was used to quantitate HTT protein, which resolves as a monomer and as a high molecular weight species that is modulated by the presence of transglutaminase 2. HTT levels were measured in striatum, cortex and cerebellum in congenic homozygous Q140 and HdhQ150 knock-in mice and WT littermate controls.<h4>Results</h4>Mutant HTT in both homozygous knock-in HD mouse models and WT HTT in control striatal and cortical tissues significantly declined in a progressive manner over time. Levels of mutant HTT in HD cerebellum remained high during aging.<h4>Conclusions</h4>A general decline in mutant HTT levels in striatum and cortex is observed that may contribute to disease progression in homozygous knock-in HD mouse models through reduction of HTT function. In cerebellum, sustained levels of mutant HTT with aging may be protective to this tissue which is less overtly affected in HD.

Also flagged:autoimmune diseasescanceripilimumabnivolumabpembrolizumabatezolizumab
Journal Article 2018-01-01 No Snippets Bojadzic D, Buchwald P.
Show Full Abstract

Protein-Protein Interactions (PPIs) that are part of the costimulatory and coinhibitory (immune checkpoint) signaling are critical for adequate T cell response and are important therapeutic targets for immunomodulation. Biologics targeting them have already achieved considerable clinical success in the treatment of autoimmune diseases or transplant recipients (e.g., abatacept, belatacept, and belimumab) as well as cancer (e.g., ipilimumab, nivolumab, pembrolizumab, atezolizumab, durvalumab, and avelumab). In view of such progress, there have been only relatively limited efforts toward developing small-molecule PPI inhibitors (SMPPIIs) targeting these cosignaling interactions, possibly because they, as all other PPIs, are difficult to target by small molecules and were not considered druggable. Nevertheless, substantial progress has been achieved during the last decade. SMPPIIs proving the feasibility of such approaches have been identified through various strategies for a number of cosignaling interactions including CD40-CD40L, OX40-OX40L, BAFFR-BAFF, CD80-CD28, and PD-1-PD-L1s. Here, after an overview of the general aspects and challenges of SMPPII-focused drug discovery, we review them briefly together with relevant structural, immune-signaling, physicochemical, and medicinal chemistry aspects. While so far only a few of these SMPPIIs have shown activity in animal models (DRI-C21045 for CD40-D40L, KR33426 for BAFFR-BAFF) or reached clinical development (RhuDex for CD80-CD28, CA-170 for PD-1-PD-L1), there is proof-of-principle evidence for the feasibility of such approaches in immunomodulation. They can result in products that are easier to develop/ manufacture and are less likely to be immunogenic or encounter postmarket safety events than corresponding biologics, and, contrary to them, can even become orally bioavailable.

Also flagged:saltdegradationexcretionnanoparticledeoxyribonucleic acidsuccinic acid
Journal Article 2018-01-01 No Snippets Schubert J, Chanana M.
Show Full Abstract

Within the last two decades, the field of nanomedicine has not developed as successfully as has widely been hoped for. The main reason for this is the immense complexity of the biological systems, including the physico-chemical properties of the biological fluids as well as the biochemistry and the physiology of living systems. The nanoparticles' physicochemical properties are also highly important. These differ profoundly from those of freshly synthesized particles when applied in biological/living systems as recent research in this field reveals. The physico-chemical properties of nanoparticles are predefined by their structural and functional design (core and coating material) and are highly affected by their interaction with the environment (temperature, pH, salt, proteins, cells). Since the coating material is the first part of the particle to come in contact with the environment, it does not only provide biocompatibility, but also defines the behavior (e.g. colloidal stability) and the fate (degradation, excretion, accumulation) of nanoparticles in the living systems. Hence, the coating matters, particularly for a nanoparticle system for biomedical applications, which has to fulfill its task in the complex environment of biological fluids, cells and organisms. In this review, we evaluate the performance of different coating materials for nanoparticles concerning their ability to provide colloidal stability in biological media and living systems.

Also flagged:Huntingtinneurodegenerative disordersAlzheimer'sParkinson'sHuntington's diseasesAutophagy
Journal Article 2018-01-01 ✓ 1 Snippet Stamatakou E, Zhu Y, Rubinsztein DC.
In-Text Gene Mentions

…fragment of huntingtin (httexon 1) containing…

Show Full Abstract

The accumulation of mutant aggregate-prone proteins is a hallmark of the majority of neurodegenerative disorders, including Alzheimer's, Parkinson's, and Huntington's diseases. Autophagy, a cytosolic bulk degradation system, is the major clearance pathway for several aggregate-prone proteins, such as mutant huntingtin. The autophagosome-associated protein LC3-II is a specific marker of autophagic flux within cells, whereas aggregate formation of mutant huntingtin represents a good readout for studying autophagy modulation. Here we describe the method of assessing autophagic flux using LC3-II western blotting and substrate clearance by expressing the N-terminal fragment of huntingtin (htt exon 1) containing an expanded polyglutamine tract in mammalian cells.

Also flagged:HuntingtinpolyglutamineHuntington's diseaseHDpathogenesis
Journal Article 2018-01-01 No Snippets Ast A, Schindler F, Buntru A, Schnoegl S, Wanker EE.
Show Full Abstract

N-terminal mutant huntingtin (mHTT) fragments with pathogenic polyglutamine (polyQ) tracts spontaneously form stable, amyloidogenic protein aggregates with a fibrillar morphology. Such structures are detectable in brains of Huntington's disease (HD) patients and various model organisms, suggesting that they play a critical role in pathogenesis. Heat-stable, fibrillar mHTT aggregates can be detected and quantified in cells and tissues using a denaturing filter retardation assay (FRA). Here, we describe step-by-step protocols and experimental procedures for the investigation of mHTT aggregates in complex biosamples using FRAs. The methods are illustrated with examples from studies in cellular, transgenic fly, and mouse models of HD, but can be adapted for any disease-relevant protein with amyloidogenic polyQ tracts.

Also flagged:Huntington's diseaseHDautosomal dominant neurodegenerative disorderHuntingtintransdifferentiation
Journal Article 2018-01-01 ✓ 2 Snippets Geater C, Hernandez S, Thompson L, Mattis VB.
In-Text Gene Mentions

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by expanded polyglutamine (polyQ)-encoding repeats in the Huntingtin (HTT) gene.

…in the Huntingtin (HTT) gene.…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by expanded polyglutamine (polyQ)-encoding repeats in the Huntingtin (HTT) gene. Traditionally, HD cellular models consisted of either patient cells not affected by disease or rodent neurons expressing expanded polyQ repeats in HTT. As these models can be limited in their disease manifestation or proper genetic context, respectively, human HD pluripotent stem cells (PSCs) are currently under investigation as a way to model disease in patient-derived neurons and other neural cell types. This chapter reviews embryonic stem cell (ESC) and induced pluripotent stem cell (iPSC) models of disease, including published differentiation paradigms for neurons and their associated phenotypes, as well as current challenges to the field such as validation of the PSCs and PSC-derived cells. Highlighted are potential future technical advances to HD PSC modeling, including transdifferentiation, complex in vitro multiorgan/system reconstruction, and personalized medicine. Using a human HD patient model of the central nervous system, hopefully one day researchers can tease out the consequences of mutant HTT (mHTT) expression on specific cell types within the brain in order to identify and test novel therapies for disease.

Also flagged:Huntington's DiseaseHDneurological disorderbehavioral
Journal Article 2018-01-01 ✓ 1 Snippet Donzis EJ, Holley SM, Cepeda C, Levine MS.
In-Text Gene Mentions

…repeats in theHTTgene.…

Show Full Abstract

Electrophysiological and cell imaging techniques are powerful tools for understanding alterations in neuronal activity in Huntington's disease (HD), a fatal neurological disorder caused by an expansion of CAG repeats in the HTT gene. Changes in neuronal activity often precede the behavioral manifestations of HD, therefore, understanding the electrophysiology of HD is critical for identifying potential prodromal markers and therapeutic targets. This chapter outlines the basic methodology behind four major electrophysiological and imaging techniques used in HD mouse models: patch clamp recordings, optogenetics, in vivo electrophysiology, and Ca<sup>2+</sup> imaging, as well as some of the advancements in HD research using each of these techniques.

Also flagged:Huntington's DiseaseHDautosomal dominant progressive neurological disorder
Journal Article 2018-01-01 ✓ 1 Snippet Kosior N, Leavitt BR.
In-Text Gene Mentions

…expansion in theHTTgene, in 1993…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant progressive neurological disorder characterized by motor, cognitive, and psychiatric symptoms that typically present later on in life, although juvenile cases do exist. The identification of the disease-causing mutation, a CAG triplet repeat expansion in the HTT gene, in 1993 generated numerous investigations into the cellular and molecular pathways underlying the disorder. HD mouse models have played a prominent role in these studies, and the use of these mouse models of HD in the development and evaluation of novel therapeutic strategies is reviewed in this chapter. As new interventions and therapeutic approaches are evaluated and implemented, genetic mouse models will continue to be used with the hope of developing effective treatments for HD.

Also flagged:Huntington's DiseaseHDneurodegenerative diseasestranslational
Journal Article 2018-01-01 ✓ 1 Snippet Aron Badin R.
In-Text Gene Mentions

…mutations in theHTTgene have been…

Show Full Abstract

Huntington's disease (HD) is a monogenic, autosomal dominant inherited fatal disease that affects 1 in 10,000 people worldwide. Given its unique genetic characteristics, HD would appear as one of the most straightforward neurodegenerative diseases to replicate in animal models. Indeed, mutations in the HTT gene have been used to generate a variety of animal models that display differential pathologies and have significantly increased our understanding of the pathological mechanisms of HD. However, decades of efforts have also shown the complexity of recapitulating the human condition in other species. Here we describe the three different types of models that have been generated in nonhuman primate species, stating their advantages and limitations and attempt to give a critical perspective of their translational value to test the efficacy of novel therapeutic strategies. Obtaining construct, phenotypic, and predictive validity has proven to be challenging in most animal models of human diseases. In HD in particular, it is hard to assess the predictive validity of a new therapeutic strategy when no effective "benchmark" treatment is available in the clinic. In this light, only phenotypic/face validity and construct validity are discussed.

Also flagged:Huntington's DiseaseHDgenetic neurodegenerative disorderpolyglutaminepsychiatric disordersmitochondrial complex II
Journal Article 2018-01-01 No Snippets Flament J, Hantraye P, Valette J.
Show Full Abstract

Huntington's disease (HD) is a genetic neurodegenerative disorder caused by an abnormal expansion of a CAG repeat located in the gene encoding for huntingtin protein. This mutation induces the expression of a polyglutamine stretch in the mutated protein resulting in the modification of various biological properties of the wild-type protein and the progressive appearance of motor, cognitive, and psychiatric disorders that are typically associated to this condition. Although the exact neuropathological mechanisms of degeneration are still not fully understood, HD pathology is characterized by severe neuronal losses in various brain regions including the basal ganglia and many cortical areas. Early signs of astrogliosis may precede actual neuronal degeneration. Early metabolic impairment at least in part associated with mitochondrial complex II deficiency may play a key role in huntingtin-induced mechanisms of neurodegeneration. Clinical trials are actively prepared including various gene-silencing approaches aiming at decreasing mutated huntingtin production. However, with the lack of a specific imaging biomarker capable of visualizing mutated huntingtin or huntingtin aggregates, there is a need for surrogate markers of huntingtin neurodegeneration. MRI and caudate nucleus atrophy is one of the most sensitive imaging biomarkers of HD. As such it can be used as a means to study disease progression and potential halting of the neurodegenerative process by therapeutic intervention, but this marker relies on actual neuronal loss which is a somewhat a late event in the pathology. As a means to develop, characterize and evaluate new, potentially earlier biomarkers of HD pathology we have recently embarked on a series of NMR developments looking for brain imaging techniques that allow for noninvasive longitudinal evaluation/characterization of functional alterations in animal models of HD. This chapter describes an assemblage of innovative NMR methods that have proved useful in detecting pathological cell dysfunctions in various preclinical models of HD.

Also flagged:KynurenineHuntington's DiseaseKynurenine 3-MonooxygenasemetabolismHDpathogenesis
Journal Article 2018-01-01 No Snippets Sathyasaikumar KV, Breda C, Schwarcz R, Giorgini F.
Show Full Abstract

The link between disturbances in kynurenine pathway (KP) metabolism and Huntington's disease (HD) pathogenesis has been explored for a number of years. Several novel genetic and pharmacological tools have recently been developed to modulate key regulatory steps in the KP such as the reaction catalyzed by the enzyme kynurenine 3-monooxygenase (KMO). This insight has offered new options for exploring the mechanistic link between this metabolic pathway and HD, and provided novel opportunities for the development of candidate drug-like compounds. Here, we present an overview of the field, focusing on some novel approaches for interrogating the pathway experimentally.

Also flagged:Cas9Huntington's DiseaseCRISPR
Journal Article 2018-01-01 No Snippets Vachey G, Déglon N.
Show Full Abstract

This chapter describes the potential use of viral-mediated gene transfer in the central nervous system for genome editing in the context of Huntington's disease. Here, we provide protocols that cover the design of various genome editing strategies, the cloning of CRISPR/Cas9 elements into lentiviral vectors, and the assessment of cleavage efficiency, as well as potential unwanted effects.

Also flagged:Huntington's Diseaseoligonucleotidesribonucleic acidgene expressionneurodegenerative disordersHD
Journal Article 2018-01-01 ✓ 5 Snippets Lane RM, Smith A, Baumann T, Gleichmann M, Norris D, Bennett CF, Kordasiewicz H.
In-Text Gene Mentions

This includes characterizing the natural history of the disease, including evolution of biomarkers indexing the underlying pathology; using predictive preclinical models to assess the putative gain-of-function of mutant Htt protein and any loss-of-function of the wild-type protein; characterizing toxicokinetic and pharmacodynamic effects of ASOs in predictive animal models; developing sensitive and reliable biomarkers to monitor target engagement and effects on pathology that translate from animal models to patients with HD; establishing a drug delivery method that ensures reliable distribution to relevant CNS tissue; and designing clinical trials that move expeditiously from proof of concept to proof of efficacy.

Huntington's disease (HD), which is caused by a CAG repeat expansion in exon 1 of the huntingtin (HTT) gene and leads to the pathogenic expansion of a polyglutamine (PolyQ ) tract in the N terminus of the huntingtin protein (Htt), is a prime candidate for ASO therapy.State-of-the art translational science techniques can be applied to the development of an ASO targeting HTT RNA, allowing for a data-driven, stepwise progression through the drug development process.

…of the huntingtin (HTT) gene and leads…

…the huntingtin protein (Htt), is a prime…

…gain-of-function of mutantHttprotein and any…

Show Full Abstract

Advances in molecular biology and genetics have been used to elucidate the fundamental genetic mechanisms underlying central nervous system (CNS) diseases, yet disease-modifying therapies are currently unavailable for most CNS conditions. Antisense oligonucleotides (ASOs) are synthetic single stranded chains of nucleic acids that bind to a specific sequence on ribonucleic acid (RNA) and regulate posttranscriptional gene expression. Decreased gene expression with ASOs might be able to reduce production of the disease-causing protein underlying dominantly inherited neurodegenerative disorders. Huntington's disease (HD), which is caused by a CAG repeat expansion in exon 1 of the huntingtin (HTT) gene and leads to the pathogenic expansion of a polyglutamine (PolyQ ) tract in the N terminus of the huntingtin protein (Htt), is a prime candidate for ASO therapy.State-of-the art translational science techniques can be applied to the development of an ASO targeting HTT RNA, allowing for a data-driven, stepwise progression through the drug development process. A deep and wide-ranging understanding of the basic, preclinical, clinical, and epidemiologic components of drug development will improve the likelihood of success. This includes characterizing the natural history of the disease, including evolution of biomarkers indexing the underlying pathology; using predictive preclinical models to assess the putative gain-of-function of mutant Htt protein and any loss-of-function of the wild-type protein; characterizing toxicokinetic and pharmacodynamic effects of ASOs in predictive animal models; developing sensitive and reliable biomarkers to monitor target engagement and effects on pathology that translate from animal models to patients with HD; establishing a drug delivery method that ensures reliable distribution to relevant CNS tissue; and designing clinical trials that move expeditiously from proof of concept to proof of efficacy. This review focuses on the translational science techniques that allow for efficient and informed development of an ASO for the treatment of HD.

Also flagged:Huntington's diseaseHDpathogenesisbrain-derived neurotrophic factorBDNFpeptides
Journal Article 2018-01-01 No Snippets Savolainen M, Emerich D, Kordower JH.
Show Full Abstract

Huntington's disease (HD) is characterized by a significant loss of striatal neurons that project to the globus pallidus and substantia nigra, together with loss of cortical projection neurons in varying regions. Mutant huntingtin is suggested to drive the pathogenesis partially by downregulating corticostriatal brain-derived neurotrophic factor (BDNF) levels and signaling. Neurotrophic factors are endogenous peptides that promote the survival and maintenance of neurons. BDNF and other neurotrophic factors have shown neuroprotective benefits in various animal models of neurodegeneration, and are interesting candidates to protect the cell populations that are destined to die in HD. In an attempt to enhance the delivery of neurotrophic factors, several methods have been established to deliver long-term neurotrophic factor gene therapy to human target tissues. This chapter discusses two alternative approaches that have been shown to have potential to deliver neurotrophic factors as a neuroprotective gene therapy for HD. The methods are (1) ex vivo approach where encapsulated cells engineered to express neurotrophic factor are inserted into brain parenchyma or ventricle, and (2) in vivo viral vector therapy, in which viral vector is injected into desired brain area to express gene of interest in the host cells.

Also flagged:GPCR ReceptorEndocannabinoid ReceptorsHuntington's DiseaseG protein-coupled receptorsGPCRscannabinoid
Journal Article 2018-01-01 No Snippets Bagher AM, Laprairie RB, Kelly MEM, Denovan-Wright EM.
Show Full Abstract

G protein-coupled receptors (GPCRs) interact with multiple intracellular effector proteins such that different ligands may preferentially activate one signal pathway over others, a phenomenon known as signaling bias. Signaling bias can be quantified to optimize drug selection for preclinical research. Here, we describe moderate-throughput methods to quantify signaling bias of known and novel compounds. In the example provided, we describe a method to define cannabinoid-signaling bias in a cell culture model of Huntington's disease (HD). Decreasing type 1 cannabinoid receptor (CB<sub>1</sub>) levels is correlated with chorea and cognitive deficits in HD. There is evidence that elevating CB<sub>1</sub> levels and/or signaling may be beneficial for HD patients while decreasing CB<sub>1</sub> levels and/or signaling may be detrimental. Recent studies have found that Gα<sub>i/o</sub>-biased CB<sub>1</sub> agonists activate extracellular signal-regulated kinase (ERK), increase CB<sub>1</sub> protein levels, and improve viability of cells expressing mutant huntingtin. In contrast, CB<sub>1</sub> agonists that are β-arrestin1-biased were found to reduce CB<sub>1</sub> protein levels and cell viability. Measuring agonist bias of known and novel CB<sub>1</sub> agonists will provide important data that predict CB<sub>1</sub>-specific agonists that might be beneficial in animal models of HD and, following animal testing, in HD patients. This method can also be applied to study signaling bias for other GPCRs.

Also flagged:protocadherin8tumorPCDH8integral membrane proteincancershypopharyngeal carcinoma
Journal Article 2018-01-01 ✓ 1 Snippet Li Y, Liu C, Wang Z, Hu G.
In-Text Gene Mentions

PCDH17

Show Full Abstract

Protocadherin8 (PCDH8), an integral membrane protein, was reported to be a tumor suppressor involved in tumorigenesis in cancers. We aimed to investigate the expression of PCDH8 and its clinicopathological significance in hypopharyngeal carcinoma. We also examined the possible inactivation mechanism of PCDH8. A total of 80 pairs of hypopharyngeal carcinoma tumor tissues and non-tumor tissues were investigated to examine the immunohistochemical expression of PCDH8. Prognostic value and clinicopathological significance of PCDH8 expression were examined by Kaplan-Meier and log-rank test and Cox's ones. Ten pairs of tumor tissues and non-tumor tissues were analyzed by RT-PCR and 4 pairs by Western blot respectively. Promoter methylation of PCDH8 was observed in 14 pairs of tumor tissues and non-tumor tissues by methylation-specific PCR (MSP). The expression of PCDH8 in tumor tissues was depressed immunohistochemically when compared with non-tumor tissues and was significantly lower in the advanced pathological stage. Meanwhile, the expression of PCDH8 served as an independent prognostic risk factor for overall survival of hypopharyngeal carcinoma. The mRNA and protein levels of PCDH8 in tumor tissues was also down-regulated than in non-tumor tissues. Moreover, aberrant promoter methylation of PCDH8 occurred frequently in tumor tissues, rather than in non-tumor tissues. For the first time, our study demonstrates the tumor-suppressive function of PCDH8 and its epigenetic inactivation by promoter methylation in hypopharyngeal carcinoma. It suggests that PCDH8 may serve as a useful prognostic biomarker and a potential therapeutic target for hypopharyngeal carcinoma patients.

Also flagged:neurodegenerative diseasedementiakidney diseasemenopauseosteoporosisdegenerative disease
Journal Article 2018-01-01 No Snippets Reuben A.
Show Full Abstract

Millions of Americans now entering midlife and old age were exposed to high levels of lead, a neurotoxin, as children. Evidence from animal-model and human observational studies suggest that childhood lead exposure may raise the risk of adult neurodegenerative disease, particularly dementia, through a variety of possible mechanisms including epigenetic modification, delayed cardiovascular and kidney disease, direct degenerative CNS injury from lead remobilized from bone, and lowered neural and cognitive reserve. Within the next ten years, the generation of children with the highest historical lead exposures, those born in the 1960s, 1970s, and 1980s, will begin to enter the age at which dementia symptoms tend to emerge. Many will also enter the age in which lead stored in the skeleton may be remobilized at greater rates, particularly for women entering menopause and men and women experiencing osteoporosis. Should childhood lead exposure prove pro-degenerative, the next twenty years will provide the last opportunities for possible early intervention to forestall greater degenerative disease burden across the aging lead-exposed population. More evidence is needed now to characterize the nature and magnitude of the degenerative risks facing adults exposed to lead as children and to identify interventions to limit long-term harm.

Also flagged:Huntingtinneurodegenerative disordervesicleendocytosisautophagymitochondrial
Journal Article 2018-01-01 ✓ 5 Snippets Romo L, Mohn ES, Aronin N.
In-Text Gene Mentions

For HD, it has not been established whether HTT mRNA splice isoforms are translated or whether they impact HD pathology.

However, one study determined that knockdown of an RNA binding protein, CCR4-NOT transcription complex subunit 6 (CNOT6), in human control fibroblasts resulted in HTT mRNA 3′UTR isoform amounts similar to those in HD fibroblasts [23].

In HD fibroblasts and brain tissue, the splicing factor SRSF6 processes mutant HTT mRNA into a third alternatively polyadenylated splice isoform that terminates in intron 1.

However, the exact role of HTT 3′UTR isoform changes in HD remains to be established.

Experimental Huntington’s disease (HD) therapies target mutant HTT mRNA before it is processed into the toxic HTT protein [1–4].

Show Full Abstract

Huntington's disease (HD) is an inherited neurodegenerative disorder caused by a mutation that expands the polyglutamine (CAG) repeat in exon 1 of the huntingtin (HTT) gene. Wild-type HTT protein interacts with other proteins to protect cells against toxic stimuli, mediate vesicle transport and endocytosis, and modulate synaptic activity. Mutant HTT protein disrupts autophagy, vesicle transport, neurotransmitter signaling, and mitochondrial function. Although many of the activities of wild-type HTT protein and the toxicities of mutant HTT protein are characterized, less is known about the activities of HTT mRNA. Most putative HD therapies aim to target mutant HTT mRNA before it is translated into the protein. Therefore, it is imperative to learn as much as we can about how cells handle both wild-type and mutant HTT mRNA so that effective therapies can be designed. Here, we review the structure of wild-type and mutant HTT mRNA, with emphasis on their alternatively polyadenylated or spliced isoforms. We then consider the abundance of HTT mRNA isoforms in HD and discuss the potential implications of these findings. Evidence in the review should be used to guide future research aimed at developing mRNA-lowering therapies for HD.

Also flagged:transcription factorpou3f3pou3f4localizationPit-Oct-Uncpou3f1
Journal Article 2018-01-01 ✓ 4 Snippets Cosse-Etchepare C, Gervi I, Buisson I, Formery L, Schubert M, Riou JF, Umbhauer M, Le Bouffant R.
In-Text Gene Mentions

pou3f1, pou3f2, pou3f3, pou3f4) characterized by expression in ectodermal tissue derivatives, such as nervous

pou3f2, pou3f3, pou3f4) characterized by expression in ectodermal tissue derivatives, such as nervous

…four members (pou3f1,pou3f2, pou3f3, pou3f4) characterize…

…Thepou3f2, pou3f3, and pou3f4…

Show Full Abstract

The POU (Pit-Oct-Unc) genes encode a large transcription factor family comprising 6 classes (pou1f to pou6f ) involved in many developmental processes, such as cell commitment and differentiation. The pou3f class contains four members (pou3f1, pou3f2, pou3f3, pou3f4) characterized by expression in ectodermal tissue derivatives, such as nervous system and otic vesicle, during mammalian development. In order to obtain insights into the potential conservation of this class of transcription factors in vertebrates, we carried out a phylogenetic analysis and a comprehensive comparative study of pou3f expression in the frog Xenopus laevis. All vertebrates examined possessed members of the four pou3f subfamilies, excepting the zebrafish, which lacked a pou3f4 gene. Whole mount in situ hybridization and real-time quantitative polymerase chain reaction (RT-qPCR) analyses revealed that Xenopus pou3f genes were expressed in the forming neural tube and their expression was maintained in the brain, mostly in the dorsal part, at tailbud stages. The pou3f2, pou3f3, and pou3f4 genes were also expressed in the developing otic vesicle, and pou3f1 in some cells of the epidermis. Besides ectodermal derivatives, pou3f3 and pou3f4 were expressed in the developing kidney. Their expression started at the early tailbud stage in the pronephric anlage and partly overlapped. In the mature pronephric tubule, pou3f3 was restricted to the intermediate tubule, while pou3f4 was also expressed in the distal and connecting tubule. Together, our results highlight a significant conservation of pou3f gene expression in vertebrates and indicate that they may have distinct but also redundant functions during neural and renal development.

Also flagged:CancerHuntingtinHDtumorHuntington Diseaseneurological disorder
Journal Article 2018-01-01 ✓ 5 Snippets Thion MS, Humbert S.
In-Text Gene Mentions

Thus, HTT may modulate tumor differentiation, intercellular adhesion, and therefore metastasis progression, by regulating ZO-1.

S421-P-HTT is much less abundant in human in situ tumors than healthy tissue and nearly absent from invasive cancer cells and colocalize at cell-cell junctions with ZO-1 (Fig. 2).

HTT and ZO-1 expression positively correlate with the glandular differentiation stage of human carcinomas and are concomitantly downregulated in low-grade, poorly differentiated carcinomas associated with a poor prognosis.

Huntingtin (HTT) is a large scaffold protein of 350 kDa, conserved from flies to mammals, that has been mostly studied in the context of Huntington’s disease (HD), a rare inherited neurological disorder.

Mutant HTT increases P53 expression, which has been shown to accumulate in murine and cellular HD models and postmortem brains of HD patients [68].

Show Full Abstract

Huntingtin (HTT) is a scaffold protein mostly known because it gives rise to the severe and incurable inherited neurological disorder Huntington's disease (HD) when mutated. The Huntingtin gene (HTT) carries a polymorphic trinucleotide expansion of CAGs in exon 1 that ranges from 9 to 35 in the non-HD affected population. However, if it exceeds 35 CAG repeats, the altered protein is referred to as mutant HTT and leads to the development of HD. Given the wide spectrum of severe symptoms developed by HD individuals, wild-type and mutant HTT have been mostly studied in the context of this disorder. However, HTT expression is ubiquitous and several peripheral symptoms in HD have been described, suggesting that HTT is of importance, not only in the central nervous system (CNS), but also in peripheral organs. Accordingly, HTT and mutant HTT may interfere with non-brain-related diseases. Correlative studies have highlighted a decreased cancer incidence in the HD population and both wild-type and mutant HTT have been implicated in tumor progression. In this review, we describe the current evidence linking wild-type and mutant HTT to cancer and discuss how CAG polymorphism, HTT function, and partners may influence carcinogenesis and metastatic progression.

Also flagged:hydroxyapatitebone morphogenetic proteincalcium sulfatecalciuminfectiontumor
Journal Article 2018-01-01 No Snippets Fernandez de Grado G, Keller L, Idoux-Gillet Y, Wagner Q, Musset AM, Benkirane-Jessel N, Bornert F, Offner D.
Show Full Abstract

Bone replacement might have been practiced for centuries with various materials of natural origin, but had rarely met success until the late 19th century. Nowadays, many different bone substitutes can be used. They can be either derived from biological products such as demineralized bone matrix, platelet-rich plasma, hydroxyapatite, adjunction of growth factors (like bone morphogenetic protein) or synthetic such as calcium sulfate, tri-calcium phosphate ceramics, bioactive glasses, or polymer-based substitutes. All these substitutes are not suitable for every clinical use, and they have to be chosen selectively depending on their purpose. Thus, this review aims to highlight the principal characteristics of the most commonly used bone substitutes and to give some directions concerning their clinical use, as spine fusion, open-wedge tibial osteotomy, long bone fracture, oral and maxillofacial surgery, or periodontal treatments. However, the main limitations to bone substitutes use remain the management of large defects and the lack of vascularization in their central part, which is likely to appear following their utilization. In the field of bone tissue engineering, developing porous synthetic substitutes able to support a faster and a wider vascularization within their structure seems to be a promising way of research.

Also flagged:autophagyreticulophagydegradationendoplasmic reticulumtoER-localized protein
Journal Article 2018-01-01 ✓ 2 Snippets Lahiri V, Klionsky DJ.
In-Text Gene Mentions

CCPG1is a noncanonical…

…the ER-localized proteinCCPG1is a novel…

Show Full Abstract

Reticulophagy is the conserved macroautophagic/autophagic degradation of the endoplasmic reticulum (ER) in response to ER stress or general nutrient deprivation. Sequestration of the ER by phagophores plays an important role in regulating ER size and homeostasis. In their recent work, Smith et al. have discovered that the ER-localized protein CCPG1 is a novel mammalian reticulophagy receptor that interacts with core autophagy machinery components-LC3, GABARAP and RB1CC1-and regulates reticulophagy.

Also flagged:Ribonucleic aciddegradationneurodegenerative diseaseNeurodegenerative diseasespathogenesisdeath
Journal Article 2018-01-01 No Snippets Weskamp K, Barmada SJ.
Show Full Abstract

Ribonucleic acid (RNA) homeostasis is dynamically modulated in response to changing physiological conditions. Tight regulation of RNA abundance through both transcription and degradation determines the amount, timing, and location of protein translation. This balance is of particular importance in neurons, which are among the most metabolically active and morphologically complex cells in the body. As a result, any disruptions in RNA degradation can have dramatic consequences for neuronal health. In this chapter, we will first discuss mechanisms of RNA stabilization and decay. We will then explore how the disruption of these pathways can lead to neurodegenerative disease.

Also flagged:Metabolismnucleo-cytoplasmic exportMyotonic DystrophyRNA Binding ProteinsGene expression
Journal Article 2018-01-01 No Snippets Misra C, Lin F, Kalsotra A.
Show Full Abstract

RNA metabolism impacts different steps of mRNA life cycle including splicing, polyadenylation, nucleo-cytoplasmic export, translation, and decay. Growing evidence indicates that defects in any of these steps lead to devastating diseases in humans. This chapter reviews the various RNA metabolic mechanisms that are disrupted in Myotonic Dystrophy-a trinucleotide repeat expansion disease-due to dysregulation of RNA-Binding Proteins. We also compare Myotonic Dystrophy to other microsatellite expansion disorders and describe how some of these mechanisms commonly exert direct versus indirect effects toward disease pathologies.

Also flagged:Protein SynthesisALStranslationalneurodegenerative disorderslocalizationtRNA synthetases
Journal Article 2018-01-01 No Snippets Lehmkuhl EM, Zarnescu DC.
Show Full Abstract

Cells utilize a complex network of proteins to regulate translation, involving post-transcriptional processing of RNA and assembly of the ribosomal unit. Although the complexity provides robust regulation of proteostasis, it also offers several opportunities for translational dysregulation, as has been observed in many neurodegenerative disorders. Defective mRNA localization, mRNA sequatration, inhibited ribogenesis, mutant tRNA synthetases, and translation of hexanucleotide expansions have all been associated with neurodegenerative disease. Here, we review dysregulation of translation in the context of age-related neurodegeneration and discuss novel methods to interrogate translation. This review primarily focuses on amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), a spectrum disorder heavily associated with RNA metabolism, while also analyzing translational inhibition in the context of related neurodegenerative disorders such as Alzheimer's disease and Huntington's disease and the translation-related pathomechanisms common in neurodegenerative disease.

Also flagged:Nonalcoholic Fatty Liver DiseaseNAFLDchronic liver diseasehepatocellular carcinomaNonalcoholic steatohepatitisNASH
Journal Article 2018-01-01 ✓ 1 Snippet Dassanayake AS.
In-Text Gene Mentions

…alcoholic cirrhosis andhemochromatosis.…

Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD) is becoming one of the most important causes for chronic liver disease and also hepatocellular carcinoma (HCC) in Sri Lanka. This tendency is also recognized worldwide. More than half of the middle-aged and elderly adults in urban Sri Lanka have ultrasonic evidence of NAFLD. The NAFLD is also identified in population from rural areas of Sri Lanka and also in children. Nonalcoholic steatohepatitis (NASH) cirrhosis is the most common cause of referral for liver transplantation in Sri Lankans. The NASH is also the most common cause for rejecting potential donors for liver transplantation in Sri Lanka. Patients who underwent liver transplantation for cryptogenic cirrhosis developed evidence of NASH following liver transplantation. Recent evidence suggests that there is a genetic component to NAFLD. PNPLA3, a single gene polymorphism linked to the short arm of chromosome 22, is associated with the severity of NAFLD. The presence of this genetic polymorphism appears to carry higher risk of patients with NAFLD developing NASH with fibrosis cirrhosis and hepatocellular carcinoma. In a large population-based study from Sri Lanka, there was a tendency to develop NAFLD associated with this genetic polymorphism. In a population-based study, NAFLD was identified as an independent risk factor for development of diabetes. This association is recognized worldwide now. Most patients with HHC in Sri Lanka developed it on a back ground of cryptogenic cirrhosis. At the same time, the prevalence of the markers for hepatitis B and C was rare in Sri Lankan patients with HCC. <b>How to cite this article:</b> Dassanayake AS. Nonalcoholic Fatty Liver Disease: Identifying the Disease Burden in Sri Lanka. Euroasian J Hepato-Gastroenterol 2018;8(1):69-72.

Also flagged:methylationprotocadherinscancertumorserous ovarian carcinomatumors
Journal Article 2018-01-01 ✓ 5 Snippets Baranova I, Kovarikova H, Laco J, Dvorak O, Sedlakova I, Palicka V, Chmelarova M.
In-Text Gene Mentions

Methylation of PCDH17 could play an important role in development and progression of HGSOC and has potential to become a target in the search for new clinical biomarkers.

For further confirmation of discovered alterations we used methylation-sensitive high-resolution melting analysis.<h4>Results</h4>PCDH17 methylation was detected in almost 70% of HGSOC patients without any methylation in the group of control samples and was found both in the late stage tumors as well as in the early stage ones.

Subsequent gene expression analysis of PCDH17 revealed decreased expression in all of the tumor samples in comparison to the control ones.

Aberrant methylation of PCDH17 gene in high-grade serous ovarian carcinoma.

…Aberrant methylation ofPCDH17gene in high-grade…

Show Full Abstract

<h4>Background</h4>Aberrant DNA methylation of protocadherins (PCDHs) has been associated with development and progression of various types of cancer. It could represent possible direction in the search for critically needed tumor biomarkers for ovarian cancer.<h4>Objective</h4>To investigate methylation of δ2 group of non-clustered PCDHs in high-grade serous ovarian carcinoma (HGSOC) tissue in comparison with control tissue.<h4>Methods</h4>We used next-generation sequencing for detecting regions with the most altered methylation. For further confirmation of discovered alterations we used methylation-sensitive high-resolution melting analysis.<h4>Results</h4>PCDH17 methylation was detected in almost 70% of HGSOC patients without any methylation in the group of control samples and was found both in the late stage tumors as well as in the early stage ones. Other selected PCDHs did not show any relevant changes in methylation. Subsequent gene expression analysis of PCDH17 revealed decreased expression in all of the tumor samples in comparison to the control ones. Statistically significant negative correlation was found between methylation and levels of expression suggesting potentially methylation-based silencing.<h4>Conclusions</h4>Methylation of PCDH17 could play an important role in development and progression of HGSOC and has potential to become a target in the search for new clinical biomarkers.

Also flagged:neurodegenerative disorderdopamineCancerPDcell proliferationcancers
Journal Article 2018-01-01 ✓ 1 Snippet Bose A, Petsko GA, Eliezer D.
In-Text Gene Mentions

DCC netrin1 receptornetrin1 receptor…

Show Full Abstract

Parkinson's disease (PD) is a neurodegenerative disorder that is characterized by loss of dopaminergic neurons in the substantia nigra pars compacta, depletion of dopamine in the striatum and the presence of Lewy bodies. Cancer is uncontrolled growth of cells in the body and migration of these cells from their site of origin to other parts of the body. PD and cancer are two opposite diseases, one arising from cell proliferation and the other from cell degeneration. This fundamental difference is consistent with inverse comorbidity between most cancers and neurodegenerative diseases. However, a positive association of PD and melanoma has been reported which has recently become of significant interest. A link between PD and cancer has been supported by many epidemiological studies, most of which show that PD patients have a lower risk of developing most cancers than the general population. However, the mechanisms underlying this epidemiological observation are not known. In this review we focus on epidemiological studies correlating PD and melanoma and the possible mechanisms underlying the co-occurrence of the two diseases. We explore possible explanations for the important observations that more PD patients develop melanoma that would otherwise be expected and vice-versa.

Also flagged:DepressionAlzheimer's DiseaseADmajor depressive disorderAlzheimerL3MBTL2
Journal Article 2018-01-01 ✓ 1 Snippet Ni H, Xu M, Zhan GL, Fan Y, Zhou H, Jiang HY, Lu WH, Tan L, Zhang DF, Yao YG, Zhang C.
In-Text Gene Mentions

…involvement of HACE1,NEGR1, and SLC6A15 in…

Show Full Abstract

Depression is one of the most frequent psychiatric symptoms observed in people during the development of Alzheimer's disease (AD). We hypothesized that genetic factors conferring risk of depression might affect AD development. In this study, we screened 31 genes, which were located in 19 risk loci for major depressive disorder (MDD) identified by two recent large genome-wide association studies (GWAS), in AD patients at the genomic and transcriptomic levels. Association analysis of common variants was performed by using summary statistics of the International Genomics of Alzheimer's Project (IGAP), and association analysis of rare variants was conducted by sequencing the entire coding region of the 31 MDD risk genes in 107 Han Chinese patients with early-onset and/or familial AD. We also quantified the mRNA expression alterations of these MDD risk genes in brain tissues of AD patients and AD mouse models, followed by protein-protein interaction network prediction to show their potential effects in AD pathways. We found that common and rare variants of L3MBTL2 were significantly associated with AD. mRNA expression levels of 18 MDD risk genes, in particular SORCS3 and OAT, were differentially expressed in AD brain tissues. 13 MDD risk genes were predicted to physically interact with core AD genes. The involvement of HACE1, NEGR1, and SLC6A15 in AD was supported by convergent lines of evidence. Taken together, our results showed that MDD risk genes might play an active role in AD pathology and supported the notion that depression might be the "common cold" of psychiatry.

Also flagged:Riboflavinpantothenic acidbiosynthesisironinvasive fungal infectionsDeath
Journal Article 2018-01-01 No Snippets Dietl AM, Meir Z, Shadkchan Y, Osherov N, Haas H.
Show Full Abstract

<h4>Background</h4>Aspergillus fumigatus is the most prevalent airborne fungal pathogen, causing invasive fungal infections mainly in immunosuppressed individuals. Death rates from invasive aspergillosis remain high because of limited treatment options and increasing antifungal resistance. The aim of this study was to identify key fungal-specific genes participating in vitamin B biosynthesis in A. fumigatus. Because these genes are absent in humans they can serve as possible novel targets for antifungal drug development.<h4>Methods</h4>By sequence homology we identified, deleted and analysed four key A. fumigatus genes (riboB, panA, pyroA, thiB) involved respectively in the biosynthesis of riboflavin (vitamin B2), pantothenic acid (vitamin B5), pyridoxine (vitamin B6) and thiamine (vitamin B1).<h4>Results</h4>Deletion of riboB, panA, pyroA or thiB resulted in respective vitamin auxotrophy. Lack of riboflavin and pantothenic acid biosynthesis perturbed many cellular processes including iron homeostasis. Virulence in murine pulmonary and systemic models of infection was severely attenuated following deletion of riboB and panA, strongly reduced after pyroA deletion and weakly attenuated after thiB deletion.<h4>Conclusions</h4>This study reveals the biosynthetic pathways of the vitamins riboflavin and pantothenic acid as attractive targets for novel antifungal therapy. Moreover, the virulence studies with auxotrophic mutants serve to identify the availability of nutrients to pathogens in host niches.<h4>Abbreviations</h4>BPS: bathophenanthrolinedisulfonate; BSA: bovine serum albumin; CFU: colony forming unit; -Fe: iron starvation; +Fe: iron sufficiency; hFe: high iron; NRPSs: nonribosomal peptide synthetases; PKSs: polyketide synthaseses; wt: wild type.

Also flagged:IronHepcidinAnemiaChronic Diseaseiron overloadRed Cell Disorders
Journal Article 2018-01-01 ✓ 5 Snippets Borowitz MJ, Moliterno A.
In-Text Gene Mentions

The HFE C282Y on chromosome 6p22.2, as present in this case, is the most common mutation seen in classic (type 1 or HFE1) hemochromatosis and is associated with autosomal recessive inheritance.

If you had seen the father early in his course and had had no family history of hemochromatosis, it would be appropriate to do targeted analysis for both the HFE C282Y and H63D mutations, and if these were negative, sequence analysis could be used to identify other less common mutant alleles associated with HFE.

…Iron Overload andHemochromatosis

…the Diagnosis ofHemochromatosis?…

…carrier of theHFEmutation, making it…

Show Full Abstract

No abstract available.

Also flagged:nuclear transport factornuclear transportnuclear transport receptorsmall GTPase Rannuclear pore complexorganelles
Journal Article 2018-01-01 No Snippets Oka M, Yoneda Y.
Show Full Abstract

Nucleocytoplasmic transport is an essential process in eukaryotes. The molecular mechanisms underlying nuclear transport that involve the nuclear transport receptor, small GTPase Ran, and the nuclear pore complex are highly conserved from yeast to humans. On the other hand, it has become clear that the nuclear transport system diverged during evolution to achieve various physiological functions in multicellular eukaryotes. In this review, we first summarize the molecular mechanisms of nuclear transport and how these were elucidated. Then, we focus on the diverse functions of importin α, which acts not merely an import factor but also as a multi-functional protein contributing to a variety of cellular functions in higher eukaryotes.

Also flagged:tauADamyloid-βpostsynaptic densitiespostsynapticdementia
Journal Article 2018-01-01 ✓ 2 Snippets Zolochevska O, Bjorklund N, Woltjer R, Wiktorowicz JE, Taglialatela G.
In-Text Gene Mentions

…(amyloid-β precursor protein),HTT(huntingtin), and D-glucose.…

…PSEN1, AβPP, andHTTare known to…

Show Full Abstract

Some individuals, here referred to as Non-Demented with Alzheimer's Neuropathology (NDAN), retain their cognitive function despite the presence of amyloid plaques and tau tangles typical of symptomatic Alzheimer's disease (AD). In NDAN, unlike AD, toxic amyloid-β oligomers do not localize to the postsynaptic densities (PSDs). Synaptic resistance to amyloid-β in NDAN may thus enable these individuals to remain cognitively intact despite the AD-like pathology. The mechanism(s) responsible for this resistance remains unresolved and understanding such protective biological processes could reveal novel targets for the development of effective treatments for AD. The present study uses a proteomic approach to compare the hippocampal postsynaptic densities of NDAN, AD, and healthy age-matched persons to identify protein signatures characteristic for these groups. Subcellular fractionation followed by 2D gel electrophoresis and mass spectrometry were used to analyze the PSDs. We describe fifteen proteins which comprise the unique proteomic signature of NDAN PSDs, thus setting them apart from control subjects and AD patients.

Also flagged:Huntington's diseaseneurological disordertranscription factorbindingSTAT1TF
Journal Article 2018-01-01 ✓ 5 Snippets De Souza RAG, Kosior N, Thomson SB, Mathelier A, Zhang AW, Bečanović K, Wasserman WW, Leavitt BR.
In-Text Gene Mentions

<h4>Background</h4>Huntington's disease is a late onset neurological disorder caused by a trinucleotide CAG repeat expansion mutation in the HTT gene encoding for the protein huntingtin.

…mutation in theHTTgene encoding for…

…improve knowledge ofHTTgene regulation at…

…at uncovering theHTTgene's normal function.<h4>Met…

…l function.<h4>Methods</h4>TheHTTgene region was…

Show Full Abstract

<h4>Background</h4>Huntington's disease is a late onset neurological disorder caused by a trinucleotide CAG repeat expansion mutation in the HTT gene encoding for the protein huntingtin. Despite considerable ongoing research, the wild-type function of huntingtin is not yet fully understood.<h4>Objective</h4>To improve knowledge of HTT gene regulation at the transcriptional level and inform future studies aimed at uncovering the HTT gene's normal function.<h4>Methods</h4>The HTT gene region was functionally characterized through an in silico analysis using publicly available data sets. ChIP-seq data sets and the online STRING database were used to identify putative transcription factor binding sites (TFBSs) and protein-protein interactions within the HTT promoter region. siRNA-mediated knockdown and ChIP-qPCR of STAT1, a TF identified from the in silico analysis, were used to validate the bioinformatics screen.<h4>Results</h4>16 regions containing potential regulatory genomic markers were identified. TFBSs for 59 transcription factors (TFs) were detected in one or more of the 16 candidate regions. Using these TFs, 15 clusters of protein-protein interactions were identified using STRING. siRNA-mediated knockdown of STAT1 resulted in an increase in HTT expression, and ChIP-qPCR detected enrichment of STAT1 binding at one of the predicted regions. These assays confirmed the utility of the bioinformatic analysis.<h4>Conclusions</h4>Putative regulatory regions outside of the immediate HTT promoter region have been identified with specific protein-protein interactions. Future work will focus on in vitro and in vivo studies to examine the effect of modulating identified TFBSs and altering the levels of specific TFs of interest in regulating HTT gene expression.

Also flagged:adenosine triphosphateserinethreoninetyrosinelipid kinasesphosphorylation
Journal Article 2018-01-01 No Snippets Schneider T, Alpdogan S, Hescheler J, Neumaier F.
Show Full Abstract

During the recording of whole cell currents from stably transfected HEK-293 cells, the decline of currents carried by the recombinant human Cav2.3+β3 channel subunits is related to adenosine triphosphate (ATP) depletion after rupture of the cells. It reduces the number of functional channels and leads to a progressive shift of voltage-dependent gating to more negative potentials (Neumaier F., et al., 2018). Both effects can be counteracted by hydrolysable ATP, whose protective action is almost completely prevented by inhibition of serine/threonine but not tyrosine or lipid kinases. These findings indicate that ATP promotes phosphorylation of either the channel or an associated protein, whereas dephosphorylation during cell dialysis results in run-down. Protein phosphorylation is required for Ca<sub>v</sub>2.3 channel function and could directly influence the normal features of current carried by these channels. Therefore, results from in vitro and in vivo phosphorylation of Ca<sub>v</sub>2.3 are summarized to come closer to a functional analysis of structural variations in Ca<sub>v</sub>2.3 splice variants.

Also flagged:cardiac arrhythmiascardiacdeathheart diseaseion channelsion channel
Journal Article 2018-01-01 No Snippets London B, Greiner AM, Mehdi H, Gutmann R.
Show Full Abstract

Inherited conditions that lead to cardiac arrhythmias and sudden cardiac death remain an important cause of morbidity and mortality. Identifying the genes responsible for these rare conditions can provide insights into the more common and heritable forms of sudden cardiac death seen in patients with structural heart disease. We and others have used candidate gene approaches and positional cloning in large families to show that mutations in ion channels and ion channel related proteins cause familial arrhythmia syndromes including long QT and Brugada syndromes. The genes responsible for many familial arrhythmia syndromes and the vast majority of the predisposition to common arrhythmias remain unknown. Using whole exome sequencing in families with Brugada syndrome and idiopathic ventricular fibrillation, we now seek to identify mutations in genes previously not thought to play a significant role in the heart.

Also flagged:metabolismInborn errors of metabolismdiabetesendocrine disorderpathogenesissynthesis
Journal Article 2018-01-01 ✓ 2 Snippets Alfadhel M, Babiker A.
In-Text Gene Mentions

hemochromatosis

HFE

Show Full Abstract

Inborn errors of metabolism (IEM) are heterogeneous group of disorders that might present in the clinics or emergency departments in different phenotypes, and one of these is a diabetes scenario. Diabetes is the most common endocrine disorder among children. The mechanism of how IEM could lead to diabetes is unclear; however, the postulated pathogenesis consists of three mechanisms: 1) accumulation of toxic substance in the gland, ruining structure and normal functionality, 2) disturbing energy availability required for hormone synthesis and 3) defect of complex molecules. The differential diagnosis of IEM associated with hyperglycaemic ketoacidosis and diabetes include: organic acidemias specifically propionic acidemia, methylmalonic acidemia, isovaleric acidemia, hereditary hemochromatosis, aceruloplasminemia, holocarboxylase synthetase deficiency, β-ketothiolase deficiency and finally, cystinosis, Rogers syndrome (thiamine-responsive megaloblastic anaemia) and congenital disorders of glycosylation type Ia. Clinical approach will help in ready diagnosis and treatment for IEM disorders in early detection of diabetes. In this review, we will discuss the differential diagnosis, clinical features and diagnostic approaches of IEM presenting as hyperglycaemic ketoacidosis and diabetes.

Also flagged:Histone deacetylasehypersensitivitytrigeminal inflammatory compressionnerve injurygene expressionHDAC
Journal Article 2018-01-01 No Snippets Danaher RJ, Zhang L, Donley CJ, Laungani NA, Hui SE, Miller CS, Westlund KN.
Show Full Abstract

Chronic orofacial pain is a significant health problem requiring identification of regulating processes. Involvement of epigenetic modifications that is reported for hindlimb neuropathic pain experimental models, however, is less well studied in cranial nerve pain models. Three independent observations reported here are the (1) epigenetic profile in mouse trigeminal ganglia (TG) after trigeminal inflammatory compression (TIC) nerve injury mouse model determined by gene expression microarray, (2) H3K9 acetylation pattern in TG by immunohistochemistry, and (3) efficacy of histone deacetylase (HDAC) inhibitors to attenuate development of hypersensitivity. After TIC injury, ipsilateral whisker pad mechanical sensitization develops by day 3 and persists well beyond day 21 in contrast to sham surgery. Global acetylation of H3K9 decreases at day 21 in ipsilateral TG . Thirty-four genes are significantly ( p < 0.05) overexpressed in the ipsilateral TG by at least two-fold at either 3 or 21 days post-trigeminal inflammatory compression injury. The three genes most overexpressed three days post-trigeminal inflammatory compression nerve injury are nerve regeneration-associated gene ATF3, up 6.8-fold, and two of its regeneration-associated gene effector genes, Sprr1a and Gal, up 174- and 25-fold, respectively. Although transcription levels of 25 of 32 genes significantly overexpressed three days post-trigeminal inflammatory compression return to constitutive levels by day 21, these three regeneration-associated genes remain significantly overexpressed at the later time point. On day 21, when tissues are healed, other differentially expressed genes include 39 of the top 50 upregulated and downregulated genes. Remarkably, preemptive manipulation of gene expression with two HDAC inhibitors (HDACi's), suberanilohydroxamic acid (SAHA) and MS-275, reduces the magnitude and duration of whisker pad mechanical hypersensitivity and prevents the development of a persistent pain state. These findings suggest that trigeminal nerve injury leads to epigenetic modifications favoring overexpression of genes involved in nerve regeneration and that maintaining transcriptional homeostasis with epigenetic modifying drugs could help prevent the development of persistent pain.

Also flagged:acquired immunodeficiency syndromepulmonary hypertensionpericardial effusionleft ventricular systolic dysfunctionright ventricular dysfunctionCD4
Journal Article 2018-01-01 ✓ 1 Snippet Singh S, Vatsa D, Tomar S, Aneja GK, S Arya TV.
In-Text Gene Mentions

…sufficiency, hyperinsulinemia,hemochromatosis, sarcoidosis, amyloidosis phe…

Show Full Abstract

<h4>Introduction</h4>Cardiac complications of HIV infection tend to occur late in the disease or are associated with related therapies and are therefore becoming more prevalent as therapy and longevity improve.<h4>Materials and methods</h4>The study was undertaken to study the common cardiovascular complications in Indian HIV patients and to their association with the CD4+ T-cell count.<h4>Observations and conclusion</h4>Prevalence of cardiac abnormality in our study was 24%. The abnormalities included LVDD (22%), pulmonary hypertension (12%), DCMP (12%), pericardial effusion (7%), left ventricular systolic dysfunction (5%), and right ventricular dysfunction (1%).

Also flagged:cohesinATPaseorganizationchromosomeschromatinStructural Maintenance of Chromosomes
Journal Article 2018-01-01 ✓ 1 Snippet Murayama Y.
In-Text Gene Mentions

Condensinis recruited to…

Show Full Abstract

Cohesin is a ring-shaped, multi-subunit ATPase assembly that is fundamental to the spatiotemporal organization of chromosomes. The ring establishes a variety of chromosomal structures including sister chromatid cohesion and chromatin loops. At the core of the ring is a pair of highly conserved SMC (Structural Maintenance of Chromosomes) proteins, which are closed by the flexible kleisin subunit. In common with other essential SMC complexes including condensin and the SMC5-6 complex, cohesin encircles DNA inside its cavity, with the aid of HEAT (Huntingtin, elongation factor 3, protein phosphatase 2A and TOR) repeat auxiliary proteins. Through this topological embrace, cohesin is thought to establish a series of intra- and interchromosomal interactions by tethering more than one DNA molecule. Recent progress in biochemical reconstitution of cohesin provides molecular insights into how this ring complex topologically binds and mediates DNA-DNA interactions. Here, I review these studies and discuss how cohesin mediates such chromosome interactions.

Also flagged:Cholinergic Neurostimulating PeptideAcetylcholineSynthesisimmune responsescholine acetyltransferaseChAT
Journal Article 2018-01-01 ✓ 3 Snippets Saito Y, Mashimo M, Nobeyama A, Murakami K, Fujii T.
In-Text Gene Mentions

…hanolamine-binding protein 1 (PEBP1).…

…AlthoughPEBP1and HCNP appears…

…we observed thatPEBP1is also expressed…

Show Full Abstract

Lymphocytic cholinergic system has important roles in T cell functions, including immune responses and proliferation and differentiation of immune cells. T lymphocytes exclusively produces acetylcholine (ACh) via choline acetyltransferase (ChAT), activating their muscarinic and nicotinic ACh receptors (mAChRs and nAChRs, respectively) in an autocrine and paracrine manners. Hippocampal cholinergic neurostimulating peptide (HCNP) is an undecapeptide cleaved from N-terminal of phosphatidylethanolamine-binding protein 1 (PEBP1). HCNP enhances ACh synthesis through upreglation of ChAT expression in septo-hippocampal cholinergic neurons and participates in neuronal development and differentiation. Although PEBP1 and HCNP appears to be distributed ubiquitously in tissues and cells including spleen, its functions in immune cells have not been understood. In the present study, we observed that PEBP1 is also expressed in human and murine T cells. Long-term exposure to HCNP suppressed ChAT expression in MOLT3 human leukemic T cells, resulting in decreased release of ACh. HCNP also decreased the expression of extracellular signal-regulated kinase (ERK). Thus, HCNP appears to suppress lymphocytic cholinergic signaling, which might act as an immune modulator.

Also flagged:spondylolisthesisdegenerative disc diseaselumenradiculopathydisc herniationinfection
Journal Article 2018-01-01 No Snippets Tally WC, Temple HT, Subhawong TY, Ganey T.
Show Full Abstract

<h4>Background</h4>When conservative treatments fail to alleviate the discomfort of abnormal motion, spinal fusion has been shown to provide symptomatic treatment for spinal instability, stenosis, spondylolisthesis, and symptomatic degenerative disc disease. The trend and rates of fusion over the past few years have been dramatic in the United States. Accompanying that higher incidence has been the shifting from traditional open surgery to minimally invasive techniques to reduce scar tissue formation, extent of muscle stripping, and muscle retraction which all have been shown to adversely affect outcomes. Other reasons supporting the widespread transition to minimally invasive surgical (MIS) techniques include decreased postoperative pain, decreased intraoperative blood loss, shorter postoperative hospital stay, faster return to normal activity, and reduced reoperation rates. Spinal fusion procedures rely on a bony fusion substrate in addition to fixation hardware. While available grafting options include autogenous, allogeneic, and synthetic materials, recent interest in viable allograft material with living cells has drawn attention and attraction for incorporating a biologic basis for regenerative consideration. A recent viable allograft, complete with cellular and designated bone carrier (VIA Graft, Vivex Biomedical, Marietta, Georgia) has been developed. This study represents a retrospective review of a single-practice, single-surgeon evaluation of the product in 75 consecutive patients for fusion by computed tomography (CT) and radiographic evaluation at 12 months in conjunction with a MIS approach. Viable allograft was used to fill the peri-implant space, and central implant lumen was filled with a cancellous bone sponge soaked in perivertebral bone marrow. Posterolateral supplementation was attained with beta-tricalcium phosphate as a bulking agent.<h4>Methods</h4>A retrospective review identified patients treated for both primary and revision surgery who received VIA Graft cellular bone matrix material in minimally invasive interbody fusion (MIS-TLIF) with a minimum of 12-month follow up. The patient diagnoses included radiculopathy in all instances and varied collateral indications such as foraminal collapse, recurrent disc herniation, and spondylolisthesis to which pain and morbidity had been unresolved by conservative treatment. Adverse events including infection, revisions, and evidence of immune response were evaluated and patient comorbidities defined for the entire population of patients. Patient fusion status was assessed using thin slice CT by 2 independent radiologists separate from the surgeon. There were 75 consecutive adult patients with degenerative conditions of the lumbar spine who underwent MIS-TLIF surgery of which 40 (53%) were male and 35 (47%) were female. Mean age, height, and weight were 58 years, 170.18 cm (67 in), and 88.45 kg (195 lbs), respectively. The mean body mass index was 30. There were 16 patients (21%) who smoked and 12 (16%) with a history of diabetes. Independent blinded review of fusion was obtained by a board certified musculoskeletal radiologist and an experienced board certified orthopaedic surgeon to assess patient fusion status. Spinal segments were deemed fused if 12-month CT scans demonstrated evidence of bridging bone at the fusion site without observed motion on flexion-extension radiographs. Findings such as osteolysis around the implant or pedicle screws, extensive endplate cystic changes, or linear defects parallel to the endplates through intradiscal new bone formation were interpreted as signs of pseudarthrosis. Interobserver and intraobserver error and κ assessments were analyzed to assure agreement in the CT outcomes assessment where interpretation of κ were as follows: <0.00 = poor agreement, 0.00-0.20 = slight agreement, 0.21-0.40 = fair agreement, 0.41-0.60 = moderate agreement, 0.61-0.80 = substantial agreement, and 0.81-1.00 = almost perfect agreement. Differences were resolved by consensus amongst the observers.<h4>Results</h4>In total, 96% of the 75 patients with a total of 85 levels (96.5% of levels treated) achieved a fusion at 12 months. There were no perioperative or latent complications and no transfusions in all 75 patients.<h4>Conclusions</h4>In this population, 96% of the patients treated achieved the surgical objective in 96.5% of the levels treated.<h4>Level of evidence</h4>IV.<h4>Clinical relevance</h4>The high rate of fusion, the lack of secondary morbidity with autologous bone harvest, and the clinical success account for the benefits of viable allograft matrix for MIS-TLIF use.

Also flagged:RKIPcancercell growthepithelial-to-mesenchymal transitionmetastasis suppressor Raf-1 kinase inhibitory proteinmacroautophagy
Journal Article 2018-01-01 No Snippets Wang Y, Bonavida B.
Show Full Abstract

The complexities of molecular signaling in cancer cells have been hypothesized to mediate cross-network alterations of oncogenic processes such as uncontrolled cell growth, proliferation, acquisition of epithelial-to-mesenchymal transition (EMT) markers, and resistance to cytotoxic therapies. The two biochemically exclusive processes/proteins examined in the present review are the metastasis suppressor Raf-1 kinase inhibitory protein (RKIP) and the cell-intrinsic system of macroautophagy (hereafter referred to as autophagy). RKIP is poorly expressed in human cancer tissues, and low expression levels are correlated with high incidence of tumor growth, metastasis, poor treatment efficacy, and poor prognoses in cancer patients. By comparison, autophagy is a conserved cytoprotective degradation pathway that has been shown to influence the acquisition of resistance to hypoxia and nutrient depletion as well as the regulation of chemo-immuno-resistance and apoptotic evasion. Evidently, a broad library of cancer-relevant studies exists for RKIP and autophagy, although reports of the interactions between pathways involving RKIP and autophagy have been relatively sparse. To circumvent this limitation, the coordinate regulatory and effector mechanisms were examined for both RKIP and autophagy. Here, we propose three putative pathways that demonstrate the inherent pleiotropism and relevance of RKIP and the microtubule-associated protein 1 light chain 3 (MAP1LC3, LC3) on cell growth, proliferation, senescence, and EMT, among the hallmarks of cancer. Our findings suggest that signaling modules involving p53, signal transducer and activator of transcription 3 (STAT3), nuclear factor-κB (NF-κB), and Snail highlight the novel roles for RKIP in the control of autophagy and vice versa. The suggested potential crosstalk mechanisms are new areas of research in which to further study RKIP and autophagy in cancer models. These should lead to novel prognostic motifs and will provide alternative therapeutic strategies for the treatment of unresponsive aggressive cancer types.

Also flagged:Autophagypathogenesiscancerscancercell proliferationepithelial-to-mesenchymal transition
Journal Article 2018-01-01 No Snippets Bonavida B.
Show Full Abstract

The role of autophagy in the pathogenesis of various cancers has been well documented in many reports. Autophagy in cancer cells regulates cell proliferation, viability, invasion, epithelial-to-mesenchymal transition (EMT), metastasis, and responses to chemotherapeutic and immunotherapeutic treatment strategies. These manifestations are the result of various regulatory gene products that govern autophagic, biochemical, and molecular mechanisms. In several human cancer cell models, the presence of a dysregulated circuit-namely, NFκB/SNAIL/YY1/RKIP/PTEN-that plays a major role in the regulation of tumor cell unique characteristics just listed for autophagy-regulated activities. Accordingly, the autophagic mechanism and the dysregulated circuit in cancer cells share many of the same properties and activities. Thus, it has been hypothesized that there must exist a biochemical/molecular link between the two. The present review describes the link and the association of each gene product of the dysregulated circuit with the autophagic mechanism and delineates the presence of crosstalk. Crosstalk between autophagy and the dysregulated circuit is significant and has important implications in the development of targeted therapies aimed at either autophagy or the dysregulated gene products in cancer cells.

Also flagged:Huntington's diseasecapsuleGFPviral genomesDARPP32
Journal Article 2018-01-01 No Snippets Mondo E, Moser R, Gao G, Mueller C, Sena-Esteves M, Sapp E, Pfister E, O'Connell D, Takle K, Erger KE, Liu W, Conlon TJ, DiFiglia M, Gounis MJ, Aronin N.
Show Full Abstract

<h4>Background</h4>Transgenic sheep are currently the only large animal model of Huntington's disease expressing full-length mutant human huntingtin. These transgenic sheep provide an opportunity to test adeno associated virus (AAV) therapies directly targeting the huntingtin gene. A recent study demonstrated that self-complementary (sc) AAV with artificial miRNA against human huntingtin reduced mutant human huntingtin in caudate and putamen after a single injection near the internal capsule.<h4>Objective</h4>To identify an AAV serotype among AAVrh8, AAV9 and AAVrh10 with the highest neuronal uptake and distribution, with no obvious cell loss in the neostriatum of the sheep.<h4>Methods</h4>We tested AAVrh8, AAV9 and AAVrh10 by stereotactic direct unilateral injection into the neostriatum of sheep, near the internal capsule. Four weeks after administration, we examined the viral spread and neuronal uptake of each serotype of AAV containing GFP. We compared single stranded (ss) and scAAVs. Further, we measured the distribution of AAVrh8 and AAV9 to a variety of tissues outside the brain.<h4>Results</h4>Sc AAV9 had the best combination of neuronal uptake and distribution throughout the neostriatum. scAAVrh10 demonstrated good spread, but was not taken up by neurons. scAAVrh8 demonstrated good spread, but had less neuronal uptake than AAV9. Six hours after convection-enhanced administration to the neostriatum, both AAVrh8 and AAV9 viral genomes were detected in blood, saliva, urine, feces and wool. By four weeks, viral genomes were detected in wool only. Administration of AAVrh8, AAV9 and AAVrh10 was not associated with loss of neostriatal, medium spiny neuron number as measured by DARPP32 immunohistochemistry.<h4>Conclusions</h4>Altogether, we found scAAV9 had the best neuronal uptake and spread, showed no loss of neurons at one-month post-injection, and was not measurable in body fluids one month after injection. This information will guide future clinical experiments requiring brain injection of AAV for therapeutics for gene or miRNA deliveries in sheep transgenic for the human huntingtin gene.

Also flagged:leukoencephalopathylactateLBSLinheritance disordermitochondrialaspartyl-tRNA synthetase
Journal Article 2018-01-01 ✓ 3 Snippets Çavuşoğlu D, Olgaç-Dündar N, Öztekin Ö, Özdemir TR, Arıcan P, Gençpınar P.
In-Text Gene Mentions

Herein, we report the first pediatric case from Turkey with a typical MRI course of LBSL associated with a compound heterozygous mutation in DARS2 gene.

…mutations in theDARS2gene which encodes…

…heterozygous mutation inDARS2gene.…

Show Full Abstract

Çavuşoğlu D, Olgaç-Dündar N, Öztekin Ö, Özdemir TR, Arıcan P, Gençpınar P. The first pediatric case of leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL) from Turkey. Turk J Pediatr 2018; 60: 216-220. Leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL) is defined as an autosomal recessive inheritance disorder characterized by slowly progressive cerebellar, pyramidal and dorsal column dysfunction. The diagnosis is based on specific magnetic resonance imaging abnormalities (MRI) in the cerebral and cerebellar white matter and selective involvement of white matter tracts in the brain stem and spinal cord. LBSL is caused by mutations in the DARS2 gene which encodes the mitochondrial aspartyl-tRNA synthetase. Herein, we report the first pediatric case from Turkey with a typical MRI course of LBSL associated with a compound heterozygous mutation in DARS2 gene.

Also flagged:Traumatic Brain InjurydementiaTauamyloid-β proteinmild traumatic brain injury
Journal Article 2018-01-01 ✓ 1 Snippet Chen M, Song H, Cui J, Johnson CE, Hubler GK, DePalma RG, Gu Z, Xia W.
In-Text Gene Mentions

Htt

Show Full Abstract

Alzheimer's disease (AD), the most prevalent form of dementia, is characterized by two pathological hallmarks: Tau-containing neurofibrillary tangles and amyloid-β protein (Aβ)-containing neuritic plaques. The goal of this study is to understand mild traumatic brain injury (mTBI)-related brain proteomic changes and tau-related biochemical adaptations that may contribute to AD-like neurodegeneration. We found that both phosphorylated tau (p-tau) and the ratio of p-tau/tau were significantly increased in brains of mice collected at 3 and 24 h after exposure to 82-kPa low-intensity open-field blast. Neurological deficits were observed in animals at 24 h and 7 days after the blast using Simple Neuroassessment of Asymmetric imPairment (SNAP) test, and axon/dendrite degeneration was revealed at 7 days by silver staining. Liquid chromatography-mass spectrometry (LC-MS/MS) was used to analyze brain tissue labeled with isobaric mass tags for relative protein quantification. The results from the proteomics and bioinformatic analysis illustrated the alterations of axonal and synaptic proteins in related pathways, including but not being limited to substantia nigra development, cortical cytoskeleton organization, and synaptic vesicle exocytosis, suggesting a potential axonal damage caused by blast-induced mTBI. Among altered proteins found in brains suffering blast, microtubule-associated protein 1B, stathmin, neurofilaments, actin binding proteins, myelin basic protein, calcium/calmodulin-dependent protein kinase, and synaptotagmin I were representative ones involved in altered pathways elicited by mTBI. Therefore, TBI induces elevated phospho-tau, a pathological feature found in brains of AD, and altered a number of neurophysiological processes, supporting the notion that blast-induced mTBI as a risk factor contributes to AD pathogenesis. LC/MS-based profiling has presented candidate target/pathways that could be explored for future therapeutic development.

Also flagged:Pancreatic cancercancersmetastatic diseasetumorcancerdimethyl
Journal Article 2018-01-01 ✓ 2 Snippets Mukundan S, Sharma K, Honselmann K, Singleton A, Liss A, Parekkadan B.
In-Text Gene Mentions

…domain family ofchromatin adaptorsadaptors (BRD2, BRD3,…

…BET family ofchromatin adaptorsadaptors plays a…

Show Full Abstract

Pancreatic cancer is one of the most aggressive cancers with a 5-year patient survival rate of 8.2% and limited availability of therapeutic agents to target metastatic disease. Pancreatic cancer is characterized by a dense stromal cell population with unknown contribution to the progression or suppression of tumor growth. In this study, we describe a microengineered tumor stromal assay of patient-derived pancreatic cancer cells to study the heterotypic interactions of patient pancreatic cancer cells with different types of stromal fibroblasts under basal and drug-treated conditions. The population dynamics of tumor cells in terms of migration and viability were visualized as a functional end point. Coculture with cancer-associated fibroblasts increased the migration of cancer cells when compared to dermal fibroblasts. Finally, we imaged the response of a bromodomain and extraterminal inhibitor on the viability of pancreatic cancer clusters surrounding by stroma in microengineered tumor stromal assay. We visualized a codynamic reduction in both cancer and stromal cells with bromodomain and extraterminal treatment compared to the dimethyl sulfoxide-treated group. This study demonstrates the ability to engineer tumor-stromal assays with patient-derived cells, study the role of diverse types of stromal cells on cancer progression, and precisely visualize a coculture during the screening of therapeutic compounds.

Also flagged:glutamineparturitionformaldehydeMGGlucosealbumin
Journal Article 2018-01-01 No Snippets Nemati M, Menatian S, Joz Ghasemi S, Hooshmandfar R, Taheri M, Saifi T.
Show Full Abstract

The present study was conducted to study the effect of protected-glutamine (Gln) supplementation on dry matter intake (DMI), milk yield (MY) and composition, somatic cell counts (SCC) and blood parameters in fresh cows. Forty Holstein cows at zero day of parturition (calving day = day 0) were divided into four groups (n=10), and fed (<i>ad libitum</i>) with one of the diets including: basal diet (control), basal diet supplemented with 150 (low Gln, LG), 250 (medium Gln, MG) or 350 (high Gln, HG) g of Gln protected with formaldehyde/cow per day. The DMI and MY were recorded from 0 to 21 days post-calving. Milk fat and protein were assessed on days 7, 14 and 21, and blood was collected on days 0, 7, 14, and 21 after parturition. The DMI and MY at 21 days in milk (DIM) in HG group were compared with control (P<0.05). The DMI at 14 and 21 DIM and the MY at 21 DIM were higher in MG group compared with control group (P>0.05). Glucose concentration at 7, 14 and 21 DIM increased in both HG and MG groups compared with control group (P>0.05). The milk SCC of Gln groups was lower (P<0.05) compared with control, at 14 and 21 DIM. Glutamine supplementation increased the blood concentrations of total protein and albumin, but lowered the β-hydoxybutyrate (BHBA), non-esterified fatty acids (NEFA) and aspartate amino transferase (AST) concentrations (P<0.05). These results indicate that rumen protected Gln supplementation at 250 g/heat/day to fresh Holstein cows improved the SCC in milk and health status.

Also flagged:vitamin Dcancercancers of the prostateinflammation-associated disorderscervical intraepithelial neoplasiaCIN
Journal Article 2018-01-01 No Snippets Young MRI, Xiong Y.
Show Full Abstract

The association between vitamin D and cancer has long been studied, but the results have been variable. Thus, there does not seem to be a consensus on whether vitamin D has a beneficial anti-cancer effect. This review not only summarizes the association between vitamin D and cancer risk and results of clinical trials involving vitamin D, but explores some of the reasons that contribute to the variability of study outcomes. Highlighted are single nucleotide polymorphisms (SNPs) that contribute to variability in the efficacy of vitamin D supplementation. Understanding these differences can personalize approaches to optimize the effectiveness of vitamin D in limiting cancer risk.

Also flagged:Polyglutaminepolyglutamine (polyQ) diseasesspinocerebellar ataxiaspolyQ disordersreproductionamyloidogenic proteins
Journal Article 2018-01-01 ✓ 5 Snippets Hashimoto M, Ho G, Takamatsu Y, Wada R, Sugama S, Takenouchi T, Masliah E, Waragai M.
In-Text Gene Mentions

…repeats in huntingtin (HTT) gene, below disease…

…Moreover, mutantHTTwas s detected…

…of wild typeHTThave the capacity…

…aggregation of mutantHTTN-terminal fragments […

…the role ofHTTin DNA damage…

Show Full Abstract

The polyglutamine (polyQ) diseases, such as Huntington's disease and the spinocerebellar ataxias, are characterized by the accumulation of elongated polyQ sequences (epolyQ) and mostly occur during midlife. Considering that polyQ disorders have not been selected out in evolution, there might be important physiological functions of epolyQ during development and/or reproduction. In a similar context, the physiological functions of neurodegeneration-associated amyloidogenic proteins (APs), such as β-amyloid in Alzheimer's disease and α-synuclein in Parkinson's disease, remain elusive. In this regard, we recently proposed that evolvability for coping with diverse stressors in the brain, which is beneficial for offspring, might be relevant to the physiological functions of APs. Given analogous properties of APs and epolyQ in terms of neurotoxic amyloid-fibril formation, the objective of this paper is to determine whether evolvability could also be applied to the physiological functions of epolyQ. Indeed, APs and epolyQ are similar in many ways, including functional redundancy of non-amyloidogenic homologues, hormesis conferred by the heterogeneity of the stress-induced protein aggregates, the transgenerational prion-like transmission of the protein aggregates via germ cells, and the antagonistic pleiotropy relationship between evolvability and neurodegenerative disease. Given that epolyQ is widely expressed from microorganisms to human brain, whereas APs are only identified in vertebrates, evolvability of epolyQ is considered to be much more primitive compared to those of APs during evolution. Collectively, epolyQ may be not only be important in the pathophysiology of polyQ diseases, but also in the evolution of amyloid-related evolvability.

Also flagged:Diamond Blackfan Anemiaerythroid aplasiaRibosomal ProteinribosomesteroidsDiamond-Blackfan Anemia
Journal Article 2018-01-01 ✓ 1 Snippet Aspesi A, Borsotti C, Follenzi A.
In-Text Gene Mentions

…to avoid secondaryhemochromatosis[ 28 ].…

Show Full Abstract

Diamond Blackfan Anemia (DBA) is an inherited erythroid aplasia with onset in childhood. Patients carry heterozygous mutations in one of 19 Ribosomal Protein (RP) genes, that lead to defective ribosome biogenesis and function. Standard treatments include steroids or blood transfusions but the only definitive cure is allogeneic Hematopoietic Stem Cell Transplantation (HSCT). Although advances in HSCT have greatly improved the success rate over the last years, the risk of adverse events and mortality is still significant. Clinical trials employing gene therapy are now in progress for a variety of monogenic diseases and the development of innovative stem cell-based strategies may open new alternatives for DBA treatment as well. In this review, we summarize the most recent progress toward the implementation of new therapeutic approaches for this disorder. We present different DNA- and RNA-based technologies as well as new candidate pharmacological treatments and discuss their relevance and potential applicability for the cure of DBA.

Also flagged:HuntingtinHDbehavioralactinCAGautosomal-dominant neurodegenerative disorder
Journal Article 2018-01-01 ✓ 1 Snippet Morozko EL, Ochaba J, Hernandez SJ, Lau A, Sanchez I, Orellana I, Kopan L, Crapser J, Duong JH, Overman J, Yeung S, Steffan JS, Reidling J, Thompson LM.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Background</h4>Biochemical analysis of mutant huntingtin (mHTT) aggregation species in HD mice is a common measure to track disease. A longitudinal and systematic study of how tissue processing affects detection of conformers has not yet been reported. Understanding the homeostatic flux of mHTT over time and under different processing conditions would aid in interpretation of pre-clinical assessments of disease interventions.<h4>Objective</h4>Provide a systematic evaluation of tissue lysis methods and molecular and biochemical assays in parallel with behavioral readouts in R6/2 mice to establish a baseline for HTT exon1 protein accumulation.<h4>Methods</h4>Established biochemical methods were used to process tissue from R6/2 mice of specific ages following behavior tasks. Aggregation states and accumulation of mHTT exon 1 protein were evaluated using multiple break and assay methods to determine potential conformational flux assay specificity in detection of mHTT species, and tissue specificity of conformers.<h4>Results</h4>Detection of mHTT exon 1 protein species varied based on biochemical processing and analysis providing a baseline for subsequent studies in R6/2 mice. Insoluble, high molecular weight species of mHTT exon 1 protein increased and tracked with onset of behavioral impairments in R6/2 mice using multiple assay methods.<h4>Conclusions</h4>Conformational flux from soluble monomer to high molecular weight, insoluble species of mHTT exon 1 protein was generally consistent for multiple assay methods throughout R6/2 disease progression; however, the results support the use of multiple biochemical techniques to detect mHTT exon 1 protein species for preclinical assessments in HD mouse models expressing mHTT exon 1 protein.

Also flagged:autosomal dominant neurodegenerative disorderpolyglutamineHDHuntingtincognitive impairmentbehavioral
Journal Article 2018-01-01 ✓ 5 Snippets Thomson SB, Leavitt BR.
In-Text Gene Mentions

Characterization of the regulatory mechanisms that control HTT gene expression will help expand our understanding of both normal huntingtin function and HD pathogenesis.

The manipulation of HTT expression has enormous potential as a novel therapeutic approach for HD.

In the first study of its kind, a regulatory single nucleotide polymorphism (rSNP) in an NF-κB binding site in the HTT promoter was associated with reduced, allele-specific HTT expression that bidirectionally influences HD age of onset [9].

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by a CAG trinucleotide expansion in the HTT gene, which encodes for an abnormal polyglutamine tract in the huntingtin protein (HTT).

Finally, the effects of a transcription-lowering rSNP affecting NF-κB binding located in the promoter of the HTT gene was associated with a significant delay in age of onset when present on the mutant allele, but the same SNP on the normal HTT allele had only a modest effect in accelerating the age of onset [9].Together, these effects suggest that while HD is clearly caused by mHTT expression, the relative proportions of wild type HTT and mHTT may also be important modifying factors in HD.

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by a CAG trinucleotide expansion in the HTT gene, which encodes for an abnormal polyglutamine tract in the huntingtin protein (HTT). This review examines the known mechanisms of HTT gene regulation. We discuss HTT expression patterns, features of the HTT promoter, regulatory regions of the HTT promoter with functional significance, and HTT regulators located outside of the proximal promoter region. The factors that influence HTT expression in the brain and the mechanisms of HTT transcriptional regulation are currently poorly understood, despite continuing research. Expanding knowledge of HTT regulation will inform future studies investigating HTT function. Improving understanding of HTT expression and control may also uncover novel therapeutic approaches for HD through the development of methods to modulate mHTT levels.

Also flagged:Xanthineacyclicnucleoside phosphonatesxanthine nucleotidespurine nucleotidenucleobase
Journal Article 2018-01-01 No Snippets Baszczyňski O, Kaiser MM, Česnek M, Břehová P, Jansa P, Procházková E, Dračínský M, Snoeck R, Andrei G, Janeba Z.
Show Full Abstract

While noncanonic xanthine nucleotides XMP/dXMP play an important role in balancing and maintaining intracellular purine nucleotide pool as well as in potential mutagenesis, surprisingly, acyclic nucleoside phosphonates bearing a xanthine nucleobase have not been studied so far for their antiviral properties. Herein, we report the synthesis of a series of xanthine-based acyclic nucleoside phosphonates and evaluation of their activity against a wide range of DNA and RNA viruses. Two acyclic nucleoside phosphonates within the series, namely 9-[2-(phosphonomethoxy)ethyl]xanthine (PMEX) and 9-[3-hydroxy-2-(phosphonomethoxy)propyl]xanthine (HPMPX), were shown to possess activity against several human herpesviruses. The most potent compound was PMEX, a xanthine analogue of adefovir (PMEA). PMEX exhibited a single digit µM activity against VZV (EC<sub>50</sub> = 2.6 µM, TK<sup>+</sup> Oka strain) and HCMV (EC<sub>50</sub> = 8.5 µM, Davis strain), while its hexadecyloxypropyl monoester derivative was active against HSV-1 and HSV-2 (EC<sub>50</sub> values between 1.8 and 4.0 µM). In contrast to acyclovir, PMEX remained active against the TK<sup>-</sup> VZV 07-1 strain with EC<sub>50</sub> = 4.58 µM. PMEX was suggested to act as an inhibitor of viral DNA polymerase and represents the first reported xanthine-based acyclic nucleoside phosphonate with potent antiviral properties.

Also flagged:NF-κBRKIPLiver CarcinomacancertumorMDA-9
Journal Article 2018-01-01 No Snippets Notarbartolo M, Labbozzetta M, Pojero F, D'Alessandro N, Poma P.
Show Full Abstract

<h4>Background</h4>Overexpression of MDA-9/Syntenin occurs in multiple human cancer cell lines and is associated with higher grade of tumor classification, invasiveness and metastasis. In some cases, its role in cancer biology depends on relationships between MDA-9/Syntenin and NF-κB.<h4>Objective</h4>This study aims to analyze the presence of a regulation loop like that between MDA-9/Syntenin - NF-κB - RKIP in human liver carcinoma.<h4>Methods</h4>Transient transfection was performed with siRNA anti-MDA-9/Syntenin. Expression of different factors was evaluated by Real time-PCR and Western blotting, while NF-κB activation by TransAM assay. Invasion capacity was analyzed by Matrigel Invasion Assay and the effects of agents on cell viability were examined by MTS assay.<h4>Results</h4>We have examined basal expression of MDA-9/Syntenin in three cell lines of human liver carcinoma (HA22T/VGH, Hep3B and HepG2). In all cell lines there was an inverse relationship between MDA-9/Syntenin and RKIP expression levels, and a positive correlation between MDA-9/Syntenin expression and NF-κB activation levels. By silencing with a siRNA anti-MDA-9/Syntenin we observed in all cell lines a very strong increase of RKIP at mRNA level. Interestingly, in all cell lines, inhibition of MDA- 9/Syntenin expression induced NF-κB downregulation and contemporary a reduction in invasion ability MMP-2 dependent. Finally, we showed a good additive effect of MDA- 9/Syntenin siRNA when associated with Curcumin or Doxorubicin on cell growth inhibition.<h4>Conclusion</h4>Our data confirm the key role of MDA-9/Syntenin in HCC biology. The presence of a regulation loop among MDA-9/Syntenin, NF-κB and RKIP provide new pharmacological approaches.

Also flagged:HIV infectiondrug efflux transportersCYParginaseCytokineinflammatory cytokine
Journal Article 2018-01-01 ✓ 1 Snippet Mu Y, Patters BJ, Midde NM, He H, Kumar S, Cory TJ.
In-Text Gene Mentions

…Cambridge, UK, 1:1,000), anti-PRDX6(LSBio, Seattle, USA,1:400),…

Show Full Abstract

<h4>Background</h4>Cigarette smoking increases systemic oxidative stress, inflammation, and viral replication in individuals with HIV. Macrophages are infected during HIV infection and serve as an important reservoir throughout the process. Macrophages exist in two phenotypes, the classically activated M1 macrophage and alternatively activated M2 macrophage. The expression of drug efflux transporters and metabolic enzymes, which have direct effects on intracellular drug concentrations, differ between the pro-inflammatory M1 macrophage and the anti-inflammatory M2 macrophage.<h4>Objective</h4>To further explain the role of tobacco use in worsened outcomes in the HIV + population receiving antiretroviral therapy.<h4>Methods</h4>Western blotting was used to examine macrophage polarization and expression of drug efflux transporters, CYP enzymes, and antioxidant enzymes. The arginase assay was used to measure arginase activity. Cytokine production was measured using the human multiplex inflammatory cytokine assay kit. The 8-OHdG DNA Damage Quantification Direct Kit was used to quantify DNA damage. Viral replication under the influence of tobacco and antiretroviral drug use was measured by p24 Elisa.<h4>Results</h4>We observed phenotypic shifts from M1 to M2 with both individual and combination treatments with cigarette smoke condensate and the protease inhibitor antiretroviral drug lopinavir. These shifts lead to changes in cytokine production, the expression of CYP enzymes, anti-oxidant enzymes, and drug efflux transporters, as well as changes in viral replication.<h4>Conclusion</h4>This data suggest a mechanism by which tobacco use impairs HIV antiretroviral therapy to increase intracellular drug concentrations in this important cellular reservoir.

Also flagged:myopicchorioretinal atrophychoroidal neovascularizationtraction retinopathyPEX7OCA2
Journal Article 2018-01-01 ✓ 1 Snippet Chen L, Wei Y, Chi W, Fang D, Jiang X, Zhang S.
In-Text Gene Mentions

…RASGRF1, RBFOX1, RDH5,SHISA6, TJP2, TOX and…

Show Full Abstract

<h4>Purpose</h4>Pathologic myopia is a leading cause of visual impairment in East Asia. The aim of this study was to investigate the potential mutations in Chinese pathologic myopic patients and to analyze the correlations between genotype and clinical phenotype.<h4>Methods</h4>One hundred and three patients with pathologic myopia and one hundred and nine unrelated healthy controls were recruited from Zhongshan Ophthalmic Center. Detailed clinical data, including ultra-widefield retinal images, measurements of bestcorrected visual acuity, axial length, refractive error and ophthalmic examination results, were obtained. Blood samples were collected for high-throughput DNA targeted sequencing. Based on the screening results, phenotype-genotype correlations were analyzed.<h4>Results</h4>The study included 196 eyes of 103 patients (36 men and 67 women) with an average age of 52.19 (38.92 - 65.46) years, an average refractive error of -11.80 D (- 16.38 - -7.22) and a mean axial length of 28.26 mm (25.79 - 30.73). The patients were subdivided into three groups: myopic chorioretinal atrophy (190 eyes of 101 patients), myopic choroidal neovascularization (17 eyes of 15 patients), and myopic traction retinopathy (71 eyes of 61 patients). Systematic analysis of variants in the 255 genes revealed six potential pathogenic mutations: PEX7, OCA2, LRP5 (rs545382, c.1647T>C), TSPAN12 (rs41623, c.765G>T), RDH5 (rs3138142, c.423C>T) and TTC21B (rs80225158, c.2385G>C). OCA2 mutations were primarily observed in patients with myopic traction maculopathy.<h4>Conclusion</h4>Genetic alterations contribute to various clinical characteristics in Chinese pathologic myopic patients. The study may provide new insights into the etiology of pathologic myopia and potential targets for therapeutic interventions.

Also flagged:Gene expressioncolorectal cancerIL1BIL6TNFTRL4
Journal Article 2018-01-01 ✓ 1 Snippet Malekpour H, Heidari MH, Vafaee R, Moravvej Farshi H, Khodadoostan M.
In-Text Gene Mentions

…as APC, p53,DCC, survivin and RAS…

Show Full Abstract

<h4>Aim</h4>The aim of this research was to find a clear molecular view of dysplasia via network analysis.<h4>Background</h4>There are some evidence suggest the relationship between dysplasia and colorectal cancer. Understanding of high-grade dysplasia (HGD) could be beneficial for colon cancer management.<h4>Methods</h4>Bioinformatics study of HGD versus healthy subjects was conducted to check the status of differentially expressed genes (DEGs). GSE31106, GPL1261, GSM770092-94 and GSM770101-6 were the sources from gene expression omnibus (GEO) that queried for protein-protein interaction (PPI) network analysis via Cytoscape and its algorithms. Hubs of network were enriched for biochemical pathways and were validated via clustering analysis.<h4>Results</h4>Numbers of 46 hub nodes were determined and were included in 12 pathways. A main cluster including 76 nodes was identified containing 45 hubs. 33 hubs among 46 genes were involved in biochemical pathways. IL1B, IL6, TNF, and TRL4 were the most important critical genes.<h4>Conclusion</h4>Many different genes as hub nodes might influence the trigger and development of advance condition and also colon cancer.

Also flagged:T cell activationmembraneBTLAHVEMCD40CD40L
Journal Article 2018-01-01 No Snippets Bourque J, Hawiger D.
Show Full Abstract

By acquiring, processing, and presenting both foreign and self-antigens, dendritic cells (DCs) initiate T cell activation that is shaped through the immunomodulatory functions of a variety of cell-membrane-bound molecules including BTLA-HVEM, CD40-CD40L, CTLA-4-CD80/CD86, CD70-CD27, ICOS-ICOS-L, OX40-OX40L, and PD-L1-PD-1, as well as several key cytokines and enzymes such as interleukin-6 (IL-6), IL-12, IL-23, IL-27, transforming growth factor-beta 1 (TGF-β1), retinaldehyde dehydrogenase (Raldh), and indoleamine 2,3-dioxygenase (IDO). Some of these distinct immunomodulatory signals are mediated by specific subsets of DCs, therefore contributing to the functional specialization of DCs in the priming and regulation of immune responses. In addition to responding to the DC-mediated signals, T cells can reciprocally modulate the immunomodulatory capacities of DCs, further refining immune responses. Here, we review recent studies, particularly in experimental mouse systems, that have delineated the integrated mechanisms of crucial immunomodulatory pathways that enable specific populations of DCs and T cells to work intimately together as single functional units that are indispensable for the maintenance of immune homeostasis.

Ferroptosis and Brain Injury.

Also flagged:deathironlipidoxygenferroptosisstroke
Journal Article 2018-01-01 ✓ 1 Snippet Magtanong L, Dixon SJ.
In-Text Gene Mentions

PEBP1

Show Full Abstract

Ferroptosis is a nonapoptotic form of cell death characterized by the iron-dependent accumulation of toxic lipid reactive oxygen species. Small-molecule screening and subsequent optimization have yielded potent and specific activators and inhibitors of this process. These compounds have been employed to dissect the lethal mechanism and implicate this process in pathological cell death events observed in many tissues, including the brain. Indeed, ferroptosis is emerging as an important mechanism of cell death during stroke, intracerebral hemorrhage, and other acute brain injuries, and may also play a role in certain degenerative brain disorders. Outstanding issues include the practical need to identify molecular markers of ferroptosis that can be used to detect and study this process in vivo, and the more basic problem of understanding the relationship between ferroptosis and other forms of cell death that can be triggered in the brain during injury.

Also flagged:replication forksRAD51recombinasecancerreplication forksynthesis
Journal Article 2018-01-01 ✓ 5 Snippets Son MY, Hasty P.
In-Text Gene Mentions

MMS22L-TONL binds to RAD51…

…TheMMS22L-TONSL complex is apart…

MMS22L-TONSL associated with RPA-coa…

…RPA-coated ssDNA andMMS22Ldirectly interacts with…

MMS22L-TONSL recruitment of RAD51…

Show Full Abstract

Homologous recombination (HR) repairs DNA double strand breaks (DSBs) and stabilizes replication forks (RFs). RAD51 is the recombinase for the HR pathway. To preserve genomic integrity, RAD51 forms a filament on the 3' end of a DSB and on a single-stranded DNA (ssDNA) gap. But unregulated HR results in undesirable chromosomal rearrangements. This review describes the multiple mechanisms that regulate HR with a focus on those mechanisms that promote and contain RAD51 filaments to limit chromosomal rearrangements. If any of these pathways break down and HR becomes unregulated then disease, primarily cancer, can result.

Also flagged:IronHepcidin
Journal Article 2018-01-01 No Snippets Silvestri L.
Show Full Abstract

No abstract available.

Also flagged:AMLacute myeloid leukemiakinasetranscription factorstumorchromatin
Journal Article 2018-01-01 ✓ 3 Snippets Marceau-Renaut A, Duployez N, Ducourneau B, Labopin M, Petit A, Rousseau A, Geffroy S, Bucci M, Cuccuini W, Fenneteau O, Ruminy P, Nelken B, Ducassou S, Gandemer V, Leblanc T, Michel G, Bertrand Y, Baruchel A, Leverger G, Preudhomme C, Lapillonne H.
In-Text Gene Mentions

KMT2A were found to be rearranged in 79 AML (21%) with 13 different partners among which MLLT3 was by far the most common (n = 36, 46% of KMT2A-rearranged AML) followed by MLLT10 (n = 13, 16%), ELL (n = 6, 8%), MLLT1 (n = 5, 6%), and MLLT4 (n = 5, 6%).

…(exons 7, 9)],chromatin modifiersmodifiers [ ASXL1…

…AML) followed byMLLT10(n = 13,…

Show Full Abstract

Despite major treatment improvements over the past decades, pediatric acute myeloid leukemia (AML) is still a life-threatening malignancy with relapse rates up to 30% and survival rates below 75%. A better description of the pattern of molecular aberrations in childhood AML is needed to refine prognostication in such patients. We report here the comprehensive molecular landscape using both high-throughput sequencing focused on 36 genes and ligation-dependent RT-PCR in 385 children with de novo AML enrolled in the prospective ELAM02 trial and we evaluated their prognostic significance. Seventy-six percent of patients had at least 1 mutation among the genes we screened. The most common class of mutations involved genes that control kinase signaling (61%) followed by transcription factors (16%), tumor suppressors (14%), chromatin modifiers (9%), DNA methylation controllers (8%), cohesin genes (5%), and spliceosome (3%). Moreover, a recurrent transcript fusion was detected in about a half of pediatric patients. Overall, CBF rearrangements, <i>NPM1</i> and double <i>CEBPA</i> mutations represented 37% of the cohort and defined a favorable molecular subgroup (3 years OS: 92.1%) while <i>NUP98</i> fusions, <i>WT1</i>, <i>RUNX1</i>, and <i>PHF6</i> mutations (15% of the cohort) segregated into a poor molecular subgroup (3 years OS: 46.1%). <i>KMT2A</i>-rearrangements (21% of the cohort) were associated with an intermediate risk. Despite some overlaps, the spectrum of molecular aberrations and their prognostic significance differ between childhood and adult AML. These data have important implications to contribute in refining risk stratification of pediatric AML and show the need for further validations in independent pediatric cohorts.

Also flagged:deathrespiratory failurepathogenesisanxiety disordersSerotoninserotonin receptor-1A
Journal Article 2018-01-01 ✓ 2 Snippets Lesch K.
In-Text Gene Mentions

…onin transporter (5-HTT) gene, widely known…

…he generation of the 5-HTT knockout mouse. …

Show Full Abstract

No abstract available.

Also flagged:GBMbrain tumourGlioblastomatumours5-aminolevulinic acidtumor
Journal Article 2018-01-01 ✓ 1 Snippet Wood J, Smith S, Lourdusamy A, Castellanos M, May S, Grundy R, Rahman R.
In-Text Gene Mentions

…(APOD, LRP2, andPLCL1).…

Show Full Abstract

Abstract <h4>INTRODUCTION</h4> Maximal surgical resection for the malignant brain tumour Glioblastoma (GBM) inevitably leaves residual disease that disseminates predominantly along white matter tracts in the invasive unresectable region. Multi-region sampling has revealed phylogenetic relationships amongst GBM subclones, highlighting the utility of this method for the study of these heterogeneous tumours. Here, we report on an invasive region expression profile obtained through a multi-region sampling approach. <h4>METHODS</h4> Multi-region sampling during maximal surgical resection was performed on five adult GBM patients based on MRI scans and 5-aminolevulinic acid administration for fluorescent identification of the invasive region. RNA was extracted from each region of the GBM patient and hybridized with Affymetrix GeneChip Human Gene 2.0 ST arrays. <h4>RESULTS</h4> Distinct expression profiles were observed for regions within a patient, indicating intra-tumor heterogeneity of GBM. The comparison of invasive region with other tumor regions using linear models for microarray data revealed 44 differentially expressed genes (adjusted P-value < 0.05). Remarkably, all 44 genes showed elevated expression in the invasive region and were enriched with biological processes such as myelination (KLK6, MAL, and MBP), cell adhesion (CNTNAP4, CTNNA3, EDIL3, HAPLN2, MAG, and MOG), and lipid metabolic process (APOD, LRP2, and PLCL1). In addition, the GBM invasive region was characterized by the expression of several genes associated with a GBM neural subtype. <h4>CONCLUSIONS</h4> Isolating and characterising tumour cells infiltrating normal brain within the invasive region remains a bottleneck to the development of therapies tailored to GBM. Gene expression analysis of the invasive region revealed the overexpression of cancer-related genes with possible involvement in invasion along white matter tracts. Although several overexpressed genes likely represent the normal white matter brain component obtained during maximal surgical removal, the identification of cancer-related genes provides proof-of-principle for -omics approaches utilising invasive region tumour tissue to identify biomarkers and targets for therapeutic evaluation.

Also flagged:Rho GTPaseRac1DOCK4GBMbrain tumourstumour
Journal Article 2018-01-01 No Snippets Egnuni T, Speirs V, Chakrabarty A, Wurdak H, Short S, Mavria G.
Show Full Abstract

Abstract <h4>INTRODUCTION</h4> The aggressive nature of brain tumours and resistance to therapy is highly influenced by the tumour microenvironment. A key feature of glioblastoma, also used in diagnosis, is the high degree of aberrant vascularity. Rho GTPases are key regulators of blood vessel growth and morphology. Activation of Rho proteins is controlled by guanine nucleotide exchange factors (GEFs), and GTPase activating proteins (GAPs). The study is focused on understanding the role of the Rac1 GEF DOCK4 in the tumour cell, and stroma cell compartments of glioblastoma. <h4>METHODS</h4> i) The role of DOCK4 in invasion was analysed using organotypic spheroid assays ii) DOCK4 expression was determined in patient samples and related to expression of stem cell markers iii) The role of vascular Dock4 was investigated in experimental tumours implanted intracranially in heterozygous Dock4 null mice and treated with radiotherapy. <h4>RESULTS</h4> i) DOCK4 knockdown reduced outgrowth of patient derived glioblastoma cells in spheroid assays. ii) Oncomine microarray data showed significant increase of DOCK4 levels in cultured GBM cells isolated from tumours compared to neural stem cells. Immunohistochemical analysis showed correlation between DOCK4 and nestin expression. iii) Analysis of primary and recurrent GBM samples showed larger diameter and blood vessels with more of glomeruloid structures in recurrent tumours iv) Heterozygous Dock4 genetic deletion resulted in reduction of blood vessel diameter. There was reduced tumour burden in response to radiotherapy with Dock4 deletion in the vascular compartment, compared to radiation therapy alone. <h4>CONCLUSIONS</h4> Invasion of tumour cells into normal brain parenchyma, and microvascular proliferation of endothelial cells, both pathologic hallmarks of GBM, may be potentially blocked by inhibition of Rac1 signaling and the Rac1 GEF factor DOCK4.

Also flagged:folategliomaglioblastomatumourstumourmethylation
Journal Article 2018-01-01 No Snippets Rudd M, Lea R, Alder J.
Show Full Abstract

Abstract Survival rates in patients with glioblastoma have shown little improvement over the last 40 years due to the heterogeneity of tumours and the difficulty of specifically targeting the tumour whilst sparing surrounding healthy tissue. Altered gene methylation is often observed in glioma cells, and methylating agents such as folate may reverse aberrant methylation. Folate treatment has shown a beneficial effect, reducing risk of certain cancers (colorectal, breast, squamous cell carcinoma), whereas other studies have shown detrimental effects following folate treatment, whereby proliferation of cancer increased (mammary, prostate). The aim of this study was to investigate the opposing roles of folate in glioma. The glioma cell lines 1321N1, U87 MG and non-cancerous glial SVGp12 cells were grown in folate deficient, folic or folinic acid supplemented media and compared to standard cell culture media. Cell viability, apoptosis and cell cycle analysis along with methylation status and protein expression of the genes of interest; PTEN, FOLR1, RFC, PCFT, and MTHFR were analysed to determine differences between cell lines following treatment. Folic and folinic acid behaved differently depending on the concentration used and the cell lines treated. Low folic acid at 5 µg/ml significantly increased cell viability and protein expression levels in the U87 MG and SVGp12 cell lines, whilst the high dose of folinic acid (35 µg/ml) resulted in significant decreased cell viability, increased apoptotic activity and down regulation of the folate transporters in the 1321N1, U87 MG and SVGp12 cell lines. Folate treatment did not significantly alter cell cycle phase. Altered methylation of genes specific for folate metabolism and transport did not explain the cytotoxic effects of folate in cell lines. In conclusion folinic acid rather than folic acid supplementation should be investigated further to elucidate the mechanism of potential cytotoxic effects in glioma.

Also flagged:BNOS
Journal Article 2018-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:breast cancerCancertransportersdetoxification5-fluorouracildoxorubicin
Journal Article 2018-01-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…genes (rs1799945 inHFE, rs3817672 in TFR1,…

Show Full Abstract

No abstract available.

ISEV2018 abstract book

Also flagged:AutophagyMetabolismRegulation of AutophagyMacroautophagydigestionresponses to stress
Journal Article 2018-01-01 ✓ 5 Snippets Unknown Authors
In-Text Gene Mentions

…ied olfactomedin 4 (OLFM4) as a critical dist…

…ophil exosomes with OLFM4 cargo activated ker…

…t the proportion of OLFM4-positive neutrophil…

…acid cellulose (DAC and DCC respectively). …

…ctionalized CNF and DCC were inactive towar…

Show Full Abstract

No abstract available.

Index

Also flagged:Ectonucleotidase CD39ovarian cancerBrugada syndromeELMO1Elvitegraviremtricitabine
Journal Article 2018-01-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

Tumor suppressor genes APCsuppressor genes APC,…

Show Full Abstract

No abstract available.

Also flagged:MeaslesSpontaneous AbortionColorectal CancerThiazideChronic PainBehavior
Journal Article 2018-01-01 No Snippets Lozano P, Palazzo L, Morrison C, Cheadle A, Fahey K, Simon L, Rauchwerger A, Chettipally U, Vinson D, Warton M, Kharbanda A, Kharbanda E, Ballard D, Allen B, Soderberg K, McClure D, McLean H, Klein N, Naleway A, Kharbanda E, Vazquez-Benitez G, Lipkind H, Sheth S, Zhu J, Naleway A, Klein N, Hecther R, Daley M, Donahue J, Jackson M, Kawai A, Nordin J, Bandoli G, Kuo G, Sugathan R, Chambers C, Rolland M, Palmsten K, Sterling S, Jones A, Iturralde E, Skinner A, Hinman A, Weisner C, Lafata J, Alishahitabriz A, Fleming P, Flocke S, Hawley S, Jones R, Resnicow K, Shires D, Shin Y, Tu S, Pressman A, Azar K, Jacobson A, Nerlekar R, Robinson S, Sudat S, Dingbaum E, Darsie B, Rashed J, Hall E, Moreno M, Lockhart S, Marshall C, Adams A, Ma L, Altschuler A, Kim E, Kim M, Thompson N, Young J, Laing S, Sterling R, Ocampo C, Baugh S, Maeng D, Baylor K, Han J, Bulger J, Sherman K, Walker R, Saunders K, Shortreed S, Parchman M, Hansen R, Thakral M, Ludman E, Dublin S, Von Korff M, Tu H, Nadeau R, Wagner C, Fricton J, Whitebird R, Vazquez-Benitez G, Ziegenfuss J, Grossman E, Dillon E, Yang Y, Tang V, Sudore R, Tai-Seale M, Westgard B, Kaye K, Zagar A, Anderson J, Wewerka S, Nakagaki K, Pulk R, Evans M, Carmichael J, Greskovic G, Kern M, Parry D, Wright E, Williams M, Fisher K, Smith K, Gallagher T, Huang J, Borton J, Mazor K, Hung D, Truong Q, Zhang Q, Liang S, Luft H, Chung S, Luft H, Tai-Seale M, Nordgren R, Yang Y, Meehan A, Steinberg R, Chang J, Chan A, Dillon E, Li J, Olson C, Lee T, Nauenberg T, Connolly S, Frosch D, Thompson J, Davis M, Michaels L, Rivelli J, Castro M, Younger B, Castillo M, Reich S, Coronado G, Goble J, Zolfaghari K, Yu S, Godley P, Copeland L, Dehmer G, Michel J, Sperl-Hillen J, Crain A, Margolis K, Kottke T, O’Connor P, Cooper S, Rehrauer D, Marshall P, Westgard B, Martinson B, Maciosek M, Farah F, Wewerka S, Pryce D, Yan X, Jones J, Liberman J, Liang L, Stewart W, Vupputuri S, Boonyasai R, Rubenstein K, Derus A, Truong C, Schousboe J, Kats A, Langsetmo L, Vo T, Taylor B, Schwartz A, Cawthon P, Lewis B, Barrett-Connor E, Hoffman A, Orwoll E, Ensrud K, Green B, Anderson M, Campbell J, Cook A, Ehrlich K, Evers S, Hall Y, Hsu C, Joseph D, Klasnja P, Margolis K, Munson S, Thompson M, Dehmer S, Maciosek M, LaFrance A, Flottemesch T, Garg T, Anzuoni K, Landyn V, Hajduk A, Waring S, Hanson L, Whitson H, Divan H, Erickson K, Barrett K, Winer Z, Malenfant J, Herzig-Marx C, Brown J, Armstrong M, Merchant M, Alabaster A, Raine-Bennett T, Postlethwaite D, Malenfant J, Hochstadt J, Barrett K, Wyner Z, Dee D, Corriveau D, Nolan B, Herzig-Marx C, Brown J, Rodriguez C, Rubenstein K, Jonas C, Sun Y, Horberg M, Loftus B, Yu S, Liao I, Chen L, Godley P, Ivy D, Cryar A, Graham J, Capatch K, Yarczower B, Krupka D, Zerhouni Y, Reich A, Li A, Weissman J, Rendle K, Garrett S, Abramson C, Dohan D, Basu R, Stevens A, Tisminetzky M, Gurwitz J, Goldberg R, Tabada G, Sung S, Go A, Mosen D, Banegas M, Friedman N, Shuster E, Cho J, Stevens A, Bayliss E, Ellis J, Zeng C, Garg T, Young A, O’Keeffe-Rosetti M, McMullen C, Nielsen M, Kirchner H, Murphy T, Johnson N, Renner J, Durham J, Schroder L, Ziegenfuss J, Switzer J, Zhang N, Field T, Zhou Y, Mazor K, Gurwitz J, Le S, Copeland L, Zeber J, Benge J, Allen L, Cho J, Liao I, Rasmussen J, Lerman S, Amichai B, Weinstein G, Shalev V, Chodick G, Garg T, Connors J, Ladd I, Bogaczyk T, Larson S, Epstein M, Saphirak C, Zhou Y, Birmann B, LeBlanc C, Rosmarin A, Gurwitz J, Check D, Chawla N, Lee V, Brenman L, De Mucha Flores A, Liu R, Li Y, Davis A, Kwan M, Singh S, Marshall J, Haynes K, McMahill-Walraven C, Brown J, Chawla N, Brunner J, Rose D, Chanfreau C, Darling J, Yano E, Mosen D, Mummadi R, Banegas M, Shuster E, Chawla N, Rose D, Brunner J, Darling J, Yano E, Pawloski P, Jackson J, DeFor T, Butani A, Saxen C, Kane S, Chang S, Pawloski P, Kehn H, Shapiro A, Anderson D, Lacy M, Shankaran V, Jones L, Ladd I, Graham J, Evans M, Gionfriddo M, Worrall C, Spencer D, Au-Yeung C, Zylla E, Johnson K, Hartman L, Ham K, Anderson J, Sperl-Hillen J, Crain A, Desai J, Margolis K, Ekstrom H, O’Connor P, Grossman E, Vazquez-Benitez G, Whitebird R, Lawson K, Fricton J, Isenberger K, Burnett A, Anderson J, Mayer A, Wewerka S, Pasquarella J, Frascone R, Mazor K, Smith K, Gallagher T, Crawford S, Zhou Y, Amroze A, Fisher K, Niccum D, Kharbanda E, Asche S, Sinaiko A, Nordin J, Ekstrom H, Dehmer S, DeSilva M, Vazquez-Benitez G, Kharbanda E, Li M, Dillon E, Li J, Yang Y, Erlich K, Heneghan A, Tai-Seale M, Becker D, Li J, Dillon E, Li M, Erlich K, Heneghan A, Yang Y, Tai-Seale M, Becker D, Nordin J, Vazquez-Benitez G, Kharbanda E, Olsen A, Kuckler L, Dehmer S, Trower N, Asche S, Ekstrom H, Nordin J, O’Connor P, Sinaiko A, Kharbanda E, Ekstrom H, Kharbanda E, Vazquez-Benitez G, Dehmer S, O’Connor P, Kunisetty G, Sharma R, Kharbanda A, Pardee R, Irving S, Bachman D, Crane B, Vesco K, Harsh S, Sengupta S, Kharbanda E, Vazquez-Benitez G, McCarthy N, Naleway A, Pawloski P, Haynes K, Kent D, McMahill-Walraven C, Panozzo C, Pindolia V, Brown J, Barr C, Eichelberger B, Hung D, Zhang Q, Truong Q, Liang S, Luft H, Jefferson C, Oakkar A, Derus A, Blank J, Ter-Minassian M, Mack C, Weeks J, Groom H, Crane B, Irving S, McCarthy N, Daley M, Donahue J, Glenn S, Goddard K, Jackson M, Kiniry E, Lewis N, Lugg M, Madziwa L, Scotty E, Sy L, Wain K, Naleway A, Weeks J, Carrell D, Kamineni A, Gundersen G, Oliver M, Lawrence M, Graham V, Szwerinski N, Nasrallah C, Chopra V, Lee L, Romanelli R, Vazquez-Benitez G, Canterbury M, Johnson J, Elizondo A, Tillema J, Kottke T, Keeler E, Nasrallah C, Szwerinski N, Chopra V, Halley M, Azar K, Romanelli R, Sperl-Hillen J, Desai J, Crain A, O’Connor P, Kopski K, Kaul R, Johns C, Fu N, O’Leary J, Melnick G, LaMori J, Howe J, Rich J, Pineda E, McNeal C, Liao I, Godley P, Hassen D, Snyder S, Rahm A, Jarrett D, Crissinger S, Hao Q, Leeming R, Wynn R, Miller K, Grafton J, Ralston J, Scrol A, Carrell D, Jonas C, Turner M, Janes K, Burnett-Hartman A, Blum-Barnett E, Clancy H, Aziz N, Blum-Barnett E, Burnett-Hartman A, Madrid S, Jonas C, Turner M, Janes K, Clancy H, Harris-Wai J, Aziz N, O’Leary J, Fu N, Melnick G, LaMori J, Howe J, Rich J, Papajorgji-Taylor D, Schneider J, Gruss I, Mosen D, Lindberg N, Sandler P, Jordan L, Nguyen M, Baldwin M, Sanchez K, Stoecker Z, Van Amber B, Isenberger K, LeFevere R, Woster C, Terwilliger A, Dries D, Radant T, Pasquarella J, Majerus A, Simpson M, Mayer A, Wewerka S, Miller P, Burnett A, Naleway A, Henninger M, Waiwaiole L, Leo M, Mosen D, Pihlstrom D, Liang S, Luft H, Li J, Chung S, Luft H, Kottke T, Gallagher J, Lowry M, Rauri S, Tillema J, Ziegenfuss J, Pronk N, Knudson S, Vupputuri S, Derus A, Truong C, Wells A, Emanuel E, Erlich K, Becker D, Dillon E, Li M, Li J, Heneghan A, Harry M, Saman D, O’Connor P, Ekstrom H, Sperl-Hillen J, Bianco J, Elliott T, Jonas C, Rivelli J, Coronado G, Fuoco M, Gawlik V, Petrik A, Jimenez R, Beidas R, Wolk C, Jager-Hyman S, Ahmedani B, Zeber J, Fein J, Brown G, Gregor C, Lieberman A, Marcus S, Husby H, Liang L, Delatorre-Reimer J, Mosser C, Yan X, Jones J, Delatorre-Reimer J, Liang L, Husby H, Mosser C, Jones J, Fuller S, Bachman D, Sengupta S, Zhu J, Olsen A, DeFor T, Butani A, Vazquez-Benitez G, Bachman D, Sengupta S, Blank J, Fuller S, Folck B, Gray M, Nyirenda C, Cleveland C, Bulkley J, Naleway A, Vesco K, Hoffman S, Urosevich T, Kirchner H, Boscarino J, Adams R, Figley C, Withey C, Dugan R, Boscarino J, Yeh H, Westphal J, Hu Y, Peterson E, Williams L, Prabhakar D, Frank C, Autio K, Elsiss F, Simon G, Beck A, Lynch F, Rossom R, Lu C, Owen-Smith A, Waitzfelder B, Ahmedani B, Elsiss F, Autio K, Westphal J, Yeh H, Hu Y, Peterson E, Williams L, Prabhakar D, Frank C, Simon G, Lu C, Lynch F, Rossom R, Owen-Smith A, Beck A, Waitzfelder B, Ahmedani B, Terwilliger A, Godfrey G, Billstein L, Wewerka S, Rossom R, Peterson E, Chawa M, DiGiandomenico C, Prabhakar D, Hu Y, Owen-Smith A, Simon G, Williams L, Hubley S, Lynch F, Beck A, Waitzfelder B, Lu C, Ahmedani B, Sengupta S, Bachman D, Blank J, Wong C, Gray M, Cleveland C, Ziegenfuss J, Dean K, Bergdall A, Beran M, Green B, Helm A, Norton C, O’Connor P, Solberg L, Haugen P, Sperl-Hillen J, Margolis K, Fuoco M, Crawford P, Papajorgji-Taylor D, Laws R, McBurnie M, Hansen K, Weatherby L, Vazquez-Benitez G, Kharbanda E, Lipkind H, Sheth S, Zhu J, Naleway A, Klein N, Hechter R, Daley M, Donahue J, Jackson M, Kawai A, Xu Z, Newcomer S, Nordin J, Sour E, Ziegenfuss J, Vazquez-Benitez G, Grossman E, Whitebird R, Fricton J, Ziegenfuss J, Easterday C, Anderson J, Gallagher J, Knudson S, Kottke T, Pronk N, Rauri S, Levy D, Yan X, Jones J, Delatorre-Reimer J, Husby H, Mosser C, Nerlekar R, Liang L, Mudiganti S, Shen Z, Stewart W, Nelson J, Hegarty J, Ladd I, Gogoi R, Bogaczyk T, Larson S, Reams M, Appana D, Solberg L, Thirumalai V, Boehm C, Paskach R, Ahlers T, Rindal D, Pronk N, Gesko D, Ogden J, Rush W, Vupputuri S, Truong C, Wells A, Derus A, Emanuel E, Renner J, Katz A, Kottke T, McCannn P, Harvey L, Mettner J, Taswell R, Ziegenfuss J, Wright L, Dillon E, Madrid S, Napolitano G, Tuzzio L, Schramke M, Truong C, Daugherty S, Hu H, Durfee J, Wain K, Maertens J, McCance J, Heyn H, Skenadore A, Wright L, Dircksen S, Hanratty R, Steiner J, Blair I, Dickinson L, Helmkamp L, Havernek E, Vupputuri S, Nelson J, Simon H, Schnitker C, Wewerka S, Gionfriddo M, Nelson J, Sazama A, Grall K, Wewerka S, Wright L, Bellofatto T, Dunham S, Barrientos-Ortiz C, Dries D, Wewerka S, Miller P, Melnick G, O’Leary J, Fu N, Howe J, Rich J, Yang Y, Dillon E, Meehan A, Li J, Frosch D, Nordgren R, Tai-Seale M, Westgard B, Warren D, Johnson J, Canterbury M, Kottke T, Caspi C, Grannon K, Riley L.
Show Full Abstract

No abstract available.

Also flagged:proB-type natriuretic peptidetumor-necrosis factor-αinterleukin-2
Journal Article 2018-01-01 No Snippets Thiriet M.
Show Full Abstract

No abstract available.

Hyperlipidemias and Obesity

Also flagged:HyperlipidemiasObesityoxygenamino acidssugarsfatty acids
Journal Article 2018-01-01 No Snippets Thiriet M.
Show Full Abstract

No abstract available.