Gene Literature Dashboard

Viewing February 2018 — 378 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← January 2018 March 2018 →
Also flagged:Hepatocellular carcinomamalignant tumormethylationCOXLiver cancerdeath
Journal Article 2018-02-28 No Snippets Liu S, Miao C, Liu J, Wang CC, Lu XJ.
Show Full Abstract

Hepatocellular carcinoma (HCC) was the second most common malignant tumor with a poor prognostic condition. We aimed to identify novel methylation signatures to predict HCC patients at their early stages. Differentially expressed methylated genes between HCC patients and normal liver tissues retrieved from TCGA were screened out by SAM. Genes highly related to patients' survival were figured out by COX. The signatures that could identify relapse HCC patients were identified by the forwarding search algorithm. Besides, functional enrichment analysis was performed on the methylation genes in the signature. A total of 5,392 CPG sites that differentially methylated expressed were found out and 4,294 differentially expressed genes were obtained. A total of 197 genes among were associated with RFS of HCC patients at both stage I and stage II. Signature composed of 21 pairs was obtained to predict the prognostic situation by C-index forward search method. The function of these genes was figured out by functional enrichment analysis. To summary, the signature composed of 21 gene pairs that can predict the prognostic situation of HCC patients at both stage I and stage II, provided a reference standard for the adjuvant therapy of HCC patients after surgery.

Also flagged:aginggene expressiontelomerecystsageingReverse Transcriptase
Journal Article 2018-02-28 No Snippets Mouton S, Grudniewska M, Glazenburg L, Guryev V, Berezikov E.
Show Full Abstract

Animals show a large variability of lifespan, ranging from short-lived as Caenorhabditis elegans to immortal as Hydra. A fascinating case is flatworms, in which reversal of aging by regeneration is proposed, yet conclusive evidence for this rejuvenation-by-regeneration hypothesis is lacking. We tested this hypothesis by inducing regeneration in the sexual free-living flatworm Macrostomum lignano. We studied survival, fertility, morphology, and gene expression as a function of age. Here, we report that after regeneration, genes expressed in the germline are upregulated at all ages, but no signs of rejuvenation are observed. Instead, the animal appears to be substantially longer lived than previously appreciated, and genes expressed in stem cells are upregulated with age, while germline genes are downregulated. Remarkably, several genes with known beneficial effects on lifespan when overexpressed in mice and C. elegans are naturally upregulated with age in M. lignano, suggesting that molecular mechanism for offsetting negative consequences of aging has evolved in this animal. We therefore propose that M. lignano represents a novel powerful model for molecular studies of aging attenuation, and the identified aging gene expression patterns provide a valuable resource for further exploration of anti-aging strategies.

Also flagged:transcriptional coactivatorHDsignal transductionpathogenesisstriatal atrophydeath
Journal Article 2018-02-28 ✓ 1 Snippet McMeekin LJ, Li Y, Fox SN, Rowe GC, Crossman DK, Day JJ, Li Y, Detloff PJ, Cowell RM.
In-Text Gene Mentions

htt

Show Full Abstract

Multiple lines of evidence indicate that a reduction in the expression and function of the transcriptional coactivator peroxisome proliferator-activated receptor gamma coactivator-1α (PGC-1α) is associated with neurodegeneration in diseases such as Huntington's disease (<i>H</i>D). Polymorphisms in the PGC-1α gene modify HD progression and PGC-1α expression is reduced in striatal medium spiny neurons (MSNs) of HD patients and mouse models. However, neither the MSN-specific function of PGC-1α nor the contribution of PGC-1α deficiency to motor dysfunction is known. We identified novel, PGC-1α-dependent transcripts involved in RNA processing, signal transduction, and neuronal morphology and confirmed reductions in these transcripts in male and female mice lacking PGC-1α specifically in MSNs, indicating a cell-autonomous effect in this population. MSN-specific PGC-1α deletion caused reductions in previously identified neuronal and metabolic PGC-1α-dependent genes without causing striatal vacuolizations. Interestingly, these mice exhibited a hypoactivity with age, similar to several HD animal models. However, these newly identified PGC-1α-dependent genes were upregulated with disease severity and age in knock-in HD mouse models independent of changes in PGC-1α transcript, contrary to what would be predicted from a loss-of-function etiological mechanism. These data indicate that PGC-1α is necessary for MSN transcriptional homeostasis and function with age and that, whereas PGC-1α loss in MSNs does not replicate an HD-like phenocopy, its downstream genes are altered in a repeat-length and age-dependent fashion. Understanding the additive effects of PGC-1α gene functional variation and mutant huntingtin on transcription in this cell type may provide insight into the selective vulnerability of MSNs in HD.<b>SIGNIFICANCE STATEMENT</b> Reductions in peroxisome proliferator-activated receptor gamma coactivator-1α (PGC-1α)-mediated transcription have been implicated in the pathogenesis of Huntington's disease (<i>H</i>D). We show that, although PGC-1α-dependent transcription is necessary to maintain medium spiny neuron (MSN) function with age, its loss is insufficient to cause striatal atrophy in mice. We also highlight a set of genes that can serve as proxies for PGC-1α functional activity in the striatum for target engagement studies. Furthermore, we demonstrate that PGC-1α-dependent genes are upregulated in a dose- and age-dependent fashion in HD mouse models, contrary to what would be predicted from a loss-of-function etiological mechanism. However, given this role for PGC-1α in MSN transcriptional homeostasis, it is important to consider how genetic variation in PGC-1α could contribute to mutant-huntingtin-induced cell death and disease progression.

Also flagged:nuclei2A-DUBMysm1InvolucrinCollagenLoricrin
Journal Article 2018-02-28 ✓ 1 Snippet Wilms C, Krikki I, Hainzl A, Kilo S, Alupei M, Makrantonaki E, Wagner M, Kroeger CM, Brinker TJ, Gatzka M.
In-Text Gene Mentions

…Conversely,polycomb repressiverepressive complex (PRC)…

Show Full Abstract

Development and homeostasis of the epidermis are governed by a complex network of sequence-specific transcription factors and epigenetic modifiers cooperatively regulating the subtle balance of progenitor cell self-renewal and terminal differentiation. To investigate the role of histone H2A deubiquitinase 2A-DUB/Mysm1 in the skin, we systematically analyzed expression, developmental functions, and potential interactions of this epigenetic regulator using Mysm1-deficient mice and skin-derived epidermal cells. Morphologically, skin of newborn and young adult Mysm1-deficient mice was atrophic with reduced thickness and cellularity of epidermis, dermis, and subcutis, in context with altered barrier function. Skin atrophy correlated with reduced proliferation rates in Mysm1<sup>-/-</sup> epidermis and hair follicles, and increased apoptosis compared with wild-type controls, along with increases in DNA-damage marker γH2AX. In accordance with diminished α6-Integrin<sup>high+</sup>CD34⁺ epidermal stem cells, reduced colony formation of Mysm1<sup>-/-</sup> epidermal progenitors was detectable in vitro. On the molecular level, we identified p53 as potential mediator of the defective Mysm1-deficient epidermal compartment, resulting in increased pro-apoptotic and anti-proliferative gene expression. In Mysm1<sup>-/-</sup>p53<sup>-/-</sup> double-deficient mice, significant recovery of skin atrophy was observed. Functional properties of Mysm1<sup>-/-</sup> developing epidermis were assessed by quantifying the transepidermal water loss. In summary, this investigation uncovers a role for 2A-DUB/Mysm1 in suppression of p53-mediated inhibitory programs during epidermal development.

Also flagged:schizophreniaCACNA1Ctranscription factorbipolar affective disorderL-type voltage gated calcium channelsneuroblastoma
Journal Article 2018-02-28 No Snippets Billingsley KJ, Manca M, Gianfrancesco O, Collier DA, Sharp H, Bubb VJ, Quinn JP.
Show Full Abstract

Genomic wide association studies identified the CACNA1C locus as genetically associated with both schizophrenia and bipolar affective disorder. CACNA1C encodes Cav1.2, one of four subunits of L-type voltage gated calcium channels. Variation resides in non-coding regions of CACNA1C which interact with the promoter and are validated expression quantitative trait loci. Using reporter gene constructs we demonstrate the CACNA1C promoter is a major mediator of inducible regulation of CACNA1C activity in the SH-SY5Y neuroblastoma cell line. Exposure of SH-SY5Y cells to lithium and cocaine modulated both the endogenous CACNA1C gene and the promoter in reporter gene constructs. Deletion analysis of the promoter demonstrated the actions of both lithium and cocaine were mediated by the proximal promoter. Initial interrogation of ENCODE ChIP-seq data over the CACNA1C promoter indicated binding of the transcription factor 'Enhancer of zeste homolog 2' (EZH2), which was consistent with our data that overexpression of EZH2 repressed CACNA1C promoter reporter gene expression. Array data from the Human Brain Transcriptome demonstrated that EZH2 was highly expressed across the developing brain, but subsequently maintained at low levels after birth and adulthood. RNA-seq data obtained from PD_NGSAtlas, a reference database for epigenomic and transcriptomic data for psychiatric disorders, demonstrated a 3-fold increase in EZH2 expression in the anterior cingulate cortex of individuals with schizophrenia compared to controls. We propose that EZH2 may contribute to schizophrenia risk at two distinct time points either through disruption in development leading to neurodevelopmental changes, or through anomalous reactivation of expression in the adult brain.

Also flagged:fluoroquinolonesfluoroquinoloneamino acidciprofloxacinlevofloxacingyrA
Journal Article 2018-02-28 No Snippets Nguyen KV, Nguyen TV, Nguyen HTT, Le DV.
Show Full Abstract

<h4>Introduction</h4><i>Pseudomonas aeruginosa</i> has many mechanisms of resistance to fluoroquinolones. The main mechanism is to change the effect of two enzymes that open the DNA helix - the enzyme DNA gyrase (<i>gyrA</i>) and the topoisomerase IV (<i>parC</i>). In addition, mutations that render the MexAB-oprM pump (<i>mexR</i>) dysfunctional, leading to its overexpression, also enhance resistance to fluoroquinolones. In this study, we aim to detect point mutations of <i>gyrA</i>, <i>parC</i>, and <i>mexR</i> genes that are predicted to be associated with fluoroquinolone resistance in 141 fluoroquinolone-resistant clinical isolates of <i>P. aeruginosa</i> isolated in Vietnam during 2013-2016.<h4>Methods</h4>We tested minimum inhibitory concentrations (MICs) of fluoroquinolone antibiotics in 141 clinical isolates of <i>P. aeruginosa</i> using the VITEK 2 Compact System, followed by PCR assay, to detect and clone the fluoroquinolone resistance-determining region (FRDR) of <i>gyrA</i>, <i>parC</i>, and <i>mexR</i>. Point mutations were analyzed through Sanger sequencing, and the correlation between genetic mutations and phenotypic resistance of 141 clinical isolates was undertaken.<h4>Results</h4>Fluoroquinolone-resistant substitution mutations such as Ile for Thr83 and Met for Thr133 in <i>gyrA</i>, Leu for Ser87 in <i>parC</i>, and Val for Glu126 in the repressor of <i>mexR</i> were mainly detected. Comparative analytical data indicated that amino acid alterations within the <i>gyrA</i> and <i>parC</i> genes are highly associated with resistance to ciprofloxacin (CIP) and levofloxacin (LEV) in the isolates, whereas alterations in the efflux regulatory <i>mexR</i> gene are not highly consistent with resistance in these isolates. Moreover, fluoroquinolone-resistant clinical isolates of <i>P. aeruginosa</i> were mainly isolated from pus and sputum specimens.<h4>Conclusion</h4>In clinical isolates of <i>P. aeruginosa</i>, a high correlation was observed between MICs of CIP and LEV and alterations in <i>gyrA</i> and <i>parC</i> genes. However, mutations occurring in <i>mexR</i> did not highly correlate with the antibiotic resistance of the bacterium.

Also flagged:Aplastic anemiaalloimmunizationAApancytopeniaGrowth restrictionneonatal sepsis
Journal Article 2018-02-28 ✓ 1 Snippet Riveros-Perez E, Hermesch AC, Barbour LA, Hawkins JL.
In-Text Gene Mentions

…to complications, includinghemochromatosisand (most concerning)…

Show Full Abstract

Aplastic anemia is a hematologic condition occasionally presenting during pregnancy. This pathological process is associated with significant maternal and neonatal morbidity and mortality. Obstetric and anesthetic management is challenging, and treatment requires a coordinated effort by an interdisciplinary team, in order to provide safe care to these patients. In this review, we describe the current state of the literature as it applies to the complexity of aplastic anemia in pregnancy, focusing on pathophysiologic aspects of the disease in pregnancy, as well as relevant obstetric and anesthetic considerations necessary to treat this challenging problem. A multidisciplinary-team approach to the management of aplastic anemia in pregnancy is necessary to coordinate prenatal care, optimize maternofetal outcomes, and plan peripartum interventions. Conservative transfusion management is critical to prevent alloimmunization. Although a safe threshold-platelet count for neuraxial anesthesia has not been established, selection of anesthetic technique must be evaluated on a case-to-case basis.

Also flagged:NeurotrophicCatecholamineMajor Depressionbrain-derived neurotrophic factorBDNFmethoxy
Journal Article 2018-02-28 ✓ 4 Snippets Yoshimura R, Kishi T, Atake K, Katsuki A, Iwata N.
In-Text Gene Mentions

Numerous genetic association studies have examined how 5-HTT functional polymorphisms relate to vulnerability to mood disorders and therapeutic responses to antidepressants.

…the serotonin transporter (5-HTT) and/or the noradrenaline…

…have examined how5-HTTfunctional polymorphisms relat…

…effects of the5-HTT-linked polymorphic region (5-…

Show Full Abstract

<h4>Background</h4>There are complicated interactions between catecholaminergic neurons and brain-derived neurotrophic factor (BDNF) in the brain. However, no reports have addressed the relationship among 3-methoxy-4-hydroxyphenylglycol (MHPG), homovanillic acid (HVA), and BDNF in the blood.<h4>Objective</h4>This paper sought to investigate correlations between serum BDNF and plasma levels of MHPG and HVA in people with major depression (MD).<h4>Materials and methods</h4>A total of 148 patients (male/female 65/83, age 49.5 ± 12.1 years old) who satisfied criteria for MD based on the Diagnostic and Statistical Manual of Mental Disorders IV were enrolled in the present study. Plasma levels of MHPG and HVA were analyzed using high-performance liquid chromatography, and serum BDNF was measured using ELISA.<h4>Results</h4>No interactions were observed between plasma HVA levels (mean ± SD = 4.5 ± 1.5 ng/mL) and age, sex, HAMD scores, or serum BDNF levels (mean ± SD = 9.8 ± 2.9 ng/mL). No correlations were not also observed between plasma MHPG levels (mean ± SD = 5.9 ± 2.1 ng/mL) and age, sex, the HAMD17 scores (mean ± SD = 22.2 ± 2.9 ng/mL), or serum BDNF levels. Serum BDNF levels were negatively associated with HAMD17 scores.<h4>Conclusion</h4>The results suggest that there are no significant correlations between catecholamine metabolites and BDNF in the blood for MDD patients.

The DnaA Tale.

Also flagged:chromosomebindingDnaAorigin of chromosomeinitiator proteinsgene expression
Journal Article 2018-02-28 No Snippets Hansen FG, Atlung T.
Show Full Abstract

More than 50 years have passed since the presentation of the Replicon Model which states that a positively acting initiator interacts with a specific site on a circular chromosome molecule to initiate DNA replication. Since then, the origin of chromosome replication, <i>oriC</i>, has been determined as a specific region that carries sequences required for binding of positively acting initiator proteins, DnaA-boxes and DnaA proteins, respectively. In this review we will give a historical overview of significant findings which have led to the very detailed knowledge we now possess about the initiation process in bacteria using <i>Escherichia coli</i> as the model organism, but emphasizing that virtually all bacteria have DnaA proteins that interacts with DnaA boxes to initiate chromosome replication. We will discuss the <i>dnaA</i> gene regulation, the special features of the <i>dnaA</i> gene expression, promoter strength, and translation efficiency, as well as, the DnaA protein, its concentration, its binding to DnaA-boxes, and its binding of ATP or ADP. Furthermore, we will discuss the different models for regulation of initiation which have been proposed over the years, with particular emphasis on the Initiator Titration Model.

Also flagged:Hepatocellular CarcinomaChronic infectionpersistent infectioncirrhosismalignant hepatomamalignant tumor of the liver
Journal Article 2018-02-28 ✓ 2 Snippets Schietroma I, Scheri GC, Pinacchio C, Statzu M, Petruzziello A, Vullo V.
In-Text Gene Mentions

…diabetes mellitus, obesity,hemochromatosisand Wilson’s disease.…

…with HCC includehemochromatosis, Wilson’s disease, alfa-1…

Show Full Abstract

<h4>Introduction</h4>Globally, between 64 and 103 million people are chronically infected with Hepatitis C virus (HCV), with more than 4.6 million people in the United States and is associated with more than 15.000 deaths annually. Chronic infection can result in cirrhosis and hepatocellular carcinoma.<h4>Explanation</h4>Epidemiological studies have indicated that persistent infection with hepatitis C virus (HCV) is a major risk for the development of hepatocellular carcinoma (HCC), mainly through chronic inflammation, cell deaths, and proliferation. Despite the new direct-acting antiviral drugs (DAA's) being able to clear the HCV, HCC recurrence rate in these patients is still observed.<h4>Conclusion</h4>In this review we highlighted some aspects that could be involved in the onset of HCV-induced HCC such as immune system, viral factors and host genetics factors.Moreover, we focused on some of the last reports about the effects of DAA's on the HCV clearance and their potential implications in HCC recurrence.

Also flagged:mineralosteoporosisserotonin transportermineralizationalkaline phosphataseamitriptyline
Journal Article 2018-02-28 ✓ 5 Snippets Kruk JS, Bermeo S, Skarratt KK, Fuller SJ, Duque G.
In-Text Gene Mentions

Since all three of these antidepressants have strong affinity for the 5-HTT,[23, 29, 31] the effect observed here could have resulted from different levels of affinity with this molecular target, which is also associated with variable levels of serotonin.

Currently, the drug class of choice for most cases of depression and anxiety requiring treatment are the selective serotonin reuptake inhibitors (SSRIs).[25, 26] While selectively targeting the serotonin transporter (5-HTT) with considerably less affinity for other receptors, these drugs have fewer side effects than tricyclic antidepressants and are generally better tolerated.[27] In terms of chemical structure and specific targets, fluoxetine is an SSRI with specific inhibition constants (Ki concentration of 1 nM and 10 μM against the 5-HTT and other serotonin receptors respectively [28, 29, 30]).

…the serotonin transporter (5-HTT) with considerably less…

…µM against the5-HTTand other serotonin…

…82 nM for5-HTTand 2,480 nM…

Show Full Abstract

<h4>Background</h4>Use of antidepressant medications has been linked to detrimental impacts on bone mineral density and osteoporosis; however, the cellular basis behind these observations remains poorly understood. The effect does not appear to be homogeneous across the whole class of drugs and may be linked to affinity for the serotonin transporter system. In this study, we hypothesized that antidepressants have a class- and dose-dependent effect on mesenchymal stem cell (MSC) differentiation, which may affect bone metabolism.<h4>Methods</h4>Human MSCs (hMSCs) were committed to differentiate when either adipogenic or osteogenic media was added, supplemented with five increasing concentrations of amitriptyline (0.001-10 µM), venlafaxine (0.01-25 µM), or fluoxetine (0.001-10 µM). Alizarin red staining (mineralization), alkaline phosphatase (osteoblastogenesis), and oil red O (adipogenesis) assays were performed at timed intervals. In addition, cell viability was assessed using a MTT.<h4>Results</h4>We found that fluoxetine had a significant inhibitory effect on mineralization. Furthermore, adipogenic differentiation of hMSC was affected by the addition of amitriptyline, venlafaxine, and fluoxetine to the media. Finally, none of the tested medications significantly affected cell survival.<h4>Conclusions</h4>This study showed a divergent effect of three antidepressants on hMSC differentiation, which appears to be independent of class and dose. As fluoxetine and amitriptyline, but not venlafaxine, affected both osteoblastogenesis and adipogenesis, this inhibitory effect could be associated to the high affinity of fluoxetine to the serotonin transporter system.

Also flagged:fluoridealuminumneurological disordersAlzheimer's diseaseAl3+neurodegenerative disorders
Journal Article 2018-02-28 No Snippets Hasan MK, Alam S, Mirkovic J, Hossain MF.
Show Full Abstract

Previous studies showed that prolonged exposure to fluoride (F-) and aluminum (Al3+) ions is associated with numerous diseases including neurological disorders. They don't have any known biological function. But they can bind with proteins that interact with ions similar to them. Such unwanted interactions affect the normal biological function of the target proteins, as well as their downstream protein-protein interactions. Several studies show the detrimental effects posed by them including Alzheimer's disease. However, their target proteins have never been reported. Here, we have screened for the human protein targets subjected to F- and Al3+ interactions by using data-driven prediction tools. We have identified 20 different proteins that directly bind with them (10 interact with fluoride and 10 with aluminum). In addition, protein-protein interaction has been explored to find the proteins that indirectly interact with F- and Al3+. We have found 86 indirect targets for F- and 90 for Al3+. Furthermore, 19 common protein targets have been identified, including proteins (9 out of 19) associated with neurodegenerative disorders. However, wet lab experiments are beyond our scopes to validate the binding networks. Additional studies must be warranted.

Also flagged:Eph Receptorsreceptor tyrosine kinasesephrinmembranetransmembraneaxon guidance
Journal Article 2018-02-28 ✓ 1 Snippet Kou CJ, Kandpal RP.
In-Text Gene Mentions

…/chemokine receptors, netrins/DCC, Slit/Robo, and Notch/Delta…

Show Full Abstract

Eph receptors constitute the largest family of receptor tyrosine kinases, which are activated by ephrin ligands that either are anchored to the membrane or contain a transmembrane domain. These molecules play important roles in the development of multicellular organisms, and the physiological functions of these receptor-ligand pairs have been extensively documented in axon guidance, neuronal development, vascular patterning, and inflammation during tissue injury. The recognition that aberrant regulation and expression of these molecules lead to alterations in proliferative, migratory, and invasive potential of a variety of human cancers has made them potential targets for cancer therapeutics. We present here the involvement of Eph receptors and ephrin ligands in lung carcinoma, breast carcinoma, prostate carcinoma, colorectal carcinoma, glioblastoma, and medulloblastoma. The aberrations in their abundances are described in the context of multiple signaling pathways, and differential expression is suggested as the mechanism underlying tumorigenesis.

Also flagged:Breast cancercancerneoplastic diseasecancerstumoroncogenes
Journal Article 2018-02-28 ✓ 2 Snippets Richard JLC, Eichhorn PJA.
In-Text Gene Mentions

…protein coding geneZNFX1.…

…of DDX, SOX1,SOX6and SOX17 in…

Show Full Abstract

Breast cancer is the second leading cause of cancer related deaths in women. It is therefore important to understand the mechanisms underlying breast cancer development as well as raises the need for enhanced, non-invasive strategies for novel prognostic and diagnostic methods. The emergence of long non-coding RNAs (lncRNAs) as potential key players in neoplastic disease has received considerable attention over the past few years. This relatively new class of molecular regulators has been shown from ongoing research to act as critical players for key biological processes. Deregulated expression levels of lncRNAs have been observed in a number of cancers including breast cancer. Furthermore, lncRNAs have been linked to breast cancer initiation, progression, metastases and to limit sensitivity to certain targeted therapeutics. In this review we provide an update on the lncRNAs associated with breast cancer and mammary gland development and illustrate the versatility of such lncRNAs in gene control, differentiation and development both in normal physiological conditions and in diseased states. We also highlight the therapeutic and diagnostic potential of lncRNAs in cancer.

Also flagged:PPM1ADNMBPGUCY2CPPM1EDEPDC1CKAP4
Journal Article 2018-02-28 ✓ 5 Snippets Juarez-Flores A, José MV.
In-Text Gene Mentions

NEGR1

OLFM4

PCDH17

MLLT10

FBXL4

Show Full Abstract

There is an important urgency to detect cancer at early stages to treat it, to improve the patients' lifespans, and even to cure it. In this work, we determined the entropic contributions of genes in cancer networks. We detected sudden changes in entropy values in melanoma, hepatocellular carcinoma, pancreatic cancer, and squamous lung cell carcinoma associated to transitions from healthy controls to cancer. We also identified the most relevant genes involved in carcinogenic process of the four types of cancer with the help of entropic changes in local networks. Their corresponding proteins could be used as potential targets for treatments and as biomarkers of cancer.

Also flagged:Neurodegenerationneurodegenerative diseasesamyotrophic lateral sclerosisALSfrontotemporal lobar degenerationFTLD
Journal Article 2018-02-27 No Snippets Gao J, Wang L, Huntley ML, Perry G, Wang X.
Show Full Abstract

Neurodegeneration, a term that refers to the progressive loss of structure and function of neurons, is a feature of many neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), Alzheimer's disease (AD), Parkinson's disease (PD), and Huntington's disease (HD). There is no cure or treatment available that can prevent or reverse neurodegenerative conditions. The causes of neurodegeneration in these diseases remain largely unknown; yet, an extremely small proportion of these devastating diseases are associated with genetic mutations in proteins involved in a wide range of cellular pathways and processes. Over the past decade, it has become increasingly clear that the most notable neurodegenerative diseases, such as ALS, FTLD, and AD, share a common prominent pathological feature known as TAR DNA-binding protein 43 (TDP-43) proteinopathy, which is usually characterized by the presence of aberrant phosphorylation, ubiquitination, cleavage and/or nuclear depletion of TDP-43 in neurons and glial cells. The role of TDP-43 as a neurotoxicity trigger has been well documented in different in vitro and in vivo experimental models. As such, the investigation of TDP-43 pathomechanisms in various major neurodegenerative diseases is on the rise. Here, after a discussion of stages of TDP-43 proteinopathy during disease progression in various major neurodegenerative diseases, we review previous and most recent studies about the potential pathomechanisms with a particular emphasis on ALS, FTLD, and AD, and discuss the possibility of targeting TDP-43 as a common therapeutic approach to treat neurodegenerative diseases.

Also flagged:NPTX1HIP1Rneurodegenerative diseasesdeathhistone deacetylase-3HDAC3
Journal Article 2018-02-27 ✓ 1 Snippet Qu Z, D'Mello SR.
In-Text Gene Mentions

HTT

Show Full Abstract

A defining feature of neurodegenerative diseases is the abnormal and excessive loss of neurons. One molecule that is particularly important in promoting neuronal death in a variety of cell culture and in vivo models of neurodegeneration is histone deacetylase-3 (HDAC3), a member of the histone deacetylase family of proteins. As a step towards understanding how HDAC3 promotes neuronal death, we conducted a proteomic screen aimed at identifying proteins that were regulated by HDAC3. HDAC3 was overexpressed in cultured rat cerebellar granule neurons (CGNs) and protein lysates were analyzed by mass spectrometry. Of over 3000 proteins identified in the screen, only 21 proteins displayed a significant alteration in expression. Of these, 12 proteins were downregulated whereas 9 proteins were upregulated. The altered expression of five of these proteins, TEX10, NPTX1, TFG, TSC1, and NFL, along with another protein that was downregulated in the proteomic screen, HIP1R, was confirmed using Western blots and commercially available antibodies. Because antibodies were not available for some of the proteins and since HDAC3 is a transcriptional regulator of gene expression, we conducted RT-PCR analysis to confirm expression changes. In separate analyses, we also included other proteins that are known to regulate neurodegeneration, including HDAC9, HSF1, huntingtin, GAPDH, FUS, and p65/RELA. Based on our proteomic screen and candidate protein approach, we identify three genes, Nptx1, Hip1r, and Hdac9, all known to regulate neurodegeneration that are robustly regulated by HDAC3. Given their suggested roles in regulating neuronal death, these genes are likely to be involved in regulating HDAC3-mediated neurotoxicity. Impact statement Neurodegenerative diseases are a major medical, social, and economic problem. Recent studies by several laboratories have indicated that histone deacetylase-3 (HDAC3) plays a key role in promoting neuronal death. But the downstream mediators of HDAC3 neurotoxicity have yet to be identified. We conducted a proteomic screen to identify HDAC3 targets the results of which have been described in this report. Briefly, we identify Nptx1, Hip1r, and Hdac9 as genes whose expression is altered by HDAC3. Investigating how these genes are involved in HDAC3 neurotoxicity could shed valuable insight into neurodegenerative disease and identify molecules that can be targeted to treat these devastating disorders.

Also flagged:methylationcolorectal cancercancersmethylation-tumorAPC
Journal Article 2018-02-27 No Snippets Freitas M, Ferreira F, Carvalho S, Silva F, Lopes P, Antunes L, Salta S, Diniz F, Santos LL, Videira JF, Henrique R, Jerónimo C.
Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) is one of the most incident cancers, associated with significant morbidity and mortality, and usually classified into three main molecular pathways: chromosomal instability, microsatellite instability (MSI) and CpG island methylator phenotype (CIMP). Currently, available screening methods are either costly or of limited specificity, impairing global implementation. More cost-effective strategies, including DNA methylation-based tests, might prove advantageous. Although some are already available, its performance is suboptimal, entailing the need for better candidate biomarkers. Herein, we tested whether combined use of APC, IGF2, MGMT, RASSF1A, and SEPT9 promoter methylation might accurately detect CRC irrespective of molecular subtype.<h4>Methods</h4>Selected genes were validated using formalin-fixed paraffin-embedded tissues from 214 CRC and 50 non-malignant colorectal mucosae (CRN). Promoter methylation levels were assessed using real-time quantitative methylation-specific PCR. MSI and CIMP status were determined. Molecular data were correlated with standard clinicopathological features. Diagnostic and prognostic performances were evaluated by receiver operator characteristics curve and survival analyses, respectively.<h4>Results</h4>Except for IGF2, promoter methylation levels were significantly higher in CRC compared to CRN. A three-gene panel (MGMT, RASSF1A, SEPT9) identified malignancy with 96.6% sensitivity, 74.0% specificity and 91.5 positive predictive value (area under the curve: 0.97), independently of tumor location, stage, and molecular pathway.<h4>Conclusions</h4>Combined promoter methylation analysis of MGMT/RASSF1A/SEPT9 displays a better performance than currently available epigenetic-based biomarkers for CRC, providing the basis for the development of a non-invasive assay to detect CRC irrespective of the molecular pathway.

Also flagged:esophageal adenocarcinomaEAgastric refluxTP53cancerBarrett
Journal Article 2018-02-27 ✓ 1 Snippet Galipeau PC, Oman KM, Paulson TG, Sanchez CA, Zhang Q, Marty JA, Delrow JJ, Kuhner MK, Vaughan TL, Reid BJ, Li X.
In-Text Gene Mentions

…including TP53 (21%),DCC(21%), CDKN2A (12%),…

Show Full Abstract

<h4>Background</h4>Use of aspirin and other non-steroidal anti-inflammatory drugs (NSAIDs) has been shown to protect against tetraploidy, aneuploidy, and chromosomal alterations in the metaplastic condition Barrett's esophagus (BE) and to lower the incidence and mortality of esophageal adenocarcinoma (EA). The esophagus is exposed to both intrinsic and extrinsic mutagens resulting from gastric reflux, chronic inflammation, and exposure to environmental carcinogens such as those found in cigarettes. Here we test the hypothesis that NSAID use inhibits accumulation of point mutations/indels during somatic genomic evolution in BE.<h4>Methods</h4>Whole exome sequences were generated from 82 purified epithelial biopsies and paired blood samples from a cross-sectional study of 41 NSAID users and 41 non-users matched by sex, age, smoking, and continuous time using or not using NSAIDs.<h4>Results</h4>NSAID use reduced overall frequency of point mutations across the spectrum of mutation types, lowered the frequency of mutations even when adjusted for both TP53 mutation and smoking status, and decreased the prevalence of clones with high variant allele frequency. Never smokers who consistently used NSAIDs had fewer point mutations in signature 17, which is commonly found in EA. NSAID users had, on average, a 50% reduction in functional gene mutations in nine cancer-associated pathways and also had less diversity in pathway mutational burden compared to non-users.<h4>Conclusions</h4>These results indicate NSAID use functions to limit overall mutations on which selection can act and supports a model in which specific mutant cell populations survive or expand better in the absence of NSAIDs.

Also flagged:cholangiocarcinomaCCliver tumorintra-hepatic cholangiocarcinomahepatocellular carcinomatumor
Journal Article 2018-02-27 ✓ 1 Snippet Sammon J, Fischer S, Menezes R, Hosseini-Nik H, Lewis S, Taouli B, Jhaveri K.
In-Text Gene Mentions

…1 patient hadhemochromatosis, 1 patient had…

Show Full Abstract

<h4>Background</h4>Combined hepatocellular-cholangiocarcinoma (cHCC-CC) is a rare primary liver tumor, which has overlapping imaging features with mass forming intra-hepatic cholangiocarcinoma (ICC) and hepatocellular carcinoma (HCC). Previous studies reported imaging features more closely resemble ICC and the aim of our study was to examine the differential MRI features of cHCC-CC and ICC with emphasis on enhancement pattern observations of gadolinium enhanced MRI.<h4>Methods</h4>Institutional review board approval with consent waiver was obtained for this retrospective bi-centric study. Thirty-three patients with pathologically proven cHCC-CC and thirty-eight patients with pathologically proven ICC, who had pre-operative MRI, were identified. MRI images were analyzed for tumor location and size, T1 and T2 signal characteristics, the presence/absence of: cirrhosis, intra-lesional fat, hemorrhage/hemosiderin, scar, capsular retraction, tumor thrombus, biliary dilatation, degree of arterial enhancement, enhancement pattern, pseudocapsule and washout. Associations between MRI features and tumor type were examined using the Fisher's exact and chi-square tests.<h4>Results</h4>Strong arterial phase enhancement and the presence of: washout, washout and progression, intra-lesional fat and hemorrhage were all strongly associated with cHCC-CC (P < 0.001). While cHCC-CC had a varied enhancement pattern, the two most common enhancement patterns were peripheral persistent (n = 6) and heterogeneous hyperenhancement with washout (n = 6), compared to ICC where the most common enhancement patterns were peripheral hypoenhancement with progression (n = 18) followed by heterogeneous hypoenhancement with progression (n = 14) (P < 0.001).<h4>Conclusion</h4>The cHCC-CC enhancement pattern seems to more closely resemble HCC with the degree of arterial hyperenhancement and the presence of washout being valuable in differentiating cHCC-CC from ICC. However the presence of washout and progression, in the same lesion or a predominantly peripheral /rim hyperenhancing mass were also seen as important features that should alert the radiologist to the possibility of a cHCC-CC.

Also flagged:myelomaplatinummembranecancerEbolarheumatoid arthritis
Journal Article 2018-02-27 No Snippets Schoeman RM, van den Beld WTE, Kemna EWM, Wolbers F, Eijkel JCT, van den Berg A.
Show Full Abstract

We present a microfluidic chip that enables electrofusion of cells in microdroplets, with exchange of nuclear components. It is shown, to our knowledge for the first time, electrofusion of two HL60 cells, inside a microdroplet. This is the crucial intermediate step for controlled hybridoma formation where a B cell is electrofused with a myeloma cell. We use a microfluidic device consisting of a microchannel structure in PDMS bonded to a glass substrate through which droplets with two differently stained HL60 cells are transported. An array of six recessed platinum electrode pairs is used for electrofusion. When applying six voltage pulses of 2-3 V, the membrane electrical field is about 1 MV/cm for 1 ms. This results in electrofusion of these cells with a fusion yield of around 5%. The operation with individual cell pairs, the appreciable efficiency and the potential to operate in high-throughput (up to 500 cells sec<sup>-1</sup>) makes the microdroplet fusion technology a promising platform for cell electrofusion, which has the potential to compete with the conventional methods. Besides, this platform is not restricted to cell fusion but is also applicable to various other cell-based assays such as single cell analysis and differentiation assays.

Also flagged:DOT1Lorganizationchromatinmethyltransferasesmethylhistone
Journal Article 2018-02-27 No Snippets Wood K, Tellier M, Murphy S.
Show Full Abstract

The organization of eukaryotic genomes into chromatin provides challenges for the cell to accomplish basic cellular functions, such as transcription, DNA replication and repair of DNA damage. Accordingly, a range of proteins modify and/or read chromatin states to regulate access to chromosomal DNA. Yeast Dot1 and the mammalian homologue DOT1L are methyltransferases that can add up to three methyl groups to histone H3 lysine 79 (H3K79). H3K79 methylation is implicated in several processes, including transcription elongation by RNA polymerase II, the DNA damage response and cell cycle checkpoint activation. DOT1L is also an important drug target for treatment of mixed lineage leukemia (MLL)-rearranged leukemia where aberrant transcriptional activation is promoted by DOT1L mislocalisation. This review summarizes what is currently known about the role of Dot1/DOT1L and H3K79 methylation in transcription and genomic stability.

Also flagged:OsteogenesisGraphenearginineglycineaspartic acidpeptide
Journal Article 2018-02-27 No Snippets Kang ES, Kim DS, Han Y, Son H, Chung YH, Min J, Kim TH.
Show Full Abstract

Graphene derivatives have immense potential in stem cell research. Here, we report a three-dimensional graphene/arginine-glycine-aspartic acid (RGD) peptide nanoisland composite effective in guiding the osteogenesis of human adipose-derived mesenchymal stem cells (ADSCs). Amine-modified silica nanoparticles (SiNPs) were uniformly coated onto an indium tin oxide electrode (ITO), followed by graphene oxide (GO) encapsulation and electrochemical deposition of gold nanoparticles. A RGD-MAP-C peptide, with a triple-branched repeating RGD sequence and a terminal cysteine, was self-assembled onto the gold nanoparticles, generating the final three-dimensional graphene-RGD peptide nanoisland composite. We generated substrates with various gold nanoparticle-RGD peptide cluster densities, and found that the platform with the maximal number of clusters was most suitable for ADSC adhesion and spreading. Remarkably, the same platform was also highly efficient at guiding ADSC osteogenesis compared with other substrates, based on gene expression (alkaline phosphatase (ALP), runt-related transcription factor 2), enzyme activity (ALP), and calcium deposition. ADSCs induced to differentiate into osteoblasts showed higher calcium accumulations after 14-21 days than when grown on typical GO-SiNP complexes, suggesting that the platform can accelerate ADSC osteoblastic differentiation. The results demonstrate that a three-dimensional graphene-RGD peptide nanoisland composite can efficiently derive osteoblasts from mesenchymal stem cells.

Also flagged:extracellularsynapsetransductionkeratinCollagenmembrane
Journal Article 2018-02-27 No Snippets Jacob J, More N, Kalia K, Kapusetti G.
Show Full Abstract

Tissues like bone and cartilage are remodeled dynamically for their functional requirements by signaling pathways. The signals are controlled by the cells and extracellular matrix and transmitted through an electrical and chemical synapse. Scaffold-based tissue engineering therapies largely disturb the natural signaling pathways, due to their rigidity towards signal conduction, despite their therapeutic advantages. Thus, there is a high need of smart biomaterials, which can conveniently generate and transfer the bioelectric signals analogous to native tissues for appropriate physiological functions. Piezoelectric materials can generate electrical signals in response to the applied stress. Furthermore, they can stimulate the signaling pathways and thereby enhance the tissue regeneration at the impaired site. The piezoelectric scaffolds can act as sensitive mechanoelectrical transduction systems. Hence, it is applicable to the regions, where mechanical loads are predominant. The present review is mainly concentrated on the mechanism related to the electrical stimulation in a biological system and the different piezoelectric materials suitable for bone and cartilage tissue engineering.

Also flagged:HuntingtinHuntington's DiseaseHDE3 ubiquitin ligaseMID1peptide
Journal Article 2018-02-27 ✓ 2 Snippets Monteiro O, Chen C, Bingham R, Argyrou A, Buxton R, Pancevac Jönsson C, Jones E, Bridges A, Gatfield K, Krauß S, Lambert J, Langston R, Schweiger S, Uings I.
In-Text Gene Mentions

Expression of mutant Huntingtin (HTT) protein is central to the pathophysiology of Huntington's Disease (HD).

…of mutant Huntingtin (HTT) protein is central…

Show Full Abstract

Expression of mutant Huntingtin (HTT) protein is central to the pathophysiology of Huntington's Disease (HD). The E3 ubiquitin ligase MID1 appears to have a key role in facilitating translation of the mutant HTT mRNA suggesting that interference with the function of this complex could be an attractive therapeutic approach. Here we describe a peptide that is able to disrupt the interaction between MID1 and the α4 protein, a regulatory subunit of protein phosphatase 2A (PP2A). By fusing this peptide to a sequence from the HIV-TAT protein we demonstrate that the peptide can disrupt the interaction within cells and show that this results in a decrease in levels of ribosomal S6 phosphorylation and HTT expression in cultures of cerebellar granule neurones derived from Hdh<sup>Q111/Q7</sup> mice. This data serves to validate this pathway and paves the way for the discovery of small molecule inhibitors of this interaction as potential therapies for HD.

Also flagged:GestationalAlloimmune Liver DiseaseGALDliver diseaseliver failuregestations
Journal Article 2018-02-27 ✓ 2 Snippets Taylor SA, Kelly S, Alonso EM, Whitington PF.
In-Text Gene Mentions

…pedigrees of neonatalhemochromatosisto determine the…

…with proven neonatalhemochromatosisbetween 1997 and…

Show Full Abstract

<h4>Objectives</h4>To evaluate pregnancy outcomes in pedigrees of neonatal hemochromatosis to determine the spectrum of gestational alloimmune liver disease (GALD) in a large cohort.<h4>Study design</h4>We prospectively collected data from women with a prior offspring with proven neonatal hemochromatosis between 1997 and 2015 and analyzed pregnancy outcomes.<h4>Results</h4>The pedigrees from 150 women included 350 gestations with outcomes potentially related to GALD. There were 105 live-born infants without liver disease, 157 live-born infants with liver failure, and 88 fetal losses. Fetal loss occurred in 25% of total gestations. Ninety-seven pedigrees contained a single affected offspring, whereas 53 contained multiple affected offspring. Analysis of these 53 pedigrees yielded a per-pregnancy repeat occurrence rate of 95%. Notably, the first poor outcome occurred in the first pregnancy in 60% of pedigrees. Outcomes of the 157 live-born infants with liver failure were poor: 18% survived, 82% died. Of the 134 live-born infants with treatment data, 20 received intravenous immunoglobulin with or without double-volume exchange transfusion of which 9 (45%) survived; 14 infants (10%) received a liver transplant of which 6 (43%) survived.<h4>Conclusions</h4>GALD is a significant cause of both fetal loss and neonatal mortality with a high rate of disease recurrence in untreated pregnancies at risk. Poor outcomes related to GALD commonly occur in the first gestation, necessitating a high index of suspicion to diagnose this disorder at first presentation.

Also flagged:ObesityCancerkynureninemetabolismaryl hydrocarbon receptorAHR
Journal Article 2018-02-27 ✓ 5 Snippets Stone TW, McPherson M, Gail Darlington L.
In-Text Gene Mentions

In the absence of netrins, DCC and neogenin inhibit proliferation and induce apoptosis, resulting in their classification as ‘tumor suppressors’.

The tumor suppressor proteins that were studied included Deleted in Colorectal Cancer (DCC), neogenin (a related protein with 49% structural homology with DCC) and uncoordinated-5 (unc5), all of which are receptors for the extracellular protein family of netrins (Sun et al., 2011a).

…in Colorectal Cancer (DCC) and neogenin.…

…suppressors such asDCC.…

…partial loss ofDCCor neogenin could…

Show Full Abstract

Existing explanations of obesity-associated cancer emphasise direct mutagenic effects of dietary components or hormonal imbalance. Some of these hypotheses are reviewed briefly, but recent evidence suggests a major role for chronic inflammation in cancer risk, possibly involving dietary content. These ideas include the inflammation-induced activation of the kynurenine pathway and its role in feeding and metabolism by activation of the aryl hydrocarbon receptor (AHR) and by modulating synaptic transmission in the brain. Evidence for a role of the kynurenine pathway in carcinogenesis then provides a potentially major link between obesity and cancer. A second new hypothesis is based on evidence that serine proteases can deplete cells of the tumour suppressors Deleted in Colorectal Cancer (DCC) and neogenin. These enzymes include mammalian chymotryptic proteases released by pro-inflammatory neutrophils and macrophages. Blood levels of chymotrypsin itself increase in parallel with food intake. The mechanistically similar bacterial enzyme subtilisin is widespread in the environment, animal probiotics, meat processing and cleaning products. Simple public health schemes in these areas, with selective serine protease inhibitors and AHR antagonists and could prevent a range of intestinal and other cancers.

Also flagged:Arsenic TrioxideCanceracute promyelocytic leukemiaPMLRARAtumor
Journal Article 2018-02-27 No Snippets Dawood M, Hamdoun S, Efferth T, Efferth T.
Show Full Abstract

Arsenic trioxide is a traditional remedy in Chinese Medicine since ages. Nowadays, it is clinically used to treat acute promyelocytic leukemia (APL) by targeting PML/RARA. However, the drug's activity is broader and the mechanisms of action in other tumor types remain unclear. In this study, we investigated molecular modes of action by classical and network pharmacological approaches. CEM/ADR5000 resistance leukemic cells were similar sensitive to As<sub>2</sub>O<sub>3</sub> as their wild-type counterpart CCRF-CEM (resistance ratio: 1.88). Drug-resistant U87.MG ΔEGFR glioblastoma cells harboring mutated epidermal growth factor receptor were even more sensitive (collateral sensitive) than wild-type U87.MG cells (resistance ratio: 0.33). HCT-116 colon carcinoma p53<sup>-/-</sup> knockout cells were 7.16-fold resistant toward As<sub>2</sub>O<sub>3</sub> compared to wild-type cells. Forty genes determining cellular responsiveness to As<sub>2</sub>O<sub>3</sub> were identified by microarray and COMPARE analyses in 58 cell lines of the NCI panel. Hierarchical cluster analysis-based heat mapping revealed significant differences between As<sub>2</sub>O<sub>3</sub> sensitive cell lines and resistant cell lines with <i>p</i>-value: 1.86 × 10<sup>-5</sup>. The genes were subjected to Galaxy Cistrome gene promoter transcription factor analysis to predict the binding of transcription factors. We have exemplarily chosen NF-kB and AP-1, and indeed As<sub>2</sub>O<sub>3</sub> dose-dependently inhibited the promoter activity of these two transcription factors in reporter cell lines. Furthermore, the genes identified here and those published in the literature were assembled and subjected to Ingenuity Pathway Analysis for comprehensive network pharmacological approaches that included all known factors of resistance of tumor cells to As<sub>2</sub>O<sub>3</sub>. In addition to pathways related to the anticancer effects of As<sub>2</sub>O<sub>3</sub>, several neurological pathways were identified. As arsenic is well-known to exert neurotoxicity, these pathways might account for neurological side effects. In conclusion, the activity of As<sub>2</sub>O<sub>3</sub> is not restricted to acute promyelocytic leukemia. In addition to PML/RARA, numerous other genes belonging to diverse functional classes may also contribute to its cytotoxicity. Network pharmacology is suited to unravel the multifactorial modes of action of As<sub>2</sub>O<sub>3</sub>.

Also flagged:oxygenanemiaintraventricular hemorrhagenecrotizing enterocolitisHbiron
Journal Article 2018-02-27 No Snippets Straňák Z, Feyereislová S, Korček P, Dempsey E.
Show Full Abstract

Postnatal adaptation in preterm newborn comprises complex physiological processes that involve significant changes in the circulatory and respiratory system. Increasing hemoglobin level and blood volume following placental transfusion may be of importance in enhancing arterial oxygen content, increasing cardiac output, and improving oxygen delivery. The European consensus on resuscitation of preterm infants recommends delayed cord clamping (DCC) for at least 60 s to promote placenta-fetal transfusion in uncompromised neonates. Recently, published meta-analyses suggest that DCC is associated with fewer infants requiring transfusions for anemia, a lower incidence of intraventricular hemorrhage, and lower risk for necrotizing enterocolitis. Umbilical cord milking (UCM) has the potential to avoid some disadvantages associated with DCC including the increased risk of hypothermia or delay in commencing manual ventilation. UCM represents an active form of blood transfer from placenta to neonate and may have some advantages over DCC. Moreover, both methods are associated with improvement in hemodynamic parameters and blood pressure within first hours after delivery compared to immediate cord clamping. Placental transfusion appears to be beneficial for the preterm uncompromised infant. Further studies are needed to evaluate simultaneous placental transfusion with resuscitation of deteriorating neonates. It would be of great interest for future research to investigate advantages of this approach further and to assess its impact on neonatal outcomes, particularly in extremely preterm infants.

Also flagged:Huntington's diseaseHDneurodegenerative disordersinclusion bodiesHuntingtindegradation
Journal Article 2018-02-27 ✓ 2 Snippets Ochaba J, Morozko EL, O'Rourke JG, Thompson LM.
In-Text Gene Mentions

…accumulation of mutantHTT(mHTT) protein into…

HTT

Show Full Abstract

The accumulation of misfolded proteins is central to pathology in Huntington's disease (HD) and many other neurodegenerative disorders. Specifically, a key pathological feature of HD is the aberrant accumulation of mutant HTT (mHTT) protein into high molecular weight complexes and intracellular inclusion bodies composed of fragments and other proteins. Conventional methods to measure and understand the contributions of various forms of mHTT-containing aggregates include fluorescence microscopy, western blot analysis, and filter trap assays. However, most of these methods are conformation specific, and therefore may not resolve the full state of mHTT protein flux due to the complex nature of aggregate solubility and resolution. For the identification of aggregated mHTT and various modified forms and complexes, separation and solubilization of the cellular aggregates and fragments is mandatory. Here we describe a method to isolate and visualize soluble mHTT, monomers, oligomers, fragments, and an insoluble high molecular weight (HMW) accumulated mHTT species. HMW mHTT tracks with disease progression, corresponds with mouse behavior readouts, and has been beneficially modulated by certain therapeutic interventions<sup>1</sup>. This approach can be used with mouse brain, peripheral tissues, and cell culture but may be adapted to other model systems or disease contexts.

Also flagged:Prostate CancerPCacancerdeathpathogenesisHLA
Journal Article 2018-02-27 No Snippets Wu Y, Chen H, Jiang G, Mo Z, Ye D, Wang M, Qi J, Lin X, Zheng SL, Zhang N, Na R, Ding Q, Xu J, Sun Y.
Show Full Abstract

<b>Introduction:</b> The associations between Prostate cancer (PCa) and germline copy number variations (CNVs) in genome-wide level based on Chinese population are unknown. The objective of this study was to identify possible PCa-risk associated CNV regions in Chinese population. <b>Materials and Methods:</b> We performed a genome-wide association study for CNV in 1,417 PCa cases and 1,008 controls in Chinese population. <b>Results:</b> 7 risk-associated CNVs were identified for PCa after association analyses (<i>P</i> <7.2×10<sup>-6</sup>). Another 34 CNVs were found to be potentially risk-associated CNVs (<i>P</i><0.05). Among the total 41 CNVs, 27 CNVs were risk variations and the other 14 were found to be protective of PCa. 25 of the CNVs (19 duplications and 6 deletions) were located in gene regions while 16 CNVs (9 duplications and 7 deletions) were located in intergenic regions. We identified a higher burden of gaining PCa-risk CNVs and a lower frequency of protective CNVs in cases than controls. Bioinformatics analyses suggested that genes related to PCa risk-associated CNVs were significantly enriched in some biological processes, cellular components and molecular functions. <b>Conclusion:</b> These results provided additional information of genetic risks for PCa. Several CNV regions involved actionable genes that might be potential gene for target therapy. Additional validation and functional studies are warranted for these results.

Also flagged:Hepatic Diffuse Large B-cell Lymphoma of the Liverdiffuse large B-cell lymphomaDLBCLmethylprednisolonecyclophosphamidePrimary hepatic diffuse large B-cell lymphoma
Journal Article 2018-02-27 ✓ 1 Snippet Dhingra R, Winter MW, Yilmaz OH, Jaiswal S, Sterling M.
In-Text Gene Mentions

…sarcoidosis, tuberculosis, andhemochromatosis[ 4 ].…

Show Full Abstract

This report describes a case of primary hepatic diffuse large B-cell lymphoma (DLBCL) in a 64-year-old male who presented with constitutional symptoms, jaundice, abdominal swelling, and right upper quadrant pain. The diagnosis was confirmed on percutaneous liver biopsy. Notably, there was no evidence of extra-hepatic involvement. The patient received methylprednisolone and cyclophosphamide with good response but was lost to follow-up upon being transferred. This case highlights the importance of considering primary hepatic DLBCL in patients with unexplained abnormal liver tests and atypical imaging without solitary or discrete lesions, as this rare malignancy can present furtively.

Also flagged:Hb
Journal Article 2018-02-27 No Snippets Lad H, Yadav M, Mehta P, Patel P, Sawant P, Colah RB, Mukherjee MB, Shanmugam R.
Show Full Abstract

No abstract available.

Also flagged:deubiquitinaseUSP9XFBW7tumoroncoproteinsc-MYC
Journal Article 2018-02-26 ✓ 1 Snippet Khan OM, Carvalho J, Spencer-Dene B, Mitter R, Frith D, Snijders AP, Wood SA, Behrens A.
In-Text Gene Mentions

…situ hybridization ofOlfm4, and by…

Show Full Abstract

The tumor suppressor FBW7 targets oncoproteins such as c-MYC for ubiquitylation and is mutated in several human cancers. We noted that in a substantial percentage of colon cancers, FBW7 protein is undetectable despite the presence of FBW7 mRNA. To understand the molecular mechanism of FBW7 regulation in these cancers, we employed proteomics and identified the deubiquitinase (DUB) USP9X as an FBW7 interactor. USP9X antagonized FBW7 ubiquitylation, and Usp9x deletion caused Fbw7 destabilization. Mice lacking Usp9x in the gut showed reduced secretory cell differentiation and increased progenitor proliferation, phenocopying Fbw7 loss. In addition, Usp9x inactivation impaired intestinal regeneration and increased tumor burden in colitis-associated intestinal cancer. c-Myc heterozygosity abrogated increased progenitor proliferation and tumor burden in Usp9x-deficient mice, suggesting that Usp9x suppresses tumor formation by regulating Fbw7 protein stability and thereby reducing c-Myc. Thus, we identify a tumor suppressor mechanism in the mammalian intestine that arises from the posttranslational regulation of FBW7 by USP9X independent of somatic FBW7 mutations.

Also flagged:HuntingtinHuntington's diseaseHDautosomal-neurodegenerative genetic disorderpolyglutamine
Journal Article 2018-02-26 ✓ 5 Snippets Oh E, Liu Y, Sonar MV, Merry DE, Wickstrom E.
In-Text Gene Mentions

…1 of theHTTgene.…

… (polyQ)-expanded huntingtin (Htt) protein.…

…To measureHTTmRNA knockdown effectiveness…

…encompassing the humanHTTmRNA initiation codon.…

…while the rathttequivalent 12mer contained…

Show Full Abstract

Huntington's disease (HD) is an autosomal-dominant neurodegenerative genetic disorder caused by CAG repeat expansion in exon 1 of the HTT gene. Expression of the mutant gene results in the production of a neurotoxic polyglutamine (polyQ)-expanded huntingtin (Htt) protein. Clinical trials of knockdown therapy of mutant polyglutamine-encoding HTT mRNA in Huntington's disease (HD) have begun. To measure HTT mRNA knockdown effectiveness in human cells, we utilized a fluorescent hybridization imaging agent specific to the region encompassing the human HTT mRNA initiation codon. We designed, synthesized, purified, and characterized Cal560-spacer-peptide nucleic acid (PNA)-spacer-IGF1 tetrapeptides. The human HTT PNA 12mer complement was CATGGCGGTCTC, while the rat htt equivalent 12mer contained the sequence CATGaCGGcCTC, with two bases differing from the human sequence. The cyclized IGF1 tetrapeptide fragment d(CSKC) that promotes IGF1 receptor-mediated endocytosis was bonded to the C-terminus. We tested the reliability of HTT mRNA imaging with Cal560-spacer-peptide nucleic acid (PNA)-spacer-IGF1 tetrapeptides in human embryonic kidney (HEK) 293T cells that express endogenous HTT and IGF1 receptor. By qPCR, we quantitated HTT mRNA in HEK293T cells with and without HTT mRNA knockdown by three different siRNAs. By confocal fluorescence imaging, we quantitated the accumulation of fluorescent HTT hybridization agent in the same cells. A rat homologue differing from the human sequence by two bases showed negligible fluorescence. qPCR indicated 86 ± 5% knockdown of HTT mRNA by the most effective siRNA. Similarly, Cal560- HTT PNA-peptide fluorescence intensity indicated 69 ± 6% reduction in HTT mRNA. We concluded that the fluorescence hybridization method correlates with the established qPCR method for quantitating HTT mRNA knockdown by siRNA in HEK293T cells, with a Pearson correlation coefficient of 0.865 for all three siRNA sequences. These results will enable real time imaging and quantitation of HTT mRNA in animal models of HD.

Also flagged:isproblaslonllapia
Journal Article 2018-02-26 ✓ 1 Snippet Wang X, Yu T, Liao X, Yang C, Han C, Zhu G, Huang K, Yu L, Qin W, Su H, Liu X, Peng T.
In-Text Gene Mentions

…ohepatitis, alcohol ingestion,hemochromatosis, and other metabolic…

Show Full Abstract

Cytochrome P2C (CYP2C) subfamily members (CYP2C8, CYP2C9, CYP2C18, and CYP2C19) are known to participate in clinical drug metabolism. However, the association between CYP2C subfamily members and hepatocellular carcinoma (HCC) remains unclear. This study investigated the prognostic value of CYP2C subfamily gene expression levels with HCC prognosis. Data of 360 HCC patients in The Cancer Genome Atlas database and 231 in the Gene Expression Omnibus database were analyzed. Kaplan-Meier analysis and a Cox regression model were used to ascertain overall survival and recurrence-free survival, and to calculate median survival time using hazard ratios (HR) and 95% confidence intervals (CI). In TCGA database, low expression of CYP2C8, CYP2C9, and CYP2C19 in tumor tissue was associated with a short median survival time (all crude P = 0.001, adjusted P = 0.004, P = 0.047, and P = 0.020, respectively). In TCGA database, joint effects analysis of the combinations of CYP2C8 and CYP2C9, CYP2C8 and CYP2C19, and CYP2C9 and CYP2C19 revealed that high expression of two genes (group 4; group IV, group d) was associated with a reduced risk of death as compared to low expression (group 1, group I, and group a) (adjusted P = 0.005, P = 0.013, and P = 0.016, respectively). In TCGA database, joint effects analysis of CYP2C8, CYP2C9, and CYP2C19 showed that the risk of death from HCC was lower for groups C and D than for group A (adjusted P = 0.012 and P = 0.008, respectively). CYP2C8, CYP2C9, and CYP2C19 gene expression levels are potential prognostic markers of HCC following hepatectomy.

Also flagged:ethanollipopolysaccharideinflammatory diseaselipopolysaccharide receptorToll-like Receptor 4peptide
Journal Article 2018-02-26 ✓ 1 Snippet Kamal AHM, Fessler MB, Chowdhury SM.
In-Text Gene Mentions

…with ANXA4, PRX4,PEBP1, and DHX9, while…

Show Full Abstract

Macrophages are specialized phagocytes that play an essential role in inflammation, immunity, and tissue repair. Profiling the global proteomic response of macrophages to microbial molecules such as bacterial lipopolysaccharide is key to understanding fundamental mechanisms of inflammatory disease. Ethanol is a widely abused substance that has complex effects on inflammation. Reports have indicated that ethanol can activate or inhibit the lipopolysaccharide receptor, Toll-like Receptor 4, in different settings, with important consequences for liver and neurologic inflammation, but the underlying mechanisms are poorly understood. To profile the sequential effect of low dose ethanol and lipopolysaccharide on macrophages, a gel-free proteomic technique was applied to RAW 264.7 macrophages. Five hundred four differentially expressed proteins were identified and quantified with high confidence using ≥ 5 peptide spectral matches. Among these, 319 proteins were shared across all treatment conditions, and 69 proteins were exclusively identified in ethanol-treated or lipopolysaccharide-stimulated cells. The interactive impact of ethanol and lipopolysaccharide on the macrophage proteome was evaluated using bioinformatics tools, enabling identification of differentially responsive proteins, protein interaction networks, disease- and function-based networks, canonical pathways, and upstream regulators. Five candidate protein coding genes (PGM2, ISYNA1, PARP1, and PSAP) were further validated by qRT-PCR that mostly related to glucose metabolism and fatty acid synthesis pathways. Taken together, this study describes for the first time at a systems level the interaction between ethanol and lipopolysaccharide in the proteomic programming of macrophages, and offers new mechanistic insights into the biology that may underlie the impact of ethanol on infectious and inflammatory disease in humans.

Also flagged:Hirschsprung diseaseHSCRnucleotideERBB4CCT2VASH1
Journal Article 2018-02-26 ✓ 1 Snippet Tang CS, Zhuang X, Lam WY, Ngan ES, Hsu JS, Michelle YU, Man-Ting SO, Cherny SS, Ngo ND, Sham PC, Tam PK, Garcia-Barcelo MM.
In-Text Gene Mentions

DCC

Show Full Abstract

Hirschsprung disease (HSCR) is a complex birth defect characterized by the lack of ganglion cells along a variable length of the distal intestine. A large proportion of HSCR patients remain genetically unexplained. We applied whole-genome sequencing (WGS) on 9 trios where the probands are sporadically affected with the most severe form of the disorder and harbor no coding sequence variants affecting the function of known HSCR genes. We found de novo protein-altering variants in three intolerant to change genes-CCT2, VASH1, and CYP26A1-for which a plausible link with the enteric nervous system (ENS) exists. De novo single-nucleotide and indel variants were present in introns and non-coding neighboring regions of ENS-related genes, including NRG1 and ERBB4. Joint analysis with those inherited rare variants found under recessive and/or digenic models revealed both patient-unique and shared genetic features where rare variants were found to be enriched in the extracellular matrix-receptor (ECM-receptor) pathway (p = 3.4 × 10<sup>-11</sup>). Delineation of the genetic profile of each patient might help finding common grounds that could lead to the discovery of shared molecules that could be used as drug targets for the currently ongoing cell therapy effort which aims at providing an alternative to the surgical treatment.

Also flagged:type 2 diabetesGCKANK1TBC1D4glucoseinsulin
Journal Article 2018-02-26 ✓ 1 Snippet Appel EVR, Moltke I, Jørgensen ME, Bjerregaard P, Linneberg A, Pedersen O, Albrechtsen A, Hansen T, Grarup N.
In-Text Gene Mentions

HFE

Show Full Abstract

We previously showed that a common genetic variant leads to a remarkably increased risk of type 2 diabetes (T2D) in the small and historically isolated Greenlandic population. Motivated by this, we aimed at discovering novel genetic determinants for glycated hemoglobin (HbA<sub>1C</sub>) and at estimating the effect of known HbA<sub>1C</sub>-associated loci in the Greenlandic population. We analyzed genotype data from 4049 Greenlanders generated using the Illumina Cardio-Metabochip. We performed the discovery association analysis by an additive linear mixed model. To estimate the effect of known HbA<sub>1C</sub>-associated loci, we modeled the effect in the European and Inuit ancestry proportions of the Greenlandic genome (EAPGG and IAPGG, respectively). After correcting for multiple testing, we found no novel significant associations. When we investigated loci known to associate with HbA<sub>1C</sub> levels, we found that the lead variant in the GCK locus associated significantly with HbA<sub>1C</sub> levels in the IAPGG ([Formula: see text]). Furthermore, for 10 of 15 known HbA<sub>1C</sub> loci, the effects in IAPGG were similar to the previously reported effects. Interestingly, the ANK1 locus showed a statistically significant ancestral population differential effect, with opposing directions of effect in the two ancestral populations. In conclusion, we found only 1 of the 15 known HbA<sub>1C</sub> loci to be significantly associated with HbA<sub>1C</sub> levels in the IAPGG and that two-thirds of the loci showed similar effects in Inuit as previously found in European and East Asian populations. Our results shed light on the genetic effects across ethnicities.

Also flagged:SKIV2LSyndromic diarrheatricho-hepato-enteric (THE) syndromeTHE syndromeTricho-hepato-enteric Syndromeimmunodeficiency
Journal Article 2018-02-26 ✓ 1 Snippet Vardi I, Barel O, Sperber M, Schvimer M, Nunberg M, Field M, Ouahed J, Marek-Yagel D, Werner L, Haberman Y, Lahad A, Anikster Y, Rechavi G, Barshack I, McElwee JJ, Maranville J, Somech R, Snapper SB, Weiss B, Shouval DS.
In-Text Gene Mentions

BTN2A2

Show Full Abstract

<h4>Background</h4>Advances in genomics have facilitated the discovery of monogenic disorders in patients with unique gastro-intestinal phenotypes. Syndromic diarrhea, also called tricho-hepato-enteric (THE) syndrome, results from deleterious mutations in SKIV2L or TTC37 genes. The main features of this disorder are intractable diarrhea, abnormal hair, facial dysmorphism, immunodeficiency and liver disease.<h4>Aim</h4>To report on a patient with THE syndrome and present the genetic analysis that facilitated diagnosis.<h4>Methods</h4>Whole-exome sequencing (WES) was performed in a 4-month-old female with history of congenital diarrhea and severe failure to thrive but without hair anomalies or dysmorphism. Since the parents were first-degree cousins, the analysis focused on an autosomal recessive model. Sanger sequencing was used to validate suspected variants. Mutated protein structure was modeled to assess the effect of the mutation on protein function.<h4>Results</h4>We identified an autosomal recessive C.1891G > A missense mutation (NM_006929) in SKIV2L gene that was previously described only in a compound heterozygous state as causing THE syndrome. The mutation was determined to be deleterious in multiple prediction models. Protein modeling suggested that the mutation has the potential to cause structural destabilization of SKIV2L, either through conformational changes, interference with the protein's packing, or changes at the protein's interface.<h4>Conclusions</h4>THE syndrome can present with a broad range of clinical features in the neonatal period. WES is an important diagnostic tool in patients with congenital diarrhea and can facilitate diagnosis of various diseases presenting with atypical features.

Also flagged:Idiopathic Dilated Cardiomyopathynon-ischemic chronic heart failurecalcium channelgap junctionCACNB4heart failure
Journal Article 2018-02-26 No Snippets Xu H, Dorn GW, Shetty A, Parihar A, Dave T, Robinson SW, Gottlieb SS, Donahue MP, Tomaselli GF, Kraus WE, Mitchell BD, Liggett SB.
Show Full Abstract

Idiopathic dilated cardiomyopathy (IDC) is the most common form of non-ischemic chronic heart failure. Despite the higher prevalence of IDC in African Americans, the genetics of IDC have been relatively understudied in this ethnic group. We performed a genome-wide association study to identify susceptibility genes for IDC in African Americans recruited from five sites in the U.S. (662 unrelated cases and 1167 controls). The heritability of IDC was calculated to be 33% (95% confidence interval: 19-47%; <i>p</i> = 6.4 × 10<sup>-7</sup>). We detected association of a variant in a novel intronic locus in the <i>CACNB4</i> gene meeting genome-wide levels of significance (<i>p</i> = 4.1 × 10<sup>-8</sup>). The <i>CACNB4</i> gene encodes a calcium channel subunit expressed in the heart that is important for cardiac muscle contraction. This variant has not previously been associated with IDC in any racial group. Pathway analysis, based on the 1000 genes most strongly associated with IDC, showed an enrichment for genes related to calcium signaling, growth factor signaling, neuronal/neuromuscular signaling, and various types of cellular level signaling, including gap junction and cAMP signaling. Our results suggest a novel locus for IDC in African Americans and provide additional insights into the genetic architecture and etiology.

Also flagged:bindingproteinNS1-binding proteinNS1-BPKelch proteinNS1
Journal Article 2018-02-26 ✓ 1 Snippet Guo L, Liu Y.
In-Text Gene Mentions

KLHL20

Show Full Abstract

NS1-binding protein (NS1-BP), which belongs to the Kelch protein superfamily, was first identified as a novel human 70 kDa protein that interacts with NS1 of Influenza A virus. It is involved in many cell functions, including pre-mRNA splicing, the ERK signalling pathway, the aryl hydrocarbon receptor (AHR) pathway, F-actin organization and protein ubiquitylation. However, the structure of NS1-BP is still unknown, which may impede functional studies. Here, the structure of the C-terminal Kelch domain of NS1-BP (NS1-BP-C; residues 330-642) was determined at 1.98 Å resolution. The Kelch domain adopts a highly symmetric six-bladed β-propeller fold structure. Each blade of the β-propeller is composed of four antiparallel β-strands. Comparison of the Kelch-domain structures of NS1-BP and its homologues showed that the Gly-Gly pair in β-strand B and the hydrophobic Trp residue in β-strand D are highly conserved, while the B-C loops in blades 2 and 6 are variable. This structure of the Kelch domain of NS1-BP extends the understanding of NS1-BP.

Also flagged:synthesisarterial thrombosispeptidecarbonylplatelet activationaspirin
Journal Article 2018-02-26 No Snippets Wu J, Zhu H, Yang G, He J, Wang Y, Zhao S, Zhang X, Gui L, Zhao M, Peng S.
Show Full Abstract

<h4>Background</h4>Arterial thrombosis has been associated with a series of pathological conditions, and the discovery of arterial thrombosis inhibitor is of clinical importance.<h4>Methods</h4>By analyzing the pharmacophores of anti-platelet agents, thrombus targeting peptide and anti-thrombotic nano-systems 3S-1,2,3,4-tetrahydroisoquino-line-3-carbonyl-Thr-Ala-Arg-Gly-Asp(Val)-Val (IQCA-TAVV) was designed and prepared as a nano-scaled arterial thrombosis inhibitor.<h4>Results</h4>In vitro the nanoparticles of IQCA-TAVV were able to adhere onto the surface of activated platelets, attenuate activated platelets to extend pseudopodia and inhibit activated platelets to form aggregators. In vivo IQCA-TAVV targeted arterial thrombus, dose dependently inhibited arterial thrombosis with a 1 nmol/kg of minimal effective dose, and the activity waŝ1670 folds of that of aspirin.<h4>Conclusion</h4>IQCA-TAVV represented the design, preparation and application of nanomedicine capable of adhering on the surface of activated platelets, attenuating platelet activation, targeting arterial thrombus and inhibiting arterial thrombosis.

Also flagged:HuntingtinHuntington's diseaseHDautosomal dominant neurodegenerative disorderpolyglutamineCas9
Journal Article 2018-02-26 ✓ 5 Snippets Dabrowska M, Juzwa W, Krzyzosiak WJ, Olejniczak M.
In-Text Gene Mentions

Huntington's disease (HD) is a progressive autosomal dominant neurodegenerative disorder caused by the expansion of CAG repeats in the first exon of the huntingtin gene (HTT).

HD is caused by the expansion of CAG repeats in exon 1 of the HTT gene, which encodes huntingtin (HTT), a large protein of more than 3,000 amino acids (Saudou and Humbert, 2016).

In addition, the non-allele selective approach has been used to inactivate the HTT gene by using a pair of sgRNAs flanking CAG repeats and wt Cas9 in a transgenic mouse model of HD (Yang et al., 2017).

…huntingtin gene (HTT).…

…1 of theHTTgene, which encodes…

Show Full Abstract

Huntington's disease (HD) is a progressive autosomal dominant neurodegenerative disorder caused by the expansion of CAG repeats in the first exon of the huntingtin gene (<i>HTT</i>). The accumulation of polyglutamine-rich huntingtin proteins affects various cellular functions and causes selective degeneration of neurons in the striatum. Therapeutic strategies used to date to silence the expression of mutant <i>HTT</i> include antisense oligonucleotides, RNA interference-based approaches and, recently, genome editing with the CRISPR/Cas9 system. Here, we demonstrate that the CAG repeat tract can be precisely excised from the <i>HTT</i> gene with the use of the paired Cas9 nickase strategy. As a model, we used HD patient-derived fibroblasts with varied numbers of CAG repeats. The repeat excision inactivated the <i>HTT</i> gene and abrogated huntingtin synthesis in a CAG repeat length-independent manner. Because Cas9 nickases are known to be safe and specific, our approach provides an attractive treatment tool for HD that can be extended to other polyQ disorders.

Also flagged:TumorCancerchimeric antigen receptorimmune responsesβ-glucanCell-wall
Journal Article 2018-02-26 ✓ 5 Snippets Zhang M, Kim JA, Huang AY.
In-Text Gene Mentions

(B) Tumor cells lack of β-glucans do not induce dual binding to leukocytes; however, the introduction of exogenous β-glucan can create dual-binding of leukocyte to iC3b-positive tumor cells to stimulate CR3-DCC for the destruction of the target.

…endent cellular toxicity (CR3-DCC), which is critical…

…mediated mechanism, i.e., CR3-DCC, against the microorganisms.…

…nt cellular cytotoxicity (CR3-DCC). (…

…cells to stimulate CR3-DCCfor the destruction…

Show Full Abstract

Immunotherapy is revolutionizing cancer treatment. Recent clinical success with immune checkpoint inhibitors, chimeric antigen receptor T-cell therapy, and adoptive immune cellular therapies has generated excitement and new hopes for patients and investigators. However, clinically efficacious responses to cancer immunotherapy occur only in a minority of patients. One reason is the tumor microenvironment (TME), which potently inhibits the generation and delivery of optimal antitumor immune responses. As our understanding of TME continues to grow, strategies are being developed to change the TME toward one that augments the emergence of strong antitumor immunity. These strategies include eliminating tumor bulk to provoke the release of tumor antigens, using adjuvants to enhance antigen-presenting cell function, and employ agents that enhance immune cell effector activity. This article reviews the development of β-glucan and β-glucan-based nanoparticles as immune modulators of TME, as well as their potential benefit and future therapeutic applications. Cell-wall β-glucans from natural sources including plant, fungi, and bacteria are molecules that adopt pathogen-associated molecular pattern (PAMP) known to target specific receptors on immune cell subsets. Emerging data suggest that the TME can be actively manipulated by β-glucans and their related nanoparticles. In this review, we discuss the mechanisms of conditioning TME using β-glucan and β-glucan-based nanoparticles, and how this strategy enables future design of optimal combination cancer immunotherapies.

Also flagged:cleft lipcleft palateCLalcoholGxAlcoholorofacial clefts
Journal Article 2018-02-26 No Snippets Haaland ØA, Lie RT, Romanowska J, Gjerdevik M, Gjessing HK, Jugessur A.
Show Full Abstract

<b>Background:</b> It is widely accepted that cleft lip with or without cleft palate (CL/P) results from the complex interplay between multiple genetic and environmental factors. However, a robust investigation of these gene-environment (GxE) interactions at a genome-wide level is still lacking for isolated CL/P. <b>Materials and Methods:</b> We used our R-package Haplin to perform a genome-wide search for GxE effects in isolated CL/P. From a previously published GWAS, genotypes and information on maternal periconceptional cigarette smoking, alcohol intake, and vitamin use were available on 1908 isolated CL/P triads of predominantly European or Asian ancestry. A GxE effect is present if the relative risk estimates for gene-effects in the offspring are different across exposure strata. We tested this using the relative risk ratio (RRR). Besides analyzing all ethnicities combined ("pooled analysis"), separate analyses were conducted on Europeans and Asians to investigate ethnicity-specific effects. To control for multiple testing, <i>q</i>-values were calculated from the <i>p</i>-values. <b>Results:</b> We identified significant GxVitamin interactions with three SNPs in "Estrogen-related receptor gamma" (<i>ESRRG</i>) in the pooled analysis. The RRRs (95% confidence intervals) were 0.56 (0.45-0.69) with rs1339221 (<i>q</i> = 0.011), 0.57 (0.46-0.70) with rs11117745 (<i>q</i> = 0.011), and 0.62 (0.50-0.76) with rs2099557 (<i>q</i> = 0.037). The associations were stronger when these SNPs were analyzed as haplotypes composed of two-SNP and three-SNP combinations. The strongest effect was with the "t-t-t" haplotype of the rs1339221-rs11117745-rs2099557 combination [RRR = 0.50 (0.40-0.64)], suggesting that the effects observed with the other SNP combinations, including those in the single-SNP analyses, were mainly driven by this haplotype. Although there were potential GxVitamin effects with rs17734557 and rs1316471 and GxAlcohol effects with rs9653456 and rs921876 in the European sample, respectively, none of the SNPs was located in or near genes with strong links to orofacial clefts. GxAlcohol and GxSmoke effects were not assessed in the Asian sample because of a lack of observations for these exposures. <b>Discussion/Conclusion:</b> We identified significant interactions between vitamin use and variants in <i>ESRRG</i> in the pooled analysis. These GxE effects are novel and warrant further investigations to elucidate their roles in orofacial clefting. If validated, they could provide prospects for exploring the impact of estrogens and vitamins on clefting, with potential translational applications.

Also flagged:corticosteroidAutoimmune hepatitiscorticosteroidsChemokinesecretionCD39
Journal Article 2018-02-26 ✓ 2 Snippets Jeffery HC, Braitch MK, Bagnall C, Hodson J, Jeffery LE, Wawman RE, Wong LL, Birtwistle J, Bartlett H, Lohse AW, Hirschfield GM, Dyson J, Jones D, Hubscher SG, Klenerman P, Adams DH, Oo YH.
In-Text Gene Mentions

…control patients withhemochromatosis, the Treg/NK bright…

…bright frequencies inhemochromatosisbut also due…

Show Full Abstract

Autoimmune hepatitis (AIH) is an immune-mediated liver disease currently treated by immunosuppressive medications with significant side effects. Thus, novel mechanistic treatments are greatly needed. We performed prospective deep immunophenotyping of blood immune cells in patients with acute AIH before and after corticosteroid therapy. Blood samples from 26 patients with acute AIH (United Kingdom-AIH Consortium) were phenotyped by flow cytometry at baseline and 4 months after starting corticosteroids. Pretreatment liver tissues were stained for forkhead box P3-positive (FOXP3<sup>POS</sup>) regulatory T cells (Tregs), clusters of differentiation (CD)56<sup>POS</sup> natural killer (NK) cells, and chemokine (C-X-C motif) ligand 10. Chemokine secretion by cultured primary hepatocyte and biliary epithelial cells was measured by enzyme-linked immunosorbent assay. Functional coculture assays with stimulated NK cells and Tregs were performed. CD161 ligand, lectin-like transcript-1 expression by intrahepatic immune cells was demonstrated with flow cytometry. Frequencies of NK<sup>bright</sup> cells declined with therapy (<i>P</i> < 0.001) and correlated with levels of alanine aminotransferase (<i>P =</i> 0.023). The Treg:NK<sup>bright</sup> ratio was lower pretreatment, and Tregs had an activated memory phenotype with high levels of CD39, cytotoxic T lymphocyte antigen 4, and FOXP3 but also high programmed death ligand 1, indicating exhaustion. Coculture experiments suggested the Tregs could not efficiently suppress interferon-γ secretion by NK cells. Both Tregs and NK cells had high expression of liver infiltration and T helper 17 plasticity-associated marker CD161 (<i>P =</i> 0.04). Pretreatment and CD161<sup>pos</sup> NK cells expressed high levels of perforin and granzyme B, consistent with an activated effector phenotype (<i>P</i> < 0.05). Lectin-like transcript 1, a ligand for CD161, is expressed on intrahepatic B cells, monocytes, and neutrophils. <i>Conclusion:</i> Activated effector NK cells, which correlate with biochemical measurements of hepatitis, and exhausted memory Tregs are increased in the blood of patients with treatment-naive AIH and decline with corticosteroid therapy. Inadequate regulation of NK cells by exhausted FOXP3<sup>pos</sup> Tregs may play a role in AIH pathogenesis and contribute to liver injury. (<i>Hepatology Communications</i> 2018;2:421-436).

Also flagged:Mitochondrial Encephalopathy20complexVARS2microcephalynystagmus
Journal Article 2018-02-25 ✓ 1 Snippet Pereira S, Adrião M, Sampaio M, Basto MA, Rodrigues E, Vilarinho L, Teles EL, Alonso I, Leão M.
In-Text Gene Mentions

DARS2

Show Full Abstract

<h4>Introduction</h4>Combined oxidative phosphorylation deficiency 20 (COXPD20) is a mitochondrial respiratory chain complex (RC) disorder, caused by disease-causing variants in the VARS2 gene, which encodes a mitochondrial aminoacyl-tRNA synthetase. Here we describe a patient with fatal mitochondrial encephalopathy caused by a homozygous VARS2 gene missense variant.<h4>Case report</h4>We report the case of a girl, the first child of non-consanguineous and healthy parents, born from an uneventful term pregnancy, who presented, in the neonatal period, major hypotonia and microcephaly. At 4 months of age she showed poor eye contact, nystagmus, global psychomotor development delay and failure to thrive, without dysmorphic features. Focal seizures started at 24 months which evolved to a severe epileptic encephalopathy and finally to super refractory status epilepticus, leading to her death at 28 months of age. Etiologic investigation encompassing metabolic and genetic causes failed to disclose a diagnosis. Post-mortem exome sequencing allowed the identification of a pathogenic variant in VARS2 gene in the homozygous state (c.1100C > T, p.Thr367Ile) in the patient, inherited from her heterozygous parents, leading to the diagnosis of COXPD2.<h4>Conclusion</h4>To the best of our knowledge, this is the fifth case described in the literature of a child with disease-causing variant in VARS2. With this report we expand the knowledge about the phenotype associated with this very rare mitochondrial defect, further emphasizing the use of exome sequencing as a very powerful diagnostic tool.

Also flagged:SynthesishydroxyapatiteapatiteMitochondriallactate dehydrogenaseLDH
Journal Article 2018-02-25 No Snippets Rincón-López JA, Hermann-Muñoz JA, Giraldo-Betancur AL, De Vizcaya-Ruiz A, Alvarado-Orozco JM, Muñoz-Saldaña J.
Show Full Abstract

The physicochemical properties and biological behavior of sintered-bovine-derived hydroxyapatite (BHAp) are here reported and compared to commercial synthetic-HAp (CHAp). Dense ceramics were sintered for 2 h and 4 h at 1200 °C to investigate their microstructure-structure-in-vitro behavior relationship for both HAp ceramics. Densification was directly proportional to sintering time, showing a grain coarsening behavior with a greater effect on BHAp. Lattice parameters, crystallite size, cell volume and <i>Ca</i>/<i>P</i> ratio were determined by Rietveld refinement of X-ray diffraction (XRD) patterns using GSAS<sup>®</sup>. Ionic substitutions (Na⁺, Mg<sup>2+</sup>, CO₃<sup>2-</sup>) related to BHAp structure were associated with their position changes in the vibrational modes and correlated with the structural parameters obtained from the XRD analysis. Variations in the structural parameters and surface morphology were also evaluated after different soaking periods in simulated body fluid, which is associated with the formation of bone-like apatite layer and thus bioactivity. Mitochondrial activity (MTS) and lactate dehydrogenase (LDH) assays showed that the material released by the ceramics does not induce toxicity after exposure in human fetal osteoblastic (hFOB) cells. Furthermore, no statistically significant differences were found between the HAp obtained from different sources. These results show that BHAp can be used with no restrictions for the same biomedical applications as CHAp.

Also flagged:gene expressioncardiovascular diseasenucleotidesCardiovascularCV) diseasedeath
Journal Article 2018-02-25 No Snippets Gomes CPC, Salgado-Somoza A, Creemers EE, Dieterich C, Lustrek M, Devaux Y, Cardiolinc™ network.
Show Full Abstract

Until recently considered as rare, circular RNAs (circRNAs) are emerging as important regulators of gene expression. They are ubiquitously expressed and represent a novel branch of the family of non-coding RNAs. Recent investigations showed that circRNAs are regulated in the cardiovascular system and participate in its physiological and pathological development. In this review article, we will provide an overview of the role of circRNAs in cardiovascular health and disease. After a description of the biogenesis of circRNAs, we will summarize what is known of the expression, regulation and function of circRNAs in the cardiovascular system. We will then address some technical aspects of circRNAs research, discussing how artificial intelligence may aid in circRNAs research. Finally, the potential of circRNAs as biomarkers of cardiovascular disease will be addressed and directions for future research will be proposed.

Also flagged:HemicyanineCoumarinconjugationvinylmorpholinephenylenediamine
Journal Article 2018-02-25 No Snippets Xia S, Wang J, Bi J, Wang X, Fang M, Phillips T, May A, Conner N, Tanasova M, Luo FT, Liu H.
Show Full Abstract

We report two ratiometric fluorescent probes based on π-conjugation modulation between coumarin and hemicyanine moieties for sensitive ratiometric detection of pH alterations in live cells by monitoring visible and near-infrared fluorescence changes. In a π-conjugation modulation strategy, a coumarin dye was conjugated to a near-infrared hemicyanine dye via a vinyl connection while lysosome-targeting morpholine ligand and o-phenylenediamine residue were introduced to the hemicyanine dye to form closed spirolactam ring structures in probes <b>A</b> and <b>B</b>, respectively. The probes show only visible fluorescence of the coumarin moiety under physiological and basic conditions because the hemicyanine moieties retain their closed spirolactam ring structures. However, decrease of pH to acidic condition causes spirolactam ring opening, and significantly enhances π-conjugation within the probes, thus generating new near-infrared fluorescence peaks of the hemicyanine at 755 nm and 740 nm for probes <b>A</b> and <b>B</b>, respectively. Moreover, the probes display ratiometric fluorescence response to pH with decreases of the coumarin fluorescence and increases of the hemicyanine fluorescence when pH changes from 7.4 to 2.5. The probes are fully capable of imaging pH changes in live cells with good ratiometric responses in visible and near-infrared channels, and effectively avoid fluorescence blind spots under neutral and basic pH conditions - an issue that typical intensity-based pH fluorescent probes run into. The probe design platform reported herein can be easily applied to prepare a variety of ratiometric fluorescent probes for detection of biological thiols, metal ions, reactive oxygen and nitrogen species by introducing appropriate functional groups to hemicyanine moiety.

Also flagged:cholesterolobesityCCDC171carbohydratescoronary artery diseaseType 2 diabetes
Journal Article 2018-02-24 ✓ 2 Snippets Chang X, Dorajoo R, Sun Y, Han Y, Wang L, Khor CC, Sim X, Tai ES, Liu J, Yuan JM, Koh WP, van Dam RM, Friedlander Y, Heng CK.
In-Text Gene Mentions

A total of nine loci (TMEM18, GNPDA2, RALYL, NT5C2, OLFM4, FTO, MC4R, QPCTL and ZC3H4) were associated with the outcome and the most strongly associated locus was rs11191560 on NT5C2. Nominal associations observed between the AHEI-2010 score and individual dietary components with BMI levels in our study suggest that a healthier diet may reduce obesity levels.

…GNPDA2, RALYL, NT5C2,OLFM4, FTO, MC4R, QPCTL…

Show Full Abstract

<h4>Background</h4>Recent genome-wide association studies (GWAS) have identified 97 body-mass index (BMI) associated loci. We aimed to evaluate if dietary intake modifies BMI associations at these loci in the Singapore Chinese population.<h4>Methods</h4>We utilized GWAS information from six data subsets from two adult Chinese population (N = 7817). Seventy-eight genotyped or imputed index BMI single nucleotide polymorphisms (SNPs) that passed quality control procedures were available in all datasets. Alternative Healthy Eating Index (AHEI)-2010 score and ten nutrient variables were evaluated. Linear regression analyses between z score transformed BMI (Z-BMI) and dietary factors were performed. Interaction analyses were performed by introducing the interaction term (diet x SNP) in the same regression model. Analysis was carried out in each cohort individually and subsequently meta-analyzed using the inverse-variance weighted method. Analyses were also evaluated with a weighted gene-risk score (wGRS) contructed by BMI index SNPs from recent large-scale GWAS studies.<h4>Results</h4>Nominal associations between Z-BMI and AHEI-2010 and some dietary factors were identified (P = 0.047-0.010). The BMI wGRS was robustly associated with Z-BMI (P = 1.55 × 10<sup>- 15</sup>) but not with any dietary variables. Dietary variables did not significantly interact with the wGRS to modify BMI associations. When interaction analyses were repeated using individual SNPs, a significant association between cholesterol intake and rs4740619 (CCDC171) was identified (β = 0.077, adjP<sub>interaction</sub> = 0.043).<h4>Conclusions</h4>The CCDC171 gene locus may interact with cholesterol intake to increase BMI in the Singaporean Chinese population, however most known obesity risk loci were not associated with dietary intake and did not interact with diet to modify BMI levels.

Also flagged:MT-ND5ND5Leigh SyndromeLSmitochondrial encephalomyopathylactic acidosis and stroke-like episodes
Journal Article 2018-02-24 ✓ 2 Snippets Ng YS, Lax NZ, Maddison P, Alston CL, Blakely EL, Hepplewhite PD, Riordan G, Meldau S, Chinnery PF, Pierre G, Chronopoulou E, Du A, Hughes I, Morris AA, Kamakari S, Chrousos G, Rodenburg RJ, Saris CGJ, Feeney C, Hardy SA, Sakakibara T, Sudo A, Okazaki Y, Murayama K, Mundy H, Hanna MG, Ohtake A, Schaefer AM, Champion MP, Turnbull DM, Taylor RW, Pitceathly RDS, McFarland R, Gorman GS.
In-Text Gene Mentions

The radiological appearances of patients with LS harboring the m.13094T>C mutation bear similarities to mitochondrial diseases caused by autosomal recessive tRNA synthetase mutations, such as leukoencephalopathy with thalamus and brainstem involvement and high lactate (LTBL) caused by EARS2 mutations and leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL) caused by DARS2 mutations (Diodato et al., 2014).

…(LBSL) caused byDARS2mutations ( Diodato…

Show Full Abstract

Mutations in the m.13094T>C MT-ND5 gene have been previously described in three cases of Leigh Syndrome (LS). In this retrospective, international cohort study we identified 20 clinically affected individuals (13 families) and four asymptomatic carriers. Ten patients were deceased at the time of analysis (median age of death was 10years (range: 5·4months-37years, IQR=17·9years). Nine patients manifested with LS, one with mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (MELAS), and one with Leber hereditary optic neuropathy. The remaining nine patients presented with either overlapping syndromes or isolated neurological symptoms. Mitochondrial respiratory chain activity analysis was normal in five out of ten muscle biopsies. We confirmed maternal inheritance in six families, and demonstrated marked variability in tissue segregation, and phenotypic expression at relatively low blood mutant loads. Neuropathological studies of two patients manifesting with LS/MELAS showed prominent capillary proliferation, microvacuolation and severe neuronal cell loss in the brainstem and cerebellum, with conspicuous absence of basal ganglia involvement. These findings suggest that whole mtDNA genome sequencing should be considered in patients with suspected mitochondrial disease presenting with complex neurological manifestations, which would identify over 300 known pathogenic variants including the m.13094T>C.

Also flagged:patent ductus arteriosussepsisrespiratory distress syndromeintrauterine growth restriction-metabolizing enzymesprostaglandin
Journal Article 2018-02-24 No Snippets Lewis TR, Shelton EL, Van Driest SL, Kannankeril PJ, Reese J.
Show Full Abstract

Patent ductus arteriosus (PDA) is a frequent, complex, and difficult to treat clinical syndrome among preterm infants in the neonatal intensive care unit. In addition to known clinical risk factors, there are emerging data about genetic predisposition to PDA in both animal and human models. Clinical response and toxicity from drugs used to treat PDA are highly variable. Developmental and genetic aspects of pharmacokinetics and pharmacodynamics influence exposure and response to pharmacologic therapies. Given the variable efficacy and toxicity of known drug therapies, novel therapeutic targets for PDA treatment offer the promise of precision medicine. This review addresses the known genetic contributions to prolonged ductal patency, variability in response to drug therapy for PDA, and potential novel drug targets for future PDA treatment discovery.

Also flagged:tumorbreast cancerrecurrentcancermetastatic diseasedeoxyribonucleic acids
Journal Article 2018-02-24 No Snippets Rohanizadegan M.
Show Full Abstract

Despite all the advances in diagnosis and treatment of breast cancer, a large number of patients suffer from late diagnosis or recurrence of their disease. Current available imaging modalities do not reveal micrometastasis and tumor biopsy is an invasive method to detect early stage or recurrent cancer, signifying the need for an inexpensive, non-invasive diagnostic modality. Cell-free tumor DNA (ctDNA) has been tried for early detection and targeted therapy of breast cancer, but its diagnostic and prognostic utility is still under investigation. This review summarizes the existing evidence on the use of ctDNA specifically in breast cancer, including detection methods, diagnostic accuracy, role in genetics and epigenetics evaluation of the tumor, and comparison with other biomarkers. Current evidence suggests that increasing levels of ctDNA in breast cancer can be of significant diagnostic value for early detection of breast cancer although the sensitivity and specificity of the methods is still suboptimal. Additionally, ctDNA allows for characterizing the tumor in a non-invasive way and monitor the response to therapy, although discordance of ctDNA results with direct biopsy (i.e. due to tumor heterogeneity) is still considered a notable limitation.

Also flagged:HuntingtinHuntington's diseaseHDneurodegenerative diseaseDARPP32Iba1
Journal Article 2018-02-23 ✓ 5 Snippets Pfister EL, DiNardo N, Mondo E, Borel F, Conroy F, Fraser C, Gernoux G, Han X, Hu D, Johnson E, Kennington L, Liu P, Reid SJ, Sapp E, Vodicka P, Kuchel T, Morton AJ, Howland D, Moser R, Sena-Esteves M, Gao G, Mueller C, DiFiglia M, Aronin N.
In-Text Gene Mentions

Huntington's disease (HD) is a fatal neurodegenerative disease caused by a genetic expansion of the CAG repeat region in the huntingtin (HTT) gene.

…of endogenous sheepHTTprotein were not…

…the huntingtin (HTT) gene.…

htt

HTT

Show Full Abstract

Huntington's disease (HD) is a fatal neurodegenerative disease caused by a genetic expansion of the CAG repeat region in the huntingtin (HTT) gene. Studies in HD mouse models have shown that artificial miRNAs can reduce mutant HTT, but evidence for their effectiveness and safety in larger animals is lacking. HD transgenic sheep express the full-length human HTT with 73 CAG repeats. AAV9 was used to deliver unilaterally to HD sheep striatum an artificial miRNA targeting exon 48 of the human HTT mRNA under control of two alternative promoters: U6 or CβA. The treatment reduced human mutant (m) HTT mRNA and protein 50-80% in the striatum at 1 and 6 months post injection. Silencing was detectable in both the caudate and putamen. Levels of endogenous sheep HTT protein were not affected. There was no significant loss of neurons labeled by DARPP32 or NeuN at 6 months after treatment, and Iba1-positive microglia were detected at control levels. It is concluded that safe and effective silencing of human mHTT protein can be achieved and sustained in a large-animal brain by direct delivery of an AAV carrying an artificial miRNA.

Also flagged:Voriconazoleaspergillosisazolesazoledrugbinding
Journal Article 2018-02-23 No Snippets Sharma C, Kumar R, Kumar N, Masih A, Gupta D, Chowdhary A.
Show Full Abstract

Invasive and allergic infections by <i>Aspergillus flavus</i> are more common in tropical and subtropical countries. The emergence of voriconazole (VRC) resistance in <i>A. flavus</i> impacts the management of aspergillosis, as azoles are used as the first-line and empirical therapy. We screened 120 molecularly confirmed <i>A. flavus</i> isolates obtained from respiratory and sinonasal specimens in a chest hospital in Delhi, India, for azole resistance using the CLSI broth microdilution (CLSI-BMD) method. Overall, 2.5% (<i>n</i> = 3/120) of <i>A. flavus</i> isolates had VRC MICs above epidemiological cutoff values (>1 μg/ml). The whole-genome sequence analysis of three non-wild-type (WT) <i>A. flavus</i> isolates with high VRC MICs showed polymorphisms in azole target genes (<i>cyp51A</i>, <i>cyp51B</i>, and <i>cyp51C</i>). Further, four novel substitutions (S196F, A324P, N423D, and V465M) encoded in the <i>cyp51C</i> gene were found in a single non-WT isolate which also exhibited overexpression of <i>cyp51</i> (<i>cyp51A</i>, -<i>B</i>, and -<i>C</i>) genes and transporter genes, namely, <i>MDR1</i>, <i>MDR2</i>, <i>atrF</i>, and <i>mfs1</i> The homology model of the non-WT isolate suggests that substitutions S196F and N423D exhibited major structural and functional effects on cyp51C drug binding. The substrate (drug) may not be able to bind to binding pocket due to changes in the pocket size or closing down or narrowing of cavities in drug entry channels. Notably, the remaining two VRC-resistant <i>A. flavus</i> isolates, including the one which had a pan-azole resistance phenotype (itraconazole and posaconazole), did not show upregulation of any of the analyzed target genes. These results suggest that multiple target genes and mechanisms could simultaneously contribute to azole resistance in <i>A. flavus</i>.

Also flagged:Diabetesdiabetes mellituschronic kidney diseasehypertensionBPuncontrolled hypertension
Journal Article 2018-02-23 No Snippets Anderegg MD, Gums TH, Uribe L, MacLaughlin EJ, Hoehns J, Bazaldua OV, Ives TJ, Hahn DL, Coffey CS, Carter BL.
Show Full Abstract

<h4>Objectives</h4>The objectives of this study were to determine if hypertensive patients with comorbid diabetes mellitus (DM) and/or chronic kidney disease (CKD) receiving a pharmacist intervention had a greater reduction in mean blood pressure (BP) and improved BP control at 9 months compared with those receiving usual care; and compare Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC 7) guideline and 2014 guideline (JNC 8) BP control rates in patients with DM and/or CKD.<h4>Methods</h4>This cluster randomized trial included 32 medical offices in 15 states. Clinical pharmacists made treatment recommendations to physicians at intervention sites. This post hoc analysis evaluated mean BP and BP control rates in the intervention and control groups.<h4>Main results</h4>The study included 335 patients (227 intervention, 108 control) when mean BP and control rates were evaluated by JNC 7 inclusion and control criteria. When JNC 8 inclusion and control criteria were applied, 241 patients (165 intervention, 76 control) remained and were included in the analysis. The pharmacist-intervention group had significantly greater mean systolic blood pressure reduction compared with usual care at 9 months (8.64 mm Hg; 95% confidence interval [CI] -12.8 to -4.49, p<0.001). The pharmacist-intervention group had significantly higher BP control at 9 months than usual care by either the JNC 7 or JNC 8 inclusion and control groups (adjusted odds ratio [OR] 1.97, 95% CI 1.01-3.86, p=0.0470 and OR 2.16, 95% CI 1.21-3.85, p=0.0102, respectively).<h4>Principal conclusions</h4>This study demonstrated that a physician-pharmacist collaborative intervention was effective in reducing mean systolic BP and improving BP control in patients with uncontrolled hypertension with DM and/or CKD, regardless of which BP guidelines were used.

Also flagged:HistoneBindingchromosomestranscriptional regulatorshistonesgene expression
Journal Article 2018-02-23 ✓ 1 Snippet Tekel SJ, Vargas DA, Song L, LaBaer J, Caplan MR, Haynes KA.
In-Text Gene Mentions

…interaction between itspolycomb chromodomainchromodomain (PCD) motif…

Show Full Abstract

Fusion proteins that specifically interact with biochemical marks on chromosomes represent a new class of synthetic transcriptional regulators that decode cell state information rather than DNA sequences. In multicellular organisms, information relevant to cell state, tissue identity, and oncogenesis is often encoded as biochemical modifications of histones, which are bound to DNA in eukaryotic nuclei and regulate gene expression states. We have previously reported the development and validation of the "polycomb-based transcription factor" (PcTF), a fusion protein that recognizes histone modifications through a protein-protein interaction between its polycomb chromodomain (PCD) motif and trimethylated lysine 27 of histone H3 (H3K27me3) at genomic sites. We demonstrated that PcTF activates genes at methyl-histone-enriched loci in cancer-derived cell lines. However, PcTF induces modest activation of a methyl-histone associated reporter compared to a DNA-binding activator. Therefore, we modified PcTF to enhance its binding avidity. Here, we demonstrate the activity of a modified regulator called Pc<sub>2</sub>TF, which has two tandem copies of the H3K27me3-binding PCD at the N-terminus. Pc<sub>2</sub>TF has a smaller apparent dissociation constant value in vitro and shows enhanced gene activation in HEK293 cells compared to PcTF. These results provide compelling evidence that the intrinsic histone-binding activity of the PCD motif can be used to tune the activity of synthetic histone-binding transcriptional regulators.

Also flagged:neurodegenerative disorderpathogenesisHDYKL-40innate immunityadaptive immunity
Journal Article 2018-02-23 ✓ 1 Snippet Niemelä V, Burman J, Blennow K, Zetterberg H, Larsson A, Sundblom J.
In-Text Gene Mentions

…1 in theHTT-gene [ 1 ].…

Show Full Abstract

<h4>Introduction</h4>Huntington's disease (HD) is a neurodegenerative disorder, but evidence also suggests neuroinflammation in the pathogenesis. The immune mechanisms involved and the timing of their activation need further clarification.<h4>Methods</h4>A clinically well-characterized HD cohort and gene negative controls were enrolled. YKL-40 reflecting innate immunity and sCD27, a marker of adaptive immunity, were measured across disease stages. Comparisons were made with markers of neurodegeneration: neurofilament light (NFL), total-tau (T-tau), and phospho-tau (P-tau).<h4>Results</h4>52 cross-sectional cerebrospinal fluid samples and 23 follow-up samples were analyzed. sCD27 was elevated in manifest HD and premanifest gene expansion carriers, whereas controls mostly had undetectable levels. YKL-40 showed a trend toward increase in manifest HD. sCD27 correlated with YKL-40 which in turn was closely associated to all included markers of neurodegeneration. YKL-40, NFL, and both forms of tau could all independently predict HD symptoms, but only NFL levels differed between groups after age-adjustment.<h4>Conclusion</h4>Increased sCD27 in premanifest HD is a sign of T cell-mediated neuroinflammation. This finding is novel since other reports almost exclusively have found early involvement of innate immunity. Validation of sCD27 in a larger HD cohort is needed. The role of adaptive immunity in HD needs further clarification, as it may hasten disease progression.

Also flagged:cytoplasmsarcoplasmic reticulumMISERCA2abindingMyocardial Infarction
Journal Article 2018-02-23 ✓ 1 Snippet Zhang Y, Jiao L, Sun L, Li Y, Gao Y, Xu C, Shao Y, Li M, Li C, Lu Y, Pan Z, Xuan L, Zhang Y, Li Q, Yang R, Zhuang Y, Zhang Y, Yang B.
In-Text Gene Mentions

Human genome sequencing and GENCODE (human genome encyclopedia of DNA elements) project have revealed that only ≈2% of the human genome can be translated into proteins and the rest of it is primarily transcribed into ncRNAs.25,26 Recently, several lncRNAs have been reported to be involved in heart disease.27–35 In addition, lncRNAs are also emerging as biomarkers for cardiovascular diseases.29,35 In our previous study, we identified ZFAS1—an antisense lncRNA to the 5′ end of the protein-coding gene ZNFX1—as an independent predictor of acute MI29.

Show Full Abstract

<h4>Rationale</h4>Ca<sup>2+</sup> homeostasis-a critical determinant of cardiac contractile function-is critically regulated by SERCA2a (sarcoplasmic reticulum Ca<sup>2+</sup>-ATPase 2a). Our previous study has identified <i>ZFAS1</i> as a new lncRNA biomarker of acute myocardial infarction (MI).<h4>Objective</h4>To evaluate the effects of <i>ZFAS1</i> on SERCA2a and the associated Ca<sup>2+</sup> homeostasis and cardiac contractile function in the setting of MI.<h4>Methods and results</h4><i>ZFAS1</i> expression was robustly increased in cytoplasm and sarcoplasmic reticulum in a mouse model of MI and a cellular model of hypoxia. Knockdown of endogenous <i>ZFAS1</i> by virus-mediated silencing shRNA partially abrogated the ischemia-induced contractile dysfunction. Overexpression of <i>ZFAS1</i> in otherwise normal mice created similar impairment of cardiac function as that observed in MI mice. Moreover, at the cellular level, <i>ZFAS1</i> overexpression weakened the contractility of cardiac muscles. At the subcellular level, <i>ZFAS1</i> deleteriously altered the Ca<sup>2+</sup> transient leading to intracellular Ca<sup>2+</sup> overload in cardiomyocytes. At the molecular level, <i>ZFAS1</i> was found to directly bind SERCA2a protein and to limit its activity, as well as to repress its expression. The effects of <i>ZFAS1</i> were readily reversible on knockdown of this lncRNA. Notably, a sequence domain of <i>ZFAS1</i> gene that is conserved across species mimicked the effects of the full-length <i>ZFAS1</i>. Mutation of this domain or application of an antisense fragment to this conserved region efficiently canceled out the deleterious actions of <i>ZFAS1</i>. <i>ZFAS1</i> had no significant effects on other Ca<sup>2+</sup>-handling regulatory proteins.<h4>Conclusions</h4><i>ZFAS1</i> is an endogenous SERCA2a inhibitor, acting by binding to SERCA2a protein to limit its intracellular level and inhibit its activity, and a contributor to the impairment of cardiac contractile function in MI. Therefore, anti-<i>ZFAS1</i> might be considered as a new therapeutic strategy for preserving SERCA2a activity and cardiac function under pathological conditions of the heart.

Also flagged:BRI2BRItype II transmembrane proteinsprotein phosphatase 1DLG4PSD-95
Journal Article 2018-02-23 No Snippets Martins F, Marafona AM, Pereira CD, Müller T, Loosse C, Kolbe K, da Cruz E Silva OAB, Rebelo S.
Show Full Abstract

BRI family proteins are ubiquitous type II transmembrane proteins but BRI2 is highly expressed in some neuronal tissues. Possible BRI2 functions include neuronal maturation and differentiation. Protein complexes appear to be important in mediating its functions. Previously described BRI2 interactors include the Alzheimer's amyloid precursor protein and protein phosphatase 1, but clearly the identification of novel interactors provides an important tool to understand the role and function of BRI2. To this end three rat brain regions (cerebellum, hippocampus, and cerebral cortex) were processed by BRI2 immunoprecipitation; co-precipitating proteins were identified by Nano-HPLC-MS/MS. The pool of the brain regions resulted in 511 BRI2 interacting proteins (BRI2 brain interactome) of which 120 were brain specific and 49 involved in neuronal differentiation. Brain region-specific analyses were also carried out for cerebellum, hippocampus, and cerebral cortex. Several novel BRI2 interactors were identified among them DLG4/PSD-95, which is singularly important as it places BRI2 in the postsynaptic compartment. This interaction was validated as well as the interaction with GAP-43 and synaptophysin. In essence, the resulting BRI2 brain interactome, associates this protein with neurite outgrowth and neuronal differentiation, as well as synaptic signalling and plasticity. It follows that further studies should address BRI2 particularly given its relevance to neuropathological conditions.

Also flagged:Macroautophagyautophagydegradationorganellesligand receptorsscaffold proteins
Journal Article 2018-02-23 No Snippets Gatica D, Lahiri V, Klionsky DJ.
Show Full Abstract

Macroautophagy, initially described as a non-selective nutrient recycling process, is essential for the removal of multiple cellular components. In the past three decades, selective autophagy has been characterized as a highly regulated and specific degradation pathway for removal of unwanted cytosolic components and damaged and/or superfluous organelles. Here, we discuss different types of selective autophagy, emphasizing the role of ligand receptors and scaffold proteins in providing cargo specificity, and highlight unanswered questions in the field.

Also flagged:dementiafrontotemporal dementianeurodegenerative dementiasADmotor neuron diseaseC9orf72
Journal Article 2018-02-23 ✓ 2 Snippets Pasanen P, Myllykangas L, Pöyhönen M, Kiviharju A, Siitonen M, Hardy J, Bras J, Paetau A, Tienari PJ, Guerreiro R, Verkkoniemi-Ahola A.
In-Text Gene Mentions

…damaging variants inUNC13Cand MARCH4 .…

UNC13C

Show Full Abstract

Alzheimer's disease (AD) and frontotemporal dementia (FTD) are the two most common neurodegenerative dementias. Variants in APP, PSEN1 and PSEN2 are typically linked to early-onset AD, and several genetic risk loci are associated with late-onset AD. Inherited FTD can be caused by hexanucleotide expansions in C9orf72, or variants in GRN, MAPT or CHMP2B. Several other genes have also been linked to FTD or FTD with motor neuron disease. Here we describe a cohort of 60 Finnish families with possible inherited dementia. Our aim was to clarify the genetic background of dementia in this cohort by analysing both known dementia-associated genes (APOE, APP, C9ORF72, GRN, PSEN1 and PSEN2) and searching for rare or novel segregating variants with exome sequencing. C9orf72 repeat expansions were detected in 12 (20%) of the 60 families, including, in addition to FTD, a family with neuropathologically verified AD. Twelve families (10 with AD and 2 with FTD) with representative samples from affected and unaffected subjects and without C9orf72 expansions were selected for whole-exome sequencing. Exome sequencing did not reveal any variants that could be regarded unequivocally causative, but revealed potentially damaging variants in UNC13C and MARCH4.

Also flagged:major depressive disorderneurogenesisBDNFpathogenesisHOMER1cognition
Journal Article 2018-02-23 No Snippets Zhang HF, Mellor D, Peng DH.
Show Full Abstract

Genetic-neuroimaging studies could identify new potential endophenotypes of major depressive disorder (MDD). Morphological and functional alterations may be attributable to genetic factors that regulate neurogenesis and neurodegeneration. Given that the association between gene polymorphisms and brain morphology or function has varied across studies, this systematic review aims at evaluating and summarizing all available genetic-neuroimaging studies. Twenty-eight gene variants were evaluated in 64 studies by structural or functional magnetic resonance imaging. Significant genetic-neuroimaging associations were found in monoaminergic genes, BDNF genes, glutamatergic genes, HPA axis genes, and the other common genes, which were consistent with common hypotheses of the pathogenesis of MDD.

Also flagged:AURKACell Differentiationhistone-lineage leukemiaMLLAF9
Journal Article 2018-02-23 ✓ 2 Snippets Park JW, Cho H, Oh H, Kim JY, Seo SB.
In-Text Gene Mentions

Previous study showed that Sox6-mediated K562 differentiation increases total hemoglobin content, but which is less than cells treated with hemin (Cantu et al., 2011).

…study showed thatSox6-mediated K562 differentiation…

Show Full Abstract

Aberrations in histone modifications are being studied in mixed-lineage leukemia (MLL)-AF9-driven acute myeloid leukemia (AML). In this study, we focused on the regulation of the differentiation of the MLL-AF9 type AML cell line THP-1. We observed that, upon phorbol 12-myristate 13-acetate (PMA) treatment, THP-1 cells differentiated into monocytes by down-regulating Aurora kinase A (AURKA), resulting in a reduction in H3S10 phosphorylation. We revealed that the AURKA inhibitor alisertib accelerates the expression of the H3K27 demethylase KDM6B, thereby dissociating AURKA and YY1 from the <i>KDM6B</i> promoter region. Using Flow cytometry, we found that alisertib induces THP-1 differentiation into monocytes. Furthermore, we found that treatment with the KDM6B inhibitor GSK-J4 perturbed the PMA-mediated differentiation of THP-1 cells. Thus, we discovered the mechanism of AURKA-KDM6B signaling that controls the differentiation of THP-1 cells, which has implications for biotherapy for leukemia.

Also flagged:diffuse intrinsic pontine gliomacancerlymphocyte proliferationCTLA-4cluster of differentiation (CD)284-1BB
Journal Article 2018-02-23 ✓ 1 Snippet Scutti JAB.
In-Text Gene Mentions

Numerous antigens from glioma have been described, including IL-13Ra2 (109,111,147,148), N-acetyl-β-glucosamine (149), sex-determining region Y box (SOX)2 (150,151), EGFRvIII (152), SOX6 (153), glioma-expressed antigen 1/2 (154), paired helical filament 3 (154), NK group 2D (NKG2D), NKp30, MHC class I polypeptide-related sequence A/B (MICA/B) (155,156), UL16-binding protein 1 (157), EphA2 (109,110), EphB6 (158), antigen isolated from immunoselected melanoma-2 (159), squamous cell carcinoma antigen recognized by T cells 1/3 (160,161), HER2 (162), tyrosinase-related protein 2 (163,164), glycoprotein 100 (165), melanoma antigen-1 (166) and NY-ESO1 (167).

Show Full Abstract

On the basis of immunological results, it is not in doubt that the immune system is able to recognize and eliminate transformed cells. A plethora of studies have investigated the immune system of patients with cancer and how it is prone to immunosuppression, due in part to the decrease in lymphocyte proliferation and cytotoxic activity. The series of experiments published following the demonstration by Dr Allison's group of the potential effect of anti-cytotoxic T lymphocyte-associated antigen-4 (CTLA-4) paved the way for a new perception in cancer immunotherapy: Immune checkpoints. Several T cell‑co-stimulatory molecules including cluster of differentiation (CD)28, inducible T cell co-stimulatory, 4-1BB, OX40, glucocorticoid-induced tumor necrosis factor receptor-related gene and CD27, and inhibitory molecules including T cell immunoglobulin and mucin domain-containing-3, programmed cell death-1 (PD-1), programmed cell death ligand-1 (PD-L1), V-domain immunoglobulin suppressor of T cells activation, T cell immunoglobulin and immunoreceptor tyrosine-based inhibitory motif domain, and B and T lymphocyte attenuator have been described in regulating T cell functions, and have been demonstrated to be essential targets in immunotherapy. In preclinical studies, glioblastoma multiforme, a high-grade glioma, the monotherapy targeting PD-1/PD-L1 and CTLA-4 resulted in increased survival times. An improved understanding of the pharmacodynamics and immune monitoring on glioma cancers, particularly in diffuse intrinsic pontine glioma (DIPG), an orphan type of cancer, is expected to have a major contribution to the development of novel therapeutic approaches. On the basis of the recent preclinical and clinical studies of glioma, but not of DIPG, the present review makes a claim for the importance of investigating the tumor microenvironment, the immune response and the use of immune checkpoints (agonists or antagonists) in preclinical/clinical DIPG samples by immune monitoring approaches and high-dimensional analysis. Evaluating the potential predictive and correlative biomarkers in preclinical and clinical studies may assist in answering certain crucial questions that may be useful to improve the clinical response in patients with DIPG.

Also flagged:brain developmentNeurotoxicitybehavioralbrain developmentresponse tothyroid hormones
Journal Article 2018-02-23 ✓ 1 Snippet Bal-Price A, Hogberg HT, Crofton KM, Daneshian M, FitzGerald RE, Fritsche E, Heinonen T, Hougaard Bennekou S, Klima S, Piersma AH, Sachana M, Shafer TJ, Terron A, Monnet-Tschudi F, Viviani B, Waldmann T, Westerink RHS, Wilks MF, Witters H, Zurich MG, Leist M.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Multiple non-animal-based test methods have never been formally validated. In order to use such new approach methods (NAMs) in a regulatory context, criteria to define their readiness are necessary. The field of developmental neurotoxicity (DNT) testing is used to exemplify the application of readiness criteria. The costs and number of untested chemicals are overwhelming for in vivo DNT testing. Thus, there is a need for inexpensive, high-throughput NAMs, to obtain initial information on potential hazards, and to allow prioritization for further testing. A background on the regulatory and scientific status of DNT testing is provided showing different types of test readiness levels, depending on the intended use of data from NAMs. Readiness criteria, compiled during a stakeholder workshop, uniting scientists from academia, industry and regulatory authorities are presented. An important step beyond the listing of criteria, was the suggestion for a preliminary scoring scheme. On this basis a (semi)-quantitative analysis process was assembled on test readiness of 17 NAMs with respect to various uses (e.g. prioritization/screening, risk assessment). The scoring results suggest that several assays are currently at high readiness levels. Therefore, suggestions are made on how DNT NAMs may be assembled into an integrated approach to testing and assessment (IATA). In parallel, the testing state in these assays was compiled for more than 1000 compounds. Finally, a vision is presented on how further NAM development may be guided by knowledge of signaling pathways necessary for brain development, DNT pathophysiology, and relevant adverse outcome pathways (AOP).

Also flagged:Butyrophilin 3cell receptorisopentenylpyrophosphatehydroxymethyl
Journal Article 2018-02-23 ✓ 5 Snippets Fichtner AS, Karunakaran MM, Starick L, Truman RW, Herrmann T.
In-Text Gene Mentions

In silico splicing and translation of this alpaca BTN3-like gene with an overall nucleotide identity of 81% to human BTN3A3 results in a protein sequence, which shares 72% amino acids with the human homolog.

…homologous to humanBTN3A3.…

…alpaca, and dolphinBTN3A3loci.…

…) and aBTN3A3-like gene was…

…homologies to humanBTN3A3exons.…

Show Full Abstract

1-5% of human blood T cells are Vγ9Vδ2 T cells whose T cell receptor (TCR) contain a <i>TRGV9/TRGJP</i> rearrangement and a <i>TRDV2</i> comprising Vδ2-chain. They respond to phosphoantigens (PAgs) like isopentenyl pyrophosphate or (E)-4-hydroxy-3-methyl-but-2-enyl-pyrophosphate (HMBPP) in a butyrophilin 3 (BTN3)-dependent manner and may contribute to the control of mycobacterial infections. These cells were thought to be restricted to primates, but we demonstrated by analysis of genomic databases that <i>TRGV9, TRDV2</i>, and <i>BTN3</i> genes coevolved and emerged together with placental mammals. Furthermore, we identified alpaca (<i>Vicugna pacos</i>) as species with typical Vγ9Vδ2 TCR rearrangements and currently aim to directly identify Vγ9Vδ2 T cells and BTN3. Other candidates to study this coevolution are the bottlenose dolphin (<i>Tursiops truncatus</i>) and the nine-banded armadillo (<i>Dasypus novemcinctus</i>) with genomic sequences encoding open reading frames for <i>TRGV9, TRDV2</i>, and the extracellular part of <i>BTN3</i>. Dolphins have been shown to express Vγ9- and Vδ2-like TCR chains and possess a predicted <i>BTN3</i>-like gene homologous to human <i>BTN3A3</i>. The other candidate, the armadillo, is of medical interest since it serves as a natural reservoir for <i>Mycobacterium leprae</i>. In this study, we analyzed the armadillo genome and found evidence for multiple non-functional <i>BTN3</i> genes including genomic context which closely resembles the organization of the human, alpaca, and dolphin <i>BTN3A3</i> loci. However, no <i>BTN3</i> transcript could be detected in armadillo cDNA. Additionally, attempts to identify a functional <i>TRGV9/TRGJP</i> rearrangement <i>via</i> PCR failed. In contrast, complete <i>TRDV2</i> gene segments preferentially rearranged with a <i>TRDJ4</i> homolog were cloned and co-expressed with a human Vγ9-chain in murine hybridoma cells. These cells could be stimulated by immobilized anti-mouse CD3 antibody but not with human RAJI-RT1B<sup>l</sup> cells and HMBPP. So far, the lack of expression of <i>TRGV9</i> rearrangements and <i>BTN3</i> renders the armadillo an unlikely candidate species for PAg-reactive Vγ9Vδ2 T cells. This is in line with the postulated coevolution of the three genes, where occurrence of Vγ9Vδ2 TCRs coincides with a functional BTN3 molecule.

Also flagged:Systemic Lupus ErythematosusSLEautoimmune diseaseautoantibodiesB cell receptorBCR
Journal Article 2018-02-22 ✓ 1 Snippet Karrar S, Cunninghame Graham DS.
In-Text Gene Mentions

Variants in loci near or within OX40L/TNFSF4, MHC class II, and CD80 have all been implicated as associated with risk of SLE in various GWAS 13, 14, 30, 31 (Table 1).

Show Full Abstract

No abstract available.

Also flagged:degradationcondensinschromatinchromosomechromosomesmitosis
Journal Article 2018-02-22 ✓ 4 Snippets Samejima K, Booth DG, Ogawa H, Paulson JR, Xie L, Watson CA, Platani M, Kanemaki MT, Earnshaw WC.
In-Text Gene Mentions

Condensinis not required…

Condensinloss is reported…

Condensinis essential for…

Condensinis required both…

Show Full Abstract

The requirement for condensin in chromosome formation in somatic cells remains unclear, as imperfectly condensed chromosomes do form in cells depleted of condensin by conventional methodologies. In order to dissect the roles of condensin at different stages of vertebrate mitosis, we have established a versatile cellular system that combines auxin-mediated rapid degradation with chemical genetics to obtain near-synchronous mitotic entry of chicken DT40 cells in the presence and absence of condensin. We analyzed the outcome by live- and fixed-cell microscopy methods, including serial block face scanning electron microscopy with digital reconstruction. Following rapid depletion of condensin, chromosomal defects were much more obvious than those seen after a slow depletion of condensin. The total mitotic chromatin volume was similar to that in control cells, but a single mass of mitotic chromosomes was clustered at one side of a bent mitotic spindle. Cultures arrest at prometaphase, eventually exiting mitosis without segregating chromosomes. Experiments where the auxin concentration was titrated showed that different condensin levels are required for anaphase chromosome segregation and formation of a normal chromosome architecture.This article has an associated First Person interview with the first author of the paper.

Also flagged:chromosomescanceracute myeloid leukemiaAMLchromosomeMYC
Journal Article 2018-02-22 ✓ 1 Snippet L Abbate A, Tolomeo D, Cifola I, Severgnini M, Turchiano A, Augello B, Squeo G, D Addabbo P, Traversa D, Daniele G, Lonoce A, Pafundi M, Carella M, Palumbo O, Dolnik A, Muehlematter D, Schoumans J, Van Roy N, De Bellis G, Martinelli G, Merla G, Bullinger L, Haferlach C, Storlazzi CT.
In-Text Gene Mentions

…H1 and relatedlinker histoneshistones are important…

Show Full Abstract

Double minutes (dmin), homogeneously staining regions, and ring chromosomes are vehicles of gene amplification in cancer. The underlying mechanism leading to their formation as well as their structure and function in acute myeloid leukemia (AML) remain mysterious. We combined a range of high-resolution genomic methods to investigate the architecture and expression pattern of amplicons involving chromosome band 8q24 in 23 cases of AML (AML-amp). This revealed that different MYC-dmin architectures can coexist within the same leukemic cell population, indicating a step-wise evolution rather than a single event origin, such as through chromothripsis. This was supported also by the analysis of the chromothripsis criteria, that poorly matched the model in our samples. Furthermore, we found that dmin could evolve toward ring chromosomes stabilized by neocentromeres. Surprisingly, amplified genes (mainly PVT1) frequently participated in fusion transcripts lacking a corresponding DNA template. We also detected a significant overexpression of the circular RNA of PVT1 (circPVT1) in AML-amp cases versus AML with a normal karyotype. Our results show that 8q24 amplicons in AML are surprisingly plastic DNA structures with an unexpected association to novel fusion transcripts and circular RNAs.

Also flagged:Thrombospondin-2TSP2matricellulartumorangiogenesisbladder cancers
Journal Article 2018-02-22 ✓ 1 Snippet Roudnicky F, Yoon SY, Poghosyan S, Schwager S, Poyet C, Vella G, Bachmann SB, Karaman S, Shin JW, Otto VI, Detmar M.
In-Text Gene Mentions

…3′ end ofRABGAP1L, we identified ENST0000047844…

Show Full Abstract

Thrombospondin-2 (TSP2) is an anti-angiogenic matricellular protein that inhibits tumor growth and angiogenesis. Tumor-associated blood vascular endothelial cells (BECs) were isolated from human invasive bladder cancers and from matched normal bladder tissue by immuno-laser capture microdissection. Exon expression profiling analyses revealed a particularly high expression of a short TSP2 transcript containing only the last 9 (3') exons of the full-length TSP2 transcript. Using 5' and 3' RACE (rapid amplification of cDNA ends) and Sanger sequencing, we confirmed the existence of the shorter transcript of TSP2 (sTSP2) and determined its sequence which completely lacked the anti-angiogenic thrombospondin type 1 repeats domain. The largest open reading frame predicted within the transcript comprises 209 amino acids and matches almost completely the C-terminal lectin domain of full-length TSP2. We produced recombinant sTSP2 and found that unlike the full-length TSP2, sTSP2 did not inhibit vascular endothelial growth factor-A-induced proliferation of cultured human BECs, but in contrast when combined with TSP2 blocked the inhibitory effects of TSP2 on BEC proliferation. In vivo studies with stably transfected A431 squamous cell carcinoma cells revealed that full-length TSP2, but not sTSP2, inhibited tumor growth and angiogenesis. This study reveals that the transcriptional program of tumor stromal cells can change to transcribe a new version of an endogenous angiogenesis inhibitor that has lost its anti-angiogenic activity.

Also flagged:ionssynthesisorganic compoundsHC3cane sugarwater
Journal Article 2018-02-22 No Snippets Furley TH, Brodeur J, Silva de Assis HC, Carriquiriborde P, Chagas KR, Corrales J, Denadai M, Fuchs J, Mascarenhas R, Miglioranza KS, Miguez Caramés DM, Navas JM, Nugegoda D, Planes E, Rodriguez-Jorquera IA, Orozco-Medina M, Orozco-Medina M, Boxall AB, Rudd MA, Brooks BW.
Show Full Abstract

The Global Horizon Scanning Project (GHSP) is an innovative initiative that aims to identify important global environmental quality research needs. Here we report 20 key research questions from Latin America (LA). Members of the Society of Environmental Toxicology and Chemistry (SETAC) LA and other scientists from LA were asked to submit research questions that would represent priority needs to address in the region. One hundred questions were received, then partitioned among categories, examined, and some rearranged during a workshop in Buenos Aires, Argentina. Twenty priority research questions were subsequently identified. These research questions included developing, improving, and harmonizing across LA countries methods for 1) identifying contaminants and degradation products in complex matrices (including biota); 2) advancing prediction of contaminant risks and effects in ecosystems, addressing lab-to-field extrapolation challenges, and understanding complexities of multiple stressors (including chemicals and climate change); and 3) improving management and regulatory tools toward achieving sustainable development. Whereas environmental contaminants frequently identified in these key questions were pesticides, pharmaceuticals, endocrine disruptors or modulators, plastics, and nanomaterials, commonly identified environmental challenges were related to agriculture, urban effluents, solid wastes, pulp and paper mills, and natural extraction activities. Several interesting research topics included assessing and preventing pollution impacts on conservation protected areas, integrating environment and health assessments, and developing strategies for identification, substitution, and design of less hazardous chemicals (e.g., green chemistry). Finally, a recurrent research need included developing an understanding of differential sensitivity of regional species and ecosystems to environmental contaminants and other stressors. Addressing these critical questions will support development of long-term strategic research efforts to advance more sustainable environmental quality and protect public health and the environment in LA. Integr Environ Assess Manag 2018;14:344-357. © 2018 The Authors. Integrated Environmental Assessment and Management published by Wiley Periodicals, Inc. on behalf of Society of Environmental Toxicology & Chemistry (SETAC).

Also flagged:infectionchromosomeschlorosischromosomenucleotidebinding
Journal Article 2018-02-22 No Snippets Phan HTT, Rybak K, Bertazzoni S, Furuki E, Dinglasan E, Hickey LT, Oliver RP, Tan KC.
Show Full Abstract

<h4>Key message</h4>The fungus Parastagonospora nodorum causes Septoria nodorum blotch (SNB) of wheat. A genetically diverse wheat panel was used to dissect the complexity of SNB and identify novel sources of resistance. The fungus Parastagonospora nodorum is the causal agent of Septoria nodorum blotch (SNB) of wheat. The pathosystem is mediated by multiple fungal necrotrophic effector-host sensitivity gene interactions that include SnToxA-Tsn1, SnTox1-Snn1, and SnTox3-Snn3. A P. nodorum strain lacking SnToxA, SnTox1, and SnTox3 (toxa13) retained wild-type-like ability to infect some modern wheat cultivars, suggesting evidence of other effector-mediated susceptibility gene interactions or the lack of host resistance genes. To identify genomic regions harbouring such loci, we examined a panel of 295 historic wheat accessions from the N. I. Vavilov Institute of Plant Genetic Resources in Russia, which is comprised of genetically diverse landraces and breeding lines registered from 1920 to 1990. The wheat panel was subjected to effector bioassays, infection with P. nodorum wild type (SN15) and toxa13. In general, SN15 was more virulent than toxa13. Insensitivity to all three effectors contributed significantly to resistance against SN15, but not toxa13. Genome-wide association studies using phenotypes from SN15 infection detected quantitative trait loci (QTL) on chromosomes 1BS (Snn1), 2DS, 5AS, 5BS (Snn3), 3AL, 4AL, 4BS, and 7AS. For toxa13 infection, a QTL was detected on 5AS (similar to SN15), plus two additional QTL on 2DL and 7DL. Analysis of resistance phenotypes indicated that plant breeders may have inadvertently selected for effector insensitivity from 1940 onwards. We identify accessions that can be used to develop bi-parental mapping populations to characterise resistance-associated alleles for subsequent introgression into modern bread wheat to minimise the impact of SNB.

Also flagged:SUMOylationPost-translational modificationsSUMOsmall ubiquitin-like modifiertranslationalprophase
Journal Article 2018-02-22 ✓ 1 Snippet Reichman R, Shi Z, Malone R, Smolikove S.
In-Text Gene Mentions

…, along withDCCcomplex components, has…

Show Full Abstract

Meiosis is a highly regulated process, partly due to the need to break and then repair DNA as part of the meiotic program. Post-translational modifications are widely used during meiotic events to regulate steps such as protein complex formation, checkpoint activation, and protein attenuation. In this paper, we investigate how proteins that are obligatory components of the SUMO (small ubiquitin-like modifier) pathway, one such post-translational modification, affect the <i>Caenorhabditis elegans</i> germline. We show that UBC-9, the E2 conjugation enzyme, and the <i>C. elegans</i> homolog of SUMO, SMO-1, localize to germline nuclei throughout prophase I. Mutant analysis of <i>smo-1</i> and <i>ubc-9</i> revealed increased recombination intermediates throughout the germline, originating during the mitotic divisions. SUMOylation mutants also showed late meiotic defects including defects in the restructuring of oocyte bivalents and endomitotic oocytes. Increased rates of noninterfering crossovers were observed in <i>ubc-9</i> heterozygotes, even though interfering crossovers were unaffected. We have also identified a physical interaction between UBC-9 and DNA repair protein MRE-11 <i>ubc-9</i> and <i>mre-11</i> null mutants exhibited similar phenotypes at germline mitotic nuclei and were synthetically sick. These phenotypes and genetic interactions were specific to MRE-11 null mutants as opposed to RAD-50 or resection-defective MRE-11 We propose that the SUMOylation pathway acts redundantly with MRE-11, and in this process MRE-11 likely plays a structural role.

Also flagged:homCP12runimpABSamino
Journal Article 2018-02-22 ✓ 1 Snippet Wegmann S, Eftekharzadeh B, Tepper K, Zoltowska KM, Bennett RE, Dujardin S, Laskowski PR, MacKenzie D, Kamath T, Commins C, Vanderburg C, Roe AD, Fan Z, Molliex AM, Hernandez-Vega A, Muller D, Hyman AA, Mandelkow E, Taylor JP, Hyman BT.
In-Text Gene Mentions

…GFP‐tau441 or GFP‐polyQ(79) (Httexon‐1 with 79Q)…

Show Full Abstract

The transition between soluble intrinsically disordered tau protein and aggregated tau in neurofibrillary tangles in Alzheimer's disease is unknown. Here, we propose that soluble tau species can undergo liquid-liquid phase separation (LLPS) under cellular conditions and that phase-separated tau droplets can serve as an intermediate toward tau aggregate formation. We demonstrate that phosphorylated or mutant aggregation prone recombinant tau undergoes LLPS, as does high molecular weight soluble phospho-tau isolated from human Alzheimer brain. Droplet-like tau can also be observed in neurons and other cells. We found that tau droplets become gel-like in minutes, and over days start to spontaneously form thioflavin-S-positive tau aggregates that are competent of seeding cellular tau aggregation. Since analogous LLPS observations have been made for FUS, hnRNPA1, and TDP43, which aggregate in the context of amyotrophic lateral sclerosis, we suggest that LLPS represents a biophysical process with a role in multiple different neurodegenerative diseases.

Also flagged:cohesinchromosomesorganizationStructural Maintenance of Chromosomes
Journal Article 2018-02-22 ✓ 1 Snippet Ganji M, Shaltiel IA, Bisht S, Kim E, Kalichava A, Haering CH, Dekker C.
In-Text Gene Mentions

Condensin-induced loop extrusion is…

Show Full Abstract

It has been hypothesized that SMC protein complexes such as condensin and cohesin spatially organize chromosomes by extruding DNA into large loops. We directly visualized the formation and processive extension of DNA loops by yeast condensin in real time. Our findings constitute unambiguous evidence for loop extrusion. We observed that a single condensin complex is able to extrude tens of kilobase pairs of DNA at a force-dependent speed of up to 1500 base pairs per second, using the energy of adenosine triphosphate hydrolysis. Condensin-induced loop extrusion was strictly asymmetric, which demonstrates that condensin anchors onto DNA and reels it in from only one side. Active DNA loop extrusion by SMC complexes may provide the universal unifying principle for genome organization.

Also flagged:curcuminhyaluronic acidSunSDCS11Sun1
Journal Article 2018-02-22 No Snippets Jiang Z, Dong X, Yan X, Liu Y, Zhang L, Sun Y.
Show Full Abstract

Inhibition of amyloid β-protein (Aβ) aggregation is considered as a promising strategy for the prevention and treatment of Alzheimer's disease. Epigallocatechin-3-gallate (EGCG) and curcumin have been recognized as effective inhibitors of Aβ aggregation. Herein, we proposed dual-inhibitor modification of hyaluronic acid (HA) to explore the synergistic effect of the two inhibitors. EGCG-modified HA (EHA) formed dispersed hydrogel structures, while EGCG-curcumin bi-modified HA (CEHA) self-assembled into nanogels like curcumin-modified HA (CHA). Thioflavin T fluorescent assays revealed that the inhibitory effect of CEHA was 69% and 55% higher than EHA and CHA, respectively, and cytotoxicity assays showed that the viability of SH-SY5Y cells incubated with Aβ and CEHA was 28% higher than that with Aβ and the mixture of EHA and CHA. These results clearly indicate the synergism of the two inhibitors. It is considered that the difference in the hydrophobicities of the two inhibitors made the bi-modification of HA provide a favorable CEHA nanostructure that coordinated different inhibition effects of the two inhibitors. This research indicates that fabrication of dual-inhibitor nanosystem is promising for the development of potent agents against Aβ aggregation and cytotoxicity.

Also flagged:wound healingCD8
Journal Article 2018-02-22 No Snippets Dhariwala MO, Scharschmidt TC.
Show Full Abstract

Although our knowledge of host-commensal interactions has increased exponentially, the mechanisms linking a specific commensal, its detection by the immune system, and its impact on tissue function are still often poorly understood. In a recent study in Cell, Linehan et al. dissect one of these interactions in the context of the skin, and demonstrate that Staphylococcus epidermidis antigens, presented through a non-classical pathway, drive the accumulation of CD8<sup>+</sup> T cells that promote wound healing.

Also flagged:CAF-1Rad51chromatinASF1Abindinghistones
Journal Article 2018-02-22 ✓ 5 Snippets Huang TH, Fowler F, Chen CC, Shen ZJ, Sleckman B, Tyler JK.
In-Text Gene Mentions

In agreement, histones occupy ssDNA during DNA repair in yeast. We also uncovered DNA-PKcs-dependent DNA damage-induced ASF1A phosphorylation, which enhances chromatin assembly, promoting MMS22L-TONSL recruitment and, hence, Rad51 loading.

…the Rad51 loaderMMS22L-TONSL to ssDNA, resulting…

…serves to recruitMMS22L-TONSL to efficiently form…

…and CAF-1 promoteMMS22L-TONSL-mediated Rad51 loading …

…chromatin assembly, promotingMMS22L-TONSL recruitment and hence…

Show Full Abstract

The access-repair-restore model for the role of chromatin in DNA repair infers that chromatin is a mere obstacle to DNA repair. However, here we show that blocking chromatin assembly, via knockdown of the histone chaperones ASF1 or CAF-1 or a mutation that prevents ASF1A binding to histones, hinders Rad51 loading onto ssDNA during homologous recombination. This is a consequence of reduced recruitment of the Rad51 loader MMS22L-TONSL to ssDNA, resulting in persistent RPA foci, extensive DNA end resection, persistent activation of the ATR-Chk1 pathway, and cell cycle arrest. In agreement, histones occupy ssDNA during DNA repair in yeast. We also uncovered DNA-PKcs-dependent DNA damage-induced ASF1A phosphorylation, which enhances chromatin assembly, promoting MMS22L-TONSL recruitment and, hence, Rad51 loading. We propose that transient assembly of newly synthesized histones onto ssDNA serves to recruit MMS22L-TONSL to efficiently form the Rad51 nucleofilament for strand invasion, suggesting an active role of chromatin assembly in homologous recombination.

Also flagged:cancerbreast cancerp53cell adhesioncell proliferationgene expression
Journal Article 2018-02-22 ✓ 1 Snippet Meng G.
In-Text Gene Mentions

…WNK3, SCN1A, PTPRD,TAOK3, NPAS4, SLC10A3, DPEP1,…

Show Full Abstract

The progress of cancer genome sequencing projects yields unprecedented information of mutations for numerous patients. However, the complexity of mutation profiles of cancer patients hinders the further understanding to mechanisms of oncogenesis. One basic question is how to find mutations with functional impacts. In this work, we introduce a computational method to predict functional somatic mutations of each patient by integrating mutation recurrence with expression profile similarity. With this method, the functional mutations are determined by checking the mutation enrichment among a group of patients with similar expression profiles. We applied this method to three cancer types and identified the functional mutations. Comparison of the predictions for three cancer types suggested that most of the functional mutations were cancer-type-specific with one exception to <i>p53</i>. By checking predicted results, we found that our method effectively filtered non-functional mutations resulting from large protein sizes. In addition, this method can also perform functional annotation to each patient to describe their association with signalling pathways or biological processes. In breast cancer, we predicted "cell adhesion" and other terms to be significantly associated with oncogenesis.

Also flagged:dopaminergic receptorsobesitynucleusFTOmetabolismaddiction
Journal Article 2018-02-22 ✓ 2 Snippets Olivo G, Latini F, Wiemerslage L, Larsson EM, Schiöth HB.
In-Text Gene Mentions

Dennis et al. (2014) reported an association of WM integrity in several brain structures with only one gene (NEGR1) out of the 14 obesity-gene selected.

…only one gene (NEGR1) out of the…

Show Full Abstract

<b>Background</b>: Neurovascular coupling is associated with white matter (WM) structural integrity, and it is regulated by specific subtypes of dopaminergic receptors. An altered activity of such receptors, highly expressed in reward-related regions, has been reported in carriers of obesity-risk alleles of the fat mass and obesity associated (<i>FTO</i>) gene. Among the reward-related regions, the thalamus and the nucleus accumbens are particularly vulnerable to blood pressure dysregulation due to their peculiar anatomo-vascular characteristics, and have been consistently reported to be altered in early-stage obesity. We have thus hypothesized that a disruption in thalamus and nucleus accumbens WM microstructure, possibly on neurovascular basis, could potentially be a predisposing factor underlying the enhanced risk for obesity in the risk-allele carriers. <b>Methods</b>: We have tested WM integrity in 21 male participants genotyped on the <i>FTO</i> risk single nucleotide polymorphisms (SNP) rs9939609, through a deterministic tractography analysis. Only homozygous participants (9 AA, 12 TT) were included. 11 tracts were selected and categorized as following according to our hypothesis: "risk tracts", "obesity-associated tracts", and a control tract (forcpes major). We investigated whether an association existed between genotype, body mass index (BMI) and WM microstructural integrity in the "risk-tracts" (anterior thalamic radiation and accumbofrontal fasciculus) compared to other tracts. Moreover, we explored whether WM diffusivity could be related to specific personality traits in terms of punishment and reward sensitivity, as measure by the BIS/BAS questionnaire. <b>Results</b>: An effect of the genotype and an interaction effect of genotype and BMI were detected on the fractional anisotropy (FA) of the "risk tracts". Correlations between WM diffusivity parameters and measures of punishment and reward sensitivity were also detected in many WM tracts of both networks. <b>Conclusions</b>: A disruption of the structural connectivity from the nucleus accumbens and the thalamus might occur early in carriers of the <i>FTO</i> AA risk-allele, and possibly act as a predisposing factor to the development of obesity.

Also flagged:HOXA11ovarian cancergliomalung cancernon-small cell lung cancerNSCLC
Journal Article 2018-02-22 No Snippets Zhang Y, Luo J, Wang X, Wang HL, Zhang XL, Gan TQ, Chen G, Luo DZ.
Show Full Abstract

Long non-coding RNA HOXA11 antisense RNA (HOXA11-AS) has been previously reported to be involved in the tumorigenesis and progression of ovarian cancer and glioma. However, the function of HOXA11-AS in lung cancer remains unclear. Following the knockdown of HOXA11-AS in A549 cells, a microarray analysis was performed in order to detect the differences in microRNA (miRNA/miR) profiles. Subsequently, miR-642b-3p was selected for further analysis. Four miRNA target prediction algorithms were used to identify potential target genes of miR-642b-3p. Bioinformatics analyses, including Gene Ontology (GO), Kyoto Encyclopaedia of Genes and Genomes, protein-protein interactions (PPIs) and network analysis, were performed to investigate the potential functions, pathways and networks of the target genes. Furthermore, the differential expression of miR-642b-3p and its target genes between normal lung and non-small cell lung cancer (NSCLC) tissues was verified using The Cancer Genome Atlas (TCGA) database. Six target genes [zinc finger protein 350, heterogeneous nuclear ribonucleoprotein U, high mobility group box 1, phosphodiesterase 4D (PDE4D), synaptotagmin binding cytoplasmic RNA interacting protein and basic helix-loop-helix family member B9] of miR-642b-3p were predicted using all 4 algorithms. It was revealed that miR-642b-3p was overexpressed in adenocarcinoma and squamous cell carcinoma tissues compared with non-cancerous lung tissues based on the TCGA database. From the 6 target genes, PDE4D was downregulated in lung adenocarcinoma and squamous cell carcinoma tissues, and a weak negative correlation between HOXA11-AS and PDE4D was identified. The area under the curve of PDE4D was 0.905 [95% confidence interval (CI), 0.879-0.931] for patients with lung adenocarcinoma and 0.665 (95% CI, 0.606-0.725) for patients with squamous cell carcinoma. Additionally, GO analysis of the target genes revealed that miR-642b-3p was specifically involved in complex cellular pathways. The target gene RAN binding protein 2 possessed the highest degree of interactions in the PPI network (degree=40). It was hypothesized that HOXA11-AS may have a function in NSCLC by regulating the expression of miR-642b-3p and PDE4D, which laid the foundation for the further elucidation of the potential molecular mechanisms of NSCLC.

Also flagged:gene expressionspliceosomeneurodegenerative diseasesneurological disordersspliceosomessmall nuclear ribonucleoproteins
Journal Article 2018-02-22 No Snippets Jutzi D, Akinyi MV, Mechtersheimer J, Frilander MJ, Ruepp MD.
Show Full Abstract

Pre-mRNA splicing is an essential step in eukaryotic gene expression. Mutations in <i>cis</i>-acting sequence elements within pre-mRNA molecules or <i>trans</i>-acting factors involved in pre-mRNA processing have both been linked to splicing dysfunction that give rise to a large number of human diseases. These mutations typically affect the major splicing pathway, which excises more than 99% of all introns in humans. However, approximately 700-800 human introns feature divergent intron consensus sequences at their 5' and 3' ends and are recognized by a separate pre-mRNA processing machinery denoted as the minor spliceosome. This spliceosome has been studied less than its major counterpart, but has received increasing attention during the last few years as a novel pathomechanistic player on the stage in neurodevelopmental and neurodegenerative diseases. Here, we review the current knowledge on minor spliceosome function and discuss its potential pathomechanistic role and impact in neurodegeneration.

Also flagged:autophagyMacroautophagyCD34Cell differentiationSPI1PU.1
Journal Article 2018-02-21 No Snippets Huang Y, Tan P, Wang X, Yi Y, Hu Y, Wang D, Wang F.
Show Full Abstract

Macroautophagy/autophagy plays an essential role in hematopoietic stem cell (HSC) differentiation. However, the role of autophagy during monocytic and granulocytic differentiation remains poorly understood. Hence, we first represented global transcriptomic analysis for temporal expression of autophagy genes during monocytic and granulocytic differentiation by combining RNA-Seq data with monocytic and granulocytic induction in CD34<sup>+</sup> hematopoietic stem and progenitor cells. According to a self-organizing map (SOM) algorithm, our results show temporal expression patterns of autophagy genes during monocytic and granulocytic differentiation. More importantly, 22 autophagy genes present significantly divergent roles during monocytic and granulocytic differentiation, indicating these autophagy genes could be important factors involved in the differentiation of myeloid progenitors into monocytes and granulocytes.

Also flagged:Huntington's diseaseglutamateamino acidascorbateHDbehavioral
Journal Article 2018-02-21 No Snippets Rebec GV.
Show Full Abstract

<h4>Aims</h4>This review summarizes evidence for dysfunctional connectivity between cortical and striatal neurons in Huntington's disease (HD), a fatal neurodegenerative condition caused by a single gene mutation. The focus is on data derived from recording of electrophysiological signals in behaving transgenic mouse models.<h4>Discussions</h4>Firing patterns of individual neurons and the frequency oscillations of local field potentials indicate a disruption in corticostriatal processing driven, in large part, by interactions between cells that contain the mutant gene rather than the mutant gene alone. Dysregulation of glutamate, an excitatory amino acid released by cortical afferents, plays a key role in the breakdown of corticostriatal communication, a process modulated by ascorbate, an antioxidant vitamin found in high concentration in striatum. Up-regulation of glutamate transport by drug administration or viral-vector delivery improves ascorbate homeostasis and neurobehavioral processing in HD mice. Further analysis of electrophysiological data, including the use of sophisticated computational strategies, is required to discern how behavioral demands modulate the flow of corticostriatal information and its disruption by HD.<h4>Conclusions</h4>Long before massive cell loss occurs, HD impairs the mechanisms by which cortical and striatal neurons communicate. A key problem identified in transgenic animal models is dysregulation of the dynamic changes in extracellular glutamate and ascorbate. Improved understanding of how these neurochemical systems impact corticostriatal communication is necessary before an effective therapeutic strategy can emerge.

Also flagged:Ditopic ReceptorAlkylammoniumarenepyridylbindingions
Journal Article 2018-02-21 No Snippets Jiang XK, Ikejiri Y, Wu C, Rahman S, Georghiou PE, Zeng X, Elsegood MRJ, Redshaw C, Teat SJ, Yamato T.
Show Full Abstract

A receptor cone-1 based on a hexahomotrioxacalix[3]arene bearing three pyridyl groups was successfully synthesized, which has a C₃-symmetric conformation and is capable of binding alkylammonium and metal ions simultaneously in a cooperative fashion. It can bind alkylammonium ions through the -cavity formed by three aryl rings. This behaviour is consistent with the cone-in/cone-out conformational rearrangement needed to reorganize the cavity for endo-complexation. As a C₃-symmetrical pyridyl-substituted calixarene, receptor cone-1 can also bind an Ag⁺ ion, and the nitrogen atoms are turned towards the inside of the cavity and interact with Ag⁺. After complexation of tris(2-pyridylamide) derivative receptor cone-1 with Ag⁺, the original C₃-symmetry was retained and higher complexation selectivity for n-BuNH₃⁺ versus t-BuNH₃⁺ was observed. Thus, it is believed that this receptor will have a role to play in the sensing, detection, and recognition of Ag⁺ and n-BuNH₃<sup>+</sup> ions.

Also flagged:HAP40Huntingtinendocytosisautophagyorganizationantibodies
Journal Article 2018-02-21 ✓ 5 Snippets Guo Q, Bin Huang, Cheng J, Seefelder M, Engler T, Pfeifer G, Oeckl P, Otto M, Moser F, Maurer M, Pautsch A, Baumeister W, Fernández-Busnadiego R, Kochanek S.
In-Text Gene Mentions

Here we use cryo-electron microscopy to determine the structure of full-length human HTT in a complex with HTT-associated protein 40 (HAP40; encoded by three F8A genes in humans) to an overall resolution of 4 Å.

Cell lines have been authenticated by inducibility of Htt expressionwith doxycycline and Western blot analysis.

Most structural studies have focused on an N-terminal fragmentcorresponding to the first exon of the Htt gene, while the majority of the protein(>97 % of its amino acid length) remains largely uncharted14.

Huntingtin (Htt) is a large (348 kDa) protein, essential for embryonicdevelopment and involved in diverse cellular activities such as vesiculartransport, endocytosis, autophagy and transcription regulation1,2.While an integrative understanding of Htt's biological functions islacking, the large number of identified interactors suggests that Htt serves asa protein-protein interaction hub1,3,4.Furthermore, Huntington’s disease is caused by a mutation in the Httgene, resulting in a pathogenic expansion of a polyglutamine (polyQ) repeat atthe N-terminus of Htt5,6.

The tested proteins were diluted in sample buffer (25 mM HEPES, 300mM NaCl, 0.1 % CHAPS, 1 mM DTT and 10 % glycerol) to concentrations of 1.6μM (Htt, Htt-HAP40 complex) and 2 μM (HAP40).

Show Full Abstract

Huntingtin (HTT) is a large (348 kDa) protein that is essential for embryonic development and is involved in diverse cellular activities such as vesicular transport, endocytosis, autophagy and the regulation of transcription. Although an integrative understanding of the biological functions of HTT is lacking, the large number of identified HTT interactors suggests that it serves as a protein-protein interaction hub. Furthermore, Huntington's disease is caused by a mutation in the HTT gene, resulting in a pathogenic expansion of a polyglutamine repeat at the amino terminus of HTT. However, only limited structural information regarding HTT is currently available. Here we use cryo-electron microscopy to determine the structure of full-length human HTT in a complex with HTT-associated protein 40 (HAP40; encoded by three F8A genes in humans) to an overall resolution of 4 Å. HTT is largely α-helical and consists of three major domains. The amino- and carboxy-terminal domains contain multiple HEAT (huntingtin, elongation factor 3, protein phosphatase 2A and lipid kinase TOR) repeats arranged in a solenoid fashion. These domains are connected by a smaller bridge domain containing different types of tandem repeats. HAP40 is also largely α-helical and has a tetratricopeptide repeat-like organization. HAP40 binds in a cleft and contacts the three HTT domains by hydrophobic and electrostatic interactions, thereby stabilizing the conformation of HTT. These data rationalize previous biochemical results and pave the way for improved understanding of the diverse cellular functions of HTT.

Also flagged:ophthalmic diseasesage-related macular degenerationcystoid macular edemaretinitis pigmentosadiabetic retinopathyheat-shock protein 90-alpha
Journal Article 2018-02-21 No Snippets Velez G, Machlab DA, Tang PH, Sun Y, Tsang SH, Bassuk AG, Mahajan VB.
Show Full Abstract

Differences in regional protein expression within the human retina may explain molecular predisposition of specific regions to ophthalmic diseases like age-related macular degeneration, cystoid macular edema, retinitis pigmentosa, and diabetic retinopathy. To quantify protein levels in the human retina and identify patterns of differentially-expressed proteins, we collected foveomacular, juxta-macular, and peripheral retina punch biopsies from healthy donor eyes and analyzed protein content by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Protein expression was analyzed with 1-way ANOVA, gene ontology, pathway representation, and network analysis. We identified a mean of 1,974 proteins in the foveomacular retina, 1,999 in the juxta-macular retina, and 1,779 in the peripheral retina. Six hundred ninety-seven differentially-expressed proteins included those unique to and abundant in each anatomic region. Proteins with higher expression in each region include: heat-shock protein 90-alpha (HSP90AA1), and pyruvate kinase (PKM) in the foveomacular retina; vimentin (VIM) and fructose-bisphosphate aldolase C (ALDOC); and guanine nucleotide-binding protein subunit beta-1 (GNB1) and guanine nucleotide-binding protein subunit alpha-1 (GNAT1) in the peripheral retina. Pathway analysis identified downstream mediators of the integrin signaling pathway to be highly represented in the foveomacular region (P = 6.48 e-06). Metabolic pathways were differentially expressed among all retinal regions. Gene ontology analysis showed that proteins related to antioxidant activity were higher in the juxta-macular and the peripheral retina, but present in lower amounts in the foveomacular retina. Our proteomic analysis suggests that certain retinal regions are susceptible to different forms of metabolic and oxidative stress. The findings give mechanistic insight into retina function, reveal important molecular processes, and prioritize new pathways for therapeutic targeting.

Also flagged:Single-stranded DNA binding proteinsdegradationbindingbinding proteinSSBhelicase
Journal Article 2018-02-21 ✓ 5 Snippets Chisty LT, Quaglia D, Webb MR.
In-Text Gene Mentions

DCC-PfSSB was tested in a helicase assay, namely AddAB-catalyzed unwinding of linear dsDNA, with a biotin at one end to allow that end to be blocked by streptavidin and leave only the distal end free for AddAB binding.

…that interpretation ofDCC-EcSSB fluorescence was potent…

…(dissociation constant forDCC-PfSSB <5 pM).…

…], application ofDCC-EcSSB to ssDNA assays…

…70 binding toDCC-EcSSB.…

Show Full Abstract

Single-stranded DNA (ssDNA) is a product of many cellular processes that involve double-stranded DNA, for example during DNA replication and repair, and is formed transiently in many others. Measurement of ssDNA formation is fundamental for understanding many such processes. The availability of a fluorescent biosensor for the determination of single-stranded DNA provides an important route to achieve this. Single-stranded DNA binding proteins (SSBs) protect ssDNA from degradation, but can be displaced to allow processing of the ssDNA. Their tight binding of ssDNA means that they are very good candidates for the development of a biosensor. Previously, the single stranded DNA binding protein from Escherichia coli, labeled with a fluorophore, (DCC-EcSSB) was developed and used for this purpose. However, the multiple binding modes of this protein meant that interpretation of DCC-EcSSB fluorescence was potentially complex in terms of determining the amount of ssDNA. Here, we present an improved biosensor, developed using the tetrameric SSB from Plasmodium falciparum as a new scaffold for fluorophore attachment. Each subunit of this tetrameric SSB was labeled with a diethylaminocoumarin fluorophore at a single site on its surface, such that there is a very large, 20-fold, fluorescence increase when it binds to ssDNA. This adduct can be used as a biosensor to report ssDNA formation. Because SSB from this organism has a single mode of binding ssDNA, namely 65-70 bases per tetramer, over a wide range of conditions, the fluorescent SSB allows simple quantitation of ssDNA. The binding is fast, possibly diffusion controlled, and tight (dissociation constant for DCC-PfSSB <5 pM). Its suitability for real-time assays of ssDNA formation was demonstrated by measurement of AddAB helicase activity, unwinding double-stranded DNA.

Also flagged:cancerCyaninerunironPEGdigestion
Journal Article 2018-02-21 No Snippets Alric C, Hervé-Aubert K, Aubrey N, Melouk S, Lajoie L, Même W, Même S, Courbebaisse Y, Ignatova AA, Feofanov AV, Chourpa I, Allard-Vannier E.
Show Full Abstract

<h4>Background</h4>Recent advances in nanomedicine have shown the great interest of active targeting associated to nanoparticles. Single chain variable fragments (scFv) of disease-specific antibodies are very promising targeting entities because they are small, not immunogenic and able to bind their specific antigens. The present paper is devoted to biological properties in vitro and in vivo of fluorescent and pegylated iron oxide nanoparticles (SPIONs-Cy-PEG-scFv) functionalized with scFv targeting Human Epithelial growth Receptor 2 (HER2).<h4>Results</h4>Thanks to a site-selective scFv conjugation, the resultant nanoprobes demonstrated high affinity and specific binding to HER2 breast cancer cells. The cellular uptake of SPIONs-Cy-PEG-scFv was threefold higher than that for untargeted PEGylated iron oxide nanoparticles (SPIONs-Cy-PEG) and is correlated to the expression of HER2 on cells. In vivo, the decrease of MR signals in HER2+ xenograft tumor is about 30% at 24 h after the injection.<h4>Conclusions</h4>These results all indicate that SPIONs-Cy-PEG-scFv are relevant tumor-targeting magnetic resonance imaging agents, suitable for diagnosis of HER2 overexpressing breast tumor.

Also flagged:caspase-3IL-7IL-6cell deathindoleamine 2,3 dioxygenasesepsis
Journal Article 2018-02-21 ✓ 1 Snippet Riché F, Chousterman BG, Valleur P, Mebazaa A, Launay JM, Gayat E.
In-Text Gene Mentions

…(IL)-6, IL-10, d-dimers,antithrombin-III, and factor IX,…

Show Full Abstract

<h4>Background</h4>Sepsis is a leading cause of mortality and critical illness worldwide and is associated with an increased mortality rate in the months following hospital discharge. The occurrence of persistent or new organ dysfunction(s) after septic shock raises questions about the mechanisms involved in the post-sepsis status. The present study aimed to explore the immune profiles of patients one year after being discharged from the intensive care unit (ICU) following treatment for abdominal septic shock.<h4>Methods</h4>We conducted a prospective, single-center, observational study in the surgical ICU of a university hospital. Eighty-six consecutive patients admitted for septic shock of abdominal origin were included in this study. Fifteen different plasma biomarkers were measured at ICU admission, at ICU discharge and at one year after ICU discharge. Three different clusters of biomarkers were distinguished according to their functions, namely: (1) inflammatory response, (2) cell damage and apoptosis, (3) immunosuppression and resolution of inflammation. The primary objective was to characterize variations in the immune status of septic shock patients admitted to ICU up to one year after ICU discharge. The secondary objective was to evaluate the relationship between these biomarker variations and patient outcomes.<h4>Results</h4>At the onset of septic shock, we observed a cohesive pro-inflammatory profile and low levels of inflammation resolution markers. At ICU discharge, the immune status demonstrated decreased but persistent inflammation and increased immunosuppression, with elevated programmed cell death protein-1 (PD-1) levels, and a counterbalanced resolution process, with elevated levels of interleukin-10 (IL-10), resolvin D5 (RvD5), and IL-7. One year after hospital discharge, homeostasis was not completely restored with several markers of inflammation remaining elevated. Remarkably, IL-7 was persistently elevated, with levels comparable to those observed after ICU discharge, and PD-1, while lower, remained in the elevated abnormal range.<h4>Conclusions</h4>In this study, protracted immune disturbances were observed one year after ICU discharge. The study results suggested the presence of long-lasting immune illness disorders following a long-term septic insult, indicating the need for long-term patient follow up after ICU discharge and questioning the use of immune intervention to restore immune homeostasis after abdominal septic shock.

Also flagged:obesityRIPinsulinAPPL 2AMPKβ3‐adrenergic receptor
Journal Article 2018-02-21 No Snippets Wang B, Li A, Li X, Ho PW, Wu D, Wang X, Liu Z, Wu KK, Yau SS, Xu A, Cheng KK.
Show Full Abstract

Activation of brown adipose tissue (BAT) and beige fat by cold increases energy expenditure. Although their activation is known to be differentially regulated in part by hypothalamus, the underlying neural pathways and populations remain poorly characterized. Here, we show that activation of rat-insulin-promoter-Cre (RIP-Cre) neurons in ventromedial hypothalamus (VMH) preferentially promotes recruitment of beige fat via a selective control of sympathetic nervous system (SNS) outflow to subcutaneous white adipose tissue (sWAT), but has no effect on BAT Genetic ablation of APPL2 in RIP-Cre neurons diminishes beiging in sWAT without affecting BAT, leading to cold intolerance and obesity in mice. Such defects are reversed by activation of RIP-Cre neurons, inactivation of VMH AMPK, or treatment with a β3-adrenergic receptor agonist. Hypothalamic APPL2 enhances neuronal activation in VMH RIP-Cre neurons and raphe pallidus, thereby eliciting SNS outflow to sWAT and subsequent beiging. These data suggest that beige fat can be selectively activated by VMH RIP-Cre neurons, in which the APPL2-AMPK signaling axis is crucial for this defending mechanism to cold and obesity.

Also flagged:Cleft palateCPregulatorsmetabolismIRF6FOXE1
Journal Article 2018-02-21 No Snippets Suzuki A, Abdallah N, Gajera M, Jun G, Jia P, Zhao Z, Iwata J.
Show Full Abstract

Cleft palate (CP) is the most prevalent craniofacial deformity, with ethnic and geographic variation in prevalence in humans. Mice have been used as an animal model to study the cause(s) of CP by several approaches, including genetic and chemical-induced approaches. Mouse genetic approaches revealed that significant amounts of genes are involved in the CP pathology. The aim of this study was to identify common features of CP-associated genes and to explore the roles of microRNAs (miRNAs) as important post-transcriptional regulators that may be involved in the regulation of CP genes. To generate an accurate list of genes associated with CP, we first conducted systematic literature searches through main databases such as Medline, Embase, and PubMed, as well as other sources such as Scopus and Mouse Genome Informatics. We found that 195 mouse strains with single-gene mutations and 140 mouse strains with compound-gene mutations were reported to have CP. The CP genes were categorized by functions and pathways using the Kyoto Encyclopedia of Genes and Genomes and Gene Ontology annotations, highlighting the contribution of cellular metabolism to CP. A total of 18 miRNAs were involved in the regulation of multiple CP genes. Human genotype-phenotype analysis revealed that variants in five human homologous CP genes (IRF6, FOXE1, VAX1, WNT9B, and GAD1) significantly contributed to the human CP phenotype. Thus, our results suggest that cellular metabolism and miRNAs play an important role in the regulation of genetic pathways and networks crucial for palatal formation.

Also flagged:gene expressionatherosclerosiscardiovascular diseasesdeathtranslationalcancer
Journal Article 2018-02-21 No Snippets Kutikhin AG, Sinitsky MY, Yuzhalin AE, Velikanova EA.
Show Full Abstract

Among applicable high-throughput techniques in cardiovascular biology, whole-transcriptome sequencing is of particular use. By utilizing RNA that is isolated from virtually all cells and tissues, the entire transcriptome can be evaluated. In comparison with other high-throughput approaches, RNA sequencing is characterized by a relatively low-cost and large data output, which permits a comprehensive analysis of spatiotemporal variation in the gene expression profile. Both shear stress and cyclic strain exert hemodynamic force upon the arterial endothelium and are considered to be crucial determinants of endothelial physiology. Laminar blood flow results in a high shear stress that promotes atheroresistant endothelial phenotype, while a turbulent, oscillatory flow yields a pathologically low shear stress that disturbs endothelial homeostasis, making respective arterial segments prone to atherosclerosis. Severe atherosclerosis significantly impairs blood supply to the organs and frequently requires bypass surgery or an arterial replacement surgery that requires tissue-engineered vascular grafts. To provide insight into patterns of gene expression in endothelial cells in native or bioartificial arteries under different biomechanical conditions, this article discusses applications of whole-transcriptome sequencing in endothelial mechanobiology and vascular tissue engineering.

Also flagged:Huntington's diseaseHDneurodegenerative disorderHuntingtin
Journal Article 2018-02-21 ✓ 1 Snippet Bidollari E, Rotundo G, Ferrari D, Candido O, Bernardini L, Consoli F, De Luca A, Santimone I, Lamorte G, Ilari A, Squitieri F, Vescovi AL, Rosati J.
In-Text Gene Mentions

…polyglutamine expansion inHTTgene codifying Huntingtin…

Show Full Abstract

Huntington's disease (HD) is an incurable, autosomal dominant, hereditary neurodegenerative disorder that typically manifests itself in midlife. This pathology is linked to the deregulation of multiple, as yet unknown, cellular processes starting before HD onset. A human iPS cell line was generated from skin fibroblasts of a subject at the presymptomatic life stage, carrying a polyglutamine expansion in HTT gene codifying Huntingtin protein. The iPSC line contained the expected CAG expansion, expressed the expected pluripotency markers, displayed in vivo differentiation potential to the three germ layers and had a normal karyotype.

Also flagged:RIG-IRIG-I receptorinterferontype I interferonsinterferon-stimulated genespolyinosinic:polycytidylic acid
Journal Article 2018-02-21 ✓ 1 Snippet Linehan MM, Dickey TH, Molinari ES, Fitzgerald ME, Potapova O, Iwasaki A, Pyle AM.
In-Text Gene Mentions

…type I IFNs,TNFSF4(OX40L) and several…

Show Full Abstract

We have developed highly potent synthetic activators of the vertebrate immune system that specifically target the RIG-I receptor. When introduced into mice, a family of short, triphosphorylated stem-loop RNAs (SLRs) induces a potent interferon response and the activation of specific genes essential for antiviral defense. Using RNA sequencing, we provide the first in vivo genome-wide view of the expression networks that are initiated upon RIG-I activation. We observe that SLRs specifically induce type I interferons, subsets of interferon-stimulated genes (ISGs), and cellular remodeling factors. By contrast, polyinosinic:polycytidylic acid [poly(I:C)], which binds and activates multiple RNA sensors, induces type III interferons and several unique ISGs. The short length (10 to 14 base pairs) and robust function of SLRs in mice demonstrate that RIG-I forms active signaling complexes without oligomerizing on RNA. These findings demonstrate that SLRs are potent therapeutic and investigative tools for targeted modulation of the innate immune system.

Also flagged:language disorderchromatingene expressionTBR1transcription factorsFOXP2
Journal Article 2018-02-21 ✓ 2 Snippets Becker M, Devanna P, Fisher SE, Vernes SC.
In-Text Gene Mentions

…regulated by thePOU3F2transcription factor (TF)…

…APOU3F2binding site in…

Show Full Abstract

Mutations of the <i>FOXP2</i> gene cause a severe speech and language disorder, providing a molecular window into the neurobiology of language. Individuals with <i>FOXP2</i> mutations have structural and functional alterations affecting brain circuits that overlap with sites of <i>FOXP2</i> expression, including regions of the cortex, striatum, and cerebellum. <i>FOXP2</i> displays complex patterns of expression in the brain, as well as in non-neuronal tissues, suggesting that sophisticated regulatory mechanisms control its spatio-temporal expression. However, to date, little is known about the regulation of <i>FOXP2</i> or the genomic elements that control its expression. Using chromatin conformation capture (3C), we mapped the human <i>FOXP2</i> locus to identify putative enhancer regions that engage in long-range interactions with the promoter of this gene. We demonstrate the ability of the identified enhancer regions to drive gene expression. We also show regulation of the <i>FOXP2</i> promoter and enhancer regions by candidate regulators - FOXP family and TBR1 transcription factors. These data point to regulatory elements that may contribute to the temporal- or tissue-specific expression patterns of human <i>FOXP2</i>. Understanding the upstream regulatory pathways controlling <i>FOXP2</i> expression will bring new insight into the molecular networks contributing to human language and related disorders.

Also flagged:Tumor Necrosis Factor α-Induced Protein 3AutoimmunityImmune cell activationimmune responsesautoimmune diseasesnuclear factor-κB
Journal Article 2018-02-21 No Snippets Das T, Chen Z, Hendriks RW, Kool M.
Show Full Abstract

Immune cell activation is a stringently regulated process, as exaggerated innate and adaptive immune responses can lead to autoinflammatory and autoimmune diseases. Perhaps the best-characterized molecular pathway promoting cell activation is the nuclear factor-κB (NF-κB) signaling pathway. Stimulation of this pathway leads to transcription of numerous pro-inflammatory and cell-survival genes. Several mechanisms tightly control NF-κB activity, including the key regulatory zinc finger (de)ubiquitinating enzyme A20/tumor necrosis factor α-induced protein 3 (TNFAIP3). Single nucleotide polymorphisms (SNPs) in the vicinity of the <i>TNFAIP3</i> gene are associated with a spectrum of chronic systemic inflammatory diseases, indicative of its clinical relevance. Mice harboring targeted cell-specific deletions of the <i>Tnfaip3</i> gene in innate immune cells such as macrophages spontaneously develop autoinflammatory disease. When immune cells involved in the adaptive immune response, such as dendritic cells or B-cells, are targeted for A20/TNFAIP3 deletion, mice develop spontaneous inflammation that resembles human autoimmune disease. Therefore, more knowledge on A20/TNFAIP3 function in cells of the immune system is beneficial in our understanding of autoinflammation and autoimmunity. Using the aforementioned mouse models, novel A20/TNFAIP3 functions have recently been described including control of necroptosis and inflammasome activity. In this review, we discuss the function of the A20/TNFAIP3 enzyme and its critical role in various innate and adaptive immune cells. Finally, we discuss the latest findings on <i>TNFAIP3</i> SNPs in human autoinflammatory and autoimmune diseases and address that genotyping of <i>TNFAIP3</i> SNPs may guide treatment decisions.

Also flagged:DocetaxelBreast Cancercancertumortumorscancers
Journal Article 2018-02-21 No Snippets Kong N, Deng M, Sun XN, Chen YD, Sui XB.
Show Full Abstract

Current limitations of cancer therapy include the lack of effective strategy for target delivery of chemotherapeutic drugs, and the difficulty of achieving significant efficacy by single treatment. Herein, we reported a synergistic chemo-photothermal strategy based on aptamer (Apt)-polydopamine (pD) functionalized CA-(PCL-<i>ran</i>-PLA) nanoparticles (NPs) for effective delivery of docetaxel (DTX) and enhanced therapeutic effect. The developed DTX-loaded Apt-pD-CA-(PCL-<i>ran</i>-PLA) NPs achieved promising advantages, such as (i) improved drug loading content (LC) and encapsulation efficiency (EE) initiated by star-shaped copolymer CA-(PCL-<i>ran</i>-PLA); (ii) effective target delivery of drugs to tumor sites by incorporating AS1411 aptamers; (iii) significant therapeutic efficacy caused by synergistic chemo-photothermal treatment. In addition, the pD coating strategy with simple procedures could address the contradiction between targeting modification and maintaining formerly excellent bio-properties. Therefore, with excellent bio-properties and simple preparation procedures, the DTX-loaded Apt-pD-CA-(PCL-<i>ran</i>-PLA) NPs effectively increased the local drug concentration in tumor sites, minimized side effects, and significantly eliminated tumors, indicating the promising application of these NPs for cancer therapy.

Also flagged:Gene Expressionheart failure with preservedheart failureDahl salt sensitivehypertensive heart failurediabetes 1
Journal Article 2018-02-21 No Snippets Altara R, Zouein FA, Brandão RD, Bajestani SN, Cataliotti A, Booz GW.
Show Full Abstract

Standard therapies for heart failure with preserved ejection fraction (HFpEF) have been unsuccessful, demonstrating that the contribution of the underlying diastolic dysfunction pathophysiology differs from that of systolic dysfunction in heart failure and currently is far from being understood. Complicating the investigation of HFpEF is the contribution of several comorbidities. Here, we selected three established rat models of diastolic dysfunction defined by three major risk factors associated with HFpEF and researched their commonalities and differences. The top differentially expressed genes in the left ventricle of Dahl salt sensitive (Dahl/SS), spontaneous hypertensive heart failure (SHHF), and diabetes 1 induced HFpEF models were derived from published data in Gene Expression Omnibus and used for a comprehensive interpretation of the underlying pathophysiological context of each model. The diversity of the underlying transcriptomic of the heart of each model is clearly observed by the different panel of top regulated genes: the diabetic model has 20 genes in common with the Dahl/SS and 15 with the SHHF models. Advanced analytics performed in Ingenuity Pathway Analysis (IPA<sup>®</sup>) revealed that Dahl/SS heart tissue transcripts triggered by upstream regulators lead to dilated cardiomyopathy, hypertrophy of heart, arrhythmia, and failure of heart. In the heart of SHHF, a total of 26 genes were closely linked to cardiovascular disease including cardiotoxicity, pericarditis, ST-elevated myocardial infarction, and dilated cardiomyopathy. IPA Upstream Regulator analyses revealed that protection of cardiomyocytes is hampered by inhibition of the ERBB2 plasma membrane-bound receptor tyrosine kinases. Cardioprotective markers such as natriuretic peptide A (<i>NPPA</i>), heat shock 27 kDa protein 1 (<i>HSPB1</i>), and angiogenin (<i>ANG</i>) were upregulated in the diabetes 1 induced model; however, the model showed a different underlying mechanism with a majority of the regulated genes involved in metabolic disorders. In conclusion, our findings suggest that multiple mechanisms may contribute to diastolic dysfunction and HFpEF, and thus drug therapies may need to be guided more by phenotypic characteristics of the cardiac remodeling events than by the underlying molecular processes.

Also flagged:EstrogenMitochondrialPhosphorylationDynamin-related Protein 1Drp1breast cancer
Journal Article 2018-02-21 ✓ 1 Snippet Oo PS, Yamaguchi Y, Sawaguchi A, Tin Htwe Kyaw M, Choijookhuu N, Noor Ali M, Srisowanna N, Hino SI, Hishikawa Y.
In-Text Gene Mentions

Prior to treatment with estrogen or ER antagonists, MCF7 cells were cultured in phenol-red-free DMEM (Gibco, Thermo Fisher Scientific Inc., Waltham, MA, USA) with 10% dextran-coated charcoal-treated FBS (DCC-treated FBS) overnight, then, the cells were cultured in serum-free, phenol-red-free DMEM overnight.

Show Full Abstract

Estrogen affects mitochondrial function in various tissues, but the precise mechanism remains unclear. We, therefore investigated the effect on estrogen-regulated mitochondrial morphology by dynamin-related protein 1 (Drp1) and its Ser616-phosphorylated derivative (pDrp1<sup>Ser616</sup>) are involved in mitochondrial fission. MCF7 human breast cancer cells were treated with 17β-estradiol (E<sub>2</sub>), an estrogen receptor (ER) α and β antagonist (ICI 182, 780), an ERα antagonist (MPP), and an ERβ antagonist (PHTPP) for 24 hr. The expression of Drp1 and pDrp1<sup>Ser616</sup> was analyzed by western blotting and immunohistochemistry. Mitochondrial morphology was analyzed by transmission electron microscopy (TEM). In control cells, Drp1 was detected in the cytoplasm of all cells while pDrp1 was observed in the cytoplasm of 3.4 ± 1.0% of the total population. After E<sub>2</sub> treatment, pDrp1<sup>Ser616</sup>-positive cells comprised 30.6 ± 5.6% of the total population, 10.5 ± 1.7% after E<sub>2</sub> + ICI treatment, 12.4 ± 4.2% after E<sub>2</sub> + MPP treatment, and 24.0 ± 2.2% after E<sub>2</sub> + PHTPP treatment. In ERα knockdown MCF7 cells, pDrp1 expression was decreased after E<sub>2</sub> treatment compared to E<sub>2</sub>-treated wild type cells. Tubular pattern mitochondria were found in the control cells but the number of short and small pattern mitochondria (< 0.5 μm<sup>2</sup>) was significantly increased after E<sub>2</sub> treatment (as observed by TEM). We, therefore concluded that the phosphorylation of Drp1 is important for E<sub>2</sub>-dependent mitochondrial morphological changes through ERα.

Also flagged:Netrin-1axoncancerDorsal repulsive axon guidance proteinDraxinguidance molecule receptors
Journal Article 2018-02-21 ✓ 5 Snippets Sato Y, Matsuo A, Kudoh S, Fang L, Hasegawa K, Shinmyo Y, Ito T.
In-Text Gene Mentions

The expression of DCC was weakly observed in SCLC and SCC.

Netrin-1/DCC interaction mediates tumor progression by inducing apoptosis in diffuse large B-cell lymphoma (DLBCL) and mantle cell lymphoma (MCL).

Contrary to the histological type-independent expression of ligands, the expression of individual receptors is varied—DCC is expressed more in non-SCLC cell lines, and Neogenin is expressed more in SCLC cell lines.

Expression of Draxin, Netrin-1, DCC and Neogenin is not always similar between the lung cancer cell lines with WB analysis and the formalin-fixed and paraffin-embedded lung cancer tissues with IHC analysis.

In addition, Netrin-1 antibody inhibits the interaction of Netrin-1 and DCC in vitro and vivo, and Netrin-1 acts as a survival factor for activated B cells in DLBCL and MCL tumor cells [5].

Show Full Abstract

Guidance molecules, such as Netrin-1, and their receptors have important roles in controlling axon pathfinding, modulate biological activities of various cancer cells, and may be a useful target for cancer therapy. Dorsal repulsive axon guidance protein (Draxin) is a novel guidance molecule that binds not only common guidance molecule receptors with Netrin-1, but also directly binds the EGF domain of Netrin-1 through a 22-amino-acid peptide (22aa). By immunostaining, Draxin was positively expressed in small cell carcinoma, adenocarcinoma (ADC), and squamous cell carcinoma of the lung. In addition, western blot analysis revealed that Draxin was expressed in all histological types of lung cancer cell lines examined. Knockdown of Draxin in an ADC cell line H358 resulted in altered expression of molecules associated with proliferation and apoptosis. The Ki-67 labeling index of Draxin-knockdown ADC cells was increased compared to that of control ADC cells. In H358 cells, treatment of 22aa induced phosphorylation of histone H3, but did not change apoptosis-associated enzymes. These data suggest that Draxin might be involved in cell proliferation and apoptosis in lung adenocarcinoma cells.

Also flagged:osteoarthritisSynovitisproteolysisglycosaminoglycanRUNX2proteoglycan
Journal Article 2018-02-20 ✓ 1 Snippet Sieker JT, Proffen BL, Waller KA, Chin KE, Karamchedu NP, Akelman MR, Perrone GS, Kiapour AM, Konrad J, Fleming BC, Murray MM.
In-Text Gene Mentions

PCDH17

Show Full Abstract

To determine the transcriptional profile of synovium during the molecular phase of post-traumatic osteoarthritis, anterior cruciate ligament transections (ACL) were performed in 36 Yucatan minipigs. Equal numbers were randomly assigned to no further treatment, ACL reconstruction or repair. Perimeniscal synovium for histopathology and RNA-sequencing was harvested at 1 and 4 weeks post-operatively and from six healthy control animals. Microscopic synovitis scores significantly worsened at 1 (p < 0.001) and 4 weeks (p = 0.003) post-surgery relative to controls, and were driven by intimal hyperplasia and increased stromal cellularity without inflammatory infiltrates. Synovitis scores were similar between no treatment, reconstruction, and repair groups (p ≥ 0.668). Relative to no treatment at 1 week, 88 and 367 genes were differentially expressed in the reconstruction and repair groups, respectively (227 and 277 at 4 weeks). Relative to controls and with the treatment groups pooled, 1,683 transcripts were concordantly differentially expressed throughout the post-surgery time-course. Affected pathways included, proteolysis_connective tissue degradation (including upregulations of protease-encoding MMP1, MMP13, and ADAMTS4), and development_cartilage development (including upregulations of ACAN, SOX9, and RUNX2), among others. Using linear regression, significant associations of post-surgery synovial expression levels of 20 genes with the articular cartilage glycosaminoglycan loss were identified. These genes were predominantly related to embryonic skeletal system development and included RUNX2. In conclusion, this study confirmed an increased synovial expression of genes that may serve as targets to prevent cartilage degradation, including MMP1, MMP13, and ADAMTS4, in knees with microscopic synovitis and cartilage proteoglycan loss. Attractive novel targets include regulators of embryonic developmental processes in synovium. © 2018 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res.

Also flagged:gene expressionnuclear receptormetabolismcarcinomasfollicular lymphoma
Journal Article 2018-02-20 No Snippets Mav D, Shah RR, Howard BE, Auerbach SS, Bushel PR, Collins JB, Gerhold DL, Judson RS, Karmaus AL, Maull EA, Mendrick DL, Merrick BA, Sipes NS, Svoboda D, Paules RS.
Show Full Abstract

Changes in gene expression can help reveal the mechanisms of disease processes and the mode of action for toxicities and adverse effects on cellular responses induced by exposures to chemicals, drugs and environment agents. The U.S. Tox21 Federal collaboration, which currently quantifies the biological effects of nearly 10,000 chemicals via quantitative high-throughput screening(qHTS) in in vitro model systems, is now making an effort to incorporate gene expression profiling into the existing battery of assays. Whole transcriptome analyses performed on large numbers of samples using microarrays or RNA-Seq is currently cost-prohibitive. Accordingly, the Tox21 Program is pursuing a high-throughput transcriptomics (HTT) method that focuses on the targeted detection of gene expression for a carefully selected subset of the transcriptome that potentially can reduce the cost by a factor of 10-fold, allowing for the analysis of larger numbers of samples. To identify the optimal transcriptome subset, genes were sought that are (1) representative of the highly diverse biological space, (2) capable of serving as a proxy for expression changes in unmeasured genes, and (3) sufficient to provide coverage of well described biological pathways. A hybrid method for gene selection is presented herein that combines data-driven and knowledge-driven concepts into one cohesive method. Our approach is modular, applicable to any species, and facilitates a robust, quantitative evaluation of performance. In particular, we were able to perform gene selection such that the resulting set of "sentinel genes" adequately represents all known canonical pathways from Molecular Signature Database (MSigDB v4.0) and can be used to infer expression changes for the remainder of the transcriptome. The resulting computational model allowed us to choose a purely data-driven subset of 1500 sentinel genes, referred to as the S1500 set, which was then augmented using a knowledge-driven selection of additional genes to create the final S1500+ gene set. Our results indicate that the sentinel genes selected can be used to accurately predict pathway perturbations and biological relationships for samples under study.

Also flagged:cDNALpoCerium oxidebariumsulfategene expression
Journal Article 2018-02-20 No Snippets Schwotzer D, Niehof M, Schaudien D, Kock H, Hansen T, Dasenbrock C, Creutzenberg O.
Show Full Abstract

<h4>Background</h4>Understanding the molecular mechanisms of nanomaterial interacting with cellular systems is important for appropriate risk assessment. The identification of early biomarkers for potential (sub-)chronic effects of nanoparticles provides a promising approach towards cost-intensive and animal consuming long-term studies. As part of a 90-day inhalation toxicity study with CeO<sub>2</sub> NM-212 and BaSO<sub>4</sub> NM-220 the present investigations on gene expression and immunohistochemistry should reveal details on underlying mechanisms of pulmonary effects. The role of alveolar epithelial cells type II (AEII cells) is focused since its contribution to defense against inhaled particles and potentially resulting adverse effects is assumed. Low dose levels should help to specify particle-related events, including inflammation and oxidative stress.<h4>Results</h4>Rats were exposed to clean air, 0.1, 0.3, 1.0, and 3.0 mg/m<sup>3</sup> CeO<sub>2</sub> NM-212 or 50.0 mg/m<sup>3</sup> BaSO<sub>4</sub> NM-220 and the expression of 391 genes was analyzed in AEII cells after one, 28 and 90 days exposure. A total number of 34 genes was regulated, most of them related to inflammatory mediators. Marked changes in gene expression were measured for Ccl2, Ccl7, Ccl17, Ccl22, Ccl3, Ccl4, Il-1α, Il-1ß, and Il-1rn (inflammation), Lpo and Noxo1 (oxidative stress), and Mmp12 (inflammation/lung cancer). Genes related to genotoxicity and apoptosis did not display marked regulation. Although gene expression was less affected by BaSO<sub>4</sub> compared to CeO<sub>2</sub> the gene pattern showed great overlap. Gene expression was further analyzed in liver and kidney tissue showing inflammatory responses in both organs and marked downregulation of oxidative stress related genes in the kidney. Increases in the amount of Ce were measured in liver but not in kidney tissue. Investigation of selected genes on protein level revealed increased Ccl2 in bronchoalveolar lavage of exposed animals and increased Lpo and Mmp12 in the alveolar epithelia.<h4>Conclusion</h4>AEII cells contribute to CeO<sub>2</sub> nanoparticle caused inflammatory and oxidative stress reactions in the respiratory tract by the release of related mediators. Effects of BaSO<sub>4</sub> exposure are low. However, overlap between both substances were detected and support identification of potential early biomarkers for nanoparticle effects on the respiratory system. Signs for long-term effects need to be further evaluated by comparison to a respective exposure setting.

Also flagged:acutegraft-versus-host diseaseGVHDacute GVHDmajor histocompatibility complex (MHC)-IIJAK1
Journal Article 2018-02-20 No Snippets Hülsdünker J, Ottmüller KJ, Neeff HP, Koyama M, Gao Z, Thomas OS, Follo M, Al-Ahmad A, Prinz G, Duquesne S, Dierbach H, Kirschnek S, Lämmermann T, Blaser MJ, Fife BT, Blazar BR, Beilhack A, Hill GR, Häcker G, Zeiser R.
Show Full Abstract

Conditioning-induced damage of the intestinal tract plays a critical role during the onset of acute graft-versus-host disease (GVHD). Therapeutic interference with these early events of GVHD is difficult, and currently used immunosuppressive drugs mainly target donor T cells. However, not donor T cells but neutrophils reach the sites of tissue injury first, and therefore could be a potential target for GVHD prevention. A detailed analysis of neutrophil fate during acute GVHD and the effect on T cells is difficult because of the short lifespan of this cell type. By using a novel photoconverter reporter system, we show that neutrophils that had been photoconverted in the ileum postconditioning later migrated to mesenteric lymph nodes (mLN). This neutrophil migration was dependent on the intestinal microflora. In the mLN, neutrophils colocalized with T cells and presented antigen on major histocompatibility complex (MHC)-II, thereby affecting T cell expansion. Pharmacological JAK1/JAK2 inhibition reduced neutrophil influx into the mLN and MHC-II expression, thereby interfering with an early event in acute GVHD pathogenesis. In agreement with this finding, neutrophil depletion reduced acute GVHD. We conclude that neutrophils are attracted to the ileum, where the intestinal barrier is disrupted, and then migrate to the mLN, where they participate in alloantigen presentation. JAK1/JAK2-inhibition can interfere with this process, which provides a potential therapeutic strategy to prevent early events of tissue damage-related innate immune cell activation and, ultimately, GVHD.

Also flagged:cysteineact-1ThrSAXNeuron MigrationSax-3
Journal Article 2018-02-20 ✓ 2 Snippets Wang J, Ding M.
In-Text Gene Mentions

…interacts with the netrin–DCCchemoattractive signaling path…

…in associations with Frazzled/DCC/UNC-40 ( 3 ),…

Show Full Abstract

Growing axons are exposed to various guidance cues en route to their targets, but the mechanisms that govern the response of growth cones to combinations of signals remain largely elusive. Here, we found that the sole Robo receptor, SAX-3, in <i>Caenorhabditis elegans</i> functions as a coreceptor for Wnt/CWN-2 molecules. SAX-3 binds to Wnt/CWN-2 and facilitates the membrane recruitment of CWN-2. SAX-3 forms a complex with the Ror/CAM-1 receptor and its downstream effector Dsh/DSH-1, promoting signal transduction from Wnt to Dsh. <i>sax-3</i> functions in Wnt-responsive cells and the SAX-3 receptor is restricted to the side of the cell from which the neurite is extended. DSH-1 has a similar asymmetric distribution, which is disrupted by <i>sax-3</i> mutation. Taking these results together, we propose that Robo receptor can function as a Wnt coreceptor to regulate Wnt-mediated biological processes in vivo.

Also flagged:Ro52TRIM21antibodyautoantigenautoimmune diseasesTRIM
Journal Article 2018-02-20 ✓ 5 Snippets Burbelo PD, Teos LY, Herche JL, Iadarola MJ, Alevizos I.
In-Text Gene Mentions

…including TRIM22, andTRIM38, showed sporadic immunoreacti…

…DTX3L, IFI35, NMI,TRIM38and TRIM22) were…

…for Ro52 andTRIM38autoantibodies (Supplemental T…

…extract or Renilla luciferase-TRIM38extract (1 million…

…DTX3L, IFI35, NMI,TRIM38, and TRIM22, as…

Show Full Abstract

Ro52/TRIM21 plays a key role in antibody-dependent pathogen neutralization and is a major autoantigen in systemic lupus erythematosus, Sjögren's syndrome (SS), and other autoimmune diseases. Here we evaluated immunoreactivity against Ro52-related molecules in SS and healthy volunteers. Although most proteins examined were not antigenic, several TRIM paralogs, including TRIM22, and TRIM38, showed sporadic immunoreactivity in SS. In contrast, the murine Ro52 ortholog with limited linear homology demonstrated high levels of autoantibodies implicating the importance of shared conformational epitopes. To further explore the autoantigencity of Ro52, deletion and point mutant analyses were employed revealing previously hidden, robust autoantibodies directed against its C-terminal immunoglobulin-binding domain. Another autoantibody, rheumatoid factor, targeting the Fc region of IgG, strongly overlapped with Ro52 seropositivity (odds ratio 14; P < 0.0001). These convergent mechanistic findings support a model whereby intracellular Ro52-bound antibody-coated pathogen complexes, released or misprocessed from infected cells, drive autoantigenicity against Ro52 and the Fc region of IgG.

Also flagged:bindingFAKnetrin-1axonDeleted in ColorectalCancer
Journal Article 2018-02-20 ✓ 5 Snippets Xu S, Liu Y, Li X, Liu Y, Meijers R, Zhang Y, Wang JH.
In-Text Gene Mentions

In the DCC-P3 motif, the equivalent residue of this conserved aspartate residue is S1424, whose side chain is shorter and does not form any contact with the FAT domain (Fig. 3a).

…The binding ofDCC-P3 motif and FAK-FAT…

…initial step of netrin-1/DCCsignaling for axon…

…in Colorectal Cancer (DCC).…

…the cell after netrin-1/DCCligation is the…

Show Full Abstract

Netrin-1 plays a key role in axon guidance through binding to its receptor, Deleted in Colorectal Cancer (DCC). The initial step of signaling inside the cell after netrin-1/DCC ligation is the binding of DCC cytoplasmic P3 motif to focal adhesion targeting (FAT) domain of focal adhesion kinase (FAK). Here we report the crystal structure of P3/FAT complex. The helical P3 peptide interacts with a helix-swapped FAT dimer in a 2:2 ratio. Dimeric FAT binding is P3-specific and stabilized by a calcium ion. Biochemical studies showed that DCC-P3 motif and calcium ion could facilitate FAT dimerization in solution. Axon guidance assays confirm that the DCC/FAK complex is essential for netrin-1-induced chemoattraction. We propose that netrin-1/DCC engagement creates a small cluster of P3/FAT for FAK recruitment close to the cell membrane, which exerts a concerted effect with PIP2 for FAK signaling. We also compare P3/FAT binding with paxillin/FAT binding and discuss their distinct recognition specificity on a common FAT domain for axon attraction versus integrin signaling, respectively.

Also flagged:squamous cell cancersoral cavity cancersquamous cell cancergingivobuccal complex squamous cell cancersOral cavity squamous cell cancercancer
Journal Article 2018-02-20 ✓ 1 Snippet Gupta P, Migliacci JC, Montero PH, Zanoni DK, Shah JP, Patel SG, Ganly I.
In-Text Gene Mentions

UNC13C

Show Full Abstract

<h4>Objectives</h4>To determine the need for a separate staging system for gingivobuccal complex squamous cell cancers (GBCSCC) based on 5-year overall survival (OS), disease-specific survival (DSS), and recurrence-free survival (RFS) data from one institution.<h4>Patients and methods</h4>An Institutional Review Board (IRB)-approved retrospective analysis was performed on an oral cavity cancer patient database. Patients from 1985 to 2012 with primary surgical treatment for biopsy-proven squamous cell cancer (SCC) from either the oral tongue (TSCC Group) or gingivobuccal complex (GBCSCC Group), were selected as two separate subgroups. The clinicopathologic data were used to stage the patients based on the American Joint Committee on Cancer 7th edition. Survival outcomes including 5-year OS, RFS, and DSS were calculated and analyzed. A multivariate analysis was performed to identify if subsite was an independent predictor for the survival outcomes, adjusting for other variables. A p-value of less than .05 was considered statistically significant.<h4>Results</h4>936 patients with TSCC and 486 patients with GBCSCC were considered eligible for the analysis. Patients with GBCSCC were more likely to be older (p < .001) and presented with more advanced disease (p < .001) compared to patients with TSCC. Unadjusted hazard ratio (HR) suggested GBCSCC had poor OS compared to TSCC. However, after adjusting for other variables, the adjusted HR was not significant (p = .593). There was no difference in 5-year DSS or RFS in either of the study groups.<h4>Conclusion</h4>With similar survival outcomes by stage, there is no justification for using a different staging system for GBCSCC.

Also flagged:HIV infectionantibodytenofovirantibodiesgold nanoparticletenofovir disoproxil fumarate
Journal Article 2018-02-20 No Snippets Pratt GW, Fan A, Melakeberhan B, Klapperich CM.
Show Full Abstract

Proper management of an HIV infection requires that a patient be at least 80-95% adherent to a prescribed drug regimen to avoid poor health outcomes and the development of drug-resistant HIV strains. Clinicians generally monitor adherence habits indirectly through patient self-reporting, pill counting, and electronic drug monitoring. While direct measurement of patient samples like urine for monitoring drug levels is possible, it requires specialized equipment and training that is not readily available in resource-limited settings where the need is greatest. In this work we report the development of an antibody that binds to tenofovir (TFV), a key small molecule drug for both the treatment and prevention of HIV, and a competitive lateral flow assay that uses that antibody to monitor urine samples for the presence of the drug. TFV was conjugated to an immunogenic protein and injected into rabbits to raise polyclonal antibodies sensitive to the drug. The antibodies were verified for TFV-sensitivity by immunoprecipitation and HPLC. A gold nanoparticle-based competitive assay was developed to detect the presence of TFV in urine samples with a sensitivity of 1 μg mL<sup>-1</sup>. This TFV assay could be deployed as a point-of-care device for adherence monitoring in resource-limited settings as a low-cost, accurate, and speedy alternative to current methods to better inform changes in treatment.

Also flagged:paclitaxelcoronary heart diseasecoronary artery diseasezotarolimuseverolimuscardiovascular diseases
Journal Article 2018-02-20 No Snippets Tang Z, Gu J, Sun P, Zhao J, Zhao Y.
Show Full Abstract

Bare-metal stents (BMS) and paclitaxel-eluting stent (PES) are frequently used in medicine for the treatment of coronary heart disease, with millions of patients treated worldwide. The protein-protein interactions (PPI) were adopted to construct the networks. The M-module algorithm was used to identify multiple differential modules. Gene Ontology enrichment and pathway enrichment analysis were performed to analyze characteristics of modules. With the PPI and microarray data, two differential co-expressed networks were constructed, module 1 indicating PES and module 2 indicating BMS, with the same genes but different edges. At a module connectivity dynamic score P-value cut-off of <0.05, module 1 was identified with 142 nodes and 460 edges and in the module 2, 73 nodes and 222 edges were identified. Significant biological processes and pathways were found different in the two modules. Through the two differential modules, we revealed the potential molecular changes induced by PES and BMS providing new insights into the underlying mechanisms in human left internal mammary arteries after inserted with a stent.

Also flagged:primary sclerosing cholangitisinflammatory bowel diseaseliver fibrosisinflammatory responsestem cell proliferationliver injury
Journal Article 2018-02-19 ✓ 2 Snippets Liu R, Li X, Huang Z, Zhao D, Ganesh BS, Lai G, Pandak WM, Hylemon PB, Bajaj JS, Sanyal AJ, Zhou H.
In-Text Gene Mentions

…cell markers (Lgr5,Olfm4and Sox9) and…

Olfm4

Show Full Abstract

Impaired intestinal barrier function promotes the progression of various liver diseases, including cholestatic liver diseases. The close association of primary sclerosing cholangitis (PSC) with inflammatory bowel disease highlights the importance of the gut-liver axis. It has been reported that bile duct ligation (BDL)-induced liver fibrosis is significantly reduced in C/EBP homologous protein knockout (CHOP<sup>-/-</sup> ) mice. However, the underlying mechanisms remain unclear. In the current study, we demonstrate that BDL induces striking and acute hepatic endoplasmic reticulum (ER) stress responses after 1 day, which return to normal after 3 days. No significant hepatocyte apoptosis is detected 7-14 days following BDL. However, the inflammatory response is significantly increased after 7 days, which is similar to what we found in human PSC liver samples. BDL-induced loss of stemness in intestinal stem cells (ISCs), disruption of intestinal barrier function, bacterial translocation, activation of hepatic inflammation, M2 macrophage polarization and liver fibrosis are significantly reduced in CHOP<sup>-/-</sup> mice. In addition, intestinal organoids derived from CHOP<sup>-/-</sup> mice contain more and longer crypt structures than those from wild-type (WT) mice, which is consistent with the upregulation of stem cell markers (leucine-rich repeat-containing G-protein-coupled receptor 5, olfactomedin 4, and SRY [sex determining region Y]-box 9) and in vivo findings that CHOP<sup>-/-</sup> mice have longer villi and crypts as compared to WT mice. Similarly, mRNA levels of CD14, interleukin-1β, tumor necrosis factor-alpha, and monocyte chemotactic protein-1 are increased and stem cell proliferation is suppressed in the duodenum of patients with cirrhosis.<h4>Conclusion</h4>Activation of ER stress and subsequent loss of stemness of ISCs plays a critical role in BDL-induced systemic inflammation and cholestatic liver injury. Modulation of the ER stress response represents a potential therapeutic strategy for cholestatic liver diseases as well as other inflammatory diseases. (Hepatology 2018;67:1441-1457).

Also flagged:hepatic steatosisnonalcoholic fatty liver diseaseNAFLDsteatosisCAPchronic liver disease
Journal Article 2018-02-19 ✓ 1 Snippet Caussy C, Alquiraish MH, Nguyen P, Hernandez C, Cepin S, Fortney LE, Ajmera V, Bettencourt R, Collier S, Hooker J, Sy E, Rizo E, Richards L, Sirlin CB, Loomba R.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

The optimal threshold of controlled attenuation parameter (CAP) for the detection of hepatic steatosis using both M and XL probe is unknown in nonalcoholic fatty liver disease (NAFLD). Magnetic resonance imaging proton density fat fraction (MRI-PDFF) is an accurate and precise method of detecting the presence of hepatic steatosis that is superior to CAP. Thus, the aim of this study was to evaluate the diagnostic accuracy and optimal threshold of CAP for the detection of hepatic steatosis as defined by MRI-PDFF ≥ 5%. This prospective cross-sectional study included 119 adults (59% women) with and without NAFLD who underwent MRI-PDFF and CAP using either M or XL probe when indicated within a 6-month period at the NAFLD Research Center, University of California, San Diego. The mean ( ± standard deviation) age and body mass index were 52.4 (±15.2) years and 29.9 (±5.5) kg/m<sup>2</sup> , respectively. The prevalence of NAFLD (MRI-PDFF ≥ 5%) and MRI-PDFF ≥ 10% was 70.6% and 47.1%, respectively. The area under the receiver operating characteristic (AUROC) of CAP for the detection of MRI-PDFF ≥ 5% was 0.80 (95% confidence interval [CI], 0.70-0.90) at the cut-point of 288 dB/m and of MRI-PDFF ≥ 10% was 0.87 (95% CI, 0.80-0.94) at the cut-point of 306 dB/m. When stratified by the interquartile range (IQR) of CAP, we observed that an IQR below the median (30 dB/m) had a robust AUROC compared with an IQR above the median (0.92 [95% CI, 0.85-1.00] versus 0.70 [95% CI, 0.56-0.85]; P = 0.0117), and these differences were statistically and clinically significant.<h4>Conclusion</h4>The cut-point of CAP for presence of hepatic steatosis (MRI-PDFF ≥ 5%) was 288 dB/m. The diagnostic accuracy of CAP for the detection of hepatic steatosis is more reliable when the IQR of CAP is <30 dB/m. These data have implications for the clinical use of CAP in the assessment of NAFLD. (Hepatology 2018;67:1348-1359).

Also flagged:MLH1mismatch repairBRAFmethylationcancerdeath
Journal Article 2018-02-19 No Snippets Bond CE, Liu C, Kawamata F, McKeone DM, Fernando W, Jamieson S, Pearson SA, Kane A, Woods SL, Lannagan TRM, Somashekar R, Lee Y, Dumenil T, Hartel G, Spring KJ, Borowsky J, Fennell L, Bettington M, Lee J, Worthley DL, Leggett BA, Whitehall VLJ.
Show Full Abstract

Colorectal cancer is a major cause of cancer death and approximately 20% arises within serrated polyps, which are under-recognized and poorly understood. Human serrated colorectal polyps frequently exhibit both oncogenic BRAF mutation and widespread DNA methylation changes, which are important in silencing genes restraining neoplastic progression. Here, we investigated whether in vivo induction of mutant Braf is sufficient to result in coordinated promoter methylation changes for multiple cancer-related genes. The Braf<sup>V637E</sup> mutation was induced in murine intestine on an FVB;C57BL/6J background and assessed for morphological and DNA methylation changes at multiple time points from 10 days to 14 months. Extensive intestinal hyperplasia developed by 10 days post-induction of the mutation. By 8 months, most mice had murine serrated adenomas with dysplasia and invasive cancer developed in 40% of mice by 14 months. From 5 months onwards, Braf mutant mice showed extensive, gene-specific increases in DNA methylation even in hyperplastic mucosa without lesions. This demonstrates that persistent oncogenic Braf signaling is sufficient to induce widespread DNA methylation changes. This occurs over an extended period of time, mimicking the long latency followed by rapid progression of human serrated neoplasia. This study establishes for the first time that DNA methylation arises slowly in direct response to prolonged oncogenic Braf signaling in serrated polyps; this finding has implications both for chemoprevention and for understanding the origin of DNA hypermethylation in cancer generally.

Also flagged:Lipoxygenaseelectron transferhydrogenbindingLipoxygenasespolyunsaturated fatty acids
Journal Article 2018-02-19 No Snippets Li P, Soudackov AV, Hammes-Schiffer S.
Show Full Abstract

The proton-coupled electron transfer (PCET) reaction catalyzed by soybean lipoxygenase has served as a prototype for understanding hydrogen tunneling in enzymes. Herein this PCET reaction is studied with mixed quantum mechanical/molecular mechanical (QM/MM) free energy simulations. The free energy surfaces are computed as functions of the proton donor-acceptor (C-O) distance and the proton coordinate, and the potential of mean force is computed as a function of the C-O distance, inherently including anharmonicity. The simulation results are used to calculate the kinetic isotope effects for the wild-type enzyme (WT) and the L546A/L754A double mutant (DM), which have been measured experimentally to be ∼80 and ∼700, respectively. The PCET reaction is found to be exoergic for WT and slightly endoergic for the DM, and the equilibrium C-O distance for the reactant is found to be ∼0.2 Å greater for the DM than for WT. The larger equilibrium distance for the DM, which is due mainly to less optimal substrate binding in the expanded binding cavity, is primarily responsible for its higher kinetic isotope effect. The calculated potentials of mean force are anharmonic and relatively soft at shorter C-O distances, allowing efficient thermal sampling of the shorter distances required for effective hydrogen tunneling. The primarily local electrostatic field at the transferring hydrogen is ∼100 MV/cm in the direction to facilitate proton transfer and increases dramatically as the C-O distance decreases. These simulations suggest that the overall protein environment is important for conformational sampling of active substrate configurations aligned for proton transfer, but the PCET reaction is influenced primarily by local electrostatic effects that facilitate conformational sampling of shorter proton donor-acceptor distances required for effective hydrogen tunneling.

Also flagged:Tyrosine kinasestyrosinecell surfacecytoplasmicnucleusNon-receptor tyrosine kinases
Journal Article 2018-02-19 No Snippets Siveen KS, Prabhu KS, Achkar IW, Kuttikrishnan S, Shyam S, Khan AQ, Merhi M, Dermime S, Uddin S.
Show Full Abstract

Tyrosine kinases belong to a family of enzymes that mediate the movement of the phosphate group to tyrosine residues of target protein, thus transmitting signals from the cell surface to cytoplasmic proteins and the nucleus to regulate physiological processes. Non-receptor tyrosine kinases (NRTK) are a sub-group of tyrosine kinases, which can relay intracellular signals originating from extracellular receptor. NRTKs can regulate a huge array of cellular functions such as cell survival, division/propagation and adhesion, gene expression, immune response, etc. NRTKs exhibit considerable variability in their structural make up, having a shared kinase domain and commonly possessing many other domains such as SH2, SH3 which are protein-protein interacting domains. Recent studies show that NRTKs are mutated in several hematological malignancies, including lymphomas, leukemias and myelomas, leading to aberrant activation. It can be due to point mutations which are intragenic changes or by fusion of genes leading to chromosome translocation. Mutations that lead to constitutive kinase activity result in the formation of oncogenes, such as Abl, Fes, Src, etc. Therefore, specific kinase inhibitors have been sought after to target mutated kinases. A number of compounds have since been discovered, which have shown to inhibit the activity of NRTKs, which are remarkably well tolerated. This review covers the role of various NRTKs in the development of hematological cancers, including their deregulation, genetic alterations, aberrant activation and associated mutations. In addition, it also looks at the recent advances in the development of novel natural compounds that can target NRTKs and perhaps in combination with other forms of therapy can show great promise for the treatment of hematological malignancies.

Also flagged:cGASimmune responseimmune responsescyclic GMP-AMP synthaseadapter proteinSTING
Journal Article 2018-02-19 No Snippets Luo WW, Shu HB.
Show Full Abstract

Although it has long been demonstrated that cytosolic DNA is a potent immune stimulant, it is only in recent years that the molecular mechanisms of DNA-stimulated innate immune responses have emerged. Studies have established critical roles for the DNA sensor cyclic GMP-AMP synthase (cGAS) and the adapter protein MITA/STING in the innate immune response to cytosolic DNA or DNA viruses. Although the regulation of cGAS-MITA/STING-mediated signaling remains to be fully investigated, understanding the processes involved may help to explain the mechanisms of innate immune signaling events and perhaps autoinflammatory diseases and to provide potential therapeutic targets for drug intervention. In this review, we summarize recent progress on the regulation of the cGAS-MITA/STING-mediated innate immune response to DNA viruses at the organelle-trafficking, post-translational and transcriptional levels.

Also flagged:STAT3secretionIL-22TNF-αLgr5lysozyme
Journal Article 2018-02-19 ✓ 1 Snippet Hou Q, Ye L, Liu H, Huang L, Yang Q, Turner JR, Yu Q.
In-Text Gene Mentions

Olfm4

Show Full Abstract

The regeneration of intestinal epithelial are maintained by continuous differentiation and proliferation of intestinal stem cells (ISCs) under physiological and pathological conditions. However, little is known about the regulatory effect of intestinal microbiota on its recovery ability to repair damaged mucosal barrier. In this study, we established intestinal organoids and lamina propria lymphocytes (LPLs) co-cultured system, plus mice experiments, to explore the protective effect of Lactobacillus reuteri D8 on integrity of intestinal mucosa. We found that only live L. reuteri D8 was effective in protecting the morphology of intestinal organoids and normal proliferation of epithelial stained with EdU under TNF-α treatment, which was also further verified in mice experiments. L. reuteri D8 colonized in the intestinal mucosa and ameliorated intestinal mucosa damage caused by DSS treatment, including improvement of body weight, colon length, pathological change, and proliferation level. The repair process stimulated by L. reuteri D8 was also accompanied with increased numbers of Lgr5<sup>+</sup> and lysozyme<sup>+</sup> cells both in intestinal organoids and mice intestine. Furthermore, we demonstrated that D8 metabolite indole-3-aldehyde stimulated LPLs to secret IL-22 through aryl hydrocarbon receptor (AhR) and then induced phosphorylation of STAT3 to accelerate proliferation of intestinal epithelial, thus recovering damaged intestinal mucosa. Our findings indicate L. reuteri protects intestinal barrier and activates intestinal epithelial proliferation, which sheds light on treatment approaches for intestinal inflammation based on ISCs with probiotics Lactobacillus and daily probiotic consumption in heath foods.

Also flagged:retrotransposonscognitionneurodegenerative disordersmitochondrialneurological diseasenucleotides
Journal Article 2018-02-19 No Snippets Larsen PA, Hunnicutt KE, Larsen RJ, Yoder AD, Saunders AM.
Show Full Abstract

Alu elements are a highly successful family of primate-specific retrotransposons that have fundamentally shaped primate evolution, including the evolution of our own species. Alus play critical roles in the formation of neurological networks and the epigenetic regulation of biochemical processes throughout the central nervous system (CNS), and thus are hypothesized to have contributed to the origin of human cognition. Despite the benefits that Alus provide, deleterious Alu activity is associated with a number of neurological and neurodegenerative disorders. In particular, neurological networks are potentially vulnerable to the epigenetic dysregulation of Alu elements operating across the suite of nuclear-encoded mitochondrial genes that are critical for both mitochondrial and CNS function. Here, we highlight the beneficial neurological aspects of Alu elements as well as their potential to cause disease by disrupting key cellular processes across the CNS. We identify at least 37 neurological and neurodegenerative disorders wherein deleterious Alu activity has been implicated as a contributing factor for the manifestation of disease, and for many of these disorders, this activity is operating on genes that are essential for proper mitochondrial function. We conclude that the epigenetic dysregulation of Alu elements can ultimately disrupt mitochondrial homeostasis within the CNS. This mechanism is a plausible source for the incipient neuronal stress that is consistently observed across a spectrum of sporadic neurological and neurodegenerative disorders.

Also flagged:RictorHuntingtinNeuronal DegenerationmTORmTORC2Neurodegenerative diseases
Journal Article 2018-02-19 No Snippets Creus-Muncunill J, Rué L, Alcalá-Vida R, Badillos-Rodríguez R, Romaní-Aumedes J, Marco S, Alberch J, Perez-Otaño I, Malagelada C, Pérez-Navarro E.
Show Full Abstract

Rictor associates with mTOR to form the mTORC2 complex, which activity regulates neuronal function and survival. Neurodegenerative diseases are characterized by the presence of neuronal dysfunction and cell death in specific brain regions such as for example Huntington's disease (HD), which is characterized by the loss of striatal projection neurons leading to motor dysfunction. Although HD is caused by the expression of mutant huntingtin, cell death occurs gradually suggesting that neurons have the capability to activate compensatory mechanisms to deal with neuronal dysfunction and later cell death. Here, we analyzed whether mTORC2 activity could be altered by the presence of mutant huntingtin. We observed that Rictor levels are specifically increased in the striatum of HD mouse models and in the putamen of HD patients. Rictor-mTOR interaction and the phosphorylation levels of Akt, one of the targets of the mTORC2 complex, were increased in the striatum of the R6/1 mouse model of HD suggesting increased mTORC2 signaling. Interestingly, acute downregulation of Rictor in striatal cells in vitro reduced mTORC2 activity, as shown by reduced levels of phospho-Akt, and increased mutant huntingtin-induced cell death. Accordingly, overexpression of Rictor increased mTORC2 activity counteracting cell death. Furthermore, normalization of endogenous Rictor levels in the striatum of R6/1 mouse worsened motor symptoms suggesting an induction of neuronal dysfunction. In conclusion, our results suggest that increased Rictor striatal levels could counteract neuronal dysfunction induced by mutant huntingtin.

Also flagged:Transcription Factorspathogenesisneuromuscular diseasesgene expressionchromatinpost-translational modifications
Journal Article 2018-02-19 ✓ 3 Snippets Imbriano C, Molinari S.
In-Text Gene Mentions

…The transcription factorSOX6, a member of…

…expression by recruitingSOX6to the promoters…

…the transcriptional repressorSOX6, which represses slow…

Show Full Abstract

Skeletal muscle formation is a multi-step process that is governed by complex networks of transcription factors. The regulation of their functions is in turn multifaceted, including several mechanisms, among them alternative splicing (AS) plays a primary role. On the other hand, altered AS has a role in the pathogenesis of numerous muscular pathologies. Despite these premises, the causal role played by the altered splicing pattern of transcripts encoding myogenic transcription factors in neuromuscular diseases has been neglected so far. In this review, we systematically investigate what has been described about the AS patterns of transcription factors both in the physiology of the skeletal muscle formation process and in neuromuscular diseases, in the hope that this may be useful in re-evaluating the potential role of altered splicing of transcription factors in such diseases.

Also flagged:α-SynucleinParkinson's diseasePDα-Synaxonalcell bodies
Journal Article 2018-02-19 No Snippets Bridi JC, Hirth F.
Show Full Abstract

Parkinson's disease (PD) is characterized by intracellular inclusions of aggregated and misfolded α-Synuclein (α-Syn), and the loss of dopaminergic (DA) neurons in the brain. The resulting motor abnormalities mark the progression of PD, while non-motor symptoms can already be identified during early, prodromal stages of disease. Recent studies provide evidence that during this early prodromal phase, synaptic and axonal abnormalities occur before the degenerative loss of neuronal cell bodies. These early phenotypes can be attributed to synaptic accumulation of toxic α-Syn. Under physiological conditions, α-Syn functions in its native conformation as a soluble monomer. However, PD patient brains are characterized by intracellular inclusions of insoluble fibrils. Yet, oligomers and protofibrils of α-Syn have been identified to be the most toxic species, with their accumulation at presynaptic terminals affecting several steps of neurotransmitter release. First, high levels of α-Syn alter the size of synaptic vesicle pools and impair their trafficking. Second, α-Syn overexpression can either misregulate or redistribute proteins of the presynaptic SNARE complex. This leads to deficient tethering, docking, priming and fusion of synaptic vesicles at the active zone (AZ). Third, α-Syn inclusions are found within the presynaptic AZ, accompanied by a decrease in AZ protein levels. Furthermore, α-Syn overexpression reduces the endocytic retrieval of synaptic vesicle membranes during vesicle recycling. These presynaptic alterations mediated by accumulation of α-Syn, together impair neurotransmitter exocytosis and neuronal communication. Although α-Syn is expressed throughout the brain and enriched at presynaptic terminals, DA neurons are the most vulnerable in PD, likely because α-Syn directly regulates dopamine levels. Indeed, evidence suggests that α-Syn is a negative modulator of dopamine by inhibiting enzymes responsible for its synthesis. In addition, α-Syn is able to interact with and reduce the activity of VMAT2 and DAT. The resulting dysregulation of dopamine levels directly contributes to the formation of toxic α-Syn oligomers. Together these data suggest a vicious cycle of accumulating α-Syn and deregulated dopamine that triggers synaptic dysfunction and impaired neuronal communication, ultimately causing synaptopathy and progressive neurodegeneration in Parkinson's disease.

Also flagged:Tropomyosingene expressionneuroblastomaactin‐associated proteinsNucleotidegeneticin
Journal Article 2018-02-19 No Snippets Stefen H, Suchowerska AK, Chen BJ, Brettle M, Kuschelewski J, Gunning PW, Janitz M, Fath T.
Show Full Abstract

Tropomyosins, a family of actin-associated proteins, bestow actin filaments with distinct biochemical and physical properties which are important for determining cell shape and regulating many cellular processes in eukaryotic cells. Here, we used RNA-seq to investigate the effect of four tropomyosin isoforms on gene expression in undifferentiated and differentiated rat B35 neuroblastoma cells. In undifferentiated cells, overexpression of tropomyosin isoforms Tpm1.12, Tpm2.1, Tpm3.1, and Tpm4.2 differentially regulates a vast number of genes, clustering into several gene ontology terms. In differentiated cells, tropomyosin overexpression exerts a much weaker influence on overall gene expression. Our findings are particularly compelling because they demonstrate that tropomyosin-dependent changes are attenuated once the cells are induced to follow a defined path of differentiation.<h4>Database</h4>Sequence data for public availability are deposited in the European Nucleotide Archive under the accession number PRJEB24136.

Also flagged:seasonal infectionsavian Influenzainfluenzainfectionbindingoligosaccharides
Journal Article 2018-02-19 No Snippets Antonova E, Glazova O, Gaponova A, Eremyan A, Grebenkina N, Zvereva S, Volkova N, Volchkov P.
Show Full Abstract

<b>Background:</b> Influenza virus can cause both seasonal infections and unpredictable pandemics. Rapidly evolving avian H5N1 and  H7N9 viruses have a potential pandemic threat for humans. Since avian Influenza can be transmitted by domestic birds, serving as a key link between wild birds and humans, an effective measure to control the influenza transmission would be eradication of the infection in poultry. It is known that the virus penetrates into the cell through binding with the terminal oligosaccharides - sialic acids (SA) - on the cell surfaces. Removal of SA might be a potential antiviral strategy. An approach to developing chicken lines that are resistant to influenza viruses could be the creation of genetically modified birds. Thus it is necessary to select a gene that provides defense to influenza. Here we have expressed in cells a range of exogenous sialidases and estimated their activity and specificity towards SA residues. <b>Methods:</b> Several bacterial, viral and human sialidases were tested. We adopted bacterial sialidases from <i>Salmonella</i> and <i>Actinomyces</i> for expression on the cell surface by fusing catalytic domains with transmembrane domains. We also selected Influenza A/PuertoRico/8/34/H1N1 neuraminidase and human membrane sialidase ( <i>hNeu3</i>) genes. Lectin binding assay was used for estimation of a α (2,3)-sialylation level by fluorescent microscopy and FACS.   <b>Results:</b> We compared sialidases from bacteria, Influenza virus and human. Sialidases from <i>Salmonella</i> and Influenza A neuraminidase effectively cleaved α (2-3)-SA receptors. Viral neuraminidase demonstrated a higher activity. Sialidases from <i>Actinomyces</i> and <i>hNeu3</i> did not show any activity against α (2-3) SA under physiological conditions. <b>Conclusion</b>: Our results demonstrated that sialidases with different specificity and activity can be selected as genes providing antiviral defence. Combining chosen sialidases with different activity together with tissue-specific promoters would provide an optimal level of desialylation. Tissue specific expression of the sialidases could protect domestic birds from infection.

Also flagged:CocrystalspolypeptidesK72GFPPeptidesgreen fluorescent protein
Journal Article 2018-02-19 No Snippets Korpi A, Ma C, Liu K, Nonappa, Herrmann A, Ikkala O, Kostiainen MA.
Show Full Abstract

Self-assembly is a convenient process to arrange complex biomolecules into large hierarchically ordered structures. Electrostatic attraction between the building blocks is a particularly interesting driving force for the assembly process, as it is easily tunable and reversible. Large biomolecules with high surface charge density, such as proteins and protein cages, are very promising building blocks due to their uniform size and shape. Assemblies of functional molecules with well-defined nanostructures have wide-ranging applications but are difficult to produce precisely by synthetic methods. Furthermore, obtaining highly ordered structures is an important prerequisite for X-ray structure analysis. Here we show how negatively charged ferritin and viral protein cages can adopt specific cocrystal structures with supercharged cationic polypeptides (SUPs, K72) and their recombinant fusions with green fluorescent protein (GFP-K72). The cage structures and recombinant proteins self-assemble in aqueous solution to large ordered structures, where the structure morphology and size are controlled by the ratio of oppositely charged building blocks and the electrolyte concentration. Both ferritin and viral cages form cocrystals with face centered cubic structure and lattice constants of 14.0 and 28.5 nm, respectively. The crystals are porous and the cationic recombinant proteins occupy the voids between the cages. Such systems resemble naturally occurring occlusion bodies and may serve as protecting agents as well as aid the structure determination of biomolecules by X-ray scattering.

Also flagged:Aliphatic Polyesterspolyesterbiomacromoleculesynthesis--opening
Journal Article 2018-02-18 No Snippets Zeng FR, Liang Y, Li ZL.
Show Full Abstract

Precise structure-property relation of a biodegradable polymer (e.g., aliphatic polyester) is anticipated only if monomer units and chiral centers are arranged in a defined primary sequence as a biomacromolecule. An emerging synthetic methodology, namely segmer assembly polymerization (SAP), is introduced in this paper to reveal the latest progress in polyester synthesis. Almost any periodic polyester envisioned can be synthesized via SAP using a programed linear or cyclic monomer. In this context, the macroscopic properties of a biodegradable polymer are fundamentally determined by microstructural information through a bottom-up approach. It can be highlighted that SAP ideally combines the precision of organic synthesis and the high efficiency of a polymerization reaction. Previously reported strategies including nucleophilic displacement, polyesterification, cross-metathesis polymerization (CMP), ring-opening polymerization (ROP), ring-opening metathesis polymerization (ROMP) and entropy-driven ring-opening metathesis polymerization (ED-ROMP) are critically reviewed in this paper to shed light on precision synthesis of aliphatic polyesters via SAP. Emerging yet challenging, SAP is a paradigm which reflects the convergence of organic and polymer chemistries and is also an efficient pathway to microstructural control. The current status, future challenges and promising trends in this realm are analyzed and discussed in this overview of the state-of-the-art.

Also flagged:Nonalcoholic SteatohepatitisNASHnonalcoholic fatty liver diseaseNAFLDliver cirrhosishepatocellular carcinoma
Journal Article 2018-02-18 ✓ 1 Snippet Del Ben M, Overi D, Polimeni L, Carpino G, Labbadia G, Baratta F, Pastori D, Noce V, Gaudio E, Angelico F, Mancone C.
In-Text Gene Mentions

…LGALS4, CTSB, SERPINB1,SERPINC1), and the vitronectin…

Show Full Abstract

Nonalcoholic steatohepatitis (NASH) is the critical stage of nonalcoholic fatty liver disease (NAFLD). The persistence of necroinflammatory lesions and fibrogenesis in NASH is the leading cause of liver cirrhosis and, ultimately, hepatocellular carcinoma. To date, the histological examination of liver biopsies, albeit invasive, remains the means to distinguish NASH from simple steatosis (NAFL). Therefore, a noninvasive diagnosis by serum biomarkers is eagerly needed. Here, by a proteomic approach, we analysed the soluble low-molecular-weight protein fragments flushed out from the liver tissue of NAFL and NASH patients. On the basis of the assumption that steatohepatitis leads to the remodelling of the liver extracellular matrix (ECM), NASH-specific fragments were in silico analysed for their involvement in the ECM molecular composition. The 10 kDa C-terminal fragment of the ECM protein vitronectin (VTN) was then selected as a promising circulating biomarker in discriminating NASH. The analysis of sera of patients provided these major findings: the circulating VTN fragment (i) is overexpressed in NASH patients and positively correlates with the NASH activity score (NAS); (ii) originates from the disulfide bond reduction between the V10 and the V65 subunits. In conclusion, V10 determination in the serum could represent a reliable tool for the noninvasive discrimination of NASH from simple steatosis.

Also flagged:TumorOral Cavity TumorLarynx TumorCMDNucleotideFloor of mouth
Journal Article 2018-02-17 ✓ 5 Snippets Pereira CM, de Carvalho AC, da Silva FR, Melendez ME, Lessa RC, Andrade VCC, Kowalski LP, Vettore AL, Carvalho AL.
In-Text Gene Mentions

HMGN4

The eight remaining genes (ANXA6, WDR26, HMGN4, C9orf64, FSTL1, CCN1, SAR1B and NFE2L1) were expressed in all five HNSCC cell lines evaluated (Fig. 1).

The expression level of ten genes (CA3, FHL1, HMGN4, FSTL1, NFE2L1, SAR1B, C9orf64, ANXA6, WDR26, CCN1) was evaluated by Reverse Transcription PCR (RT-PCR) in five HNSCC cell lines.

…genes (CA3, FHL1,HMGN4, FSTL1, NFE2L1, SAR1B,…

…FHL1, ANXA6, WDR26,HMGN4, C9orf64, FSTL1, CCN1,…

Show Full Abstract

<h4>Background</h4>Aberrant methylation is a frequent event in oral cancer.<h4>Methods</h4>In order to better characterize these alterations, a search for genes downregulated by aberrant methylation in oral squamous cell carcinoma (OSCC) was conducted through the mining of ORESTES dataset. Findings were further validated in OSCC cell lines and patients' samples and confirmed using TCGA data. Differentially expressed genes were identified in ORESTES libraries and validated in vitro using RT-PCR in HNSCC cell-lines and OSCC tumor samples. Further confirmation of these results was performed using mRNA expression and methylation data from The Cancer Genome Atlas (TCGA) data.<h4>Results</h4>From the set of genes selected for validation, CA3 and FHL1 were downregulated in 60% (12/20) and 75% (15/20) of OSCC samples, respectively, and in HNSCC cell lines. The treatment of cell lines JHU-13 and FaDu with the demethylating agent 5'-aza-dC was efficient in restoring CA3 and FHL1 expression. TCGA expression and methylation data on OSCC confirms the downregulation of these genes in OSCC samples and also suggests that expression of CA3 and FHL1 is probably regulated by methylation. The downregulation of CA3 and FHL1 observed in silico was validated in HNSCC cell lines and OSCC samples, showing the feasibility of integrating different datasets to select differentially expressed genes in silico.<h4>Conclusions</h4>These results showed that the downregulation of CA3 and FHL1 data observed in the ORESTES libraries was validated in HNSCC cell lines and OSCC samples and in a large cohort of samples from the TCGA database. Moreover, it suggests that expression of CA3 and FHL1 could probably be regulated by methylation having an important role the oral carcinogenesis.

Also flagged:iron metabolism disordergenetic diseaseironsynthesiscirrhosishepatocellular carcinoma
Journal Article 2018-02-17 ✓ 5 Snippets Scotet V, Saliou P, Uguen M, L'Hostis C, Merour MC, Triponey C, Chanu B, Nousbaum JB, Le Gac G, Ferec C.
In-Text Gene Mentions

Recent findings revealed that the gender difference observed in diseases associated with altered hepcidin expression such as HFE hemochromatosis may be explained by the negative regulation of hepcidin transcription by testosterone [19].

HFE-related hemochromatosis (or…

…HFE -relatedhemochromatosis(or type 1…

…-related hemochromatosis (ortype 1 hemochromatosis1 hemochromatosis; OMIM…

HFE hemochromatosishemochromatosis is inherited…

Show Full Abstract

<h4>Background</h4>HFE hemochromatosis is an inborn error of iron metabolism linked to a defect in the regulation of hepcidin synthesis. This autosomal recessive disease typically manifests later in women than men. Although it is commonly stated that pregnancy is, with menses, one of the factors that offsets iron accumulation in women, no epidemiological study has yet supported this hypothesis. The aim of our study was to evaluate the influence of pregnancy on expression of the predominant HFE p.[Cys282Tyr];[Cys282Tyr] genotype.<h4>Methods</h4>One hundred and forty p.Cys282Tyr homozygous women enrolled in a phlebotomy program between 2004 and 2011 at a blood centre in western Brittany (France) were included in the study. After checking whether the disease expression was delayed in women than in men in our study, the association between pregnancy and iron overload was assessed using multivariable regression analysis.<h4>Results</h4>Our study confirms that women with HFE hemochromatosis were diagnosed later than men cared for during the same period (52.6 vs. 47.4 y., P < 0.001). Compared to no pregnancy, having at least one pregnancy was not associated with lower iron markers. In contrast, the amount of iron removed by phlebotomies appeared significantly higher in women who had at least one pregnancy (e<sup>β</sup> = 1.50, P = 0.047). This relationship disappeared after adjustment for confounding factors (e<sup>β</sup> = 1.35, P = 0.088).<h4>Conclusions</h4>Our study shows that pregnancy status has no impact on iron markers level, and is not in favour of pregnancy being a protective factor in progressive iron accumulation. Our results are consistent with recent experimental data suggesting that the difference in disease expression observed between men and women may be explained by other factors such as hormones.

Also flagged:BIG2ARF1RhoAGolgidendriteRho GTPases
Journal Article 2018-02-17 ✓ 3 Snippets Hong EH, Kim JY, Kim JH, Lim DS, Kim M, Kim JY.
In-Text Gene Mentions

…knockdown of theARFGEF2gene encoding BIG2…

…dendrite morphogenesis ofARFGEF2-null neurons, indicating that…

…utero electroporation ofARFGEF2shRNA into the…

Show Full Abstract

Proper dendrite development is essential for establishing neural circuitry, and Rho GTPases play key regulatory roles in this process. From mouse brain lysates, we identified Brefeldin A-inhibited guanine exchange factor 2 (BIG2) as a novel Rho GTPase regulatory protein involved in dendrite growth and maintenance. BIG2 was highly expressed during early development, and knockdown of the ARFGEF2 gene encoding BIG2 significantly reduced total dendrite length and the number of branches. Expression of the constitutively active ADP-ribosylation factor 1 ARF1 Q71L rescued the defective dendrite morphogenesis of ARFGEF2-null neurons, indicating that BIG2 controls dendrite growth and maintenance by activating ARF1. Moreover, BIG2 co-localizes with the Golgi apparatus and is required for Golgi deployment into major dendrites in cultured hippocampal neurons. Simultaneous overexpression of BIG2 and ARF1 activated RhoA, and treatment with the RhoA activator lysophosphatidic acid in neurons lacking BIG2 or ARF1 increased the number of cells with dendritic Golgi, suggesting that BIG2 and ARF1 activate RhoA to promote dendritic Golgi polarization. mDia1 was identified as a downstream effector of BIG2-ARF1-RhoA axis, mediating Golgi polarization and dendritic morphogenesis. Furthermore, in utero electroporation of ARFGEF2 shRNA into the embryonic mouse brain confirmed an in vivo role of BIG2 for Golgi deployment into the apical dendrite. Taken together, our results suggest that BIG2-ARF1-RhoA-mDia1 signaling regulates dendritic Golgi polarization and dendrite growth and maintenance in hippocampal neurons.

Also flagged:Autophagycardiac diseasecancerdegradationmitophagymacroautophagy
Journal Article 2018-02-17 ✓ 1 Snippet Denny P, Feuermann M, Hill DP, Lovering RC, Plun-Favreau H, Roncaglia P.
In-Text Gene Mentions

…these proteins (WASHC1,HTT, TICAM1, FYCO1 and…

Show Full Abstract

Autophagy is a fundamental cellular process that is well conserved among eukaryotes. It is one of the strategies that cells use to catabolize substances in a controlled way. Autophagy is used for recycling cellular components, responding to cellular stresses and ridding cells of foreign material. Perturbations in autophagy have been implicated in a number of pathological conditions such as neurodegeneration, cardiac disease and cancer. The growing knowledge about autophagic mechanisms needs to be collected in a computable and shareable format to allow its use in data representation and interpretation. The Gene Ontology (GO) is a freely available resource that describes how and where gene products function in biological systems. It consists of 3 interrelated structured vocabularies that outline what gene products do at the biochemical level, where they act in a cell and the overall biological objectives to which their actions contribute. It also consists of 'annotations' that associate gene products with the terms. Here we describe how we represent autophagy in GO, how we create and define terms relevant to autophagy researchers and how we interrelate those terms to generate a coherent view of the process, therefore allowing an interoperable description of its biological aspects. We also describe how annotation of gene products with GO terms improves data analysis and interpretation, hence bringing a significant benefit to this field of study.

Also flagged:-LysLys-LysBocTPPGalactose
Journal Article 2018-02-17 No Snippets Huang Z, Zhao DM, Deng X, Zhang J, Zhang YM, Yu XQ.
Show Full Abstract

The studies of bolaamphiphile-based nanoparticles as delivery vectors are still rudimentary and under development. In this study, several asymmetric bolaamphiphiles containing lysine and another moiety with special functions, such as pH-sensitive or cell-targeting property, were designed and synthesized. The potentials of these bolaamphiphile-based nanoparticles as versatile vectors for both nucleic acids and chemical drugs were studied. With the presence of 1,2-dioleoyl-<i>sn</i>-glycero-3-phosphoethanolamine (DOPE), these amphiphiles could be prepared into bolasomes, which showed good DNA binding ability and could condense plasmid DNA into nanoparticles with appropriate size and surface potential. <b>Lys-His</b>, which has a pH-sensitive histidine on one head, exhibited higher transfection efficiency than the symmetric counterpart and comparable efficiency to commercially available transfection reagent. Mechanism studies confirmed that the bolaplexes formed from <b>Lys-His</b> might induce the highest cellular uptake and the best endosomal escape ability. On the other hand, these bolaamphiphiles also exhibited good drug loading ability. The self-assembly vesicles could efficiently encapsulate the hydrophobic anti-cancer drug doxorubicin (DOX) in aqueous solution with high drug loading content and encapsulation efficiency. Confocal laser scanning microscopy (CLSM) experiment and cell viability assay exhibited a controlled release of the drug with the assistance of bolasomes. It was shown that such bolaamphiphiles have great potential as nano-vectors for both drug and gene or their co-delivery.

Also flagged:HRPperoxidaseactinsynthesiscycloheximidecarcinoma
Journal Article 2018-02-16 ✓ 2 Snippets Zhu J, Yan F, Tao J, Zhu X, Liu J, Deng S, Zhang X.
In-Text Gene Mentions

Colorectal carcinoma is a common malignancy, and its morbidity rate ranks second for digestive system tumors.1 As CRC is not easy to diagnose early, it has mostly reached through the serosa and lymph node metastasis has occurred, making it difficult to treat.2 So far, many oncogenes (survivin, C‐myc, Bcl‐2 etc.)and anti‐oncogenes (p53, DCC, nm23, APC, PTEN) have been identified to be related to the development and progression of CRC.2 However, many oncogenes still have not been identified, and the functional role of these genes has also not been clarified.

…and anti‐oncogenes (p53,DCC, nm23, APC, PTEN)…

Show Full Abstract

Cell division cycle 37 (Cdc37) is an important partner for heat shock protein 90 (HSP90), assisting in molecular chaperone activities, particularly with regard to the regulation of protein kinases. Given its influence on cell growth pathways, Cdc37 has been discussed as a potential intermediate in carcinogenesis. However, to date, the potential functional roles and molecular mechanisms by which Cdc37 regulates cell survival in colorectal carcinoma (CRC) remain unclear. Here, we investigated the expression of Cdc37 and its clinical significance in CRC, and systematically explored the role and the underlying mechanism of Cdc37 in CRC cell survival both in vitro and in vivo. Our results showed that Cdc37 was remarkably up-regulated in CRC, which facilitated cell survival mainly by promoting cell proliferation, G1-S transition, and inhibiting cell apoptosis. Our data further indicated that Cdc37 increased the stability of cyclin-dependent kinase 4 (CDK4) to activate the retinoblastoma 1 (RB1) signaling pathway, followed by increased expression of Bcl-2 and Bcl-xL, which ultimately promoted cell survival in CRC. Moreover, knockdown of CDK4 reversed the Cdc37-mediated effect in promoting the progression of CRC. Our findings showed that Cdc37 played a critical role in promoting CRC cell survival by increasing CDK4 stability to activate the RB1 signaling pathway. Thereby, Cdc37 might serve as a potential therapeutic target in CRC patients.

Also flagged:hepatocellular Carcinomacancercirrhosischronic hepatitis Clin-4tumors
Journal Article 2018-02-16 ✓ 1 Snippet Mourad L, El-Ahwany E, Zoheiry M, Abu-Taleb H, Hassan M, Ouf A, Rahim AA, Hassanien M, Zada S.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objectives</h4>Due to the absence of reliable and accurate biomarkers for the early detection of liver malignancy, circulating microRNAs have recently emerged as great candidates for prompt cancer identification. Therefore, the aim of this study was to investigate the potential of liver-specific circulating microRNAs as an accurate non-invasive diagnostic tool for early diagnosis of hepatitis C virus (HCV)-induced hepatocellular carcinoma (HCC).<h4>Methodology</h4>A total of 165 patients were enrolled in this study and categorized into four main groups: 42 chronic hepatitis C (CHC) without cirrhosis, 45 CHC with cirrhosis (LC), 38 HCC with HCV patients, and 40 healthy controls. The expression profiles of seven miRNAs (miR-16, miR-34a, miR-125a, miR-139, miR-145, miR-199a, and miR-221) were analyzed using real-time PCR.<h4>Results</h4>Serum levels of miRNA-125a, miRNA-139, miRNA-145, and miRNA199a were significantly lower (p < 0.01) in HCC than in both CHC and LC groups. On the other hand, no significant difference was shown in the expression of miR-16, miR-34a, and miR-221 between the CHC, LC, and HCC groups. MiR-16, miR-34a, and miR-221 were significantly elevated in the HCC group compared to the control group. MiR-34a showed the highest specificity and sensitivity.<h4>Conclusions</h4>The results indicated that the measurement of serum levels of miR-125a, miR-139, miR-145, and miR-199a can help to differentiate HCC from CHC and LC. Also, miR-16, miR-34a, and miR-221 serum levels would have a prognostic value. MiR-34a had the highest specificity and sensitivity, indicating that it might serve as a novel and potential non-invasive biomarker for HCV-induced HCC.

Also flagged:liver diseasenon-alcoholic fatty liver diseaseNAFLDfatty liver diseasedyslipidaemiahypertension
Journal Article 2018-02-16 ✓ 1 Snippet Tuttolomondo A, Petta S, Casuccio A, Maida C, Corte VD, Daidone M, Di Raimondo D, Pecoraro R, Fonte R, Cirrincione A, Zafonte R, Cabibi D, Cammà C, Di Marco V, Licata A, Magliozzo F, Marchesini G, Merlino G, Craxì A, Pinto A.
In-Text Gene Mentions

…autoimmune Wilson’s disease,hemochromatosis, α1-antitrypsin deficiency); …

Show Full Abstract

<h4>Background</h4>No study evaluated vascular health markers in subjects with non-alcoholic fatty liver disease (NAFLD) through a combined analysis of reactive hyperemia peripheral arterial tonometry (RH-PAT) and arterial stiffness indexes.<h4>Aim of the study</h4>We aimed to assess whether NAFLD and its histological severity are associated with impairment of arterial stiffness and RH-PAT indexes in a mixed cohort of patients with biopsy-proven NAFLD.<h4>Materials and methods</h4>The Kleiner classification was used to grade NAFLD grade. Pulse wave velocity (PWV) and augmentation index (Aix) were used as markers of arterial stiffness, whereas endothelial function was assessed using reactive hyperemia index (RHI). The mini-mental state examination (MMSE) was administered to test cognitive performance.<h4>Results</h4>80 consecutive patients with biopsy-proven NAFLD and 83 controls without fatty liver disease. NAFLD subjects showed significantly lower mean RHI, higher mean arterial stiffness indexes and lower mean MMSE score. Multivariable analysis after correction for BMI, dyslipidaemia, hypertension, sex, diabetes, age and cardiovascular disease showed that BMI, diastolic blood pressure and RHI are significantly associated to NAFLD. Simple linear regression analysis showed among non-alcoholic steatohepatitis (NASH) subjects a significant negative relationship between ballooning grade and MMSE and a significant positive association between Kleiner steatosis grade and augmentation index.<h4>Conclusions</h4>Future research will be addressed to evaluate the relationship between inflammatory markers and arterial stiffness and endothelial function indexes in NAFLD subjects. These study will evaluate association between cardiovascular event incidence and arterial stiffness, endothelial and cognitive markers, and they will address the beneficial effects of cardiovascular drugs such as statins and ACE inhibitors on these surrogate markers in NAFLD subjects.

Also flagged:phosphorylationadenosine triphosphateserinethreoninetyrosinelipid kinases
Journal Article 2018-02-16 No Snippets Neumaier F, Alpdogan S, Hescheler J, Schneider T.
Show Full Abstract

R-type currents mediated by native and recombinant Ca<sub>v</sub>2.3 voltage-gated Ca<sup>2+</sup> channels (VGCCs) exhibit facilitation (run-up) and subsequent decline (run-down) in whole-cell patch-clamp recordings. A better understanding of the two processes could provide insight into constitutive modulation of the channels in intact cells, but low expression levels and the need for pharmacological isolation have prevented investigations in native systems. Here, to circumvent these limitations, we use conventional and perforated-patch-clamp recordings in a recombinant expression system, which allows us to study the effects of cell dialysis in a reproducible manner. We show that the decline of currents carried by human Ca<sub>v</sub>2.3+β<sub>3</sub> channel subunits during run-down is related to adenosine triphosphate (ATP) depletion, which reduces the number of functional channels and leads to a progressive shift of voltage-dependent gating to more negative potentials. Both effects can be counteracted by hydrolysable ATP, whose protective action is almost completely prevented by inhibition of serine/threonine but not tyrosine or lipid kinases. Protein kinase inhibition also mimics the effects of run-down in intact cells, reduces the peak current density, and hyperpolarizes the voltage dependence of gating. Together, our findings indicate that ATP promotes phosphorylation of either the channel or an associated protein, whereas dephosphorylation during cell dialysis results in run-down. These data also distinguish the effects of ATP on Ca<sub>v</sub>2.3 channels from those on other VGCCs because neither direct nucleotide binding nor PIP<sub>2</sub> synthesis is required for protection from run-down. We conclude that protein phosphorylation is required for Ca<sub>v</sub>2.3 channel function and could directly influence the normal features of current carried by these channels. Curiously, some of our findings also point to a role for leupeptin-sensitive proteases in run-up and possibly ATP protection from run-down. As such, the present study provides a reliable baseline for further studies on Ca<sub>v</sub>2.3 channel regulation by protein kinases, phosphatases, and possibly proteases.

Also flagged:ResveratrolLipidColorectal Canceromega-3 polyunsaturated fatty acidscolon cancercell growth
Journal Article 2018-02-16 No Snippets Serini S, Cassano R, Corsetto PA, Rizzo AM, Calviello G, Trombino S.
Show Full Abstract

New strategies are being investigated to ameliorate the efficacy and reduce the toxicity of the drugs currently used in colorectal cancer (CRC), one of the most common malignancies in the Western world. Data have been accumulated demonstrating that the antineoplastic therapies with either conventional or single-targeted drugs could take advantage from a combined treatment with omega-3 polyunsaturated fatty acids (omega-3 PUFA). These nutrients, shown to be safe at the dosage generally used in human trials, are able to modulate molecules involved in colon cancer cell growth and survival. They have also the potential to act against inflammation, which plays a critical role in CRC development, and to increase the anti-cancer immune response. In the present study, omega-3 PUFA were encapsulated in solid lipid nanoparticles (SLN) having a lipid matrix containing resveratrol esterified to stearic acid. Our aim was to increase the efficiency of the incorporation of these fatty acids into the cells and prevent their peroxidation and degradation. The Resveratrol-based SLN were characterized and investigated for their antioxidant activity. It was observed that the encapsulation of omega-3 PUFA into the SLN enhanced significantly their incorporation in human HT-29 CRC cells in vitro, and their growth inhibitory effects in these cancer cells, mainly by reducing cell proliferation.

Also flagged:endometriosisautoimmune diseasesmultiple sclerosisMSimmunodeficiencygene expression
Journal Article 2018-02-16 ✓ 5 Snippets Katiyar A, Sharma S, Singh TP, Kaur P.
In-Text Gene Mentions

POU3F2 (POU domain, class 3, transcription factor 2), BACH1 (breast cancer type 1 susceptibility protein; Igarashi et al., 2017), and STAT3 (signal transducer and activator of transcription 3; Kortylewski et al., 2005; Ho and Ivashkiv, 2006) were top 3 identified TFs from the shared up-regulated genes, leading to the activated immune response when down expressed in cells (Table 4, Figure 7A).

Therefore, the down-movement reaction of these pathways in EMS and MS is probably regulated through the same activated TFs, resulting in concomitant up-regulation of NEGR1 genes in MS in patients with EMS.

…approach revealed thatPOU3F2, BACH1 and 3…

…CLDN11, ITGB8, NCAM1,NEGR1, and NRXN1), neurotransmitter…

POU3F2(POU domain, class…

Show Full Abstract

Women with endometriosis (EMS) appear to be at a higher risk of developing other autoimmune diseases predominantly multiple sclerosis (MS). Though EMS and MS are evidently diverse in their phenotype, they are linked by a common autoimmune condition or immunodeficiency which could play a role in the expansion of endometriosis and possibly increase the risk of developing MS in women with EMS. However, the common molecular links connecting EMS with MS are still unclear. We conducted a meta-analysis of microarray experiments focused on EMS and MS with their respective controls. The GEO2R web application discovered a total of 711 and 1516 genes that are differentially expressed across the experimental conditions in EMS and MS, respectively with 129 shared DEGs between them. The functional enrichment analysis of DEGs predicts the shared gene expression signatures as well as the overlapping biological processes likely to infer the co-occurrence of EMS with MS. Network based meta-analysis unveiled six interaction networks/crosstalks through overlapping edges between commonly dysregulated pathways of EMS and MS. The PTPN1, ERBB3, and CDH1 were observed to be the highly ranked hub genes connected with disease-related genes of both EMS and MS. Androgen receptor (AR) and nuclear factor-kB p65 (RelA) were observed to be the most enriched transcription factor in the upstream of shared down-regulated and up-regulated genes, respectively. The two disease sample sets compared through crosstalk interactions between shared pathways revealed commonly up- and down-regulated expressions of 10 immunomodulatory proteins as probable linkers between EMS and MS. This study pinpoints the number of shared genes, pathways, protein kinases, and upstream regulators that may help in the development of biomarkers for diagnosis of MS and endometriosis at the same time through improved understanding of shared molecular signatures and crosstalk.

Also flagged:venous thrombosisdeficiency
Journal Article 2018-02-16 ✓ 2 Snippets Zeng W, Hu B, Tang L, You YY, Toderici M, Eugenia de la Morena-Barrio M, Corral J, Hu Y.
In-Text Gene Mentions

Correction: Recurrent mutations in a SERPINC1 hotspot associate with venous thrombosis without apparent antithrombin deficiency

…mutations in aSERPINC1hotspot associate with…

Show Full Abstract

[This corrects the article DOI: 10.18632/oncotarget.21365.].

Also flagged:Innate immunityimmune responsepattern recognition receptorsTRIMantibodyTRIM21
Journal Article 2018-02-16 No Snippets Bottermann M, James LC.
Show Full Abstract

Innate immunity is traditionally thought of as the first line of defense against pathogens that enter the body. It is typically characterized as a rather weak defense mechanism, designed to restrict pathogen replication until the adaptive immune response generates a tailored response and eliminates the infectious agent. However, intensive research in recent years has resulted in better understanding of innate immunity as well as the discovery of many effector proteins, revealing its numerous powerful mechanisms to defend the host. Furthermore, this research has demonstrated that it is simplistic to strictly separate adaptive and innate immune functions since these two systems often work synergistically rather than sequentially. Here, we provide a broad overview of innate pattern recognition receptors in antiviral defense, with a focus on the TRIM family, and discuss their signaling pathways and mechanisms of action with special emphasis on the intracellular antibody receptor TRIM21.

Also flagged:cancerpaclitaxelfolateXin-CysNMR
Journal Article 2018-02-16 No Snippets Shan L, Zhuo X, Zhang F, Dai Y, Zhu G, Yung BC, Fan W, Zhai K, Jacobson O, Kiesewetter DO, Ma Y, Gao G, Chen X.
Show Full Abstract

Folate receptor (FR) has proven to be a valuable target for chemotherapy using folic acid (FA) conjugates. However, FA-conjugated chemotherapeutics still have low therapeutic efficacy accompanied with side effects, resulting from complications such as short circulation half-life, limited tumor delivery, as well as high kidney accumulation. Herein, we present a novel FA-conjugated paclitaxel (PTX) prodrug which was additionally conjugated with an Evans blue (EB) derivative for albumin binding. The resulting bifunctional prodrug prolonged blood circulation, enhanced tumor accumulation, and consequently improved tumor therapeutic efficacy. <b>Methods:</b> Fmoc-Cys(Trt)-OH was coupled onto PTX at the 7'-OH position for further synthesis of ester prodrug FA-PTX-EB. The targeting ability was investigated using confocal microscopy and flow cytometry. The pharmacokinetics of this bifunctional compound was also studied. Meanwhile, cell viability was evaluated in normal cells and three cancer cell lines by MTT assay. <i>In vivo</i> therapeutic effect was tested on FR-α overexpressing MDA-MB-231 tumor model. <b>Results:</b> Compared with free PTX, the FA-PTX, PTX-EB and FA-PTX-EB prodrugs increased circulation half-life in mice from 2.19 to 3.82, 4.41, and 7.51 h, respectively. Pharmacokinetics studies showed that the FA-PTX-EB delivered more PTX to tumors than FA-PTX and free PTX. <i>In vitro</i> and <i>in vivo</i> studies demonstrated that FA-EB-conjugated PTX induced potent antitumor activity. <b>Conclusion:</b> FA-PTX-EB showed prolonged blood circulation, enhanced drug accumulation in tumors, higher therapeutic index, and lower side effects than either free PTX or monofunctional FA-PTX and EB-PTX. The results support the potential of using EB for the development of long-acting therapeutics.

Also flagged:breast cancercancertumorimmune responsein situ carcinomainvasive
Journal Article 2018-02-16 No Snippets Chen W, Hoffmann AD, Liu H, Liu X.
Show Full Abstract

Metastasis accounts for 90% of breast cancer mortality. Despite the significant progress made over the past decade in cancer medicine our understanding of metastasis remains limited, therefore preventing and targeting metastasis is not yet possible. Breast cancer cells preferentially metastasize to specific organs, known as "organotropic metastasis", which is regulated by subtypes of breast cancer, host organ microenvironment, and cancer cells-organ interactions. The cross-talk between cancer cells and host organs facilitates the formation of the premetastatic niche and is augmented by factors released from cancer cells prior to the cancer cells' arrival at the host organ. Moreover, host microenvironment and specific organ structure influence metastatic niche formation and interactions between cancer cells and local resident cells, regulating the survival of cancer cells and formation of metastatic lesions. Understanding the molecular mechanisms of organotropic metastasis is essential for biomarker-based prediction and prognosis, development of innovative therapeutic strategy, and eventual improvement of patient outcomes. In this review, we summarize the molecular mechanisms of breast cancer organotropic metastasis by focusing on tumor cell molecular alterations, stemness features, and cross-talk with the host environment. In addition, we also update some new progresses on our understanding about genetic and epigenetic alterations, exosomes, microRNAs, circulating tumor cells and immune response in breast cancer organotropic metastasis.

Also flagged:Tyrosine hydroxylaseAbelson helper integration site 1AHI1depressionbrain developmental disordersschizophrenia
Journal Article 2018-02-15 ✓ 1 Snippet Guo D, Zhang S, Sun H, Xu X, Hao Z, Mu C, Xu X, Wang G, Ren H.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Abelson helper integration site 1 (AHI1) is associated with several neuropsychiatric and brain developmental disorders, such as schizophrenia, depression, autism, and Joubert syndrome. <i>Ahi1</i> deficiency in mice leads to behaviors typical of depression. However, the mechanisms by which AHI1 regulates behavior remain to be elucidated. Here, we found that down-regulation of expression of the rate-limiting enzyme in dopamine biosynthesis, tyrosine hydroxylase (TH), in the midbrains of <i>Ahi1-</i>knockout (KO) mice is responsible for <i>Ahi1</i>-deficiency-mediated depressive symptoms. We also found that Rev-Erbα, a <i>TH</i> transcriptional repressor and circadian regulator, is up-regulated in the <i>Ahi1-</i>KO mouse midbrains and <i>Ahi1</i>-knockdown Neuro-2a cells. Moreover, brain and muscle Arnt-like protein 1 (BMAL1), the <i>Rev-Erb</i>α transcriptional regulator, is also increased in the <i>Ahi1-</i>KO mouse midbrains and <i>Ahi1</i>-knockdown cells. Our results further revealed that AHI1 decreases BMAL1/Rev-Erbα expression by interacting with and repressing retinoic acid receptor-related orphan receptor α, a nuclear receptor and transcriptional regulator of circadian genes. Of note, <i>Bmal1</i> deficiency reversed the reduction in TH expression induced by <i>Ahi1</i> deficiency. Moreover, microinfusion of the Rev-Erbα inhibitor SR8278 into the ventral midbrain of <i>Ahi1-</i>KO mice significantly increased TH expression in the ventral tegmental area and improved their depressive symptoms. These findings provide a mechanistic explanation for a link between AHI1-related behaviors and the circadian clock pathway, indicating an involvement of circadian regulatory proteins in AHI1-regulated mood and behavior.

Also flagged:phosphorylationextracellularJAGprogeria syndromesgrowth disordersgenetic diseases
Journal Article 2018-02-15 ✓ 1 Snippet Jam FA, Kadota Y, Mendsaikhan A, Tooyama I, Mori M.
In-Text Gene Mentions

…PER3 , andSOX6) were included, suggesting…

Show Full Abstract

Young individuals possess distinct properties that adults do not. The juvenile animals show higher activities for growth, healing, learning and plasticity than adults. The machinery for establishing these juvenile properties is not fully understood. To better understand the molecular constituents for the above properties, we performed a comprehensive transcriptome analysis of differently aged cells of mice by high-throughput sequencing and identified the genes selectively highly expressed in the young cells. These genes, collectively called as juvenility-associated genes (JAGs), show significant enrichments in the functions such as alternative splicing, phosphorylation and extracellular matrix (ECM). This implies the juvenescence might be achieved by these functions at the cell level. The JAG mutations are associated with progeria syndromes and growth disorders. Thus, the JAGs might organize the juvenile property of young animals and analysis of JAGs may provide scientific and therapeutic approaches toward treating the genetic diseases.

Also flagged:idiopathicpigmentationmembranesmelanoacanthomashyperpigmentation disorderpigmentation disorder
Journal Article 2018-02-15 ✓ 1 Snippet Zaki H, Sabharwal A, Kramer J, Aguirre A.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Laugier-Hunziker syndrome (LHS, also termed idiopathic lenticular mucocutaneous hyperpigmentation) is an unusual condition characterized by progressive pigmentation of the mucous membranes. LHS displays a benign course and is not associated with malignancy. Here we present a case of LHS with a 7-year follow-up. We document metachronous oral melanoacanthomas in this individual. In addition, we found that the oral melanotic macules in this patient waxed and waned in a cyclical manner. To our knowledge, this is the first report of these findings in the context of LHS. Finally, we provide an overview of other conditions that can present with mucosal hyperpigmentation. It is critical to distinguish LHS from other conditions characterized by mucosal pigmentation in order to facilitate optimal patient care.

Also flagged:CurcuminGulf War IllnessneurogenesismitochondrialWar Illnesspyridostigmine
Journal Article 2018-02-15 ✓ 1 Snippet Kodali M, Hattiangady B, Shetty GA, Bates A, Shuai B, Shetty AK.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Diminished cognitive and mood function are among the most conspicuous symptoms of Gulf War Illness (GWI). Our previous studies in a rat model of GWI have demonstrated that persistent cognitive and mood impairments are associated with substantially declined neurogenesis, chronic low-grade inflammation, increased oxidative stress and mitochondrial dysfunction in the hippocampus. We tested the efficacy of curcumin (CUR) to maintain better cognitive and mood function in a rat model of GWI because of its neurogenic, antiinflammatory, antioxidant, and memory and mood enhancing properties. Male rats were exposed daily to low doses of GWI-related chemicals, pyridostigmine bromide, N,N-diethyl-m-toluamide (DEET) and permethrin, and 5-minutes of restraint stress for 28 days. Animals were next randomly assigned to two groups, which received daily CUR or vehicle treatment for 30 days. Animals also received 5'-bromodeoxyuridine during the last seven days of treatment for analysis of neurogenesis. Behavioral studies through object location, novel object recognition and novelty suppressed feeding tests performed sixty days after treatment revealed better cognitive and mood function in CUR treated GWI rats. These rats also displayed enhanced neurogenesis and diminished inflammation typified by reduced astrocyte hypertrophy and activated microglia in the hippocampus. Additional studies showed that CUR treatment to GWI rats enhanced the expression of antioxidant genes and normalized the expression of multiple genes related to mitochondrial respiration. Thus, CUR therapy is efficacious for maintaining better memory and mood function in a model of GWI. Enhanced neurogenesis, restrained inflammation and oxidative stress with normalized mitochondrial respiration may underlie better memory and mood function mediated by CUR treatment.

Also flagged:coronary heart diseasestrokeBPaddictionCDKN1BBCAR1
Journal Article 2018-02-15 No Snippets Sung YJ, Winkler TW, de las Fuentes L, Bentley AR, Brown MR, Kraja AT, Schwander K, Ntalla I, Guo X, Franceschini N, Lu Y, Cheng CY, Sim X, Vojinovic D, Marten J, Musani SK, Li C, Feitosa MF, Kilpeläinen TO, Richard MA, Noordam R, Aslibekyan S, Aschard H, Bartz TM, Dorajoo R, Liu Y, Manning AK, Rankinen T, Smith AV, Tajuddin SM, Tayo BO, Warren HR, Zhao W, Zhou Y, Matoba N, Sofer T, Alver M, Amini M, Boissel M, Chai JF, Chen X, Divers J, Gandin I, Gao C, Giulianini F, Goel A, Harris SE, Hartwig FP, Horimoto ARVR, Hsu FC, Jackson AU, Kähönen M, Kasturiratne A, Kühnel B, Leander K, Lee WJ, Lin KH, 'an Luan J, McKenzie CA, Meian H, Nelson CP, Rauramaa R, Schupf N, Scott RA, Sheu WHH, Stančáková A, Takeuchi F, van der Most PJ, Varga TV, Wang H, Wang Y, Ware EB, Weiss S, Wen W, Yanek LR, Zhang W, Zhao JH, Afaq S, Alfred T, Amin N, Arking D, Aung T, Barr RG, Bielak LF, Boerwinkle E, Bottinger EP, Braund PS, Brody JA, Broeckel U, Cabrera CP, Cade B, Caizheng Y, Campbell A, Canouil M, Chakravarti A, CHARGE Neurology Working Group, Chauhan G, Christensen K, Cocca M, COGENT-Kidney Consortium, Collins FS, Connell JM, de Mutsert R, de Silva HJ, Debette S, Dörr M, Duan Q, Eaton CB, Ehret G, Evangelou E, Faul JD, Fisher VA, Forouhi NG, Franco OH, Friedlander Y, Gao H, GIANT Consortium, Gigante B, Graff M, Gu CC, Gu D, Gupta P, Hagenaars SP, Harris TB, He J, Heikkinen S, Heng CK, Hirata M, Hofman A, Howard BV, Hunt S, Irvin MR, Jia Y, Joehanes R, Justice AE, Katsuya T, Kaufman J, Kerrison ND, Khor CC, Koh WP, Koistinen HA, Komulainen P, Kooperberg C, Krieger JE, Kubo M, Kuusisto J, Langefeld CD, Langenberg C, Launer LJ, Lehne B, Lewis CE, Li Y, Lifelines Cohort Study, Lim SH, Lin S, Liu CT, Liu J, Liu J, Liu K, Liu Y, Loh M, Lohman KK, Long J, Louie T, Mägi R, Mahajan A, Meitinger T, Metspalu A, Milani L, Momozawa Y, Morris AP, Mosley TH, Munson P, Murray AD, Nalls MA, Nasri U, Norris JM, North K, Ogunniyi A, Padmanabhan S, Palmas WR, Palmer ND, Pankow JS, Pedersen NL, Peters A, Peyser PA, Polasek O, Raitakari OT, Renström F, Rice TK, Ridker PM, Robino A, Robinson JG, Rose LM, Rudan I, Sabanayagam C, Salako BL, Sandow K, Schmidt CO, Schreiner PJ, Scott WR, Seshadri S, Sever P, Sitlani CM, Smith JA, Snieder H, Starr JM, Strauch K, Tang H, Taylor KD, Teo YY, Tham YC, Uitterlinden AG, Waldenberger M, Wang L, Wang YX, Wei WB, Williams C, Wilson G, Wojczynski MK, Yao J, Yuan JM, Zonderman AB, Becker DM, Boehnke M, Bowden DW, Chambers JC, Chen YI, de Faire U, Deary IJ, Esko T, Farrall M, Forrester T, Franks PW, Freedman BI, Froguel P, Gasparini P, Gieger C, Horta BL, Hung YJ, Jonas JB, Kato N, Kooner JS, Laakso M, Lehtimäki T, Liang KW, Magnusson PKE, Newman AB, Oldehinkel AJ, Pereira AC, Redline S, Rettig R, Samani NJ, Scott J, Shu XO, van der Harst P, Wagenknecht LE, Wareham NJ, Watkins H, Weir DR, Wickremasinghe AR, Wu T, Zheng W, Zheng W, Kamatani Y, Laurie CC, Bouchard C, Cooper RS, Evans MK, Gudnason V, Kardia SLR, Kritchevsky SB, Levy D, O'Connell JR, Psaty BM, van Dam RM, Sims M, Arnett DK, Mook-Kanamori DO, Kelly TN, Fox ER, Hayward C, Fornage M, Rotimi CN, Province MA, van Duijn CM, Tai ES, Wong TY, Loos RJF, Reiner AP, Rotter JI, Zhu X, Bierut LJ, Gauderman WJ, Caulfield MJ, Elliott P, Rice K, Munroe PB, Morrison AC, Cupples LA, Rao DC, Chasman DI.
Show Full Abstract

Genome-wide association analysis advanced understanding of blood pressure (BP), a major risk factor for vascular conditions such as coronary heart disease and stroke. Accounting for smoking behavior may help identify BP loci and extend our knowledge of its genetic architecture. We performed genome-wide association meta-analyses of systolic and diastolic BP incorporating gene-smoking interactions in 610,091 individuals. Stage 1 analysis examined ∼18.8 million SNPs and small insertion/deletion variants in 129,913 individuals from four ancestries (European, African, Asian, and Hispanic) with follow-up analysis of promising variants in 480,178 additional individuals from five ancestries. We identified 15 loci that were genome-wide significant (p < 5 × 10<sup>-8</sup>) in stage 1 and formally replicated in stage 2. A combined stage 1 and 2 meta-analysis identified 66 additional genome-wide significant loci (13, 35, and 18 loci in European, African, and trans-ancestry, respectively). A total of 56 known BP loci were also identified by our results (p < 5 × 10<sup>-8</sup>). Of the newly identified loci, ten showed significant interaction with smoking status, but none of them were replicated in stage 2. Several loci were identified in African ancestry, highlighting the importance of genetic studies in diverse populations. The identified loci show strong evidence for regulatory features and support shared pathophysiology with cardiometabolic and addiction traits. They also highlight a role in BP regulation for biological candidates such as modulators of vascular structure and function (CDKN1B, BCAR1-CFDP1, PXDN, EEA1), ciliopathies (SDCCAG8, RPGRIP1L), telomere maintenance (TNKS, PINX1, AKTIP), and central dopaminergic signaling (MSRA, EBF2).

Also flagged:post-translational proteincancerGrowth and death factor receptorsmembrane glycoproteinsextracellularsignal transduction
Journal Article 2018-02-15 No Snippets Ferreira IG, Pucci M, Venturi G, Malagolini N, Chiricolo M, Dall'Olio F.
Show Full Abstract

Glycosylation is a very frequent and functionally important post-translational protein modification that undergoes profound changes in cancer. Growth and death factor receptors and plasma membrane glycoproteins, which upon activation by extracellular ligands trigger a signal transduction cascade, are targets of several molecular anti-cancer drugs. In this review, we provide a thorough picture of the mechanisms bywhich glycosylation affects the activity of growth and death factor receptors in normal and pathological conditions. Glycosylation affects receptor activity through three non-mutually exclusive basic mechanisms: (1) by directly regulating intracellular transport, ligand binding, oligomerization and signaling of receptors; (2) through the binding of receptor carbohydrate structures to galectins, forming a lattice thatregulates receptor turnover on the plasma membrane; and (3) by receptor interaction with gangliosides inside membrane microdomains. Some carbohydrate chains, for example core fucose and β1,6-branching, exert a stimulatory effect on all receptors, while other structures exert opposite effects on different receptors or in different cellular contexts. In light of the crucial role played by glycosylation in the regulation of receptor activity, the development of next-generation drugs targeting glyco-epitopes of growth factor receptors should be considered a therapeutically interesting goal.

Also flagged:deutetrabenazinetetrabenazinevesicular monoamine transporter 2VMAT2deuteriumhydrogen
Journal Article 2018-02-15 ✓ 3 Snippets Dean M, Sung VW.
In-Text Gene Mentions

The diagnosis of manifest HD was made based on characteristic motor features and an expanded CAG repeat ≥36 in HTT. Patients were included if they had a Unified Huntington’s Disease Rating Scale (UHDRS) total maximal chorea score of ≥8 and a total functional capacity score of ≥5.15 Patients were excluded if they had a prolonged QTc interval, left bundle-branch block, hepatic impairment, renal impairment, serious untreated psychiatric illness, or significant impairment in speech or were taking drugs that prolong QT intervals (other than escitalopram or citalopram).

Huntington’s disease (HD) is a hereditary neurodegenerative disorder that is caused by a trinucleotide CAG repeat expansion on chromosome 4 in the HTT gene, which encodes for the huntingtin protein.1 HD is characterized by motor disturbances, behavioral disturbances, and cognitive dysfunction, with the most common motor symptom being chorea.2 Up to 90% of patients with HD suffer from chorea that can interfere with daily function and may cause injury.3 For many years, there was no US Food and Drug Administration (FDA)-approved medication for the treatment of chorea, but in 2008, the FDA approved tetrabenazine for HD-associated chorea.

…4 in theHTTgene, which encodes…

Show Full Abstract

Deutetrabenazine was recently approved for the treatment of chorea in Huntington's disease (HD) and is the first deuterated medication that has been US Food and Drug Administration (FDA)-approved for therapeutic use. In this article, we review deutetrabenazine's drug design, pharmacokinetics, drug interactions, efficacy, adverse events, comparison with tetrabenazine, dosage, and administration. Deutetrabenazine is a deuterated form of tetrabenazine and is a vesicular monoamine transporter 2 (VMAT2) inhibitor. The substitution of deuterium for hydrogen at key positions in the tetrabenazine molecule allows a longer drug half-life and less frequent daily dosing. Deutetrabenazine is administered twice daily up to a maximum daily dose of 48 mg, which corresponds to a similar daily dose of 100 mg of tetrabenazine. In a Phase III clinical trial (First-HD), there was a statistically significant improvement of chorea in HD subjects, as well as improvements in global impression of change as assessed by both patients and clinicians. This improvement was seen without significant adverse effects as the overall tolerability profile of deutetrabenazine was similar to placebo. Somnolence was the most commonly reported symptom in the deutetrabenazine group. In a study where subjects converted from tetrabenazine to deutetrabenazine in an open-label fashion (ARC-HD) and indirect comparison studies between tetrabenazine and deutetrabenazine, there is a suggestion that while efficacy for chorea is similar, the data may slightly favor tetrabenazine, but adverse effects and tolerability strongly favor deutetrabenazine. These data have not been replicated in true head-to-head studies. Current evidence supports that deutetrabenazine is an effective therapeutic treatment option for chorea in HD and may provide a more favorable adverse effect profile than tetrabenazine. However, more data are needed, particularly in the form of head-to-head studies between deutetrabenazine and other treatment options as well as longer term clinical experience with deutetrabenazine.

Also flagged:Cytoskeletonlipidgene expressionextracellularcytochalasin Dosteogenesis
Journal Article 2018-02-15 No Snippets Elsafadi M, Manikandan M, Almalki S, Mobarak M, Atteya M, Iqbal Z, Hashmi JA, Shaheen S, Alajez N, Alajez N, Alfayez M, Kassem M, Dawud RA, Mahmood A.
Show Full Abstract

TGF<i>β</i> is a potent regulator of several biological functions in many cell types, but its role in the differentiation of human bone marrow-derived skeletal stem cells (hMSCs) is currently poorly understood. In the present study, we demonstrate that a single dose of TGF<i>β</i>1 prior to induction of osteogenic or adipogenic differentiation results in increased mineralized matrix or increased numbers of lipid-filled mature adipocytes, respectively. To identify the mechanisms underlying this TGF<i>β</i>-mediated enhancement of lineage commitment, we compared the gene expression profiles of TGF<i>β</i>1-treated hMSC cultures using DNA microarrays. In total, 1932 genes were upregulated, and 1298 genes were downregulated. Bioinformatics analysis revealed that TGF<i>β</i>l treatment was associated with an enrichment of genes in the skeletal and extracellular matrix categories and the regulation of the actin cytoskeleton. To investigate further, we examined the actin cytoskeleton following treatment with TGF<i>β</i>1 and/or cytochalasin D. Interestingly, cytochalasin D treatment of hMSCs enhanced adipogenic differentiation but inhibited osteogenic differentiation. Global gene expression profiling revealed a significant enrichment of pathways related to osteogenesis and adipogenesis and of genes regulated by both TGF<i>β</i>1 and cytochalasin D. Our study demonstrates that TGF<i>β</i>1 enhances hMSC commitment to either the osteogenic or adipogenic lineages by reorganizing the actin cytoskeleton.

Also flagged:cancerprostate cancergene expressionccrTumorAIPC
Journal Article 2018-02-15 ✓ 5 Snippets Bii VM, Collins CP, Hocum JD, Trobridge GD.
In-Text Gene Mentions

TAOK3

Thus, the frequency of genetic alterations in PC patients for the genes we have identified, including TAOK3 and ABCC1, may provide important information for PC progression.

We also found association of TAOK3 and ABCC1 expression levels with PC patient clinical outcome.

Previous studies have shown that TAOK3 and ABCC1 are involved in various cancers [47, 48, 50–53].

OR2A14, FER1L6, TAOK3, MAN1A2, MBNL2, SERBP1, PLEKHA2, SPTAN1, ADAMTS1, SLC30A5, ABCC1, SLC7A1 and SLC25A24 were identified as candidate prostate cancer (PC) progression genes.

Show Full Abstract

Replication-incompetent gammaretroviral (γRV) and lentiviral (LV) vectors have both been used in insertional mutagenesis screens to identify cancer drivers. In this approach the vectors stably integrate in the host cell genome and induce cancers by dysregulating nearby genes. The cells that contain a retroviral vector provirus in or near a proto-oncogene or tumor suppressor are preferentially enriched in a tumor. γRV and LV vectors have different integration profiles and genotoxic potential, making them potentially complementary tools for insertional mutagenesis screens. We performed screens using both γRV and LV vectors to identify driver genes that mediate progression of androgen-independent prostate cancer (AIPC) using a xenotransplant mouse model. Vector transduced LNCaP cells were injected orthotopically into the prostate gland of immunodeficient mice. Mice that developed tumors were castrated to create an androgen-deficient environment and metastatic tumors that developed were analyzed. A high-throughput modified genomic sequencing PCR (MGS-PCR) approach identified the positions of vector integrations in these metastatic tumors. <i>OR2A14</i>, <i>FER1L6</i>, <i>TAOK3</i>, <i>MAN1A2</i>, <i>MBNL2</i>, <i>SERBP1</i>, <i>PLEKHA2</i>, <i>SPTAN1</i>, <i>ADAMTS1</i>, <i>SLC30A5</i>, <i>ABCC1</i>, <i>SLC7A1</i> and <i>SLC25A24</i> were identified as candidate prostate cancer (PC) progression genes. <i>TAOK3</i> and <i>ABCC1</i> expression in PC patients predicted the risk of recurrence after androgen deprivation therapy. Our data shows that γRV and LV vectors are complementary approaches to identify cancer driver genes which may be promising potential biomarkers and therapeutic targets.

Also flagged:hepatitisviral genomereverse transcriptasewaterhepatitis illnessesinfection
Journal Article 2018-02-14 No Snippets Masachessi G, Pisano MB, Prez VE, Martínez LC, Michelena JF, Martínez-Wassaf M, Giordano MO, Isa MB, Pavan JV, Welter A, Nates SV, Ré V.
Show Full Abstract

Water resources contaminated with wastewater are an important source for the dissemination of enteric viruses with an impact on the health of the population. The aim of the study was to assess the viral contamination of freshwater from a dam in Argentina by using infectious enterovirus detection, viral RNA amplification, and a genetic characterization of five enteric viruses associated with diarrhea and hepatitis. Enterovirus infectivity (iEV) was evaluated by cell culture and direct immunofluorescence. The detection of the viral genome of rotavirus (RV), human astrovirus (HAstV), norovirus (NoV), hepatitis A virus (HAV), and hepatitis E virus (HEV) was performed by reverse transcriptase PCR (RT-PCR). A total of 48 water samples from 4 monitoring points on the body of the dam from January to December 2012 and 66 water samples from 3 tourist beaches on the edge of the dam from October 2013 to October 2015 were collected monthly. During the first period, the overall viral frequency detection was 52.1% for group A RV, 50% for HAstV, 60.4% for NoV, 22.9% for HAV, 2.1% for HEV, and 64.6% for iEV. The overall frequency detection for the second sampling was 18.2% for RV and HAstV, 31.8% for NoV, 7.57% for HEV, and 66.7% for iEV. There was no detection of HAV during this period. The genotypes and genogroups detected through the study correlated with the most common genomic variants associated with human gastrointestinal and hepatitis illnesses. The results obtained could alert the health systems and environmental sanitation to make decisions for viral control and prevention in our environment.<b>IMPORTANCE</b> The study shows the impact of anthropic contamination of one of the most important tourist water resources in Argentina. This course of recreational water would be a favorable scenario for infection, as well as a reservoir for the enteric viruses, creating a risk for the population exposed to these waters. The results obtained could alert the health systems and environmental sanitation to make decisions for the control and prevention of viral diseases in this environment.

Also flagged:Iron deficiencyironHepcidinIL-6oxygenflavonoids
Journal Article 2018-02-14 ✓ 1 Snippet Domínguez R, Sánchez-Oliver AJ, Mata-Ordoñez F, Feria-Madueño A, Grimaldi-Puyana M, López-Samanes Á, Pérez-López A.
In-Text Gene Mentions

…is found inhemochromatosispatients [ 44…

Show Full Abstract

Iron deficiency is a frequent and multifactorial disorder in the career of athletes, particularly in females. Exercise-induced disturbances in iron homeostasis produce deleterious effects on performance and adaptation to training; thus, the identification of strategies that restore or maintain iron homeostasis in athletes is required. Hepcidin is a liver-derived hormone that degrades the ferroportin transport channel, thus reducing the ability of macrophages to recycle damaged iron, and decreasing iron availability. Although it has been suggested that the circulating fraction of hepcidin increases during early post-exercise recovery (~3 h), it remains unknown how an acute exercise bout may modify the circulating expression of hepcidin. Therefore, the current review aims to determine the post-exercise expression of serum hepcidin in response to a single session of exercise. The review was carried out in the Dialnet, Elsevier, Medline, Pubmed, Scielo and SPORTDiscus databases, using hepcidin (and "exercise" or "sport" or "physical activity") as a strategy of search. A total of 19 articles were included in the review after the application of the inclusion/exclusion criteria. This search found that a single session of endurance exercise (intervallic or continuous) at moderate or vigorous intensity (60-90% VO<sub>2peak</sub>) stimulates an increase in the circulating levels of hepcidin between 0 h and 6 h after the end of the exercise bout, peaking at ~3 h post-exercise. The magnitude of the response of hepcidin to exercise seems to be dependent on the pre-exercise status of iron (ferritin) and inflammation (IL-6). Moreover, oxygen disturbances and the activation of a hypoxia-induced factor during or after exercise may stimulate a reduction of hepcidin expression. Meanwhile, cranberry flavonoids supplementation promotes an anti-oxidant effect that may facilitate the post-exercise expression of hepcidin. Further studies are required to explore the effect of resistance exercise on hepcidin expression.

Also flagged:vasoconstrictionhypertensive criseshypertensive crises emergenciesspontaneouslyadrenalineglucose
Journal Article 2018-02-14 ✓ 1 Snippet Liu H, Su WW, Long CF, Zhang WJ, Li PB, Wu Z, Liao YY, Zeng X, Chen TB, Zheng YY, Yan ZH, Bi C, Yao HL.
In-Text Gene Mentions

ATIII

Show Full Abstract

Currently, the prevention and treatment of hypertensive crises especially when it occurs with serious adverse outcomes have led to worldwide controversy. Despite of clinical possibilities of multiple agents, clinical failures still occur frequently. Therefore, early evaluations and observations of different therapies on appropriate animals should be emphasized. In the present study, an animal model for hypertensive crises emergencies was firstly established and experimentally testified. Five-month-male spontaneously hypertensive rat was consecutively fed with 60%-Kcal fat diet for four, six, and eight weeks with body weight and blood pressure monitored every two weeks, and then followed by an acute vasoconstriction stress of 5-min ice-bath treatment in the 4-h time interval of two adrenaline injections (0.8 mg/kg). Forty-four biochemical parameters were detected, covering hepatic and renal function, blood glucose and lipid levels, myocardial enzymes and energy metabolisms, blood coagulative and anti-coagulative system, oxidative stress and anti-inflammatory cytokine, blood viscosity, and RAAS system. Six tissues including heart, brain, liver, kidney, coronary arteries, and mesenteries were removed for pathological observations with hematoxylin-eosin staining. As a result, multi-organ dysfunctions in the heart, brain, liver, kidney, vascular endothelium, and blood system were testified in the modeling rats at weeks 6 and 8. In conclusion, severe consequences of this animal model were highly similar to those in hypertensive crises emergencies, which could be further utilized in the early intervention of hypertensive crises emergencies including the possible risk factors control and efficient therapies assessment. Impact statement In the late 90s, numerous reports predicted that 1-2% of hypertensive individuals would undergo hypertensive crises (HPC) and figures reached as high as 7% when no antihypertensive therapies were administrated. Currently, clinical failures appear frequently due to the improper or excessive medication regimen instead of the illness itself. Therefore, early evaluations and observations of HPC on appropriate animal models ahead of patients should be discussed and emphasized more widely. In the present study, an appropriate animal model for HPC emergencies was firstly established, in which the consequences of long-term high-fat diet feeding followed by an acute vasoconstriction stress on the spontaneously hypertensive rats were experimentally testified. The proposed model would have a wide application prospects in early intervention of HPC emergencies including the controls of possible risk factors and assessments of efficient therapies.

Also flagged:mitomycinstarchmicrospherestumorPDhepatocellular carcinoma
Journal Article 2018-02-14 ✓ 1 Snippet Gruber-Rouh T, Schmitt C, Naguib NNN, Nour-Eldin NA, Eichler K, Beeres M, Vogl TJ.
In-Text Gene Mentions

…patients (3.0%) hadhemochromatosis.…

Show Full Abstract

<h4>Background</h4>To evaluate survival data and local tumor control after transarterial chemoembolization in two groups with different embolization protocols for the treatment of HCC patients.<h4>Methods</h4>Ninty-nine patients (mean age: 63.6 years), 78 male (78.8%) with HCC were repeatedly treated with chemoembolization in 4-week-intervals. Eighty-eight patients had BCLC-Stage-B and in 11 patients, chemoembolization was performed for bridging (BCLC-Stage-A). In total, 667 chemoembolization treatments were performed (mean 6.7 treatments/patient). The administered chemotherapeutic agent included mitomycin. For embolization, lipiodol only (n = 51;51.5%; mean age 63.8 years; 38 male), or lipiodol plus degradable starch microspheres (DSM) (n = 48; 48.5%; mean age 63.4 years; 40 male) were used. The local tumor response was assessed by MRI using Response Evaluation Criteria in Solid Tumors 1.1 (RECIST 1.1). Patient survival times were evaluated using Kaplan-Meier curves and log-rank tests.<h4>Results</h4>The local tumor control in the lipiodol-group was: PR (partial response) in 11 (21.6%), SD (stable disease) in 32 (62.7%) and PD (progressive disease) in 8 cases (15.7%). In the lipiodol-DSM-group, PR was seen in 14 (29.2%), SD in 22 (45.8%), and PD in 12 (25.0%) individuals (p = 0.211). The median survival of patients after chemoembolization with lipiodol was 25 months and in the lipiodol-DSM-group 28 months (p = 0.845).<h4>Conclusion</h4>Our data suggest a slight benefit of the use of lipiodol and DSM in comparison of using lipiodol only for chemoembolization of HCC in terms of local tumor control and survival data, this trend did not reach the level of significance.

Also flagged:AgingrelatedCisd2Casp2Fn1Stub1
Journal Article 2018-02-14 No Snippets Pedro de Magalhães J, Thompson L, de Lima I, Gaskill D, Li X, Thornton D, Yang C, Palmer D.
Show Full Abstract

Many studies have reported genetic interventions that have an effect on mouse life span; however, it is crucial to discriminate between manipulations of aging and aging-independent causes of life extension. Here, we used the Gompertz equation to determine whether previously reported aging-related mouse genes statistically affect the demographic rate of aging. Of 30 genetic manipulations previously reported to extend life span, for only two we found evidence of retarding demographic aging: <i>Cisd2</i> and <i>hMTH1</i> Of 24 genetic manipulations reported to shorten life span and induce premature aging features, we found evidence of five accelerating demographic aging: <i>Casp2</i>, <i>Fn1</i>, <i>IKK</i>-β, <i>JunD</i>, and <i>Stub1</i> Overall, our reassessment found that only 15% of the genetic manipulations analyzed significantly affected the demographic rate of aging as predicted, suggesting that a relatively small proportion of interventions affecting longevity do so by regulating the rate of aging. By contrast, genetic manipulations affecting longevity tend to impact on aging-independent mortality. Our meta-analysis of multiple mouse longevity studies also reveals substantial variation in the controls used across experiments, suggesting that a short life span of controls is a potential source of bias. Overall, the present work leads to a reassessment of genes affecting the aging process in mice, with broad implications for our understanding of the genetics of mammalian aging and which genes may be more promising targets for drug discovery.

Also flagged:CancerHsp70Hsp90tumorco-chaperoneBag3
Journal Article 2018-02-14 No Snippets Yaglom JA, Wang Y, Li A, Li Z, Monti S, Alexandrov I, Lu X, Sherman MY.
Show Full Abstract

Hsp70 is a promising anti-cancer target. Our JG-98 series of Hsp70 inhibitors show anti-cancer activities affecting both cancer cells and tumor-associated macrophages. They disrupt Hsp70 interaction with a co-chaperone Bag3 and affect signaling pathways important for cancer development. Due to a prior report that depletion of Hsp70 causes similar responses as depletion of Hsp90, interest to Hsp70 inhibitors as drug prototypes is hampered by potential similarity of their effects to effects of Hsp90 inhibitors. Here, using the Connectivity Map platform we demonstrate that physiological effects of JG-98 are dissimilar from effects of Hsp90 inhibitors, thus justifying development of these compounds. Using gene expression and ActivSignal IPAD platform, we identified pathways modulated by JG-98. Some of these pathways were affected by JG-98 in Bag3-dependent (e.g. ERK) and some in Bag3-independent manner (e.g. Akt or c-myc), indicating multiple effects of Hsp70 inhibition. Further, we identified genes that modulate cellular responses to JG-98, developed approaches to predict potent combinations of JG-98 with known drugs, and demonstrated that inhibitors of proteasome, RNApol, Akt and RTK synergize with JG-98. Overall, here we established unique effects of novel Hsp70 inhibitors on cancer cell physiology, and predicted potential drug combinations for pre-clinical development.

Also flagged:IronDiabetic Retinopathyblindnessdegenerative diseasespathogenesisdiabetes
Journal Article 2018-02-14 ✓ 5 Snippets Chaudhary K, Promsote W, Ananth S, Veeranan-Karmegam R, Tawfik A, Arjunan P, Martin P, Smith SB, Thangaraju M, Kisselev O, Ganapathy V, Gnana-Prakasam JP.
In-Text Gene Mentions

We have reported previously that retinal iron overload induces GPR91 expression in the retinas of HFE and hemojuvelin knockout mice models of hemochromatosis, a genetic disorder of iron overload, and subsequently stimulates the production of downstream vascular endothelial growth factor (VEGF)34,35.

We have reported previously that retinal iron overload enhances GPR91 expression in HFE and hemojuvelin knockout mouse models of hemochromatosis, a genetic disorder of iron overload34,35.

By 12- weeks (Fig. 3D, middle panel) and 16-weeks post diabetes (Fig. 3D, bottom panel), the incidence of tortuous vessels, arteriovenous crossings and retinal vein occlusion with associated pigmentary abnormalities were much higher in diabetic HFE KO mice in comparison to diabetic HFE WT mice.

We have previously reported that HFE is expressed predominantly in the basolateral membrane of the retinal pigment epithelium, and HFE knockout (KO) mice accumulate iron in the retina with significant retinal degeneration by 18 months of age36.

In the present study, we induced diabetes in HFE knockout (KO) mice to understand the mechanistic role of iron, GPR91 and renin angiotensin system in the pathogenesis of DR.

Show Full Abstract

Diabetic retinopathy (DR) is a leading cause of blindness among working-age adults. Increased iron accumulation is associated with several degenerative diseases. However, there are no reports on the status of retinal iron or its implications in the pathogenesis of DR. In the present study, we found that retinas of type-1 and type-2 mouse models of diabetes have increased iron accumulation compared to non-diabetic retinas. We found similar iron accumulation in postmortem retinal samples from human diabetic patients. Further, we induced diabetes in HFE knockout (KO) mice model of genetic iron overload to understand the role of iron in the pathogenesis of DR. We found increased neuronal cell death, vascular alterations and loss of retinal barrier integrity in diabetic HFE KO mice compared to diabetic wildtype mice. Diabetic HFE KO mouse retinas also exhibited increased expression of inflammation and oxidative stress markers. Severity in the pathogenesis of DR in HFE KO mice was accompanied by increase in retinal renin expression mediated by G-protein-coupled succinate receptor GPR91. In light of previous reports implicating retinal renin-angiotensin system in DR pathogenesis, our results reveal a novel relationship between diabetes, iron and renin-angiotensin system, thereby unraveling new therapeutic targets for the treatment of DR.

Also flagged:nanostructurespairingcholesterollipidPaclitaxelwater
Journal Article 2018-02-14 No Snippets Shu Y, Yin H, Rajabi M, Li H, Vieweger M, Guo S, Shu D, Guo P.
Show Full Abstract

RNA can serve as powerful building blocks for bottom-up fabrication of nanostructures for biotechnological and biomedical applications. In addition to current self-assembly strategies utilizing base pairing, motif piling and tertiary interactions, we reported for the first time the formation of RNA based micellar nanoconstruct with a cholesterol molecule conjugated onto one helical end of a branched pRNA three-way junction (3WJ) motif. The resulting amphiphilic RNA micelles consist of a hydrophilic RNA head and a covalently linked hydrophobic lipid tail that can spontaneously assemble in aqueous solution via hydrophobic interaction. Taking advantage of pRNA 3WJ branched structure, the assembled RNA micelles are capable of escorting multiple functional modules. As a proof of concept for delivery for therapeutics, Paclitaxel was loaded into the RNA micelles with significantly improved water solubility. The successful construction of the drug loaded RNA micelles was confirmed and characterized by agarose gel electrophoresis, atomic force microscopy (AFM), dynamic light scattering (DLS), and fluorescence Nile Red encapsulation assay. The estimate critical micelle formation concentration ranges from 39 nM to 78 nM. The Paclitaxel loaded RNA micelles can internalize into cancer cells and inhibit their proliferation. Further studies showed that the Paclitaxel loaded RNA micelles induced cancer cell apoptosis in a Caspase-3 dependent manner but RNA micelles alone exhibited low cytotoxicity. Finally, the Paclitaxel loaded RNA micelles targeted to tumor in vivo without accumulation in healthy tissues and organs. There is also no or very low induction of pro-inflammatory response. Therefore, multivalence, cancer cell permeability, combined with controllable assembly, low or non toxic nature, and tumor targeting are all promising features that make our pRNA micelles a suitable platform for potential drug delivery.

Also flagged:DNM2Myotubular myopathyXcentronuclear myopathymuscle disorderdynamin 2
Journal Article 2018-02-14 No Snippets Tasfaout H, Lionello VM, Kretz C, Koebel P, Messaddeq N, Bitz D, Laporte J, Cowling BS.
Show Full Abstract

Myotubular myopathy, or X-linked centronuclear myopathy, is a severe muscle disorder representing a significant burden for patients and their families. It is clinically characterized by neonatal and severe muscle weakness and atrophy. Mutations in the myotubularin (MTM1) gene cause myotubular myopathy, and no specific curative treatment is available. We previously found that dynamin 2 (DNM2) is upregulated in both Mtm1 knockout and patient muscle samples, whereas its reduction through antisense oligonucleotides rescues the clinical and histopathological features of this myopathy in mice. Here, we propose a novel approach targeting Dnm2 mRNA. We screened and validated in vitro and in vivo several short hairpin RNA (shRNA) sequences that efficiently target Dnm2 mRNA. A single intramuscular injection of AAV-shDnm2 resulted in long-term reduction of DNM2 protein level and restored muscle force, mass, histology, and myofiber ultrastructure and prevented molecular defects linked to the disease. Our results demonstrate a robust DNM2 knockdown and provide an alternative strategy based on reduction of DNM2 to treat myotubular myopathy.

Also flagged:InsulinInsulin resistancenonalcoholic fatty liver diseaseNAFLDliver fibrosismetabolic syndrome
Journal Article 2018-02-14 ✓ 1 Snippet Amer J, Salhab A, Noureddin M, Doron S, Abu-Tair L, Ghantous R, Mahamid M, Safadi R.
In-Text Gene Mentions

…hepatitis, autoimmune disease,hemochromatosis, Wilson's disease, alpha‐1‐an…

Show Full Abstract

Insulin resistance is a key risk factor in the progression of nonalcoholic fatty liver disease (NAFLD) and may lead to liver fibrosis. Natural killer (NK) cells are thought to exert an antifibrotic effect through their killing of activated hepatic stellate cells (HSCs). Here, we investigated how the interplay between NK cells and HSCs are modified by insulin resistance in NAFLD. Fresh peripheral blood NK cells (clusters of differentiation [CD]56<sup>dim</sup>, CD16<sup>+</sup>) were collected from 22 healthy adults and 72 patients with NAFLD not currently taking any medications and without signs of metabolic syndrome. NK cells were assessed for insulin receptor expressions and cytotoxic activity when cultured in medium with HSCs. Fibrosis severities in patients with NAFLD were correlated linearly with elevated serum proinflammatory cytokine expression and insulin resistance severity. At the same time, fibrosis severities inversely correlated with insulin receptor expressions on NK cells as well as with their cytotoxic activities determined by CD107a by flow cytometry. NK cells from donors exhibiting severe fibrosis and insulin resistance exhibited significant mammalian target of rapamycin and extracellular signal-regulated kinase depletion (through NK cell western blot quantitation), increased apoptosis, and failure to attenuate HSC activation <i>in vitro</i>. While exposure to insulin stimulated the cytotoxic activity of healthy NK cells, rapamycin prevented this effect and reduced NK insulin receptor expressions. <i>Conclusion</i>: Elevated insulin levels in F1 and F2 fibrosis enhances NK cell cytotoxic activity toward HSCs and prevents fibrosis progression by insulin receptors and downstream mammalian target of rapamycin and extracellular signal-regulated kinase pathways. At more advanced stages of insulin resistance (F3 and F4 fibrosis), impaired NK cell activity rooted in low insulin receptor expression and or low serum insulin levels could further deteriorate fibrosis and may likely lead to cirrhosis development. (<i>Hepatology Communications</i> 2018;2:285-298).

Also flagged:mineralshydroxyapatitecellularmineraltitaniumcobalt
Journal Article 2018-02-13 No Snippets Cheng H, Chabok R, Guan X, Chawla A, Li Y, Khademhosseini A, Jang HL.
Show Full Abstract

The inorganic part of human bone is mainly composed of hydroxyapatite (HAP: Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>) and whitlockite (WH: Ca<sub>18</sub>Mg<sub>2</sub>(HPO<sub>4</sub>)<sub>2</sub>(PO<sub>4</sub>)<sub>12</sub>) minerals, where the WH phase occupies up to 20-35% of total weight. These two bone minerals have different crystal structures and physicochemical properties, implying their distinguished role in bone physiology. However, until now, the biological significance of the presence of a certain ratio between HAP and WH in bone is unclear. To address this fundamental question, bone mimetic scaffolds are designed to encapsulate human mesenchymal stem cells (MSCs) for assessing their osteogenic activity depending on different ratios of HAP and WH. Interestingly, cellular growth and osteogenic differentiation are significantly promoted when MSCs are grown with a 3-1 ratio of HAP and WH nanoparticles, which is similar to bone. One of the reasons for this synergism between HAP and WH in hydrogel scaffolds is that, while WH nanoparticles can enhance osteogenic differentiation of MSCs compared to HAP, WH counterintuitively decreases the mechanical stiffness of nanocomposite hydrogels and hinders the osteogenic activity of cells. Taken together, these findings identify the optimal ratio between two major minerals in bone mimetic scaffolds to maximize the osteogenic differentiation of MSCs.<h4>Statement of significance</h4>Human bone minerals are composed of HAP and WH inorganic nanoparticles which have different material properties. However, the reason for the coexistence of HAP and WH in human bone is not fully identified, and HAP and WH composite biomaterial has not been utilized in the clinic. In this study, we have developed bone mimetic HAP and WH nanocomposite hydrogel scaffolds with various ratios. Importantly, we found out that HAP can promote the mechanical stiffness of the composite hydrogel scaffolds while WH can enhance the osteogenic activity of stem cells, which together induced synergism to maximize osteogenic differentiation of stem cells when mixed into 3-1 ratio that is similar to human bone.

Also flagged:Carboxylatedgraphene oxideaxonalNetrin-1colorectal cancerNanomaterials
Journal Article 2018-02-13 No Snippets Liu M, Jia Z, Xiao X, Zhang Z, Li P, Zhou G, Fan Y.
Show Full Abstract

Nanomaterials of graphene and its derivatives have been widely applied in recent years, but whose impacts on the neuronal guidance growth are still not reported. In the present study, graphene oxide (GO) and carboxylated graphene oxide (GO-COOH) were used to investigate the potential effects on axonal guidance growth in the primary cultured cortical neurons. In addition, we characterized the structure and chemical composition of synthesized GO and GO-COOH using Fourier transform infrared spectrophotometer and scanning electron microscope assays and Raman analysis. GO is not neurotoxic and not conductive in a soluble form. However, GO-COOH has higher solubility and conductivity. Cell viability was assessed using CCK-8 assays and fluorescein diacetate after GO and GO-COOH treatment (0, 1, 2, 4, 5, 6, 8, 10, 12, 14, 16, 18, 20, 50, and 100 µg/mL). There are significant increases of cell viability and axonal growth after GO (2 and 4 μg/mL) and GO-COOH treatment (2 and 4 μg/mL). We further investigated the molecular mechanism of axonal guidance growth after GO and GO-COOH (2 and 4 μg/mL) application. Additionally, GO and GO-COOH up-regulated expression of Netrin-1 and its receptor, deleted in colorectal cancer by immunofluorescence assays and western blots assay. Our study demonstrated that GO-COOH activated Cdc42 and Rac1 and dramatically decreased RhoA. Thus, GO-COOH (2 µg/mL) is much better to be nanocarriers than GO for axonal guidance and growth in this study. GO-COOH may be used to facilitate guidance for regenerating neurons in the future. © 2018 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 106A: 1500-1510, 2018.

Also flagged:HuntingtinProtein KHuntingtin interacting protein KHYPKbindings
Journal Article 2018-02-13 No Snippets Ghosh DK, Roy A, Ranjan A.
Show Full Abstract

Protein misfolding due to mutation(s) and/or generation of unstable intermediate state(s) can be the cause of aberrant aggregations, leading to cellular degeneration. While molecular signatures like amyloidogenic regions cause aggregation, other features in proteins, like disorder and unique complexity regions, regulate and restrict such adhesive accumulation processes. Huntingtin interacting protein K (HYPK) is an aggregation-prone protein. Using various biophysical, microscopy, and computational techniques, we have deciphered how HYPK's N-terminal nanodisordered region plays a significant modulatory role in preventing its own aggregation and that of other proteins. HYPK's C-terminal hydrophobic regions lead to annular oligomerization and intermolecular charge interactions among the residues of low-complexity region (LCR) generate amorphous aggregates. The N-terminal disordered nanostructure loops toward the C-terminus, and a negative charge-rich patch in this region interacts with the LCR to shield LCR's positive charges. This interaction is required to prevent HYPK aggregation. Loss of this interaction causes partial unfolding of the structured C-terminus, resulting in HYPK's molten globule-like state and rapid annular oligomerization. The N-terminus also determines the specificity to mediate the differential bindings with aggregation-prone and wild type Huntingtin-exon1 proteins (Huntingtin97Q-exon1 and Huntingtin25Q-exon1). A sliding interaction of the specific N-terminal segment of HYPK along the extended polyglutamine region of Huntingtin-exon1 is responsible for HYPK's higher affinity for aggregation-prone Huntingtin than for its non-aggregating counterpart. Overall, our study provides evidence of the existence of disordered nanostructure in HYPK protein that mechanistically plays a decisive role in preventing both self and non-self protein aggregation.

Also flagged:MembranetauADkinaseSynthesisC-Glycosylflavones
Journal Article 2018-02-13 No Snippets Liang Z, Li QX.
Show Full Abstract

Glycogen synthase kinase-3β (GSK-3β) is a key enzyme responsible for tau hyperphosphorylation and is a viable therapeutic target of Alzheimer's disease (AD). We developed a new class of GSK-3β inhibitors based on the 6- C-glycosylflavone isoorientin (1). The new inhibitors are passive membrane permeable and constitutively attenuate GSK-3β mediated tau hyperphosphorylation and amyloid neurotoxicity in an AD cellular model. Enzymatic assays and kinetic studies demonstrated that compound 30 is a GSK-3β substrate-competitive inhibitor with distinct kinase selectivity, isoform-selectivity and over 310-fold increased potency as compared to 1. Structure-activity relationship analyses and in silico modeling suggest the mechanism of actions by which the hydrophobic, π-cation, and orthogonal multipolar interactions of 30 with the substrate site are critical for the GSK-3β inhibition and selectivity. The results provide new insights into GSK-3β drug discovery. The new inhibitors are valuable chemical probes and drug leads with therapeutic potential to tackle AD and other GSK-3β relevant diseases.

Also flagged:Annexin A1calcium oxalate monohydratebindingHSP90membranecalcium
Journal Article 2018-02-13 No Snippets Abd El-Salam M, Bastos JK, Han JJ, Previdi D, Coelho EB, Donate PM, Romero MF, Lieske J.
Show Full Abstract

The plant metabolite 3,4,5-tri-O-galloylquinic acid methyl ester (TGAME, compound 6) was synthesized, and its potential effect on calcium oxalate monohydrate (COM) crystal binding to the surface of Madin-Darby canine kidney cells type I (MDCKI) and crystal growth in a Drosophila melanogaster Malpighian tubule (MT) model were investigated. Membrane, cytosolic, and total annexin A1 (AxA1), α-enolase, and heat shock protein 90 (HSP90) amounts were examined by Western blot analysis after subcellular fractionation, then confirmed by immunofluorescence staining of cultured cells. Pretreatment of MDCKI cells with TGAME for up to 6 h significantly diminished COM crystal binding in a concentration-dependent manner. TGAME significantly inhibited AxA1 surface expression by immunofluorescence microscopy, whereas intracellular AxA1 increased. Western blot analysis confirmed AxA1 expression changes in the membrane and cytosolic fractions of compound-treated cells, whereas whole cell AxA1 remained unchanged. TGAME also significantly decreased the size, number, and growth of calcium oxalate (CaOx) crystals induced in a Drosophila melanogaster MT model and possessed a potent antioxidant activity in a DPPH assay.

Also flagged:Azelaic Acidacnecutaneoushyperpigmentary disorderslauryl alcoholdilaurylazelate ester
Journal Article 2018-02-13 No Snippets Khairudin N, Basri M, Fard Masoumi HR, Samson S, Ashari SE.
Show Full Abstract

Azelaic acid (AzA) and its derivatives have been known to be effective in the treatment of acne and various cutaneous hyperpigmentary disorders. The esterification of azelaic acid with lauryl alcohol (LA) to produce dilaurylazelate using immobilized lipase B from <i>Candida antarctica</i> (Novozym 435) is reported. Response surface methodology was selected to optimize the reaction conditions. A well-fitting quadratic polynomial regression model for the acid conversion was established with regards to several parameters, including reaction time and temperature, enzyme amount, and substrate molar ratios. The regression equation obtained by the central composite design of RSM predicted that the optimal reaction conditions included a reaction time of 360 min, 0.14 g of enzyme, a reaction temperature of 46 °C, and a molar ratio of substrates of 1:4.1. The results from the model were in good agreement with the experimental data and were within the experimental range (R² of 0.9732).The inhibition zone can be seen at dilaurylazelate ester with diameter 9.0±0.1 mm activities against <i>Staphylococcus epidermidis</i> S273. The normal fibroblasts cell line (3T3) was used to assess the cytotoxicity activity of AzA and AzA derivative, which is dilaurylazelate ester. The comparison of the IC<sub>50</sub> (50% inhibition of cell viability) value for AzA and AzA derivative was demonstrated. The IC<sub>50</sub> value for AzA was 85.28 μg/mL, whereas the IC<sub>50</sub> value for AzA derivative was more than 100 μg/mL. The 3T3 cell was still able to survive without any sign of toxicity from the AzA derivative; thus, it was proven to be non-toxic in this MTT assay when compared with AzA.

Also flagged:Telomerecolorectal tumourcolorectal polypcancercolorectal neoplasiamethylation
Journal Article 2018-02-13 ✓ 1 Snippet Fernandez-Rozadilla C, Kartsonaki C, Woolley C, McClellan M, Whittington D, Horgan G, Leedham S, Kriaucionis S, East J, Tomlinson I.
In-Text Gene Mentions

…, ID3 ,OLFM4, PLK1 ) or…

Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) screening might be improved by using a measure of prior risk to modulate screening intensity or the faecal immunochemical test threshold. Intermediate molecular biomarkers could aid risk prediction by capturing both known and unknown risk factors.<h4>Methods</h4>We sampled normal bowel mucosa from the proximal colon, distal colon and rectum of 317 individuals undergoing colonoscopy. We defined cases as having a personal history of colorectal polyp(s)/cancer, and controls as having no history of colorectal neoplasia. Molecular analyses were performed for: telomere length (TL); global methylation; and the expression of genes in molecular pathways associated with colorectal tumourigenesis. We also calculated a polygenic risk score (PRS) based on CRC susceptibility polymorphisms.<h4>Results</h4>Bowel TL was significantly longer in cases than controls, but was not associated with blood TL. PRS was significantly and independently higher in cases. Hypermethylation showed a suggestive association with case:control status. No gene or pathway was differentially expressed between cases and controls. Gene expression often varied considerably between bowel locations.<h4>Conclusions</h4>PRS and bowel TL (but not blood TL) may be clinically-useful predictors of CRC risk. Sample collection to assess these biomarkers is feasible in clinical practice, especially where population screening uses flexible sigmoidoscopy or colonoscopy.

Also flagged:Chronic liver diseasechronic hepatitiscirrhosishepatocellular carcinomachronic infectionalcohol
Journal Article 2018-02-13 ✓ 1 Snippet Orlien SMS, Ismael NY, Ahmed TA, Berhe N, Lauritzen T, Roald B, Goldin RD, Stene-Johansen K, Dyrhol-Riise AM, Gundersen SG, Morgan MY, Johannessen A.
In-Text Gene Mentions

Patients who, after initial screening, appeared to have unexplained CLD underwent more extensive testing including: measurement of serum alpha-1-antitrypsin and caeruloplasmin concentrations using the IMMAGE® 800 Immunochemistry System (Beckman Coulter); high iron Fe (HFE) genotyping, if the serum transferrin saturation was increased above 50%, without obvious explanation; and, screening for visceral leishmaniasis using a recombinant K39-antigen strip test IT-LEISH® (Bio-Rad) and confirmed by Giemsa stained splenic smear.

Show Full Abstract

<h4>Background</h4>Hepatitis B virus (HBV) infection is assumed to be the major cause of chronic liver disease (CLD) in sub-Saharan Africa. The contribution of other aetiological causes of CLD is less well documented and hence opportunities to modulate other potential risk factors are being lost. The aims of this study were to explore the aetiological spectrum of CLD in eastern Ethiopia and to identify plausible underlying risk factors for its development.<h4>Methods</h4>A cross-sectional study was undertaken between April 2015 and April 2016 in two public hospitals in Harar, eastern Ethiopia. The study population comprised of consenting adults with clinical and radiological evidence of chronic liver disease. The baseline evaluation included: (i) a semi-structured interview designed to obtain information about the ingestion of alcohol, herbal medicines and local recreational drugs such as khat (Catha edulis); (ii) clinical examination; (iii) extensive laboratory testing; and, (iv) abdominal ultrasonography.<h4>Results</h4>One-hundred-and-fifty patients with CLD (men 72.0%; median age 30 [interquartile range 25-40] years) were included. CLD was attributed to chronic HBV infection in 55 (36.7%) individuals; other aetiological agents were identified in a further 12 (8.0%). No aetiological factors were identified in the remaining 83 (55.3%) patients. The overall prevalence of daily khat use was 78.0%, while alcohol abuse, defined as > 20 g/day in women and > 30 g/day in men, was rare (2.0%). Histological features of toxic liver injury were observed in a subset of patients with unexplained liver injury who underwent liver biopsy.<h4>Conclusion</h4>The aetiology of CLD in eastern Ethiopia is largely unexplained. The widespread use of khat in the region, together with histopathological findings indicating toxic liver injury, suggests an association which warrants further investigation.

Also flagged:bovine leukemia virus infectioninfectionlymphosarcomaprovirusimmune responsetranscription factors
Journal Article 2018-02-13 ✓ 4 Snippets Carignano HA, Roldan DL, Beribe MJ, Raschia MA, Amadio A, Nani JP, Gutierrez G, Alvarez I, Trono K, Poli MA, Miretti MM.
In-Text Gene Mentions

The PVL phenotype association study included all significant SNPs for the GWAS considering WBCs -except the SNP assigned to Activator of Transcription Basal 1 gene (ABT1, rs110277740) - and other 14 significant SNPs.

…highlighted ( TFAP2D;ABT1, GCM1, PRRC2A ).…

…RIM40 (ENSBTAG00000037381) andABT1(ENSBTAG00000010784) genes (Ta…

…1 gene (ABT1, rs110277740) -…

Show Full Abstract

<h4>Background</h4>Bovine leukemia virus (BLV) infection is omnipresent in dairy herds causing direct economic losses due to trade restrictions and lymphosarcoma-related deaths. Milk production drops and increase in the culling rate are also relevant and usually neglected. The BLV provirus persists throughout a lifetime and an inter-individual variation is observed in the level of infection (LI) in vivo. High LI is strongly correlated with disease progression and BLV transmission among herd mates. In a context of high prevalence, classical control strategies are economically prohibitive. Alternatively, host genomics studies aiming to dissect loci associated with LI are potentially useful tools for genetic selection programs tending to abrogate the viral spreading. The LI was measured through the proviral load (PVL) set-point and white blood cells (WBC) counts. The goals of this work were to gain insight into the contribution of SNPs (bovine 50KSNP panel) on LI variability and to identify genomics regions underlying this trait.<h4>Results</h4>We quantified anti-p24 response and total leukocytes count in peripheral blood from 1800 cows and used these to select 800 individuals with extreme phenotypes in WBCs and PVL. Two case-control genomic association studies using linear mixed models (LMMs) considering population stratification were performed. The proportion of the variance captured by all QC-passed SNPs represented 0.63 (SE ± 0.14) of the phenotypic variance for PVL and 0.56 (SE ± 0.15) for WBCs. Overall, significant associations (Bonferroni's corrected -log<sub>10</sub>p > 5.94) were shared for both phenotypes by 24 SNPs within the Bovine MHC. Founder haplotypes were used to measure the linkage disequilibrium (LD) extent (r<sup>2</sup> = 0.22 ± 0.27 at inter-SNP distance of 25-50 kb). The SNPs and LD blocks indicated genes potentially associated with LI in infected cows: i.e. relevant immune response related genes (DQA1, DRB3, BOLA-A, LTA, LTB, TNF, IER3, GRP111, CRISP1), several genes involved in cell cytoskeletal reorganization (CD2AP, PKHD1, FLOT1, TUBB5) and modelling of the extracellular matrix (TRAM2, TNXB). Host transcription factors (TFs) were also highlighted (TFAP2D; ABT1, GCM1, PRRC2A).<h4>Conclusions</h4>Data obtained represent a step forward to understand the biology of BLV-bovine interaction, and provide genetic information potentially applicable to selective breeding programs.

Also flagged:coiled-coil domain containing 92insulin resistancehyperlipidemiaApoA1coronary heart diseaseCoronary artery disease
Journal Article 2018-02-13 ✓ 5 Snippets Xiao L, Shi D, Zhang H, Zhang Y, Liu Y, Lu H, Zheng Y.
In-Text Gene Mentions

The genotypic and allelic frequencies of the rs11057401 SNP were significantly different between the patients with CHD and controls.

Association between single nucleotide polymorphism rs11057401 of CCDC92 gene and the risk of coronary heart disease (CHD)

Given that the CCDC92 (coiled-coil domain containing 92) was important in insulin resistance, we sought to investigate whether the CCDC92 rs825476 SNP is associated with the risk of CHD in Chinese Han population.

The aforementioned studies have strongly indicated the important role of CCDC92 in insulin resistance, which would further influence CHD risk.

Our study demonstrated that the CCDC92 gene could influence the levels of serum lipid and glucose, which would add the risks of CHD.

Show Full Abstract

<h4>Background</h4>Given that the CCDC92 (coiled-coil domain containing 92) was important in insulin resistance, we sought to investigate whether the CCDC92 rs825476 SNP is associated with the risk of CHD in Chinese Han population.<h4>Methods</h4>Rs11057401 was genotyped for 817 patients with CHD and 724 age- and sex-matched controls using PCR-based Invader assay with the probe sets designed and synthesized by third wave.<h4>Results</h4>Patients were found to have a significantly higher frequency of AA than the controls (23.5% vs. 14.7%, OR = 1.60, p = 0.000), and the frequency of allele A was found to be remarkably higher in the patients than the controls (48.1% vs. 40.3%, OR = 1.19, p = 0.000). Multivariate logistic analysis showed that the incidence of CHD was positively correlated with hyperlipidemia, T2D and rs11057401 AA/AT genotypes. The FPG, TC, and ApoA1 levels in the CHD patients were different among the AA, AT and TT genotypes (P < 0.05), the A allele carriers had higher FPG, TC and lower ApoA1 levels than the A allele non-carriers (P < 0.05).<h4>Conclusion</h4>The genotypic and allelic frequencies of the rs11057401 SNP were significantly different between the patients with CHD and controls. Subjects with AA genotype or A allele were associated with an increased risk of CHD. The AA/AT genotypes were also associated with increased serum FPG, TC and decreased ApoA1 in CHD.

Also flagged:GFPBiotinlocalizationbindingMalachite GreenMango II
Journal Article 2018-02-13 No Snippets Autour A, C Y Jeng S, D Cawte A, Abdolahzadeh A, Galli A, Panchapakesan SSS, Rueda D, Ryckelynck M, Unrau PJ.
Show Full Abstract

Despite having many key roles in cellular biology, directly imaging biologically important RNAs has been hindered by a lack of fluorescent tools equivalent to the fluorescent proteins available to study cellular proteins. Ideal RNA labelling systems must preserve biological function, have photophysical properties similar to existing fluorescent proteins, and be compatible with established live and fixed cell protein labelling strategies. Here, we report a microfluidics-based selection of three new high-affinity RNA Mango fluorogenic aptamers. Two of these are as bright or brighter than enhanced GFP when bound to TO1-Biotin. Furthermore, we show that the new Mangos can accurately image the subcellular localization of three small non-coding RNAs (5S, U6, and a box C/D scaRNA) in fixed and live mammalian cells. These new aptamers have many potential applications to study RNA function and dynamics both in vitro and in mammalian cells.

Also flagged:mitochondrial cardiomyopathypediatric cardiomyopathybrain diseasephosphorylationQRSL1MTO1
Journal Article 2018-02-13 No Snippets Kamps R, Szklarczyk R, Theunissen TE, Hellebrekers DMEI, Sallevelt SCEH, Boesten IB, de Koning B, van den Bosch BJ, Salomons GS, Simas-Mendes M, Verdijk R, Schoonderwoerd K, de Coo IFM, Vanoevelen JM, Smeets HJM.
Show Full Abstract

This study aims to identify gene defects in pediatric cardiomyopathy and early-onset brain disease with oxidative phosphorylation (OXPHOS) deficiencies. We applied whole-exome sequencing in three patients with pediatric cardiomyopathy and early-onset brain disease with OXPHOS deficiencies. The brain pathology was studied by MRI analysis. In consanguineous patient 1, we identified a homozygous intronic variant (c.850-3A > G) in the QRSL1 gene, which was predicted to cause abnormal splicing. The variant segregated with the disease and affected the protein function, which was confirmed by complementation studies, restoring OXPHOS function only with wild-type QRSL1. Patient 2 was compound heterozygous for two novel affected and disease-causing variants (c.[253G > A];[938G > A]) in the MTO1 gene. In patient 3, we detected one unknown affected and disease-causing variants (c.2872C > T) and one known disease-causing variant (c.1774C > T) in the AARS2 gene. The c.1774C > T variant was present in the paternal copy of the AARS2 gene, the c.2872C > T in the maternal copy. All genes were involved in translation of mtDNA-encoded proteins. Defects in mtDNA-encoded protein translation lead to severe pediatric cardiomyopathy and brain disease with OXPHOS abnormalities. This suggests that the heart and brain are particularly sensitive to defects in mitochondrial protein synthesis during late embryonic or early postnatal development, probably due to the massive mitochondrial biogenesis occurring at that stage. If both the heart and brain are involved, the prognosis is poor with a likely fatal outcome at young age.

Also flagged:oligostilbenoidsarthritisbronchitisCOX-2nitric oxideNF-κB
Journal Article 2018-02-13 ✓ 3 Snippets Ha DT, Long PT, Hien TT, Tuan DT, An NTT, Khoi NM, Van Oanh H, Hung TM.
In-Text Gene Mentions

…ignificantly attenuated mutantHtt-induced depletion of SIRT3…

…cells from mutantHtt.…

…cells expressing mutantHtt[ 33 ].…

Show Full Abstract

<h4>Background</h4>Vitis heyneana is widely distributed in the north of Vietnam, it has been used in Vietnamese traditional medicine as an agent for treatment of arthritis, bronchitis, carbuncles and inflammatory conditions, and menstrual irregularities. However, this plant has not been investigated in phytochemical constituents and biological effects, especially in the anti-inflammatory property.<h4>Results</h4>Bioassay-guided fractionation of the EtOAc soluble fraction from the aerial part of Vitis heyneana resulted in the isolation of a series of oligostilbenoids as piceid (1), 2-r-viniferin (2), betulifol A (3), vitisinol C (4), (-)-trans-ε-viniferin (5), α-viniferin (6), shoreaketon (7), amurensin B (8), vitisinol B (9), and cis-vitisin B (10). Compound 5 showed the most potent inhibitory activities by suppressing LPS-induced COX-2 expression and PGE2 production. This compound exhibited significantly reduced LPS-induced nitric oxide (NO) release in a dose-dependent manner. These effects are accompanied with the inhibition of transcription factor NF-κB activation.<h4>Conclusion</h4>The results suggested that trans-ε-viniferin exerts anti-inflammatory effects via suppression the NF-κB activation in RAW 264.7 cells.

Also flagged:Netrin-1JNK1c-Junaxonangiogenesisstroke
Journal Article 2018-02-13 ✓ 5 Snippets Zheng M, Chen R, Chen H, Zhang Y, Chen J, Lin P, Lan Q, Yuan Q, Lai Y, Jiang X, Pan X, Liu N.
In-Text Gene Mentions

So, we hypothesize that Netrin-1 binding to DCC may participate in the complicated process of neural regeneration after a cerebral ischemia.

Our previous study found that treadmill exercise significantly increased the expression of Netrin-1 and its receptor DCC after the acute stage of cerebral ischemia injury.

When binding to the downstream transmembrane protein DCC, Netrin-1 is involved in the reorganization of actin cytoskeleton; it can promote axonal distribution and presynaptic differentiation of the optic tectum in Xenopus laevis; it can increase the axonal branching in mammalian fetal cortex (Dent et al., 2004) and is engaged in the development of human cerebral cortex (Harter et al., 2010); it has been demonstrated to enhance synaptic regeneration of cortical neurons by initiating synaptic assembly at the peak of postnatal synapse formation (Goldman et al., 2013); its tyrosine phosphorylation mediates Netrin-1 signaling in growth cone guidance by selectively interacting with the Src family kinases (Meriane et al., 2004; Ren et al., 2008); our previous study has found that rehabilitation training can up-regulate the expression of Netrin-1 and DCC in the peri-ischemic area in a rat MCAO model and improve the neural axonal growth and remodeling, thus promoting the functional recovery after the cerebral ischemia (Liu et al., 2011).

Furthermore, DCC is expressed in both neurons and astrocytic feet and affects the promoting effects of Netrin-1 on axonal growth after a transient cerebral ischemia (Tsuchiya et al., 2007).

…and its receptorDCCpromoted axonal regeneration…

Show Full Abstract

As a secreted axon guidance molecule, Netrin-1 has been documented to be a neuroprotective factor, which can reduce infarct volume, promote angiogenesis and anti-apoptosis after stroke in rodents. However, its role in axonal regeneration and synaptic formation after cerebral ischemic injury, and the related underlying mechanisms remain blurred. In this study, we used Adeno-associated vectors carrying Netrin-1 gene (AAV-NT-1) to up-regulate the expression level of Netrin-1 in rats' brain after middle cerebral artery occlusion (MCAO). We found that the up-regulated level of Netrin-1 and its receptor DCC promoted axonal regeneration and synaptic formation; the overexpression of Netrin-1 activated the JNK1 signaling pathway; these effects were partially reduced when JNK1 signaling pathway was inhibited by SP600125 (JNK specific inhibitor). Taken together, these findings suggest that Netrin-1 can facilitate the synaptic formation and axonal regeneration via the JNK1 signaling pathway after cerebral ischemia, thus promoting the recovery of neural functions.

Also flagged:disulfidePluronic-linoleic acidBrusatoltumorlinoleic acidmitochondrial
Journal Article 2018-02-13 No Snippets Zhang J, Fang X, Li Z, Chan HF, Lin Z, Wang Y, Chen M.
Show Full Abstract

Brusatol (Bru) exhibits promising anticancer effects, with both proliferation inhibition and chemoresistance amelioration activity. However, the poor solubility and insufficient intracellular delivery of Bru greatly restrict its application. Herein, to simultaneously utilize the advantages of Pluronics as drug carriers and tumor microenvironment-responsive drug release profiles, a flexible amphiphilic copolymer with a polymer skeleton, that is, Pluronic<sup>®</sup> F68 grafting with linoleic acid moieties by redox-reducible disulfide bonds (F68-SS-LA), was synthesized. After characterization by <sup>1</sup>H-nuclear magnetic resonance and Fourier transform infrared spectroscopy, the redox-sensitive F68-SS-LA micelles were self-assembled in a much lower critical micelle concentration than that of the unmodified F68 copolymer. Bru was loaded in micelles (Bru/SS-M) with high loading efficiency, narrow size distribution, and excellent storage stability. The redox-sensitive Bru/SS-M exhibited rapid particle dissociation and drug release in response to a redox environment. Based on the enhanced cellular internalization, Bru/SS-M achieved higher cytotoxicity in both Bel-7402 and MCF-7 cells compared with free Bru and nonreducible micelles. The improved anticancer effect was attributed to the remarkably decreased mitochondrial membrane potential and increased reactive oxygen species level as well as apoptotic rate. These results demonstrated that F68-SS-LA micelles possess great potential as an efficient delivery vehicle for Bru to promote its anticancer efficiency via an oxidation pathway.

Also flagged:CCmetastatic diseaseBRAFtumorsBcl-xLdeath
Journal Article 2018-02-13 No Snippets Dunne PD, Coleman HG, Bankhead P, Alderdice M, Gray RT, McQuaid S, Bingham V, Loughrey MB, James JA, McCorry AMB, Gilmore A, Holohan C, Klingbiel D, Tejpar S, Johnston PG, McArt DG, Di Nicolantonio F, Longley DB, Lawler M.
Show Full Abstract

<h4>Purpose</h4>BRAF mutation occurs in 8-15% of colon cancers (CC), and is associated with poor prognosis in metastatic disease. Compared to wild-type BRAF (BRAFWT) disease, stage II/III CC patients with BRAF mutant (BRAFMT) tumors have shorter overall survival after relapse; however, time-to-relapse is not significantly different. The aim of this investigation was to identify, and validate, novel predictors of relapse of stage II/III BRAFMT CC.<h4>Experimental design</h4>We used gene expression data from a cohort of 460 patients (GSE39582) to perform a supervised classification analysis based on risk-of-relapse within BRAFMT stage II/III CC, to identify transcriptomic biomarkers associated with prognosis within this genotype. These findings were validated using immunohistochemistry in an independent population-based cohort of Stage II/III CC (<i>n</i> = 691), applying Cox proportional hazards analysis to determine associations with survival.<h4>Results</h4>High gene expression levels of Bcl-xL, a key regulator of apoptosis, were associated with increased risk of relapse, specifically in BRAFMT tumors (HR = 8.3, 95% CI 1.7-41.7), but not KRASMT/BRAFWT or KRASWT/BRAFWT tumors. High Bcl-xL protein expression in BRAFMT, untreated, stage II/III CC was confirmed to be associated with an increased risk of death in an independent cohort (HR = 12.13, 95% CI 2.49-59.13). Additionally, BRAFMT tumors with high levels of Bcl-xL protein expression appeared to benefit from adjuvant chemotherapy (P for interaction = 0.006), indicating the potential predictive value of Bcl-xL expression in this setting.<h4>Conclusions</h4>These findings provide evidence that Bcl-xL gene and/or protein expression identifies a poor prognostic subgroup of BRAFMT stage II/III CC patients, who may benefit from adjuvant chemotherapy.

Also flagged:Hereditary hemochromatosisHHirongenetic diseasesTfR2TfR
Journal Article 2018-02-12 ✓ 2 Snippets Kleven MD, Jue S, Enns CA.
In-Text Gene Mentions

HFE

HFE 8

Show Full Abstract

Hereditary hemochromatosis (HH), a disease marked by chronic iron overload from insufficient expression of the hormone hepcidin, is one of the most common genetic diseases. One form of HH (type III) results from mutations in transferrin receptor-2 (TfR2). TfR2 is postulated to be a part of signaling system that is capable of modulating hepcidin expression. However, the molecular details of TfR2's role in this system remain unclear. TfR2 is predicted to bind the iron carrier transferrin (Tf) when the iron saturation of Tf is high. To better understand the nature of these TfR-Tf interactions, a binding study with the full-length receptors was conducted. In agreement with previous studies with truncated forms of these receptors, holo-Tf binds to the TfR1 homologue significantly stronger than to TfR2. However, the binding constant for Tf-TfR2 is still far above that of physiological holo-Tf levels, inconsistent with the hypothetical model, suggesting that other factors mediate the interaction. One possible factor, apo-Tf, only weakly binds TfR2 at serum pH and thus will not be able to effectively compete with holo-Tf. Tf binding to a TfR2 chimera containing the TfR1 helical domain indicates that the differences in the helical domain account for differences in the on rate of Tf, and nonconserved inter-receptor interactions are necessary for the stabilization of the complex. Conserved residues at one possible site of stabilization, the apical arm junction, are not important for TfR1-Tf binding but are critical for the TfR2-Tf interaction. Our results highlight the differences in Tf interactions with the two TfRs.

Also flagged:ZDHHC11immune responseimmune responseskinaseTBK1transcription factor
Journal Article 2018-02-12 ✓ 1 Snippet Liu Y, Zhou Q, Zhong L, Lin H, Hu MM, Zhou Y, Shu HB, Li S.
In-Text Gene Mentions

TRIM38

Show Full Abstract

MITA is a central adaptor in innate immune responses to DNA viruses. The mechanisms responsible for recruitment of downstream kinase TBK1 and the transcription factor IRF3 to MITA remains enigmatic. Here we identified ZDHHC11, a member of DHHC palmitoyl transferase family, as a positive regulator of DNA virus-triggered signaling. Overexpression of ZDHHC11 activated the IFN-β promoter, while ZDHHC11-deficiency specifically impaired DNA virus HSV-1-induced transcription of downstream antiviral genes. Zdhhc11<sup>-/-</sup> mice exhibited lower serum cytokine levels and higher lethality after HSV-1 infection. Mechanistically, ZDHHC11 facilitated the optimal recruitment of IRF3 to MITA. Our findings support an important role for ZDHHC11 in mediating MITA-dependent innate immune responses against DNA viruses.

Also flagged:DegradationHuntingtinProteasomeneurodegenerative diseasesendoplasmic reticulumHomocysteine-induced endoplasmic reticulum protein
Journal Article 2018-02-12 ✓ 1 Snippet Luo H, Cao L, Liang X, Du A, Peng T, Li H.
In-Text Gene Mentions

…to the overexpressedHttN-terminal, and this…

Show Full Abstract

In neurodegenerative diseases, pathogenic proteins tend to misfold and form aggregates that are difficult to remove and able to induce excessive endoplasmic reticulum (ER) stress, leading to neuronal injury and apoptosis. Homocysteine-induced endoplasmic reticulum protein (Herp), an E3 ubiquitin ligase, is an important early marker of ER stress and is involved in the ubiquitination and degradation of many neurodegenerative proteins. However, in Huntington's disease (HD), a typical polyglutamine disease, whether Herp is also involved in the metabolism and degradation of the pathogenic protein, mutant huntingtin, has not been reported. Therefore, we studied the relationship between Herp and N-terminal fragments of huntingtin (HttN-20Q and HttN-160Q). We found that Herp was able to bind to the overexpressed Htt N-terminal, and this interaction was enhanced by expansion of the polyQ fragment. Confocal microscopy demonstrated that Herp was co-localized with the HttN-160Q aggregates in the cytoplasm and tightly surrounded the aggregates. Overexpression of Herp significantly decreased the amount of soluble and insoluble HttN-160Q, promoted its ubiquitination, and inhibited its cytotoxicity. In contrast, knockdown of Herp resulted in more HttN-160Q protein, less ubiquitination, and stronger cytotoxicity. Inhibition of the autophagy-lysosomal pathway (ALP) had no effect on the function of Herp. However, blocking the ubiquitin-proteasome pathway (UPP) inhibited the reduction in soluble HttN-160Q caused by Herp. Interestingly, blocking the UPP did not weaken the ability of Herp to reduce HttN-160Q aggregates. Deletions of the N-terminal of Herp weakened its ability to inhibit HttN-160Q aggregation but did not result in a significant increase in its soluble form. However, loss of the C-terminal led to a significant increase in soluble HttN-160Q, but Herp still maintained the ability to inhibit aggregate formation. We further found that the expression level of Herp was significantly increased in HD animal and cell models. Our findings suggest that Herp is a newly identified huntingtin-interacting protein that is able to reduce the cytotoxicity of mutant huntingtin by inhibiting its aggregation and promoting its degradation. The N-terminal of Herp serves as the molecular chaperone to inhibit protein aggregation, while its C-terminal functions as an E3 ubiquitin ligase to promote the degradation of misfolded proteins through the UPP. Increased expression of Herp in HD models may be a pro-survival mechanism under stress.

Also flagged:L1CAMmelanomatumorsepithelial to mesenchymal transitionJagged 1Notch
Journal Article 2018-02-12 No Snippets Ernst AK, Putscher A, Samatov TR, Suling A, Galatenko VV, Shkurnikov MY, Knyazev EN, Tonevitsky AG, Haalck T, Lange T, Maar H, Schröder-Schwarz J, Riecken K, Schumacher U, Wicklein D.
Show Full Abstract

Finding additional functional targets for combination therapy could improve the outcome for melanoma patients. In a spontaneous metastasis xenograft model of human melanoma a shRNA mediated knockdown of L1CAM more than sevenfold reduced the number of lung metastases after the induction of subcutaneous tumors for two human melanoma cell lines (MeWo, MV3). Whole genome expression arrays of the initially L1CAM high MeWo subcutaneous tumors revealed unchanged or downregulated genes involved in epithelial to mesenchymal transition (EMT) except an upregulation of Jagged 1, indicating a compensatory change in Notch signaling especially as Jagged 1 expression showed an increase in MeWo L1CAM metastases and Jagged 1 was expressed in metastases of the initially L1CAM low MV3 cells as well. Expression of 17 genes showed concordant regulation for L1CAM knockdown tumors of both cell lines. The changes in gene expression indicated changes in the EMT network of the melanoma cells and an increase in p53/p21 and p38 activity contributing to the reduced metastatic potential of the L1CAM knockdowns. Taken together, these data make L1CAM a highly interesting therapeutic target to prevent further metastatic spread in melanoma patients.

Also flagged:waterprotein degradationproteasomeNRF2endoplasmic reticulumamino acid
Journal Article 2018-02-12 ✓ 2 Snippets Nuez-Ortín WG, Carter CG, Nichols PD, Cooke IR, Wilson R.
In-Text Gene Mentions

…of suppression (ACAD11,ECI2).…

…PRDX 1 andPRDX6and increased PRDX3…

Show Full Abstract

<h4>Background</h4>Atlantic salmon production in Tasmania (Southern Australia) occurs near the upper limits of the species thermal tolerance. Summer water temperatures can average over 19 °C over several weeks and have negative effects on performance and health. Liver tissue exerts important metabolic functions in thermal adaptation. With the aim of identifying mechanisms underlying liver plasticity in response to chronic elevated temperature in Atlantic salmon, label-free shotgun proteomics was used to explore quantitative protein changes after 43 days of exposure to elevated temperature.<h4>Results</h4>A total of 276 proteins were differentially (adjusted p-value < 0.05) expressed between the control (15 °C) and elevated (21 °C) temperature treatments. As identified by Ingenuity Pathway Analysis (IPA), transcription and translation mechanisms, protein degradation via the proteasome, and cytoskeletal components were down-regulated at elevated temperature. In contrast, an up-regulated response was identified for NRF2-mediated oxidative stress, endoplasmic reticulum stress, and amino acid degradation. The proteome response was paralleled by reduced fish condition factor and hepato-somatic index at elevated temperature.<h4>Conclusions</h4>The present study provides new evidence of the interplay among different cellular machineries in a scenario of heat-induced energy deficit and oxidative stress, and refines present understanding of how Atlantic salmon cope with chronic exposure to temperature near the upper limits of thermal tolerance.

Also flagged:gene expressionFoxP3Il2raCD4Ctla4GFP
Journal Article 2018-02-12 No Snippets Zemmour D, Zilionis R, Kiner E, Klein AM, Mathis D, Benoist C.
Show Full Abstract

CD4<sup>+</sup> T regulatory cells (T<sub>reg</sub>) are central to immune homeostasis, their phenotypic heterogeneity reflecting the diverse environments and target cells that they regulate. To understand this heterogeneity, we combined single-cell RNA-seq, activation reporter and T cell receptor (TCR) analysis to profile thousands of T<sub>reg</sub> or conventional CD4<sup>+</sup>FoxP3<sup>-</sup> T cells (T<sub>conv</sub>) from mouse lymphoid organs and human blood. T<sub>reg</sub> and T<sub>conv</sub> pools showed areas of overlap, as resting 'furtive' T<sub>regs</sub> with overall similarity to T<sub>convs</sub> or as a convergence of activated states. All T<sub>regs</sub> expressed a small core of FoxP3-dependent transcripts, onto which additional programs were added less uniformly. Among suppressive functions, Il2ra and Ctla4 were quasiconstant, inhibitory cytokines being more sparsely distributed. TCR signal intensity did not affect resting/activated T<sub>reg</sub> proportions but molded activated T<sub>reg</sub> programs. The main lines of T<sub>reg</sub> heterogeneity in mice were strikingly conserved in human blood. These results reveal unexpected TCR-shaped states of activation, providing a framework to synthesize previous observations of T<sub>reg</sub> heterogeneity.

Also flagged:GenisteinAutophagyHDtrihydroxyisoflavonechloroquinedegradation
Journal Article 2018-02-12 ✓ 5 Snippets Pierzynowska K, Gaffke L, Hać A, Mantej J, Niedziałek N, Brokowska J, Węgrzyn G.
In-Text Gene Mentions

Here we studied effects of genistein (trihydroxyisoflavone) on a HD cellular model consisting of HEK-293 cells transfected with a plasmid bearing mutated HTT gene.

Since genistein can cross the blood–brain-barrier (Tsai 2005), and it was demonstrated to be safe when used for a long time (over 1 year) at concentration as high as 150 mg/kg/day during a clinical trial (Kim et al. 2013), we aimed to test effects of this isoflavone on mutated huntingtin in HEK-293 cells expressing the HTT gene exon 1 with 74 CAG repeats which is a commonly used cellular model of HD.

Employing the HEK-293 cell line transfected with either vector or wild-type or the mutated HTT gene fragment, we have found that following relatively short (48 h) treatment with genistein, the level of both aggregates and the soluble form of the mutated gene product were significantly decreased relative to untreated cells (DMSO, used as a control), and the effects were within the dose–response correlation (Fig. 1).

Huntington’s disease (HD) is a monogenic disorder, caused by mutations in the HTT gene which result in expansion of CAG triplets.

…mutations in theHTTgene which result…

Show Full Abstract

Huntington's disease (HD) is a monogenic disorder, caused by mutations in the HTT gene which result in expansion of CAG triplets. The product of the mutated gene is misfolded huntingtin protein that forms aggregates leading to impairment of neuronal function, neurodegeneration, motor abnormalities and cognitive deficits. No effective cure is currently available for HD. Here we studied effects of genistein (trihydroxyisoflavone) on a HD cellular model consisting of HEK-293 cells transfected with a plasmid bearing mutated HTT gene. Both level of mutated huntingtin and number of aggregates were significantly decreased in genistein-treated HD cell model. This led to increased viability of the cells. Autophagy was up-regulated while inhibition of lysosomal functions by chloroquine impaired the genistein-mediated degradation of the mutated huntingtin aggregates. Hence, we conclude that through stimulating autophagy, genistein removes the major pathogenic factor of HD. Prolonged induction of autophagy was suspected previously to be risky for patients due to putative adverse effects; however, genistein has been demonstrated recently to be safe and suitable for long-term therapies even at doses as high as 150 mg/kg/day. Therefore, results presented in this report provide a basis for the use of genistein in further studies on development of the potential treatment of HD.

Also flagged:gene expressionReverse Transcriptionorthopedic disorderstranscription factorsOCT4SOX2
Journal Article 2018-02-12 ✓ 2 Snippets Stelcer E, Kulcenty K, Rucinski M, Jopek K, Trzeciak T, Richter M, Wroblewska JP, Suchorska WM.
In-Text Gene Mentions

…in 100% methanol (SOX6and SOX9) (CHEMPUR,…

…collagen (1:100) (ab34712);SOX6(1:50) (ab30455); SOX9…

Show Full Abstract

Human induced pluripotent stem cells (hiPSCs) constitute an important breakthrough in regenerative medicine, particularly in orthopedics, where more effective treatments are urgently needed. Despite the promise of hiPSCs only limited data on in vitro chondrogenic differentiation of hiPSCs are available. Therefore, we compared the gene expression profile of pluripotent genes in hiPSC-derived chondrocytes (ChiPS) to that of an hiPSC cell line created by our group (GPCCi001-A). The results are shown on heatmaps and plots and confirmed by Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR) analysis. Unlike the ChiPS, our GPCCi001-A cells maintained their pluripotency state during long-term culture, thus demonstrating that this cell line was comprised of stable, fully pluripotent hiPSCs. Moreover, these chondrocyte-like cells not only presented features that are characteristic of chondrocytes, but they also lost their pluripotency, which is an important advantage in favor of using this cell line in future clinical studies.

Also flagged:Trinucleotidedegenerative diseasescancerHDtumorovarian cancer
Journal Article 2018-02-12 ✓ 3 Snippets Murmann AE, Gao QQ, Putzbach WE, Patel M, Bartom ET, Law CY, Bridgeman B, Chen S, McMahon KM, Thaxton CS, Peter ME.
In-Text Gene Mentions

A prominent TNR expansion involves the triplet CAG in the huntingtin (HTT) gene responsible for Huntington's disease (HD).

…the huntingtin (HTT) gene responsible…

HTT

Show Full Abstract

Trinucleotide repeat (TNR) expansions in the genome cause a number of degenerative diseases. A prominent TNR expansion involves the triplet CAG in the huntingtin (HTT) gene responsible for Huntington's disease (HD). Pathology is caused by protein and RNA generated from the TNR regions including small siRNA-sized repeat fragments. An inverse correlation between the length of the repeats in HTT and cancer incidence has been reported for HD patients. We now show that siRNAs based on the CAG TNR are toxic to cancer cells by targeting genes that contain long reverse complementary TNRs in their open reading frames. Of the 60 siRNAs based on the different TNRs, the six members in the CAG/CUG family of related TNRs are the most toxic to both human and mouse cancer cells. siCAG/CUG TNR-based siRNAs induce cell death <i>in vitro</i> in all tested cancer cell lines and slow down tumor growth in a preclinical mouse model of ovarian cancer with no signs of toxicity to the mice. We propose to explore TNR-based siRNAs as a novel form of anticancer reagents.

Also flagged:lipopolysaccharidelipid Abiosynthesisethanolaminecolistinazithromycin
Journal Article 2018-02-12 No Snippets Farshadzadeh Z, Taheri B, Rahimi S, Shoja S, Pourhajibagher M, Haghighi MA, Bahador A.
Show Full Abstract

Two different mechanisms of resistance to colistin in <i>Acinetobacter baumannii</i> have been described. The first involves the total loss of lipopolysaccharide (LPS) due to mutations in the <i>lpxACD</i> operon, which is involved in the lipid A biosynthesis pathway. The second entails the addition of ethanolamine to the lipid A of the LPS resulting from mutations in the <i>PmrAB</i> two-component system. To evaluate the impact of colistin resistance-associated mutations on antimicrobial resistance and virulence properties, four pairs of clinical and laboratory-evolved colistin-susceptible/colistin-resistant (Col<sup>S</sup>/Col<sup>R</sup>) <i>A. baumannii</i> isolates were used. Antimicrobial susceptibility, surface motility, <i>in vitro</i> and <i>in vivo</i> biofilm-forming capacity, <i>in vitro</i> and <i>in vivo</i> expression levels of biofilm-associated genes, and <i>in vitro</i> growth rate were analyzed in these strains. Growth rate, <i>in vitro</i> and <i>in vivo</i> biofilm formation ability, as well as expression levels of biofilm-associated gene were reduced in Col<sup>R</sup> LPS-deficient isolate (the <i>lpxD</i> mutant) when compared with its Col<sup>S</sup> partner, whereas there were not such differences between LPS-modified isolates (the <i>pmrB</i> mutants) and their parental isolates. Mutation in <i>lpxD</i> was accompanied by a greater reduction in minimum inhibitory concentrations of azithromycin, vancomycin, and rifampin than mutation in <i>pmr</i>B. Besides, loss of LPS was associated with a significant reduction in surface motility without any change in expression of type IV pili. Collectively, colistin resistance through loss of LPS causes a more considerable cost in biological features such as growth rate, motility, and biofilm formation capacity relative to LPS modification. Therefore, Col<sup>R</sup> LPS-modified strains are more likely to spread and transmit from one patient to another in hospital settings, which results in more complex treatment and control.

Also flagged:immune responsemannoseTRP2MHC IICD80CD86
Journal Article 2018-02-12 No Snippets Lai C, Duan S, Ye F, Hou X, Li X, Zhao J, Yu X, Hu Z, Tang Z, Mo F, Yang X, Lu X.
Show Full Abstract

<h4>Purpose</h4>Dendritic cell (DC)-based cancer vaccines is a newly emerging and potent form of immune therapy. As for any new technology, there are still considerable challenges that need to be addressed. Here, we investigate the antitumor potential of a novel liposomal vaccine, M/CpG-ODN-TRP2-Lipo.<h4>Methods</h4>We developed a vaccination strategy by assembling the DC-targeting mannose and immune adjuvant CpG-ODN on the surface of liposomes, which were loaded with melanoma-specific TRP2<sub>180-188</sub> peptide as liposomal vaccine. M/CpG-ODN-TRP2-Lipo treatment was used to intendedly induce activation of DCs and antitumor- specific immune response in vivo.<h4>Results</h4>Our results demonstrated in vitro that the prepared liposomal particles were efficiently taken up by DCs. This uptake led to an enhanced activation of DCs, as measured by the upregulation of MHC II, CD80, and CD86. Furthermore, M/CpG-ODN-TRP2-Lipo effectively inhibited the growth of implanted B16 melanoma and prolonged the survival of mice. This therapy significantly reduced the number of myeloid-derived suppressor cells (MDSCs) and regulatory T cells, while simultaneously increasing the number of activated T cells, tumor antigen-specific CD8<sup>+</sup> cytotoxic T cells, and interferon-γ-producing cells. At the same time, it was found to suppress tumor angiogenesis and tumor cell proliferation, as well as up-regulate their apoptosis. Interestingly, MyD88-knockout mice had significantly shorter median survival times compared to wild-type mice following the administration of M/CpG-ODN-TRP2-Lipo.<h4>Conclusions</h4>The results suggested that the antitumor activities of the vaccine partially rely on the Myd88 signaling pathway. Interestingly, compared to whole tumor cell lysate-based vaccine, M/CpG-ODN-TRP2-Lipo, tumor specific antigen peptide-based vaccine, improved survival of tumor-bearing mice as well as enhanced their antitumor responses. All in all, we describe a novel vaccine formulation, M/CpG-ODN-TRP2-Lipo, with the aim of improving antitumor responses by alleviating the immunosuppressive environment in tumors.

Also flagged:Alcoholic Liver Diseasehyperbilirubinemiachronic alcoholismASTextrahepatic cholestasisautoimmune hepatitis
Journal Article 2018-02-12 ✓ 2 Snippets Hossain MR, Pandey RK, Islam MF, Datar P, Gayam V, Puri P, Malar T.
In-Text Gene Mentions

…Liver biopsy excludedhemochromatosis, dysplasia, or malignancy…

…3 ) excludedhemochromatosis, dysplasia, or malignancy.…

Show Full Abstract

Isolated hyperbilirubinemia as a manifestation of alcoholic liver disease without significant liver abnormalities is seen very rarely. We report such a case where a patient with chronic alcoholism presented to the ER with acute jaundice with bilirubin of 24.8 mg/dl, predominantly conjugated in nature along with mild elevation of AST (76 IU/L). There were no other abnormalities of the liver function. The patient underwent extensive laboratory and imaging tests that excluded extrahepatic cholestasis, viral and autoimmune hepatitis, ischemic hepatitis, and so forth. Liver biopsy excluded hemochromatosis, dysplasia, or malignancy and other differentials. Bilirubin gradually trended down to 7.3 mg/dl when alcohol consumption was stopped.

Also flagged:nitrogenphosphorousphytostimulationindol-3-acetic acid1-aminocyclopropane-1-carboxylateACC
Journal Article 2018-02-11 No Snippets Moronta-Barrios F, Gionechetti F, Pallavicini A, Marys E, Venturi V.
Show Full Abstract

Rice is currently the most important food crop in the world and we are only just beginning to study the bacterial associated microbiome. It is of importance to perform screenings of the core rice microbiota and also to develop new plant-microbe models and simplified communities for increasing our understanding about the formation and function of its microbiome. In order to begin to address this aspect, we have performed a 16S rDNA taxonomic bacterial profiling of the rhizosphere and endorhizosphere of two high-yield rice cultivars-Pionero 2010 FL and DANAC SD20A-extensively grown in Venezuela in 2014. Fifteen putative bacterial endophytes were then isolated from surface-sterilized roots and further studied in vitro and <i>in planta</i>. We have then performed inoculation of rice seedlings with a simplified community composed by 10 of the isolates and we have tracked them in the course of 30 days in greenhouse cultivation. The results obtained suggest that a set was able to significantly colonize together the rice endorhizospheres, indicating possible cooperation and the ability to form a stable multispecies community. This approach can be useful in the development of microbial solutions for a more sustainable rice production.

Also flagged:Immune Responsesinfectionpattern recognition receptorsToll-like receptorsTLRsNod-like receptors
Journal Article 2018-02-11 No Snippets Wang Z, Zheng Y.
Show Full Abstract

The innate immune system is the first line of defense against microbial pathogens. The activated innate immune system plays important roles in eliciting antimicrobial defenses. Despite the benefits of innate immune responses, excessive inflammation will cause host damage. Thus, tight regulation of these processes is required for the maintenance of immune homeostasis. Recently, a new class of long noncoding RNAs (lncRNAs) has emerged as important regulators in many physiological and pathological processes. Dysregulated lncRNAs have been found to be associated with excessive or uncontrolled inflammation. In this brief review, we summarize the roles of functional lncRNAs in regulating innate immune responses. We also discuss the roles of lncRNAs in macrophage polarization, an important molecular event in the innate immune responses.

Also flagged:insulinincretindiabetestoglucoseglucagon
Journal Article 2018-02-10 No Snippets Purnell JQ, Johnson GS, Wahed AS, Dalla Man C, Piccinini F, Cobelli C, Prigeon RL, Goodpaster BH, Kelley DE, Staten MA, Foster-Schubert KE, Cummings DE, Flum DR, Courcoulas AP, Havel PJ, Wolfe BM.
Show Full Abstract

<h4>Aims/hypothesis</h4>In this prospective case-control study we tested the hypothesis that, while long-term improvements in insulin sensitivity (S<sub>I</sub>) accompanying weight loss after Roux-en-Y gastric bypass (RYGB) would be similar in obese individuals with and without type 2 diabetes mellitus, stimulated-islet-cell insulin responses would differ, increasing (recovering) in those with diabetes but decreasing in those without. We investigated whether these changes would occur in conjunction with favourable alterations in meal-related gut hormone secretion and insulin processing.<h4>Methods</h4>Forty participants with type 2 diabetes and 22 participants without diabetes from the Longitudinal Assessment of Bariatric Surgery (LABS-2) study were enrolled in a separate, longitudinal cohort (LABS-3 Diabetes) to examine the mechanisms of postsurgical diabetes improvement. Study procedures included measures of S<sub>I</sub>, islet secretory response and gastrointestinal hormone secretion after both intravenous glucose (frequently-sampled IVGTT [FSIVGTT]) and a mixed meal (MM) prior to and up to 24 months after RYGB.<h4>Results</h4>Postoperatively, weight loss and S<sub>I</sub>-<sub>FSIVGTT</sub> improvement was similar in both groups, whereas the acute insulin response to glucose (AIRglu) decreased in the non-diabetic participants and increased in the participants with type 2 diabetes. The resulting disposition indices (DI<sub>FSIVGTT</sub>) increased by three- to ninefold in both groups. In contrast, during the MM, total insulin responsiveness did not significantly change in either group despite durable increases of up to eightfold in postprandial glucagon-like peptide 1 levels, and S<sub>I-MM</sub> and DI<sub>MM</sub> increased only in the diabetes group. Peak postprandial glucagon levels increased in both groups.<h4>Conclusions/interpretation</h4>For up to 2 years following RYGB, obese participants without diabetes showed improvements in DI that approach population norms. Those with type 2 diabetes recovered islet-cell insulin secretion response yet continued to manifest abnormal insulin processing, with DI values that remained well below population norms. These data suggest that, rather than waiting for lifestyle or medical failure, RYGB is ideally considered before, or as soon as possible after, onset of type 2 diabetes.<h4>Trial registration</h4>ClinicalTrials.gov NCT00433810.

Also flagged:CancerCarboncarbon dotscarbon nanotubesdoxorubicingemcitabine
Journal Article 2018-02-10 No Snippets Pardo J, Peng Z, Leblanc RM.
Show Full Abstract

Currently cancer treatment is in large part non-specific with respect to treatment. Medication is often harsh on patients, whereby they suffer several undesired side effects as a result. Carbon-based nanoparticles have attracted attention in recent years due to their ability to act as a platform for the attachment of several drugs and/or ligands. Relatively simple models are often used in cancer research, wherein carbon nanoparticles are conjugated to a ligand that is specific to an overexpressed receptor for imaging and drug delivery in cancer treatment. These carbon nanoparticles confer unique properties to the imaging or delivery vehicle due to their nontoxic nature and their high fluorescence qualities. Chief among the ongoing research within carbon-based nanoparticles emerge carbon dots (C-dots) and carbon nanotubes (CNTs). In this review, the aforementioned carbon nanoparticles will be discussed in their use within doxorubicin and gemcitabine based drug delivery vehicles, as well as the ligand-mediated receptor specific targeted therapy. Further directions of research in current field are also discussed.

Also flagged:Axitinibpembrolizumabrenal cell cancertyrosine kinaseVEGFPD-1
Journal Article 2018-02-10 No Snippets Atkins MB, Plimack ER, Puzanov I, Fishman MN, McDermott DF, Cho DC, Vaishampayan U, George S, Olencki TE, Tarazi JC, Rosbrook B, Fernandez KC, Lechuga M, Choueiri TK.
Show Full Abstract

<h4>Background</h4>Previous studies combining PD-1 checkpoint inhibitors with tyrosine kinase inhibitors of the VEGF pathway have been characterised by excess toxicity, precluding further development. We hypothesised that axitinib, a more selective VEGF inhibitor than others previously tested, could be combined safely with pembrolizumab (anti-PD-1) and yield antitumour activity in patients with treatment-naive advanced renal cell carcinoma.<h4>Methods</h4>In this ongoing, open-label, phase 1b study, which was done at ten centres in the USA, we enrolled patients aged 18 years or older who had advanced renal cell carcinoma (predominantly clear cell subtype) with their primary tumour resected, and at least one measureable lesion, Eastern Cooperative Oncology Group performance status 0-1, controlled hypertension, and no previous systemic therapy for renal cell carcinoma. Eligible patients received axitinib plus pembrolizumab in a dose-finding phase to estimate the maximum tolerated dose, and additional patients were enrolled into a dose-expansion phase to further establish safety and determine preliminary efficacy. Axitinib 5 mg was administered orally twice per day with pembrolizumab 2 mg/kg given intravenously every 3 weeks. We assessed safety in all patients who received at least one dose of axitinib or pembrolizumab; antitumour activity was assessed in all patients who received study treatment and had an adequate baseline tumour assessment. The primary endpoint was investigator-assessed dose-limiting toxicity during the first two cycles (6 weeks) to estimate the maximum tolerated dose and recommended phase 2 dose. This study is registered with ClinicalTrials.gov, number NCT02133742.<h4>Findings</h4>Between Sept 23, 2014, and March 25, 2015, we enrolled 11 patients with previously untreated advanced renal cell carcinoma to the dose-finding phase and between June 3, 2015, and Oct 13, 2015, we enrolled 41 patients to the dose-expansion phase. All 52 patients were analysed together. No unexpected toxicities were observed. Three dose-limiting toxicities were reported in the 11 patients treated during the 6-week observation period (dose-finding phase): one patient had a transient ischaemic attack and two patients were only able to complete less than 75% of the planned axitinib dose because of treatment-related toxicity. At the data cutoff date (March 31, 2017), 25 (48%) patients were still receiving study treatment. Grade 3 or worse treatment-related adverse events occurred in 34 (65%) patients; the most common included hypertension (n=12 [23%]), diarrhoea (n=5 [10%]), fatigue (n=5 [10%]), and increased alanine aminotransferase concentration (n=4 [8%]). The most common potentially immune-related adverse events (probably related to pembrolizumab) included diarrhoea (n=15 [29%]), increased alanine aminotransferase concentration (n=9 [17%]) or aspartate aminotransferase concentration (n=7 [13%]), hypothyroidism (n=7 [13%]), and fatigue (n=6 [12%]). 28 (54%) patients had treatment-related serious adverse events. At data cutoff, 38 (73%; 95% CI 59·0-84·4) patients achieved an objective response (complete or partial response).<h4>Interpretation</h4>The treatment combination of axitinib plus pembrolizumab is tolerable and shows promising antitumour activity in patients with treatment-naive advanced renal cell carcinoma. Whether or not the combination works better than a sequence of VEGF pathway inhibition followed by an anti-PD-1 therapy awaits the completion of a phase 3 trial comparing axitinib plus pembrolizumab with sunitinib monotherapy (NCT02853331).<h4>Funding</h4>Pfizer Inc.

Also flagged:synthesispyrazoleG-protein-coupled receptor 52Gs-coupled G-protein-coupled receptordopamine D2 receptordopamine
Journal Article 2018-02-10 ✓ 5 Snippets Nakahata T, Tokumaru K, Ito Y, Ishii N, Setoh M, Shimizu Y, Harasawa T, Aoyama K, Hamada T, Kori M, Aso K.
In-Text Gene Mentions

While evaluating the pyrazole derivatives, introduction of a methyl substituent at the 3-position of the pyrazole ring led to increased GPR52 agonistic activity.

…novel series ofG protein-coupled receptor 52protein-coupled receptor 52…

…protein-coupled receptor 52 (GPR52) agonists.…

…-protein-coupled receptor 52 (GPR52) is classified as…

GPR52cancels dopamine D2…

Show Full Abstract

G-protein-coupled receptor 52 (GPR52) is classified as an orphan Gs-coupled G-protein-coupled receptor. GPR52 cancels dopamine D2 receptor signaling and activates dopamine D1/N-methyl-d-aspartate receptors via intracellular cAMP accumulation. Therefore, GPR52 agonists are expected to alleviate symptoms of psychotic disorders. A novel series of 1-(benzothiophen-7-yl)-1H-pyrazole as GPR52 agonists was designed and synthesized based on compound 1b. Compound 1b has been reported by our group as the first orally active GPR52 agonist, but high lipophilicity and poor aqueous solubility still remained as issues for candidate selection. To resolve these issues, replacement of the benzene ring at the 7-positon of compound 1b with heterocylic rings, such as pyrazole and pyridine, was greatly expected to reduce lipophilicity to levels for which calculated logD values were lower than that of compound 1b. While evaluating the pyrazole derivatives, introduction of a methyl substituent at the 3-position of the pyrazole ring led to increased GPR52 agonistic activity. Moreover, additional methyl substituent at the 5-position of the pyrazole and further introduction of hydroxy group to lower logD led to significant improvement of solubility while maintaining the activity. As a result, we identified 3-methyl-5-hydroxymethyl-1H-pyrazole derivative 17 (GPR52 EC<sub>50</sub> = 21 nM, E<sub>max</sub> = 103%, logD = 2.21, Solubility at pH 6.8 = 21 μg/mL) with potent GPR52 agonistic activity and good solubility compared to compound 1b. Furthermore, this compound 17 dose-dependently suppressed methamphetamine-induced hyperlocomotion in mice.

Also flagged:cDNAVcVitamin Cdemyelinating diseasesMultiple Sclerosismyelin sheaths
Journal Article 2018-02-09 ✓ 1 Snippet Guo YE, Suo N, Cui X, Yuan Q, Xie X.
In-Text Gene Mentions

…Id4, Hes5, andSox6are critical in…

Show Full Abstract

Oligodendrocyte-formed myelin sheaths play important roles in the neuronal functions in the central nervous system. In demyelinating diseases, such as Multiple Sclerosis, the myelin sheaths are damaged and the remyelinating process is somehow hindered. Restoration of the myelin sheaths requires the differentiation of the oligodendrocyte precursor cells (OPCs) into mature oligodendrocytes (OLs). To discover small molecule compounds that might promote the OPC to OL differentiation, a high-throughput screening system is established and L-ascorbyl-2-phosphate (As-2P), a stable form of Vitamin C (Vc), is found to greatly enhance the OPC to OL differentiation. As-2P promotes gradual expression of OL lineage markers, including O4, CNPase and MBP, in a dose- and time-dependent manner. It also facilitates the formation of myelin sheaths in OPC-neuron co-culture. As-2P also promotes the repair of the myelin sheaths in vivo and provides significant therapeutic effect in a cuprizone-mediated demyelination animal model. Interestingly, As-2P's function in promoting OPC differentiation is not related to its antioxidant activity. And an intracellular rather than an extracellular mechanism might be involved. Considering the safe use of Vc as a dietary supplement for many years, it might also be used as an alternative medicine for CNS demyelinating diseases.

Also flagged:IronHyperuricemiametabolismgoutcardiovascular diseasestransferrin receptors
Journal Article 2018-02-09 ✓ 1 Snippet Li X, He T, Yu K, Lu Q, Alkasir R, Guo G, Xue Y.
In-Text Gene Mentions

…French patients withhemochromatosis.…

Show Full Abstract

<h4>Background</h4>Elevated serum uric acid (SUA) involved in iron metabolism, has been increasingly recognized as a risk factor for gout and cardiovascular diseases. The objective of this study was to examine the associations between markers of iron status with risk of hyperuricemia (HU) in Chinese adult population.<h4>Methods</h4>Data were extracted from the 2009 wave of the China Health and Nutrition Survey, consisting of 7946 apparently healthy adults. Serum ferritin (SF), transferrin, soluble transferrin receptors (sTfR), hemoglobin (Hb), high-sensitivity C-reactive protein (hs-CRP), and SUA were measured. Diet was assessed with three consecutive 24 h recalls. Demographic characteristics, smoking status, alcohol consumption, and physical activities were investigated using a structured questionnaire. Multilevel mixed-effects models were constructed to estimate the associations of SF, transferrin, sTfR, and Hb with SUA and the risk of HU.<h4>Results</h4>The crude prevalence of HU was 16.1%. SF, transferrin, and Hb levels were positively associated with SUA and the risk of HU after adjustment for cluster effects and potential confounders (all <i>p</i>-trend < 0.05). Compared with participants in the lowest quartile of SF, those in the highest quartile had significantly higher SUA concentrations (β = 0.899 mg/dL, 95% confidence interval (CI): 0.788, 1.010; <i>p</i> < 0.001) and higher risk of HU (odds ratio (OR) = 3.086, 95% CI: 2.450, 3.888; <i>p</i> < 0.001). Participants with the highest quartile of transferrin had significantly higher SUA concentrations (β = 0.488 mg/dL, 95% CI: 0.389, 0.587; <i>p</i> < 0.001) and higher risk of HU (OR: 1.900; 95% CI: 1.579, 2.286; <i>p</i> < 0.001) when compared with those with the lowest quartile. In male participants, those in the highest quartile of Hb had significantly higher risk of HU when compared to the reference group (OR: 1.401, 95% CI: 1.104, 1.777; <i>p</i> < 0.01); however, this association was not found in female participants (OR: 1.093; 95% CI: 0.821, 1.455; <i>p</i> = 0.544).<h4>Conclusion</h4>SF, transferrin, and Hb levels were positively associated with the risk of HU, and additional studies are needed to confirm the findings, as well as to elucidate their underlying mechanisms.

Also flagged:Insulin resistancetriglyceridetype 2 diabetes mellitusnon-alcoholic fatty liver diseaseNAFLDobesity
Journal Article 2018-02-09 ✓ 1 Snippet Gonzalez-Cantero J, Martin-Rodriguez JL, Gonzalez-Cantero A, Arrebola JP, Gonzalez-Calvin JL.
In-Text Gene Mentions

…primary biliary cirrhosis,hemochromatosis, Wilson’s disease, cancer,…

Show Full Abstract

<h4>Aims</h4>Insulin resistance is the pathophysiological precursor of type 2 diabetes mellitus (DM-2), and its relationship with non-alcoholic fatty liver disease (NAFLD) has been widely studied in patients with obesity or metabolic syndrome using not only ultrasound but also liver biopsies or proton magnetic resonance spectroscopy (H1-MRS) to assess liver fat content. In contrast, there are no studies on insulin resistance and NAFLD in lean or overweight Caucasian individuals using H1-MRS or liver biopsies for the quantification of hepatic triglyceride content. Our objectives were to study the presence of insulin resistance in lean and overweight Caucasian adults and investigate its possible relationship with liver triglyceride content, waist circumference (as proxy of visceral adiposity), BMI, and cardiometabolic risk factors.<h4>Methods</h4>A cross-sectional study was conducted in 113 non-obese, non-diabetic individuals classified as overweight (BMI 25-29.9 kg/m2) or lean (BMI 19.5-24.9 kg/m2). Hepatic triglyceride content was quantified by 3T H1-MRS. NAFLD was defined as hepatic triglyceride content >5.56%. Insulin resistance (HOMA-IR), serum adiponectin, and tumor necrosis factor (TNF) were determined.<h4>Results</h4>HOMA-IR was significantly correlated with hepatic triglyceride content (r:0.76; p<0.0001). The lean-with-NAFLD group had significantly higher HOMA-IR (p<0.001) and lower serum adiponectin (p<0.05) than the overweight-without-NAFLD group. Insulin resistance was independently associated with NAFLD but not with waist circumference or BMI. Regression analysis showed hepatic triglyceride content to be the most important determinant of insulin resistance (p<0.01).<h4>Conclusions</h4>Our findings suggest that NAFLD, once established, seems to be involved in insulin resistance and cardio-metabolic risk factors above and beyond waist circumference and BMI in non-obese, non-diabetic Caucasian individuals.

Also flagged:cancerstumourmelanomaBRAFdeathtumours
Journal Article 2018-02-09 ✓ 5 Snippets Werner-Klein M, Scheitler S, Hoffmann M, Hodak I, Dietz K, Lehnert P, Naimer V, Polzer B, Treitschke S, Werno C, Markiewicz A, Weidele K, Czyz Z, Hohenleutner U, Hafner C, Haferkamp S, Berneburg M, Rümmele P, Ulmer A, Klein CA.
In-Text Gene Mentions

To determine the ADO in single cells from human primary tumours or DCC-derived xenografts of patients with known mutational BRAF/NRAS status, tumour tissue was digested with collagenase (0.33 μg/ml, Sigma-Aldrich) and DNAseI (0.1 mg/ml Roche) to obtain a single-cell suspension.

…identify for eachDCCalteration the most…

…were developed fromDCC-derived xenografts and are…

…Ki-67 labelling ofDCC

…corresponding to theDCCmeasurement data D…

Show Full Abstract

Mouse models indicate that metastatic dissemination occurs extremely early; however, the timing in human cancers is unknown. We therefore determined the time point of metastatic seeding relative to tumour thickness and genomic alterations in melanoma. Here, we find that lymphatic dissemination occurs shortly after dermal invasion of the primary lesion at a median thickness of ~0.5 mm and that typical driver changes, including BRAF mutation and gained or lost regions comprising genes like MET or CDKNA2, are acquired within the lymph node at the time of colony formation. These changes define a colonisation signature that was linked to xenograft formation in immunodeficient mice and death from melanoma. Thus, melanoma cells leave primary tumours early and evolve at different sites in parallel. We propose a model of metastatic melanoma dormancy, evolution and colonisation that will inform direct monitoring of adjuvant therapy targets.

Also flagged:behaviouralpsychiatric disordersserotonin transporterserotonin5-hydroxytryptaminesleep
Journal Article 2018-02-09 ✓ 3 Snippets Åslund C, Nilsson KW.
In-Text Gene Mentions

One main regulator of serotonin is the serotonin transporter (5-HTT), which removes the serotonin released into the synaptic cleft.

…the serotonin transporter (5-HTT), which removes the…

…The5-HTTprotein is encoded…

Show Full Abstract

The gene-environment interaction research field in psychiatry has traditionally been dominated by the diathesis-stress framework, where certain genotypes are assumed to confer increased risk for adverse outcomes in a stressful environment. In later years, theories of differential susceptibility, or biological sensitivity, suggest that candidate genes that interact with environmental events do not exclusively confer a risk for behavioural or psychiatric disorders but rather seem to alter the sensitivity to both positive and negative environmental influences. The present study investigates the susceptibility properties of the serotonin transporter-linked polymorphic region (5HTTLPR) in relation to depressive symptoms and delinquency in two separate adolescent community samples: n = 1457, collected in 2006; and n = 191, collected in 2001. Two-, three-, and four-way interactions between the 5HTTLPR, positive and negative family environment, and sex were found in relation to both depressive symptoms and delinquency. However, the susceptibility properties of the 5HTTLPR were distinctly less pronounced in relation to depressive symptoms. If the assumption that the 5HTTLPR induces differential susceptibility to both positive and negative environmental influences is correct, the previous failures to measure and control for positive environmental factors might be a possible explanation for former inconsistent findings within the research field.

Also flagged:serotonin transportermethylationdemethylationnucleusPTSDhydroxymethylcytosine
Journal Article 2018-02-09 ✓ 2 Snippets Shan L, Guo HY, van den Heuvel CNAM, van Heerikhuize J, Homberg JR.
In-Text Gene Mentions

Candidate genes are those encoding for BDNF42, 43 and gamma‐aminobutyric acid (GABA) signaling components44 and the glucocorticoid receptor.45, 46 Finally, given that PTSD is associated with fear extinction deficits due to impaired recall of the fear extinction memory,47 a similar study should be followed up to investigate the association between epigenetic mechanisms and the recall of the fear extinction memory in 5‐HTT−/− rats.18

…Nonextinction 5‐HTT−/− rats exhibited…

Show Full Abstract

<h4>Aims</h4>One potential risk factor for posttraumatic stress disorder (PTSD) involves the low activity (short; s) allelic variant of the serotonin transporter-linked polymorphic region (5-HTTLPR), possibly due to reduced prefrontal control over the amygdala. Evidence shows that DNA methylation/demethylation is crucial for fear extinction in these brain areas and is associated with neuronal activation marker c-Fos expression. We hypothesized that impaired fear extinction in serotonin transporter knockout (5-HTT<sup>-/-</sup> ) rats is related to changes in DNA (de) methylation and c-Fos expression in the prefrontal cortex (PFC) and/or amygdala.<h4>Methods</h4>5-HTT<sup>-/-</sup> and 5-HTT<sup>+/+</sup> rats were subjected to fear extinction. 2 hours after the extinction session, the overall levels of DNA methylation (5-mC), demethylation (5-hmC), and c-Fos in fear extinction and nonfear extinction rats were measured by immunohistochemistry.<h4>Results</h4>5-HTT<sup>-/-</sup> rats displayed decreased fear extinction. This was associated with reduced c-Fos activity in the infralimbic PFC. In the central nucleus of the amygdala, c-Fos immunoreactivity was increased in the fear extinction group compared to the no-fear extinction group, regardless of genotype. 5-hmC levels were unaltered in the PFC, but reduced in the amygdala of nonextinction 5-HTT<sup>-/-</sup> rats compared to nonextinction wild-type rats, which caught up to wild-type levels during fear extinction. 5-mC levels were stable in central amygdala in both wild-type and 5-HTT<sup>-/-</sup> extinction rats. Finally, c-Fos and 5-mC levels were correlated with the prelimbic PFC, but not amygdala.<h4>Conclusions</h4>In the amygdala, DNA demethylation, independent from c-Fos activation, may contribute to individual differences in risk for PTSD, as conferred by the 5-HTTLPR s-allele.

Also flagged:Huntington's diseaseHDSPNhereditary neurodegenerative disorderNMDA ‐type glutamate receptorsendoplasmic reticulum IP 3 receptors
Journal Article 2018-02-09 ✓ 1 Snippet Mackay JP, Nassrallah WB, Raymond LA.
In-Text Gene Mentions

HTT

Show Full Abstract

Huntington's disease (HD) is a hereditary neurodegenerative disorder of typically middle-aged onset for which there is no disease-modifying treatment. Caudate and putamen medium-sized spiny projection neurons (SPNs) most severely degenerate in HD. However, it is unclear why mutant huntingtin protein (mHTT) is preferentially toxic to these neurons or why symptoms manifest only relatively late in life. mHTT interacts with numerous neuronal proteins. Likewise, multiple SPN cellular processes have been described as altered in various HD models. Among these, altered neuronal Ca<sup>2+</sup> influx and intracellular Ca<sup>2+</sup> handling feature prominently and are addressed here. Specifically, we focus on extrasynaptic NMDA-type glutamate receptors, endoplasmic reticulum IP3 receptors, and mitochondria. As mHTT is expressed throughout development, compensatory processes will likely be mounted to mitigate any deleterious effects. Although some compensations can lessen mHTT's disruptive effects, others-such as upregulation of the ER-refilling store-operated Ca<sup>2+</sup> channel response-contribute to pathogenesis. A causation-based approach is therefore necessary to decipher the complex sequence of events linking mHTT to neurodegeneration, and to design rational therapeutic interventions. With this in mind, we highlight evidence, or lack thereof, that the above alterations in Ca<sup>2+</sup> handling occur early in the disease process, clearly interact with mHTT, and show disease-modifying potential when reversed in animals.

Also flagged:Tracheobronchomalaciacongenital disorderWntWlsNotumdeacylase
Journal Article 2018-02-09 ✓ 1 Snippet Gerhardt B, Leesman L, Burra K, Snowball J, Rosenzweig R, Guzman N, Ambalavanan M, Sinner D.
In-Text Gene Mentions

Lrrc7

Show Full Abstract

Tracheobronchomalacia (TBM) is a common congenital disorder in which the cartilaginous rings of the trachea are weakened or missing. Despite the high prevalence and clinical issues associated with TBM, the etiology is largely unknown. Our previous studies demonstrated that Wntless (Wls) and its associated Wnt pathways are critical for patterning of the upper airways. Deletion of Wls in respiratory endoderm caused TBM and ectopic trachealis muscle. To understand mechanisms by which Wls mediates tracheal patterning, we performed RNA sequencing in prechondrogenic tracheal tissue of Wls<sup>f/f</sup>;Shh<sup>Cre/wt</sup> embryos. Chondrogenic Bmp4, and Sox9 were decreased, while expression of myogenic genes was increased. We identified Notum, a deacylase that inactivates Wnt ligands, as a target of Wls induced Wnt signaling. Notum's mesenchymal ventral expression in prechondrogenic trachea overlaps with expression of Axin2, a Wnt/β-catenin target and inhibitor. Notum is induced by Wnt/β-catenin in developing trachea. Deletion of Notum activated mesenchymal Wnt/β-catenin and caused tracheal mispatterning of trachealis muscle and cartilage as well as tracheal stenosis. Notum is required for tracheal morphogenesis, influencing mesenchymal condensations critical for patterning of tracheal cartilage and muscle. We propose that Notum influences mesenchymal cell differentiation by generating a barrier for Wnt ligands produced and secreted by airway epithelial cells to attenuate Wnt signaling.

Also flagged:anaplastic large cell lymphomapseudogoutgranulocyte-stimulating factorG-CSFchondro-calcinosiscalcium
Journal Article 2018-02-09 ✓ 1 Snippet Hatayama M, Ikuta K, Ishioh M, Saito T, Toki Y, Yamamoto M, Shindo M, Torimoto Y, Okumura T.
In-Text Gene Mentions

…disease, such ashemochromatosis, hyperparathyroidism and hypo…

Show Full Abstract

A 67-year-old man with relapsed anaplastic large cell lymphoma received salvage chemotherapy, and pegfilgrastim was used to prevent febrile neutropenia. On day 18 of chemotherapy, he developed a pseudogout attack. Although the first symptoms improved, another pseudogout attack occurred when he received the second course of chemotherapy and pegfilgrastim. Filgrastim was then used for the third course of chemotherapy, and a pseudogout attack did not occur. The serum granulocyte-stimulating factor (G-CSF) level was extremely elevated only when pegfilgrastim was used, suggesting a relationship between pseudogout and G-CSF. Pseudogout should be recognized as an adverse effect of pegfilgrastim.

Also flagged:Neurological diseasesdementiasAlzheimer's diseaseADfronto-temporal dementiadegenerative motor neuron diseases
Journal Article 2018-02-09 No Snippets Ghaffari LT, Starr A, Nelson AT, Sattler R.
Show Full Abstract

Neurological diseases, including dementias such as Alzheimer's disease (AD) and fronto-temporal dementia (FTD) and degenerative motor neuron diseases such as amyotrophic lateral sclerosis (ALS), are responsible for an increasing fraction of worldwide fatalities. Researching these heterogeneous diseases requires models that endogenously express the full array of genetic and epigenetic factors which may influence disease development in both familial and sporadic patients. Here, we discuss the two primary methods of developing patient-derived neurons and glia to model neurodegenerative disease: reprogramming somatic cells into induced pluripotent stem cells (iPSCs), which are differentiated into neurons or glial cells, or directly converting (DC) somatic cells into neurons (iNeurons) or glial cells. Distinct differentiation techniques for both models result in a variety of neuronal and glial cell types, which have been successful in displaying unique hallmarks of a variety of neurological diseases. Yield, length of differentiation, ease of genetic manipulation, expression of cell-specific markers, and recapitulation of disease pathogenesis are presented as determining factors in how these methods may be used separately or together to ascertain mechanisms of disease and identify therapeutics for distinct patient populations or for specific individuals in personalized medicine projects.

Also flagged:immunoglobulin superfamily cell adhesion moleculeobesitydifficultiesintellectual disabilitypsychiatric disordersbehavioral
Journal Article 2018-02-09 ✓ 5 Snippets Singh K, Loreth D, Pöttker B, Hefti K, Innos J, Schwald K, Hengstler H, Menzel L, Sommer CJ, Radyushkin K, Kretz O, Philips MA, Haas CA, Frauenknecht K, Lilleväli K, Heimrich B, Vasar E, Schäfer MKE.
In-Text Gene Mentions

Negr1-deficiency Does Not Affect Activity, Anxiety-like Behavior and Sensorimotor Gating

These results indicate that, Negr1-deficiency does not affect activity, anxiety-like behavior and sensorimotor gating.

Neuronal Growth and Behavioral Alterations in Mice Deficient for the Psychiatric Disease-Associated Negr1 Gene

Moreover, Negr1-KO mice showed reversal learning deficits in the Morris water maze and increased susceptibility to pentylenetetrazol (PTZ)-induced seizures.

Seizure susceptibility in mice (Negr1-WT: n = 13, Negr1-KO: n = 14) was studied after single administration of pentylenetetrazol (PTZ; s.c. 50 mg/kg body weight) and monitored for 30 min using a video camera.

Show Full Abstract

Neuronal growth regulator 1 (NEGR1), a member of the immunoglobulin superfamily cell adhesion molecule subgroup IgLON, has been implicated in neuronal growth and connectivity. In addition, genetic variants in or near the NEGR1 locus have been associated with obesity and more recently with learning difficulties, intellectual disability and psychiatric disorders. However, experimental evidence is lacking to support a possible link between NEGR1, neuronal growth and behavioral abnormalities. Initial expression analysis of NEGR1 mRNA in C57Bl/6 wildtype (WT) mice by <i>in situ</i> hybridization demonstrated marked expression in the entorhinal cortex (EC) and dentate granule cells. In co-cultures of cortical neurons and NSC-34 cells overexpressing NEGR1, neurite growth of cortical neurons was enhanced and distal axons occupied an increased area of cells overexpressing NEGR1. Conversely, in organotypic slice co-cultures, <i>Negr1</i>-knockout (KO) hippocampus was less permissive for axons grown from EC of β-actin-enhanced green fluorescent protein (EGFP) mice compared to WT hippocampus. Neuroanatomical analysis revealed abnormalities of EC axons in the hippocampal dentate gyrus (DG) of <i>Negr1</i>-KO mice including increased numbers of axonal projections to the hilus. Neurotransmitter receptor ligand binding densities, a proxy of functional neurotransmitter receptor abundance, did not show differences in the DG of <i>Negr1</i>-KO mice but altered ligand binding densities to NMDA receptor and muscarinic acetylcholine receptors M1 and M2 were found in CA1 and CA3. Activity behavior, anxiety-like behavior and sensorimotor gating were not different between genotypes. However, <i>Negr1</i>-KO mice exhibited impaired social behavior compared to WT littermates. Moreover, <i>Negr1</i>-KO mice showed reversal learning deficits in the Morris water maze and increased susceptibility to pentylenetetrazol (PTZ)-induced seizures. Thus, our results from neuronal growth assays, neuroanatomical analyses and behavioral assessments provide first evidence that deficiency of the psychiatric disease-associated <i>Negr1</i> gene may affect neuronal growth and behavior. These findings might be relevant to further evaluate the role of NEGR1 in cognitive and psychiatric disorders.

Also flagged:siliconeretinal detachmentAll‐trans retinoic acidpolydimethylsiloxaneRDRhegmatogenous retinal detachment
Journal Article 2018-02-09 No Snippets Cauldbeck H, Le Hellaye M, McDonald TO, Long M, Williams RL, Rannard SP, Kearns VR.
Show Full Abstract

Complicated cases of retinal detachment can be treated with silicone oil tamponades. There is the potential for silicone oil tamponades to have adjunctive drug releasing behaviour within the eye, however the lipophilic nature of silicone oil limits the number of drugs that are suitable, and drug release from the hydrophobic reservoir is uncontrolled. Here, a radiometric technique was developed to accurately measure drug solubility in silicone oil and measure release into culture media. All-trans retinoic acid (atRA), a lipophilic drug known to act as an anti-proliferative within the eye, was used throughout this work. Chain-end modification of polydimethylsiloxane with atRA produced a polydimethylsiloxane retinoate (PDMS-atRA), which was used as an additive to silicone oil to modify the solvent environment within the silicone oil and the distribution coefficient. Blends of PDMS-atRA and silicone oil containing different concentrations of free atRA were produced. The presence of PDMS-atRA in silicone oil had a positive effect on atRA solubility and the longevity of release <i>in vitro</i>. The drug release period was independent of atRA starting concentration and dependent on the PDMS-atRA concentration in the blend. A clinically relevant release period of atRA over 7 weeks from a silicone oil blend with PDMS-atRA was observed. © 2018 The Authors. Journal of Polymer Science Part A: Polymer Chemistry Published by Wiley Periodicals, Inc. J. Polym. Sci., Part A: Polym. Chem. <b>2018</b>, <i>56</i>, 938-946.

Also flagged:CCGfibroblast growth factor-2Nucleotideβ-actinGAGntr
Journal Article 2018-02-08 No Snippets Kolhe R, Mondal AK, Pundkar C, Periyasamy-Thandavan S, Mendhe B, Hunter M, Isales CM, Hill WD, Hamrick MW, Fulzele S.
Show Full Abstract

MicroRNAs (miRNAs) are small (18-25 nucleotides), noncoding RNAs that have been identified as potential regulators of bone marrow stromal cell (BMSC) proliferation, differentiation, and musculoskeletal development. Vitamin C is known to play a vital role in such types of biological processes through various different mechanisms by altering mRNA expression. We hypothesized that vitamin C mediates these biological processes partially through miRNA regulation. We performed global miRNA expression analysis on human BMSCs following vitamin C treatment using microarrays containing human precursor and mature miRNA probes. Bioinformatics analyses were performed on differentially expressed miRNAs to identify novel target genes and signaling pathways. Our bioinformatics analysis suggested that the miRNAs may regulate multiple stem cell-specific signaling pathways such as cell adhesion molecules (CAMs), fatty acid biosynthesis and hormone signaling pathways. Furthermore, our analysis predicted novel stem cell proliferation and differentiation gene targets. The findings of the present study demonstrate that vitamin C can have positive effects on BMSCs in part by regulating miRNA expression.

Also flagged:CC chemokine receptor 2insulin resistanceNonalcoholic fatty liver diseaseNAFLDobesityliver disease
Journal Article 2018-02-08 ✓ 1 Snippet Parker R, Weston CJ, Miao Z, Corbett C, Armstrong MJ, Ertl L, Ebsworth K, Walters MJ, Baumart T, Newland D, McMahon J, Zhang P, Singh R, Campbell J, Newsome PN, Charo I, Schall TJ, Adams DH.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD) is a common disease, closely associated with obesity and insulin resistance. We investigated the presence of a subset of myeloid cells associated with metabolic disturbance in the liver of patients with NAFLD and a murine model of obesity-induced liver disease. Gene and protein expression in liver and serum was investigated with RT-PCR or ELISA and correlated to clinical disease. Liver-infiltrating immune cells were isolated from normal or diseased human liver for flow cytometric analysis. In animal experiments, mice were fed a high-fat diet (60% of calories from fat) for 16 wk, or high-fat diet with 30% fructose for 32 wk to induce steatohepatitis and fibrosis. A small molecule inhibitor of CC chemokine receptor 2 (CCR2), CCX872, was administered to some mice. A subset of CD11c<sup>+</sup>CD206<sup>+</sup> immune cells was enriched in human liver tissue, and greater infiltration was observed in NAFLD. The presence of CD11c<sup>+</sup>CD206<sup>+</sup> myeloid cells correlated with systemic insulin resistance. CD11c<sup>+</sup>CD206<sup>+</sup> cells expressed high levels of CCR2, and liver CC chemokine ligand 2 (CCL2) expression was increased in nonalcoholic steatohepatitis and correlated with disease activity. In mice, CCR2 inhibition reduced infiltration of liver CD11b<sup>+</sup>CD11c<sup>+</sup>F4/80<sup>+</sup> monocytes, which are functional homologs of human CD11c<sup>+</sup>CD206<sup>+</sup> cells, and improved liver injury and glycemic control. A role for CCR2/CCL2 in human NAFLD has long been postulated. These data confirm a role for this chemokine/receptor axis, through mediating adipose and hepatic infiltration of myeloid cells. Inhibition of CCR2 improved hepatic inflammation and fibrosis in murine models of NAFLD. These data confirm the rationale for targeting CCR2 to treat NAFLD. NEW & NOTEWORTHY These data show for the first time that CD11c<sup>+</sup>CD206<sup>+</sup> myeloid cells, previously associated with human adipose tissue inflammation, infiltrate into liver tissue in nonalcoholic fatty liver disease. These cells express CCR2. Inhibition of CCR2 in mice inhibits hepatic inflammation caused by a murine homolog of these myeloid cells and improves experimental liver disease.

Also flagged:peroxiredoxin-5peroxiredoxinPRDX5Peroxiredoxinsthiol-dependent peroxidasesPRDX1
Journal Article 2018-02-08 ✓ 5 Snippets Pirson M, Pirson M, Clippe A, Knoops B.
In-Text Gene Mentions

In most vertebrates, the PRDX family comprises 6 enzymes (PRDX1–6) divided into three subgroups depending on their catalytic mechanism and the conservation of their catalytic cysteines: typical 2-Cys PRDXs (PRDX1–4), atypical 2-Cys PRDX (PRDX5) and 1-Cys PRDX (PRDX6) [5, 6].

…and 1-Cys PRDX (PRDX6) [ 5 ,…

…For the 1-cysPRDX6, reduction of the…

…PRDX1, PRDX3–4, andPRDX6isoforms was previously…

…(Prdxs1–4) and 1-cysPRDX6, and have offered…

Show Full Abstract

<h4>Background</h4>Peroxiredoxins are ubiquitous thiol-dependent peroxidases that represent a major antioxidant defense in both prokaryotic cells and eukaryotic organisms. Among the six vertebrate peroxiredoxin isoforms, peroxiredoxin-5 (PRDX5) appears to be a particular peroxiredoxin, displaying a different catalytic mechanism, as well as a wider substrate specificity and subcellular distribution. In addition, several evolutionary peculiarities, such as loss of subcellular targeting in certain species, have been reported for this enzyme.<h4>Results</h4>Western blotting analyses of 2-cys PRDXs (PRDX1-5) failed to identify the PRDX5 isoform in chicken tissue homogenates. Thereafter, via in silico analysis of PRDX5 orthologs, we went on to show that the PRDX5 gene is conserved in all branches of the amniotes clade, with the exception of aves. Further investigation of bird genomic sequences and expressed tag sequences confirmed the disappearance of the gene, though TRMT112, a gene located closely to the 5' extremity of the PRDX5 gene, is conserved. Finally, using in ovo electroporation to overexpress the long and short forms of human PRDX5, we showed that, though the gene is lost in birds, subcellular targeting of human PRDX5 is conserved in the chick.<h4>Conclusions</h4>Further adding to the distinctiveness of this enzyme, this study reports converging evidence supporting loss of PRDX5 in aves. In-depth analysis revealed that this absence is proper to birds as PRDX5 appears to be conserved in non-avian amniotes. Finally, taking advantage of the in ovo electroporation technique, we validate the subcellular targeting of human PRDX5 in the chick embryo and bring forward this gain-of-function model as a potent way to study PRDX5 functions in vivo.

Also flagged:deathWaterobesitysynthesisLIPA
Journal Article 2018-02-08 No Snippets Dowd KP, Szeklicki R, Minetto MA, Murphy MH, Polito A, Ghigo E, van der Ploeg H, Ekelund U, Maciaszek J, Stemplewski R, Tomczak M, Donnelly AE.
Show Full Abstract

The links between increased participation in Physical Activity (PA) and improvements in health are well established. As this body of evidence has grown, so too has the search for measures of PA with high levels of methodological effectiveness (i.e. validity, reliability and responsiveness to change). The aim of this "review of reviews" was to provide a comprehensive overview of the methodological effectiveness of currently employed measures of PA, to aid researchers in their selection of an appropriate tool. A total of 63 review articles were included in this review, and the original articles cited by these reviews were included in order to extract detailed information on methodological effectiveness.Self-report measures of PA have been most frequently examined for methodological effectiveness, with highly variable findings identified across a broad range of behaviours. The evidence-base for the methodological effectiveness of objective monitors, particularly accelerometers/activity monitors, is increasing, with lower levels of variability observed for validity and reliability when compared to subjective measures. Unfortunately, responsiveness to change across all measures and behaviours remains under-researched, with limited information available.Other criteria beyond methodological effectiveness often influence tool selection, including cost and feasibility. However, researchers must be aware of the methodological effectiveness of any measure selected for use when examining PA. Although no "perfect" tool for the examination of PA in adults exists, it is suggested that researchers aim to incorporate appropriate objective measures, specific to the behaviours of interests, when examining PA in free-living environments.

Also flagged:Type IV collagen α6keratin 10keratinizationmembranetype IV collagentype IV collagen isoform α6
Journal Article 2018-02-08 No Snippets Komori T, Ono M, Hara ES, Ueda J, Nguyen HTT, Nguyen HT, Yonezawa T, Maeba T, Kimura-Ono A, Takarada T, Momota R, Maekawa K, Kuboki T, Oohashi T.
Show Full Abstract

Keratinized mucosa is of fundamental importance to maintain healthy gingival tissue, and understanding the mechanisms of oral mucosa keratinization is crucial to successfully manage healthy gingiva. Previous studies have shown a strong involvement of the basement membrane in the proliferation and differentiation of epithelial cells. Therefore, first, to identify the keratinized mucosa-specific basement membrane components, immunohistochemical analysis for the six alpha chains of type IV collagen was performed in 8-week-old mice. No difference in the expression pattern of type IV collagen α1(IV) and α2(IV) chains was observed in the keratinized and non-keratinized mucosa. Interestingly, however, type IV collagen α5(IV) and α6(IV) chains specifically were strongly detected in the keratinized mucosa. To analyze the functional roles of the type IV collagen isoform α6(IV) in oral mucosa keratinization, we analyzed Col4a6-knockout mice. Epithelial developmental delay and low levels of KRT10 were observed in new-born Col4a6-knockout mice. Additionally, in vitro experiments with loss-of function analysis using human gingival epithelial cells confirmed the important role of α6(IV) chain in epithelial keratinization. These findings indicate that α112:α556 (IV) network, which is the only network that includes the α6(IV) chain, is one regulator of KRT10 expression in keratinization of oral mucosal epithelium.

Also flagged:nanorodsnanoparticlecalcium phosphatepoly(acrylic acid)hydroxyapatiteair
Journal Article 2018-02-08 ✓ 1 Snippet Nakayama M, Kajiyama S, Kumamoto A, Nishimura T, Ikuhara Y, Yamato M, Kato T.
In-Text Gene Mentions

Ca10

Show Full Abstract

Liquid crystals are mostly formed by self-assembly of organic molecules. In contrast, inorganic materials available as liquid crystals are limited. Here we report the development of liquid-crystalline (LC) hydroxyapatite (HAp), which is an environmentally friendly and biocompatible biomineral. Its alignment behavior, magneto-optical properties, and atomic-scale structures are described. We successfully induce LC properties into aqueous colloidal dispersions of rod-shaped HAp by controlling the morphology of the material using acidic macromolecules. These LC HAp nanorod materials are macroscopically oriented in response to external magnetic fields and mechanical forces. We achieve magnetic modulation of the optical transmission by dynamic control of the LC order. Atomic-scale observations using transmission electron microscopy show the self-organized inorganic/organic hybrid structures of mesogenic nanorods. HAp liquid crystals have potential as bio-friendly functional materials because of their facile preparation, the bio-friendliness of HAp, and the stimuli-responsive properties of these colloidal ordered fluids.

Also flagged:HuRHiraChromatin remodelingMcm2microtubuleMapre2
Journal Article 2018-02-08 ✓ 1 Snippet Wang F, Zhu S, Fisher LA, Wang W, Oakley GG, Li C, Peng A.
In-Text Gene Mentions

Condensinsubunit Smc2 was…

Show Full Abstract

The specific function of PP2A, a major serine/threonine phosphatase, is mediated by regulatory targeting subunits, such as members of the B55 family. Although implicated in cell division and other pathways, the specific substrates and functions of B55 targeting subunits are largely undefined. In this study we identified over 100 binding proteins of B55α and B55β in Xenopus egg extracts that are involved in metabolism, mitochondria function, molecular trafficking, cell division, cytoskeleton, DNA replication, DNA repair, and cell signaling. Among the B55α and B55β-associated proteins were numerous mitotic regulators, including many substrates of CDK1. Consistently, upregulation of B55α accelerated M-phase exit and inhibited M-phase entry. Moreover, specific substrates of CDK2, including factors of DNA replication and chromatin remodeling were identified within the interactomes of B55α and B55β, suggesting a role for these phosphatase subunits in DNA replication. In particular, we confirmed in human cells that B55α binds RPA and mediates the dephosphorylation of RPA2. The B55-RPA association is disrupted after replication stress, consistent with the induction of RPA2 phosphorylation. Thus, we report here a new mechanism that accounts for both how RPA phosphorylation is modulated by PP2A and how the phosphorylation of RPA2 is abruptly induced after replication stress.

Also flagged:autophagyCytochalasinsynthesisglycogen synthaseGFPMYC
Journal Article 2018-02-08 ✓ 2 Snippets Rai A, Singh PK, Singh V, Kumar V, Mishra R, Thakur AK, Mahadevan A, Shankar SK, Jana NR, Ganesh S.
In-Text Gene Mentions

…IHC 1:100) and anti-Htt(sc-8767; IHC 1:500)…

…(R6/2), bearing theHttexon 1 with…

Show Full Abstract

Healthy neurons do not store glycogen while they do possess the machinery for the glycogen synthesis albeit at an inactive state. Neurons in the degenerating brain, however, are known to accumulate glycogen, although its significance was not well understood. Emerging reports present contrasting views on neuronal glycogen synthesis; a few reports demonstrate a neurotoxic effect of glycogen while a few others suggest glycogen to be neuroprotective. Thus, the specific role of glycogen and glycogen synthase in neuronal physiology is largely unexplored. Using cellular and animal models of Huntington's disease, we show here that the overexpression of cytotoxic mutant huntingtin protein induces glycogen synthesis in the neurons by activating glycogen synthase and the overexpressed glycogen synthase protected neurons from the cytotoxicity of the mutant huntingtin. Exposure of neuronal cells to proteasomal blockade and oxidative stress also activate glycogen synthase to induce glycogen synthesis and to protect against stress-induced neuronal death. We show that the glycogen synthase plays an essential and inductive role in the neuronal autophagic flux, and helps in clearing the cytotoxic huntingtin aggregate. We also show that the increased neuronal glycogen inhibits the aggregation of mutant huntingtin, and thus could directly contribute to its clearance. Finally, we demonstrate that excessive autophagy flux is the molecular basis of cell death caused by the activation of glycogen synthase in unstressed neurons. Taken together, our results thus provide a novel function for glycogen synthase in proteolytic processes and offer insight into the role of glycogen synthase and glycogen in both survival and death of the neurons.

Also flagged:organizationGScystic fibrosisalpha 1-antitrypsin deficiencySERPINA1GJB2
Journal Article 2018-02-08 ✓ 3 Snippets Lynch FL, Himes P, Gilmore MJ, Morris EM, Schneider JL, Kauffman TL, Shuster E, Reiss JA, Dickerson JF, Leo MC, Davis JV, McMullen CK, Wilfond BS, Goddard KAB.
In-Text Gene Mentions

Variants were identified in 101 different genes in the time study population, and the most frequently observed genes that were reported in the time study were hemochromatosis (HFE—27 carriers), alpha 1-antitrypsin deficiency (SERPINA1—10 carriers), GJB2-associated deafness (10 carriers), and ABCA4-associated Stargardt macular dystrophy/retinal dystrophy (7 carriers).

…time study werehemochromatosis( HFE— 27…

…were hemochromatosis (HFE— 27 carriers), alpha…

Show Full Abstract

Advances in technology and the promise of personalized health care are driving greater use of genome sequencing (GS) for a variety of clinical scenarios. As health systems consider adopting GS, they need to understand the impact of GS on the organization and cost of care. While research has documented a dramatic decrease in the cost of sequencing and interpreting GS, few studies have examined how GS impacts genetic counseling workloads. This study examined the time needed to provide genetic counseling for GS in the context of preconception carrier screening. Genetic counselors prospectively reported on the time spent in the results disclosure process with 107 study participants who were part of the NextGen study. We found that the median time for results disclosure was 64 min (ranged from 5 to 229 min). Preparation work was the most time-consuming activity. Qualitative data from journal entries, debrief interviews with genetic counselors, and detailed case conference notes provided information on factors influencing time for results disclosure and implications for practice. Results suggest that expanded carrier screening could require significant increases in genetic counseling time, unless we are able to generate new resources to reduce preparation work or develop other strategies such as the creation of new models to deliver this type of service.

Also flagged:Hepatocellular carcinomaGaucher diseasehematological malignanciessolid tumorspathogenesisGD type 1
Journal Article 2018-02-08 ✓ 5 Snippets Regenboog M, van Dussen L, Verheij J, Weinreb NJ, Santosa D, Vom Dahl S, Häussinger D, Müller MN, Canbay A, Rigoldi M, Piperno A, Dinur T, Zimran A, Mistry PK, Salah KY, Belmatoug N, Kuter DJ, Hollak CEM.
In-Text Gene Mentions

In one case the presence of homozygosity for the C282Y mutation in the HFE-gene indicates that this patient possibly suffers from hereditary haemochromatosis as well as GD.

One of those (no. 13) was recorded to have the C282Y/H63D mutation of the HFE-gene, indicating that iron overload as a consequence of hereditary hemochromatosis might contribute to the development of HCC.

…B/C, alcohol abuse,HFE-mutation, history of blood…

…Analysis ofHFE-gene mutations was performed…

…mutation in theHFE-gene indicates that this…

Show Full Abstract

Gaucher disease (GD) is associated with an increased risk for malignancies. Next to hematological malignancies, the development of solid tumors in several organs has been described. The liver is one of the major storage sites involved in GD pathogenesis, and is also affected by liver-specific complications. In this case series, we describe 16 GD type 1 (GD1) patients from eight different referral centers around the world who developed hepatocellular carcinoma (HCC). Potential factors contributing to the increased HCC risk in GD patients are studied. Eleven patients had undergone a splenectomy in the past. Liver cirrhosis, one of the main risk factors for the development of HCC, was present in nine out of 14 patients for whom data was available. Three out of seven examined patients showed a transferrin saturation > 45%. In these three patients the presence of iron overload after histopathological examination of the liver was shown. Chronic hepatitis C infection was present in three of 14 examined cases. We summarized all findings and made a comparison to the literature. We recommend that GD patients, especially those with prior splenectomy or iron overload, be evaluated for signs of liver fibrosis and if found to be monitored for HCC development.

Also flagged:gene expressionanxietyneuropeptide YCorticotropin releasing hormone receptor 1CRHR1serotonin transporter
Journal Article 2018-02-08 ✓ 1 Snippet Azadmarzabadi E, Haghighatfard A, Mohammadi A.
In-Text Gene Mentions

…(DAT), serotonin transporter (5-HTT), brain-derived neurotrophic …

Show Full Abstract

<h4>Background</h4>In stressful situations, a person's ability to appropriately complete tasks with minimal anxiety is known as stress resilience. Genetic variants in neuropeptide Y, Corticotropin releasing hormone receptor 1 (CRHR1), and serotonin transporter have been previously reported to be associated with low resilience, but the relationship between low resilience and the dopaminergic signalling pathway is not well understood. Here, we aimed to describe the association between comprehensive psychological characteristics and messenger RNA levels of dopamine receptor D1 (DRD1), dopamine receptor D2 (DRD2), dopamine receptor D3 (DRD3), dopamine receptor D4 (DRD4), dopamine receptor D5 (DRD5), COMT, Dopamine Beta-Hydroxylase (DBH), Tyrosine hydroxylase (TH), monoamine oxidase A (MAOM), dopa decarboxylase (DDC), dopamine transporter (DAT), serotonin transporter (5-HTT), brain-derived neurotrophic factor (BDNF) and glial cell line-derived neurotrophic factor (GDNF) genes based on peripheral blood samples from 400 subjects who react differently to major life event stressors. The blood samples were analyzed by quantitative real-time polymerase chain reaction.<h4>Methods</h4>Four hundred Iranian individuals (age range: 17-42 years) were selected from 18 of Iran's 31 provinces. They were divided into four groups: (i) group A, persons with normal reactions to major life-event stressors; (ii) group B, persons with acute stress reactions to major life-event stressors; (iii) group C, persons with normal reactions to crises/catastrophes; and (iv) group D, persons with acute stress reactions to crises/catastrophes. Individuals were divided into groups by a senior psychiatrist based on an unstructured interview, the 21-item Depression Anxiety Stress Scale, and Connor-Davidson Resilience Scale.<h4>Results</h4>We found that the upregulation of DRD1, DRD2, DRD3, DRD4, DBH, DAT, and BDNF and the downregulation of serotonin transporter, monoamine oxidase A, and COMT are associated with stress resilience, which is modulated by dopaminergic and serotonergic pathways.<h4>Conclusions</h4>Gene expression variations were not only correlated with stress resilience, but they were also associated with other psychological parameters including personality, depression, anxiety, and intelligence.

Also flagged:synaptic connectionsDOCK180guanine nucleotide exchange factorunc-6GliCI
Journal Article 2018-02-08 ✓ 2 Snippets Weinberg P, Berkseth M, Zarkower D, Hobert O.
In-Text Gene Mentions

…its cognate receptor, UNC-40/DCCand the CED-5/DOCK180…

DCC

Show Full Abstract

Nervous systems display intriguing patterns of sexual dimorphisms across the animal kingdom, but the mechanisms that generate such dimorphisms remain poorly characterized. In the nematode Caenorhabditis elegans, a number of neurons present in both sexes are synaptically connected to one another in a sexually dimorphic manner as a result of sex-specific synaptic pruning and maintenance [1-3]. We define here a mechanism for the male-specific maintenance of the synaptic connections of the phasmid sensory neuron PHB and its male-specific target, the sex-shared AVG interneuron. We show that the C. elegans Netrin ortholog UNC-6, signaling through its cognate receptor UNC-40/DCC and the CED-5/DOCK180 guanine nucleotide exchange factor, is both required and sufficient for male-specific synaptic maintenance. The dimorphism of unc-6 activity is brought about by sex-specific regulation of unc-6 transcription. Although unc-6 is transcribed in the AVG neuron of males and hermaphrodites during juvenile stages, unc-6 expression is downregulated in AVG in hermaphrodites during sexual maturation but is maintained during sexual maturation of males. unc-6 downregulation in hermaphrodites is conferred by the master regulator of hermaphrodite sexual identity, the Gli/CI homolog TRA-1, which antagonizes the non-sex-specific function of the LIM homeobox gene lin-11, a terminal selector and activator of unc-6 in AVG. Preventing the downregulation of unc-6 in AVG of hermaphrodites through ectopic expression of unc-6 in transgenic animals results in the maintenance of the PHB>AVG synapses in hermaphrodites. Taken together, intersectional transcriptional regulation of unc-6/Netrin is required and sufficient to cell autonomously pattern sexually dimorphic synapses.

Also flagged:Cdx2 homeoboxcancercolon cancersNF-κBinducible nitric oxide synthasetumor
Journal Article 2018-02-08 ✓ 5 Snippets Balbinot C, Armant O, Elarouci N, Marisa L, Martin E, De Clara E, Onea A, Deschamps J, Beck F, Freund JN, Duluc I.
In-Text Gene Mentions

…z Biotechnology), rabbit anti-Olfm4(D6Y5A, mouse-specific; diluti…

…ling Technology), rabbit anti-Olfm4(ab85046, human-specific; dilu…

…Sox9 (6×) andOlfm4(>200×).…

…TheOlfm4protein, present in…

…+/− mice, theOlfm4pattern was very…

Show Full Abstract

Developmental genes contribute to cancer, as reported for the homeobox gene <i>Cdx2</i> playing a tumor suppressor role in the gut. In this study, we show that human colon cancers exhibiting the highest reduction in <i>CDX2</i> expression belong to the serrated subtype with the worst evolution. In mice, mosaic knockout of <i>Cdx2</i> in the adult intestinal epithelium induces the formation of imperfect gastric-type metaplastic lesions. The metaplastic knockout cells do not spontaneously become tumorigenic. However, they induce profound modifications of the microenvironment that facilitate the tumorigenic evolution of adjacent <i>Cdx2</i>-intact tumor-prone cells at the surface of the lesions through NF-κB activation, induction of inducible nitric oxide synthase, and stochastic loss of function of <i>Apc</i> This study presents a novel paradigm in that metaplastic cells, generally considered as precancerous, can induce tumorigenesis from neighboring nonmetaplastic cells without themselves becoming cancerous. It unveils the novel property of non-cell-autonomous tumor suppressor gene for the <i>Cdx2</i> gene in the gut.

Also flagged:KITPDGFRASystemic mastocytosisimatinibkinasemastocytosis
Journal Article 2018-02-08 ✓ 5 Snippets Schneeweiss M, Peter B, Bibi S, Eisenwort G, Smiljkovic D, Blatt K, Jawhar M, Berger D, Stefanzl G, Herndlhofer S, Greiner G, Hoermann G, Hadzijusufovic E, Gleixner KV, Bettelheim P, Geissler K, Sperr WR, Reiter A, Arock M, Valent P.
In-Text Gene Mentions

DCC-2618 is a spectrum-selective pan KIT and PDGFRA inhibitor which blocks KIT D816V and multiple other kinase targets relevant to systemic mastocytosis.

Since the target spectrum of midostaurin (PKC412) and DCC-2618 is not identical, we were also interested to learn whether DCC-2618 and midostaurin can produce synergistic antineoplastic effects on neoplastic MC.

We found that DCC-2618 and midostaurin produce clear cooperative (synergistic) growth-inhibitory effects in HMC-1.1 cells (Online Supplementary Figure S3A,C).

DCC-2618 is a switch-control type II inhibitor of KIT, which arrests KIT in an inactive state, regardless of activating mutations, such as KIT D816V.35 Moreover, several additional oncogenic kinases, including FLT-3, PDGFRA, PDGFRB, KDR, TIE2 and FMS are recognized by DCC- 2618.35 Recently, the first clinical trials with DCC-2618 (NCT02571036) were started in patients with kinase-driven malignancies.

We found that DCC-2618 (0.1–1.0 μM) slightly inhibited anti-IgE mediated histamine release from normal human blood basophils (Figure 4A).

Show Full Abstract

Systemic mastocytosis is a complex disease defined by abnormal growth and accumulation of neoplastic mast cells in various organs. Most patients exhibit a D816V-mutated variant of <i>KIT</i>, which confers resistance against imatinib. Clinical problems in systemic mastocytosis arise from mediator-related symptoms and/or organ destruction caused by malignant expansion of neoplastic mast cells and/or other myeloid cells in various organ systems. DCC-2618 is a spectrum-selective pan KIT and PDGFRA inhibitor which blocks KIT D816V and multiple other kinase targets relevant to systemic mastocytosis. We found that DCC-2618 inhibits the proliferation and survival of various human mast cell lines (HMC-1, ROSA, MCPV-1) as well as primary neoplastic mast cells obtained from patients with advanced systemic mastocytosis (IC<sub>50</sub> <1 μM). Moreover, DCC-2618 decreased growth and survival of primary neoplastic eosinophils obtained from patients with systemic mastocytosis or eosinophilic leukemia, leukemic monocytes obtained from patients with chronic myelomonocytic leukemia with or without concomitant systemic mastocytosis, and blast cells obtained from patients with acute myeloid leukemia. Furthermore, DCC-2618 was found to suppress the proliferation of endothelial cells, suggesting additional drug effects on systemic mastocytosis-related angiogenesis. Finally, DCC-2618 was found to downregulate IgE-mediated histamine release from basophils and tryptase release from mast cells. Together, DCC-2618 inhibits growth, survival and activation of multiple cell types relevant to advanced systemic mastocytosis. Whether DCC-2618 is effective <i>in vivo</i> in patients with advanced systemic mastocytosis is currently under investigation in clinical trials.

Also flagged:polysaccharideAEG-1osteosarcomaconjugationchitosanpropargyl
Journal Article 2018-02-08 No Snippets Wang F, Pang JD, Huang LL, Wang R, Li D, Sun K, Wang LT, Zhang LM.
Show Full Abstract

<h4>Background</h4>Nanomedicine, which is the application of nanotechnology in medicine to make medical diagnosis and treatment more accurate, has great potential for precision medicine. Despite some improvements in nanomedicine, the lack of efficient and low-toxic vectors remains a major obstacle.<h4>Objective</h4>The aim of this study was to prepare an efficient and low-toxic vector which could deliver astrocyte elevated gene-1 (<i>AEG-1</i>) small interfering RNA (siRNA; siAEG-1) into osteosarcoma cells effectively and silence the targeted gene both in vitro and in vivo.<h4>Materials and methods</h4>We prepared a novel polysaccharide derivative by click conjugation of azidized chitosan with propargyl focal point poly (L-lysine) dendrons (PLLD) and subsequent coupling with folic acid (FA; Cs-g-PLLD-FA). We confirmed the complexation of siAEG-1and Cs-g-PLLD or Cs-g-PLLD-FA by gel retardation assay. We examined the cell cytotoxicity, cell uptake, cell proliferation and invasion abilities of Cs-g-PLLD-FA/siAEG-1 in osteosarcoma cells. In osteosarcoma 143B cells tumor-bearing mice models, we established the therapeutic efficacy and safety of Cs-g-PLLD-FA/siAEG-1.<h4>Results</h4>Cs-g-PLLD-FA could completely encapsulate siAEG-1 and showed low cytotoxicity in osteosarcoma cells and tumour-bearing mice. The Cs-g-PLLD-FA/siAEG-1 nanocomplexes were capable of transferring siAEG-1 into osteosarcoma cells efficiently, and the knockdown of AEG-1 resulted in the inhibition of tumour cell proliferation and invasion. In addition, caudal vein injecting of Cs-g-PLLD-FA/siAEG-1 complexes inhibited tumor growth and lung metastasis in tumor-bearing mice by silencing AEG-1 and regulating MMP-2/9.<h4>Conclusion</h4>In summary, Cs-g-PLLD-FA nanoparticles are a promising system for the effective delivery of AEG-1 siRNA for treating osteosarcoma.

Also flagged:Leucine-Rich Repeat Kinase 2LRRK2negative regulator of nuclear factor of activated T cellsNFATimmune responsekinase
Journal Article 2018-02-08 ✓ 5 Snippets Wong AYW, Oikonomou V, Paolicelli G, De Luca A, Pariano M, Fric J, Tay HS, Ricciardi-Castagnoli P, Zelante T.
In-Text Gene Mentions

CSE1L is a nuclear exportin protein that is involved in the cell cycle, and SPAG9 has also been associated with various carcinomas [as reviewed in Behrens et al. (46)].

…hromosome segregation 1-like (CSE1L), and transportin-1 (…

…sequences targeting NRON,CSE1L, sperm-associated antigen 9…

…complex; NRON, PPP2R1A,CSE1L, and SPAG9 was…

…components, including PPP2R1A,CSE1Land SPAG9, could…

Show Full Abstract

The Parkinson's disease-associated protein, Leucine-rich repeat kinase 2 (LRRK2), a known negative regulator of nuclear factor of activated T cells (NFAT), is expressed in myeloid cells such as macrophages and dendritic cells (DCs) and is involved in the host immune response against pathogens. Since, the Ca<sup>2+</sup>/NFAT/IL-2 axis has been previously found to regulate DC response to the fungus <i>Aspergillus</i>, we have investigated the role played by the kinase LRRK2 during fungal infection. Mechanistically, we found that in the early stages of the non-canonical autophagic response of DCs to the germinated spores of <i>Aspergillus</i>, LRRK2 undergoes progressive degradation and regulates NFAT translocation from the cytoplasm to the nucleus. Our results shed new light on the complexity of the Ca<sup>2+</sup>/NFAT/IL-2 pathway, where LRRK2 plays a role in controlling the immune response of DCs to <i>Aspergillus</i>.

Also flagged:RibosomeDExD/H-box RNA helicasesATPasesribonucleoproteinBiogenesisRNP
Journal Article 2018-02-08 No Snippets Liu Y, Imai R.
Show Full Abstract

Ribosome biogenesis is a highly complex process that requires several cofactors, including DExD/H-box RNA helicases (RHs). RHs are a family of ATPases that rearrange the secondary structures of RNA and thus remodel ribonucleoprotein complexes. DExD/H-box RHs are found in most organisms and play critical roles in a variety of RNA-involved cellular events. In human and yeast cells, many DExD/H box RHs participate in multiple steps of ribosome biogenesis and regulate cellular proliferation and stress responses. In plants, several DExD/H-box RHs have been demonstrated to be associated with plant development and abiotic stress tolerance through their functions in modulating pre-rRNA processing. In this review, we summarize the pleiotropic roles of DExD/H-box RHs in rRNA biogenesis and other biological functions. We also describe the overall function of the DExD/H-box RH family in ribosome biogenesis based on data from human and yeast.

Also flagged:HuntingtinHDneurodegenerative disorder
Journal Article 2018-02-08 ✓ 4 Snippets Miniarikova J, Evers MM, Konstantinova P.
In-Text Gene Mentions

The single mutation underlying the fatal neuropathology of Huntington's disease (HD) is a CAG triplet expansion in exon 1 of the huntingtin (HTT) gene, which gives rise to a toxic mutant HTT protein.

…a toxic mutantHTTprotein.…

…the overall mutantHTTprotein.…

…the huntingtin (HTT) gene, which…

Show Full Abstract

The single mutation underlying the fatal neuropathology of Huntington's disease (HD) is a CAG triplet expansion in exon 1 of the huntingtin (HTT) gene, which gives rise to a toxic mutant HTT protein. There have been a number of not yet successful therapeutic advances in the treatment of HD. The current excitement in the HD field is due to the recent development of therapies targeting the culprit of HD either at the DNA or RNA level to reduce the overall mutant HTT protein. In this review, we briefly describe short-term and long-term HTT-lowering strategies targeting HTT transcripts. One of the most advanced HTT-lowering strategies is a microRNA (miRNA)-based gene therapy delivered by a single administration of an adeno-associated viral (AAV) vector to the HD patient. We outline the outcome measures for the miRNA-based HTT-lowering therapy in the context of preclinical evaluation in HD animal and cell models. We highlight the strengths and ongoing queries of the HTT-lowering gene therapy as an HD intervention with a potential disease-modifying effect. This review provides a perspective on the fast-developing HTT-lowering therapies for HD and their translation to the clinic based on existing knowledge in preclinical models.

Also flagged:carotid atherosclerosisatherosclerosisatherosclerotic diseaserheumatoid arthritisRAstatin
Journal Article 2018-02-08 No Snippets Arya R, Escalante A, Farook VS, Restrepo JF, Battafarano DF, Almeida M, Kos MZ, Fourcaudot MJ, Mummidi S, Kumar S, Curran JE, Jenkinson CP, Blangero J, Duggirala R, Del Rincon I.
Show Full Abstract

Carotid Intima-media thickness (CIMT) and plaque are well established markers of subclinical atherosclerosis and are widely used for identifying subclinical atherosclerotic disease. We performed association analyses using Metabochip array to identify genetic variants that influence variation in CIMT and plaque, measured using B-mode ultrasonography, in rheumatoid arthritis (RA) patients. Data on genetic associations of common variants associated with both CIMT and plaque in RA subjects involving Mexican Americans (MA) and European Americans (EA) populations are presented in this article. Strong associations were observed after adjusting for covariate effects including baseline clinical characteristics and statin use. Susceptibility loci and genes and/or nearest genes associated with CIMT in MAs and EAs with RA are presented. In addition, common susceptibility loci influencing CIMT and plaque in both MAs and EAs have been presented. Polygenic Risk Score (PRS) plots showing complementary evidence for the observed CIMT and plaque association signals are also shown in this article. For further interpretation and details, please see the research article titled "A Genetic Association Study of Carotid Intima-Media Thickness (CIMT) and Plaque in Mexican Americans and European Americans with Rheumatoid Arthritis" which is being published in Atherosclerosis (Arya et al., 2018) [1].(Arya et al., in press) Thus, common variants in several genes exhibited significant associations with CIMT and plaque in both MAs and EAs as presented in this article. These findings may help understand the genetic architecture of subclinical atherosclerosis in RA populations.

Also flagged:ascitesliver cirrhosisliver diseasecirrhosisWDcopper
Journal Article 2018-02-08 ✓ 1 Snippet El Imad T, Al Moussawi H, Haddad FG, Felix R, Mulrooney SM.
In-Text Gene Mentions

…autoimmune hepatitis andhemochromatosiswere each excluded…

Show Full Abstract

A 64-year-old woman, presented with abdominal distention, jaundice and resting tremor, was found to have liver injury and abnormal liver enzymes. A computed tomography (CT) scan of the abdomen and pelvis showed abdominopelvic ascites and signs of liver cirrhosis. An extensive liver disease workup was performed and came back negative; therefore, a liver biopsy was obtained and showed evidence of cirrhosis with elevated liver copper consistent with Wilson's disease (WD). We report a unique case of late-onset WD in which the ceruloplasmin level and 24-h urinary copper excretion were all normal.

Also flagged:gene expressionschizophreniaGABA receptormental disorderbindingMetabolic Syndrome
Journal Article 2018-02-07 No Snippets Wu C, Pan W.
Show Full Abstract

Many genetic variants affect complex traits through gene expression, which can be exploited to boost statistical power and enhance interpretation in genome-wide association studies (GWASs) as demonstrated by the transcriptome-wide association study (TWAS) approach. Furthermore, due to polygenic inheritance, a complex trait is often affected by multiple genes with similar functions as annotated in gene pathways. Here, we extend TWAS from gene-based analysis to pathway-based analysis: we integrate public pathway collections, expression quantitative trait locus (eQTL) data and GWAS summary association statistics (or GWAS individual-level data) to identify gene pathways associated with complex traits. The basic idea is to weight the SNPs of the genes in a pathway based on their estimated cis-effects on gene expression, then adaptively test for association of the pathway with a GWAS trait by effectively aggregating possibly weak association signals across the genes in the pathway. The P values can be calculated analytically and thus fast. We applied our proposed test with the KEGG and GO pathways to two schizophrenia (SCZ) GWAS summary association data sets, denoted by SCZ1 and SCZ2 with about 20,000 and 150,000 subjects, respectively. Most of the significant pathways identified by analyzing the SCZ1 data were reproduced by the SCZ2 data. Importantly, we identified 15 novel pathways associated with SCZ, such as GABA receptor complex (GO:1902710), which could not be uncovered by the standard single SNP-based analysis or gene-based TWAS. The newly identified pathways may help us gain insights into the biological mechanism underlying SCZ. Our results showcase the power of incorporating gene expression information and gene functional annotations into pathway-based association testing for GWAS.

Also flagged:insulin resistancetype II diabeteshepatitis C virus infectionliver diseaseshepatocellular carcinomaHCV infection
Journal Article 2018-02-07 ✓ 1 Snippet Singhal A, Agrawal A, Ling J.
In-Text Gene Mentions

In skeletal muscle, additional genes with IR‐relevant functions were also identified, including glucose metabolism and insulin‐induced glycogenesis (GYS1), Wnt and ERK signalling (SOX6), and nitric oxide synthesis (NOS1).

Show Full Abstract

Hepatitis C virus (HCV) infection is a serious worldwide healthcare issue. Its association with various liver diseases including hepatocellular carcinoma (HCC) is well studied. However, the study on the relationship between HCV infection and the development of insulin resistance and diabetes is very limited. Current research has already elucidated some underlying mechanisms, especially on the regulation of metabolism and insulin signalling by viral proteins. More studies have emerged recently on the correlation between HCV infection-derived miRNAs and diabetes and insulin resistance. However, no studies have been carried out to directly address if these miRNAs, especially circulating miRNAs, have causal effects on the development of insulin resistance and diabetes. Here, we proposed a new perspective that circulating miRNAs can perform regulatory functions to modulate gene expression in peripheral tissues leading to insulin resistance and diabetes, rather than just a passive factor associated with these pathological processes. The detailed rationales were elaborated through comprehensive literature review and bioinformatic analyses. miR-122 was identified to be one of the most potential circulating miRNAs to cause insulin resistance. This result along with the idea about the driver function of circulating miRNAs will promote further investigations that eventually lead to the development of novel strategies to treat HCV infection-associated extrahepatic comorbidities.

Also flagged:neurodegenerative disorderHDGene expressionD1D2dopaminergic receptors
Journal Article 2018-02-07 ✓ 2 Snippets Manfré G, Novati A, Faccini I, Rossetti AC, Bosch K, Molteni R, Riva MA, Van der Harst JE, Nguyen HP, Homberg JR.
In-Text Gene Mentions

Huntington disease (HD) is a dominantly inherited neurodegenerative disorder that is caused by an unstable expansion of a CAG repeat within the coding region of the huntingtin (HTT) gene [1].

…the huntingtin (HTT) gene […

Show Full Abstract

<h4>Background</h4>Huntington disease (HD) is a devastating inherited neurodegenerative disorder characterized by progressive motor, cognitive, and psychiatric symptoms without any cure to slow down or stop the progress of the disease. The BACHD rat model for HD carrying the human full-length mutant huntingtin protein (mHTT) with 97 polyQ repeats has been recently established as a promising model which reproduces several HD-like features. While motor and cognitive functions have been characterized in BACHD rats, little is known about their social phenotype.<h4>Objective</h4>This study focuses especially on social behavior since evidence for social disturbances exists in human patients. Our objective was to compare social behavior in BACHD and wild-type (WT) rats at different ages, using two different measures of sociability.<h4>Methods</h4>Animals were tested longitudinally at the age of 2, 4 and 8 months in the social interaction test to examine different parameters of sociability. A separate cohort of 7 month old rats was tested in the three chamber social test to measure both sociability and social novelty. Gene expression analyses in 8 months old animals were performed by real time qRT-PCR to evaluate a potential involvement of D1 and D2 dopaminergic receptors and the contribution of Brain-derived neurotrophic factor (BDNF) to the observed behavioral alterations.<h4>Results</h4>In the social interaction test, BACHD rats showed age-dependent changes in behaviour when they were-re introduced to their cagemate after a 24 hours-period of individual housing. The time spent on nape attacks increased with aging. Furthermore, a significant higher level of pinning at 2 months of age was shown in the BACHD rats compared to wild-types, followed by a reduction at 4 and 8 months. On the other hand, BACHD rats exhibited a decreased active social behaviour compared to wild-types, reflected by genotype-effects on approaching, following and social nose contact. In the three chamber social test, BACHD rats seemed to show a mild deficit in preference for social novelty, but no changes in social interest. Molecular analyses revealed that BACHD animals exposed to the social interaction test displayed decreased mRNA levels of the total form of BDNF in ventral striatum and unaltered striatal expression of D1 and D2 dopamine receptors.<h4>Conclusions</h4>Taken together, these results indicate deficits in several parameters representative of sociability. Altered BDNF expression in the ventral striatum may contribute to the deficits in sociability in 8 months old BACHD rats. These data support the validity of the BACHD rat model in mimicking features of certain social deficits that could be relevant to symptoms in patients.

Also flagged:Hepcidinironbrain hemorrhagesecretionpeptidemetabolism
Journal Article 2018-02-07 ✓ 3 Snippets Vela D.
In-Text Gene Mentions

…Inhemochromatosis(HH), which is…

…Hepcidin, neogenin, TFR2,HFEmRNA was present…

…hepcidin independent ofHFEand HJV.…

Show Full Abstract

Hepcidin is emerging as a new important factor in brain iron homeostasis. Studies suggest that there are two sources of hepcidin in the brain; one is local and the other comes from the circulation. Little is known about the molecular mediators of local hepcidin expression, but inflammation and iron-load have been shown to induce hepcidin expression in the brain. The most important source of hepcidin in the brain are glial cells. Role of hepcidin in brain functions has been observed during neuronal iron-load and brain hemorrhage, where secretion of abundant hepcidin is related with the severity of brain damage. This damage can be reversed by blocking systemic and local hepcidin secretion. Studies have yet to unveil its role in other brain conditions, but the rationale exists, since these conditions are characterized by overexpression of the factors that stimulate brain hepcidin expression, such as inflammation, hypoxia and iron-overload.

Also flagged:Hsp90lectinGli1cholesterolAXIN2Ptch1
Journal Article 2018-02-07 ✓ 5 Snippets Li SF, Zhu CS, Wang YM, Xie XX, Xiao LL, Zhang ZC, Tang QQ, Li X.
In-Text Gene Mentions

B4GalT5

We showed that the expression of β1, 4-galactosyltransferase 5 (B4GalT5) was positively correlated with diabetes and obesity.

B4GalT5 knockdown in subcutaneous adipose tissue protected mice from obesity-induced insulin resistance and adipose inflammation (Fig. 2).

B4GalT5 expression was increased in type 2 diabetes and obesity

B4GalT5 is generally responsible for the synthesis of complex-type N-linked oligosaccharides in many glycoproteins1,9, we screened the amino-acid sequences of BMPRIA and found three potential N-linked glycosylation sites (N73, N314, and N373).

Show Full Abstract

Protein glycosylation is an important post-translational modification. Aberrant glycosylation has been implicated in many diseases because of associated changes in protein distribution and biological function. We showed that the expression of β1, 4-galactosyltransferase 5 (B4GalT5) was positively correlated with diabetes and obesity. In vivo, B4GalT5 knockdown in subcutaneous adipose tissue alleviated insulin resistance and adipose tissue inflammation, and increased adipogenesis in high-fat diet (HFD)-fed mice and ob/ob mice. Downregulation of B4GalT5 in preadipocyte cells induced commitment to the adipocyte lineage in the absence of bone morphogenetic protein (BMP) 2/4 treatment, which is typically essential for adipogenic commitment. RNAi silencing experiments showed B4GalT5 knockdown activated Smad and p38 MPAK signaling pathways through both type 1A and 2 BMP receptors. Remarkably, B4GalT5 knockdown decreased BMPRIA glycosylation but increased BMPRIA stability and cellular location, thus leading to redistribution of BMPRIA and activation of the BMP signaling pathway. Meanwhile, downregulation of B4GalT5 decreased the infiltration of macrophages and the markers of M1 macrophages in subcutaneous adipose tissue of HFD mice and ob/ob mice. In bone marrow-derived macrophages (BMDMs) and RAW264.7cells, B4GalT5 knockdown also repressed the markers of M1 by reducing NFκB and JNK signaling. These results demonstrated B4GalT5 downregulation improved insulin resistance by promoting adipogenic commitment and decreasing M1 macrophage infiltration.

Also flagged:SLCABC membrane transportertransportertransportersSLC transportersABC transporters
Journal Article 2018-02-07 ✓ 3 Snippets O'Hagan S, Wright Muelas M, Day PJ, Lundberg E, Kell DB.
In-Text Gene Mentions

…SLC6A18, HPA006539 forSLC2A14(all from the…

…Similarly,SLC2A14, a glucose transporter…

…SLC22A12, SLC6A18, andSLC2A14( Figure 2…

Show Full Abstract

The expression levels of SLC or ABC membrane transporter transcripts typically differ 100- to 10,000-fold between different tissues. The Gini coefficient characterizes such inequalities and here is used to describe the distribution of the expression of each transporter among different human tissues and cell lines. Many transporters exhibit extremely high Gini coefficients even for common substrates, indicating considerable specialization consistent with divergent evolution. The expression profiles of SLC transporters in different cell lines behave similarly, although Gini coefficients for ABC transporters tend to be larger in cell lines than in tissues, implying selection. Transporter genes are significantly more heterogeneously expressed than the members of most non-transporter gene classes. Transcripts with the stablest expression have a low Gini index and often differ significantly from the "housekeeping" genes commonly used for normalization in transcriptomics/qPCR studies. PCBP1 has a low Gini coefficient, is reasonably expressed, and is an excellent novel reference gene. The approach, referred to as GeneGini, provides rapid and simple characterization of expression-profile distributions and improved normalization of genome-wide expression-profiling data.

Also flagged:RIPK4pancreatic cancercell migrationRAF1MEKERK
Journal Article 2018-02-07 ✓ 5 Snippets Qi ZH, Xu HX, Zhang SR, Xu JZ, Li S, Gao HL, Jin W, Wang WQ, Wu CT, Ni QX, Yu XJ, Liu L.
In-Text Gene Mentions

The definition for high RIPK4 and PEBP1 was IRS ≥7 (at least moderate intensity in >50% of tumor cells or at least strong intensity in >10% of tumor cells).

We then examined the effect of PEBP1 on RIPK4-mediated activation of RAF1/MEK/ERK signaling and tumor cell migration and invasion.

The suppression of PEBP1 degradation eliminated the RIPK4-induced activation of RAF1/MEK/ERK signaling and pancreatic cancer cell migration or invasion.

RIPK4 overexpression promoted pancreatic cancer cell migration and invasion via the PEBP1 degradation-induced activation of the RAF1/MEK/ERK pathway.

Consistent with this finding, a negative correlation between RIPK4 and PEBP1 was also observed in 34 pancreatic cancer patient tissues (P=0.0418 with Pearson's χ2 test) (Fig. 4F and G).

Show Full Abstract

Pancreatic cancer is a lethal disease with a high metastatic potential. In our previous study, we identified a specific subgroup of patients with pancreatic cancer with a serum signature of carcinoembryonic antigen (CEA)+/cancer antigen (CA)125+/CA19-9 ≥1,000 U/ml. In this study, by using high-throughput screening analysis, we found that receptor-interacting protein kinases 4 (RIPK4) may be a key molecule involved in the high metastatic potential of this subgroup of patients with pancreatic cancer. A high RIPK4 expression predicted a poor prognosis and promoted pancreatic cancer cell migration and invasion via the RAF1/MEK/ERK pathway. Moreover, RIPK4 activated the RAF1/MEK/ERK pathway by regulating proteasome-mediated phosphatidylethanolamine binding protein 1 (PEBP1) degradation. The suppression of PEBP1 degradation eliminated the RIPK4-induced activation of RAF1/MEK/ERK signaling and pancreatic cancer cell migration or invasion. Thus, on the whole, the findings of this study indicated that RIPK4 was upregulated in the subgroup of pancreatic cancer with a high metastatic potential. RIPK4 overexpression promoted pancreatic cancer cell migration and invasion via the PEBP1 degradation-induced activation of the RAF1/MEK/ERK pathway.

Also flagged:heat shock proteinsproteasome-associated proteinsproteostasischaperonedegradationproteasome
Journal Article 2018-02-07 ✓ 1 Snippet Bamberger C, Martínez-Bartolomé S, Montgomery M, Lavallée-Adam M, Yates JR.
In-Text Gene Mentions

…in neurogenesis, andPebp1, which is part…

Show Full Abstract

Cellular proteomes are thought to be optimized for function, leaving no room for proteome plasticity and, thus, evolution. However, hybrid animals that result from a viable cross of two different species harbor hybrid proteomes of unknown complexity. We charted the hybrid proteome of a viable cross between <i>Drosophila melanogaster</i> females and <i>Drosophila simulans</i> males with bottom-up proteomics. Developing hybrids harbored 20% novel proteins in addition to proteins that were also present in either parental species. In contrast, adult hybrids and developmentally failing embryos of the reciprocal cross showed less additional proteins (5 and 6%, respectively). High levels of heat shock proteins, proteasome-associated proteins, and proteasomal subunits indicated that proteostasis sustains the expanded complexity of the proteome in developing hybrids. We conclude that increased proteostasis gives way to proteomic plasticity and thus opens up additional space for rapid phenotypic variation during embryonic development.

Also flagged:pathogenesisADclustered regularly interspaced shortgenetic diseasesCas9β-amyloid precursor protein
Journal Article 2018-02-07 No Snippets Giau VV, Lee H, Shim KH, Bagyinszky E, An SSA.
Show Full Abstract

Genetic variations play an important role in the clinical presentation and progression of Alzheimer's disease (AD), especially early-onset Alzheimer's disease. Hundreds of mutations have been reported with the majority resulting from alterations in β-amyloid precursor protein (<i>APP</i>), presenilin 1 (<i>PSEN1</i>), or presenilin 2 (<i>PSEN2</i>) genes. The roles of these mutations in the pathogenesis of AD have been classically confirmed or refuted through functional studies, where the mutations are cloned, inserted into cell lines, and monitored for changes in various properties including cell survival, amyloid production, or Aβ42/40 ratio. However, these verification studies tend to be expensive, time consuming, and inconsistent. Recently, the clustered regularly interspaced short palindromic repeats-CRISPR-associated protein 9 (CRISPR-Cas9) system was developed, which improves sequence-specific gene editing in cell lines, organs, and animals. CRISPR-Cas9 is a promising tool for the generation of models of human genetic diseases and could facilitate the establishment of new animal AD models and the observation of dynamic bioprocesses in AD. Here, we recapitulated the history of CRISPR technology, recent progress, and, especially, its potential applications in AD-related genetic, animal modeling, and functional studies.

Also flagged:nervebrain-derived neurotrophic factorBDNFOpioid receptornaloxonehypersensitivity
Journal Article 2018-02-07 ✓ 4 Snippets Sumizono M, Sakakima H, Otsuka S, Terashi T, Nakanishi K, Ueda K, Takada S, Kikuchi K.
In-Text Gene Mentions

The expression of BDNF and endogenous opioid in relation to exercise-induced alleviation of neuropathic pain differed in the HFE and LFE groups.

…rats in theHFEgroup (n =…

…In theHFEgroup, the 50%…

…TheHFEgroup showed significant…

Show Full Abstract

<h4>Background</h4>Exercise regimens are established methods that can relieve neuropathic pain. However, the relationship between frequency and intensity of exercise and multiple cellular responses of exercise-induced alleviation of neuropathic pain is still unclear. We examined the influence of exercise frequency on neuropathic pain and the intracellular responses in a sciatic nerve chronic constriction injury (CCI) model.<h4>Materials and methods</h4>Rats were assigned to four groups as follows: CCI and high-frequency exercise (HFE group), CCI and low-frequency exercise (LFE group), CCI and no exercise (No-Ex group), and naive animals (control group). Rats ran on a treadmill, at a speed of 20 m/min, for 30 min, for 5 (HFE) or 3 (LFE) days a week, for a total of 5 weeks. The 50% withdrawal threshold was evaluated for mechanical sensitivity. The activation of glial cells (microglia and astrocytes), expression of brain-derived neurotrophic factor (BDNF) and μ-opioid receptor in the spinal dorsal horn and endogenous opioid in the midbrain were examined using immunohistochemistry. Opioid receptor antagonists (naloxone) were administered using intraperitoneal injection.<h4>Results</h4>The development of neuropathic pain was related to the activation of glial cells, increased BDNF expression, and downregulation of the μ-opioid receptor in the ipsilateral spinal dorsal horn. In the No-Ex group, neuropathic pain showed the highest level of mechanical hypersensitivity at 2 weeks, which improved slightly until 5 weeks after CCI. In both exercise groups, the alleviation of neuropathic pain was accelerated through the regulation of glial activation, BDNF expression, and the endogenous opioid system. The expression of BDNF and endogenous opioid in relation to exercise-induced alleviation of neuropathic pain differed in the HFE and LFE groups. The effects of exercise-induced alleviation of mechanical hypersensitivity were reversed by the administration of naloxone.<h4>Conclusion</h4>The LFE and HFE program reduced neuropathic pain. Our findings indicated that aerobic exercise-induced alleviated neuropathic pain through the regulation of glial cell activation, expression of BDNF in the ipsilateral spinal dorsal horn, and the endogenous opioid system.

Also flagged:LipoxygenasesferroptosisdeathlipidhydroperoxidesLOX
Journal Article 2018-02-07 ✓ 1 Snippet Shah R, Shchepinov MS, Pratt DA.
In-Text Gene Mentions

…their activity (e.g.,PEBP1, a scaffolding protein…

Show Full Abstract

Lipoxygenases (LOXs) have been implicated as central players in ferroptosis, a recently characterized cell death modality associated with the accumulation of lipid hydroperoxides: the products of LOX catalysis. To provide insight on their role, human embryonic kidney cells were transfected to overexpress each of the human isoforms associated with disease, 5-LOX, p12-LOX, and 15-LOX-1, which yielded stable cell lines that were demonstrably sensitized to ferroptosis. Interestingly, the cells could be rescued by less than half of a diverse collection of known LOX inhibitors. Furthermore, the cytoprotective compounds were similarly potent in each of the cell lines even though some were clearly isoform-selective LOX inhibitors. The cytoprotective compounds were subsequently demonstrated to be effective radical-trapping antioxidants, which protect lipids from autoxidation, the autocatalytic radical chain reaction that produces lipid hydroperoxides. From these data (and others reported herein), a picture emerges wherein LOX activity <i>may</i> contribute to the cellular pool of lipid hydroperoxides that initiate ferroptosis, but lipid autoxidation drives the cell death process.

Also flagged:TTKionsmethionineCSRfluorideatom
Journal Article 2018-02-07 No Snippets Bi C, Liang Y, Shen L, Tian S, Zhang K, Li Y, He X, Chen L, Zhang Y.
Show Full Abstract

Efficient enrichment glycoproteins/glycopeptides from complex biological solutions are very important in the biomedical sciences, in particular biomarker research. In this work, the high hydrophilic polyethylenimine conjugated polymaltose polymer brushes functionalized magnetic Fe<sub>3</sub>O<sub>4</sub> nanoparticles (NPs) denoted as Fe<sub>3</sub>O<sub>4</sub>-PEI-pMaltose were designed and synthesized via a simple two-step modification. The obtained superhydrophilic Fe<sub>3</sub>O<sub>4</sub>-PEI-pMaltose NPs displayed outstanding advantages in the enrichment of N-linked glycopeptides, including high selectivity (1:100, mass ratios of HRP and bovine serum albumin (BSA) digest), low detection limit (10 fmol), large binding capacity (200 mg/g), and high enrichment recovery (above 85%). The above-mentioned excellent performance of novel Fe<sub>3</sub>O<sub>4</sub>-PEI-pMaltose NPs was attributed to graft of maltose polymer brushes and efficient assembly strategy. Moreover, Fe<sub>3</sub>O<sub>4</sub>-PEI-pMaltose NPs were further utilized to selectively enrich glycopeptides from human renal mesangial cell (HRMC, 200 μg) tryptic digest, and 449 N-linked glycopeptides, representing 323 different glycoproteins and 476 glycosylation sites, were identified. It was expected that the as-synthesized Fe<sub>3</sub>O<sub>4</sub>-PEI-pMaltose NPs, possessing excellent performance (high binding capacity, good selectivity, low detection limit, high enrichment recovery, and easy magnetic separation) coupled to a facile preparation procedure, have a huge potential in N-glycosylation proteome analysis of complex biological samples.

Also flagged:liver diseasefibrotic liver diseasealanine transaminaseALTnon-alcoholic fatty liver diseaseNAFLD
Journal Article 2018-02-07 No Snippets Miller MH, Fraser A, Leggett G, MacGilchrist A, Gibson G, Orr J, Forrest EH, Dow E, Bartlett W, Weatherburn C, Laurell A, Grant K, Scott K, Neville R, Dillon JF.
Show Full Abstract

<h4>Background</h4>Liver function tests (LFTs) are commonly abnormal; most patients with 'incidental' abnormal LFTs are not investigated appropriately and for those who are, current care pathways are geared to find an explanation for the abnormality by a lengthy process of investigation and exclusion, with costs to the patient and to the health service.<h4>Objective</h4>To validate an intelligent automatable analysis tool (iLFT) for abnormal liver enzymes, which diagnoses common liver conditions, provides fibrosis stage and recommends management.<h4>Design</h4>A retrospective case note review from three tertiary referral liver centres, with application of the iLFT algorithm and comparison with the clinician's final opinion as gold standard.<h4>Results</h4>The iLFT algorithm in 91.3% of cases would have correctly recommended referral or management in primary care. In the majority of the rest of the cases, iLFT failed safe and recommended referral even when the final clinical diagnosis could have been managed in primary care. Diagnostic accuracy was achieved in 82.4% of cases, consistent with the fail-safe design of the algorithm. Two cases would have remained in primary care as per the algorithm outcome, however on clinical review had features of advanced fibrosis.<h4>Conclusion</h4>iLFT analysis of abnormal liver enzymes offers a safe and robust method of risk stratifying patients to the most appropriate care pathway as well as providing reliable diagnostic information based on a single blood draw, without repeated contacts with health services. Offers the possibility of high quality investigation and diagnosis to all patients rather than a tiny minority.

Also flagged:Lshchromatin remodeling factormethylationchromatingene expressionbinding
Journal Article 2018-02-06 ✓ 1 Snippet Ren J, Hathaway NA, Crabtree GR, Muegge K.
In-Text Gene Mentions

polycomb repressive

Show Full Abstract

Lsh is a chromatin remodeling factor that regulates DNA methylation and chromatin function in mammals. The dynamics of these chromatin changes and whether they are directly controlled by Lsh remain unclear. To understand the molecular mechanisms of Lsh chromatin controlled regulation of gene expression, we established a tethering system that recruits a Gal4-Lsh fusion protein to an engineered Oct4 locus through Gal4 binding sites in murine embryonic stem (ES) cells. We examined the molecular epigenetic events induced by Lsh binding including: histone modification, DNA methylation and chromatin accessibility to determine nucleosome occupancy before and after embryonic stem cell differentiation. Our results indicate that Lsh assists gene repression upon binding to the Oct4 promoter region. Furthermore, we detected less chromatin accessibility and reduced active histone modifications at the tethered site in undifferentiated ES, while GFP reporter gene expression and DNA methylation patterns remained unchanged at this stage. Upon differentiation, association of Lsh promotes transcriptional repression of the reporter gene accompanied by the increase of repressive histone marks and a gain of DNA methylation at distal and proximal Oct4 enhancer sites. Taken together, this approach allowed us to examine Lsh mediated epigenetic regulation as a dynamic process and revealed chromatin accessibility changes as the primary consequence of Lsh function.

Also flagged:Serp-1SerpinPeptidesvasculitislupusviral sepsis
Journal Article 2018-02-06 ✓ 2 Snippets Mahon BP, Ambadapadi S, Yaron JR, Lomelino CL, Pinard MA, Keinan S, Kurnikov I, Macaulay C, Zhang L, Reeves W, McFadden G, Tibbetts S, McKenna R, Lucas AR.
In-Text Gene Mentions

…(PAI-1), anti-thrombin III (ATIII), and α-1 antitrypsin…

…the peptides withATIII, A1AT, and target…

Show Full Abstract

The Myxomavirus-derived protein Serp-1 has potent anti-inflammatory activity in models of vasculitis, lupus, viral sepsis, and transplant. Serp-1 has also been tested successfully in a Phase IIa clinical trial in unstable angina, representing a "first-in-class" therapeutic. Recently, peptides derived from the reactive center loop (RCL) have been developed as stand-alone therapeutics for reducing vasculitis and improving survival in MHV68-infected mice. However, both Serp-1 and the RCL peptides lose activity in MHV68-infected mice after antibiotic suppression of intestinal microbiota. Here, we utilize a structure-guided approach to design and test a series of next-generation RCL peptides with improved therapeutic potential that is not reduced when the peptides are combined with antibiotic treatments. The crystal structure of cleaved Serp-1 was determined to 2.5 Å resolution and reveals a classical serpin structure with potential for serpin-derived RCL peptides to bind and inhibit mammalian serpins, plasminogen activator inhibitor 1 (PAI-1), anti-thrombin III (ATIII), and α-1 antitrypsin (A1AT), and target proteases. Using in silico modeling of the Serp-1 RCL peptide, S-7, we designed several modified RCL peptides that were predicted to have stronger interactions with human serpins because of the larger number of stabilizing hydrogen bonds. Two of these peptides (MPS7-8 and -9) displayed extended activity, improving survival where activity was previously lost in antibiotic-treated MHV68-infected mice (P < 0.0001). Mass spectrometry and kinetic assays suggest interaction of the peptides with ATIII, A1AT, and target proteases in mouse and human plasma. In summary, we present the next step toward the development of a promising new class of anti-inflammatory serpin-based therapeutics.

Also flagged:lung cancercell cyclemitosisp53cell cycle arrestamino
Journal Article 2018-02-06 ✓ 2 Snippets Cheng HW, Chein RJ, Cheng TJ, Wu PS, Wu HY, Hung PF, Wang CJ, Hsu YL, Wong JM, Yuan A, Wong CH, Yang PC, Pan SH.
In-Text Gene Mentions

…proteins iASPP andCSE1Lfor further validation,…

…iASPP but notCSE1Lcould be co‐immunoprecipitated…

Show Full Abstract

Lung cancer is the leading cause of cancer-related death worldwide. Thus, developing novel therapeutic agents has become critical for lung cancer treatment. In this study, compound AS7128 was selected from a 2-million entry chemical library screening and identified as a candidate drug against non-small cell lung cancer in vitro and in vivo. Further investigation indicated that AS7128 could induce cell apoptosis and cell cycle arrest, especially in the mitosis stage. In addition, we also found that iASPP, an oncogenic protein that functionally inhibits p53, might be associated with AS7128 through mass identification. Further exploration indicated that AS7128 treatment could restore the transactivation ability of p53 and, thus, increase the expressions of its downstream target genes, which are related to cell cycle arrest and apoptosis. This occurs through disruption of the interactions between p53 and iASPP in cells. Taken together, AS7128 could bind to iASPP, disrupt the interaction between iASPP and p53, and result in cell cycle arrest and apoptosis. These findings may provide new insight for using iASPP as a therapeutic target for non-small cell lung cancer treatment.

Also flagged:MoldAlbadiabetestype 2 diabeteslipoproteincholesterol
Journal Article 2018-02-06 No Snippets Hertroijs DFL, Elissen AMJ, Brouwers MCGJ, Schaper NC, Ruwaard D.
Show Full Abstract

AimTo identify which patient-related effect modifiers influence the outcomes of integrated care programs for type 2 diabetes in primary care.<h4>Background</h4>Integrated care is a widespread management strategy for the treatment of type 2 diabetes. However, most integrated care programs are not tailored to patients' needs, preferences and abilities. There is increasing consensus that such a patient-centered approach could improve the management of type 2 diabetes. Thus far, it remains unclear which patient-related effect modifiers should guide such an approach.<h4>Methods</h4>PubMed, CINAHL and EMBASE were searched for empirical studies published after 1998. A systematic literature review was conducted according to the PRISMA guidelines.FindingsIn total, 23 out of 1015 studies were included. A total of 21 studies measured the effects of integrated diabetes care programs on hemoglobin A1c (HbA1c) and three on low-density lipoprotein cholesterol, systolic blood pressure and health-care utilization. In total, 49 patient characteristics were assessed as potential effect modifiers with HbA1c as an outcome, of which 46 were person or health-related and only three were context-related. Younger age, insulin therapy and longer disease duration were associated with higher HbA1c levels in cross-sectional and longitudinal studies. Higher baseline HbA1c was associated with higher HbA1c at follow-up in longitudinal studies. Information on context- and person-related characteristics was limited, but is necessary to help identify the care needs of individual patients and implement an effective integrated type 2 diabetes tailored care program.

Also flagged:SmadRift Valley fever virus infectioninfectionphosphorylationtranscription factorsTGF-β superfamily receptors
Journal Article 2018-02-06 No Snippets de la Fuente C, Pinkham C, Dabbagh D, Beitzel B, Garrison A, Palacios G, Hodge KA, Petricoin EF, Schmaljohn C, Campbell CE, Narayanan A, Kehn-Hall K.
Show Full Abstract

Rift Valley fever virus (RVFV) infects both ruminants and humans leading to a wide variance of pathologies dependent on host background and age. Utilizing a targeted reverse phase protein array (RPPA) to define changes in signaling cascades after in vitro infection of human cells with virulent and attenuated RVFV strains, we observed high phosphorylation of Smad transcription factors. This evolutionarily conserved family is phosphorylated by and transduces the activation of TGF-β superfamily receptors. Moreover, we observed that phosphorylation of Smad proteins required active RVFV replication and loss of NSs impaired this activation, further corroborating the RPPA results. Gene promoter analysis of transcripts altered after RVFV infection identified 913 genes that contained a Smad-response element. Functional annotation of these potential Smad-regulated genes clustered in axonal guidance, hepatic fibrosis and cell signaling pathways involved in cellular adhesion/migration, calcium influx, and cytoskeletal reorganization. Furthermore, chromatin immunoprecipitation confirmed the presence of a Smad complex on the interleukin 1 receptor type 2 (IL1R2) promoter, which acts as a decoy receptor for IL-1 activation.

Also flagged:cancertumorCK1colorectal tumortumorskinase
Journal Article 2018-02-06 ✓ 1 Snippet Richter J, Kretz AL, Lemke J, Fauler M, Werner JU, Paschke S, Leithäuser F, Henne-Bruns D, Hillenbrand A, Knippschild U.
In-Text Gene Mentions

…(GTPase KRas) ,DCC(Deleted in Colorectal…

Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) is the fourth leading cause of cancer related deaths worldwide and prognosis in advanced tumor stage still remains poor. Since CK1 isoforms have been reported to be deregulated in several tumor entities CK1 has emerged as a novel drug target in cancer therapy. In this study we set out to investigate whether CK1α might have the potential to serve as prognostic marker.<h4>Methods</h4>CK1α RNA and protein expression levels in healthy and tumor tissue of CRC patients were analyzed using quantitative real-time PCR and Western Blot analysis, respectively. Prognostic relevance was investigated by correlating obtained CK1α expression levels with patients' survival rate generating Kaplan-Meier survival plots.<h4>Results</h4>It could be shown that CK1α is overexpressed in colorectal tumor tissue compared to normal tissue and CK1α overexpression in tumor tissue correlates with poor survival in CRC patients. Results become more significant when only considering patients with high-grade tumors, as well as patients assigned to UICC II and UICC III stage. Furthermore, Cox regression analysis revealed that CK1α is an independent prognostic factor. In addition, tumors expressing decreased levels of the kinase reveal positive effects on overall survival when localized in the right colon compared to those in the left side.<h4>Conclusion</h4>In summary, this study provides evidence for the first time that CK1α RNA levels might serve as prognostic marker for CRC.

Also flagged:vitamin D binding proteincolorectal cancervitamin DBRAFtumorscancer
Journal Article 2018-02-06 No Snippets Zhu Y, Wang PP, Zhai G, Bapat B, Savas S, Woodrow JR, Campbell PT, Li Y, Yang N, Zhou X, Dicks E, Mclaughlin JR, Parfrey PS.
Show Full Abstract

<h4>Background</h4>The rs2282679 A>C polymorphism in the vitamin D binding protein gene is associated with lower circulating levels of vitamin D. We investigated associations of this SNP with colorectal cancer (CRC) risk and survival and whether the associations vary by dietary vitamin D intake and tumor molecular phenotype.<h4>Methods</h4>A population-based case-control study identified 637 incident CRC cases (including 489 participants with follow-up data on mortality end-points) and 489 matched controls. Germline DNA samples were genotyped with the Illumina Omni-Quad 1 Million chip in cases and the Affymetrix Axiom® myDesign™ Array in controls. Logistic regression examined the association between the rs2282679 polymorphism and CRC risk with inclusion of potential confounders. Kaplan-Meier curves and multivariable Cox models assessed the polymorphism relative to overall survival (OS) and disease-free survival (DFS).<h4>Results</h4>The rs2282679 polymorphism was not associated with overall CRC risk; there was evidence, however, of effect modification by total vitamin D intake (P<sub>interaction</sub> = 0.019). Survival analyses showed that the C allele was correlated with poor DFS (per-allele HR, 1.36; 95%CI, 1.05-1.77). The association of rs2282679 on DFS was limited to BRAF wild-type tumors (HR, 1.58; 95%CI, 1.12-2.23). For OS, the C allele was associated with higher all-cause mortality among patients with higher levels of dietary vitamin D (HR, 2.11; 95%CI, 1.29-3.74), calcium (HR, 1.93; 95%CI, 1.08-3.46), milk (HR, 2.36; 95%CI, 1.26-4.44), and total dairy product intakes (HR, 2.03; 95%CI, 1.11-3.72).<h4>Conclusion</h4>The rs2282679 SNP was not associated with overall CRC risk, but may be associated with survival after cancer diagnosis. The association of this SNP on survival among CRC patients may differ according to dietary vitamin D and calcium intakes and according to tumor BRAF mutation status.

Also flagged:FACFe2+Fe3+SLC13A5isocitratechloride
Journal Article 2018-02-06 ✓ 1 Snippet Ogura J, Babu E, Miyauchi S, Ramachandran S, Nemeth E, Bhutia YD, Ganapathy V.
In-Text Gene Mentions

…, 34 andhemochromatosis35 , 36…

Show Full Abstract

NaCT is a Na<sup>+</sup>-coupled transporter for citrate expressed in hepatocytes and neurons. It is the mammalian ortholog of INDY (I'm Not Dead Yet), a transporter which modifies lifespan in Drosophila. Here we describe a hitherto unknown transport system for citrate in mammalian cells. When liver and mammary epithelial cells were pretreated with the iron supplement ferric ammonium citrate (FAC), uptake of citrate increased >10-fold. Iron chelators abrogated the stimulation of citrate uptake in FAC-treated cells. The iron exporter ferroportin had no role in this process. The stimulation of citrate uptake also occurred when Fe<sup>3+</sup> was added during uptake without pretreatment. Similarly, uptake of Fe<sup>3+</sup> was enhanced by citrate. The Fe<sup>3+</sup>-citrate uptake was coupled to Na<sup>+</sup>. This transport system was detectable in primary hepatocytes and neuronal cell lines. The functional features of this citrate transport system distinguish it from NaCT. Loss-of-function mutations in NaCT cause early-onset epilepsy and encephalopathy; the newly discovered Na<sup>+</sup>-coupled Fe<sup>3+</sup>-citrate transport system might offer a novel treatment strategy for these patients to deliver citrate into affected neurons independent of NaCT. It also has implications to iron-overload conditions where circulating free iron increases, which would stimulate cellular uptake of citrate and consequently affect multiple metabolic pathways.

Also flagged:iron overload diseasehereditary hemochromatosisironcirrhosischromosome
Journal Article 2018-02-06 ✓ 1 Snippet Al-Ali M, Osman W, Tay GK, AlSafar HS.
In-Text Gene Mentions

…variants in theHFEgene on chromosome…

Show Full Abstract

Discoveries from the human genome, HapMap, and 1000 genome projects have collectively contributed toward the creation of a catalog of human genetic variations that has improved our understanding of human diversity. Despite the collegial nature of many of these genome study consortiums, which has led to the cataloging of genetic variations of different ethnic groups from around the world, genome data on the Arab population remains overwhelmingly underrepresented. The National Arab Genome project in the United Arab Emirates (UAE) aims to address this deficiency by using Next Generation Sequencing (NGS) technology to provide data to improve our understanding of the Arab genome and catalog variants that are unique to the Arab population of the UAE. The project was conceived to shed light on the similarities and differences between the Arab genome and those of the other ethnic groups.

Also flagged:mitochondrial diseasePARS2mitochondrial aminoacyl-tRNA synthetasesmt-aaRSsmitochondrialprotein synthesis
Journal Article 2018-02-06 ✓ 1 Snippet Ciara E, Rokicki D, Lazniewski M, Mierzewska H, Jurkiewicz E, Bekiesińska-Figatowska M, Piekutowska-Abramczuk D, Iwanicka-Pronicka K, Szymańska E, Stawiński P, Kosińska J, Pollak A, Pronicki M, Plewczyński D, Płoski R, Pronicka E.
In-Text Gene Mentions

…other mt-aaRSs defects (DARS2, EARS2, IARS2, and…

Show Full Abstract

Most of the 19 mitochondrial aminoacyl-tRNA synthetases (mt-aaRSs) involved in mitochondrial protein synthesis are already linked to specific entities, one of the exceptions being PARS2 mutations for which pathogenic significance is not finally validated. The aim of the study was to characterize the PARS2- related phenotype.Three siblings with biallelic PARS2 mutations presented from birth with infantile spasms, secondary microcephaly, and similar facial dysmorphy. Mental development was deeply impaired with speech absence and no eye contact. A dilated cardiomyopathy and multiorgan failure developed in childhood at the terminal stage, together with mitochondrial dysfunction triggered by valproate administration.Brain MRI showed progressive volume loss of the frontal lobes, both cortical and subcortical, with widening of the cortical sulci and frontal horns of the lateral ventricles. Hypoplasia of the corpus callosum and progressive demyelination were additional findings. Similar brain features were seen in three already reported PARS2 patients and seemed specific for this defect when compared with other mt-aaRSs defects (DARS2, EARS2, IARS2, and RARS2).Striking resemblance of the phenotype and Alpers-like brain MRI changes with predominance of frontal cerebral volume loss (FCVL-AS) in six patients from three families of different ethnicity with PARS2 mutations, justifies to distinguish the condition as a new disease entity.

Also flagged:Oligonucleotidegene expressionoligonucleotidescancercell-penetratingpeptides
Journal Article 2018-02-06 ✓ 2 Snippets Grijalvo S, Alagia A, Jorge AF, Eritja R.
In-Text Gene Mentions

Preliminary in vivo experiments in mouse brain showed important silencing of the Htt mRNA expression in two brain areas where Huntington disease is mainly affected (i.e., cortex and ipsilateral striatum) without significant neuronal toxicities but with an important gradient of diffusion.

The resultant lipid-siRNA conjugates were designed for targeting both Huntingtin (Htt) mRNA and CyclophilinB, a binding protein that is involved in some neurodegenerative disorders [128].

Show Full Abstract

Oligonucleotide-based therapy has become an alternative to classical approaches in the search of novel therapeutics involving gene-related diseases. Several mechanisms have been described in which demonstrate the pivotal role of oligonucleotide for modulating gene expression. Antisense oligonucleotides (ASOs) and more recently siRNAs and miRNAs have made important contributions either in reducing aberrant protein levels by sequence-specific targeting messenger RNAs (mRNAs) or restoring the anomalous levels of non-coding RNAs (ncRNAs) that are involved in a good number of diseases including cancer. In addition to formulation approaches which have contributed to accelerate the presence of ASOs, siRNAs and miRNAs in clinical trials; the covalent linkage between non-viral vectors and nucleic acids has also added value and opened new perspectives to the development of promising nucleic acid-based therapeutics. This review article is mainly focused on the strategies carried out for covalently modifying siRNA and miRNA molecules. Examples involving cell-penetrating peptides (CPPs), carbohydrates, polymers, lipids and aptamers are discussed for the synthesis of siRNA conjugates whereas in the case of miRNA-based drugs, this review article makes special emphasis in using antagomiRs, locked nucleic acids (LNAs), peptide nucleic acids (PNAs) as well as nanoparticles. The biomedical applications of siRNA and miRNA conjugates are also discussed.

Also flagged:UBE3Aubiquitin-ligaseAngelman syndromeautism spectrum disordersE6 proteinp53
Journal Article 2018-02-06 ✓ 1 Snippet Martínez-Noël G, Luck K, Kühnle S, Desbuleux A, Szajner P, Galligan JT, Rodriguez D, Zheng L, Boyland K, Leclere F, Zhong Q, Hill DE, Vidal M, Howley PM.
In-Text Gene Mentions

ECI2

Show Full Abstract

Perturbations in activity and dosage of the UBE3A ubiquitin-ligase have been linked to Angelman syndrome and autism spectrum disorders. UBE3A was initially identified as the cellular protein hijacked by the human papillomavirus E6 protein to mediate the ubiquitylation of p53, a function critical to the oncogenic potential of these viruses. Although a number of substrates have been identified, the normal cellular functions and pathways affected by UBE3A are largely unknown. Previously, we showed that UBE3A associates with HERC2, NEURL4, and MAPK6/ERK3 in a high-molecular-weight complex of unknown function that we refer to as the HUN complex (HERC2, UBE3A, and NEURL4). In this study, the combination of two complementary proteomic approaches with a rigorous network analysis revealed cellular functions and pathways in which UBE3A and the HUN complex are involved. In addition to finding new UBE3A-associated proteins, such as MCM6, SUGT1, EIF3C, and ASPP2, network analysis revealed that UBE3A-associated proteins are connected to several fundamental cellular processes including translation, DNA replication, intracellular trafficking, and centrosome regulation. Our analysis suggests that UBE3A could be involved in the control and/or integration of these cellular processes, in some cases as a component of the HUN complex, and also provides evidence for crosstalk between the HUN complex and CAMKII interaction networks. This study contributes to a deeper understanding of the cellular functions of UBE3A and its potential role in pathways that may be affected in Angelman syndrome, UBE3A-associated autism spectrum disorders, and human papillomavirus-associated cancers.

Also flagged:Auditory Nerve Demyelinationauditory nerveANhearing deficiencyQKImyelination
Journal Article 2018-02-06 No Snippets Panganiban CH, Barth JL, Darbelli L, Xing Y, Zhang J, Li H, Noble KV, Liu T, Brown LN, Schulte BA, Richard S, Lang H.
Show Full Abstract

Noise exposure causes auditory nerve (AN) degeneration and hearing deficiency, though the proximal biological consequences are not entirely understood. Most AN fibers and spiral ganglion neurons are ensheathed by myelinating glia that provide insulation and ensure rapid transmission of nerve impulses from the cochlea to the brain. Here we show that noise exposure administered to mice of either sex rapidly affects myelinating glial cells, causing molecular and cellular consequences that precede nerve degeneration. This response is characterized by demyelination, inflammation, and widespread expression changes in myelin-related genes, including the RNA splicing regulator <i>Quaking</i> (QKI) and numerous QKI target genes. Analysis of mice deficient in QKI revealed that QKI production in cochlear glial cells is essential for proper myelination of spiral ganglion neurons and AN fibers, and for normal hearing. Our findings implicate QKI dysregulation as a critical early component in the noise response, influencing cochlear glia function that leads to AN demyelination and, ultimately, to hearing deficiency.<b>SIGNIFICANCE STATEMENT</b> Auditory glia cells ensheath a majority of spiral ganglion neurons with myelin, protect auditory neurons, and allow for fast conduction of electrical impulses along the auditory nerve. Here we show that noise exposure causes glial dysfunction leading to myelin abnormality and altered expression of numerous genes in the auditory nerve, including QKI, a gene implicated in regulating myelination. Study of a conditional mouse model that specifically depleted QKI in glia showed that QKI deficiency alone was sufficient to elicit myelin-related abnormality and auditory functional declines. These results establish QKI as a key molecular target in the noise response and a causative agent in hearing loss.

Also flagged:chronic pancreatitispancreatitisdepressionanxietyinsulindiabetes
Journal Article 2018-02-06 No Snippets Bellin MD, Abu-El-Haija M, Morgan K, Adams D, Beilman GJ, Chinnakotla S, Conwell DL, Dunn TB, Freeman ML, Gardner T, Kirchner VA, Lara LF, Long-Simpson L, Nathan JD, Naziruddin B, Nyman JA, Pruett TL, Schwarzenberg SJ, Singh VK, Smith K, Steel JL, Wijkstrom M, Witkowski P, Hodges JS, POST study consortium.
Show Full Abstract

<h4>Background/objectives</h4>Total pancreatectomy with islet autotransplantation (TPIAT) is considered for managing chronic pancreatitis in selected patients when medical and endoscopic interventions have not provided adequate relief from debilitating pain. Although more centers are performing TPIAT, we lack large, multi-center studies to guide decisions about selecting candidates for and timing of TPIAT.<h4>Methods</h4>Multiple centers across the United States (9 to date) performing TPIAT are prospectively enrolling patients undergoing TPIAT for chronic pancreatitis into the Prospective Observational Study of TPIAT (POST), a NIDDK funded study with a goal of accruing 450 TPIAT recipients. Baseline data include participant phenotype, pancreatitis history, and medical/psychological comorbidities from medical records, participant interview, and participant self-report (Medical Outcomes Survey Short Form-12, EQ-5D, andPROMIS inventories for pain interference, depression, and anxiety). Outcome measures are collected to at least 1 year after TPIAT, including the same participant questionnaires, visual analog pain scale, pain interference scores, opioid requirements, insulin requirements, islet graft function, and hemoglobin A1c. Health resource utilization data are collected for a cost-effectiveness analysis. Biorepository specimens including urine, serum/plasma, genetic material (saliva and blood), and pancreas tissue are collected for future study.<h4>Conclusions</h4>This ongoing multicenter research study will enroll and follow TPIAT recipients, aiming to evaluate patient selection and timing for TPIAT to optimize pain relief, quality of life, and diabetes outcomes, and to measure the procedure's cost-effectiveness. A biorepository is also established for future ancillary studies.

Also flagged:P2X7 ReceptorInflammatory Diseasesadenosine triphosphateextracellularnucleotidesnucleoside
Journal Article 2018-02-06 ✓ 2 Snippets Savio LEB, de Andrade Mello P, da Silva CG, Coutinho-Silva R.
In-Text Gene Mentions

The molecular mechanisms behind HTT toxicity are still under investigation, but recent studies have suggested a possible role for ATP and P2X7 receptor activation in the pathophysiology of HD.

Huntington's disease is an inherited neurodegenerative disorder caused by a CAG triplet-repeat expansion coding for a polyglutamine (polyQ) sequence in the N-terminal region of the huntingtin (HTT) protein, leading to progressive degeneration of nerve cells in the brain, predominantly in the cortex and striatum.

Show Full Abstract

Under physiological conditions, adenosine triphosphate (ATP) is present at low levels in the extracellular milieu, being massively released by stressed or dying cells. Once outside the cells, ATP and related nucleotides/nucleoside generated by ectonucleotidases mediate a high evolutionary conserved signaling system: the purinergic signaling, which is involved in a variety of pathological conditions, including inflammatory diseases. Extracellular ATP has been considered an endogenous adjuvant that can initiate inflammation by acting as a danger signal through the activation of purinergic type 2 receptors-P2 receptors (P2Y G-protein coupled receptors and P2X ligand-gated ion channels). Among the P2 receptors, the P2X7 receptor is the most extensively studied from an immunological perspective, being involved in both innate and adaptive immune responses. P2X7 receptor activation induces large-scale ATP release via its intrinsic ability to form a membrane pore or in association with pannexin hemichannels, boosting purinergic signaling. ATP acting via P2X7 receptor is the second signal to the inflammasome activation, inducing both maturation and release of pro-inflammatory cytokines, such as IL-1β and IL-18, and the production of reactive nitrogen and oxygen species. Furthermore, the P2X7 receptor is involved in caspases activation, as well as in apoptosis induction. During adaptive immune response, P2X7 receptor modulates the balance between the generation of T helper type 17 (Th17) and T regulatory (Treg) lymphocytes. Therefore, this receptor is involved in several inflammatory pathological conditions. In infectious diseases and cancer, P2X7 receptor can have different and contrasting effects, being an angel or a demon depending on its level of activation, cell studied, type of pathogen, and severity of infection. In neuroinflammatory and neurodegenerative diseases, P2X7 upregulation and function appears to contribute to disease progression. In this review, we deeply discuss P2X7 receptor dual function and its pharmacological modulation in the context of different pathologies, and we also highlight the P2X7 receptor as a potential target to treat inflammatory related diseases.

Also flagged:IronHepatocellular Carcinomacancerchronic liver diseasesmetabolismHCV infection
Journal Article 2018-02-06 ✓ 3 Snippets Wei Y, Ye W, Zhao W.
In-Text Gene Mentions

…the relationship betweenhemochromatosisand iron overload…

…251 patients withhemochromatosisin 1996, the…

…showed prognosis ofhemochromatosisand most of…

Show Full Abstract

<b>Background:</b> Hepatocellular carcinoma (HCC) is common and the second leading causes of cancer-related deaths. HCC usually occurs on the basis of chronic liver diseases. At present, the study of iron metabolism in chronic liver diseases was limited to chronic HCV infection, nonalcoholic fatty liver disease, and alcoholic liver disease. This study aimed to investigate the effect of serum iron levels on the progression of chronic HBV infection and the relationship with the prognosis of HBV-related HCC. <b>Methods:</b> A respective study involving 277 healthy individuals as controls (HC), 295 patients with chronic hepatitis B (CHB), 224 patients with HBV-related liver cirrhosis (HBV-related LC), and 586 patients with HBV- related HCC were enrolled in this study. Hematological parameters, HBVDNA and liver biochemistry were analyzed. Child-Pugh grade and BCLC stage of the HBV-related HCC patients were calculated. <b>Results:</b> The serum iron levels were lowest in the HBV- related HCC group as compared with HC, CHB, and HBV-related LC groups (35.07 ± 6.97, 27.37 ± 10.26, 24.53 ± 10.36 vs. 17.90 ± 0.14, <i>P</i> < 0.001). Strikingly, serum iron levels were lowest in HBV- related HCC patients with tumor size more than 10 cm as compared with HBV- related HCC patients with tumor size smaller than 3, 3-5, and 5-10 cm by subgroup analysis (22.12 ± 0.94, 21.44 ± 1.41, 15.65 ± 0.98 vs. 13.36 ± 1.15, <i>P</i> < 0.001). Serum iron levels significantly decreased with worsening Child-Pugh grades and BCLC stages in HBV-related HCC group. In addition, serum iron levels was positively correlated with Retinol-Binding Protein, total bile acid, hemoglobin, and lymphocyte and negatively correlated with white blood cell (WBC) and platelet in HBV- related HCC group. ROC curve analysis showed serum iron levels at 15.1 μmol/L as the optimal cut-off point for determining the survival of HBV-related HCC. By the Cox regression model analysis, serum iron levels <15.1 μmol/l together with higher AFP levels, worse BCLC stages, and larger tumor size showed higher mortality of HBV-related HCC patients (hazard ratio = 2.280, 95% confidence interval, 1.815-2.865; <i>P</i> < 0.001). <b>Conclusions:</b> Serum iron levels affected the progression of chronic HBV infection. The prognosis of HBV- related HCC patients with serum iron levels <15.1 μmol/l together with higher AFP levels, worse BCLC stages, and larger tumor lesion were poor.

Also flagged:pattern-recognition receptorsacidsadaptor proteinskinasestranscription factorsIL-1β
Journal Article 2018-02-06 No Snippets Li K, Zhong B.
Show Full Abstract

The initiation of cellular antiviral signaling depends on host pattern-recognition receptors (PRRs)-mediated recognition of viral nucleic acids that are known as classical pathogen-associated molecular patterns (PAMPs). PRRs recruit adaptor proteins and kinases to activate transcription factors and epigenetic modifiers to regulate transcription of hundreds of genes, the products of which collaborate to elicit antiviral responses. In addition, PRRs-triggered signaling induces activation of various inflammasomes which leads to the release of IL-1β and inflammation. Recent studies have demonstrated that PRRs-triggered signaling is critically regulated by ubiquitin and ubiquitin-like molecules. In this review, we first summarize an updated understanding of cellular antiviral signaling and virus-induced activation of inflammasome and then focus on the regulation of key components by ubiquitin and ubiquitin-like molecules.

Also flagged:peptidesdipeptideHER2peptidesynthesisHexanes
Journal Article 2018-02-06 No Snippets Chen KT, Ieritano C, Seimbille Y.
Show Full Abstract

Herein, we describe a synthetic strategy for the regioselective labeling of peptides by using a bioorthogonal click reaction between 2-cyanobenzothiazole (CBT) and a 1,2-aminothiol moiety. This methodology allows for the facile and site-specific modification of peptides with various imaging agents, including fluorophores and radioisotope-containing prosthetic groups. We investigated the feasibility of an early-stage incorporation of dipeptide <b>1</b> into targeting vectors, such as <b>c[RGDyK(C)]</b> and <b>HER2 pep</b>, during solid-phase peptide synthesis. Then, the utility of the click reaction to label bioactive peptides with a CBT-modified imaging agent (FITC-CBT, <b>9</b>) was assessed. The ligation reaction was found to be highly selective and efficient under various conditions. The fluorescently labeled peptides <b>2</b> and <b>3</b> were obtained in respective yields of 88 and 82 % under optimized conditions.

Also flagged:autophagyautophagy-relatedcutaneous squamous cell carcinoma of head and neckGene Expressionhypoxia-inducible factor 1αHIF1A
Journal Article 2018-02-06 No Snippets Zheng LQ, Li SY, Li CX.
Show Full Abstract

The aim of the present study was to identify the potential autophagy-related genes and to explore the underlying molecular mechanisms involved in cutaneous squamous cell carcinoma of head and neck (cSCCHN) by bioinformatics analysis. The Gene Expression Omnibus (GEO) series GSE86544 was downloaded from the GEO database. The primary data was generated from cSCCHN with clinical perineural invasion (PNI) and cSCCHN without PNI, and was further analyzed in order to identify differentially expressed genes (DEGs). The results revealed 239 autophagy-related DEGs. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed and intersected to investigate the predicted functions of the key DEGs, including hypoxia-inducible factor 1α (HIF1A), mitogen-activated protein kinase 8 (MAPK8), mammalian target of rapamycin (mTOR) and B-cell lymphoma 2 like 1 (BCL2L1). Up and downregulated genes shared one pathway, namely 'pathways in cancer'. Next, the protein-protein interaction (PPI) network of the autophagy-related DEGs was constructed using Cytoscape 3.30 software. HIF1A, MAPK8, mTOR and BCL2L1 were key nodes in the PPI network. Additionally, RAB23 gene expression was positively correlated with HIF1A, MAPK8 and ADP ribosylation factor GTPase activating protein 1 (ARFGAP1), but negatively correlated with mTOR and BCL2L1. The present results suggested that the genes HIF1A, MAPK8, mTOR, BCL2L1 and RAB23 may be associated with and serve as potential therapeutic targets in cSCCHN with clinical PNI.

Also flagged:bladder cancercancerssolid tumors-to-mesenchymal transitionepithelial-to-mesenchymal transitioncancer of the urinary system
Journal Article 2018-02-06 No Snippets Gao JM, Huang LZ, Huang ZG, He RQ.
Show Full Abstract

The clinicopathological value and exploration of the potential molecular mechanism of microRNA-183-5p (miR-183-5p) have been investigated in various cancers; however, to the best of the author's knowledge, no similar research has been reported for bladder cancer. In the present study, it was revealed that the expression level of miR-183-5p was notably increased in bladder cancer tissues compared with adjacent non-cancerous tissues (P=0.001) and was markedly increased in the tissue samples of papillary, pathological T stage (T0-T2) and pathological stage (I-II) compared with tissue samples of their counterparts (P=0.05), according to data from The Cancer Genome Atlas. Receiver operating characteristic analysis revealed the robust diagnostic value of miR-183-5p for distinguishing bladder cancer from non-cancerous bladder tissues (area under curve=0.948; 95% confidence interval: 0.919-0.977). Amplification and deep deletion of miR-183-5p were indicated by cBioPortal, accounting for 1% (4/412) of bladder cancer cases. Data from YM500v3 demonstrated that compared with other cancers, bladder cancer exhibited high expression levels of miR-183-5p, and miR-183-5p expression in primary solid tumors was much higher compared with solid normal tissues. A meta-analysis indicated that miR-183-5p was more highly expressed in bladder cancer samples compared with normal counterparts. A total of 88 potential target genes of miR-183-5p were identified, 13 of which were discerned as hub genes by protein-protein interaction. The epithelial-to-mesenchymal transition pathway was the most significantly enriched pathway by FunRich (P=0.0001). In summary, miR-183-5p may participate in the tumorigenesis and development of bladder cancer via certain signaling pathways, particularly the epithelial-to-mesenchymal transition pathway. However, the exact molecular mechanism of miR-183-5p in bladder cancer must be validated by <i>in vitro</i> and <i>in vivo</i> experiments.

Also flagged:myocardial infarctionMIcoronary artery diseasestable anginanitrogensynthesis
Journal Article 2018-02-06 No Snippets Wongsurawat T, Woo CC, Giannakakis A, Lin XY, Cheow ESH, Lee CN, Richards M, Sze SK, Nookaew I, Kuznetsov VA, Sorokin V.
Show Full Abstract

This article contains further data and information from our published manuscript [1]. We aim to identify significant transcriptome alterations of vascular smooth muscle cells (VSMCs) in the aortic wall of myocardial infarction (MI) patients. Microarray gene analysis was applied to evaluate VSMCs of MI and non-MI patients. Prediction Analysis of Microarray (PAM) identified genes that significantly discriminated the two groups of samples. Incorporation of gene ontology (GO) identified a VSMCs-associated classifier that discriminated between the two groups of samples. Mass spectrometry-based iTRAQ analysis revealed proteins significantly differentiating these two groups of samples. Ingenuity Pathway Analysis (IPA) revealed top pathways associated with hypoxia signaling in cardiovascular system. Enrichment analysis of these proteins suggested an activated pathway, and an integrated transcriptome-proteome pathway analysis revealed that it is the most implicated pathway. The intersection of the top candidate molecules from the transcriptome and proteome highlighted overexpression.

Also flagged:fentanylmorphinecancerrespiratory depressionadrenoceptor β2ADRB2
Journal Article 2018-02-06 ✓ 1 Snippet Yoshida K, Nishizawa D, Ide S, Ichinohe T, Fukuda KI, Ikeda K.
In-Text Gene Mentions

…(SNP variable forCACNA1E) + ( −…

Show Full Abstract

<h4>Introduction</h4>Opioid analgesics are widely used as effective analgesics for the treatment of moderate-to-severe pain. However, the analgesic efficacy of opioids is well known to vary widely among individuals, and effective pain treatment is hampered by vast individual differences. Although these differences in opioid requirements have been attributed to various factors, genetic factors are becoming increasingly relevant to the development of genome science.<h4>Aim</h4>This review covers the association between opioid analgesic requirements and particularly gene polymorphisms.<h4>Future perspectives</h4>Personalized pain treatment has begun using prediction formulas based on associated gene polymorphisms. Improvements in personalized pain treatment are expected as scientific knowledge further expands in the future.

Also flagged:axon guidance receptorlocomotionaxons
Journal Article 2018-02-05 ✓ 4 Snippets Peng J, Ferent J, Li Q, Liu M, Da Silva RV, Zeilhofer HU, Kania A, Zhang Y, Charron F.
In-Text Gene Mentions

Local spinal cord defects following loss of Dcc cause a hopping gait in mice and may contribute to MM in humans.

…axon guidance receptorDCCdisplay congenital mirror…

…to specifically removeDccfrom the spinal…

…following loss ofDcccause a hopping…

Show Full Abstract

<h4>Background</h4>Humans with heterozygous mutations in the axon guidance receptor DCC display congenital mirror movements (MMs), which are involuntary movements of body parts, such as fingers, on one side of the body that mirror voluntary movement of the opposite side. In mice, the homozygous Dcc<sup>kanga</sup> mutant allele causes synchronous MM-like hindlimb movements during locomotion, resulting in hopping. In both human and mice, the neuroanatomical defect responsible for the deficit in lateralized motor control remains to be elucidated.<h4>Results</h4>Using the HoxB8-Cre line to specifically remove Dcc from the spinal cord, we found misrouting of commissural axons during their migration toward the floor plate, resulting in fewer axons crossing the midline. These mice also have a hopping gait, indicating that spinal cord guidance defects alone are sufficient to cause hopping.<h4>Conclusions</h4>Dcc plays a role in the development of local spinal networks to ensure proper lateralization of motor control during locomotion. Local spinal cord defects following loss of Dcc cause a hopping gait in mice and may contribute to MM in humans. Developmental Dynamics 247:620-629, 2018. © 2017 Wiley Periodicals, Inc.

Also flagged:Arid5aOX40CD4AT-rich interactive domain-containing protein 5aRNA-binding proteinRBP
Journal Article 2018-02-05 ✓ 1 Snippet Hanieh H, Masuda K, Metwally H, Chalise JP, Mohamed M, Nyati KK, Standley DM, Li S, Higa M, Zaman MM, Kishimoto T.
In-Text Gene Mentions

…of Regnase-1 andRoquin-1on OX40 ADE-like…

Show Full Abstract

AT-rich interactive domain-containing protein 5a (Arid5a) is an RNA-binding protein (RBP) required for autoimmunity via stabilization of interleukin-6 (Il6) and signal transducer and activator of transcription 3 (STAT3) mRNAs. However, the roles of Arid5a in Th17 cells and its association with autoimmunity remain unknown. Here, we show that the levels of Arid5a and OX40 are correlated in CD4<sup>+</sup> T cells under Th17 conditions in an IL-6-dependent manner. Lack of Arid5a in T cells reduced OX40 expression levels and repressed IL-17 production in response to OX40 ligation. Arid5a stabilized OX40 mRNA by recognizing the alternative decay element (ADE)-like stem-loop (SL) in the 3' untranslated region (3'UTR). Interestingly, Arid5a impaired the RNA-destabilizing functions of Regnase-1 and Roquin-1 on OX40 ADE-like SL. In EAE, Arid5a-deficient mice exhibited resistance to EAE, with reduced OX40 expression in CD4<sup>+</sup> T cells, and the number of CD4<sup>+</sup> CD45<sup>+</sup> T cells was decreased in CNS. Furthermore, ameliorated EAE was induced by adoptive transfer of Arid5a<sup>-/-</sup> encephalitogenic CD4<sup>+</sup> T cells expressing less OX40 mRNA and producing less IL-17. In conclusion, our findings indicate that the Arid5a/OX40 axis in CD4<sup>+</sup> T cells may have important implications in pathogenesis of autoimmune diseases such as EAE.

Also flagged:biotin ligasebindinggenetic disordersbreast cancerironL-ferritin
Journal Article 2018-02-05 ✓ 1 Snippet Ramanathan M, Majzoub K, Rao DS, Neela PH, Zarnegar BJ, Mondal S, Roth JG, Gai H, Kovalski JR, Siprashvili Z, Palmer TD, Carette JE, Khavari PA.
In-Text Gene Mentions

RC3H1

Show Full Abstract

RNA-protein interactions play numerous roles in cellular function and disease. Here we describe RNA-protein interaction detection (RaPID), which uses proximity-dependent protein labeling, based on the BirA* biotin ligase, to rapidly identify the proteins that bind RNA sequences of interest in living cells. RaPID displays utility in multiple applications, including in evaluating protein binding to mutant RNA motifs in human genetic disorders, in uncovering potential post-transcriptional networks in breast cancer, and in discovering essential host proteins that interact with Zika virus RNA. To improve the BirA*-labeling component of RaPID, moreover, a new mutant BirA* was engineered from Bacillus subtilis, termed BASU, that enables >1,000-fold faster kinetics and >30-fold increased signal-to-noise ratio over the prior standard Escherichia coli BirA*, thereby enabling direct study of RNA-protein interactions in living cells on a timescale as short as 1 min.

Also flagged:litApatiteIntracellularCancercalciumnanoparticles
Journal Article 2018-02-05 No Snippets Fatemian T, Chowdhury EH.
Show Full Abstract

Pharmacotherapy as the mainstay in the management of breast cancer has demonstrated various drawbacks, including non-targeted bio distribution and narrow therapeutic and safety windows. Thus, enhancements in pharmacodynamic and pharmacokinetic profiles of the classical anti-cancer drugs could lead to improved efficacy against cancer cells. Therefore, inorganic pH-dependent carbonate apatite (CA) nanoparticles were utilized to efficiently deliver various drugs into cancer cells. Following characterization and various modifications in the structure of CA complexes with different drugs, lifted outcomes were achieved. Markedly, complexing paclitaxel with CA resulted in 20.71 ± 4.34% loading efficiency together with 24.14 ± 2.21% enhancement in cytotoxicity on MCF-7 cells plus superior in vivo anti-tumour efficacy compared to free paclitaxel.

Also flagged:reproductionmetabolismbiosynthesisplacentationgestationlactation
Journal Article 2018-02-05 No Snippets Whittington CM, O'Meally D, Laird MK, Belov K, Thompson MB, McAllan BM.
Show Full Abstract

Early pregnancy is a critical time for successful reproduction; up to half of human pregnancies fail before the development of the definitive chorioallantoic placenta. Unlike the situation in eutherian mammals, marsupial pregnancy is characterised by a long pre-implantation period prior to the development of the short-lived placenta, making them ideal models for study of the uterine environment promoting embryonic survival pre-implantation. Here we present a transcriptomic study of pre-implantation marsupial pregnancy, and identify differentially expressed genes in the Sminthopsis crassicaudata uterus involved in metabolism and biosynthesis, transport, immunity, tissue remodelling, and uterine receptivity. Interestingly, almost one quarter of the top 50 genes that are differentially upregulated in early pregnancy are putatively involved in histotrophy, highlighting the importance of nutrient transport to the conceptus prior to the development of the placenta. This work furthers our understanding of the mechanisms underlying survival of pre-implantation embryos in the earliest live bearing ancestors of mammals.

Also flagged:HDdeathneurological disordersmitochondrialPolyglutaminepolyethyleneimine
Journal Article 2018-02-05 ✓ 5 Snippets Victor MB, Richner M, Olsen HE, Lee SW, Monteys AM, Ma C, Huh CJ, Zhang B, Davidson BL, Yang XW, Yoo AS.
In-Text Gene Mentions

Importantly, aggregation propensity was not dependent on HTT mutation, as evidenced by similar levels of proteostasis between HD and control samples (Fig. 5f,i).

In Huntington’s disease (HD), expansion of CAG codons within the huntingtin gene (HTT) leads to the aberrant formation of protein aggregates and the differential degeneration of striatal medium spiny neurons (MSNs).

Huntington’s disease (HD) is a progressive neurodegenerative disorder caused by an abnormal expansion of CAG codons within the huntingtin (HTT) gene1,2.

…huntingtin gene (HTT) leads to…

…#124805, 1:200), mouse anti-HTT(mEM48, Millipore #MAB5374,…

Show Full Abstract

In Huntington's disease (HD), expansion of CAG codons in the huntingtin gene (HTT) leads to the aberrant formation of protein aggregates and the differential degeneration of striatal medium spiny neurons (MSNs). Modeling HD using patient-specific MSNs has been challenging, as neurons differentiated from induced pluripotent stem cells are free of aggregates and lack an overt cell death phenotype. Here we generated MSNs from HD patient fibroblasts through microRNA-based direct neuronal conversion, bypassing the induction of pluripotency and retaining age signatures of the original fibroblasts. We found that patient MSNs consistently exhibited mutant HTT (mHTT) aggregates, mHTT-dependent DNA damage, mitochondrial dysfunction and spontaneous degeneration in culture over time. We further provide evidence that erasure of age stored in starting fibroblasts or neuronal conversion of presymptomatic HD patient fibroblasts results in differential manifestation of cellular phenotypes associated with HD, highlighting the importance of age in modeling late-onset neurological disorders.

Also flagged:ironHbC-reactive proteinCRPHepcidiniron deficiency
Journal Article 2018-02-05 ✓ 5 Snippets Aranda N, Bedmar C, Arija V, Jardí C, Jimenez-Feijoo R, Ferré N, Tous M, Defensas Study investigators.
In-Text Gene Mentions

…iron status, andHFEgene alterations during…

…variants in theHFEgene in healthy…

…infants with wild-typeHFEgene (p =…

…not found inHFE-alteration-carrying infants.…

…infants with wild-typeHFEgene, a situation…

Show Full Abstract

The aims of this study were to describe hepcidin levels and to assess their associations with iron status and the main variants in the HFE gene in healthy and full-term newborns during the first year of life, as a longitudinal study conducted on 140 infants. Anthropometric and biochemical parameters, hepcidin, hemoglobin (Hb), serum ferritin (SF), transferrin saturation (TS), mean corpuscular volume (MCV), and C-reactive protein (CRP), were assessed in 6- and 12-month-olds. Infants were genotyped for the three main HFE variants: C282Y, H63D, and S65C. Hepcidin levels increased from 6 to 12 months of age (43.7 ± 1.5 to 52.0 ± 1.5 ng/mL; p < 0.001), showing higher levels in infants with better iron status compared to those with iron deficiency (ID) (44.8 ± 1.5 vs 37.9 ± 1.3 ng/mL, p < 0.018, and 54.3 ± 1.5 vs 44.0 ± 1.4 ng/mL, p < 0.038, in 6- and 12-month-olds, respectively). In multivariate linear regression models, iron status was found to be associated with hepcidin levels in infants with wild-type HFE gene (p = 0.046 and p = 0.048 in 6- and 12-month-olds, respectively). However, this association was not found in HFE-alteration-carrying infants. Hepcidin levels increased in healthy infants during the first year of life and were positively associated with iron levels only in infants with wild-type HFE gene, a situation that requires further investigation.

Also flagged:GLUT12prostate cancercell growthmetabolismcancerandrogen receptor
Journal Article 2018-02-05 ✓ 1 Snippet White MA, Tsouko E, Lin C, Rajapakshe K, Spencer JM, Wilkenfeld SR, Vakili SS, Pulliam TL, Awad D, Nikolos F, Katreddy RR, Kaipparettu BA, Sreekumar A, Zhang X, Cheung E, Coarfa C, Frigo DE.
In-Text Gene Mentions

SLC2A14

Show Full Abstract

Despite altered metabolism being an accepted hallmark of cancer, it is still not completely understood which signaling pathways regulate these processes. Given the central role of androgen receptor (AR) signaling in prostate cancer, we hypothesized that AR could promote prostate cancer cell growth in part through increasing glucose uptake via the expression of distinct glucose transporters. Here, we determined that AR directly increased the expression of <i>SLC2A12</i>, the gene that encodes the glucose transporter GLUT12. In support of these findings, gene signatures of AR activity correlated with <i>SLC2A12</i> expression in multiple clinical cohorts. Functionally, GLUT12 was required for maximal androgen-mediated glucose uptake and cell growth in LNCaP and VCaP cells. Knockdown of GLUT12 also decreased the growth of C4-2, 22Rv1 and AR-negative PC-3 cells. This latter observation corresponded with a significant reduction in glucose uptake, indicating that additional signaling mechanisms could augment GLUT12 function in an AR-independent manner. Interestingly, GLUT12 trafficking to the plasma membrane was modulated by calcium/calmodulin-dependent protein kinase kinase 2 (CaMKK2)-5'-AMP-activated protein kinase (AMPK) signaling, a pathway we previously demonstrated to be a downstream effector of AR. Inhibition of CaMKK2-AMPK signaling decreased GLUT12 translocation to the plasma membrane by inhibiting the phosphorylation of TBC1D4, a known regulator of glucose transport. Further, AR increased <i>TBC1D4</i> expression. Correspondingly, expression of <i>TBC1D4</i> correlated with AR activity in prostate cancer patient samples. Taken together, these data demonstrate that prostate cancer cells can increase the functional levels of GLUT12 through multiple mechanisms to promote glucose uptake and subsequent cell growth.

Also flagged:obesitygenetic syndromePrader-Willi syndromesyndromic obesitychildhood obesityGNB3
Journal Article 2018-02-05 ✓ 5 Snippets D'Angelo CS, Varela MC, de Castro CIE, Otto PA, Perez ABA, Lourenço CM, Kim CA, Bertola DR, Kok F, Garcia-Alonso L, Koiffmann CP.
In-Text Gene Mentions

Overall, we found CNVs that further implicate genes previously associated with obesity such as PTBP2, TMEM18, MYT1L, POU3F2, SIM1, SH2B1 and GNB3, and also identified other potentially relevant candidate genes including TAS1R3, ALOX5AP, and GAS6. Our study highlights the significant value of chromosomal microarrays in providing not only a genetic diagnosis for syndromic causes of obesity but in uncovering genes relevant to human obesity.

As previously mentioned, SH2B1, SIM1, PTBP2, PRLH, CAPN10, ACP1, TMEM18, EHMT1, and GNB3 are relevant candidate and known genes for obesity within these regions (Fig. 6), and POU3F2 [20], HDAC4 [50], MYT1L [52], and RAI1 [53] were also candidate genes identified in these loci. Moreover, our gene prioritization analysis identified 20 new genes of interest to obesity overlapping these CNVs, among which we highlight the potential importance of TAS1R3, encoding a taste receptor differentially expressed in obese mice [54].

Small 6q16.1 deletions encompassing the POU3F2 gene were identified in 10 individuals presenting with obesity, hyperphagia and IDDs [20].

Our findings implicate many genes previously associated with obesity (e.g. PTBP2, TMEM18, MYT1L, POU3F2, SIM1, SH2B1), and also identified other potentially relevant candidates including TAS1R3, ALOX5AP, and GAS6.

…, MYT1L ,POU3F2, SIM1 ,…

Show Full Abstract

<h4>Background</h4>Syndromic obesity is an umbrella term used to describe cases where obesity occurs with additional phenotypes. It often arises as part of a distinct genetic syndrome with Prader-Willi syndrome being a classical example. These rare forms of obesity provide a unique source for identifying obesity-related genetic changes. Chromosomal microarray analysis (CMA) has allowed the characterization of new genetic forms of syndromic obesity, which are due to copy number variants (CNVs); however, CMA in large cohorts requires more study. The aim of this study was to characterize the CNVs detected by CMA in 279 patients with a syndromic obesity phenotype.<h4>Results</h4>Pathogenic CNVs were detected in 61 patients (22%) and, among them, 35 had overlapping/recurrent CNVs. Genomic imbalance disorders known to cause syndromic obesity were found in 8.2% of cases, most commonly deletions of 1p36, 2q37 and 17p11.2 (5.4%), and we also detected deletions at 1p21.3, 2p25.3, 6q16, 9q34, 16p11.2 distal and proximal, as well as an unbalanced translocation resulting in duplication of the <i>GNB3</i> gene responsible for a syndromic for of childhood obesity. Deletions of 9p terminal and 22q11.2 proximal/distal were found in 1% and 3% of cases, respectively. They thus emerge as being new putative obesity-susceptibility <i>loci</i>. We found additional CNVs in our study that overlapped with CNVs previously reported in cases of syndromic obesity, including a new case of 13q34 deletion (<i>CHAMP1</i>), bringing to 7 the number of patients in whom such defects have been described in association with obesity. Our findings implicate many genes previously associated with obesity (e.g. <i>PTBP2</i>, <i>TMEM18</i>, <i>MYT1L</i>, <i>POU3F2</i>, <i>SIM1</i>, <i>SH2B1</i>), and also identified other potentially relevant candidates including <i>TAS1R3</i>, <i>ALOX5AP</i>, and <i>GAS6.</i><h4>Conclusion</h4>Understanding the genetics of obesity has proven difficult, and considerable insight has been obtained from the study of genomic disorders with obesity associated as part of the phenotype. In our study, CNVs known to be causal for syndromic obesity were detected in 8.2% of patients, but we provide evidence for a genetic basis of obesity in as many as 14% of cases. Overall, our results underscore the genetic heterogeneity in syndromic forms of obesity, which imposes a substantial challenge for diagnosis.

Also flagged:dental diseasesnucleotidespathogenesiscardiovascular diseasesdiabetesneurodegenerative disorders
Journal Article 2018-02-05 ✓ 1 Snippet Li Y, Zhang J, Pan J, Feng X, Duan P, Yin X, Xu Y, Wang X, Zou S.
In-Text Gene Mentions

STAU1-mediated mRNA decay…

Show Full Abstract

Long noncoding RNAs (lncRNAs) are a class of non-protein-coding transcripts with the length longer than 200 nucleotides. Growing evidence suggests that lncRNAs, which were initially thought to be merely transcriptional "noise", participate in a wide repertoire of biological processes. It has been well established that lncRNAs not only play important roles in genomic regulation, transcription, posttranscriptional processes but are also implicated in the pathogenesis of human diseases including cardiovascular diseases, diabetes, neurodegenerative disorders, and cancer. However, the pathological role of lncRNAs in skeletal and dental diseases is just beginning to be uncovered. In the present review, we outline the current understanding of the established functions and underlying mechanisms of lncRNAs in various cellular processes. Furthermore, we discuss new findings on the role of lncRNAs in osteoblastogenesis and osteoclastogenesis as well as their involvement in skeletal and dental diseases. This review intends to provide a general framework for the actions of lncRNAs and highlight the emerging evidence for the functions of lncRNAs in skeletal and dental diseases.

Also flagged:Matrix MetalloproteinasesHuntington's diseaseHDautosomal dominant neurodegenerative disordermovement disordercognitive impairments
Journal Article 2018-02-05 ✓ 3 Snippets Naphade S, Embusch A, Madushani KL, Ring KL, Ellerby LM.
In-Text Gene Mentions

HD is caused by an expanded CAG triplet repeat in the huntingtin (HTT) gene that encodes a stretch of polyglutamine residues which renders the mutant huntingtin (mHTT) protein prone to aggregate formation.

…in the huntingtin (HTT) gene that encodes…

…associates with nuclearHTTimmunoreactivity (Figure 3B…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder characterized by a progressive movement disorder, psychiatric symptoms, and cognitive impairments. HD is caused by a CAG repeat expansion encoding a stretch of polyglutamine residues in the N-terminus of mutant huntingtin (mHTT) protein. Proteolytic processing of mHTT yields toxic fragments, which cause neurotoxicity and massive neuronal cell death predominantly in the striatum and cortex. Inhibition of mHTT cleavage reduces neuronal toxicity suggesting mHTT proteolysis contributes to HD pathogenesis. A previously conducted unbiased siRNA screen in our lab for known human proteases identified matrix metalloproteinases (MMPs) as modifiers of mHTT proteolysis and toxicity. To further study MMP activation in HD, isogenic HD, and control corrected (C116) neural stem cells (NSCs) prepared from HD patient-derived induced pluripotent stem cells were used to examine the role of MMPs and their endogenous inhibitors in this highly relevant model system. We found altered expression of MMP-2 and MMP-9 (gelatinases), MMP-3/10, and MMP-14, activity in HD-NSCs when compared to control C116-NSCs. Dysregulation in MMP activity was accompanied with concomitant changes in levels of endogenous inhibitors of MMPs, called tissue inhibitors of matrix metalloproteinases (TIMPs). Specifically, we observed decreased levels of TIMP-1 and TIMP-2 in HD-NSCs, suggesting part of the altered expression and activity of MMPs is due to lower abundance of these endogenous inhibitors. Immunofluorescence analysis revealed increased MMP/TIMP localization in the nucleus or aggregates of HD-NSCs, suggesting potential interaction with mHTT. TIMP-1 was found to associate with mHTT aggregates in discrete punctate structures in HD-NSCs. These events collectively contribute to increased neurotoxicity in HD. Previous characterization of these NSCs revealed transforming growth factor beta (TGF-β) pathway as the top dysregulated pathway in HD. TGF-β was significantly upregulated in HD-NSCs and addition of TGF-β to HD-NSCs was found to be neuroprotective. To determine if TGF-β regulated MMP and TIMP activity, C116- and HD-NSCs were exogenously treated with recombinant TGF-β. TIMP-1 levels were found to be elevated in response to TGF-β treatment, representing a potential mechanism through which elevated TGF-β levels confer neuroprotection in HD. Studying the mechanism of action of MMPs and TIMPs, and their interactions with mHTT in human isogenic patient-derived NSCs elucidates new mechanisms of HD neurotoxicity and will likely provide novel therapeutics for treatment of HD.

Also flagged:HDFTLDADPDneurodegenerative diseasesFrontotemporal Lobar Degeneration
Journal Article 2018-02-05 ✓ 1 Snippet Jain N, Chen-Plotkin AS.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Purpose of review</h4>To review the evidence for genetic modifier effects in the neurodegenerative diseases Huntington's Disease (HD), Frontotemporal Lobar Degeneration (FTLD), Alzheimer's Disease (AD), and Parkinson's Disease (PD).<h4>Recent findings</h4>Increasingly, we understand human disease genetics less through the lens of single-locus/single-trait effects, and more through that of polygenic contributions to disease risk. In addition, specific examples of genetic modifier effects of the chromosome 7 gene <i>TMEM106B</i> on various target genes including those causal for Mendelian classes of FTLD - <i>GRN</i> and <i>c9orf72</i> - have emerged from both genetic cohort studies and mechanistic examinations of biological pathways.<h4>Summary</h4>Here, we summarize the literature reporting genetic modifier effects in HD, FTLD, AD, and PD. We further contextualize reported genetic modifier effects in these diseases in terms of insight they may lend to the concept of a polygenic landscape for the major neurodegenerative diseases.

Also flagged:SIMPLPketonesiliconeNucleaseESI
Journal Article 2018-02-05 ✓ 1 Snippet Diefenbach XW, Farasat I, Guetschow ED, Welch CJ, Kennedy RT, Sun S, Moore JC.
In-Text Gene Mentions

HFE

Show Full Abstract

Directed Evolution is a key technology driving the utility of biocatalysis in pharmaceutical synthesis. Conventional approaches to Directed Evolution are conducted using bacterial cells expressing enzymes in microplates, with catalyzed reactions measured by HPLC, high-performance liquid chromatography-mass spectrometry (HPLC-MS), or optical detectors, which require either long cycle times or tailor-made substrates. To better fit modern, fast-paced process chemistry development where solutions are rapidly needed for new substrates, droplet microfluidics interfaced with electrospray ionization (ESI)-MS provides a label-free high-throughput screening platform. To apply this method to industrial enzyme screening and to explore potential approaches that may further improve the overall throughput, we optimized the existing droplet-MS methods. Carryover between droplets, traditionally a significant issue, was reduced to undetectable level by replacing the stainless steel ESI needle with a Teflon needle within a capillary electrophoresis (CE)-MS source. Throughput was improved to 3 Hz with a wide range of droplet sizes (10-50 nL) by tuning the sheath flow within the CE-MS source. The optimized method was demonstrated by screening reactions using two different transaminase libraries. Good correlations (<i>r</i><sup>2</sup> ∼ 0.95) were found between the droplet-MS and LC-MS methods, with 100% match on hit variants. We further explored the capability of the system by performing in vitro transcription-translation inside the droplets and directly analyzing the intact reaction mixture droplets by MS. The synthesized protein attained comparable activity to the protein standard, and the complex samples appeared well tolerated by the MS. The success of the above applications indicates that the MS analysis of the microfluidic droplets is an available option for considerably accelerating the screening of enzyme evolution libraries.

Also flagged:type 1 transmembrane proteinsimmunoglobulinlactationsecretioncell surface receptorBTN
Journal Article 2018-02-04 ✓ 5 Snippets Redwan EM, Al-Hejin AM, Almehdar HA, Elsaway AM, Uversky VN.
In-Text Gene Mentions

In fact, in these studies, the C-T polymorphism of the BTN2A1 gene allele was significantly associated with the myocardial infarction [169,170], dislipidema [171,172,173], chronic kidney diseases (CKD) [172,174,175,176], hypertension [177,178,179], type 2 diabetes mellitus [81], and metabolic syndrome [180] in Japanese individuals and in East Asian populations.

⭐ same-sentence co-mention

…is formed byBTN2A1, BTN2A2, and BTN2A3,…

⭐ same-sentence co-mention

…formed by BTN2A1,BTN2A2, and BTN2A3, whereas…

…BTN3A1, BTN3A2, andBTN3A3constitute the BTN3…

⭐ same-sentence co-mention

…giving rise toBTN2A1, BTN2A2 ,…

Show Full Abstract

Butyrophilins (BTNs) are a group of the moonlighting proteins, some members of which are secreted in milk. They constitute a large family of structurally similar type 1 transmembrane proteins from the immunoglobulin superfamily. Although the founding member of this family is related to lactation, participating in the secretion, formation and stabilization of milk fat globules, it may also have a cell surface receptor function. Generally, the BTN family members are known to modulate co-stimulatory responses, T cell selection, differentiation, and cell fate determination. Polymorphism of these genes was shown to be associated with the pathology of several human diseases. Despite their biological significance, structural information on human butyrophilins is rather limited. Based on their remarkable multifunctionality, butyrophilins seem to belong to the category of moonlighting proteins, which are known to contain intrinsically disordered protein regions (IDPRs). However, the disorder status of human BTNs was not systematically investigated as of yet. The goal of this study is to fill this gap and to evaluate peculiarities of intrinsic disorder predisposition of the members of human BTN family, and to find if they have IDPRs that can be attributed to the multifunctionality of these important proteins.

Also flagged:IronNonalcoholic fatty liver diseaseNAFLDliver diseasenonalcoholic steatohepatitisNASH
Journal Article 2018-02-04 ✓ 5 Snippets Atarashi M, Izawa T, Miyagi R, Ohji S, Hashimoto A, Kuwamura M, Yamate J.
In-Text Gene Mentions

Several studies have suggested that heterozygosity for HFE gene mutation, the most common mutation type of hereditary hemochromatosis, can exacerbate chronic liver diseases, presumably via increased iron accumulation [12,13,14]; however, the role of HFE mutation in the pathology of NAFLD and chronic hepatitis C has not been confirmed [15,16,17,18].

…Several studies have suggested that heterozygosity forHFEgene mutation, the most common mutation type of hereditary hemochromatosis, can exacerbate chronic liver diseases, presumably via increased iron accumulation [ 12 , 13 , 14 ]; however, the role of HFE mutation in the pathology of NAFLD and chronic hepatitis C has not been confirmed [ 15 , 16 , 17 , 18 ].…

…Several studies have suggested that heterozygosity for HFE gene mutation, the most common mutation type of hereditary hemochromatosis, can exacerbate chronic liver diseases, presumably via increased iron accumulation [ 12 , 13 , 14 ]; however, the role ofHFEmutation in the pathology of NAFLD and chronic hepatitis C has not been confirmed [ 15 , 16 , 17 , 18 ].…

…that heterozygosity forHFEgene mutation, the…

…the role ofHFEmutation in the…

Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD) is now the most common liver disease in the world. NAFLD can progress to nonalcoholic steatohepatitis (NASH), cirrhosis and eventually hepatocellular carcinoma. Acquired hepatic iron overload is seen in a number of patients with NAFLD; however, its significance in the pathology of NAFLD is still debated. Here, we investigated the role of dietary iron supplementation in experimental steatohepatitis in rats. Rats were fed a control, high-fat (HF), high-fat high-iron (HFHI) and high-iron (HI) diet for 30 weeks. Blood biochemical, histopathological and gut microbiota analyses were performed. Rats in HF and HFHI groups showed an ALT-dominant elevation of serum transaminases, hepatic steatosis, hepatic inflammation, and upregulation of proinflammatory cytokines. The number of large inflammatory foci, corresponding to lobular inflammation in NASH patients, was significantly higher in HFHI than in HF group; within the lesion, macrophages with intense iron staining were observed. Hepatic expression of TNFα was higher in HFHI than that in HF group. There was no significant change in hepatic oxidative stress, gut microbiota or serum endotoxin levels between HF and HFHI groups. These results suggested that dietary iron supplementation enhances experimental steatohepatitis induced by long-term high-fat diet feeding in rats. Iron-laden macrophages can play an important role in the enhancement of hepatic inflammation.

Also flagged:Hydrogen SulfidecysteineCAT3-mercaptopyruvate sulfurtransferaseoxygennitrogen
Journal Article 2018-02-04 ✓ 1 Snippet Shefa U, Kim MS, Jeong NY, Jung J.
In-Text Gene Mentions

HD is an autosomal dominant disease associated with a mutation in the gene encoding huntingtin (Htt) following to extended polyglutamine repeats of mutant Htt (mHtt) which elicits oxidative stress, neurotoxicity, motor, and behavioral changes.

Show Full Abstract

Hydrogen sulfide (H<sub>2</sub>S), a toxic gaseous molecule, plays a physiological role in regulating homeostasis and cell signaling. H<sub>2</sub>S is produced from cysteine by enzymes, such as cystathionine <i>β</i>-synthase (CBS), cystathionine <i>γ</i>-lyase (CSE), cysteine aminotransferase (CAT), and 3-mercaptopyruvate sulfurtransferase (3MST). These enzymes regulate the overall production of H<sub>2</sub>S in the body. H<sub>2</sub>S has a cell-signaling function in the CNS and plays important roles in combating oxidative species such as reactive oxygen species (ROS) and reactive nitrogen species (RNS) in the body. H<sub>2</sub>S is crucial for maintaining balanced amounts of antioxidants to protect the body from oxidative stress, and appropriate amounts of H<sub>2</sub>S are required to protect the CNS in particular. The body regulates CBS, 3MST, and CSE levels in the CNS, and higher or lower levels of these enzymes cause various neurodegenerative diseases. This review discusses how H<sub>2</sub>S protects the CNS by acting as an antioxidant that reduces excessive amounts of ROS and RNS. Additionally, H<sub>2</sub>S regulates cell signaling to combat neuroinflammation and protect against central neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS).

Also flagged:diabetic vascular complicationsDiabeteshypertensionatherosclerosisnephropathyretinopathy
Journal Article 2018-02-03 ✓ 1 Snippet Leung A, Amaram V, Natarajan R.
In-Text Gene Mentions

STAU1

Show Full Abstract

Diabetes leads to markedly accelerated rates of many associated macrovascular complications like hypertension and atherosclerosis, and microvascular complications like nephropathy and retinopathy. High glucose, the hallmark of diabetes, drives changes in vascular and inflammatory cells that promote the development of these complications. Understanding the molecular processes involved in the development of diabetes and its debilitating complications can lead to much needed newer clinical therapies. Recently, long-noncoding RNAs (lncRNAs) have been shown to be important in the biology of vascular cells and there is growing evidence that lncRNAs are also involved in the cell biology relevant to diabetic vascular complications. In this review, we provide an overview of lncRNAs that function in vascular cells, and those that have been linked to diabetic complications.

Also flagged:transient ischemiaunsaturatedlipidmitochondriacalciumglutamate
Journal Article 2018-02-03 No Snippets Cobley JN, Fiorello ML, Bailey DM.
Show Full Abstract

The human brain consumes 20% of the total basal oxygen (O<sub>2</sub>) budget to support ATP intensive neuronal activity. Without sufficient O<sub>2</sub> to support ATP demands, neuronal activity fails, such that, even transient ischemia is neurodegenerative. While the essentiality of O<sub>2</sub> to brain function is clear, how oxidative stress causes neurodegeneration is ambiguous. Ambiguity exists because many of the reasons why the brain is susceptible to oxidative stress remain obscure. Many are erroneously understood as the deleterious result of adventitious O<sub>2</sub> derived free radical and non-radical species generation. To understand how many reasons underpin oxidative stress, one must first re-cast free radical and non-radical species in a positive light because their deliberate generation enables the brain to achieve critical functions (e.g. synaptic plasticity) through redox signalling (i.e. positive functionality). Using free radicals and non-radical derivatives to signal sensitises the brain to oxidative stress when redox signalling goes awry (i.e. negative functionality). To advance mechanistic understanding, we rationalise 13 reasons why the brain is susceptible to oxidative stress. Key reasons include inter alia unsaturated lipid enrichment, mitochondria, calcium, glutamate, modest antioxidant defence, redox active transition metals and neurotransmitter auto-oxidation. We review RNA oxidation as an underappreciated cause of oxidative stress. The complex interplay between each reason dictates neuronal susceptibility to oxidative stress in a dynamic context and neural identity dependent manner. Our discourse sets the stage for investigators to interrogate the biochemical basis of oxidative stress in the brain in health and disease.

Also flagged:cancerglioblastoma multiformetumorsoxygentumornanostructures
Journal Article 2018-02-03 No Snippets Xue X, Huang Y, Wang X, Wang Z, Carney RP, Li X, Yuan Y, He Y, Lin TY, Li Y.
Show Full Abstract

Conventional drug delivery systems contain substantial amounts of excipients such as polymers and lipids, typically with low drug loading capacity and lack of intrinsic traceability and multifunctionality. Here, we report fully active pharmaceutical ingredient nanoparticles (FAPIN) which were self-assembled by minimal materials, but seamlessly orchestrated versatile theranostic functionalities including: i) self-delivery: no additional carriers were required, all components in the formulation are active pharmaceutical ingredients; ii) self-indicating: no additional imaging tags were needed. The nanoparticle itself was composed of 100% imaging agents, so that the stability, drug release, subcellular dispositions, biodistribution and therapeutic efficacy of FAPINs can be readily visualized by ample imaging capacities, including energy transfer relay dominated, dual-color fluorogenic property, near-infrared fluorescence imaging and magnetic resonance imaging; and iii) highly effective trimodality cancer therapy, encompassing photodynamic-, photothermal- and chemo-therapies. FAPINs were fabricated with very simple material (a photosensitizer-drug conjugate), unusually achieved ∼10 times better in vitro antitumor activity than their free counterparts, and were remarkably efficacious in patient-derived xenograft (PDX) glioblastoma multiforme animal models. Only two doses of FAPINs enabled complete ablation of highly-malignant PDX tumors in 50% of the mice.

Also flagged:Polybrominated diphenyl ethers-5-hydroxytryptamineserotonintryptophan hydroxylase 2TPH2
Journal Article 2018-02-03 ✓ 1 Snippet Wang F, Fang M, Hinton DE, Chernick M, Jia S, Zhang Y, Xie L, Dong W, Dong W.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Polybrominated diphenyl ethers (PBDEs) are a group of brominated flame retardants that are ubiquitously detected in the environment and associated with adverse health outcomes. 6-OH-BDE-47 is a metabolite of the flame retardant, 2,2',4,4'-Tetrabromodiphenyl ether (BDE-47), and there is increasing concern regarding its developmental neurotoxicity and endocrine disrupting properties. In this study, we report that early life exposure in zebrafish (Danio rerio) embryos to 6-OH-BDE-47 (50 and 100 nM) resulted in higher coiling frequency and significantly increased apoptotic cells in the brain. These effects were partially rescued by overexpression of thyroid hormone receptor β (THRβ) mRNA. Moreover, exposure to 100 nM 6-OH-BDE-47 significantly reduced the number of hypothalamic 5-hydroxytryptamine (5-HT, serotonin)-immunoreactive (5-HT-ir) neurons and the mRNA expression of tryptophan hydroxylase 2 (TPH2). These results indicate that 6-OH-BDE-47 affected thyroid hormone regulation through THRβ and negatively impacted the nervous system, in turn, affecting coiling behavior. Correlations of these endpoints suggest that coiling frequency could be used as an indicator of neurotoxicity in embryos.

Also flagged:cancerRedoxcell growthmetabolismcancerstumor
Journal Article 2018-02-03 ✓ 1 Snippet Hegedűs C, Kovács K, Polgár Z, Regdon Z, Szabó É, Robaszkiewicz A, Forman HJ, Martner A, Virág L.
In-Text Gene Mentions

SODs converts superoxide to H2O2 (and O2) while catalase, the glutathione peroxidases and peroxiredoxins reduce H2O2 to H2O. GPxs and Prdx6 use glutathione as the reducing substrate, Prdxs 1–5 use reduced thioredoxin, and catalase dismutates H2O2 to H2O and O2.

Show Full Abstract

Redox regulation has been proposed to control various aspects of carcinogenesis, cancer cell growth, metabolism, migration, invasion, metastasis and cancer vascularization. As cancer has many faces, the role of redox control in different cancers and in the numerous cancer-related processes often point in different directions. In this review, we focus on the redox control mechanisms of tumor cell destruction. The review covers the tumor-intrinsic role of oxidants derived from the reduction of oxygen and nitrogen in the control of tumor cell proliferation as well as the roles of oxidants and antioxidant systems in cancer cell death caused by traditional anticancer weapons (chemotherapeutic agents, radiotherapy, photodynamic therapy). Emphasis is also put on the role of oxidants and redox status in the outcome following interactions between cancer cells, cytotoxic lymphocytes and tumor infiltrating macrophages.

Also flagged:colitispeptidesRag116S rDNAInflammatory bowel diseasemetronidazole
Journal Article 2018-02-02 ✓ 1 Snippet Moon C, Stupp GS, Su AI, Wolan DW.
In-Text Gene Mentions

Serpinc1

Show Full Abstract

Metaproteomics can greatly assist established high-throughput sequencing methodologies to provide systems biological insights into the alterations of microbial protein functionalities correlated with disease-associated dysbiosis of the intestinal microbiota. Here, the authors utilize the well-characterized murine T cell transfer model of colitis to find specific changes within the intestinal luminal proteome associated with inflammation. MS proteomic analysis of colonic samples permitted the identification of ≈10 000-12 000 unique peptides that corresponded to 5610 protein clusters identified across three groups, including the colitic Rag1<sup>-/-</sup> T cell recipients, isogenic Rag1<sup>-/-</sup> controls, and wild-type mice. The authors demonstrate that the colitic mice exhibited a significant increase in Proteobacteria and Verrucomicrobia and show that such alterations in the microbial communities contributed to the enrichment of specific proteins with transcription and translation gene ontology terms. In combination with 16S sequencing, the authors' metaproteomics-based microbiome studies provide a foundation for assessing alterations in intestinal luminal protein functionalities in a robust and well-characterized mouse model of colitis, and set the stage for future studies to further explore the functional mechanisms of altered protein functionalities associated with dysbiosis and inflammation.

Also flagged:Ulk4pathogenesisneurodevelopmental disordersUnc-51 like kinase 4Serine/Threonine kinaseschizophrenia
Journal Article 2018-02-02 No Snippets Liu M, Fitzgibbon M, Wang Y, Reilly J, Qian X, O'Brien T, Clapcote S, Shen S, Roche M.
Show Full Abstract

Excitation/inhibition imbalance has been proposed as a fundamental mechanism in the pathogenesis of neuropsychiatric and neurodevelopmental disorders, in which copy number variations of the Unc-51 like kinase 4 (ULK4) gene encoding a putative Serine/Threonine kinase have been reported in approximately 1/1000 of patients suffering pleiotropic clinical conditions of schizophrenia, depression, autistic spectrum disorder (ASD), developmental delay, language delay, intellectual disability, or behavioral disorder. The current study characterized behavior of heterozygous Ulk4 <sup>+/tm1a</sup> mice, demonstrating that Ulk4 <sup>+/tm1a</sup> mice displayed no schizophrenia-like behavior in acoustic startle reactivity and prepulse inhibition tests or depressive-like behavior in the Porsolt swim or tail suspension tests. However, Ulk4 <sup>+/tm1a</sup> mice exhibited an anxiety-like behavioral phenotype in several tests. Previously identified hypo-anxious (Atp1a2, Ptn, and Mdk) and hyper-anxious (Gria1, Syngap1, and Npy2r) genes were found to be dysregulated accordingly in Ulk4 mutants. Ulk4 was found to be expressed in GABAergic neurons and the Gad67<sup>+</sup> interneurons were significantly reduced in the hippocampus and basolateral amygdala of Ulk4 <sup>+/tm1a</sup> mice. Transcriptome analyses revealed a marked reduction of GABAergic neuronal subtypes, including Pvalb, Sst, Cck, Npy, and Nos3, as well as significant upregulation of GABA receptors, including Gabra1, Gabra3, Gabra4, Gabra5, and Gabrb3. This is the first evidence that Ulk4 plays a major role in regulating GABAergic signaling and anxiety-like behavior, which may have implications for the development of novel anxiolytic treatments.

Also flagged:cancerpeptideirontumorHepcidinsynthesis
Journal Article 2018-02-02 No Snippets Vela D, Vela-Gaxha Z.
Show Full Abstract

Hepcidin is a crucial peptide for regulating cellular iron efflux. Because iron is essential for cell survival, especially for highly active cells, such as tumor cells, it is imperative to understand how tumor cells manipulate hepcidin expression for their own metabolic needs. Studies suggest that hepcidin expression and regulation in tumor cells show important differences in comparison with those in non-tumorous cells. These differences should be investigated to develop new strategies to fight cancer cells. Manipulating hepcidin expression to starve cancer cells for iron may prove to be a new therapy in the anticancer arsenal.

Also flagged:GrapheneSilicaPolycyclic musksgraphene oxidewaterGalaxolide
Journal Article 2018-02-02 No Snippets Li C, Chen J, Chen Y, Wang J, Ping H, Lu A.
Show Full Abstract

Polycyclic musks (PCMs) have recently received growing attention as emerging contaminants because of their bioaccumulation and potential ecotoxicological effects. Herein, an effective method for the determination of five PCMs in aqueous samples is presented. Reduced graphene oxide-derivatized silica (rGO@silica) particles were prepared from graphene oxide and aminosilica microparticles and characterized by scanning electron microscopy, Fourier transform infrared spectroscopy, and X-ray photoelectron spectroscopy. PCMs were preconcentrated using rGO@silica as the solid-phase extraction sorbent and quantified by gas chromatography-tandem mass spectrometry. Several experimental parameters, such as eluent, elution volume, sorbent amount, pH, and sample volume were optimized. The correlation coefficient (<i>R</i>) ranged from 0.9958 to 0.9992, while the limits of detection and quantitation for the five PCMs were 0.3-0.8 ng/L and 1.1-2.1 ng/L, respectively. Satisfactory recoveries were obtained for tap water (86.6-105.9%) and river water samples (82.9-107.1%), with relative standard deviations <10% under optimal conditions. The developed method was applied to analyze PCMs in tap and river water samples from Beijing, China. Galaxolide (HHCB) and tonalide (AHTN) were the main PCM components detected in one river water sample at concentrations of 18.7 for HHCB, and 11.7 ng/L for AHTN.

Also flagged:Lithocholic AcidMacromoleculesmacromoleculeoxidized low-density lipoproteinTGR5 receptorlipid
Journal Article 2018-02-02 No Snippets Moretti A, Li Q, Chmielowski R, Joseph LB, Moghe PV, Uhrich KE.
Show Full Abstract

Previously-designed amphiphilic scorpion-like macromolecule (AScM) nanoparticles (NPs) showed elevated potency to counteract oxidized low-density lipoprotein (oxLDL) uptake in atherosclerotic macrophages, but failed to ameliorate oxLDL-induced inflammation. We designed a new class of composite AScMs incorporating lithocholic acid (LCA), a natural agonist for the TGR5 receptor that is known to counteract atherosclerotic inflammation, with two complementary goals: to simultaneously decrease lipid uptake and inhibit pro-inflammatory cytokine secretion by macrophages. LCA was conjugated to AScMs for favorable interaction with TGR5 and was also hydrophobically modified to enable encapsulation in the core of AScM-based NPs. Conjugates were formulated into negatively charged NPs with different core/shell combinations, inspired by the negative charge on oxLDL to enable competitive interaction with scavenger receptors (SRs). NPs with LCA-containing shells exhibited reduced sizes, and all NPs lowered oxLDL uptake to <30% of untreated, human derived macrophages in vitro, while slightly downregulating SR expression. Pro-inflammatory cytokine expression, including IL-1β, IL-8, and IL-10, is known to be modulated by TGR5, and was dependent on NP composition, with LCA-modified cores downregulating inflammation. Our studies indicate that LCA-conjugated AScM NPs offer a unique approach to minimize atherogenesis and counteract inflammation.

Also flagged:ubiquitinOPTNubiquitin-binding scaffold proteinautophagyneurodegenerative diseasesALS
Journal Article 2018-02-02 ✓ 1 Snippet Li F, Xu D, Wang Y, Zhou Z, Liu J, Hu S, Gong Y, Yuan J, Pan L.
In-Text Gene Mentions

HTT

Show Full Abstract

OPTN (optineurin), a ubiquitin-binding scaffold protein, functions as an important macroautophagy/autophagy receptor in selective autophagy processes. Mutations in OPTN have been linked with human neurodegenerative diseases including ALS and glaucoma. However, the mechanistic basis underlying the recognition of ubiquitin by OPTN and its regulation by TBK1-mediated phosphorylation are still elusive. Here, we demonstrate that the UBAN domain of OPTN preferentially recognizes linear ubiquitin chain and forms an asymmetric 2:1 stoichiometry complex with the linear diubiquitin. In addition, our results provide new mechanistic insights into how phosphorylation of UBAN would regulate the ubiquitin-binding ability of OPTN and how disease-associated mutations in the OPTN UBAN domain disrupt its interaction with ubiquitin. Finally, we show that defects in ubiquitin-binding may affect the recruitment of OPTN to linear ubiquitin-decorated mutant Huntington protein aggregates. Taken together, our findings clarify the interaction mode between UBAN and linear ubiquitin chain in general, and expand our knowledge of the molecular mechanism of ubiquitin-decorated substrates recognition by OPTN as well as the pathogenesis of neurodegenerative diseases caused by OPTN mutations.

Also flagged:XRCC3TYMScancercolorectal cancertumorstumor
Journal Article 2018-02-02 No Snippets He Y, Penney ME, Negandhi AA, Parfrey PS, Savas S, Yilmaz YE.
Show Full Abstract

<h4>Background</h4>Metastasis is a major cause of mortality in cancer. Identifying prognostic factors that distinguish patients who will experience metastasis in the short-term and those that will be free of metastasis in the long-term is of particular interest in current medical research. The objective of this study was to examine if select genetic polymorphisms can differentiate colorectal cancer patients based on timing and long-term risk of metastasis.<h4>Methods</h4>The patient cohort consisted of 402 stage I-III colorectal cancer patients with microsatellite instability (MSI)-low (MSI-L) or microsatellite stable (MSS) tumors. We applied multivariable mixture cure model, which is the proper model when there is a substantial group of patients who remain free of metastasis in the long-term, to 26 polymorphisms. Time-dependent receiver operator characteristic (ROC) curve analysis was performed to determine the change in discriminatory accuracy of the models when the significant SNPs were included.<h4>Results</h4>After adjusting for significant baseline characteristics, two polymorphisms were significantly associated with time-to-metastasis: TT and TC genotypes of the XRCC3 Thr241Met (p = 0.042) and the 3R/3R genotype of TYMS 5'-UTR variable number tandem repeat (VNTR) (p = 0.009) were associated with decreased time-to-metastasis. ROC curves showed that the discriminatory accuracy of the model is increased slightly when these polymorphisms were added to the significant baseline characteristics.<h4>Conclusions</h4>Our results indicate XRCC3 Thr241Met and TYMS 5'-UTR VNTR polymorphisms are associated with time-to-metastasis, and may have potential biological roles in expediting the metastatic process. Once replicated, these associations could contribute to the development of precision medicine for colorectal cancer patients.

Also flagged:MethylationROD1NLRC5HKR1cytosineguanosine
Journal Article 2018-02-02 No Snippets Zeng Q, Chen X, Ning C, Zhu Q, Yao Y, Zhao Y, Luan F.
Show Full Abstract

<h4>Background</h4>Human aging is a hot topic in biology, and it has been associated with DNA methylation changes at specific genomic sites. We aimed to study the changes of DNA methylation at a single-CpG-site resolution using peripheral blood samples from centenarians.<h4>Methods</h4>Using Illumina 450 K Methylation BeadChip microarray assays, we carried out a pool-based, epigenome-wide investigation of DNA methylation of blood samples from 12 centenarians and 12 healthy controls. Differentially methylated cytosine-phosphate-guanosine (CpG) sites were selected for further pyrosequencing analysis of blood samples from 30 centenarians and 30 healthy controls.<h4>Result</h4>We identified a total of 31 high-confidence CpG sites with differential methylation profiles between the groups: 9 (29%) were hypermethylated and 22 (71%) were hypomethylated in centenarians. It was also found that hypermethylation of HKR1 and hypomethylation of ROD1 and NLRC5 genes strongly correlated with age in centenarians.<h4>Conclusion</h4>Our results indicate that the methylation profile combination of HKR1, ROD1, and NLRC5 could be a promising biomarker for aging in Hainan centenarians.

Also flagged:sepsisLgr5ERT2tamoxifenOrganoid growthstem cell
Journal Article 2018-02-02 ✓ 1 Snippet Bhanja P, Norris A, Gupta-Saraf P, Hoover A, Saha S.
In-Text Gene Mentions

…markers including Lgr5,Olfm4, Lrig1, and Ascl2…

Show Full Abstract

<h4>Background</h4>Radiation-induced gastrointestinal syndrome (RIGS) results from the acute loss of intestinal stem cells (ISC), impaired epithelial regeneration, and subsequent loss of the mucosal barrier, resulting in electrolyte imbalance, diarrhea, weight loss, sepsis, and mortality. The high radiosensitivity of the intestinal epithelium limits effective radiotherapy against abdominal malignancies and limits the survival of victims of nuclear accidents or terrorism. Currently, there is no approved therapy to mitigate radiation toxicity in the intestine. Here we demonstrate that BCN057, an anti-neoplastic small molecular agent, induces ISC proliferation and promotes intestinal epithelial repair against radiation injury.<h4>Methods</h4>BCN057 (90 mg/kg body weight, subcutaneously) was injected into C57Bl6 male mice (JAX) at 24 h following abdominal irradiation (AIR) and was continued for 8 days post-irradiation. BCN057-mediated rescue of Lgr5-positive ISC was validated in Lgr5-EGFP-Cre-ERT2 mice exposed to AIR. The regenerative response of Lgr5-positive ISC was examined by lineage tracing assay using Lgr5-EGFP-ires-CreERT2-TdT mice with tamoxifen administration to activate Cre recombinase and thereby marking the ISC and their respective progeny. Ex vivo three-dimensional organoid cultures were developed from surgical specimens of human colon or from mice jejunum and were used to examine the radio-mitigating role of BCN057 on ISC ex vivo. Organoid growth was determined by quantifying the budding crypt/total crypt ratio. Statistical analysis was performed using Log-rank (Mantel-Cox) test and paired two-tail t test.<h4>Results</h4>Treatment with BCN057 24 h after a lethal dose of AIR rescues ISC, promotes regeneration of the intestinal epithelium, and thereby mitigates RIGS. Irradiated mice without BCN057 treatment suffered from RIGS, resulting in 100% mortality within 15 days post-radiation. Intestinal organoids developed from mice jejunum or human colon demonstrated a regenerative response with BCN057 treatment and mitigated radiation toxicity. However, BCN057 did not deliver radio-protection to mouse or human colon tumor tissue.<h4>Conclusion</h4>BCN057 is a potential mitigator against RIGS and may be useful for improving the therapeutic ratio of abdominal radiotherapy. This is the first report demonstrating that a small molecular agent mitigates radiation-induced intestinal injury by inducing ISC self-renewal and proliferation.

Also flagged:carcinomaBrducolitisβ-cateninLgr5DLD1
Journal Article 2018-02-02 ✓ 2 Snippets Deng F, Peng L, Li Z, Tan G, Liang E, Chen S, Zhao X, Zhi F.
In-Text Gene Mentions

Olfm4

…makers Lgr5 andOlfm4were also clearly…

Show Full Abstract

Impaired epithelial regeneration is a crucial pathophysiological feature of ulcerative colitis (UC). Yes-associated protein (YAP1) appears to control cell proliferation and differentiation. In this study, we sought to identify the roles of YAP in intestinal epithelial cell (IEC) self-renewal, regeneration and tumorigenesis. We first observed that YAP was significantly reduced in 62.5% (45/72) of human UC tissues and it was dramatically enhanced during epithelial regeneration in a murine colitis model. Using lentiviral infection, we established a YAP-overexpression (YAP<sup>WT</sup>) mouse model. We then found that after tissue injury, YAP<sup>WT</sup> mice had increased epithelial cell self-renewal capacity and drastically restored intestinal crypt structure. Strikingly, these mice were more susceptible to colitis-associated cancer (CAC) in chemically induced carcinoma. Mechanistically, YAP and β-catenin showed increased nuclear co-localization during regeneration after inflammation. Overexpressing YAP significantly improved IEC 'wound-healing' ability and increased the expression of both β-catenin and the transcriptional targets of Wnt signalling Lgr5 and cyclin D1, whereas silencing β-catenin in YAP<sup>WT</sup> cells attenuated this effect. Remarkably, we observed that YAP could directly interact with β-catenin in the nucleus and formed a transcriptional YAP/β-catenin/TCF4 complex; Lgr5 and cyclin D1 were confirmed to be the target genes of this complex. In contrast, cancer cell proliferation and tumour development were suppressed by the phospho-mimetic YAP mutant. In summary, nuclear YAP-driven IEC proliferation could control epithelial regeneration after inflammation and may serve as a potential therapeutic target in UC. However, excessive YAP activation promoted CAC development.

Also flagged:foreign body reactionethanolforeign body reactionsalginatefree-radicalPro
Journal Article 2018-02-02 ✓ 1 Snippet Guo S, Kang G, Phan DT, Hsu MN, Por YC, Chen CH.
In-Text Gene Mentions

HFE

Show Full Abstract

Excessive scar formation can form disabling contractures that result in a debilitating psychological outcome. Sustainable hydrophobic corticosteroid release in vivo is essential to regulate the wound healing process. Functional hydrogel particles are widely applied for sustainable release. However, due to the limited aqueous solubility of hydrophobic compounds, most of the corticosteroid is released from the hydrogels within seconds, causing undesirable scar formation and recurrence. In this study, a novel polymerization-induced phase separation is investigated to form well-defined polyethylene glycol diacrylate (PEGDA) core/alginate shell structured hydrogel particles using microfluidics without toxic organic solvents. Based on their wettability preference, hydrophobic corticosteroid-loaded poly(lactic-co-glycolic acid) (PLGA) nanoparticles are compartmentalized in the PEGDA core during polymerization to control the corticosteroid release. The distribution of the PLGA nanoparticles is precisely regulated by the phase separation boundary and characterized using a fluorescent dye. The thickness of the shell and partition coefficients are determined using the UV intensity and irradiation period. Upon encapsulation of the PLGA nanoparticles within the poly(PEGDA) core, a long-term corticosteroid treatment is developed and effective scar therapeutic outcomes are evaluated using both in vitro and in vivo models.

Also flagged:ApathyHDHuntington ’ s Diseaseneurological disordercytosineadenine
Journal Article 2018-02-02 ✓ 5 Snippets Minnig S, Bragg RM, Tiwana HS, Solem WT, Hovander WS, Vik ES, Hamilton M, Legg SRW, Shuttleworth DD, Coffey SR, Cantle JP, Carroll JB.
In-Text Gene Mentions

Huntington’s disease (HD) is a fatal, progressive neurological disorder caused by a coding cytosine-adenine-guanine (CAG) expansion in the huntingtin (HTT) gene, where repeat lengths above 40 result in full penetrance of the disease1.

…(ROBucket) to testHttQ111/ + mice…

…the FR task,HttQ111/ + mice…

…the huntingtin (HTT) gene, where…

HttQ111/ + mice,…

Show Full Abstract

Apathy is one of the most prevalent and progressive psychiatric symptoms in Huntington's disease (HD) patients. However, preclinical work in HD mouse models tends to focus on molecular and motor, rather than affective, phenotypes. Measuring behavior in mice often produces noisy data and requires large cohorts to detect phenotypic rescue with appropriate power. The operant equipment necessary for measuring affective phenotypes is typically expensive, proprietary to commercial entities, and bulky which can render adequately sized mouse cohorts as cost-prohibitive. Thus, we describe here a home-built, open-source alternative to commercial hardware that is reliable, scalable, and reproducible. Using off-the-shelf hardware, we adapted and built several of the rodent operant buckets (ROBucket) to test Htt<sup>Q111/+</sup> mice for attention deficits in fixed ratio (FR) and progressive ratio (PR) tasks. We find that, despite normal performance in reward attainment in the FR task, Htt<sup>Q111/+</sup> mice exhibit reduced PR performance at 9-11 months of age, suggesting motivational deficits. We replicated this in two independent cohorts, demonstrating the reliability and utility of both the apathetic phenotype, and these ROBuckets, for preclinical HD studies.

Also flagged:CCN5WISP2matricellular proteinscell proliferationlacZosteoblast proliferation
Journal Article 2018-02-02 ✓ 1 Snippet Jiang J, Zhao G, Lyons KM.
In-Text Gene Mentions

-Induced CCN-like Protein

Show Full Abstract

CCN5/WISP2 is part of the CCN family of matricellular proteins, but is distinct in that it lacks the C-terminal (CT) domain. Although CCN5 has been shown to impact cell proliferation and differentiation in vitro, its role in vivo is unclear. We therefore generated mice using ES cells developed by the Knockout Mouse Project (KOMP) in which exons 2-5, which encode the all of the conserved protein coding regions, are replaced by a lacZ cassette. Ccn5 <sup>LacZ/LacZ</sup> mice were viable and apparently normal. Based on previous studies showing that CCN5 impacts osteoblast proliferation and differentiation, we performed an analysis of adult bone phenotype. LacZ expression was examined in adult bone, and was found to be strong within the periosteum, but not in trabecular bone or bone marrow. Micro-CT analysis revealed no apparent changes in bone mineral density (BMD) or bone tissue volume (BV/TV) in Ccn5 <sup>LacZ/LacZ</sup> mice. These studies indicate that CCN5 is not required for normal bone formation, but they do not rule out a role in mechanotransduction or repair processes. The availability of Ccn5 <sup>LacZ</sup> mice enables studies of CCN5 expression and function in multiple tissues.

Also flagged:RHOAtumorsmall GTPaseTet2ICOSPI3K
Journal Article 2018-02-02 ✓ 1 Snippet Cortes JR, Ambesi-Impiombato A, Couronné L, Quinn SA, Kim CS, da Silva Almeida AC, West Z, Belver L, Martin MS, Scourzic L, Bhagat G, Bernard OA, Ferrando AA, Palomero T.
In-Text Gene Mentions

Roquin-1

Show Full Abstract

Angioimmunoblastic T cell lymphoma (AITL) is an aggressive tumor derived from malignant transformation of T follicular helper (Tfh) cells. AITL is characterized by loss-of-function mutations in Ten-Eleven Translocation 2 (TET2) epigenetic tumor suppressor and a highly recurrent mutation (p.Gly17Val) in the RHOA small GTPase. Yet, the specific role of RHOA G17V in AITL remains unknown. Expression of Rhoa G17V in CD4<sup>+</sup> T cells induces Tfh cell specification; increased proliferation associated with inducible co-stimulator (ICOS) upregulation and increased phosphoinositide 3-kinase (PI3K) and mitogen-activated protein kinase signaling. Moreover, RHOA G17V expression together with Tet2 loss resulted in development of AITL in mice. Importantly, Tet2<sup>-/-</sup>RHOA G17V tumor proliferation in vivo can be inhibited by ICOS/PI3K-specific blockade, supporting a driving role for ICOS signaling in Tfh cell transformation.

Also flagged:peptidyl transferaseribosomepeptidebindingprotein synthesisaminoacyl
Journal Article 2018-02-02 No Snippets Tereshchenkov AG, Dobosz-Bartoszek M, Osterman IA, Marks J, Sergeeva VA, Kasatsky P, Komarova ES, Stavrianidi AN, Rodin IA, Konevega AL, Sergiev PV, Sumbatyan NV, Mankin AS, Bogdanov AA, Polikanov YS.
Show Full Abstract

Antibiotic chloramphenicol (CHL) binds with a moderate affinity at the peptidyl transferase center of the bacterial ribosome and inhibits peptide bond formation. As an approach for modifying and potentially improving properties of this inhibitor, we explored ribosome binding and inhibitory activity of a number of amino acid analogs of CHL. The L-histidyl analog binds to the ribosome with the affinity exceeding that of CHL by 10 fold. Several of the newly synthesized analogs were able to inhibit protein synthesis and exhibited the mode of action that was distinct from the action of CHL. However, the inhibitory properties of the semi-synthetic CHL analogs did not correlate with their affinity and in general, the amino acid analogs of CHL were less active inhibitors of translation in comparison with the original antibiotic. The X-ray crystal structures of the Thermus thermophilus 70S ribosome in complex with three semi-synthetic analogs showed that CHL derivatives bind at the peptidyl transferase center, where the aminoacyl moiety of the tested compounds established idiosyncratic interactions with rRNA. Although still fairly inefficient inhibitors of translation, the synthesized compounds represent promising chemical scaffolds that target the peptidyl transferase center of the ribosome and potentially are suitable for further exploration.

Also flagged:mitochondrial proteaseClpPCaseinolytic peptidase Pquality control proteasemitochondrialmetabolic disorders
Journal Article 2018-02-02 ✓ 1 Snippet Bhaskaran S, Pharaoh G, Ranjit R, Murphy A, Matsuzaki S, Nair BC, Forbes B, Gispert S, Auburger G, Humphries KM, Kinter M, Griffin TM, Deepa SS.
In-Text Gene Mentions

DARS2

Show Full Abstract

Caseinolytic peptidase P (ClpP) is a mammalian quality control protease that is proposed to play an important role in the initiation of the mitochondrial unfolded protein response (UPR<sup>mt</sup>), a retrograde signaling response that helps to maintain mitochondrial protein homeostasis. Mitochondrial dysfunction is associated with the development of metabolic disorders, and to understand the effect of a defective UPR<sup>mt</sup> on metabolism, ClpP knockout (<i>ClpP</i><sup>-/-</sup>) mice were analyzed. <i>ClpP</i><sup>-/-</sup> mice fed <i>ad libitum</i> have reduced adiposity and paradoxically improved insulin sensitivity. Absence of ClpP increased whole-body energy expenditure and markers of mitochondrial biogenesis are selectively up-regulated in the white adipose tissue (WAT) of <i>ClpP</i><sup>-/-</sup> mice. When challenged with a metabolic stress such as high-fat diet, despite similar caloric intake, <i>ClpP</i><sup>-/-</sup> mice are protected from diet-induced obesity, glucose intolerance, insulin resistance, and hepatic steatosis. Our results show that absence of ClpP triggers compensatory responses in mice and suggest that ClpP might be dispensable for mammalian UPR<sup>mt</sup> initiation. Thus, we made an unexpected finding that deficiency of ClpP in mice is metabolically beneficial.

Also flagged:Agingage-related diseasesdeathsenescencemetabolismmitochondrial
Journal Article 2018-02-02 No Snippets Ruan L, Ruan L, Zhang X, Li R.
Show Full Abstract

Aging is the gradual decline of physiological functions and organismal fitness, which leads to age-dependent fitness loss, diseases and eventually mortality. Understanding the cause of aging constitutes one of most intriguing areas of research in biology. On both the cellular and molecular levels, it has been hypothesized that there are aging determinants to control the onset and progression of aging, including the loss of beneficial components and accumulation of detrimental factors. This Review highlights the recent advance in identifying various factors that affect the aging process, focusing on how these determinants affect the lifespan and fitness of a cell or organism. With more and more aging determinants revealed, further understanding about their functions and interconnections could enable the development of specific intervention to extend healthy lifespan and reduce the risk of age-related diseases.

Also flagged:argininestrokesmetabolic strokeMitochondrial Encephalopathy withLactic Acidosis and Stroke-like EpisodesMELAS) syndrome
Journal Article 2018-02-02 ✓ 1 Snippet Ganetzky RD, Falk MJ.
In-Text Gene Mentions

FBXL4

Show Full Abstract

<h4>Background</h4>Intravenous (IV) arginine has been reported to ameliorate acute metabolic stroke symptoms in adult patients with Mitochondrial Encephalopathy with Lactic Acidosis and Stroke-like Episodes (MELAS) syndrome, where its therapeutic benefit is postulated to result from arginine acting as a nitric oxide donor to reverse vasospasm. Further, reduced plasma arginine may occur in mitochondrial disease since the biosynthesis of arginine's precursor, citrulline, requires ATP. Metabolic strokes occur across a wide array of primary mitochondrial diseases having diverse molecular etiologies that are likely to share similar pathophysiologic mechanisms. Therefore, IV arginine has been increasingly used for the acute clinical treatment of metabolic stroke across a broad mitochondrial disease population.<h4>Methods</h4>We performed retrospective analysis of a large cohort of subjects who were under 18 years of age at IRB #08-6177 study enrollment and had molecularly-confirmed primary mitochondrial disease (n = 71, excluding the common MELAS m.3243A>G mutation). 9 unrelated subjects in this cohort received acute arginine IV treatment for one or more stroke-like episodes (n = 17 total episodes) between 2009 and 2016 at the Children's Hospital of Philadelphia. Retrospectively reviewed data included subject genotype, clinical symptoms, age, arginine dosing, neuroimaging (if performed), prophylactic therapies, and adverse events.<h4>Results</h4>Genetic etiologies of subjects who presented with acute metabolic strokes included 4 mitochondrial DNA (mtDNA) pathogenic point mutations, 1 mtDNA deletion, and 4 nuclear gene disorders. Subject age ranged from 19 months to 23 years at the time of any metabolic stroke episode (median, 8 years). 3 subjects had recurrent stroke episodes. 70% of subjects were on prophylactic arginine or citrulline therapy at the time of a stroke-like episode. IV arginine was initiated on initial presentation in 65% of cases. IV arginine was given for 1-7 days (median, 1 day). A positive clinical response to IV arginine occurred in 47% of stroke-like episodes; an additional 6% of episodes showed clinical benefit from multiple simultaneous treatments that included arginine, confounding sole interpretation of arginine effect. All IV arginine-responsive stroke-like episodes (n = 8) received treatment immediately on presentation (p = .003). Interestingly, the presence of unilateral symptoms strongly predicted arginine response (p = .02, Chi-Square); however, almost all of these cases immediately received IV arginine, confounding interpretation of causality direction. Suggestive trends toward increased IV arginine response were seen in subjects with mtDNA relative to nDNA mutations and in older pediatric subjects, although statistical significance was not reached possibly due to small sample size. No adverse events, including hypotensive episodes, from IV arginine therapy were reported.<h4>Conclusions</h4>Single-center retrospective analysis suggests that IV arginine therapy yields significant therapeutic benefit with little risk in pediatric mitochondrial disease stroke subjects across a wide range of genetic etiologies beyond classical MELAS. Acute hemiplegic stroke, in particular, was highly responsive to IV arginine treatment. Prospective studies with consistent arginine dosing, and pre- and post-neuroimaging, will further inform the clinical utility of IV arginine therapy for acute metabolic stroke in pediatric mitochondrial disease.

Also flagged:G Protein-Coupled ReceptorsGPCRsgene expressionGPCRtranslationalsynthesis
Journal Article 2018-02-02 No Snippets Tréfier A, Pellissier LP, Musnier A, Reiter E, Guillou F, Crépieux P.
Show Full Abstract

G protein-coupled receptors (GPCRs) exert their physiological function by transducing a complex signaling network that coordinates gene expression and dictates the phenotype of highly differentiated cells. Much is known about the gene networks they transcriptionally regulate upon ligand exposure in a process that takes hours before a new protein is synthesized. However, far less is known about GPCR impact on the translational machinery and subsequent mRNA translation, although this gene regulation level alters the cell phenotype in a strikingly different timescale. In fact, mRNA translation is an early response kinetically connected to signaling events, hence it leads to the synthesis of a new protein within minutes following receptor activation. By these means, mRNA translation is responsive to subtle variations of the extracellular environment. In addition, when restricted to cell subcellular compartments, local mRNA translation contributes to cell micro-specialization, as observed in synaptic plasticity or in cell migration. The mechanisms that control where in the cell an mRNA is translated are starting to be deciphered. But how an extracellular signal triggers such local translation still deserves extensive investigations. With the advent of high-throughput data acquisition, it now becomes possible to review the current knowledge on the translatome that some GPCRs regulate, and how this information can be used to explore GPCR-controlled local translation of mRNAs.

Also flagged:neurodegenerative disorderHuntingtinHDcognitive declinechromosomepolyglutamine
Journal Article 2018-02-02 ✓ 5 Snippets Fukuoka M, Takahashi M, Fujita H, Chiyo T, Popiel HA, Watanabe S, Furuya H, Murata M, Wada K, Okada T, Nagai Y, Hohjoh H.
In-Text Gene Mentions

Disease-causing mutant HTT proteins adversely affect biomolecules such as proteins, mRNAs, and miRNAs in the HD brain.

indicated that the association of Htt with MeCP2 increased in knock-in Hdh mice (another HD model), suggesting that abnormal interaction between Htt and MeCP2 may cause transcriptional dysregulation.

Huntington’s disease (HD; OMIM #143100) is a dominantly inherited neurodegenerative disorder characterized by chorea movement, muscular incoordination, cognitive decline, and psychiatric problems.1, 2 The responsible gene for HD is the Huntingtin (HTT) gene on chromosome 4p16.3, and aberrantly expanded CAG repeats (translated into polyglutamine tracts) in exon 1 are closely related to the onset and severity of HD;1, 2 such abnormal expansion of the CAG repeat results in unusual aggregation of the HTT protein, which is harmful to neurons in the brain.

The results were confirmed by northern blotting as well (Figure 1A), and the findings were consistent with previous studies:17, 18 another HD model of YAC128 mice expressing full-length mutant HTT mRNAs showed a decrease in miR-132 in the brain,17 and more noteworthy, Johnson et al.18

Huntington’s disease (HD) is an intractable neurodegenerative disorder caused by mutant Huntingtin (HTT) proteins that adversely affect various biomolecules and genes.

Show Full Abstract

Huntington's disease (HD) is an intractable neurodegenerative disorder caused by mutant Huntingtin (HTT) proteins that adversely affect various biomolecules and genes. MicroRNAs (miRNAs), which are functional small non-coding RNAs, are also affected by mutant HTT proteins. Here, we show amelioration in motor function and lifespan of HD-model mice, R6/2 mice, by supplying miR-132 to HD brains using a recombinant adeno-associated virus (rAAV) miRNA expression system. miR-132 is an miRNA related to neuronal maturation and function, but the level of miR-132 in the brain of R6/2 mice was significantly lower than that of wild-type mice. Our miR-132 supplemental treatment, i.e., supplying miR-132 to the brain, produced symptomatic improvement or retarded disease progression in R6/2 mice; interestingly, it had little effect on disease-causing mutant HTT mRNA expression and its products. Therefore, the findings suggest that there may be a therapeutic way to treat HD without inhibiting and/or repairing disease-causing HTT genes and gene products. Although miR-132 supplement may not be a definitive treatment for HD, it may become a therapeutic method for relieving HD symptoms and delaying HD progression.

Also flagged:Transmissible spongiform encephalopathiesinfectious neurodegenerative diseasesprion proteinPrPprionneurodegenerative diseases
Journal Article 2018-02-01 ✓ 3 Snippets Pearce MMP, Kopito RR.
In-Text Gene Mentions

Aggregates formed by polyQ-expanded huntingtin (Htt) in Huntington's disease can transfer between cells and seed the aggregation of cytoplasmic wild-type Htt in a prion-like manner.

…of cytoplasmic wild-typeHttin a prion-like…

…by polyQ-expanded huntingtin (Htt) in Huntington’s disease…

Show Full Abstract

Transmissible spongiform encephalopathies are infectious neurodegenerative diseases caused by the conversion of prion protein (PrP) into a self-replicating conformation that spreads via templated conversion of natively folded PrP molecules within or between cells. Recent studies provide compelling evidence that prion-like behavior is a general property of most protein aggregates associated with neurodegenerative diseases. Many of these disorders are associated with spontaneous protein aggregation, but genetic mutations can increase the aggregation propensity of specific proteins, including expansion of polyglutamine (polyQ) tracts, which is causative of nine inherited neurodegenerative diseases. Aggregates formed by polyQ-expanded huntingtin (Htt) in Huntington's disease can transfer between cells and seed the aggregation of cytoplasmic wild-type Htt in a prion-like manner. Additionally, prion-like properties of glutamine-rich proteins underlie nonpathological processes in yeast and higher eukaryotes. Here, we review current evidence supporting prion-like characteristics of polyQ and glutamine-rich proteins.

Also flagged:Huntington diseaseHDbehavioraltumor necrosis factor-αsubstance Pcytokine
Journal Article 2018-02-01 ✓ 2 Snippets Lin YC, Hsiao HT, Wu SN, Liu YC.
In-Text Gene Mentions

Previous studies have shown that HD is caused by the exon 1 region of the huntingtin (HTT) gene having expanded CAG trinucleotide repeats.

…of the huntingtin (HTT) gene having expanded…

Show Full Abstract

<h4>Background</h4>Huntington disease (HD) affects the nervous system and leads to mental and motor dysfunction. Previous studies have shown that HD is caused by the exon 1 region of the huntingtin (HTT) gene having expanded CAG trinucleotide repeats. However, few studies have focused on the relationship between HD and pain. The purpose of this study is to investigate the relationship between HD and pain response.<h4>Methods</h4>We used clinical similar transgenic HD mice carrying a mutant HTT exon 1 containing 84 CAG trinucleotide repeats to evaluate the relationship between HD and pain. Inflammatory pain models were induced by either formalin or complete Freund adjuvant injection over the hind paw. Spinal cord, dorsal root ganglion, and paw skin tissues were harvested at the end of the behavioral inflammatory pain studies. Immunofluorescence assay, Western blotting, and enzyme-linked immunosorbent assay were used to identify changes in cells and cytokines.<h4>Results</h4>Our data demonstrate that preonset HD mice exhibited less pain behavior than wild-type (WT) mice in both young (n = 11 [WT], 13 [HD]) and aged (n = 8 [WT], 9 [HD]) mice. Western blotting and immunohistological examination of lumbar spinal cord tissue and dorsal root ganglion indicate less activation of glial cells and astrocytes in young HD mice (n = 6-7) compared to that in WT mice (n = 6-7). The production levels of tumor necrosis factor-α, interleukin-1β, and substance P were also lower in young HD mice (n = 6-7).<h4>Conclusions</h4>Our data demonstrate less pain behavior and pain-related cytokine response at the spinal cord level for HD mice compared to those for WT mice. Further studies are needed for determining the mechanism as to how mutant HTT leads to altered pain behavior and pain-related cytokine response.

Also flagged:colistinmcr-1Enterobacteriaceae infectionsmultidrug-resistant Enterobacteriaceae infectionscephalosporinmcr
Journal Article 2018-02-01 No Snippets Zhong LL, Phan HTT, Shen C, Vihta KD, Sheppard AE, Huang X, Zeng KJ, Li HY, Zhang XF, Patil S, Crook DW, Walker AS, Xing Y, Lin JL, Feng LQ, Doi Y, Xia Y, Stoesser N, Tian GB.
Show Full Abstract

<h4>Background</h4>mcr-1-mediated colistin resistance in Enterobacteriaceae is concerning, as colistin is used in treating multidrug-resistant Enterobacteriaceae infections. We identified trends in human fecal mcr-1-positivity rates and colonization with mcr-1-positive, third-generation cephalosporin-resistant (3GC-R) Enterobacteriaceae in Guangzhou, China, and investigated the genetic contexts of mcr-1 in mcr-1-positive 3GC-R strains.<h4>Methods</h4>Fecal samples were collected from in-/out-patients submitting specimens to 3 hospitals (2011-2016). mcr-1 carriage trends were assessed using iterative sequential regression. A subset of mcr-1-positive isolates was sequenced (whole-genome sequencing [WGS], Illumina), and genetic contexts (flanking regions, plasmids) of mcr-1 were characterized.<h4>Results</h4>Of 8022 fecal samples collected, 497 (6.2%) were mcr-1 positive, and 182 (2.3%) harbored mcr-1-positive 3GC-R Enterobacteriaceae. We observed marked increases in mcr-1 (0% [April 2011] to 31% [March 2016]) and more recent (since January 2014; 0% [April 2011] to 15% [March 2016]) increases in human colonization with mcr-1-positive 3GC-R Enterobacteriaceae (P < .001). mcr-1-positive 3GC-R isolates were commonly multidrug resistant. WGS of mcr-1-positive 3GC-R isolates (70 Escherichia coli, 3 Klebsiella pneumoniae) demonstrated bacterial strain diversity; mcr-1 in association with common plasmid backbones (IncI, IncHI2/HI2A, IncX4) and sometimes in multiple plasmids; frequent mcr-1 chromosomal integration; and high mobility of the mcr-1-associated insertion sequence ISApl1. Sequence data were consistent with plasmid spread among animal/human reservoirs.<h4>Conclusions</h4>The high prevalence of mcr-1 in multidrug-resistant E. coli colonizing humans is a clinical threat; diverse genetic mechanisms (strains/plasmids/insertion sequences) have contributed to the dissemination of mcr-1, and will facilitate its persistence.

Also flagged:Retrotransposonsretrotransposontransposonstransfergenechromosomes
Journal Article 2018-02-01 No Snippets Gao D, Chu Y, Xia H, Xu C, Heyduk K, Abernathy B, Ozias-Akins P, Leebens-Mack JH, Jackson SA.
Show Full Abstract

Even though lateral movements of transposons across families and even phyla within multicellular eukaryotic kingdoms have been found, little is known about transposon transfer between the kingdoms Animalia and Plantae. We discovered a novel non-LTR retrotransposon, AdLINE3, in a wild peanut species. Sequence comparisons and phylogenetic analyses indicated that AdLINE3 is a member of the RTE clade, originally identified in a nematode and rarely reported in plants. We identified RTE elements in 82 plants, spanning angiosperms to algae, including recently active elements in some flowering plants. RTE elements in flowering plants were likely derived from a single family we refer to as An-RTE. Interestingly, An-RTEs show significant DNA sequence identity with non-LTR retroelements from 42 animals belonging to four phyla. Moreover, the sequence identity of RTEs between two arthropods and two plants was higher than that of homologous genes. Phylogenetic and evolutionary analyses of RTEs from both animals and plants suggest that the An-RTE family was likely transferred horizontally into angiosperms from an ancient aphid(s) or ancestral arthropod(s). Notably, some An-RTEs were recruited as coding sequences of functional genes participating in metabolic or other biochemical processes in plants. This is the first potential example of horizontal transfer of transposons between animals and flowering plants. Our findings help to understand exchanges of genetic material between the kingdom Animalia and Plantae and suggest arthropods likely impacted on plant genome evolution.

Also flagged:enoxaparinsodiumvenous thromboembolismheparintraumacoagulation
Journal Article 2018-02-01 ✓ 1 Snippet Karcutskie CA, Dharmaraja A, Patel J, Eidelson SA, Padiadpu AB, Martin AG, Lama G, Lineen EB, Namias N, Schulman CI, Proctor KG.
In-Text Gene Mentions

ATIII

Show Full Abstract

<h4>Importance</h4>The efficacy of anti-factor Xa (anti-Xa)-guided dosing of thromboprophylaxis after trauma remains controversial.<h4>Objective</h4>To assess whether dosing of enoxaparin sodium based on peak anti-Xa levels is associated with the venous thromboembolism (VTE) rate after trauma.<h4>Design, setting, and participants</h4>Retrospective review of 950 consecutive adults admitted to a single level I trauma intensive care unit for more than 48 hours from December 1, 2014, through March 31, 2017. Within 24 hours of admission, these trauma patients were screened with the Greenfield Risk Assessment Profile (RAP) (possible score range, 0-46). Patients younger than 18 years and those with VTE on admission were excluded, resulting in a study population of 792 patients.<h4>Exposures</h4>The control group received fixed doses of either heparin sodium, 5000 U 3 times a day, or enoxaparin sodium, 30 mg twice a day. The adjustment cohort initially received enoxaparin sodium, 30 mg twice a day. A peak anti-Xa level was drawn 4 hours after the third dose. If the anti-Xa level was 0.2 IU/mL or higher, no adjustment was made. If the anti-Xa level was less than 0.2 IU/mL, each dose was increased by 10 mg. The process was repeated up to a maximum dose of 60 mg twice a day.<h4>Main outcomes and measures</h4>Rates of VTE were measured. Venous duplex ultrasonography and computed tomographic angiography were used for diagnosis.<h4>Results</h4>The study population comprised 792 patients with a mean (SD) age of 46 (19) years and was composed of 598 men (75.5%). The control group comprised 570 patients, was older, and had a longer time to thromboprophylaxis initiation. The adjustment group consisted of 222 patients, was more severely injured, and had a longer hospital length of stay. The mean (SD) RAP scores were 9 (4) for the control group and 9 (5) for the adjustment group (P = .28). The VTE rates were similar for both groups (34 patients [6.0%] vs 15 [6.8%]; P = .68). Prophylactic anti-Xa levels were reached in 119 patients (53.6%) in the adjustment group. No difference in VTE rates was observed between those who became prophylactic and those who did not (7 patients [5.9%] vs 8 [7.8%]; P = .58). To control for confounders, 132 patients receiving standard fixed-dose enoxaparin were propensity matched to 84 patients receiving dose-adjusted enoxaparin. The VTE rates remained similar between the control and adjustment groups (3 patients [2.3%] vs 3 [3.6%]; P = .57).<h4>Conclusions and relevance</h4>Rates of VTE were not reduced with anti-Xa-guided dosing, and almost half of the patients never reached prophylactic anti-Xa levels; achieving those levels did not decrease VTE rates. Thus, other targets, such as platelets, may be necessary to optimize thromboprophylaxis after trauma.

Also flagged:metalsorganohalogensArsenicleadcadmiumpolychlorinated biphenyls
Journal Article 2018-02-01 No Snippets Schecter A, Kincaid J, Quynh HT, Lanceta J, Tran HTT, Crandall R, Shropshire W, Birnbaum LS.
Show Full Abstract

<h4>Objective</h4>Electronic waste is increasing. It is frequently recycled in developing countries. This is the first study to report metals, polybrominated diphenyl-ethers (PBDEs), polychlorinated biphenyls (PCBs), 2,2-bis(4-chlorophenyl)-1,1,1-trichloroethane (p,p'-DDT), and p,p'-DDE concentrations in female e-waste workers.<h4>Methods</h4>Female Vietnamese recyclers and non-recyclers were studied. Metals and halogenated organics were measured in blood and urine, and compared with levels in women in the US National Health and Nutrition Examination Survey (NHANES).<h4>Results</h4>Recyclers had higher serum PBDE than nonrecyclers. PCB-138/158 and PCB-153 were higher in 18 to less than 38-year-old nonrecyclers. Median urinary arsenic in both cohorts was six to seven-fold higher than NHANES. Median lead in blood and urine was 40% to 60% higher in recyclers than nonrecyclers. Lead in nonrecyclers was four to six-fold higher than NHANES. Both cohorts had higher arsenic and mercury than NHANES.<h4>Conclusion</h4>Occupational exposure to PBDEs and lead occurred in recyclers. Environmental exposure to arsenic, lead, and mercury occurred in both cohorts. Occupational and environmental remediation are recommended.

Also flagged:heparinenoxaparinsmall-cell lung cancermalignant diseasecancerCoagulation
Journal Article 2018-02-01 ✓ 1 Snippet Ek L, Gezelius E, Bergman B, Bendahl PO, Anderson H, Sundberg J, Wallberg M, Falkmer U, Verma S, Belting M, Swedish Lung Cancer Study Group (SLUSG).
In-Text Gene Mentions

…(LMWH) binds toantithrombin-IIIand potentiates its…

Show Full Abstract

<h4>Background</h4>Coagulation activation and venous thromboembolism (VTE) are hallmarks of malignant disease and represent a major cause of morbidity and mortality in cancer. Coagulation inhibition with low-molecular-weight heparin (LMWH) may improve survival specifically in small-cell lung cancer (SCLC) patients by preventing VTE and tumor progression; however, randomized trials with well-defined patient populations are needed to obtain conclusive data. The aim of RASTEN was to investigate the survival effect of LMWH enoxaparin in a homogenous population of SCLC patients.<h4>Patients and methods</h4>We carried out a randomized, multicenter, open-label trial to investigate the addition of enoxaparin at a supraprophylactic dose (1 mg/kg) to standard treatment in patients with newly diagnosed SCLC. The primary outcome was overall survival (OS), and secondary outcomes were progression-free survival (PFS), incidence of VTE and hemorrhagic events.<h4>Results</h4>In RASTEN, 390 patients were randomized over an 8-year period (2008-2016), of whom 186 and 191 were included in the final analysis in the LMWH and control arm, respectively. We found no evidence of a difference in OS or PFS by the addition of enoxaparin [hazard ratio (HR), 1.11; 95% confidence interval (CI) 0.89-1.38; P = 0.36 and HR, 1.18; 95% CI 0.95-1.46; P = 0.14, respectively]. Subgroup analysis of patients with limited and extensive disease did not show reduced mortality by enoxaparin. The incidence of VTE was significantly reduced in the LMWH arm (HR, 0.31; 95% CI 0.11-0.84; P = 0.02). Hemorrhagic events were more frequent in the LMWH-treated group but fatal bleedings occurred in both arms.<h4>Conclusion</h4>LMWH enoxaparin in addition to standard therapy did not improve OS in SCLC patients despite being administered at a supraprophylactic dose and despite resulting in a significant reduction in VTE incidence. Addition of LMWH cannot be generally recommended in the management of SCLC patients, and predictive biomarkers of VTE and LMWH-associated bleeding in cancer patients are warranted.

Also flagged:genomemethylationgene silencingretrotransposonsgene expressionchromosomal regions
Journal Article 2018-02-01 No Snippets Choi JY, Purugganan MD.
Show Full Abstract

Plant genomes contain numerous transposable elements (TEs), and many hypotheses on the evolutionary drivers that restrict TE activity have been postulated. Few models, however, have focused on the evolutionary epigenomic interaction between the plant host and its TE. The host genome recruits epigenetic factors, such as methylation, to silence TEs but methylation can spread beyond the TE sequence and influence the expression of nearby host genes. In this study, we investigated this epigenetic trade-off between TE and proximal host gene silencing by studying the epigenomic regulation of repressing long terminal repeat (LTR) retrotransposons (RTs) in Oryza sativa. Results showed significant evidence of methylation spreading originating from the LTR-RT sequences, and the extent of spreading was dependent on five factors: 1) LTR-RT family, 2) time since the LTR-RT insertion, 3) recombination rate of the LTR-RT region, 4) level of LTR-RT sequence methylation, and 5) chromosomal location. Methylation spreading had negative effects by reducing host gene expression, but only on host genes with LTR-RT inserted in its introns. Our results also suggested high levels of LTR-RT methylation might have a role in suppressing TE-mediated deleterious ectopic recombination. In the end, despite the methylation spreading, no strong epigenetic trade-off was detected and majority of LTR-RT may have only minor epigenetic effects on nearby host genes.

Also flagged:LGR5Leucine-rich repeat containing G protein-coupled receptor 5olfactomedin 4embryogenesispeptide transporter
Journal Article 2018-02-01 ✓ 5 Snippets Zhang H, Wong EA.
In-Text Gene Mentions

…of cells expressingOLFM4and LGR5 mRNA…

…and olfactomedin 4 (Olfm4) are 2 widely…

…expressing LGR5 andOLFM4mRNA in the…

…Cells expressingOLFM4and LGR5 mRNA…

…LGR5 and notOLFM4mRNA were localized…

Show Full Abstract

The chicken yolk sac (YS) and small intestine are essential for nutrient absorption during the pre-hatch and post-hatch periods, respectively. Absorptive enterocytes and secretory cells line the intestinal villi and originate from stem cells located in the intestinal crypts. Similarly, in the YS, there are absorptive and secretory cells that presumably originate from a stem cell population. Leucine-rich repeat containing G protein-coupled receptor 5 (Lgr5) and olfactomedin 4 (Olfm4) are 2 widely used markers for intestinal stem cells. The objective of this study was to map the distribution of putative stem cells expressing LGR5 and OLFM4 mRNA in the chicken small intestine from the late embryonic period to early post hatch and the YS during embryogenesis. At embryonic d 11, 13, 15, 17, and 19, the YS was collected (n = 3), and small intestine was collected at embryonic d 19, d of hatch (doh), and d 1, 4, and 7 post hatch (n = 3). Cells expressing OLFM4 and LGR5 mRNA were identified by in situ hybridization. In the YS, cells expressing only LGR5 and not OLFM4 mRNA were localized to the vascular endothelial cells lining the blood vessels. In the small intestine, cells in the intestinal crypt expressed both LGR5 and OLFM4 mRNA. Staining for OLFM4 mRNA was more intense than LGR5 mRNA, demonstrating that Olfm4 is a more robust marker for stem cells than Lgr5. At embryonic d 19 and doh, cells staining for OLFM4 mRNA were already present in the rudimentary crypts, with the greatest staining in the duodenal crypts. The intensity of OLFM4 mRNA staining increased from doh to d 7 post hatch. Dual label staining at doh for the peptide transporter PepT1 and Olfm4 revealed a population of cells above the crypts that did not express Olfm4 or PepT1 mRNA. These cells are likely progenitor transit amplifying cells. Thus, avians and mammals share similarity in the ontogeny of stem cells in the intestinal crypts.

Also flagged:FTOdemethylationpathogenesispubertyobesityChronic illness
Journal Article 2018-02-01 ✓ 1 Snippet Howard SR, Guasti L, Poliandri A, David A, Cabrera CP, Barnes MR, Wehkalampi K, O'Rahilly S, Aiken CE, Coll AP, Ma M, Rimmington D, Yeo GSH, Dunkel L.
In-Text Gene Mentions

In addition to leptin signaling, overlap with several genes implicated in body mass index was found, including fat mass and obesity–associated gene (FTO), SEC16B, TMEM18, and NEGR1 (Supplemental Table 1) (5).

Show Full Abstract

<h4>Context</h4>Self-limited delayed puberty (DP) is often associated with a delay in physical maturation, but although highly heritable the causal genetic factors remain elusive. Genome-wide association studies of the timing of puberty have identified multiple loci for age at menarche in females and voice break in males, particularly in pathways controlling energy balance.<h4>Objective/main outcome measures</h4>We sought to assess the contribution of rare variants in such genes to the phenotype of familial DP.<h4>Design/patients</h4>We performed whole-exome sequencing in 67 pedigrees (125 individuals with DP and 35 unaffected controls) from our unique cohort of familial self-limited DP. Using a whole-exome sequencing filtering pipeline one candidate gene [fat mass and obesity-associated gene (FTO)] was identified. In silico, in vitro, and mouse model studies were performed to investigate the pathogenicity of FTO variants and timing of puberty in FTO+/- mice.<h4>Results</h4>We identified potentially pathogenic, rare variants in genes in linkage disequilibrium with genome-wide association studies of age at menarche loci in 283 genes. Of these, five genes were implicated in the control of body mass. After filtering for segregation with trait, one candidate, FTO, was retained. Two FTO variants, found in 14 affected individuals from three families, were also associated with leanness in these patients with DP. One variant (p.Leu44Val) demonstrated altered demethylation activity of the mutant protein in vitro. Fto+/- mice displayed a significantly delayed timing of pubertal onset (P < 0.05).<h4>Conclusions</h4>Mutations in genes implicated in body mass and timing of puberty in the general population may contribute to the pathogenesis of self-limited DP.

Also flagged:Gene Expressionendometrial cancertumorslymph nodelymph node metastasisendometrioid endometrial cancer
Journal Article 2018-02-01 ✓ 1 Snippet Kang S, Thompson Z, McClung EC, Abdallah R, Lee JK, Gonzalez-Bosquet J, Wenham RM, Chon HS.
In-Text Gene Mentions

SLC9C2

Show Full Abstract

<h4>Objective</h4>This study aimed to develop a prediction model for lymph node metastasis using a gene expression signature in patients with endometrioid-type endometrial cancer.<h4>Methods</h4>Newly diagnosed endometrioid-type endometrial cancer cases in which the patients had undergone lymphadenectomy during a surgical staging procedure were identified from a national dataset (N = 330). Clinical and pathologic data were extracted from patient medical records, and gene expression datasets of their tumors were used to create a 12-gene predictive model for lymph node metastasis. We used principal components analysis on a training set (n = 110) to develop multivariate logistic models to predict low-risk patients having a probability of lymph node metastasis of less than 4%. The model with the highest prediction performance was selected for an evaluation set (n = 112), which, in turn, was validated in an independent validation set (n = 108).<h4>Results</h4>The model applied to the evaluation set showed 100% sensitivity (90% confidence interval [CI], 74%-100%) and 42% specificity (90% CI, 34%-51%), which resulted in 100% negative predictive value (90% CI, 89%-100%). In the validation set, we confirmed that the model consistently showed 100% sensitivity (90% CI, 88%-100%), 42% specificity (90% CI, 32%-50%), and 100% negative predictive value (90% CI, 88%-100%).<h4>Conclusions</h4>Our 12-gene signature model is a useful tool for the identification of patients with endometrioid-type endometrial cancer at low risk of lymph node metastasis, particularly given that it can be used to analyze histologic tissue before surgery and used to tailor surgical options.

Also flagged:urothelial bladder cancertumorbladder cancertomuscle-invasive bladder cancercancer
Journal Article 2018-02-01 No Snippets Xiong J, Xiong K, Bing Z.
Show Full Abstract

<h4>Background</h4>Accumulating evidence shows that clinical factors alone are not adequate for predicting the survival of patients with urothelial bladder cancer (UBC), and many genes have been found to be associated with UBC prognosis.<h4>Purpose</h4>The objective of this study is to develop a signature which integrates clinical and molecular information to predict the overall survival of UBC patients more accurate.<h4>Materials and methods</h4>We integrated messenger RNA (mRNA) and microRNA (miRNA) expression profiles and the corresponding clinical data of 402 UBC patients and 19 normal controls from The Cancer Genome Atlas. Univariate Cox regression followed by a multiple testing correction and an elastic net-regulated Cox regression were adopted to identify a prognostic signature.<h4>Results</h4>We generated an integrated clinical-RNA signature which consisting of 3 clinical variables, 3 protective mRNAs, 7 risky mRNAs, 2 protective miRNAs and 1 risky miRNA. The area under the receiver operating characteristic curve of the integrated clinical-RNA signature was 0.802, larger than that of the clinical-alone signature (0.709) or the RNA-alone signature (0.726). UBC patients in the high-risk group had a significantly shorter overall survival time compared with patients in the low-risk group (clinical-RNA signature, hazard ratio = 2.441).<h4>Conclusions</h4>Our conclusions that we have identified an integrated clinical-RNA signature that was superior to the traditional clinical-alone signature for ascertaining the overall survival prognosis of patients with UBC. These findings provide some novel genes for tumor molecular biologist to further study their functions and mechanisms in UBC tumorigenesis and malignance, and may be useful for effective clinical risk management of UBC patients.

Also flagged:PeroxiredoxincancerPeroxiredoxinsthiol-dependent peroxidaseshydrogenperoxide
Journal Article 2018-02-01 No Snippets Hampton MB, Vick KA, Skoko JJ, Neumann CA.
Show Full Abstract

<h4>Significance</h4>It has been proposed that cancer cells are heavily dependent on their antioxidant defenses for survival and growth. Peroxiredoxins are a family of abundant thiol-dependent peroxidases that break down hydrogen peroxide, and they have a central role in the maintenance and response of cells to alterations in redox homeostasis. As such, they are potential targets for disrupting tumor growth. Recent Advances: Genetic disruption of peroxiredoxin expression in mice leads to an increased incidence of neoplastic disease, consistent with a role for peroxiredoxins in protecting genomic integrity. In contrast, many human tumors display increased levels of peroxiredoxin expression, suggesting that strengthened antioxidant defenses provide a survival advantage for tumor progression. Peroxiredoxin inhibitors are being developed and explored as therapeutic agents in different cancer models.<h4>Critical issues</h4>It is important to complement peroxiredoxin knockout and expression studies with an improved understanding of the biological function of the peroxiredoxins. Although current results can be interpreted within the context that peroxiredoxins scavenge hydroperoxides, some peroxiredoxin family members appear to have more complex roles in regulating the response of cells to oxidative stress through protein interactions with constituents of other signaling pathways.<h4>Future directions</h4>Further mechanistic information is required for understanding the role of oxidative stress in cancer, the function of peroxiredoxins in normal versus cancer cells, and for the design and testing of specific peroxiredoxin inhibitors that display selectivity to malignant cells. Antioxid. Redox Signal. 28, 591-608.

Also flagged:Calciphylaxisskin diseaserenal diseasechronic kidney diseasewarfarinantithrombin III
Journal Article 2018-02-01 ✓ 2 Snippets Dobry AS, Ko LN, St John J, Sloan JM, Nigwekar S, Kroshinsky D.
In-Text Gene Mentions

…(ie, antithrombin III [ATIII] deficiency, protein C…

ATIII

Show Full Abstract

<h4>Importance</h4>Calciphylaxis is a rare skin disease with high morbidity and mortality that frequently affects patients with renal disease. Hypercoagulable conditions are frequently observed in both patients with calciphylaxis and those with chronic kidney disease (CKD), complicating our understanding of which hypercoagulable conditions are specific to calciphylaxis.<h4>Objective</h4>To identify hypercoagulable conditions that are risk factors for developing calciphylaxis while controlling for CKD.<h4>Design, setting, and participants</h4>This was a case-control study, comparing the hypercoagulability status of patients with calciphylaxis and with renal disease with that of a matched control population at 2 large urban academic hospitals in Boston, Massachusetts. Retrospective medical record review of laboratory values was performed to identify patients with hypercoagulable conditions. Case and control patients were further stratified based on both severity of CKD and warfarin. Patients with a dermatologic diagnosis of calciphylaxis between 2006 and 2014 and concomitant CKD were included as cases (n = 38). Three controls (n = 114) per case patient with CKD were included, and were matched by age, sex, and race.<h4>Main outcomes and measures</h4>The rate of various hypercoagulable states (ie, antithrombin III [ATIII] deficiency, protein C and S deficiency, factor V Leiden mutation, prothrombin gene mutation [G20210A], elevated factor VIII level, lupus anticoagulant, anti-IgG or IgM cardiolipin antibodies, heparin-induced thrombocytopenia antibodies, and elevation of homocysteine) in patients with calciphylaxis compared with their matched controls.<h4>Results</h4>Of the calciphylaxis cohort, 28 (58%) were female and 18 (55%) were non-Hispanic white. Among all patients, lupus anticoagulant (13 [48%] positive in cases vs 1 [5%] in controls; P = .001), protein C deficiency (9 [50%] vs 1 [8%]; P = .02), and combined thrombophilias (18 [62%] vs 10 [31%]; P = .02) were found to be significantly associated with calciphylaxis. In a subanalysis of patients with stage 5 CKD, only lupus anticoagulant (12 [53%] vs 9 [0%]; P = .01) and combined thrombophilia (15 [63%] vs 1 [8%]; P = .004) remained significantly associated with calciphylaxis. In a separate subanalysis of warfarin-unexposed patients, only lupus anticoagulant (7 [50%] vs 1 [6%]; P = .01) and protein C deficiency (5 [46%] vs 10 [0%]; P = .04) remained significantly associated with calciphylaxis.<h4>Conclusions and relevance</h4>Presence of lupus anticoagulant and combined thrombophilias are risk factors for the development of calciphylaxis in patients with late-stage renal disease. Clinicians should be aware of these associations in patients with impaired kidney function and may consider increased screening and appropriate anticoagulation treatment to reduce the risk of calciphylaxis development.

Also flagged:pairingoligonucleotidesoligonucleotidegene expressionsynthesisnucleic acids
Journal Article 2018-02-01 ✓ 1 Snippet Shen X, Corey DR.
In-Text Gene Mentions

Huntington disease (HD) is a progressive neurological disorder caused by a CAG trinucleotide expansion within the coding region of the huntingtin (HTT) gene (128).

Show Full Abstract

RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed.

Also flagged:Anthracyclineanthracyclinesanthracycline cardiomyopathydilated cardiomyopathyrestrictive cardiomyopathymitochondriopathy
Journal Article 2018-02-01 ✓ 1 Snippet Lipshultz SE, Herman EH.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

No abstract available.

Also flagged:p62neurodegenerative diseasesAlzheimer's diseaseHuntington's diseasefrontotemporal dementiaubiquitin-associated proteins
Journal Article 2018-02-01 ✓ 2 Snippets Zhou L, Hao Z, Wang G, Xu G.
In-Text Gene Mentions

Here, using cell and animal models, we discover that CRBN directly interacts with p62 and inhibits the formation of protein aggregates induced by mutant huntingtin (Htt-polyQ) and TAR DNA-binding protein 43 (TDP43C) in a p62-dependent manner.

…by mutant huntingtin (Htt-polyQ) and TAR DNA-binding…

Show Full Abstract

Formation of protein aggregates is the hallmark of neurodegenerative diseases such as Alzheimer's disease, Huntington's disease, and frontotemporal dementia. Many ubiquitin-associated proteins are recruited to protein aggregates, such as sequestosome 1/p62 (p62), parkin, and cereblon (CRBN). However, the roles of these proteins in the regulation of the formation of protein aggregates are not well understood. Here, using cell and animal models, we discover that CRBN directly interacts with p62 and inhibits the formation of protein aggregates induced by mutant huntingtin (Htt-polyQ) and TAR DNA-binding protein 43 (TDP43C) in a p62-dependent manner. Furthermore, we find the suppression of the formation of protein aggregates by CRBN is caused by the decrease of the binding affinity of p62 to ubiquitinated proteins but not by the change of p62 protein level. Our study reveals a novel role of CRBN and the underlying molecular mechanism in the regulation of misfolded proteins in neurodegenerative diseases, which may provide new insights for finding pharmacological targets for these diseases.

Also flagged:Spinal muscular atrophy with respiratory distress type 1SMARD1autosomal recessive motor neuron diseasedistal limb muscle atrophymyelinationpathogenesis
Journal Article 2018-02-01 ✓ 1 Snippet Villalón E, Shababi M, Kline R, Lorson ZC, Florea KM, Lorson CL.
In-Text Gene Mentions

ABT1

Show Full Abstract

Spinal muscular atrophy with respiratory distress type 1 (SMARD1) is an autosomal recessive motor neuron disease causing distal limb muscle atrophy that progresses proximally and is accompanied by diaphragmatic paralysis. Neuromuscular junction (NMJ) alterations have been reported in muscles of SMARD1 model mice, known as nmd mice, with varying degrees of severity, suggesting that different muscles are specifically and selectively resistant or susceptible to denervation. To evaluate the extent of NMJ pathology in a broad range of muscles, a panel of axial and appendicular muscles were isolated and immunostained from nmd mice. These analyses revealed that selective distal appendage muscles were highly vulnerable to denervation. Susceptibility to pathology was not limited to NMJ alterations, but included defects in myelination within those neurons innervating susceptible muscles. Interestingly, end plate fragmentation was present within all muscles independent of the extent of NMJ alterations, suggesting that end plate fragmentation is an early hallmark of SMARD1 pathogenesis. Expressing the full-length IGHMBP2 cDNA using an adeno-associated virus (AAV9) significantly decreased all aspects of muscle and nerve disease pathology. These results shed new light onto the pathogenesis of SMARD1 by identifying specific motor units that are resistant and susceptible to neurodegeneration in an important model of SMARD1.

Also flagged:histone demethylaseUtxneurodegenerative diseaseHDmethylationchromatin
Journal Article 2018-02-01 ✓ 5 Snippets Song W, Zsindely N, Faragó A, Marsh JL, Bodai L.
In-Text Gene Mentions

In contrast, modulating enzymes acting on the facultative heterochromatin mark at H3K27 had specific effects on HD pathology, with reduction of the demethylase Utx rescuing HTT-induced pathology while reducing Polycomb Repressive Complex2 core methylase components led to more aggressive pathology.

Huntington's disease (HD) is a dominantly inherited neurodegenerative disease caused by alterations in the huntingtin gene (htt).

…huntingtin gene (htt).…

HTT

Htt esc 5

Show Full Abstract

Huntington's disease (HD) is a dominantly inherited neurodegenerative disease caused by alterations in the huntingtin gene (htt). Transcriptional dysregulation is an early event in HD progression. Protein acetylation and methylation particularly on histones regulates chromatin structure thereby preventing or facilitating transcription. Although protein acetylation has been found to affect HD symptoms, little is known about the potential role of protein methylation in HD pathology. In recent years, a series of proteins have been described that are responsible for methylating and demethylating histones as well as other proteins. We carried out systematic genetic interaction studies testing lysine and arginine methylases and demethylases in a Drosophila melanogaster HD model. We found that modulating methylation enzymes that typically affect histone positions H3K4, H3K36 or H3K79 had varying effects on HD pathology while modulating ones that typically affect constitutive heterochromatin marks at H3K9 and H4K20 generally had limited impact on HD pathology. In contrast, modulating enzymes acting on the facultative heterochromatin mark at H3K27 had specific effects on HD pathology, with reduction of the demethylase Utx rescuing HTT-induced pathology while reducing Polycomb Repressive Complex2 core methylase components led to more aggressive pathology. Further exploration of the mechanism underlying the methylation-specific interactions suggest that these lysine and arginine methylases and demethylases are likely exerting their influence through non-histone targets. These results highlight a novel therapeutic approach for HD in the form of Utx inhibition.

Also flagged:copperazidealkynesynthesispeptideantibody
Journal Article 2018-02-01 No Snippets Pickens CJ, Johnson SN, Pressnall MM, Leon MA, Berkland CJ.
Show Full Abstract

Interrogating biological systems is often limited by access to biological probes. The emergence of "click chemistry" has revolutionized bioconjugate chemistry by providing facile reaction conditions amenable to both biologic molecules and small molecule probes such as fluorophores, toxins, or therapeutics. One particularly popular version is the copper-catalyzed azide-alkyne cycloaddition (AAC) reaction, which has spawned new alternatives such as the strain-promoted azide-alkyne cycloaddition reaction, among others. This focused review highlights practical approaches to AAC reactions for the synthesis of peptide or protein bioconjugates and contrasts current challenges and limitations in light of recent advances in the field. The conical success of antibody drug conjugates has expanded the toolbox of linkers and payloads to facilitate practical applications of bioconjugation to create novel therapeutics and biologic probes. The AAC reaction in particular is poised to enable a large set of functionalized molecules as a combinatorial approach to high-throughput bioconjugate generation, screening, and honing of lead compounds.

Also flagged:tRNA synthetasesamino acidsprotein synthesiscytosolphosphorylationARS
Journal Article 2018-02-01 ✓ 1 Snippet Boczonadi V, Jennings MJ, Horvath R.
In-Text Gene Mentions

The most typical clinical presentations are leukoencephalopathy with brainstem and spinal cord involvement and high lactate (LBSL) due to DARS2 mutations 8, leukoencephalopathy with thalamus and brainstem involvement and high lactate (LTBL) caused by EARS2 mutations 9, but other mt‐ARS mutations may also cause white matter lesions.

Show Full Abstract

Aminoacyl-tRNA synthetases (ARSs) are ubiquitously expressed enzymes responsible for charging tRNAs with their cognate amino acids, therefore essential for the first step in protein synthesis. Although the majority of protein synthesis happens in the cytosol, an additional translation apparatus is required to translate the 13 mitochondrial DNA-encoded proteins important for oxidative phosphorylation. Most ARS genes in these cellular compartments are distinct, but two genes are common, encoding aminoacyl-tRNA synthetases of glycine (GARS) and lysine (KARS) in both mitochondria and the cytosol. Mutations in the majority of the 37 nuclear-encoded human ARS genes have been linked to a variety of recessive and dominant tissue-specific disorders. Current data indicate that impaired enzyme function could explain the pathogenicity, however not all pathogenic ARSs mutations result in deficient catalytic function; thus, the consequences of mutations may arise from other molecular mechanisms. The peripheral nerves are frequently affected, as illustrated by the high number of mutations in cytosolic and bifunctional tRNA synthetases causing Charcot-Marie-Tooth disease (CMT). Here we provide insights on the pathomechanisms of CMT-causing tRNA synthetases with specific focus on the two bifunctional tRNA synthetases (GARS, KARS).

Also flagged:gene expressioncancerstumorcancertumorsmetabolism
Journal Article 2018-02-01 ✓ 2 Snippets Wilk G, Braun R.
In-Text Gene Mentions

In addition, many cancer genes targeted by hsa-mir-141 and its family members are on the pathways in Table 5, including SRC, PTEN, GRB2, CDK6, KRAS, DCC and various protein kinases.

…GRB2, CDK6, KRAS,DCCand various protein…

Show Full Abstract

MicroRNAs (miRNAs) are small endogenous regulatory molecules that modulate gene expression post-transcriptionally. Although differential expression of miRNAs have been implicated in many diseases (including cancers), the underlying mechanisms of action remain unclear. Because each miRNA can target multiple genes, miRNAs may potentially have functional implications for the overall behavior of entire pathways. Here, we investigate the functional consequences of miRNA dysregulation through an integrative analysis of miRNA and mRNA expression data using a novel approach that incorporates pathway information a priori. By searching for miRNA-pathway associations that differ between healthy and tumor tissue, we identify specific relationships at the systems level which are disrupted in cancer. Our approach is motivated by the hypothesis that if an miRNA and pathway are associated, then the expression of the miRNA and the collective behavior of the genes in a pathway will be correlated. As such, we first obtain an expression-based summary of pathway activity using Isomap, a dimension reduction method which can articulate non-linear structure in high-dimensional data. We then search for miRNAs that exhibit differential correlations with the pathway summary between phenotypes as a means of finding aberrant miRNA-pathway coregulation in tumors. We apply our method to cancer data using gene and miRNA expression datasets from The Cancer Genome Atlas and compare ∼105 miRNA-pathway relationships between healthy and tumor samples from four tissues (breast, prostate, lung and liver). Many of the flagged pairs we identify have a biological basis for disruption in cancer.

Also flagged:aminoglycosidesinfectionsneamineneomycin Bparomomycinparomamine
Journal Article 2018-02-01 No Snippets Thamban Chandrika N, Garneau-Tsodikova S.
Show Full Abstract

A systematic analysis of all synthetic and chemoenzymatic methodologies for the preparation of aminoglycosides for a variety of applications (therapeutic and agricultural) reported in the scientific literature up to 2017 is presented. This comprehensive analysis of derivatization/generation of novel aminoglycosides and their conjugates is divided based on the types of modifications used to make the new derivatives. Both the chemical strategies utilized and the biological results observed are covered. Structure-activity relationships based on different synthetic modifications along with their implications for activity and ability to avoid resistance against different microorganisms are also presented.

Also flagged:UBTFtranscription factorRNA polymerase 1RNA polymerase 2amino acidbehavioral
Journal Article 2018-02-01 ✓ 1 Snippet Toro C, Hori RT, Malicdan MCV, Tifft CJ, Goldstein A, Gahl WA, Adams DR, Fauni HB, Wolfe LA, Xiao J, Khan MM, Tian J, Hope KA, Reiter LT, Tremblay MG, Moss T, Franks AL, Balak C, C4RCD Research Group, LeDoux MS.
In-Text Gene Mentions

…For example, mutantHtttranscripts have been…

Show Full Abstract

UBTF (upstream binding transcription factor) exists as two isoforms; UBTF1 regulates rRNA transcription by RNA polymerase 1, whereas UBTF2 regulates mRNA transcription by RNA polymerase 2. Herein, we describe 4 patients with very similar patterns of neuroregression due to recurrent de novo mutations in UBTF (GRCh37/hg19, NC_000017.10: g.42290219C > T, NM_014233.3: c.628G > A) resulting in the same amino acid change in both UBTF1 and UBTF2 (p.Glu210Lys [p.E210K]). Disease onset in our cohort was at 2.5 to 3 years and characterized by slow progression of global motor, cognitive and behavioral dysfunction. Notable early features included hypotonia with a floppy gait, high-pitched dysarthria and hyperactivity. Later features included aphasia, dystonia, and spasticity. Speech and ambulatory ability were lost by the early teens. Magnetic resonance imaging showed progressive generalized cerebral atrophy (supratentorial > infratentorial) with involvement of both gray and white matter. Patient fibroblasts showed normal levels of UBTF transcripts, increased expression of pre-rRNA and 18S rRNA, nucleolar abnormalities, markedly increased numbers of DNA breaks, defective cell-cycle progression, and apoptosis. Expression of mutant human UBTF1 in Drosophila neurons was lethal. Although no loss-of-function variants are reported in the Exome Aggregation Consortium (ExAC) database and Ubtf-/- is early embryonic lethal in mice, Ubtf+/- mice displayed only mild motor and behavioral dysfunction in adulthood. Our data underscore the importance of including UBTF E210K in the differential diagnosis of neuroregression and suggest that mainly gain-of-function mechanisms contribute to the pathogenesis of the UBTF E210K neuroregression syndrome.

Also flagged:Protocadherin-8gynecological cancerPCDH8tumorOCcancer
Journal Article 2018-02-01 ✓ 5 Snippets Cao Y, Yu Y, Chen X, Ren F, Zhang R, Jia Y, Ren Z, Sun R, Li J, Shi H.
In-Text Gene Mentions

The invasion and metastasis is one of the most important hallmarks of tumor progression.5 Ovarian cancer patients diagnosed at an early stage (before the cancer has spread) have a much higher 5-year survival rate (92.1%) than those diagnosed at an advanced stage (28.8%).1 The local invasion and distant metastasis of carcinomas that were associated with cancer cells typically developed alterations in their shape as well as in their attachment to other cells and to the extracellular matrix.5 The abnormal expression and mutational inactivation of cell-to-cell and cell-to-extracellular matrix adhesion molecules were considered as key suppressors of this hallmark capability.6 A major class of cell-cell adhesion molecules is the cadherin superfamily, including E-cadherin, N-cadherin, P-cadherin, protocadherins (PCDHs), and so on.7,8 Protocadherin-8 (PCDH8) is a nonclustered protocadherin which belongs to the protocadherin family, a subfamily of the cadherin superfamily, and plays multiple roles in cell adhesion, proliferation, differentiation, and migration.9–11 Previous studies have indicated that PCDH17 and 20 could act as tumor suppressors in gastric and colorectal cancers, nasopharynx carcinoma, breast cancer, or non–small-cell lung cancers.12–15

It has been proven that PCDH17 could suppress Wnt/β-catenin signaling and cell metastasis and was frequently downregulated or silenced in 78% of breast tumor cell lines, as well as 89% of primary breast tumors.15 It also could induce tumor cell apoptosis and autophagy in gastric and colorectal cancers.12 Moreover, PCDH17, combined with POU4F2, has yielded the highest sensitivity and specificity for detecting bladder cancer.24 Protocadherin-20, another number of PCDH family, was silenced in non–small-cell lung cancers, nasopharyngeal carcinoma and liver cancer,13,15,25,26 and suppress tumor through antagonizing the Wnt/β-catenin signaling pathway in liver cancer.25 These studies indicated that PCDH17 and 20 could act as tumor suppressors in a series of cancers.12–15,24–26

Recent studies have proved that the silenced expression of PCDHs, such as PCDH17 and PCDH20, was due to the promoter methylation of PCDHs genes in a series of cancers.12,15,24 Moreover, the promoter methylation also induced inactivated PCDH8 in liver cancer, nasopharyngeal carcinoma, renal cell carcinoma, mantle cell lymphoma, resulting in the inhibition of cancer cell growth, colony formation, and migration.16–19 Thus, we suspected that the low expression of PCDH8 might also attribute to the promoter methylation in OC.

…been proven thatPCDH17could suppress Wnt/β-catenin…

…12 Moreover,PCDH17, combined with POU4F2,…

Show Full Abstract

<h4>Objective</h4>Ovarian cancer (OC) is the second most lethal gynecological cancer among women throughout the world. Protocadherin-8 (PCDH8) could function as a candidate tumor suppressor. However, the link between PCDH8 and OC development is poorly understood.<h4>Materials and methods</h4>A total of 68 OC patients were retrospectively enrolled. Clinical information was collected and cancer tissues were used for tissue microarray. The PCDH8 expression was determined on tissue microarray by immunohistochemical staining, and PCDH8 protein was detected in cancer tissues and adjacent tissue by western blotting. Human OC cell lines (SKOV-3 and OVCAR-3) were used to assess the effects of PCDH8 overexpression by western blot and real-time PCR analysis. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide cell proliferation assay, wound healing migration assay, colony formation assay and invasion assays were performed to assess the influence of PCDH8 on cell function. Cells with Luc-nonspecific Lentiviral or Luc-Lentiviral with PCDH8 gene were subcutaneously injected into nude mice to observe the effect of PCDH8 gene on tumor growth. Bioluminescence imaging was used to observe tumor volume.<h4>Results</h4>We found a low expression of PCDH8 in OC tissues versus the corresponding adjacent tissue. The PCDH8 expression, International Federation of Gynecology and Obstetrics stage, metastasis and recurrence were the independent prognostic factors for over-all survival by multivariate analyses. Furthermore, the patients with recurrence presented a low level of PCDH8 in OC tissues, and patients with advanced tumor stage also had a low PCDH8 expression. Importantly, the low expression of PCDH8 in OC tissues had a poor prognosis with a low overall survival rate. Overexpression of PCDH8 could inhibit OC cell growth/proliferation, migration, invasion, and colony formation in vitro. In vivo experiments also proved that overexpression of PCDH8 could inhibit OC cell growth/proliferation.<h4>Conclusions</h4>Protocadherin-8 might be considered as a candidate tumor suppressor and play a crucial role in the progression of OC.

Also flagged:PeptidesZFP57BAZ1BionslocalizationCTCF
Journal Article 2018-02-01 ✓ 1 Snippet Zaidan NZ, Walker KJ, Brown JE, Schaffer LV, Scalf M, Shortreed MR, Iyer G, Smith LM, Sridharan R.
In-Text Gene Mentions

…replication complex, thechromatin remodeling NuRDremodeling NuRD complex,…

Show Full Abstract

The heterochromatin protein 1 (HP1) family is involved in various functions with maintenance of chromatin structure. During murine somatic cell reprogramming, we find that early depletion of HP1γ reduces the generation of induced pluripotent stem cells, while late depletion enhances the process, with a concomitant change from a centromeric to nucleoplasmic localization and elongation-associated histone H3.3 enrichment. Depletion of heterochromatin anchoring protein SENP7 increased reprogramming efficiency to a similar extent as HP1γ, indicating the importance of HP1γ release from chromatin for pluripotency acquisition. HP1γ interacted with OCT4 and DPPA4 in HP1α and HP1β knockouts and in H3K9 methylation depleted H3K9M embryonic stem cell (ESC) lines. HP1α and HP1γ complexes in ESCs differed in association with histones, the histone chaperone CAF1 complex, and specific components of chromatin-modifying complexes such as DPY30, implying distinct functional contributions. Taken together, our results reveal the complex contribution of the HP1 proteins to pluripotency.

Also flagged:transcription factorbindinggene expressiongenetic diseaseschromatinhistone
Journal Article 2018-02-01 No Snippets Diehl AG, Boyle AP.
Show Full Abstract

The mouse is widely used as system to study human genetic mechanisms. However, extensive rewiring of transcriptional regulatory networks often confounds translation of findings between human and mouse. Site-specific gain and loss of individual transcription factor binding sites (TFBS) has caused functional divergence of orthologous regulatory loci, and so we must look beyond this positional conservation to understand common themes of regulatory control. Fortunately, transcription factor co-binding patterns shared across species often perform conserved regulatory functions. These can be compared to 'regulatory sentences' that retain the same meanings regardless of sequence and species context. By analyzing TFBS co-occupancy patterns observed in four human and mouse cell types, we learned a regulatory grammar: the rules by which TFBS are combined into meaningful regulatory sentences. Different parts of this grammar associate with specific sets of functional annotations regardless of sequence conservation and predict functional signatures more accurately than positional conservation. We further show that both species-specific and conserved portions of this grammar are involved in gene expression divergence and human disease risk. These findings expand our understanding of transcriptional regulatory mechanisms, suggesting that phenotypic divergence and disease risk are driven by a complex interplay between deeply conserved and species-specific transcriptional regulatory pathways.

Also flagged:schizophreniabrain-developmentneural tube developmentmethylationmental disorderbrain development
Journal Article 2018-02-01 ✓ 1 Snippet Hu W, Lin D, Cao S, Liu J, Chen J, Calhoun VD, Wang YP.
In-Text Gene Mentions

DCC

Show Full Abstract

Finding correlations across multiple data sets in imaging and (epi)genomics is a common challenge. Sparse multiple canonical correlation analysis (SMCCA) is a multivariate model widely used to extract contributing features from each data while maximizing the cross-modality correlation. The model is achieved by using the combination of pairwise covariances between any two data sets. However, the scales of different pairwise covariances could be quite different and the direct combination of pairwise covariances in SMCCA is unfair. The problem of "unfair combination of pairwise covariances" restricts the power of SMCCA for feature selection. In this paper, we propose a novel formulation of SMCCA, called adaptive SMCCA, to overcome the problem by introducing adaptive weights when combining pairwise covariances. Both simulation and real-data analysis show the outperformance of adaptive SMCCA in terms of feature selection over conventional SMCCA and SMCCA with fixed weights. Large-scale numerical experiments show that adaptive SMCCA converges as fast as conventional SMCCA. When applying it to imaging (epi)genetics study of schizophrenia subjects, we can detect significant (epi)genetic variants and brain regions, which are consistent with other existing reports. In addition, several significant brain-development related pathways, e.g., neural tube development, are detected by our model, demonstrating imaging epigenetic association may be overlooked by conventional SMCCA. All these results demonstrate that adaptive SMCCA are well suited for detecting three-way or multiway correlations and thus can find widespread applications in multiple omics and imaging data integration.

Also flagged:rhodaminealkaline phosphataseTNF-αpeptidesbindingPeroxidase
Journal Article 2018-02-01 No Snippets Giri B, Liu Y, Nchocho FN, Corcoran RC, Dutta D.
Show Full Abstract

The requirement for an enzyme label to carry out a chemical reaction directly at the signaling region of the enzyme substrate in order to produce a large change in its detectability places a significant constraint on the scope of enzyme-linked immunosorbent assays (ELISAs). In particular, this requirement limits the kinds of enzyme label-substrate couples employable in ELISAs and prevents their independent optimization with respect to the enzyme reaction and the detectability of the enzyme reaction substrate/product. The detection limit and multiplexing capabilities of the assay are consequently restricted in addition to rendering the technique applicable to a narrow range of assay conditions/samples. Attempting to address some of these limitations, the current article describes a microfluidic ELISA method that does not require the enzyme label to act around the signaling region of the substrate molecule. A highly detectable rhodamine based substrate was synthesized to demonstrate the reported assay which upon cleavage by the enzyme label, alkaline phosphatase, transformed from a monoanionic to a monocationic species, both of which had nearly identical fluorescence properties. These species were later separated based on their charge difference using capillary zone electrophoresis in an integrated device yielding a quantitative measure for the analyte (human TNF-α) in our sample. Impressively, the noted approach not only enabled the use of a new kind of enzyme substrate for ELISAs but also allowed the detection of human TNF-α at concentrations over 54-fold lower than that possible on commercial microwell plates primarily due to the better detectability of the rhodamine dye.

Also flagged:Acute Respiratory Infectionsinfluenzaear infectionotitis mediainfluenza infectionAcute otitis media
Journal Article 2018-02-01 No Snippets Jefferson T, Rivetti A, Di Pietrantonj C, Demicheli V.
Show Full Abstract

<h4>Background</h4>The consequences of influenza in children and adults are mainly absenteeism from school and work. However, the risk of complications is greatest in children and people over 65 years of age. This is an update of a review published in 2011. Future updates of this review will be made only when new trials or vaccines become available. Observational data included in previous versions of the review have been retained for historical reasons but have not been updated because of their lack of influence on the review conclusions.<h4>Objectives</h4>To assess the effects (efficacy, effectiveness, and harm) of vaccines against influenza in healthy children.<h4>Search methods</h4>We searched the Cochrane Central Register of Controlled Trials (CENTRAL) (the Cochrane Library 2016, Issue 12), which includes the Cochrane Acute Respiratory Infections Group Specialised Register, MEDLINE (1966 to 31 December 2016), Embase (1974 to 31 December 2016), WHO International Clinical Trials Registry Platform (ICTRP; 1 July 2017), and ClinicalTrials.gov (1 July 2017).<h4>Selection criteria</h4>Randomised controlled trials comparing influenza vaccines with placebo or no intervention in naturally occurring influenza in healthy children under 16 years. Previous versions of this review included 19 cohort and 11 case-control studies. We are no longer updating the searches for these study designs but have retained the observational studies for historical purposes.<h4>Data collection and analysis</h4>Review authors independently assessed risk of bias and extracted data. We used GRADE to rate the certainty of evidence for the key outcomes of influenza, influenza-like illness (ILI), complications (hospitalisation, ear infection), and adverse events. Due to variation in control group risks for influenza and ILI, absolute effects are reported as the median control group risk, and numbers needed to vaccinate (NNVs) are reported accordingly. For other outcomes aggregate control group risks are used.<h4>Main results</h4>We included 41 clinical trials (> 200,000 children). Most of the studies were conducted in children over the age of two and compared live attenuated or inactivated vaccines with placebo or no vaccine. Studies were conducted over single influenza seasons in the USA, Western Europe, Russia, and Bangladesh between 1984 and 2013. Restricting analyses to studies at low risk of bias showed that influenza and otitis media were the only outcomes where the impact of bias was negligible. Variability in study design and reporting impeded meta-analysis of harms outcomes.Live attenuated vaccinesCompared with placebo or do nothing, live attenuated influenza vaccines probably reduce the risk of influenza infection in children aged 3 to 16 years from 18% to 4% (risk ratio (RR) 0.22, 95% confidence interval (CI) 0.11 to 0.41; 7718 children; moderate-certainty evidence), and they may reduce ILI by a smaller degree, from 17% to 12% (RR 0.69, 95% CI 0.60 to 0.80; 124,606 children; low-certainty evidence). Seven children would need to be vaccinated to prevent one case of influenza, and 20 children would need to be vaccinated to prevent one child experiencing an ILI. Acute otitis media is probably similar following vaccine or placebo during seasonal influenza, but this result comes from a single study with particularly high rates of acute otitis media (RR 0.98, 95% CI 0.95 to 1.01; moderate-certainty evidence). There was insufficient information available to determine the effect of vaccines on school absenteeism due to very low-certainty evidence from one study. Vaccinating children may lead to fewer parents taking time off work, although the CI includes no effect (RR 0.69, 95% CI 0.46 to 1.03; low-certainty evidence). Data on the most serious consequences of influenza complications leading to hospitalisation were not available. Data from four studies measuring fever following vaccination varied considerably, from 0.16% to 15% in children who had live vaccines, while in the placebo groups the proportions ranged from 0.71% to 22% (very low-certainty evidence). Data on nausea were not reported.Inactivated vaccinesCompared with placebo or no vaccination, inactivated vaccines reduce the risk of influenza in children aged 2 to 16 years from 30% to 11% (RR 0.36, 95% CI 0.28 to 0.48; 1628 children; high-certainty evidence), and they probably reduce ILI from 28% to 20% (RR 0.72, 95% CI 0.65 to 0.79; 19,044 children; moderate-certainty evidence). Five children would need to be vaccinated to prevent one case of influenza, and 12 children would need to be vaccinated to avoid one case of ILI. The risk of otitis media is probably similar between vaccinated children and unvaccinated children (31% versus 27%), although the CI does not exclude a meaningful increase in otitis media following vaccination (RR 1.15, 95% CI 0.95 to 1.40; 884 participants; moderate-certainty evidence). There was insufficient information available to determine the effect of vaccines on school absenteeism due to very low-certainty evidence from one study. We identified no data on parental working time lost, hospitalisation, fever, or nausea.We found limited evidence on secondary cases, requirement for treatment of lower respiratory tract disease, and drug prescriptions. One brand of monovalent pandemic vaccine was associated with a sudden loss of muscle tone triggered by the experience of an intense emotion (cataplexy) and a sleep disorder (narcolepsy) in children. Evidence of serious harms (such as febrile fits) was sparse.<h4>Authors' conclusions</h4>In children aged between 3 and 16 years, live influenza vaccines probably reduce influenza (moderate-certainty evidence) and may reduce ILI (low-certainty evidence) over a single influenza season. In this population inactivated vaccines also reduce influenza (high-certainty evidence) and may reduce ILI (low-certainty evidence). For both vaccine types, the absolute reduction in influenza and ILI varied considerably across the study populations, making it difficult to predict how these findings translate to different settings. We found very few randomised controlled trials in children under two years of age. Adverse event data were not well described in the available studies. Standardised approaches to the definition, ascertainment, and reporting of adverse events are needed. Identification of all global cases of potential harms is beyond the scope of this review.

Also flagged:Pulmonary hypertensionPHendothelial dysfunctionpulmonary arterial hypertensionvasodilationRV failure
Journal Article 2018-02-01 No Snippets Hensley MK, Levine A, Gladwin MT, Lai YC.
Show Full Abstract

Pulmonary hypertension (PH) is a progressive and often fatal illness presenting with nonspecific symptoms of dyspnea, lower extremity edema, and exercise intolerance. Pathologically, endothelial dysfunction leads to abnormal intimal and smooth muscle proliferation along with reduced apoptosis, resulting in increased pulmonary vascular resistance and elevated pulmonary pressures. PH is subdivided into five World Health Organization groups based on the disease pathology and specific cause. While there are Food and Drug Administration-approved medications for the treatment of pulmonary arterial hypertension (PAH; Group 1 PH), as well as for chronic thromboembolic PH (Group 4 PH), the morbidity and mortality remain high. Moreover, there are no approved therapies for other forms of PH (Groups 2, 3, and 5) at present. New research has identified molecular targets that mediate vasodilation, anti-inflammatory, and antifibrotic changes within the pulmonary vasculature. Given that PAH is the most commonly studied form of PH worldwide and because recent studies have led to better mechanistic understanding of this devastating disease, in this review we attempt to provide an updated overview of new therapeutic approaches under investigation for the treatment of PH, with a particular focus on PAH, as well as to offer guidelines for future investigations.

Also flagged:RYR1PALB2CHEK2BRCA1ovarian cancerMUTYH
Journal Article 2018-02-01 ✓ 1 Snippet Christensen KD, Bernhardt BA, Jarvik GP, Hindorff LA, Ou J, Biswas S, Powell BC, Grundmeier RW, Machini K, Karavite DJ, Pennington JW, Krantz ID, Berg JS, Goddard KAB.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Purpose</h4>Secondary findings from genomic sequencing are becoming more common. We compared how health-care providers with and without specialized genetics training anticipated responding to different types of secondary findings.<h4>Methods</h4>Providers with genomic sequencing experience reviewed five secondary-findings reports and reported attitudes and potential clinical follow-up. Analyses compared genetic specialists and physicians without specialized genetics training, and examined how responses varied by secondary finding.<h4>Results</h4>Genetic specialists scored higher than other providers on four-point scales assessing understandings of reports (3.89 vs. 3.42, p = 0.0002), and lower on scales assessing reporting obligations (2.60 vs. 3.51, p < 0.0001) and burdens of responding (1.73 vs. 2.70, p < 0.0001). Nearly all attitudes differed between findings, although genetic specialists were more likely to assert that laboratories had no obligations when findings had less-established actionability (p < 0.0001 in interaction tests). The importance of reviewing personal and family histories, documenting findings, learning more about the variant, and recommending familial discussions also varied according to finding (all p < 0.0001).<h4>Conclusion</h4>Genetic specialists felt better prepared to respond to secondary findings than providers without specialized genetics training, but perceived fewer obligations for laboratories to report them, and the two groups anticipated similar clinical responses. Findings may inform development of targeted education and support.

Also flagged:chromatinHRPmultiple myelomamonoclonal gammopathy of undetermined significanceUSP45endonuclease
Journal Article 2018-02-01 ✓ 2 Snippets Waller RG, Darlington TM, Wei X, Madsen MJ, Thomas A, Curtin K, Coon H, Rajamanickam V, Musinsky J, Jayabalan D, Atanackovic D, Rajkumar SV, Kumar S, Slager S, Middha M, Galia P, Demangel D, Salama M, Joseph V, McKay J, Offit K, Klein RJ, Lipkin SM, Dumontet C, Vachon CM, Camp NJ.
In-Text Gene Mentions
⭐ same-sentence co-mention

…includes 9 genes:POU3F2, FBXL4 ,…

⭐ same-sentence co-mention

…genes: POU3F2 ,FBXL4, FAXC ,…

Show Full Abstract

The high-risk pedigree (HRP) design is an established strategy to discover rare, highly-penetrant, Mendelian-like causal variants. Its success, however, in complex traits has been modest, largely due to challenges of genetic heterogeneity and complex inheritance models. We describe a HRP strategy that addresses intra-familial heterogeneity, and identifies inherited segments important for mapping regulatory risk. We apply this new Shared Genomic Segment (SGS) method in 11 extended, Utah, multiple myeloma (MM) HRPs, and subsequent exome sequencing in SGS regions of interest in 1063 MM / MGUS (monoclonal gammopathy of undetermined significance-a precursor to MM) cases and 964 controls from a jointly-called collaborative resource, including cases from the initial 11 HRPs. One genome-wide significant 1.8 Mb shared segment was found at 6q16. Exome sequencing in this region revealed predicted deleterious variants in USP45 (p.Gln691* and p.Gln621Glu), a gene known to influence DNA repair through endonuclease regulation. Additionally, a 1.2 Mb segment at 1p36.11 is inherited in two Utah HRPs, with coding variants identified in ARID1A (p.Ser90Gly and p.Met890Val), a key gene in the SWI/SNF chromatin remodeling complex. Our results provide compelling statistical and genetic evidence for segregating risk variants for MM. In addition, we demonstrate a novel strategy to use large HRPs for risk-variant discovery more generally in complex traits.

Also flagged:Olig2motor neuron differentiationtissue developmentgene expressionNotchHes1
Journal Article 2018-02-01 ✓ 3 Snippets Sagner A, Gaber ZB, Delile J, Kong JH, Rousso DL, Pearson CA, Weicksel SE, Melchionda M, Mousavy Gharavy SN, Briscoe J, Novitch BG.
In-Text Gene Mentions

…POU domain TFPou3f2(aka Brn-2).…

…including Ngn2 andPou3f2( S6K Fig…

…Zbtb18 , andPou3f2(K); and MN…

Show Full Abstract

During tissue development, multipotent progenitors differentiate into specific cell types in characteristic spatial and temporal patterns. We addressed the mechanism linking progenitor identity and differentiation rate in the neural tube, where motor neuron (MN) progenitors differentiate more rapidly than other progenitors. Using single cell transcriptomics, we defined the transcriptional changes associated with the transition of neural progenitors into MNs. Reconstruction of gene expression dynamics from these data indicate a pivotal role for the MN determinant Olig2 just prior to MN differentiation. Olig2 represses expression of the Notch signaling pathway effectors Hes1 and Hes5. Olig2 repression of Hes5 appears to be direct, via a conserved regulatory element within the Hes5 locus that restricts expression from MN progenitors. These findings reveal a tight coupling between the regulatory networks that control patterning and neuronal differentiation and demonstrate how Olig2 acts as the developmental pacemaker coordinating the spatial and temporal pattern of MN generation.

Also flagged:poreclaudin-1claudin-15zonula occludens 1E-cadherinclaudin-7
Journal Article 2018-02-01 ✓ 5 Snippets Pearce SC, Al-Jawadi A, Kishida K, Yu S, Hu M, Fritzky LF, Edelblum KL, Gao N, Ferraris RP.
In-Text Gene Mentions

…stem cell biomarker,Olfm4, were greatest…

…An antibody againstOLFM4, whose mRNA expression…

OLFM4was highly visible…

OLFM4is secreted, and…

…interestingly, virtually noOLFM4or LYZ.…

Show Full Abstract

<h4>Background</h4>Mammalian small intestinal tight junctions (TJ) link epithelial cells to one another and function as a permselective barrier, strictly modulating the passage of ions and macromolecules through the pore and leak pathways, respectively, thereby preventing the absorption of harmful compounds and microbes while allowing regulated transport of nutrients and electrolytes. Small intestinal epithelial permeability is ascribed primarily to the properties of TJs between adjoining enterocytes (ENTs), because there is almost no information on TJ composition and the paracellular permeability of nonenterocyte cell types that constitute a small but significant fraction of the intestinal epithelia.<h4>Results</h4>Here we directed murine intestinal crypts to form specialized organoids highly enriched in intestinal stem cells (ISCs), absorptive ENTs, secretory goblet cells, or Paneth cells. The morphological and morphometric characteristics of these cells in organoids were similar to those in vivo. The expression of certain TJ proteins varied with cell type: occludin and tricellulin levels were high in both ISCs and Paneth cells, while claudin-1, -2, and -7 expression was greatest in Paneth cells, ISCs, and ENTs, respectively. In contrast, the distribution of claudin-15, zonula occludens 1 (ZO-1), and E-cadherin was relatively homogeneous. E-cadherin and claudin-7 marked mainly the basolateral membrane, while claudin-2, ZO-1, and occludin resided in the apical membrane. Remarkably, organoids enriched in ENTs or goblet cells were over threefold more permeable to 4 and 10 kDa dextran compared to those containing stem and Paneth cells. The TJ-regulator larazotide prevented the approximately tenfold increases in dextran flux induced by the TJ-disrupter AT1002 into organoids of different cell types, indicating that this ZO toxin nonselectively increases permeability. Forced dedifferentiation of mature ENTs results in the reacquisition of ISC-like characteristics in TJ composition and dextran permeability, suggesting that the post-differentiation properties of TJs are not hardwired.<h4>Conclusions</h4>Differentiation of adult intestinal stem cells into mature secretory and absorptive cell types causes marked, but potentially reversible, changes in TJ composition, resulting in enhanced macromolecular permeability of the TJ leak pathway between ENTs and between goblet cells. This work advances our understanding of how cell differentiation affects the paracellular pathway of epithelia.

Also flagged:ironneurological diseasescancerresponse toL-ferritinsecretion
Journal Article 2018-02-01 ✓ 5 Snippets Nixon AM, Neely E, Simpson IA, Connor JR.
In-Text Gene Mentions

We also previously reported that monocyte chemoattractant protein-1 (MCP-1) is elevated in amyotrophic lateral sclerosis patients with H63D HFE [64], as well as in SH-SY5Y neuroblastoma cells transfected with the H63D HFE mutation [65].

The H63D variant of the HFE gene is reportedly a disease modifier for a number of neurodegenerative diseases and possibly cancer [7, 45].

When mice with the H67D HFE gene variant (mouse homolog of H63D) are bred with the SOD1 mutant mouse model of ALS the result is accelerated disease progression [12].

…The role ofHFEgenotype in macrophage…

…variant of theHFEgene is the…

Show Full Abstract

<h4>Background</h4>Iron regulation is essential for cellular energy production. Loss of cellular iron homeostasis has critical implications for both normal function and disease progression. The H63D variant of the HFE gene is the most common gene variant in Caucasians. The resulting mutant protein alters cellular iron homeostasis and is associated with a number of neurological diseases and cancer. In the brain, microglial and infiltrating macrophages are critical to maintaining iron homeostasis and modulating inflammation associated with the pathogenic process in multiple diseases. This study addresses whether HFE genotype affects macrophage function and the implications of these findings for disease processes.<h4>Methods</h4>Bone marrow macrophages were isolated from wildtype and H67D HFE knock-in mice. The H67D gene variant in mice is the human equivalent of the H63D variant. Upon differentiation, the macrophages were used to analyze iron regulatory proteins, cellular iron release, migration, phagocytosis, and cytokine expression.<h4>Results</h4>The results of this study demonstrate that the H67D HFE genotype significantly impacts a number of critical macrophage functions. Specifically, fundamental activities such as proliferation in response to iron exposure, L-ferritin expression in response to iron loading, secretion of BMP6 and cytokines, and migration and phagocytic activity were all found to be impacted by genotype. Furthermore, we demonstrated that exposure to apo-Tf (iron-poor transferrin) can increase the release of iron from macrophages. In normal conditions, 70% of circulating transferrin is unsaturated. Therefore, the ability of apo-Tf to induce iron release could be a major regulatory mechanism for iron release from macrophages.<h4>Conclusions</h4>These studies demonstrate that the HFE genotype impacts fundamental components of macrophage phenotype that could alter their role in degenerative and reparative processes in neurodegenerative disorders.

Also flagged:IFNγMultiple sclerosisMSchronic inflammatory diseaseaxonalmyelin
Journal Article 2018-02-01 ✓ 1 Snippet Lentferink DH, Jongsma JM, Werkman I, Baron W.
In-Text Gene Mentions

…Gpr1 7 andSox6) or downregulated…

Show Full Abstract

Multiple sclerosis (MS) is a chronic inflammatory disease characterized by the formation of demyelinated lesions in the central nervous system. At later stages of the disease repair in the form of remyelination often fails, which leads to axonal degeneration and neurological disability. For the regeneration of myelin, oligodendrocyte progenitor cells (OPCs) have to migrate, proliferate and differentiate into remyelinating oligodendrocytes. Remyelination occurs faster and is more extensive in grey matter (GM) lesions than in white matter (WM) lesions. Here, we examined differences in neonatal OPCs from GM (gmOPCs) and WM (wmOPCs), both intrinsically and in response to environmental (injury) signals. We show that gmOPCs are less mature than wmOPCs, both on morphological and on gene-expression level. Additionally, gmOPCs proliferate more and differentiate slower than wmOPCs. When exposed to astrocyte-secreted signals wmOPC, but not gmOPC, migration decreases. In addition, wmOPCs are more sensitive to the detrimental effects of IFNγ treatment on proliferation, differentiation, and process arborisation, which is potentiated by TNFα. Our results demonstrate that OPCs from GM and WM differ both intrinsically and in response to their environment, which may contribute to the difference in remyelination efficiency between GM and WM MS lesions.

Also flagged:vascular calcificationhydroxyapatiteBGPChronic kidney diseaseMagnesiumNuclei
Journal Article 2018-02-01 No Snippets Ter Braake AD, Tinnemans PT, Shanahan CM, Hoenderop JGJ, de Baaij JHF.
Show Full Abstract

Magnesium has been shown to effectively prevent vascular calcification associated with chronic kidney disease. Magnesium has been hypothesized to prevent the upregulation of osteoblastic genes that potentially drives calcification. However, extracellular effects of magnesium on hydroxyapatite formation are largely neglected. This study investigated the effects of magnesium on intracellular changes associated with transdifferentiation and extracellular crystal formation. Bovine vascular smooth muscle cells were calcified using β-glycerophosphate. Transcriptional analysis, alkaline phosphatase activity and detection of apoptosis were used to identify transdifferentiation. Using X-ray diffraction and energy dispersive spectroscopy extracellular crystal composition was investigated. Magnesium prevented calcification in vascular smooth muscle cells. β-glycerophosphate increased expression of osteopontin but no other genes related to calcification. Alkaline phosphatase activity was stable and apoptosis was only detected after calcification independent of magnesium. Blocking of the magnesium channel TRPM7 using 2-APB did not abrogate the protective effects of magnesium. Magnesium prevented the formation of hydroxyapatite, which formed extensively during β-glycerophosphate treatment. Magnesium reduced calcium and phosphate fractions of 68% and 41% extracellular crystals, respectively, without affecting the fraction of magnesium. This study demonstrates that magnesium inhibits hydroxyapatite formation in the extracellular space, thereby preventing calcification of vascular smooth muscle cells.

Also flagged:actinIL-6GAPDHCancerWnt3aHes5
Journal Article 2018-02-01 ✓ 5 Snippets Wei L, Leibowitz BJ, Epperly M, Bi C, Li A, Steinman J, Wipf P, Li S, Zhang L, Greenberger J, Yu J.
In-Text Gene Mentions

OLFM4

…markers ( Lgr5,OLFM4), Wnt (…

…EGF, Notch (OLFM4, Hes1, Math1, Neurogenin…

…increased Notch targetsOLFM4, Hes1 and Math…

…The expression ofOLFM4in the crypts…

Show Full Abstract

Total body irradiation (TBI) leads to dose- and tissue-specific lethality. In the current study, we demonstrate that a mitochondrion-targeted nitroxide JP4-039 given once 24 hours after 9-10 Gy TBI significantly improves mouse survival, and the recovery of intestinal barrier, differentiation and stem cell functions. The GI-protective effects are associated with rapid and selective induction of tight junction proteins and cytokines including TGF-β, IL-10, IL-17a, IL-22 and Notch signaling long before bone marrow depletion. However, no change was observed in crypt death or the expression of prototypic pro-inflammatory cytokines such as TNF-α, IL-6 or IL-1β. Surprisingly, bone marrow transplantation (BMT) performed 24 hours after TBI improves intestinal barrier and stem cell recovery with induction of IL-10, IL-17a, IL-22, and Notch signaling. Further, BMT-rescued TBI survivors display increased intestinal permeability, impaired ISC function and proliferation, but not obvious intestinal inflammation or increased epithelial death. These findings identify intestinal epithelium as a novel target of radiation mitigation, and potential strategies to enhance ISC recovery and regeneration after accidental or medical exposures.

Also flagged:PhospholipidCholesterolcancermembranebiosynthesisphospholipid-remodeling enzyme
Journal Article 2018-02-01 ✓ 1 Snippet Wang B, Rong X, Palladino END, Wang J, Fogelman AM, Martín MG, Alrefai WA, Ford DA, Tontonoz P.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Adequate availability of cellular building blocks, including lipids, is a prerequisite for cellular proliferation, but excess dietary lipids are linked to increased cancer risk. Despite these connections, specific regulatory relationships between membrane composition, intestinal stem cell (ISC) proliferation, and tumorigenesis are unclear. We reveal an unexpected link between membrane phospholipid remodeling and cholesterol biosynthesis and demonstrate that cholesterol itself acts as a mitogen for ISCs. Inhibition of the phospholipid-remodeling enzyme Lpcat3 increases membrane saturation and stimulates cholesterol biosynthesis, thereby driving ISC proliferation. Pharmacologic inhibition of cholesterol synthesis normalizes crypt hyperproliferation in Lpcat3-deficient organoids and mice. Conversely, increasing cellular cholesterol content stimulates crypt organoid growth, and providing excess dietary cholesterol or driving endogenous cholesterol synthesis through SREBP-2 expression promotes ISC proliferation in vivo. Finally, disruption of Lpcat3-dependent phospholipid and cholesterol homeostasis dramatically enhances tumor formation in Apc<sup>min</sup> mice. These findings identify a critical dietary-responsive phospholipid-cholesterol axis regulating ISC proliferation and tumorigenesis.

Also flagged:antibodysynthesisconjugationcysteinedisulfidedibromopyridazinediones
Journal Article 2018-02-01 No Snippets Bahou C, Richards DA, Maruani A, Love EA, Javaid F, Caddick S, Baker JR, Chudasama V.
Show Full Abstract

Due to their exquisite cysteine-selectivity, excellent stability, and ability to functionally rebridge disulfide bonds, dibromopyridazinediones are emerging as an exciting new class of bioconjugation reagents, particularly in the field of antibody conjugation. Despite this, relatively little work has been performed on the optimisation of their synthesis and subsequent reaction with immunoglobulins. Herein we present a novel synthetic route towards functionalised dibromopyridazinediones, proceeding via an isolatable dibromopyridazinedione-NHS ester. Reaction of this activated intermediate with a variety of amines produces functional dibromopyridazinediones in good to excellent yields. The disulfide rebridging capacity of these reagents was optimised on the clinically relevant IgG1 trastuzumab, resulting in a general method which allows for the generation of site-selectively modified native trastuzumab with over 90% homogeneity (no disulfide scrambling) without the need for protein engineering or enzymatic conjugation.

Also flagged:canceroxygenironepothilonestubulindeath
Journal Article 2018-02-01 No Snippets Fedorka SR, So K, Al-Hamashi AA, Gad I, Shah R, Kholodovych V, Alqahtani HD, Taylor WR, Tillekeratne LMV.
Show Full Abstract

In the course of generating a library of open-chain epothilones, we discovered a new class of small molecule anticancer agents that has no effect on tubulin but instead kills selected cancer cell lines by harnessing reactive oxygen species in an iron-dependent manner. Results of the preliminary studies are consistent with the recently described cell death mechanism ferroptosis. Studies are in progress to confirm ferroptosis as the cell death mechanism and to identify the specific molecular targets of these small molecule anticancer agents.

Also flagged:urge incontinencepathogenesisinflammatory responseBladder Outlet Obstructionwaterxylazine
Journal Article 2018-02-01 ✓ 1 Snippet Park EC, Lim JS, Kim SI, Lee SY, Tak YK, Choi CW, Yun S, Park J, Lee M, Chung HK, Kim KS, Na YG, Shin JH, Kim GH.
In-Text Gene Mentions

HTT

Show Full Abstract

<i>O</i>ver<i>a</i>ctive <i>b</i>ladder (OAB) syndrome is a condition that has four symptoms: urgency, urinary frequency, nocturia, and urge incontinence and negatively affects a patient's life. Recently, it is considered that the urinary bladder urothelium is closely linked to pathogenesis of OAB. However, the mechanisms of pathogenesis of OAB at the molecular level remain poorly understood, mainly because of lack of modern molecular analysis. The goal of this study is to identify a potential target protein that could act as a predictive factor for effective diagnosis and aid in the development of therapeutic strategies for the treatment of OAB syndrome. We produced OAB in a rat model and performed the first proteomic analysis on the mucosal layer (urothelium) of the bladders of sham control and OAB rats. The resulting data revealed the differential expression of 355 proteins in the bladder urothelium of OAB rats compared with sham subjects. Signaling pathway analysis revealed that the differentially expressed proteins were mainly involved in the inflammatory response and apoptosis. Our findings suggest a new target for accurate diagnosis of OAB that can provide essential information for the development of drug treatment strategies as well as establish criteria for screening patients in the clinical environment.

Also flagged:synthesisterpenoidsterpenoidterpenebiosynthesiscarbonyl
Journal Article 2018-02-01 No Snippets Hung K, Hu X, Maimone TJ.
Show Full Abstract

Covering: 2011-2017Radical cyclizations have a rich history in organic chemistry and have been particularly generous to the field of natural product synthesis. Owing to their ability to operate in highly congested molecular quarters, and with significant functional group compatibility, these transformations have enabled the synthesis of numerous polycyclic terpenoid natural products over the past several decades. Moreover, when programmed accordingly into a synthetic plan, radical cascade processes can be used to rapidly assemble molecular complexity, much in the same way nature rapidly constructs terpene frameworks through cationic cyclization pathways. This review highlights recent total syntheses of complex terpenoids (from 2011-2017) employing C-C bond-forming radical cascade sequences.

Also flagged:polypeptideblock copolymerscopolymerspolyethylene glycolbenzylglutamate
Journal Article 2018-02-01 No Snippets Turabee MH, Thambi T, Duong HTT, Jeong JH, Lee DS.
Show Full Abstract

Sustained delivery of protein therapeutics is limited owing to the fragile nature of proteins. Despite its great potential, delivery of proteins without any loss of bioactivity remains a challenge in the use of protein therapeutics in the clinic. To surmount this shortcoming, we report a pH- and temperature-responsive in situ-forming injectable hydrogel based on comb-type polypeptide block copolymers for the controlled delivery of proteins. Polypeptide block copolymers, composed of hydrophilic polyethylene glycol (PEG), temperature-responsive poly(γ-benzyl-l-glutamate) (PBLG), and pH-responsive oligo(sulfamethazine) (OSM), exhibit pH- and temperature-induced sol-to-gel transition behavior in aqueous solutions. Polypeptide block copolymers were synthesized by combining N-carboxyanhydride-based ring-opening polymerization and post-functionalization of the chain-end using N-hydroxy succinimide ester activated OSM. The physical properties of polypeptide-based hydrogels were tuned by varying the composition of temperature- and pH-responsive PBLG and OSM in block copolymers. Polypeptide block copolymers were non-toxic to human embryonic kidney cells at high concentrations (2000 μg mL<sup>-1</sup>). Subcutaneous administration of polypeptide block copolymer sols formed viscoelastic gel instantly at the back of Sprague-Dawley (SD) rats. The in vivo gels exhibited sustained degradation and were found to be bioresorbable in 6 weeks without any noticeable inflammation at the injection site. Anionic characteristics of hydrogels allow efficient loading of a cationic model protein, lysozyme, through electrostatic interaction. Lysozyme-loaded polypeptide block copolymer sols readily formed a viscoelastic gel in vivo and sustained lysozyme release for at least a week. Overall, the results demonstrate an elegant approach to control the release of certain charged proteins and open a myriad of therapeutic possibilities in protein therapeutics.

Also flagged:ureasecatheter-associated urinary tract infectionsinfectionsurolithiasiskidney stonesurea
Journal Article 2018-02-01 No Snippets Armbruster CE, Mobley HLT, Pearson MM.
Show Full Abstract

<i>Proteus mirabilis</i>, a Gram-negative rod-shaped bacterium most noted for its swarming motility and urease activity, frequently causes catheter-associated urinary tract infections (CAUTIs) that are often polymicrobial. These infections may be accompanied by urolithiasis, the development of bladder or kidney stones due to alkalinization of urine from urease-catalyzed urea hydrolysis. Adherence of the bacterium to epithelial and catheter surfaces is mediated by 17 different fimbriae, most notably MR/P fimbriae. Repressors of motility are often encoded by these fimbrial operons. Motility is mediated by flagella encoded on a single contiguous 54-kb chromosomal sequence. On agar plates, <i>P. mirabilis</i> undergoes a morphological conversion to a filamentous swarmer cell expressing hundreds of flagella. When swarms from different strains meet, a line of demarcation, a "Dienes line," develops due to the killing action of each strain's type VI secretion system. During infection, histological damage is caused by cytotoxins including hemolysin and a variety of proteases, some autotransported. The pathogenesis of infection, including assessment of individual genes or global screens for virulence or fitness factors has been assessed in murine models of ascending urinary tract infections or CAUTIs using both single-species and polymicrobial models. Global gene expression studies performed in culture and in the murine model have revealed the unique metabolism of this bacterium. Vaccines, using MR/P fimbria and its adhesin, MrpH, have been shown to be efficacious in the murine model. A comprehensive review of factors associated with urinary tract infection is presented, encompassing both historical perspectives and current advances.

Also flagged:tumor necrosis factor superfamily member 4coronary heart diseasestrokecardiovascular diseasescerebrovascular diseasesdeath
Journal Article 2018-02-01 ✓ 5 Snippets Lu JS, Wang H, Yuan FF, Wu LL, Wang B, Ye DQ.
In-Text Gene Mentions

The search algorithm was as follows: (“TNFSF4” or “Tumor necrosis factor superfamily number” or “OX40 ligand” or “OX40L”) and (“atherosclerosis” or “coronary heart disease” or “CHD” or “coronary artery disease” or “CAD” or “ischemic heart disease” or “IHD” or “myocardial infarction” or “MI” or “CI” or “ACI” or “stroke” or “cerebral infarction”) and (“polymorphism” or “genotype” or “variant” or “allele” or “variation” or “mutation”).

Several studies have showed the relationship between TNFSF4 polymorphisms and the risk of CHD and stroke, but contradictory findings were observed (21-30).

Publication bias in studies of the association between the TNFSF4 polymorphism (rs3850641) and the risk of CHD and stroke assessed by funnel plot for allele contrast model

Figures 3–6 present the results of meta-analysis for each genotypic model; these demonstrated that there is no significant association between TNFSF4 polymorphism rs3850641 and the risk of CHD and stroke [Table 2; homozygous comparison (GG vs. AA): OR=1.05, 95% CI=0.74–1.50; heterozygous comparison (GA vs. AA): OR=1.00, 95% CI=0.88–1.13; recessive model (GG vs. GA+AA): OR=1.04, 95% CI=0.76–1.43; dominant model (GG+GA vs. AA): OR=1.01, 95% CI=0.88–1.17)].

Though exhausted retrieval, apart from limited papers of association between rs3850641 and the risk of CHD, we found that there were also some case-control studies that detected the correlation between TNFSF4 polymorphisms and the risk of stroke.

Show Full Abstract

<h4>Objective</h4>To evaluate the association between the tumor necrosis factor superfamily member 4 (TNFSF4) gene polymorphisms and common cardiovascular and cerebrovascular diseases.<h4>Methods</h4>A literature-based search was conducted through databases including PubMed, EMBASE, Cochrane Library, CNKI, and WanFang data. Crude odds ratios (ORs) and 95% confidence intervals (CI) were calculated to estimate the strength of the association between TNFSF4 polymorphisms (rs3850641 and rs17568) and the risk of coronary heart disease (CHD) and stroke.<h4>Results</h4>Overall, 11 eligible studies were included in this meta-analysis. G allele was showed not to be associated with CHD and stroke, compared with A allele (rs3850641: OR=1.02, 95% CI=0.89-1.17; rs17568: OR=1.09, 95% CI=0.89-1.33). Genotypic analysis demonstrated that there was no significant association between the risk of CHD and stroke and rs3850641 [homozygous comparison (GG vs. AA): OR=1.05, 95% CI=0.74-1.50; heterozygous comparison (GA vs. AA): OR=1.00, 95% CI=0.88-1.13; recessive model (GG vs. GA+AA): OR=1.04, 95% CI=0.76-1.43; dominant model (GG+GA vs. AA): OR=1.01, 95% CI=0.88-1.17]. Similarly, no susceptibility between CHD and stroke and rs17568 polymorphism was uncovered (GG vs. AA: OR=1.04, 95% CI=0.74-1.46; GA vs. AA: OR=1.07, 95% CI=0.62-1.83; GG+GA vs. AA: OR=1.13, 95% CI=0.82-1.56; GG vs. GA+AA: OR=1.01, 95% CI=0.74-1.39).<h4>Conclusion</h4>The present study demonstrated that there is no significant relationship between TNFSF4 gene polymorphism and cerebrovascular and cardiovascular diseases.

Also flagged:Transcription factorschromatinbindingTFimmune responsescell differentiation
Journal Article 2018-02-01 No Snippets Lambert SA, Jolma A, Campitelli LF, Das PK, Yin Y, Albu M, Chen X, Taipale J, Hughes TR, Weirauch MT.
Show Full Abstract

Transcription factors (TFs) recognize specific DNA sequences to control chromatin and transcription, forming a complex system that guides expression of the genome. Despite keen interest in understanding how TFs control gene expression, it remains challenging to determine how the precise genomic binding sites of TFs are specified and how TF binding ultimately relates to regulation of transcription. This review considers how TFs are identified and functionally characterized, principally through the lens of a catalog of over 1,600 likely human TFs and binding motifs for two-thirds of them. Major classes of human TFs differ markedly in their evolutionary trajectories and expression patterns, underscoring distinct functions. TFs likewise underlie many different aspects of human physiology, disease, and variation, highlighting the importance of continued effort to understand TF-mediated gene regulation.

Nervous System Malformations.

Also flagged:perinatal infectionsFolic acidneural tube defectsmyelomeningoceledevelopmental delaysepilepsy
Journal Article 2018-02-01 No Snippets Gaitanis J, Tarui T.
Show Full Abstract

<h4>Purpose of review</h4>This article provides an overview of the most common nervous system malformations and serves as a reference for the latest advances in diagnosis and treatment.<h4>Recent findings</h4>Major advances have occurred in recognizing the genetic basis of nervous system malformations. Environmental causes of nervous system malformations, such as perinatal infections including Zika virus, are also reviewed. Treatment for nervous system malformations begins prior to birth with prevention. Folic acid supplementation reduces the risk of neural tube defects and is an important part of health maintenance for pregnant women. Fetal surgery is now available for prenatal repair of myelomeningocele and has been demonstrated to improve outcomes.<h4>Summary</h4>Each type of nervous system malformation is relatively uncommon, but, collectively, they constitute a large population of neurologic patients. The diagnosis of nervous system malformations begins with radiographic characterization. Genetic studies, including chromosomal microarray, targeted gene sequencing, and next-generation sequencing, are increasingly important aspects of the assessment. A genetic diagnosis may identify an associated medical condition and is necessary for family planning. Treatment consists primarily of supportive therapies for developmental delays and epilepsy, but prenatal surgery for myelomeningocele offers a glimpse of future possibilities. Prognosis depends on multiple clinical factors, including the examination findings, imaging characteristics, and genetic results. Treatment is best conducted in a multidisciplinary setting with neurology, neurosurgery, developmental pediatrics, and genetics working together as a comprehensive team.

Also flagged:Hepatocellular carcinomacancerscancerdeathnucleotidesgene expression
Journal Article 2018-02-01 ✓ 3 Snippets El Khodiry A, Afify M, El Tayebi HM.
In-Text Gene Mentions

While HULC contributes to lipid deregulation and tumor progression through the downregulation of miR-9, ZNFX1-AS1 upregulates miR-9 resulting in tumor suppression HULC and PCAT-14 promote proliferation through the inhibition of miR-372 however through different mechanisms.

ZNFX1-AS1 is significantly downregulated in HCC and its overexpression suppressed cell proliferation, colony formation and promoted cell apoptosis.

…induces apoptosis miR-9 (ZNFX1-AS1) Inhibitory Positive feed…

Show Full Abstract

Hepatocellular carcinoma (HCC) is one of the most common and aggressive cancers worldwide. HCC is the fifth common malignancy in the world and the second leading cause of cancer death in Asia. Long non-coding RNAs (lncRNAs) are RNAs with a length greater than 200 nucleotides that do not encode proteins. lncRNAs can regulate gene expression and protein synthesis in several ways by interacting with DNA, RNA and proteins in a sequence specific manner. They could regulate cellular and developmental processes through either gene inhibition or gene activation. Many studies have shown that dysregulation of lncRNAs is related to many human diseases such as cardiovascular diseases, genetic disorders, neurological diseases, immune mediated disorders and cancers. However, the study of lncRNAs is challenging as they are poorly conserved between species, their expression levels aren't as high as that of mRNAs and have great interpatient variations. The study of lncRNAs expression in cancers have been a breakthrough as it unveils potential biomarkers and drug targets for cancer therapy and helps understand the mechanism of pathogenesis. This review discusses many long non-coding RNAs and their contribution in HCC, their role in development, metastasis, and prognosis of HCC and how to regulate and target these lncRNAs as a therapeutic tool in HCC treatment in the future.

Also flagged:p53cancerPUMAWNTNOTCHLGR5
Journal Article 2018-02-01 ✓ 1 Snippet Leibowitz BJ, Yang L, Wei L, Buchanan ME, Rachid M, Parise RA, Beumer JH, Eiseman JL, Schoen RE, Zhang L, Yu J.
In-Text Gene Mentions

Olfm4

Show Full Abstract

The gastrointestinal (GI) epithelium is the fastest renewing adult tissue and is maintained by tissue-specific stem cells. Treatment-induced GI side effects are a major dose-limiting factor for chemotherapy and abdominal radiotherapy and can decrease the quality of life in cancer patients and survivors. p53 is a key regulator of the DNA damage response, and its activation results in stimulus- and cell type-specific outcomes via distinct effectors. We demonstrate that p53-dependent PUMA induction mediates chemotherapy-induced intestinal injury in mice. Genetic ablation of <i>Puma</i>, but not of <i>p53</i>, protects against chemotherapy-induced lethal GI injury. Blocking chemotherapy-induced loss of LGR5<sup>+</sup> stem cells by <i>Puma</i> KO or a small-molecule PUMA inhibitor (PUMAi) prevents perturbation of the stem cell niche, rapid activation of WNT and NOTCH signaling, and stem cell exhaustion during repeated exposures. PUMAi also protects human and mouse colonic organoids against chemotherapy-induced apoptosis and damage but does not protect cancer cells in vitro or in vivo. Therefore, targeting PUMA is a promising strategy for normal intestinal chemoprotection because it selectively blocks p53-dependent stem cell loss but leaves p53-dependent protective effects intact.

Also flagged:methylationSLEtype I interferonsystemic lupus erythematosusPTPRCCD45
Journal Article 2018-02-01 No Snippets Imgenberg-Kreuz J, Carlsson Almlöf J, Leonard D, Alexsson A, Nordmark G, Eloranta ML, Rantapää-Dahlqvist S, Bengtsson AA, Jönsen A, Padyukov L, Gunnarsson I, Svenungsson E, Sjöwall C, Rönnblom L, Syvänen AC, Sandling JK.
Show Full Abstract

<h4>Objectives</h4>Systemic lupus erythematosus (SLE) is a chronic autoimmune condition with heterogeneous presentation and complex aetiology where DNA methylation changes are emerging as a contributing factor. In order to discover novel epigenetic associations and investigate their relationship to genetic risk for SLE, we analysed DNA methylation profiles in a large collection of patients with SLE and healthy individuals.<h4>Methods</h4>DNA extracted from blood from 548 patients with SLE and 587 healthy controls were analysed on the Illumina HumanMethylation 450 k BeadChip, which targets 485 000 CpG sites across the genome. Single nucleotide polymorphism (SNP) genotype data for 196 524 SNPs on the Illumina ImmunoChip from the same individuals were utilised for methylation quantitative trait loci (<i>cis</i>-meQTLs) analyses.<h4>Results</h4>We identified and replicated differentially methylated CpGs (DMCs) in SLE at 7245 CpG sites in the genome. The largest methylation differences were observed at type I interferon-regulated genes which exhibited decreased methylation in SLE. We mapped <i>cis</i>-meQTLs and identified genetic regulation of methylation levels at 466 of the DMCs in SLE. The meQTLs for DMCs in SLE were enriched for genetic association to SLE, and included seven SLE genome-wide association study (GWAS) loci: <i>PTPRC</i> (CD45), <i>MHC-class III</i>, <i>UHRF1BP1</i>, <i>IRF5</i>, <i>IRF7</i>, <i>IKZF3</i> and <i>UBE2L3</i>. In addition, we observed association between genotype and variance of methylation at 20 DMCs in SLE, including at the <i>HLA-DQB2</i> locus.<h4>Conclusions</h4>Our results suggest that several of the genetic risk variants for SLE may exert their influence on the phenotype through alteration of DNA methylation levels at regulatory regions of target genes.

Also flagged:Thymic epithelial tumorsthymomaautoimmune diseasestumorsHRASNRAS
Journal Article 2018-02-01 No Snippets Radovich M, Pickering CR, Felau I, Ha G, Zhang H, Jo H, Hoadley KA, Anur P, Zhang J, McLellan M, Bowlby R, Matthew T, Danilova L, Hegde AM, Kim J, Leiserson MDM, Sethi G, Lu C, Ryan M, Su X, Cherniack AD, Robertson G, Akbani R, Spellman P, Weinstein JN, Hayes DN, Raphael B, Lichtenberg T, Leraas K, Zenklusen JC, Cancer Genome Atlas Network, Fujimoto J, Scapulatempo-Neto C, Moreira AL, Hwang D, Huang J, Marino M, Korst R, Giaccone G, Gokmen-Polar Y, Badve S, Rajan A, Ströbel P, Girard N, Tsao MS, Marx A, Tsao AS, Loehrer PJ.
Show Full Abstract

Thymic epithelial tumors (TETs) are one of the rarest adult malignancies. Among TETs, thymoma is the most predominant, characterized by a unique association with autoimmune diseases, followed by thymic carcinoma, which is less common but more clinically aggressive. Using multi-platform omics analyses on 117 TETs, we define four subtypes of these tumors defined by genomic hallmarks and an association with survival and World Health Organization histological subtype. We further demonstrate a marked prevalence of a thymoma-specific mutated oncogene, GTF2I, and explore its biological effects on multi-platform analysis. We further observe enrichment of mutations in HRAS, NRAS, and TP53. Last, we identify a molecular link between thymoma and the autoimmune disease myasthenia gravis, characterized by tumoral overexpression of muscle autoantigens, and increased aneuploidy.

Also flagged:Pax6sucrosewashsodiumVIIIcell bodies
Journal Article 2018-02-01 ✓ 5 Snippets Yung AR, Druckenbrod NR, Cloutier JF, Wu Z, Tessier-Lavigne M, Goodrich LV.
In-Text Gene Mentions

DCC

Dcc

netrin receptor DCC

…or its receptorDCC, hindbrain neurons enter…

…al., 2017 ),DCC+/− ; Neo1…

Show Full Abstract

During brainstem development, newborn neurons originating from the rhombic lip embark on exceptionally long migrations to generate nuclei important for audition, movement, and respiration. Along the way, this highly motile population passes several cranial nerves yet remains confined to the CNS. We found that Ntn1 accumulates beneath the pial surface separating the CNS from the PNS, with gaps at nerve entry sites. In mice null for Ntn1 or its receptor DCC, hindbrain neurons enter cranial nerves and migrate into the periphery. CNS neurons also escape when Ntn1 is selectively lost from the sub-pial region (SPR), and conversely, expression of Ntn1 throughout the mutant hindbrain can prevent their departure. These findings identify a permissive role for Ntn1 in maintaining the CNS-PNS boundary. We propose that Ntn1 confines rhombic lip-derived neurons by providing a preferred substrate for tangentially migrating neurons in the SPR, preventing their entry into nerve roots.

Also flagged:cell deathMsl3Msl2DoxycyclinelocalizationCrystal Violet
Journal Article 2018-02-01 ✓ 4 Snippets Denaxa M, Neves G, Rabinowitz A, Kemlo S, Liodis P, Burrone J, Pachnis V.
In-Text Gene Mentions

Sox6

SOX6

…-dependent effector geneSox6in postmitotic immature…

…of CIs inSox6mutants remain unclear.…

Show Full Abstract

Cortical networks are composed of excitatory projection neurons and inhibitory interneurons. Finding the right balance between the two is important for controlling overall cortical excitation and network dynamics. However, it is unclear how the correct number of cortical interneurons (CIs) is established in the mammalian forebrain. CIs are generated in excess from basal forebrain progenitors, and their final numbers are adjusted via an intrinsically determined program of apoptosis that takes place during an early postnatal window. Here, we provide evidence that the extent of CI apoptosis during this critical period is plastic and cell-type specific and can be reduced in a cell-autonomous manner by acute increases in neuronal activity. We propose that the physiological state of the emerging neural network controls the activity levels of local CIs to modulate their numbers in a homeostatic manner.

Also flagged:VCPChromosomeMorphogenesisChromatinchromosomesmitosis
Journal Article 2018-02-01 ✓ 1 Snippet Thattikota Y, Tollis S, Palou R, Vinet J, Tyers M, D'Amours D.
In-Text Gene Mentions

…Morphogenesis by ReleasingCondensinfrom Self-Entrapment in…

Show Full Abstract

The morphological transformation of amorphous chromatin into distinct chromosomes is a hallmark of mitosis. To achieve this, chromatin must be compacted and remodeled by a ring-shaped enzyme complex known as condensin. However, the mechanistic basis underpinning condensin's role in chromosome remodeling has remained elusive. Here we show that condensin has a strong tendency to trap itself in its own reaction product during chromatin compaction and yet is capable of interacting with chromatin in a highly dynamic manner in vivo. To resolve this apparent paradox, we identified specific chromatin remodelers and AAA-class ATPases that act in a coordinated manner to release condensin from chromatin entrapment. The Cdc48 segregase is the central linchpin of this regulatory mechanism and promotes ubiquitin-dependent cycling of condensin on mitotic chromatin as well as effective chromosome condensation. Collectively, our results show that condensin inhibition by its own reaction product is relieved by forceful enzyme extraction from chromatin.

Also flagged:LocalizationMunc13-3photonsynapsescalcium channel
Journal Article 2018-02-01 No Snippets Kusch V, Bornschein G, Loreth D, Bank J, Jordan J, Baur D, Watanabe M, Kulik A, Heckmann M, Eilers J, Schmidt H.
Show Full Abstract

Spatial relationships between Ca<sub>v</sub> channels and release sensors at active zones (AZs) are a major determinant of synaptic fidelity. They are regulated developmentally, but the underlying molecular mechanisms are largely unclear. Here, we show that Munc13-3 regulates the density of Ca<sub>v</sub>2.1 and Ca<sub>v</sub>2.2 channels, alters the localization of Ca<sub>v</sub>2.1, and is required for the development of tight, nanodomain coupling at parallel-fiber AZs. We combined EGTA application and Ca<sup>2+</sup>-channel pharmacology in electrophysiological and two-photon Ca<sup>2+</sup> imaging experiments with quantitative freeze-fracture immunoelectron microscopy and mathematical modeling. We found that a normally occurring developmental shift from release being dominated by Ca<sup>2+</sup> influx through Ca<sub>v</sub>2.1 and Ca<sub>v</sub>2.2 channels with domain overlap and loose coupling (microdomains) to a nanodomain Ca<sub>v</sub>2.1 to sensor coupling is impaired in Munc13-3-deficient synapses. Thus, at AZs lacking Munc13-3, release remained triggered by Ca<sub>v</sub>2.1 and Ca<sub>v</sub>2.2 microdomains, suggesting a critical role of Munc13-3 in the formation of release sites with calcium channel nanodomains.

Also flagged:ironInvasive pulmonary diseasedeferoxaminehemochromatosissreAcccA
Journal Article 2018-02-01 ✓ 3 Snippets Hsu JL, Manouvakhova OV, Clemons KV, Inayathullah M, Tu AB, Sobel RA, Tian A, Nazik H, Pothineni VR, Pasupneti S, Jiang X, Dhillon GS, Bedi H, Rajadas J, Haas H, Aurelian L, Stevens DA, Nicolls MR.
In-Text Gene Mentions

…hemochromatosis gene (Hfe−/− ).…

Hfe

hemochromatosis

Show Full Abstract

Invasive pulmonary disease due to the mold <i>Aspergillus fumigatus</i> can be life-threatening in lung transplant recipients, but the risk factors remain poorly understood. To study this process, we used a tracheal allograft mouse model that recapitulates large airway changes observed in patients undergoing lung transplantation. We report that microhemorrhage-related iron content may be a major determinant of <i>A. fumigatus</i> invasion and, consequently, its virulence. Invasive growth was increased during progressive alloimmune-mediated graft rejection associated with high concentrations of ferric iron in the graft. The role of iron in <i>A. fumigatus</i> invasive growth was further confirmed by showing that this invasive phenotype was increased in tracheal transplants from donor mice lacking the hemochromatosis gene (<i>Hfe</i><sup><i>-/-</i></sup> ). The invasive phenotype was also increased in mouse syngrafts treated with topical iron solution and in allograft recipients receiving deferoxamine, a chelator that increases iron bioavailability to the mold. The invasive growth of the iron-intolerant <i>A. fumigatus</i> double-knockout mutant (Δ<i>sreA</i>/Δ<i>cccA</i>) was lower than that of the wild-type mold. Alloimmune-mediated microvascular damage and iron overload did not appear to impair the host's immune response. In human lung transplant recipients, positive staining for iron in lung transplant tissue was more commonly seen in endobronchial biopsy sections from transplanted airways than in biopsies from the patients' own airways. Collectively, these data identify iron as a major determinant of <i>A. fumigatus</i> invasive growth and a potential target to treat or prevent <i>A. fumigatus</i> infections in lung transplant patients.

Also flagged:gene expressionmetabolismobesitymineralgrowth hormoneGH
Journal Article 2018-02-01 ✓ 5 Snippets Hernandez Cordero AI, Carbonetto P, Riboni Verri G, Gregory JS, Vandenbergh DJ, P Gyekis J, Blizard DA, Lionikas A.
In-Text Gene Mentions

…TTTGTCTGTGTCCATACTTTCTTG), andSox6(forward: GGAATTTGGACCCCTCTGA;…

…were used (forSox6).…

…that expression ofSox6and 2310014F06Rik were…

…Arntl , andSox6emerged as promising…

Sox6also emerged as…

Show Full Abstract

The genetics underlying variation in health-related musculoskeletal phenotypes can be investigated in a mouse model. Quantitative trait loci (QTLs) affecting musculoskeletal traits in the LG/J and SM/J strain lineage remain to be refined and corroborated. The aim of this study was to map muscle and bone traits in males (n = 506) of the 50th filial generation of advanced intercross lines (LG/SM AIL) derived from the two strains. Genetic contribution to variation in all musculoskeletal traits was confirmed; the SNP heritability of muscle mass ranged between 0.46 and 0.56; and the SNP heritability of tibia length was 0.40. We used two analytical software, GEMMA and QTLRel, to map the underlying QTLs. GEMMA required substantially less computation and recovered all the QTLs identified by QTLRel. Seven significant QTLs were identified for muscle weight (Chr 1, 7, 11, 12, 13, 15, and 16), and two for tibia length, (Chr 1 and 13). Each QTL explained 4-5% of phenotypic variation. One muscle and both bone loci replicated previous findings; the remaining six were novel. Positional candidates for the replicated QTLs were prioritized based on in silico analyses and gene expression in muscle tissue. In summary, we replicated existing QTLs and identified novel QTLs affecting muscle weight, and replicated bone length QTLs in LG/SM AIL males. Heritability estimates substantially exceed the cumulative effect of the QTLs, hence a richer genetic architecture contributing to muscle and bone variability could be uncovered with a larger sample size.

Also flagged:CYP4A11CYP4F2biosynthesis20-hydroxyeicosatetraenoic acidpathogenesiscoronary artery disease
Journal Article 2018-02-01 No Snippets Sirotina S, Ponomarenko I, Kharchenko A, Bykanova M, Bocharova A, Vagaytseva K, Stepanov V, Churnosov M, Solodilova M, Polonikov A.
Show Full Abstract

Enzymes CYP4A11 and CYP4F2 are involved in biosynthesis of vasoactive 20-hydroxyeicosatetraenoic acid and may contribute to pathogenesis of coronary artery disease (CAD). We investigated whether polymorphisms of the <i>CYP4A11</i> and <i>CYP4F2</i> genes are associated with the risk of CAD in Russian population. DNA samples from 1323 unrelated subjects (637 angiographically confirmed CAD patients and 686 age- and sex-matched healthy individuals) were genotyped for polymorphisms rs3890011, rs9332978, and rs9333029 of <i>CYP4A11</i> and rs3093098 and rs1558139 of <i>CYP4F2</i> by using the Mass-ARRAY 4 system. SNPs rs3890011 and rs9332978 of <i>CYP4A11</i> were associated with increased risk of CAD in women: OR = 1.26, 95% CI: 1.02-1.57, <i>P</i> = 0.004, and <i>Q</i> = 0.01 and OR = 1.45, 95% CI: 1.13-1.87, <i>P</i> = 0.004, and <i>Q</i> = 0.01, respectively. Haplotype G-C-A of <i>CYP4A11</i> was associated with increased risk of CAD (adjusted OR = 1.41, 95% CI: 1.12-1.78, and <i>P</i> = 0.0036). Epistatic interactions were found between rs9332978 of <i>CYP4A11</i> and rs1558139 of <i>CYP4F2</i> (<i>P</i><sub>interaction</sub> = 0.025). In silico analysis allowed identifying that SNP rs9332978 is located at a binding site for multiple transcription factors; many of them are known to regulate the pathways involved in the pathogenesis of CAD. This is the first study in Europeans that reported association between polymorphism rs9332978 of <i>CYP4A11</i> and susceptibility to coronary artery disease.

Also flagged:metal transportersZrt- and Irt-likeZIPZIP14interleukin 6IL-6
Journal Article 2018-02-01 No Snippets Aydemir TB, Cousins RJ.
Show Full Abstract

The SLC39A family of metal transporters was identified through homologies with the Zrt- and Irt-like (ZIP) proteins from yeast and plants. Of all the ZIP transporters, ZIP14 is arguably the most robustly characterized in terms of function at the integrative level. Mice with a global knockout of Zip14 are viable, thus providing the opportunity to conduct physiologic experiments. In mice, Zip14 expression is highly tissue specific, with the greatest abundance in the jejunum > liver > heart > kidney > white adipose tissue > skeletal muscle > spleen > pancreas. A unique feature of Zip14 is its upregulation by proinflammatory conditions, particularly increased interleukin 6 (IL-6) and nitric oxide. The transcription factors AP-1, ATF4, and ATF6α are involved in Zip14 regulation. ZIP14 does not appear to be zinc-regulated. The Zip14 knockout phenotype shows multiple sites of ZIP14 function, including the liver, adipose tissue, brain, pancreas, and bone. A prominent feature of the Zip14 ablation is a reduction in intestinal barrier function and onset of metabolic endotoxemia. Many aspects of the phenotype are accentuated with age and accompany increased circulating IL-6. Studies with 65Zn, 59Fe [nontransferrin-bound iron (NTBI)] and 54Mn show that ZIP14 transports these metals. At a steady state, the plasma concentrations of zinc, NTBI, and manganese are such that zinc ions are the major substrate available for ZIP14 at the cell surface. Upregulation of ZIP14 accounts for the hypozincemia and hepatic zinc accumulation associated with acute inflammation and sepsis and is required for liver regeneration and resistance to endoplasmic reticulum (ER) stress. Zip14 ablation in mice produces a defect in manganese excretion that leads to excess manganese accumulation in the brain that produces characteristics of Parkinsonism.

Also flagged:hereditary ataxiaataxianucleotidehereditary ataxiasautosomal dominant ataxiaautosomal recessive ataxias
Journal Article 2018-02-01 No Snippets Wallace SE, Bird TD.
Show Full Abstract

<h4>Purpose of review</h4>Because of extensive clinical overlap among many forms of hereditary ataxia, molecular genetic testing is often required to establish a diagnosis. Interrogation of multiple genes has become a popular diagnostic approach as the cost of sequence analysis has decreased and the number of genes associated with overlapping phenotypes has increased. We describe the benefits and limitations of molecular genetic tests commonly used to determine the etiology of hereditary ataxia.<h4>Recent findings</h4>There are more than 300 hereditary disorders associated with ataxia. The most common causes of hereditary ataxia are expansion of nucleotide repeats within 7 genes: <i>ATXN1</i>, <i>ATXN2</i>, <i>ATXN3</i>, <i>ATXN7</i>, <i>ATXN8</i>, <i>CACNA1A</i> (spinocerebellar ataxia type 6), and <i>FXN</i> (Friedreich ataxia). Recent reports describing the use of clinical exome sequencing to identify causes of hereditary ataxia may lead neurologists to start their clinical investigation with a less sensitive molecular test providing a misleading "negative" result.<h4>Summary</h4>The majority of individuals with hereditary ataxias have nucleotide repeat expansions, pathogenic variants that are not detectable with clinical exome sequencing. Multigene panels that include specific assays to determine nucleotide repeat lengths should be considered first in individuals with hereditary ataxia.

Also flagged:bladder cancernon-muscle invasive bladder cancerNMIBCmuscle-invasive bladder cancercancerprimary tumor
Journal Article 2018-02-01 No Snippets Piao XM, Byun YJ, Kim WJ, Kim J.
Show Full Abstract

Precision medicine is designed to tailor treatments for individual patients by factoring in each person's specific biology and mechanism of disease. This paradigm shifted from a "one size fits all" approach to "personalized and precision care" requires multiple layers of molecular profiling of biomarkers for accurate diagnosis and prediction of treatment responses. Intensive studies are also being performed to understand the complex and dynamic molecular profiles of bladder cancer. These efforts involve looking bladder cancer mechanism at the multiple levels of the genome, epigenome, transcriptome, proteome, lipidome, metabolome etc. The aim of this short review is to outline the current technologies being used to investigate molecular profiles and discuss biomarker candidates that have been investigated as possible diagnostic and prognostic indicators of bladder cancer.

Also flagged:Glycogenic hepatopathyGHdiabetes mellitusglycogentype 1 diabetes mellitustype 2 diabetes mellitus
Journal Article 2018-02-01 ✓ 1 Snippet Sherigar JM, Castro J, Yin YM, Guss D, Mohanty SR.
In-Text Gene Mentions

…B, Hepatitis C,hemochromatosis, and Wilson’s disease…

Show Full Abstract

Glycogenic hepatopathy (GH) is a rare complication of the poorly controlled diabetes mellitus characterized by the transient liver dysfunction with elevated liver enzymes and associated hepatomegaly caused by the reversible accumulation of excess glycogen in the hepatocytes. It is predominantly seen in patients with longstanding type 1 diabetes mellitus and rarely reported in association with type 2 diabetes mellitus. Although it was first observed in the pediatric population, since then, it has been reported in adolescents and adults with or without ketoacidosis. The association of GH with hyperglycemia in diabetes has not been well established. One of the essential elements in the pathophysiology of development of GH is the wide fluctuation in both glucose and insulin levels. GH and non-alcoholic fatty liver disease (NAFLD) are clinically indistinguishable, and latter is more prevalent in diabetic patients and can progress to advanced liver disease and cirrhosis. Gradient dual-echo MRI can distinguish GH from NAFLD; however, GH can reliably be diagnosed only by liver biopsy. Adequate glycemic control can result in complete remission of clinical, laboratory and histological abnormalities. There has been a recent report of varying degree of liver fibrosis identified in patients with GH. Future studies are required to understand the biochemical defects underlying GH, noninvasive, rapid diagnostic tests for GH, and to assess the consequence of the fibrosis identified as severe fibrosis may progress to cirrhosis. Awareness of this entity in the medical community including specialists is low. Here we briefly reviewed the English literature on pathogenesis involved, recent progress in the evaluation, differential diagnosis, and management.

Also flagged:cell growth-relatedBaxBcl-2luciferaseapoptosis-related proteins
Journal Article 2018-02-01 ✓ 3 Snippets Han Y, Fan TB, Peng BT, Li B, Cheng JT, Xu HD, Gao CY, Cheng ZY.
In-Text Gene Mentions

…expression level ofSox6in P19CL6 cells.…

…reporter showed thatSox6is the direct…

…differentiation by targetingSox6expression.…

Show Full Abstract

<b>Objective:</b> To explore the effect of miR-19b on the function of P19CL6 cells and its molecular mechanism. <b>Methods:</b> Overexpression of miR-19b was carried out by transfecting miR-19b plasmid into the P19CL6 cells. MTT assay and flow cytometry were used to determine cell growth and apoptosis, respectively. Western blot was used to detect the expression level of Sox6 in P19CL6 cells. ELISA assay was used to detect the expression levels of apoptosis-related genes (Bax, Bcl-2) in P19CL6 cells at late-stage cardiac differentiation. Further online software TargetScan was used to predict the target genes of miR-19b and verified by dual luciferase reporter assay. <b>Results:</b> Our data showed that overexpression of miR-19b in P19CL6 cells significantly increased the cell growth rates and the apoptosis inhibition rates. The ratio of apoptosis-related proteins (Bax/Bcl-2) was significantly reduced. Results from the TargetScan and dual luciferase reporter showed that Sox6 is the direct target of miR-19b. <b>Conclusions:</b> We conclude that miR-19b might promote cell proliferation and inhibits cell apoptosis during the late-stage of cardiac differentiation by targeting Sox6 expression.

Also flagged:pathogenesistranscription regulatorschromatinsmall cell lung cancerSCLCtumor
Journal Article 2018-02-01 No Snippets Kim DW, Kim KC, Kim KB, Dunn CT, Park KS.
Show Full Abstract

The discovery of recurrent alterations in genes encoding transcription regulators and chromatin modifiers is one of the most important recent developments in the study of the small cell lung cancer (SCLC) genome. With advances in models and analytical methods, the field of SCLC biology has seen remarkable progress in understanding the deregulated transcription networks linked to the tumor development and malignant progression. This review will discuss recent discoveries on the roles of RB and P53 family of tumor suppressors and MYC family of oncogenes in tumor initiation and development. It will also describe the roles of lineage-specific factors in neuroendocrine (NE) cell differentiation and homeostasis and the roles of epigenetic alterations driven by changes in NFIB and chromatin modifiers in malignant progression and chemoresistance. These recent findings have led to a model of transcriptional network in which multiple pathways converge on regulatory regions of crucial genes linked to tumor development. Validation of this model and characterization of target genes will provide critical insights into the biology of SCLC and novel strategies for tumor intervention.

Also flagged:NF-κBmalignant melanomacancerc-Jun N-terminal kinaseJNKnuclear factor-κB
Journal Article 2018-02-01 ✓ 5 Snippets Xiong J, Wang Y, Gu Y, Xue Y, Dang L, Li Y.
In-Text Gene Mentions

However, as a limitation, CDK5RAP1 does not exist only in cancer cells, but also in all normal cells.

It has been reported that, CDK5RAP1 deficiency, induces cancer cell apoptosis via the phospho-c-Jun N-terminal kinase (p-JNK) signaling pathway (8).

Since targeting mitochondrial modifications is a new field for the treatment of cancer, and apoptosis is linked with NF-κB signaling pathway (16), the aim of the present study was to investigate the relationship between CDK5RAP1 deficiency and NF-κB signaling pathway during the apoptosis process in human malignant melanoma (A375) cells.

As CDK5RAP1 deficiency-induced deficiency in ms2 modification is closely associated with cancer cell apoptosis, CDK5RAP1 deficiency may have a beneficial effect on inhibiting cancer process.

Cdk5 regulatory subunit-associated protein 1 (CDK5RAP1), which catalyzes 2-methylthio (ms2) modification of mitochondrial transfer RNAs, has been reported to induce cancer cell apoptosis, by a phospho-c-Jun N-terminal kinase (p-JNK) signaling pathway.

Show Full Abstract

Malignant melanoma is characterized by rapid deterioration, early metastasis and high mortality. Cdk5 regulatory subunit-associated protein 1 (CDK5RAP1), which catalyzes 2-methylthio (ms<sup>2</sup>) modification of mitochondrial transfer RNAs, has been reported to induce cancer cell apoptosis, by a phospho-c-Jun N-terminal kinase (p-JNK) signaling pathway. The present study was the first to report on the association between CDK5RAP1 deficiency and nuclear factor-κB (NF-κB) signaling pathway during the apoptosis process in human malignant melanoma (A375) cells. CDK5RAP1 small interfering RNA (siRNA) and control siRNA were transfected into A375 cells. CDK5RAP1 deficiency inhibited Ca<sup>2+</sup> influx in A375 cells. CDK5RAP1 deficiency also suppressed the proliferation of A375 cells, induced A375 cells apoptosis, and increased the generation of reactive oxygen species (ROS). In addition, CDK5RAP1 deficiency induced the phosphorylation of NF-κB and Bcl-2/Bcl-xl-associated death promoter (Bad). Notably, the phosphorylation of B-cell lymphoma-xl (Bcl-xl) and B-cell lymphoma-2 (Bcl-2) was downregulated by CDK5RAP1 deficiency. Pretreatment with pyrrolidine dithiocarbamate (PDTC), the inhibitor of NF-κB, prevented the decrease in cell proliferation and apoptosis induced by CDK5RAP1 deficiency in A375 cells. However, pretreatment with PDTC did not affect the generation of ROS in A375 cells, indicating that ROS is an upstream target of NF-κB signaling pathway during the apoptosis process. Taken together, CDK5RAP1 deficiency induces cell apoptosis in malignant melanoma A375 cells via the NF-κB signaling pathway. The results from the present study indicated a potential novel candidate for the treatment of skin cancer.

Also flagged:Alcoholic Liver DamagePrimary HepatomaLiver CirrhosisCholelithiasisliver diseaseliver disorders
Journal Article 2018-02-01 ✓ 1 Snippet Singh A, Pandey B.
In-Text Gene Mentions

…olelithiasis, liver cirrhosis,hemochromatosis, primary sclerosing cholangit…

Show Full Abstract

Diagnosis of liver disease principally depends on physician's subjective knowledge. Automatic prediction of the disease is a critical real-world medical problem. This work presents an EHC-ERF-based intelligence-integrated model purposive to predict different types of liver disease including alcoholic liver damage, primary hepatoma, liver cirrhosis, and cholelithiasis. These diseases cause many clinical complications, and their accurate assessment is the only way for providing efficient treatment facilities to patients. EHC is deployed to divide the data into a hierarchy structure that is more informative for the disease predictions carried out by ERF. The occurrence of ERF error rate was dependent on correlation and strength of each individual tree where correlation is directly proportional to forest error rate and strength is inversely proportional to the forest rate. In total, two individual and three integrated classification models are developed to achieve enhanced predictions for the liver disease types. Analysis of results showed that the proposed framework achieved better outcomes in terms of accuracy, true positive rate, precision, <i>F</i>-measure, kappa statistic, mean absolute error, and root mean squared error. Furthermore, it achieved the highest accuracy rates when compared with the state-of-the-art techniques. Results also indicated that the weighted distance function employed in EHC has improved the efficiency of proposed system and has shown the capability to be used by physicians for diagnostic advice.

Also flagged:CAMK2Atriple negative breast cancerBreast cancerdeathmetastatic breast cancertriple-negative breast cancer
Journal Article 2018-02-01 No Snippets Shao B, Tian Z, Ding H, Wang Q, Song G, Di L, Zhang H, Li H, Shen J.
Show Full Abstract

<h4>Background</h4>Chemotherapy resistance is a great obstacle in effective treatment for metastatic triple negative breast cancer (TNBC). The ability to predict chemotherapy response would allow chemotherapy administration to be directed toward only those patients who would benefit, thus maximizing treatment efficiency. Differentially expressed plasma proteins may serve as putative biomarkers for predicting chemotherapy outcomes.<h4>Patients and methods</h4>In this study, 26 plasma samples (10 samples with partial response (S) and 16 samples with progression disease (R)) from patients with metastatic TNBC were measured by Tandem Mass Tag (TMT)-based proteomics analysis to identify differentially expressed proteins between the S and R group. Potential proteinswere validated with enzyme-linked immunosorbent assay (ELISA) in another 67 plasma samples.<h4>Results</h4>A total of 320 plasma proteins were identified, and statistical analysis showed that 108 proteins were significantly dysregulated between R and S groups in the screening stage. Bioinformatics revealed relevant pathways and regulatory networks of the differentially expressed proteins. Three differentially expressed proteins were validated by ELISA with 67 samples from TNBC patients. The R group had significantly higher plasma CAMK2A level than the S group (<i>P</i>=0.0074). The ROC curve analysis showed an AUC of 0.708, with sensitivity 48.4% and specificity 86.1%. In multivariate logistic regression analysis, the level of plasma CAMK2A was also significant for chemotherapeutic response (<i>P</i>=0.009, OR=0.152). Furthermore, the patients with higher CAMK2A level had shorter OS than those with lower CAMK2A level, which amounted to 13.9 and 28.9 months, respectively (<i>P</i>=0.034). In the multivariate Cox regression analysis, CAMK2A level still had significant effect on OS (<i>P</i>=0.031, HR=1.865).<h4>Conclusion</h4>TMT-based proteomic analysis was able to identify potential biomarkers in plasma that predicted chemotherapy resistance in the metastatic TNBC. The plasma of CAMK2A level may serve as apotential predictive and prognostic biomarker for chemotherapy in metastatic TNBC.

Also flagged:synthesisArylnaphthalene lactonesarylnaphthalene lactonelignans1-arylnaphthalene lactone lignansphosphodiesterase
Journal Article 2018-02-01 No Snippets Zhao C, Rakesh KP, Mumtaz S, Moku B, Asiri AM, Marwani HM, Manukumar HM, Qin HL.
Show Full Abstract

Arylnaphthalene lactones are natural products extracted from a wide range of different parts of plants. The progressing interest in the synthesis of these compounds is due to their significant biological activities, which have made them potential candidates in drug discovery and development. This review mainly covers recent developments in the synthesis and biological applications of arylnaphthalene lactone analogs.

FREE PAPERS

Also flagged:lack of interestpsychiatric disordersSchizophreniaDepressionClozapinemental disorders
Journal Article 2018-02-01 ✓ 2 Snippets Unknown Authors
In-Text Gene Mentions

…etch of huntingtin (HTT).This stretch is en…

…tition in exon 1 of HTT.An expansion of > 3…

Show Full Abstract

No abstract available.

Also flagged:ironobesityalcoholoverloadHJVHAMP
Journal Article 2018-02-01 ✓ 3 Snippets Adams P, Levstik A, Sadikovic B.
In-Text Gene Mentions

…mutation of theHFEgene.…

…Genes analyzed includedHFE, HJV, HAMP,TfR2,FTL,CP,SLC40A…

…rapidly test forHFEand many other…

Show Full Abstract

Abstract <h4>Background</h4> Hyperferritinemia is common and often suggests the diagnosis of iron overload. However, many times it is elevated secondary to inflammation, obesity, alcohol use, or unknown causes. Most Caucasian patients with iron overload are homozygotes for the C282Y mutation of the HFE gene. There are a growing number of iron related genes that may contribute to an elevated ferritin and iron overload. <h4>Aims</h4> To design a next generation sequencing platform to assess for genetic mutations in 15 iron genes as a diagnostic tool in the investigation of hyperferritinema. <h4>Methods</h4> Libraries were sequenced using the MiSeq v2 reagent kit to generate 2 x 150 bp paired-end reads using the MiSeq fastq generation mode (Illumina, San Diego, CA), with 24 different patient samples multiplexed per run. Sequence analysis for variant identification, alignment and coverage distribution was performed with NextGene software v2.4.1 (SoftGenetics, LLC, State College, PA) using standard alignment settings (allowable mismatch bases: 1; allowable ambiguous alignments: 50; seeds bases: 30; move step bases: 5; allowable alignments: 100; matching base percentage > 85%). BAM and VCF files were imported into Geneticist Assistant v1.1.5 (SoftGenetics, LLC; State College, PA) for quality control assessment (minimum base coverage; mean exon coverage). The methodology also will assess copy number variation and does not require MLPA confirmation. Genes analyzed included HFE, HJV, HAMP,TfR2,FTL,CP,SLC40A1. Patients were selected from the referral practice at a tertiary care hospital with elevations in serum ferritin > 1000 ug/L who were not typical C282Y homozygotes. <h4>Results</h4> There were 120 patients selected for analysis. There were 6 patients homozygous for HJV mutations (G320V in 2 unrelated, and Leu366Ter in 4 related). There were 3 FTL mutations detected in patients with cataracts and heterozygous mutations found in HAMP, CP, TfR2, and TF genes. <h4>Conclusions</h4> Next generation sequencing provides a platform to rapidly test for HFE and many other mutations in selected cases. Funding has been requested to provide this analysis for selected Ontario cases similar to funded genetic panels for other rare genetic diseases. <h4>Funding Agencies</h4> None