Gene Literature Dashboard

Viewing November 2018 — 449 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← October 2018 December 2018 →
Also flagged:extracellulartransdifferentiationBMPtranslational
Journal Article 2018-11-30 No Snippets Bahney CS, Zondervan RL, Allison P, Theologis A, Ashley JW, Ahn J, Miclau T, Marcucio RS, Hankenson KD.
Show Full Abstract

The biology of bone healing is a rapidly developing science. Advances in transgenic and gene-targeted mice have enabled tissue and cell-specific investigations of skeletal regeneration. As an example, only recently has it been recognized that chondrocytes convert to osteoblasts during healing bone, and only several years prior, seminal publications reported definitively that the primary tissues contributing bone forming cells during regeneration were the periosteum and endosteum. While genetically modified animals offer incredible insights into the temporal and spatial importance of various gene products, the complexity and rapidity of healing-coupled with the heterogeneity of animal models-renders studies of regenerative biology challenging. Herein, cells that play a key role in bone healing will be reviewed and extracellular mediators regulating their behavior discussed. We will focus on recent studies that explore novel roles of inflammation in bone healing, and the origins and fates of various cells in the fracture environment. © 2018 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res.

Also flagged:glioblastomatumorstumorcancergliomaCAV1
Journal Article 2018-11-30 ✓ 4 Snippets Fiscon G, Conte F, Paci P.
In-Text Gene Mentions

The inhibition of switch genes highly correlates with the activation of genes related to neural development and differentiation, such as the 4-core OLIG2, POU3F2, SALL2, SOX2, whose induction has been shown to be sufficient to reprogram differentiated glioblastoma into stem-like cells.

We found that switch genes inhibition strongly correlated with the activation in GSf lines and tumors of genes significantly enriched in processes related to the development and differentiation of the glia and neuronal cells, such as the four core of OLIG2, POU3F2, SALL2, and SOX2 (Fig. 6, d-e).

…the 4-core OLIG2,POU3F2, SALL2, SOX2, whose…

…core of OLIG2,POU3F2, SALL2, and SOX2…

Show Full Abstract

<h4>Background</h4>It is well-known that glioblastoma contains self-renewing, stem-like subpopulation with the ability to sustain tumor growth. These cells - called cancer stem-like cells - share certain phenotypic characteristics with untransformed stem cells and are resistant to many conventional cancer therapies, which might explain the limitations in curing human malignancies. Thus, the identification of genes controlling the differentiation of these stem-like cells is becoming a successful therapeutic strategy, owing to the promise of novel targets for treating malignancies.<h4>Methods</h4>Recently, we developed SWIM, a software able to unveil a small pool of genes - called switch genes - critically associated with drastic changes in cell phenotype. Here, we applied SWIM to the expression profiling of glioblastoma stem-like cells and conventional glioma cell lines, in order to identify switch genes related to stem-like phenotype.<h4>Results</h4>SWIM identifies 171 switch genes that are all down-regulated in glioblastoma stem-like cells. This list encompasses genes like CAV1, COL5A1, COL6A3, FLNB, HMMR, ITGA3, ITGA5, MET, SDC1, THBS1, and VEGFC, involved in "ECM-receptor interaction" and "focal adhesion" pathways. The inhibition of switch genes highly correlates with the activation of genes related to neural development and differentiation, such as the 4-core OLIG2, POU3F2, SALL2, SOX2, whose induction has been shown to be sufficient to reprogram differentiated glioblastoma into stem-like cells. Among switch genes, the transcription factor FOSL1 appears as the brightest star since: it is down-regulated in stem-like cells; it highly negatively correlates with the 4-core genes that are all up-regulated in stem-like cells; the promoter regions of the 4-core genes harbor a consensus binding motif for FOSL1.<h4>Conclusions</h4>We suggest that the inhibition of switch genes in stem-like cells could induce the deregulation of cell communication pathways, contributing to neoplastic progression and tumor invasiveness. Conversely, their activation could restore the physiological equilibrium between cell adhesion and migration, hampering the progression of cancer. Moreover, we posit FOSL1 as promising candidate to orchestrate the differentiation of cancer stem-like cells by repressing the 4-core genes' expression, which severely halts cancer growth and might affect the therapeutic outcome. We suggest FOSL1 as novel putative therapeutic and prognostic biomarker, worthy of further investigation.

Also flagged:JMJD5CRY1circadian oscillatorproteolysisCRYPTOCHROME 1FBXL3
Journal Article 2018-11-30 ✓ 4 Snippets Saran AR, Kalinowska D, Oh S, Janknecht R, DiTacchio L.
In-Text Gene Mentions

…(CRY1) in anF-box/leucine-rich repeat protein 3repeat protein 3…

…non-clock roles ofF-box/leucine-rich repeat protein 3repeat protein 3…

…CRYPTOCHROME 1; FBXL3,F-box/leucine-rich repeat protein 3repeat protein 3;…

…CRY, CRYPTOCHROME; FBXL3,F-box/leucine-rich repeat protein 3repeat protein 3;…

Show Full Abstract

The circadian oscillator is a molecular feedback circuit whose orchestration involves posttranslational control of the activity and protein levels of its components. Although controlled proteolysis of circadian proteins is critical for oscillator function, our understanding of the underlying mechanisms remains incomplete. Here, we report that JmjC domain-containing protein 5 (JMJD5) interacts with CRYPTOCHROME 1 (CRY1) in an F-box/leucine-rich repeat protein 3 (FBXL3)-dependent manner and facilitates targeting of CRY1 to the proteasome. Genetic deletion of JMJD5 results in greater CRY1 stability, reduced CRY1 association with the proteasome, and disruption of circadian gene expression. We also report that in the absence of JMJD5, AMP-regulated protein kinase (AMPK)-induced CRY1 degradation is impaired, establishing JMJD5 as a key player in this mechanism. JMJD5 cooperates with CRY1 to repress circadian locomotor output cycles protein kaput (CLOCK)-brain and muscle ARNT-like protein 1 (BMAL1), thus linking CRY1 destabilization to repressive function. Finally, we find that ablation of JMJD5 impacts FBXL3- and CRY1-related functions beyond the oscillator.

Also flagged:myelinlipidsulfatidephosphatidylcholineShimyelin diseases
Journal Article 2018-11-30 ✓ 1 Snippet Maganti RJ, Hronowski XL, Dunstan RW, Wipke BT, Zhang X, Jandreski L, Hamann S, Juhasz P.
In-Text Gene Mentions

…weeks old, maleC57BL/six micemice (obtained from…

Show Full Abstract

Myelin is composed primarily of lipids and diseases affecting myelin are associated with alterations in its lipid composition. However, correlation of the spatial (in situ) distribution of lipids with the disease-associated compositional and morphological changes is not well defined. Herein we applied high resolution matrix-assisted laser desorption ionization imaging mass spectrometry (MALDI-IMS), immunohistochemistry (IHC), and liquid chromatography-electrospray ionization-mass spectrometry (LC-ESI-MS) to evaluate brain lipid alterations in the dysmyelinating shiverer (Shi) mouse and cuprizone (Cz) mouse model of reversible demyelination. MALDI-IMS revealed a decrease in the spatial distribution of sulfatide (SHexCer) species, SHexCer (d42:2), and a phosphatidylcholine (PC) species, PC (36:1), in white matter regions like corpus callosum (CC) both in the Shi mouse and Cz mouse model. Changes in these lipid species were restored albeit not entirely upon spontaneous remyelination after demyelination in the Cz mouse model. Lipid distribution changes correlated with the local morphological changes as confirmed by IHC. LC-ESI-MS analyses of CC extracts confirmed the MALDI-IMS derived reductions in SHexCer and PC species. These findings highlight the role of SHexCer and PC in preserving the normal myelin architecture and our experimental approaches provide a morphological basis to define lipid abnormalities relevant to myelin diseases.

Also flagged:phosphatidylinositol transfer proteinphosphoinositidePhosphoinositidesmembranemembrane receptorcell proliferation
Journal Article 2018-11-30 No Snippets Grabon A, Bankaitis VA, McDermott MI.
Show Full Abstract

Phosphoinositides are key regulators of a large number of diverse cellular processes that include membrane trafficking, plasma membrane receptor signaling, cell proliferation, and transcription. How a small number of chemically distinct phosphoinositide signals are functionally amplified to exert specific control over such a diverse set of biological outcomes remains incompletely understood. To this end, a novel mechanism is now taking shape, and it involves phosphatidylinositol (PtdIns) transfer proteins (PITPs). The concept that PITPs exert instructive regulation of PtdIns 4-OH kinase activities and thereby channel phosphoinositide production to specific biological outcomes, identifies PITPs as central factors in the diversification of phosphoinositide signaling. There are two evolutionarily distinct families of PITPs: the Sec14-like and the StAR-related lipid transfer domain (START)-like families. Of these two families, the START-like PITPs are the least understood. Herein, we review recent insights into the biochemical, cellular, and physiological function of both PITP families with greater emphasis on the START-like PITPs, and we discuss the underlying mechanisms through which these proteins regulate phosphoinositide signaling and how these actions translate to human health and disease.

Also flagged:Gallstonesgallstone diseasegallstonesodium-dependent bile acid transporterASBTbile acid
Journal Article 2018-11-30 No Snippets Ferkingstad E, Oddsson A, Gretarsdottir S, Benonisdottir S, Thorleifsson G, Deaton AM, Jonsson S, Stefansson OA, Norddahl GL, Zink F, Arnadottir GA, Gunnarsson B, Halldorsson GH, Helgadottir A, Jensson BO, Kristjansson RP, Sveinbjornsson G, Sverrisson DA, Masson G, Olafsson I, Eyjolfsson GI, Sigurdardottir O, Holm H, Jonsdottir I, Olafsson S, Steingrimsdottir T, Rafnar T, Bjornsson ES, Thorsteinsdottir U, Gudbjartsson DF, Sulem P, Stefansson K.
Show Full Abstract

Gallstones are responsible for one of the most common diseases in the Western world and are commonly treated with cholecystectomy. We perform a meta-analysis of two genome-wide association studies of gallstone disease in Iceland and the UK, totaling 27,174 cases and 736,838 controls, uncovering 21 novel gallstone-associated variants at 20 loci. Two distinct low frequency missense variants in SLC10A2, encoding the apical sodium-dependent bile acid transporter (ASBT), associate with an increased risk of gallstone disease (Pro290Ser: OR = 1.36 [1.25-1.49], P = 2.1 × 10<sup>-12</sup>, MAF = 1%; Val98Ile: OR = 1.15 [1.10-1.20], P = 1.8 × 10<sup>-10</sup>, MAF = 4%). We demonstrate that lower bile acid transport by ASBT is accompanied by greater risk of gallstone disease and highlight the role of the intestinal compartment of the enterohepatic circulation of bile acids in gallstone disease susceptibility. Additionally, two low frequency missense variants in SERPINA1 and HNF4A and 17 common variants represent novel associations with gallstone disease.

Also flagged:polysaccharideshypertriglyceridemiaSODGSH-PxCATmultiple organ failure
Journal Article 2018-11-30 ✓ 2 Snippets Gao Z, Lai Q, Yang Q, Xu N, Liu W, Zhao F, Liu X, Zhang C, Zhang J, Jia L.
In-Text Gene Mentions

…and spleen inHFE-induced hypertriglyceridemic …

…were observed inHFE-induced HTG mice when…

Show Full Abstract

The antioxidant and multiple organ protection effects of acid- extracted mycelia polysaccharides (Ac-MPS) from Pleurotus eryngii var. tuoliensis on HFE-induced hypertriglyceridemic mice were investigated. The results showed that Ac-MPS have potential ability to relieve the hypertriglyceridemia and preventing oxidative stress by decreasing levels of TG, TC LDL-C, elevating contents of HDL-C in serum, increasing the activities of SOD, GSH-Px, CAT and T-AOC, and the down regulating MDA and LPO contents in liver, heart, kidney and spleen. And the histopathological observations also displayed that Ac-MPS could alleviate organ damage. Moreover, the GC, HPGPC, FT-IR and AFM analyses revealed the Ac-MPS possessed the typical polysaccharides structure with the molecular weights (Mw) of 2.712 × 10<sup>5</sup> Da. These conclusions indicated that the Ac-MPS had the potential to develop new drugs for hypertriglyceridemia-induced multiple organ failure.

Also flagged:nicotinechromosomepolymeraseSirtuin 1SIRT1caspase 3
Journal Article 2018-11-30 ✓ 1 Snippet Pittenger ST, Schaal VL, Moore D, Guda RS, Koul S, Yelamanchili SV, Bevins RA, Pendyala G.
In-Text Gene Mentions

In Huntington’s disease, SIRT1 overexpression ameliorates the neurotoxic effect of the mutant protein HTT while overexpression reverses this effect59.

Show Full Abstract

Previous research has established sex differences associated with nicotine intake, however a significant gap in knowledge remains regarding the molecular mechanisms that govern these differences at the transcriptional level. One critical regulator of transcription are microRNAs (miRNAs). miRNAs are a family of non-coding RNAs that regulate an array of important biological functions altered in several disease states, including neuroadaptive changes within the brain associated with drug dependence. We examined the prefrontal cortex (PFC) from male and female Sprague-Dawley rats following self-administration (22 days) of nicotine or yoked saline controls using next generation RNA-Sequencing (RNA-Seq) technology and found an array of miRNAs to be significantly and differentially regulated by nicotine self-administration. Of these, we found the expression of miR-199a and 214, which are expressed on the same cluster of chromosome 1, to be upregulated in the female rats exposed to nicotine; upregulation in this group was further validated by real time polymerase chain reaction (RT-PCR). Bioinformatics analysis to assess common targets of miR-199/214 identified Sirtuin 1 (SIRT1), a nicotinamide adenine dinucleotide (NAD)- dependent deacetylase that plays a role in apoptosis, neuron survival, and stress resistance. Using western-blot, we confirmed downregulation of SIRT1 and increased cleaved caspase 3 expression in the brains of nicotine-exposed female rats and no change in expression levels in the other groups. Collectively, our findings highlight a miR-199/214 regulatory network that, through SIRT1, may be associated with nicotine seeking in females which may serve as a potential therapeutic target for sex-specific treatment approaches.

Also flagged:Palmitoylationpost-translational modificationsgene expressionlipidationpalmitic acidcysteine
Journal Article 2018-11-30 ✓ 4 Snippets Spinelli M, Fusco S, Grassi C.
In-Text Gene Mentions

It has also been demonstrated that HTT may act as a modulator of DHHC17 activity, because the activity of palmitoyl-transferase appears to be compromised upon HD mutation [121].

HTT protein is palmitoylated at cysteine 214 (C214) by DHHC17 (also named HIP14) and DHHC13.

However, upon HD mutation, the interaction between HTT and its PATs is impaired, resulting in a strong reduction of HTT palmitoylation [119,120].

HD is an autosomal dominant disease caused by a mutation in the Huntingtin gene due to an expansion of the CAG trinucleotide repeat to more than 35 repeats, leading to an abnormal huntingtin protein (HTT) with an expanded polyglutamine in its N-terminal domain, and toxic gain of function.

Show Full Abstract

Diet is the main environmental stimulus chronically impinging on the organism throughout the entire life. Nutrients impact cells via a plethora of mechanisms including the regulation of both protein post-translational modifications and gene expression. Palmitoylation is the most-studied protein lipidation, which consists of the attachment of a molecule of palmitic acid to residues of proteins. <i>S</i>-palmitoylation is a reversible cysteine modification finely regulated by palmitoyl-transferases and acyl-thioesterases that is involved in the regulation of protein trafficking and activity. Recently, several studies have demonstrated that diet-dependent molecules such as insulin and fatty acids may affect protein palmitoylation. Here, we examine the role of protein palmitoylation on the regulation of gene expression focusing on the impact of this modification on the activity of chromatin remodeler enzymes, transcription factors, and nuclear proteins. We also discuss how this physiological phenomenon may represent a pivotal mechanism underlying the impact of diet and nutrient-dependent signals on human diseases.

Also flagged:innervationSjögren Syndromeepithelial cell proliferationautophagyaxonIL-2 receptor alpha
Journal Article 2018-11-30 ✓ 3 Snippets Stepp MA, Pal-Ghosh S, Tadvalkar G, Williams AR, Pflugfelder SC, de Paiva CS.
In-Text Gene Mentions

…CXCL-1, BDNF, NTN1,DCC, Unc5b1, Efna4, Efna5,…

…NTN1 (Qiagen #QT00128478),DCC(Qiagen #QT00135100), Unc5b…

…and its receptorsDCC, Unc5b, and Efna5.…

Show Full Abstract

Decreased corneal innervation is frequent in patients with Sjögren Syndrome (SS). To investigate the density and morphology of the intraepithelial corneal nerves (ICNs), corneal sensitivity, epithelial cell proliferation, and changes in mRNA expression of genes that are involved in autophagy and axon targeting and extension were assessed using the IL-2 receptor alpha chain (CD25 null) model of SS. ICN density and thickness in male and female wt and CD25 null corneas were assessed at 4, 6, 8, and 10/11 wk of age. Cell proliferation was assessed using ki67. Mechanical corneal sensitivity was measured. Quantitative PCR was performed to quantify expression of beclin 1, LC3, Lamp-1, Lamp-2, CXCL-1, BDNF, NTN1, DCC, Unc5b1, Efna4, Efna5, Rgma, and p21 in corneal epithelial mRNA. A significant reduction in corneal axon density and mechanical sensitivity were observed, which negatively correlate with epithelial cell proliferation. CD25 null mice have increased expression of genes regulating autophagy (beclin-1, LC3, LAMP-1, LAMP-2, CXCL1, and BDNF) and no change was observed in genes that were related to axonal targeting and extension. Decreased anatomic corneal innervation in the CD25 null SS model is accompanied by reduced corneal sensitivity, increased corneal epithelial cell proliferation, and increased expression of genes regulating phagocytosis and autophagy.

Also flagged:NADPH Oxidasesnicotinamide adenine dinucleotide phosphate (NADPH) oxidasesNOXNOX1NOX2NOX3
Journal Article 2018-11-30 ✓ 1 Snippet Tarafdar A, Pula G.
In-Text Gene Mentions

The disruption in the translation of huntingtin protein due to mutations in the HTT gene causes HD.

Show Full Abstract

For a number of years, nicotinamide adenine dinucleotide phosphate (NADPH) oxidases (NOX) was synonymous with NOX2/gp91<sup>phox</sup> and was considered to be a peculiarity of professional phagocytic cells. Over the last decade, several more homologs have been identified and based on current research, the NOX family consists of NOX1, NOX2, NOX3, NOX4, NOX5, DUOX1 and DUOX2 enzymes. NOXs are electron transporting membrane proteins that are responsible for reactive oxygen species (ROS) generation-primarily superoxide anion (O₂<sup>●-</sup>), although hydrogen peroxide (H₂O₂) can also be generated. Elevated ROS leads to oxidative stress (OS), which has been associated with a myriad of inflammatory and degenerative pathologies. Interestingly, OS is also the commonality in the pathophysiology of neurodegenerative disorders, such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS) and multiple sclerosis (MS). NOX enzymes are expressed in neurons, glial cells and cerebrovascular endothelial cells. NOX-mediated OS is identified as one of the main causes of cerebrovascular damage in neurodegenerative diseases. In this review, we will discuss recent developments in our understanding of the mechanisms linking NOX activity, OS and neurodegenerative diseases, with particular focus on the neurovascular component of these conditions. We conclude highlighting current challenges and future opportunities to combat age-related neurodegenerative disorders by targeting NOXs.

Also flagged:Breast CancerGene ExpressionUBIAD1HEBP1BTNL8TSPO
Journal Article 2018-11-30 ✓ 2 Snippets Park SB, Chung CK, Gonzalez E, Yoo C.
In-Text Gene Mentions

Using cell line or animal model of BMBC, IL-6, TGF-β, and TFF genes were over-expressed.[30, 40, 41, 42, 43] The recent article presented that 15 genes (APOPEC3B, ATL2, BBS1, C6orf61, C6orf167, MMS22L, KCNS1, MFAP3L, NIP7, NUP155, PALM2, PH-4, PGD5, SFT2D2, and STEAP3) were associated with the development of BMBC among patients.[43] Among 3 niches associated with BM, we considered the endosteal niche related with osteoblast as the critical key.[18] Therefore, we evaluated the causal network with the genes present in both BMBC and osteoblast, but excluded all of the genes present in the primary BC data set.

…BBS1, C6orf61, C6orf167,MMS22L, KCNS1, MFAP3L, NIP7,…

Show Full Abstract

<h4>Background</h4>The causal networks among genes that are commonly expressed in osteoblasts and during bone metastasis (BM) of breast cancer (BC) are not well understood. Here, we developed a machine learning method to obtain a plausible causal network of genes that are commonly expressed during BM and in osteoblasts in BC.<h4>Methods</h4>We selected BC genes that are commonly expressed during BM and in osteoblasts from the Gene Expression Omnibus database. Bayesian Network Inference with Java Objects (Banjo) was used to obtain the Bayesian network. Genes registered as BC related genes were included as candidate genes in the implementation of Banjo. Next, we obtained the Bayesian structure and assessed the prediction rate for BM, conditional independence among nodes, and causality among nodes. Furthermore, we reported the maximum relative risks (RRs) of combined gene expression of the genes in the model.<h4>Results</h4>We mechanistically identified 33 significantly related and plausibly involved genes in the development of BC BM. Further model evaluations showed that 16 genes were enough for a model to be statistically significant in terms of maximum likelihood of the causal Bayesian networks (CBNs) and for correct prediction of BM of BC. Maximum RRs of combined gene expression patterns showed that the expression levels of <i>UBIAD1</i>, <i>HEBP1</i>, <i>BTNL8</i>, <i>TSPO</i>, <i>PSAT1</i>, and <i>ZFP36L2</i> significantly affected development of BM from BC.<h4>Conclusions</h4>The CBN structure can be used as a reasonable inference network for accurately predicting BM in BC.

Also flagged:ADL
Journal Article 2018-11-30 No Snippets Czarkowska M, Saran T, Mazur A, Panasiuk L.
Show Full Abstract

<h4>Introduction</h4>The answer to current social and health needs of people aged over 60 are the multidirectional and carefully planned, comprehensive activation and rehabilitation activities carried out as part of Daycare Centres (DCC). The aim of creating and the functioning of DCCs deployed all over Poland is to improve the health and psychophysical fitness of this group of people. Health factors and psychophysical fitness determine the ability to live independently, both today, and later in life.<h4>Objective</h4>The objective of the study was to assess the impact of comprehensive ambulatory rehabilitation, including tailored endurance training preceded by an ergospirometry test, on indicators demonstrating the ability to live independently and the risk ratio of future health problems in the elderly.<h4>Material and methods</h4>60 people participating in a rehabilitation cycle implemented as part of the services provided to patients aged over 60 in the DCC of the Witold Chodźko Institute of Rural Medicine (IMW) in Lublin comprised the sample. The tests were carried out in the test-retest model on the first and last day of the kinesiotherapy cycle. Patients were tested using standardized Barthel, I-ADL and VES-13 questionnaires. The rehabilitation programme applied included systemic kinesiotherapy (endurance training) with a load determined according to individual exercise capacity, determined on the basis of a ergospirometry test, and varied rehabilitation activities resulting from the condition of the locomotor system, as provided for under the project.<h4>Results</h4>After completing the rehabilitation cycle, patients obtained higher results in comparison to the tests carried out before the beginning of the cycle in the Barthel index used to measure functional efficiency (Z = 5.41; p = 0.001), as well as lower in the I-ADL scale used to test the degree of dependence on the help of others when performing complex activities of everyday life (Z = 2.63; p = 0.009) and in VES-13 scale used to assess the risk of geriatric health problems (Z = 5.47; p = 0.001).<h4>Conclusions</h4>As the result of the use of comprehensive rehabilitation, including obligatory endurance training, desired changes were achieved in terms of fitness and independence in performing advanced daily activities and reducing the risk of geriatric health problems.

Also flagged:porphyriahemebiosynthesiserythronporphyriasacute hepatic porphyrias
Journal Article 2018-11-30 No Snippets Yasuda M, Chen B, Desnick RJ.
Show Full Abstract

The inborn errors of heme biosynthesis, the Porphyrias, include eight major disorders resulting from loss-of-function (LOF) or gain-of-function (GOF) mutations in eight of the nine heme biosynthetic genes. The major sites of heme biosynthesis are the liver and erythron, and the underlying pathophysiology of each of these disorders depends on the unique biochemistry, cell biology, and genetic mechanisms in these tissues. The porphyrias are classified into three major categories: 1) the acute hepatic porphyrias (AHPs), including Acute Intermittent Porphyria (AIP), Hereditary Coproporphyria (HCP), Variegate Porphyria (VP), and 5-Aminolevlulinic Acid Dehydratase Deficient Porphyria (ADP); 2) a hepatic cutaneous porphyria, Porphyria Cutanea Tarda (PCT); and 3) the cutaneous erythropoietic porphyrias, Congenital Erythropoietic Porphyria (CEP), Erythropoietic Protoporphyria (EPP), and X-Linked Protoporphyria (XLP). Their modes of inheritance include autosomal dominant with markedly decreased penetrance (AIP, VP, and HCP), autosomal recessive (ADP, CEP, and EPP), or X-linked (XLP), as well as an acquired sporadic form (PCT). There are severe homozygous dominant forms of the three AHPs. For each porphyria, its phenotype, inheritance pattern, unique genetic principles, and molecular genetic heterogeneity are presented. To date, >1000 mutations in the heme biosynthetic genes causing their respective porphyrias have been reported, including low expression alleles and genotype/phenotype correlations that predict severity for certain porphyrias. The tissue-specific regulation of heme biosynthesis and the unique genetic mechanisms for each porphyria are highlighted.

Also flagged:blackcarbonozonegene expressionsreverse transcriptioncell cycle
Journal Article 2018-11-30 ✓ 5 Snippets An J, He H, Wang L, Jin Y, Kong J, Zhong Y, Liu M, Shang Y.
In-Text Gene Mentions

breast cancer susceptibility protein 1 (brca1), recombination protein A paralog B (rad51b), methyl methanesulfonate-sensitivity protein 22-like and tonsoku-like (mms22l

…( rad51b ),methyl methanesulfonate-sensitivity protein 22-likemethanesulfonate-sensitivity p…

…and tonsoku-like (mms22l).…

methyl methanesulfonate-sensitivity protein 22-like

mms22l

Show Full Abstract

Nano-sized ambient black carbon (BC) is hypothesized to pose a serious threat to human health. After emission into the air, the atmospheric oxidation process can modify its physiochemical properties and change its biological responses. In this study, we aimed to compare different DNA damage and repair responses promoted by fresh BC (FBC) and ozone oxidized-BC (OBC). The cell apoptosis, cell arrest, DNA damage and repair were investigated in A549 cells after treatment with FBC and OBC. Associated gene expressions were measured with the reverse transcription quantitative polymerase chain reaction (RT-qPCR) method. Both FBC and OBC could induce cell apoptosis in A549 cells with up-regulated gene of promyelocytic leukemia protein (<i>pml</i>) and down-regulated gene of anti-apoptotic B-cell lymphoma-2 (<i>bcl-2</i>). FBC caused cell cycle arrest at S and G2/M phases, which was associated with up-regulated ataxia telangiectasia mutated (<i>atm</i>), checkpoint kinase 2 (<i>chk2</i>), structural maintenance of chromosomes 1 (<i>smc1</i>) and cell division cycle 25 homolog A (<i>cdc25a</i>) genes. OBC promoted cell cycle arrest at the S phase with up-regulated genes of <i>atm</i>, <i>chk2</i> and <i>smc1</i>. Both FBC and OBC induced oxidative DNA damage and time-dependent DNA repair responses with increased gene expressions of breast cancer susceptibility protein 1 (<i>brca1</i>), recombination protein A paralog B (<i>rad51b</i>), methyl methanesulfonate-sensitivity protein 22-like and tonsoku-like (<i>mms22l</i>). Compared to FBC, OBC could cause more sufficient DNA damage repair responses through cell cycle arrest at the S phase, resulting in relatively weaker DNA damages.

Also flagged:catalytic activitytyrosine-protein phosphatase zetaglioblastomabindingaspartateenzyme activity
Journal Article 2018-11-30 ✓ 1 Snippet Agoni C, Ramharack P, Soliman MES.
In-Text Gene Mentions

…Investigation of theDCCmatrix and PCA…

Show Full Abstract

The mobility of loops around the catalytic site of a protein remains crucial to its activity. Dynamics of the WPD-loop is an essential determinant of the catalytic activity of tyrosine-protein phosphatase zeta, an implicated protein in glioblastoma cells. The WPD-loop assumes a closed conformation upon substrate binding in order to position its catalytic aspartate to participate in catalysis. Herein, we explore the impact of NAZ2329, a recently identified allosteric inhibitor of tyrosine-protein phosphatase zeta, on the atomic flexibility of the WPD-loop. The druglikeness of NAZ2329 was assessed using the SwissADME online tool. The enzymatic complex was then subjected to conformational simulations using the AMBER molecular dynamics software. Structural analysis revealed that NAZ2329 induced an open conformation of the crucial WPD-loop, consequently impeding enzyme activity even upon substrate binding. Based on the molecular interactions between NAZ2329 and tyrosine-protein phosphatase zeta, a pharmacophore model was generated to exhibit the important functional moieties of NAZ2329. These findings provide an insightful molecular and structural mechanism in targeting tyrosine-protein phosphatase zeta as a therapeutic intervention for glioblastoma. We believe that this optimized pharmacophoric model will aid in the design of improved anti-tyrosine phosphatase agents, thus allowing for increased patient adherence.

Also flagged:paclitaxelseleniumwatercancercyclodextrinfolate
Journal Article 2018-11-30 No Snippets Gong G, Fu B, Ying C, Zhu Z, He X, Li Y, Shen Z, Xuan Q, Huang Y, Lin Y, Li Y.
Show Full Abstract

As a therapeutic anticancer agent, the clinical use of paclitaxel (PTX) is limited by its poor water solubility and serious adverse side effects. The targeted-specific intracellular delivery of an anticancer drug as a new therapeutic modality is promising for cancer treatment. The anticancer activity of selenium nanoparticles (SeNPs) with low toxicity and excellent activity has attracted increasing attention for use in biomedical intervention in recent years. In this study, β-cyclodextrin (β-CD)-folate (FA)-modified selenium nanoparticles (SeNPs) loaded with paclitaxel (PTX) (Se@β-CD-FA@PTX) were successfully fabricated through a layer-by-layer method. The nanosystem is able to enter cancer cells through FA receptor-mediated endocytosis to achieve targeted-specific intracellular delivery. Se@β-CD-FA@PTX was found to increase the selectivity between normal and cancer cells. The viability in MCF-7 cells was remarkably lower than in MCF 10A cells, which may promote the specific targeted delivery of Se@β-CD-FA@PTX into MCF-7 cells. Moreover, Se@β-CD-FA@PTX was found to enhance the cytotoxic effect on MCF-7 cells <i>via</i> the induction of apoptosis activation of ROS-mediated p53 and AKT signaling pathways. The results demonstrate that Se@β-CD-FA@PTX nanoparticles provide a strategy for the design of cancer-targeted nanosystems for use in cancer therapy.

Also flagged:Fibromyalgiasleepcognitive dysfunctiondepressionpathogenesisTRPV2
Journal Article 2018-11-29 ✓ 1 Snippet D'Agnelli S, Arendt-Nielsen L, Gerra MC, Zatorri K, Boggiani L, Baciarello M, Bignami E.
In-Text Gene Mentions

In order to clarify the potential association between gene polymorphisms in 5-HTT, COMT, and 5-HT2A genes and FM susceptibility, Lee et al.31 have led a meta-analysis on FM genetic predisposition, highlighting the potential central role of 102T/C polymorphism in 5-HT2A receptor; the significant associations of 5-HTTLPR S/L allele and COMT Val158Met with FM were not confirmed.31 More investigations need to understand the role of these genes in pain biology and in chronic pain diseases as FM.

Show Full Abstract

Fibromyalgia is a disease characterized by chronic widespread pain with additional symptoms, such as joint stiffness, fatigue, sleep disturbance, cognitive dysfunction, and depression. Currently, fibromyalgia diagnosis is based exclusively on a comprehensive clinical assessment, according to 2016 ACR criteria, but validated biological biomarkers associated with fibromyalgia have not yet been identified. Genome-wide association studies investigated genes potentially involved in fibromyalgia pathogenesis highlighting that genetic factors are possibly responsible for up to 50% of the disease susceptibility. Potential candidate genes found associated to fibromyalgia are SLC64A4, TRPV2, MYT1L, and NRXN3. Furthermore, a gene-environmental interaction has been proposed as triggering mechanism, through epigenetic alterations: In particular, fibromyalgia appears to be characterized by a hypomethylated DNA pattern, in genes implicated in stress response, DNA repair, autonomic system response, and subcortical neuronal abnormalities. Differences in the genome-wide expression profile of microRNAs were found among multiple tissues, indicating the involvement of distinct processes in fibromyalgia pathogenesis. Further studies should be dedicated to strength these preliminary findings, in larger multicenter cohorts, to identify reliable directions for biomarker research and clinical practice.

Also flagged:pathogenesisHIV infectionAIDSimmune responseinflammatory responsedefense responses
Journal Article 2018-11-29 No Snippets Zhang Y, Zhang H, An M, Zhao B, Ding H, Zhang Z, He Y, Shang H, Han X.
Show Full Abstract

<h4>Background</h4>The events in early HIV infection (EHI) are important determinants of disease severity and progression rate to AIDS, but the mechanisms of pathogenesis in EHI have not been fully understood. Circular RNAs (circRNAs) have been verified as "microRNA sponges" that regulate gene expression through competing endogenous RNA (ceRNA) networks, but circRNA expression profiles and their contribution to EHI pathogenesis are still unclear.<h4>Methods</h4>Two different libraries were constructed with RNA from human peripheral blood mononuclear cells from 3 HARRT-naive EHI patients and 3 healthy controls (HCs). The complete transcriptomes were sequenced with RNA sequencing (RNA-Seq) and miRNA sequencing (miRNA-Seq). The differentially expressed (DE) RNAs were validated with RT-qPCR. The circRNA profile and circRNA-associated-ceRNA network in EHI were analyzed with the integrated data of RNA-Seq and miRNA-Seq. Gene ontology (GO) analysis was used to annotate the circRNAs involved in the circRNA-associated-ceRNA networks.<h4>Results</h4>A total of 1365 circRNAs, 30 miRNAs, and 2049 mRNAs were differentially expressed between HARRT-naive EHI patients and HCs. A ceRNA network was constructed with 516 DE circRNAs and 903 DE mRNAs that shared miR response elements with 21 DE miRNAs. GO analysis demonstrated the multiple roles of the circRNAs enriched in EHI with circRNA-associated-ceRNA networks, such as immune response, inflammatory response and defense responses to virus, 67 circRNAs were revealed to be potentially involved in HIV-1 replication through regulating the expression of CCNK, CDKN1A and IL-15.<h4>Conclusions</h4>This study, for the first time, revealed a large circRNA profile and complex pathogenesis roles of circRNAs in EHI. A group of enriched circRNAs and associated circRNA-associated-ceRNA networks might contribute to HIV replication regulation and provide novel potential targets for both the pathogenesis of EHI and antiviral therapy.

Also flagged:ironHDatrophybrain atrophyHuntington Diseaseneurodegenerative disorder
Journal Article 2018-11-29 ✓ 1 Snippet Chen L, Hua J, Ross CA, Cai S, van Zijl PCM, Li X.
In-Text Gene Mentions

HTT

Show Full Abstract

Altered brain iron content in the striatum of premanifest and manifest Huntington's disease (HD) has been reported. However, its natural history remains unclear. This study aims to investigate altered brain iron content in premanifest and early HD, and the iron deposition rate in these patients through a longitudinal one-year follow-up test, with quantitative magnetic susceptibility as an iron imaging marker. Twenty-four gene mutation carriers divided into three groups (further-from-onset, closer-to-onset and early HD) and 16 age-matched healthy controls were recruited at baseline, and of these, 14 carriers and 7 controls completed the one-year follow-up. Quantitative magnetic susceptibility and effective transverse relaxation rate ( R2∗ ) were measured at 7.0 Tesla and correlated with atrophy and available clinical and cognitive measurements. Higher susceptibility values indicating higher iron content in the striatum and globus pallidus were only observed in closer-to-onset (N = 6, p < 0.05 in caudate and p < 0.01 in putamen) and early HD (N = 9, p < 0.05 in caudate and globus pallidus and p < 0.01 in putamen). Similar results were found by R2∗ measurement. Such increases directly correlated with HD CAG-age product score and brain atrophy, but not with motor or cognitive scores. More importantly, a significantly higher iron deposition rate (11.9%/years in caudate and 6.1%/years in globus pallidus) was firstly observed in closer-to-onset premanifest HD and early HD as compared to the controls. These results suggest that monitoring brain iron may provide further insights into the pathophysiology of HD disease progression, and may provide a biomarker for clinical trials.

Also flagged:mGluR3mGluR7chemosensory receptorsIonotropic ReceptorsG protein-coupled receptorsglutamate
Journal Article 2018-11-29 ✓ 2 Snippets Roberts RE, Powell D, Wang T, Hall MH, Motti CA, Cummins SF.
In-Text Gene Mentions

…This includes aG protein-coupled receptor 52protein-coupled receptor 52…

…ADRA1A ), aG protein-coupled receptor 52protein-coupled receptor 52…

Show Full Abstract

<h4>Background</h4>Chemosensation is a critical signalling process for all organisms and is achieved through the interaction between chemosensory receptors and their ligands. The Crown-of-thorns starfish, Acanthaster planci species complex (COTS), is a predator of coral polyps and Acanthaster cf. solaris is currently considered to be one of the main drivers of coral loss on the Great Barrier Reef in Queensland, Australia.<h4>Results</h4>This study reveals the presence of putative variant Ionotropic Receptors (IRs) which are differentially expressed in the olfactory organs of COTS. Several other types of G protein-coupled receptors such as adrenergic, metabotropic glutamate, cholecystokinin, trace-amine associated, GRL101 and GPCR52 receptors have also been identified. Several receptors display male-biased expression within the sensory tentacles, indicating possible reproductive significance.<h4>Conclusions</h4>Many of the receptors identified in this study may have a role in reproduction and are therefore key targets for further investigation. Based on their differential expression within the olfactory organs and presence in multiple tissues, it is possible that several of these receptor types have expanded within the Echinoderm lineage. Many are likely to be species-specific with novel ligand-binding affinity and a diverse range of functions. This study is the first to describe the presence of variant Ionotropic Glutamate Receptors in any Echinoderm, and is only the second study to investigate chemosensory receptors in any starfish or marine pest. These results represent a significant step forward in understanding the chemosensory abilities of COTS.

Also flagged:Lanthanumchitosancell adhesionWntosteogenesisrelated
Journal Article 2018-11-29 No Snippets Hu H, Zhao P, Liu J, Ke Q, Zhang C, Guo Y, Ding H.
Show Full Abstract

<h4>Background</h4>Fabrication of porous scaffolds with great biocompatibility and osteoinductivity to promote bone defect healing has attracted extensive attention.<h4>Methods</h4>In a previous study, novel lanthanum phosphate (LaPO<sub>4</sub>)/chitosan (CS) scaffolds were prepared by distributing 40- to 60-nm LaPO<sub>4</sub> nanoparticles throughout plate-like CS films.<h4>Results</h4>Interconnected three dimensional (3D) macropores within the scaffolds increased the scaffold osteoconductivity, thereby promoting cell adhesion and bone tissue in-growth. The LaPO<sub>4</sub>/CS scaffolds showed no obvious toxicity and accelerated bone generation in a rat cranial defect model. Notably, the element La in the scaffolds was found to promote osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) through the Wnt/β-catenin signalling pathway and induced high expression of the osteogenesis-related genes alkaline phosphatase, osteocalcin and Collagen I (Col-I). Moreover, the LaPO<sub>4</sub>/CS scaffolds enhanced bone regeneration and collagen fibre deposition in rat critical-sized calvarial defect sites.<h4>Conclusion</h4>The novel LaPO<sub>4</sub>/CS scaffolds provide an admirable and promising platform for the repair of bone defects.

Also flagged:deubiquitinaseUSP38LSD1Deubiquitinasesubiquitinluciferase
Journal Article 2018-11-29 ✓ 3 Snippets Liu W, Zhang Q, Fang Y, Wang Y.
In-Text Gene Mentions

…25 (CDC25) andsuppressor of defective silencing 3 protein homologof defective silencing…

…3 protein homolog (SUDS3), so the relationship…

suppressor of defective silencing 3 protein homologof defective silencing…

Show Full Abstract

<h4>Background</h4>Deubiquitination is a posttranslational protein modification prevalent in mammalian cells. Deubiquitinases regulate the functions of the target protein by removing its ubiquitin chain. In this study, the effects of the deubiquitinase USP38's functions on the LSD1 protein and on cell physiology were investigated.<h4>Materials and methods</h4>Western blotting, real-time quantitative PCR, immunoprecipitation, denaturing immunoprecipitation and luciferase reporter assays were used to analyze the protein stability, protein interactions and changes in the ubiquitin chain. Cell proliferation assays, colony formation assays, drug treatments and western blotting were used to explore the functions of USP38 in cells.<h4>Results</h4>The deubiquitinase USP38 stabilizes protein LSD1 in cells by binding LSD1 and cleaving its ubiquitin chain to prevent the degradation of LSD1 by the intracellular proteasome. USP38 enhances the ability of LSD1 to activate signaling pathways and hence promotes cellular abilities of proliferation and colony formation through interacting with LSD1. Furthermore, USP38 enhances the drug tolerance of human colon cancer cells.<h4>Conclusions</h4>USP38 is an LSD1-specific deubiquitinase that affects cellular physiology through interacting with LSD1.

Also flagged:hepatocellular carcinomaalcoholdiabetes mellitushypertensiondyslipidemiafatty liver
Journal Article 2018-11-29 ✓ 2 Snippets Tateishi R, Uchino K, Fujiwara N, Takehara T, Okanoue T, Seike M, Yoshiji H, Yatsuhashi H, Shimizu M, Torimura T, Moriyama M, Sakaida I, Okada H, Chiba T, Chuma M, Nakao K, Isomoto H, Sasaki Y, Kaneko S, Masaki T, Chayama K, Koike K.
In-Text Gene Mentions

…(NAFLD), Budd–Chiari syndrome,hemochromatosis, Wilson’s disease, and…

…in 1 (0.04%),hemochromatosisin 2 (0.1%),…

Show Full Abstract

<h4>Background</h4>We previously reported that the incidence of hepatocellular carcinoma (HCC) with non-viral etiologies increased rapidly between 1991 and 2010 in Japan.<h4>Methods</h4>To update this investigation, we enrolled patients who were initially diagnosed as having non-B, non-C HCC at participating hospitals between 2011 and 2015. In addition to the patient characteristics investigated in the previous report, we also investigated the duration of alcohol consumption. The overall survival rate was analyzed using the Kaplan-Meier method, and the hazard function against the body mass index (BMI) was plotted using cubic splines.<h4>Results</h4>A total of 2087 patients were enrolled. The proportion of patients with non-viral etiologies has continued to increase from 10.0% in 1991 to 32.5% in 2015. Patients were also older (median ages, 70-73 years) and more obese (median BMIs, 23.9-24.2 kg/m<sup>2</sup>), and the proportions of patients with diabetes mellitus (46.1% to 51.6%), hypertension (42.7% to 58.6%), dyslipidemia (14.6% to 22.9%), and fatty liver (24.0% to 28.8%) had all increased significantly. There was a significant inverse relationship between the duration and the amount of daily alcohol consumption. The improvement in the overall survival was relatively small, with a decreased proportion of patients under surveillance (41.3% to 31.6%). A hazard function plot showed a curve similar to that in our previous report, with a lowest hazard of ~ 26 kg/m<sup>2</sup>.<h4>Conclusions</h4>The proportion of HCC patients with non-viral etiologies continues to increase in Japan. Lifetime total amount of alcohol consumption may be a risk factor.

Also flagged:CD36membraneNEU1lysosomescatabolismsialoglycoconjugates
Journal Article 2018-11-29 No Snippets Kawecki C, Bocquet O, Schmelzer CEH, Heinz A, Ihling C, Wahart A, Romier B, Bennasroune A, Blaise S, Terryn C, Linton KJ, Martiny L, Duca L, Maurice P.
Show Full Abstract

In addition to its critical role in lysosomes for catabolism of sialoglycoconjugates, NEU1 is expressed at the plasma membrane and regulates a myriad of receptors by desialylation, playing a key role in many pathophysiological processes. Here, we developed a proteomic approach dedicated to the purification and identification by LC-MS/MS of plasma membrane NEU1 interaction partners in human macrophages. Already known interaction partners were identified as well as several new candidates such as the class B scavenger receptor CD36. Interaction between NEU1 and CD36 was confirmed by complementary approaches. We showed that elastin-derived peptides (EDP) desialylate CD36 and that this effect was blocked by the V14 peptide, which blocks the interaction between bioactive EDP and the elastin receptor complex (ERC). Importantly, EDP also increased the uptake of oxidized LDL by macrophages that is blocked by both the V14 peptide and the sialidase inhibitor 2-deoxy-2,3-didehydro-N-acetylneuraminic acid (DANA). These results demonstrate, for the first time, that binding of EDP to the ERC indirectly modulates CD36 sialylation level and regulates oxidized LDL uptake through this sialidase. These effects could contribute to the previously reported proatherogenic role of EDP and add a new dimension in the regulation of biological processes through NEU1.

Also flagged:nephrogenic systemic fibrosisrenal diseasegadoliniumhydrogen atomshydrogencalcium channel
Journal Article 2018-11-29 ✓ 1 Snippet Lyapustina T, Goldfine C, Rhyee S, Babu KM, Griswold MK.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Introduction</h4>Gadolinium-based contrast agents (GBCAs) have been increasingly used in clinical practice since their introduction in the 1980s. Recently, increased public attention has been given to patients who report new symptoms following GBCA exposure. This review details the current knowledge surrounding GBCAs, with a focus on the known and proposed disease states that may be associated with GBCAs. Recommendations for the appropriate clinical workup of a patient suspected of having symptoms attributable to gadolinium exposure are included.<h4>Discussion</h4>GBCAs are known to precipitate the disease state nephrogenic systemic fibrosis (NSF), a syndrome characterized by skin thickening in patients with preexisting renal disease. An additional syndrome, termed gadolinium deposition disease, has been proposed to describe patients with normal renal function who develop an array of symptoms following GBCA exposure. While there is a potential physiologic basis for the development of this condition, there is no conclusive evidence to support a causal relationship between GBCA administration and the reported symptoms yet. Clinical evaluation revolves around focused history-taking and physical examination, given the absence of a reliable link between patient symptoms and measured gadolinium levels. There are no recommended treatments for suspected gadolinium deposition disease. Chelation therapy, which is not approved for this indication, carries undue risk without documented efficacy.<h4>Conclusions</h4>The extent to which GBCAs contribute to clinically relevant adverse effects remains an important and evolving field of study. NSF remains the only proven disease state associated with GBCA exposure. Additional data are required to evaluate whether other symptoms should be attributed to GBCAs.

Also flagged:TRIM5Ubiquitinationretroviral capsidsantiviral responsescapsidresponses
Journal Article 2018-11-29 ✓ 1 Snippet Fletcher AJ, Vaysburd M, Maslen S, Zeng J, Skehel JM, Towers GJ, James LC.
In-Text Gene Mentions

…TRIM1, TRIM32, andTRIM38( Figure S3…

Show Full Abstract

TRIM5 is a RING domain E3 ubiquitin ligase with potent antiretroviral function. TRIM5 assembles into a hexagonal lattice on retroviral capsids, causing envelopment of the infectious core. Concomitantly, TRIM5 initiates innate immune signaling and orchestrates disassembly of the viral particle, yet how these antiviral responses are regulated by capsid recognition is unclear. We show that hexagonal assembly triggers N-terminal polyubiquitination of TRIM5 that collectively drives antiviral responses. In uninfected cells, N-terminal monoubiquitination triggers non-productive TRIM5 turnover. Upon TRIM5 assembly on virus, a trivalent RING arrangement allows elongation of N-terminally anchored K63-linked ubiquitin chains (N-K63-Ub). N-K63-Ub drives TRIM5 innate immune stimulation and proteasomal degradation. Inducing ubiquitination before TRIM5 assembly triggers premature degradation and ablates antiviral restriction. Conversely, driving N-K63 ubiquitination after TRIM5 assembly enhances innate immune signaling. Thus, the hexagonal geometry of TRIM5's antiviral lattice converts a capsid-binding protein into a multifunctional antiviral platform.

Also flagged:inherited disordersgenetic disordersgene expressionspliceosomemyotonic dystrophy type 1neurogenetic
Journal Article 2018-11-29 ✓ 1 Snippet Tankard RM, Bennett MF, Degorski P, Delatycki MB, Lockhart PJ, Bahlo M.
In-Text Gene Mentions

HTT

Show Full Abstract

Repeat expansions cause more than 30 inherited disorders, predominantly neurogenetic. These can present with overlapping clinical phenotypes, making molecular diagnosis challenging. Single-gene or small-panel PCR-based methods can help to identify the precise genetic cause, but they can be slow and costly and often yield no result. Researchers are increasingly performing genomic analysis via whole-exome and whole-genome sequencing (WES and WGS) to diagnose genetic disorders. However, until recently, analysis protocols could not identify repeat expansions in these datasets. We developed exSTRa (expanded short tandem repeat algorithm), a method that uses either WES or WGS to identify repeat expansions. Performance of exSTRa was assessed in a simulation study. In addition, four retrospective cohorts of individuals with eleven different known repeat-expansion disorders were analyzed with exSTRa. We assessed results by comparing the findings to known disease status. Performance was also compared to three other analysis methods (ExpansionHunter, STRetch, and TREDPARSE), which were developed specifically for WGS data. Expansions in the assessed STR loci were successfully identified in WES and WGS datasets by all four methods with high specificity and sensitivity. Overall, exSTRa demonstrated more robust and superior performance for WES data than did the other three methods. We demonstrate that exSTRa can be effectively utilized as a screening tool for detecting repeat expansions in WES and WGS data, although the best performance would be produced by consensus calling, wherein at least two out of the four currently available screening methods call an expansion.

Also flagged:zinc oxidedigestionglucosegene expressionglucose transporterGLUT2
Journal Article 2018-11-29 ✓ 1 Snippet Moreno-Olivas F, Tako E, Mahler GJ.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Nano-sized zinc oxide (ZnO) is present in food packaging, putting consumers at risk of ingestion. There is little information on the amount of ZnO nanoparticles (NP) present in food packaging and the effects of ZnO NP ingestion on intestinal function. To estimate physiologically relevant ZnO NP exposures from food that are commonly packaged with ZnO NP, food samples were analyzed with inductively coupled plasma mass spectrometry (ICP-MS). An in vitro model of the small intestine was used to investigate the effects of ZnO NP exposure. Cells were exposed to pristine NP in culture medium and to NP subjected to an in vitro digestion process to better reflect the transformation that the NP undergo in the human gastrointestinal (GI) tract. The findings show that a physiologically relevant dose of ZnO NP can cause a significant decrease in glucose transport, which is consistent with gene expression changes for the basolateral glucose transporter GLUT2. There is also evidence that the ZnO NP affect the microvilli of the intestinal cells, therefore reducing the amount of surface area available to absorb nutrients. These results suggest that the ingestion of ZnO NP can alter nutrient absorption in an in vitro model of the human small intestine.

Also flagged:glutamineneurodegenerative diseasesChoreaHuntingtonpolyQ diseasespolyglutamine
Journal Article 2018-11-29 ✓ 1 Snippet Hansen CV, Schroll HJ, Wüstner D.
In-Text Gene Mentions

…show that mutatedHttshuttles rapidly across…

Show Full Abstract

<h4>Background</h4>Intracellular phase separation and aggregation of proteins with extended poly-glutamine (polyQ) stretches are hallmarks of various age-associated neurodegenerative diseases. Progress in our understanding of such processes heavily relies on quantitative fluorescence imaging of suitably tagged proteins. Fluorescence loss in photobleaching (FLIP) is particularly well-suited to study the dynamics of protein aggregation in cellular models of Chorea Huntington and other polyQ diseases, as FLIP gives access to the full spatio-temporal profile of intensity changes in the cell geometry. In contrast to other methods, also dim aggregates become visible during time evolution of fluorescence loss in cellular compartments. However, methods for computational analysis of FLIP data are sparse, and transport models for estimation of transport and diffusion parameters from experimental FLIP sequences are missing.<h4>Results</h4>In this paper, we present a computational method for analysis of FLIP imaging experiments of intracellular polyglutamine protein aggregates also called inclusion bodies (IBs). By this method, we can determine the diffusion constant and nuclear membrane transport coefficients of polyQ proteins as well as the exchange rates between aggregates and the cytoplasm. Our method is based on a reaction-diffusion multi-compartment model defined on a mesh obtained by segmentation of the cell images from the FLIP sequence. The discontinuous Galerkin (DG) method is used for numerical implementation of our model in FEniCS, which greatly reduces the computing time. The method is applied to representative experimental FLIP sequences, and consistent estimates of all transport parameters are obtained.<h4>Conclusions</h4>By directly estimating the transport parameters from live-cell image sequences using our new computational FLIP approach surprisingly fast exchange dynamics of mutant Huntingtin between cytoplasm and dim IBs could be revealed. This is likely relevant also for other polyQ diseases. Thus, our method allows for quantifying protein dynamics at different stages of the protein aggregation process in cellular models of neurodegeneration.

Also flagged:anxietydepressionpsychological distressimmunityironlipid
Journal Article 2018-11-29 ✓ 1 Snippet Wåhlén K, Ghafouri B, Ghafouri N, Gerdle B.
In-Text Gene Mentions

…(immunity process) andantithrombin-III(metabolic process) was…

Show Full Abstract

<b>Objectives:</b> Although generalized muscle pain, tiredness, anxiety, and depression are commonly present among chronic widespread pain (CWP) patients, the molecular mechanisms behind CWP are not fully elucidated. Moreover, the lack of biomarkers often makes diagnosis and treatment problematic. In this study, we investigated the correlation between pain intensity, psychological distress, and plasma proteins among CWP patients and controls (CON). <b>Methods:</b> The plasma proteome of CWP (<i>n</i> = 15) and CON (<i>n</i> = 23) was analyzed using two-dimensional gel electrophoresis. Orthogonal Partial Least Square analysis (OPLS) was used to determine proteins associated with pain intensity (numeric rating scale) in CWP and psychological distress (Hospital and Depression Scale, HADS) in CWP and CON. Significant proteins were identified by MALDI-TOF and tandem MS. <b>Results:</b> In CWP, pain intensity was associated with plasma proteins mostly involved in metabolic and immunity processes (e.g., kininogen-1, fibrinogen gamma chain, and ceruloplasmin), and psychological distress was associated with plasma proteins related to immunity response, iron ion, and lipid metabolism (e.g., complement factor B, complement C1r subcomponent, hemopexin, and clusterin). <b>Discussion:</b> This study suggests that different plasma protein patterns are associated with different pain intensity and psychological distress in CWP. Proteins belonging to the coagulation cascade and immunity processes showed strong associations to each clinical outcome. Using the plasma proteome profile of CWP to study potential biomarker candidates provides a snapshot of ongoing systemic mechanisms in CWP.

Also flagged:Gene expressionheat-shock proteinsredox regulatorsHeat shock proteinsHSPsgastrointestinal tumours
Journal Article 2018-11-29 ✓ 1 Snippet Pohl SÖ, Pervaiz S, Dharmarajan A, Agostino M.
In-Text Gene Mentions

…and DNAJA2 high /PRDX6high genotypes all…

Show Full Abstract

Heat shock proteins (HSPs) are a large family of ubiquitously expressed proteins with diverse functions, including protein assembly and folding/unfolding. These proteins have been associated with the progression of various gastrointestinal tumours. Dysregulation of cellular redox has also been associated with gastrointestinal carcinogenesis, however, a link between HSPs and dysregulation of cellular redox in carcinogenesis remains unclear. In this study, we analysed mRNA co-expression and methylation patterns, as well as performed survival analysis and gene set enrichment analysis, on gastrointestinal cancer data sets (oesophageal, stomach and colorectal carcinomas) to determine whether HSP activity and cellular redox dysregulation are linked. A widespread relationship between HSPs and cellular redox was identified, with specific combinatorial co-expression patterns demonstrated to significantly alter patient survival outcomes. This comprehensive analysis provides the foundation for future studies aimed at deciphering the mechanisms of cooperativity between HSPs and redox regulatory enzymes, which may be a target for future therapeutic intervention for gastrointestinal tumours.

Also flagged:Egr2axonstranscription factorsmyelinationcell proliferationSox10
Journal Article 2018-11-29 ✓ 1 Snippet Tammia M, Mi R, Sluch VM, Zhu A, Chung T, Shinn D, Zack DJ, Höke A, Mao HQ.
In-Text Gene Mentions

…called Brn2 (orPou3f2) is related…

Show Full Abstract

Schwann cells are key players in peripheral nerve regeneration, and are uniquely capable of remyelinating axons in this context. Schwann cells orchestrate this process via a set of transcription factors. While it has been shown that overexpression of specific genes, <i>e.g. Egr2,</i> upregulates myelin-related transcripts, it remains unknown if such manipulation can functionalize the cells and enhance their myelination frequency. The ability to do so could have implications in the use of human stem cell-derived Schwann cells, where myelination is hard to achieve. After screening four candidate transcription factors (<i>Sox10, Oct6, Brn2</i> and <i>Egr2</i>), we found that overexpression of <i>Egr2</i> in rat Schwann cells co-cultured with sensory neurons enhanced myelination frequency and reduced cell proliferation. However, in a mouse model of sciatic nerve repair with cells engrafted within a nerve guide, myelination frequency in the engrafted cells was reduced upon <i>Egr2</i> overexpression. Our results show that while overexpression of <i>Egr2</i> can enhance the myelination frequency <i>in vitro</i>, it is context-dependent, potentially influenced by the microenvironment, timing of association with axons, expression level, species differences, or other factors.

Also flagged:cancerhyaluronic acidnucleusSun1001DIR
Journal Article 2018-11-29 No Snippets Zhong L, Xu L, Liu Y, Li Q, Zhao D, Li Z, Zhang H, Zhang H, Kan Q, Wang Y, Sun J, He Z.
Show Full Abstract

Hyaluronic acid (HA) is a natural ligand of tumor-targeted drug delivery systems (DDS) due to the relevant CD44 receptor overexpressed on tumor cell membranes. However, other HA receptors (HARE and LYVE-1) are also overexpressing in the reticuloendothelial system (RES). Therefore, polyethylene glycol (PEG) modification of HA-based DDS is necessary to reduce RES capture. Unfortunately, pegylation remarkably inhibits tumor cellular uptake and endosomal escapement, significantly compromising the <i>in vivo</i> antitumor efficacy. Herein, we developed a Dox-loaded HA-based transformable supramolecular nanoplatform (Dox/HCVBP) to overcome this dilemma. Dox/HCVBP contains a tumor extracellular acidity-sensitive detachable PEG shell achieved by a benzoic imine linkage. The <i>in vitro</i> and <i>in vivo</i> investigations further demonstrated that Dox/HCVBP could be in a "stealth" state at blood stream for a long circulation time due to the buried HA ligands and the minimized nonspecific interaction by PEG shell. However, it could transform into a "recognition" state under the tumor acidic microenvironment for efficient tumor cellular uptake due to the direct exposure of active targeting ligand HA following PEG shell detachment. Such a transformative concept provides a promising strategy to resolve the dilemma of natural ligand-based DDS with conflicting two processes of tumor cellular uptake and <i>in vivo</i> nonspecific biodistribution.

Also flagged:mitochondriaLibADRphosphateMPPSMP
Journal Article 2018-11-29 No Snippets Zhou M, Li L, Li L, Lin X, Wang F, Li Q, Huang Y.
Show Full Abstract

Multidrug resistance (MDR) has been considered as a huge challenge to the effective chemotherapy. Therefore, it is necessary to develop new strategies to effectively overcome MDR. Here, based on the previous research of <i>N</i>-(2-hydroxypropyl)methacrylamide (HPMA) polymer-drug conjugates, we designed an effective system that combined drug-efflux circumvention and mitochondria targeting of anticancer drug doxorubicin (Dox). Briefly, Dox was modified with mitochondrial membrane penetrating peptide (MPP) and then attached to (HPMA) copolymers (P-M-Dox). Our study showed that macromolecular HPMA copolymers successfully bypassed drug efflux pumps and escorted Dox into resistant MCF-7/ADR cells <i>via</i> endocytic pathway. Subsequently, the mitochondria accumulation of drugs was significantly enhanced with 11.6-fold increase by MPP modification. The excellent mitochondria targeting then resulted in significant enhancement of reactive oxygen species (ROS) as well as reduction of adenosine triphosphate (ATP) production, which could further inhibit drug efflux and resistant cancer cell growth. By reversing Dox resistance, P-M-Dox achieved much better suppression in the growth of 3D MCF-7/ADR tumor spheroids compared with free Dox. Hence, our study provides a promising approach to treat drug-resistant cancer through simultaneous drug efflux circumvention and direct mitochondria delivery.

Also flagged:siglec-2CD22hepatocellular carcinomaSialic-acid-bindingimmunoglobulin-like lectin
Journal Article 2018-11-28 No Snippets Ren X, Ji Y, Jiang X, Qi X.
Show Full Abstract

Sialic-acid-binding immunoglobulin-like lectin (siglec) regulates cell death, anti-proliferative effects and mediates a variety of cellular activities. Little was known about the relationship between siglecs and hepatocellular carcinoma (HCC) prognosis. Siglec gene expression between tumor and non-tumor tissues were compared and correlated with overall survival (OS) from HCC patients in GSE14520 microarray expression profile. Siglec-1 to siglec-9 were all down-regulated in tumor tissues compared with those in non-tumor tissues in HCC patients (all <i>P</i> < 0.05). Univariate and multivariate Cox regression analysis revealed that siglec-2 overexpression could predict better OS (HR = 0.883, 95%CI = 0.806-0.966, <i>P</i> = 0.007). Patients with higher siglec-2 levels achieved longer OS months than those with lower siglec-2 levels in the Kaplan-Meier event analysis both in training and validation sets (<i>P</i> < 0.05). Alpha-fetoprotein (AFP) levels in siglec-2 low expression group were significantly higher than those in siglec-2 high expression group using Chi-square analysis (<i>P</i> = 0.043). In addition, both logistic regression analysis and ROC curve method showed that siglec-2 down-regulation in tumor tissues was significantly associated with AFP elevation over 300 ng/ml (<i>P</i> < 0.05). In conclusion, up-regulation of siglec-2 in tumor tissues could predict better OS in HCC patients. Mechanisms of siglec-2 in HCC development need further research.

Also flagged:AntibodyFluorineepidermal growth factor receptor 2HER2breast cancerbreast carcinoma
Journal Article 2018-11-28 No Snippets Zhou Z, McDougald D, Devoogdt N, Zalutsky MR, Vaidyanathan G.
Show Full Abstract

ImmunoPET agents are being investigated to assess the status of epidermal growth factor receptor 2 (HER2) in breast cancer patients with the goal of selecting those likely to benefit from HER2-targeted therapies and monitoring their progress after these treatments. We have been exploring the use of single domain antibody fragments (sdAbs) labeled with <sup>18</sup>F using residualizing prosthetic agents for this purpose. In this study, we have labeled two sdAbs that bind to different domains on the HER2 receptor, 2Rs15d and 5F7, using 2,3,5,6-tetrafluorophenyl 6-[<sup>18</sup>F]fluoronicotinate ([<sup>18</sup>F]TFPFN) and evaluated their HER2 targeting properties in vitro and in vivo. The overall decay-corrected radiochemical yield for the synthesis of [<sup>18</sup>F]TFPFN-2Rs15d and [<sup>18</sup>F]TFPFN-5F7 was 5.7 ± 3.6 and 4.0 ± 2.0%, respectively. The radiochemical purity of labeled sdAbs was >95%, immunoreactive fractions were about 60%, and affinity was in the low nanomolar range. Intracellularly trapped activity from [<sup>18</sup>F]TFPFN-2Rs15d and [<sup>18</sup>F]TFPFN-5F7 in HER2-expressing SKOV-3 ovarian and BT474M1 breast carcinoma cells were similar to the sdAbs labeled using the previously validated radioiodination residualizing prosthetic agents N-succinimidyl 4-guanidinomethyl-3-[<sup>125</sup>I]iodobenzoate ([<sup>125</sup>I]SGMIB) and N-succinimidyl 3-guanidinomethyl-5-[<sup>125</sup>I]iodobenzoate ( iso-[<sup>125</sup>I]SGMIB). Intracellular activity was about 2-fold higher for radiolabeled 5F7 compared with 2Rs15d for both <sup>18</sup>F and <sup>125</sup>I. While tumor uptake of both [<sup>18</sup>F]TFPFN-2Rs15d and [<sup>18</sup>F]TFPFN-5F7 was comparable to those for the coadministered <sup>125</sup>I-labeled sdAb, renal uptake of the <sup>18</sup>F-labeled sdAbs was substantially lower. In microPET images, the tumor was clearly delineated in SKOV-3 and BT474 xenograft-bearing athymic mice with low levels of background activity in normal tissues, except the bladder. These results indicate that the [<sup>18</sup>F]TFPFN prosthetic group could be a valuable reagent for developing sdAb-based immunoPET imaging agents.

Also flagged:ARHGAP11Bcognitionbrain developmentbrain diseasescellARHGAP11A
Journal Article 2018-11-28 ✓ 1 Snippet Kalebic N, Gilardi C, Albert M, Namba T, Long KR, Kostic M, Langen B, Huttner WB.
In-Text Gene Mentions

…neocortex for Brn2 (Pou3f2, Figure 4—figure supplement…

Show Full Abstract

The evolutionary increase in size and complexity of the primate neocortex is thought to underlie the higher cognitive abilities of humans. <i>ARHGAP11B</i> is a human-specific gene that, based on its expression pattern in fetal human neocortex and progenitor effects in embryonic mouse neocortex, has been proposed to have a key function in the evolutionary expansion of the neocortex. Here, we study the effects of <i>ARHGAP11B</i> expression in the developing neocortex of the gyrencephalic ferret. In contrast to its effects in mouse, <i>ARHGAP11B</i> markedly increases proliferative basal radial glia, a progenitor cell type thought to be instrumental for neocortical expansion, and results in extension of the neurogenic period and an increase in upper-layer neurons. Consequently, the postnatal ferret neocortex exhibits increased neuron density in the upper cortical layers and expands in both the radial and tangential dimensions. Thus, human-specific <i>ARHGAP11B</i> can elicit hallmarks of neocortical expansion in the developing ferret neocortex.

Also flagged:IcariinNrf2AP-1NF-κB
Journal Article 2018-11-28 No Snippets Hwang E, Lin P, Ngo HTT, Gao W, Wang YS, Yu HS, Yi TH.
Show Full Abstract

Correction for 'Icariin and icaritin recover UVB-induced photoaging by stimulating Nrf2/ARE and reducing AP-1 and NF-κB signaling pathways: a comparative study on UVB-irradiated human keratinocytes' by Eunson Hwang et al., Photochem. Photobiol. Sci., 2018, 17, 1396-1408.

Also flagged:MELfitactinTP53tumorsMelanoma
Journal Article 2018-11-28 ✓ 3 Snippets Jiang Z, Cinti C, Taranta M, Mattioli E, Schena E, Singh S, Khurana R, Lattanzi G, Tsinoremas NF, Capobianco E.
In-Text Gene Mentions

POU3F2

Among the genes considered putatively involved in chromatin remodeling, two were present as down-expressed among our DEGs, POU3F2 (transcription factor, logFC = –1.549) classified as a melanoma gene, and IRF4 (interferon, logFC = -1.833) classified as a skin neoplasma gene.

…among our DEGs,POU3F2(transcription factor, logFC…

Show Full Abstract

<h4>Background</h4>In melanoma, like in other cancers, both genetic alterations and epigenetic underlie the metastatic process. These effects are usually measured by changes in both methylome and transcriptome profiles, whose cross-correlation remains uncertain. We aimed to assess at systems scale the significance of epigenetic treatment in melanoma cells with different metastatic potential.<h4>Methods and findings</h4>Treatment by DAC demethylation with 5-Aza-2'-deoxycytidine of two melanoma cell lines endowed with different metastatic potential, SKMEL-2 and HS294T, was performed and high-throughput coupled RNA-Seq and RRBS-Seq experiments delivered differential profiles (DiP) of both transcriptomes and methylomes. Methylation levels measured at both TSS and gene body were studied to inspect correlated patterns with wide-spectrum transcript abundance levels quantified in both protein coding and non-coding RNA (ncRNA) regions. The DiP were then mapped onto standard bio-annotation sources (pathways, biological processes) and network configurations were obtained. The prioritized associations for target identification purposes were expected to elucidate the reprogramming dynamics induced by the epigenetic therapy. The interactomic connectivity maps of each cell line were formed to support the analysis of epigenetically re-activated genes. i.e. those supposedly silenced by melanoma. In particular, modular protein interaction networks (PIN) were used, evidencing a limited number of shared annotations, with an example being MAPK13 (cascade of cellular responses evoked by extracellular stimuli). This gene is also a target associated to the PANDAR ncRNA, therapeutically relevant because of its aberrant expression observed in various cancers. Overall, the non-metastatic SKMEL-2 map reveals post-treatment re-activation of a richer pathway landscape, involving cadherins and integrins as signatures of cell adhesion and proliferation. Relatively more lncRNAs were also annotated, indicating more complex regulation patterns in view of target identification. Finally, the antigen maps matched to DiP display other differential signatures with respect to the metastatic potential of the cell lines. In particular, as demethylated melanomas show connected targets that grow with the increased metastatic potential, also the potential target actionability seems to depend to some degree on the metastatic state. However, caution is required when assessing the direct influence of re-activated genes over the identified targets. In light of the stronger treatment effects observed in non-metastatic conditions, some limitations likely refer to in silico data integration tools and resources available for the analysis of tumor antigens.<h4>Conclusion</h4>Demethylation treatment strongly affects early melanoma progression by re-activating many genes. This evidence suggests that the efficacy of this type of therapeutic intervention is potentially high at the pre-metastatic stages. The biomarkers that can be assessed through antigens seem informative depending on the metastatic conditions, and networks help to elucidate the assessment of possible targets actionability.

Also flagged:Systemic lupus erythematosusSLEautoimmune diseaseautoantibodyFCGR3BCFHR4
Journal Article 2018-11-28 ✓ 4 Snippets Barbosa FB, Simioni M, Wiezel CEV, Torres FR, Molck MC, Bonilla MM, de Araujo TK, Donadi EA, Gil-da-Silva-Lopes VL, Lemos B, Simões AL.
In-Text Gene Mentions

Similar synergistic effect of losses in three other loci encompassing the RABGAP1L, C4, and a region on chromosome 10q21 with no genes in the interval, which resulted in a 5.5-fold increase in the risk for developing SLE compared to deletions in any loci [16].

Well-documented CNVs that increase risk for SLE include deletions in C4 [12] and FCGR3B [13] genes, while CNVs in other genes were associated with SLE in single-population studied, e.g., TLR7 [14], DEFB4 [15], RABGAP1L [16] and HLA-DRB5 [17].

…[ 15 ],RABGAP1L[ 16 ]…

…loci encompassing theRABGAP1L, C4 ,…

Show Full Abstract

Systemic lupus erythematosus (SLE) is an autoimmune disease with a strong genetic component and etiology characterized by chronic inflammation and autoantibody production. The purpose of this study was to ascertain copy number variation (CNV) in SLE using a case-control design in an admixed Brazilian population. The whole-genome detection of CNV was performed using Cytoscan HD array in SLE patients and healthy controls. The best CNV candidates were then evaluated by quantitative real-time PCR in a larger cohort or validated using droplet digital PCR. Logistic regression models adjusted for sex and ancestry covariates was applied to evaluate the association between CNV with SLE susceptibility. The data showed a synergistic effect between the FCGR3B and ADAM3A loci with the presence of deletions in both loci significantly increasing the risk to SLE (5.9-fold) compared to the deletion in the single FCGR3B locus (3.6-fold). In addition, duplications in these genes were indeed more frequent in healthy subjects, suggesting that high FCGR3B/ADAM3A gene copy numbers are protective factors against to disease development. Overall, 21 rare CNVs were identified in SLE patients using a four-step pipeline created for identification of rare variants. Furthermore, heterozygous deletions overlapping the CFHR4, CFHR5 and HLA-DPB2 genes were described for the first time in SLE patients. Here we present the first genome-wide CNV study of SLE patients in a tri-hybrid population. The results show that novel susceptibility loci to SLE can be found once the distribution of structural variants is analyzed throughout the whole genome.

Also flagged:gene expressioncell proliferationmineralizationalkaline phosphataseosteoblast differentiationossification
Journal Article 2018-11-28 No Snippets De-Ugarte L, Balcells S, Nogues X, Grinberg D, Diez-Perez A, Garcia-Giralt N.
Show Full Abstract

MicroRNAs (miRNAs) are important regulators of many cellular processes, including the differentiation and activity of osteoblasts, and therefore, of bone turnover. MiR-320a is overexpressed in osteoporotic bone tissue but its role in osteoblast function is unknown. In the present study, functional assays were performed with the aim to elucidate the mechanism of miR-320a action in osteoblastic cells. MiR-320a was either overexpressed or inhibited in human primary osteoblasts (hOB) and gene expression changes were evaluated through microarray analysis. In addition, the effect of miR-320a on cell proliferation, viability, and oxidative stress in hOB was evaluated. Finally, matrix mineralization and alkaline phosphatase activity were assessed in order to evaluate osteoblast functionality. Microarray results showed miR-320a regulation of a number of key osteoblast genes and of genes involved in oxidative stress. Regulation of osteoblast differentiation and ossification appeared as the best significant biological processes (PANTHER P value = 3.74E-05; and P value = 3.06E-04, respectively). The other enriched pathway was that of the cellular response to cadmium and zinc ions, mostly by the overexpression of metallothioneins. In hOBs, overexpression of miR-320a increased cell proliferation and oxidative stress levels whereas mineralization capacity was reduced. In conclusion, overexpression of miR-320a increased stress oxidation levels and was associated with reduced osteoblast differentiation and functionality, which could trigger an osteoporotic phenotype.

Also flagged:ICERHepatocellular carcinomaSofosbuvirdeathdecompensated cirrhosisHCC
Journal Article 2018-11-28 No Snippets Buti M, Domínguez-Hernández R, Casado MÁ, Sabater E, Esteban R.
Show Full Abstract

<h4>Background</h4>Elimination of hepatitis C virus (HCV) infection requires high diagnostic rates and universal access to treatment. Around 40% of infected individuals are unaware of their infection, which indicates that effective screening strategies are needed. We analyzed the efficiency (incremental cost-utility ratio, ICUR) of 3 HCV screening strategies: a) general population of adults, b) high-risk groups, and c) population with the highest anti-HCV prevalence plus high-risk groups.<h4>Methods</h4>An analytical decision model, projecting progression of the disease over a lifetime, was used to establish the candidate population for HCV screening. HCV data were obtained from the literature: anti-HCV prevalence (0.56%-1.54%), viremic patients (31.5%), and percentage of undiagnosed persons among those with viremia (35%). It was assumed that most patients would be treated and have HCV therapy response (98% SVR); transition probabilities, utilities, and disease management annual costs were obtained from the literature. Efficiency over the life of patients under the National Health System perspective was measured as quality-adjusted life years (QALY) and total cost (screening, diagnosis, pharmacological and disease management). A discount rate of 3% was applied to costs and outcomes.<h4>Results</h4>Screening of the adult population would identify a larger number of additional chronic hepatitis C cases (N = 52,694) than screening the highest anti-HCV prevalence population plus high-risk groups (N = 42,027) or screening high-risk groups (N = 26,128). ICUR for the general population vs. high-risk groups was €8914/QALY gained per patient (€18,157 incremental cost and 2.037 QALY). ICUR for the general population vs. population with highest anti-HCV prevalence plus high-risk groups was €7,448/QALY gained per patient (€7,733 incremental cost and 1.038 QALY). These ICUR values are below the accepted efficiency threshold (€22,000-€30,000).<h4>Conclusion</h4>HCV screening and treatment of the general adult population is cost-effective compared to screening of high-risk groups or the population with the highest anti-HCV prevalence plus high-risk groups.

Also flagged:tumoursTesticular germ cell tumoursseminomamitosiscell proliferationcell cycle
Journal Article 2018-11-28 ✓ 5 Snippets Liu C, Wei J, Xu K, Sun X, Zhang H, Xiong C.
In-Text Gene Mentions

CSE1L has been reported to be highly expressed in various tumours.

In melanogenesis, CSE1L links and regulates cAMP/PKA and Ras/ERK signal pathways to induce CREB and MITF expression.28 In another study, the CSE1L protein was found to interact with mutS homolog 6 (MSH6) and positively regulate the MSH6 protein to promote osteosarcoma progression.29 CSE1L, also as a microvesicle membrane protein, can be detected in tumour‐derived exosomes/microvesicles.10 Because tumour cells secrete exosomes/microvesicles more frequently than do normal cells, CSE1L can be used as a diagnostic marker for tumours.30

The CSE1L gene maps to 20q13, a chromosome region correlated with the development of solid tumours.16 CSE1L is highly expressed in various types of cancers, such as ovarian tumours,17 hepatocellular carcinoma (HCC),7 lymphomas,18 colorectal tumours,19 breast tumours,8 melanomas,20 bladder cancer,21 lung cancer,22 oligodendroglial tumours23 and thyroid tumours,24 and CSE1L expression is correlated with cancer grade, cancer stage and poor cancer outcome.25 However, the regulatory mechanism of the CSE1L signalling pathway on cancer progression is still obscure; only a few studies have reported on the interaction of CSE1L with other cancer signalling pathways.

After blocking, the cell slides were incubated with primary antibodies, including CSE1L (1:200; Abcam), α‐tubulin (1:500; Sigma), γ‐tubulin (1:200; Sigma) and serine‐10‐phosphorylated histone H3 (PH3; 1:500; CST, Boston, MA, USA).

CSE1L is significantly overexpressed in multiple types of tumours in comparison with their corresponding normal tissues, such as the colorectum, liver, breast, thyroid and ovary.18, 19, 24, 32, 33, 34 However, whether CSE1L plays a role in seminomas is unclear.

Show Full Abstract

<h4>Objectives</h4>CSE1L has been reported to be highly expressed in various tumours. Testicular germ cell tumours are common among young males, and seminoma is the major type. However, whether CSE1L has functions in the seminoma is unclear.<h4>Materials and methods</h4>The expression of CSE1L was detected by immunohistochemistry in seminoma tissues and non-tumour normal testis tissues from patients. CSE1L distribution during cell mitosis was determined by immunofluorescent staining with CSE1L, α-tubulin and γ-tubulin antibodies. The effects of Cse1L knockdown on cell proliferation and cell cycle progression were determined by Cell Counting Kit-8 assay, flow cytometry, PH3 staining and bromodeoxyuridine incorporation assay.<h4>Results</h4>CSE1L was significantly enriched in the seminoma tissue compared with the non-tumour normal testis tissue. CSE1L also co-localized with α-tubulin in the cells with a potential to divide. In the seminoma cell line TCam-2, CSE1L was associated with the spindles and the centrosomes during cell division. The knockdown of CSE1L in TCam-2 cells attenuated the cells' proliferative capacity. Cell cycle assay revealed that the CSE1L-deficient cells were mainly arrested in the G0/G1 phase and moderately delayed in the G2/M phase. The proportion of cells with multipolar spindle and abnormal spindle geometry was obviously increased by CSE1L expression silencing in the TCam-2 cells.<h4>Conclusions</h4>Overall, these findings showed that CSE1L plays a pivotal role in maintaining cell proliferation and cell division in seminomas.

Also flagged:IronMitochondriametabolismdeathorganellestransition metals
Journal Article 2018-11-28 No Snippets Ward DM, Cloonan SM.
Show Full Abstract

Mitochondria are an iconic distinguishing feature of eukaryotic cells. Mitochondria encompass an active organellar network that fuses, divides, and directs a myriad of vital biological functions, including energy metabolism, cell death regulation, and innate immune signaling in different tissues. Another crucial and often underappreciated function of these dynamic organelles is their central role in the metabolism of the most abundant and biologically versatile transition metals in mammalian cells, iron. In recent years, cellular and animal models of mitochondrial iron dysfunction have provided vital information in identifying new proteins that have elucidated the pathways involved in mitochondrial homeostasis and iron metabolism. Specific signatures of mitochondrial iron dysregulation that are associated with disease pathogenesis and/or progression are becoming increasingly important. Understanding the molecular mechanisms regulating mitochondrial iron pathways will help better define the role of this important metal in mitochondrial function and in human health and disease.

Also flagged:AIMcholesterolnonalcoholic fatty liver diseaseNAFLDsimplenonalcoholic steatohepatitis
Journal Article 2018-11-28 ✓ 1 Snippet Komatsu G, Nonomura T, Sasaki M, Ishida Y, Arai S, Miyazaki T.
In-Text Gene Mentions

…disorders such ashemochromatosisalso, but not…

Show Full Abstract

Owing to changes in lifestyle, nonalcoholic fatty liver disease (NAFLD) is becoming a common form of chronic liver injury. NAFLD comprises a wide variety of disease stages, from simple steatosis to nonalcoholic steatohepatitis, which is a risk factor for the development of hepatocellular carcinoma (HCC). Because animal models for NAFLD are needed to investigate the precise pathogenesis, we aimed to establish a new mouse model employing mice deficient for apoptosis inhibitor of macrophage (AIM<sup>-/-</sup>), which exhibit accelerated lipid storage in the liver and high susceptibility to developing HCC in response to a high-fat diet (HFD). AIM<sup>-/-</sup> mice were fed the D09100301 diet, which contains 40 kcal% fat (trans fat 30 kcal%), high cholesterol (2%), and 40 kcal% carbohydrates (20 kcal% fructose), and then features of obesity and NAFLD including steatosis, inflammation, fibrosis, and HCC development were analyzed. Although a comparable grade of liver steatosis was promoted in AIM<sup>-/-</sup> mice by the D09100301 diet and the standard HFD (60 kcal% largely lard fat), significantly less lipid storage in visceral fat was observed when the mice were fed the D09100301 diet. Accelerated liver inflammation was promoted by the D09100301 diet compared with the HFD, but interestingly, HCC development was decreased in mice fed the D09100301 diet. Our findings suggest that AIM<sup>-/-</sup> mice fed the D09100301 diet exhibited a phenotype that resembled nonobese NAFLD patients and thus could be an appropriate tool to study the pathophysiology by which obesity increases the risk of HCC.

Also flagged:Synapsessynaptic cleftorganizationperoxidasesynaptic cell adhesion proteinSynCAM 1
Journal Article 2018-11-28 ✓ 1 Snippet Cijsouw T, Ramsey AM, Lam TT, Carbone BE, Blanpied TA, Biederer T.
In-Text Gene Mentions

…3, Latrophilin-3, Contactin-1,Kilon, Hapln1, and Noelin-1,…

Show Full Abstract

Synapses are specialized neuronal cell-cell contacts that underlie network communication in the mammalian brain. Across neuronal populations and circuits, a diverse set of synapses is utilized, and they differ in their molecular composition to enable heterogenous connectivity patterns and functions. In addition to pre- and post-synaptic specializations, the synaptic cleft is now understood to be an integral compartment of synapses that contributes to their structural and functional organization. Aiming to map the cleft proteome, this study applied a peroxidase-mediated proximity labeling approach and used the excitatory synaptic cell adhesion protein SynCAM 1 fused to horseradish peroxidase (HRP) as a reporter in cultured cortical neurons. This reporter marked excitatory synapses as measured by confocal microcopy and was targeted to the edge zone of the synaptic cleft as determined using 3D dSTORM super-resolution imaging. Proximity labeling with a membrane-impermeant biotin-phenol compound restricted labeling to the cell surface, and Label-Free Quantitation (LFQ) mass spectrometry combined with ratiometric HRP tagging of membrane vs. synaptic surface proteins was used to identify the proteomic content of excitatory clefts. Novel cleft candidates were identified, and Receptor-type tyrosine-protein phosphatase zeta was selected and successfully validated. This study supports the robust applicability of peroxidase-mediated proximity labeling for synaptic cleft proteomics and its potential for understanding synapse heterogeneity in health and changes in diseases such as psychiatric disorders and addiction.

Also flagged:Synthesiscardiovascular diseasescancerspseudellone Cbisindole alkaloidtryptophan
Journal Article 2018-11-28 No Snippets Wang D, Neupane P, Ragnarsson L, Capon RJ, Lewis RJ.
Show Full Abstract

T-type calcium channel (Ca<sub>V</sub>3.x) blockers are receiving increasing attention as potential therapeutics for the treatment of pathophysiological disorders and diseases, including absence epilepsy, Parkinson's disease (PD), hypertension, cardiovascular diseases, cancers, and pain. However, few clinically approved Ca<sub>V</sub>3.x blockers are available, and selective pharmacological tools are needed to further unravel the roles of individual Ca<sub>V</sub>3.x subtypes. In this work, through an efficient synthetic route to the marine fungal product pseudellone C, we obtained bisindole alkaloid analogs of pseudellone C with a modified tryptophan moiety and identified two Ca<sub>V</sub>3.2 (<b>2</b>, IC<sub>50</sub> = 18.24 µM; <b>3</b>, IC<sub>50</sub> = 6.59 µM) and Ca<sub>V</sub>3.3 (<b>2</b>, IC<sub>50</sub> = 7.71 µM; <b>3</b>, IC<sub>50</sub> = 3.81 µM) selective blockers using a FLIPR cell-based assay measuring Ca<sub>V</sub>3.x window currents. Further characterization by whole-cell patch-clamp revealed a preferential block of Ca<sub>V</sub>3.1 activated current (<b>2</b>, IC<sub>50</sub> = 5.60 µM; <b>3</b>, IC<sub>50</sub> = 9.91 µM), suggesting their state-dependent block is subtype specific.

Also flagged:Gal 2defectseliquisgagtohProtein C
Journal Article 2018-11-28 ✓ 1 Snippet Robin P, Eddy M, Sikora L, Le Roux PY, Carrier M, Couturaud F, Planquette B, Pesavento R, Rodger M, Salaun PY, Le Gal G.
In-Text Gene Mentions

…(V Leiden mutation,ATIII/protein C/protein S deficienc…

Show Full Abstract

<h4>Background</h4>In patients with a first, unprovoked venous thromboembolism (VTE), the optimal duration of anticoagulant therapy (AT) is controversial due to tightly balanced risks and benefits of indefinite anticoagulation. The objective of this study is to assess among patients with a first acute pulmonary embolism (PE) who received ≥3 months of AT and thereafter had a planar lung scan, whether residual pulmonary vascular obstruction (RPVO) is associated with VTE recurrence after discontinuation of AT.<h4>Methods and analysis</h4>We will conduct a systematic review with a meta-analysis of individual participant data of contemporary studies evaluating the prognostic significance of RPVO in patients with a first acute PE. We will search from inception to 24 January 2018, PubMed, Medline, Embase and Cochrane's Central Registry for Randomized Controlled Trials, CENTRAL for randomized controlled trials and prospective cohort studies. Two reviewers will conduct all screening and data collection independently. The methodological quality and risk of bias of eligible studies will be carefully and rigorously assessed using the Risk Of Bias In Non-randomised Studies of Interventions tool. The primary objective will be to assess the relationship between RPVO on ventilation-perfusion scan after completion of at least 3 months of AT after an acute PE event, and the risk of an objectively confirmed symptomatic recurrent VTE (including deep vein thrombosis or PE) or death due to PE. The secondary objectives will include the assessment of the optimal RPVO cut-off and the risk of recurrent VTE, as well as the relationship between the relative change in RPVO between PE diagnosis and at discontinuation of AT (≥3 months) and risk of recurrent VTE.<h4>Ethics and dissemination</h4>This study of secondary data does not require ethics approval. It will be presented internationally and published in the peer-reviewed literature.<h4>Prospero registration number</h4>CRD42017081080.

Also flagged:IronEnd-Stage Renal DiseaseNAFLDsteatosisnonalcoholic steatohepatitisNASH
Journal Article 2018-11-28 ✓ 4 Snippets Rostoker G, Loridon C, Griuncelli M, Rabaté C, Lepeytre F, Ureña-Torres P, Issad B, Ghali N, Cohen Y.
In-Text Gene Mentions

Mesenchymal iron deposition is more common than hepatocellular iron accumulation in NASH and NAFLD, and hepatic iron accumulation has been linked to the severity of hepatic fibrosis (without any influence of the HFE gene) [1,2].

…influence of theHFEgene) [ 1…

…H63D, and S65CHFEgene mutations (Laboratory…

…H63D, or S65CHFEgene mutations.…

Show Full Abstract

<h4>Background</h4>Nonalcoholic fatty liver disease (NAFLD) is a spectrum of diseases including steatosis, nonalcoholic steatohepatitis (NASH), cirrhosis, and end-stage liver failure. Hepatic iron accumulation has been linked to hepatic fibrosis severity in NASH and NAFLD. Iron overload induced by parenteral (IV) iron therapy is a potential clinical problem in dialysis patients. We analyzed the hypothetical triggering and aggravating role of iron on NAFLD in patients on dialysis.<h4>Methods</h4>Liver iron concentration (LIC) and hepatic proton density fat fraction (PDFF) were analyzed prospectively in 68 dialysis patients by magnetic resonance imaging (MRI). Follow up of LIC and PDFF was performed in 17 dialysis patients during iron therapy.<h4>Findings</h4>PDFF differed significantly among dialysis patients classified according to LIC: patients with moderate or severe iron overload had increased fat fraction (PDFF: 7.9% (0.5-14.8%)) when compared to those with normal LIC (PDFF: 5% (0.27-11%)) or mild iron overload (PDFF: 5% (0.30-11.6%); P = 0.0049). PDFF correlated with LIC, and ferritin and body mass index. In seven patients monitored during IV iron therapy, LIC and PDFF increased concomitantly (PDFF: initial 2.5%, final 8%, P = 0.0156; LIC: initial 20 μmol/g, final 160 μmol/g: P = 0.0156), whereas in ten patients with iron overload, PDFF decreased after IV iron withdrawal or major dose reduction (initial: 8%, final: 4%; P = 0.0098) in parallel with LIC (initial: 195 μmol/g, final: 45 μmol/g; P = 0.002).<h4>Interpretation</h4>Liver iron load influences hepatic fat fraction in dialysis patients. Iron overload induced by iron therapy may aggravate or trigger NAFLD in dialysis patients.<h4>Trial registration number (isrctn)</h4>80100088.

Also flagged:autosomal dominant neurodegenerative disorderbehaviouralcognitive declineHDageingpathogenesis
Journal Article 2018-11-28 ✓ 5 Snippets Soares TR, Reis SD, Pinho BR, Duchen MR, Oliveira JMA.
In-Text Gene Mentions

Huntington’s Disease (HD) is a neurodegenerative disease caused by a CAG repeat expansion mutation in the exon 1 of the huntingtin (Htt) gene.

Consistently, expression of full-length Htt lacking a polyQ stretch (ΔQ-Htt) enhanced neuronal autophagy in HD mice (Hdh140Q/ΔQ) (Zheng et al., 2010), suggesting that polyQ expansion in Htt disrupts its physiological role as an autophagy-promoting scaffold.

K444 acetylation was found in mutant, but not wild-type, Htt, and was proposed to facilitate trafficking of mHtt into autophagosomes, increasing its autophagic clearance and reducing its toxic effects in primary neurons and in a C. elegans HD model (Jeong et al., 2009).

Caspase 6 cleaves Htt at the amino acid 586.

The activity of the protease caspase 6 is increased in HD (Graham et al., 2010), possibly because mHtt hinders the normal inhibitory binding of wild-type Htt to the proform of caspase 6 (Riechers et al., 2016).

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by a polyglutamine expansion mutation in the huntingtin protein. Expansions above 40 polyglutamine repeats are invariably fatal, following a symptomatic period characterised by choreiform movements, behavioural abnormalities, and cognitive decline. While mutant huntingtin (mHtt) is widely expressed from early life, most patients with HD present in mid-adulthood, highlighting the role of ageing in disease pathogenesis. mHtt undergoes proteolytic cleavage, misfolding, accumulation, and aggregation into inclusion bodies. The emerging model of HD pathogenesis proposes that the chronic production of misfolded mHtt overwhelms the chaperone machinery, diverting other misfolded clients to the proteasome and the autophagy pathways, ultimately leading to a global collapse of the proteostasis network. Multiple converging hypotheses also implicate ageing and its impact in the dysfunction of organelles as additional contributing factors to the collapse of proteostasis in HD. In particular, mitochondrial function is required to sustain the activity of ATP-dependent chaperones and proteolytic machinery. Recent studies elucidating mitochondria-endoplasmic reticulum interactions and uncovering a dedicated proteostasis machinery in mitochondria, suggest that mitochondria play a more active role in the maintenance of cellular proteostasis than previously thought. The enhancement of cytosolic proteostasis pathways shows promise for HD treatment, protecting cells from the detrimental effects of mHtt accumulation. In this review, we consider how mHtt and its post translational modifications interfere with protein quality control pathways, and how the pharmacological and genetic modulation of components of the proteostasis network impact disease phenotypes in cellular and in vivo HD models.

Also flagged:immune responsesreceptorspeptideMHC class IglycolipidCD1d
Journal Article 2018-11-28 ✓ 1 Snippet Shissler SC, Webb TJ.
In-Text Gene Mentions

Roquin-1

Show Full Abstract

Natural killer T (NKT) cells are innate-like lymphocytes that bridge the gap between the innate and adaptive immune responses. Like innate immune cells, they have a mature, effector phenotype that allows them to rapidly respond to threats, compared to adaptive cells. NKT cells express T cell receptors (TCRs) like conventional T cells, but instead of responding to peptide antigen presented by MHC class I or II, NKT cell TCRs recognize glycolipid antigen in the context of CD1d. NKT cells are subdivided into classes based on their TCR and antigen reactivity. This review will focus on type I iNKT cells that express a semi invariant Vα14Jα18 TCR and respond to the canonical glycolipid antigen, α-galactosylceramide. The innate-like effector functions of these cells combined with their T cell identity make their developmental path quite unique. In addition to the extrinsic factors that affect iNKT cell development such as lipid:CD1d complexes, co-stimulation, and cytokines, this review will provide a comprehensive delineation of the cell intrinsic factors that impact iNKT cell development, differentiation, and effector functions - including TCR rearrangement, survival and metabolism signaling, transcription factor expression, and gene regulation.

Also flagged:Sialic acidsmembranescarbonmonosaccharidesialic acidneuraminic acid
Journal Article 2018-11-28 No Snippets Schauer R, Kamerling JP.
Show Full Abstract

Sialic acids are cytoprotectors, mainly localized on the surface of cell membranes with multiple and outstanding cell biological functions. The history of their structural analysis, occurrence, and functions is fascinating and described in this review. Reports from different researchers on apparently similar substances from a variety of biological materials led to the identification of a 9-carbon monosaccharide, which in 1957 was designated "sialic acid." The most frequently occurring member of the sialic acid family is N-acetylneuraminic acid, followed by N-glycolylneuraminic acid and O-acetylated derivatives, and up to now over about 80 neuraminic acid derivatives have been described. They appeared first in the animal kingdom, ranging from echinoderms up to higher animals, in many microorganisms, and are also expressed in insects, but are absent in higher plants. Sialic acids are masks and ligands and play as such dual roles in biology. Their involvement in immunology and tumor biology, as well as in hereditary diseases, cannot be underestimated. N-Glycolylneuraminic acid is very special, as this sugar cannot be expressed by humans, but is a xenoantigen with pathogenetic potential. Sialidases (neuraminidases), which liberate sialic acids from cellular compounds, had been known from very early on from studies with influenza viruses. Sialyltransferases, which are responsible for the sialylation of glycans and elongation of polysialic acids, are studied because of their significance in development and, for instance, in cancer. As more information about the functions in health and disease is acquired, the use of sialic acids in the treatment of diseases is also envisaged.

Also flagged:Porphyria Cutanea Tardahemeenzymeuroporphyrinogen decarboxylaseURODtype 2 PCT
Journal Article 2018-11-28 ✓ 2 Snippets Weiss Y, Chen B, Yasuda M, Nazarenko I, Anderson KE, Desnick RJ.
In-Text Gene Mentions

…genetic traits (e.g.hemochromatosismutations) can increase…

HFE

Show Full Abstract

Porphyria Cutanea Tarda (PCT) is a cutaneous porphyria that results from the hepatic inhibition of the heme biosynthetic enzyme uroporphyrinogen decarboxylase (UROD), and can occur either in the absence or presence of an inherited heterozygous UROD mutation (PCT subtypes 1 and 2, respectively). A heterozygous UROD mutation causes half-normal levels of UROD activity systemically, which is a susceptibility factor but is not sufficient alone to cause type 2 PCT. In both Types 1 and 2 PCT, the cutaneous manifestations are precipitated by additional factors that lead to generation of an inhibitor that more profoundly reduces hepatic UROD activity. PCT is an iron-related disorder, and many of its known susceptibility factors, which include infections (e.g. hepatitis C virus, HIV), high alcohol consumption, smoking, estrogens, and genetic traits (e.g. hemochromatosis mutations) can increase hepatic iron accumulation. Hepatoerythropoietic Porphyria (HEP) is a rare autosomal recessive disease that results from homozygosity or compound heterozygosity for UROD mutations and often causes infantile or childhood onset of both erythropoietic and cutaneous manifestations. During the 11-year period from 01/01/2007 through 12/31/2017, the Mount Sinai Porphyrias Diagnostic Laboratory provided molecular diagnostic testing for 387 unrelated patients with PCT and four unrelated patients with HEP. Of the 387 unrelated individuals tested for Type 2 PCT, 79 (20%) were heterozygous for UROD mutations. Among 26 family members of mutation-positive PCT patients, eight (31%) had the respective family mutation. Additionally, of the four unrelated HEP patients referred for UROD mutation analyses, all had homozygosity or compound heterozygosity for UROD mutations, and all eight asymptomatic family members were heterozygotes for UROD mutations. Of the UROD mutations identified, 19 were novel, including nine missense, two nonsense, one consensus splice-site, and seven insertions and deletions. These results expand the molecular heterogeneity of PCT and HEP by adding a total of 19 novel UROD mutations. Moreover, the results document the usefulness of molecular testing to confirm a genetic susceptibility trait in Type 2 PCT, confirm a diagnosis in HEP, and identify heterozygous family members.

Also flagged:membraneamino acidsfructosecarbohydratesmineralslipid
Journal Article 2018-11-28 ✓ 1 Snippet Kasimanickam RK, Kasimanickam VR, Arangasamy A, Kastelic JP.
In-Text Gene Mentions

…TIMP, AKI andPEBP1were higher for…

Show Full Abstract

Sperm are highly specialized compartmentalized cells, with unique compositional, morphological and functional properties, including a plasma membrane that undergoes dynamic protein remodeling and surface modifications. Seminal plasma is a highly complex biological fluid containing proteins, amino acids, enzymes, fructose and other carbohydrates, lipids, major minerals and trace elements. Seminal plasma proteins are involved in regulation of osmotic pressure and pH of seminal plasma, transport of ions, lipid and hormones. The objective was to compare sperm and seminal plasma proteomes of bulls with differing fertility and to relate differences to biological processes. Semen was collected from bulls with high or low fertility (4 bulls in each category). Sperm and seminal plasma proteins were isolated, purified, subjected to 2-D gel electrophoresis, protein identification and ontology. In sperm and seminal plasma, binder of sperm proteins (BSP)-1, -3 and -5, and spermadhesin-1, ALB, TIMP, AKI and PEBP1 were higher for high-versus low-fertility bulls (P < 0.05), whereas proteins CLU, CCT5 and 8, ELSPbP1, and PSMA6 were more abundant in sperm and seminal plasma of low- versus high-fertility bulls (P < 0.05). Further, HSP90, ZFP34, IFNRF4, BCL62, NADHD, TUBB3 and Histone H1 were in greater abundance in sperm of high- compared with low-fertility bulls. The two key biological processes of proteins differentially expressed in high- and low-fertility bulls were metabolic processes and biological regulation. The most prominent molecular functions for proteins that differed are binding, catalytic and receptor activities. The main cellular components for proteins that differed are cellular, extracellular, and plasma membrane. Since protein content differed in high- versus low-fertility bulls, we inferred that the efficiency of associated sperm functions that are necessary for fertility may also differ between high- and low-fertility semen. In conclusion, differences between high- and low-fertility bulls regarding abundance of sperm and seminal plasma proteins likely contributed to differences in fertility.

Also flagged:Indoxyl SulfateArterial ThrombosisPAI-1Platelet ActivationSIRT3chronic kidney disease
Journal Article 2018-11-28 ✓ 1 Snippet Karbowska M, Kaminski TW, Znorko B, Domaniewski T, Misztal T, Rusak T, Pryczynicz A, Guzinska-Ustymowicz K, Pawlak K, Pawlak D.
In-Text Gene Mentions

…and activity ofATIII.…

Show Full Abstract

Patients suffering from chronic kidney disease (CKD) are at a 20-fold higher risk of dying due to cardiovascular diseases (CVDs), primarily thrombosis following vascular injury. CKD is connected with retention of uremic toxins, especially indoxyl sulfate (IS), which are currently considered as a non-classical CKD-specific risk factor for CVDs. The present study aimed to examine the effect of chronic exposure to IS on the hemostatic system and arterial thrombosis in a model without greater interferences from the uremic milieu consisting of additional uremic toxins. Forty-eight male Wistar Crl:WI (cmdb) rats were divided into three groups: one control group and two experimental groups, which were exposed to 100 or 200 mg/kg of b.w./day of IS in drinking water for a period of 28 days. The control group received water without IS. At the end of the experiment, the induction of arterial thrombosis was performed. We investigated the impact of IS on thrombosis incidence, kinetics and strength of clot formation, platelet activity, aortic contents of sirtuin (SIRT) 1 and sirtuin 3 (SIRT3), hemostatic system, cardiorespiratory parameters, biochemistry of plasma and urine as well as histology of the thrombus, kidney, and liver. Obtained data revealed that chronic exposure to IS promotes arterial thrombosis via increased levels of complex tissue factor/factor VII, plasminogen activator inhibitor-1 (PAI-1), platelet activation, as well as decreased aortic levels of SIRT1 and SIRT3. Therefore, we hypothesize that IS enhances primary hemostasis leading to augmented formation of platelet plug with increased amounts of fibrin and affects secondary hemostasis through the influence on plasma coagulation and fibrinolysis factors, which results in the increased kinetics and strength of clot formation. The findings described may contribute to a better understanding of the mechanisms leading to increased thrombotic events in patients with CKD with elevated levels of IS.

Also flagged:cervical cancerMAPKPI3KAktmTORestrogen cancer
Journal Article 2018-11-28 No Snippets Chen Q, Zeng X, Huang D, Qiu X.
Show Full Abstract

<h4>Background and aim</h4>Previous studies have suggested that lymph node metastasis (LNM) in early-stage cervical cancer (CESC) may affect the prognosis of patients and the outcomes of subsequent adjuvant therapy. However, research focused on miRNA expression in early-stage CESC patients with LNM remains limited. Therefore, it is necessary to identify prognostic miRNAs and determine their molecular mechanisms.<h4>Methods</h4>We evaluated the differentially expressed genes in early-stage CESC patients with LNM compared to patients without LNM and evaluated the prognostic significance of these differentially expressed genes by analyzing a public dataset from The Cancer Genome Atlas. Potential molecular mechanisms were investigated by gene ontology, the Kyoto Encyclopedia of Genes and Genomes, and protein-protein interaction network analyses.<h4>Results</h4>According to the The Cancer Genome Atlas data, hsa-miR-508, hsa-miR-509-2, and hsa-miR-526b expression levels were significantly lower in early-stage CESC patients with LNM than in patients without LNM. A multivariate analysis suggested that three miRNAs were prognostic factors for CESC (<i>P</i><0.05). The target genes were identified to be involved in the MAPK, cAMP, PI3K/Akt, mTOR, and estrogen cancer signaling pathways. Protein-protein interaction network analysis showed that TP53, MMP1, NOTCH1, SMAD4, and NFKB1 were the most significant hub proteins.<h4>Conclusion</h4>Our results indicate that hsa-miR-508, hsa-miR-509-2, and hsa-miR-526b may be potential diagnostic biomarkers for early-stage CESC with LNM, and serve as prognostic predictors for patients with CESC.

Also flagged:NRF2neurodegenerative disordersoxygenamyotrophic lateral sclerosisALSstroke
Journal Article 2018-11-28 ✓ 5 Snippets Sivandzade F, Prasad S, Bhalerao A, Cucullo L.
In-Text Gene Mentions

HD gene (huntingtin) presents an atypical expansion of cytosine, adenine, and guanine (CAG) trinucleotide repeats encoding for an abnormally elongated poly-glutamine (polyQ) stretch present at the N-terminal of the huntingtin protein (Htt).

Moreover, Htt stimulates the transport of NF-κB out of dendritic spines and supports a high level of active NF-κB in neuronal nuclei in the HD model [149].

…the huntingtin protein (Htt).…

…of this mutantHtt(mHtt) [144] while…

…al. demonstrated thatHttaggregation directly enhanced…

Show Full Abstract

Electrophiles and reactive oxygen species (ROS) play a major role in modulating cellular defense mechanisms as well as physiological functions, and intracellular signaling. However, excessive ROS generation (endogenous and exogenous) can create a state of redox imbalance leading to cellular and tissue damage (Ma and He, 2012) [1]. A growing body of research data strongly suggests that imbalanced ROS and electrophile overproduction are among the major prodromal factors in the onset and progression of several cerebrovascular and neurodegenerative disorders such as amyotrophic lateral sclerosis (ALS), stroke, Alzheimer's disease (AD), Parkinson's disease (PD), and aging (Ma and He, 2012; Ramsey et al., 2017; Salminen et al., 2012; Sandberg et al., 2014; Sarlette et al., 2008; Tanji et al., 2013) [1-6]. Cells offset oxidative stress by the action of housekeeping antioxidative enzymes (such as superoxide dismutase, catalase, glutathione peroxidase) as well direct and indirect antioxidants (Dinkova-Kostova and Talalay, 2010) [7]. The DNA sequence responsible for modulating the antioxidative and cytoprotective responses of the cells has been identified as the antioxidant response element (ARE), while the nuclear factor erythroid 2-related factor (NRF2) is the major regulator of the xenobiotic-activated receptor (XAR) responsible for activating the ARE-pathway, thus defined as the NRF2-ARE system (Ma and He, 2012) [1]. In addition, the interplay between the NRF2-ARE system and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-ĸB, a protein complex that controls cytokine production and cell survival), has been further investigated in relation to neurodegenerative and neuroinflammatory disorders. On these premises, we provide a review analysis of current understanding of the NRF2-NF-ĸB interplay, their specific role in major CNS disorders, and consequent therapeutic implication for the treatment of neurodegenerative and cerebrovascular diseases.

Also flagged:Alzheimer's diseaseHuntington's diseaseHDneurodegenerative disorderneurodegenerative diseasesAD
Journal Article 2018-11-28 ✓ 2 Snippets Menéndez-González M, Clarimón J, Rosas-Allende I, Blázquez M, San Martín ES, García-Fernández C, Lleó A, Dols-Icardo O, Illán-Gala I, Morís G, Ribacoba R, Álvarez V, Martínez C.
In-Text Gene Mentions

HTTgene intermediate alleles…

…repeats in theHTTgene.…

Show Full Abstract

Huntington's disease (HD) is an autosomal progressive neurodegenerative disorder caused by the expansion of CAG repeats in the HTT gene. Intermediate alleles (IAs) are in the range of 27-35 repeats and have been associated to a normal phenotype. The aim of this work was to analyze the association between intermediate huntingtin CAG-repeat alleles (IAs) and neurodegenerative diseases, other than HD. We screened the HTT CAG repeats in patients with Alzheimer's disease (AD) (n = 1126), Parkinson's disease (PD) (n = 610), and frontotemporal lobar degeneration (FTLD) (n = 225). We also studied 509 healthy controls (HCs). The relative frequency of IAs for each group was 6.03% in AD, 5.3% in FTLD, 3.5% in PD, and 2.9% in HCs. The frequency of IA was significantly higher among patients with AD when compared to HCs (p = 0.011, OR = 2.11, 95% CI = 1.19-3.74); no significant difference was observed in FTLD (p = 0.17; OR = 1.88, 95% CI = 0.85-4.03) and PD (p = 0.69; OR = 1.21; 95% CI (0.61-2.37) versus HCs. No atypical symptoms or clinical features distinctive of HD were found among carriers of IAs. We found 3 cases with CAG expansions within the pathological range, one diagnosed with AD, one with PD, and one with FTD. Results suggest that IAs might have a role in the pathogenesis of AD. In addition, HD patients might be misdiagnosed with other neurodegenerative diseases, particularly when CAG repeats are in the lower pathological range.

Also flagged:Hemoglobiniron-deficiency anemiairon deficiencyglucoseironanemia
Journal Article 2018-11-28 ✓ 1 Snippet Intra J, Limonta G, Cappellini F, Bertona M, Brambilla P.
In-Text Gene Mentions

…autoimmune disorders, andhemochromatosiswere excluded on…

Show Full Abstract

Previous studies have suggested that iron-deficiency anemia affects glycosylated hemoglobin (HbA1c) measurements, but the results were contradictory. We conducted a retrospective case-control study to determine the effects of iron deficiency on HbA1c levels. Starting with the large computerized database of the Italian Hospital of Desio, including data from 2000 to 2016, all non-pregnant individuals older than 12 years of age with at least one measurement of HbA1c, cell blood count, ferritin, and fasting blood glucose on the same date of blood collection were enrolled. A total of 2,831 patients met the study criteria. Eighty-six individuals were diagnosed with iron-deficiency anemia, while 2,745 had a normal iron state. The adjusted means of HbA1c were significantly higher in anemic subjects (5.59% [37.37 mmol/mol]), than those measured in individuals without anemia (5.34% [34.81 mmol/mol]) (<i>P</i><0.0001). These results suggest that clinicians should be cautious about diagnosing prediabetes and diabetes in individuals with anemia.

Also flagged:S1-1S12S13ESIMPApolyesters
Journal Article 2018-11-28 No Snippets Wu Z, Liu D, Huang J, Proksch P, Zhu K, Lin W.
Show Full Abstract

Bioassay-guided fractionation and chromatographic separation of a sponge-derived fungus <i>Hansfordia sinuosae</i>, resulted in the isolation of thirteen new polyesters namely hansforesters A-M (1-13), along with five known analogues involving ascotrichalactone A, ascotrichester B, 15G256π, 6<i>R</i>-hydroxymellein, and (-)orthosporin. The structures of the new compounds were determined through extensive spectroscopic analysis, in addition to the chemical conversion for the configurational assignment. The polyesters incorporating the motifs of orsellinic acid, 2,4-dihydroxy-6-acetonylbenzoic acid, and orcinotriol were found from nature for the first time. Hansforester A (1) and ascotrichalactone A exhibited potent inhibition against a panel of bacterial strains, including the agricultural pathogenic bacteria, <i>Pseudomonas lachrymans</i>, <i>Agrobacterium tumefaciens</i>, <i>Xanthomonas vesicatoria</i>, and <i>Ralstonia solanacearum</i>, with the MIC values of 15.6 μM, and the human infected bacterium <i>Staphylococcus aureus</i> with the MIC values of 3.9 μM. These findings suggested that hansforester A and ascotrichalactone A are the potential leads to be developed as the antibacterial agents for the treatment of agriculture bacterial pathogens.

bioRxiv 2018-11-28 Preprint (No Snippets API) Raghavan NS, Vardarajan B, Mayeux R.
Show Full Abstract

<h4>Objective</h4> To determine the putative protective relationship of educational attainment on Alzheimer’s disease (AD) risk using Mendelian randomization, and to test the hypothesis that by using genetic regions surrounding individually associated SNPs as the instrumental variable we can identify genes that contribute to the relationship. <h4>Methods</h4> We performed Mendelian randomization using genome-wide association study summary statistics from studies of educational attainment and AD in two stages. Our instrumental variable comprised of i) 1,271 SNPs significantly associated with educational attainment and ii) individual 2Mb regions surrounding the genome-wide significant SNPs. <h4>Results</h4> A causal inverse relationship between educational attainment and AD was identified by the 1,271 SNPs (odds ratio = 0.63; 95% CI, 0.54-0.74; p =4.08×10 −8 ). Analysis of individual loci identified six regions that significantly replicated the causal relationship. Genes within these regions included LRRC2 , SSBP2 , and NEGR1 ; the latter a regulator of neuronal growth. <h4>Conclusions</h4> Educational attainment is an important protective factor for AD. Genomic regions that significantly paralleled the overall causal relationship contain genes expressed in neurons or involved in the regulation of neuronal development.

bioRxiv 2018-11-28 Preprint (No Snippets API) Arnau-Soler A, Macdonald-Dunlop E, Adams MJ, Clarke T, MacIntyre DJ, Milburn K, Navrady L, Scotland G, Major Depressive Disorder Working Group of the Psychiatric Genomics Consortium, Hayward C, McIntosh AM, Thomson PA.
Show Full Abstract

<h4>ABSTRACT</h4> Stress is associated with poorer physical and mental health. To improve our understanding of this link, we performed genome-wide association studies (GWAS) of depressive symptoms and genome-wide by environment interaction studies (GWEIS) of depressive symptoms and stressful life events (SLE) in two UK population cohorts (Generation Scotland and UK Biobank). No SNP was individually significant in either GWAS, but gene-based tests identified six genes associated with depressive symptoms in UK Biobank ( DCC, ACSS3, DRD2, STAG1, FOXP2 and KYNU; p < 2.77×10 -6 ). Two SNPs with genome-wide significant GxE effects were identified by GWEIS in Generation Scotland: rs12789145 (53kb downstream PIWIL4; p = 4.95×10 -9 ; total SLE) and rs17070072 (intronic to ZCCHC2; p = 1.46×10 -8 ; dependent SLE). A third locus upstream CYLC2 (rs12000047 and rs12005200, p < 2.00×10 -8 ; dependent SLE) when the joint effect of the SNP main and GxE effects was considered. GWEIS gene-based tests identified: MTNR1B with GxE effect with dependent SLE in Generation Scotland; and PHF2 with the joint effect in UK Biobank ( p < 2.77×10 -6 ). Polygenic risk scores (PRS) analyses incorporating GxE effects improved the prediction of depressive symptom scores, when using weights derived from either the UK Biobank GWAS of depressive symptoms ( p = 0.01) or the PGC GWAS of major depressive disorder ( p = 5.91×10 -3 ). Using an independent sample, PRS derived using GWEIS GxE effects provided evidence of shared aetiologies between depressive symptoms and schizotypal personality, heart disease and COPD. Further such studies are required and may result in improved treatments for depression and other stress-related conditions.

Also flagged:peptideAlzheimer diseaseADneurodegenerative disorderagingsynapse
Journal Article 2018-11-27 No Snippets Butterfield DA, Boyd-Kimball D.
Show Full Abstract

Alzheimer disease (AD) is a progressive neurodegenerative disorder associated with aging and characterized pathologically by the presence of senile plaques, neurofibrillary tangles, and neurite and synapse loss. Amyloid beta-peptide (1-42) [Aβ(1-42)], a major component of senile plaques, is neurotoxic and induces oxidative stress in vitro and in vivo. Redox proteomics has been used to identify proteins oxidatively modified by Aβ(1-42) in vitro and in vivo. In this review, we discuss these proteins in the context of those identified to be oxidatively modified in animal models of AD, and human studies including familial AD, pre-clinical AD (PCAD), mild cognitive impairment (MCI), early AD, late AD, Down syndrome (DS), and DS with AD (DS/AD). These redox proteomics studies indicate that Aβ(1-42)-mediated oxidative stress occurs early in AD pathogenesis and results in altered antioxidant and cellular detoxification defenses, decreased energy yielding metabolism and mitochondrial dysfunction, excitotoxicity, loss of synaptic plasticity and cell structure, neuroinflammation, impaired protein folding and degradation, and altered signal transduction. Improved access to biomarker imaging and the identification of lifestyle interventions or treatments to reduce Aβ production could be beneficial in preventing or delaying the progression of AD. This article is part of the special issue "Proteomics".

Also flagged:cpsAlytAcpsBuptakepneumoniaeacute otitis media
Journal Article 2018-11-27 No Snippets Quirk SJ, Haraldsson G, Erlendsdóttir H, Hjálmarsdóttir MÁ, van Tonder AJ, Hrafnkelsson B, Sigurdsson S, Bentley SD, Haraldsson Á, Brueggemann AB, Kristinsson KG.
Show Full Abstract

Vaccination with pneumococcal conjugate vaccines (PCVs) disrupts the pneumococcal population. Our aim was to determine the impact of the 10-valent PCV on the serotypes, genetic lineages, and antimicrobial susceptibility of pneumococci isolated from children in Iceland. Pneumococci were collected between 2009 and 2017 from the nasopharynges of healthy children attending 15 day care centers and from the middle ears (MEs) of children with acute otitis media from the greater Reykjavik capital area. Isolates were serotyped and tested for antimicrobial susceptibility. Whole-genome sequencing (WGS) was performed on alternate isolates from 2009 to 2014, and serotypes and multilocus sequence types (STs) were extracted from the WGS data. Two study periods were defined: 2009 to 2011 (PreVac) and 2012 to 2017 (PostVac). The overall nasopharyngeal carriage rate was similar between the two periods (67.3% PreVac and 61.5% PostVac, <i>P</i> = 0.090). Vaccine-type (VT) pneumococci decreased and nonvaccine-type (NVT) pneumococci (serotypes 6C, 15A, 15B/C, 21, 22F, 23A, 23B, 35F, and 35B) significantly increased in different age strata post-PCV introduction. The total number of pneumococci recovered from ME samples significantly decreased as did the proportion that were VTs, although NVT pneumococci (6C, 15B/C, 23A, and 23B) increased significantly. Most serotype 6C pneumococci were multidrug resistant (MDR). Serotype 19F was the predominant serotype associated with MEs, and it significantly decreased post-PCV introduction: these isolates were predominantly MDR and of the Taiwan<sup>19F</sup>-14 PMEN lineage. Overall, the nasopharyngeal carriage rate remained constant and the number of ME-associated pneumococci decreased significantly post-PCV introduction; however, there was a concomitant and statistically significant shift from VTs to NVTs in both collections of pneumococci.

Also flagged:amoxicillinhydroxyapatitebone infectionsNanohydroxyapatitesodium alginatepolyvinyl alcohol
Journal Article 2018-11-27 No Snippets Prasanna APS, Venkatasubbu GD.
Show Full Abstract

Hydroxyapatite (HAP) is the main constituent of human bone and teeth. Hydroxyapatite nanoparticles are used for the treatment of various bone infections. Nanohydroxyapatite is a biocompatible material. It is used as a drug carrier for drugs and biomolecules for various diseases. Hydroxyapatite nanoparticles are made into nanocomposite with sodium alginate and polyvinyl alcohol. This nanocomposite is used for the sustained release of drugs. It is characterized by various characterization techniques like XRD, FTIR, TEM, and Raman. Hydroxyapatite nanoparticles are coated initially with polyvinyl alcohol and then coated with sodium alginate. Amoxicillin is used as the model drug. Studies on the drug loading and drug release have been done. The release of the drug is sustained for about 30 days. Antimicrobial studies have shown good activity against pathogens. The zone of inhibition is found to be 18 mm for a concentration of 500 µg against Bacillus subtilis and 16 µg against Klebsiella pneumonia.

Also flagged:GUCY2FHIC1CBFCKAP5PPM1DPPM1E
Journal Article 2018-11-27 ✓ 4 Snippets Simonetti G, Padella A, do Valle IF, Fontana MC, Fonzi E, Bruno S, Baldazzi C, Guadagnuolo V, Manfrini M, Ferrari A, Paolini S, Papayannidis C, Marconi G, Franchini E, Zuffa E, Laginestra MA, Zanotti F, Astolfi A, Iacobucci I, Bernardi S, Sazzini M, Ficarra E, Hernandez JM, Vandenberghe P, Cools J, Bullinger L, Ottaviani E, Testoni N, Cavo M, Haferlach T, Castellani G, Remondini D, Martinelli G.
In-Text Gene Mentions

MLLT10

RC3H1

A panel of genes was related to AML pathogenesis (Fig. 5A); they included HOX transcription factors, the KMT2A partner MLLT10, and the DNA hydroxymethylation regulator WT1, which showed lower expression in A‐AML.

…the KMT2A partnerMLLT10, and the…

Show Full Abstract

<h4>Background</h4>Aneuploidy occurs in more than 20% of acute myeloid leukemia (AML) cases and correlates with an adverse prognosis.<h4>Methods</h4>To understand the molecular bases of aneuploid acute myeloid leukemia (A-AML), this study examined the genomic profile in 42 A-AML cases and 35 euploid acute myeloid leukemia (E-AML) cases.<h4>Results</h4>A-AML was characterized by increased genomic complexity based on exonic variants (an average of 26 somatic mutations per sample vs 15 for E-AML). The integration of exome, copy number, and gene expression data revealed alterations in genes involved in DNA repair (eg, SLX4IP, RINT1, HINT1, and ATR) and the cell cycle (eg, MCM2, MCM4, MCM5, MCM7, MCM8, MCM10, UBE2C, USP37, CK2, CK3, CK4, BUB1B, NUSAP1, and E2F) in A-AML, which was associated with a 3-gene signature defined by PLK1 and CDC20 upregulation and RAD50 downregulation and with structural or functional silencing of the p53 transcriptional program. Moreover, A-AML was enriched for alterations in the protein ubiquitination and degradation pathway (eg, increased levels of UHRF1 and UBE2C and decreased UBA3 expression), response to reactive oxygen species, energy metabolism, and biosynthetic processes, which may help in facing the unbalanced protein load. E-AML was associated with BCOR/BCORL1 mutations and HOX gene overexpression.<h4>Conclusions</h4>These findings indicate that aneuploidy-related and leukemia-specific alterations cooperate to tolerate an abnormal chromosome number in AML, and they point to the mitotic and protein degradation machineries as potential therapeutic targets.

Also flagged:HuntingtinNeurodegenerative DiseaseHuntington's diseaseHDoxygenmitochondrial
Journal Article 2018-11-27 No Snippets Maiuri T, Bowie LE, Truant R.
Show Full Abstract

A new hypothesis for the mechanism of Huntington's disease (HD) is driven by a small molecule lead that may connect age-associated reactive oxygen stress, oxidative DNA damage, and mitochondrial dysfunction. These pathways have also recently been defined in genome-wide association studies of cytosine-adenine-guanine-expansion polyglutamine neurodegenerative diseases, including HD and the spinocerebellar ataxias. We discuss how N6-furfuryladenine (N6FFA) nucleotide salvage and role as a kinase neosubstrate may have important mechanistic implications for both HD and familial Parkinson's disease. N6FFA highlights a mechanism of how energy dysregulation and protein misfolding in neurodegeneration may be the effect of age-associated reactive oxygen species damage to DNA and part of a feedback loop augmenting with aging.

Also flagged:Shiga toxinsmembraneglycansShiga-like toxins1glycolipid
Journal Article 2018-11-27 ✓ 5 Snippets Tian S, Muneeruddin K, Choi MY, Tao L, Bhuiyan RH, Ohmi Y, Furukawa K, Furukawa K, Boland S, Shaffer SA, Adam RM, Dong M.
In-Text Gene Mentions

UGCG may also flip GlcCer into the lumen side of the Golgi, where β-1,4-galactosyltransferase 5 (B4GALT5) then catalyzes the transfer of a galactose from UDP-galactose onto GlcCer to generate lactosylceramide (LacCer), which is the precursor for both globo-series and ganglio-series of glycosphingolipids.

…EMC1 (4831005), andB4GALT5(30915234) were purchased…

…full-length A4GALT andB4GALT5with triple-FLAG tag…

…encoding FLAG-tagged A4GALT,B4GALT5, or a chimeric…

…): A4GALT ,B4GALT5, SLC35A2 ,…

Show Full Abstract

Glycosylation is a fundamental modification of proteins and membrane lipids. Toxins that utilize glycans as their receptors have served as powerful tools to identify key players in glycosylation processes. Here, we carried out Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9-mediated genome-wide loss-of-function screens using two related bacterial toxins, Shiga-like toxins (Stxs) 1 and 2, which use a specific glycolipid, globotriaosylceramide (Gb3), as receptors, and the plant toxin ricin, which recognizes a broad range of glycans. The Stxs screens identified major glycosyltransferases (GTs) and transporters involved in Gb3 biosynthesis, while the ricin screen identified GTs and transporters involved in N-linked protein glycosylation and fucosylation. The screens also identified lysosomal-associated protein transmembrane 4 alpha (LAPTM4A), a poorly characterized four-pass membrane protein, as a factor specifically required for Stxs. Mass spectrometry analysis of glycolipids and their precursors demonstrates that LAPTM4A knockout (KO) cells lack Gb3 biosynthesis. This requirement of LAPTM4A for Gb3 synthesis is not shared by its homolog lysosomal-associated protein transmembrane 4 beta (LAPTM4B), and switching the domains between them determined that the second luminal domain of LAPTM4A is required, potentially acting as a specific "activator" for the GT that synthesizes Gb3. These screens also revealed two Golgi proteins, Transmembrane protein 165 (TMEM165) and Transmembrane 9 superfamily member 2 (TM9SF2), as shared factors required for both Stxs and ricin. TMEM165 KO and TM9SF2 KO cells both showed a reduction in not only Gb3 but also other glycosphingolipids, suggesting that they are required for maintaining proper levels of glycosylation in general in the Golgi. In addition, TM9SF2 KO cells also showed defective endosomal trafficking. These studies reveal key Golgi proteins critical for regulating glycosylation and glycolipid synthesis and provide novel therapeutic targets for blocking Stxs and ricin toxicity.

Also flagged:urinary stonesbacterial infectionsbacterial infectionpolymeraseinfectious urinary stonescalcium phosphate
Journal Article 2018-11-27 No Snippets Arabski M, Stabrawa I, Kubala-Kukuś A, Gałczyńska K, Banaś D, Piskorz Ł, Forma E, Bryś M, Różański W, Lipiński M.
Show Full Abstract

The aim of this study was to analyze the correlation between past bacterial infections and the type and chemical composition of urinary stones experienced by human patients. Bacteria have been recognized to contribute to urinary stones; however, the role of uropathogens in the development of specific stones has not been extensively investigated. The detection of past bacterial infection (eleven different bacterial species) in urinary stones from 83 patients was made on a DNA level using polymerase chain reaction (PCR) and denaturing gradient gel electrophoresis (DGGE) and correlated with the chemical composition of urinary stones measured using X-ray powder diffraction (XPRD) technique and their elemental composition by total reflection X-ray fluorescence (TXRF). In this study, two scenarios of urinary stones formation mediated by Proteus sp. or Escherichia coli are presented. The first one is associated with Proteus spp. which dominated in 84% of infectious urinary stones and is strongly correlated with struvite and calcium phosphate, in whose matrix additionally strontium, phosphorus, potassium, nickel and zinc are detected. The formation of these stones is closely correlated with urease activity. The second scenario for urinary stone mineralization is associated with E. coli identified in weddellite stones, in which matrix iron was detected. In conclusion, the statistical correlations of bacterial infections with crystalline and elemental composition showed that in mixed bacterial infections, one scenario dominated and excluded the second one.

Also flagged:Xanthone1,4-dihydropyridinesdihydropyridinexanthen-9-onedihydropyridinesnifedipine
Journal Article 2018-11-27 No Snippets Bisi A, Micucci M, Gobbi S, Belluti F, Budriesi R, Rampa A.
Show Full Abstract

As a follow-up to our previous studies on differently substituted 1,4-dihydropyridines endowed with a peculiar cardiac selectivity, in this paper, a small series of hybrid compounds bearing the pharmacophore fragment of lidoflazine in position 2 or 3 on a 4-(xanthen-9-one)-dihydropyridine core was reported. Lidoflazine was selected due to our promising previously reported data, and the xanthen-9-one substituent was introduced in position 4 of the dihydropyridine scaffold based on the cardiac selectivity observed in several of our studies. The new hybrid compounds were tested to assess cardiac and vascular activities, and the data were evaluated in comparison with those previously obtained for 4-(xanthen-9-one)-dihydropyridines and lidoflazine⁻nifedipine hybrid compounds. The functional studies indicated an interesting peculiar selectivity for the cardiac parameter inotropy, in particular when the lidoflazine fragment was introduced in position 2 of the dihydropyridine scaffold (<b>4a</b>⁻<b>e</b>), and thus a possible preferential binding with the Ca<sub>v</sub> 1.2 isoform of l-type calcium channels, which are mainly involved in cardiac contractility.

Also flagged:ChlorambucilCisplatintumoroxaliplatincolon cancerconjugation
Journal Article 2018-11-27 No Snippets Montagner D, Tolan D, Andriollo E, Gandin V, Marzano C.
Show Full Abstract

In this study, two DNA-targeting agents, cisplatin and chlorambucil, were combined in a Pt(IV) prodrug, <b>1</b>, which was thoroughly characterized by means of spectroscopic and spectrometric techniques. Tested towards a panel of various human tumor cell lines, this compound showed superior in vitro antitumor potential than the reference drug cisplatin. In addition, an antitumor potential of <b>1</b> was found, which is comparable to that of oxaliplatin in 3D spheroid models of colon cancer cells. Mechanistic studies performed in colon cancer cells confirmed that the conjugation of chlorambucil to Pt(IV) cisplatin-based scaffold tunes the lipophilicity of the prodrug, consequently improving the ability of the compound to accumulate into cancer cells and to target DNA, ultimately leading to apoptotic cancer cell death.

Also flagged:bone-related diseasesmetalstitaniumcobalthydroxyapatitecalcium phosphate
Journal Article 2018-11-27 No Snippets Alizadeh-Osgouei M, Li Y, Wen C.
Show Full Abstract

The application of various materials in biomedical procedures has recently experienced rapid growth. One area that is currently receiving significant attention from the scientific community is the treatment of a number of different types of bone-related diseases and disorders by using biodegradable polymer-ceramic composites. Biomaterials, the most common materials used to repair or replace damaged parts of the human body, can be categorized into three major groups: metals, ceramics, and polymers. Composites can be manufactured by combining two or more materials to achieve enhanced biocompatibility and biomechanical properties for specific applications. Biomaterials must display suitable properties for their applications, about strength, durability, and biological influence. Metals and their alloys such as titanium, stainless steel, and cobalt-based alloys have been widely investigated for implant-device applications because of their excellent mechanical properties. However, these materials may also manifest biological issues such as toxicity, poor tissue adhesion and stress shielding effect due to their high elastic modulus. To mitigate these issues, hydroxyapatite (HA) coatings have been used on metals because their chemical composition is similar to that of bone and teeth. Recently, a wide range of synthetic polymers such as poly (l-lactic acid) and poly (l-lactide-<i>co</i>-glycolide) have been studied for different biomedical applications, owing to their promising biocompatibility and biodegradability. This article gives an overview of synthetic polymer-ceramic composites with a particular emphasis on calcium phosphate group and their potential applications in tissue engineering. It is hoped that synthetic polymer-ceramic composites such as PLLA/HA and PCL/HA will provide advantages such as eliminating the stress shielding effect and the consequent need for revision surgery.

Also flagged:glucosetriglyceridereproductiontriglyceridesinsulincorticosterone
Journal Article 2018-11-27 ✓ 3 Snippets Singh D, Swarup V, Le H, Kumar V.
In-Text Gene Mentions

Similarly, downregulated pathways were found to be enriched with genes associated mainly with phosphatidylinositol signaling (PIK3R1, PIK3CA, PRKCE, PDPK1; Figure 2B6), lipid and fat metabolism (CYP7B1, ACOT9, LIPIN1, PLCB4; Figure 2B7), ubiquitin mediated protein catabolism (USP46, CUL5, FBXL4, UBR1; Figure 2B8), MAPK signaling pathway (MAPK37, Figure 2B9), pantothenate and CoA biosynthesis signaling pathways (INSR, PANK3, ACSL3; Figure 2B9), autophagy, Golgi transport, and vesicle transport (TBCID5, MAN1A2, CLEC16A, GAK; Figure 2B10).

…, CUL5 ,FBXL4, UBR1 ;…

…( IZNF318 ,ZNF644, ZNF318 ,…

Show Full Abstract

The molecular underpinnings of metabolic adaptation to seasons are poorly understood in long- distance migrants. We measured changes in physiology and performed <i>de novo</i> sequencing of RNA extracted from liver samples collected at 4-h intervals over a period of 24 h from a long-distance avian migrant, the blackheaded bunting (<i>Emberiza melanocephala</i>), during two states: photostimulated vernal migratory (M) state and photorefractory non-migratory (nM) state. The M state was differentiated from the nM state based on body fattening and weight gain, as well as on <i>Zugunruhe</i>, that is, nocturnal migratory restlessness in caged birds. We found that baseline blood glucose and triglyceride levels were significantly higher in the M state than the nM state; conversely, surface body temperature was higher in the nM state than the M state. In a total of 6 liver samples that were sequenced from each state, 11,246 genes were annotated, including 4448 genes that were cyclic over 24 h. We found 569 differentially expressed genes (DEGs) between the M and the nM state, and the M state showed 131 upregulated and 438 downregulated genes. These DEGs formed core gene hubs associated with specific biological processes in both the states. In addition, weighted gene coexpression network analysis revealed two discrete modules of coexpressed genes, with a significant difference in the expression pattern of metab olism-associated genes between M and nM states. These results demonstrate, for the first time, transcriptome-wide changes in the liver between two distinct physiological states and give molecular insights into seasonal metabolic adaptations in latitudinal migrants.

Also flagged:Myotonic Dystrophy Type 1DMPKspinocerebellar ataxia type 10myotonic dystrophiesFMR1membrane
Journal Article 2018-11-27 No Snippets Pešović J, Perić S, Brkušanin M, Brajušković G, Rakočević-Stojanović V, Savić-Pavićević D.
Show Full Abstract

CTG expansions in <i>DMPK</i> gene, causing myotonic dystrophy type 1 (DM1), are characterized by pronounced somatic instability. A large proportion of variability of somatic instability is explained by expansion size and patient's age at sampling, while individual-specific differences are attributed to additional factors. The age at onset is extremely variable in DM1, and inversely correlates with the expansion size and individual-specific differences in somatic instability. Three to five percent of DM1 patients carry repeat interruptions and some appear with later age at onset than expected for corresponding expansion size. Herein, we characterized somatic instability of interrupted <i>DMPK</i> expansions and the effect on age at onset in our previously described patients. Repeat-primed PCR showed stable structures of different types and patterns of repeat interruptions in blood cells over time and buccal cells. Single-molecule small-pool PCR quantification of somatic instability and mathematical modeling showed that interrupted expansions were characterized by lower level of somatic instability accompanied by slower progression over time. Mathematical modeling demonstrated that individual-specific differences in somatic instability had greater influence on age at onset in patients with interrupted expansions. Therefore, repeat interruptions have clinical importance for disease course in DM1 patients due to stabilizing effect on <i>DMPK</i> expansions in somatic cells.

Also flagged:alendronatebisphosphonategold nanoparticlesprostate cancertumordeath
Journal Article 2018-11-27 No Snippets Plan Sangnier A, Aufaure R, Motte L, Wilhelm C, Guenin E, Lalatonne Y.
Show Full Abstract

A gold therapeutic nanoplatform with the same molecule used as reductant, coating and therapeutic agent has been developed in a one-pot, one-phase process using alendronate, a drug from the bisphosphonate family known for its antitumor effects. In addition, the core made of gold nanoparticles (NPs) brings thermal functionalities under irradiation within the first biological window (650-900 nm). The Au@alendronate nanoplatform thus provided a combined antitumor activity through drug delivery and photothermal therapy. Au@alendronate NPs inhibited in vitro the proliferation of prostate cancer cells (PC3) in a dose-dependent manner, with an IC<sub>50</sub> value of 100 µM. Under NIR irradiation a temperature increase was observed leading to a reduction of the IC<sub>50</sub> value to 1 µM, with total tumor cell death at 100 µM.

Also flagged:cancergene expressionlung cancerlung adenocarcinomaperoxiredoxinsperoxiredoxin
Journal Article 2018-11-27 ✓ 5 Snippets Chen L, Huang C, Yang X, Zhang Q, Chen F.
In-Text Gene Mentions

PRDX6 is the only mammalian 1-Cys member of the PRDX family and is expressed in all major organs with a particularly high level in lung.39 Schremmer et al showed that PRDX6 expression was significantly associated with high-grade dysplasia and tumor progression in lung cancer cells.40 The invasion-promoting action of PRDX6 has also been confirmed using lung cancer cells, in which upregulation of PRDX6 results in the activation of Akt via PI3K and p38 kinase, which, in turn, promotes cell invasion by inducing uPA.41 Yun et al found that PRDX6 promotes lung tumor progression via its GPx and iPLA2 activities and promotes lung tumor development via activation of the JAK2/STAT3 pathway in a carcinogen-induced mouse lung tumor model.42,43 Our recent study demonstrated that high mRNA expression of PRDX6 was associated with worse OS in lung cancer patients, Ade patients, and those with early stage I–II.

Briefly, the JetSet probe IDs representing the six genes of PRDXs (PRDX1, PRDX2, PRDX3, PRDX4, PRDX5, and PRDX6) individually entered into the database (http://kmplot.com/analysis/index.php?p=service&cancer=lung) to analyze Kaplan–Meier survival curves.

…whereas PRDX5 andPRDX6mRNA expressions were…

…PRDX5 , andPRDX6) individually entered…

…of PRDX5 andPRDX6, respectively.…

Show Full Abstract

<h4>Background</h4>The peroxiredoxin (PRDX) protein family is involved in cancer cell invasion and metastasis, but its prognostic value in lung cancer remain elusive.<h4>Methods</h4>In this report, we accessed the overall survival (OS) of each individual <i>PRDX</i> mRNA expression through the Kaplan-Meier plotter (KM plotter) database, in which updated gene expression data and survival information include a total of 1,926 lung cancer patients.<h4>Results</h4>Our results indicated that <i>PRDX1</i> and <i>PRDX2</i> mRNA expressions were associated with improved OS in all lung cancer patients especially in lung adenocarcinoma patients, whereas <i>PRDX5</i> and <i>PRDX6</i> mRNA expressions were associated with poor OS in all lung cancer patients. In addition, the prognostic value of PRDXs in the different clinicopathological features according to smoking status, pathological grades, clinical stages, and chemotherapeutic treatment of lung cancer patients was further assessed in the KM plotter database by the multivariate cox regression analysis.<h4>Conclusion</h4>Our finding will elucidate the prognostic role of PRDXs in lung cancer and might promote development of PRDX-targeted inhibitors for the treatment of lung cancer.

Also flagged:NQO1TriptolideSynthesisHepatocellular carcinomadeathcirrhosis
Journal Article 2018-11-27 No Snippets Liu M, Song W, Du X, Su J, Dong K, Chen Y, Peng Z.
Show Full Abstract

Hepatocellular carcinoma (HCC) is the leading cause of death in patients with cirrhosis. Due to its poor response to conventional chemotherapy drugs, the prognosis for its survival is the worst. NAD(P)H:quinone oxidoreductase 1 (NQO1) is an attractive anticancer target due to its overexpression in HCC. Although triptolide (TP) possesses potent antitumor activity, its clinical practice is greatly limited due to its general toxicities and narrow therapeutic window. Herein, we develop an NQO1-selective activated TP analog, named CX-23, which exhibited antiproliferation of HepG2 over normal hepatocytes in vitro. In vivo study shows that CX-23 can not only prevent the hepatocellular carcinoma progression but also migrate the liver and kidney toxicity. These findings indicate that NQO1 may serve as a targeted delivery system to release an antitumor reagent and that CX-23 may be a promising lead for developing targeted antihepatocellular carcinoma drugs.

Also flagged:NotchGreen Fluorescent ProteinDoxorubicinadenomaADAM10Defa4
Journal Article 2018-11-27 ✓ 5 Snippets Jones JC, Brindley CD, Elder NH, Myers MG, Rajala MW, Dekaney CM, McNamee EN, Frey MR, Shroyer NF, Dempsey PJ.
In-Text Gene Mentions

…the expression ofOlfm4, which is a…

…31Olfm4was greatly up-regulated…

…well as normalOlfm4expression was observed…

…robust expansion ofOlfm4-expressing cells ( Figure…

…in proliferation orOlfm4expression were detected…

Show Full Abstract

<h4>Background & aims</h4>Loss of leucine-rich repeat-containing G-protein-coupled receptor 5-positive crypt base columnar cells provides permissive conditions for different facultative stem cell populations to dedifferentiate and repopulate the stem cell compartment. In this study, we used a defensin α4-Cre recombinase (Defa4Cre) line to define the potential of Paneth cells to dedifferentiate and contribute to intestinal stem cell (ISC) maintenance during normal homeostasis and after intestinal injury.<h4>Methods</h4>Small intestine and enteroids from Defa4<sup>Cre</sup>;Rosa26 tandem dimer Tomato (tdTomato), a red fluoresent protein, (or Rosa26 Enhanced Yellow Fluorescent Protein (EYFP)) reporter, Notch gain-of-function (Defa4<sup>Cre</sup>;Rosa26 Notch Intracellular Domain (NICD)-ires-nuclear Green Fluorescent Protein (nGFP) and Defa4<sup>Cre</sup>;Rosa26<sup>reverse tetracycline transactivator-ires</sup> Enhanced Green Fluorescent Protein (EGFP);TetO<sup>NICD</sup>), A Disintegrin and Metalloproteinase domain-containing protein 10 (ADAM10) loss-of-function (Defa4<sup>Cre</sup>;ADAM10<sup>flox/flox</sup>), and Adenomatous polyposis coli (APC) inactivation (Defa4<sup>Cre</sup>;APC<sup>flox/flox</sup>) mice were analyzed. Doxorubicin treatment was used as an acute intestinal injury model. Lineage tracing, proliferation, and differentiation were assessed in vitro and in vivo.<h4>Results</h4>Defa4<sup>Cre</sup>-expressing cells are fated to become mature Paneth cells and do not contribute to ISC maintenance during normal homeostasis in vivo. However, spontaneous lineage tracing was observed in enteroids, and fluorescent-activated cell sorter-sorted Defa4<sup>Cre</sup>-marked cells showed clonogenic enteroid growth. Notch activation in Defa4<sup>Cre</sup>-expressing cells caused dedifferentiation to multipotent ISCs in vivo and was required for adenoma formation. ADAM10 deletion had no significant effect on crypt homeostasis. However, after acute doxorubicin-induced injury, Defa4<sup>Cre</sup>-expressing cells contributed to regeneration in an ADAM10-Notch-dependent manner.<h4>Conclusions</h4>Our studies have shown that Defa4<sup>Cre</sup>-expressing Paneth cells possess cellular plasticity, can dedifferentiate into multipotent stem cells upon Notch activation, and can contribute to intestinal regeneration in an acute injury model.

Also flagged:CarbapenemaseinfectionCarbapenemmetallo-β-lactamasesoxacillinasesNDM
Journal Article 2018-11-26 No Snippets Decraene V, Phan HTT, George R, Wyllie DH, Akinremi O, Aiken Z, Cleary P, Dodgson A, Pankhurst L, Crook DW, Lenney C, Walker AS, Woodford N, Sebra R, Fath-Ordoubadi F, Mathers AJ, Seale AC, Guiver M, McEwan A, Watts V, Welfare W, Stoesser N, Cawthorne J, TRACE Investigators’ Group.
Show Full Abstract

Carbapenem-resistant <i>Enterobacteriaceae</i> (CRE) represent a health threat, but effective control interventions remain unclear. Hospital wastewater sites are increasingly being highlighted as important potential reservoirs. We investigated a large <i>Klebsiella pneumoniae</i> carbapenemase (KPC)-producing <i>Escherichia coli</i> outbreak and wider CRE incidence trends in the Central Manchester University Hospital NHS Foundation Trust (CMFT) (United Kingdom) over 8 years, to determine the impact of infection prevention and control measures. Bacteriology and patient administration data (2009 to 2017) were linked, and a subset of CMFT or regional hospital KPC-producing <i>E. coli</i> isolates (<i>n</i> = 268) were sequenced. Control interventions followed international guidelines and included cohorting, rectal screening (<i>n</i> = 184,539 screens), environmental sampling, enhanced cleaning, and ward closure and plumbing replacement. Segmented regression of time trends for CRE detections was used to evaluate the impact of interventions on CRE incidence. Genomic analysis (<i>n</i> = 268 isolates) identified the spread of a KPC-producing <i>E. coli</i> outbreak clone (strain A, sequence type 216 [ST216]; <i>n</i> = 125) among patients and in the environment, particularly on 2 cardiac wards (wards 3 and 4), despite control measures. ST216 strain A had caused an antecedent outbreak and shared its KPC plasmids with other <i>E. coli</i> lineages and <i>Enterobacteriaceae</i> species. CRE acquisition incidence declined after closure of wards 3 and 4 and plumbing replacement, suggesting an environmental contribution. However, ward 3/ward 4 wastewater sites were rapidly recolonized with CRE and patient CRE acquisitions recurred, albeit at lower rates. Patient relocation and plumbing replacement were associated with control of a clonal KPC-producing <i>E. coli</i> outbreak; however, environmental contamination with CRE and patient CRE acquisitions recurred rapidly following this intervention. The large numbers of cases and the persistence of <i>bla</i><sub>KPC</sub> in <i>E. coli</i>, including pathogenic lineages, are of concern.

Also flagged:Sertralinevisceral leishmaniasismetabolismthiolpolyamineamino acids
Journal Article 2018-11-26 ✓ 1 Snippet Lima ML, Abengózar MA, Nácher-Vázquez M, Martínez-Alcázar MP, Barbas C, Tempone AG, Tempone AG, López-Gonzálvez Á, Rivas L.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Drug repurposing affords the implementation of new treatments at a moderate cost and under a faster time-scale. Most of the clinical drugs against <i>Leishmania</i> share this origin. The antidepressant sertraline has been successfully assayed in a murine model of visceral leishmaniasis. Nevertheless, sertraline targets in <i>Leishmania</i> were poorly defined. In order to get a detailed insight into the leishmanicidal mechanism of sertraline on <i>Leishmania infantum</i>, unbiased multiplatform metabolomics and transmission electron microscopy were combined with a focused insight into the sertraline effects on the bioenergetics metabolism of the parasite. Sertraline induced respiration uncoupling, a significant decrease of intracellular ATP level, and oxidative stress in <i>L. infantum</i> promastigotes. Metabolomics evidenced an extended metabolic disarray caused by sertraline. This encompasses a remarkable variation of the levels of thiol-redox and polyamine biosynthetic intermediates, as well as a shortage of intracellular amino acids used as metabolic fuel by <i>Leishmania</i> Sertraline killed <i>Leishmania</i> through a multitarget mechanism of action, tackling essential metabolic pathways of the parasite. As such, sertraline is a valuable candidate for visceral leishmaniasis treatment under a drug repurposing strategy.

Also flagged:homopolymeracetoneacetonitrileethanoltetrahydrofurandioxane
Journal Article 2018-11-26 No Snippets Bagheri M, Bresseleers J, Varela-Moreira A, Sandre O, Meeuwissen SA, Schiffelers RM, Metselaar JM, van Nostrum CF, van Hest JCM, Hennink WE.
Show Full Abstract

Micelles composed of block copolymers of poly(ethylene glycol)- b-poly( N-2-benzoyloxypropyl methacrylamide) (mPEG- b-p(HPMA-Bz)) have shown great promise as drug-delivery carriers due to their excellent stability and high loading capacity. In the present study, parameters influencing micelle size were investigated to tailor sizes in the range of 25-100 nm. Micelles were prepared by a nanoprecipitation method, and their size was modulated by the block copolymer properties such as molecular weight, their hydrophilic-to-hydrophobic ratio, homopolymer content, as well as formulation and processing parameters. It was shown that the micelles have a core-shell structure using a combination of dynamic light scattering and transmission electron microscopy analysis. By varying the degree of polymerization of the hydrophobic block ( N<sub>B</sub>) between 68 and 10, at a fixed hydrophilic block mPEG<sub>5k</sub> ( N<sub>A</sub> = 114), it was shown that the hydrophobic core of the micelle was collapsed following the power law of ( N<sub>B</sub> × N<sub>agg</sub>)<sup>1/3</sup>. Further, the calculated brush height was similar for all the micelles examined (10 nm), indicating that crew-cut micelles were made. Both addition of homopolymer and preparation of micelles at lower concentrations or lower rates of addition of the organic solvent to the aqueous phase increased the size of micelles due to partitioning of the hydrophobic homopolymer chains to the core of the micelles and lower nucleation rates, respectively. Furthermore, it was shown that by using different solvents, the size of the micelles substantially changed. The use of acetone, acetonitrile, ethanol, tetrahydrofuran, and dioxane resulted in micelles in the size range of 45-60 nm after removal of the organic solvents. The use of dimethylformamide and dimethylsulfoxide led to markedly larger sizes of 75 and 180 nm, respectively. In conclusion, the results show that by modulating polymer properties and processing conditions, micelles with tailorable sizes can be obtained.

Also flagged:Chylothoraxhilar cholangiocarcinomachylous ascitespleural effusionoctreotidechylous effusion
Journal Article 2018-11-26 ✓ 1 Snippet Yamamoto R, Mokuno Y, Matsubara H, Kaneko H, Sato Y, Iyomasa S.
In-Text Gene Mentions

…tumor as aBismuth type 1 cholangiocarcinomatype 1 cholangiocarcinoma,…

Show Full Abstract

<h4>Background</h4>Chylothorax is the accumulation of chyle within the pleural space. Chylothorax can occur as a complication after multiple different types of surgery, most frequently after thoracic surgery, albeit with an incidence rate of less than 1%. Chylothorax after abdominal surgery is extremely rare, and there are only a few case reports.<h4>Case presentation</h4>A 74-year-old Japanese woman presented with jaundice. She was diagnosed as having hilar cholangiocarcinoma and underwent right hepatectomy, caudate lobectomy, extrahepatic bile duct resection, and lymph node dissection after preoperative percutaneous transhepatic portal vein embolization. Postoperative liver function was normal. She developed chylous ascites on postoperative day 5, for which conservative treatment was initially effective. Dyspnea developed suddenly on postoperative day 42, and she had a massive right pleural effusion and a small amount of ascites. Management with pleural drainage, total parenteral nutrition, and octreotide injections decreased the chylothorax. However, the chylous effusion reaccumulated on postoperative day 57. As conservative treatments ultimately failed, lymphangiography was performed on postoperative day 62. Lymphangiography with Lipiodol (ethiodized oil) revealed extravasation into the pleural space, but the location of the leak was not identified. There was neither obstruction nor dilation of the thoracic duct. A lymphatic leak in her abdominal cavity was not demonstrated. A chest tube was placed after lymphangiography, and the chylothorax was diminished by postoperative day 71. She was discharged on postoperative day 72. Two and a half years after surgery, she is doing well with no evidence of recurrence of either chylothorax or cancer.<h4>Conclusions</h4>Chylothorax can occur after hepatectomy and pleural effusion should raise suspicion for chylothorax. Lymphangiography may be effective for both diagnosis and treatment in the case of chylothorax after hepatectomy.

Also flagged:ironerythropoiesistobehavioraliron deficiency anemiametabolism
Journal Article 2018-11-26 No Snippets Kanias T, Stone M, Page GP, Guo Y, Endres-Dighe SM, Lanteri MC, Spencer BR, Cable RG, Triulzi DJ, Kiss JE, Murphy EL, Kleinman S, Gladwin MT, Busch MP, Mast AE, NHLBI Recipient Epidemiology Donor Evaluation Study (REDS)-III Program.
Show Full Abstract

<h4>Background</h4>Frequent whole blood donations increase the prevalence of iron depletion in blood donors, which may subsequently interfere with normal erythropoiesis. The purpose of this study was to evaluate the associations between donation frequency and red blood cell (RBC) storage stability in a racially/ethnically diverse population of blood donors.<h4>Study design</h4>Leukoreduced RBC concentrate-derived samples from 13,403 donors were stored for 39 to 42 days (1-6°C) and then evaluated for storage, osmotic, and oxidative hemolysis. Iron status was evaluated by plasma ferritin measurement and self-reported intake of iron supplements. Donation history in the prior 2 years was obtained for each subject.<h4>Results</h4>Frequent blood donors enrolled in this study were likely to be white, male, and of older age (56.1 ± 5.0 years). Prior donation intensity was negatively associated with oxidative hemolysis (p < 0.0001) in multivariate analyses correcting for age, sex, and race/ethnicity. Increased plasma ferritin concentration was associated with increased RBC susceptibility to each of the three measures of hemolysis (p < 0.0001 for all), whereas self-reported iron intake was associated with reduced susceptibility to osmotic and oxidative hemolysis (p < 0.0001 for both).<h4>Conclusions</h4>Frequent blood donations may alter the quality of blood components by modulating RBC predisposition to hemolysis. RBCs collected from frequent donors with low ferritin have altered susceptibility to hemolysis. Thus, frequent donation and associated iron loss may alter the quality of stored RBC components collected from iron-deficient donors. Further investigation is necessary to assess posttransfusion safety and efficacy in patients receiving these RBC products.

Also flagged:behavioralsynthesisBRCA1heart diseaseironcancer
Journal Article 2018-11-26 ✓ 5 Snippets Beskow LM, Hammack CM, Brelsford KM.
In-Text Gene Mentions

If, on the other hand, you are otherwise healthy, and you get your HFE gene sequence ... and there’s a variant in that gene, the chance that this is actually contributing to hemochromatosis, down the line, is less than one percent.

…the symptoms ofhemochromatosisand you have…

…a variant inHFE, a gene that’s…

…that’s linked tohemochromatosis, there’s an 80…

…contributing to yourhemochromatosis.…

Show Full Abstract

Precision medicine research is underway to identify targeted approaches to improving health and preventing disease. However, such endeavors raise significant privacy and confidentiality concerns. The objective of this study was to elucidate the potential benefits and harms associated with precision medicine research through in-depth interviews with a diverse group of thought leaders, including primarily U.S.-based experts and scholars in the areas of ethics, genome research, health law, historically-disadvantaged populations, informatics, and participant-centric perspectives, as well as government officials and human subjects protections leaders. The results suggest the prospect of an array of individual and societal benefits, as well as physical, dignitary, group, economic, psychological, and legal harms. Relative to the way risks and harms are commonly described in consent forms for precision medicine research, the thought leaders we interviewed arguably emphasized a somewhat different set of issues. The return of individual research results, harm to socially-identifiable groups, the value-dependent nature of many benefits and harms, and the risks to the research enterprise itself emerged as important cross-cutting themes. Our findings highlight specific challenges that warrant concentrated care during the design, conduct, dissemination, and translation of precision medicine research and in the development of consent materials and processes.

Also flagged:Procyanidin trimer C1JQ1flavonoidMAPKPC1PKC
Journal Article 2018-11-26 No Snippets Cary DC, Peterlin BM.
Show Full Abstract

Although anti-retroviral therapies have greatly extended the lives of HIV infected individuals, current treatments are unable to completely eliminate virally infected cells. A number of latency reversing agents have been proposed for use in a "shock and kill" strategy to reactivate latent HIV, thus making it vulnerable to killing mechanisms. Procyanidin trimer C1 (PC1) is a flavonoid found in multiple plant sources including grape, apple, and cacao, which has antioxidant and anti-inflammatory properties. We determined that PC1 reactivates latent HIV in cell line and primary cell models of HIV, through activation of the MAPK pathway. Notably, PC1 reactivates latent HIV without increasing surface markers of T cell activation. Combining several therapeutics, which activate HIV transcription through different mechanisms, is the most efficient approach to clinically reactivate latent reservoirs. We utilized PC1 (MAPK agonist), kansui (PKC agonist), and JQ1 (BET bromodomain inhibitor) in a triple combination approach to reactivate latent HIV in cell line and primary cell models of HIV latency. When used in combination, low concentrations which fail to reactivate HIV as single treatments, are effective. Thus, several mechanisms, using distinct activation pathways, act together to reactivate latent HIV.

Also flagged:Pazopanibmetastatic renal cell cancersunitinibkidney failurecardiovascular diseaserenal cell carcinoma
Journal Article 2018-11-26 ✓ 2 Snippets Méndez-Vidal MJ, Molina Á, Anido U, Chirivella I, Etxaniz O, Fernández-Parra E, Guix M, Hernández C, Lambea J, Montesa Á, Pinto Á, Ros S, Gallardo E.
In-Text Gene Mentions

Specific polymorphisms such as the rs2858996/rs707889 in the HFE gene may be associated with reversible ALT elevation in patients treated with pazopanib [65].

…rs2858996/rs707889 in theHFEgene may be…

Show Full Abstract

<h4>Background</h4>Pazopanib is indicated in the first-line treatment of metastatic renal cell cancer (mRCC). The aim of this study was to review the efficacy, safety, and pharmacokinetics of pazopanib and see how these aspects are linked to clinical practice.<h4>Methods</h4>A non-exhaustive systematic review was conducted according to the three topics. No publication restrictions were imposed and the selected languages were Spanish and English. After that, a summary of the main results and findings of the review was presented and discussed during three meetings (one for each topic) with 13 medical oncologists that usually treat mRCC. At these meetings, a questionnaire on the first-line use of pazopanib in clinical practice was also drawn up. After the meetings, the questionnaire was completed by 60 specialist medical oncologists in renal cancer.<h4>Results</h4>The efficacy and safety of pazopanib have been demonstrated in several clinical trials, and subsequently confirmed in studies in real-world clinical practice. In addition to its clinical benefit and good safety profile, quality of life results for pazopanib, which compare favorably to sunitinib, make it a good option in the first-line treatment of patients. Special populations have been included in studies conducted with pazopanib, and it is safe for use in elderly patients, poor functional status, kidney failure, and mild or moderate hepatic impairment, and in patients with concomitant cardiovascular disease. The results of the questionnaire have shown that pazopanib is perceived as an effective drug, in which quality of life (QoL) outcomes are valued above all.<h4>Conclusions</h4>This paper offers a comprehensive and critical summary of efficacy, tolerability, and pharmacokinetics of pazopanib in the treatment of mRCC. Pazopanib is an effective treatment with an acceptable safety profile. Its QoL and tolerability results offer certain advantages when compared with other therapeutic alternatives, and its use appears to be safe in different patient profiles.

Also flagged:MHC-IICD68IL-1βlipopolysaccharidecolony-stimulating factor 1 receptorCSF1R
Journal Article 2018-11-26 ✓ 2 Snippets O'Neil SM, Witcher KG, McKim DB, Godbout JP.
In-Text Gene Mentions

…of Grin3a ,Negr1, Nrep ,…

…neurotrophic/growth factors (Negr1, Nrep ,…

Show Full Abstract

Microglia are the resident innate immune cells of the central nervous system. Limited turnover throughout the lifespan leaves microglia susceptible to age-associated dysfunction. Indeed, we and others have reported microglia develop a pro-inflammatory or "primed" profile with age, characterized by increased expression of inflammatory mediators (e.g., MHC-II, CD68, IL-1β). Moreover, immune challenge with lipopolysaccharide (LPS) causes an exaggerated and prolonged neuroinflammatory response mediated by primed microglia in the aged brain. Recent studies show colony-stimulating factor 1 receptor (CSF1R) antagonism results in rapid depletion of microglia without significant complications. Therefore, we hypothesized that CSF1R antagonist-mediated depletion of microglia in the aged brain would result in repopulation with new and unprimed microglia. Here we provide novel evidence that microglia in the brain of adult (6-8 weeks old) and aged (16-18 months old) BALB/c mice were depleted following 3-week oral PLX5622 administration. When CSF1R antagonism was stopped, microglia repopulated equally in the adult and aged brain. Microglial depletion and repopulation reversed age-associated increases in microglial CD68<sup>+</sup> lysosome enlargement and lipofuscin accumulation. Microglia-specific RNA sequencing revealed 511 differentially expressed genes with age. Of these, 117 genes were reversed by microglial repopulation (e.g., Apoe, Tgfb2, Socs3). Nevertheless, LPS challenge still induced an exaggerated microglial inflammatory response in the aged brain compared to adults. RNA sequencing of whole-brain tissue revealed an age-induced inflammatory signature, including reactive astrocytes, that was not restored by microglial depletion and repopulation. Furthermore, the microenvironment of the aged brain produced soluble factors that influenced developing microglia ex vivo and induced a profile primed to LPS challenge. Thus, the aged brain microenvironment promotes microglial priming despite repopulation of new microglia. Collectively, aged microglia proliferate and repopulate the brain, but these new cells still adopt a pro-inflammatory profile in the aged brain.

Also flagged:cantharidinprotein phosphatase 2APP2AkinasesERKJNK
Journal Article 2018-11-26 ✓ 2 Snippets Xu MD, Liu L, Wu MY, Jiang M, Shou LM, Wang WJ, Wu J, Zhang Y, Gong FR, Chen K, Tao M, Zhi Q, Li W.
In-Text Gene Mentions

As presented in Fig. 2c, both cantharidin and OA upregulated the expression levels of multiple proangiogenic genes, including TIMP1, CXCL1/GRO-α, CXCL2/GRO-β, IL-8/CXCL8, PLAUR/uPAR, RUNX1, PGF/PIGF-2, VEGF/VEGFA, RHOB, BTG1, CD55, SPHK1, EFNB2, IL12A, CXCL5/ENA78/LIX, IL-10, BAI1, CXCL3/GRO-γ, TNF/TNF-α, GM-CSF/CSF2, F3, KITLG, TIE1, CSF3, SERPINC1, IL-1α, CXCL14, and FGF1. The expression of antiangiogenic COL18A1/Endostatin was downregulated following cantharidin and OA treatments.

…, CSF3 ,SERPINC1, IL-1α ,…

Show Full Abstract

Cantharidin, one of the active components of mylabris, is believed to have antitumor activity. Cantharidin selectively inhibits protein phosphatase 2A (PP2A), which can repress multiple oncogenic kinases (ERK, JNK, PKC, and NF-κB). Researches in vitro have shown that cantharidin suppresses cell viability and metastasis in pancreatic cancer cells. This study aims to investigate the effects of cantharidin on pancreatic cancer xenografts in vivo. Xenograft models were established using cells stably expressing luciferase. Xenograft growth was evaluated by living imaging. Gene expression was determined using a microarray, real-time PCR, a RayBiotech antibody array, and the Milliplex assay. Surprisingly, cantharidin significantly accelerated xenograft growth. Living imaging showed a rapid distribution of D-luciferin in cantharidin-treated xenografts, suggesting a rich blood supply. Immunohistochemistry confirmed increased angiogenesis. Microarray and antibody array identified upregulated proangiogenic and downregulated antiangiogenic factors. The Milliplex assay suggested elevated secretion of IL-6, IL-8, TNF-α, and VEGF. Inhibitors of ERK, JNK, PKC, and NF-κB pathway attenuated the cantharidin-induced changes to proangiogenic gene expression. PKC pathway-inhibiting tamoxifen or antiangiogenic therapeutics, including Ginsenoside Rg3, bevacizumab, Apatinib, and Endostar, antagonized the proangiogenic effect of cantharidin or its derivatives. These regimens presented remarkable additive antitumor effects in vivo. Although cantharidin presents antitumor effects in vitro and has been applied in clinical practice, we revealed an unfavorable proangiogenic side effect. We recommend that the clinical application of cantharidin should be performed on the premise of antivascularization therapy.

Also flagged:USP25USP25 deubiquitinating enzymeubiquitinWntbindingcatalytic activity
Journal Article 2018-11-26 ✓ 1 Snippet Liu B, Sureda-Gómez M, Zhen Y, Amador V, Reverter D.
In-Text Gene Mentions

…is suppressed aftervaccinia-related kinase 2kinase 2-mediated phosphorylat…

Show Full Abstract

USP25 deubiquitinating enzyme is a key member of the ubiquitin system, which acts as a positive regulator of the Wnt/β-catenin signaling by promoting the deubiquitination and stabilization of tankyrases. USP25 is characterized by the presence of a long insertion in the middle of the conserved catalytic domain. The crystal structure of USP25 displays an unexpected homotetrameric quaternary assembly that is directly involved in the inhibition of its enzymatic activity. The tetramer is assembled by the association of two dimers and includes contacts between the coiled-coil insertion domain and the ubiquitin-binding pocket at the catalytic domain, revealing a distinctive autoinhibitory mechanism. Biochemical and kinetic assays with dimer, tetramer and truncation constructs of USP25 support this mechanism, displaying higher catalytic activity in the dimer assembly. Moreover, the high stabilization of tankyrases in cultured cells by ectopic expression of a constitutive dimer of USP25 supports a biological relevance of this tetramerization/inhibition mechanism.

Also flagged:ADmild cognitive impairmentTCIRG1mitochondrialNF-κBiNOS
Journal Article 2018-11-26 No Snippets Li X, Wang H, Long J, Pan G, He T, Anichtchik O, Belshaw R, Albani D, Edison P, Green EK, Scott J.
Show Full Abstract

Revealing the relationship between dysfunctional genes in blood and brain tissues from patients with Alzheimer's Disease (AD) will help us to understand the pathology of this disease. In this study, we conducted the first such large systematic analysis to identify differentially expressed genes (DEGs) in blood samples from 245 AD cases, 143 mild cognitive impairment (MCI) cases, and 182 healthy control subjects, and then compare these with DEGs in brain samples. We evaluated our findings using two independent AD blood datasets and performed a gene-based genome-wide association study to identify potential novel risk genes. We identified 789 and 998 DEGs common to both blood and brain of AD and MCI subjects respectively, over 77% of which had the same regulation directions across tissues and disease status, including the known ABCA7, and the novel TYK2 and TCIRG1. A machine learning classification model containing NDUFA1, MRPL51, and RPL36AL, implicating mitochondrial and ribosomal function, was discovered which discriminated between AD patients and controls with 85.9% of area under the curve and 78.1% accuracy (sensitivity = 77.6%, specificity = 78.9%). Moreover, our findings strongly suggest that mitochondrial dysfunction, NF-κB signalling and iNOS signalling are important dysregulated pathways in AD pathogenesis.

Also flagged:Hsp70chaperonedegradationJ-domain containing proteinsco-chaperonesJ-domain proteins
Journal Article 2018-11-26 No Snippets Kampinga HH, Andreasson C, Barducci A, Cheetham ME, Cyr D, Emanuelsson C, Genevaux P, Gestwicki JE, Goloubinoff P, Huerta-Cepas J, Kirstein J, Liberek K, Mayer MP, Nagata K, Nillegoda NB, Nillegoda NB, Pulido P, Ramos C, De Los Rios P, Rospert S, Rosenzweig R, Sahi C, Taipale M, Tomiczek B, Ushioda R, Young JC, Zimmermann R, Zylicz A, Zylicz M, Craig EA, Marszalek J.
Show Full Abstract

Hsp70 chaperone systems are very versatile machines present in nearly all living organisms and in nearly all intracellular compartments. They function in many fundamental processes through their facilitation of protein (re)folding, trafficking, remodeling, disaggregation, and degradation. Hsp70 machines are regulated by co-chaperones. J-domain containing proteins (JDPs) are the largest family of Hsp70 co-chaperones and play a determining role functionally specifying and directing Hsp70 functions. Many features of JDPs are not understood; however, a number of JDP experts gathered at a recent CSSI-sponsored workshop in Gdansk (Poland) to discuss various aspects of J-domain protein function, evolution, and structure. In this report, we present the main findings and the consensus reached to help direct future developments in the field of Hsp70 research.

Also flagged:IronGenetic hemochromatosisiron overload diseasepeptidecirrhosisliver cancer
Journal Article 2018-11-26 ✓ 5 Snippets Loréal O, Cavey T, Robin F, Kenawi M, Guggenbuhl P, Brissot P.
In-Text Gene Mentions

Complications of HFE-related genetic hemochromatosis, and more globally of hemochromatosis related to hepcidin deficiency, include hepatic damage with the development of liver fibrosis, with the risks of cirrhosis and hepatocellular carcinoma, diabetes, and at a lesser degree, heart dysfunction, which are sources of morbidity and mortality [66,67].

It is important to note that rare or very rare non-HFE mutations may also favor hepcidin deficiency.

The p.Cys282Tyr mutation alters the structure of the HFE protein due to the substitution of a cysteine that is engaged in intra-molecular disulfide bounds, that play a role in the protein shape, by a threonine.

Some exceptional private mutations in the HFE gene can also lead to hemochromatosis, when present either at the homozygous state or in association with the C282Y mutation [46].

This suggests that: (i) synovial iron deposition [103] may represent an inaccessible compartment for iron depletion by venesections because synovial fluid is not contiguous with serum; (ii) synovitis, that has been documented in hemochromatosis [104,105] is irreversible despite effective iron depletion; and/or (iii) hepcidin deficiency leading to iron excess could be involved directly in symptomatic arthropathy and/or (iv) the mutations of the HFE gene, that encodes an HLA-like class I protein, could be involved directly in disease expression [106].

Show Full Abstract

Genetic hemochromatosis is an iron overload disease that is mainly related to the <i>C282Y</i> mutation in the <i>HFE</i> gene. This gene controls the expression of hepcidin, a peptide secreted in plasma by the liver and regulates systemic iron distribution. Homozygous <i>C282Y</i> mutation induces hepcidin deficiency, leading to increased circulating transferrin saturation, and ultimately, iron accumulation in organs such as the liver, pancreas, heart, and bone. Iron in excess may induce or favor the development of complications such as cirrhosis, liver cancer, diabetes, heart failure, hypogonadism, but also complaints such as asthenia and disabling arthritis. Iron depletive treatment mainly consists of venesections that permit the removal of iron contained in red blood cells and the subsequent mobilization of stored iron in order to synthesize hemoglobin for new erythrocytes. It is highly efficient in removing excess iron and preventing most of the complications associated with excess iron in the body. However, this treatment does not target the biological mechanisms involved in the iron metabolism disturbance. New treatments based on the increase of hepcidin levels, by using hepcidin mimetics or inducers, or inhibitors of the iron export activity of ferroportin protein that is the target of hepcidin, if devoid of significant secondary effects, should be useful to better control iron parameters and symptoms, such as arthritis.

Also flagged:NucleocytoplasmicNeurodegenerative diseasesamyotrophic lateral sclerosisALSfrontotemporal dementiacytoplasm
Journal Article 2018-11-26 ✓ 5 Snippets Fahrenkrog B, Harel A.
In-Text Gene Mentions

The HTT protein localizes to both the cytoplasm and the nucleus and contains a so-called PY-NLS, a nuclear localization signal enriched in proline-tyrosine residues, as well as a nuclear export signal (NES; Figure 2) [7,8,9].

In the case of HD, expansion of a polyglutamine (polyQ) stretch within the N-terminal domain of the Huntingtin (HTT) protein leads to nuclear accumulation of polyQ HTT (or mHTT) and a toxic gain-of-function phenotype resulting in neurodegeneration.

By contrast, Huntington’s disease (HD) presents with the nuclear accumulation of mutant Huntingtin (mHTT), which arises from the expansion of a polyglutamine (polyQ) stretch within the N-terminal domain of the HTT protein [3].

…of the Huntingtin (HTT) protein leads to…

…accumulation of polyQHTT(or mHTT) and…

Show Full Abstract

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), and Huntington's disease (HD), are characterized by intracellular aggregation of proteins. In the case of ALS and FTD, these protein aggregates are found in the cytoplasm of affected neurons and contain certain RNA-binding proteins (RBPs), namely the TAR DNA-binding protein of 43 kDa (TDP-43) and the fused in sarcoma (FUS) gene product. TDP-43 and FUS are nuclear proteins and their displacement to the cytoplasm is thought to be adverse in at least two ways: loss-of-function in the nucleus and gain-of-toxicity in the cytoplasm. In the case of HD, expansion of a polyglutamine (polyQ) stretch within the N-terminal domain of the Huntingtin (HTT) protein leads to nuclear accumulation of polyQ HTT (or mHTT) and a toxic gain-of-function phenotype resulting in neurodegeneration. Numerous studies in recent years have provided evidence that defects in nucleocytoplasmic transport critically contribute to the pathology of these neurodegenerative diseases. A new mechanistic view is emerging, implicating three types of perturbations in normal cellular pathways that rely on nucleocytoplasmic transport: displacement of nuclear transport receptors and nucleoporins from nuclear pore complexes (NPCs), mislocalization and aggregation of RNA-binding proteins, and weakening of the chaperone activity of nuclear import receptors.

Also flagged:Equine Metabolic Syndromeinsulinlaminitismetabolic syndromeendocrine abnormalitiesaryl hydrocarbon
Journal Article 2018-11-26 No Snippets Durward-Akhurst SA, Schultz NE, Norton EM, Rendahl AK, Besselink H, Behnisch PA, Brouwer A, Geor RJ, Mickelson JR, McCue ME.
Show Full Abstract

Equine Metabolic Syndrome (EMS) is characterized by abnormalities in insulin regulation, increased adiposity and laminitis, and has several similarities to human metabolic syndrome. A large amount of environmental variability in the EMS phenotype is not explained by commonly measured factors (diet, exercise, and season), suggesting that other environmental factors play a role in EMS development. Endocrine disrupting chemicals (EDCs) are associated with metabolic syndrome and other endocrine abnormalities in humans. This led us to hypothesize that EDCs are detectable in horse plasma and play a role in the pathophysiology of EMS. EDCs acting through the aryl hydrocarbon and estrogen receptors, were measured in plasma of 301 horses from 32 farms. The median (range) TEQ (2,3,7,8-TCDD equivalent) and EEQ (17β-estradiol equivalent) were 19.29 pg/g (0.59-536.36) and 10.50 pg/ml (4.35-15000.00), respectively. TEQ was negatively associated with plasma fat extracted and batch analyzed. EEQ was positively associated with pregnancy and batch analyzed, and negatively associated with being male and superfund score ≤100 miles of the farm. Of particular interest, serum glucose and insulin, glucose and insulin post oral sugar challenge, and leptin concentrations were associated with EEQ, and serum triglyceride concentration was associated with TEQ. Overall, we demonstrated that EDCs are present in the plasma of horses and may explain some of the environmental variability in measured EMS phenotypes. This is the first example of EDCs being associated with clinical disease phenotype components in domestic animals.

Also flagged:HemostasisHomeostasisCoagulationdiseases of the central nervous systemproteasecomplement factors
Journal Article 2018-11-26 No Snippets De Luca C, Colangelo AM, Alberghina L, Papa M.
Show Full Abstract

Coagulation and the immune system interact in several physiological and pathological conditions, including tissue repair, host defense, and homeostatic maintenance. This network plays a key role in diseases of the central nervous system (CNS) by involving several cells (CNS resident cells, platelets, endothelium, and leukocytes) and molecular pathways (protease activity, complement factors, platelet granule content). Endothelial damage prompts platelet activation and the coagulation cascade as the first physiological step to support the rescue of damaged tissues, a flawed rescuing system ultimately producing neuroinflammation. Leukocytes, platelets, and endothelial cells are sensitive to the damage and indeed can release or respond to chemokines and cytokines (platelet factor 4, CXCL4, TNF, interleukins), and growth factors (including platelet-derived growth factor, vascular endothelial growth factor, and brain-derived neurotrophic factor) with platelet activation, change in capillary permeability, migration or differentiation of leukocytes. Thrombin, plasmin, activated complement factors and matrix metalloproteinase-1 (MMP-1), furthermore, activate intracellular transduction through complement or protease-activated receptors. Impairment of the neuro-immune hemostasis network induces acute or chronic CNS pathologies related to the neurovascular unit, either directly or by the systemic activation of its main steps. Neurons, glial cells (astrocytes and microglia) and the extracellular matrix play a crucial function in a "tetrapartite" synaptic model. Taking into account the neurovascular unit, in this review we thoroughly analyzed the influence of neuro-immune hemostasis on these five elements acting as a functional unit ("pentapartite" synapse) in the adaptive and maladaptive plasticity and discuss the relevance of these events in inflammatory, cerebrovascular, Alzheimer, neoplastic and psychiatric diseases. Finally, based on the solid reviewed data, we hypothesize a model of neuro-immune hemostatic network based on protein-protein interactions. In addition, we propose that, to better understand and favor the maintenance of adaptive plasticity, it would be useful to construct predictive molecular models, able to enlighten the regulating logic of the complex molecular network, which belongs to different cellular domains. A modeling approach would help to define how nodes of the network interact with basic cellular functions, such as mitochondrial metabolism, autophagy or apoptosis. It is expected that dynamic systems biology models might help to elucidate the fine structure of molecular events generated by blood coagulation and neuro-immune responses in several CNS diseases, thereby opening the way to more effective treatments.

Also flagged:Serotonin5-hydroxytryptaminebiosynthesistryptophan hydroxylaseTPH2AADC
Journal Article 2018-11-26 ✓ 1 Snippet Pan HR, Tian M, Xue JB, Li SM, Luo XC, Huang X, Chen ZH, Huang L.
In-Text Gene Mentions

…transporter (SERT or5-HTT) in type III…

Show Full Abstract

Serotonin or 5-hydroxytryptamine (5-HT) is an important neurotransmitter that is found in mammalian taste buds and can regulate the output of intragemmal signaling networks onto afferent nerve fibers. However, it is unclear how 5-HT is produced, synthesized locally inside taste buds or absorbed from outside sources. In this study, we attempt to address this question by delineating the process of possible 5-HT biosynthesis within taste buds. First, we verified that the rate-limiting enzyme tryptophan hydroxylase (TPH2) responsible for converting L-tryptophan into the intermediate 5-hydroxy-L-tryptophan (5-HTP) is expressed in a subset of type II taste bud cells (TBCs) whereas the enzyme aromatic L-aromatic amino acid decarboxylase (AADC) capable of converting 5-HTP into 5-HT is found in type III TBCs. And abolishment of TPH2 did not affect the production of intragemmal 5-HT or alter TBCs; the mutant mice did not show any changes in behavioral responses to all five primary taste qualities: sweet, umami, bitter, salty, and sour. Then we identified that 5-HTP as well as AADC are abundant in type III TBCs; and application of an AADC inhibitor significantly blocked the production of 5-HT in taste buds. In contrast, administration of an inhibitor on serotonin-reuptake transporters had minimal impact on the 5-HT amount in taste buds, indicating that exogenous 5-HT is not a major source for the intragemmal transmitter. Taken together, our data indicate that intragemmal serotonin is not biosynthesized <i>de novo</i> from tryptophan; instead, it is produced by AADC-mediated conversion of 5-HTP absorbed from the plasma and/or nerve fibers into 5-HT. Thus, our results suggest that the overall bodily 5-HTP level in the plasma and nervous system can regulate taste buds' physiological function, and provide an important molecular mechanism connecting these peripheral taste organs with the circulatory and nervous systems.

Also flagged:Ironmetabolismtumoroxygendeathferroptosis
Journal Article 2018-11-26 ✓ 2 Snippets Pfeifhofer-Obermair C, Tymoszuk P, Petzer V, Weiss G, Nairz M.
In-Text Gene Mentions

…in patients withHFE-associated HH, a…

…while patients withHFE-associated HH show…

Show Full Abstract

Iron metabolism and tumor biology are intimately linked. Iron facilitates the production of oxygen radicals, which may either result in iron-induced cell death, ferroptosis, or contribute to mutagenicity and malignant transformation. Once transformed, malignant cells require high amounts of iron for proliferation. In addition, iron has multiple regulatory effects on the immune system, thus affecting tumor surveillance by immune cells. For these reasons, inconsiderate iron supplementation in cancer patients has the potential of worsening disease course and outcome. On the other hand, chronic immune activation in the setting of malignancy alters systemic iron homeostasis and directs iron fluxes into myeloid cells. While this response aims at withdrawing iron from tumor cells, it may impair the effector functions of tumor-associated macrophages and will result in iron-restricted erythropoiesis and the development of anemia, subsequently. This review summarizes our current knowledge of the interconnections of iron homeostasis with cancer biology, discusses current clinical controversies in the treatment of anemia of cancer and focuses on the potential roles of iron in the solid tumor microenvironment, also speculating on yet unknown molecular mechanisms.

Also flagged:Escherichia coli BacteremiaPurpura Fulminansdisseminated intravascularcoagulationskin necrosisprotein C deficiency
Journal Article 2018-11-26 ✓ 1 Snippet Ahmed M, Samotowka M, Habis S, Mahmoud A, Saeed R.
In-Text Gene Mentions

…or antithrombin III (ATIII).…

Show Full Abstract

Purpura fulminans (PF) is a dermatologic manifestation of an underlying life-threatening condition associated with disseminated intravascular coagulation and skin necrosis. The known categories include protein C deficiency or abnormalities of other coagulation systems (inherited or acquired), acute infectious PF and idiopathic. We describe a case of PF induced by <i>Escherichia coli-</i>associated bacteremia.

Also flagged:CCNA2DecanallsplecithincarcinomaSitogluside
Journal Article 2018-11-25 No Snippets Xie G, Peng W, Li P, Xia Z, Zhong Y, He F, Tulake Y, Feng D, Wang Y, Xing Z.
Show Full Abstract

Traumatic brain injury (TBI) is a critical public health and socioeconomic problem worldwide. The herb pair <i>Astragali Radix</i> (AR)-<i>Radix Angelica Sinensis</i> (RAS) is a common prescribed herbal formula or is added to other Chinese medicine prescriptions for traumatic brain injury (TBI) treatment. However, the underlying mechanisms are unclear. In this study, we aimed to explore the active ingredients and action targets of AR-RAS based on the combined methods of network pharmacology prediction and experimental verification. Furthermore, the corresponding potential mechanisms of "multicomponents, multitargets, and multipathways" were disclosed. <i>Methods</i>. A network pharmacology approach including ADME (absorption, distribution, metabolism, and excretion) filter analysis, target prediction, known therapeutic targets collection, Gene Ontology (GO), pathway enrichment analysis, and network construction was used in this study. Further verification experiments were performed to reveal the therapeutic effects of AR-RAS in a rat model of TBI. <i>Results</i>. The comprehensive systematic approach was to successfully identify 14 bioactive ingredients in AR-RAS, while 33 potential targets hit by these ingredients related to TBI. Based on GO annotation analysis, multiple biological processes were significantly regulated by AR-RAS. In addition, 89 novel signaling pathways (P<0.05) underlying the effects of AR-RAS for TBI treatment were identified by DAVID. The neurotrophin signaling pathway was suggested as the major related pathway targeted by AR-RAS to improve axonal growth. The animal experiment confirmed that AR-RAS significantly induced tissue recovery and improved neurological deficits on the 14th day (P<0.01). Treatment with AR-RAS markedly reduced the protein and mRNA expression level of NogoA in the hippocampus of TBI rats. <i>Conclusion</i>. Our work illuminates the "multicompounds, multitargets, and multipathways" curative action of AR-RAS in the treatment of TBI by network pharmacology. The animal experiment verifies the effects of AR-RAS on neurological function improvement and axonal outgrowth via downregulation of NogoA expression, providing a theoretical basis for further research on treatment of TBI.

Also flagged:atherosclerosisdyslipidemialipoproteintriglyceridephospholipidlipid
Journal Article 2018-11-25 ✓ 5 Snippets Rodger EJ, Porteous CM, Jones GT, Legge M, Kleffmann T, McCormick SPA.
In-Text Gene Mentions

We investigated whether Lp(a) alone could promote changes in the antioxidant enzymes, GPx1, Prdx6, and Sod1, by incubating purified Lp(a) with human hepatoma cells.

…antioxidant (Park7, Gpx1,Prdx6, and Sod1) and…

…in Gpx1 andPrdx6but not Sod1…

…against Gpx1 (ab22604),Prdx6(ab59543), and Sod1…

…-Gpx1 (ab108427, Abcam), anti-Prdx6(ab16947 Abcam), and…

Show Full Abstract

<h4>Background</h4>Mouse models of hypercholesterolaemia have been used to identify arterial proteins involved in atherosclerosis. As the liver is extremely sensitive to dyslipidemia, one might expect major changes in the abundance of liver proteins in these models even before atherosclerosis develops.<h4>Methods</h4>Lipid levels were measured and a proteomic approach was used to quantify proteins in the livers of mice with an elevated low-density lipoprotein (LDL) and the presence of lipoprotein(a) [Lp(a)] but no atherosclerosis.<h4>Results</h4>The livers of Lp(a) mice showed an increased triglyceride but reduced phospholipid and oxidised lipid content. Two-dimensional gel electrophoresis and mass spectrometry analysis identified 24 liver proteins with significantly increased abundance in Lp(a) mice (<i>P</i><0.05). A bioinformatic analysis of the 24 proteins showed the major effect was that of an enhanced antioxidant and lipid efflux response with significant increases in antioxidant (Park7, Gpx1, Prdx6, and Sod1) and lipid metabolism proteins (Fabp4, Acaa2, apoA4, and ApoA1). Interestingly, human liver cells treated with Lp(a) showed significant increases in Gpx1 and Prdx6 but not Sod1 or Park7.<h4>Conclusions</h4>The presence of human LDL and Lp(a) in mice promotes an enhanced flux of lipids into the liver which elicits an antioxidant and lipid export response before the onset of atherosclerosis. The antioxidant response can be reproduced in human liver cells treated with Lp(a).

Also flagged:Fibrinogendeficiencyfibrinogen deficiencycoagulopathyhemostasiscoagulation
Journal Article 2018-11-25 No Snippets Peng HT, Nascimento B, Beckett A.
Show Full Abstract

Fibrinogen is crucial for the formation of blood clot and clinical outcomes in major bleeding. Both Thromboelastography (TEG) and Rotational Thromboelastometry (ROTEM) have been increasingly used to diagnose fibrinogen deficiency and guide fibrinogen transfusion in trauma and surgical bleeding patients. We conducted a comprehensive and comparative review on the technologies and clinical applications of two typical functional fibrinogen assays using TEG (FF TEG) and ROTEM (FIBTEM) for assessment of fibrinogen level and deficiency, and prediction of transfusion requirement. Clot strength and firmness of FF TEG and ROTEM FIBTEM were the most used parameters, and their associations with fibrinogen levels as measured by Clauss method ranged from 0 to 0.9 for FF TEG and 0.27 to 0.94 for FIBTEM. A comparison of the interchangeability and clinical performance of the functional fibrinogen assays using the two systems showed that the results were correlated, but are not interchangeable between the two systems. It appears that ROTEM FIBTEM showed better associations with the Clauss method and more clinical use for monitoring fibrinogen deficiency and predicting transfusion requirements including fibrinogen replacement than FF TEG. TEG and ROTEM functional fibrinogen tests play important roles in the diagnosis of fibrinogen-related coagulopathy and guidance of transfusion requirements. Despite the fact that high-quality evidence is still needed, the two systems are likely to remain popular for the hemostatic management of bleeding patients.

Also flagged:alanineaspartate aminotransferasemineralALTdiabetesglutamyl
Journal Article 2018-11-24 ✓ 2 Snippets Do HJ, Shin JS, Lee J, Lee YJ, Kim MR, Nam D, Kim EJ, Park Y, Suhr K, Ha IH.
In-Text Gene Mentions

…liver disease (NAFLD),hemochromatosis, and liver transplants…

…alcoholic cirrhosis, NAFLD,hemochromatosis, and liver transplants…

Show Full Abstract

<h4>Background</h4>Osteoporosis is a major health concern for both men and women, and associated fractures incur substantial economic burden. While there are a multitude of studies on bone mineral density (BMD) and liver diseases, not many studies have assessed the association between liver enzyme levels and BMD in homogeneous populations.<h4>Methods</h4>The current study investigated the association between serum liver enzyme levels and BMD at various sites in Koreans. Out of 21,517 surveyees of the 5th Korean National Health and Nutrition Examination Survey (2010-2012), 7160 participants' data on BMD, serum liver enzymes, and full covariate data were included for cross-sectional analysis. BMD at the femoral neck, lumbar spine, entire femur, and whole body was assessed using dual energy X-ray absorptiometry (DEXA), and liver enzymes included aspartate aminotransferase (AST), alanine aminotransferase (ALT), and gamma(γ)-glutamyl transferase (GGT) levels. Differences in participant characteristics by BMD and liver enzyme levels were analyzed, and complex sample design regression analysis adjusted for multiple covariates was performed to assess the relationship between liver enzymes and BMD.<h4>Results</h4>Negative associations were seen with GGT and BMD at all sites (P ≤ 0.02), ALT with lumbar spine (P = 0.0013), and AST with lumbar BMD (P = 0.0009). In particular, GGT presented strong negative associations with BMD in postmenopausal women and elder men.<h4>Conclusions</h4>This study demonstrates a negative relationship between liver enzyme levels and BMD, and suggests that a significant association exists between osteoporosis/decreased BMD and liver disorders.

Also flagged:Peroxiredoxin 6peroxiredoxinperoxiredoxinscysteineglutathioneglutathione S-transferase
Journal Article 2018-11-24 ✓ 5 Snippets Arevalo JA, Vázquez-Medina JP.
In-Text Gene Mentions

In contrast, extracellular Prdx6 signals through a toll-like receptor (TLR) after focal cerebral ischemia/reperfusion [87].

Prdx6 can also be aberrantly Sumoylated by Sumo1 at lysines 122 and 142 during oxidative stress.

Both aiPLA2 and Prdx6 peroxidase activities are implicated in lung tumor development through the regulation of redox-sensitive pathways such as MAPK, JNK, JAK/STAT, and AP-1 [75,76,77].

Mice that over-express Prdx6 show a greater increase in the growth of lung tumors compared to wild-type animals.

Similarly, Prdx6 reduces inflammation and protects against disruption to the blood–brain barrier in a model of multiple sclerosis [106].

Show Full Abstract

Peroxiredoxin 6 (Prdx6, 1-cys peroxiredoxin) is a unique member of the peroxiredoxin family that, in contrast to other mammalian peroxiredoxins, lacks a resolving cysteine and uses glutathione and π glutathione S-transferase to complete its catalytic cycle. Prdx6 is also the only peroxiredoxin capable of reducing phospholipid hydroperoxides through its glutathione peroxidase (Gpx) activity. In addition to its peroxidase activity, Prdx6 expresses acidic calcium-independent phospholipase A₂ (aiPLA₂) and lysophosphatidylcholine acyl transferase (LPCAT) activities in separate catalytic sites. Prdx6 plays crucial roles in lung phospholipid metabolism, lipid peroxidation repair, and inflammatory signaling. Here, we review how the distinct activities of Prdx6 are regulated during physiological and pathological conditions, in addition to the role of Prdx6 in cellular signaling and disease.

Also flagged:Peroxiredoxin 6fertilizationspermatogenesisPeroxiredoxinsoxygenperoxidase
Journal Article 2018-11-24 ✓ 5 Snippets O'Flaherty C.
In-Text Gene Mentions

The inhibition of 2-Cys PRDXs or PRDX6 iPLA2 activity promoted a rise in ROS levels, identified by increased lipid peroxidation that did not impair sperm viability, but prevented phosphorylation of protein kinase A (PKA) substrates [47] and residues of tyrosine (a hallmark of sperm capacitation) [48,49,50], leading to the inhibition of human sperm capacitation [46].

Thus, it is possible that failure to achieve fatherhood resides in the inactivation of PRDX6 iPLA2 in spermatozoa of infertile men.

…redoxins (PRDXs), particularlyPRDX6, are important players…

PRDX6, through its peroxidase…

…The absence ofPRDX6is sufficient to…

Show Full Abstract

The spermatozoon is a terminal cell with the unique purpose of delivering the paternal genome to the oocyte during fertilization. Once spermatozoa enter into the female reproductive tract, they count on only the antioxidant protection that they received during spermatogenesis and epididymal maturation. Peroxiredoxins (PRDXs), particularly PRDX6, are important players in the antioxidant protection and regulation of reactive oxygen species (ROS) levels in spermatozoa. PRDX6, through its peroxidase and calcium-independent phospholipase A₂ activities, plays a major role in the regulation of ROS to maintain viability and motility and allow the spermatozoon to achieve fertilizing ability during the complex process of capacitation. The absence of PRDX6 is sufficient to promote abnormal reproductive outcomes in mice that resemble what we observe in infertile men. Indeed, Prdx6<sup>-/-</sup> spermatozoa display low motility and severe DNA damage, which is translated into reduced ability to fertilize oocytes in vitro or produce a low number of pups compared to wild-type controls. This review focuses on the role of PRDX6 as the primary antioxidant enzyme that protects the spermatozoon from oxidative-stress-associated damages to protect the paternal genome and assure fertility.

Also flagged:Hodgkin lymphomaα-1-antitrypsinapolipoprotein A-IVinter-α-trypsin inhibitor heavyvitronectinfibrinogen
Journal Article 2018-11-24 ✓ 2 Snippets Repetto O, Mussolin L, Elia C, Martina L, Bianchi M, Buffardi S, Sala A, Burnelli R, Mascarin M, De Re V.
In-Text Gene Mentions

…inhibitor heavy chain;antithrombin-III; vitronectin; fibrinogen α,…

…inhibitor heavy chain;antithrombin-III; vitronectin; and 4…

Show Full Abstract

The treatment of paediatric Hodgkin lymphoma (HL) has steadily improved over the years, so that 10- years survival exceed 80%. The purpose of this study was to identify prognostic markers for relapsed HL that might contribute to optimize therapeutic approaches. To this aim we retrospectively analysed differential protein expression profiles obtained from plasma of children/adolescents with HL (age ranging from 10 to 18 years) collected at diagnosis. We examined the protein profiles of 15 HL relapsed (R) patients compared with 14 HL not relapsed (NR) patients treated with the same LH-2004 protocol. Two dimensional difference in gel electrophoresis (2D-DIGE) revealed significant differences (fold change > 1.5; Student's T-test <i>p</i><0.01) between R and NR patients in 10 proteins: α-1-antitrypsin chain a, apolipoprotein A-IV precursor; inter-α-trypsin inhibitor heavy chain; antithrombin-III; vitronectin; fibrinogen α, β and γ chains, complement C3, and ceruloplasmin. An up-regulation of fibrinogen α (spots 78, 196, 230, 234, 239) and β (spots 98, 291, 296, 300) chains together with a lower level of α-1-antitrypsin (spots 255, 264, 266, 272, 273) were found in R patients, and this difference was validated by immunoblotting. The functional role(s) of these proteins in the coagulation and inflammation associated with paediatric/adolescent HL progression and relapse deserves further investigations.

Also flagged:SF3B1Myeloproliferative NeoplasmThrombocytosis
Journal Article 2018-11-23 No Snippets Lazo-Langner A, Sadikovic B.
Show Full Abstract

No abstract available.

Also flagged:thrombotic antiphospholipid syndromevenous thromboembolismTSP1A-Ihistidineglycoprotein
Journal Article 2018-11-23 ✓ 4 Snippets Stachowicz A, Zabczyk M, Natorska J, Suski M, Olszanecki R, Korbut R, Wiśniewski JR, Undas A.
In-Text Gene Mentions

…amounts of (pro)thrombin,antithrombin-III, apolipoprotein A-I, and…

…decreased content ofantithrombin-III(ATIII), prothrombin (F2),…

…content of antithrombin-III (ATIII), prothrombin (F2), FXIII…

…low amounts ofATIIIor prothrombin.…

Show Full Abstract

The prothrombotic fibrin clot phenotype has been reported in patients with thrombotic antiphospholipid syndrome (APS) and venous thromboembolism (VTE). Protein composition of plasma fibrin clots in APS has not been studied. We evaluated 23 patients with thrombotic APS, 19 with VTE alone, and 20 well-matched controls. A proteomic analysis of fibrin clots generated from citrated plasma was based on liquid chromatography-mass spectrometry. Plasma levels of thrombospondin-1 (TSP1), apolipoprotein(a), A-I, and B-100, complement components (C)3a, C5b-C9, histidine-rich glycoprotein (HRG), and prothrombin were evaluated using immunoenzymatic tests. In plasma fibrin clots of APS patients, compared with VTE subjects and controls, we identified decreased amounts of (pro)thrombin, antithrombin-III, apolipoprotein A-I, and HRG with no differences in plasma levels of antithrombin, prothrombin, along with lower plasma HRG and apolipoprotein A-I. In APS patients, plasma HRG positively correlated with amounts of clot-bound HRG, while apolipoprotein A-I was inversely associated with clot-bound levels of this protein. The most predominant proteins within the clots of APS patients were bone marrow proteoglycan, C5-C9, immunoglobulins, apolipoprotein B-100, platelet-derived proteins, and TSP1. Our study is the first to demonstrate differences in the protein composition of fibrin clots generated from plasma of thrombotic APS patients versus those with VTE alone.

Also flagged:synthesis2,4,6-triarylpyridinesacetophenonearyl aldehydesammoniumacetate
Journal Article 2018-11-23 No Snippets Maleki A, Firouzi-Haji R.
Show Full Abstract

In this work, an efficient method for the immobilization of L-proline on magnetic nanoparticles was offered and evaluated as a recoverable magnetic nanocatalyst for synthesis of 2,4,6-triarylpyridines through one-pot three-component reaction of acetophenone, aryl aldehydes and ammonium acetate. This article is the first report of the catalytic application of L-proline functionalized magnetic nanoparticles in organic reactions as a magnetic nanocatalyst. This novel magnetic nanocatalyst proved to be effective and provided the products in high to excellent yield under solvent-free conditions. The structure of obtained nanoparticles was characterized by Fourier transform infrared spectrophotometry (FT-IR), field-emission scanning electron microscopy (FE-SEM), thermogravimetric analysis (TGA) and energy-dispersive X-ray spectroscopy (EDX). TGA result revealed that it is stable up to 200 °C for using as a catalyst in organic reactions. FE-SEM image of the synthesized nanocatalyst showed that it has nearly core-shell spherical shape and uniform size distribution with an average size about 80 nm. Moreover, the catalyst could be easily recovered by facile separation by magnetic forces and recycled for several times without significant loss of its catalytic activity. The benefits of this study are simplicity, nontoxicity, low cost, simple workup, and an environmentally benign nature.

Also flagged:Fgf8axonal growth conesIgsf21Pde10aBtbd3gene expression
Journal Article 2018-11-23 ✓ 5 Snippets Botella-López A, Garcia-Lopez R, Pombero A, Martinez S.
In-Text Gene Mentions

…and incubated with anti-DCCantibody (1:100; SantaCruz…

…Altered Ntn1 andDCCexpression in the…

…Netrin 1 (Ntn1) /DCCand Slit 1,…

…the axons expressingDCC receptorsreceptors (Powell et…

…and its receptor (DCC).…

Show Full Abstract

Thalamic neurons are distributed between different nuclear groups of the thalamic multinuclear complex; they develop topologically ordered specific projections that convey information on voluntary motor programs and sensory modalities to functional areas in the cerebral cortex. Since thalamic neurons present a homogeneous morphology, their functional specificity is derived from their afferent and efferent connectivity. Adequate development of thalamic afferent and efferent connections depends on guide signals that bind receptors in nuclear neuropils and axonal growth cones, respectively. These are finally regulated by regionalization processes in the thalamic neurons, codifying topological information. In this work, we studied the role of Fgf8 morphogenetic signaling in establishing the molecular thalamic protomap, which was revealed by Igsf21, Pde10a and Btbd3 gene expression in the thalamic mantle layer. Fgf8 signaling activity was evidenced by pERK expression in radial glia cells and fibers, which may represent a scaffold that translates neuroepithelial positional information to the mantle layer. In this work, we describe the fact that Fgf8-hypomorphic mice did not express pERK in radial glia cells and fibers and presented disorganized thalamic regionalization, increasing neuronal death in the ventro-lateral thalamus and strong disruption of thalamocortical projections. In conclusion, Fgf8 encodes the positional information required for thalamic nuclear regionalization and the development of thalamocortical projections.

Also flagged:IronHomeostasismetabolismmyelinationsynthesisneurodegenerative diseases
Journal Article 2018-11-23 No Snippets Nnah IC, Wessling-Resnick M.
Show Full Abstract

Iron is an essential trace element required for important brain functions including oxidative metabolism, synaptic plasticity, myelination, and the synthesis of neurotransmitters. Disruptions in brain iron homeostasis underlie many neurodegenerative diseases. Increasing evidence suggests that accumulation of brain iron and chronic neuroinflammation, characterized by microglia activation and secretion of proinflammatory cytokines, are hallmarks of neurodegenerative disorders including Alzheimer' s disease. While substantial efforts have led to an increased understanding of iron metabolism and the role of microglial cells in neuroinflammation, important questions still remain unanswered. Whether or not increased brain iron augments the inflammatory responses of microglial cells, including the molecular cues that guide such responses, is still unclear. How these brain macrophages accumulate, store, and utilize intracellular iron to carry out their various functions under normal and disease conditions is incompletely understood. Here, we describe the known and emerging mechanisms involved in microglial cell iron transport and metabolism as well as inflammatory responses in the brain, with a focus on AD.

Also flagged:CurcuminNeurodegenerative diseasesneurodegenerative disordersresveratrolvitamin Erosmarinic acid
Journal Article 2018-11-23 No Snippets Rakotoarisoa M, Angelova A.
Show Full Abstract

Neurodegenerative diseases have become a major challenge for public health because of their incurable status. Soft nanotechnology provides potential for slowing down the progression of neurodegenerative disorders by using innovative formulations of neuroprotective antioxidants like curcumin, resveratrol, vitamin E, rosmarinic acid, 7,8-dihydroxyflavone, coenzyme Q10, and fish oil. Curcumin is a natural, liposoluble compound, which is of considerable interest for nanomedicine development in combination therapies. The neuroprotective effects of combination treatments can involve restorative mechanisms against oxidative stress, mitochondrial dysfunction, inflammation, and protein aggregation. Despite the anti-amyloid and anti-tau potential of curcumin and its neurogenesis-stimulating properties, the utilization of this antioxidant as a drug in neuroregenerative therapies has huge limitations due to its poor water solubility, physico-chemical instability, and low oral bioavailability. We highlight the developments of soft lipid- and polymer-based delivery carriers of curcumin, which help improve the drug solubility and stability. We specifically focus on amphiphilic liquid crystalline nanocarriers (cubosome, hexosome, spongosome, and liposome particles) for the encapsulation of curcumin with the purpose of halting the progressive neuronal loss in Alzheimer's, Parkinson's, and Huntington's diseases and amyotrophic lateral sclerosis (ALS).

Also flagged:myelinlipidmembranesphingolipidssphingolipidmetabolism
Journal Article 2018-11-23 No Snippets Wattenberg BW.
Show Full Abstract

The myelin sheath, produced by oligodendrocytes in the central nervous system, provides essential electrical insulation to neurons, but also is critical for viability of neurons. Both the protein and lipid composition of this fascinating membrane is unique. Here the focus is on the sphingolipids that are highly abundant in myelin and, in particular, how they are produced. This review discusses how sphingolipid metabolism is regulated. In particular the subcellular localization of lipid metabolic enzymes is discussed and how inter-organelle transport can affect the metabolic routes that sphingolipid precursors take. Understanding the regulation of sphingolipid metabolism in formation of the myelin membrane will have a significant impact on strategies to treat demyelinating diseases.

Also flagged:malignant hyperthermiaMHheat illnessHIoxygenlactate
Journal Article 2018-11-23 No Snippets House CM, Tipton MJ, Tipton MJ, Hopkins PM, Roiz de Sa D.
Show Full Abstract

<h4>Objectives</h4>The study was undertaken to compare the thermal and biochemical responses to a heat tolerance test (HTT) of malignant hyperthermia (MH) susceptible individuals, volunteers who have suffered heat illness (HI) and control volunteers.<h4>Methods</h4>Three groups of male volunteers (n=6 in each group) were recruited to the study: MHS - civilian volunteers previously diagnosed as MH susceptible; EHI - military volunteers with a history of exertional HI; CON - military volunteers with no history of HI or MH. For the HTT, volunteers walked on a treadmill at 60% maximal oxygen uptake in a hot environment. Measurements were made of core and skin temperatures, heat flow, whole body sweat rate and serum lactate, creatine kinase and myoglobin concentrations.<h4>Results</h4>There were no differences in deep body temperature, oxygen uptake or serum lactate and creatine kinase concentrations between the three groups. One MHS volunteer and two EHI volunteers failed to achieve thermal balance with rectal temperature continuing to rise throughout the test and reaching 39.5°C, the rectal temperatures of the other volunteers plateaued at a mean (SD) of 38.7 (0.4)°C demonstrating thermal tolerance on this test. Serum myoglobin concentration and the increase in serum myoglobin was higher in MHS than EHI and CON Post HHT (P<0.05).<h4>Conclusion</h4>MH susceptibility does not always predispose an individual to heat intolerance during an acute HTT, but does appear to increase muscle breakdown. The inclusion of serum myoglobin measurements to a HTT may help to distinguish patients that are potentially MHS, and who otherwise demonstrate thermal tolerance.

Also flagged:Semaphorin 3FNetrin-1angiogenesistumorSEMA3Faxon guidance factor
Journal Article 2018-11-23 ✓ 4 Snippets Nakayama H, Kusumoto C, Nakahara M, Fujiwara A, Higashiyama S.
In-Text Gene Mentions

For example, the netrin-1 receptor DCC was identified originally as a tumor suppressor in colon cancer associated with a deletion in chromosome 18q21 (Fearon et al., 1990).

…neuropilins, UNC5, orDCCfamilies, Eph, and…

…in colorectal cancer (DCC), its ortholog neogenin,…

…the netrin-1 receptorDCCwas identified originally…

Show Full Abstract

Axon guidance molecules play an important role in regulating proper neuronal networking during neuronal development. They also have non-neuronal properties, which include angiogenesis, inflammation, and tumor development. Semaphorin 3F (SEMA3F), a member of the class 3 semaphorins, was initially identified as an axon guidance factor, that repels axons and collapses growth cones. However, SEMA3F has similar effects on endothelial cells (ECs) and tumor cells. In this review, we discuss the novel molecular mechanisms underlying SEMA3F activity in vascular and tumor biology. Recent evidence suggests that SEMA3F functions as a PI3K-Akt-mTOR inhibitor in mammalian cells, including T cells, ECs, and tumor cells. Therefore, SEMA3F may have broad therapeutic implications. We also discuss the key role of axon guidance molecules as regulators of the tumor microenvironment. Netrin-1, a chemoattractant factor in the neuronal system, promotes tumor progression by enhancing angiogenesis and metastasis. Moreover, our recent studies demonstrate that netrin-1/neogenin interactions augment CD4+ T cell chemokinesis and elicit pro-inflammatory responses, suggesting that netrin-1 plays a key role in modulating the function of a tumor and its surrounding cells in the tumor microenvironment. Overall, this review focuses on SEMA3F and netrin-1 signaling mechanisms to understand the diverse biological functions of axon guidance molecules.

Also flagged:Netrin-1Glucoseinsulin resistancetype 2 diabetesimpaired fastingobesity
Journal Article 2018-11-23 ✓ 2 Snippets Yim J, Kim G, Lee BW, Kang ES, Cha BS, Kim JH, Cho JW, Lee SG, Lee YH.
In-Text Gene Mentions

…in colorectal cancer (DCC) subfamily (e.g., DCC…

…(DCC) subfamily (e.g.,DCCand Neogenin) and…

Show Full Abstract

<b>Background:</b> The protein netrin-1 has demonstrated anti-inflammatory, tissue regeneration, and immune modulation properties. Although inflammation is a major contributing factor in the development of insulin resistance and type 2 diabetes, little is known about a possible relationship between serum netrin-1 and type 2 diabetes. Therefore, we investigated the association between circulating levels of netrin-1 and glycometabolic parameters predictive of type 2 diabetes. <b>Methods:</b> Serum samples were collected from 41 normal controls, 85 subjects with impaired fasting glucose (IFG), and 92 subjects with newly diagnosed type 2 diabetes. Clinical and laboratory parameters were assessed and netrin-1 levels were measured by commercial enzyme-linked immunosorbent assay. Spearman correlation analyses and multivariable-adjusted regression analyses were conducted to examine the relationship between serum netrin-1 levels and glycometabolic parameters. <b>Results:</b> Serum netrin-1 levels in subjects with type 2 diabetes or IFG were significantly higher compared to normal controls (441.0, 436.6, and 275.9 pg/mL, respectively; <i>P</i> for trend < 0.001). Serum netrin-1 levels were significantly positively correlated with fasting glucose, HbA<sub>1c</sub>, and insulin resistance index (all <i>P</i>s < 0.01). Serum netrin-1 levels were independently associated with IFG or type 2 diabetes (standardized β = 0.405, <i>P</i> < 0.001) after adjusting for covariates and potential confounders. In addition, the receiver operating characteristic (ROC) analysis showed that serum netrin-1 levels could identify the presence of IFG and type 2 diabetes with the area under the ROC curve (AUC) of 0.784 (<i>P</i> < 0.001). <b>Conclusions:</b> Our results suggest that elevated serum netrin-1 levels are significantly associated with the presence of IFG and type 2 diabetes.

Also flagged:Coppersynthesis1,2,3-triazolesalkylperoxidesdiacyl
Journal Article 2018-11-23 No Snippets Israr M, Ye C, Muhammad MT, Li Y, Bao H.
Show Full Abstract

A copper-catalyzed azide-alkyne cycloaddition (CuAAC) reaction for the synthesis of 1,4-disubstituted 1,2,3-triazoles from alkyl diacyl peroxides, azidotrimethylsilane, and terminal alkynes is reported. The alkyl carboxylic acids is for the first time being used as the alkyl azide precursors in the form of alkyl diacyl peroxides. This method avoids the necessity to handle organic azides, as they are generated in situ, making this protocol operationally simple. The Cu(I) catalyst not only participates in the alkyl diacyl peroxides decomposition to afford alkyl azides but also catalyzes the subsequent CuAAC reaction to produce the 1,2,3-triazoles.

Also flagged:Ewing sarcomareversible lysine specific demethylaseHDACvorinostatentinostatextracellular matrix proteins
Journal Article 2018-11-23 No Snippets Pishas KI, Lessnick SL.
Show Full Abstract

Ewing sarcoma is the second most common solid bone malignancy diagnosed in pediatric and young adolescent populations. Despite global co-operative efforts, outcomes for patients with relapsed and refractory disease remains obstinately poor. It has become increasingly clear that disruption of the epigenome as a result of alterations in epigenetic regulators, plays a pivotal role in tumorigenesis. As such, this study investigated Ewing sarcoma mechanisms of acquired resistance to the small molecule reversible lysine specific demethylase (<i>LSD1</i>/<i>KDM1A</i>) inhibitor SP-2509. Surprisingly, whole exome sequencing analysis of our generated A673 SP-2509 drug resistant cell line revealed an absence of mutations in <i>KDM1A</i>. Compared to parental counterparts, SP-2509 drug resistant cells demonstrated decreased anchorage independent growth capacity, enhanced sensitivity to the HDAC inhibitors vorinostat/entinostat and a distinct transcriptional profile that was enriched for extracellular matrix proteins. SP-2509 drug resistant cells also exhibited elevated expression levels of the multi-drug resistance genes <i>ABCB1</i>, <i>ABCC3</i>, and <i>ABBC5</i> and decreased expression of the transcriptional repressor <i>RCOR1</i>/<i>CoREST</i>. Following several months of SP-2509 withdrawal, low level SP-2509 resistance was still apparent (6.3 fold increase in IC<sub>50</sub>), with drug resistant cell populations maintaining their distinct transcriptional profile. Furthermore, compared to parental cells, washout drug resistant lines displayed equal sensitivity to the standard Ewing sarcoma chemotherapeutic agent's vincristine and doxorubicin. Together these findings indicate that resistance to SP-2509 is not fully reversible or driven by direct mutation in <i>KDM1A</i>.

Also flagged:OligonucleotidesoligonucleotideDNase Idegradationgene expressionbiosynthesis
Journal Article 2018-11-23 ✓ 1 Snippet Fihurka O, Sanchez-Ramos J, Sava V.
In-Text Gene Mentions

htt

Show Full Abstract

Gene therapy delivery systems that rely on synthetic nanocarriers can be optimized by assays of nucleic acid protection and kinetic studies of nucleic acid release. These empirical measurements ensure nanoparticle stability and predict potential <i>in vivo</i> efficacy. Quantitative methods for assessment of the capacity of nanoparticles to protect oligonucleotide cargo and to measure the rate of release of the cargo were developed and tested based on six commercial cationic matrices. <i>in vitro</i> study of drug release kinetics provides predictable release rates under a variety of conditions which can be adapted to appropriate physiological factors that affect release <i>in vivo</i>. In brief, <i>in vitro</i> DNA release and DNase I degradation assays described here will be useful for optimization of nanocarrier-mediated gene therapy administration by various routes.

Also flagged:chromosomeAMLacute myeloid leukemiahematologicacute leukemiamyelodysplasia
Journal Article 2018-11-22 ✓ 2 Snippets Aypar U, Smoley SA, Pitel BA, Pearce KE, Zenka RM, Vasmatzis G, Johnson SH, Smadbeck JB, Peterson JF, Geiersbach KB, Van Dyke DL, Thorland EC, Jenkins RB, Ketterling RP, Greipp PT, Kearney HM, Hoppman NL, Baughn LB.
In-Text Gene Mentions

…exons 9‐24 ofMLLT10into intron 9…

…confirmed using aMLLT10/KMT2A D‐FISH probe and…

Show Full Abstract

<h4>Objective</h4>Acute myeloid leukemia (AML) can be subtyped based on recurrent cytogenetic and molecular genetic abnormalities with diagnostic and prognostic significance. Although cytogenetic characterization classically involves conventional chromosome and/or fluorescence in situ hybridization (FISH) assays, limitations of these techniques include poor resolution and the inability to precisely identify breakpoints.<h4>Method</h4>We evaluated whether an NGS-based methodology that detects structural abnormalities and copy number changes using mate pair sequencing (MPseq) can enhance the diagnostic yield for patients with AML.<h4>Results</h4>Using 68 known abnormal and 20 karyotypically normal AML samples, each recurrent primary AML-specific abnormality previously identified in the abnormal samples was confirmed using MPseq. Importantly, in eight cases with abnormalities that could not be resolved by conventional cytogenetic studies, MPseq was utilized to molecularly define eight recurrent AML-fusion events. In addition, MPseq uncovered two cryptic abnormalities that were missed by conventional cytogenetic studies. Thus, MPseq improved the diagnostic yield in the detection of AML-specific structural rearrangements in 10/88 (11%) of cases analyzed.<h4>Conclusion</h4>Utilization of MPseq represents a precise, molecular-based technique that can be used as an alternative to conventional cytogenetic studies for newly diagnosed AML patients with the potential to revolutionize the diagnosis of hematologic malignancies.

Also flagged:Sialosidessynthesisbindingoligoethylene glycolspike proteinsadamantane
Journal Article 2018-11-22 No Snippets Kiran P, Bhatia S, Lauster D, Aleksić S, Fleck C, Peric N, Maison W, Liese S, Keller BG, Herrmann A, Haag R.
Show Full Abstract

Herein, the chemical synthesis and binding analysis of functionalizable rigid and flexible core trivalent sialosides bearing oligoethylene glycol (OEG) spacers interacting with spike proteins of influenza A virus (IAV) X31 is described. Although the flexible Tris-based trivalent sialosides achieved micromolar binding constants, a trivalent binder based on a rigid adamantane core dominated flexible tripodal compounds with micromolar binding and hemagglutination inhibition constants. Simulation studies indicated increased conformational penalties for long OEG spacers. Using a systematic approach with molecular modeling and simulations as well as biophysical analysis, these findings emphasize on the importance of the scaffold rigidity and the challenges associated with the spacer length optimization.

Also flagged:adult-onsetleukodystrophiesAdult-onset leukodystrophiesgenetic leukoencephalopathiesneurodegenerative disorderscognitive impairment
Journal Article 2018-11-22 ✓ 4 Snippets Lynch DS, Wade C, Paiva ARB, John N, Kinsella JA, Merwick Á, Ahmed RM, Warren JD, Mummery CJ, Schott JM, Fox NC, Houlden H, Adams ME, Davagnanam I, Murphy E, Chataway J.
In-Text Gene Mentions

DARS2 mutations are usually compound heterozygous, and the most frequent variant is a splice site mutation in intron 2.58 This region is poorly covered by next-generation sequencing approaches, and single-gene testing is recommended if the clinical and radiological picture is suggestive of LBSL.

…as AARS2 andDARS2, are discussed…

…mutations in theDARS2gene.…

DARS2mutations are usually…

Show Full Abstract

Adult-onset leukodystrophies and genetic leukoencephalopathies comprise a diverse group of neurodegenerative disorders of white matter with a wide age of onset and phenotypic spectrum. Patients with white matter abnormalities detected on MRI often present a diagnostic challenge to both general and specialist neurologists. Patients typically present with a progressive syndrome including various combinations of cognitive impairment, movement disorders, ataxia and upper motor neuron signs. There are a number of important and treatable acquired causes for this imaging and clinical presentation. There are also a very large number of genetic causes which due to their relative rarity and sometimes variable and overlapping presentations can be difficult to diagnose. In this review, we provide a structured approach to the diagnosis of inherited disorders of white matter in adults. We describe clinical and radiological clues to aid diagnosis, and we present an overview of both common and rare genetic white matter disorders. We provide advice on testing for acquired causes, on excluding small vessel disease mimics, and detailed advice on metabolic and genetic testing available to the practising neurologist. Common genetic leukoencephalopathies discussed in detail include <i>CSF1R</i>, <i>AARS2</i>, cerebral arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL), and mitochondrial and metabolic disorders.

Also flagged:IκB kinasegene expressionproteinenhancer of decapping 4mRNA decapping proteins 1atranscription factor
Journal Article 2018-11-22 ✓ 1 Snippet Mikuda N, Kolesnichenko M, Beaudette P, Popp O, Uyar B, Sun W, Tufan AB, Perder B, Akalin A, Chen W, Mertins P, Dittmar G, Hinz M, Scheidereit C.
In-Text Gene Mentions

RC3H1

Show Full Abstract

The IκB kinase (IKK) is considered to control gene expression primarily through activation of the transcription factor NF-κB. However, we show here that IKK additionally regulates gene expression on post-transcriptional level. IKK interacted with several mRNA-binding proteins, including a Processing (P) body scaffold protein, termed enhancer of decapping 4 (EDC4). IKK bound to and phosphorylated EDC4 in a stimulus-sensitive manner, leading to co-recruitment of P body components, mRNA decapping proteins 1a and 2 (DCP1a and DCP2) and to an increase in P body numbers. Using RNA sequencing, we identified scores of transcripts whose stability was regulated via the IKK-EDC4 axis. Strikingly, in the absence of stimulus, IKK-EDC4 promoted destabilization of pro-inflammatory cytokines and regulators of apoptosis. Our findings expand the reach of IKK beyond its canonical role as a regulator of transcription.

Also flagged:Gpr101Msh5RbpjlKcnf1Aldh1b1CASQ2
Journal Article 2018-11-22 ✓ 3 Snippets Qu Z, Titus ASCLS, Xuan Z, D'Mello SR.
In-Text Gene Mentions

Ptgis

…with huntingtin (Htt) and this…

…nteraction with polyQ-expandedHtt.…

Show Full Abstract

Heat shock factor-1 (HSF1) protects neurons from death caused by the accumulation of misfolded proteins by stimulating the transcription of genes encoding heat shock proteins (HSPs). This stimulatory action depends on the association of trimeric HSF1 to sequences within HSP gene promoters. However, we recently described that HSF-AB, a mutant form of HSF1 that is incapable of either homo-trimerization, association with HSP gene promoters, or stimulation of HSP expression, protects neurons just as efficiently as wild-type HSF1 suggesting an alternative neuroprotective mechanism that is activated by HSF1. To gain insight into the mechanism by which HSF1 and HSF1-AB protect neurons, we used RNA-Seq technology to identify transcriptional alterations induced by these proteins in either healthy cerebellar granule neurons (CGNs) or neurons primed to die. When HSF1 was ectopically-expressed in healthy neurons, 1,211 differentially expressed genes (DEGs) were identified with 1,075 being upregulated. When HSF1 was expressed in neurons primed to die, 393 genes were upregulated and 32 genes were downregulated. In sharp contrast, HSF1-AB altered expression of 13 genes in healthy neurons and only 6 genes in neurons under apoptotic conditions, suggesting that the neuroprotective effect of HSF1-AB may be mediated by a non-transcriptional mechanism. We validated the altered expression of 15 genes by QPCR. Although other studies have conducted RNA-Seq analyses to identify HSF1 targets, our study performed using primary neurons has identified a number of novel targets that may play a special role in brain maintenance and function.

Also flagged:regulator of G-protein signalling 2RGS2Prostate cancercancerRegulator of G-protein signaling 2carcinomas
Journal Article 2018-11-22 No Snippets Linder A, Hagberg Thulin M, Damber JE, Welén K.
Show Full Abstract

Prostate cancer (PC) represents the second highest cancer-related mortality among men and the call for biomarkers for early discrimination between aggressive and indolent forms is essential. Downregulation of Regulator of G-protein signaling 2 (RGS2) has been shown in PC, however the underlying mechanism has not been described. Aberrant RGS2 expression has also been reported for other carcinomas in association to both positive and negative prognosis. In this study, we assessed RGS2 expression during PC progression in terms of regulation and impact on tumour phenotype and evaluated its prognostic value. Our experimental data suggest that the RGS2 downregulation seen in early PC is caused by hypoxia. In line with the common indolent phenotype of a primary PC, knockdown of RGS2 induced epithelial features and impaired metastatic properties. However, increased STAT3, TWIST1 and decreased E-cadherin expression suggest priming for EMT. Additionally, improved tumour cell survival and increased BCL-2 expression linked decreased RGS2 levels to fundamental tumour advantages. In contrast, high RGS2 levels in advanced PC were correlated to poor patient survival and a positive metastatic status. This study describes novel roles for RGS2 during PC progression and suggests a prognostic potential discriminating between indolent and metastatic forms of PC.

Also flagged:NeurogenesisbehavioralSubstance use disordersmethamphetaminecancercell division
Journal Article 2018-11-22 No Snippets Oliver RJ, Mandyam CD.
Show Full Abstract

The discovery of non-coding RNAs (ncRNAs)has been one of the central findings from early genomic sequencing studies. Not only was the presence of these genes unknown previously, it was the staggering disproportionate share of the genome that was predicted to be encoded by ncRNAs that was truly significant in genomic research. Over the years the function of various classes of these ncRNAs has been revealed. One of the first and enduring regulatory programs associated with these factors was development. In the neurosciences, the discovery of adult derived populations of dividing cells within the brain was equally substantial. The brain was hypothesized to be plastic only in its neuronal connectivity, but the discovery of the generation of new neurons was a novel mechanism of neuronal and behavioral plasticity. The process of adult neurogenesis resembles early neuronal development and has been found to share many parallels in the proper stages of specified genetic programs. Adult neurogenesis has also been found to play a role in learning and memory involved in particular hippocampal-dependent behaviors. Substance use disorders (SUDs) are an example of a behavioral condition that is associated with and possibly driven by hippocampal alterations. Our laboratory has determined that hippocampal adult neurogenesis is necessary for a rodent model of methamphetamine relapse. Due to the previous research on ncRNAs in development and in other brain regions involved in SUDs, we posit that ncRNAs may play a role in adult neurogenesis associated with this disorder. This review will cover the regulatory mechanisms of various classes of ncRNAs on the coordinated genetic program associated with adult neurogenesis with a special focus on how these programs could be dysregulated in SUDs.

Also flagged:vascular diseasegene expressiondegradationtranslationalchromatinatherosclerosis
Journal Article 2018-11-22 No Snippets Hung J, Miscianinov V, Sluimer JC, Newby DE, Baker AH.
Show Full Abstract

Only recently have we begun to appreciate the importance and complexity of the non-coding genome, owing in some part to truly significant advances in genomic technology such as RNA sequencing and genome-wide profiling studies. Previously thought to be non-functional transcriptional "noise," non-coding RNAs (ncRNAs) are now known to play important roles in many diverse biological pathways, not least in vascular disease. While microRNAs (miRNA) are known to regulate protein-coding gene expression principally through mRNA degradation, long non-coding RNAs (lncRNAs) can activate and repress genes by a variety of mechanisms at both transcriptional and translational levels. These versatile molecules, with complex secondary structures, may interact with chromatin, proteins, and other RNA to form complexes with an array of functional consequences. A body of emerging evidence indicates that both classes of ncRNAs regulate multiple physiological and pathological processes in vascular physiology and disease. While dozens of miRNAs are now implicated and described in relative mechanistic depth, relatively fewer lncRNAs are well described. However, notable examples include <i>ANRIL</i>, <i>SMILR</i>, and <i>SENCR</i> in vascular smooth muscle cells; <i>MALAT1 and GATA-6S</i> in endothelial cells; and mitochondrial lncRNA <i>LIPCAR</i> as a powerful biomarker. Due to such ubiquitous involvement in pathology and well-known biogenesis and functional genetics, novel miRNA-based therapies and delivery methods are now in development, including some early stage clinical trials. Although lncRNAs may hold similar potential, much more needs to be understood about their relatively complex molecular behaviours before realistic translation into novel therapies. Here, we review the current understanding of the mechanism and function of ncRNA, focusing on miRNAs and lncRNAs in vascular disease and atherosclerosis. We discuss existing therapies and current delivery methods, emphasising the importance of miRNAs and lncRNAs as effectors and biomarkers in vascular pathology.

Also flagged:MAPK15nasopharyngeal canceroxygenprotein kinaseCNE1Nasopharyngeal Carcinoma
Journal Article 2018-11-22 No Snippets Li Z, Li N, Shen L, Fu J.
Show Full Abstract

Since resistance to radiotherapy remains refractory for the clinical management of nasopharyngeal cancer (NPC), further understanding the mechanisms of radioresistance is necessary in order to develop more effective NPC treatment and improve prognosis. In this study, an integrated quantitative proteomic approach involving tandem mass tag labeling and liquid chromatograph-mass spectrometer was used to identify proteins potentially responsible for the radioresistance of NPC. The differential radiosensitivity in NPC model cells was examined through clonogenic survival assay, CCK-8 viability assay, and BrdU incorporation analysis. Apoptosis of NPC cells after exposure to irradiation was detected using caspase-3 colorimetric assay. Intracellular reactive oxygen species (ROS) was detected by a dichlorofluorescin diacetate fluorescent probe. In total, 5,946 protein groups were identified, among which 5,185 proteins were quantified. KEGG pathway analysis and protein-protein interaction enrichment analysis revealed robust activation of multiple biological processes/pathways in radioresistant CNE2-IR cells. Knockdown of MAPK15, one up-regulated protein kinase in CNE2-IR cells, significantly impaired clonogenic survival, decreased cell viability and increased cell apoptosis following exposure to irradiation, while over-expression of MAPK15 promoted cell survival, induced radioresistance and reduced apoptosis in NPC cell lines CNE1, CNE2, and HONE1. MAPK15 might regulate radioresistance through attenuating ROS accumulation and promoting DNA damage repair after exposure to irradiation in NPC cells. Quantitative proteomic analysis revealed enormous metabolic processes/signaling networks were potentially involved in the radioresistance of NPC cells. MAPK15 might be a novel potential regulator of radioresistance in NPC cells, and targeting MAPK15 might be useful in sensitizing NPC cells to radiotherapy.

Also flagged:autosomesMAFnucleotidenucleotidesamino acidscytosine
Journal Article 2018-11-22 No Snippets Gagliano SA, Sengupta S, Sidore C, Maschio A, Cucca F, Schlessinger D, Abecasis GR.
Show Full Abstract

It is unclear whether insertions and deletions (indels) are more likely to influence complex traits than abundant single-nucleotide polymorphisms (SNPs). We sought to understand which category of variation is more likely to impact health. Using the SardiNIA study as an exemplar, we characterized 478,876 common indels and 8,246,244 common SNPs in up to 5,949 well-phenotyped individuals from an isolated valley in Sardinia. We assessed association between 120 traits, resulting in 89 nonoverlapping-associated loci.We evaluated whether indels were enriched among credible sets of potential causal variants. These credible sets included 1,319 SNPs and 88 indels. We did not find indels to be significantly enriched. Indels were the most likely causal variant in seven loci, including one locus associated with monocyte count where an indel with causality and mechanism previously demonstrated (rs200748895:TGCTG/T) had a 0.999 posterior probability. Overall, our results show a very modest and nonsignificant enrichment for common indels in associated loci.

Also flagged:Nonalcoholic Fatty Liver DiseaseNAFLDliver diseasesmetabolic syndromefattyhepatic steatosis
Journal Article 2018-11-22 ✓ 1 Snippet Lin YH, Liao YY, Yeh CK, Yang KC, Tsui PH.
In-Text Gene Mentions

…vascular, or inheritedhemochromatosisor Wilson disease).…

Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD) is the leading cause of advanced liver diseases. Fat accumulation in the liver changes the hepatic microstructure and the corresponding statistics of ultrasound backscattered signals. Acoustic structure quantification (ASQ) is a typical model-based method for analyzing backscattered statistics. Shannon entropy, initially proposed in information theory, has been demonstrated as a more flexible solution for imaging and describing backscattered statistics without considering data distribution. NAFLD is a hepatic manifestation of metabolic syndrome (MetS). Therefore, we investigated the association between ultrasound entropy imaging of NAFLD and MetS for comparison with that obtained from ASQ. A total of 394 participants were recruited to undergo physical examinations and blood tests to diagnose MetS. Then, abdominal ultrasound screening of the liver was performed to calculate the ultrasonographic fatty liver indicator (US-FLI) as a measure of NAFLD severity. The ASQ analysis and ultrasound entropy parametric imaging were further constructed using the raw image data to calculate the focal disturbance (FD) ratio and entropy value, respectively. Tertiles were used to split the data of the FD ratio and entropy into three groups for statistical analysis. The correlation coefficient <i>r</i>, probability value <i>p</i>, and odds ratio (OR) were calculated. With an increase in the US-FLI, the entropy value increased (<i>r</i> = 0.713; <i>p</i> < 0.0001) and the FD ratio decreased (<i>r</i> = -0.630; <i>p</i> < 0.0001). In addition, the entropy value and FD ratio correlated with metabolic indices (<i>p</i> < 0.0001). After adjustment for confounding factors, entropy imaging (OR = 7.91, 95% confidence interval (CI): 0.96-65.18 for the second tertile; OR = 20.47, 95% CI: 2.48-168.67 for the third tertile; <i>p</i> = 0.0021) still provided a more significant link to the risk of MetS than did the FD ratio obtained from ASQ (OR = 0.55, 95% CI: 0.27-1.14 for the second tertile; OR = 0.42, 95% CI: 0.15-1.17 for the third tertile; <i>p</i> = 0.13). Thus, ultrasound entropy imaging can provide information on hepatic steatosis. In particular, ultrasound entropy imaging can describe the risk of MetS for individuals with NAFLD and is superior to the conventional ASQ technique.

bioRxiv 2018-11-22 Preprint (No Snippets API) Kadler S, Vural Ö, Reiners-Schramm L, Lauster R, Rosowski M.
Show Full Abstract

<h4>Background</h4> Given regenerative therapies, the utilization of primary human cells is desired and requested in the development of in vitro systems and disease models. After a few passages in vitro , all cells from the connective tissue end up in a similar fibroblastoid cell type marked by loss of the specific expression pattern. It is still under discussion whether different de-differentiated mesenchymal cells have similar or identical differentiation capacities in vitro . <h4>Methods</h4> Chondrocytes isolated from patients with late-stage osteoarthritis were cultured for several passages until de-differentiation was completed. The mRNA level of cartilage markers was investigated, and the adipogenic, osteogenic and chondrogenic differentiation capacity was examined. By adding 5-aza-2’-deoxycytidine (5-aza-dC) to the media, the influence of DNA methylation on the differentiation capacity was analyzed. <h4>Results</h4> The chondrocytes used in this work were not affected by the loss of specific gene expression upon cell culture. The mRNA levels of SOX5, SOX6, SOX9, aggrecan, and proteoglycan-4 remained unchanged. The underlying mechanisms of cartilage marker maintenance in osteoarthritic (OA) chondrocytes were investigated with a focus on the epigenetic modification by DNA methylation. The treatment of de-differentiated chondrocytes with the DNA methyltransferase inhibitor 5-aza-2’-deoxycytidine (5-aza-dC) displayed no appreciable impact on the observed maintenance of marker gene expression, while the chondrogenic differentiation capacity was compromised. On the other hand, the pre-cultivation with 5-aza-dC improved the osteogenesis and adipogenesis of OA chondrocytes. Contradictory to these effects, the DNA methylation levels were not reduced after treatment with 1 μM 5-aza-dC for four weeks. <h4>Conclusion</h4> Chondrocytes isolated from late-stage osteoarthritic patients represents a reliable cell source for in vitro studies as wells as disease models since the chondrogenic differentiation potential remains. 5-aza-2’-deoxycytidine could not further improve their chondrogenic potential.

Also flagged:GFAPmicrotubule-associated protein tauEGFMIFAKT1PSMB8
Journal Article 2018-11-21 ✓ 4 Snippets Trattnig C, Üçal M, Tam-Amersdorfer C, Bucko A, Zefferer U, Grünbacher G, Absenger-Novak M, Öhlinger KA, Kraitsy K, Hamberger D, Schaefer U, Patz S.
In-Text Gene Mentions

POU3F2

…RAB14, TSC1, OSR1,POU3F2, TNS4, PSMB8, CXCL16,…

…predicted targets OSR1,POU3F2, TNS4 was analysed…

…consisting of OSR1,POU3F2, TNS4, PSMB8, CXCL16,…

Show Full Abstract

MiR-451a is best known for its role in erythropoiesis and for its tumour suppressor features. Here we show a role for miR-451a in neuronal differentiation through analysis of endogenous and ectopically expressed or silenced miR-451a in Ntera2/D1 cells during neuronal differentiation. Furthermore, we compared neuronal differentiation in the dentate gyrus of hippocampus of miR-451a-/- and wild type mice. MiR-451a overexpression in lentiviral transduced Ntera2/D1 cells was associated with a significant shifting of mRNA expression of the developmental markers Nestin, βIII Tubulin, NF200, DCX and MAP2 to earlier developmental time points, compared to control vector transduced cells. In line with this, accelerated neuronal network formation in AB.G.miR-451a transduced cells, as well as an increase in neurite outgrowth both in number and length was observed. MiR-451a targets genes MIF, AKT1, CAB39, YWHAZ, RAB14, TSC1, OSR1, POU3F2, TNS4, PSMB8, CXCL16, CDKN2D and IL6R were, moreover, either constantly downregulated or exhibited shifted expression profiles in AB.G.miR-451a transduced cells. Lentiviral knockdown of endogenous miR-451a expression in Ntera2/D1 cells resulted in decelerated differentiation. Endogenous miR-451a expression was upregulated during development in the hippocampus of wildtype mice. In situ hybridization revealed intensively stained single cells in the subgranular zone and the hilus of the dentate gyrus of wild type mice, while genetic ablation of miR-451a was observed to promote an imbalance between proliferation and neuronal differentiation in neurogenic brain regions, suggested by Ki67 and DCX staining. Taken together, these results provide strong support for a role of miR-451a in neuronal maturation processes in vitro and in vivo.

Also flagged:pyridoxineseleniumgene expressionseleniteestrusbinding
Journal Article 2018-11-21 ✓ 1 Snippet Dalto DB, Tsoi S, Dyck MK, Matte JJ.
In-Text Gene Mentions

…, TNFAIP8L3 ,TNFSF4, and TNFRSF9…

Show Full Abstract

<h4>Background</h4>Gene ontology analysis using the microarray database generated in a previous study by this laboratory was used to further evaluate how maternal dietary supplementation with pyridoxine combined with different sources of selenium (Se) affected global gene expression of expanded porcine blastocysts. Data were generated from 18 gilts randomly assigned to one of three experimental diets (n = 6 per treatment): i) basal diet without supplemental Se or pyridoxine (CONT); ii) CONT + 0.3 mg/kg of Na-selenite and 10 mg/kg of HCl-pyridoxine (MSeB<sub>6</sub>10); and iii) CONT + 0.3 mg/kg of Se-enriched yeast and 10 mg/kg of HCl-pyridoxine (OSeB<sub>6</sub>10). All gilts were inseminated at their fifth post-pubertal estrus and euthanized 5 days later for embryo harvesting. Differential gene expression between MSeB<sub>6</sub>10 vs CONT, OSeB<sub>6</sub>10 vs CONT and OSeB<sub>6</sub>10 vs MSeB<sub>6</sub>10 was performed using a porcine embryo-specific microarray.<h4>Results</h4>There were 559, 2458, and 1547 differentially expressed genes for MSeB<sub>6</sub>10 vs CONT, OSeB<sub>6</sub>10 vs CONT and OSeB<sub>6</sub>10 vs MSeB<sub>6</sub>10, respectively. MSeB<sub>6</sub>10 vs CONT stimulated 13 biological processes with a strict effect on RNA binding and translation initiation. OSeB<sub>6</sub>10 vs CONT and OSeB<sub>6</sub>10 vs MSeB<sub>6</sub>10 impacted 188 and 66 biological processes, respectively, with very similar effects on genome stability, ceramide biosynthesis, protein trafficking and epigenetic events. The stimulation of genes related with these processes was confirmed by quantitative real-time RT-PCR.<h4>Conclusions</h4>Gene expression of embryos from OSeB<sub>6</sub>10 supplemented gilts was more impacted than those from MSeB<sub>6</sub>10 supplemented gilts. Whereas maternal OSeB<sub>6</sub>10 supplementation influenced crucial aspects of embryo development, maternal MSeB<sub>6</sub>10 supplementation was restricted to binding activity.

Also flagged:mucusolfactionneurodegenerative disordersinfectionputativeodorant receptors
Journal Article 2018-11-21 ✓ 1 Snippet Yoshikawa K, Wang H, Jaen C, Haneoka M, Saito N, Nakamura J, Adappa ND, Cohen NA, Dalton P.
In-Text Gene Mentions

…The disruption ofPEBP1was not only…

Show Full Abstract

Age-related decreases in olfactory sensitivity are often accompanied by a decrease in the quality of life. However, the molecular mechanisms underlying these changes are not well described. Inhaled substances including odorants are detected by sensory neurons in the olfactory cleft covered with a layer of mucus. This olfactory mucus is the first molecular machinery responsible for tissue protection and for detection of environmental odorants. Yet, little is known about the molecular identities of the actors because of the lack of information on the mucus proteome and its age-related changes. Here, we sampled human mucus from different nasal locations and from young and elderly subjects. The composition of the mucus was extensively analyzed by shotgun proteomic analysis for a vast array of proteins. We also explored correlations between the levels of each mucus proteins with the olfactory sensitivity of subjects. This analysis revealed previously unrecognized proteins with potentially important functions in olfaction. Taken together, this report describes the most comprehensive catalogue of the nasal mucus proteins to date, their positional and age-related differences, and candidate proteins associated with olfaction. This catalogue will provide fundamental information useful for future studies, such as identification of olfactory auxiliary proteins, causes of age-related declines in olfaction, and biomarkers for neurodegenerative disorders.

Also flagged:Friedreich ataxiaFRDAgenetic disorderFXNheterochromatinfrataxin
Journal Article 2018-11-21 ✓ 1 Snippet Mikaeili H, Sandi M, Bayot A, Al-Mahdawi S, Pook MA.
In-Text Gene Mentions

…p15 and huntingtin (HTT) naturally occurring antisens…

Show Full Abstract

Friedreich ataxia (FRDA) is a multisystem genetic disorder caused by GAA repeat expansion mutations within the FXN gene, resulting in heterochromatin formation and deficiency of frataxin protein. Elevated levels of the FXN antisense transcript (FAST-1) have previously been detected in FRDA. To investigate the effects of FAST-1 on the FXN gene expression, we first stably overexpressed FAST-1 in non-FRDA cell lines and then we knocked down FAST-1 in FRDA fibroblast cells. We observed decreased FXN expression in each FAST-1 overexpressing cell type compared to control cells. We also found that FAST-1 overexpression is associated with both CCCTC-Binding Factor (CTCF) depletion and heterochromatin formation at the 5'UTR of the FXN gene. We further showed that knocking down FAST-1 in FRDA fibroblast cells significantly increased FXN expression. Our results indicate that FAST-1 can act in trans in a similar manner to the cis-acting FAST-1 overexpression that has previously been identified in FRDA fibroblasts. The effects of stably transfected FAST-1 expression on CTCF occupancy and heterochromatin formation at the FXN locus suggest a direct role for FAST-1 in the FRDA molecular disease mechanism. Our findings also support the hypothesis that inhibition of FAST-1 may be a potential approach for FRDA therapy.

Also flagged:hearingIkzf2hair cell maturationtranscription factorSlc26a5Ocm
Journal Article 2018-11-21 No Snippets Chessum L, Matern MS, Kelly MC, Johnson SL, Ogawa Y, Milon B, McMurray M, Driver EC, Parker A, Song Y, Codner G, Esapa CT, Prescott J, Trent G, Wells S, Dragich AK, Frolenkov GI, Kelley MW, Marcotti W, Brown SDM, Elkon R, Bowl MR, Hertzano R.
Show Full Abstract

The sensory cells that are responsible for hearing include the cochlear inner hair cells (IHCs) and outer hair cells (OHCs), with the OHCs being necessary for sound sensitivity and tuning<sup>1</sup>. Both cell types are thought to arise from common progenitors; however, our understanding of the factors that control the fate of IHCs and OHCs remains limited. Here we identify Ikzf2 (which encodes Helios) as an essential transcription factor in mice that is required for OHC functional maturation and hearing. Helios is expressed in postnatal mouse OHCs, and in the cello mouse model a point mutation in Ikzf2 causes early-onset sensorineural hearing loss. Ikzf2<sup>cello/cello</sup> OHCs have greatly reduced prestin-dependent electromotile activity, a hallmark of OHC functional maturation, and show reduced levels of crucial OHC-expressed genes such as Slc26a5 (which encodes prestin) and Ocm. Moreover, we show that ectopic expression of Ikzf2 in IHCs: induces the expression of OHC-specific genes; reduces the expression of canonical IHC genes; and confers electromotility to IHCs, demonstrating that Ikzf2 can partially shift the IHC transcriptome towards an OHC-like identity.

Also flagged:RPGchromosomesllsmethylationvesicleMACS
Journal Article 2018-11-21 No Snippets Marlétaz F, Firbas PN, Maeso I, Tena JJ, Bogdanovic O, Perry M, Wyatt CDR, de la Calle-Mustienes E, Bertrand S, Burguera D, Acemel RD, van Heeringen SJ, Naranjo S, Herrera-Ubeda C, Skvortsova K, Jimenez-Gancedo S, Aldea D, Marquez Y, Buono L, Kozmikova I, Permanyer J, Louis A, Albuixech-Crespo B, Le Petillon Y, Leon A, Subirana L, Balwierz PJ, Duckett PE, Farahani E, Aury JM, Mangenot S, Wincker P, Albalat R, Benito-Gutiérrez È, Cañestro C, Castro F, D'Aniello S, Ferrier DEK, Huang S, Laudet V, Marais GAB, Pontarotti P, Schubert M, Seitz H, Somorjai I, Takahashi T, Mirabeau O, Xu A, Yu JK, Carninci P, Martinez-Morales JR, Crollius HR, Kozmik Z, Weirauch MT, Garcia-Fernàndez J, Lister R, Lenhard B, Holland PWH, Escriva H, Gómez-Skarmeta JL, Irimia M.
Show Full Abstract

Vertebrates have greatly elaborated the basic chordate body plan and evolved highly distinctive genomes that have been sculpted by two whole-genome duplications. Here we sequence the genome of the Mediterranean amphioxus (Branchiostoma lanceolatum) and characterize DNA methylation, chromatin accessibility, histone modifications and transcriptomes across multiple developmental stages and adult tissues to investigate the evolution of the regulation of the chordate genome. Comparisons with vertebrates identify an intermediate stage in the evolution of differentially methylated enhancers, and a high conservation of gene expression and its cis-regulatory logic between amphioxus and vertebrates that occurs maximally at an earlier mid-embryonic phylotypic period. We analyse regulatory evolution after whole-genome duplications, and find that-in vertebrates-over 80% of broadly expressed gene families with multiple paralogues derived from whole-genome duplications have members that restricted their ancestral expression, and underwent specialization rather than subfunctionalization. Counter-intuitively, paralogues that restricted their expression increased the complexity of their regulatory landscapes. These data pave the way for a better understanding of the regulatory principles that underlie key vertebrate innovations.

Also flagged:Nuclear transport receptorskaryopherinnuclear transportnuclear transporterslocalizationpathogenesis
Journal Article 2018-11-21 No Snippets Kosyna FK, Depping R.
Show Full Abstract

Nuclear transport receptors of the karyopherin superfamily of proteins transport macromolecules from one compartment to the other and are critical for both cell physiology and pathophysiology. The nuclear transport machinery is tightly regulated and essential to a number of key cellular processes since the spatiotemporally expression of many proteins and the nuclear transporters themselves is crucial for cellular activities. Dysregulation of the nuclear transport machinery results in localization shifts of specific cargo proteins and associates with the pathogenesis of disease states such as cancer, inflammation, viral illness and neurodegenerative diseases. Therefore, inhibition of the nuclear transport system has future potential for therapeutic intervention and could contribute to the elucidation of disease mechanisms. In this review, we recapitulate clue findings in the pathophysiological significance of nuclear transport processes and describe the development of nuclear transport inhibitors. Finally, clinical implications and results of the first clinical trials are discussed for the most promising nuclear transport inhibitors.

Hepcidin Therapeutics.

Also flagged:Hepcidinironiron deficiency anemiaanemiaserythropoiesisanemia
Journal Article 2018-11-21 ✓ 1 Snippet Katsarou A, Pantopoulos K.
In-Text Gene Mentions

In another setting, dietary supplementation of Hfe-/- mice with adenine was reported to induce hepcidin and attenuate iron overload by a mechanism requiring BMP/SMAD and cAMP/protein kinase A (PKA) signaling [80].

Show Full Abstract

Hepcidin is a key hormonal regulator of systemic iron homeostasis and its expression is induced by iron or inflammatory stimuli. Genetic defects in iron signaling to hepcidin lead to "hepcidinopathies" ranging from hereditary hemochromatosis to iron-refractory iron deficiency anemia, which are disorders caused by hepcidin deficiency or excess, respectively. Moreover, dysregulation of hepcidin is a pathogenic cofactor in iron-loading anemias with ineffective erythropoiesis and in anemia of inflammation. Experiments with preclinical animal models provided evidence that restoration of appropriate hepcidin levels can be used for the treatment of these conditions. This fueled the rapidly growing field of hepcidin therapeutics. Several hepcidin agonists and antagonists, as well as inducers and inhibitors of hepcidin expression have been identified to date. Some of them were further developed and are currently being evaluated in clinical trials. This review summarizes the state of the art.

Also flagged:MACF1ZincGARmicrotubule-associatedlissencephalyciliogenesis
Journal Article 2018-11-21 No Snippets Dobyns WB, Aldinger KA, Ishak GE, Mirzaa GM, Timms AE, Grout ME, Dremmen MHG, Schot R, Vandervore L, van Slegtenhorst MA, Wilke M, Kasteleijn E, Lee AS, Barry BJ, Chao KR, Szczałuba K, Kobori J, Hanson-Kahn A, Bernstein JA, Carr L, D'Arco F, Miyana K, Okazaki T, Saito Y, Sasaki M, Das S, Wheeler MM, Bamshad MJ, Nickerson DA, University of Washington Center for Mendelian Genomics, Center for Mendelian Genomics at the Broad Institute of MIT and Harvard, Engle EC, Verheijen FW, Doherty D, Mancini GMS.
Show Full Abstract

To date, mutations in 15 actin- or microtubule-associated genes have been associated with the cortical malformation lissencephaly and variable brainstem hypoplasia. During a multicenter review, we recognized a rare lissencephaly variant with a complex brainstem malformation in three unrelated children. We searched our large brain-malformation databases and found another five children with this malformation (as well as one with a less severe variant), analyzed available whole-exome or -genome sequencing data, and tested ciliogenesis in two affected individuals. The brain malformation comprised posterior predominant lissencephaly and midline crossing defects consisting of absent anterior commissure and a striking W-shaped brainstem malformation caused by small or absent pontine crossing fibers. We discovered heterozygous de novo missense variants or an in-frame deletion involving highly conserved zinc-binding residues within the GAR domain of MACF1 in the first eight subjects. We studied cilium formation and found a higher proportion of mutant cells with short cilia than of control cells with short cilia. A ninth child had similar lissencephaly but only subtle brainstem dysplasia associated with a heterozygous de novo missense variant in the spectrin repeat domain of MACF1. Thus, we report variants of the microtubule-binding GAR domain of MACF1 as the cause of a distinctive and most likely pathognomonic brain malformation. A gain-of-function or dominant-negative mechanism appears likely given that many heterozygous mutations leading to protein truncation are included in the ExAC Browser. However, three de novo variants in MACF1 have been observed in large schizophrenia cohorts.

Also flagged:Ascending Infectionsinfectionsgonococcal infectioninflammatory responsepelvic inflammatory diseasePID
Journal Article 2018-11-21 No Snippets Lenz JD, Dillard JP.
Show Full Abstract

<i>Neisseria gonorrhoeae</i> is an obligate human pathogen that causes mucosal surface infections of male and female reproductive tracts, pharynx, rectum, and conjunctiva. Asymptomatic or unnoticed infections in the lower reproductive tract of women can lead to serious, long-term consequences if these infections ascend into the fallopian tube. The damage caused by gonococcal infection and the subsequent inflammatory response produce the condition known as pelvic inflammatory disease (PID). Infection can lead to tubal scarring, occlusion of the oviduct, and loss of critical ciliated cells. Consequences of the damage sustained on the fallopian tube epithelium include increased risk of ectopic pregnancy and tubal-factor infertility. Additionally, the resolution of infection can produce new adhesions between internal tissues, which can tear and reform, producing chronic pelvic pain. As a bacterium adapted to life in a human host, the gonococcus presents a challenge to the development of model systems for probing host-microbe interactions. Advances in small-animal models have yielded previously unattainable data on systemic immune responses, but the specificity of <i>N. gonorrhoeae</i> for many known (and unknown) host targets remains a constant hurdle. Infections of human volunteers are possible, though they present ethical and logistical challenges, and are necessarily limited to males due to the risk of severe complications in women. It is routine, however, that normal, healthy fallopian tubes are removed in the course of different gynecological surgeries (namely hysterectomy), making the very tissue most consequentially damaged during ascending gonococcal infection available for laboratory research. The study of fallopian tube organ cultures has allowed the opportunity to observe gonococcal biology and immune responses in a complex, multi-layered tissue from a natural host. Forty-five years since the first published example of human fallopian tube being infected <i>ex vivo</i> with <i>N. gonorrhoeae</i>, we review what modeling infections in human tissue explants has taught us about the gonococcus, what we have learned about the defenses mounted by the human host in the upper female reproductive tract, what other fields have taught us about ciliated and non-ciliated cell development, and ultimately offer suggestions regarding the next generation of model systems to help expand our ability to study gonococcal pathogenesis.

Also flagged:collagenWnthydroxyapatiteimmune responseangiogenesisneurogenesis
Journal Article 2018-11-21 ✓ 1 Snippet Zhang Z, Li Z, Zhang C, Liu J, Bai Y, Li S, Zhang C.
In-Text Gene Mentions

…osteoblast function (Runx2,Sox6) were all upregulated.…

Show Full Abstract

<h4>Purpose</h4>The purpose of this study was to assess the effects of biomimetic intrafibrillar mineralized collagen (IMC) bone scaffold materials on bone regeneration and the underlying biological mechanisms.<h4>Materials and methods</h4>A critical-sized bone defect in the rat femur was created; then IMC, extrafibrillar mineralized collagen, and nano-hydroxyapatite bone scaffold materials were grafted into the defect. Ten weeks after implantation, micro-computed tomography and histology were applied to evaluate the bone regeneration. Furthermore, microarray technology was applied for transcriptional profile analysis at two postoperative time points (7 and 14 days). Subsequently, the critical genes involved in bone regeneration identified by transcriptional analysis were verified both in vivo through immunohistochemical analysis and in vitro by quantitative real-time transcription polymerase chain reaction evaluation.<h4>Results</h4>Significantly increased new bone formation was found in the IMC group based on micro-computed tomography and histological evaluation (<i>P</i><0.05). Transcriptional analysis revealed that the early process of IMC-guided bone regeneration involves the overexpression of genes mainly associated with inflammation, immune response, skeletal development, angiogenesis, neurogenesis, and the Wnt signaling pathway. The roles of the Wnt signaling pathway-related factors Wnt5a, β-catenin, and Axin2 were further confirmed both in vivo and in vitro.<h4>Conclusion</h4>The IMC bone scaffold materials significantly enhanced bone regeneration via activation of the Wnt signaling pathway.

Also flagged:fibromyalgia syndromesleepFMSphosphorylationmitochondrialglutamate
Journal Article 2018-11-21 No Snippets Lukkahatai N, Walitt B, Deandrés-Galiana EJ, Fernández-Martínez JL, Saligan LN.
Show Full Abstract

<h4>Objectives</h4>Fibromyalgia syndrome (FMS) is a chronic and often debilitating condition that is characterized by persistent fatigue, pain, bowel abnormalities, and sleep disturbances. Currently, there are no definitive prognostic or diagnostic biomarkers for FMS. This study attempted to utilize a novel predictive algorithm to identify a group of genes whose differential expression discriminated individuals with FMS diagnosis from healthy controls.<h4>Methods</h4>Secondary analysis of gene expression data from 28 women with FMS and 19 age-and race-matched healthy women. Expression of discriminatory genes were identified using fold-change differential and Fisher's ratio (FR). Discriminatory accuracy of the differential expression of these genes was determined using leave-one-out-cross-validation. Functional networks of the discriminating genes were described from the Ingenuity's Knowledge Base.<h4>Results</h4>The small-scale signature contained 57 genes whose expressions were highly discriminatory of the FMS diagnosis. The combination of these high discriminatory genes with FR higher than 1.45 provided a leave-one-out-cross-validation accuracy for the FMS diagnosis of 85.11%. The discriminatory genes were associated with 3 canonical pathways: hepatic stellate cell activation, oxidative phosphorylation, and airway pathology related to COPD.<h4>Conclusion</h4>The discriminating genes, especially the 2 with the highest accuracy, are associated with mitochondrial function or oxidative phosphorylation and glutamate signaling. Further validation of the clinical utility of this finding is warranted.

Also flagged:gliomaNotch
Journal Article 2018-11-21 No Snippets Parajuli P, Mittal S.
Show Full Abstract

No abstract available.

Also flagged:CDH5CTGFCSF1SPP1CDH1Col4a2
Journal Article 2018-11-21 ✓ 4 Snippets Rakipovski G, Rolin B, Nøhr J, Klewe I, Frederiksen KS, Augustin R, Hecksher-Sørensen J, Ingvorsen C, Polex-Wolf J, Knudsen LB.
In-Text Gene Mentions

Ptgis

PTGIS

The opposite directions of the diet and treatment effects are also exemplified by the representative genes (Figure 4D) for processes relevant to the pathogenesis of atherosclerosis, such as leukocyte recruitment (IL-6, IL-1 receptor antagonist [IL-1RN], chemokine [C-C motif] ligand 2 [CCL2], leukocyte rolling, adhesion and extravasation (SELE, VCAM-1), cholesterol metabolism and lipid-mediated signaling (ATP-binding cassette transporter 1 [ABCA 1], prostaglandin I2 synthase [PTGIS], extracellular matrix protein turnover [MMP-3 and MMP-13], and plaque hemorrhage [CD163]).

…prostaglandin I2 synthase [PTGIS], extracellular matrix protei…

Show Full Abstract

The glucagon-like peptide-1 receptor agonists (GLP-1RAs) liraglutide and semaglutide reduce cardiovascular risk in type 2 diabetes patients. The mode of action is suggested to occur through modified atherosclerotic progression. In this study, both of the compounds significantly attenuated plaque lesion development in apolipoprotein E-deficient (ApoE<sup>-/-</sup>) mice and low-density lipoprotein receptor-deficient (LDLr<sup>-/-</sup>) mice. This attenuation was partly independent of weight and cholesterol lowering. In aortic tissue, exposure to a Western diet alters expression of genes in pathways relevant to the pathogenesis of atherosclerosis, including leukocyte recruitment, leukocyte rolling, adhesion/extravasation, cholesterol metabolism, lipid-mediated signaling, extracellular matrix protein turnover, and plaque hemorrhage. Treatment with semaglutide significantly reversed these changes. These data suggest GLP-1RAs affect atherosclerosis through an anti-inflammatory mechanism.

Also flagged:behavioralobesitymetabolic diseaselipidmetabolismmetabolic disorders
Journal Article 2018-11-21 No Snippets Faillaci F, Milosa F, Critelli RM, Turola E, Schepis F, Villa E.
Show Full Abstract

Obesity is becoming a silent worldwide epidemic, with a steady increase in both adults and children. To date, even though several drugs have been licensed for long-term obesity treatment, none of them are yet used in routine clinical practice. So far the only successful intervention has been behavioral therapy. A suitable and economic experimental model mimicking the human condition would therefore be extremely useful to evaluate preventive measures and novel treatments. Zebrafish are emerging as an important model system to study obesity and related metabolic disease. Remarkable similarities have been reported in lipid metabolism and the adipogenic pathway between zebrafish and mammals. Moreover, the zebrafish possesses a number of features-the relative inexpensiveness of animal husbandry, its optical transparency and the ability to produce a large number of offspring at low cost-that make it ideal for large-scale screening and for testing drugs and intervention. In this review, we summarize recent progress in using zebrafish as a model system to study obesity and obesity-related metabolic disorders. We describe several zebrafish models (in both larvae and adult animals) that develop obesity and non-alcoholic fatty liver disease (NAFLD) using different approaches, including gene manipulation, diet manipulation and modification of microbiota composition. For these models, we have outlined the specific aspects related to obesity and its development and we have summarized their advantages and limitations.

Also flagged:Adenomatous polyposis coli-stimulated GEF 1Asef1Guanine nucleotide exchange factorsdendritic spinesGEFARHGEF4
Journal Article 2018-11-20 No Snippets Oh JY, Lim CS, Yoo KS, Park H, Park YS, Kim EG, Lee YS, Kaang BK, Kim HK.
Show Full Abstract

Guanine nucleotide exchange factors (GEFs) play important roles in many cellular processes, including regulation of the structural plasticity of dendritic spines. A GEF protein, adenomatous polyposis coli-stimulated GEF 1 (Asef1, ARHGEF4) is highly expressed in the nervous system. However, the function of Asef1 has not been investigated in neurons. Here, we present evidence showing that Asef1 negatively regulates the synaptic localization of postsynaptic density protein 95 (PSD-95) in the excitatory synapse by inhibiting Staufen-mediated synaptic localization of PSD-95. Accordingly, Asef1 expression impairs synaptic transmission in hippocampal cultured neurons. In addition, neuronal activity facilitates the dissociation of Asef1 from Staufen in a phosphoinositide 3 kinase (PI3K)-dependent manner. Taken together, our data reveal Asef1 functions as a negative regulator of synaptic localization of PSD-95 and synaptic transmission.

Also flagged:signal transducer and activator of transcription 3STAT3cancersbindingphosphorylationtyrosine
Journal Article 2018-11-20 No Snippets Yoon YJ, Kim YH, Lee YJ, Choi J, Kim CH, Han DC, Kwon BM.
Show Full Abstract

Inhibition of the signal transducer and activator of transcription 3 (STAT3) signaling pathway is a novel therapeutic strategy to treat human cancers with constitutively active STAT3. During the screening of natural products to find STAT3 inhibitors, we identified 2'-hydroxycinnamaldehyde (HCA) as a STAT3 inhibitor, which was isolated from the stem bark of Cinnamomum cassia. In this study, we found that HCA inhibited constitutive and inducible STAT3 activation in STAT3-activated DU145 prostate cancer cells. HCA selectively inhibited the STAT3 activity by direct binding to STAT3, which was confirmed by biochemical methods, including a pull-down assay with biotin-conjugated HCA, a drug affinity responsive target stability (DARTS) experiment and a cellular thermal shift assay (CETSA). HCA inhibited STAT3 phosphorylation at the tyrosine 705 residue, dimer formation, and nuclear translocation in DU145 cells, which led to a downregulation of STAT3 target genes. The downregulation of cell cycle progression and antiapoptosis-related gene expression by HCA induced the accumulation of cells in the G0/G1 phase of the cell cycle and then induced apoptosis. We also found that reactive oxygen species (ROS) were involved in the HCA-induced inhibition of STAT3 activation and cell proliferation because the suppressed p-STAT3 level was rescued by glutathione or N-acetyl-L-cysteine treatment, which are general ROS inhibitors. These results suggest that HCA could be a potent anticancer agent targeting STAT3-activated tumor cells.

Also flagged:mitochondrialcytbethanolcytochrome bgrowth hormone copy IDNA Polymerase
Journal Article 2018-11-20 No Snippets Corona-Santiago DK, Domínguez-Domínguez O, Tovar-Mora L, Pardos-Blas JR, Herrerías-Diego Y, Pérez-Rodríguez R, Doadrio I.
Show Full Abstract

<h4>Background</h4>The Pantosteus plebeius-nebuliferus species-group is a group of freshwater fishes distributed in endo- and exorheic drainage basins in the Mexican Sierra Madre Occidental mountain range system and central North Mexico. The geological history of this region is considered an important factor in explaining the evolutionary history of low vagility animals like freshwaters fishes. The aim of this study was to examine the phylogenetic relationships and describe the evolutionary history of the species-group. We hypothesized that the genetic structure and distribution of the main clades of Pantosteus plebeius-nebuliferus are associated with the geological history of Northern Mexico. To this end, we obtained DNA sequences of mitochondrial and nuclear genes and performed phylogenetic and phylogeographic analyses. Divergence time estimation and ancestral area reconstruction were also carried out to propose a biogeographical hypothesis, and species boundaries within the species-group were also tested.<h4>Results</h4>We identified four clades within the Pantosteus plebeius-nebuliferus species-group in both markers. Divergence ranged from 5.9% to 9.2% for cytb and 0.1% to 0.9% for GHI. We observed significant genetic structure and no shared haplotypes between clades. We estimated that the clades diverged during the last 5.1 Myr, with a biogeographic scenario suggesting eight vicariant and four dispersal events through the historic range of the species-group. We found that the best species-delimitation model is when four species are assumed, which correspond to the main clades. We identified nine evolutionary significance units (ESUs), pertinent to the conservation of the group, each representing populations present in distinct drainage basins.<h4>Conclusions</h4>The evolutionary history of the Pantosteus plebeius-nebuliferus species-group is characterized by vicariant post-dispersal processes, linked to geological changes in the Sierra Madre Occidental and central Northern Mexico since the Pliocene. This is congruent with biogeographic patterns described for other co-distributed fish species. We propose a new phylogenetic hypothesis for the species-group, clarifying the taxonomy of this evolutionarily complex group. Our results suggest that the species-group consists of at least four clades with independent evolutionary histories, two of which may represent new undescribed species. Our identification of ESUs provides a basis upon which conservation measures can be developed for the species-group.

Also flagged:alpha globinbeta globinironmetabolismpicarestless leg syndrome
Journal Article 2018-11-20 ✓ 1 Snippet Guo Y, Busch MP, Seielstad M, Endres-Dighe S, Westhoff CM, Keating B, Hoppe C, Bordbar A, Custer B, Butterworth AS, Kanias T, Mast AE, Kleinman S, Lu Y, Page GP, National Heart, Lung, and Blood Institute Recipient Epidemiology Donor Evaluation Study (REDS)-III.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Many aspects of transfusion medicine are affected by genetics. Current single-nucleotide polymorphism (SNP) arrays are limited in the number of targets that can be interrogated and cannot detect all variation of interest. We designed a transfusion medicine array (TM-Array) for study of both common and rare transfusion-relevant variations in genetically diverse donor and recipient populations.<h4>Study design and methods</h4>The array was designed by conducting extensive bioinformatics mining and consulting experts to identify genes and genetic variation related to a wide range of transfusion medicine clinical relevant and research-related topics. Copy number polymorphisms were added in the alpha globin, beta globin, and Rh gene clusters.<h4>Results</h4>The final array contains approximately 879,000 SNP and copy number polymorphism markers. Over 99% of SNPs were called reliably. Technical replication showed the array to be robust and reproducible, with an error rate less than 0.03%. The array also had a very low Mendelian error rate (average parent-child trio accuracy of 0.9997). Blood group results were in concordance with serology testing results, and the array accurately identifies rare variants (minor allele frequency of 0.5%). The array achieved high genome-wide imputation coverage for African-American (97.5%), Hispanic (96.1%), East Asian (94.6%), and white (96.1%) genomes at a minor allele frequency of 5%.<h4>Conclusions</h4>A custom array for transfusion medicine research has been designed and evaluated. It gives wide coverage and accurate identification of rare SNPs in diverse populations. The TM-Array will be useful for future genetic studies in the diverse fields of transfusion medicine research.

Also flagged:influenzaH9N2 infectioninfectionavianco-infectionimmune suppression
Journal Article 2018-11-20 No Snippets Ellakany HF, Gado AR, Elbestawy AR, Abd El-Hamid HS, Hafez HM, Abd El-Hack ME, Swelum AA, Al-Owaimer A, Saadeldin IM.
Show Full Abstract

<h4>Background</h4>H9N2 avian influenza virus is endemic in Egyptian poultry flocks. The role of the live viral vaccines such as LaSota in exaggeration of the clinical picture of H9N2 infection under field conditions is significantly important leading to severe economic losses due to higher mortality and lower growth performance. This experiment was designed to identify the possible interaction between experimental infection with H9N2 virus and NDV live vaccine (LaSota strain) in broiler chickens. Six groups each of 20 broiler chicks were used. Three groups (G1-3) were infected with H9N2 and vaccinated with LaSota, 3 days before, at the same day or 3 days post vaccination (dpv), while the remaining groups (G4-6) were non-vaccinated infected, vaccinated non-infected and non-vaccinated non-infected.<h4>Results</h4>The highest mortality rate (37.5%) was noticed in chickens of G1 (H9N2 infected 3 days prior LaSota vaccination). Also, this bird group had the most severe clinical signs, histopathological lesions and the longest viral shedding for 9 days post infection (dpi). In the 2nd and 3rd groups, the mortality rate was the similar (31.2%) with less pronounced clinical signs, histopathological lesions and H9N2 shedding was for only 6 dpi with the least shedding quantity in chickens of G3. The control non-vaccinated infected chickens (G4) had 18.7% mortality with the least degree of clinical signs, lesions and the highest viral shedding quantity but only for 6 dpi. At 35 days of age, there was a statistical significant decrease (P < 0.05) in chicken's body weight of all H9N2 infected groups from G1 to G4 compared to non-infected control groups, G5 and G6 respectively.<h4>Conclusion</h4>It was clear that laSota vaccination significantly affect H9N2 infection in broiler chickens regarding clinical signs, mortality rate, lesions, performance and viral shedding.

Also flagged:cardiometabolic disordersnucleotidesgene expressiondegradationtranslationalcancers
Journal Article 2018-11-20 ✓ 2 Snippets Mustafa R, Ghanbari M, Evangelou M, Dehghan A.
In-Text Gene Mentions

…COBLL1, FAM13A, FTO,HFEand SLC39A8 )…

…( ARL15 ,HFE, MTMR3 ,…

Show Full Abstract

MicroRNAs (miRNAs) regulate the expression of the majority of genes. However, it is not known whether they regulate genes in random or are organized according to their function. To this end, we chose cardiometabolic disorders as an example and investigated whether genes associated with cardiometabolic disorders are regulated by a random set of miRNAs or a limited number of them. Single-nucleotide polymorphisms (SNPs) reaching genome-wide level significance were retrieved from most recent genome-wide association studies on cardiometabolic traits, which were cross-referenced with Ensembl to identify related genes and combined with miRNA target prediction databases (TargetScan, miRTarBase, or miRecords) to identify miRNAs that regulate them. We retrieved 520 SNPs, of which 355 were intragenic, corresponding to 304 genes. While we found a higher proportion of genes reported from all GWAS that were predicted targets for miRNAs in comparison to all protein-coding genes (75.1%), the proportion was even higher for cardiometabolic genes (80.6%). Enrichment analysis was performed within each database. We found that cardiometabolic genes were over-represented in target genes for 29 miRNAs (based on TargetScan) and 3 miRNAs (miR-181a, miR-302d and miR-372) (based on miRecords) after Benjamini-Hochberg correction for multiple testing. Our work provides evidence for non-random assignment of genes to miRNAs and supports the idea that miRNAs regulate sets of genes that are functionally related.

Also flagged:TAZCancerTissue fibrosisextracellularYes-associated proteintranscriptional coactivator
Journal Article 2018-11-20 No Snippets Noguchi S, Saito A, Nagase T.
Show Full Abstract

Tissue fibrosis is a pathological condition that is associated with impaired epithelial repair and excessive deposition of extracellular matrix (ECM). Fibrotic lesions increase the risk of cancer in various tissues, but the mechanism linking fibrosis and cancer is unclear. Yes-associated protein (YAP) and the transcriptional coactivator with PDZ-binding motif (TAZ) are core components of the Hippo pathway, which have multiple biological functions in the development, homeostasis, and regeneration of tissues and organs. YAP/TAZ act as sensors of the structural and mechanical features of the cell microenvironment. Recent studies have shown aberrant YAP/TAZ activation in both fibrosis and cancer in animal models and human tissues. In fibroblasts, ECM stiffness mechanoactivates YAP/TAZ, which promote the production of profibrotic mediators and ECM proteins. This results in tissue stiffness, thus establishing a feed-forward loop of fibroblast activation and tissue fibrosis. In contrast, in epithelial cells, YAP/TAZ are activated by the disruption of cell polarity and increased ECM stiffness in fibrotic tissues, which promotes the proliferation and survival of epithelial cells. YAP/TAZ are also involved in the epithelial⁻mesenchymal transition (EMT), which contributes to tumor progression and cancer stemness. Importantly, the crosstalk with transforming growth factor (TGF)-β signaling and Wnt signaling is essential for the profibrotic and tumorigenic roles of YAP/TAZ. In this article, we review the latest advances in the pathobiological roles of YAP/TAZ signaling and their function as a molecular link between fibrosis and cancer.

Also flagged:ABCC6Pseudoxanthoma elasticumpyrophosphatemineralizationextracellularcalcium
Journal Article 2018-11-20 ✓ 1 Snippet Pomozi V, Julian CB, Zoll J, Pham K, Kuo S, Tőkési N, Martin L, Váradi A, Le Saux O.
In-Text Gene Mentions

DCC

Show Full Abstract

Pseudoxanthoma elasticum is a heritable disease caused by ABCC6 deficiency. Patients develop ectopic calcification in skin, eyes, and vascular tissues. ABCC6, primarily found in liver and kidneys, mediates the cellular efflux of ATP, which is rapidly converted into inorganic pyrophosphate (PPi), a potent inhibitor of calcification. Pseudoxanthoma elasticum patients and Abcc6<sup>-/-</sup> mice display reduced PPi levels in plasma and peripheral tissues. Pseudoxanthoma elasticum is currently incurable, although some palliative treatments exist. In recent years, we have successfully developed therapeutic methodologies to compensate the PPi deficit in animal models and humans. Here, we inadvertently discovered that modulating dietary PPi can also be an effective approach to reducing calcification in Abcc6<sup>-/-</sup> mice. Our findings were prompted by a change in institutional rodent diet. The new chow was enriched in PPi, which increased plasma PPi, and significantly reduced mineralization in Abcc6<sup>-/-</sup> mice. We also found that dietary PPi is readily absorbed in humans. Our results suggest that the consumption of food naturally or artificially enriched in PPi represents a possible intervention to mitigate calcification progression in pseudoxanthoma elasticum, that dietary preferences of patients may explain pseudoxanthoma elasticum heterogeneous manifestations, and that animal chow has the potential to influence data reproducibility.

Also flagged:systemic lupus erythematosusrheumatoid arthritistumour necrosis factor superfamily 4autoimmune diseasesSLERA
Journal Article 2018-11-20 ✓ 5 Snippets Xu J, He Y, Wang J, Li X, Huang L, Li S, Qin X.
In-Text Gene Mentions

Influence of the TNFSF4 rs1234315 polymorphism in the susceptibility to systemic lupus erythematosus and rheumatoid arthritis.

<h4>Objectives</h4>The tumour necrosis factor superfamily 4 (TNFSF4) is a candidate gene for autoimmune diseases.

The Akaike's information criterion (AIC) values indicated that the recessive model may serve as the best-fit model for the SNP for SLE and RA.<h4>Conclusion</h4>Our results provided support for TNFSF4 rsl234315 as a SLE and RA susceptibility locus in a Chinese Guangxi population.

…Influence of theTNFSF4rs1234315 polymorphism in…

…factor superfamily 4 (TNFSF4) is a candidate…

Show Full Abstract

<h4>Objectives</h4>The tumour necrosis factor superfamily 4 (TNFSF4) is a candidate gene for autoimmune diseases. We investigated the relationship of this gene with systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA) in a Chinese Guangxi population.<h4>Methods</h4>A total of 294 patients with SLE, 210 with RA, and 282 healthy controls were genotyped for single nucleotide polymorphism (SNP) rs1234315 using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The potential functional effects of the SNP were predicted by in silico analysis.<h4>Results</h4>Statistically significant associations with SLE and RA were detected at rs1234315, both by allele analysis (odds ratio 1.47, 95% confidence interval 1.17-1.86, p = 0.001; odds ratio 1.49, 95% confidence interval 1.15-1.92, p = 0.002; respectively), and genotype analysis (p = 0.003 and p = 7.000 × 10<sup>-5</sup>, respectively). The Akaike's information criterion (AIC) values indicated that the recessive model may serve as the best-fit model for the SNP for SLE and RA.<h4>Conclusion</h4>Our results provided support for TNFSF4 rsl234315 as a SLE and RA susceptibility locus in a Chinese Guangxi population.

Also flagged:PBGtranslationalinjuryDILItranscription factorsE2F1
Journal Article 2018-11-20 ✓ 1 Snippet Souza T, Trairatphisan P, Piñero J, Furlong LI, Saez-Rodriguez J, Kleinjans J, Jennen D.
In-Text Gene Mentions

…YIPF1, TMEM168, RSRC2,CCDC92, ITFG1, ZMYND19, TTC14…

Show Full Abstract

In toxicogenomics, functional annotation is an important step to gain additional insights into genes with aberrant expression that drive pathophysiological mechanisms. Nevertheless, there exists a gap on annotation of these genes which often hampers the interpretation of results and limits their applicability in translational medicine. In this study, we evaluated the coverage of functional annotations of differentially expressed genes (DEGs) induced by 10 selected compounds from the TG-GATEs database identified as high- or no-risk in causing drug-induced liver injury (most-DILI or no-DILI, respectively) using <i>in vitro</i> human data. Functional roles of DEGs not present in the most common biological annotation databases - termed "dark genes" - were unveiled via literature mining and via the identification of shared regulatory transcription factors or signaling pathways. Our results demonstrated that there were approximately 13% of dark genes induced by these compounds <i>in vitro</i> and we were able to obtain additional relevant information for up to 76% of those. Using interactome data from several sources, we have uncovered genes such as <i>LRBA</i>, and <i>WDR26</i> as highly connected in the protein network that play roles in drug response. Genes such as <i>MALAT1, H19</i>, and <i>MIR29C</i> - whose links to hepatotoxicity have been confirmed - were identified as markers for the most-DILI group and appeared as top hits across all literature-based mining methods. Furthermore, we investigated the potential impact of dark genes on liver toxicity by identifying their rat orthologs in combination with their correlation to drug-induced liver pathologies observed <i>in vivo</i> following chemical exposure. We identified a set of important regulatory transcription factors of dark genes for all most-DILI compounds including E2F1 and JUND with supporting evidences in literature and we found <i>Magee1</i> correlated with chemically induced bile duct hyperplasia and adverse responses at 29 days in rats <i>in vivo</i>. In conclusion, in this study we show the potential role of these poorly annotated genes in mechanisms underlying hepatotoxicity and offer a number of computational approaches that may help to minimize current gaps in gene annotation and highlight their values as potential biomarkers in toxicological studies.

Also flagged:NIRnanocrystalsDPPtopCationphosphine
Journal Article 2018-11-20 No Snippets Samart N, Arhouma Z, Kumar S, Murakami HA, Crick DC, Crans DC.
Show Full Abstract

<sup>51</sup>V NMR spectroscopy is used to document, using speciation analysis, that one oxometalate is a more potent growth inhibitor of two Mycobacterial strains than other oxovanadates, thus demonstrating selectivity in its interaction with cells. Historically, oxometalates have had many applications in biological and medical studies, including study of the phase-problem in X-ray crystallography of the ribosome. The effect of different vanadate salts on the growth of <i>Mycobacterium smegmatis</i> (<i>M. smeg</i>) and <i>Mycobacterium tuberculosis</i> (<i>M. tb</i>) was investigated, and speciation was found to be critical for the observed growth inhibition. Specifically, the large orange-colored sodium decavanadate (V<sub>10</sub> O 28 6 - ) anion was found to be a stronger inhibitor of growth of two mycobacterial species than the colorless oxovanadate prepared from sodium metavanadate. The vanadium(V) speciation in the growth media and conversion among species under growth conditions was monitored using <sup>51</sup>V NMR spectroscopy and speciation calculations. The findings presented in this work is particularly important in considering the many applications of polyoxometalates in biological and medical studies, such as the investigation of the phase-problem in X-ray crystallography for the ribosome. The findings presented in this work investigate the interactions of oxometalates with other biological systems.

Also flagged:Serotonin Transporterserotonin5-hydroxytryptamine5-HThatching-
Journal Article 2018-11-20 ✓ 5 Snippets Phi Van VD, Krause ET, Phi-Van L.
In-Text Gene Mentions

The serotonin transporter (5-HTT) plays a key role in regulating serotonergic transmission via removal of serotonin (5-hydroxytryptamine, 5-HT) from synaptic clefts.

…by Serotonin Transporter (5-HTT) Genotypes in Newly…

…The serotonin transporter (5-HTT) plays a key…

…to investigate the5-HTTrole in fear…

…the three functional5-HTTgenotypes W/W, W/D…

Show Full Abstract

The serotonin transporter (5-HTT) plays a key role in regulating serotonergic transmission via removal of serotonin (5-hydroxytryptamine, 5-HT) from synaptic clefts. Alterations in 5-HTT expression and 5-HT transmission have been shown to cause changes to adult behavior including fear. The objective of the present study was to investigate the 5-HTT role in fear in birds at the very early stages of post-hatching life. Using an avoidance test with an elevated balance beam, which was based on depth perception and the respective fear of heights, we assessed fear-related avoidance behaviors of newly hatched chicks of the three functional 5-HTT genotypes W/W, W/D and D/D. Newly hatched chicks of the genotype D/D, which was linked to high 5-HTT expression, showed less intensive avoidance responses as measured by decreased latency to jump than W/W and W/D chicks. Further, significantly fewer D/D hens than W/W hens showed fear-like behavior that resembled a freezing response. Furthermore, in an arousal test the arousal reaction of the chicks in response to an acute short-term visual social deprivation in the home compartment was assessed 5 weeks after hatching, which also revealed that D/D chicks exhibited decreased arousal reaction, compared to W/W chicks. Thus, the results indicate that fear responses differ in D/D chicks in the early post-hatching periods, possibly due to the different expression of 5-HTT respectively 5-HT levels in this strain.

Also flagged:Allergic diseasesasthmachronic rhinosinusitisatopic dermatitisimmune responsesallergy
Journal Article 2018-11-20 No Snippets Hurrell BP, Shafiei Jahani P, Akbari O.
Show Full Abstract

Allergic diseases including asthma, chronic rhinosinusitis, and atopic dermatitis are common conditions worldwide. While type 2 immune responses induced by T-cells significantly cause allergic inflammation, the recently identified group two innate lymphoid cells (ILC2s) are emerging as critical players in the development of allergy. Upon allergen exposure, ILC2s are rapidly activated by cytokines released by epithelial cells. Activated ILC2s release various effector cytokines altogether contributing to the pathogenesis of allergy and can even cause inflammation in the absence of T-cells, as observed in asthma. Although the factors inducing ILC2 activation have been identified, evidence suggests that multiple factors can enhance or repress ILC2 proliferation, trafficking, or secretion of effector cytokines upon allergic inflammation. In this review, we discuss the recent findings that influence ILC2 activation and the resulting effects on the pathogenesis of allergy. A better understanding of how ILC2s are modulated will open the door to the development of new therapeutic strategies against allergic diseases.

Also flagged:lectininfectionsOligonucleotideprotein 3IQGAP1UNG
Journal Article 2018-11-20 ✓ 5 Snippets Shaw TA, Singaravelu R, Powdrill MH, Nhan J, Ahmed N, Özcelik D, Pezacki JP.
In-Text Gene Mentions

ECI2

TNFSF4

…, ACADVL ,ECI2, CPT1A ,…

…of HADHA andECI2protein levels (…

ECI2contributes to the…

Show Full Abstract

MicroRNAs (miRNAs) are part of a complex regulatory network that modulates cellular lipid metabolism. Here, we identify miR-124 as a regulator of triglyceride (TG) metabolism. This study advances our knowledge of the role of miR-124 in human hepatoma cells. Transcriptional profiling of Huh7.5 cells overexpressing miR-124 reveals enrichment for host factors involved in fatty acid oxidation among repressed miRNA targets. In addition, miR-124 down-regulates arylacetamide deacetylase (AADAC) and adipose triglyceride lipase, lipases proposed to mediate breakdown of hepatic TG stores for lipoprotein assembly and mitochondrial β-oxidation. Consistent with the inhibition of TG and fatty acid catabolism, miR-124 expression promotes cellular TG accumulation. Interestingly, miR-124 inhibits the production of hepatitis C virus, a virus that hijacks lipid pathways during its life cycle. Antiviral activity of miR-124 is consistent with repression of AADAC, a pro-viral host factor. Overall, our data highlight miR-124 as a novel regulator of TG metabolism in human hepatoma cells.

Also flagged:cystic fibrosispalmar fibromatosishereditary hemochromatosisChromosomepigmentationsynthesis
Journal Article 2018-11-20 ✓ 2 Snippets Kurbel S.
In-Text Gene Mentions

…three "Celtic" diseases (hemochromatosis, cystic fibrosis and…

…spreading of thehemochromatosismutation.…

Show Full Abstract

Cystic fibrosis, hereditary hemochromatosis and palmar fibromatosis are often described as "Celtic", based on their contemporary prevalence. The former two are among genetically defined disorders that seem to provide survival advantages to heterozygote individuals, while severe health problems happen in homozygote mutation carriers. Although palmar fibromatosis has no defined mutations, its prevalence has been linked to the prevalence of Y-Chromosome Haplogroup I that expanded after the Last Ice Age, thus making th distribution of all three "Celtic" diseases dependent on the global climate from 40 to 8 Kya. During the Last Ice Age, the global climate was dry and dark due to dust-laden atmosphere (20-25 times more than today). It has been postulated that skin pigmentation was related to insolation, UV protection and skin synthesis of vitamin D, so when our ancestors moved to Eurasia, individuals with pale skin became advantageous. Deficiency of vitamin D has several health consequences and some of them have been proposed by other authors as important for the spreading of cystic fibrosis mutations: rickets/osteomalacia; susceptibility to diarrheal diseases and tuberculosis and salt induced arterial hypertension. The here proposed link is between vitamin D deficiency and the anaemia of chronic disease that might have facilitated spreading of the hemochromatosis mutation. It seems plausible that the risk of health problems in the offspring of close relatives might have resulted in social taboos of consanguinity in Eurasian protosocieties. Ancient steam bath rituals seem linked to lower incidences of cystic fibrosis in several European populations, thus suggesting health protection in an arid, dusty climate of the last glaciation, that made CFTR mutations in heterozygote carriers less advantageous.

Also flagged:food poisoninginfectionimmune responsesIgGantibodycell surfaces
Journal Article 2018-11-20 No Snippets Ishida Y, Sakai E, Sato K, Sugiyama E, Mima K, Taneno A, Shimomura H, Cui L, Hirai Y.
Show Full Abstract

<i>Salmonella enterica</i> subsp. <i>enterica</i> serovar Enteritidis (SE) is one of the major causes of food poisoning. Much effort has been made to develop a vaccine for the prevention of SE colonization and infection in poultry. However, the effect of inactivated whole-cell SE vaccines on the bacterial attachment has not been clarified. This study investigated the immune responses to a killed whole-cell SE vaccine in chickens and the effect of vaccination on the bacterial attachment of SE to cultured Vero cells. A 1 ml dose of 10<sup>8</sup>-10<sup>9</sup> CFU viable SE bacterial cells was orally administered to chickens at 4 weeks or 10 months post vaccination. The number (CFU) of SE in 1 g of cecal droppings was counted on day 6 after administration. The SE CFUs were significantly lower (<i>p</i> < 0.05) in the vaccinated chickens, not only at 4 weeks but also at 10 months after vaccination, than in the unvaccinated control chickens. Anti-SE IgG and anti-SE IgA were detected using enzyme-linked immunosorbent assay (ELISA) in serum and intestinal and oviduct fluid samples from vaccinated chickens. Adhesion of heat-killed SE cells to Vero cells was reduced by pre-treatment of the bacteria by the vaccinated chicken-derived intestinal fluid, indicating the potential of the vaccine-induced antibody to prevent SE adhesion to epithelial cell surfaces.

bioRxiv 2018-11-20 Preprint (No Snippets API) McNeer NA, Philip J, Geiger H, Ries RE, Lavallée V, Walsh M, Shah M, Arora K, Emde A, Robine N, Alonzo TA, Kolb EA, Gamis AS, Smith M, Gerhard DS, Guidry-Auvil J, Meshinchi S, Kentsis A.
Show Full Abstract

Acute myeloid leukemias (AML) are characterized by mutations of tumor suppressor and oncogenes, involving distinct genes in adults and children. While certain mutations have been associated with the increased risk of AML relapse, the genomic landscape of primary chemotherapy resistant AML is not well defined. As part of the TARGET initiative, we performed whole-genome DNA and transcriptome (RNA and miRNA) sequencing analysis of pediatric AML with failure of induction chemotherapy. We identified at least three genetic groups of patients with induction failure, including those with NUP98 rearrangements, somatic mutations of WT1 in the absence of NUP98 mutations, and additional recurrent variants including those in KMT2C and MLLT10. Comparison of specimens before and after chemotherapy revealed distinct and invariant gene expression programs. While exhibiting overt therapy resistance, these leukemias nonetheless showed diverse forms of clonal evolution upon chemotherapy exposure. This included selection for mutant alleles of FRMD8 , DHX32 , PIK3R1 , SHANK3 , MKLN1 , as well as persistence of WT1 and TP53 mutant clones, and elimination or contraction of FLT3 , PTPN11 , and NRAS mutant clones. These findings delineate genetic mechanisms of primary chemotherapy resistance in pediatric AML, which should inform improved approaches for its diagnosis and therapy.

Also flagged:Hepatocellular Carcinomamyelodysplastic syndromerefractory anemialiver tumorcancerdeath
Journal Article 2018-11-19 ✓ 5 Snippets Yamauchi R, Takata K, Shinagawa Y, Tanaka T, Fukuda H, Fukuda S, Kunimoto H, Umeda K, Morihara D, Yokoyama K, Takeyama Y, Irie M, Shakado S, Mizoguchi M, Hisano S, Yoshimitsu K, Sakisaka S.
In-Text Gene Mentions

…anemia and secondaryhemochromatosisbut had not…

…and non-cirrhotic liverhemochromatosis.…

…Secondaryhemochromatosismay be a…

…Liver with SecondaryHemochromatosis

…Secondaryhemochromatosiscan also occasionally…

Show Full Abstract

A 70-year-old man was admitted for treatment of a single liver nodule that was detected by contrast-enhanced computed tomography. Twenty years earlier, the patient had been diagnosed with myelodysplastic syndrome-refractory anemia and secondary hemochromatosis but had not received erythrocyte transfusions. The current histological, computed tomography, and magnetic resonance imaging findings revealed hepatocellular carcinoma (HCC) and non-cirrhotic liver hemochromatosis. The liver tumor was treated using radiofrequency ablation therapy. Secondary hemochromatosis may be a risk factor for HCC, even if the liver is not cirrhotic. In such cases, additional surveillance may be required to detect the development of HCC.

Also flagged:cysteineRPS26dense fibrillar componentGDF9gene expressionphosphorylation
Journal Article 2018-11-19 No Snippets Liu XM, Yan MQ, Ji SY, Sha QQ, Huang T, Zhao H, Liu HB, Fan HY, Chen ZJ.
Show Full Abstract

Global transcriptional activity increases as oocytes grow and is silenced in fully grown oocytes. Thus, the chromatin configuration varies during oocyte growth, but the molecular mechanisms regulating these changes remain to be clarified. Here, we studied a susceptibility gene of polycystic ovary syndrome (PCOS), RPS26, which is a ribosomal protein-encoding gene that is highly expressed in the ovary, but the functions of which remain unknown. Specific knockout of Rps26 in mouse oocytes resulted in retarded follicle development from pre-antral follicles to antral follicles, while the chromatin configurations of the oocytes were arrested at the transition from the non-surrounded nucleolus (NSN) to surrounded nucleolus (SN)-type. As a consequence, all oocytes died by postnatal day 84 resulting in premature ovarian failure (POF). Loss of Rps26 in oocytes led to decreased mRNA transcription and low levels of histone trimethylation on H3K4/H3K9 and DNA methylation at 5-cytosine, high levels of which are required for oocytes to transform from NSN to SN-type. Low protein levels of oocyte-derived growth differentiation factor 9, bone morphogenetic protein 15, and the oocyte-granulosa cell gap junction protein connexin 37 inhibited oocyte growth and retarded follicle development. The disruption of the phosphoinositide 3-kinase/protein kinase B/Forkhead box O-3a pathway contributed to oocyte death and follicle atresia. These results provide genetic clues for the clinical diagnosis of POF, especially in PCOS patients without treatment.

Also flagged:Nkx2-5Isl1transposasechromatinCPCMesp1
Journal Article 2018-11-19 No Snippets Jia G, Preussner J, Chen X, Guenther S, Yuan X, Yekelchyk M, Kuenne C, Looso M, Zhou Y, Teichmann S, Braun T.
Show Full Abstract

Formation and segregation of cell lineages forming the heart have been studied extensively but the underlying gene regulatory networks and epigenetic changes driving cell fate transitions during early cardiogenesis are still only partially understood. Here, we comprehensively characterize mouse cardiac progenitor cells (CPCs) marked by Nkx2-5 and Isl1 expression from E7.5 to E9.5 using single-cell RNA sequencing and transposase-accessible chromatin profiling (ATAC-seq). By leveraging on cell-to-cell transcriptome and chromatin accessibility heterogeneity, we identify different previously unknown cardiac subpopulations. Reconstruction of developmental trajectories reveal that multipotent Isl1<sup>+</sup> CPC pass through an attractor state before separating into different developmental branches, whereas extended expression of Nkx2-5 commits CPC to an unidirectional cardiomyocyte fate. Furthermore, we show that CPC fate transitions are associated with distinct open chromatin states critically depending on Isl1 and Nkx2-5. Our data provide a model of transcriptional and epigenetic regulations during cardiac progenitor cell fate decisions at single-cell resolution.

Also flagged:CTXBDNFtopacidificationaxonsWater
Journal Article 2018-11-19 ✓ 4 Snippets Yu C, Li CH, Chen S, Yoo H, Qin X, Park H.
In-Text Gene Mentions

Huntington’s disease (HD) is a dominantly inherited neurodegenerative disease caused by an increase in CAG repeats in the Huntingtin gene (HTT).

Huntington’s disease (HD), a dominantly inherited neurodegenerative disease, is caused by an expansion of CAG repeats in the Huntingtin gene (HTT)1,2.

…Huntingtin gene (HTT).…

…Huntingtin gene (HTT) 1 ,…

Show Full Abstract

Huntington's disease (HD) is a dominantly inherited neurodegenerative disease caused by an increase in CAG repeats in the Huntingtin gene (HTT). The striatum is one of the most vulnerable brain regions in HD, and altered delivery of BDNF to the striatum is believed to underlie this high vulnerability. However, the delivery of BDNF to the striatum in HD remains poorly understood. Here, we used real-time imaging to visualize release of BDNF from cortical neurons cultured alone or co-cultured with striatal neurons. BDNF release was significantly decreased in the cortical neurons of zQ175 mice (a knock-in model of HD), and total internal reflection fluorescence microscopy revealed several release patterns of single BDNF-containing vesicles, with distinct kinetics and prevalence, in co-cultured cortical HD neurons. Notably, a smaller proportion of single BDNF-containing vesicles underwent full release in HD neurons than in wild-type neurons. This decreased release of BDNF in cortical neurons might lead to decreased BDNF levels in the striatum because the striatum receives BDNF mainly from the cortex. In addition, we observed a decrease in the total travel length and speed of BDNF-containing vesicles in HD neurons, indicating altered transport of these vesicles in HD. Our findings suggest a potential mechanism for the vulnerability of striatal neurons in HD and offer new insights into the pathogenic mechanisms underlying the degeneration of neurons in HD.

Also flagged:glucoseinsulinsecretionaction potentialExocytosisvesicles
Journal Article 2018-11-19 ✓ 2 Snippets Hastoy B, Godazgar M, Clark A, Nylander V, Spiliotis I, van de Bunt M, Chibalina MV, Barrett A, Burrows C, Tarasov AI, Scharfmann R, Gloyn AL, Rorsman P.
In-Text Gene Mentions

…low levels ofCACNA1E(R-type) expression.…

…Expression ofCACNA1Eand CACNA1B (encoding…

Show Full Abstract

Limited access to human islets has prompted the development of human beta cell models. The human beta cell lines EndoC-βH1 and EndoC-βH2 are increasingly used by the research community. However, little is known of their electrophysiological and secretory properties. Here, we monitored parameters that constitute the glucose-triggering pathway of insulin release. Both cell lines respond to glucose (6 and 20 mM) with 2- to 3-fold stimulation of insulin secretion which correlated with an elevation of [Ca<sup>2+</sup>]<sub>i</sub>, membrane depolarisation and increased action potential firing. Similar to human primary beta cells, K<sub>ATP</sub> channel activity is low at 1 mM glucose and is further reduced upon increasing glucose concentration; an effect that was mimicked by the K<sub>ATP</sub> channel blocker tolbutamide. The upstroke of the action potentials reflects the activation of Ca<sup>2+</sup> channels with some small contribution of TTX-sensitive Na<sup>+</sup> channels. The repolarisation involves activation of voltage-gated Kv2.2 channels and large-conductance Ca<sup>2+</sup>-activated K<sup>+</sup> channels. Exocytosis presented a similar kinetics to human primary beta cells. The ultrastructure of these cells shows insulin vesicles composed of an electron-dense core surrounded by a thin clear halo. We conclude that the EndoC-βH1 and -βH2 cells share many features of primary human β-cells and thus represent a useful experimental model.

Also flagged:SLPIGRPPLFAPOL1BLVRBPPIA
Journal Article 2018-11-19 ✓ 1 Snippet Cominetti O, Núñez Galindo A, Corthésy J, Valsesia A, Irincheeva I, Kussmann M, Saris WHM, Astrup A, McPherson R, Harper ME, Dent R, Hager J, Dayon L.
In-Text Gene Mentions

Antithrombin-III(ANT3), kininogen-1 (KNG1),…

Show Full Abstract

Holistic human proteome maps are expected to complement comprehensive profile assessment of health and disease phenotypes. However, methodologies to analyze proteomes in human tissue or body fluid samples at relevant scale and performance are still limited in clinical research. Their deployment and demonstration in large enough human populations are even sparser. In the present study, we have characterized and compared the plasma proteomes of two large independent cohorts of obese and overweight individuals using shotgun mass spectrometry (MS)-based proteomics. Herein, we showed, in both populations from different continents of about 500 individuals each, the concordance of plasma protein MS measurements in terms of variability, gender-specificity, and age-relationship. Additionally, we replicated several known and new associations between proteins, clinical and molecular variables, such as insulin and glucose concentrations. In conclusion, our MS-based analyses of plasma samples from independent human cohorts proved the practical feasibility and efficiency of a large and unified discovery/replication approach in proteomics, which was also recently coined "rectangular" design.

Also flagged:MSH3TTKTP53SCLT1KMT2CTDG
Journal Article 2018-11-19 ✓ 3 Snippets Gorlov IP, Pikielny CW, Frost HR, Her SC, Cole MD, Strohbehn SD, Wallace-Bradley D, Kimmel M, Gorlova OY, Amos CI.
In-Text Gene Mentions

DDX27

We have identified 18 novel cancer-associated genes with an excess of missense mutations: MUC4, CSMD3, FLG, USH2A, DNAH8, FAT4, MUC17, MUC16, SYNE1, COL11A1, RP1, SI, SACS, SLC25A5, DMD, DST, XIRP2, and PKHD1L1. We also identified 67 genes with an excess of FS and/or nonsense mutations: ACVR2A, SOX9, RPL22, CDCP2, CRIPAK, FAT1, BAX, BCL9L, SON, TTK, ZFP36L2, RBMX, XYLT2, USP35, WBP1, BMPR2, ZDBF2, MBD6, TCF7L2, PABPC3, ESRP1, ZC3H18, TDG, SLC23A2, JPH4, UBR5, PDS5B, IL32, BCL9, SYCP1, PRRT2, ROBO2, TEAD2, ZNF626, CASP8, RBM10, WNT16, PTCHD3, CD3G, RTKN2, PLEKHA6, AKAP7, DDX27, SEC63, ADNP, NKTR, NDUFC2, MANEA, SYNJ2, TMEM60, ARV1, LARP4B, PHACTR4, TBX3, HNRNPL, PRRG1, MCPH1, CEP290, MAP7D1, CCDC73, GPATCH4, TGIF1, FAM111B, CLOCK, SCLT1, HOXB3, and SRRT. A larger number of novel cancer-associated genes identified through the analyses of FS and nonsense mutilations compared to the analysis of missense mutations can be due to the fact that a large proportion of variation in number of mutation is due to gene involvement in cancer development.

…RTKN2, PLEKHA6, AKAP7,DDX27, SEC63, ADNP, NKTR,…

Show Full Abstract

<h4>Background</h4>Because driver mutations provide selective advantage to the mutant clone, they tend to occur at a higher frequency in tumor samples compared to selectively neutral (passenger) mutations. However, mutation frequency alone is insufficient to identify cancer genes because mutability is influenced by many gene characteristics, such as size, nucleotide composition, etc. The goal of this study was to identify gene characteristics associated with the frequency of somatic mutations in the gene in tumor samples.<h4>Results</h4>We used data on somatic mutations detected by genome wide screens from the Catalog of Somatic Mutations in Cancer (COSMIC). Gene size, nucleotide composition, expression level of the gene, relative replication time in the cell cycle, level of evolutionary conservation and other gene characteristics (totaling 11) were used as predictors of the number of somatic mutations. We applied stepwise multiple linear regression to predict the number of mutations per gene. Because missense, nonsense, and frameshift mutations are associated with different sets of gene characteristics, they were modeled separately. Gene characteristics explain 88% of the variation in the number of missense, 40% of nonsense, and 23% of frameshift mutations. Comparisons of the observed and expected numbers of mutations identified genes with a higher than expected number of mutations- positive outliers. Many of these are known driver genes. A number of novel candidate driver genes was also identified.<h4>Conclusions</h4>By comparing the observed and predicted number of mutations in a gene, we have identified known cancer-associated genes as well as 111 novel cancer associated genes. We also showed that adding the number of silent mutations per gene reported by genome/exome wide screens across all cancer type (COSMIC data) as a predictor substantially exceeds predicting accuracy of the most popular cancer gene predicting tool - MutsigCV.

Also flagged:sesquiterpenoidreproductionJH receptorstranscription factormethoprenebinding
Journal Article 2018-11-19 No Snippets Bittova L, Jedlicka P, Dracinsky M, Kirubakaran P, Vondrasek J, Hanus R, Jindra M.
Show Full Abstract

The sesquiterpenoid juvenile hormone (JH) is vital to insect development and reproduction. Intracellular JH receptors have recently been established as basic helix-loop-helix transcription factor (bHLH)/PAS proteins in <i>Drosophila melanogaster</i> known as germ cell-expressed (Gce) and its duplicate paralog, methoprene-tolerant (Met). Upon binding JH, Gce/Met activates its target genes. Insects possess multiple native JH homologs whose molecular activities remain unexplored, and diverse synthetic compounds including insecticides exert JH-like effects. How the JH receptor recognizes its ligands is unknown. To determine which structural features define an active JH receptor agonist, we tested several native JHs and their nonnative geometric and optical isomers for the ability to bind the <i>Drosophila</i> JH receptor Gce, to induce Gce-dependent transcription, and to affect the development of the fly. Our results revealed high ligand stereoselectivity of the receptor. The geometry of the JH skeleton, dictated by two stereogenic double bonds, was the most critical feature followed by the presence of an epoxide moiety at a terminal position. The optical isomerism at carbon C11 proved less important even though Gce preferentially bound a natural JH enantiomer. The results of receptor-ligand-binding and cell-based gene activation assays tightly correlated with the ability of different geometric JH isomers to induce gene expression and morphogenetic effects in the developing insects. Molecular modeling supported the requirement for the proper double-bond geometry of JH, which appears to be its major selective mechanism. The strict stereoselectivity of Gce toward the natural hormone contrasts with the high potency of synthetic Gce agonists of disparate chemistries.

Also flagged:Adrenal crisishypercalcemiahyponatremiaacute pyelonephritishypopituitarismchronic kidney disease
Journal Article 2018-11-19 ✓ 1 Snippet Yamada S, Arase H, Morishita T, Tsuchimoto A, Torisu K, Torisu T, Tsuruya K, Nakano T, Kitazono T.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

A 57-year-old woman with pre-dialysis chronic kidney disease (CKD) was hospitalized because of fever and fatigue. On admission, increased inflammatory response and pyuria with bacteriuria were observed. Pyelonephritis was successfully treated with antibiotics, whereas her fatigue continued and she developed progressive hypercalcemia and hyponatremia; serum sodium level, 116 mEq/L and corrected serum calcium level, 13.4 mg/dL. Plasma concentrations of adrenocorticotropic hormone and cortisol and serum luteinizing hormone were under the detection level. Although the reaction of other anterior pituitary hormones and the serum antidiuretic hormone (ADH) was preserved, the response of serum luteinizing hormone to administration of luteinizing hormone releasing hormone was impaired. Magnetic resonance imaging showed no structural abnormality in the thalamus, hypothalamus, and pituitary gland. She was diagnosed with adrenal insufficiency caused by partial hypopituitarism in concomitant with pyelonephritis. After starting hydrocortisone replacement, serum levels of sodium and calcium were rapidly normalized. This case highlights the importance of adrenal insufficiency as a differential diagnosis of hypercalcemia in patients with pre-dialysis CKD, especially when hyponatremia was concomitantly observed. Besides, infection should be considered as an important trigger for the development of latent adrenal insufficiency since it could increase the physiological demand of corticosteroid in the body. Also, CKD may enhance the magnitude of hypercalcemia since CKD patients have decreased capacity to increase urinary calcium excretion.

Also flagged:Synthesisginsenosidesacetylsalicylic acidsalicylic acidginsenoside salicylic acidcancer
Journal Article 2018-11-19 No Snippets Xu L, Xiao S, Yuan W, Cui J, Su G, Zhao Y.
Show Full Abstract

To increase the antitumor activity of ginsenosides and acetylsalicylic acid, acid hydrolysis products of <i>Panaxnotoginseng</i> saponin were used as raw materials to be combined with salicylic acid to obtain ginsenoside salicylic acid derivatives. All derivatives were assessed for anti-cancer activity. A total of 20 target compounds were designed and synthesized. The cytotoxic activity on five cancer cell lines, including human colon cancer (HT-29), gastric cancer (BGC-823), cervical cancer (Hela), human breast cancer (MCF-7), human lung cancer cells (A549), and two normal cancer cell lines (human gastric epithelial cells (GES-1), and human ovarian epithelial cells (IOSE144)) was evaluated following treatment with the compounds. The results showed that all compounds inhibited the growth of cancer cells. Compounds <b>1a</b>, <b>3a</b>, <b>7a</b>, <b>1b</b>, <b>2b</b>, <b>3b</b> and <b>8b</b> showed strong anticancer activity. For MCF-7 cells, compound <b>3b</b> showed the strongest inhibitory activity, IC<sub>50</sub> = 2.56 ± 0.09 μM. In the cytotoxicity test, all compounds showed low toxicity or no toxicity (IC<sub>50</sub> > 100 μM). In addition, a cell cycle distribution assay and wound healing assay demonstrated that compound <b>3b</b> specifically inhibited MCF-7 proliferation and migration ability. Our results indicate that compound <b>3b</b> represents a promising compound for further cancer studies.

Also flagged:Brain-Derived NeurotrophinNeurogenesisBrain Diseasesbrain-derived neurotrophic factorBDNFmitogen-activated protein kinase
Journal Article 2018-11-19 ✓ 5 Snippets Numakawa T, Odaka H, Adachi N.
In-Text Gene Mentions

Patients with HD carry an expanded CAG-repeat in huntingtin (HTT) gene that generates abnormally elongated poly glutamine stretch in the N-terminal region of the huntingtin (htt) protein.

…in huntingtin (HTT) gene that…

…of the huntingtin (htt) protein.…

…The mutanthttprotein has been…

…function of wild-typehttprotein.…

Show Full Abstract

It is well known that brain-derived neurotrophic factor, BDNF, has an important role in a variety of neuronal aspects, such as differentiation, maturation, and synaptic function in the central nervous system (CNS). BDNF stimulates mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/ERK), phosphoinositide-3kinase (PI3K), and phospholipase C (PLC)-gamma pathways via activation of tropomyosin receptor kinase B (TrkB), a high affinity receptor for BDNF. Evidence has shown significant contributions of these signaling pathways in neurogenesis and synaptic plasticity in in vivo and in vitro experiments. Importantly, it has been demonstrated that dysfunction of the BDNF/TrkB system is involved in the onset of brain diseases, including neurodegenerative and psychiatric disorders. In this review, we discuss actions of BDNF and related signaling molecules on CNS neurons, and their contributions to the pathophysiology of brain diseases.

Also flagged:Pyrrolizidine alkaloidprostanoidsynthesisPyrrolizidine alkaloidscirrhosisveno-occlusive disease
Journal Article 2018-11-19 No Snippets Ebmeyer J, Behrend J, Lorenz M, Günther G, Reif R, Hengstler JG, Braeuning A, Lampen A, Hessel-Pras S.
Show Full Abstract

Pyrrolizidine alkaloids (PA) are a group of secondary plant metabolites belonging to the most widely distributed natural toxins. PA intoxication of humans leads to severe liver damage, such as hepatomegaly, hepatic necrosis, fibrosis and cirrhosis. An acute consequence observed after ingestion of high amounts of PA is veno-occlusive disease (VOD) where the hepatic sinusoidal endothelial cells are affected. However, the mechanisms leading to VOD after PA intoxication remain predominantly unknown. Thus, we investigated PA-induced molecular effects on human umbilical vein endothelial cells (HUVEC). We compared the effects of PA with the effects of PA metabolites obtained by in vitro metabolism using liver homogenate (S9 fraction). In vitro-metabolized lasiocarpine and senecionine resulted in significant cytotoxic effects in HUVEC starting at 300 μM. Initial molecular effect screening using a PCR array with genes associated with endothelial cell biology showed PA-induced upregulation of the Fas receptor, which is involved in extrinsic apoptosis, and regulation of a number of interleukins, as well as of different enzymes relevant for prostanoid synthesis. Modulation of prostanoid synthesis was subsequently studied at the mRNA and protein levels and verified by increased release of prostaglandin I<sub>2</sub> as the main prostanoid of endothelial cells. All effects occurred only with in vitro-metabolically activated PA lasiocarpine and senecionine. By contrast, no effect was observed for the PA echimidine, heliotrine, lasiocarpine, senecionine, senkirkine and platyphylline in the absence of an external metabolizing system up to the highest tested concentration of 500 μM. Overall, our results confirm the metabolism-dependent toxification of PA and elucidate the involved pathways. These include induction of inflammatory cytokines and deregulation of the prostanoid synthesis pathway in endothelial cells, linking for the first time PA-dependent changes in prostanoid release to distinct alterations at the mRNA and protein levels of enzymes of prostanoid synthesis.

Also flagged:immune diseasealloimmune diseaseintra uterine growth restrictionIUGRhydropsIGFBP-1
Journal Article 2018-11-19 ✓ 1 Snippet Sciard C, Collardeau-Frachon S, Atallah A, Combourieu D, Massardier J, Heissat S, Gaucherand P, Guibaud L, Massoud M.
In-Text Gene Mentions

…cases of neonatalhemochromatosisdue to an…

Show Full Abstract

We report prenatal imaging features of four cases of neonatal hemochromatosis due to an alloimmune disease. All cases exhibited intra uterine growth restriction (IUGR) without arguments for a vascular etiology, associated with oligohydramnios. Placental hydrops was present in 75% of cases. Splenomegaly was identified in one case. Other causes of NH have been ruled out during diagnostic workup including karyotype, detection of IGFBP-1 to evaluate a premature rupture of membranes, maternal serologic tests. MRI was performed in two cases and showed an atrophic liver associated with a low signal intensity on T2-sequence in one case. Prenatal NH was suspected in this later case and the fetus was successfully treated with two IVIG (intravenous immunoglobulins) perfusions performed during pregnancy followed by exchange transfusion and IVIG after birth. The child is doing well with normal liver function tests after 17 months of follow up. Our aim was to highlight the importance of suggesting NH-GALD when facing IUGR with oligohydramnios, ascites, placental hydrops, splenomegaly on prenatal ultrasound with negative work up for placental vascular pathologies and infectious fetopathies. MRI might be of a good help, showing an atrophic liver but enhancing iron overload in hepatic and extrahepatic tissue is helpful but not constant.

Also flagged:muscular dystrophiescancerneurodegenerative diseasescancersoncogenestumor
Journal Article 2018-11-19 No Snippets Montes M, Sanford BL, Comiskey DF, Chandler DS.
Show Full Abstract

Alternative splicing of pre-mRNA increases genetic diversity, and recent studies estimate that most human multiexon genes are alternatively spliced. If this process is not highly regulated and accurate, it leads to mis-splicing events, which may result in proteins with altered function. A growing body of work has implicated mis-splicing events in a range of diseases, including cancer, neurodegenerative diseases, and muscular dystrophies. Understanding the mechanisms that cause aberrant splicing events and how this leads to disease is vital for designing effective therapeutic strategies. In this review, we focus on advances in therapies targeting splicing, and highlight the animal models developed to recapitulate disease phenotypes as a model for testing these therapies.

Also flagged:DIP-αDIPimmunoglobulinsynapsebindingdevelopment
Journal Article 2018-11-19 ✓ 1 Snippet Xu S, Xiao Q, Cosmanescu F, Sergeeva AP, Yoo J, Lin Y, Katsamba PS, Ahlsen G, Kaufman J, Linaval NT, Lee PT, Bellen HJ, Shapiro L, Honig B, Tan L, Zipursky SL.
In-Text Gene Mentions

DCC

Show Full Abstract

Drosophila Dpr (21 paralogs) and DIP proteins (11 paralogs) are cell recognition molecules of the immunoglobulin superfamily (IgSF) that form a complex protein interaction network. DIP and Dpr proteins are expressed in a synaptic layer-specific fashion in the visual system. How interactions between these proteins regulate layer-specific synaptic circuitry is not known. Here we establish that DIP-α and its interacting partners Dpr6 and Dpr10 regulate multiple processes, including arborization within layers, synapse number, layer specificity, and cell survival. We demonstrate that heterophilic binding between Dpr6/10 and DIP-α and homophilic binding between DIP-α proteins promote interactions between processes in vivo. Knockin mutants disrupting the DIP/Dpr binding interface reveal a role for these proteins during normal development, while ectopic expression studies support an instructive role for interactions between DIPs and Dprs in circuit development. These studies support an important role for the DIP/Dpr protein interaction network in regulating cell-type-specific connectivity patterns.

Also flagged:cell-cyclecell cycleCancergliomatumorBrain Cancer
Journal Article 2018-11-19 No Snippets Gulaia V, Kumeiko V, Shved N, Cicinskas E, Rybtsov S, Ruzov A, Kagansky A.
Show Full Abstract

Cellular quiescence is a reversible, non-cycling state controlled by epigenetic, transcriptional and niche-associated molecular factors. Quiescence is a condition where molecular signaling pathways maintain the poised cell-cycle state whilst enabling rapid cell cycle re-entry. To achieve therapeutic breakthroughs in oncology it is crucial to decipher these molecular mechanisms employed by the cancerous milieu to control, maintain and gear stem cells towards re-activation. Cancer stem-like cells (CSCs) have been extensively studied in most malignancies, including glioma. Here, the aberrant niche activities skew the quiescence/activation equilibrium, leading to rapid tumor relapse after surgery and/or chemotherapy. Unraveling quiescence mechanisms promises to afford prevention of (often multiple) relapses, a key problem in current glioma treatment. This review article covers the current knowledge regarding normal and aberrant cellular quiescence control whilst also exploring how different molecular mechanisms and properties of the neighboring cells can influence the molecular processes behind glioma stem cell quiescence.

Also flagged:tumorsinfectiongene expressiontranscription factorsporulationtumor
Journal Article 2018-11-19 No Snippets Schmitz L, McCotter S, Kretschmer M, Kronstad JW, Heimel K.
Show Full Abstract

Biotrophic fungal pathogens of plants must sense and adapt to the host environment to complete their life cycles. Recent transcriptome studies of the infection of maize by the biotrophic pathogen <i>Ustilago maydis</i> are providing molecular insights into an ordered program of changes in gene expression and the deployment of effectors as well as key features of nutrient acquisition. In particular, the transcriptome data provide a deeper appreciation of the complexity of the transcription factor network that controls the biotrophic program of invasion, proliferation, and sporulation. Additionally, transcriptome analysis during tumor formation, a key late stage in the life cycle, revealed features of the remodeling of host and pathogen metabolism that may support the formation of tremendous numbers of spores. Transcriptome studies are also appearing for other smut species during interactions with their hosts, thereby providing opportunities for comparative approaches to understand biotrophic adaptation.

Also flagged:Decapeptidesilicadoxorubicinprostate cancercancergonadotropin-releasing hormone
Journal Article 2018-11-19 No Snippets Tambe P, Kumar P, Paknikar KM, Gajbhiye V.
Show Full Abstract

<h4>Background</h4>Considering the increase in cancer cases and number of deaths per year worldwide, development of potential therapeutics is imperative. Mesoporous silica nanoparticles (MSNPs) are among the potential nanocarriers having unique properties for drug delivery. Doxorubicin (DOX), being the most commonly used drug, can be efficiently delivered to gonadotropin-releasing hormone (GnRH)-overexpressing cancer cells using functionalized MSNPs.<h4>Aim</h4>We report the development of decapeptide-conjugated MSNPs loaded with DOX for the targeted drug delivery in breast and prostate cancer cells.<h4>Materials and methods</h4>MSNPs were synthesized and subsequently functionalized with an analog of GnRH by using a heterobifunctional polyethylene glycol as a linker. These targeted MSNPs were then characterized by Fourier transform infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, and Raman spectroscopy. An anticancer drug DOX was loaded and then characterized for drug loading. DOX-loaded nanocarriers were then studied for their cellular uptake using confocal microscopy. The cytotoxicity of DOX-loaded targeted MSNPs and DOX-loaded bare MSNPs was studied by performing MTT assay on MCF-7 (breast cancer) and LNCaP (prostate cancer) cells. Further, acridine orange/ethidium bromide staining, as well as flow cytometry, was performed to confirm the apoptotic mode of cancer cell death.<h4>Results</h4>MSNPs were conjugated with polyethylene glycol as well as an agonist of GnRH and subsequently loaded with DOX. These targeted and bare MSNPs showed excellent porous structure and loading of DOX. Further, higher uptake of DOX-loaded targeted MSNPs was observed as compared to DOX-loaded bare MSNPs in GnRH-overexpressing breast (MCF-7) and prostate (LNCaP) cancer cells. The targeted MSNPs also showed significantly higher (<i>P</i><0.001) cytotoxicity than DOX-loaded bare MSNPs at different time points. After 48 hours of treatment, the IC<sub>50</sub> value for DOX-loaded targeted MSNPs was found to be 0.44 and 0.43 µM in MCF-7 and LNCaP cells, respectively. Acridine orange/ethidium bromide staining and flow cytometry analysis further confirmed the pathway of cell death through apoptosis.<h4>Conclusion</h4>This study suggests GnRH analog-conjugated targeted MSNPs can be the suitable and promising approach for targeted drug delivery in all hormone-dependent cancer cells.

Also flagged:LipidObesitycholesterollipoproteintriglyceridesalcohol
Journal Article 2018-11-19 ✓ 1 Snippet Ramos-Lopez O, Riezu-Boj JI, Milagro FI, Cuervo M, Goni L, Martinez JA.
In-Text Gene Mentions

…HDL-c: rs2815752 (NEGR1), rs2943641 (…

Show Full Abstract

<h4>Background and aim</h4>Individual lipid phenotypes including circulating total cholesterol (TC), low-density lipoprotein cholesterol (LDL-c), high-density lipoprotein cholesterol (HDL-c), and triglycerides (TG) determinations are influenced by gene-environment interactions. The aim of this study was to predict blood lipid level (TC, LDL-c, HDL-c, and TG) variability using genetic and lifestyle data in subjects with excessive body weight-for-height.<h4>Methods</h4>This cross-sectional study enrolled 304 unrelated overweight/obese adults of self-reported European ancestry. A total of 95 single nucleotide polymorphisms (SNPs) related to obesity and weight loss were analyzed by a targeted next-generation sequencing system. Relevant genotypes of each SNP were coded as 0 (nonrisk) and 1 (risk). Four genetic risk scores (GRS) for each lipid phenotype were calculated by adding the risk genotypes. Information concerning lifestyle (diet, physical activity, alcohol drinking, and smoking) was obtained using validated questionnaires. Total body fat (TFAT) and visceral fat (VFAT) were determined by dual-energy X-ray absorptiometry.<h4>Results</h4>Overall, 45 obesity-related genetic variants were associated with some of the studied blood lipids. In addition to conventional factors (age, sex, dietary intakes, and alcohol consumption), the calculated GRS significantly contributed to explain their corresponding plasma lipid trait. Thus, HDL-c, TG, TC, and LDL-c serum concentrations were predicted by approximately 28% (optimism-corrected adj. <i>R</i> <sup>2</sup> = 0.28), 25% (optimism-corrected adj. <i>R</i> <sup>2</sup> = 0.25), 24% (optimism-corrected adj. <i>R</i> <sup>2</sup> = 0.24), and 21% (optimism-corrected adj. <i>R</i> <sup>2</sup>=0.21), respectively. Interestingly, GRS were the greatest contributors to TC (squared partial correlation (PC<sup>2</sup>) = 0.18) and LDL-c (PC<sup>2</sup> = 0.18) features. Likewise, VFAT and GRS had a higher impact on HDL-c (PC<sup>2</sup> = 0.09 and PC<sup>2</sup> = 0.06, respectively) and TG levels (PC<sup>2</sup> = 0.20 and PC<sup>2</sup> = 0.07, respectively) than the rest of variables.<h4>Conclusions</h4>Besides known lifestyle influences, some obesity-related genetic variants could help to predict blood lipid phenotypes.

Also flagged:immune responsesTLRsTLRToll‐like receptorToll‐like receptorsmembrane
Journal Article 2018-11-18 No Snippets Anwar MA, Shah M, Kim J, Choi S.
Show Full Abstract

Toll-like receptors (TLRs) are germline-encoded receptors that are central to innate and adaptive immune responses. Owing to their vital role in inflammation, TLRs are rational targets in clinics; thus, many ligands and biologics have been reported to overcome the progression of various inflammatory and malignant conditions and support the immune system. For each TLR, at least one, and often many, drug formulations are being evaluated. Ligands reported as stand-alone drugs may also be reported based on their use in combinatorial therapeutics as adjuvants. Despite their profound efficacy in TLR-modulation in preclinical studies, multiple drugs have been terminated at different stages of clinical trials. Here, TLR modulating drugs that have been evaluated in clinical trials are discussed, along with their mode of action, suggestive failure reasons, and ways to improve the clinical outcomes. This review presents recent advances in TLR-targeting drugs and provides directions for more successful immune system manipulation.

Also flagged:Breast CancerTumorinducible nitric oxide synthaseiNOSarginase-1ARG-1
Journal Article 2018-11-18 ✓ 1 Snippet Mao D, Feng L, Gong H.
In-Text Gene Mentions

…transducers and theactivator of transcription 1of transcription 1…

Show Full Abstract

<h4>Background</h4>Yanghe decoction (YHD) has been used in the treatment of breast cancer for hundreds of years in Asia. However, the underlying mechanisms are currently unknown. The present study aims to evaluate the efficacy of YHD on antitumor and immune system enhancement in a 4T1 mouse breast cancer model and to clarify the antitumor mechanisms of YHD in breast cancer.<h4>Materials and methods</h4>The YHD was orally administrated for 2 weeks after inoculation. Tumor tissues were then removed, weighed, and homogenized. Flow cytometry was used to detect the number of Myeloid-Derived Suppressor Cells (MDSCs), Natural Killer T Cells (NKTs), and T cell subsets. Quantitative real-time PCR was used to detect the expression of inducible nitric oxide synthase (iNOS) and arginase-1 (ARG-1). Western blot was used to detect the protein expression of signal transducers and the activator of transcription 1 (STAT1), phosphorylated-signal transducers and the activator of transcription 1 (p-STAT1), signal transducers and the activator of transcription 3 (STAT3), and phosphorylated-signal transducers and the activator of transcription 3 (p-STAT3). The expression levels of interleukin-6 (IL-6), transforming growth factor-<i>β</i> (TGF-<i>β</i>), and interferon-<i>γ</i> (IFN-<i>γ</i>) were detected using an enzyme linked immunosorbent assay.<h4>Results</h4>We found that the tumor weight of YHD high-dose group was significantly lower compared with the control group (<i>p</i><0.05). The YHD depressed the expression of MDSCs, iNOS, ARG-1, IL-6, TGF-<i>β</i>, and p-STAT3 and significantly increased the expression of IFN-<i>γ</i>, NKTs, CD4<sup>+</sup> T cells, and p-STAT1.<h4>Conclusion</h4>Our results showed that The mechanisms of YHD inhibit 4T1 breast tumor growth may be related to downregulating the expression of iNOS and ARG-1, negatively regulating the Janus kinase/STAT3 (JAK/STAT3) pathway by repressing the expression of IL-6 and TGF-<i>β</i>. Meanwhile, YHD enhances the immune capacity via increasing the expression of NKTs, CD4<sup>+</sup> T cells, IFN-<i>γ</i>, and p-STAT1.

Also flagged:Statinbiliary tract cancersextrahepatic cholangiocarcinomastatinscancers of the gallbladderduct
Journal Article 2018-11-17 No Snippets Liu Z, Alsaggaf R, McGlynn KA, Anderson LA, Tsai HT, Zhu B, Zhu Y, Mbulaiteye SM, Gadalla SM, Koshiol J.
Show Full Abstract

<h4>Objective</h4>To evaluate the association between statin use and risk of biliary tract cancers (BTC).<h4>Design</h4>This is a nested case-control study conducted in the UK Clinical Practice Research Datalink. We included cases diagnosed with incident primary BTCs, including cancers of the gall bladder, bile duct (ie, both intrahepatic and extrahepatic cholangiocarcinoma), ampulla of Vater and mixed type, between 1990 and 2017. For each case, we selected five controls who did not develop BTCs at the time of case diagnosis, matched by sex, year of birth, calendar time and years of enrolment in the general practice using incidence density sampling. Exposures were defined as two or more prescription records of statins 1 year prior to BTC diagnosis or control selection. ORs and 95% CIs for associations between statins and BTC overall and by subtypes were estimated using conditional logistic regression, adjusted for relevant confounders.<h4>Results</h4>We included 3118 BTC cases and 15 519 cancer-free controls. Current statin use versus non-use was associated with a reduced risk of all BTCs combined (adjusted OR=0.88, 95% CI 0.79 to 0.98). The reduced risks were most pronounced among long-term users, as indicated by increasing number of prescriptions (p<sub>trend</sub>=0.016) and cumulative dose of statins (p<sub>trend</sub>=0.008). The magnitude of association was similar for statin use and risk of individual types of BTCs. The reduced risk of BTCs associated with a record of current statin use versus non-use was more pronounced among persons with diabetes (adjusted OR=0.72, 95% CI 0.57 to 0.91). Among non-diabetics, the adjusted OR for current statin use versus non-use was 0.91 (95% CI 0.81 to 1.03, p<sub>heterogeneity</sub>=0.007).<h4>Conclusion</h4>Compared with non-use of statins, current statin use is associated with 12% lower risk of BTCs; no association found with former statin use. If replicated, particularly in countries with a high incidence of BTCs, our findings could pave the way for evaluating the value of statins for BTC chemoprevention.

Also flagged:paclitaxelcell cycleprostate cancercancersulphoraphanesilymarin
Journal Article 2018-11-17 ✓ 2 Snippets Doğan Şiğva ZÖ, Balci Okcanoğlu T, Biray Avci Ç, Yilmaz Süslüer S, Kayabaşi Ç, Turna B, Dodurga Y, Nazli O, Gündüz C.
In-Text Gene Mentions

…and decreased BAD,CDK5RAP1, CDC20, cyclin H,…

…CDC20, cyclin H,CDK5RAP1, CDC20.…

Show Full Abstract

Paclitaxel, which isolated from Taxus brevifolia, is recently started to be used against prostate cancer treatment and it is a very effective compound against cancer. In this study, we aimed to test the synergistic effect of two plant active compounds (sulphoraphane (SFN) and silymarin (SILY)) and several endemic plant species from Turkey (such as Phlomis leucophracta, Rubia davisiana, Alkanna tinctoria), which are known to have anticarcinogenic effect on androgen-independent PC3 and DU145, and androgen-dependent VCaP prostate cancer cell lines, with paclitaxel on the expression of cell cycle signaling and apoptosis regulator genes. Herbal substances and endemic herbal extracts were combined with Paclitaxel drug. IC<sub>50</sub> doses were identified as real-time online. The most effective synergistic doses were determined according to isobologram analysis. The apoptotic effects of effective combined doses were evaluated by TUNEL, Annexin V, and JC-1 methods. Apoptotic and/or cell cycle arrest effects of confirmed combined doses on the expression of genes in these pathways were assessed by real-time online. Endemic plant extracts (Alkanna tinctoria, Phlomis leucophracta and Rubia davisiana, IC<sub>50</sub> < 220 μg/ml) and herbal substances (SILY, and SFN IC<sub>50</sub> < 130 μM) indicated antiproliferative and apoptotic effects in prostate cancer cell lines. They testified to the synergistic effect of paclitaxel with endemic plant extracts (Combination Index CI, ED<sub>50</sub> < 0.41). The combinations, which indicate the synergistic effect was increased to the Bax/Bcl‑2 ratio by suppressing Bcl‑2 gene expression into the prostate cancer cell lines. Besides, they increased the expression of TNFRSF10A, TNFRSF1A, CHEK1, CDKN1A, CDKN2B, CDK8, CDKN3 and CASP14 and decreased BAD, CDK5RAP1, CDC20, cyclin H, CDK5RAP1, CDC20. The effective doses of paclitaxel were reduced and G2/M arrest was induced by the endemic plant extracts and herbal substances that indicate a synergistic effect with paclitaxel. By using different combination of herbal extracts or active substances with paclitaxel, more economical and efficient treatment strategies can be developed.

Also flagged:gestationorgan developmentlactationinsulinglucoseglycogen
Journal Article 2018-11-16 ✓ 1 Snippet Quesnel H, Père MC, Louveau I, Lefaucheur L, Perruchot MH, Prunier A, Pastorelli H, Meunier-Salaün MC, Gardan-Salmon D, Merlot E, Gondret F.
In-Text Gene Mentions

…expression level ofPRDX6, a gene playing…

Show Full Abstract

Sow environment during gestation can generate maternal stress which could alter foetal development. The effects of two group-housing systems for gestating sows on piglet morphological and physiological traits at birth were investigated. During gestation, sows were reared in a conventional system on a slatted floor (C, 18 sows), demonstrated as being stressful for sows or in an enriched system in larger pens and on deep straw bedding (E, 19 sows). On gestation day 105, sows were transferred into identical individual farrowing crates on a slatted floor. Farrowing was supervised to allow sampling from piglets at birth. In each litter, one male piglet of average birth weight was euthanized immediately after birth to study organ development and tissue traits. Blood samples were collected from 6 or 7 piglets per litter at birth and 2 piglets per litter at 4 days of lactation (DL4). At birth, mean piglet BW did not differ between groups (P &gt; 0.10); however, the percentage of light ( 0.10) between C and E piglets, but the insulin to glucose ratio was greater (P = 0.02) in C than in E piglets. Compared with E piglets, C piglets had a lighter gut at birth (P = 0.01) and their glycogen content in longissimus muscle was lower (P &lt; 0.01). In this muscle, messenger RNA levels of PAX7, a marker of satellite cells and of PPARGC1A, a transcriptional coactivator involved in mitochondriogenesis and mitochondrial energy metabolism, were greater (P &lt; 0.05), whereas the expression level of PRDX6, a gene playing a role in antioxidant pathway, was lower (P = 0.03) in C than in E piglets. Other studied genes involved in myogenesis did not differ between C and E piglets. No system effect was observed on target genes in liver and subcutaneous adipose tissue. On DL4, C piglets exhibited a lower plasma antioxidant capacity than E piglets (P = 0.002). In conclusion, exposure of sows to a stressful environment during gestation had mild negative effects on the maturity of piglets at birth.

Also flagged:follicular lymphomaFLchromosomeCDKN2ACREBBPTP53
Journal Article 2018-11-16 ✓ 1 Snippet Qu X, Li H, Braziel RM, Passerini V, Rimsza LM, Hsi ED, Leonard JP, Smith SM, Kridel R, Press O, Weigert O, LeBlanc M, Friedberg JW, Fang M.
In-Text Gene Mentions

…gain specifically encompassingVRK2and FANCL predicted…

Show Full Abstract

Although recent advances in molecular genetics have enabled improved risk classification of follicular lymphoma (FL) using, for example, the m7-FLIPI score, the impact on treatment has been limited. We aimed to assess the prognostic significance of copy-number aberrations (CNAs) and copy-neutral loss of heterozygosity (cnLOH) identified by chromosome genomic-array testing (CGAT) at FL diagnosis using prospectively collected clinical trial specimens from 255 patients enrolled in the SWOG study S0016. The impact of genomic aberrations was assessed for early progression (progressed or died within 2 years after registration), progression-free survival (PFS), and overall survival (OS). We showed that increased genomic complexity (ie, the total number of aberration calls) was associated with poor outcome in FL. Certain chromosome arms were critical for clinical outcome. Prognostic CNAs/cnLOH were identified: whereas early progression was correlated with 2p gain (<i>P</i> = .007; odds ratio [OR] = 2.55 [1.29, 5.03]) and 2p cnLOH (<i>P</i> = .005; OR = 10.9 [2.08, 57.2]), 2p gain specifically encompassing <i>VRK2</i> and <i>FANCL</i> predicted PFS (<i>P</i> = .01; hazard ratio = 1.80 [1.14, 2.68]) as well as OS (<i>P</i> = .005; 2.40 [1.30, 4.40]); <i>CDKN2A/B</i> (9p) deletion correlated with worse PFS (<i>P</i> = .004, 3.50 [1.51, 8.28]); whereas <i>CREBBP</i> (16p) (<i>P</i> < .001; 6.70 [2.52, 17.58]) and <i>TP53</i> (17p) (<i>P</i> < .001; 3.90 [1.85, 8.31]) deletion predicted worse OS. An independent cohort from the m7-FLIPI study was explored, and the prognostic significance of aberration count, and <i>TP53</i> and <i>CDKN2A</i>/<i>B</i> deletion were further validated. In conclusion, assessing genomic aberrations at FL diagnosis with CGAT improves risk stratification independent of known clinical parameters, and provides a framework for development of future rational targeted therapies.

Also flagged:DopaminebindingG protein-coupled receptorsDopamine receptorsneurodegenerative diseasesdopamine receptor
Journal Article 2018-11-16 No Snippets Klein MO, Battagello DS, Cardoso AR, Hauser DN, Bittencourt JC, Correa RG.
Show Full Abstract

The dopaminergic system plays important roles in neuromodulation, such as motor control, motivation, reward, cognitive function, maternal, and reproductive behaviors. Dopamine is a neurotransmitter, synthesized in both central nervous system and the periphery, that exerts its actions upon binding to G protein-coupled receptors. Dopamine receptors are widely expressed in the body and function in both the peripheral and the central nervous systems. Dopaminergic signaling pathways are crucial to the maintenance of physiological processes and an unbalanced activity may lead to dysfunctions that are related to neurodegenerative diseases. Unveiling the neurobiology and the molecular mechanisms that underlie these illnesses may contribute to the development of new therapies that could promote a better quality of life for patients worldwide. In this review, we summarize the aspects of dopamine as a catecholaminergic neurotransmitter and discuss dopamine signaling pathways elicited through dopamine receptor activation in normal brain function. Furthermore, we describe the potential involvement of these signaling pathways in evoking the onset and progression of some diseases in the nervous system, such as Parkinson's, Schizophrenia, Huntington's, Attention Deficit and Hyperactivity Disorder, and Addiction. A brief description of new dopaminergic drugs recently approved and under development treatments for these ailments is also provided.

Also flagged:Drp1behavioralneurodegenerative diseaseDynamin-related protein 1mitochondrialHD
Journal Article 2018-11-16 ✓ 1 Snippet Zhao Y, Sun X, Qi X.
In-Text Gene Mentions

Htt

Show Full Abstract

Mitochondrial dysfunction manifests in the pathogenesis of Huntington's disease (HD), a fatal and inherited neurodegenerative disease. Dynamin-related protein 1 (Drp1) is the primary component of mitochondrial fission and becomes hyperactivated in various models of HD. We previously reported that inhibition of Drp1 hyperactivation by P110, a rationally designed peptide inhibitor of Drp1-Fis1 interaction, is protective in the HD R6/2 mouse model, which expresses a fragment of mutant Huntingtin (mHtt). In this study, we expand our work to test the effect of P110 treatment in HD knock-in (zQ175 KI) mice that express full-length mtHtt and exhibit progressive disease symptoms, reminiscent of human HD. We find that subcutaneously sustained treatment with P110 reduces movement deficits of mice. Moreover, the treatment attenuates striatal neuronal loss, microglial hyperactivity and white matter disorganization in zQ175 KI mice. These findings provide an additional line of evidence that inhibition of Drp1 hyperactivation is sufficient to reduce HD-associated neuropathology and behavioral deficits. We propose that manipulation of Drp1 hyperactivation might be a useful strategy to develop therapeutics for treating HD.

Also flagged:capsidnanofiberpeptidesstem cell differentiationpolymersbiomacromolecules
Journal Article 2018-11-16 No Snippets Cao B, Li Y, Yang T, Bao Q, Yang M, Mao C.
Show Full Abstract

Bacteriophage, also called phage, is a human-safe bacteria-specific virus. It is a monodisperse biological nanostructure made of proteins (forming the outside surface) and nucleic acids (encased in the protein capsid). Among different types of phages, filamentous phages have received great attention in tissue regeneration research due to their unique nanofiber-like morphology. They can be produced in an error-free format, self-assemble into ordered scaffolds, display multiple signaling peptides site-specifically, and serve as a platform for identifying novel signaling or homing peptides. They can direct stem cell differentiation into specific cell types when they are organized into proper patterns or display suitable peptides. These unusual features have allowed scientists to employ them to regenerate a variety of tissues, including bone, nerves, cartilage, skin, and heart. This review will summarize the progress in the field of phage-based tissue regeneration and the future directions in this field.

Also flagged:LSCClaryngeal squamous cell carcinomaluciferaseAnnexin Vwound-healingcell proliferation
Journal Article 2018-11-16 No Snippets Luo M, Sun G, Sun JW.
Show Full Abstract

<h4>Objective</h4>To explore the effect of miR-196bon the biological features of human laryngeal squamous cell carcinoma (LSCC) through targeting PCDH-17.<h4>Methods</h4>miR-196b and PCDH-17 expressions were determined in tissues, and the targeting relation of miR-196b and PCDH-17 was verified through dual-luciferase reporter system. In vitro, Hep-2 cells were divided into the Control, miR-196b inhibitors, miR-NC, PCDH-17, and miR-196b mimics+PCDH-17 groups. The miR-196b and PCDH-17 expressions were determined by qRT-PCR or/and Western blot, and the biological features by MTT, Annexin V-FITC/PI, wound-healing and Transwell assays.<h4>Results</h4>MiR-196b was found to be up-regulated, while PCDH-17 was down-regulated in a negative correlation in LSCC patients, which was related to histological grade and TNM stage. And low expression of miR-196b and high expression of PCDH-17 contributed to an increase in the 5-year-survival rate of LSCC patients. Besides, miR-196b directly targeted PCDH-17, while miR-196b inhibitors could up-regulate the PCDH-17 in Hep-2 cells. Moreover, miR-196b inhibitors and PCDH-17 curbed Hep-2 cell proliferation but facilitated the apoptosis, with decreases in cell invasion and migration. In addition, no statistical significance was found in cell proliferation, apoptosis, invasion and migration between Control group and miR-196b mimics+PCDH-17 group.<h4>Conclusion</h4>LSCC patients exhibited the up-regulated miR-196b and down-regulated PCDH-17, which are correlated with the major clinical features and prognosis. Inhibiting miR-196b may suppress proliferation, migration and invasion abilities, and promote apoptosis of Hep-2 cells via targeting PCDH-17.

Also flagged:Plk1spindlecell divisionLGNdyneinmitosis
Journal Article 2018-11-16 ✓ 1 Snippet Sana S, Keshri R, Rajeevan A, Kapoor S, Kotak S.
In-Text Gene Mentions

…partners such asF-actin–binding 4.4.1 family of…

Show Full Abstract

Proper orientation of the mitotic spindle defines the correct division plane and is essential for accurate cell division and development. In metazoans, an evolutionarily conserved complex comprising of NuMA/LGN/Gαi regulates proper orientation of the mitotic spindle by orchestrating cortical dynein levels during metaphase. However, the molecular mechanisms that modulate the spatiotemporal dynamics of this complex during mitosis remain elusive. Here, we report that acute inactivation of Polo-like kinase 1 (Plk1) during metaphase enriches cortical levels of dynein/NuMA/LGN and thus influences spindle orientation. We establish that this impact of Plk1 on cortical levels of dynein/NuMA/LGN is through NuMA, but not via dynein/LGN. Moreover, we reveal that Plk1 inhibition alters the dynamic behavior of NuMA at the cell cortex. We further show that Plk1 directly interacts and phosphorylates NuMA. Notably, NuMA-phosphorylation by Plk1 impacts its cortical localization, and this is needed for precise spindle orientation during metaphase. Overall, our finding connects spindle-pole pool of Plk1 with cortical NuMA and answers a long-standing puzzle about how spindle-pole Plk1 gradient dictates proper spindle orientation for error-free mitosis.

Also flagged:serotonin5-HT 1A receptorbinding5-HT 1Asleeppsychiatric disorders
Journal Article 2018-11-16 ✓ 1 Snippet Griffioen G, Matheson GJ, Cervenka S, Farde L, Borg J.
In-Text Gene Mentions

5-HTT(serotonin transporter) has…

Show Full Abstract

<h4>Objective</h4>A putative relationship between markers for the serotonin system and the personality scale self-transcendence (ST) and its subscale spiritual acceptance (SA) has been demonstrated in a previous PET study of 5-HT<sub>1A</sub> receptor binding in healthy control subjects. The results could however not be replicated in a subsequent PET study at an independent centre. In this study, we performed a replication of our original study in a larger sample using Bayesian hypothesis testing to evaluate relative evidence both for and against this hypothesis.<h4>Methods</h4>Regional 5-HT<sub>1A</sub> receptor binding potential (BP<sub>ND</sub>) was examined in 50 healthy male subjects using PET with the radioligand [<sup>11</sup>C]WAY100635. 5-HT<sub>1A</sub>availability was calculated using the simplified reference tissue model (SRTM) yielding regional BP<sub>ND</sub>. ST and SA were measured using the Temperament and Character Inventory (TCI) questionnaire. Correlations between ST/SA scores and 5-HT<sub>1A</sub>BP<sub>ND</sub> in frontal cortex, hippocampus and raphe nuclei were examined by calculation of default correlation Bayes factors (BFs) and replication BFs.<h4>Results</h4>There were no significant correlations between 5-HT<sub>1A</sub> receptor binding and ST/SA scores. Rather, five of six replication BFs provided moderate to strong evidence for no association between 5-HT<sub>1A</sub> availability and ST/SA, while the remaining BF provided only weak evidence.<h4>Conclusion</h4>We could not replicate our previous findings of an association between 5-HT<sub>1A</sub> availability and the personality trait ST/SA. Rather, the Bayesian analysis provided evidence for a lack of correlation. Further research should focus on whether other components of the serotonin system may be related to ST or SA. This study also illustrates how Bayesian hypothesis testing allows for greater flexibility and more informative conclusions than traditional <i>p</i>-values, suggesting that this approach may be advantageous for analysis of molecular imaging data.

Also flagged:Serotonin TransporterChronic fatigue syndromeinfectionToll-like receptor 3TLR3secretion
Journal Article 2018-11-16 ✓ 5 Snippets Noda M, Ifuku M, Hossain MS, Katafuchi T.
In-Text Gene Mentions

Therefore, inhibition of microglial IL-1β and astrocytic 5-HTT, or specific activation of 5-HT1A receptor could be promising ways to ameliorate the various symptoms of CFS, at least in infection-related cases.

In a model using virus mimicking synthetic double-stranded RNA, infection causes sequential signaling such as increased blood brain barrier (BBB) permeability, microglia/macrophage activation through Toll-like receptor 3 (TLR3) signaling, secretion of IL-1β, upregulation of the serotonin transporter (5-HTT) in astrocytes, reducing extracellular serotonin (5-HT) levels and hence reduced activation of 5-HT1A receptor subtype.

The direct effect of poly-I:C is actually on microglia, which then affect astrocytes, because the upregulated expression of 5-HTT in the brain of poly-I:C-injected rats was abolished by pretreatment of minocycline, an inhibitor of microglial activation (48).

…the serotonin transporter (5-HTT) in astrocytes, reducing…

…IL-1β and astrocytic5-HTT, or specific activation…

Show Full Abstract

Fatigue is commonly reported in a variety of illnesses and has major impact on quality of life. Chronic fatigue syndrome (CFS) is a debilitating syndrome of unknown etiology. The clinical symptoms include problems in neuroendocrine, autonomic, and immune systems. It is becoming clear that the brain is the central regulator of CFS. For example, neuroinflammation, especially induced by activation of microglia and astrocytes, may play a prominent role in the development of CFS, though little is known about molecular mechanisms. Many possible causes of CFS have been proposed. However, in this mini-review, we summarize evidence for a role for microglia and astrocytes in the onset and the maintenance of immunologically induced CFS. In a model using virus mimicking synthetic double-stranded RNA, infection causes sequential signaling such as increased blood brain barrier (BBB) permeability, microglia/macrophage activation through Toll-like receptor 3 (TLR3) signaling, secretion of IL-1β, upregulation of the serotonin transporter (5-HTT) in astrocytes, reducing extracellular serotonin (5-HT) levels and hence reduced activation of 5-HT<sub>1A</sub> receptor subtype. Hopefully, drug discovery targeting these pathways may be effective for CFS therapy.

Also flagged:ThioredoxinglutaredoxinmetabolismTrxGrxthiol
Journal Article 2018-11-16 ✓ 5 Snippets López-Grueso MJ, González-Ojeda R, Requejo-Aguilar R, McDonagh B, Fuentes-Almagro CA, Muntané J, Bárcena JA, Padilla CA.
In-Text Gene Mentions

Cys91 of peroxiredoxin-6 (PRDX6) and Cys153 of phosphoglycerate mutase-1 (PGAM1), that are known to be involved in progression of tumor growth, are reported here for the first time as specific targets of Grx1.

The Grx-dependent redox modified Cys at position 91 is not the canonical catalytic (“peroxidatic”) cysteine that lies at position 47 of PRDX6.

Further and deeper insights into the underlying mechanisms, i.e. possible involvement of PRDX6 and Nrf2 signaling [40], CD95 ligand or TNFα induced activation of sphingomyelinases and ceramide induced MRRSP activation of NOX [18], etc., are expected to be discovered with ongoing focused experiments.

PRDX6 and PKM are likely substrates of Trx1 denitrosase activity, although the involved cysteines cannot be mapped with this technique and we cannot tell whether the S-nitrosated Cys are Cys91 or Cys47 in PRDX6 and Cys358 or another Cys in PKM.

Moreover, arachidonic acid has been shown to mediate the known proliferative action of PRDX6 [72].

Show Full Abstract

The aim of the present study was to define the role of Trx and Grx on metabolic thiol redox regulation and identify their protein and metabolite targets. The hepatocarcinoma-derived HepG2 cell line under both normal and oxidative/nitrosative conditions by overexpression of NO synthase (NOS3) was used as experimental model. Grx1 or Trx1 silencing caused conspicuous changes in the redox proteome reflected by significant changes in the reduced/oxidized ratios of specific Cys's including several glycolytic enzymes. Cys<sup>91</sup> of peroxiredoxin-6 (PRDX6) and Cys<sup>153</sup> of phosphoglycerate mutase-1 (PGAM1), that are known to be involved in progression of tumor growth, are reported here for the first time as specific targets of Grx1. A group of proteins increased their Cys<sub>RED</sub>/Cys<sub>OX</sub> ratio upon Trx1 and/or Grx1 silencing, including caspase-3 Cys<sup>163</sup>, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Cys<sup>247</sup> and triose-phosphate isomerase (TPI) Cys<sup>255</sup> likely by enhancement of NOS3 auto-oxidation. The activities of several glycolytic enzymes were also significantly affected. Glycolysis metabolic flux increased upon Trx1 silencing, whereas silencing of Grx1 had the opposite effect. Diversion of metabolic fluxes toward synthesis of fatty acids and phospholipids was observed in siRNA-Grx1 treated cells, while siRNA-Trx1 treated cells showed elevated levels of various sphingomyelins and ceramides and signs of increased protein degradation. Glutathione synthesis was stimulated by both treatments. These data indicate that Trx and Grx have both, common and specific protein Cys redox targets and that down regulation of either redoxin has markedly different metabolic outcomes. They reflect the delicate sensitivity of redox equilibrium to changes in any of the elements involved and the difficulty of forecasting metabolic responses to redox environmental changes.

Also flagged:CRB3FERMEPB41L4Bcell proliferationmembraneoncogenes
Journal Article 2018-11-15 ✓ 2 Snippets Walker SJ, Selfors LM, Margolis BL, Brugge JS.
In-Text Gene Mentions

…genes (GAPDH, HINT1,PRDX6) as described […

PRDX6fwd, 5´-CGTGTGGTGTTTGTTTTTGG-3…

Show Full Abstract

Numerous observations have suggested a connection between the maintenance of cell polarity and control of cell proliferation; however, the mechanisms underlying these connections remain poorly understood. Here we found that ectopic expression of CRB3, which was previously shown to restore tight junctions and membrane polarity in MCF-10A cells, induced a hyperproliferative phenotype, with significantly enlarged acini in basement membrane culture, similar to structures induced by expression of proliferative oncogenes such as cyclinD1. We found that CRB3-induced proliferation is epidermal growth factor (EGF)-independent and occurs through a mechanism that involves secretion of the EGF-family ligand, amphiregulin (AREG). The increase in AREG secretion is associated with an increase in the number and size of both early and late endosomes. Both the proliferative and endocytic phenotypes associated with CRB3 expression require the FERM-binding domain (FBD) but not the PDZ-binding domain of CRB3, arguing that this proliferative phenotype is independent of the PDZ-dependent polarity signaling by CRB3. We identified the FBD-containing protein, EPB41L4B, as an essential mediator of CRB3-driven proliferation and observed that the CRB3-dependent changes in endocytic trafficking were also dependent on EPB41L4B. Taken together, these data reveal a previously uncharacterized role for CRB3 in regulating proliferation in mammalian cells that is associated with changes in the endocytic trafficking machinery.

Also flagged:IL-1RIcytokineIL-1βautoimmune diseasesinflammatory responseMARCH3
Journal Article 2018-11-15 No Snippets Lin H, Gao D, Hu MM, Zhang M, Wu XX, Feng L, Xu WH, Yang Q, Zhong X, Wei J, Xu ZS, Zhang HX, Song ZM, Zhou Q, Ye W, Liu Y, Li S, Shu HB.
Show Full Abstract

The proinflammatory cytokine IL-1β plays critical roles in inflammatory and autoimmune diseases. IL-1β signaling is tightly regulated to avoid excessive inflammatory response. In this study, we identified the E3 ubiquitin ligase membrane-associated RING-CH-type finger 3 (MARCH3) as a critical negative regulator of IL-1β-triggered signaling. Overexpression of MARCH3 inhibited IL-1β-triggered activation of NF-κB as well as expression of inflammatory genes, whereas MARCH3 deficiency had the opposite effects. MARCH3-deficient mice produced higher levels of serum inflammatory cytokines and were more sensitive to inflammatory death upon IL-1β injection or <i>Listeria monocytogenes</i> infection. Mechanistically, MARCH3 was associated with IL-1 receptor I (IL-1RI) and mediated its K48-linked polyubiquitination at K409 and lysosomal-dependent degradation. Furthermore, IL-1β stimulation triggered dephosphorylation of MARCH3 by CDC25A and activation of its E3 ligase activity. Our findings suggest that MARCH3-mediated IL-1RI degradation is an important mechanism for attenuating IL-1β-triggered inflammatory response.

Also flagged:serotonin transporterbehavioralaggressionserotonin5-hydroxytryptamine transporter; 5-НТТSLC6A4
Journal Article 2018-11-15 ✓ 5 Snippets Cherepkova EV, Maksimov VV, Aftanas LI.
In-Text Gene Mentions

…serotonin transporter gene (5-HTT) polymorphisms and their…

…the polymorphism of5-HTTgene also draws…

…decreased expression of5-HTTS (or SL)…

…Chinese origin, and5-HTTmay underlie the…

…10-repeat allele of5-HTTgene and/or the…

Show Full Abstract

In our study, the frequencies of serotonin transporter gene (5-HTT) polymorphisms and their combinations are compared in the healthy male subjects with antisocial behavior, in general, and in those with its particular forms, as well as in the reference group of MMA fighters. Subjects convicted of unlawful actions were classified into those convicted of violent crimes or non-violent ones. The group of subjects convicted of violent crimes was further subdivided into those convicted of murder, or robbery, or of inflicting grave body injuries. The group of MMA fighters was selected from the subjects without a prior history of antisocial behavior or criminal record in the subjects or their relatives. The frequency of D allele in the groups of convicted subjects and MMA fighters was higher, than in the population sample. Furthermore, the frequencies of D/D and 12/12 genotype combinations were shown to be higher in the group of convicted subjects, especially, in habitual criminals and those convicted of grave crimes or murder. The predisposition of MMA fighters to violent behavior and physical aggressive suppression of an opponent is successfully implemented in their professional career; however, this behavioral pattern appears to represent the controlled aggression.

Also flagged:-carbonmetabolismmethylationcarbonfolatemethyl
Journal Article 2018-11-15 ✓ 5 Snippets Knight AK, Park HJ, Hausman DB, Fleming JM, Bland VL, Rosa G, Kennedy EM, Caudill MA, Malysheva O, Kauwell GPA, Sokolow A, Fisher S, Smith AK, Bailey LB.
In-Text Gene Mentions

In maternal blood at delivery, B4GALT5 was associated with choline, serum folate, and 5meTHF (p < 0.05), and PSMB7 methylation was associated with choline, 5meTHF, and TMAO (p < 0.05).

In maternal blood at baseline, there were no additional associations with B4GALT5 or the unannotated CpG site, but PSMB7 was also associated with SAM, serum folate, and 5meTHF.

In cord blood, B4GALT5 was also associated with the SAM/SAH ratio, PSMB7 methylation was associated with RBC folate and DMG, and the unannotated site was also associated with DMG.

For example, PSMB7 was associated with 5meTHF in maternal baseline and delivery samples and choline was associated with both B4GALT5 and PSMB7 at delivery.

B4GALT5 has been associated with cancer progression and drug resistance, especially in gliomas41–43.

Show Full Abstract

One-carbon metabolism is essential for multiple cellular processes and can be assessed by the concentration of folate metabolites in the blood. One-carbon metabolites serve as methyl donors that are required for epigenetic regulation. Deficiencies in these metabolites are associated with a variety of poor health outcomes, including adverse pregnancy complications. DNA methylation is known to vary with one-carbon metabolite concentration, and therefore may modulate the risk of adverse pregnancy outcomes. This study addresses changes in one-carbon indices over pregnancy and the relationship between maternal and child DNA methylation and metabolite concentrations by leveraging data from 24 mother-infant dyads. Five of the 13 metabolites measured from maternal blood and methylation levels of 993 CpG sites changed over the course of pregnancy. In dyads, maternal and fetal one-carbon concentrations were highly correlated, both early in pregnancy and at delivery. The 993 CpG sites whose methylation levels changed over pregnancy in maternal blood were also investigated for associations with metabolite concentrations in infant blood at delivery, where five CpG sites were associated with the concentration of at least one metabolite. Identification of CpG sites that change over pregnancy may result in better characterization of genes and pathways involved in maintaining a healthy, term pregnancy.

Also flagged:Wntretinoic acidextracellularspermatogenesiscytokinesisgene expression
Journal Article 2018-11-15 No Snippets Yoshida S.
Show Full Abstract

In mammalian testes, robust stem cell functions ensure the continual production of sperm. In testicular seminiferous tubules, spermatogenic stem cells (SSCs) are highly motile and are interspersed between their differentiating progeny, while undergoing self-renewal and differentiation. In such an "open niche" microenvironment, some SSCs proliferate, while others exit the stem cell compartment through differentiation; therefore, self-renewal and differentiation are perfectly balanced at the population (or tissue) level, a dynamics termed "population asymmetry." This is in stark contrast to the classical perception of tissue stem cells being cells that are clustered in a specialized "closed niche" region and that invariantly undergo asymmetric divisions. However, despite its importance, how the self-renewal and differentiation of SSCs are balanced in an open niche environment is poorly understood. Recent studies have thrown light on the key mechanism that enables SSCs to follow heterogeneous fates, although they are equally exposed to signaling molecules controlling self-renewal and differentiation. In particular, SSCs show heterogeneous susceptibilities to differentiation-promoting signals such as Wnt and retinoic acid. Heterogeneous susceptibility to the ubiquitously distributed fate-controlling extracellular signal might be a key generic mechanism for the heterogeneous fate of tissue stem cells in open niche microenvironments.

Also flagged:RUNX2mineralizationtranscription factorBARX1bone diseasesbone tumours
Journal Article 2018-11-15 ✓ 1 Snippet Lin X, Yang H, Wang L, Li W, Diao S, Du J, Wang S, Dong R, Li J, Fan Z.
In-Text Gene Mentions

…factor Sox5 andSox6, as well as…

Show Full Abstract

<h4>Objectives</h4>Bone regeneration by bone tissue engineering is a therapeutic option for bone defects. Improving the osteogenic differentiation of mesenchymal stem cells (MSCs) is essential for successful bone regeneration. We previously showed that AP2a enhances the osteogenic differentiation in MSCs. The present study investigated the mechanism of how AP2a regulates the direct differentiation.<h4>Materials and methods</h4>Co-immunoprecipitation and ChIP assays were carried out to investigate the underlying mechanism in MSCs differentiation. The osteogenic differentiation potential was determined by mineralization ability and the expression of osteogenic marker in vitro and the in vivo bone-like tissue generation in nude mice.<h4>Results</h4>We show that AP2a can compete with RUNX2, a key transcription factor in osteogenic differentiation, to recruit YAP and release the inhibition of RUNX2 activity from YAP by forming YAP-AP2a protein complex. YAP-AP2a protein complex also interacts with the BARX1 promoter through AP2a, inhibit the transcription of BARX1. Moreover, BARX1 inhibits osteogenic differentiation of MSCs.<h4>Conclusions</h4>Our discoveries revealed that AP2a may regulate the osteogenic differentiation in an indirect way through competing with RUNX2 to relieve the RUNX2 activity which inhibited by YAP, and also in a direct way via targeting the BARX1 and directly repressed its transcription. Thus, our discoveries shed new light on the mechanism of direct differentiation of MSCs and provide candidate targets for improving the osteogenic differentiation and enhancing bone tissue regeneration.

Also flagged:ZincHydroxyapatiteapatitemineralmetalsiron
Journal Article 2018-11-15 No Snippets Negrila CC, Predoi MV, Iconaru SL, Predoi D.
Show Full Abstract

Zinc- (Zn) doped hydroxyapatite (HAp) were prepared by sol-gel method. Zinc-doped hydroxyapatite (ZnHAp) and HAp were analyzed by X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS). The Rietveld analysis revealed that the HAp and 7ZnHAp powders obtained by sol-gel method have a monophasic hydroxyapatite structure belonging to the P6<sub>3/m</sub> spatial group. The results obtained from the ultrasound characterization of HAp and ZnHAp are also presented in this study. The effect of zinc concentration on properties that were deduced from ultrasonic measurements are studied in the case of a significant zinc concentration (x<sub>Zn</sub> = 0.07). From the values of the ultrasonic waves velocities were determined by the pairs of elastic coefficients of the suspensions (Young modulus E, Poisson coefficient ν), which have proven to be similar to those determined by other authors.

Also flagged:lactationmetabolismmembraneorganizationNotchTGF-β
Journal Article 2018-11-15 ✓ 2 Snippets Ibeagha-Awemu EM, Li R, Dudemaine PL, Do DN, Bissonnette N.
In-Text Gene Mentions

…also known asZNFX1antisense RNA 1…

ZNFX1antisense RNA 1…

Show Full Abstract

This study aimed to characterize the long non-coding RNA (lncRNA) expression in the bovine mammary gland and to infer their functions in dietary response to 5% linseed oil (LSO) or 5% safflower oil (SFO). Twelve cows (six per treatment) in mid lactation were fed a control diet for 28 days followed by a treatment period (control diet supplemented with 5% LSO or 5% SFO) of 28 days. Mammary gland biopsies were collected from each animal on day-14 (D-14, control period), D+7 (early treatment period) and D+28 (late treatment period) and were subjected to RNA-Sequencing and subsequent bioinformatics analyses. Functional enrichment of lncRNA was performed via potential <i>cis</i> regulated target genes located within 50 kb flanking regions of lncRNAs and having expression correlation of >0.7 with mRNAs. A total of 4955 lncRNAs (325 known and 4630 novel) were identified which potentially <i>cis</i> targeted 59 and 494 genes in LSO and SFO treatments, respectively. Enrichments of <i>cis</i> target genes of lncRNAs indicated potential roles of lncRNAs in immune function, nucleic acid metabolism and cell membrane organization processes as well as involvement in Notch, cAMP and TGF-β signaling pathways. Thirty-two and 21 lncRNAs were differentially expressed (DE) in LSO and SFO treatments, respectively. Six genes (<i>KCNF1</i>, <i>STARD13</i>, <i>BCL6</i>, <i>NXPE2</i>, <i>HHIPL2</i> and <i>MMD</i>) were identified as potential <i>cis</i> target genes of six DE lncRNAs. In conclusion, this study has identified lncRNAs with potential roles in mammary gland functions and potential candidate genes and pathways via which lncRNAs might function in response to LSO and SFA.

Also flagged:BHLHA15Tumorscancerdiphtheria toxindoxorubicindextran sodium sulfate
Journal Article 2018-11-15 ✓ 1 Snippet Hayakawa Y, Tsuboi M, Asfaha S, Kinoshita H, Niikura R, Konishi M, Hata M, Oya Y, Kim W, Middelhoff M, Hikiba Y, Higashijima N, Ihara S, Ushiku T, Fukayama M, Tailor Y, Hirata Y, Guha C, Yan KS, Koike K, Wang TC.
In-Text Gene Mentions

Olfm4

Show Full Abstract

<h4>Background & aims</h4>The intestinal epithelium is maintained by long-lived intestinal stem cells (ISCs) that reside near the crypt base. Above the ISC zone, there are short-lived progenitors that normally give rise to lineage-specific differentiated cell types but can dedifferentiate into ISCs in certain circumstances. However, the role of epithelial dedifferentiation in cancer development has not been fully elucidated.<h4>Methods</h4>We performed studies with Bhlha15-CreERT, Lgr5-DTR-GFP, Apc<sup>flox/flox</sup>, LSL-Notch (IC), and R26-reporter strains of mice. Some mice were given diphtheria toxin to ablate Lgr5-positive cells, were irradiated, or were given 5-fluorouracil, hydroxyurea, doxorubicin, or dextran sodium sulfate to induce intestinal or colonic tissue injury. In intestinal tissues, we analyzed the fate of progeny that expressed Bhlha15. We used microarrays and reverse-transcription PCR to analyze gene expression patterns in healthy and injured intestinal tissues and in tumors. We analyzed gene expression patterns in human colorectal tumors using The Cancer Genome Atlas data set.<h4>Results</h4>Bhlha15 identified Paneth cells and short-lived secretory precursors (including pre-Paneth label-retaining cells) located just above the ISC zone in the intestinal epithelium. Bhlha15<sup>+</sup> cells had no plasticity after loss of Lgr5-positive cells or irradiation. However, Bhlha15<sup>+</sup> secretory precursors started to supply the enterocyte lineage after doxorubicin-induced epithelial injury in a Notch-dependent manner. Sustained activation of Notch converts Bhlha15<sup>+</sup> secretory precursors to long-lived enterocyte progenitors. Administration of doxorubicin and expression of an activated form of Notch resulted in a gene expression pattern associated with enterocyte progenitors, whereas only sustained activation of Notch altered gene expression patterns in Bhlha15<sup>+</sup> precursors toward those of ISCs. Bhlha15<sup>+</sup> enterocyte progenitors with sustained activation of Notch formed intestinal tumors with serrated features in mice with disruption of Apc. In the colon, Bhlha15 marked secretory precursors that became stem-like, cancer-initiating cells after dextran sodium sulfate-induced injury, via activation of Src and YAP signaling. In analyses of human colorectal tumors, we associated activation of Notch with chromosome instability-type tumors with serrated features in the left colon.<h4>Conclusions</h4>In mice, we found that short-lived precursors can undergo permanent reprogramming by activation of Notch and YAP signaling. These cells could mediate tumor formation in addition to traditional ISCs.

Also flagged:AcetoacetateglucosecarboncytoplasmicglycosaminoglycanSCOT
Journal Article 2018-11-15 ✓ 1 Snippet Puchalska P, Martin SE, Huang X, Lengfeld JE, Daniel B, Graham MJ, Han X, Nagy L, Patti GJ, Crawford PA.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Metabolic plasticity has been linked to polarized macrophage function, but mechanisms connecting specific fuels to tissue macrophage function remain unresolved. Here we apply a stable isotope tracing, mass spectrometry-based untargeted metabolomics approach to reveal the metabolome penetrated by hepatocyte-derived glucose and ketone bodies. In both classically and alternatively polarized macrophages, [<sup>13</sup>C]acetoacetate (AcAc) labeled ∼200 chemical features, but its reduced form D-[<sup>13</sup>C]β-hydroxybutyrate (D-βOHB) labeled almost none. [<sup>13</sup>C]glucose labeled ∼500 features, and while unlabeled AcAc competed with only ∼15% of them, the vast majority required the mitochondrial enzyme succinyl-coenzyme A-oxoacid transferase (SCOT). AcAc carbon labeled metabolites within the cytoplasmic glycosaminoglycan pathway, which regulates tissue fibrogenesis. Accordingly, livers of mice lacking SCOT in macrophages were predisposed to accelerated fibrogenesis. Exogenous AcAc, but not D-βOHB, ameliorated diet-induced hepatic fibrosis. These data support a hepatocyte-macrophage ketone shuttle that segregates AcAc from D-βOHB, coordinating the fibrogenic response to hepatic injury via mitochondrial metabolism in tissue macrophages.

Also flagged:tamoxifenbindingestrogen receptorCreER recombinasesCreER T2cytoplasmic
Journal Article 2018-11-15 ✓ 5 Snippets Bohin N, Carlson EA, Samuelson LC.
In-Text Gene Mentions

…cells, and ISC-specificOlfm4-CreER T2 ( Schuijers…

…(CBC) ISCs, includingOlfm4-CreER T2 and Lgr5-CreER…

…T2 mice, TX-treatedOlfm4-CreER T2 mice had…

…irradiation in TX-treatedOlfm4-CreER T2 and Lgr5-CreER…

…fewer organoids inOlfm4-CreER T2 and 2-fold…

Show Full Abstract

With the tamoxifen-inducible CreER<sup>T2</sup> system, genetic recombination can be temporally controlled in a cell-type-specific manner in intact animals, permitting dissection of the molecular underpinnings of mammalian physiology. Here we present a significant drawback to CreER<sup>T2</sup> technology for analysis of intestinal stem cells. Using the intestine-specific Villin-CreER<sup>T2</sup> mouse strain, we observed delayed intestinal regeneration post irradiation. Villin-CreER<sup>T2</sup> activation was associated with DNA damage and cryptic loxP site cleavage. Analysis of stem cell-specific CreER<sup>T2</sup> strains showed that the genome toxicity impairs function of crypt base columnar stem cells, resulting in loss of organoid initiating activity. Importantly, the stem cell impairment is short-lived, with return to normal by 7 days post tamoxifen treatment. Our findings demonstrate that mouse genetic experiments that utilize CreER<sup>T2</sup> should consider the confounding effects of enhanced stem cell sensitivity to genome toxicity resulting from CreER<sup>T2</sup> activation.

Also flagged:transcription factorBrain-derived neurotrophic factorBDNForganogenesisNTRK2Chronic kidney disease
Journal Article 2018-11-15 ✓ 1 Snippet Wu H, Uchimura K, Donnelly EL, Kirita Y, Morris SA, Humphreys BD.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Kidney organoids derived from human pluripotent stem cells have great utility for investigating organogenesis and disease mechanisms and, potentially, as a replacement tissue source, but how closely organoids derived from current protocols replicate adult human kidney is undefined. We compared two directed differentiation protocols by single-cell transcriptomics of 83,130 cells from 65 organoids with single-cell transcriptomes of fetal and adult kidney cells. Both protocols generate a diverse range of kidney cells with differing ratios, but organoid-derived cell types are immature, and 10%-20% of cells are non-renal. Reconstructing lineage relationships by pseudotemporal ordering identified ligands, receptors, and transcription factor networks associated with fate decisions. Brain-derived neurotrophic factor (BDNF) and its cognate receptor NTRK2 were expressed in the neuronal lineage during organoid differentiation. Inhibiting this pathway improved organoid formation by reducing neurons by 90% without affecting kidney differentiation, highlighting the power of single-cell technologies to characterize and improve organoid differentiation.

Also flagged:Gliomamethylationchromatinhistonemodificationspathogenesis
Journal Article 2018-11-15 No Snippets Zang L, Kondengaden SM, Che F, Wang L, Heng X.
Show Full Abstract

Glioma is characterized by a high recurrence rate, short survival times, high rates of mortality and treatment difficulties. Surgery, chemotherapy and radiation (RT) are the standard treatments, but outcomes rarely improve even after treatment. With the advancement of molecular pathology, recent studies have found that the development of glioma is closely related to various epigenetic phenomena, including DNA methylation, abnormal microRNA (miRNA), chromatin remodeling and histone modifications. Owing to the reversibility of epigenetic modifications, the proteins and genes that regulate these changes have become new targets in the treatment of glioma. In this review, we present a summary of the potential therapeutic targets of glioma and related effective treating drugs from the four aspects mentioned above. We further illustrate how epigenetic mechanisms dynamically regulate the pathogenesis and discuss the challenges of glioma treatment. Currently, among the epigenetic treatments, DNA methyltransferase (DNMT) inhibitors and histone deacetylase inhibitors (HDACIs) can be used for the treatment of tumors, either individually or in combination. In the treatment of glioma, only HDACIs remain a good option and they provide new directions for the treatment. Due to the complicated pathogenesis of glioma, epigenetic applications to glioma clinical treatment are still limited.

Also flagged:CholesterolDyslipidemiacardiovascular diseaselipoproteinchromosomezinc transporters
Journal Article 2018-11-15 ✓ 1 Snippet Liu H, Wang W, Zhang C, Xu C, Duan H, Tian X, Zhang D.
In-Text Gene Mentions

…VPS13D, IGF2BP2, PSMB7,CA10, NECTIN2, APOE, APOC1,…

Show Full Abstract

Dyslipidemia represents a strong and independent risk factor for cardiovascular disease. Plasma cholesterol, such as total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), and high density lipoprotein cholesterol (HDL-C), is the common indicator of diagnosing dyslipidemia. Here based on 382 Chinese twin pairs, we explored the magnitude of genetic impact on TC, HDL-C, LDL-C variation and further searched for genetic susceptibility loci for them using genome-wide association study (GWAS). The ACE model was the best fit model with additive genetic parameter (A) accounting for 26.6%, common or shared environmental parameter (C) accounting for 47.8%, unique/non-shared environmental parameter (E) accounting for 25.6% for the variance in HDL-C. The AE model was the best fit model for TC (A: 61.4%; E: 38.6%) and LDL-C (A: 65.5%; E: 34.5%). While no SNPs reached the genome-wide significance level (<i>P</i> < 5 × 10<sup>-8</sup>), 8, 14, 9 SNPs exceeded the suggestive significance level (<i>P</i> < 1 × 10<sup>-5</sup>) for TC, HDL-C, LDL-C, respectively. The promising genetic regions for TC, HDL-C, LDL-C were on chromosome 11 around rs7107698, chromosome 5 around rs12518218, chromosome 2 around rs10490120, respectively. Gene-based analysis found 1038, 1033 and 1090 genes nominally associated with TC, HDL-C, LDL-C (<i>P</i> < 0.05), especially <i>FAF1, KLKB1</i> for TC, <i>KLKB1</i> for HDL-C, and <i>NTRK1, FAF1, SNTB2</i> for LDL-C, respectively. The number of common related genes among TC, HDL-C and LDL-C was 71, including <i>FAF1, KLKB1</i>, etc. Pathway enrichment analysis discovered known related pathways-zinc transporters, metal ion SLC transporters for TC, cell adhesion molecules CAMs, IL-6 signaling for HDL, FC epsilon RI signaling pathway, NFAT pathway for LDL, respectively. In conclusion, the TC and LDL-C level is moderately heritable and the HDL-C level is lowly heritable in Chinese population. The genomic loci, functional genes and pathways are identified to account for the heritability of plasma cholesterol level. Our findings provide important insights into plasma cholesterol molecular physiology and expect future research to replicate and validate our results.

Also flagged:NEAT1paraspecklesneurodegenerative diseasesNuclear Paraspeckle Assembly Transcript 1nucleusnuclear body
Journal Article 2018-11-15 No Snippets An H, Williams NG, Shelkovnikova TA.
Show Full Abstract

Neurodegenerative diseases are among the most common causes of disability worldwide. Although neurodegenerative diseases are heterogeneous in both their clinical features and the underlying physiology, they are all characterised by progressive loss of specific neuronal populations. Recent experimental evidence suggests that long non-coding RNAs (lncRNAs) play important roles in the CNS in health and disease. Nuclear Paraspeckle Assembly Transcript 1 (NEAT1) is an abundant, ubiquitously expressed lncRNA, which forms a scaffold for a specific RNA granule in the nucleus, or nuclear body, the paraspeckle. Paraspeckles act as molecular hubs for cellular processes commonly affected by neurodegeneration. Transcriptomic analyses of the diseased human tissue have revealed altered NEAT1 levels in the CNS in major neurodegenerative disorders as well as in some disease models. Although it is clear that changes in NEAT1 expression (and in some cases, paraspeckle assembly) accompany neuronal damage, our understanding of NEAT1 contribution to the disease pathogenesis is still rudimentary. In this review, we have summarised the available knowledge on NEAT1 involvement in the molecular processes linked to neurodegeneration and on NEAT1 dysregulation in this type of disease, with a special focus on amyotrophic lateral sclerosis. The goal of this review is to attract the attention of researchers in the field of neurodegeneration to NEAT1 and paraspeckles.

Also flagged:Synthesisbiofilm formationalkylhexadecylglycerolammonium
Journal Article 2018-11-15 No Snippets Wang Y, Costin S, Zhang JF, Liao S, Wen ZT, Lallier T, Yu Q, Xu X.
Show Full Abstract

<h4>Purpose</h4>To synthesize a small library of antibacterial dental monomers based on quaternary ammonium salts and to test their antibacterial activity against cariogenic bacteria.<h4>Methods</h4>Five new antibacterial monomers were synthesized and characterized by NMR, IR and HRMS.<h4>Results</h4>Cytotoxicity assays using human gingival fibroblast cells showed that these new antibacterial monomers were biocompatible at concentrations of 10⁻⁵ M and displayed less cytotoxicity than BisGMA, a common dental monomer. When analyzed in vitro, all new monomers demonstrated strong inhibitory activity against biofilm formation by cariogenic Streptococcus mutans and Lactobacillus casei. Results indicated that antibacterial monomers containing a long alkyl (i.e. hexadecyl) chain are superior to their shorter-chain counterparts. The cross-linking monomers based on glycerol dimethacrylate also consistently outperformed their monomethacrylate analogs. Finally, the ammonium salts containing the dimethylbenzyl moiety were superior to the similar structures containing 1,4-diazabicyclo[2.2.2]octane (DABCO) in some cases.<h4>Clinical significance</h4>All five new monomers were deemed biocompatible at concentrations of 10⁻⁵ M or less, and most had better biocompatibility than BisGMA. Dimethacrylate monomers 5 and 6 generally demonstrated high antibacterial activities, with the highest activity shown for the most lipophilic monomer 6, and these new antibacterial monomers have potential future application in dental composites and bonding agents.

Also flagged:AmphiphilichomopolymersThiol-ynealkynemethacrylatethiol
Journal Article 2018-11-15 No Snippets He H, Liu B, Wang M, Vachet RW, Thayumanavan S.
Show Full Abstract

Amphiphilic homopolymers with high densities of functional groups are synthetically challenging. Thiol-yne nucleophilic click reactions have been investigated to introduce multiple functional groups in polymers with high density. An electron deficient alkyne group bearing methacrylate monomer was polymerized using reversible addition-fragmentation chain-transfer (RAFT) polymerization. Subsequently, the electron deficient alkyne group on polymer side chain was readily reacted with a thiol reagent using triethylamine (TEA) as the organocatalyst. This reaction was found to be very efficient under mild conditions. The resultant homopolymer bearing thiol vinyl ether functional groups could perform a second thiol addition with a stronger base, such as triazabicyclodecene (TBD), to prepare multifunctional homopolymers. This stepwise addition process was monitored by <sup>1</sup>H NMR as well as gel permeation chromatography. The fidelity of this method was demonstrated by attaching four different functionalities, including both hydrophobic and hydrophilic moieties. Furthermore, these dual functionalized polymers bearing dithio-acetal groups are sensitive to reactive oxygen species (ROS), which compromises the host-guest properties of the assembly in response to this stimulus. The ROS responsive polymers reported here may have potential use in therapeutic delivery.

Also flagged:degradationRNA binding proteinslocalizationsynthesisgene expressionoligonucleotide
Journal Article 2018-11-14 No Snippets Kim SH, Vieira M, Shim JY, Choi H, Park HY.
Show Full Abstract

From biogenesis to degradation, mRNA goes through diverse types of regulation and interaction with other biomolecules. Uneven distribution of mRNA transcripts and the diverse isoforms and modifications of mRNA make us wonder how cells manage the complexity and keep the functional integrity for the normal development of cells and organisms. Single-molecule microscopy tools have expanded the scope of RNA research with unprecedented spatiotemporal resolution. In this review, we highlight the recent progress in the methods for labeling mRNA targets and analyzing the quantitative information from fluorescence images of single mRNA molecules. In particular, the MS2 system and its various applications are the main focus of this article. We also review how recent studies have addressed biological questions related to the significance of mRNA localization <i>in vivo</i>. Efforts to visualize the dynamics of single mRNA molecules in live cells will push forward our knowledge on the nature of heterogeneity in RNA sequence, structure, and distribution as well as their molecular function and coordinated interaction with RNA binding proteins.

Also flagged:Non-alcoholic fatty liver diseaseinflammatory bowel diseaseNAFLDliver steatosischronic liver diseasemetabolic syndrome
Journal Article 2018-11-14 ✓ 1 Snippet Adams LC, Lübbe F, Bressem K, Wagner M, Hamm B, Makowski MR.
In-Text Gene Mentions

…diseases, such ashemochromatosis, alpha-1-antitrypsin deficien…

Show Full Abstract

Non-alcoholic fatty liver disease (NAFLD) was shown to also occur in lean and underweight patients. So far, the prevalence of NAFLD in underweight individuals with and without inflammatory bowel disease (IBD) is insufficiently enlightened. In this cross-sectional age, gender and disease-matched case-control study, underweight patients (BMI<18.5 kg/m2) with inflammatory bowel disease (IBD), who underwent abdominal MRI at 1.5 T/3 T with fat-saturated fast-spin-echo imaging from 10/2005-07/2018 were analysed (control-to-case-ratio 1:1, n = 130). All patients were additionally investigated for duration, history of surgery, medical treatment, laboratory values, liver and spleen diameters. On MRI, liver fat was quantified by two observers based on the relative signal loss on T2-weighted fast spin-echo MR images with fat saturation compared to images without fat saturation. The prevalence of NAFLD/liver steatosis, defined as a measured intrahepatic fat content of at least 5%, was significantly higher in underweight IBD patients than in normal weight patients (87.6% versus 21.5%, p<0.001). Compared to the cases, the liver fat content of the controls was reduced by -0.19 units on average (-19%; 95%Cl: -0.20; -0.14). Similar results were obtained for the subgroup of non-IBD individuals (n = 12; -0.25 units on average (-25%); 95%Cl: -0.35; -0.14). Patients with extremely low body weight (BMI <17.5 kg/m2) showed the highest liver fat content (+0.15 units on average (+15%) compared to underweight patients with a BMI of 17.5-18.5 kg/m2 (p<0.05)). Furthermore, underweight patients showed slightly increased liver enzymes and liver diameters. There were no indications of significant differences in disease duration, type of medications or surgery between cases and controls and also, there were no significant differences between observers or field strengths (p>0.05). The prevalence of liver steatosis was higher among underweight IBD and non-IBD patients compared to normal weight controls. Also, underweight patients showed slightly increased liver enzymes and liver diameters, hinting at initial metabolic disturbances.

Also flagged:osteoarthritisironoverloadosteoarthritis ofHHliver cirrhosis
Journal Article 2018-11-14 ✓ 5 Snippets Oppl B, Husar-Memmer E, Pfefferkorn S, Blank M, Zenz P, Gollob E, Wurnig C, Engel A, Stadlmayr A, Uyanik G, Brozek W, Klaushofer K, Zwerina J, Datz C.
In-Text Gene Mentions

Our screening approach could not identify an increased prevalence of HFE gene mutations and iron overload in younger patients with severe osteoarthritis of the hip.

Other mutations such as the H63D mutation (histidine to aspartic acid) of the HFE gene can also be found frequently, but are usually clinically not relevant [3].

HFE hemochromatosishemochromatosis screening in…

…high frequency ofHFEgene mutations in…

…widespread screening forHFE hemochromatosishemochromatosis is not…

Show Full Abstract

<h4>Objective</h4>Despite the high frequency of HFE gene mutations in Western Europe, widespread screening for HFE hemochromatosis is not recommended due to its variable phenotype. Joint pain and a premature osteoarthritis-like disease including the hip joints are the most frequent manifestation in patients with HFE hemochromatosis and iron overload. Therefore, screening of patients with severe osteoarthritis of the hip could identify patients with HFE hemochromatosis.<h4>Methods</h4>In this prospective cross-sectional study, 940 patients aged <70 years with end-stage osteoarthritis of the hip undergoing elective joint replacement surgery were screened for HFE hemochromatosis and compared to age- and sex-matched controls.<h4>Results</h4>No greater prevalence of C282Y homozygosity mutation or elevated serum ferritin or transferrin saturation levels was found in the study cohort with severe osteoarthritis of the hip than in controls from the general population.<h4>Conclusion</h4>Our screening approach could not identify an increased prevalence of HFE gene mutations and iron overload in younger patients with severe osteoarthritis of the hip.

Also flagged:IronOsteoporosishereditary hemochromatosisHHbone formationbone resorption
Journal Article 2018-11-14 ✓ 5 Snippets Simão M, Camacho A, Ostertag A, Cohen-Solal M, Pinto IJ, Porto G, Hang Korng E, Cancela ML.
In-Text Gene Mentions

This appeared to result from an imbalance between bone formation and bone resorption driven by iron toxicity associated to Hfe-KO and confirmed by a decrease in bone microarchitecture parameters (identified by micro-CT) and osteoblast number.

To study the effects of dietary iron supplementation on bone metabolism and which molecular mechanisms could be involved on the onset and progression of OP phenotype, we have used an HH biological model for systemic iron overload, the Hfe-KO mouse [14], and evaluated its bone status when subjected to two different diets, standard (200 mg/Kg of Fe) and iron-enriched (200mg/Kg of Fe plus 1% iron carbonyl relatively to total ratio weight).

The main objective of this study was to investigate the role of dietary iron on osteoporosis, using as biological model the Hfe-KO mice, which have a systemic iron overload.

…biological model theHfe-KO mice, which have…

…both WT andHfe-KO mice.…

Show Full Abstract

Osteoporosis is associated with chronic iron overload secondary to hereditary hemochromatosis (HH), but the causative mechanisms are incompletely understood. The main objective of this study was to investigate the role of dietary iron on osteoporosis, using as biological model the Hfe-KO mice, which have a systemic iron overload. We showed that these mice show an increased susceptibility for developing a bone loss phenotype compared to WT mice, which can be exacerbated by an iron rich diet. The dietary iron overload caused an increase in inflammation and iron incorporation within the trabecular bone in both WT and Hfe-KO mice. However, the osteoporotic phenotype was only evident in Hfe-KO mice fed the iron-enriched diet. This appeared to result from an imbalance between bone formation and bone resorption driven by iron toxicity associated to Hfe-KO and confirmed by a decrease in bone microarchitecture parameters (identified by micro-CT) and osteoblast number. These findings were supported by the observed downregulation of bone metabolism markers and upregulation of ferritin heavy polypeptide 1 (Fth1) and transferrin receptor-1 (Tfrc), which are associated with iron toxicity and bone loss phenotype. In WT mice the iron rich diet was not enough to promote a bone loss phenotype, essentially due to the concomitant depression of bone resorption observed in those animals. In conclusion the dietary challenge influences the development of osteoporosis in the HH mice model thus suggesting that the iron content in the diet may influence the osteoporotic phenotype in systemic iron overload conditions.

Also flagged:chromosomechromosomeslocalizationmitochondrialcolchicineglycerol
Journal Article 2018-11-14 No Snippets García-Angulo A, Merlo MA, Portela-Bens S, Rodríguez ME, García E, Al-Rikabi A, Liehr T, Rebordinos L.
Show Full Abstract

<h4>Background</h4>Solea senegalensis (Kaup, 1858) is a commercially important flatfish species, belonging to the Pleuronectiformes order. The taxonomy of this group has long been controversial, and the karyotype of the order presents a high degree of variability in diploid number, derived from chromosomal rearrangements such as Robertsonian fusions. Previously it has been proposed that the large metacentric chromosome of S. senegalensis arises from this kind of chromosome rearrangement and that this is a proto-sex chromosome.<h4>Results</h4>In this work, the Robertsonian origin of the large metacentric chromosome of S. senegalensis has been tested by the Zoo-FISH technique applied to two species of the Soleidae family (Dicologlossa cuneata and Dagetichthys lusitanica), and by comparative genome analysis with Cynoglossus semilaevis. From the karyotypic analysis we were able to determine a chromosome complement comprising 2n = 50 (FN = 54) in D. cuneata and 2n = 42 (FN = 50) in D. lusitanica. The large metacentric painting probe gave consistent signals in four acrocentric chromosomes of the two Soleidae species; and the genome analysis proved a common origin with four chromosome pairs of C. semilaevis. As a result of the genomic analysis, up to 61 genes were annotated within the thirteen Bacterial Artificial Chromosome clones analysed.<h4>Conclusions</h4>These results confirm that the large metacentric chromosome of S. senegalensis originated from a Robertsonian fusion and provide new data about the chromosome evolution of S. senegalensis in particular, and of Pleuronectiformes in general.

Also flagged:Gene expressionoxygenglucosemetabolismextracellular matrixangiogenesis
Journal Article 2018-11-14 No Snippets Miyamoto-Mikami E, Tsuji K, Horii N, Hasegawa N, Fujie S, Homma T, Uchida M, Hamaoka T, Kanehisa H, Tabata I, Iemitsu M.
Show Full Abstract

High-intensity intermittent exercise training (HIIT) has been proposed as an effective approach for improving both, the aerobic and anaerobic exercise capacity. However, the detailed molecular response of the skeletal muscle to HIIT remains unknown. We examined the effects of the HIIT on the global gene expression in the human skeletal muscle. Eleven young healthy men participated in the study and completed a 6-week HIIT program involving exhaustive 6-7 sets of 20-s cycling periods with 10-s rests. In addition to determining the maximal oxygen uptake ([Formula: see text]), maximal accumulated oxygen deficit, and thigh muscle cross-sectional area (CSA), muscle biopsy samples were obtained from the vastus lateralis before and after the training to analyse the skeletal muscle transcriptome. The HIIT program significantly increased the [Formula: see text], maximal accumulated oxygen deficit, and thigh muscle CSA. The expression of 79 genes was significantly elevated (fold-change >1.2), and that of 73 genes was significantly reduced (fold-change <0.8) after HIIT. Gene ontology analysis of the up-regulated genes revealed that the significantly enriched categories were "glucose metabolism", "extracellular matrix", "angiogenesis", and "mitochondrial membrane". By providing information about a set of genes in the human skeletal muscle that responds to the HIIT, the study provided insight into the mechanism of skeletal muscle adaptation to HIIT.

Also flagged:Cancerhemostasistumorplatelet activationprimary tumorplatelet aggregation
Journal Article 2018-11-14 ✓ 1 Snippet Plantureux L, Mège D, Crescence L, Dignat-George F, Dubois C, Panicot-Dubois L.
In-Text Gene Mentions

Recently, Luo et al. evaluated the differential expression of LncRNA, including MAGI2 antisense RNA (MAGI2-AS3) and ZNFX1 antisense RNA1 (ZFAS1), in platelets from healthy individuals and NSCLC patients.

Show Full Abstract

Platelets are small anucleate cells that are traditionally described as the major effectors of hemostasis and thrombosis. However, increasing evidence indicates that platelets play several roles in the progression of malignancies and in cancer-associated thrombosis. A notable cross-communication exists between platelets and cancer cells. On one hand, cancer can "educate" platelets, influencing their RNA profiles, the numbers of circulating platelets and their activation states. On the other hand, tumor-educated platelets contain a plethora of active biomolecules, including platelet-specific and circulating ingested biomolecules, that are released upon platelet activation and participate in the progression of malignancy. The numerous mechanisms by which the primary tumor induces the production, activation and aggregation of platelets (also known as tumor cell induced platelet aggregation, or TCIPA) are directly related to the pro-thrombotic state of cancer patients. Moreover, the activation of platelets is critical for tumor growth and successful metastatic outbreak. The development or use of existing drugs targeting the activation of platelets, adhesive proteins responsible for cancer cell-platelet interactions and platelet agonists should be used to reduce cancer-associated thrombosis and tumor progression.

Also flagged:Gene ExpressionemphysemaCOPDGPR65GNB4P2RY13
Journal Article 2018-11-14 No Snippets Hu WP, Zeng YY, Zuo YH, Zhang J.
Show Full Abstract

<h4>Purpose</h4>By reanalyzing the gene expression profile GSE76925 in the Gene Expression Omnibus database using bioinformatic methods, we attempted to identify novel candidate genes promoting the development of emphysema in patients with COPD.<h4>Patients and methods</h4>According to the Quantitative CT data in GSE76925, patients were divided into mild emphysema group (%LAA-950<20%, n=12) and severe emphysema group (%LAA-950>50%, n=11). Differentially expressed genes (DEGs) were identified using Agilent GeneSpring GX v11.5 (corrected <i>P</i>-value <0.05 and |Fold Change|>1.3). Known driver genes of COPD were acquired by mining literatures and retrieving databases. Direct protein-protein interaction network (PPi) of DEGs and known driver genes was constructed by STRING.org to screen the DEGs directly interacting with driver genes. In addition, we used STRING.org to obtain the first-layer proteins interacting with DEGs' products and constructed the indirect PPi of these interaction proteins. By merging the indirect PPi with driver genes' PPi using Cytoscape v3.6.1, we attempted to discover potential pathways promoting emphysema's development.<h4>Results</h4>All the patients had COPD with severe airflow limitation (age=62±8, FEV<sub>1</sub>%=28±12). A total of 57 DEGs (including 12 pseudogenes) and 135 known driving genes were identified. Direct PPi suggested that GPR65, GNB4, P2RY13, NPSR1, BCR, BAG4, and IMPDH2 were potential pathogenic genes. GPR65 could regulate the response of immune cells to the acidic microenvironment, and NPSR1's expression on eosinophils was associated with asthma's severity and IgE level. Indirect merging PPi demonstrated that the interacting network of TP53, IL8, CCR2, HSPA1A, ELANE, PIK3CA was associated with the development of emphysema. IL8, ELANE, and PIK3CA were molecules involved in the pathological mechanisms of emphysema, which also in return proved the role of TP53 in emphysema.<h4>Conclusion</h4>Candidate genes such as GPR65, NPSR1, and TP53 may be involved in the progression of emphysema.

Also flagged:mitochondriaepilepsyHuntington's diseaseHDmitochondrialDRP1
Journal Article 2018-11-14 No Snippets Huang NK, Lin CC, Lin YL, Huang CL, Chiou CT, Lee YC, Lee SY, Huang HT, Yang YC.
Show Full Abstract

<h4>Background</h4>According to Compendium of Materia Medica, Gastrodia elata (GE) Blume as a top grade and frequently prescribed herbal medicine has been used in treating dizziness, headaches, and epilepsy, indicating a neuroprotective effect. Because GE is capable of suppressing a hyperactive liver and thus calming endogenous wind, and because Huntington's disease (HD) can be classified as a phenomenon of disturbed liver wind, it is suggested that GE might be beneficial in treating HD. However, although current studies support GE for the prevention of diverse neurodegenerations such as HD, its detailed mechanisms remain elusive.<h4>Purpose</h4>To investigate the molecular mechanism of GE in preventing HD by focusing on mitochondrial morphology, which is highly associated with HD etiology and thus proposed as a therapeutic target of neurodegenerations.<h4>Study design/methods</h4>The overexpression of the mutant huntingtin (mHTT) gene in rat pheochromocytoma (PC12) cells was used as an in vitro cell model of HD. A filter retardation assay was applied to measure protein aggregations during HTT expression. Cotransfection with mitochondrial fusion and fission genes was used to test their relationships with HTT aggregates by monitoring with a confocal laser scanning microscope and filter retardation assay. Western blot analysis was used to estimate protein expression under different drug treatments or cotransfections with other related genes.<h4>Results</h4>The overexpression of mutant but not normal HTT genes significantly resulted in protein aggregations in PC12 cells. GE dose-dependently attenuated mHTT-induced protein aggregations and free radical formations. GE significantly reversed mHTT-induced mitochondrial fragmentation and dysregulation of mitochondrial fusion and fission molecules. The overexpression of mitochondrial fusion genes attenuated mHTT-induced protein aggregations. Further, Mdivi-1, a DRP1 fission molecule inhibitor, significantly reversed mHTT-induced protein aggregations and mitochondrial fragmentation.<h4>Conclusion</h4>GE attenuated mHTT aggregations through the control of mitochondrial fusion and the fission pathway.

Also flagged:ADAM10ChondrogenesisossificationNotch1SOX9A disintegrin and metalloprotease
Journal Article 2018-11-14 ✓ 1 Snippet Fu R, Wang X, Xia L, Tan Y, Liu J, Yuan L, Yang Z, Fang B.
In-Text Gene Mentions

…with SOX5 andSOX6.…

Show Full Abstract

The cranial base is the foundation of the craniofacial structure, and any interruption of the cranial base can lead to facial deformity. The cranial base develops from two synchondroses <i>via</i> endochondral ossification. Chondrogenesis is an important step in endochondral ossification. A disintegrin and metalloprotease (ADAM) 10 participates in the Notch1 signalling pathway, which has been reported to regulate chondrogenesis <i>via</i> a SOX9-dependent mechanism. However, little is known about the function of ADAM10 in chondrogenesis. In this study, adam10-conditional-knockout (cKO) mice exhibited sharper naso-labial angles and flatter skulls than wild-type (WT) mice. In the sagittal plane, SOX9 was more widespread in the cranial base in Adam10-cKO mice than in WT mice. For <i>in vitro</i> experiments, we used the ATDC5 cell line as a model to investigate the role of ADAM10 in chondrogenesis. Plasmid 129 was designed to decrease the expression of Adam10; the resulting downregulation of Adam10 reduced the production of N1ICD. Plasmid 129 increased the expression of SOX9 under chondrogenic induction, and this increase could be inhibited by transfection with exogenous N1ICD. Collectively, these results show that ADAM10 participates in chondrogenesis by negatively regulating SOX9 expression in an N1ICD-dependent manner during cranial base development.

Also flagged:isocitrate dehydrogenasegliomatumorIDHlowerTERT
Journal Article 2018-11-13 No Snippets Vuong HG, Tran TTK, Ngo HTT, Pham TQ, Nakazawa T, Fung KM, Hassell L, Katoh R, Kondo T.
Show Full Abstract

The clinical outcomes of isocitrate dehydrogenase-wild-type (IDH-wt) lower-grade glioma (LGG) have been the subject of debate for some time. In this meta-analysis, we aimed to assess the prognostic values of several known genetic markers (e.g. TERT promoter mutation, H3F3A mutation, CDKN2A loss) in this tumor group. Four electronic databases, including PubMed, Scopus, Web of Science and Virtual Health Library, were searched for relevant articles. Pooled hazard ratio (HR) and corresponding 95% confidence interval (CI) for overall survival were calculated using a random-effect model weighted by an inverse variance method. A total of 11 studies were finally selected from 2274 articles for meta-analyses. Several genetic alterations were demonstrated to have a negative impact on prognosis of IDH-wt LGGs, specifically TERT promoter mutation (HR, 1.96; 95% CI, 1.42-2.70), H3F3A mutation (HR, 3.21; 95% CI, 1.86-5.55) and EGFR amplification (HR, 1.67; 95% CI, 1.02-2.74). However, CDKN loss, ATRX mutation and coexisting gain of chromosome 7/loss of chromosome 10 showed no clinical significance in this glioma entity. Our study results demonstrated that IDH-wt LGGs are heterogeneous in clinical outcome and not all tumors have a poor prognosis. The presence of TERT promoter mutation, H3F3A mutation and EGFR amplification showed negative prognostic impacts in this tumor entity. These genetic events can be used to better stratify patient outcomes.

Also flagged:PSMD12neurodevelopmental disorderubiquitinproteasomeneurological disordersneurodevelopmental disorders
Journal Article 2018-11-13 No Snippets Khalil R, Kenny C, Hill RS, Mochida GH, Nasir R, Partlow JN, Barry BJ, Al-Saffar M, Egan C, Stevens CR, Gabriel SB, Barkovich AJ, Ellison JW, Al-Gazali L, Walsh CA, Chahrour MH.
Show Full Abstract

Protein homeostasis is tightly regulated by the ubiquitin proteasome pathway. Disruption of this pathway gives rise to a host of neurological disorders. Through whole exome sequencing (WES) in families with neurodevelopmental disorders, we identified mutations in PSMD12, a core component of the proteasome, underlying a neurodevelopmental disorder with intellectual disability (ID) and features of autism spectrum disorder (ASD). We performed WES on six affected siblings from a multiplex family with ID and autistic features, the affected father, and two unaffected mothers, and a trio from a simplex family with one affected child with ID and periventricular nodular heterotopia. We identified an inherited heterozygous nonsense mutation in PSMD12 (NM_002816: c.367C>T: p.R123X) in the multiplex family and a de novo nonsense mutation in the same gene (NM_002816: c.601C>T: p.R201X) in the simplex family. PSMD12 encodes a non-ATPase regulatory subunit of the 26S proteasome. We confirm the association of PSMD12 with ID, present the first cases of inherited PSMD12 mutation, and demonstrate the heterogeneity of phenotypes associated with PSMD12 mutations.

Also flagged:caspaseHuntington diseaseHDneurodegenerative diseasepolyglutaminedeath
Journal Article 2018-11-13 ✓ 1 Snippet Martin DDO, Schmidt ME, Nguyen YT, Lazic N, Hayden MR.
In-Text Gene Mentions

In particular, we have previously shown that caspase cleavage of mutant HTT at amino acid position aspartate 586 (D586) by caspase-6 is critical for the pathogenesis of the disease in an HD mouse model.

Show Full Abstract

Huntington disease (HD) is a progressive neurodegenerative disease that initially affects the striatum and leads to changes in behavior and loss of motor coordination. It is caused by an expansion in the polyglutamine repeat at the N terminus of huntingtin (HTT) that leads to aggregation of mutant HTT. The loss of wild-type function, in combination with the toxic gain of function mutation, initiates various cell death pathways. Wild-type and mutant HTT are regulated by different posttranslational modifications that can positively or negatively regulate their function or toxicity. In particular, we have previously shown that caspase cleavage of mutant HTT at amino acid position aspartate 586 (D586) by caspase-6 is critical for the pathogenesis of the disease in an HD mouse model. Herein, we describe the identification of a new caspase cleavage site at position D572 that is mediated by caspase-1. Inhibition of caspase-1 also appeared to decrease proteolysis at D586, likely by blocking the downstream activation of caspase-6 through caspase-1. Inhibition of caspase cleavage at D572 significantly decreased mutant HTT aggregation and significantly increased the turnover of soluble mutant HTT. This suggests that caspase-1 may be a viable target to inhibit caspase cleavage of mutant HTT at both D572 and D586 to promote mutant HTT clearance.-Martin, D. D. O., Schmidt, M. E., Nguyen, Y. T., Lazic, N., Hayden, M. R. Identification of a novel caspase cleavage site in huntingtin that regulates mutant huntingtin clearance.

Also flagged:HyperglycemiamembraneDMT1PKCαirondiabetes
Journal Article 2018-11-13 ✓ 1 Snippet Zhao L, Bartnikas T, Chu X, Klein J, Yun C, Srinivasan S, He P.
In-Text Gene Mentions

Hfe

Show Full Abstract

Excessive iron increases the incidence of diabetes and worsens diabetic complications. Reciprocally, diabetes induces iron loading, partially attributable to elevated intestinal iron export according to a recent report. Herein, we show that iron uptake and the mRNA expression of iron importer divalent metal transporter 1 (DMT1) were significantly increased in the duodenum of streptozotocin-induced diabetic mice. Immunofluorescence staining of human intestinal biopsies revealed increased brush border membrane (BBM) and decreased cytoplasmic DMT1 expression in patients with diabetes, suggesting translocation of DMT1. This pattern of DMT1 regulation was corroborated by immunoblotting results in diabetic mice showing that BBM DMT1 expression was increased by 210%, in contrast to a 60% increase in total DMT1. PKC mediates many diabetic complications, and PKCα activity was increased in diabetic mouse intestine. Intriguingly, diabetic mice with PKCα deficiency did not show increases in iron uptake and BBM DMT1 expression. High-glucose treatment increased plasma membrane DMT1 expression via the activation of PKCα in cultured IECs. Inhibition of PKCα potentiated the ubiquitination and degradation of DMT1 protein. We further showed that high glucose suppressed membrane DMT1 internalization. These findings demonstrate that PKCα promotes microvillus membrane DMT1 expression and intestinal iron uptake, contributing to diabetic iron loading.-Zhao, L., Bartnikas, T., Chu, X., Klein, J., Yun, C., Srinivasan, S., He, P. Hyperglycemia promotes microvillus membrane expression of DMT1 in intestinal epithelial cells in a PKCα-dependent manner.

Also flagged:Biosynthesisnanoclusterssynthesispolyphenolsmethotrexatedoxorubicin
Journal Article 2018-11-13 No Snippets Wu S, Yang X, Luo F, Wu T, Xu P, Zou M, Yan J.
Show Full Abstract

<h4>Background</h4>In the last decade, the biosynthesis of metal nanoparticles using organisms have received more and more considerations. However, the complex composition of organisms adds up to a great barrier for the characterization of biomolecules involved in the synthesis process and their biological mechanisms.<h4>Results</h4>In this research, we biosynthesized a kind of flower-shaped Au nanoclusters (Au NCs) using one definite component-epigallocatechin gallate (EGCG), which was the main biomolecules of green tea polyphenols. Possessing good stability for 6 weeks and a size of 50 nm, the Au NCs might be a successful candidate for drug delivery. Hence, both methotrexate (MTX) and doxorubicin (DOX) were conjugated to the Au NCs through a bridge of cysteine (Cys). The introduction of MTX provided good targeting property for the Au NCs, and the conjugation of DOX provided good synergistic effect. Then, a novel kind of dual-drug loaded, tumor-targeted and highly efficient drug delivery system (Au-Cys-MTX/DOX NCs) for combination therapy was successfully prepared. The TEM of HeLa cells incubated with Au-Cys-MTX/DOX NCs indicated that the Au-Cys-MTX/DOX NCs could indeed enter and kill cancer cells. The Au-Cys-MTX/DOX NCs also possessed good targeting effect to the FA-receptors-overpressed cancer cells both in vitro and in vivo. Importantly, the Au-Cys-MTX/DOX NCs resulted in an excellent anticancer activity in vivo with negligible side effects.<h4>Conclusions</h4>These results suggest that the biosynthesized Au-Cys-MTX/DOX NCs could be a potential carrier with highly efficient anticancer properties for tumor-targeted drug delivery.

Also flagged:PlGFPlacental growth factorPGFvascular endothelial growth factorVEGFangiogenesis
Journal Article 2018-11-13 ✓ 5 Snippets Saddala MS, Lennikov A, Grab DJ, Liu GS, Tang S, Huang H.
In-Text Gene Mentions

…neural protection pathways,Prdx6and Map2 respectively,…

…of Gnb1, Gnb2,Prdx6and Map2 proteins…

…lass protein Peroxiredoxin-6 (Prdx6) is expressed in…

…barrier function expressPrdx6.…

…Further, decreasedPrdx6has been reported…

Show Full Abstract

Placental growth factor (PlGF or PGF), a member of the vascular endothelial growth factor (VEGF) sub-family, plays a crucial role in pathological angiogenesis and inflammation. However, the underlying molecular mechanisms that PlGF mediates regarding the complications of non-proliferative diabetic retinopathy (DR) remain elusive. Using an LC-MS/MS-based label-free quantification proteomic approach we characterized the alterations in protein expression caused by PlGF ablation in the retinas obtained from C57BL6, Akita, PlGF<sup>-/-</sup> and Akita.PlGF<sup>-/-</sup> mice. After extraction and enzymatic digestion with Trypsin/LysC, the retinal proteins were analyzed by Q-Exactive hybrid Quadrupole-Orbitrap mass spectrometry. Differentially expressed proteins (DEPs) were identified in four comparisons based on Z-score normalization and reproducibility by Pearson's correlation coefficient. The gene ontology (GO), functional pathways, and protein-protein network interaction analysis suggested that several proteins involved in insulin resistance pathways (Gnb1, Gnb2, Gnb4, Gnai2, Gnao1, Snap2, and Gngt1) were significantly down-regulated in PlGF ablated Akita diabetic mice (Akita.PlGF<sup>-/-</sup> vs. Akita) but up-regulated in Akita vs. C57 and PlGF<sup>-/-</sup> vs. C57 conditions. Two proteins involved in the antioxidant activity and neural protection pathways, Prdx6 and Map2 respectively, were up-regulated in the Akita.PlGF<sup>-/-</sup> vs. Akita condition. Overall, we predict that down-regulation of proteins essential for insulin resistance, together with the up-regulation of antioxidant and neuroprotection proteins highlight and epitomize the potential mechanisms important for future anti-PlGF therapies in the treatment of DR.

Also flagged:autoantibodiestumor-associated antigensp53NY-ESO-1MMP-7Hsp70
Journal Article 2018-11-13 ✓ 5 Snippets Xu YW, Chen H, Guo HP, Yang SH, Luo YH, Liu CT, Huang XY, Tang XM, Hong CQ, Li EM, Xu LY, Peng YH.
In-Text Gene Mentions

Our previous studies demonstrated that different restricted combinations in early stage ESCC and nasopharyngeal carcinoma, autoantibodies against p53, NY-ESO-1, PRDX6 and Hsp70, and autoantibodies against p53, NY-ESO-1, Bmi-1 and Hsp70, respectively, kept high sensitivity and specificity in detecting corresponding tumor samples [13, 14].

We previously found that autoantibodies against a panel of six tumor-associated antigens (p53, NY-ESO-1, MMP-7, Hsp70, PRDX6 and Bmi-1) may aid in early detection of esophageal squamous cell carcinoma.

Higher expression of p53, NY-ESO-1, MMP-7, Hsp70, PRDX6, and Bmi-1 proteins was observed in 7, 8, 7, 8, 6 and 8 of the 10 tumor tissue samples, respectively, compared to individual TAAs (0, 0, 1, 2, 1 and 1, respectively) in corresponding adjacent non-tumor tissues.

The expressions of p53, NY-ESO-1, MMP-7, Hsp70, PRDX6, and Bmi-1 in tumor cell were detected by immunohistochemistry in 10 tissue samples with EJA and paired adjacent non-tumor tissue samples.

…NY-ESO-1, MMP-7, Hsp70,PRDX6and Bmi-1) may…

Show Full Abstract

<h4>Background</h4>We previously found that autoantibodies against a panel of six tumor-associated antigens (p53, NY-ESO-1, MMP-7, Hsp70, PRDX6 and Bmi-1) may aid in early detection of esophageal squamous cell carcinoma. Here we aimed to evaluate the diagnostic value of this autoantibody panel in esophagogastric junction adenocarcinoma (EJA) patients.<h4>Methods</h4>Serum autoantibody levels were measured by enzyme-linked immunosorbent assay in a training cohort and a validation cohort. We used receiver-operating characteristics (ROC) to calculate diagnostic accuracy.<h4>Results</h4>We recruited 169 normal controls and 122 EJA patients to the training cohort, and 80 normal controls and 70 EJA patients to the validation cohort. Detection of the autoantibody panel demonstrated an area under the curve (AUC) of 0.818, sensitivity 59.0% and specificity 90.5% in training cohort, and AUC 0.815, sensitivity 61.4% and specificity 90.0% in validation cohort in the diagnosis of EJA. Measurement of the autoantibody panel could distinguish early stage EJA patients from normal controls (AUC 0.786 and 0.786, sensitivity 50.0% and 56.0%, and specificity 90.5% and 90.0%, for training and validation cohorts, respectively). Moreover, a restricted panel consisting of autoantibodies against p53, NY-ESO-1 and Bmi-1 exhibited similar diagnostic performance for EJA (AUC 0.814 and 0.823, sensitivity 53.5% and 60.0%, and specificity 90.5% and 93.7%, for training and validation cohorts, respectively) and early stage EJA (AUC 0.744 and 0.773, sensitivity 55.6% and 52.0%, and specificity 90.5% and 93.7%, for training and validation cohorts, respectively).<h4>Conclusions</h4>Autoantibodies against an optimized TAA panel as serum biomarkers appear to help identify the present of early stage EJA.

Also flagged:Methylmalonyl-CoA MutaseMethylmalonic acidemiaserrors ofmetabolismMUTmethylmalonyl
Journal Article 2018-11-13 ✓ 4 Snippets Costanzo M, Cevenini A, Marchese E, Imperlini E, Raia M, Del Vecchio L, Caterino M, Ruoppolo M.
In-Text Gene Mentions

…( P30041 ,PRDX6, Rsc = −3.68,…

…Moreover,PRDX6is involved in…

…ThePRDX6down-regulation could affect…

…was reported thatPRDX6is involved in…

Show Full Abstract

Methylmalonic acidemias (MMAs) are inborn errors of metabolism due to the deficient activity of methylmalonyl-CoA mutase (MUT). MUT catalyzes the formation of succinyl-CoA from methylmalonyl-CoA, produced from propionyl-CoA catabolism and derived from odd chain fatty acids β-oxidation, cholesterol, and branched-chain amino acids degradation. Increased methylmalonyl-CoA levels allow for the presymptomatic diagnosis of the disease, even though no approved therapies exist. MMA patients show hyperammonemia, ketoacidosis, lethargy, respiratory distress, cognitive impairment, and hepatomegaly. The long-term consequences concern neurologic damage and terminal kidney failure, with little chance of survival. The cellular pathways affected by MUT deficiency were investigated using a quantitative proteomics approach on a cellular model of MUT knockdown. Currently, a consistent reduction of the MUT protein expression was obtained in the neuroblastoma cell line (SH-SY5Y) by using small-interfering RNA (siRNA) directed against an MUT transcript (MUT siRNA). The MUT absence did not affect the cell viability and apoptotic process in SH-SY5Y. In the present study, we evaluate and quantify the alterations in the protein expression profile as a consequence of MUT-silencing by a mass spectrometry-based label-free quantitative analysis, using two different quantitative strategies. Both quantitative methods allowed us to observe that the expression of the proteins involved in mitochondrial oxido-reductive homeostasis balance was affected by MUT deficiency. The alterated functional mitochondrial activity was observed in siRNA_MUT cells cultured with a propionate-supplemented medium. Finally, alterations in the levels of proteins involved in the metabolic pathways, like carbohydrate metabolism and lipid metabolism, were found.

Also flagged:Serotonin 5-HT4 Receptorserotonin receptordepressionanxietyobesityanorexia
Journal Article 2018-11-13 ✓ 1 Snippet Rebholz H, Friedman E, Castello J.
In-Text Gene Mentions

It is not surprising that genetic alteration of the serotonin transporter gene (5-HTT) has implications in mood disorders: For example, mice overexpressing SERT (OE) or with SERT depletion (KO) present anxiolytic-like or more anxious behaviors, respectively, when compared to WT littermates [121,122].

Show Full Abstract

The serotonin 4 receptor, 5-HT₄R, represents one of seven different serotonin receptor families and is implicated in a variety of physiological functions and their pathophysiological variants, such as mood and depression or anxiety, food intake and obesity or anorexia, or memory and memory loss in Alzheimer's disease. Its central nervous system expression pattern in the forebrain, in particular in caudate putamen, the hippocampus and to lesser extent in the cortex, predispose it for a role in executive function and reward-related actions. In rodents, regional overexpression or knockdown in the prefrontal cortex or the nucleus accumbens of 5-HT₄R was shown to impact mood and depression-like phenotypes, food intake and hypophagia; however, whether expression changes are causally involved in the etiology of such disorders is not clear. In this context, more data are emerging, especially based on PET technology and the use of ligand tracers that demonstrate altered 5-HT₄R expression in brain disorders in humans, confirming data stemming from post-mortem tissue and preclinical animal models. In this review, we would like to present the current knowledge of 5-HT₄R expression in brain regions relevant to mood/depression, reward and executive function with a focus on 5-HT₄R expression changes in brain disorders or caused by drug treatment, at both the transcript and protein levels.

Also flagged:atherosclerosisdeathlipidimmuneischemic strokemyocardial infarction
Journal Article 2018-11-13 No Snippets Xu S, Kamato D, Little PJ, Nakagawa S, Pelisek J, Jin ZG.
Show Full Abstract

Atherosclerosis, the principal cause of cardiovascular death worldwide, is a pathological disease characterized by fibro-proliferation, chronic inflammation, lipid accumulation, and immune disorder in the vessel wall. As the atheromatous plaques develop into advanced stage, the vulnerable plaques are prone to rupture, which causes acute cardiovascular events, including ischemic stroke and myocardial infarction. Emerging evidence has suggested that atherosclerosis is also an epigenetic disease with the interplay of multiple epigenetic mechanisms. The epigenetic basis of atherosclerosis has transformed our knowledge of epigenetics from an important biological phenomenon to a burgeoning field in cardiovascular research. Here, we provide a systematic and up-to-date overview of the current knowledge of three distinct but interrelated epigenetic processes (including DNA methylation, histone methylation/acetylation, and non-coding RNAs), in atherosclerotic plaque development and instability. Mechanistic and conceptual advances in understanding the biological roles of various epigenetic modifiers in regulating gene expression and functions of endothelial cells (vascular homeostasis, leukocyte adhesion, endothelial-mesenchymal transition, angiogenesis, and mechanotransduction), smooth muscle cells (proliferation, migration, inflammation, hypertrophy, and phenotypic switch), and macrophages (differentiation, inflammation, foam cell formation, and polarization) are discussed. The inherently dynamic nature and reversibility of epigenetic regulation, enables the possibility of epigenetic therapy by targeting epigenetic "writers", "readers", and "erasers". Several Food Drug Administration-approved small-molecule epigenetic drugs show promise in pre-clinical studies for the treatment of atherosclerosis. Finally, we discuss potential therapeutic implications and challenges for future research involving cardiovascular epigenetics, with an aim to provide a translational perspective for identifying novel biomarkers of atherosclerosis, and transforming precision cardiovascular research and disease therapy in modern era of epigenetics.

Also flagged:NUPR1agingphospholipidlipidcarbonylmetabolism
Journal Article 2018-11-13 ✓ 3 Snippets Narzt MS, Nagelreiter IM, Oskolkova O, Bochkov VN, Latreille J, Fedorova M, Ni Z, Sialana FJ, Lubec G, Filzwieser M, Laggner M, Bilban M, Mildner M, Tschachler E, Grillari J, Gruber F.
In-Text Gene Mentions

…Indeed, withPRDX6and glutathione peroxidases,…

…could recently associatePRDX6expression with epidermal…

…note, peroxiredoxin 6 (PRDX6) which has lipid…

Show Full Abstract

Ultraviolet light is the dominant environmental oxidative skin stressor and a major skin aging factor. We studied which oxidized phospholipid (OxPL) mediators would be generated in primary human keratinocytes (KC) upon exposure to ultraviolet A light (UVA) and investigated the contribution of OxPL to UVA responses. Mass spectrometric analysis immediately or 24 h post UV stress revealed significant changes in abundance of 173 and 84 lipid species, respectively. We identified known and novel lipid species including known bioactive and also potentially reactive carbonyl containing species. We found indication for selective metabolism and degradation of selected reactive lipids. Exposure to both UVA and to in vitro UVA - oxidized phospholipids activated, on transcriptome and proteome level, NRF2/antioxidant response signaling, lipid metabolizing enzyme expression and unfolded protein response (UPR) signaling. We identified NUPR1 as an upstream regulator of UVA/OxPL transcriptional stress responses and found this protein to be expressed in the epidermis. Silencing of NUPR1 resulted in augmented expression of antioxidant and lipid detoxification genes and disturbed the cell cycle, making it a potential key factor in skin reactive oxygen species (ROS) responses intimately involved in aging and pathology.

Also flagged:connective tissue disorderpathogenesisFBN1Marfan syndromedissectionfibrillin-1
Journal Article 2018-11-13 ✓ 1 Snippet Pu Z, Sun H, Du J, Cheng Y, He K, Ni B, Gu W, Dai J, Shao Y.
In-Text Gene Mentions

…the pathogenesis oftype 1 fibrillinopathies1 fibrillinopathies but…

Show Full Abstract

<h4>Background</h4>Marfan syndrome (MFS) is an inherited connective tissue disorder affecting the ocular, skeletal and cardiovascular systems. Previous studies of MFS have demonstrated the association between genetic defects and clinical manifestations. Our purpose was to investigate the role of novel genetic variants in determining MFS clinical phenotypes.<h4>Methods</h4>We sequenced the whole exome of 19 individuals derived from three Han Chinese families. The sequencing data were analyzed by a standard pipeline. Variants were further filtered against the public database and an in-house database. Then, we performed pedigree analysis under different inheritance patterns according to American College of Medical Genetics guidelines. Results were confirmed by Sanger sequencing.<h4>Results</h4>Two novel loss-of-function indels (c.5027_5028insTGTCCTCC, p.D1677Vfs*8; c.5856delG, p.S1953Lfs*27) and one nonsense variant (c.8034C>A, p.Y2678*) of <i>FBN1</i> were identified in Family 1, Family 2 and Family 3, respectively. All affected members carried pathogenic mutations, whereas other unaffected family members or control individuals did not. These different kinds of loss of function (LOF) variants of <i>FBN1</i> were located in the cbEGF region and a conserved domain across species and were not reported previously.<h4>Conclusions</h4>Our study extended and strengthened the vital role of <i>FBN1</i> LOF mutations in the pathogenesis of MFS with an autosomal dominant inheritance pattern. We confirm that genetic testing by next-generation sequencing of blood DNA can be fundamental in helping clinicians conduct mutation-based pre- and postnatal screening, genetic diagnosis and clinical management for MFS.

Also flagged:GSA
Journal Article 2018-11-13 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:cell migrationstyrosine hydroxylaseTHaxonsnucleusOtx2
Journal Article 2018-11-13 ✓ 5 Snippets García-Peña CM, Ávila-González D, Miquelajáuregui A, Lozano-Flores C, Mastick GS, Tamariz E, Varela-Echavarría A.
In-Text Gene Mentions

…by interfering withDCCfunction.…

…the netrin receptorDCC(Xu et al.,…

…the LC involving Netrin/DCCsignaling (Shi et…

DCCmutant mice maintained…

DCCgenotyping was performed…

Show Full Abstract

Stereotypic cell migrations in the developing brain are fundamental for the proper patterning of brain regions and formation of neural networks. In this work, we uncovered in the developing rat, a population of neurons expressing tyrosine hydroxylase (TH) that migrates posteriorly from the alar plate of the midbrain, in neurophilic interaction with axons of the mesencephalic nucleus of the trigeminal nerve. A fraction of this population was also shown to traverse the mid-hindbrain boundary, reaching the vicinity of the locus coeruleus (LC) in rhombomere 1 (r1). This migratory population, however, does not have a noradrenergic (NA) phenotype and, in keeping with its midbrain origin, expresses Otx2 which is down regulated upon migration into the hindbrain. The interaction with the trigeminal mesencephalic axons is necessary for the arrangement and distribution of migratory cells as these aspects are dramatically altered in whole embryo cultures upon disruption of trigeminal axon projection by interfering with DCC function. Moreover, in mouse embryos in an equivalent developmental stage, we detected a cell population that also migrates caudally within the midbrain apposed to mesencephalic trigeminal axons but that does not express TH; a fraction of this population expresses calbindin instead. Overall, our work identified TH-expressing neurons from the rat midbrain alar plate that migrate tangentially over long distances within the midbrain and into the hindbrain by means of a close interaction with trigeminal mesencephalic axons. A different migratory population in this region and also in mouse embryos revealed diversity among the cells that follow this descending migratory pathway.

Also flagged:Gene ExpressionHippocampusPremenstrual Dysphoric Disordercapsulepathogenesisfluoxetine
Journal Article 2018-11-13 No Snippets Wei S, Sun P, Guo Y, Chen J, Wang J, Song C, Li Z, Xue L, Qiao M.
Show Full Abstract

<b>Objective:</b> To explore the targets, signal regulatory networks and mechanisms involved in Baixiangdan (BXD) capsule regulation of premenstrual dysphoric disorder (PMDD) at the gene transcription level, since the etiology and pathogenesis of PMDD are not well understood. <b>Methods:</b> The PMDD rat model was prepared using the resident-intruder paradigm. The rats were tested for aggressive behavior, and those with scores in the lowest 30% were used as controls, while rats with scores in the highest 30% were divided into a PMDD model group, BXD administration group and fluoxetine administration group, which were evaluated with open-field tests and aggressive behavior tests. We also analyzed gene expression profiles in the hippocampus for each group, and verified differential expression of genes by real-time PCR. <b>Results:</b> Before and after BXD or fluoxetine administration, scores in the open-field test exhibited no significant differences. The aggressive behavior of the PMDD model rats was improved to a degree after administration of both substances. Gene chip data indicated that 715 genes were differentially expressed in the control and BXD groups. Other group-to-group comparisons exhibited smaller numbers of differentially expressed genes. The effective targets of both drugs included the <i>Htr2c, Cdh3, Serpinb1a, Ace, Trpv4, Cacna1a, Mapk13, Mapk8, Cyp2c13, and Htr1a</i> genes. The results of real-time PCR tests were in accordance with the gene chip data. Based on the target genes and signaling pathway network analysis, we have elaborated the impact and likely mechanism of BXD in treating PMDD and premenstrual irritability. <b>Conclusion:</b> Our work contributes to the understanding of PMDD pathogenesis and the mechanisms of BXD treatment. We speculate that the differentially expressed genes could participate in neuroactive ligand-receptor interactions, mitogen-activated protein kinase, calcium, and gamma-aminobutyric acid signal transduction.

Also flagged:MYCBCL2lymphomashighdiffuse large B-cell lymphomasDLBCL
Journal Article 2018-11-13 ✓ 1 Snippet Islam S, Paek AL, Hammer M, Rangarajan S, Ruijtenbeek R, Cooke L, Weterings E, Mahadevan D.
In-Text Gene Mentions

…( IGLV1-51, CCL3,TNFSF4, CXCL9, CCL4L1, SAMHD1,…

Show Full Abstract

Double-hit (DH) or double-expresser (DE) lymphomas are high-grade diffuse large B-cell lymphomas (DLBCL) that are mostly incurable with standard chemo-immunotherapy due to treatment resistance. The generation of drug-induced aneuploid/polyploid (DIAP) cells is a common effect of anti-DLBCL therapies (e.g. vincristine, doxorubicin). DIAP cells are thought to be responsible for treatment resistance, as they are capable of re-entering the cell cycle during off-therapy periods. Previously we have shown that combination of alisertib plus ibrutinib plus rituximab can partially abrogate DIAP cells and induce cell death. Here, we provide evidence that DIAP cells can re-enter the cell cycle and escape cell death during anti-DLBCL treatment. We also discuss MYC/BCL2 mediated molecular mechanism that underlie treatment resistance. We isolated aneuploid/polyploid populations of DH/DE-DLBCL cells after treatment with the aurora kinase (AK) inhibitor alisertib. Time-lapse microscopy of single polyploid cells revealed that following drug removal, a subset of these DIAP cells divide and proliferate by reductive cell divisions, including multipolar mitosis, meiosis-like nuclear fission and budding. Genomic, proteomic, and kinomic profiling demonstrated that alisertib-induced aneuploid/polyploid cells up-regulate DNA damage, DNA replication and immune evasion pathways. In addition, we identified amplified receptor tyrosine kinase and T-cell receptor signaling, as well as MYC-mediated dysregulation of the spindle assembly checkpoints <i>RanGAP1, TPX2 and KPNA2</i>. We infer that these factors contribute to treatment resistance of DIAP cells. These findings provide opportunities to develop novel DH/DE-DLBCL therapies, specifically targeting DIAP cells.<h4>Key points</h4>● MYC mediated upregulation of TPX2, KPNA2 and RanGAP1 dysregulate the spindle assembly checkpoint in drug-induced polyploid cells.● Drug-induced polyploid cells re-enter the cell cycle via multipolar mitosis, fission or budding, a mechanism of disease relapse.

Also flagged:TrkBSNAP25VAMP2SyntaxinTrkSyntaxin-1
Journal Article 2018-11-13 ✓ 4 Snippets Fuschini G, Cotrufo T, Ros O, Muhaisen A, Andrés R, Comella JX, Soriano E.
In-Text Gene Mentions

…the Netrin-1 receptorDCC[ 17 ,…

…is involved inDCC/Netrin-1-dependent chemoattra…

…that Netrin-1 receptorDCCinteracts with Sytx1…

…we found thatDCC receptorsreceptors interact with…

Show Full Abstract

SNARE proteins are essential components of the machinery that regulates vesicle trafficking and exocytosis. Their role is critical for the membrane-fusion processes that occur during neurotransmitter release. However, research in the last decade has also unraveled the relevance of these proteins in membrane expansion and cytoskeletal rearrangements during developmental processes such as neuronal migration and growth cone extension and attraction. Neurotrophins are neurotrophic factors that are required for many cellular functions throughout the brain, including neurite outgrowth and guidance, synaptic formation, and plasticity. Here we show that neurotrophin Trk receptors form a specific protein complex with the t-SNARE protein Syntaxin 1, both <i>in vivo</i> and <i>in vitro</i>. We also demonstrate that blockade of Syntaxin 1 abolishes neurotrophin-dependent growth of axons in neuronal cultures and decreases exocytotic events at the tip of axonal growth cones. 25-kDa soluble N-ethylmaleimide-sensitive factor attachment protein and Vesicle-associated membrane protein 2 do not participate in the formation of this SNARE complex, while tetanus neurotoxin-insensitive vesicle-associated membrane protein interacts with Trk receptors; knockdown of this (v) SNARE impairs Trk-dependent outgrowth. Taken together, our results support the notion that an atypical SNARE complex comprising Syntaxin 1 and tetanus neurotoxin-insensitive vesicle-associated membrane protein is required for axonal neurotrophin function.

Also flagged:squamous cell carcinomaCHPrefractory tumorstumorsimmune responsetumor
Journal Article 2018-11-13 No Snippets Ueda S, Miyahara Y, Nagata Y, Sato E, Shiraishi T, Harada N, Ikeda H, Shiku H, Kageyama S.
Show Full Abstract

MAGE-A4 antigen is a cancer-testis antigen that is frequently expressed in tumor tissues. Cholesteryl pullulan (CHP) is a novel antigen delivery system for cancer vaccines. This study evaluated the safety, immune responses and clinical outcomes of patients who received a CHP-MAGE-A4 vaccine. Twenty-two patients with advanced or metastatic cancer were enrolled, and were subcutaneously vaccinated with either 100 μg or 300 μg of CHP-MAGE-A4. Seven and 15 patients, respectively, were repeatedly vaccinated with 100 μg or 300 μg of CHP-MAGE-A4; patients in both groups received a median of 7 doses. No serious adverse events related to the vaccine were observed. Of 7 patients receiving the 100 μg dose, 2 (29%) showed immune responses, compared with 3 of the 14 (21%) patients who received the 300 μg dose. In total, MAGE-A4-specific antibody responses were induced in 5 of 21 (24%) patients. No differences in survival were seen between patients receiving the 100 μg and 300 μg doses, or between immune responders and non-responders. Eleven (50%) patients had pre-existing antibodies to NY-ESO-1. In 16 patients with esophageal or head/neck squamous cell carcinoma, the survival time was significantly shorter in those who had NY-ESO-1-co-expressing tumors. Patients with high pre-existing antibody responses to NY-ESO-1 displayed worse prognosis than those with no pre-existing response. Therefore, in planning clinical trials of MAGE-A4 vaccine, enrolling NY-ESO-1-expressing tumor or not would be a critical issue to be discussed. Combination vaccines of MAGE-A4 and NY-ESO-1 antigens would be one of the strategies to overcome the poor prognosis.

Also flagged:exocytosisHuntington's diseaseHunting's diseaseHDacetylcholineCC
Journal Article 2018-11-12 No Snippets Martínez-Ramírez C, Baraibar AM, Nanclares C, Méndez-López I, Gómez A, Muñoz MP, de Diego AMG, Gandía L, Casarejos MJ, García AG.
Show Full Abstract

As the peripheral sympathoadrenal axis is tightly controlled by the cortex via hypothalamus and brain stem, the central pathological features of Hunting's disease, (HD) that is, deposition of mutated huntingtin and synaptic dysfunctions, could also be expressed in adrenal chromaffin cells. To test this hypothesis we here present a thorough investigation on the pathological and functional changes undergone by chromaffin cells (CCs) from 2-month (2 m) to 7-month (7 m) aged wild-type (WT) and R6/1 mouse model of Huntington's disease (HD), stimulated with acetylcholine (ACh) or high [K<sup>+</sup> ] (K<sup>+</sup> ). In order to do this, we used different techniques such as inmunohistochemistry, patch-clamp, and amperometric recording. With respect to WT cells, some of the changes next summarized were already observed in HD mice at a pre-disease stage (2 m); however, they were more pronounced at 7 m when motor deficits were clearly established, as follows: (i) huntingtin over-expression as nuclear aggregates in CCs; (ii) smaller CC size with decreased dopamine β-hydroxylase expression, indicating lesser number of chromaffin secretory vesicles; (iii) reduced adrenal tissue catecholamine content; (iv) reduced Na<sup>+</sup> currents with (v) membrane hyperpolarization and reduced ACh-evoked action potentials; (v) reduced [Ca<sup>2+</sup> ]<sub>c</sub> transients with faster Ca<sup>2+</sup> clearance; (vi) diminished quantal secretion with smaller vesicle quantal size; (vii) faster kinetics of the exocytotic fusion pore, pore expansion, and closure. On the basis of these data, the hypothesis is here raised in the sense that nuclear deposition of mutated huntingtin in adrenal CCs of R6/1 mice could be primarily responsible for poorer Na<sup>+</sup> channel expression and function, giving rise to profound depression of cell excitability, altered Ca<sup>2+</sup> handling and exocytosis. OPEN PRACTICES: This article has received a badge for *Open Materials* because it provided all relevant information to reproduce the study in the manuscript. The complete Open Science Disclosure form for this article can be found at the end of the article. More information about the Open Practices badges can be found at https://cos.io/our-services/open-science-badges/. Cover Image for this issue: doi: 10.1111/jnc.14201.

Also flagged:MTP18mitochondrialpathogenesisischemic diseasesischemic acute kidney injuryHIF-1
Journal Article 2018-11-12 ✓ 1 Snippet Wei Q, Sun H, Song S, Liu Y, Liu P, Livingston MJ, Wang J, Liang M, Mi QS, Huo Y, Nahman NS, Mei C, Dong Z.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

The pathogenesis of ischemic diseases remains unclear. Here we demonstrate the induction of microRNA-668 (miR-668) in ischemic acute kidney injury (AKI) in human patients, mice, and renal tubular cells. The induction was HIF-1 dependent, as HIF-1 deficiency in cells and kidney proximal tubules attenuated miR-668 expression. We further identified a functional HIF-1 binding site in the miR-668 gene promoter. Anti-miR-668 increased apoptosis in renal tubular cells and enhanced ischemic AKI in mice, whereas miR-668 mimic was protective. Mechanistically, anti-miR-668 induced mitochondrial fragmentation, whereas miR-668 blocked mitochondrial fragmentation during hypoxia. We analyzed miR-668 target genes through immunoprecipitation of microRNA-induced silencing complexes followed by RNA deep sequencing and identified 124 protein-coding genes as likely targets of miR-668. Among these genes, only mitochondrial protein 18 kDa (MTP18) has been implicated in mitochondrial dynamics. In renal cells and mouse kidneys, miR-668 mimic suppressed MTP18, whereas anti-miR-668 increased MTP18 expression. Luciferase microRNA target reporter assay further verified MTP18 as a direct target of miR-668. In renal tubular cells, knockdown of MTP18 suppressed mitochondrial fragmentation and apoptosis. Together, the results suggest that miR-668 is induced via HIF-1 in ischemic AKI and that, upon induction, miR-668 represses MTP18 to preserve mitochondrial dynamics for renal tubular cell survival and kidney protection.

Also flagged:estrogenovarian cancerestradiolmetabolismcancerGreb1
Journal Article 2018-11-12 ✓ 5 Snippets Vuong NH, Cook DP, Forrest LA, Carter LE, Robineau-Charette P, Kofsky JM, Hodgkinson KM, Vanderhyden BC.
In-Text Gene Mentions

These results support the existence of 3 populations of cells in the in vitro model of E2-induced dysplasia, as predicted by PCA, where high expression of PTGIS and IGFBP5 are observed in the majority of cells in control and E2-treated cultures, respectively.

…Ltbp2 (unresponsive cluster),Ptgis(control-specific cluster), an…

PTGISis an endoplasmic…

…OSE cells wherePTGISwas detectable throughout…

…high expression ofPTGISand IGFBP5 are…

Show Full Abstract

Estrogen therapy increases the risk of ovarian cancer and exogenous estradiol accelerates the onset of ovarian cancer in mouse models. Both in vivo and in vitro, ovarian surface epithelial (OSE) cells exposed to estradiol develop a subpopulation that loses cell polarity, contact inhibition, and forms multi-layered foci of dysplastic cells with increased susceptibility to transformation. Here, we use single-cell RNA-sequencing to characterize this dysplastic subpopulation and identify the transcriptional dynamics involved in its emergence. Estradiol-treated cells were characterized by up-regulation of genes associated with proliferation, metabolism, and survival pathways. Pseudotemporal ordering revealed that OSE cells occupy a largely linear phenotypic spectrum that, in estradiol-treated cells, diverges towards cell state consistent with the dysplastic population. This divergence is characterized by the activation of various cancer-associated pathways including an increase in Greb1 which was validated in fallopian tube epithelium and human ovarian cancers. Taken together, this work reveals possible mechanisms by which estradiol increases epithelial cell susceptibility to tumour initiation.

Also flagged:coronary diseaseExp4Exp1Exp2coronary atherosclerosisExp7
Journal Article 2018-11-12 ✓ 1 Snippet Fernandes M, Patel A, Husi H.
In-Text Gene Mentions

…miR-let-7c (directly targetingOLFM4, and resulting query-molecule…

Show Full Abstract

The cardiovascular disease (C/VD) database is an integrated and clustered information resource that covers multi-omic studies (microRNA, genomics, proteomics and metabolomics) of cardiovascular-related traits with special emphasis on coronary artery disease (CAD). This resource was built by mining existing literature and public databases and thereafter manual biocuration was performed. To enable integration of omic data from distinct platforms and species, a specific ontology was applied to tie together and harmonise multi-level omic studies based on gene and protein clusters (CluSO) and mapping of orthologous genes (OMAP) across species. CAD continues to be a leading cause of death in the population worldwide, and it is generally thought to be an age-related disease. However, CAD incidence rates are now known to be highly influenced by environmental factors and interactions, in addition to genetic determinants. With the complexity of CAD aetiology, there is a difficulty in research studies to elucidate general elements compared to other cardiovascular diseases. Data from 92 studies, covering 13945 molecular entries (4353 unique molecules) is described, including data descriptors for experimental setup, study design, discovery-validation sample size and associated fold-changes of the differentially expressed molecular features (p-value<0.05). A dedicated interactive web interface, equipped with a multi-parametric search engine, data export and indexing menus are provided for a user-accessible browsing experience. The main aim of this work was the development of a data repository linking clinical information and molecular differential expression in several CVD-related traits from multi-omics studies (genomics, transcriptomics, proteomics and metabolomics). As an example case of how to query and identify data sets within the database framework and concomitantly demonstrate the database utility, we queried CAD-associated studies and performed a systems-level integrative analysis. URL: www.padb.org/cvd.

Also flagged:HIF-1αBenzeneHypoxia-inducible factor-1αmetabolismchromatinbinding
Journal Article 2018-11-12 ✓ 1 Snippet Man Z, Meng X, Sun F, Pu Y, Xu K, Sun R, Zhang J, Yin L, Pu Y.
In-Text Gene Mentions

…activating protein 1-Like (Rabgap1l)-mediated tyrosine kinase sig…

Show Full Abstract

Benzene is a hematopoietic toxicant, and hematopoietic cells in bone marrow (BM) are one of the main targets for its action, especially hematopoietic stem cells (HSCs). Hypoxia-inducible factor-1α (HIF-1α) is associated with the metabolism and physiological functions of HSCs. We previously found that the mechanism of regulation of HIF-1α is involved in benzene-induced hematopoietic toxicity. In this study, chromatin immunoprecipitation sequencing (ChIP-Seq) technologies were used to analyze the genome-wide binding spectrum of HIF-1α in mouse BM cells, and specific HIF-1α target genes and pathways associated with benzene toxicity were screened and validated. By application of the ChIP-Seq technique, we identified target genes HIF-1α directly binds to and regulates. Forty-two differentially down-regulated genes containing the HIF-1α specific binding site hypoxia response element (HRE) were found, of which 25 genes were with biological function. Moreover, the enrichment analysis of signal pathways indicated that these genes were significantly enriched in the Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, the Fc epsilon RI signaling pathway, Pyrimidine metabolism, the T cell receptor signaling pathway, and Transcriptional misregulation in cancer. After verification, 11 genes involved in HSC self-renewal, cell cycle, differentiation, and apoptosis pathways were found to be significantly reduced, and may participate in benzene-induced hematotoxicity. Our study provides a new academic clue for the mechanism of benzene hematotoxicity.

Also flagged:infectionHaemorrhagic diseaseGCRV infectiondeathserine proteaseprotease
Journal Article 2018-11-12 No Snippets Chen L, Huang R, Zhu D, Wang Y, Mehjabin R, Li Y, Liao L, He L, Zhu Z, Wang Y.
Show Full Abstract

Grass carp, an economically important aquaculture fish, is very sensitive to Grass Carp Reovirus (GCRV). Haemorrhagic disease caused by GCRV infection can cause large-scale death of first-year grass carp, thereby severely restricting the intensive culture. Serpins (serine protease inhibitors) belong to the protease inhibitor gene family and are involved in numerous physiological and pathological processes, particularly coagulation and anticoagulation. Reports on grass carp serpins are scarce. Thus, we cloned six grass carp serpin genes (serpinb1, serpinc1, serpind1, serpinf1, serpinf2b and serping1) in this study. Molecular evolution showed that serpins between grass carp and zebrafish or carp are the closest relatives. SERPIN domains in these 6 serpins and reactive centre loop (RCL) along with their cleavage sites of 5 serpins (serpinb1, serpinc1, serpind1, serpinf2b and serping1) were predicted. Real-time quantitative PCR (RT-qPCR) showed that these serpins displayed tissue significance. Among them, serpinc1, serpind1, serpinf2b and serping1 had the highest expression levels in the liver. After GCRV infection, RT-qPCR showed that the liver-enriched serpins were significantly changed. Key procoagulant factor genes (kng-1, f2, f3a, f3b and f7) and anticoagulant genes (tpa, plg, thbd, proc and pros) also showed significant changes on the mRNA level. Comprehensive comparative analysis showed that the up-regulated expression of key clotting factor genes was more prominent than that of main anti-coagulation factor genes. Thus, the function of coagulation may be more dominant in grass carp during the GCRV infection, which may cause overproduction of thrombi. The serpins were involved in GCRV infection and liver-enriched serpins participate in the interaction between coagulation and anticoagulation. This study provided new insights into further research on the biological functions of grass carp serpins and clarifying the molecular mechanism of GCRV affecting the homeostasis of grass carp blood environment.

Also flagged:Hepatocellular carcinomaCirrhosis of the liveralpha-fetoproteinAFPcancercirrhosis
Journal Article 2018-11-12 ✓ 1 Snippet Borges KA, Dai J, Parikh ND, Schwartz M, Nguyen MH, Roberts LR, Befeler AS, Srivastava S, Rinaudo JA, Feng Z, Marrero JA, Reddy KR.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is a common malignancy with a steadily rising incidence and associated morbidity and mortality. Cirrhosis of the liver is presently the leading risk factor for developing HCC. Abdominal imaging, with or without alpha-fetoprotein (AFP) testing, every 6 months is the current surveillance strategy for patients at risk. The available biomarkers for detecting this cancer at an early stage have inadequate sensitivity and specificity.<h4>Methods</h4>The Hepatocellular carcinoma Early Detection Strategy (HEDS) study, a multi-center initiative of the National Cancer Institutes' (NCI) Early Detection Research Network (EDRN), launched an effort to establish what has become the nation's largest comprehensive biorepository and database on patients at high risk of developing HCC. The cohort has been developed in seven clinical centers across the USA. Subjects are enrolled for a five-year period involving data and specimen collection every six months in accordance with standard surveillance for HCC. Extensive clinical data are collected and specimens are stored at a central repository.<h4>Results</h4>The database and biorepository contain longitudinally collected clinical data and serum and plasma samples from 1482 participants with cirrhosis and without evidence of HCC at baseline. Fifty-six percent are male, 85% Caucasian, 30% have a history of chronic HCV and 71% have compensated cirrhosis.<h4>Conclusions</h4>The HEDS cohort provides opportunities for the continued study of the incidence and course of HCC in a comprehensively followed population of patients at high risk for this malignancy. Further, the EDRN biorepository provides a distinct opportunity for the development of novel biomarkers. Trial registry URL: https://edrn.nci.nih.gov/protocols/316-hepatocellular-carcinoma-early-detection-strategy.

Also flagged:cognitionsynapsemembraneextracellularsynapsesaxons
Journal Article 2018-11-12 ✓ 2 Snippets Menon S, Gupton S.
In-Text Gene Mentions

…(L1CAM), Contactin-4 (CNTN4),Negr1, and Dystroglycan (DG).…

Negr1is a GPI-anchored…

Show Full Abstract

Proper neuronal wiring is central to all bodily functions, sensory perception, cognition, memory, and learning. Establishment of a functional neuronal circuit is a highly regulated and dynamic process involving axonal and dendritic branching and navigation toward appropriate targets and connection partners. This intricate circuitry includes axo-dendritic synapse formation, synaptic connections formed with effector cells, and extensive dendritic arborization that function to receive and transmit mechanical and chemical sensory inputs. Such complexity is primarily achieved by extensive axonal and dendritic branch formation and pruning. Fundamental to neuronal branching are cytoskeletal dynamics and plasma membrane expansion, both of which are regulated via numerous extracellular and intracellular signaling mechanisms and molecules. This review focuses on recent advances in understanding the biology of neuronal branching.

Also flagged:synthesisamideNMDARAMPARNMDARsaction potentials
Journal Article 2018-11-12 No Snippets Adla SK, Slavikova B, Chodounska H, Vyklicky V, Ladislav M, Hubalkova P, Krausova B, Smejkalova T, Nekardova M, Smidkova M, Monincova L, Soucek R, Vyklicky L, Kudova E.
Show Full Abstract

Herein, we report the synthesis, structure-activity relationship study, and biological evaluation of neurosteroid inhibitors of <i>N</i>-methyl-D-aspartate receptors (NMDARs) receptors that employ an amide structural motif, relative to pregnanolone glutamate (PAG) - a compound with neuroprotective properties. All compounds were found to be more potent NMDAR inhibitors (IC<sub>50</sub> values varying from 1.4 to 21.7 μM) than PAG (IC<sub>50</sub> = 51.7 μM). Selected compound 6 was evaluated for its NMDAR subtype selectivity and its ability to inhibit AMPAR/GABAR responses. Compound 6 inhibits the NMDARs (8.3 receptors (8.3 ± 2.1 μM) more strongly than it does at the GABAR and AMPARs (17.0 receptors (17.0 ± 0.2 μM and 276.4 ± 178.7 μM, respectively). In addition, compound 6 (10 μM) decreases the frequency of action potentials recorded in cultured hippocampal neurons. Next, compounds 3, 5-7, 9, and 10 were not associated with mitotoxicity, hepatotoxicity nor ROS induction. Lastly, we were able to show that all compounds have improved rat and human plasma stability over PAG.

Also flagged:CHCHD2angiogenesisrenal cell carcinomacell migrationphosphorylationRCC
Journal Article 2018-11-12 ✓ 1 Snippet Cheng Q, Qu D, Lu Z, Zhang L.
In-Text Gene Mentions

…a screen forHTTinteracting proteins (…

Show Full Abstract

Coiled-coil-helix-coiled-coil-helix domain-containing protein 2 (CHCHD2), a novel cell migration determinant, is able to co-express with other genes of the oxidative phosphorylation pathway by using a computational expression screening technique. However, little is known about the expression and biological function of CHCHD2 in human renal cell carcinoma (RCC). Western blotting was performed to detect CHCHD2 expression levels in normal renal cells and carcinoma cells. Immunohistochemistry was performed to detect an association between CHCHD2 expression and clinicopathological parameters in 75 RCC tissues using a tissue microarray. The function of CHCHD2 in the migration and angiogenesis of RCC cells was investigated using Transwell migration and tube formation assays. CHCHD2 expression was markedly increased in human RCC cells. The results of immunohistochemical analysis revealed that CHCHD2 expression was markedly associated with tumor grade (P<0.001). Notably, CHCHD2 knockdown inhibited RCC migration and tube formation of human umbilical vascular endothelial cells. CHCHD2 knockdown further suppressed matrix metalloproteinase-2 protein levels and enzyme activity. An ELISA identified that CHCHD2 knockdown decreased the secretion of vascular endothelial growth factor. The gathered data disclose information on the association of CHCHD2 with migration and angiogenesis of human RCC, and may strengthen the feasibility of targeting CHCHD2 as a potential therapeutic target.

Also flagged:Synthesisimidazoledehydroabietylaminecell proliferationsaltsamides
Journal Article 2018-11-12 No Snippets Zhao F, Lu W, Su F, Xu L, Jiang D, Sun X, Shi J, Zhou M, Lin F, Cao F.
Show Full Abstract

To seek more efficient and lower toxicity anticancer compounds, several imidazole combining dehydroabietylamine derivatives including organic salts (<b>L</b> <sup><b>1</b></sup> -<b>L</b> <sup><b>2</b></sup> ) and amides (<b>L</b> <sup><b>3</b></sup> -<b>L</b> <sup><b>5</b></sup> ) were synthesized. Their antineoplastic activity against HeLa (cervix), MCF-7 (breast), A549 (lung) and HepG2 (liver) cells and HUVECs (umbilical vein, normal cells) <i>in vitro</i> were evaluated by MTT assay. The results unequivocally showed that nearly all compounds had better antineoplastic activity and lower toxicity than dehydroabietylamine (<b>L</b> <sup><b>0</b></sup> ). For MCF-7 cells, <b>L</b> <sup><b>2</b></sup> (0.75 μM) and <b>L</b> <sup><b>5</b></sup> (2.17 μM) had higher anti-MCF-7 activity than <b>L</b> <sup><b>0</b></sup> and DOX. For A549 cells, <b>L</b> <sup><b>1</b></sup> (1.85 μM) and <b>L</b> <sup><b>2</b></sup> (4.37 μM) had higher anti-A549 activity than <b>L</b> <sup><b>0</b></sup> ; in particular, the IC<sub>50</sub> value of <b>L</b> <sup><b>1</b></sup> was much lower than that of DOX. Among these investigated compounds, <b>L</b> <sup><b>2</b></sup> and <b>L</b> <sup><b>5</b></sup> had lower IC<sub>50</sub> values (0.75 μM and 2.17 μM) against MCF-7 cells and lower toxicity, which suggested that they may be potential future anticancer drugs. In addition, <b>L</b> <sup><b>1</b></sup> and <b>L</b> <sup><b>2</b></sup> could suppress cancer cell proliferation by inducing apoptosis. <b>L</b> <sup><b>1</b></sup> -<b>L</b> <sup><b>5</b></sup> could bind with DNA through intercalation.

Also flagged:cell differentiationgene expressioncataractlensvisiontissue morphogenesis
Journal Article 2018-11-11 ✓ 1 Snippet Anand D, Kakrana A, Siddam AD, Huang H, Saadi I, Lachke SA.
In-Text Gene Mentions

Dnajc1

Show Full Abstract

Isolated or syndromic congenital cataracts are heterogeneous developmental defects, making the identification of the associated genes challenging. In the past, mouse lens expression microarrays have been successfully applied in bioinformatics tools (e.g., iSyTE) to facilitate human cataract-associated gene discovery. To develop a new resource for geneticists, we report high-throughput RNA sequencing (RNA-seq) profiles of mouse lens at key embryonic stages (E)10.5 (lens pit), E12.5 (primary fiber cell differentiation), E14.5 and E16.5 (secondary fiber cell differentiation). These stages capture important events as the lens develops from an invaginating placode into a transparent tissue. Previously, in silico whole-embryo body (WB)-subtraction-based "lens-enriched" expression has been effective in prioritizing cataract-linked genes. To apply an analogous approach, we generated new mouse WB RNA-seq datasets and show that in silico WB subtraction of lens RNA-seq datasets successfully identifies key genes based on lens-enriched expression. At ≥2 counts-per-million expression, ≥1.5 log<sub>2</sub> fold-enrichment (p < 0.05) cutoff, E10.5 lens exhibits 1401 enriched genes (17% lens-expressed genes), E12.5 lens exhibits 1937 enriched genes (22% lens-expressed genes), E14.5 lens exhibits 2514 enriched genes (31% lens-expressed genes), and E16.5 lens exhibits 2745 enriched genes (34% lens-expressed genes). Biological pathway analysis identified genes associated with lens development, transcription regulation and signaling pathways, among other functional groups. Furthermore, these new RNA-seq data confirmed high expression of established cataract-linked genes and identified new potential regulators in the lens. Finally, we developed new lens stage-specific UCSC Genome Brower annotation tracks and made these publicly accessible through iSyTE ( https://research.bioinformatics.udel.edu/iSyTE/ ) for user-friendly visualization of lens gene expression/enrichment to prioritize genes from high-throughput data from cataract cases.

Also flagged:acetaminophenacute liver injurymitochondrialPrdx3Aldh2oxygen
Journal Article 2018-11-11 ✓ 1 Snippet Feng Q, Zhao N, Xia W, Liang C, Dai G, Yang J, Sun J, Liu L, Luo L, Yang J.
In-Text Gene Mentions

…ochondrial protective proteinsPrdx6, Prdx3, and Aldh2…

Show Full Abstract

Acetaminophen (APAP) overdose-induced acute liver injury (AILI) is a significant clinical problem worldwide, the hepatotoxicity mechanisms are well elucidated, but the factors involved in the necrosis and repair still remain to be investigated. APAP was injected intraperitoneally in male Institute of Cancer Research (ICR) mice. Quantitative proteome analysis of liver tissues was performed by 2-nitrobenzenesulfenyl tagging, two-dimensional-nano high-performance liquid chromatography separation, and matrix-assisted laser desorption/ionization-time of flight mass spectrometry analysis. Diffrenetial proteins were verified by the immunochemistry method. 36 and 44 differentially expressed proteins were identified, respectively, at 24 hr after APAP (200 or 300 mg·kg <sup>-1</sup> ) administration. The decrease in the mitochondrial protective proteins Prdx6, Prdx3, and Aldh2 accounted for the accumulation of excessive reactive oxygen species (ROS) and aldehydes, impairing mitochondria structure and function. The Gzmf combined with Bax and Apaf-1 jointly contributed to the necrosis. The blockage of Stat3 activation led to the overexpression of unphosphorylated Stat3 and the overproduction of Bax. The overexpression of unphosphorylated Stat3 represented necrosis; the alternation from Stat3 to p-Stat3 in necrotic regions represented hepatocytes from death to renewal. The high expressions of P4hα1, Ncam, α-SMA, and Cygb were involved in the liver repair, they were not only the markers of activated HSC but also represented an intermediate stage of hepatocytes from damage or necrosis to renewal. Our data provided a comprehensive report on the profile and dynamic changes of the liver proteins in AILI; the involvement of Gzmf and the role of Stat3 in necrosis were revealed; and the role of hepatocyte in liver self-repair was well clarified.

Also flagged:Mouth DiseaseHerpanginahand, foot, and mouth diseaseinfectionHAdeath
Journal Article 2018-11-10 No Snippets Takechi M, Fukushima W, Nakano T, Inui M, Ohfuji S, Kase T, Ito K, Kondo K, Maeda A, Shimizu H, Hirota Y.
Show Full Abstract

<h4>Background</h4>Severe pediatric cases of hand, foot, and mouth disease (HFMD), herpangina (HA), and associated complications caused by enterovirus 71 (EV71) infection have brought substantial public health impact in Asia. This study aimed to elucidate the epidemiology of these pediatric cases in Japan.<h4>Methods</h4>A nationwide survey was conducted using stratified random sampling of hospital pediatric departments. We estimated the number of inpatients with HFMD, HA, and associated complications between April 1 and September 30, 2010, during which EV71 was circulating predominantly. Factors associated with severe cases with ≥7 days of admission, sequelae, or outcome of death were analyzed using multivariate logistic regression.<h4>Results</h4>During the 6-month epidemic period, the number of pediatric inpatients aged <15 years was about 2,900 (estimated cumulative incidence of hospitalized cases: 17.0 per 100,000 population). Severe cases were significantly associated with younger age. Compared to patients ≥5 years of age, the odds ratios (ORs) for <1 year of age and 1 to <3 years of age were 5.74 (95% confidence interval [CI], 2.14-15.4) and 2.94 (95% CI, 1.02-8.51), respectively. Elevated ORs for hyperglycemia (plasma glucose level of ≥8.3 mmol/L) on admission (OR 3.60; 95% CI, 0.94-13.8) were also observed.<h4>Conclusions</h4>Disease burden of pediatric inpatients with HFMD, HA, and associated complications in Japan was described for the first time. During an EV71 epidemic, younger age and, suggestively, hyperglycemia may have been critical factors requiring more careful treatment.

Also flagged:Cancercardiac atrophymyocarditisheart failuregene expressioncardiovascular disorders
Journal Article 2018-11-09 No Snippets Chatterjee S, Gupta SK, Bär C, Thum T.
Show Full Abstract

Cancer is the leading cause of morbidity and mortality in the United States and globally. Owing to improved early diagnosis and advances in oncological therapeutic options, the number of cancer survivors has steadily increased. Such efficient cancer therapies have also lead to alarming increase in cardiovascular complications in a significant proportion of cancer survivors, due to adverse cardiovascular effects such as cardiotoxicity, cardiac atrophy, and myocarditis. This has emerged as a notable concern in healthcare and given rise to the new field of cardioncology, which aims at understanding the processes that occur in the two distinct disorders and how they interact to influence the progression of each other. A key player in both cancer and heart failure is the genome, which is predominantly transcribed to noncoding RNAs (ncRNAs). Since the emergence of ncRNAs as master regulators of gene expression, several reports have shown the relevance of ncRNAs in cancer and cardiovascular disorders. However, the knowledge is quite limited regarding the relevance of ncRNAs in cardioncology. The objective of this review is to summarize the current knowledge of ncRNAs in the context of cardioncology. Furthermore, the therapeutic strategies as well as the prospective translational applications of these ncRNA molecules to the clinics are also discussed.

Also flagged:RBPRNA binding proteinsbindingnucleotideCLIPneurological disorders
Journal Article 2018-11-09 No Snippets Yee BA, Pratt GA, Graveley BR, Van Nostrand EL, Yeo GW.
Show Full Abstract

Alternative splicing of pre-messenger RNA transcripts enables the generation of multiple protein isoforms from the same gene locus, providing a major source of protein diversity in mammalian genomes. RNA binding proteins (RBPs) bind to RNA to control splice site choice and define which exons are included in the resulting mature RNA transcript. However, depending on where the RBPs bind relative to splice sites, they can activate or repress splice site usage. To explore this position-specific regulation, in vivo binding sites identified by methods such as cross-linking and immunoprecipitation (CLIP) are integrated with alternative splicing events identified by RNA-seq or microarray. Merging these data sets enables the generation of a "splicing map," where CLIP signal relative to a merged meta-exon provides a simple summary of the position-specific effect of binding on splicing regulation. Here, we provide RBP-Maps, a software tool to simplify generation of these maps and enable researchers to rapidly query regulatory patterns of an RBP of interest. Further, we discuss various alternative approaches to generate such splicing maps, focusing on how decisions in construction (such as the use of peak versus read density, or whole-reads versus only single-nucleotide candidate crosslink positions) can affect the interpretation of these maps using example eCLIP data from the 150 RBPs profiled by the ENCODE consortium.

Also flagged:ChromatinMdm2RNF2tumorp53replication fork
Journal Article 2018-11-09 ✓ 1 Snippet Klusmann I, Wohlberedt K, Magerhans A, Teloni F, Korbel JO, Altmeyer M, Dobbelstein M.
In-Text Gene Mentions

polycomb repressors

Show Full Abstract

The p53-Mdm2 system is key to tumor suppression. We have recently reported that p53 as well as Mdm2 are capable of supporting DNA replication fork progression. On the other hand, we found that Mdm2 is a modifier of chromatin, modulating polycomb repressor complex (PRC)-driven histone modifications. Here we show that, similar to Mdm2 knockdown, the depletion of PRC members impairs DNA synthesis, as determined in fiber assays. In particular, the ubiquitin ligase and PRC1 component RNF2/Ring1B is required to support DNA replication, similar to Mdm2. Moreover, the Ring finger domain of Mdm2 is not only essential for its ubiquitin ligase activity, but also for proper DNA replication. Strikingly, Mdm2 overexpression can rescue RNF2 depletion with regard to DNA replication fork progression, and vice versa, strongly suggesting that the two ubiquitin ligases perform overlapping functions in this context. H2A overexpression also rescues fork progression upon depletion of Mdm2 or RNF2, but only when the ubiquitination sites K118/K119 are present. Depleting the H2A deubiquitinating enzyme BAP1 reduces the fork rate, suggesting that both ubiquitination and deubiquitination of H2A are required to support fork progression. The depletion of Mdm2 elicits the accumulation of RNA/DNA hybrids, suggesting R-loop formation as a mechanism of impaired DNA replication. Accordingly, RNase H overexpression or the inhibition of the transcription elongation kinase CDK9 each rescues DNA replication upon depletion of Mdm2 or RNF2. Taken together, our results suggest that chromatin modification by Mdm2 and PRC1 ensures smooth DNA replication through the avoidance of R-loop formation.

Also flagged:RETgenital infectionglial cell derived neurotrophic factorGDNFNGFglial family receptors alpha 1
Journal Article 2018-11-09 No Snippets Baird NL, Depledge DP, Cohrs RJ.
Show Full Abstract

Meeting Report on the 8th Annual Symposium of the Colorado Alphaherpesvirus Latency Society (CALS), held on May 16-19, 2018, in Vail, Colorado.

Also flagged:cancertumorsgene transfertumoracute myeloid leukemiaAML
Journal Article 2018-11-09 No Snippets Nimmakayala RK, Batra SK, Ponnusamy MP.
Show Full Abstract

Cancer biology research over recent decades has given ample evidence for the existence of self-renewing and drug-resistant populations within heterogeneous tumors, widely recognized as cancer stem cells (CSCs). However, a lack of clear understanding about the origin, existence, maintenance, and metastatic roles of CSCs limit efforts towards the development of CSC-targeted therapy. In this review, we describe novel avenues of current CSC biology. In addition to cell fusion and horizontal gene transfer, CSCs are originated by mutations in somatic or differentiated cancer cells, resulting in de-differentiation and reprogramming. Recent studies also provided evidence for the existence of distinct or heterogeneous CSC populations within a single heterogeneous tumor. Our analysis of the literature also opens the doors for a novel hypothesis that CSC populations with specific phenotypes, metabolic profiles, and clonogenic potential metastasize to specific organs.

Also flagged:end-stage kidney diseaseinfectionglomerular diseaseGlomerular diseasesminimal change diseaseMCD
Journal Article 2018-11-09 No Snippets Mariani LH, Bomback AS, Canetta PA, Flessner MF, Helmuth M, Hladunewich MA, Hogan JJ, Kiryluk K, Nachman PH, Nast CC, Rheault MN, Rizk DV, Trachtman H, Wenderfer SE, Bowers C, Hill-Callahan P, Marasa M, Poulton CJ, Revell A, Vento S, Barisoni L, Cattran D, D'Agati V, Jennette JC, Klein JB, Laurin LP, Twombley K, Falk RJ, Gharavi AG, Gillespie BW, Gipson DS, Greenbaum LA, Holzman LB, Kretzler M, Robinson B, Smoyer WE, Guay-Woodford LM, CureGN Consortium.
Show Full Abstract

<h4>Rationale & objectives</h4>Glomerular diseases, including minimal change disease, focal segmental glomerulosclerosis, membranous nephropathy, and immunoglobulin A (IgA) nephropathy, share clinical presentations, yet result from multiple biological mechanisms. Challenges to identifying underlying mechanisms, biomarkers, and new therapies include the rarity of each diagnosis and slow progression, often requiring decades to measure the effectiveness of interventions to prevent end-stage kidney disease (ESKD) or death.<h4>Study design</h4>Multicenter prospective cohort study.<h4>Setting & participants</h4>Cure Glomerulonephropathy (CureGN) will enroll 2,400 children and adults with minimal change disease, focal segmental glomerulosclerosis, membranous nephropathy, or IgA nephropathy (including IgA vasculitis) and a first diagnostic kidney biopsy within 5 years. Patients with ESKD and those with secondary causes of glomerular disease are excluded.<h4>Exposures</h4>Clinical data, including medical history, medications, family history, and patient-reported outcomes, are obtained, along with a digital archive of kidney biopsy images and blood and urine specimens at study visits aligned with clinical care 1 to 4 times per year.<h4>Outcomes</h4>Patients are followed up for changes in estimated glomerular filtration rate, disease activity, ESKD, and death and for nonrenal complications of disease and treatment, including infection, malignancy, cardiovascular, and thromboembolic events.<h4>Analytical approach</h4>The study design supports multiple longitudinal analyses leveraging the diverse data domains of CureGN and its ancillary program. At 2,400 patients and an average of 2 years' initial follow-up, CureGN has 80% power to detect an HR of 1.4 to 1.9 for proteinuria remission and a mean difference of 2.1 to 3.0mL/min/1.73m<sup>2</sup> in estimated glomerular filtration rate per year.<h4>Limitations</h4>Current follow-up can only detect large differences in ESKD and death outcomes.<h4>Conclusions</h4>Study infrastructure will support a broad range of scientific approaches to identify mechanistically distinct subgroups, identify accurate biomarkers of disease activity and progression, delineate disease-specific treatment targets, and inform future therapeutic trials. CureGN is expected to be among the largest prospective studies of children and adults with glomerular disease, with a broad goal to lessen disease burden and improve outcomes.

Also flagged:topdeathsickdiabetesyouheart disease
Journal Article 2018-11-09 ✓ 1 Snippet Dayalu R, Cafiero-Fonseca ET, Fan VY, Schofield H, Bloom DE.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Background</h4>Priority setting in a climate of diverse needs and limited resources is one of the most significant challenges faced by health care policymakers. This paper develops and applies a comprehensive multi-criteria algorithm to help determine the relative importance of health conditions that affect a defined population.<h4>Methods</h4>Our algorithm is implemented in the context of the Waikato District Health Board (WDHB) in New Zealand, which serves approximately 10% of the New Zealand population. Strategic priorities of the WDHB are operationalized into five criteria along which the algorithm is structured-scale of disease, household financial impact of disease, health equity, cost-effectiveness, and multimorbidity burden. Using national-level data and published literature from New Zealand, the World Health Organization, and other high-income Commonwealth countries, 25 health conditions in Waikato are identified and mapped to these five criteria. These disease-criteria mappings are weighted with data from an ordered choice survey administered to the general public of the Waikato region. The resulting output of health conditions ranked in order of relative importance is validated against an explicit list of health concerns, provided by the survey respondents.<h4>Results</h4>Heart disease and cancerous disorders are assigned highest priority rankings according to both the algorithm and the survey data, suggesting that our model is aligned with the primary health concerns of the general public. All five criteria are weighted near-equal across survey respondents, though the average health equity preference score is 9.2% higher for Māori compared to non-Māori respondents. Older respondents (50 years and above) ranked issues of multimorbidity 4.2% higher than younger respondents.<h4>Conclusions</h4>Health preferences of the general population can be elicited using ordered-choice surveys and can be used to weight data for health conditions across multiple criteria, providing policymakers with a practical tool to inform which health conditions deserve the most attention. Our model connects public health strategic priorities, the health impacts and financial costs of particular health conditions, and the underlying preferences of the general public. We illustrate a practical approach to quantifying the foundational criteria that drive public preferences, for the purpose of relevant, legitimate, and evidence-based priority setting in health.

Also flagged:Alpha SynucleinParkinson's diseasePDneurodegenerative disordercognitive declinepathogenesis
Journal Article 2018-11-09 No Snippets Koh YH, Tan LY, Ng SY.
Show Full Abstract

Parkinson's disease (PD) is an age-associated, progressive neurodegenerative disorder characterized by motor impairment and in some cases cognitive decline. Central to the disease pathogenesis of PD is a small, presynaptic neuronal protein known as alpha synuclein (a-syn), which tends to accumulate and aggregate in PD brains as Lewy bodies or Lewy neurites. Numerous <i>in vitro</i> and <i>in vivo</i> studies confirm that a-syn aggregates can be propagated from diseased to healthy cells, and it has been suggested that preventing the spread of pathogenic a-syn species can slow PD progression. In this review, we summarize the works of recent literature elucidating mechanisms of a-syn propagation, and discussed the advantages in using patient-derived induced pluripotent stem cells (iPSCs) and/or induced neurons to study a-syn transmission.

Also flagged:ZincAMPA ReceptorAMPARAutism Spectrum DisordersdeficiencyShank2
Journal Article 2018-11-09 No Snippets Ha HTT, Leal-Ortiz S, Lalwani K, Kiyonaka S, Hamachi I, Mysore SP, Montgomery JM, Garner CC, Huguenard JR, Kim SA.
Show Full Abstract

During development, pyramidal neurons undergo dynamic regulation of AMPA receptor (AMPAR) subunit composition and density to help drive synaptic plasticity and maturation. These normal developmental changes in AMPARs are particularly vulnerable to risk factors for Autism Spectrum Disorders (ASDs), which include loss or mutations of synaptic proteins and environmental insults, such as dietary zinc deficiency. Here, we show how Shank2 and Shank3 mediate a zinc-dependent regulation of AMPAR function and subunit switch from GluA2-lacking to GluA2-containing AMPARs. Over development, we found a concomitant increase in Shank2 and Shank3 with GluA2 at synapses, implicating these molecules as potential players in AMPAR maturation. Since Shank activation and function require zinc, we next studied whether neuronal activity regulated postsynaptic zinc at glutamatergic synapses. Zinc was found to increase transiently and reversibly with neuronal depolarization at synapses, which could affect Shank and AMPAR localization and activity. Elevated zinc induced multiple functional changes in AMPAR, indicative of a subunit switch. Specifically, zinc lengthened the decay time of AMPAR-mediated synaptic currents and reduced their inward rectification in young hippocampal neurons. Mechanistically, both Shank2 and Shank3 were necessary for the zinc-sensitive enhancement of AMPAR-mediated synaptic transmission and act in concert to promote removal of GluA1 while enhancing recruitment of GluA2 at pre-existing Shank puncta. These findings highlight a cooperative local dynamic regulation of AMPAR subunit switch controlled by zinc signaling through Shank2 and Shank3 to shape the biophysical properties of developing glutamatergic synapses. Given the zinc sensitivity of young neurons and its dependence on Shank2 and Shank3, genetic mutations and/or environmental insults during early development could impair synaptic maturation and circuit formation that underlie ASD etiology.

Also flagged:tumorlysinechromosomechromosomesdegradationribonucleoprotein
Journal Article 2018-11-09 No Snippets Zhao Z, Tan Q, Zhan X, Lin J, Fan Z, Xiao K, Li B, Liao Y, Huang X.
Show Full Abstract

Telomerase is closely linked to the physiological transformation of tumor cells and is commonly overexpressed in most types of tumor cells. Therefore, telomerase has become a potential biomarker for the process of tumorigenesis, progression, prognosis and metastasis. Thus, it is important to develop a simple, accurate and reliable method for detecting telomerase activity. As a high signal-to-noise ratio mode, electrochemiluminescence (ECL) has been widely applied in the field of biomedical analysis. Here, our objective was to construct an improved ECL signal amplifier for the detection of telomerase activity. <b>Methods:</b> A cascaded ECL signal amplifier was constructed to detect telomerase activity with high selectivity via controllable construction of a lysine-based dendric Ru(bpy)<sub>3</sub><sup>2+</sup> polymer (DRP). The sensitivity, specificity and performance index were simultaneously evaluated by standard substance and cell and tissue samples. <b>Results:</b> With this cascaded ECL signal amplifier, high sensitivities of 100, 50, and 100 cells for three tumor cell lines (A549, MCF7 and HepG2 cell lines) were simultaneously achieved, and desirable specificity was also obtained. Furthermore, the excellent performance of this platform was also demonstrated in the detection of telomerase in tumor cells and tissues. <b>Conclusion:</b> This cascaded ECL signal amplifier has the potential to be a technological innovation in the field of telomerase activity detection.

Also flagged:KCTD7neurodegenerative disorderautosomal recessive disorderprogressive myoclonic epilepsyneuronal ceroid lipofuscinosispotassium
Journal Article 2018-11-08 ✓ 1 Snippet Metz KA, Teng X, Coppens I, Lamb HM, Wagner BE, Rosenfeld JA, Chen X, Zhang Y, Kim HJ, Meadow ME, Wang TS, Haberlandt ED, Anderson GW, Leshinsky-Silver E, Bi W, Markello TC, Pratt M, Makhseed N, Garnica A, Danylchuk NR, Burrow TA, Jayakar P, McKnight D, Agadi S, Gbedawo H, Stanley C, Alber M, Prehl I, Peariso K, Ong MT, Mordekar SR, Parker MJ, Crooks D, Agrawal PB, Berry GT, Loddenkemper T, Yang Y, Maegawa GHB, Aouacheria A, Markle JG, Wohlschlegel JA, Hartman AL, Hardwick JM.
In-Text Gene Mentions

KLHL20

Show Full Abstract

<h4>Objective</h4>Several small case series identified KCTD7 mutations in patients with a rare autosomal recessive disorder designated progressive myoclonic epilepsy (EPM3) and neuronal ceroid lipofuscinosis (CLN14). Despite the name KCTD (potassium channel tetramerization domain), KCTD protein family members lack predicted channel domains. We sought to translate insight gained from yeast studies to uncover disease mechanisms associated with deficiencies in KCTD7 of unknown function.<h4>Methods</h4>Novel KCTD7 variants in new and published patients were assessed for disease causality using genetic analyses, cell-based functional assays of patient fibroblasts and knockout yeast, and electron microscopy of patient samples.<h4>Results</h4>Patients with KCTD7 mutations can exhibit movement disorders or developmental regression before seizure onset, and are distinguished from similar disorders by an earlier age of onset. Although most published KCTD7 patient variants were excluded from a genome sequence database of normal human variations, most newly identified patient variants are present in this database, potentially challenging disease causality. However, genetic analysis and impaired biochemical interactions with cullin 3 support a causal role for patient KCTD7 variants, suggesting deleterious alleles of KCTD7 and other rare disease variants may be underestimated. Both patient-derived fibroblasts and yeast lacking Whi2 with sequence similarity to KCTD7 have impaired autophagy consistent with brain pathology.<h4>Interpretation</h4>Biallelic KCTD7 mutations define a neurodegenerative disorder with lipofuscin and lipid droplet accumulation but without defining features of neuronal ceroid lipofuscinosis or lysosomal storage disorders. KCTD7 deficiency appears to cause an underlying autophagy-lysosome defect conserved in yeast, thereby assigning a biological role for KCTD7. Ann Neurol 2018;84:774-788.

Also flagged:Ferroptosisirondeathlipidoxygencancer
Journal Article 2018-11-08 ✓ 2 Snippets Weiland A, Wang Y, Wu W, Lan X, Han X, Li Q, Wang J.
In-Text Gene Mentions

PEBP1

htt

Show Full Abstract

Ferroptosis is a recently identified, iron-regulated, non-apoptotic form of cell death. It is characterized by cellular accumulation of lipid reactive oxygen species that ultimately leads to oxidative stress and cell death. Although first identified in cancer cells, ferroptosis has been shown to have significant implications in several neurologic diseases, such as ischemic and hemorrhagic stroke, Alzheimer's disease, and Parkinson's disease. This review summarizes current research on ferroptosis, its underlying mechanisms, and its role in the progression of different neurologic diseases. Understanding the role of ferroptosis could provide valuable information regarding treatment and prevention of these devastating diseases.

Also flagged:Gene expressioncell surfaceextracellularcell adhesioncollagenchitosan
Journal Article 2018-11-08 No Snippets Li J, Chen T, Huang X, Zhao Y, Wang B, Yin Y, Cui Y, Zhao Y, Zhang R, Wang X, Wang Y, Dai J.
Show Full Abstract

Mesenchymal stem cells (MSCs) play important roles in tissue regeneration, and multi-lineage differentiation and immunomodulation are two major characteristics of MSCs that are utilized in stem cell therapy. MSCs in vivo have a markedly different three-dimensional (3D) niche compared to the traditional two-dimensional (2D) culture in vitro. A 3D scaffold is predicted to provide an artificial 3D environment similar to the in vivo environment. Significant changes in MSC differentiation are shown to be occurred when under 3D culture. However, the immunomodulatory characteristics of MSCs under 3D culture remain unknown. In this study, 3D culture systems were constructed using different substrates to evaluate the common immunomodulatory characteristics of MSCs. Compared to the MSCs under 2D culture, the MSCs under 3D culture, which had higher stemness and maintained cell phenotype, showed altered immunophenotypic pattern. Gene expression profile analysis at mRNA and protein level detected by gene chip and protein chip, respectively, further revealed the difference between 3D cultured MSCs and 2D cultured MSCs, which was mainly concentrated in the immunoregulation related aspects. Moreover, the immunoregulatory role of 3D culture was confirmed by our immunosuppressive experiments. These findings demonstrated that the immunomodulatory capacities of MSCs were enhanced by the 3D geometry of substrates.

Also flagged:Thymic Stromal LymphopoietinOX40extracellularvesiclesimmune responseasthma
Journal Article 2018-11-08 No Snippets Huang L, Zhang X, Wang M, Chen Z, Yan Y, Gu W, Tan J, Jiang W, Ji W.
Show Full Abstract

<h4>Objectives</h4>Exosomes are extracellular vesicles released from various inflammatory cells, such as T cells, B cells, dendritic cells (DCs), and mast cells, which have been implicated in the modulation of immune response in asthma. This study aimed to investigate whether exosomes from DCs activated by thymic stromal lymphopoietin (TSLP) play a role in T-helper cell differentiation through the OX40 ligand (OX40L).<h4>Methods</h4>Serum samples from patients with asthma were collected to measure the levels of OX40L, T-helper type 1 (Th1) cytokine interferon (IFN)-γ, and T-helper type 2 (Th2) cytokine interleukin (IL)-4 by enzyme-linked immunosorbent assay (ELISA). Exosomes were isolated from TSLP-activated DCs and co-cultured with CD4+ T cells. Western blot and ELISA assays were used to measure the levels of OX40L, IFN-γ, and IL-4 in DCs and CD4+ T cells. Flow cytometry was applied to detect Th1 and Th2 cells.<h4>Results</h4>OX40L and IL-4 were increased and IFN-γ was decreased in serum from asthmatic patients compared with healthy controls. TSLP induced DCs to express OX40L in released exosomes, which could promote proliferation of CD4+ T cells, elevate the level of IL-4, and promote Th2 differentiation.<h4>Conclusion</h4>Blockade of OX40L in DC-derived exosomes could inhibit exosome-mediated CD4+ T proliferation and Th2 differentiation.

Also flagged:BPSnitric acidIronbathophenanthroline sulfonatetrichloroacetic acidhepcidin
Journal Article 2018-11-08 ✓ 1 Snippet Mercadante CJ, Prajapati M, Parmar JH, Conboy HL, Dash ME, Pettiglio MA, Herrera C, Bu JT, Stopa EG, Mendes P, Bartnikas TB.
In-Text Gene Mentions

Hemochromatosisis caused by…

Show Full Abstract

The current paradigm in the field of mammalian iron biology states that body iron levels are determined by dietary iron absorption, not by iron excretion. Iron absorption is a highly regulated process influenced by iron levels and other factors. Iron excretion is believed to occur at a basal rate irrespective of iron levels and is associated with processes such as turnover of intestinal epithelium, blood loss, and exfoliation of dead skin. Here we explore iron excretion in a mouse model of iron excess due to inherited transferrin deficiency. Iron excess in this model is attributed to impaired regulation of iron absorption leading to excessive dietary iron uptake. Pharmacological correction of transferrin deficiency not only normalized iron absorption rates and halted progression of iron excess but also reversed body iron excess. Transferrin treatment did not alter the half-life of <sup>59</sup>Fe in mutant mice. <sup>59</sup>Fe-based studies indicated that most iron was excreted via the gastrointestinal tract and suggested that iron-loaded mutant mice had increased rates of iron excretion. Direct measurement of urinary iron levels agreed with <sup>59</sup>Fe-based predictions that urinary iron levels were increased in untreated mutant mice. Fecal ferritin levels were also increased in mutant mice relative to wild-type mice. Overall, these data suggest that mice have a significant capacity for iron excretion. We propose that further investigation into iron excretion is warranted in this and other models of perturbed iron homeostasis, as pharmacological targeting of iron excretion may represent a novel means of treatment for diseases of iron excess.

Also flagged:FXRobeticholic acidobstructive cholestasisCholestasisBile acid receptorfarnesoid X-receptor
Journal Article 2018-11-08 ✓ 1 Snippet van Golen RF, Olthof PB, Lionarons DA, Reiniers MJ, Alles LK, Uz Z, de Haan L, Ergin B, de Waart DR, Maas A, Verheij J, Jansen PL, Damink SWO, Schaap FG, van Gulik TM, Heger M.
In-Text Gene Mentions

…prothrombin time andantithrombin-IIIactivity were not…

Show Full Abstract

Cholestasis impairs liver regeneration following partial liver resection (PHx). Bile acid receptor farnesoid X-receptor (FXR) is a key mediator of liver regeneration. The effects of FXR agonist obeticholic acid (OCA) on liver (re)growth were therefore studied in cholestatic rats. Animals underwent sham surgery or reversible bile duct ligation (rBDL). PHx with concurrent internal biliary drainage was performed 7 days after rBDL. Animals were untreated or received OCA (10 mg/kg/day) per oral gavage from rBDL until sacrifice. After 7 days of OCA treatment, dry liver weight increased in the rBDL + OCA group, indicating OCA-mediated liver growth. Enhanced proliferation in the rBDL + OCA group prior to PHx concurred with a rise in Ki67-positive hepatocytes, elevated hepatic Ccnd1 and Cdc25b expression, and an induction of intestinal fibroblast growth factor 15 expression. Liver regrowth after PHx was initially stagnant in the rBDL + OCA group, possibly due to hepatomegaly prior to PHx. OCA increased hepatobiliary injury markers during BDL, which was accompanied by upregulation of the bile salt export pump. There were no differences in histological liver injury. In conclusion, OCA induces liver growth in cholestatic rats prior to PHx but exacerbates biliary injury during cholestasis, likely by forced pumping of bile acids into an obstructed biliary tree.

Also flagged:genetic disorderscomplex disorderslifestyle disordersobesitytype 2 diabetesDiabetes
Journal Article 2018-11-08 No Snippets John SE, Antony D, Eaaswarkhanth M, Hebbar P, Channanath AM, Thomas D, Devarajan S, Tuomilehto J, Al-Mulla F, Alsmadi O, Thanaraj TA.
Show Full Abstract

Consanguineous populations of the Arabian Peninsula have been underrepresented in global efforts that catalogue human exome variability. We sequenced 291 whole exomes of unrelated, healthy native Arab individuals from Kuwait to a median coverage of 45X and characterised 170,508 single-nucleotide variants (SNVs), of which 21.7% were 'personal'. Up to 12% of the SNVs were novel and 36% were population-specific. Half of the SNVs were rare and 54% were missense variants. The study complemented the Greater Middle East Variome by way of reporting many additional Arabian exome variants. The study corroborated Kuwaiti population genetic substructures previously derived using genome-wide genotype data and illustrated the genetic relatedness among Kuwaiti population subgroups, Middle Eastern, European and Ashkenazi Jewish populations. The study mapped 112 rare and frequent functional variants relating to pharmacogenomics and disorders (recessive and common) to the phenotypic characteristics of Arab population. Comparative allele frequency data and carrier distributions of known Arab mutations for 23 disorders seen among Arabs, of putative OMIM-listed causal mutations for 12 disorders observed among Arabs but not yet characterized for genetic basis in Arabs, and of 17 additional putative mutations for disorders characterized for genetic basis in Arab populations are presented for testing in future Arab studies.

Also flagged:benign prostatic hyperplasiaPSAprostate cancerprostate specific antigenbladder outlet obstructiondepression
Journal Article 2018-11-08 No Snippets Gudmundsson J, Sigurdsson JK, Stefansdottir L, Agnarsson BA, Isaksson HJ, Stefansson OA, Gudjonsson SA, Gudbjartsson DF, Masson G, Frigge ML, Stacey SN, Sulem P, Halldorsson GH, Tragante V, Holm H, Eyjolfsson GI, Sigurdardottir O, Olafsson I, Jonsson T, Jonsson E, Barkardottir RB, Hilmarsson R, Asselbergs FW, Geirsson G, Thorsteinsdottir U, Rafnar T, Thorleifsson G, Stefansson K.
Show Full Abstract

Benign prostatic hyperplasia and associated lower urinary tract symptoms (BPH/LUTS) are common conditions affecting the majority of elderly males. Here we report the results of a genome-wide association study of symptomatic BPH/LUTS in 20,621 patients and 280,541 controls of European ancestry, from Iceland and the UK. We discovered 23 genome-wide significant variants, located at 14 loci. There is little or no overlap between the BPH/LUTS variants and published prostate cancer risk variants. However, 15 of the variants reported here also associate with serum levels of prostate specific antigen (PSA) (at a Bonferroni corrected P < 0.0022). Furthermore, there is a strong genetic correlation, r<sub>g</sub> = 0.77 (P = 2.6 × 10<sup>-11</sup>), between PSA and BPH/LUTS, and one standard deviation increase in a polygenic risk score (PRS) for BPH/LUTS increases PSA levels by 12.9% (P = 1.6×10<sup>-55</sup>). These results shed a light on the genetic background of BPH/LUTS and its substantial influence on PSA levels.

Also flagged:DISC1psychiatric illnessmental illnessNGN2UNC5DDPP10
Journal Article 2018-11-08 ✓ 5 Snippets Srikanth P, Lagomarsino VN, Pearse RV, Liao M, Ghosh S, Nehme R, Seyfried N, Eggan K, Young-Pearse TL.
In-Text Gene Mentions

Prior studies have used expression of ASCL1, POU3F2, and MYTL to generate mature neurons from cells containing autism and psychiatric disease risk variants22,23.

…expression of ASCL1,POU3F2, and MYTL to…

…the netrin receptorDCC, and modulates DCC…

…DCC, and modulatesDCCsignaling.…

…to interact withDCCto mediate repulsive…

Show Full Abstract

The identification of convergent phenotypes in different models of psychiatric illness highlights robust phenotypes that are more likely to be implicated in disease pathophysiology. Here, we utilize human iPSCs harboring distinct mutations in DISC1 that have been found in families with major mental illness. One mutation was engineered to mimic the consequences on DISC1 protein of a balanced translocation linked to mental illness in a Scottish pedigree; the other mutation was identified in an American pedigree with a high incidence of mental illness. Directed differentiation of these iPSCs using NGN2 expression shows rapid conversion to a homogenous population of mature excitatory neurons. Both DISC1 mutations result in reduced DISC1 protein expression, and show subtle effects on certain presynaptic proteins. In addition, RNA sequencing and qPCR showed decreased expression of UNC5D, DPP10, PCDHA6, and ZNF506 in neurons with both DISC1 mutations. Longitudinal analysis of neurite outgrowth revealed decreased neurite outgrowth in neurons with each DISC1 mutation, which was mimicked by UNC5D knockdown and rescued by transient upregulation of endogenous UNC5D. This study shows a narrow range of convergent phenotypes of two mutations found in families with major mental illness, and implicates dysregulated netrin signaling in DISC1 biology.

Also flagged:cocainenucleusphosphorylationbehavioralserinesyntaxin 1a
Journal Article 2018-11-08 No Snippets Torregrossa MM, MacDonald M, Stone KL, Lam TT, Nairn AC, Taylor JR.
Show Full Abstract

<h4>Rationale</h4>Environmental stimuli, or cues, associated with the use of drugs such as cocaine are one of the primary drivers of relapse. Thus, identifying mechanisms to reduce the motivational properties of drug cues is an important research goal.<h4>Objectives</h4>The purpose of this study was to identify cellular signaling events in the nucleus accumbens (NAc) that are induced when a cocaine cue memory is either extinguished through repeated cue presentation in the absence of drug, or when the memory is reactivated and reconsolidated by a brief cue re-exposure. Signaling events specific to extinction or reconsolidation represent potential targets for pharmacotherapeutics that may enhance extinction or disrupt reconsolidation to reduce the likelihood of relapse.<h4>Methods</h4>Male Sprague-Dawley rats were trained to self-administer cocaine paired with an audiovisual cue. Following a period of self-administration, the memory for the cocaine-associated cue was either extinguished, reactivated, or not manipulated (control) 15 min before sacrifice. Tissue from the NAc was subsequently analyzed using mass spectrometry based phosphoproteomics to identify cellular signaling events induced by each condition.<h4>Results</h4>Extinction and reconsolidation of the cocaine cue memory produced both common and distinct changes in protein phosphorylation. Notably, there were no significant changes in protein phosphorylation that were modulated in the opposite direction by the two behavioral conditions. Comparison of NAc phosphoproteomic changes to previously identified changes in the basolateral amygdala (BLA) revealed that cue extinction increases phosphorylation at serine (S) 883 of the GABA<sub>B</sub> receptor subunit 2 and on S14 of syntaxin 1a in both regions, while no common regional signaling events were identified in the reconsolidation group.<h4>Conclusions</h4>Phosphoproteomics is a useful tool for identifying signaling cascades involved in different memory processes and revealed novel potential targets for selectively targeting extinction versus reconsolidation of a cocaine cue memory. Furthermore, cross region analysis suggests that cue extinction may produce unique signaling events associated with increased inhibitory signaling.

Also flagged:neuropsychiatric disorderspsychiatric disorders
Journal Article 2018-11-08 ✓ 1 Snippet Kreuzer PM, Downar J, de Ridder D, Schwarzbach J, Schecklmann M, Langguth B.
In-Text Gene Mentions

…ill scarce.<h4>Conclusion</h4>DCCstimulation over the…

Show Full Abstract

<h4>Background</h4>Repetitive transcranial magnetic stimulation (rTMS) has become increasingly popular during the last decades mainly driven by the antidepressant effects of dorsolateral prefrontal cortex stimulation with "butterfly" coils. Only recently, alternative targets such as the dorsomedial prefrontal cortex (dmPFC) have been brought into focus and innovative coil designs such as the angled geometry of the double cone coil (DCC) have raised hope to reach even deeper located targets.<h4>Objective</h4>To provide a systematic and comprehensive review on the application of rTMS stimulation of the dmPFC using the DCC in neuropathological and healthy samples.<h4>Methods</h4>We systematically searched the MEDLINE® database (http://www.ncbi.nlm.nih.gov/pubmed/). Due to the heterogeneous naming of DCC stimulation over the dmPFC a variety of search terms was applied resulting in a numeral quantity of 340 hits.<h4>Results</h4>DCC stimulation over the dmPFC has been proven to be safe and feasible in various neuropsychiatric disorders and in healthy subjects. Clinical results are encouraging, but have to be considered as preliminary as data from sham-controlled clinical trials and knowledge about the neurobiological underpinnings are still scarce.<h4>Conclusion</h4>DCC stimulation over the dmPFC represents a promising approach in the fast evolving noninvasive brain stimulation techniques aiming at the functional modulation of brain areas vitally involved in affect, sensory autonomic, cognitive, and salience regulation. This may hold potential for both neuroscientific research and clinical applications in the treatment of psychiatric disorders.

Also flagged:hydroxyapatitecell adhesionosteosarcomacell proliferationimmune responseprions
Journal Article 2018-11-08 No Snippets Turco G, Porrelli D, Marsich E, Vecchies F, Lombardi T, Stacchi C, Di Lenarda R.
Show Full Abstract

<h4>Background</h4>Bone substitutes, either from human (autografts and allografts) or animal (xenografts) sources, suffer from inherent drawbacks including limited availability or potential infectivity to name a few. In the last decade, synthetic biomaterials have emerged as a valid alternative for biomedical applications in the field of orthopedic and maxillofacial surgery. In particular, phosphate-based bone substitution materials have exhibited a high biocompatibility due to their chemical similitude with natural hydroxyapatite. Besides the nature of the biomaterial, its porous and interconnected architecture is essential for a correct osseointegration. This performance could be predicted with an extensive characterization of the biomaterial in vitro.<h4>Methods</h4>In this study, we compared the biological, chemical, and structural features of four different commercially available bone substitutes derived from an animal or a synthetic source. To this end, µ-CT and SEM were used to describe the biomaterials structure. Both FTIR and EDS analyses were carried out to provide a chemical characterization. The results obtained by these techniques were correlated with cell adhesion and proliferation of the osteosarcoma MG-63 human cell line cultured in vitro.<h4>Results</h4>The findings reported in this paper indicate a significant influence of both the nature and the structure of the biomaterials in cell adhesion and proliferation, which ultimately could affect the clinical performance of the biomaterials.<h4>Conclusions</h4>The four commercially available bone substitutes investigated in this work significantly differed in terms of structural features, which ultimately influenced in vitro cell proliferation and may so affect the clinical performance of the biomaterials.

Also flagged:Ginkgolic AcidSumoylationagingspecificity protein1Sp1Peroxiredoxin 6
Journal Article 2018-11-08 ✓ 5 Snippets Chhunchha B, Singh P, Singh DP, Kubo E.
In-Text Gene Mentions

…Signaling by RevivingPrdx6and Sp1 Expression…

…as Peroxiredoxin 6 (Prdx6), resulting in cellular…

…increased Sp1 andPrdx6expression by disrupting…

…GC-boxes in thePrdx6promoter and upregulated…

…s-evoked dysregulation of Sp1/Prdx6protective molecules.…

Show Full Abstract

Sumoylation is a downstream effector of aging/oxidative stress; excess oxidative stress leads to dysregulation of a specificity protein1 (Sp1) and its target genes, such as Peroxiredoxin 6 (Prdx6), resulting in cellular damage. To cope with oxidative stress, cells rely on a signaling pathway involving redox-sensitive genes. Herein, we examined the therapeutic efficacy of the small molecule Ginkgolic acid (GA), a Sumoylation antagonist, to disrupt aberrant Sumoylation signaling in human and mouse lens epithelial cells (LECs) facing oxidative stress or aberrantly expressing Sumo1 (small ubiquitin-like modifier). We found that GA globally reduced aberrant Sumoylation of proteins. In contrast, Betulinic acid (BA), a Sumoylation agonist, augmented the process. GA increased Sp1 and Prdx6 expression by disrupting the Sumoylation signaling, while BA repressed the expression of both molecules. In vitro DNA binding, transactivation, Sumoylation and expression assays revealed that GA enhanced Sp1 binding to GC-boxes in the Prdx6 promoter and upregulated its transcription. Cell viability and intracellular redox status assays showed that LECs pretreated with GA gained resistance against oxidative stress-driven aberrant Sumoylation signaling. Overall, our study revealed an unprecedented role for GA in LECs and provided new mechanistic insights into the use of GA in rescuing LECs from aging/oxidative stress-evoked dysregulation of Sp1/Prdx6 protective molecules.

Also flagged:embryogenesisethylene glycolcell proliferationpeptidesortase Adegradation
Journal Article 2018-11-08 No Snippets Arkenberg MR, Moore DM, Lin CC.
Show Full Abstract

Cell-laden hydrogels whose crosslinking density can be dynamically and reversibly tuned are highly sought-after for studying pathophysiological cellular fate processes, including embryogenesis, fibrosis, and tumorigenesis. Special efforts have focused on controlling network crosslinking in poly(ethylene glycol) (PEG) based hydrogels to evaluate the impact of matrix mechanics on cell proliferation, morphogenesis, and differentiation. In this study, we sought to design dynamic PEG-peptide hydrogels that permit cyclic/reversible stiffening and softening. This was achieved by utilizing reversible enzymatic reactions that afford specificity, biorthogonality, and predictable reaction kinetics. To that end, we prepared PEG-peptide conjugates to enable sortase A (SrtA) induced tunable hydrogel crosslinking independent of macromer contents. Uniquely, these hydrogels can be completely degraded by the same enzymatic reactions and the degradation rate can be tuned from hours to days. We further synthesized SrtA-sensitive peptide linker (i.e., KCLPRTGCK) for crosslinking with 8-arm PEG-norbornene (PEG8NB) via thiol-norbornene photocrosslinking. These hydrogels afford diverse softening paradigms through control of network structures during crosslinking or by adjusting enzymatic parameters during on-demand softening. Importantly, user-controlled hydrogel softening promoted spreading of human mesenchymal stem cells (hMSCs) in 3D. Finally, we designed a bis-cysteine-bearing linear peptide flanked with SrtA substrates at the peptide's N- and C-termini (i.e., NH<sub>2</sub>-GGGCKGGGKCLPRTG-CONH<sub>2</sub>) to enable cyclic/reversible hydrogel stiffening/softening. We show that matrix stiffening and softening play a crucial role in growth and chemoresistance in pancreatic cancer cells. These results represent the first dynamic hydrogel platform that affords cyclic gel stiffening/softening based on reversible enzymatic reactions. More importantly, the chemical motifs that affords such reversible crosslinking were built-in on the linear peptide crosslinker without any post-synthesis modification. STATEMENT OF SIGNIFICANCE: Cell-laden 'dynamic' hydrogels are typically designed to enable externally stimulated stiffening or softening of the hydrogel network. However, no enzymatic reaction has been used to reversibly control matrix crosslinking. The application of SrtA-mediated transpeptidation in crosslinking and post-gelation modification of biomimetic hydrogels is innovative because of the specificity of the reaction and reversible tunability of crosslinking kinetics. While SrtA has been previously used to crosslink and fully degrade hydrogels, matrix softening and reversible stiffening of cell-laden hydrogels has not been reported. By designing simple peptide substrates, this unique enzymatic reaction can be employed to form a primary network, to gradually soften hydrogels, or to reversibly stiffen hydrogels. As a result, this dynamic hydrogel platform can be used to answer important matrix-related biological questions that are otherwise difficult to address.

Also flagged:autism spectrum disorderneurodevelopmental disorderNRG1schizophreniaworking memorypsychiatric disorder
Journal Article 2018-11-08 ✓ 1 Snippet Abbasy S, Shahraki F, Haghighatfard A, Qazvini MG, Rafiei ST, Noshadirad E, Farhadi M, Rezvani Asl H, Shiryazdi AA, Ghamari R, Tabrizi Z, Mehrfard R, Esmaili Kakroudi F, Azarnoosh M, Younesi F, Parsamehr N, Garaei N, Abyari S, Salehi M, Gholami M, Zolfaghari P, Bagheri SM, Pourmehrabi M, Rastegarimogaddam E, Nobakht E, Nobakht E, Partovi R.
In-Text Gene Mentions

Expression alteration of genes that are involved in serotonin pathway like 5-HTT [5], development and functions of nervous system like CNTNAP2 and transcription factors such as FOXP1 and FOXP2 were reported in ASD patients [6].

Show Full Abstract

<h4>Background</h4>Autism spectrum disorder (ASD) is a pediatric heterogeneous psychiatric and neurodevelopmental disorder with social and communication deficits, language impairment and ritualistic or repetitive behaviors. ASD has significant genetic bases but candidate genes and molecular mechanisms of disorder are not clarified. Neuregulin1 (NRG1) gene, located in 8p12 is involved in development of central nervous system and was indicated as candidate gene in schizophrenia.<h4>Methods</h4>mRNA level of types I, II and III of NRG1 gene were studied in peripheral blood of 1540 ASD patients (IQ > 70) and 1490 control children by quantitative Real Time PCR. Also three domains of executive functions (working memory, response inhibition and vigilance) were examined in all subjects.<h4>Findings</h4>All three types were significantly down regulated in ASD patients. Significant deficiencies in executive functions (EF) were found in ASD patients. EF deficiencies mostly were associated with down expression of mRNA level of types I and III. Also correlations were found between NRG1 expression with gender and severity of ASD symptoms.<h4>Interpretations</h4>Findings primarily have been suggested involvement of NRG1 in etiology of ASD. Also correlation of NRG1 mRNA level with EF deficiencies could shed lights on EF mechanisms and may suggest targeted treatments to improve particular executive functions. FUND: Young researchers and elites club funded the project due to the annual grant of special talents of Club that gave to Arvin Haghighatfard.

Also flagged:DeubiquitinaseUSP46TumorE6 oncoproteinscell proliferationE6
Journal Article 2018-11-08 No Snippets Kiran S, Dar A, Singh SK, Lee KY, Dutta A.
Show Full Abstract

High-risk human papilloma viruses (HPVs) cause cervical, anal, and oropharyngeal cancers, unlike the low-risk HPVs, which cause benign lesions. E6 oncoproteins from the high-risk strains are essential for cell proliferation and transformation in HPV-induced cancers. We report that a cellular deubiquitinase, USP46, is selectively recruited by the E6 of high-risk, but not low-risk, HPV to deubiqutinate and stabilize Cdt2/DTL. Stabilization of Cdt2, a component of the CRL4<sup>Cdt2</sup> E3 ubiquitin ligase, limits the level of Set8, an epigenetic writer, and promotes cell proliferation. USP46 is essential for the proliferation of HPV-transformed cells, but not of cells without HPV. Cdt2 is elevated in human cervical cancers and knockdown of USP46 inhibits HPV-transformed tumor growth in xenografts. Recruitment of a cellular deubiquitinase to stabilize key cellular proteins is an important activity of oncogenic E6, and the importance of E6-USP46-Cdt2-Set8 pathway in HPV-induced cancers makes USP46 a target for the therapy of such cancers.

Also flagged:narcolepsyEDScataplexysleep disorderhypocretinHcrt
Journal Article 2018-11-08 No Snippets Szabo ST, Thorpy MJ, Mayer G, Peever JH, Kilduff TS.
Show Full Abstract

Excessive daytime sleepiness (EDS) and cataplexy are common symptoms of narcolepsy, a sleep disorder associated with the loss of hypocretin/orexin (Hcrt) neurons. Although only a few drugs have received regulatory approval for narcolepsy to date, treatment involves diverse medications that affect multiple biochemical targets and neural circuits. Clinical trials have demonstrated efficacy for the following classes of drugs as narcolepsy treatments: alerting medications (amphetamine, methylphenidate, modafinil/armodafinil, solriamfetol [JZP-110]), antidepressants (tricyclic antidepressants, selective serotonin reuptake inhibitors, serotonin-norepinephrine reuptake inhibitors), sodium oxybate, and the H<sub>3</sub>-receptor inverse agonist/antagonist pitolisant. Enhanced catecholamine availability and regulation of locus coeruleus (LC) norepinephrine (NE) neuron activity is likely central to the therapeutic activity of most of these compounds. LC NE neurons are integral to sleep/wake regulation and muscle tone; reduced excitatory input to the LC due to compromise of Hcrt/orexin neurons (likely due to autoimmune factors) results in LC NE dysregulation and contributes to narcolepsy/cataplexy symptoms. Agents that increase catecholamines and/or LC activity may mitigate EDS and cataplexy by elevating NE regulation of GABAergic inputs from the amygdala. Consequently, novel medications and treatment strategies aimed at preserving and/or modulating Hcrt/orexin-LC circuit integrity are warranted in narcolepsy/cataplexy.

Also flagged:Hepatocellular carcinomachronic liver diseasePrimary liver tumorscholangiocarcinomatumorsextrahepatic tumors
Journal Article 2018-11-08 ✓ 2 Snippets Quaglia A.
In-Text Gene Mentions

…patients with genetichemochromatosis, 33 areas of…

…(eg, viral hepatitis,hemochromatosis) without eliminating the…

Show Full Abstract

Histopathologists retain a critical role in the diagnosis and management of hepatocellular carcinoma (HCC). HCC arises usually but not exclusively in a background of advanced-stage chronic liver disease. The histological diagnosis of HCC poses many challenges particularly when dealing with liver biopsy specimens due to the heterogeneity of HCC and the difficulty to confirm hepatocellular differentiation in some instances. Primary liver tumors should be considered as a continuum with typical hepatocellular and cholangiocarcinoma at the two ends and a whole range of tumors showing both hepatocellular and cholangiocellular differentiation with or without an associated progenitor/stem cell component in the middle. Characterization of combined (or mixed) hepatocellular-cholangiocarcinoma can be very challenging. In advanced-stage chronic liver disease, the main challenge for the histopathologist is still to differentiate between HCC and its precursors, although this is rarely critical in the clinical setting at present. HCC originating in non-cirrhotic livers needs to be differentiated from other primary and extrahepatic tumors and from hepatocellular adenoma, bearing in mind that progression to malignancy is more through a continuum that watertight histological categories.

Also flagged:ZNF121ZBRK1BRCA1zinc finger protein 121MYCcell proliferation
Journal Article 2018-11-08 No Snippets Luo A, Zhang K, Zhao Y, Zhu Z, Fu L, Dong JT.
Show Full Abstract

The novel zinc finger protein 121 (ZNF121) has been demonstrated to physically and functionally associate with the MYC oncoprotein to regulate cell proliferation and likely breast cancer development. To further understand how ZNF121 functions in cell proliferation and carcinogenesis, we identified and characterized the interaction of ZNF121 with zinc finger and BRCA1-interacting protein with a KRAB domain 1 (ZBRK1), a breast and ovarian cancer susceptibility protein 1 (BRCA1)-interacting protein, using the yeast two-hybrid assay and other approaches. We also found that ZNF121 bound to BRCA1. Functionally, ZFN121 suppressed the expression of ANG1 and HMGA2, two common downstream targets of ZBRK1 and BRCA1. Interestingly, ZNF121 also regulated the expression of BRCA1 and ZBRK1. These findings suggest that ZNF121 is likely a member of the BRCA1/CtIP/ZBRK1 repressor complex that plays a role in breast cancer.

Also flagged:Prostaglandin I2 SynthaseArachidonic Acidcytochrome P450CYPoxygenasestumor
Journal Article 2018-11-08 ✓ 5 Snippets Russo A, Biselli-Chicote PM, Kawasaki-Oyama RS, Castanhole-Nunes MMU, Maniglia JV, de Santi Neto D, Pavarino ÉC, Goloni-Bertollo EM.
In-Text Gene Mentions

PTGIS protein showed significantly reduced expression in OSCC (median: OSCC = 1.58 ng/μL vs. non-tumor = 2.80 ng/μL; p = 0.0156) (Figure 3).

Therefore, reduced expression of genes encoding MAOB, CYP2E1 CYP2R1, PTGIS, and CYP27B1, which are involved in oxidative stress, could modulate the intracellular balance of ROS/antioxidants and the risk for OSCC development.

In the present study, differential expression was observed for 12 genes in OSCC compared to adjacent non-tumor tissues. CYP27A1, CYP2E1, CYP2R1, CYP2J2, CYP2U1, CYP4F12, CYP4X1, CYP4B1, PTGIS or CYP8A1, ALOX12, and MAOB genes presented reduced expression, while the CYP27B1 gene showed increased expression in OSCC.

Regarding clinical and histopathological parameters of tumor we did not find statistical significance between reduced expression of CYP27A1, CYP2E1, CYP2R1, CYP2J2, CYPU1, CYP4F12, CYP4X1, CYP4B1, PTGIS, ALOX12, and MAOB genes and increased expression of CYP27B1 gene with tumor extension, nodal metastasis, and tumor progression in OSCC development.

Studies have shown that the PTGIS enzyme is associated with the progression of cancer [61, 62].

Show Full Abstract

<h4>Introduction</h4>Differential expression of genes encoding cytochrome P450 (CYP) and other oxygenases enzymes involved in biotransformation mechanisms of endogenous and exogenous compounds can lead to oral tumor development.<h4>Objective</h4>We aimed to identify the expression profile of these genes, searching for susceptibility biomarkers in oral squamous cell carcinoma.<h4>Patients and methods</h4>Sixteen oral squamous cell carcinoma samples were included in this study (eight tumor and eight adjacent non-tumor tissues). Gene expression quantification was performed using TaqMan Array Human CYP450 and other Oxygenases 96-well plate (Applied Biosystems) by real time qPCR. Protein quantification was performed by ELISA and IHC methods. Bioinformatics tools were used to find metabolic pathways related to the enzymes encoded by differentially expressed genes. <i>Results. CYP27B1, CYP27A1, CYP2E1, CYP2R1, CYP2J2, CYP2U1, CYP4F12, CYP4X1, CYP4B1, PTGIS, ALOX12,</i> and <i>MAOB</i> genes presented differential expression in the oral tumors. After correction by multiple tests, only the <i>PTGIS (Prostaglandin I2 Synthase)</i> gene presented significant differential expression (P < 0.05). The PTGIS gene and protein were reduced in oral tumors.<h4>Conclusion</h4>PTGIS presents downexpression in oral tumors. PTGIS play an important role in the arachidonic acid metabolism. Arachidonic acid and/or metabolites are derived from this pathway, which can influence the regulation of important physiological mechanisms in tumorigenesis process.

Also flagged:HNF1Bgene expressionProstate cancercancerandrogen receptorAR
Journal Article 2018-11-08 ✓ 5 Snippets Dan C, Zhang H, Zeng W, Huang L, Gong X, Li H, Yang E, Wang L, Yao Q.
In-Text Gene Mentions

In the present study, the regulatory role of HNF1B in enoyl-CoA-(Δ) isomerase 2 (ECI2) expression in the transgenic adenocarcinoma of the mouse prostate (TRAMP) mouse model was investigated.

Notably, 18-week-old TRAMP+ mice exhibited marked downregulation of ECI2 expression levels (Fig. 2F) compared with 12-week-old TRAMP+ mice (Fig. 2B); however, this trend did not persist, with prominent overexpression of ECI2 evident as the tumor progressed further (Fig. 2H).

It was also reported that the increased expression levels of HNF1B in initial stages of the disease serve a tumor-protective role, although upon tumor progression its expression is downregulated and expression levels of ECI2 are upregulated.

Taken together, these results demonstrated that upon tumor progression, the initial tumor-protective effect of HNF1B is lost along with downregulated expression of HNF1B and increased expression of ECI2.

…HNF1B expression regulatesECI2gene expression, potentially…

Show Full Abstract

Prostate cancer is the most common form of cancer in men, with increased incidence rates observed in older individuals. Prostate cancer is primarily driven via activation of the androgen receptor (AR), the principal transcriptional factor governing prostate cancer cellular programming and its associated metabolism. One of the downstream targets of AR is hepatocyte nuclear factor-1β (HNF1B), an important oncogenic transcription factor in prostate cancer. In the present study, the regulatory role of HNF1B in enoyl-CoA-(Δ) isomerase 2 (ECI2) expression in the transgenic adenocarcinoma of the mouse prostate (TRAMP) mouse model was investigated. Using this model, tumor progression and associated pathological alterations at 12, 18 and 24 weeks were analyzed. Histological sectioning revealed pathological alterations over time, including thickening of glandular epithelial cells (12 weeks), increases in cellular proliferation (18 weeks), and extensive thickening and hardening of the tissue layer (24 weeks). Expression levels of HNF1B and ECI2 proteins were validated by immunohistochemistry and western blotting at different stages of prostate cancer development. HNF1B and ECI2 exhibited minimal differences in protein expression at 12 weeks in TRAMP<sup>+</sup> mice. However, by 18 weeks, TRAMP<sup>+</sup> mice exhibited multi-fold increases in HNF1B expression levels, along with downregulation of ECI2. These effects were reversed at 24 weeks, indicating an important time-dependent regulation of gene expression. Taken together, these results demonstrated that upon tumor progression, the initial tumor-protective effect of HNF1B is lost along with downregulated expression of HNF1B and increased expression of ECI2.

Also flagged:Gene expressionAsthmachronic inflammatory disorderresponse tocorticosteroidsT-cell development
Journal Article 2018-11-07 No Snippets Alrashoudi RH, Crane IJ, Wilson HM, Al-Alwan M, Alajez NM.
Show Full Abstract

Asthma is a chronic inflammatory disorder associated with airway hyper-responsiveness. Although a number of studies have investigated asthma at the molecular level, the molecular immune signatures associated with asthma severity or with the response to corticosteroids are still being unraveled. The present study integrated four asthma-related gene expression datasets from the Gene Expression Omnibus and identified immune-gene signatures associated with asthma development, severity, or response to treatment. Normal and mild asthmatic patients clustered separately from the severe asthma group, suggesting substantial progression-related changes in gene expression. Pathway analysis of up-regulated severe asthma-related genes identified multiple cellular processes, such as polymorphism, T-cell development, and transforming growth factor-β signaling. Comparing gene expression profiles of bronchoalveolar lavage cells in response to corticosteroid treatment, showed substantial reductions in genes related to the inflammatory response, including tumor necrosis factor signaling in the corticosteroid sensitive versus resistant patients, suggesting a defective immune response to corticosteroids. The data highlight the multifactorial nature of asthma, but revealed no significant overlap with the gene expression profiles from different datasets interrogated in current studies. The presented profile suggests that genes involved in asthma progression are different from those involved in the response to corticosteroids and this could affect the clinical management of different groups of patients with asthma.

Also flagged:tyrosine kinasetriple-negative breast cancerAXLMEThuman epidermal growth factor receptor-2HER2
Journal Article 2018-11-07 ✓ 5 Snippets Shen Y, Zhang W, Liu J, He J, Cao R, Chen X, Peng X, Xu H, Zhao Q, Zhong J, Ding W, Lei X, Jiang Y, Zu X.
In-Text Gene Mentions

Mechanistically, DCC-2036 targeted AXL/MET, especially AXL, and regulated the downstream PI3K/Akt-NFκB signaling to exert its antitumor effect in TNBC.

Furthermore, DCC-2036 significantly inhibited tumor growth and invasion of AXL/MET-high TNBC PDX tumors but not AXL/MET-low TNBC PDX tumors.

Our study confirmed that DCC-2036 inhibited the proliferation, invasion, migration and epithelial-mesenchymal transition (EMT) of TNBC cells as well as induced apoptosis.

Therefore, DCC-2036 may be a potential compound to treat TNBC, especially for tumors with AXL/MET overexpression.

These results highlighted the roles of AXL/MET in cancer growth and metastasis and further verified that the critical targets of DCC-2036 are AXL and MET, especially AXL.

Show Full Abstract

Triple-negative breast cancer (TNBC) is insensitive to endocrine therapies and targeted therapies to human epidermal growth factor receptor-2 (HER2), estrogen receptor (ER) and progesterone receptor (PR). New targets and new targeted therapeutic drugs for TNBC are desperately needed. Our study confirmed that DCC-2036 inhibited the proliferation, invasion, migration and epithelial-mesenchymal transition (EMT) of TNBC cells as well as induced apoptosis. Moreover, the antiproliferative activity of DCC-2036 was more efficient than that of most clinical drugs. In addition, the combination of DCC-2036 and cisplatin or lapatinib had synergistic effects on TNBC cells. Mechanistically, DCC-2036 targeted AXL/MET, especially AXL, and regulated the downstream PI3K/Akt-NFκB signaling to exert its antitumor effect in TNBC. DCC-2036 also inhibited the growth and metastasis of xenografted MDA-MB-231 cells (AXL/MET-high TNBC cells) but not MDA-MB-468 cells (AXL-low TNBC cells) in NSG mice in vivo. Furthermore, DCC-2036 significantly inhibited tumor growth and invasion of AXL/MET-high TNBC PDX tumors but not AXL/MET-low TNBC PDX tumors. These results highlighted the roles of AXL/MET in cancer growth and metastasis and further verified that the critical targets of DCC-2036 are AXL and MET, especially AXL. In addition, there was no significant toxicity of DCC-2036 even at a high dosage. Therefore, DCC-2036 may be a potential compound to treat TNBC, especially for tumors with AXL/MET overexpression.

Also flagged:Phenolic Acidssynthesisdendrimerswatermembranevesicles
Journal Article 2018-11-07 No Snippets Buzzacchera I, Xiao Q, Han H, Rahimi K, Li S, Kostina NY, Toebes BJ, Wilner SE, Möller M, Rodriguez-Emmenegger C, Baumgart T, Wilson DA, Wilson CJ, Klein ML, Percec V.
Show Full Abstract

Natural, including plant, and synthetic phenolic acids are employed as building blocks for the synthesis of constitutional isomeric libraries of self-assembling dendrons and dendrimers that are the simplest examples of programmed synthetic macromolecules. Amphiphilic Janus dendrimers are synthesized from a diversity of building blocks including natural phenolic acids. They self-assemble in water or buffer into vesicular dendrimersomes employed as biological membrane mimics, hybrid and synthetic cells. These dendrimersomes are predominantly uni- or multilamellar vesicles with size and polydispersity that is predicted by their primary structure. However, in numerous cases, unilamellar dendrimersomes completely free of multilamellar assemblies are desirable. Here, we report the synthesis and structural analysis of a library containing 13 amphiphilic Janus dendrimers containing linear and branched alkyl chains on their hydrophobic part. They were prepared by an optimized iterative modular synthesis starting from natural phenolic acids. Monodisperse dendrimersomes were prepared by injection and giant polydisperse by hydration. Both were structurally characterized to select the molecular design principles that provide unilamellar dendrimersomes in higher yields and shorter reaction times than under previously used reaction conditions. These dendrimersomes are expected to provide important tools for synthetic cell biology, encapsulation, and delivery.

Also flagged:Serine proteaseDependence ReceptorstumourDeleted inColorectal Cancerchymotrypsin
Journal Article 2018-11-07 ✓ 5 Snippets McNair K, Forrest CM, Vincenten MCJ, Darlington LG, Stone TW.
In-Text Gene Mentions

DCC and neogenin are ‘dependence receptors’ regulating cell viability and survival depending on the presence of their primary ligands, the netrin family of extracellular, secreted proteins.52,53 DCC has received the most attention since, compared with normal cells surrounding an early cancerous growth, the expression of DCC is greatly reduced or absent in several forms of cancer and genetic changes such as gene mutation or loss of heterozygosity have been described by many groups.5,26,54–56 Its insertion into cells can inhibit proliferation and migration.3,57–59

The tumour suppressor protein Deleted in Colorectal Cancer (DCC) has been linked with a variety of cancer cells from which it is either absent or in which its concentration or activity is substantially below that in non-cancerous tissues.1–5 Its loss or dysfunction by genetic, epi-genetic or acute disruption may represent one of the several factors required for a normal cell to undergo transformation into a cancerous cell.6 We have recently reported that the cellular expression of DCC, as well as the structurally and functionally related molecule neogenin7–9 both of which are receptors for the secreted family of netrin proteins10 can be depleted by the mammalian serine protease chymotrypsin, which is present in the gastro-intestinal tract and systemic circulation, and by the bacterial chymotryptic enzyme subtilisin.11,12 The removal of DCC and neogenin was accompanied by increased motility and migration in several transformed cell lines including human neuroblastoma (SH-SY5Y) cells and the mammary adenocarcinoma lines MCF-7 and MDA-MB-231.

We have previously reported that two common serine proteases, endogenous mammalian chymotrypsin and bacterial subtilisin, reduce the expression of DCC and neogenin at low physiologically relevant concentrations, accompanied by increased cell migration.11 The present results confirm this finding and extend it to several cancer-derived cell lines and primary human mammary epithelial cells.

This plasmid contains the Cytomegalovirus (CMV) promoter, a strong constitutive promoter, the dcc gene flanked by 2 XhoI restriction sites, a polyadenylation signal (Poly A), Ampicillin resistance gene and Neomycin (Neo) resistance gene.

The human neuroblastoma line of SH-SY5Y cells was included as these cells normally have detectable levels of endogenous DCC.

Show Full Abstract

Expression of the tumour suppressor Deleted in Colorectal Cancer (DCC) and the related protein neogenin is reduced by the mammalian serine protease chymotrypsin or the bacterial serine protease subtilisin, with increased cell migration. The present work examines whether these actions are associated with changes in the expression of cadherins, β-catenin and vimentin, established markers of the Epithelial-Mesenchymal Transition (EMT) which has been linked with cell migration and tumour metastasis. The results confirm the depletion of DCC and neogenin and show that chymotrypsin and subtilisin also reduce expression of β-catenin in acutely prepared tissue sections but not in human mammary adenocarcinoma MCF-7 or MDA-MB-231 cells cultured in normal media, or primary normal human breast cells. A loss of β-catenin was also seen in low serum media but transfecting cells with a dcc-containing plasmid induced resistance. E-cadherin was not consistently affected but vimentin was induced by low serum-containing media and was increased by serine proteases in MCF-7 and MDA-MB-231 cells in parallel with increased wound closure. Vimentin might contribute to the promotion of cell migration. The results suggest that changes in EMT proteins depend on the cells or tissues concerned and do not parallel the expression of DCC and neogenin. The increased cell migration induced by serine proteases is not consistently associated with the expression of the EMT proteins implying either that the increased migration may be independent of EMT or supporting the view that EMT is not itself consistently related to migration. (241).

Also flagged:nicotine dependencemethylationHTR3BHTR3Anicotinebinding
Journal Article 2018-11-07 ✓ 1 Snippet Han H, Liu Q, Yang Z, Wang M, Ma Y, Cao L, Cui W, Yuan W, Payne TJ, Li L, Li MD.
In-Text Gene Mentions

…SLC6A4 or5-HTTis an important…

Show Full Abstract

Variants in serotonergic genes are implicated in nicotine dependence (ND) in subjects of European and African origin, but their involvement with smoking in Asians is largely unknown. Moreover, mechanisms underlying the ND risk-associated single-nucleotide polymorphisms (SNPs) in these genes are rarely investigated. The Fagerström Test for Nicotine Dependence (FTND) score was used to assess ND in 2616 male Chinese Han smokers. Both association and interaction analysis were used to examine the association of variants in the serotonergic genes with FTND. Further, expression and methylation quantitative trait loci (cis-mQTL) analysis was employed to determine the association of individual SNPs with the extent of methylation of each CpG locus. Individual SNP-based association analysis revealed that rs1176744 in HTR3B was marginally associated with FTND (p = 0.042). Haplotype-based association analysis found that one major haplotype, T-T-A-G, formed by SNPs rs3758987-rs4938056-rs1176744-rs2276305, located in the 5' region of HTR3B, showed a significant association with FTND (p = 0.00025). Further, a significant genetic interactive effect affecting ND was detected among SNPs rs10160548 in HTR3A, and rs3758987, rs2276305, and rs1672717 in HTR3B (p = 0.0074). Finally, we found four CpG sites (CpG_4543549, CpG_4543464, CpG_4543682, and CpG_4546888) to be significantly associated with three cis-mQTL SNPs (i.e., rs3758987, rs4938056, and rs1176744) located in our detected haplotype within HTR3B. In sum, we showed SNP rs1176744 (Tyr129Ser) to be associated with ND. Together with the SNPs rs3758987 and rs4938056 in HTR3B, they formed a major haplotype, which had significant association with ND. We further showed these SNPs contribute to ND through four methylated sites in HTR3B. All these findings suggest that variants in the serotonergic system play an important role in ND in the Chinese Han population. More importantly, these findings demonstrated that the involvement of this system in ND is through gene-by-gene interaction and methylation.

Also flagged:dendritogenesisdendritesendosomal sorting complex required for transportmembranedendriteESCRT-I
Journal Article 2018-11-07 ✓ 1 Snippet Firkowska M, Macias M, Jaworski J.
In-Text Gene Mentions

…expression levels ofDCC, a receptor for…

Show Full Abstract

The proper shape of dendritic arbors of different types of neurons determines their proper communication within neuronal networks. The shape of dendritic arbors is acquired during a complex and multistep process called dendritogenesis. In most cases, once proper morphology is achieved, it remains stable throughout the lifespan, with the exception of rare events during which dendrites are abruptly pruned. The endosomal sorting complex required for transport (ESCRT) is multisubunit machinery that is involved in various cellular processes when membrane scission is needed. ESCRT subcomplexes regulate dendrite pruning in Drosophila neurons. However, the contribution of ESCRT components to the dendritogenesis of mammalian neurons and control of dendrite stability remains poorly defined. In the present study, we found that ESCRT-0, ESCRT-I, ESCRT-II, and ESCRT-III and Vps4 are required for proper dendrite morphology under basal culture conditions and for accelerated dendritogenesis in response to phosphoinositide 3-kinase (PI3K) activation. The knockdown of Vps28 (ESCRT-I) and Vps25 (ESCRT-II) resulted in downregulation of the activity of mechanistic/mammalian target of rapamycin complex 1. We also demonstrated that Vps28, Vps24, and Vps25 are required for dendrite stabilization in mature neurons.

Also flagged:glucosylatedlactoseglucansucrasessucrosecarbohydrateoligosaccharide
Journal Article 2018-11-07 No Snippets Pham HTT, Boger MCL, Dijkhuizen L, Dijkhuizen L, van Leeuwen SS.
Show Full Abstract

Previously we structurally characterized five glucosylated lactose derivatives (F1-F5) with a degree of polymerization (DP) of 3-4 (GL34), products of Lactobacillus reuteri glucansucrases, with lactose and sucrose as substrates. Here, we show that these GL34 compounds are largely resistant to the hydrolytic activities of common carbohydrate-degrading enzymes. Also, the ability of single strains of gut bacteria, bifidobacteria, lactobacilli, and commensal bacteria, to ferment the GL34 compounds was studied. Bifidobacteria clearly grew better on the GL34 mixture than lactobacilli and commensal bacteria. Lactobacilli and the commensal bacteria Escherichia coli Nissle and Bacteroides thetaiotaomicron only degraded the F2 compound α-D-Glcp-(1 → 2)-[β-D-Galp-(1 → 4)-]D-Glcp, constituting around 30% w/w of GL34. Bifidobacteria digested more than one compound from the GL34 mixture, varying with the specific strain tested. Bifidobacterium adolescentis was most effective, completely degrading four of the five GL34 compounds, leaving only one minor constituent. GL34 thus represents a novel oligosaccharide mixture with (potential) synbiotic properties towards B. adolescentis, synthesized from cheap and abundantly available lactose and sucrose.

Also flagged:ATantithrombin (AT) deficiencydominant disordervenous thrombosispulmonary embolismAT deficiency
Journal Article 2018-11-07 ✓ 4 Snippets Kovac M, Mitic G, Mikovic Z, Mandic V, Miljic P, Mitrovic M, Tomic B, Bereczky Z.
In-Text Gene Mentions

SERPINC1) on the type of pregnancy related complications

…the AT gene (SERPINC1) on the type…

…mutations in theSERPINC1gene.…

…carriers of differentSERPINC1mutations, as the…

Show Full Abstract

<h4>Background</h4>Inherited antithrombin (AT) deficiency is a rare autosomal dominant disorder, caused by mutations in the SERPINC1 gene. The most common clinical presentation in AT deficient patients includes venous thrombosis and pulmonary embolism, while the association of AT deficiency and its effect on the development of pregnancy complications has been less studied. The aim of our research was to evaluate the effect of AT deficiency types, determined by genotyping, on pregnancy outcomes.<h4>Methods</h4>A retrospective cohort study included 28 women with AT deficiency, and their 64 pregnancies were analyzed.<h4>Results</h4>With regard to live birth rate, a significant difference was observed among women who were carriers of different SERPINC1 mutations, as the rate varied from 100% in cases of type I to the extremely low rate of 8% for women with type II HBS (AT Budapest 3) in the homozygous variant, P = 0.0005. All pregnancies from the type I group, even untreated ones, resulted in live births. In women with AT Budapest 3 in homozygous variant the overall live birth rate increased to 28.5% in the treated pregnancies. In this group the highest incidence of fetal death was observed of 62%; repeated fetal losses in 30%; fetal growth restriction in 22% and placental abruption in 7% of all pregnancies.<h4>Conclusion</h4>Our study results indicate a difference between type I and type II AT deficiency. The risk of pregnancy related VTE was equally present in both groups, except for AT Budapest 3 in the heterozygous variant, while adverse pregnancy outcomes were strictly related to type II, especially AT Budapest 3 in the homozygous variant.

Also flagged:mental illnessesneurological disordersschizophreniamajor depressive disordergenetic generalized epilepsypathogenesis
Journal Article 2018-11-07 ✓ 5 Snippets Li M, Yue W.
In-Text Gene Mentions

Recent large-scale genetic approaches, such as genome-wide association studies, have identified multiple genetic variations that contribute to the risk of mental illnesses, among which single nucleotide polymorphisms (SNPs) within or near the vaccinia related kinase 2 (<i>VRK2</i>) gene have gained consistent support for their correlations with multiple psychiatric and neurological disorders including schizophrenia (SCZ), major depressive disorder (MDD), and genetic generalized epilepsy.

These studies highlight the potential roles of <i>VRK2</i> in the central nervous system, and this gene therefore might be a good candidate to investigate the shared genetic and molecular basis between SCZ and MDD, as it is one of the few genes known to show genome-wide significant associations with both illnesses.

We believe that attention to this important gene is necessary, and further investigations of <i>VRK2</i> may provide hints into the underlying mechanisms of SCZ and MDD.

While the precise function of <i>VRK2</i> in these conditions remains unclear, preliminary evidence suggests that it may affect neuronal proliferation and migration via interacting with multiple essential signaling pathways involving other susceptibility genes/proteins for psychiatric disorders.

<i>VRK2</i>, a Candidate Gene for Psychiatric and Neurological Disorders.

Show Full Abstract

Recent large-scale genetic approaches, such as genome-wide association studies, have identified multiple genetic variations that contribute to the risk of mental illnesses, among which single nucleotide polymorphisms (SNPs) within or near the vaccinia related kinase 2 (<i>VRK2</i>) gene have gained consistent support for their correlations with multiple psychiatric and neurological disorders including schizophrenia (SCZ), major depressive disorder (MDD), and genetic generalized epilepsy. For instance, the genetic variant rs1518395 in <i>VRK2</i> showed genome-wide significant associations with SCZ (35,476 cases and 46,839 controls, <i>p</i> = 3.43 × 10<sup>-8</sup>) and MDD (130,620 cases and 347,620 controls, <i>p</i> = 4.32 × 10<sup>-12</sup>) in European populations. This SNP was also genome-wide significantly associated with SCZ in Han Chinese population (12,083 cases and 24,097 controls, <i>p</i> = 3.78 × 10<sup>-13</sup>), and all associations were in the same direction of allelic effects. These studies highlight the potential roles of <i>VRK2</i> in the central nervous system, and this gene therefore might be a good candidate to investigate the shared genetic and molecular basis between SCZ and MDD, as it is one of the few genes known to show genome-wide significant associations with both illnesses. Furthermore, the <i>VRK2</i> gene was found to be involved in multiple other congenital deficits related to the malfunction of neurodevelopment, adding further support for the involvement of this gene in the pathogenesis of these neurological and psychiatric illnesses. While the precise function of <i>VRK2</i> in these conditions remains unclear, preliminary evidence suggests that it may affect neuronal proliferation and migration via interacting with multiple essential signaling pathways involving other susceptibility genes/proteins for psychiatric disorders. Here, we have reviewed the recent progress of genetic and molecular studies of <i>VRK2</i>, with an emphasis on its role in psychiatric illnesses and neurological functions. We believe that attention to this important gene is necessary, and further investigations of <i>VRK2</i> may provide hints into the underlying mechanisms of SCZ and MDD.

Also flagged:NEDD4proteinopathic disorderspolyglutamineHuntington diseaseE3-ubiquitin ligaseubiquitin
Journal Article 2018-11-06 ✓ 5 Snippets Peters TW, Nelson CS, Gerencser AA, Dumas KJ, Tavshanjian B, Chang KC, Lithgow GJ, Hughes RE.
In-Text Gene Mentions

HD is an inherited fatal neurodegenerative disease caused by a CAG expansion in the human HTT locus (1993; Saudou and Humbert 2016).

…clones from theHtt-GFP transformation for each…

…referred to asHtt-Q75-GFP) in yeast results…

…aggregation of theHtt-Q75-GFP ( Figure 1…

…aggregation of theHtt-Q75-GFP protein has been…

Show Full Abstract

A feature common to late onset proteinopathic disorders is an accumulation of toxic protein conformers and aggregates in affected tissues. In the search for potential drug targets, many studies used high-throughput screens to find genes that modify the cytotoxicity of misfolded proteins. A complement to this approach is to focus on strategies that use protein aggregation as a phenotypic readout to identify pathways that control aggregate formation and maintenance. Here we use natural variation between strains of budding yeast to genetically map loci that influence the aggregation of a polyglutamine-containing protein derived from a mutant form of huntingtin, the causative agent in Huntington disease. Linkage analysis of progeny derived from a cross between wild and laboratory yeast strains revealed two polymorphic loci that modify polyglutamine aggregation. One locus contains the gene <i>RFU1</i> which modifies ubiquitination states of misfolded proteins targeted by the E3-ubiquitin ligase complex Rsp5 Activity of the Rsp5 complex, and the mammalian homolog NEDD4, are critical in maintaining protein homeostasis in response to proteomic stress. Our analysis also showed linkage of the aggregation phenotype to a distinct locus containing a gene encoding the Rsp5-interacting Bul2 protein. Allele-swap experiments validated the impact of both <i>RFU1</i> and <i>BUL2</i> on huntingtin aggregation. Furthermore, we found that the nematode <i>Caenorhabditis elegans</i>' ortholog of <i>Rsp5</i>, <i>wwp-1</i>, also negatively regulates polyglutamine aggregation. Knockdown of the NEDD4 in human cells likewise altered polyglutamine aggregation. Taken together, these results implicate conserved processes involving the ubiquitin regulation network that modify protein aggregation and provide novel therapeutic targets for polyglutamine and other protein folding diseases.

Also flagged:GliomastumorPrussian blueCD68CD163glial fibrillary acidic protein
Journal Article 2018-11-06 ✓ 1 Snippet Iv M, Samghabadi P, Holdsworth S, Gentles A, Rezaii P, Harsh G, Li G, Thomas R, Moseley M, Daldrup-Link HE, Vogel H, Wintermark M, Cheshier S, Yeom KW.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Purpose To investigate ferumoxytol-enhanced MRI as a noninvasive imaging biomarker of macrophages in adults with high-grade gliomas. Materials and Methods In this prospective study, adults with high-grade gliomas were enrolled between July 2015 and July 2017. Each participant was administered intravenous ferumoxytol (5 mg/kg) and underwent 3.0-T MRI 24 hours later. Two sites in each tumor were selected for intraoperative sampling on the basis of the degree of ferumoxytol-induced signal change. Susceptibility and the relaxation rates R2* (1/T2*) and R2 (1/T2) were obtained by region-of-interest analysis by using the respective postprocessed maps. Each sample was stained with Prussian blue, CD68, CD163, and glial fibrillary acidic protein. Pearson correlation and linear mixed models were performed to assess the relationship between imaging measurements and number of 400× magnification high-power fields with iron-containing macrophages. Results Ten adults (four male participants [mean age, 65 years ± 9 {standard deviation}; age range, 57-74 years] and six female participants [mean age, 53 years ± 12 years; age range, 32-65 years]; mean age of all participants, 58 years ± 12 [age range, 32-74 years]) with high-grade gliomas were included. Significant positive correlations were found between susceptibility, R2*, and R2' and the number of high-power fields with CD163-positive (r range, 0.64-0.71; P < .01) and CD68-positive (r range, 0.55-0.57; P value range, .01-.02) iron-containing macrophages. No significant correlation was found between R2 and CD163-positive (r = 0.33; P = .16) and CD68-positive (r = 0.24; P = .32) iron-containing macrophages. Similar significance results were obtained with linear mixed models. At histopathologic analysis, iron particles were found only in macrophages; none was found in glial fibrillary acidic protein-positive tumor cells. Conclusion MRI measurements of susceptibility, R2*, and R2' (R2* - R2) obtained after ferumoxytol administration correlate with iron-containing macrophage concentration, and this shows their potential as quantitative imaging markers of macrophages in malignant gliomas. © RSNA, 2018 Online supplemental material is available for this article.

Also flagged:transcriptional factorsNanoghistonemodificationsCtcfNrsf
Journal Article 2018-11-06 ✓ 5 Snippets Wu C, Jiao Y, Shen M, Pan C, Cheng G, Jia D, Zhu J, Zhang L, Zheng M, Jia J.
In-Text Gene Mentions

…Fam60a, Zmynd8, andAbt1, which are either…

…at the C-terminus;Abt1cDNA was directly…

Abt1-copy2: CTACTCGGCCAAATTCCAGT T…

…genes, including Zmynd8,Abt1, and Fam60a, from…

…compared to Zmynd8,Abt1, and Fam60a in…

Show Full Abstract

<h4>Background</h4>Key regulators of developmental processes can be prioritized through integrated analysis of ChIP-Seq data of master transcriptional factors (TFs) such as Nanog and Oct4, active histone modifications (HMs) such as H3K4me3 and H3K27ac, and repressive HMs such as H3K27me3. Recent studies show that broad enrichment signals such as super-enhancers and broad H3K4me3 enrichment signals play more dominant roles than short enrichment signals of the master TFs and H3K4me3 in epigenetic regulatory mechanism. Besides the broad enrichment signals, up to ten thousands of short enrichment signals of these TFs and HMs exist in genome. Prioritization of these broad enrichment signals from ChIP-Seq data is a prerequisite for such integrated analysis.<h4>Results</h4>Here, we present a method named Clustering-Local-Unique-Enriched-Signals (CLUES), which uses an adaptive-size-windows strategy to identify enriched regions (ERs) and cluster them into broad enrichment signals. Tested on 62 ENCODE ChIP-Seq datasets of Ctcf and Nrsf, CLUES performs equally well as MACS2 regarding prioritization of ERs with the TF's motif. Tested on 165 ENCODE ChIP-Seq datasets of H3K4me3, H3K27me3, and H3K36me3, CLUES performs better than existing algorithms on prioritizing broad enrichment signals implicating cell functions influenced by epigenetic regulatory mechanism in cells. Most importantly, CLUES helps to confirm several novel regulators of mouse ES cell self-renewal and pluripotency through integrated analysis of prioritized broad enrichment signals of H3K4me3, H3K27me3, Nanog and Oct4 with the support of a CRISPR/Cas9 negative selection genetic screen.<h4>Conclusions</h4>CLUES holds promise for prioritizing broad enrichment signals from ChIP-Seq data. The download site for CLUES is https://github.com/Wuchao1984/CLUESv1.

Also flagged:Hepatocellular carcinomatype 2 diabetes mellitusNAFLDhepatic encephalopathyesophago-gastric varicesliver disease
Journal Article 2018-11-06 ✓ 1 Snippet Akuta N, Kawamura Y, Arase Y, Saitoh S, Fujiyama S, Sezaki H, Hosaka T, Kobayashi M, Kobayashi M, Suzuki Y, Suzuki F, Ikeda K, Kumada H.
In-Text Gene Mentions

…metabolic diseases (e.g.,hemochromatosis, α-1-antitrypsin deficiency, …

Show Full Abstract

<h4>Background</h4>The incidence of liver-related events, cardiovascular events and type 2 diabetes mellitus in patients with histopathologically confirmed NAFLD remains unclear.<h4>Methods</h4>We retrospectively investigated the incidence of liver events, cardiovascular events, malignancy, and type 2 diabetes mellitus in 402 Japanese patients with histopathologically confirmed NAFLD for a median follow-up of 4.2 years. We also investigated predictors of the development of hepatocellular carcinoma and type 2 diabetes mellitus in these patients.<h4>Results</h4>The rate of liver-related events per 1000 person years was 4.17 (hepatocellular carcinoma, 3.67; hepatic encephalopathy, 1.60; esophago-gastric varices, 2.43; ascites, 0.80; and jaundice, 0.40). The rate of cardiovascular events and type 2 diabetes mellitus was 5.73 and 9.95, respectively. Overall mortality was 3.33 (liver-related events, 1.25; cardiovascular events, 0.42; and malignancies other than hepatocellular carcinoma, 0.83), in patients free of previous or current malignancies. Multivariate analyses identified old age (≥70 years) and advanced fibrosis stage 4 as significant determinants of hepatocellular carcinoma development, and hepatocyte steatosis (> 33%), female sex, and serum ferritin (≤80 μg/l) as significant determinants of type 2 diabetes mellitus development in these patients.<h4>Conclusions</h4>Our results highlighted the importance of cardiovascular and liver-related events in Japanese patients with histopathologically-confirmed NAFLD. Hepatocellular carcinoma was the most common liver-related event, and the incidence of hepatocellular carcinoma was more than half of that of cardiovascular events.

Also flagged:cancerstomach cancerGene Expressionbipolar disorderlung cancertumor
Journal Article 2018-11-06 No Snippets Duan W, Zhang R, Zhao Y, Shen S, Wei Y, Chen F, Christiani DC.
Show Full Abstract

<h4>Background</h4>Modeling thousands of markers simultaneously has been of great interest in testing association between genetic biomarkers and disease or disease-related quantitative traits. Recently, an expectation-maximization (EM) approach to Bayesian variable selection (EMVS) facilitating the Bayesian computation was developed for continuous or binary outcome using a fast EM algorithm. However, it is not suitable to the analyses of time-to-event outcome in many public databases such as The Cancer Genome Atlas (TCGA).<h4>Results</h4>We extended the EMVS to high-dimensional parametric survival regression framework (SurvEMVS). A variant of cyclic coordinate descent (CCD) algorithm was used for efficient iteration in M-step, and the extended Bayesian information criteria (EBIC) was employed to make choice on hyperparameter tuning. We evaluated the performance of SurvEMVS using numeric simulations and illustrated the effectiveness on two real datasets. The results of numerical simulations and two real data analyses show the well performance of SurvEMVS in aspects of accuracy and computation. Some potential markers associated with survival of lung or stomach cancer were identified.<h4>Conclusions</h4>These results suggest that our model is effective and can cope with high-dimensional omics data.

Also flagged:cataractsFTLHyperferritinemia Cataract Syndromeautosomal dominantly inherited diseaseL-ferritinFT
Journal Article 2018-11-06 ✓ 1 Snippet Balta B, Erdoğan M, Kiraz A, Korkmaz S, Ağadayı A.
In-Text Gene Mentions

…levels, such ashemochromatosis, were excluded from…

Show Full Abstract

<h4>Objective</h4>Hyperferritinemia cataract syndrome (HFCS) is an autosomal dominantly inherited disease characterized by increased serum ferritin levels and bilateral cataract formation in the early period of life. Heterozygote mutations in the 5’ untranslated region of the L-ferritin gene (<i>FTL</i>) have been reported to cause this disease. In this study, our purpose was to research the <i>FTL</i> gene mutations that cause HFCS in Central Anatolia and the clinical effects of these mutations.<h4>Materials and methods</h4>Seventeen patients from 6 families with high ferritin levels in performed serum measurements, those who were found to have cataracts in eye examinations, and families with vertical inheritance, since the disease is autosomal dominant, were included in the study. Exons, exon-intron boundaries, and 5’ and 3’ untranslated regions of <i>FTL</i> (NM_000146) were sequenced using the Sanger sequencing method.<h4>Results</h4>The female/male ratio of the patients was 7/10. All of the patients were found to have c.-160A>G heterozygous mutation in the <i>FTL</i> gene.<h4>Conclusion</h4>In the Turkish population, the prevalence of HFCS is about 1/100,000 and the commonly observed mutation is c.-160A>G mutation.

Also flagged:Ironmetabolismβ-Thalassemiagenetic disordererythropoiesisanemia
Journal Article 2018-11-06 No Snippets Rivella S.
Show Full Abstract

β-Thalassemia (BT) is an inherited genetic disorder that is characterized by ineffective erythropoiesis (IE), leading to anemia and abnormal iron metabolism. IE is an abnormal expansion of the number of erythroid progenitor cells with unproductive synthesis of enucleated erythrocytes, leading to anemia and hypoxia. Anemic patients affected by BT suffer from iron overload, even in the absence of chronic blood transfusion, suggesting the presence of ≥1 erythroid factor with the ability to modulate iron metabolism and dietary iron absorption. Recent studies suggest that decreased erythroid cell differentiation and survival also contribute to IE, aggravating the anemia in BT. Furthermore, hypoxia can also affect and increase iron absorption. Understanding the relationship between iron metabolism and IE could provide important insights into the BT condition and help to develop novel treatments. In fact, genetic or pharmacological manipulations of iron metabolism or erythroid cell differentiation and survival have been shown to improve IE, iron overload, and anemia in animal models of BT. Based on those findings, new therapeutic approaches and drugs have been proposed; clinical trials are underway that have the potential to improve erythrocyte production, as well as to reduce the iron overload and organ toxicity in BT and in other disorders characterized by IE.

Also flagged:ironiron hormonedegradationdeficiencygenetic disorders ofiron overload and
Journal Article 2018-11-06 No Snippets Wang CY, Babitt JL.
Show Full Abstract

The liver orchestrates systemic iron balance by producing and secreting hepcidin. Known as the iron hormone, hepcidin induces degradation of the iron exporter ferroportin to control iron entry into the bloodstream from dietary sources, iron recycling macrophages, and body stores. Under physiologic conditions, hepcidin production is reduced by iron deficiency and erythropoietic drive to increase the iron supply when needed to support red blood cell production and other essential functions. Conversely, hepcidin production is induced by iron loading and inflammation to prevent the toxicity of iron excess and limit its availability to pathogens. The inability to appropriately regulate hepcidin production in response to these physiologic cues underlies genetic disorders of iron overload and deficiency, including hereditary hemochromatosis and iron-refractory iron deficiency anemia. Moreover, excess hepcidin suppression in the setting of ineffective erythropoiesis contributes to iron-loading anemias such as β-thalassemia, whereas excess hepcidin induction contributes to iron-restricted erythropoiesis and anemia in chronic inflammatory diseases. These diseases have provided key insights into understanding the mechanisms by which the liver senses plasma and tissue iron levels, the iron demand of erythrocyte precursors, and the presence of potential pathogens and, importantly, how these various signals are integrated to appropriately regulate hepcidin production. This review will focus on recent insights into how the liver senses body iron levels and coordinates this with other signals to regulate hepcidin production and systemic iron homeostasis.

Also flagged:AutophagyPPARγbenzophenone-3nuclear receptorspost-translational modificationsBP
Journal Article 2018-11-06 ✓ 1 Snippet Wnuk A, Rzemieniec J, Staroń J, Litwa E, Lasoń W, Bojarski A, Kajta M.
In-Text Gene Mentions

…, Fas ,Htt, Igf1 ,…

Show Full Abstract

The UV absorber benzophenone-3 (BP-3) is the most extensively used chemical substance in various personal care products. Despite that BP-3 exposure is widespread, knowledge about the impact of BP-3 on the brain development is negligible. The present study aimed to explore the mechanisms of prenatal exposure to BP-3 in neuronal cells, with particular emphasis on autophagy and nuclear receptors signaling as well as the epigenetic and post-translational modifications occurring in response to BP-3. To observe the impact of prenatal exposure to BP-3, we administered BP-3 to pregnant mice, and next, we isolated brain tissue from pretreated embryos for primary cell neocortical culture. Our study revealed that prenatal exposure to BP-3 (used in environmentally relevant doses) impairs autophagy in terms of BECLIN-1, MAP1LC3B, autophagosomes, and autophagy-related factors; disrupts the levels of retinoid X receptors (RXRs) and peroxisome proliferator-activated receptor gamma (PPARγ); alters epigenetic status (i.e., attenuates HDAC and sirtuin activities); inhibits post-translational modifications in terms of global sumoylation; and dysregulates expression of neurogenesis- and neurotransmitter-related genes as well as miRNAs involved in pathologies of the nervous system. Our study also showed that BP-3 has good permeability through the BBB. We strongly suggest that BP-3-evoked effects may substantiate a fetal basis of the adult onset of neurological diseases, particularly schizophrenia and Alzheimer's disease.

Also flagged:tumormedulloblastomaSKA 3DTLCRTAMMAP 3K5
Journal Article 2018-11-06 No Snippets Lv T, Lv T, Miao YF, Jin K, Han S, Xu TQ, Qiu ZL, Zhang XH.
Show Full Abstract

Circular RNAs (circRNAs) have been demonstrated to be involved in various biological processes. Nevertheless, the function of circRNAs in medulloblastoma (MB) is still unknown. The present study aimed to investigate the expression profiles of circRNAs and related mechanisms for regulating the proliferation and growth of tumor cells in MB. The expression profiles of circRNAs were screened from four normal cerebellum and four MB samples using a HiSeq Sequencer. Bioinformatic analysis was employed to predict the interaction between circRNAs and mRNAs in MB. Subsequently, the expression levels of eight differential circRNAs [circ-SKA3 (hsa_circ_0029696), circ-DTL (hsa_circ_0000179), circ-CRTAM, circ-MAP3K5 (hsa_circ_0006856), circ-RIMS1-1 (hsa_circ_0132250), circ-RIMS1-2 (hsa_circ_0076967), circ-FLT3-1 (hsa_circ_0100165), and circ-FLT3-2 (hsa_circ_0100168)] were validated using quantitative reverse transcription-polymerase chain reaction. Moreover, circ-SKA3 and circ-DTL were silenced using small interfering RNAs and their host genes were overexpressed to investigate their role in the pathogenesis of MB. A total of 33 circRNAs were found to be differentially expressed in MB tissues (fold change ≥ 2.0, FDR <0.05), of which three were upregulated and 30 were downregulated; six circRNAs were experimentally validated successfully. Upregulated circ-SKA3 and circ-DTL promoted the proliferation migration and invasion in vitro by regulating the expression of host genes. This novel study exploited the profiling of circRNAs in MB and demonstrated that circ-SKA3 and circ-DTL were crucial in the tumorigenesis and development of MB and might be considered as novel and potential biomarkers for the diagnosis and new targets for the intervention of MB.

Also flagged:Pancreatic AdenocarcinomaPancreatic ductal adenocarcinomaPDACcancerspancreatic tumourpancreatic cancer
Journal Article 2018-11-06 ✓ 2 Snippets Coleman O, Henry M, O'Neill F, Roche S, Swan N, Boyle L, Murphy J, Meiller J, Conlon NT, Geoghegan J, Conlon KC, Lynch V, Straubinger NL, Straubinger RM, McVey G, Moriarty M, Meleady P, Clynes M.
In-Text Gene Mentions

From this cohort, 4 out of 5 of the proteins (IDH1, CTSD, PRDX6, and SERPINB6) also showed a statistically significant increase in abundance (12, 2.3, 2.6, and 3-fold, respectively) in the patient tumour samples when compared to the PDX F1 generation in the species-indistinguishable study.

…proteins (IDH1, CTSD,PRDX6, and SERPINB6) also…

Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) is one of the deadliest cancers worldwide; it develops in a relatively symptom-free manner, leading to rapid disease progression and metastasis, leading to a 5-year survival rate of less than 5%. A lack of dependable diagnostic markers and rapid development of resistance to conventional therapies are among the problems associated with management of the disease. A better understanding of pancreatic tumour biology and discovery of new potential therapeutic targets are important goals in pancreatic cancer research. This study describes the comparative quantitative LC-MS/MS proteomic analysis of the membrane-enriched proteome of 10 human pancreatic ductal adenocarcinomas, 9 matched adjacent-normal pancreas and patient-derived xenografts (PDXs) in mice (10 at F1 generation and 10 F2). Quantitative label-free LC-MS/MS data analysis identified 129 proteins upregulated, and 109 downregulated, in PDAC, compared to adjacent-normal tissue. In this study, analysing peptide MS/MS data from the xenografts, great care was taken to distinguish species-specific peptides definitively derived from human sequences, or from mice, which could not be distinguished. The human-only peptides from the PDXs are of particular value, since only human tumour cells survive, and stromal cells are replaced during engraftment in the mouse; this list is, therefore, enriched in tumour-associated proteins, some of which might be potential therapeutic or diagnostic targets. Using human-specific sequences, 32 proteins were found to be upregulated, and 113 downregulated in PDX F1 tumours, compared to primary PDAC. Differential expression of CD55 between PDAC and normal pancreas, and expression across PDX generations, was confirmed by Western blotting. These data indicate the value of using PDX models in PDAC research. This study is the first comparative proteomic analysis of PDAC which employs PDX models to identify patient tumour cell-associated proteins, in an effort to find robust targets for therapeutic treatment of PDAC.

Also flagged:HydrogenoxygencysteinesdisulfideNADPH oxidasesmembrane
Journal Article 2018-11-06 No Snippets Rampon C, Volovitch M, Joliot A, Vriz S.
Show Full Abstract

Reactive oxygen species (ROS), which were originally classified as exclusively deleterious compounds, have gained increasing interest in the recent years given their action as <i>bona fide</i> signalling molecules. The main target of ROS action is the reversible oxidation of cysteines, leading to the formation of disulfide bonds, which modulate protein conformation and activity. ROS, endowed with signalling properties, are mainly produced by NADPH oxidases (NOXs) at the plasma membrane, but their action also involves a complex machinery of multiple redox-sensitive protein families that differ in their subcellular localization and their activity. Given that the levels and distribution of ROS are highly dynamic, in part due to their limited stability, the development of various fluorescent ROS sensors, some of which are quantitative (ratiometric), represents a clear breakthrough in the field and have been adapted to both ex vivo and in vivo applications. The physiological implication of ROS signalling will be presented mainly in the frame of morphogenetic processes, embryogenesis, regeneration, and stem cell differentiation. Gain and loss of function, as well as pharmacological strategies, have demonstrated the wide but specific requirement of ROS signalling at multiple stages of these processes and its intricate relationship with other well-known signalling pathways.

Also flagged:lung adenocarcinomaDUSP4MUC4EGFRtumorslung cancer
Journal Article 2018-11-06 No Snippets Subat S, Inamura K, Ninomiya H, Nagano H, Okumura S, Ishikawa Y.
Show Full Abstract

The <i>EGFR</i> gene was one of the first molecules to be selected for targeted gene therapy. <i>EGFR</i>-mutated lung adenocarcinoma, which is responsive to <i>EGFR</i> inhibitors, is characterized by a distinct oncogenic pathway in which unique microRNA (miRNA)⁻mRNA interactions have been observed. However, little information is available about the miRNA⁻mRNA regulatory network involved. Both miRNA and mRNA expression profiles were investigated using microarrays in 155 surgically resected specimens of lung adenocarcinoma with a known <i>EGFR</i> mutation status (52 mutated and 103 wild-type cases). An integrative analysis of the data was performed to identify the unique miRNA⁻mRNA regulatory network in <i>EGFR</i>-mutated lung adenocarcinoma. Expression profiling of miRNAs and mRNAs yielded characteristic miRNA/mRNA signatures (19 miRNAs/431 mRNAs) in <i>EGFR</i>-mutated lung adenocarcinoma. Five of the 19 miRNAs were previously listed as <i>EGFR</i>-mutation-specific miRNAs (i.e., miR-532-3p, miR-500a-3p, miR-224-5p, miR-502-3p, and miR-532-5p). An integrative analysis of miRNA and mRNA expression revealed a refined list of putative miRNA⁻mRNA interactions, of which 63 were potentially involved in <i>EGFR</i>-mutated tumors. Network structural analysis provided a comprehensive view of the complex miRNA⁻mRNA interactions in <i>EGFR</i>-mutated lung adenocarcinoma, including DUSP4 and MUC4 axes. Overall, this observational study provides insight into the unique miRNA⁻mRNA regulatory network present in <i>EGFR</i>-mutated tumors. Our findings, if validated, would inform future research examining the interplay of miRNAs and mRNAs in <i>EGFR</i>-mutated lung adenocarcinoma.

Also flagged:rapamycinAlzheimerPI3KAKTmTORAlzheimer Disease
Journal Article 2018-11-06 ✓ 2 Snippets Tramutola A, Lanzillotta C, Barone E, Arena A, Zuliani I, Mosca L, Blarzino C, Butterfield DA, Perluigi M, Di Domenico F.
In-Text Gene Mentions

Ts65Dn (B6EiC3Sn a/A-Ts(1716)65Dn/J), a well-established mouse model of DS, carries a reciprocal translocation that is trisomic for approximately 104 genes (56%) on Mmu16, from Mrpl39 to the distal telomere, with homologues on HSA21.

…on Mmu16, fromMrpl39to the distal…

Show Full Abstract

<h4>Background</h4>Down syndrome (DS) individuals, by the age of 40s, are at increased risk to develop Alzheimer-like dementia, with deposition in brain of senile plaques and neurofibrillary tangles. Our laboratory recently demonstrated the disturbance of PI3K/AKT/mTOR axis in DS brain, prior and after the development of Alzheimer Disease (AD). The aberrant modulation of the mTOR signalling in DS and AD age-related cognitive decline affects crucial neuronal pathways, including insulin signaling and autophagy, involved in pathology onset and progression. Within this context, the therapeutic use of mTOR-inhibitors may prevent/attenuate the neurodegenerative phenomena. By our work we aimed to rescue mTOR signalling in DS mice by a novel rapamycin intranasal administration protocol (InRapa) that maximizes brain delivery and reduce systemic side effects.<h4>Methods</h4>Ts65Dn mice were administered with InRapa for 12 weeks, starting at 6 months of age demonstrating, at the end of the treatment by radial arms maze and novel object recognition testing, rescued cognition.<h4>Results</h4>The analysis of mTOR signalling, after InRapa, demonstrated in Ts65Dn mice hippocampus the inhibition of mTOR (reduced to physiological levels), which led, through the rescue of autophagy and insulin signalling, to reduced APP levels, APP processing and APP metabolites production, as well as, to reduced tau hyperphosphorylation. In addition, a reduction of oxidative stress markers was also observed.<h4>Discussion</h4>These findings demonstrate that chronic InRapa administration is able to exert a neuroprotective effect on Ts65Dn hippocampus by reducing AD pathological hallmarks and by restoring protein homeostasis, thus ultimately resulting in improved cognition. Results are discussed in term of a potential novel targeted therapeutic approach to reduce cognitive decline and AD-like neuropathology in DS individuals.

Also flagged:NRF2gene silencingsickle cell diseasereverse transcriptionsickleoxygen
Journal Article 2018-11-06 No Snippets Li B, Zhu X, Ward CM, Starlard-Davenport A, Takezaki M, Berry A, Ward A, Wilder C, Neunert C, Kutlar A, Pace BS.
Show Full Abstract

Inherited genetic modifiers and pharmacologic agents that enhance fetal hemoglobin (HbF) expression reverse the clinical severity of sickle cell disease (SCD). Recent efforts to develop novel strategies of HbF induction include discovery of molecular targets that regulate γ-globin gene transcription and translation. The purpose of this study was to perform genome-wide microRNA (miRNA) analysis to identify genes associated with HbF expression in patients with SCD. We isolated RNA from purified reticulocytes for microarray-based miRNA expression profiling. Using samples from patients with contrasting HbF levels, we observed an eightfold upregulation of miR-144-3p (miR-144) and miR-144-5p in the low-HbF group compared with those with high HbF. Additional analysis by reverse transcription quantitative polymerase chain reaction confirmed individual miR-144 expression levels of subjects in the two groups. Subsequent functional studies in normal and sickle erythroid progenitors showed NRF2 gene silencing by miR-144 and concomitant repression of γ-globin transcription; by contrast, treatment with miR-144 antagomir reversed its silencing effects in a dose-dependent manner. Because NRF2 regulates reactive oxygen species levels, additional studies investigated mechanisms of HbF regulation using a hemin-induced oxidative stress model. Treatment of KU812 cells with hemin produced an increase in NRF2 expression and HbF induction that reversed with miR-144 pretreatment. Chromatin immunoprecipitation assay confirmed NRF2 binding to the γ-globin antioxidant response element, which was inhibited by miR-144 mimic treatment. The genome-wide miRNA microarray and primary erythroid progenitor data support a miR-144/NRF2-mediated mechanism of γ-globin gene regulation in SCD.

Also flagged:infectionADamyloidretinoid receptoramyloid-betalysosomal protease
Journal Article 2018-11-06 No Snippets Thygesen C, Ilkjær L, Kempf SJ, Hemdrup AL, von Linstow CU, Babcock AA, Darvesh S, Larsen MR, Finsen B.
Show Full Abstract

Neuroinflammation, characterized by chronic activation of the myeloid-derived microglia, is a hallmark of Alzheimer's disease (AD). Systemic inflammation, typically resulting from infection, has been linked to the progression of AD due to exacerbation of the chronic microglial reaction. However, the mechanism and the consequences of this exacerbation are largely unknown. Here, we mimicked systemic inflammation in AD with weekly intraperitoneal (i.p.) injections of APP<sub>SWE</sub>/PS1<sub>ΔE9</sub> transgenic mice with <i>E. coli</i> lipopolysaccharide (LPS) from 9 to 12 months of age, corresponding to the period with the steepest increase in amyloid pathology. We found that the repeated LPS injections ameliorated amyloid pathology in the neocortex while increasing the neuroinflammatory reaction. To elucidate mechanisms, we analyzed the proteome of the hippocampus from the same mice as well as in unique samples of CNS myeloid cells. The repeated LPS injections stimulated protein pathways of the complement system, retinoid receptor activation and oxidative stress. CNS myeloid cells from transgenic mice showed enrichment in pathways of amyloid-beta clearance and elevated levels of the lysosomal protease cathepsin Z, as well as amyloid precursor protein, apolipoprotein E and clusterin. These proteins were found elevated in the proteome of both LPS and vehicle injected transgenics, and co-localized to CD11b<sup>+</sup> microglia in transgenic mice and in primary murine microglia. Additionally, cathepsin Z, amyloid precursor protein, and apolipoprotein E appeared associated with amyloid plaques in neocortex of AD cases. Interestingly, cathepsin Z was expressed in microglial-like cells and co-localized to CD68<sup>+</sup> microglial lysosomes in AD cases, and it was expressed in perivascular cells in AD and control cases. Taken together, our results implicate systemic LPS administration in ameliorating amyloid pathology in early-to-mid stage disease in the APP<sub>SWE</sub>/PS1<sub>ΔE9</sub> mouse and attract attention to the potential disease involvement of cathepsin Z expressed in CNS myeloid cells in AD.

Also flagged:gene expressionribonucleoproteinnuclear porenuclear exportRNA-binding proteinspolyribosomes
Journal Article 2018-11-06 No Snippets Neriec N, Percipalle P.
Show Full Abstract

In eukaryotic cells, gene expression is highly regulated at many layers. Nascent RNA molecules are assembled into ribonucleoprotein complexes that are then released into the nucleoplasmic milieu and transferred to the nuclear pore complex for nuclear export. RNAs are then either translated or transported to the cellular periphery. Emerging evidence indicates that RNA-binding proteins play an essential role throughout RNA biogenesis, from the gene to polyribosomes. However, the sorting mechanisms that regulate whether an RNA molecule is immediately translated or sent to specialized locations for translation are unclear. This question is highly relevant during development and differentiation when cells acquire a specific identity. Here, we focus on the RNA-binding properties of heterogeneous nuclear ribonucleoproteins (hnRNPs) and how these mechanisms are believed to play an essential role in RNA trafficking in polarized cells. Further, by focusing on the specific hnRNP protein CBF-A/hnRNPab and its naturally occurring isoforms, we propose a model on how hnRNP proteins are capable of regulating gene expression both spatially and temporally throughout the RNA biogenesis pathway, impacting both healthy and diseased cells.

Also flagged:atherosclerosisheart valve diseaseCalcific aortic valve stenosisaortic valve stenosisextracellularosteogenesis
Journal Article 2018-11-06 ✓ 1 Snippet Jover E, Fagnano M, Angelini G, Madeddu P.
In-Text Gene Mentions

PPi, pyrophosphate; cMGP, gamma-carboxylated matrix Gla protein; BMP-2, bone morphogenetic protein 2; ECM, extracellular matrix; CKD, chronic kidney disease; CHD, congestive heart disease; VIC, valve interstitial cells; VEC, valve endothelial cells; GAGs, glycosaminoglycans; Ca10(PO4)6(OH)2, hydroxyapatite; Pi, inorganic phosphate; ALP, alkaline phosphatase; Bglap, bone Gla protein or osteocalcin.

Show Full Abstract

Cardiovascular calcification is an independent risk factor and an established predictor of adverse cardiovascular events. Despite concomitant factors leading to atherosclerosis and heart valve disease (VHD), the latter has been identified as an independent pathological entity. Calcific aortic valve stenosis is the most common form of VDH resulting of either congenital malformations or senile "degeneration." About 2% of the population over 65 years is affected by aortic valve stenosis which represents a major cause of morbidity and mortality in the elderly. A multifactorial, complex and active heterotopic bone-like formation process, including extracellular matrix remodeling, osteogenesis and angiogenesis, drives heart valve "degeneration" and calcification, finally causing left ventricle outflow obstruction. Surgical heart valve replacement is the current therapeutic option for those patients diagnosed with severe VHD representing more than 20% of all cardiac surgeries nowadays. Tissue Engineering of Heart Valves (TEHV) is emerging as a valuable alternative for definitive treatment of VHD and promises to overcome either the chronic oral anticoagulation or the time-dependent deterioration and reintervention of current mechanical or biological prosthesis, respectively. Among the plethora of approaches and stablished techniques for TEHV, utilization of different cell sources may confer of additional properties, desirable and not, which need to be considered before moving from the bench to the bedside. This review aims to provide a critical appraisal of current knowledge about calcific VHD and to discuss the pros and cons of the main cell sources tested in studies addressing <i>in vitro</i> TEHV.

Also flagged:Chimeric Antigen ReceptorsCD22ALLCD19bindingtransduction
Journal Article 2018-11-06 ✓ 1 Snippet Qin H, Ramakrishna S, Nguyen S, Fountaine TJ, Ponduri A, Stetler-Stevenson M, Yuan CM, Haso W, Shern JF, Shah NN, Fry TJ.
In-Text Gene Mentions

…C terminus ofMLLT10.…

Show Full Abstract

Despite high remission rates following CAR-T cell therapy in B-ALL, relapse due to loss of the targeted antigen is increasingly recognized as a mechanism of immune escape. We hypothesized that simultaneous targeting of CD19 and CD22 may reduce the likelihood of antigen loss, thus improving sustained remission rates. A systematic approach to the generation of CAR constructs incorporating two target-binding domains led to several novel CD19/CD22 bivalent CAR constructs. Importantly, we demonstrate the challenges associated with the construction of a bivalent CAR format that preserves bifunctionality against both CD19 and CD22. Using the most active bivalent CAR constructs, we found similar transduction efficiency compared to that of either CD19 or CD22 single CARs alone. When expressed on human T cells, the optimized CD19/CD22 CAR construct induced comparable interferon γ and interleukin-2 <i>in vitro</i> compared to single CARs against dual-antigen-expressing as well as single-antigen-expressing cell lines. Finally, the T cells expressing CD19/CD22 CAR eradicated ALL cell line xenografts and patient-derived xenografts (PDX), including a PDX generated from a patient with CD19<sup>-</sup> relapse following CD19-directed CAR therapy. The CD19/CD22 bivalent CAR provides an opportunity to test whether simultaneous targeting may reduce risk of antigen loss.

Also flagged:inflammationinnate receptorsinnate receptorgene expressionTLR4TLR2
Journal Article 2018-11-05 ✓ 1 Snippet Hosoki K, Jaruga P, Itazawa T, Aguilera-Aguirre L, Coskun E, Hazra TK, Boldogh I, Dizdaroglu M, Sur S.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

<h4>Background</h4>Ragweed pollen extract (RWPE) induces TLR4-NFκB-CXCL-dependent recruitment of ROS-generating neutrophils to the airway and OGG1 DNA glycosylase-dependent excision of oxidatively induced 8-OH-Gua DNA base lesions from the airway epithelial cell genome. Administration of free 8-OH-Gua base stimulates RWPE-induced allergic lung inflammation. These studies suggest that stimulation of innate receptors and their adaptor by allergenic extracts initiates excision of a set of DNA base lesions that facilitate innate/allergic lung inflammation.<h4>Objective</h4>To test the hypothesis that stimulation of a conserved innate receptor/adaptor pathway by allergenic extracts induces excision of a set of pro-inflammatory oxidatively induced DNA base lesions from the lung genome that stimulate allergic airway inflammation.<h4>Methods</h4>Wild-type (WT), Tlr4KO, Tlr2KO, Myd88KO, and TrifKO mice were intranasally challenged once or repeatedly with cat dander extract (CDE), and innate or allergic inflammation and gene expression were quantified. We utilized GC-MS/MS to quantify a set of oxidatively induced DNA base lesions after challenge of naïve mice with CDE.<h4>Results</h4>A single CDE challenge stimulated innate neutrophil recruitment that was partially dependent on TLR4 and TLR2, and completely on Myd88, but not TRIF. A single CDE challenge stimulated MyD88-dependent excision of DNA base lesions 5-OH-Cyt, FapyAde, and FapyGua from the lung genome. A single challenge of naïve WT mice with 5-OH-Cyt stimulated neutrophilic lung inflammation. Multiple CDE instillations stimulated MyD88-dependent allergic airway inflammation. Multiple administrations of 5-OH-Cyt with CDE stimulated allergic sensitization and allergic airway inflammation.<h4>Conclusions and clinical relevance</h4>We show for the first time that CDE challenge stimulates MyD88-dependent excision of DNA base lesions. Our data suggest that the resultant-free base(s) contribute to CDE-induced innate/allergic lung inflammation. We suggest that blocking the MyD88 pathway in the airways with specific inhibitors may be a novel targeted strategy of inhibiting amplification of innate and adaptive immune inflammation in allergic diseases by oxidatively induced DNA base lesions.

Also flagged:hereditary neurological diseasesbindingmyotonic dystrophy type 1neurological disordersHDfragile X syndrome
Journal Article 2018-11-05 ✓ 2 Snippets Witkos TM, Krzyzosiak WJ, Fiszer A, Koscianska E.
In-Text Gene Mentions

Specifically, Huntington’s disease (HD) is triggered by the expansion of a CAG repeat in the translated region of the HTT gene, both fragile X syndrome (FXS) and fragile X-associated tremor/ataxia syndrome (FXTAS) are caused by a CGG repeat expansion in the 5ʹ untranslated region (UTR) of the FMR1 gene, and Friedreich ataxia (FRDA) is caused by a GAA repeat expansion in the first intron of the FXN gene.

…region of theHTTgene, both fragile…

Show Full Abstract

MicroRNA (miRNA)-mediated crosstalk between coding and non-coding RNAs of various types is known as the competing endogenous RNA (ceRNA) concept. Here, we propose that there is a specific variant of the ceRNA language that takes advantage of simple sequence repeat (SSR) wording. We applied bioinformatics tools to identify human transcripts that may be regarded as repeat-associated ceRNAs (raceRNAs). Multiple protein-coding transcripts, transcribed pseudogenes, long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs) showing this potential were identified, and numerous miRNAs were predicted to bind to SSRs. We propose that simple repeats expanded in various hereditary neurological diseases may act as sponges for miRNAs containing complementary repeats that would affect raceRNA crosstalk. Based on the representation of specific SSRs in transcripts, expression data for SSR-binding miRNAs and expression profiling data from patients, we determined that raceRNA crosstalk is most likely to be perturbed in the case of myotonic dystrophy type 1 (DM1) and type 2 (DM2).

Also flagged:litneurofibrillary tanglesneurofibrillary tangleNucleusmitotic cell cycle checkpointpositive regulation of protein secretion
Journal Article 2018-11-05 No Snippets Sun LL, Yang SL, Sun H, Li WD, Duan SR.
Show Full Abstract

Alzheimer's disease (AD) is a complex neurodegenerative disease and the most common cause of dementia among the elderly. There has been increasing recognition of sex differences in AD prevalence, clinical manifestation, disease course and prognosis. However, there have been few studies on the molecular mechanism underlying these differences. To address this issue, we carried out global gene expression and integrative network analyses based on expression profiles (GSE84422) across 17 cortical regions of 125 individuals with AD. There were few genes that were differentially expressed across the 17 regions between the two sexes, with only four (encoding glutamate metabotropic receptor 2, oestrogen-related receptor beta, kinesin family member 26B, and aspartoacylase) that were differentially expressed in three regions. A pan-cortical brain region co-expression network analysis identified pathways and genes (eg, glycogen synthase kinase 3β) that were significantly associated with clinical characteristics of AD (such as neurofibrillary score) in males only. Similarity analyses between region-specific networks indicated that male patients exhibited greater variability, especially in the superior parietal lobule, dorsolateral prefrontal cortex and occipital visual cortex. A network module analysis revealed an association between clinical traits and crosstalk of sex-specific modules. An examination of temporal and spatial patterns of sex differences in AD showed that molecular networks were more conserved in females than in males in different cortical regions and at different AD stages. These findings provide insight into critical molecular pathways governing sex differences in AD pathology.

Also flagged:translational2post-translational modificationtype 2 diabetespathogenesisconcanavalin A
Journal Article 2018-11-05 No Snippets Chen HM, Lee LC, Hu KY, Tsai WJ, Huang C, Tsay HJ, Liu HK.
Show Full Abstract

Proteome analysis of serum from type 2 diabetics with complications may lead to the discovery of diagnostic or prognostic biomarkers. To circumvent the principal barrier of serum proteomics, our investigation aimed to evaluate whether a study of post-translational modification enriched serum proteins could be valuable for the discovery of biomarkers or metabolic pathways related to type 2 diabetes pathogenesis. Type 2 diabetes was induced from high-fat diet fed Sprague Dawley rats with streptozotocin injection. Once diabetic status was confirmed, serum samples from either fasted healthy or diabetic rats were pooled and profiled by two-dimensional difference gel electrophoresis or comparative 2D electrophoresis after protein enrichments using immobilized metal ion, concanavalin A, and lentil affinity chromatography, respectively. Differential expressed proteins were identified and the associated networks were established by an Ingenuity Pathway Analysis. As a result, induced rats became severe diabetic and accompanied by hyperlipidemia, fatty liver, and glomerular hypertrophy. There were 3 total, 14 phosphorylated and 23 glycosylated protein targets differentially expressed. Proteins could be linked to HNF4A, HNF1A, and NFκB transcriptional factors and antigen presentation, humoral immune response, and inflammatory response pathways. Predicted organ toxicity in kidney, heart, and liver matched with our histopathological results. In conclusion, post-translational modification based serum protein enrichment could be a valuable approach to enhance the resolution of serum proteomics without depleting potentially valuable abundant proteins. Our results also indicated the potential association of the hepatic secretome and hepatocyte nuclear factors in the pathogenesis of type 2 diabetes and its complications.

Also flagged:metabolismnuclear export-degradationPolyadenylationnucleuspolyadenosine
Journal Article 2018-11-05 No Snippets Tudek A, Lloret-Llinares M, Jensen TH.
Show Full Abstract

A polyA (pA) tail is an essential modification added to the 3' ends of a wide range of RNAs at different stages of their metabolism. Here, we describe the main sources of polyadenylation and outline their underlying biochemical interactions within the nuclei of budding yeast <i>Saccharomyces cerevisiae</i>, human cells and, when relevant, the fission yeast <i>Schizosaccharomyces pombe</i> Polyadenylation mediated by the <i>S. cerevisiae</i> Trf4/5 enzymes, and their human homologues PAPD5/7, typically leads to the 3'-end trimming or complete decay of non-coding RNAs. By contrast, the primary function of canonical pA polymerases (PAPs) is to produce stable and nuclear export-competent mRNAs. However, this dichotomy is becoming increasingly blurred, at least in <i>S. pombe</i> and human cells, where polyadenylation mediated by canonical PAPs may also result in transcript decay.This article is part of the theme issue '5' and 3' modifications controlling RNA degradation'.

Also flagged:CSFretinol binding protein 4protein 7Amyotrophic Lateral SclerosisLearningmlr
Journal Article 2018-11-05 ✓ 1 Snippet Bereman MS, Beri J, Enders JR, Nash T.
In-Text Gene Mentions

…uloplasmin, X-Pro dipeptidase,Antithrombin-III, and plasma kallikrein.…

Show Full Abstract

We use shotgun proteomics to identify biomarkers of diagnostic and prognostic value in individuals diagnosed with amyotrophic lateral sclerosis. Matched cerebrospinal and plasma fluids were subjected to abundant protein depletion and analyzed by nano-flow liquid chromatography high resolution tandem mass spectrometry. Label free quantitation was used to identify differential proteins between individuals with ALS (n = 33) and healthy controls (n = 30) in both fluids. In CSF, 118 (p-value < 0.05) and 27 proteins (q-value < 0.05) were identified as significantly altered between ALS and controls. In plasma, 20 (p-value < 0.05) and 0 (q-value < 0.05) proteins were identified as significantly altered between ALS and controls. Proteins involved in complement activation, acute phase response and retinoid signaling pathways were significantly enriched in the CSF from ALS patients. Subsequently various machine learning methods were evaluated for disease classification using a repeated Monte Carlo cross-validation approach. A linear discriminant analysis model achieved a median area under the receiver operating characteristic curve of 0.94 with an interquartile range of 0.88-1.0. Three proteins composed a prognostic model (p = 5e-4) that explained 49% of the variation in the ALS-FRS scores. Finally we investigated the specificity of two promising proteins from our discovery data set, chitinase-3 like 1 protein and alpha-1-antichymotrypsin, using targeted proteomics in a separate set of CSF samples derived from individuals diagnosed with ALS (n = 11) and other neurological diseases (n = 15). These results demonstrate the potential of a panel of targeted proteins for objective measurements of clinical value in ALS.

Also flagged:Breast cancertumorcancerestrogen receptorERaromatase
Journal Article 2018-11-05 ✓ 1 Snippet Wu L, Yang X.
In-Text Gene Mentions

The overexpression of YAP could upregulate KLF5 protein levels and mRNA expression levels of its downstream target genes including FGFBP1 and ITGB2 that promote BC cell proliferation and survival [71]; the interaction between TAZ/YAP and SMAD2/3 regulates novel targets such as NEGR1 and UCA1 that are necessary for tumorigenic activity in metastatic BC cells [68].

Show Full Abstract

Breast cancer (BC) is one of the most prominent diseases in the world, and the treatments for BC have many limitations, such as resistance and a lack of reliable biomarkers. Currently the Hippo pathway is emerging as a tumor suppressor pathway with its four core components that regulate downstream transcriptional targets. In this review, we introduce the present targeted therapies of BC, and then discuss the roles of the Hippo pathway in BC. Finally, we summarize the evidence of the small molecule inhibitors that target the Hippo pathway, and then discuss the possibilities and future direction of the Hippo-targeted drugs for BC therapy.

Also flagged:Chronic Lyme DiseaseLyme Disease SyndromePTLDSLyme diseaseerythema migransrash
Journal Article 2018-11-05 ✓ 1 Snippet Horowitz RI, Freeman PR.
In-Text Gene Mentions

…deficiency, Wilson’s disease,hemochromatosis, viral and autoimmune…

Show Full Abstract

We present a precision medical perspective to assist in the definition, diagnosis, and management of Post Treatment Lyme Disease Syndrome (PTLDS)/chronic Lyme disease. PTLDS represents a small subset of patients treated for an erythema migrans (EM) rash with persistent or recurrent symptoms and functional decline. The larger population with chronic Lyme disease is less understood and well defined. Multiple Systemic Infectious Disease Syndrome (MSIDS) is a multifactorial model for treating chronic disease(s), which identifies up to 16 overlapping sources of inflammation and their downstream effects. A patient symptom survey and a retrospective chart review of 200 patients was therefore performed on those patients with chronic Lyme disease/PTLDS to identify those variables on the MSIDS model with the greatest potential effect on regaining health. Results indicate that dapsone combination therapy decreased the severity of eight major Lyme symptoms, and multiple sources of inflammation (other infections, immune dysfunction, autoimmunity, food allergies/sensitivities, leaky gut, mineral deficiencies, environmental toxins with detoxification problems, and sleep disorders) along with downstream effects of inflammation may all affect chronic symptomatology. In part two of our observational study and review paper, we postulate that the use of this model can represent an important and needed paradigm shift in the diagnosis and treatment of chronic disease.

Also flagged:chaperoneDNAJB6Huntington's diseaseneurodegenerative diseasesHuntington'sHSPs
Journal Article 2018-11-05 No Snippets Bason M, Meister-Broekema M, Alberts N, Dijkers P, Bergink S, Sibon OCM, Kampinga HH.
Show Full Abstract

Several neurodegenerative diseases like Huntington's, a polyglutamine (PolyQ) disease, are initiated by protein aggregation in neurons. Furthermore, these diseases are also associated with a multitude of responses in non-neuronal cells in the brain, in particular glial cells, like astrocytes. These non-neuronal responses have repeatedly been suggested to play a disease-modulating role, but how these may be exploited to delay the progression of neurodegeneration has remained unclear. Interestingly, one of the molecular changes that astrocytes undergo includes the upregulation of certain Heat Shock Proteins (HSPs) that are classically considered to maintain protein homeostasis, thus resulting in cell autonomous protection. Previously, we discovered DNAJB6, a member of the human DNAJ family, as potent cell autonomous suppressor of PolyQ aggregation and related neurodegeneration. Using cell type specific expression systems in D. melanogaster, we show that exclusive expression of DNAJB6 in astrocytes (that do not express PolyQ protein) can delay neurodegeneration and expands lifespan when the PolyQ protein is exclusively expressed in neurons (that do not co-express DNAJB6 themselves). This provides direct evidence for a non-cell autonomous protective role of astrocytes in PolyQ diseases.

Also flagged:rheumatoid arthritisgene expressionRApathogenesistype I interferonCD4
Journal Article 2018-11-05 ✓ 1 Snippet Sumitomo S, Nagafuchi Y, Tsuchida Y, Tsuchiya H, Ota M, Ishigaki K, Suzuki A, Kochi Y, Fujio K, Yamamoto K.
In-Text Gene Mentions

Their results also suggested that the aberrant expression of several zinc finger transcription factors (ZEB1, ZNF292, and ZNF644) may be potential pathogenic factors for RA.

Show Full Abstract

In the era of precision medicine, transcriptome analysis of whole gene expression is an essential technology. While DNA microarray has a limited dynamic range and a problem of background hybridization, RNA sequencing (RNA-seq) has a broader dynamic range and a lower background signal that increase the sensitivity and reproducibility. While transcriptome analyses in rheumatoid arthritis (RA) have generally focused on whole peripheral blood mononuclear cells (PBMC), analyses of detailed cell subsets have an increased need for understanding the pathophysiology of disease because the involvement of CD4<sup>+</sup> T cells in the pathogenesis of RA has been established. Transcriptome analysis of detailed CD4<sup>+</sup> T cell subsets or neutrophils shed new light on the pathophysiology of RA. There are several analyses about the effect of biological treatment. Many studies report the association between type I interferon signature gene expression and response to therapy.

Also flagged:cancergenetic neurodegenerative disorderdeathHDmyeliniron
Journal Article 2018-11-05 ✓ 1 Snippet Rowley CD, Tabrizi SJ, Scahill RI, Leavitt BR, Roos RAC, Durr A, Bock NA.
In-Text Gene Mentions

…expansion in theHTTgene ( MacDonald…

Show Full Abstract

Huntington's disease (HD) is a genetic neurodegenerative disorder that is characterized by neuronal cell death. Although medium spiny neurons in the striatum are predominantly affected, other brain regions including the cerebral cortex also degenerate. Previous structural imaging studies have reported decreases in cortical thickness in HD. Here we aimed to further investigate changes in cortical tissue composition <i>in vivo</i> in HD using standard clinical T<sub>1</sub>-weighted (T<sub>1</sub>W) and T<sub>2</sub>-weighted (T<sub>2</sub>W) magnetic resonance images (MRIs). 326 subjects from the TRACK-HD dataset representing healthy controls and four stages of HD progression were analyzed. The intracortical T<sub>1</sub>W/T<sub>2</sub>W intensity was sampled in the middle depth of the cortex over 82 regions across the cortex. While these previously collected images were not optimized for intracortical analysis, we found a significant increase in T<sub>1</sub>W/T<sub>2</sub>W intensity (<i>p</i> < 0.05 Bonferroni-Holm corrected) beginning with HD diagnosis. Increases in ratio intensity were found in the insula, which then spread to ventrolateral frontal cortex, superior temporal gyrus, medial temporal gyral pole, and cuneus with progression into the most advanced HD group studied. Mirroring past histological reports, this increase in the ratio image intensity may reflect disease-related increases in myelin and/or iron in the cortex. These findings suggest that future imaging studies are warranted with imaging optimized to more sensitively and specifically assess which features of cortical tissue composition are abnormal in HD to better characterize disease progression.

Also flagged:MitochondrialNeurodegenerative Diseasesprion diseasesneurodegenerative disordersMitochondriaorganelles
Journal Article 2018-11-05 ✓ 1 Snippet Zhu T, Chen JL, Wang Q, Shao W, Qi B.
In-Text Gene Mentions

HD is an autosomal dominant condition caused by trinucleotide expansion within a single gene, huntingtin (HTT) and is characterized by choreoathetotic movements and progressive emotional and cognitive disturbances (Walker, 2007; Ross and Tabrizi, 2011).

Show Full Abstract

Mitochondrial dysfunction is a common and prominent feature of prion diseases and other neurodegenerative disorders. Mitochondria are dynamic organelles that constantly fuse with one another and subsequently break apart. Defective or superfluous mitochondria are usually eliminated by a form of autophagy, referred to as mitophagy, to maintain mitochondrial homeostasis. Mitochondrial dynamics are tightly regulated by processes including fusion and fission. Dysfunction of mitochondrial dynamics can lead to the accumulation of abnormal mitochondria and contribute to cellular damage. Neurons are among the cell types that consume the most energy, have a highly complex morphology, and are particularly dependent on mitochondrial functions and dynamics. In this review article, we summarize the molecular mechanisms underlying the mitochondrial dynamics and the regulation of mitophagy and discuss the dysfunction of these processes in the progression of prion diseases and other neurodegenerative disorders. We have also provided an overview of mitochondrial dynamics as a therapeutic target for neurodegenerative diseases.

Also flagged:Hepatocellular CarcinomacancerNF-κBtumor-apoptosisangiogenesis
Journal Article 2018-11-05 ✓ 1 Snippet Mohan CD, Bharathkumar H, Dukanya, Rangappa S, Shanmugam MK, Chinnathambi A, Alharbi SA, Alahmadi TA, Bhattacharjee A, Lobie PE, Deivasigamani A, Hui KM, Sethi G, Basappa, Rangappa KS, Kumar AP.
In-Text Gene Mentions

…C viral infections,hemochromatosis, obesity, and consumption…

Show Full Abstract

Hepatocellular carcinoma (HCC) is a fatal disease and ranked fifth in cancer related mortality. Persistent activation of NF-κB is responsible for the oncogenesis, metastasis, tumor evasion, anti-apoptosis, angiogenesis and proliferation in HCC. Therefore, designing of chemically novel, biologically potent small molecules that target NF-κB signaling cascade have gained prominent clinical interest. Herein we synthesized a novel class of 4-(substituted)-2H-pyrido[3,2-b][1,4]oxazin-3(4H)-one by reacting 2H-pyrido[3,2-b][1,4]oxazin-3(4H)-one with various alkyl halides by using combustion derived bismuth oxide. We evaluated the antiproliferative efficacy of newly synthesized compounds against HCC cells and identified 4-(4-nitrobenzyl)-2H-pyrido[3,2-b][1,4]oxazin-3(4H)-one (NPO) as lead anticancer agent. In addition, we investigated the effect of NPO on the DNA binding ability of NF-κB and NF-κB regulated luciferase expression in HCC cells. The results demonstrated that NPO can induce significant growth inhibitory effects in HepG2, HCCLM3 and Huh-7 cells in dose and time-dependent manner. Interestingly, NPO induced significant downregulation in p65 DNA binding ability, p65 phosphorylation and subsequent expression of NF-κB dependent luciferase gene expression in diverse HCC cell lines. Further, <i>in silico</i> docking analysis suggested that NPO can show direct physical interaction with NF-κB. Finally, NPO was found to significantly abrogate tumor growth at a dose of 50 mg/kg in an orthotopic mouse model. Thus, we report the potential anticancer effects of NPO as a novel inhibitor of NF-κB signaling pathway in HCC.

Also flagged:cancermetabolismRNA binding proteinslocalizationmethylationcancers
Journal Article 2018-11-05 No Snippets Culjkovic-Kraljacic B, Borden KLB.
Show Full Abstract

Traditionally, cancer is viewed as a disease driven by genetic mutations and/or epigenetic and transcriptional dysregulation. While these are undoubtedly important drivers, many recent studies highlight the disconnect between the proteome and the genome or transcriptome. At least in part, this disconnect arises as a result of dysregulated RNA metabolism which underpins the altered proteomic landscape observed. Thus, it is important to understand the basic mechanisms governing post-transcriptional control and how these processes can be co-opted to drive cancer cell phenotypes. In some cases, groups of mRNAs that encode protein involved in specific oncogenic processes can be co-regulated at multiple processing levels in order to turn on entire biochemical pathways. Indeed, the RNA regulon model was postulated as a means to understand how cells coordinately regulate transcripts encoding proteins in the same biochemical pathways. In this review, we describe some of the basic mRNA processes that are dysregulated in cancer and the biological impact this has on the cell. This dysregulation can affect networks of RNAs simultaneously thereby underpinning the oncogenic phenotypes observed.

Also flagged:RKIPNF-κBAlzheimer's diseaseADRaf-1 kinase inhibitorD-galactose
Journal Article 2018-11-05 No Snippets Zuo H, Liu X, Wang D, Li Y, Xu X, Peng R, Song T.
Show Full Abstract

In a previous study, we reported the positive effects of extremely low frequency electromagnetic field (ELF-MF) exposure on Alzheimer's disease (AD) rats; however, the underlying mechanism remains unclear. In addition, we found that Raf-1 kinase inhibitor protein (RKIP) was downregulated by microwave exposure in the rat hippocampus. Our hypothesis was that RKIP-mediated NF-κB pathway signaling is involved in the effect of ELF-MF on the AD rat. In this study, D-galactose intraperitoneal (50 mg/kg/d for 42 d) and Aβ<sub>25-35</sub> hippocampal (5 μL/unilateral, bilateral, single-dose) injection were implemented to establish an AD rat model. Animals were exposed to 50 Hz and 400 µT ELF-MF for 60 continuous days. The spatial memory ability of the rat was then tested using the Morris water maze. Protein expression and interaction were detected by western blotting and co-immunoprecipitation for RKIP-mediated NF-κB pathway factors. The results showed that ELF-MF exposure partially improved the cognitive disorder, upregulated the levels of RKIP, TAK1, and the RKIP/TAK1 interaction, but downregulated p-IKK levels in AD rats. These results indicated that RKIP-mediated NF-κB pathway signaling plays an important role in the ELF-MF exposure-mediated improvements in the AD rat. Our study suggested that ELF-MF exposure might have a potential therapeutic value for AD. Further in depth studies are required in the future.

Also flagged:chloroformestersbithiophenepolyfluorenecyclopentadithiophenephenyl
Journal Article 2018-11-05 No Snippets Yang DS, Barłóg M, Park J, Chung K, Shanker A, Sun J, Kang J, Lee K, Al-Hashimi M, Kim J.
Show Full Abstract

Directed alignment of polymer chains plays an indispensable role in charge transport properties. We focus not only on a specific method to induce the alignment but also on the design of a liquid crystalline (LC) conjugated polymer to take advantage of an intrinsic self-assembly characteristic. We synthesized a lyotropic LC conjugated polymer, CP1-P, having <i>o</i>-nitrobenzyl (ONB) esters as photocleavable side chains and adopted a floating film transfer method to induce the polymer chain alignment through a lyotropic LC phase transition. An optimum amount of a high boiling point solvent (1,2-dichlorobenzene) in chloroform turned out to be an important factor to maximize the polymer chain alignment. The hole transport mobility along the polymer chain alignment direction was 13-14 times higher than that in the direction perpendicular to the alignment. In addition, the removal of side chains resulted in the solvent resistivity while maintaining the alignment feature in organic thin-film transistors.

Also flagged:NEDD4Lperiventricular nodular heterotopiadevelopmental disorderbilateralheterotopiaubiquitin protein ligase
Journal Article 2018-11-04 ✓ 1 Snippet Elbracht M, Kraft F, Begemann M, Holschbach P, Mull M, Kabat IM, Müller B, Häusler M, Kurth I, Hehr U.
In-Text Gene Mentions

…known PVNH‐associated genesARFGEF2, FLNA, TUBA1A, and…

Show Full Abstract

<h4>Background</h4>Mutations in the HECT domain of NEDD4L have recently been identified in a cohort of eight patients with a syndromic form of bilateral periventricular nodular heterotopia (PVNH) in association with neurodevelopmental delay, cleft palate, and toe syndactyly (PVNH7).<h4>Methods</h4>Case report based on NGS sequencing.<h4>Results</h4>Here, we describe a girl with a novel heterozygous NEDD4L missense variant, p.Tyr679His, and characteristic clinical findings, including bilateral periventricular nodular heterotopia, cleft palate and mild toe syndactyly. Molecular testing from peripheral blood identified the healthy father to carry the NEDD4L variant in mosaic state. Notably, a previous pregnancy of the couple had been terminated due to a complex fetal developmental disorder, including hypokinesia and flexion contractures. Upon review, this affected fetus was also shown to carry the familial NEDD4L variant.<h4>Conclusion</h4>Our findings may suggest a broader spectrum of NEDD4L-associated phenotypes, including severe prenatal neurodevelopmental manifestations, which might represent yet another genetic form of fetal hypokinesia with flexion contractures.

Also flagged:diazomethaneorganic acidshydroxyamineLimonoidsthaigranatins Alimonoid
Journal Article 2018-11-04 No Snippets Ren JL, Zou XP, Li WS, Shen L, Wu J.
Show Full Abstract

Five new limonoids named thaigranatins A⁻E (<b>1</b>⁻<b>5</b>), containing a C₁⁻<i>O</i>⁻C<sub>29</sub> moiety, were isolated from seeds of the Thai <i>Xylocarpus granatum</i>, collected at the mangrove swamp of Trang Province, together with the known limonoid, granatumin L (<b>6</b>). The structures of these compounds were established by HR-ESIMS and extensive NMR spectroscopic data. The absolute configuration of <b>1</b> was unequivocally determined by single-crystal X-ray diffraction analysis, conducted with Cu Kα radiation; whereas that of <b>2</b> or <b>6</b> was established to be the same as that of <b>1</b> by the similarity of their electronic circular dichroism (ECD) spectra. In view of the marked antiviral activity of <b>6</b>, its structure was modified via hydrolysis with alkaline KOH, esterification with diazomethane and various organic acids, and oximization with hydroxyamine. Finally, 18 derivatives, <i>viz.</i> <b>7</b>⁻<b>10</b>, <b>8a</b>⁻<b>8i</b>, <b>9a</b>⁻<b>9b</b>, and <b>10a</b>⁻<b>10c</b>, were obtained. In vitro antiviral activities of these derivatives against human immunodeficiency virus 1 (HIV-1) and influenza A virus (IAV) were evaluated. Most notably, <b>8i</b> exhibited marked inhibitory activity against HIV-1 with an IC<sub>50</sub> value of 15.98 ± 6.87 μM and a CC<sub>50</sub> value greater than 100.0 μM; whereas <b>10b</b> showed significant inhibitory activity against IAV with an IC<sub>50</sub> value of 14.02 ± 3.54 μM and a CC<sub>50</sub> value greater than 100.0 μM.

Also flagged:PPARCardiac DiseasesPeroxisome proliferator-activated receptorsPPARsnuclear hormone receptorslipid
Journal Article 2018-11-04 No Snippets Khuchua Z, Glukhov AI, Strauss AW, Javadov S.
Show Full Abstract

Peroxisome proliferator-activated receptors (PPARs) are nuclear hormone receptors that bind to DNA and regulate transcription of genes involved in lipid and glucose metabolism. A growing number of studies provide strong evidence that PPARs are the promising pharmacological targets for therapeutic intervention in various diseases including cardiovascular disorders caused by compromised energy metabolism. PPAR agonists have been widely used for decades as lipid-lowering and anti-inflammatory drugs. Existing studies are mainly focused on the anti-atherosclerotic effects of PPAR agonists; however, their role in the maintenance of cellular bioenergetics remains unclear. Recent studies on animal models and patients suggest that PPAR agonists can normalize lipid metabolism by stimulating fatty acid oxidation. These studies indicate the importance of elucidation of PPAR agonists as potential pharmacological agents for protection of the heart from energy deprivation. Here, we summarize and provide a comprehensive analysis of previous studies on the role of PPARs in the heart under normal and pathological conditions. In addition, the review discusses the PPARs as a therapeutic target and the beneficial effects of PPAR agonists, particularly bezafibrate, to attenuate cardiomyopathy and heart failure in patients and animal models.

Also flagged:MetabolismHepatocellular Carcinomaliver cancertumorsenzyme activityglucose
Journal Article 2018-11-04 ✓ 1 Snippet De Matteis S, Ragusa A, Marisi G, De Domenico S, Casadei Gardini A, Bonafè M, Giudetti AM.
In-Text Gene Mentions

…latoxin), metabolic (diabetes,hemochromatosis, and nonalcoholic fatty…

Show Full Abstract

Hepatocellular carcinoma (HCC) accounts for over 80% of liver cancer cases and is highly malignant, recurrent, drug-resistant, and often diagnosed in the advanced stage. It is clear that early diagnosis and a better understanding of molecular mechanisms contributing to HCC progression is clinically urgent. Metabolic alterations clearly characterize HCC tumors. Numerous clinical parameters currently used to assess liver functions reflect changes in both enzyme activity and metabolites. Indeed, differences in glucose and acetate utilization are used as a valid clinical tool for stratifying patients with HCC. Moreover, increased serum lactate can distinguish HCC from normal subjects, and serum lactate dehydrogenase is used as a prognostic indicator for HCC patients under therapy. Currently, the emerging field of metabolomics that allows metabolite analysis in biological fluids is a powerful method for discovering new biomarkers. Several metabolic targets have been identified by metabolomics approaches, and these could be used as biomarkers in HCC. Moreover, the integration of different omics approaches could provide useful information on the metabolic pathways at the systems level. In this review, we provided an overview of the metabolic characteristics of HCC considering also the reciprocal influences between the metabolism of cancer cells and their microenvironment. Moreover, we also highlighted the interaction between hepatic metabolite production and their serum revelations through metabolomics researches.

Also flagged:NCAPGKNL1gastric cancerGene Expressioncell proliferationnuclear division
Journal Article 2018-11-03 ✓ 1 Snippet Song B, Du J, Song DF, Ren JC, Feng Y.
In-Text Gene Mentions

…miR-4317, which targetsZNF322, is related to…

Show Full Abstract

<h4>Background</h4>Emerging evidence indicate that miRNAs play an important role on gastric cancer (GC) progression via regulating several downstream targets, but it is still partially uncovered. This study aimed to explore the molecular mechanisms of GC by comprehensive analysis of mRNAs and miRNA expression profiles.<h4>Methods</h4>The mRNA and miRNA expression profiles of GSE79973 and GSE67354 downloaded from Gene Expression Omnibus were used to analyze the differentially expressed genes (DEGs) and DE-miRNAs among GC tissues and normal tissues. Then, targets genes of DE-miRNAs were predicted and the DE-miRNA-DEG regulatory network was constructed. Next, function enrichment analysis of the overlapped genes between the predicted DE-miRNAs targets and DEGs was performed and a protein-protein interactions network of overlapped genes was constructed. Finally, RT-PCR analysis was performed to detect the expression levels of several key DEGs and DE-miRNAs.<h4>Results</h4>A set of 703 upregulated and 600 downregulated DEGs, as well as 8 upregulated DE-miRNAs and 27 downregulated DE-miRNAs were identified in GC tissue. hsa-miR-193b-3p and hsa-miR-148a-3p, which targeted most DEGs, were highlighted in the DE-miRNA-DEG regulatory network, as well as hsa-miR-1179, which targeted KNL1, was newly predicted to be associated with GC. In addition, NCAPG, which is targeted by miR-193b-3p, and KNL1, which is targeted by hsa-miR-1179, had higher degrees in the PPI network. RT-qPCR results showed that hsa-miR-148a-3p, hsa-miR-193b-3p, and hsa-miR-1179 were downregulated, and NCAPG and KNL1 were upregulated in GC tissues; this is consistent with our bioinformatics-predicted results.<h4>Conclusions</h4>The downregulation of miR-193b-3p might contribute to GC cell proliferation by mediating the upregulation of NCAPG; as additionally, the downregulation of miR-193b-3p might contribute to the mitotic nuclear division of GC cells by mediating the upregulation of KNL1.

Also flagged:cadmiumprotein kinase C deltaHuntington's diseaseHDmetalsNADPH oxidase
Journal Article 2018-11-03 ✓ 2 Snippets Kwakye GF, Jiménez JA, Thomas MG, Kingsley BA, McIIvin M, Saito MA, Korley EM.
In-Text Gene Mentions

Thus, we hypothesized that heterozygous huntingtin (HTT), responsible for the majority of cases of HD in patients, in combination with Cd exposure would cause neurotoxicity and neurodegeneration via increased intracellular accumulation of Cd and activation of oxidative stress signaling mechanisms in a mouse striatal cell line model of HD.

The heterozygous HTT and Cd-induced cytotoxicity led to a NADPH oxidase (NOX) mediated oxidative stress that was attenuated by exogenous antioxidants and a NOX inhibitor, apocynin.

Show Full Abstract

Huntington's disease (HD) is functionally linked to environmental factors including cigarette use and dyshomeostasis in the levels of metals. Interestingly, one of the most abundant heavy metals in cigarettes is cadmium (Cd), which also accumulates in the striatum and causes neurotoxicity upon exposure. Thus, we hypothesized that heterozygous huntingtin (HTT), responsible for the majority of cases of HD in patients, in combination with Cd exposure would cause neurotoxicity and neurodegeneration via increased intracellular accumulation of Cd and activation of oxidative stress signaling mechanisms in a mouse striatal cell line model of HD. We report that heterozygous HTT striatal cells are significantly more susceptible to Cd-induced cytotoxicity as compared to wild-type HTT cells upon exposure for 48 h. The heterozygous HTT and Cd-induced cytotoxicity led to a NADPH oxidase (NOX) mediated oxidative stress that was attenuated by exogenous antioxidants and a NOX inhibitor, apocynin. Heterozygous HTT coupled with Cd exposure caused increased expression of protein kinase C δ (PKCδ) and other key oxidative stress proteins levels, enhanced the activation of caspase-9 and caspase-3 mediated apoptosis, and blocked the overexpression of extracellular signal-regulated kinase (ERK). We observed significantly greater intracellular accumulation of Cd and reduced expression of divalent metal transporter 1 (DMT1) protein in the heterozygous HTT striatal cells upon Cd exposure. Treatment with zinc, manganese, and iron as well as exogenous antioxidants significantly attenuated the Cd-induced cytotoxicity. Collectively, these results demonstrate that heterozygous HTT exhibits greater neurotoxic properties when coupled with Cd exposure to cause cell death via caspase mediated apoptosis, altered metal transport, and modulation of ERK and PKCδ dependent oxidative signaling mechanisms.

Also flagged:Lysosomessecretionmembrane proteinpolypeptideslumenmembranes
Journal Article 2018-11-03 No Snippets Lee J, Ye Y.
Show Full Abstract

Protein secretion in general depends on signal sequence (also named leader sequence), a hydrophobic segment located at or close to the NH2-terminus of a secretory or membrane protein. This sequence guides the entry of nascent polypeptides into the lumen or membranes of the endoplasmic reticulum (ER) for folding, assembly, and export. However, evidence accumulated in recent years has suggested the existence of a collection of unconventional protein secretion (UPS) mechanisms that are independent of the canonical vesicular trafficking route between the ER and the plasma membrane (PM). These UPS mechanisms export soluble proteins bearing no signal sequence. The list of UPS cargos is rapidly expanding, along with the implicated biological functions, but molecular mechanisms accountable for the secretion of leaderless proteins are still poorly defined. This review summarizes our current understanding of UPS mechanisms with an emphasis on the emerging role of endo-lysosomes in this process.

Also flagged:gene expressiondigoxigeninisofluranemembranenucleotidespolymerase
Journal Article 2018-11-03 No Snippets Ljungberg MC, Sadi M, Wang Y, Aronow BJ, Xu Y, Kao RJ, Liu Y, Gaddis N, Ardini-Poleske ME, Umrod T, Ambalavanan N, Nicola T, Kaminski N, Ahangari F, Sontag R, Corley RA, Ansong C, Carson JP.
Show Full Abstract

This data is a curated collection of visual images of gene expression patterns from the pre- and post-natal mouse lung, accompanied by associated mRNA probe sequences and RNA-Seq expression profiles. Mammalian lungs undergo significant growth and cellular differentiation before and after the transition to breathing air. Documenting normal lung development is an important step in understanding abnormal lung development, as well as the challenges faced during a preterm birth. Images in this dataset indicate the spatial distribution of mRNA transcripts for over 500 different genes that are active during lung development, as initially determined via RNA-Seq. Images were systematically acquired using high-throughput <i>in situ</i> hybridization with non-radioactive digoxigenin-labeled mRNA probes across mouse lungs from developmental time points E16.5, E18.5, P7, and P28. The dataset was produced as part of The Molecular Atlas of Lung Development Program (LungMAP) and is hosted at https://lungmap.net. This manuscript describes the nature of the data and the protocols for generating the dataset.

Also flagged:TDNTGGfl-cDNADNAs (fl-cDNAHOXHOX-related
Journal Article 2018-11-02 ✓ 1 Snippet Ying H, Cooke I, Sprungala S, Wang W, Hayward DC, Tang Y, Huttley G, Ball EE, Forêt S, Miller DJ.
In-Text Gene Mentions

…these, the OLF (olfactomedin-like) domain, which is…

Show Full Abstract

<h4>Background</h4>Despite the biological and economic significance of scleractinian reef-building corals, the lack of large molecular datasets for a representative range of species limits understanding of many aspects of their biology. Within the Scleractinia, based on molecular evidence, it is generally recognised that there are two major clades, Complexa and Robusta, but the genomic bases of significant differences between them remain unclear.<h4>Results</h4>Draft genome assemblies and annotations were generated for three coral species: Galaxea fascicularis (Complexa), Fungia sp., and Goniastrea aspera (Robusta). Whilst phylogenetic analyses strongly support a deep split between Complexa and Robusta, synteny analyses reveal a high level of gene order conservation between all corals, but not between corals and sea anemones or between sea anemones. HOX-related gene clusters are, however, well preserved across all of these combinations. Differences between species are apparent in the distribution and numbers of protein domains and an apparent correlation between number of HSP20 proteins and stress tolerance. Uniquely amongst animals, a complete histidine biosynthesis pathway is present in robust corals but not in complex corals or sea anemones. This pathway appears to be ancestral, and its retention in the robust coral lineage has important implications for coral nutrition and symbiosis.<h4>Conclusions</h4>The availability of three new coral genomes enabled recognition of a de novo histidine biosynthesis pathway in robust corals which is only the second identified biosynthetic difference between corals. These datasets provide a platform for understanding many aspects of coral biology, particularly the interactions of corals with their endosymbionts.

Also flagged:Insulintype 2 diabetes mellitusdammarane triterpenesdammaranehexanordammarane glycosideslongipenosides
Journal Article 2018-11-02 No Snippets Pham HTT, Ha TKQ, Cho HM, Lee BW, An JP, Tran VO, Oh WK.
Show Full Abstract

As part of ongoing research to find new antidiabetic agents from medicinal plants, the chemical composition of Gynostemma longipes, an ethnomedicinal plant used to treat type 2 diabetes mellitus by local communities in Vietnam, was investigated. Ten new dammarane triterpenes, including two 3,4- seco-dammarane analogues, secolongipegenins S1 and S2 (1 and 2), a 3,4- seco-hexanordammarane, secolongipegenin S3 (3), two hexanordammarane glycosides, longipenosides ND1 and ND2 (4 and 5), and five other dammarane glycosides, longipenosides GL1-GL5 (6-10), were isolated from a 70% EtOH extract of the whole G. longipes plant. The structures of the new compounds were elucidated using diverse spectroscopic methods. All of the isolates were evaluated for their stimulatory activities on glucose uptake in differentiated 3T3-L1 adipocyte cells using 2-[ N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-d-glucose as a fluorescent-tagged glucose probe. The stimulant activities on glucose uptake by the test compounds were mediated via the activation of the AMPK pathway using differentiated mouse C2C12 skeletal myoblasts. Consequently, compounds 1, 2, and 4 enhanced glucose uptake and GLUT4 translocation significantly by regulating the AMPK signaling pathway.

Also flagged:MembraneLipidpathogenesiscarotenoidmonocyte-endothelial cell adhesion
Journal Article 2018-11-02 ✓ 1 Snippet Haley HMS, Hill AG, Greenwood AI, Woerly EM, Rienstra CM, Burke MD.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Antilipoperoxidant protein dysfunction is associated with many human diseases, suggesting that bilayer lipid peroxidation may contribute broadly to pathogenesis. Small molecule inhibitors of this membrane-localized chemistry could in theory enable better understanding and/or treatment of such diseases, but currently available compounds have important limitations. Many biological questions thus remain unanswered, and clinical trials have largely been disappointing. Enabled by efficient, building block-based syntheses of three atypical carotenoid natural products produced by microorganisms that thrive in environments of extreme oxidative stress, we found that peridinin is a potent inhibitor of nonenzymatic bilayer lipid peroxidation in liposomes and in primary human endothelial cells. We also found that peridinin blocks monocyte-endothelial cell adhesion, a key step in atherogenesis. A series of frontier solid-state NMR experiments with a site-specifically <sup>13</sup>C-labeled isotopolog synthesized using the same MIDA boronate building block-based total synthesis approach revealed that peridinin is completely embedded within and physically spans the hydrophobic core of POPC membranes, maximizing its effective molarity at the site of the targeted lipid peroxidation reactions. Alternatively, the widely used carotenoid astaxanthin is significantly less potent and was found to primarily localize extramembranously. Peridinin thus represents a promising and biophysically well-characterized starting point for the development of small molecule antilipoperoxidants that serve as more effective biological probes and/or therapeutics.

Also flagged:lactic acidcalciumpathogenesisosteoarthritiscrystal arthropathiesoxygen
Journal Article 2018-11-02 No Snippets Bulysheva AA, Sori N, Francis MP.
Show Full Abstract

<h4>Introduction</h4>Pathological calcium-containing crystals accumulating in the joints, synovial fluid, and soft tissues are noted in most elderly patients, yet arthritic crystal formation remains idiopathic. Interestingly, elevated lactic acid and bone erosion are frequently among the comorbidities and clinical features of patients with highest incidence of crystal arthropathies. This work shows that bone particulates (modeling bone erosion) dissolve in lactic acid and directly generate crystals, possibly presenting a mechanism for crystal accumulation in osteoarthritis.<h4>Methods and results</h4>Micronized human bone (average particle size of 160 μm x 79 μm) completely dissolved in lactic acid in 48 hours, and in synovial fluid with 500 mMol lactic acid in 5 days, generating birefringent rhomboid and rod-shaped crystals. SEM analysis with energy dispersive x-ray spectroscopy of these crystals showed average dimensions of around 2 μm x 40 μm, which contained oxygen, calcium and phosphorous at 8.64:1.85:1. Raman spectroscopy of the generated crystals further showed 910/cm and 1049/cm peaks, aligning with calcium oxalate monohydrate and calcium pyrophosphate, respectively.<h4>Conclusions</h4>This work shows that lactic acid and micronized mineralized bone together directly generate calcium-containing crystals. These observations may provide insights into the elusive etiology of arthritis with crystal involvement, possibly indicating lactic acid as a clinical target for treatment.

Also flagged:PASTCRYtranslationMARKdigestionhow
Journal Article 2018-11-02 No Snippets Van Ngo T, Gammeltoft T, Nguyen HTT, Meyrowitsch DW, Rasch V.
Show Full Abstract

<h4>Background</h4>Antenatal depression is a significant health problem in low and middle- income countries. Although the condition is associated with severe adverse consequences for the mother and newborn, it remains a neglected problem. The purpose of this study was to describe the association between antenatal depressive symptoms and preterm birth (PTB), low birth weight (LBW), and small for gestation age (SGA).<h4>Methods</h4>The study was conducted in Dong Anh District, Hanoi, Vietnam, among pregnant women of less than 24 weeks of gestation. Information on socioeconomic characteristics and reproductive history was collected at enrollment and ADS and experiences of intimate partner violence were assessed at week 32. Birth outcomes were determined at delivery. Bivariate and logistic regression analyses were applied to assess the associations between ADS and PTB, LBW, and SGA.<h4>Results</h4>ADS was significantly associated with an increased risk of PTB (crude OR = 2.4; 95%; CI: 1.01-5.4 and adjusted OR = 2.4; 95% CI: 1.1-5.2, respectively) and a significantly increased risk for giving birth to an LBW infant (crude OR = 3.1; 95% CI: 1.4-7.0 and adjusted OR = 3.5; 95% CI: 1.6-7.6, respectively). In contrast, ADS was not statistically associated with small for gestation age.<h4>Conclusion</h4>ADS is associated with an increased risk of PTB and LBW but not associated with SGA.

Also flagged:Huntington diseaseHDneurodegenerative disorderlocalizations
Journal Article 2018-11-02 ✓ 2 Snippets Park H, Miyazaki H, Yamanaka T, Nukina N.
In-Text Gene Mentions

Huntington Disease (HD) is a neurodegenerative disorder caused by expanded CAG repeats in the exon1 of huntingtin gene (HTT).

…of huntingtin gene (HTT).…

Show Full Abstract

Huntington Disease (HD) is a neurodegenerative disorder caused by expanded CAG repeats in the exon1 of huntingtin gene (HTT). The mutant HTT affects the transcriptional profile of neurons by disrupting the activities of transcriptional machinery and alters expression of many genes. In this study, we identified dysregulated non-coding RNAs (ncRNAs) in medium spiny neurons of 4-week-old HD model mouse. Also, we observed the intracellular localizations of Abhd11os and Neat1 ncRNAs by ViewRNA in situ hybridization, which could provide more precise detection, suggesting that it is a useful method to investigate the expression changes of genes with low expression levels.

Also flagged:Fibroblast growth factor 9Nrf2ERKHuntington's diseaseHDneurodegenerative disorder
Journal Article 2018-11-02 No Snippets Yusuf IO, Chen HM, Cheng PH, Chang CY, Tsai SJ, Chuang JI, Wu CC, Huang BM, Sun HS, Yang SH.
Show Full Abstract

Huntington's disease (HD) is a heritable neurodegenerative disorder, and has been characterized as an increase of oxidative stress in brain regions. In our previous results, we showed fibroblast growth factor 9 (FGF9) provides neuroprotective functions to suppress cell death in HD striatal cells dominantly through ERK signalling. However, whether the working mechanism of FGF9 is related to anti-oxidative stress in HD is still unknown. In this study, STHdh<sup>Q7/Q7</sup> (Q7) and STHdh<sup>Q111/Q111</sup> (Q111) striatal knock-in cell lines were used to examine the neuroprotective effects of FGF9 against oxidative stress in HD. Results show that FGF9 alleviates oxidative stress induced by starvation in Q7 and Q111 cells. The treatment of FGF9 not only induces upregulation and activation of nuclear factor erythroid 2-like 2 (Nrf2), a critical transcription factor for anti-oxidative stress, but also further upregulates its downstream targets, such as superoxide dismutase 2, gamma-glutamylcysteine synthetase and glutathione reductase. Furthermore, blockage of the Nrf2 pathway abolishes the anti-oxidative functions of FGF9, and inhibition of ERK signalling reduces the activation of the FGF9-Nrf2 pathway, resulting in higher level of oxidative stress in HD cells. These results support the neuroprotective effects of FGF9 against oxidative stress through the ERK-Nrf2 pathway, and imply one of potential strategies for therapy of HD.

Also flagged:neurodegenerative disorderIT15HuntingtinHDchoreacognitive dysfunction
Journal Article 2018-11-02 ✓ 2 Snippets Sassone J, Papadimitriou E, Thomaidou D.
In-Text Gene Mentions

To this end, a recently released drug trial using the antisense oligonucleotide, IONIS-HTTR that targets Huntingtin mRNA and suppresses mutant HTT production, has shown promise as a potential disease-modifying HD therapy (Tabrizi et al., 2018).

…1 of theHTTgene ( MacDonald…

Show Full Abstract

Huntington's Disease (HD) is a neurodegenerative disorder caused by a CAG expansion in the exon-1 of the IT15 gene encoding the protein Huntingtin. Expression of mutated Huntingtin in humans leads to dysfunction and ultimately degeneration of selected neuronal populations of the striatum and cerebral cortex. Current available HD therapy relies on drugs to treat chorea and control psychiatric symptoms, however, no therapy has been proven to slow down disease progression or prevent disease onset. Thus, although 24 years have passed since HD gene identification, HD remains a relentless progressive disease characterized by cognitive dysfunction and motor disability that leads to death of the majority of patients, on average 10-20 years after its onset. Up to now several molecular pathways have been implicated in the process of neurodegeneration involved in HD and have provided potential therapeutic targets. Based on these data, approaches currently under investigation for HD therapy aim on the one hand at getting insight into the mechanisms of disease progression in a human-based context and on the other hand at silencing mHTT expression by using antisense oligonucleotides. An innovative and still poorly investigated approach is to identify new factors that increase neurogenesis and/or induce reprogramming of endogenous neuroblasts and parenchymal astrocytes to generate new healthy neurons to replace lost ones and/or enforce neuroprotection of pre-existent striatal and cortical neurons. Here, we review studies that use human disease-in-a-dish models to recapitulate HD pathogenesis or are focused on promoting <i>in vivo</i> neurogenesis of endogenous striatal neuroblasts and direct neuronal reprogramming of parenchymal astrocytes, which combined with neuroprotective protocols bear the potential to re-establish brain homeostasis lost in HD.

Also flagged:Obesityinsulincholesterolbiosynthesismetabolismmaternal obesity
Journal Article 2018-11-02 ✓ 1 Snippet Shrestha D, Rahman ML, Workalemahu T, Zhu C, Tekola-Ayele F.
In-Text Gene Mentions

…as PCSK1 andOLFM4) have been…

Show Full Abstract

Fetal and maternal genetic propensity to obesity can influence birthweight. We investigated the effects of fetal and maternal genetic risk of obesity on birthweight and evaluated whether these genetic influences modify the well-known association between maternal pre-pregnancy body mass index (BMI) and birthweight. In 950 mother-baby pairs of African ancestry, a genetic risk score for adulthood obesity was generated for mothers (mGRS) and their babies (bGRS) as the weighted sum of BMI-increasing alleles of 97 single nucleotide polymorphisms known to be associated with BMI. The median GRS value was used as a cut-off to define high or low bGRS and mGRS. High bGRS was significantly associated with 70 g lower birthweight (95% Confidence Interval [CI] = -127.4 to -12.4) compared to low bGRS. mGRS was positively correlated with birthweight but the association was not significant. mGRS modified the significant birthweight-increasing effect of maternal pre-pregnancy BMI (<i>P-for-interaction</i> = 0.03); among mothers with low mGRS, those who were overweight or obese had 127.7 g heavier babies (95% CI = 27.1 to 228.2) compared to those who had normal weight. In summary, fetal obesity genetic risk loci exert direct influence on birthweight, and maternal loci modify the effect of pre-pregnancy BMI on birthweight.

Also flagged:Sarcomastumorssarcomasoft tissue sarcomastumormesenchymal neoplasms
Journal Article 2018-11-02 ✓ 1 Snippet Choe J, Riedel R.
In-Text Gene Mentions

BLU-285, also known as avapritinib, and DCC-2618 are highly potent and selective inhibitors of mutant KIT and PDGFRA, with demonstrated activity against PDGFRA D842V mutations along with secondary KIT resistance mutations.

Show Full Abstract

Sarcomas are rare tumors derived from mesenchymal connective tissues in the body. Because there are well over 50 histologic sarcoma subtypes, including malignant and non-malignant pathologies, clinical courses and therapeutic management are widely divergent. In general, therapeutic options across all soft tissue sarcomas are limited in number and are often generalized across multiple sarcoma histologies. The recent emergence of molecularly targeted therapies and immune-based agents presents a future of refined systemic treatment practices that are rationally tailored to the tumor by histologic subtype and biologic mechanisms.

Also flagged:peroxiredoxin1PRDX1epithelial ovarian cancerovarian cancerepithelial ovarian tumorscell proliferation
Journal Article 2018-11-02 ✓ 5 Snippets Zheng MJ, Wang J, Wang HM, Gao LL, Li X, Zhang WC, Gou R, Guo Q, Nie X, Liu JJ, Lin B.
In-Text Gene Mentions

Duan et al found that the inhibition of PRDX3 expression triggered cisplatin-mediated apoptosis in ovarian cancer cells, which may act through suppression of the NF-κB signaling pathway.16 In a study by Pak et al, overexpression of PRDX6 was demonstrated to reduce the apoptotic effect of cisplatin on human ovarian cancer cells by reducing ROS levels and suppressing the caspase signaling pathway.17 A study by He et al showed that PRDX1 knockdown increased ROS accumulation and mitogen-activated protein to enhance lapachone-induced apoptosis.18 At present, the relationship between PRDX1 and the mechanisms involved in the development of ovarian cancer has not been investigated.

The mammalian PRDX family is made up of six members, from PRDX1 to PRDX6, which can be divided into three subgroups based on the number of cysteine residues and the catalytic reaction mechanism: typical 2-cysteine PRDX1–4, atypical 2-cysteine PRDX5, and 1-cysteine PRDX6 proteins.4 PRDX1 contains conserved N-terminal Cys52 and C-terminal Cys173 sequences.5 An antioxidant, PRDX1 regulates cell growth, differentiation, and apoptosis.

…from PRDX1 toPRDX6, which can be…

…PRDX5, and 1-cysteinePRDX6proteins.…

…members, PRDX1 toPRDX6.…

Show Full Abstract

<h4>Aim</h4>The aim of this study was to explore the expression of peroxiredoxin1 (PRDX1) in epithelial ovarian cancer, analyze the relationship between PRDX1 and clinicopathologic parameters of patients with ovarian cancer, including their prognosis, and describe changes and the mechanisms involved in malignant biologic behavior of ovarian cancer cells when PRDX1 expression is inhibited.<h4>Methods</h4>The expression of PRDX1 was detected immunohistochemically in 15 samples of normal ovarian tissue, 21 benign, 11 borderline, and 101 malignant epithelial ovarian tumors. Changes in ovarian cancer cell proliferation, invasion, and metastasis before and after inhibiting PRDX1 expression were assessed by cell function assay. Additionally, gene set enrichment analysis (GSEA) of PRDX1 was performed by the Cancer Genome Atlas database. A protein- protein interaction network was then constructed and a pathway function analysis of the genes in the network was conducted.<h4>Results</h4>PRDX1 expression was mainly localized to the cytoplasm, as well as the nucleus of cells. The expression rate of PRDX1 in epithelial ovarian malignant tissues (96.04%) was significantly higher than that in borderline (72.72%) and benign (57.14%) epithelial ovarian tumors, and normal ovarian tissue (20%; all <i>P</i><0.05). Cox multivariate regression analysis indicated that advanced clinical stage, low tissue differentiation, and high expression of PRDX1 were independent risk factors affecting the prognosis of epithelial ovarian cancer (all <i>P</i><0.05). Cell function assay verified that the decreased expression of PRDX1 inhibited ovarian cancer cell proliferation, invasion, and metastasis. GSEA analysis indicated that PRDX1 was significantly related to the Wnt signaling pathway. Western blot analysis confirmed that PRDX1 could regulate the expression of β-catenin in the Wnt pathway.<h4>Conclusion</h4>Decreased expression of PRDX1 can attenuate cell proliferation, invasion, and metastasis of ovarian cancer cells. The expression of PRDX1 is related to the prognosis of patients with ovarian cancer and can therefore be used as a biomarker.

Also flagged:Solid Cancerspediatric cancerscancertumor suppressor genestyrosine kinasesbrain tumors
Journal Article 2018-11-02 No Snippets Dupain C, Harttrampf AC, Boursin Y, Lebeurrier M, Rondof W, Robert-Siegwald G, Khoueiry P, Geoerger B, Massaad-Massade L.
Show Full Abstract

We hypothetized that pediatric cancers would more likely harbor fusion transcripts. To dissect the complexity of the fusions landscape in recurrent solid pediatric cancers, we conducted a study on 48 patients with different relapsing or resistant malignancies. By analyzing RNA sequencing data with a new in-house pipeline for fusions detection named ChimComp, followed by verification by real-time PCR, we identified and classified the most confident fusion transcripts (FTs) according to their potential biological function and druggability. The majority of FTs were predicted to affect key cancer pathways and described to be involved in oncogenesis. Contrary to previous descriptions, we found no significant correlation between the number of fusions and mutations, emphasizing the particularity to study pre-treated pediatric patients. A considerable proportion of FTs containing tumor suppressor genes was detected, reflecting their importance in pediatric cancers. FTs containing non-receptor tyrosine kinases occurred at low incidence and predominantly in brain tumors. Remarkably, more than 30% of patients presented a potentially druggable high-confidence fusion. In conclusion, we detected new oncogenic FTs in relapsing pediatric cancer patients by establishing a robust pipeline that can be applied to other malignancies, to detect and prioritize experimental validation studies leading to the development of new therapeutic options.

Also flagged:ValineetherDicyclohexylcarbodiimidesynthesispolystyreneEthyl acetate
Journal Article 2018-11-02 ✓ 1 Snippet Cazzamalli S, Figueras E, Pethő L, Borbély A, Steinkühler C, Neri D, Sewald N.
In-Text Gene Mentions

DCC

Show Full Abstract

Traditional chemotherapeutics used in cancer therapy do not preferentially accumulate in tumor tissues. The conjugation to delivery vehicles like antibodies or small molecules has been proposed as a strategy to increase the tumor uptake and improve the therapeutic window of these drugs. Here, we report the synthesis and the biological evaluation of a novel small molecule-drug conjugate (SMDC) comprising a high-affinity bidentate acetazolamide derivative, targeting carbonic anhydrase IX (CAIX), and cryptophycin, a potent microtubule destabilizer. The biological activity of the novel SMDC was evaluated in vitro, measuring binding to the CAIX antigen by surface plasmon resonance and cytotoxicity against SKRC-52 cells. In vivo studies showed a delayed growth of tumors in nude mice bearing SKRC-52 renal cell carcinomas.

Also flagged:Hereditary hemochromatosisHHironmetabolismHH type IJuvenile hemochromatosis
Journal Article 2018-11-02 ✓ 3 Snippets Mantilla-Hernández JC, Amaya-Mujica J.
In-Text Gene Mentions

…Juvenilehemochromatosiswith multi-organ involvement…

…according to theHFEgene mutation.…

…is characterized byHFEgene mutation, while…

Show Full Abstract

Hereditary hemochromatosis (HH) includes various disorders in iron metabolism producing iron deposits in several organs. HH is classified according to the HFE gene mutation. HH type I is characterized by HFE gene mutation, while types II, III and IV are due to other conditions. Juvenile hemochromatosis (JH) is related to hemojuvelin mutation, which is a regulatory peptide of the hepcidin protein, which regulates iron absorption. We report a case of JH and offer a concise review of the literature. A 14-year-old girl, with no secondary sexual characteristics, presented with abdominal pain, cough and dyspnoea. Clinical examination revealed right lower lobe consolidation, pleural effusion, cardiomegaly and an ejection fraction of 20%, with no response to treatment. On autopsy she was seen to have pleural and pericardial effusion, dilated cardiomyopathy, liver cirrhosis and pancreatic fibrosis. Prussian blue stain showed iron overload in these organs. JH with hypogonadism, cardiomyopathy and cirrhosis was diagnosed.

Also flagged:preeclampsiaPEhypertensionCD4gestationtumor necrosis factor-alpha
Journal Article 2018-11-02 No Snippets Harmon AC, Ibrahim T, Cornelius DC, Amaral LM, Cunningham MW, Wallace K, LaMarca B.
Show Full Abstract

Preeclampsia (PE), new onset hypertension during pregnancy, is associated with a proinflammatory profile compared to normal pregnancy (NP). We hypothesize that CD4<sup>+</sup> T cells from PE patient placentas cause PE symptoms during pregnancy compared to those from NP women. CD4<sup>+</sup> T cells were isolated from placentas of PE and NP women using anti-CD4 magnetic separation, cultured in TexMACS medium at 37 °C in 5% CO<sub>2</sub>, and injected intraperitoneally into nude-athymic rats on day 12 of gestation. On day 18, carotid catheters were implanted and on day 19, mean arterial pressure (MAP) was measured and blood and tissues were collected. MAP was 125 ± 2 mmHg in rats with NP CD4<sup>+</sup> T cells but increased to 140 ± 4 mmHg in rats with PE CD4<sup>+</sup> T cells. Significant differences in circulating cytokines tumor necrosis factor-alpha (TNF-α), interleukin-17 (IL-17) and soluble fms-like tyrosine kinase-1 (sFlt-1) were found with PE vs NP CD4<sup>+</sup> T cells (TNF-α- PE = 167.4 pg/mL, NP = 79.4 pg/mL; IL-17-PE = 7.054 pg/mL, NP = 3.185 pg/mL; sFlt-1-PE = 90.7 pg/mL, NP = 58.2 pg/mL. In addition, renal cortical endothelin-1 (ET-1) mRNA expression increased 4.5 fold in rats with PE CD4<sup>+</sup> T cells versus those receiving to NP CD4<sup>+</sup> T cells. These data indicate an important role for placental PE CD4<sup>+</sup> T cells to cause many characteristics of PE during pregnancy.

Also flagged:host cellhost cellsgene expressioninfectionpathogenesisresponse to
Journal Article 2018-11-01 No Snippets Marsh JW, Hayward RJ, Shetty AC, Mahurkar A, Humphrys MS, Myers GSA.
Show Full Abstract

Bacterial pathogens subvert host cells by manipulating cellular pathways for survival and replication; in turn, host cells respond to the invading pathogen through cascading changes in gene expression. Deciphering these complex temporal and spatial dynamics to identify novel bacterial virulence factors or host response pathways is crucial for improved diagnostics and therapeutics. Dual RNA sequencing (dRNA-Seq) has recently been developed to simultaneously capture host and bacterial transcriptomes from an infected cell. This approach builds on the high sensitivity and resolution of RNA sequencing technology and is applicable to any bacteria that interact with eukaryotic cells, encompassing parasitic, commensal or mutualistic lifestyles. Several laboratory protocols have been presented that outline the collection, extraction and sequencing of total RNA for dRNA-Seq experiments, but there is relatively little guidance available for the detailed bioinformatic analyses required. This protocol outlines a typical dRNA-Seq experiment, based on a Chlamydia trachomatis-infected host cell, with a detailed description of the necessary bioinformatic analyses with currently available software tools.

Also flagged:scuGlusynthesisibuprofenascorbic acidP11
Journal Article 2018-11-01 ✓ 1 Snippet Yue Q, Peng Y, Zhao Y, Lu R, Fu Q, Chen Y, Yang Y, Hai L, Guo L, Wu Y.
In-Text Gene Mentions

DCC

Show Full Abstract

Ibuprofen is one of the most potent non-steroid anti-inflammatory drugs (NSAIDs) and plays an important role in the treatment of neurodegenerative diseases. However, its poor brain penetration and serious side effects at therapeutic doses, has hindered its further application. Thus, it is of great interest to develop a carrier-mediated transporter (CMT) system that is capable of more efficiently delivering ibuprofen into the brain at smaller doses to treat neurodegenerative diseases. In this study, a dual-mediated ibuprofen prodrug modified by glucose (Glu) and vitamin C (Vc) for central nervous system (CNS) drug delivery was designed and synthesized in order to effectively deliver ibuprofen to brain. Ibuprofen could be released from the prepared prodrugs when incubated with various buffers, mice plasma and brain homogenate. Also, the prodrug showed superior neuroprotective effect in vitro and in vivo than ibuprofen. Our results suggest that chemical modification of therapeutics with warheads of glucose and Vc represents a promising and efficient strategy for the development of brain-targeting prodrugs by utilizing the endogenous transportation mechanism of the warheads.

Also flagged:albuminpaclitaxelmaleimidetumorsglutathioneoxygen
Journal Article 2018-11-01 No Snippets Yang J, Lv Q, Wei W, Yang Z, Dong J, Zhang R, Kan Q, He Z, Xu Y.
Show Full Abstract

The efficacy of traditional chemotherapy often suffers from rapid clearance and off-target toxicity. Drug delivery systems and controlled release are applied to improve the therapeutic efficiencies of small-molecule drugs. In this work, two novel oxidative/reductive (Ox/Re) -sensitive and one non-sensitive Paclitaxel (PTX) prodrugs were synthesized with a maleimide group, which rapidly conjugates with albumin in vivo. Albumin serves as a good vehicle to deliver more prodrug to tumors due to the enhanced permeation and retention (EPR) effect. PTX was then released from the prodrugs in glutathione(GSH)/ reactive oxygen species(ROS)-rich tumor microenvironments. This bioresponsive prodrug strategy demonstrates potent chemotherapeutic efficiency in vivo and may be utilized in clinical cancer therapy.

Also flagged:Vitamin Curinary tract infectionureaseSodium metasilicateammoniumstruvite stone
Journal Article 2018-11-01 No Snippets Manzoor MAP, Duwal SR, Mujeeburahiman M, Rekha PD.
Show Full Abstract

<h4>Background</h4>Formation of struvite stones is associated with urinary tract infection by urease-producing bacteria. Biogenic crystal growth in natural and synthetic materials is regulated by the action of inhibitors, ranging from small ions, molecules to large macromolecules.<h4>Materials and methods</h4>We report the dynamics of in vitro crystallization of struvite in presence of vitamin C in synthetic urine using single diffusion gel growth technique. Sodium metasilicate gel of specific gravity 1.05 and the aqueous solution of ammonium dihydrogen phosphate were used as the medium for growing the struvite crystals. The crystallization process was induced by a urease positive struvite stone associated Pseudomonas aeruginosa to mimic the infection leading to stone formation. The grown crystals were characterized by ATR-FTIR and powder XRD. The surface morphology was analysed through FE-SEM for comparison between treatments.<h4>Results</h4>We observed decrease in number, dimension, and growth rate of struvite crystals with the increasing concentrations of vitamin C. Crystals displayed well-defined faces and dendritic morphology of struvite in both control and biogenic systems.<h4>Conclusion</h4>The results strongly suggest that, vitamin C can modulate the formation of struvite crystals in the presence of uropathogenic bacteria.

Also flagged:esophageal adenocarcinomaBarrett's esophagusBEPolymerasedysplasiahematoxylin
Journal Article 2018-11-01 ✓ 1 Snippet Eluri S, Klaver E, Duits LC, Jackson SA, Bergman JJ, Shaheen NJ.
In-Text Gene Mentions

DCC

Show Full Abstract

In a prior study, baseline mutational load (ML) predicted progression to high-grade dysplasia (HGD) or esophageal adenocarcinoma (EAC) in Barrett's esophagus (BE) with an area under the curve (AUC) of 0.95. We aimed to validate the test characteristics of this predictive biomarker panel using crude DNA lysates in a larger well-characterized cohort. We performed a nested case-control study of BE patients from three tertiary referral centers in the Netherlands. Cases had baseline nondysplastic BE (NDBE) and developed HGD/EAC ≥ 2 years later. Controls were matched 2:1, had baseline NDBE, and no progression. Polymerase chain reaction (PCR)-based mutational analysis was performed on crude lysates from formalin-fixed, paraffin-embedded tissue. ML was calculated from loss of heterozygosity (LOH) and microsatellite instability (MSI) at 10 genomic loci. Receiver operator characteristic (ROC) curves were created to assess the diagnostic utility of various cutoffs of ML for progression. Of 159 subjects, 58 were progressors and 101 were nonprogressors, there was no difference in mean ML in preprogression tissue in progressors and nonprogressors (ML = 0.73 ± 0.69 vs. ML = 0.74 ± 0.61, P = 0.93). ROC curves showed poor discrimination of ML in predicting progression with AUC of 0.50 at ML ≥ 1. AUC did not vary with different ML cut-points. The utility of the ML to stratify BE patients for risk of progression was not confirmed in this study. The etiology for discrepancies between this and prior studies showing high predictiveness is likely due to the use of crude lysates in this study, but requires further investigation.

Also flagged:Estrogenglutathionechotooligosaccharidesosteosarcomapolyethylene glycolestrogen receptor
Journal Article 2018-11-01 No Snippets Yin X, Feng S, Chi Y, Liu J, Sun K, Guo C, Wu Z.
Show Full Abstract

An estrogen (ES)-functionalized cationic liposomal system was developed and exploited for targeted delivery to osteosarcoma. Natural biocompatible chotooligosaccharides (COS, MW2-5 KDa) were covalently tethered to the liposomal surface through a disulfate bond (-SS-) to confer reduction-responsive COS detachment, whereas estrogen was grafted via polyethylene glycol (PEG 2 K) chain to achieve estrogen receptor-targeting. The liposomal carriers were prepared by the ethanol injection method and fluorescent anticancer drug doxorubicin (DOX) was loaded with ammonium sulfate gradient. The physicochemical properties, reduction-sensitivity, and the roles of estrogen on cellular uptake and tumor-targeting were studied. The Chol-SS-COS/ES/DOX liposomes were spherical with an average size about 110 nm, and high encapsulation efficiency. The liposomes were stable in physiological condition but rapidly release the payload in response to tumoral intracellular glutathione (20 mM). MTT cytotoxicity assay confirmed that Chol-SS-COS/ES/DOX liposomes exhibited higher cytotoxicity to MG63 osteosarcoma cells than to liver cells (LO2). Flow cytometry (FCM) and confocal laser scanning microscopy revealed that cellular uptake of Chol-SS-COS/ES/DOX liposomes by MG63, than the free DOX or Chol-SS-COS/DOX. Ex vivo fluorescence distribution study showed that the multifunctional liposomes selectively accumulated in the MG63 xenografts versus the organs. Chol-SS-COS/ES/DOX liposomes strongly inhibited the tumor growth and enhanced the animal survival rate. Overall, the COS grafted estrogen-functionalized cationic liposomes, fortified with glutathione-responsiveness, showed great potential for specific intracellular drug delivery to estrogen receptor-expressing tumors such as osteosarcoma.

Also flagged:paclitaxeltumorGRP78breast cancerbreast tumorPeptide
Journal Article 2018-11-01 No Snippets Niu S, Bremner DH, Wu J, Wu J, Wang H, Li H, Qian Q, Zheng H, Zhu L.
Show Full Abstract

Nanoparticles and macromolecular carriers have been widely used to increase the efficacy of chemotherapeutics, largely through passive accumulation provided by their enhanced permeability and retention effect. However, the therapeutic efficacy of nanoscale anticancer drug delivery systems is severely truncated by their low tumor-targetability and inefficient drug release at the target site. Here, the design and development of novel l-peptide functionalized dual-responsive nanoparticles (l-CS-g-PNIPAM-PTX) for active targeting and effective treatment of GRP78-overexpressing human breast cancer in vitro and in vivo are reported. l-CS-g-PNIPAM-PTX NPs have a relative high drug loading (13.5%) and excellent encapsulation efficiency (74.3%) and an average diameter of 275 nm. The release of PTX is slow at pH 7.4 and 25 °C but greatly accelerated at pH 5.0 and 37 °C. MTT assays and confocal experiments showed that the l-CS-g-PNIPAM-PTX NPs possessed high targetability and antitumor activity toward GRP78 overexpressing MDA-MB-231 human breast cancer cells. As expected, l-CS-g-PNIPAM-PTX NPs could effectively treat mice bearing MDA-MB-231 human breast tumor xenografts with little side effects, resulting in complete inhibition of tumor growth and a high survival rate over an experimental period of 60 days. These results indicate that l-peptide-functionalized acid - and thermally activated - PTX prodrug NPs have a great potential for targeted chemotherapy in breast cancer.

Also flagged:angiogenesishyaluronic acidTween-80genisteinGENprogrammed cell death
Journal Article 2018-11-01 No Snippets Li C, Chen R, Xu M, Qiao J, Yan L, Guo XD.
Show Full Abstract

The ophthalmic drug delivery is a challenge in the clinical treatment of ocular diseases. The traditional drug administration usually shows apparent limitations, such as the low bioavailability from the reason of low penetration of the cornea and the short survival time of drug in the eyes. To overcome these shortcomings, we propose an amphiphilic polymer micelle modified with hyaluronic acid (HA) for high efficient ophthalmic delivery of genistein, a widely used hydrophobic drug for treatment of ocular angiogenesis. The MPEG-b-PAE copolymer was synthesized by the Michael addition reaction, and the final drug carrier MPEG-b-PAE-g-HA was obtained by the process of esterification. Then, genistein was packaged in this drug carrier, getting the final micelles with size of about 84.5 nm. The cell viability tests showed that the micelles take no obvious cytotoxicity to the human cornea epithelium cells. The functionalities of drug slow release and cornea penetration ability were demonstrated in a series ex vivo experiments. Further, the vascular inhibition test illustrated that the micelles could significantly inhibit the angiogenesis of human umbilical vein endothelial cells. These results indicate that the constructed polymer has high feasibility to be used as drug carrier in the treatment of ocular diseases.

Also flagged:heparinpreeclampsiadalteparinantithrombin IIIclottingfms-like tyrosine kinase-1
Journal Article 2018-11-01 ✓ 5 Snippets Wat JM, Hawrylyshyn K, Baczyk D, Greig IR, Kingdom JC.
In-Text Gene Mentions

…recombinant antithrombin III (ATIII) was from Haematologic…

…sFlt1 but notATIII

…curve shift forATIII, no significant shift…

…does not bindATIII.…

…LMWH with minimalATIIIbinding activity.…

Show Full Abstract

Low molecular weight heparin (LMWH) is being investigated as a potential preventative therapy against preeclampsia. There is evidence suggesting that LMWH may prevent preeclampsia through anticoagulation-independent mechanisms. In this study, we compared the in vitro placental, endothelial, and anti-inflammatory effects of an LMWH (dalteparin) with a nonanticoagulant, glycol-split heparin derivative (gsHep). In contrast with dalteparin, gsHep did not interact with antithrombin III, possess significant anti-Factor Xa activity, or significantly prolong in vitro plasma clotting time. However, dalteparin and gsHep were otherwise mechanistically similar, both interacting with soluble fms-like tyrosine kinase-1 (sFlt1) and promoting release of the pro-angiogenic protein placental growth factor, but not the antiangiogenic sFlt1, from healthy placental villous explants. Placental explant media pretreated with dalteparin or gsHep significantly stimulated endothelial cell tube formation compared to untreated explants. Lastly, dalteparin and gsHep both significantly suppressed inflammation by inhibiting complement activation and leukocyte adhesion to endothelial cells that were activated using serum from preeclamptic women. Our data suggest that nonanticoagulant heparin derivatives may be utilized as a tool to distinguish the anticoagulation-independent mechanisms of LMWH, and provide insight into the role of anticoagulation in the prevention of preeclampsia.

Also flagged:oestruscarbohydrate sulphotransferase 8CHST8corticosteroid-binding globulinCBGoestradiol 17-β-dehydrogenase 1
Journal Article 2018-11-01 ✓ 1 Snippet Sun S, Li C, Liu S, Luo J, Chen Z, Zhang C, Zhang T, Huang J, Xi L.
In-Text Gene Mentions

…PAQR9, prostacyclin synthase (PTGIS), contactin-associated protei…

Show Full Abstract

A total of 24 female Xinong Saanen dairy goats were used to examine differentially expressed genes (DEGs) in the ovaries of goats treated once or three times for oestrus synchronisation (ES). The goats were randomly divided into two groups: one group received three ES treatments at fortnightly intervals (repeated or triple ES group), whereas the other was only treated once on the same day as the third ES treatment for the triple group (control group) during the breeding season. Ovaries of three goats in oestrus from each group were collected for morphological examination and transcriptome sequencing, while the rest of the goats were artificially inseminated twice. Litter size and fecundity rate tended (P=0.06) to be lower in the triple ES group. A total of 319 DEGs were identified, including carbohydrate sulphotransferase 8 (CHST8), corticosteroid-binding globulin (CBG), oestradiol 17-β-dehydrogenase 1 (DHB1), oestrogen receptor 1 (ESR1), progestin and adipoQ receptor family member 4 (PAQR4), PAQR9, prostacyclin synthase (PTGIS), contactin-associated protein (CNTNAP4), matrix metalloproteinase-2 (MMP-2), regulator of G-protein signalling 9-2 (RGS9-2) and sperm surface protein Sp17 (Sp17); these were the most promising novel candidate genes for reproductive performances in goats. Our study indicates that triple ES could cause DNA damage and alter gene expression in goat ovaries, potentially affecting ovary function, neural regulation and hormone secretion.

Also flagged:chronic obstructive pulmonary diseaseCOPDHHIPSERPINA1CHRNA5TNS1
Journal Article 2018-11-01 No Snippets Prokopenko D, Sakornsakolpat P, Fier HL, Qiao D, Parker MM, McDonald MN, Manichaikul A, Rich SS, Barr RG, Williams CJ, Brantly ML, Lange C, Beaty TH, Crapo JD, Silverman EK, Cho MH.
Show Full Abstract

Genome-wide association studies have identified common variants associated with chronic obstructive pulmonary disease (COPD). Whole-genome sequencing (WGS) offers comprehensive coverage of the entire genome, as compared with genotyping arrays or exome sequencing. We hypothesized that WGS in subjects with severe COPD and smoking control subjects with normal pulmonary function would allow us to identify novel genetic determinants of COPD. We sequenced 821 patients with severe COPD and 973 control subjects from the COPDGene and Boston Early-Onset COPD studies, including both non-Hispanic white and African American individuals. We performed single-variant and grouped-variant analyses, and in addition, we assessed the overlap of variants between sequencing- and array-based imputation. Our most significantly associated variant was in a known region near HHIP (combined P = 1.6 × 10<sup>-9</sup>); additional variants approaching genome-wide significance included previously described regions in CHRNA5, TNS1, and SERPINA6/SERPINA1 (the latter in African American individuals). None of our associations were clearly driven by rare variants, and we found minimal evidence of replication of genes identified by previously reported smaller sequencing studies. With WGS, we identified more than 20 million new variants, not seen with imputation, including more than 10,000 of potential importance in previously identified COPD genome-wide association study regions. WGS in severe COPD identifies a large number of potentially important functional variants, with the strongest associations being in known COPD risk loci, including HHIP and SERPINA1. Larger sample sizes will be needed to identify associated variants in novel regions of the genome.

Also flagged:siliconvisioneye diseasesdaunorubicindexamethasonecell proliferation
Journal Article 2018-11-01 No Snippets Warther D, Xiao Y, Li F, Wang Y, Huffman K, Freeman WR, Sailor M, Cheng L.
Show Full Abstract

The number of blind and low vision persons in the US is projected to increase to 5.68 million by 2020. The eye diseases causing loss of vision are life-long, chronic, and often need protracted presence of therapeutics at the disease site to keep the disease in remission. In addition, multiple pathologies participate in the disease process and a single therapy seems insufficient to bring the disease under control and prevent vision loss. This study demonstrates the use of porous silicon (pSi) particles sequentially loaded with daunorubicin (DNR) and dexamethasone (DEX) to create a synergistic intravitreally injectable dual-drug delivery system. DEX targets chronic inflammation while DNR inhibits excessive cell proliferation as well as suppresses hypoxia-inducible factor 1 to reduce scarring. This pSi-based delivery system releases therapeutic concentrations of DNR for 100 days and DEX for over 165 days after a single dose. This intravitreal dual-drug delivery system is also well tolerated after injection into the rabbit eye model, attested by ocular biomicroscopy, ocular tonometry, electroretinography, and histology. This novel dual-drug delivery system opens an attractive modality for combination therapy to manage refractory chorioretinal diseases and further preclinical studies are warranted to evaluate its efficacy.

Also flagged:TumorColorectal CancerLiver Metastasiscolorectal cancer liver metastasismethylationCEA
Journal Article 2018-11-01 ✓ 3 Snippets Bhangu JS, Beer A, Mittlböck M, Tamandl D, Pulverer W, Schönthaler S, Taghizadeh H, Stremitzer S, Kaczirek K, Gruenberger T, Gnant M, Bergmann M, Mannhalter C, Weinhäusel A, Oehler R, Bachleitner-Hofmann T.
In-Text Gene Mentions

Methylation marker levels were correlated with baseline tumor volume and treatment response and compared with the standard tumor markers CEA and CA 19-9.<h4>Results</h4>The methylation markers SEPT9, DCC, BOLL, and SFRP2 were present in all patients at baseline and displayed a stronger correlation with tumor volume than CEA and CA 19-9.

…methylation markers SEPT9,DCC, BOLL, and SFRP2…

…of SEPT9 andDCCalso seemed to…

Show Full Abstract

<h4>Background</h4>Neoadjuvant chemotherapy (neoCTx) followed by hepatic resection is the treatment of choice for patients with colorectal cancer liver metastasis (CLM). Treatment response is generally assessed using radiologic imaging after several cycles of chemotherapy. However, earlier assessment of response would be desirable since nonresponders could be switched early to an alternative chemotherapy regimen. Recent evidence suggests that circulating free methylated tumor DNA is a highly sensitive biomarker and may more accurately reflect tumor burden and treatment response than conventional markers for CRC.<h4>Patients and methods</h4>Thirty-four patients with CLM who received neoCTx prior to intended hepatic resection were included in this prospective nonrandomized study. Peripheral blood plasma was collected at baseline and before each cycle of neoCTx and was then analyzed for aberrant methylation of 48 CRC-associated genes. Methylation marker levels were correlated with baseline tumor volume and treatment response and compared with the standard tumor markers CEA and CA 19-9.<h4>Results</h4>The methylation markers SEPT9, DCC, BOLL, and SFRP2 were present in all patients at baseline and displayed a stronger correlation with tumor volume than CEA and CA 19-9. Serial measurement of these methylation markers allowed for discrimination between operated and nonoperated patients already after 1 cycle of neoCTx with high sensitivity and specificity. The early dynamic changes of SEPT9 and DCC also seemed to correlate with pathohistological response.<h4>Conclusion</h4>Our data suggest that serial measurements of CRC-associated methylation markers could be a particularly valuable tool for early response assessment in patients receiving neoCTx for CLM.

Also flagged:transcription factortranscription factorsbindingTFnucleotidesChromatin
Journal Article 2018-11-01 ✓ 1 Snippet Eggeling R.
In-Text Gene Mentions

…binding sites ofSox6and Myb.…

Show Full Abstract

The binding motifs of many transcription factors (TFs) comprise a higher degree of complexity than a single position weight matrix model permits. Additional complexity is typically taken into account either as intra-motif dependencies via more sophisticated probabilistic models or as heterogeneities via multiple weight matrices. However, both orthogonal approaches have limitations when learning from in vivo data where binding sites of other factors in close proximity can interfere with motif discovery for the protein of interest. In this work, we demonstrate how intra-motif complexity can, purely by analyzing the statistical properties of a given set of TF-binding sites, be distinguished from complexity arising from an intermix with motifs of co-binding TFs or other artifacts. In addition, we study the related question whether intra-motif complexity is represented more effectively by dependencies, heterogeneities or variants in between. Benchmarks demonstrate the effectiveness of both methods for their respective tasks and applications on motif discovery output from recent tools detect and correct many undesirable artifacts. These results further suggest that the prevalence of intra-motif dependencies may have been overestimated in previous studies on in vivo data and should thus be reassessed.

Also flagged:ironmetabolisminsulin resistanceTFSimpson-Golabi-Behmel syndromeinsulin
Journal Article 2018-11-01 ✓ 1 Snippet McClain DA, Sharma NK, Jain S, Harrison A, Salaye LN, Comeau ME, Langefeld CD, Lorenzo FR, Das SK.
In-Text Gene Mentions

Pou3f2

Show Full Abstract

<h4>Context</h4>Excessive body iron stores are a risk factor for decreased insulin sensitivity (SI) and diabetes. We hypothesized that transcriptional dysregulation of genes involved in iron metabolism in adipocytes causes insulin resistance.<h4>Objective and design</h4>To define the genetic regulation of iron metabolism and its role in SI, we used gene expression, genotype, and SI data from an African American cohort (N = 256). Replication studies were performed in independent European ancestry cohorts. In vitro studies in human adipocytes were performed to define the role of a selected gene in causing insulin resistance.<h4>Results</h4>Among 62 transcripts representing iron homeostasis genes, expression of 30 in adipose tissue were correlated with SI. Transferrin (TF) and ferritin heavy polypeptide were most positively and negatively associated with SI, respectively. These observations were replicated in two independent European ancestry adipose data sets. The strongest cis-regulatory variant for TF expression (rs6785596; P = 7.84 × 10-18) was identified in adipose but not muscle or liver tissue. Variants significantly affected the normal relationship of serum ferritin to insulin resistance. Knockdown of TF in differentiated Simpson-Golabi-Behmel syndrome adipocytes by short hairpin RNA decreased intracellular iron, reduced maximal insulin-stimulated glucose uptake, and reduced Akt phosphorylation. Knockdown of TF caused differential expression of 465 genes, including genes involved in glucose transport, mitochondrial function, Wnt-pathway/ SI, chemokine activity, and obesity. Iron chelation recapitulated key changes in the expression profile induced by TF knockdown.<h4>Conclusion</h4>Genetic regulation of TF expression in adipose tissue plays a novel role in regulating SI.

Also flagged:Membraneheparinrenal failurecreatininecardiac failurecomplement activation
Journal Article 2018-11-01 ✓ 1 Snippet Dalton HJ, Cashen K, Reeder RW, Berg RA, Shanley TP, Newth CJL, Pollack MM, Wessel D, Carcillo J, Harrison R, Dean JM, Meert KL, Eunice Kennedy Shriver National Institute of Child Health and Human Development Collaborative Pediatric Critical Care Research Network (CPCCRN).
In-Text Gene Mentions

ATIII

Show Full Abstract

<h4>Objectives</h4>To describe factors associated with hemolysis during pediatric extracorporeal membrane oxygenation and the relationships between hemolysis, complications, and mortality.<h4>Design</h4>Secondary analysis of data collected prospectively by the Collaborative Pediatric Critical Care Research Network between December 2012 and September 2014.<h4>Setting</h4>Three Collaborative Pediatric Critical Care Research Network-affiliated hospitals.<h4>Patients</h4>Age less than 19 years and treated with extracorporeal membrane oxygenation.<h4>Interventions</h4>None.<h4>Measurements and main results</h4>Hemolysis was defined based on peak plasma free hemoglobin levels during extracorporeal membrane oxygenation and categorized as none (< 0.001 g/L), mild (0.001 to < 0.5 g/L), moderate (0.5 to < 1.0 g/L), or severe (≥ 1.0 g/L). Of 216 patients, four (1.9%) had no hemolysis, 67 (31.0%) had mild, 51 (23.6%) had moderate, and 94 (43.5%) had severe. On multivariable analysis, variables independently associated with higher daily plasma free hemoglobin concentration included the use of in-line hemofiltration or other continuous renal replacement therapy, higher hemoglobin concentration, higher total bilirubin concentration, lower mean heparin infusion dose, lower body weight, and lower platelet count. Using multivariable Cox modeling, daily plasma free hemoglobin was independently associated with development of renal failure during extracorporeal membrane oxygenation (defined as creatinine > 2 mg/dL [> 176.8 μmol/L] or use of in-line hemofiltration or continuous renal replacement therapy) (hazard ratio, 1.04; 95% CI, 1.02-1.06; p < 0.001), but not mortality (hazard ratio, 1.01; 95% CI, 0.99-1.04; p = 0.389).<h4>Conclusions</h4>Hemolysis is common during pediatric extracorporeal membrane oxygenation. Hemolysis may contribute to the development of renal failure, and therapies used to manage renal failure such as in-line hemofiltration and other forms of continuous renal replacement therapy may contribute to hemolysis. Hemolysis was not associated with mortality after controlling for other factors. Monitoring for hemolysis should be a routine part of extracorporeal membrane oxygenation practice, and efforts to reduce hemolysis may improve patient care.

Also flagged:DeferoxamineSkin Injurytumorcollagenskin ulcerationtype I collagen
Journal Article 2018-11-01 ✓ 1 Snippet Snider AE, Lynn JV, Urlaub KM, Donneys A, Polyatskaya Y, Nelson NS, Ettinger RE, Gurtner GC, Banaszak Holl MM, Buchman SR.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Breast cancer is most commonly managed with a combination of tumor ablation, radiation, and/or chemotherapy. Despite the oncologic benefit of these treatments, the detrimental effect of radiation on surrounding tissue challenges the attainment of ideal breast reconstruction outcomes. The purpose of this study was to determine the ability of topical deferoxamine (DFO) to reduce cutaneous ulceration and collagen disorganization following radiotherapy in a murine model of expander-based breast reconstruction.<h4>Methods</h4>Female Sprague-Dawley rats (n = 15) were divided into 3 groups: control (expander), XRT (expander + radiation), and DFO (expander + radiation + deferoxamine [DFO]). Expanders were placed in a submusculocutaneous plane in the right upper back and ultimately filled to 15 mL. Radiation was administered via a fractionated dose of 28 Gy. Deferoxamine was delivered topically for 10 days following radiation. After a 20-day recovery period, skin ulceration and dermal type I collagen organization were analyzed.<h4>Results</h4>Compared with control, the XRT group demonstrated a significant increase in skin ulceration (3.7% vs 43.3%, P = 0.00) and collagen fibril disorganization (26.3% vs 81.8%, P = 0.00). Compared with the XRT group, treatment with topical DFO resulted in a significant reduction in ulceration (43.3% vs 7.0%, P = 0.00) and fibril disorganization (81.8% vs 15.3%, P = 0.00). There were no statistical differences between the control and DFO groups in skin ulceration or collagen disorganization.<h4>Conclusions</h4>This study suggests topical DFO is capable of reducing skin ulceration and type I collagen fibril disorganization following radiotherapy. This novel application of DFO has potential to enhance expander-based breast reconstruction outcomes and improve quality of life for women suffering the devastating effects of breast cancer.

Also flagged:Methylationulcerative colitisgene expressionimmune responsechemokinesinflammatory bowel disease
Journal Article 2018-11-01 ✓ 4 Snippets Taman H, Fenton CG, Hensel IV, Anderssen E, Florholmen J, Paulssen RH.
In-Text Gene Mentions

…[DEFFA6, REG1B, BTNL3,OLFM4] showed DNA methylation…

…[OSM], and olfactomedin [OLFM4].…

…[DEFA6], olfactomedin 4 [OLFM4], regenerating protein beta…

…cadherins (olfactomedin 4 [OLFM4]), and lipid metabolism…

Show Full Abstract

<h4>Background and aims</h4>The aim of this study was to investigate the genome-wide DNA methylation status in treatment-naïve ulcerative colitis [UC], and to explore the relationship between DNA methylation patterns and gene expression levels in tissue biopsies from a well-stratified treatment-naïve UC patient group.<h4>Methods</h4>Mucosal biopsies from treatment-naïve patients [n = 10], and a healthy control group [n = 11] underwent genome-wide DNA bisulfite sequencing. Principal component analysis [PCA] and diverse statistical methods were applied to obtain a dataset of differentially methylated genes. DNA methylation annotation was investigated using the UCSC Genome Browser. Gene set enrichments were obtained using the Kyoto Encyclopaedia of Genes and Genomes [KEGG] and PANTHER.<h4>Results</h4>Of all significantly differentially expressed genes [DEGs], 25% correlated with DNA methylation patterns; 30% of these genes were methylated at CpG sites near their transcription start site [TSS]. Hyper-methylation was observed for genes involved in homeostasis and defence, whereas hypo-methylation was observed for genes playing a role in immune response [i.e. chemokines and interleukins]. Of the differentially DNA methylated genes, 25 were identified as inflammatory bowel disease [IBD] susceptibility genes. Four genes [DEFFA6, REG1B, BTNL3, OLFM4] showed DNA methylation in the absence of known CpG islands.<h4>Conclusions</h4>Genome-wide DNA methylation analysis revealed distinctive functional patterns for hyper-and hypo-methylation in treatment-naïve UC. These distinct patterns could be of importance in the development and pathogenesis of UC. Further investigation of DNA methylation patterns may be useful in the development of the targeting of epigenetic processes, and may allow new treatment and target strategies for UC patients.

Also flagged:colorectal cancertumorprimary tumorprimary tumorsmetastatic diseaseColorectal Carcinogenesis
Journal Article 2018-11-01 ✓ 1 Snippet Kelley KA, Wieghard N, Chin Y, Potter A, Mori M, Wong MH, Chin K, Tsikitis VL.
In-Text Gene Mentions

OLFM4

Show Full Abstract

<h4>Background</h4>MicroRNAs are dysregulated in colorectal cancer and subsets correlated with advanced tumor stage and metastasis. Data are lacking on microRNA dysregulation from early to late-stage disease.<h4>Objective</h4>The purpose of this study was to identify a microRNA signature associated with the primary tumor and metastatic site in stage IV disease and to examine whether the signature is evident in earlier stages.<h4>Design</h4>A microRNA profile was generated and then explored in normal colon tissue (n = 5), early stage (stage I and II; n = 10), and late-stage (stage III and IV; n = 14) colorectal primary tumors via polymerase chain reaction to delineate molecular events that may promote colorectal carcinogenesis.<h4>Setting</h4>Genome-wide microRNA expression profiling was performed.<h4>Patients</h4>A total of 14 patient-matched stage IV primary colorectal cancer tumors and corresponding liver metastases were included.<h4>Main outcome measures</h4>MicroRNA array technology was used to identify microRNA expression-predictive metastatic potential in the primary tumor.<h4>Results</h4>A distinct 9-member signature group of microRNAs was concurrent in stage IV primary colorectal cancer and their corresponding liver metastases, when compared with surrounding unaffected colon and liver tissue (microRNA-18b, microRNA-93, microRNA-182, microRNA-183, microRNA21, microRNA-486-5p, microRNA-500a, microRNA-552, and microRNA-941). Of the microRNA panel, only microRNA486-5p was differentially expressed in early stage colorectal cancer samples compared with normal tissue (p = 0.001) and additionally differentially expressed between late-stage colorectal cancer samples and normal tissue (p < 0.01).<h4>Limitations</h4>Our microRNA profile was generated in a small subset of patients and will require validation in more samples.<h4>Conclusions</h4>We identified a distinct microRNA signature in primary colon and matched metastatic disease. On additional investigation, 1 microRNA was differentially expressed in both early and late-stage cancer patient samples, and it may herald an early event in colorectal carcinogenesis. This study warrants additional investigation with a larger patient cohort to better understand the effect of microRNAs in carcinogenesis. See Video Abstract at http://links.lww.com/DCR/A723.

Also flagged:miRNAcfDNAcaspase dependentIgMST2EWSR1
Journal Article 2018-11-01 ✓ 5 Snippets Unknown Authors
In-Text Gene Mentions

Results: Among neuroblastoma clinical specimens, a significant positive correlation was documented between CSE1L/NRF2 expression and neuroblastoma cell un‐differentiation.

Silencing CSE1L also sensitized neuroblastoma cells to retinoic acid and promoted cell differentiation.

Although several studies have reported that CSE1L plays different roles in variety cancers, little is known about its role in neuroblastoma.

HR‐AML was defined as AML with ‐7/7q‐, ‐5/5q‐, complex karyotype, inv(3) or t(3;3), t(6;9)/DEK‐NUP214, t(7;12)/MNX1‐ETV6, t(4;11)/KMT2A‐AFF1, t(6;11)/KMT2A‐AFDN, t(10;11)/KMT2A‐MLLT10, t(5;11)/NUP98‐NSD1, t(9;22)/BCR‐ABL, t(16;21)/FUS‐ERG, and/or FLT3‐ITD.

NRF2 Regulated CSE1L Expression to Inhibits Differentiation of Neuroblastoma via Regulation of the P53 Pathway

Show Full Abstract

No abstract available.

Also flagged:BC200 ribonucleoproteincancersribonucleoproteinRNPbindingBC1
Journal Article 2018-11-01 ✓ 1 Snippet Booy EP, McRae EK, Ezzati P, Choi T, Gussakovsky D, McKenna SA.
In-Text Gene Mentions

…(ab70455, Abcam), Rabbit anti-STAU1(14225-1-AP, Proteintech), Rab…

Show Full Abstract

BC200 is a long non-coding RNA primarily expressed in brain but aberrantly expressed in various cancers. To gain a further understanding of the function of BC200, we performed proteomic analyses of the BC200 ribonucleoprotein (RNP) by transfection of 3' DIG-labelled BC200. Protein binding partners of the functionally related murine RNA BC1 as well as a scrambled BC200 RNA were also assessed in both human and mouse cell lines. Stringent validation of proteins identified by mass spectrometry confirmed 14 of 84 protein binding partners and excluded eight proteins that did not appreciably bind BC200 in reverse experiments. Gene ontology analyses revealed general roles in RNA metabolic processes, RNA processing and splicing. Protein/RNA interaction sites were mapped with a series of RNA truncations revealing three distinct modes of interaction involving either the 5' Alu-domain, 3' A-rich or 3' C-rich regions. Due to their high enrichment values in reverse experiments, CSDE1 and STRAP were further analyzed demonstrating a direct interaction between CSDE1 and BC200 and indirect binding of STRAP to BC200 via heterodimerization with CSDE1. Knock-down studies identified a reciprocal regulatory relationship between CSDE1 and BC200 and immunofluorescence analysis of BC200 knock-down cells demonstrated a dramatic reorganization of CSDE1 into distinct nuclear foci.

Also flagged:Autismautism spectrum disorderintellectual disabilitydevelopmental delayhearing lossneurological disorders
Journal Article 2018-11-01 No Snippets Wain KE, Palen E, Savatt JM, Shuman D, Finucane B, Seeley A, Challman TD, Myers SM, Martin CL.
Show Full Abstract

With the increasing use of clinical genomic testing across broad medical disciplines, the need for data sharing and curation efforts to improve variant interpretation is paramount. The National Center for Biotechnology Information (NCBI) ClinVar database facilitates these efforts by serving as a repository for clinical assertions about genomic variants and associations with disease. Most variant submissions are from clinical laboratories, which may lack clinical details. Laboratories may also choose not to submit all variants. Clinical providers can contribute to variant interpretation improvements by submitting variants to ClinVar with their own assertions and supporting evidence. The medical genetics team at Geisinger's Autism & Developmental Medicine Institute routinely reviews the clinical significance of all variants obtained through clinical genomic testing, using published ACMG/AMP guidelines, clinical correlation, and post-test clinical data. We describe the submission of 148 sequence and 155 copy number variants to ClinVar as "provider interpretations." Of these, 192 (63.4%) were novel to ClinVar. Detailed clinical data were provided for 298 (98.3%), and when available, segregation data and follow-up clinical correlation or testing was included. This contribution marks the first large-scale submission from a neurodevelopmental clinical setting and illustrates the importance of clinical providers in collaborative efforts to improve variant interpretation.

Also flagged:BA1Mendelian disordersBS1BS2chromosomesACADS
Journal Article 2018-11-01 ✓ 1 Snippet Ghosh R, Harrison SM, Rehm HL, Plon SE, Biesecker LG, ClinGen Sequence Variant Interpretation Working Group.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

The Clinical Genome Resource (ClinGen) Sequence Variant Interpretation Working Group set out to refine the American College of Medical Genetics and Genomics and the Association of Molecular Pathologists (ACMG/AMP) variant pathogenicity recommendations for stand-alone rule BA1 (a variant with minor allele frequency [MAF] > 0.05 is benign), by clarifying how it should be used and specifying a set of variants that should be exempted from this rule. We cross-referenced ClinVar and Exome Aggregation Consortium data to identify variants for which there was a plausible argument for pathogenicity and the variant exists in one or more population data sets at MAF > 0.05. We identified nine such variants that were present in these data sets that may not be benign. The ACMG/AMP criteria were applied to these variants that resulted in four pathogenic and five variants of uncertain significance. We have refined benign rule BA1 by clarifying terms used to describe its use, which databases we recommend using, and assumptions made about this rule. We also recognized an initial list of nine variants for which there was some evidence of pathogenicity even though the MAF was high for these variants. We specify processes whereby individuals can petition ClinGen for amendments to our variant-specific assertions and the criteria experts should use when setting a numerically lower threshold for BA1 for specific genes.

Also flagged:neurodevelopmental disordersWilliams syndromepathogenesisDNAJC30mitochondriamitochondrial
Journal Article 2018-11-01 No Snippets Tebbenkamp ATN, Varela L, Choi J, Paredes MI, Giani AM, Song JE, Sestan-Pesa M, Franjic D, Sousa AMM, Liu ZW, Li M, Bichsel C, Koch M, Szigeti-Buck K, Liu F, Li Z, Kawasawa YI, Paspalas CD, Mineur YS, Prontera P, Merla G, Picciotto MR, Arnsten AFT, Horvath TL, Sestan N.
Show Full Abstract

Despite the known causality of copy-number variations (CNVs) to human neurodevelopmental disorders, the mechanisms behind each gene's contribution to the constellation of neural phenotypes remain elusive. Here, we investigated the 7q11.23 CNV, whose hemideletion causes Williams syndrome (WS), and uncovered that mitochondrial dysfunction participates in WS pathogenesis. Dysfunction is facilitated in part by the 7q11.23 protein DNAJC30, which interacts with mitochondrial ATP-synthase machinery. Removal of Dnajc30 in mice resulted in hypofunctional mitochondria, diminished morphological features of neocortical pyramidal neurons, and altered behaviors reminiscent of WS. The mitochondrial features are consistent with our observations of decreased integrity of oxidative phosphorylation supercomplexes and ATP-synthase dimers in WS. Thus, we identify DNAJC30 as an auxiliary component of ATP-synthase machinery and reveal mitochondrial maladies as underlying certain defects in brain development and function associated with WS.

Also flagged:hyaluronic acidgambogic acidhexadecanolchitosanoligosaccharidetriple negative breast cancer
Journal Article 2018-11-01 No Snippets Sang MM, Liu FL, Wang Y, Luo RJ, Huan XX, Han LF, Zhang ZT, Feng F, Qu W, Liu W, Zheng F.
Show Full Abstract

Gambogic acid (GA) is a naturally derived potent anticancer agent with extremely poor biocompatibility. In the present study, a novel of redox/pH dual-responsive multifunctional magnetic complex micelle (sPEG/HA/CSO-SS-Hex/Fe<sub>3</sub>O<sub>4</sub>/GA), which consisted of a reducible hexadecanol-modified chitosan oligosaccharide polymer micelle (CSO-SS-Hex) coated with hyaluronic acid (HA) and DCA grafted sheddable PEG-PLL (sPEG) copolymers and loaded with gambogic acid (GA) and Fe<sub>3</sub>O<sub>4</sub> nanoparticles were developed for parenteral delivery for the treatment of triple negative breast cancer (TNBC). The ex vivo study showed that the sPEG shielded cationic HA/CSO-SS-Hex/Fe<sub>3</sub>O<sub>4</sub>/GA core at physiological pH but quickly shed off to re-expose the core due to its charge reversible property. The sPEG/HA/CSO-SS-Hex/Fe<sub>3</sub>O<sub>4</sub>/GA micelles effectively facilitated tumor-targeted GA delivery by HA, which is a targeting ligand for CD44 receptor of TNBC cells, meanwhile increase GA uptake at the acidic condition but diminished the drug uptake at neutral pH. The in vitro cellular uptake study and in vivo biodistribution and antitumor activity of the formulations were determined, all results showed that the complex micelle enhanced TNBC tumor cellular uptake and fast drug release due to the combined effect of magnet targeting, CD44 receptor-mediated internalization and redox/pH dual-responsive drug release. Hence, tumor-targeted delivery of GA with redox/pH dual-responsive multifunctional magnetic complex micelle sPEG/HA/CSO-SS-Hex/Fe<sub>3</sub>O<sub>4</sub>/GA might have potential implications for the chemotherapy of TNBC.

Also flagged:transcription factorsSOX7SOX-FSOX18GFPbinding
Journal Article 2018-11-01 ✓ 1 Snippet Moustaqil M, Fontaine F, Overman J, McCann A, Bailey TL, Rudolffi Soto P, Bhumkar A, Giles N, Hunter DJB, Gambin Y, Francois M, Sierecki E.
In-Text Gene Mentions

…of the D-Group (SOX5/SOX6/SOX13) are known for…

Show Full Abstract

During embryogenesis, vascular development relies on a handful of transcription factors that instruct cell fate in a distinct sub-population of the endothelium (1). The SOXF proteins that comprise SOX7, 17 and 18, are molecular switches modulating arterio-venous and lymphatic endothelial differentiation (2,3). Here, we show that, in the SOX-F family, only SOX18 has the ability to switch between a monomeric and a dimeric form. We characterized the SOX18 dimer in binding assays in vitro, and using a split-GFP reporter assay in a zebrafish model system in vivo. We show that SOX18 dimerization is driven by a novel motif located in the vicinity of the C-terminus of the DNA binding region. Insertion of this motif in a SOX7 monomer forced its assembly into a dimer. Genome-wide analysis of SOX18 binding locations on the chromatin revealed enrichment for a SOX dimer binding motif, correlating with genes with a strong endothelial signature. Using a SOX18 small molecule inhibitor that disrupts dimerization, we revealed that dimerization is important for transcription. Overall, we show that dimerization is a specific feature of SOX18 that enables the recruitment of key endothelial transcription factors, and refines the selectivity of the binding to discrete genomic locations assigned to endothelial specific genes.

Also flagged:Tumordeathcancerthyroid cancermetastatic cancerthyroid carcinoma
Journal Article 2018-11-01 No Snippets Saharat K, Lirdprapamongkol K, Chokchaichamnankit D, Srisomsap C, Svasti J, Paricharttanakul NM.
Show Full Abstract

<h4>Background/aim</h4>Resistance to anoikis is a pre-requisite step in metastasis, a major cause of death in patients with cancer, including thyroid cancer. Impairing anoikis resistance is a possible strategy for therapy of metastatic cancer. We, therefore, we aimed to investigate the key players of anoikis resistance.<h4>Materials and methods</h4>Papillary-type (BCPAP), follicular-type (FTC133), and anaplastic-type (ARO) thyroid carcinoma cells, cultured in poly(2-hydroxyethyl methacrylate)-coated plates to mimic circulating cells, were used as model systems in this study. Flow cytometry and soft-agar assays were used to determine cells exhibiting anoikis resistance. Proteomics was used to identify candidate proteins and validated using western blot and siRNA knockdown.<h4>Results</h4>Only ARO cells showed both anoikis resistance potential and anchorage-independent growth ability. Tumor susceptibility gene 101 protein (TSG101) was identified to be potentially important in anoikis resistance, which was confirmed by an increase in anoikis and expression of a pro-apoptotic protein (BCL-2 like protein 4) and an apoptotic marker (cleaved poly-ADP ribose polymerase) in floating siTSG101-knockdown cells.<h4>Conclusion</h4>To our knowledge, this is the first study that implicates the importance of TSG101 in anoikis resistance of thyroid cancer.

Also flagged:alginateoxygenalkaline phosphatasemyeloperoxidaseMPOantimicrobial peptide
Journal Article 2018-11-01 No Snippets Szponder T, Wessely-Szponder J, Sobczyńska-Rak A.
Show Full Abstract

<h4>Background/aim</h4>In this study, the neutrophil response to an antimicrobial extract was evaluated as a potential marker of inflammatory process after implantation of alginate and carbon fiber biomaterials into a bone or cartilage defect in rabbits.<h4>Materials and methods</h4>The response to biomaterials used was assessed based on enzyme release, generation of reactive oxygen species (ROS) and survival of neutrophils isolated from the rabbit's blood after implantation.<h4>Results</h4>The implantation of alginate biomaterial increased elastase and alkaline phosphatase release, whereas carbon fibers did not evoke increased elastase release. The implantation of both biomaterials resulted in a higher myeloperoxidase (MPO) release after 30-min incubation. Stimulation with different fractions of antimicrobial peptide (AMP) extract diminished MPO release and nitric oxide generation, as well as slightly reducing neutrophil survival.<h4>Conclusion</h4>Our study permits the assessment of the neutrophil intravital response to an implant without the need for preparation of histological sections. Additionally, AMP extract restricted some manifestations of the pro-inflammatory response and may be considered a regulator of neutrophil activity in the early inflammatory phase, preventing rejection of the implant.

Also flagged:Non-alcoholic fatty liver diseaseNAFLDchronic liver diseaseshepatic steatosisnonalcoholic steatohepatitisNASH
Journal Article 2018-11-01 ✓ 1 Snippet Danford CJ, Yao ZM, Jiang ZG.
In-Text Gene Mentions

Genetic variations in the HFE, beta-globin, and TMPRSS6 genes predispose to hepatic iron accumulation and are associated with hepatic fibrosis in NAFLD patients[112–114].

Show Full Abstract

Non-alcoholic fatty liver disease (NAFLD) is now the most common cause of chronic liver diseases worldwide. It encompasses a spectrum of disorders ranging from isolated hepatic steatosis to nonalcoholic steatohepatitis (NASH), fibrosis, cirrhosis, and hepatocellular carcinoma. One of the key challenges in NAFLD is identifying which patients will progress. Epidemiological and genetic studies indicate a strong pattern of heritability that may explain some of the variability in NAFLD phenotype and risk of progression. To date, at least three common genetic variants in the PNPLA3, TM6SF2, and GCKR genes have been robustly linked to NAFLD in the population. The function of these genes revealed novel pathways implicated in both the development and progression of NAFLD. In addition, candidate genes previously implicated in NAFLD pathogenesis have also been identified as determinants or modulators of NAFLD phenotype including genes involved in hepatocellular lipid handling, insulin resistance, inflammation, and fibrogenesis. This article will review the current understanding of the genetics underpinning the development of hepatic steatosis and the progression of NASH. These newly acquired insights may transform our strategy to risk-stratify patients with NAFLD and to identify new potential therapeutic targets.

Also flagged:chronic diseaselactationagingmineralsfolic acidvitamin C
Journal Article 2018-11-01 ✓ 1 Snippet Marra MV, Bailey RL.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

It is the position of the Academy of Nutrition and Dietetics that micronutrient supplements are warranted when requirements are not being met through the diet alone. Those with increased requirements secondary to growth, chronic disease, medication use, malabsorption, pregnancy and lactation, and aging may be at particular risk for inadequate dietary intakes. However, the routine and indiscriminate use of micronutrient supplements for the prevention of chronic disease is not recommended, given the lack of available scientific evidence. A few specific age and disease states that may benefit from micronutrient supplementation are discussed. The most common dietary supplements used by both children and adults in the United States contain micronutrients. Consumers may not be well informed about the safety and use of these products, and some may have difficulty interpreting product labels. Thus, the expertise of registered dietitian nutritionists and nutrition and dietetic technicians, registered, is needed to guide the safe and appropriate selection and use of micronutrient supplements. To accomplish this, registered dietitian nutritionists and nutrition and dietetic technicians, registered, must keep up to date on efficacy, safety, and the regulatory issues influencing the use of these products. This position paper aims to increase awareness of current issues relevant to micronutrient supplementation and of the resources available to assist registered dietitian nutritionists and nutrition and dietetic technicians, registered, in evaluating their potential benefits and adverse outcomes.

Also flagged:Systemic mastocytosisskin lesionsalkaline phosphataseβ2-microglobulinKITEZH2
Journal Article 2018-11-01 ✓ 1 Snippet Muñoz-González JI, Jara-Acevedo M, Alvarez-Twose I, Merker JD, Teodosio C, Hou Y, Henriques A, Roskin KM, Sanchez-Muñoz L, Tsai AG, Caldas C, Caldas C, Matito A, Sánchez-Gallego JI, Mayado A, Dasilva-Freire N, Gotlib JR, Escribano L, Orfao A, García-Montero AC.
In-Text Gene Mentions

DCC

Show Full Abstract

Systemic mastocytosis (SM) is a highly heterogeneous disease with indolent and aggressive forms, with the mechanisms leading to malignant transformation still remaining to be elucidated. Here, we investigated the presence and frequency of genetic variants in 34 SM patients with multilineal <i>KIT</i> D816V mutations. Initial screening was performed by targeted sequencing of 410 genes in DNA extracted from purified bone marrow cells and hair from 12 patients with nonadvanced SM and 8 patients with advanced SM, followed by whole-genome sequencing (WGS) in 4 cases. Somatic mutations were further investigated in another 14 patients with advanced SM. Despite the fact that no common mutation other than <i>KIT</i> D816V was found in WGS analyses, targeted next-generation sequencing identified 67 nonsynonymous genetic variants involving 39 genes. Half of the mutations were somatic (mostly multilineal), whereas the other half were germline variants. The presence of ≥1 multilineal somatic mutation involving genes other than <i>KIT</i> D816V, ≥3 germline variants, and ≥1 multilineal mutation in the <i>SRSF2</i>, <i>ASXL1</i>, <i>RUNX1</i>, and/or <i>EZH2</i> genes (<i>S/A/R/E</i> genes), in addition to skin lesions, splenomegaly, thrombocytopenia, low hemoglobin levels, and increased alkaline phosphatase and β2-microglobulin serum levels, were associated with a poorer patient outcome. However, the presence of ≥1 multilineal mutation, particularly involving <i>S/A/R/E</i> genes, was the only independent predictor for progression-free survival and overall survival in our cohort.

Also flagged:deathX-chromosomegene expressionchromosomesdosage compensation complexhistone
Journal Article 2018-11-01 ✓ 5 Snippets Meyer BJ.
In-Text Gene Mentions

…functional analysis ofDCCsubunit DPY-21 revealed…

…X is bothDCC-dependent and cell-cycle–depe…

…Thus, theDCCrecruits an “eraser”…

…cells in aDCC-independent manner to enrich…

…analysis of theDCC.…

Show Full Abstract

Determining sex is a binary developmental decision that most metazoans must make. Like many organisms, Caenorhabditis elegans specifies sex (XO male or XX hermaphrodite) by tallying X-chromosome number. We dissected this precise counting mechanism to determine how tiny differences in concentrations of signals are translated into dramatically different developmental fates. Determining sex by counting chromosomes solved one problem but created another-an imbalance in X gene products. We found that nematodes compensate for the difference in X-chromosome dose between sexes by reducing transcription from both hermaphrodite X chromosomes. In a surprising feat of evolution, X-chromosome regulation is functionally related to a structural problem of all mitotic and meiotic chromosomes: achieving ordered compaction of chromosomes before segregation. We showed the dosage compensation complex is a condensin complex that imposes a specific three--dimensional architecture onto hermaphrodite X chromosomes. It also triggers enrichment of histone modification H4K20me1. We discovered the machinery and mechanism underlying H4K20me1 enrichment and demonstrated its pivotal role in regulating higher-order X-chromosome structure and gene expression.

Also flagged:acute myeloid leukemiaLeukemiaLymphomaAMLtranscription factorscohesin
Journal Article 2018-11-01 ✓ 1 Snippet Matsuo H, Yoshida K, Fukumura K, Nakatani K, Noguchi Y, Takasaki S, Noura M, Shiozawa Y, Shiraishi Y, Chiba K, Tanaka H, Okada A, Nannya Y, Takeda J, Ueno H, Shiba N, Yamato G, Handa H, Ono Y, Hiramoto N, Ishikawa T, Usuki K, Ishiyama K, Miyawaki S, Itonaga H, Miyazaki Y, Kawamura M, Yamaguchi H, Kiyokawa N, Tomizawa D, Taga T, Tawa A, Hayashi Y, Mano H, Miyano S, Kamikubo Y, Ogawa S, Adachi S.
In-Text Gene Mentions

MLLT10

Show Full Abstract

In acute myeloid leukemia (AML), <i>MLL</i> (<i>KMT2A</i>) rearrangements are among the most frequent chromosomal abnormalities; however, knowledge of the genetic landscape of <i>MLL</i>-rearranged AML is limited. In this study, we performed whole-exome sequencing (n = 9) and targeted sequencing (n = 56) of samples from pediatric <i>MLL</i>-rearranged AML patients enrolled in the Japanese Pediatric Leukemia/Lymphoma Study Group AML-05 study. Additionally, we analyzed 105 pediatric t(8;21) AML samples and 30 adult <i>MLL</i>-rearranged AML samples. RNA-sequencing data from 31 patients published in a previous study were also reanalyzed. As a result, we identified 115 mutations in pediatric <i>MLL</i>-rearranged AML patients (2.1 mutations/patient), with mutations in signaling pathway genes being the most frequently detected (60.7%). Mutations in genes associated with epigenetic regulation (21.4%), transcription factors (16.1%), and the cohesin complex (8.9%) were also commonly detected. Novel <i>CCND3</i> mutations were identified in 5 pediatric <i>MLL</i>-rearranged AML patients (8.9%) and 2 adult <i>MLL</i>-rearranged AML patients (3.3%). Recurrent mutations of <i>CCND1</i> (n = 3, 2.9%) and <i>CCND2</i> (n = 8, 7.6%) were found in pediatric t(8;21) AML patients, whereas no <i>CCND3</i> mutations were found, suggesting that D-type cyclins exhibit a subtype-specific mutation pattern in AML. Treatment of <i>MLL</i>-rearranged AML cell lines with CDK4/6 inhibitors (abemaciclib and palbociclib) blocked G1 to S phase cell-cycle progression and impaired proliferation. Pediatric <i>MLL-MLLT3</i>-rearranged AML patients with coexisting mutations (n = 16) had significantly reduced relapse-free survival and overall survival compared with those without coexisting mutations (n = 9) (<i>P</i> = .048 and .046, respectively). These data provide insights into the genetics of <i>MLL</i>-rearranged AML and suggest therapeutic strategies.

Also flagged:leucine-rich repeat receptor-like kinasechromosomephotosynthesiswaterrestriction-enzymedigestion
Journal Article 2018-11-01 ✓ 1 Snippet Yang Y, Xuan L, Yu C, Wang Z, Xu J, Fan W, Guo J, Yin Y.
In-Text Gene Mentions

…members of ClassI KNOX transcription factorsKNOX transcription factors,…

Show Full Abstract

<h4>Background</h4>'Zhongshanshan' is the general designation for the superior interspecific hybrid clones of Taxodium species, which is widely grown for economic and ecological purposes in southern China. Growth is the priority objective in 'Zhongshanshan' tree improvement. A high-density linkage map is vital to efficiently identify key quantitative trait loci (QTLs) that affect growth.<h4>Results</h4>In total, 403.16 Gb of data, containing 2016,336 paired-end reads, was obtained after preprocessing. The average sequencing depth was 28.49 in T. distichum var. distichum, 25.18 in T. mucronatum, and 11.12 in each progeny. In total, 524,662 high-quality SLAFs were detected, of which 249,619 were polymorphic, and 6166 of the polymorphic markers met the requirements for use in constructing a genetic map. The final map harbored 6156 SLAF markers on 11 linkage groups, and was 1137.86 cM in length, with an average distance of 0.18 cM between adjacent markers. Separate QTL analyses of traits in different years by CIM detected 7 QTLs. While combining multiple-year data, 13 QTLs were detected by ICIM. 5 QTLs were repeatedly detected by the two methods, and among them, 3 significant QTLs (q6-2, q4-2 and q2-1) were detected in at least two traits. Bioinformatic analysis discoveried a gene annotated as a leucine-rich repeat receptor-like kinase gene within q4-2.<h4>Conclusions</h4>This map is the most saturated one constructed in a Taxodiaceae species to date, and would provide useful information for future comparative mapping, genome assembly, and marker-assisted selection.

Also flagged:clomiphenepolycystic ovary syndromeendocrinopathyovulationPCOShyperandrogenism
Journal Article 2018-11-01 No Snippets Ma HL, Xie LZ, Gao JS, Cong J, Deng YY, Ng EHY, Liu JP, Wu XK.
Show Full Abstract

<h4>Background</h4>Polycystic ovary syndrome (PCOS) is the most common endocrinopathy of reproductive-aged women. Clomiphene is regarded as the first-line medical treatment for ovulation induction in PCOS patients and acupuncture is often used as an alternative and complementary treatment for fertility issues such as those associated with PCOS. The efficacy of acupuncture alone or combined with clomiphene still lacks strong supporting evidence. Factorial 2 × 2 designs can be used for the evaluations of two treatments within a single study, to test the main effects of acupuncture and clomiphene and their interactions.<h4>Methods</h4>PCOSAct was designed to test the effect of clomiphene and acupuncture by three two-group comparisons in the original protocol. However, the trial was designed as a standard factorial trial and the factorial analysis approach for analyzing the data that were actually obtained during the trial was found to be more appropriate and more powerful than the three two-group comparisons described in the original protocol, so the statistical analysis approach and different datasets of PCOSAct in the primary publication were accordingly changed.<h4>Discussion</h4>Although the statistical analysis approach used in the primary publication deviated from the statistical analysis planned in the study protocol, focusing on the main effects of the two interventions and their interactions was a more standard approach to a factorial trial and proved to be more suitable and consistent with the characteristics of the trial data. Statistically, the revision is more powerful and precise and should be more useful to the journal and the readers.<h4>Trial registration</h4>Chinese clinical trial registry, ChiCTR-TRC-12002081 . Registered on 20 March 2012. Clinicaltrials.gov, NCT01573858 . Registered on 4 April 2012.

Also flagged:-endoplasmic reticulumorganellesbacterial infectionspancreatic disordersFAM134B
Journal Article 2018-11-01 ✓ 2 Snippets Dikic I.
In-Text Gene Mentions

As already mentioned above, ER-phagy plays a prominent role in innate defense against viral and bacterial infections [7, 10], whereas CCPG1’s function in pancreatic acinar cells implies an involvement in pancreatic disorders [6].

…10 ], whereasCCPG1’s function in pancreatic…

Show Full Abstract

The endoplasmic reticulum (ER) is one of the most complex organelles in the eukaryotic cell. Recent findings suggest that a process called ER-phagy plays a major role in maintaining the ER's shape and function.

Also flagged:ω-3 fatty acidslipidallergic conjunctivitisACocular surface diseasesinflammatory responses
Journal Article 2018-11-01 ✓ 1 Snippet Hirakata T, Lee HC, Ohba M, Saeki K, Okuno T, Murakami A, Matsuda A, Yokomizo T.
In-Text Gene Mentions

…, Akr1b3 ,Ptgis, and Tbxas1…

Show Full Abstract

Allergic conjunctivitis (AC) is one of the most common ocular surface diseases in the world. In AC, T helper type 2 (T<sub>h</sub>2) immune responses play central roles in orchestrating inflammatory responses. However, the roles of lipid mediators in the onset and progression of AC remain to be fully explored. Although previous reports have shown the beneficial effects of supplementation of ω-3 fatty acids in asthma or atopic dermatitis, the underlying molecular mechanisms are poorly understood. In this study, a diet rich in ω-3 fatty acids alleviated AC symptoms in both early and late phases without affecting T<sub>h</sub>2 immune responses, but rather by altering the lipid mediator profiles. The ω-3 fatty acids completely suppressed scratching behavior toward the eyes, an allergic reaction provoked by itch. Although total serum IgE levels and the expression levels of T<sub>h</sub>2 cytokines and chemokines in the conjunctiva were not altered by ω-3 fatty acids, eosinophil infiltration into the conjunctiva was dramatically suppressed. The levels of ω-6-derived proinflammatory lipid mediators, including those with chemoattractant properties for eosinophils, were markedly reduced in the conjunctivae of ω-3 diet-fed mice. Dietary ω-3 fatty acids can alleviate a variety of symptoms of AC by altering the lipid mediator profile.-Hirakata, T., Lee, H.-C., Ohba, M., Saeki, K., Okuno, T., Murakami, A., Matsuda, A., Yokomizo, T. Dietary ω-3 fatty acids alter the lipid mediator profile and alleviate allergic conjunctivitis without modulating T<sub>h</sub>2 immune responses.

Also flagged:TransferrinironPresenilin 1Tfiron-binding proteinTfR
Journal Article 2018-11-01 ✓ 2 Snippets Lu CD, Ma JK, Luo ZY, Tai QX, Wang P, Guan PP.
In-Text Gene Mentions

…associated with twoHFEmutations, namely, C282Y…

…the mutation ofHFEH63D may lead…

Show Full Abstract

Transferrin (Tf) is an important iron-binding protein postulated to play a key role in iron ion (Fe) absorption via the Tf receptor (TfR), which potentially contributes to the pathogenesis of Alzheimer's disease (AD). However, the role of Tf in AD remains unknown. Using mouse-derived neurons and APP/PS1 transgenic (Tg) mice as model systems, we firstly revealed the mechanisms of APH-1α/1β and presenilin 1 (PS1) upregulation by Fe in prostaglandin (PG) E<sub>2</sub>- and PGD<sub>2</sub>-dependent mechanisms. Specifically, Fe stimulated the expression of mPGES-1 and the production of PGE<sub>2</sub> and PGD<sub>2</sub> via the Tf and TfR system. Highly accumulated PGE<sub>2</sub> markedly induced the expression of anterior pharynx-defective-1α and -1β (APH-1α/1β) and PS1 via an EP receptor-dependent mechanism. In contrast, PGD<sub>2</sub> suppressed the expression of APH-1α/1β and PS1 via a prostaglandin D<sub>2</sub> (DP) receptor-dependent mechanism. As the natural dehydrated product of PGD<sub>2</sub>, 15d-PGJ<sub>2</sub> exerts inhibitory effects on the expression of APH-1α/1β and PS1 in a peroxisome proliferator-activated receptor (PPAR) γ-dependent manner. The expression of APH-1α/1β and PS1 ultimately determined the production and deposition of β-amyloid protein (Aβ), an effect that potentially contributes to the pathogenesis of AD.

Also flagged:malignant tumorspancreatic malignanciesrenal cell cancermetastatic melanomacutaneous melanomamalignant melanoma
Journal Article 2018-11-01 ✓ 2 Snippets Liu X, Feng F, Wang T, Qin J, Yin X, Meng G, Yan C, Xing Z, Duan J, Liu C, Liu J.
In-Text Gene Mentions

Chin et al[21] indicated that malignant melanomas present with significant staining for phosphorylated CSE1L (100%) and only faint staining for the benign nevi (0%).

…staining for phosphorylatedCSE1L(100%) and only…

Show Full Abstract

<h4>Rationale</h4>Pancreatic metastases from other malignant tumors are an uncommon clinical condition and account for approximately 2% of all pancreatic malignancies. The most common primary malignancy that metastasizes to pancreas is renal cell cancer. We reported a rare clinical case of metastatic melanoma to pancreas who underwent a successful laparoscopic pancreaticoduodenectomy (LPD) at our department.<h4>Patient concerns</h4>A 54-year-old Chinese man complaining an unexplained jaundice was found to have a pancreatic mass and he was diagnosed with cutaneous melanoma (CM) 6 years ago.<h4>Diagnoses</h4>Contrast-enhanced computed tomography (CECT) revealed a solid hypovascular mass measuring about 3.1 × 2.4 cm localized at the junction of pancreatic head and uncinate process, which compressed the lower common bile duct resulting in expansion of the upstream bile ducts.<h4>Interventions</h4>We performed an LPD and regional lymphadenectomy on this patient.<h4>Outcomes</h4>This patient was discharged home on postoperative day 19. Postoperative pathological results revealed a malignant melanoma with negative margins. Immunohistochemical (IHC) findings also suggested a malignant pancreatic tumor accompanied by necrosis and pigmentation, which confirmed the pathological diagnosis. Immunoreactivity was strongly positive for anti-S-100 protein (+++) and positive for anti-Vimentin (+). The cancer cells were negative for CEA, CK8/18, P53, Violin, CK19, SMA with Ki-67 over 40%. So this pancreatic mass was proved to be a metastatic pancreatic melanoma from the primary cutaneous lesion. After LPD, this patient was followed up by readmission to hospital every 2 month in the first half year. The serum bilirubin and tumor markers such as CA199 were normal. CECT and did not find any newly developed neoplasm at the pancreas or metastasis at other organs. At the last follow-up at 6 months after LPD, the patient's general condition was acceptable and the physical examination and imaging studies revealed no significant findings of melanoma.<h4>Lessons</h4>Metastatic pancreatic tumors are often associated with well-defined margins, tumor necrosis, enhancement, and distant metastases without pancreatic duct dilatation and parenchymal atrophy. As the most common type of metastatic pancreatic tumor, renal cell cancers tend to have higher attenuation values than that of primary pancreatic cancer, while they had similar attenuation values on the portal phase. Primary pancreatic cancer was always associated with an elevated CA199, total bilirubin, and fasting plasma glucose levels. Surgical resection for metastases to pancreas should be aggressively considered in selected patients due to its unique value of providing palliation and a chance to cure. For patients with unresectable lesions, new therapeutic protocols should be recommended such as the combination of BRAF with MEK inhibitor and PD-1 blocker with or without ipilimumab.

Also flagged:BARD1Breast cancer susceptibility gene 1BRCA1bindingBRCA1-associated RING domain protein 1E3 ubiquitin ligase
Journal Article 2018-11-01 ✓ 1 Snippet Li Q, Saito TT, Martinez-Garcia M, Deshong AJ, Nadarajan S, Lawrence KS, Checchi PM, Colaiacovo MP, Engebrecht J.
In-Text Gene Mentions

…ANK domain in TONSL-MMS22L, a complex involved…

Show Full Abstract

Breast cancer susceptibility gene 1 (BRCA1) and binding partner BRCA1-associated RING domain protein 1 (BARD1) form an essential E3 ubiquitin ligase important for DNA damage repair and homologous recombination. The Caenorhabditis elegans orthologs, BRC-1 and BRD-1, also function in DNA damage repair, homologous recombination, as well as in meiosis. Using functional GFP fusions we show that in mitotically-dividing germ cells BRC-1 and BRD-1 are nucleoplasmic with enrichment at foci that partially overlap with the recombinase RAD-51. Co-localization with RAD-51 is enhanced under replication stress. As cells enter meiosis, BRC-1-BRD-1 remains nucleoplasmic and in foci, and beginning in mid-pachytene the complex co-localizes with the synaptonemal complex. Following establishment of the single asymmetrically positioned crossover on each chromosome pair, BRC-1-BRD-1 concentrates to the short arm of the bivalent. Localization dependencies reveal that BRC-1 and BRD-1 are interdependent and the complex fails to properly localize in both meiotic recombination and chromosome synapsis mutants. Consistent with a role for BRC-1-BRD-1 in meiotic recombination in the context of the synaptonemal complex, inactivation of BRC-1 or BRD-1 enhances the embryonic lethality of mutants defective in chromosome synapsis. Our data suggest that under meiotic dysfunction, BRC-1-BRD-1 stabilizes the RAD-51 filament and alters the recombination landscape; these two functions can be genetically separated from BRC-1-BRD-1's role in the DNA damage response. Together, we propose that BRC-1-BRD-1 serves a checkpoint function at the synaptonemal complex where it monitors and modulates meiotic recombination.

Also flagged:coagulationcoagulation factorclottingcoagulopathyheparincoronary artery disease
Journal Article 2018-11-01 ✓ 1 Snippet Warner MA, Frank RD, Weister TJ, Smith MM, Stubbs JR, Kor DJ.
In-Text Gene Mentions

antithrombin-III

Show Full Abstract

<h4>Background</h4>Intraoperative plasma transfusion is common, yet little is known regarding its effects on perioperative coagulation tests or clinical outcomes.<h4>Study design and methods</h4>This is a retrospective cohort study of adults receiving intraoperative plasma transfusion at a single center from 2011 to 2015. Relationships between plasma transfusion volume, changes in coagulation test values, and clinical outcomes, including a primary outcome of early postoperative red blood cell (RBC) transfusion, were assessed with multivariable regression analyses. Secondary outcomes included hospital mortality, intensive care unit (ICU)- and hospital-free days, intraoperative RBC transfusions, and estimated blood loss.<h4>Results</h4>A total of 3393 unique patients were included, with median (IQR) transfusion of 2 (2-4) units. In multivariable analyses, higher plasma volumes were associated with worse outcomes, with each 1 mL/kg increase associated with increased odds for postoperative (1.02 [1.01-1.03], p < 0.001) and intraoperative RBCs (1.17 [1.16-1.19], p < 0.001) and fewer ICU- and hospital-free days (mean difference [95% CI], -0.08 [-0.12 to -0.05], p < 0.001; and -0.09 [-0.13 to -0.06], p < 0.001, respectively). Greater decreases in international normalized ratio (INR) following plasma transfusion were associated with decreased odds of postoperative RBCs (0.35 [0.25-0.47], p < 0.001), decreased mortality (0.50 [0.31-0.83], p = 0.007), and increased mean ICU- (1.31 [0.41-2.21], p = 0.004) and hospital-free days (1.15 [0.19-2.10], p = 0.018).<h4>Conclusion</h4>In patients receiving intraoperative plasma transfusion, higher transfusion volumes were associated with inferior clinical outcomes; however, greater improvements in INR were associated with improved outcomes. Future prospective studies are necessary to better define these relationships and to explore plasma transfusion triggers beyond the limitations of INR.

Also flagged:maintenance of chromosomeschromosomechromosomesamino acidpolypeptideamino acids
Journal Article 2018-11-01 ✓ 1 Snippet Krepel D, Cheng RR, Di Pierro M, Onuchic JN.
In-Text Gene Mentions

Condensin

Show Full Abstract

Protein assemblies consisting of structural maintenance of chromosomes (SMC) and kleisin subunits are essential for the process of chromosome segregation across all domains of life. Prokaryotic condensin belonging to this class of protein complexes is composed of a homodimer of SMC that associates with a kleisin protein subunit called ScpA. While limited structural data exist for the proteins that comprise the (SMC)-kleisin complex, the complete structure of the entire complex remains unknown. Using an integrative approach combining both crystallographic data and coevolutionary information, we predict an atomic-scale structure of the whole condensin complex, which our results indicate being composed of a single ring. Coupling coevolutionary information with molecular-dynamics simulations, we study the interaction surfaces between the subunits and examine the plausibility of alternative stoichiometries of the complex. Our analysis also reveals several additional configurational states of the condensin hinge domain and the SMC-kleisin interaction domains, which are likely involved with the functional opening and closing of the condensin ring. This study provides the foundation for future investigations of the structure-function relationship of the various SMC-kleisin protein complexes at atomic resolution.

Also flagged:ochratoxin Azearalenoneochratoxinsmycotoxinsgold nanoparticlesmycotoxin
Journal Article 2018-11-01 No Snippets Zhang X, He K, Fang Y, Cao T, Paudyal N, Zhang XF, Song HH, Li XL, Fang WH.
Show Full Abstract

A one-step dual flow immunochromatographic assay (DICGA), based on a competitive format, was developed for simultaneous quantification of ochratoxin A (OTA) and zearalenone (ZEN) in corn, wheat, and feed samples. The limit of detection for OTA was 0.32 ng/ml with a detection range of 0.53‒12.16 ng/ml, while for ZEN it was 0.58 ng/ml with a detection range of 1.06‒39.72 ng/ml. The recovery rates in corn, wheat, and feed samples ranged from 77.3% to 106.3% with the coefficient of variation lower than 15%. Naturally contaminated corn, wheat, and feed samples were analyzed using both DICGA and liquid chromatography-tandem mass spectrometry (LC-MS/MS) and the correlation between the two methods was evaluated using a regression analysis. The DICGA method shows great potential for simple, rapid, sensitive, and cost-effective quantitative detection of OTA and ZEN in food safety control.

Also flagged:C-reactive proteinCRPschizophreniabipolar disorderComplex Disorderscardiovascular disease
Journal Article 2018-11-01 ✓ 2 Snippets Ligthart S, Vaez A, Võsa U, Stathopoulou MG, de Vries PS, Prins BP, Van der Most PJ, Tanaka T, Naderi E, Rose LM, Wu Y, Karlsson R, Barbalic M, Lin H, Pool R, Zhu G, Macé A, Sidore C, Trompet S, Mangino M, Sabater-Lleal M, Kemp JP, Abbasi A, Kacprowski T, Verweij N, Smith AV, Huang T, Marzi C, Feitosa MF, Lohman KK, Kleber ME, Milaneschi Y, Mueller C, Huq M, Vlachopoulou E, Lyytikäinen LP, Oldmeadow C, Deelen J, Perola M, Zhao JH, Feenstra B, LifeLines Cohort Study, Amini M, CHARGE Inflammation Working Group, Lahti J, Schraut KE, Fornage M, Suktitipat B, Chen WM, Li X, Nutile T, Malerba G, Luan J, Bak T, Schork N, Del Greco M F, Thiering E, Mahajan A, Marioni RE, Mihailov E, Eriksson J, Ozel AB, Zhang W, Nethander M, Cheng YC, Aslibekyan S, Ang W, Gandin I, Yengo L, Portas L, Kooperberg C, Hofer E, Rajan KB, Schurmann C, den Hollander W, Ahluwalia TS, Zhao J, Draisma HHM, Ford I, Timpson N, Teumer A, Huang H, Wahl S, Liu Y, Huang J, Uh HW, Geller F, Joshi PK, Yanek LR, Trabetti E, Lehne B, Vozzi D, Verbanck M, Biino G, Saba Y, Meulenbelt I, O'Connell JR, Laakso M, Giulianini F, Magnusson PKE, Ballantyne CM, Hottenga JJ, Montgomery GW, Rivadineira F, Rueedi R, Steri M, Herzig KH, Stott DJ, Menni C, Frånberg M, St Pourcain B, Felix SB, Pers TH, Bakker SJL, Kraft P, Peters A, Vaidya D, Delgado G, Smit JH, Großmann V, Sinisalo J, Seppälä I, Williams SR, Holliday EG, Moed M, Langenberg C, Räikkönen K, Ding J, Campbell H, Sale MM, Chen YI, James AL, Ruggiero D, Soranzo N, Hartman CA, Smith EN, Berenson GS, Fuchsberger C, Hernandez D, Tiesler CMT, Giedraitis V, Liewald D, Fischer K, Mellström D, Larsson A, Wang Y, Scott WR, Lorentzon M, Beilby J, Ryan KA, Pennell CE, Vuckovic D, Balkau B, Concas MP, Schmidt R, Mendes de Leon CF, Bottinger EP, Kloppenburg M, Paternoster L, Boehnke M, Musk AW, Willemsen G, Evans DM, Madden PAF, Kähönen M, Kutalik Z, Zoledziewska M, Karhunen V, Kritchevsky SB, Sattar N, Lachance G, Clarke R, Harris TB, Raitakari OT, Attia JR, van Heemst D, Kajantie E, Sorice R, Gambaro G, Scott RA, Hicks AA, Ferrucci L, Standl M, Lindgren CM, Starr JM, Karlsson M, Lind L, Li JZ, Chambers JC, Mori TA, de Geus EJCN, Heath AC, Martin NG, Auvinen J, Buckley BM, de Craen AJM, Waldenberger M, Strauch K, Meitinger T, Scott RJ, McEvoy M, Beekman M, Bombieri C, Ridker PM, Mohlke KL, Pedersen NL, Morrison AC, Boomsma DI, Whitfield JB, Strachan DP, Hofman A, Vollenweider P, Cucca F, Jarvelin MR, Jukema JW, Spector TD, Hamsten A, Zeller T, Uitterlinden AG, Nauck M, Gudnason V, Qi L, Grallert H, Borecki IB, Rotter JI, März W, Wild PS, Lokki ML, Boyle M, Salomaa V, Melbye M, Eriksson JG, Wilson JF, Penninx BWJH, Becker DM, Worrall BB, Gibson G, Krauss RM, Ciullo M, Zaza G, Wareham NJ, Oldehinkel AJ, Palmer LJ, Murray SS, Pramstaller PP, Bandinelli S, Heinrich J, Ingelsson E, Deary IJ, Mägi R, Vandenput L, van der Harst P, Desch KC, Kooner JS, Ohlsson C, Hayward C, Lehtimäki T, Shuldiner AR, Arnett DK, Beilin LJ, Robino A, Froguel P, Pirastu M, Jess T, Koenig W, Loos RJF, Evans DA, Schmidt H, Smith GD, Slagboom PE, Eiriksdottir G, Morris AP, Psaty BM, Tracy RP, Nolte IM, Boerwinkle E, Visvikis-Siest S, Reiner AP, Gross M, Bis JC, Franke L, Franco OH, Benjamin EJ, Chasman DI, Dupuis J, Snieder H, Dehghan A, Alizadeh BZ.
In-Text Gene Mentions

hemochromatosis

HFE

Show Full Abstract

C-reactive protein (CRP) is a sensitive biomarker of chronic low-grade inflammation and is associated with multiple complex diseases. The genetic determinants of chronic inflammation remain largely unknown, and the causal role of CRP in several clinical outcomes is debated. We performed two genome-wide association studies (GWASs), on HapMap and 1000 Genomes imputed data, of circulating amounts of CRP by using data from 88 studies comprising 204,402 European individuals. Additionally, we performed in silico functional analyses and Mendelian randomization analyses with several clinical outcomes. The GWAS meta-analyses of CRP revealed 58 distinct genetic loci (p < 5 × 10<sup>-8</sup>). After adjustment for body mass index in the regression analysis, the associations at all except three loci remained. The lead variants at the distinct loci explained up to 7.0% of the variance in circulating amounts of CRP. We identified 66 gene sets that were organized in two substantially correlated clusters, one mainly composed of immune pathways and the other characterized by metabolic pathways in the liver. Mendelian randomization analyses revealed a causal protective effect of CRP on schizophrenia and a risk-increasing effect on bipolar disorder. Our findings provide further insights into the biology of inflammation and could lead to interventions for treating inflammation and its clinical consequences.

Also flagged:GANCPSMA3eIF4AIIIGAPDHPax6HSPD1
Journal Article 2018-11-01 ✓ 1 Snippet Blazquez L, Emmett W, Faraway R, Pineda JMB, Bajew S, Gohr A, Haberman N, Sibley CR, Bradley RK, Irimia M, Ule J.
In-Text Gene Mentions

KLHL20

Show Full Abstract

Recursive splicing (RS) starts by defining an "RS-exon," which is then spliced to the preceding exon, thus creating a recursive 5' splice site (RS-5ss). Previous studies focused on cryptic RS-exons, and now we find that the exon junction complex (EJC) represses RS of hundreds of annotated, mainly constitutive RS-exons. The core EJC factors, and the peripheral factors PNN and RNPS1, maintain RS-exon inclusion by repressing spliceosomal assembly on RS-5ss. The EJC also blocks 5ss located near exon-exon junctions, thus repressing inclusion of cryptic microexons. The prevalence of annotated RS-exons is high in deuterostomes, while the cryptic RS-exons are more prevalent in Drosophila, where EJC appears less capable of repressing RS. Notably, incomplete repression of RS also contributes to physiological alternative splicing of several human RS-exons. Finally, haploinsufficiency of the EJC factor Magoh in mice is associated with skipping of RS-exons in the brain, with relevance to the microcephaly phenotype and human diseases.

Also flagged:fucoidanendo-fucoidanasesendo-fucoglucuronomannan lyasesoligosaccharidecarbohydratepolyacrylamide
Journal Article 2018-11-01 No Snippets Cao HTT, Mikkelsen MD, Lezyk MJ, Bui LM, Tran VTT, Silchenko AS, Kusaykin MI, Pham TD, Truong BH, Holck J, Meyer AS.
Show Full Abstract

Fucoidans from brown macroalgae have beneficial biomedical properties but their use as pharma products requires homogenous oligomeric products. In this study, the action of five recombinant microbial fucoidan degrading enzymes were evaluated on fucoidans from brown macroalgae: <i>Sargassum mcclurei</i>, <i>Fucus evanescens</i>, <i>Fucus vesiculosus</i>, <i>Turbinaria ornata</i>, <i>Saccharina cichorioides</i>, and <i>Undaria pinnatifida</i>. The enzymes included three endo-fucoidanases (EC 3.2.1.-GH 107), FcnA2, Fda1, and Fda2, and two unclassified endo-fucoglucuronomannan lyases, FdlA and FdlB. The oligosaccharide product profiles were assessed by carbohydrate-polyacrylamide gel electrophoresis and size exclusion chromatography. The recombinant enzymes FcnA2, Fda1, and Fda2 were unstable but were stabilised by truncation of the C-terminal end (removing up to 40% of the enzyme sequence). All five enzymes catalysed degradation of fucoidans containing α(1→4)-linked l-fucosyls. Fda2 also degraded <i>S. cichorioides</i> and <i>U. pinnatifida</i> fucoidans that have α(1→3)-linked l-fucosyls in their backbone. In the stabilised form, Fda1 also cleaved α(1→3) bonds. For the first time, we also show that several enzymes catalyse degradation of <i>S. mcclurei</i> galactofucan-fucoidan, known to contain α(1→4) and α(1→3) linked l-fucosyls and galactosyl-β(1→3) bonds in the backbone. These data enhance our understanding of fucoidan degrading enzymes and their substrate preferences and may assist development of enzyme-assisted production of defined fuco-oligosaccharides from fucoidan substrates.

Also flagged:V416S rRNAobesitycarbohydratestarchdegradation
Journal Article 2018-11-01 ✓ 5 Snippets León-Mimila P, Villamil-Ramírez H, López-Contreras BE, Morán-Ramos S, Macias-Kauffer LR, Acuña-Alonzo V, Del Río-Navarro BE, Salmerón J, Velazquez-Cruz R, Villarreal-Molina T, Aguilar-Salinas CA, Canizales-Quinteros S.
In-Text Gene Mentions

In the present study, we sought associations of five obesity-related CNV loci [1p31.1/NEGR1 (Neuronal growth regulator 1), 10q11.22/GPRC5B (G Protein-Coupled Receptor Class C Group 5 Member B), 11q11/OR4P4/OR4S2/OR4C6, 16p12.3/NPY4R (Neuropeptide Y Receptor Y4) and 1p21.1/AMY1] with obesity risk in the Mexican population.

The lack of association of the 1p31.1/NEGR1 CNV is in agreement with previous reports in Mexican children and adults where rs2815752 (in high LD with 1p31.1/NEGR1 CNV) was not associated with obesity [12,38], but in disagreement with the findings of Antúnez-Ortiz et al. who found a significant association of another NEGR1 CNV in a group of Mexican children [39].

In contrast with previous findings, NEGR1, GPRC5 and NPY4R CNVs were not associated with obesity in Mexican children.

Firstly, the sample size was insufficient to detect associations of obesity with low frequency alleles (1p31.1/NEGR1, 10q11.22/GPRC5B, and 16p12.3/NPY4R), although it was sufficient to find associations with 11q11/OR4P4/OR4S2/OR4C6, and 1p21.1/AMY1 CNs.

…CNV loci [1p31.1/NEGR1(Neuronal growth regulator…

Show Full Abstract

Genome-wide association studies (GWAS) have identified copy number variants (CNVs) associated with obesity in chromosomal regions 1p31.1, 10q11.22, 11q11, 16p12.3, and recently 1p21.1, which contains the salivary amylase gene (<i>AMY1</i>). Recent evidence suggests this enzyme may influence gut microbiota composition through carbohydrate (mainly starch) degradation. The role of these CNVs in obesity has been scarcely explored in the Latino population, and thus the aim of our study was to evaluate the association of 1p31.1, 10q11.22, 11q11, 16p12.3 and 1p21.1 CNVs with obesity in 921 Mexican children, to replicate significant associations in 920 Mexican adults, and to analyze the association of <i>AMY1</i> copy number with gut microbiota in 75 children and 45 adults. Of the five CNVs analyzed, 1q11 CNV was significantly associated with obesity in children, but not in adults. Only <i>AMY1</i> CNV was significantly associated with obesity in both age groups. Moreover, gut microbiota analyses revealed a positive correlation between <i>AMY1</i> copy number and <i>Prevotella</i> abundance. This genus has enzymes and gene clusters essential for complex polysaccharide degradation and utilization. To our knowledge, this is the first study to analyze the association of these five CNVs in the Mexican population and to report a correlation between <i>AMY1</i> CN and gut microbiota in humans.

Also flagged:hyperlipidemiacolon polypscardiovascular diseaseCVDFHfamilial hypercholesterolemia
Journal Article 2018-11-01 ✓ 2 Snippets Kullo IJ, Olson J, Fan X, Jose M, Safarova M, Radecki Breitkopf C, Winkler E, Kochan DC, Snipes S, Pacyna JE, Carney M, Chute CG, Gupta J, Jose S, Venner E, Murugan M, Jiang Y, Zordok M, Farwati M, Philogene M, Smith E, Shaibi GQ, Caraballo P, Freimuth R, Lindor NM, Sharp R, Thibodeau SN.
In-Text Gene Mentions

…c.845G>A variant inHFEthat is associated…

…is associated withhemochromatosis( Table 5…

Show Full Abstract

<h4>Objectives</h4>To identify clinically actionable genetic variants from targeted sequencing of 68 disease-related genes, estimate their penetrance, and assess the impact of disclosing results to participants and providers.<h4>Patients and methods</h4>The Return of Actionable Variants Empirical (RAVE) Study investigates outcomes following the return of pathogenic/likely pathogenic (P/LP) variants in 68 disease-related genes. The study was initiated in December 2016 and is ongoing. Targeted sequencing was performed in 2533 individuals with hyperlipidemia or colon polyps. The electronic health records (EHRs) of participants carrying P/LP variants in 36 cardiovascular disease (CVD) genes were manually reviewed to ascertain the presence of relevant traits. Clinical outcomes, health care utilization, family communication, and ethical and psychosocial implications of disclosure of genomic results are being assessed by surveys, telephone interviews, and EHR review.<h4>Results</h4>Of 29,208 variants in the 68 genes, 1915 were rare (frequency <1%) and putatively functional, and 102 of these (60 in 36 CVD genes) were labeled P/LP based on the American College of Medical Genetics and Genomics framework. Manual review of the EHRs of participants (n=73 with P/LP variants in CVD genes) revealed that 33 had the expected trait(s); however, only 6 of 45 participants with non-familial hypercholesterolemia (FH) P/LP variants had the expected traits.<h4>Conclusion</h4>Expected traits were present in 13% of participants with P/LP variants in non-FH CVD genes, suggesting low penetrance; this estimate may change with additional testing performed as part of the clinical evaluation. Ongoing analyses of the RAVE Study will inform best practices for genomic medicine.

Also flagged:infectionTMHC class IILgr5CD4epithelial cell differentiation
Journal Article 2018-11-01 ✓ 1 Snippet Biton M, Haber AL, Rogel N, Burgin G, Beyaz S, Schnell A, Ashenberg O, Su CW, Smillie C, Shekhar K, Chen Z, Wu C, Ordovas-Montanes J, Alvarez D, Herbst RH, Zhang M, Tirosh I, Dionne D, Nguyen LT, Xifaras ME, Shalek AK, von Andrian UH, Graham DB, Rozenblatt-Rosen O, Shi HN, Kuchroo V, Yilmaz OH, Regev A, Xavier RJ.
In-Text Gene Mentions

Olfm4

Show Full Abstract

In the small intestine, a niche of accessory cell types supports the generation of mature epithelial cell types from intestinal stem cells (ISCs). It is unclear, however, if and how immune cells in the niche affect ISC fate or the balance between self-renewal and differentiation. Here, we use single-cell RNA sequencing (scRNA-seq) to identify MHC class II (MHCII) machinery enrichment in two subsets of Lgr5<sup>+</sup> ISCs. We show that MHCII<sup>+</sup> Lgr5<sup>+</sup> ISCs are non-conventional antigen-presenting cells in co-cultures with CD4<sup>+</sup> T helper (Th) cells. Stimulation of intestinal organoids with key Th cytokines affects Lgr5<sup>+</sup> ISC renewal and differentiation in opposing ways: pro-inflammatory signals promote differentiation, while regulatory cells and cytokines reduce it. In vivo genetic perturbation of Th cells or MHCII expression on Lgr5<sup>+</sup> ISCs impacts epithelial cell differentiation and IEC fate during infection. These interactions between Th cells and Lgr5<sup>+</sup> ISCs, thus, orchestrate tissue-wide responses to external signals.

Also flagged:AutismAutism spectrum disorderNeurogenin 2NGN2synaptic activityAFF2
Journal Article 2018-11-01 ✓ 1 Snippet Deneault E, White SH, Rodrigues DC, Ross PJ, Faheem M, Zaslavsky K, Wang Z, Alexandrova R, Pellecchia G, Wei W, Piekna A, Kaur G, Howe JL, Kwan V, Thiruvahindrapuram B, Walker S, Lionel AC, Pasceri P, Merico D, Yuen RKC, Singh KK, Ellis J, Scherer SW.
In-Text Gene Mentions

…the cortical markersPOU3F2and FOXG1 than…

Show Full Abstract

Autism spectrum disorder (ASD) is phenotypically and genetically heterogeneous. We present a CRISPR gene editing strategy to insert a protein tag and premature termination sites creating an induced pluripotent stem cell (iPSC) knockout resource for functional studies of ten ASD-relevant genes (AFF2/FMR2, ANOS1, ASTN2, ATRX, CACNA1C, CHD8, DLGAP2, KCNQ2, SCN2A, TENM1). Neurogenin 2 (NGN2)-directed induction of iPSCs allowed production of excitatory neurons, and mutant proteins were not detectable. RNA sequencing revealed convergence of several neuronal networks. Using both patch-clamp and multi-electrode array approaches, the electrophysiological deficits measured were distinct for different mutations. However, they culminated in a consistent reduction in synaptic activity, including reduced spontaneous excitatory postsynaptic current frequencies in AFF2/FMR2-, ASTN2-, ATRX-, KCNQ2-, and SCN2A-null neurons. Despite ASD susceptibility genes belonging to different gene ontologies, isogenic stem cell resources can reveal common functional phenotypes, such as reduced functional connectivity.

Also flagged:IronmitochondrialmetabolismdetoxificationCIANfs1
Journal Article 2018-11-01 No Snippets Misslinger M, Lechner BE, Bacher K, Haas H.
Show Full Abstract

Microorganisms have to adapt their metabolism to the requirements of their ecological niche to avoid iron shortage as well as iron toxicity. Therefore, mechanisms have been evolved to tightly regulate iron uptake, consumption, and detoxification, which depend on sensing the cellular iron status. In the facultative anaerobic yeast Saccharomyces cerevisiae, iron-sensing depends on mitochondrial (ISC) but not cytosolic iron-sulfur cluster assembly (CIA), while in mammals further processing of an ISC product via CIA is required for sensing of the cellular iron state. To address the question of how the obligatory aerobic mold Aspergillus fumigatus senses the cellular iron state, mutant strains allowing the downregulation of ISC and CIA were generated. These studies revealed that: (i) Nfs1 (Afu3g14240) and Nbp35 (Afu2g15960), which are involved in ISC and CIA, respectively, are essential for growth; (ii) a decrease in ISC (Nfs1 depletion) but not CIA (Nbp35 depletion) results in a transcriptional iron starvation response, (iii) a decrease in, ISC as well as CIA, increases the chelatable iron pool, accompanied by increased iron toxicity and increased susceptibility to oxidative stress and phleomycin. In agreement with ISC being essential for iron-sensing, a decrease in mitochondrial iron import by deletion of the mitochondrial iron importer MrsA resulted in an iron starvation response. Taken together, these data underline that iron-sensing in A. fumigatus depends on ISC but not CIA. Moreover, depletion of the glutathione pool via generating a mutant lacking γ-glutamylcysteine synthase, GshA (Afu3g13900), caused an iron starvation response, underlining a crucial role of glutathione in iron-sensing in A. fumigatus.

Also flagged:adolescent idiopathic scoliosismusculoskeletal disorderCDH13connective tissue developmentchromatindevelopment
Journal Article 2018-11-01 ✓ 3 Snippets Khanshour AM, Kou I, Fan Y, Einarsdottir E, Makki N, Kidane YH, Kere J, Grauers A, Johnson TA, Paria N, Patel C, Singhania R, Kamiya N, Takeda K, Otomo N, Watanabe K, Luk KDK, Cheung KMC, Herring JA, Rios JJ, Ahituv N, Gerdhem P, Gurnett CA, Song YQ, Ikegawa S, Wise CA.
In-Text Gene Mentions

…Expression of bothSOX6and CDH13 was…

…= 7.3E-10) andSOX6( P -value_rs1455114…

SOX6

Show Full Abstract

Adolescent idiopathic scoliosis (AIS) is the most common musculoskeletal disorder of childhood development. The genetic architecture of AIS is complex, and the great majority of risk factors are undiscovered. To identify new AIS susceptibility loci, we conducted the first genome-wide meta-analysis of AIS genome-wide association studies, including 7956 cases and 88 459 controls from 3 ancestral groups. Three novel loci that surpassed genome-wide significance were uncovered in intragenic regions of the CDH13 (P-value_rs4513093 = 1.7E-15), ABO (P-value_ rs687621 = 7.3E-10) and SOX6 (P-value_rs1455114 = 2.98E-08) genes. Restricting the analysis to females improved the associations at multiple loci, most notably with variants within CDH13 despite the reduction in sample size. Genome-wide gene-functional enrichment analysis identified significant perturbation of pathways involving cartilage and connective tissue development. Expression of both SOX6 and CDH13 was detected in cartilage chondrocytes and chromatin immunoprecipitation sequencing experiments in that tissue revealed multiple HeK27ac-positive peaks overlapping associated loci. Our results further define the genetic architecture of AIS and highlight the importance of vertebral cartilage development in its pathogenesis.

Also flagged:Nonalcoholic Fatty Liver DiseaseNAFLDchronic liver diseaseliver enzymenonalcoholic fatty livernonalcoholic steatohepatitis
Journal Article 2018-11-01 ✓ 1 Snippet Wang XJ, Malhi H.
In-Text Gene Mentions

HFE

Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD) is the leading cause of chronic liver disease. Most cases are diagnosed incidentally in the primary care or hospital setting on the basis of elevated liver enzyme levels or hepatic steatosis on imaging. NAFLD encompasses a wide spectrum: The vast majority of patients have nonprogressive nonalcoholic fatty liver, and a few of those develop progressive liver injury, inflammation, and fibrosis, a condition termed nonalcoholic steatohepatitis. Cardiovascular disease is the leading cause of death in patients with nonalcoholic fatty liver disease. Persons with nonalcoholic steatohepatitis have increased liver-related mortality. In the absence of regulatory agency-approved drugs, lifestyle modification and weight loss remain the cornerstones of NAFLD therapy.

Also flagged:cohesinSmc5chromatinchromosomegene expressionnucleic acid translocases
Journal Article 2018-11-01 ✓ 1 Snippet Hassler M, Shaltiel IA, Haering CH.
In-Text Gene Mentions

Condensin

Show Full Abstract

Protein complexes built of structural maintenance of chromosomes (SMC) and kleisin subunits, including cohesin, condensin and the Smc5/6 complex, are master organizers of genome architecture in all kingdoms of life. How these large ring-shaped molecular machines use the energy of ATP hydrolysis to change the topology of chromatin fibers has remained a central unresolved question of chromosome biology. A currently emerging concept suggests that the common principle that underlies the essential functions of SMC protein complexes in the control of gene expression, chromosome segregation or DNA damage repair is their ability to expand DNA into large loop structures. Here, we review the current knowledge about the biochemical and structural properties of SMC protein complexes that might enable them to extrude DNA loops and compare their action to other motor proteins and nucleic acid translocases. We evaluate the currently predominant models of active loop extrusion and propose a detailed version of a 'scrunching' model, which reconciles much of the available mechanistic data and provides an elegant explanation for how SMC protein complexes fulfill an array of seemingly diverse tasks during the organization of genomes.

Also flagged:primary sclerosing cholangitisursodeoxycholic acidhepatitisAlaninecholangitisbilirubin
Journal Article 2018-11-01 ✓ 1 Snippet Yoo JJ, Cho EJ, Lee B, Kim SG, Kim YS, Lee YB, Lee JH, Yu SJ, Kim YJ, Yoon JH.
In-Text Gene Mentions

…Wilson’s disease orhemochromatosis.…

Show Full Abstract

<h4>Background/aims</h4>Recently reported prognostic models for primary biliary cholangitis (PBC) have been shown to be effective in Western populations but have not been well-validated in Asian patients. This study aimed to compare the performance of prognostic models in Korean patients and to investigate whether inflammation-based scores can further help in prognosis prediction.<h4>Methods</h4>This study included 271 consecutive patients diagnosed with PBC in Korea. The following prognostic models were evaluated: the Barcelona model, the Paris-I/II model, the Rotterdam criteria, the GLOBE score and the UK-PBC score. The neutrophil-to-lymphocyte ratio (NLR) was analyzed with reference to its association with prognosis.<h4>Results</h4>For predicting liver transplant or death at the 5-year and 10-year follow-up examinations, the UK-PBC score (areas under the receiver operating characteristic curve [AUCs], 0.88 and 0.82) and GLOBE score (AUCs, 0.85 and 0.83) were significantly more accurate in predicting prognosis than the other scoring systems (all p<0.05). There was no significant difference between the performance of the UK-PBC and GLOBE scores. In addition to the prognostic models, a high NLR (>2.46) at baseline was an independent predictor of reduced transplant-free survival in the multivariate analysis (adjusted hazard ratio, 3.74; p<0.01). When the NLR was applied to the prognostic models, it significantly differentiated the prognosis of patients.<h4>Conclusions</h4>The UK-PBC and GLOBE scores showed good prognostic performance in Korean patients with PBC. In addition, a high NLR was associated with a poorer prognosis. Including the NLR in prognostic models may further help to stratify patients with PBC.

Also flagged:obesitycell adhesionbindingcardiovascular disordersdiabetes mellitusglucose
Journal Article 2018-11-01 ✓ 5 Snippets Kumar P, Mahalingam K.
In-Text Gene Mentions

<i>Neuronal growth regulator 1</i> (<i>NEGR1</i>) is a candidate gene for human obesity, which encodes the neural cell adhesion and growth molecule.

<i>In silico</i> approach to identify non-synonymous SNPs with highest predicted deleterious effect on protein function in human obesity related gene, <i>neuronal growth regulator 1</i> (<i>NEGR1</i>).

…obesity related gene,neuronal growth regulator 1growth regulator 1…

…regulator 1 (NEGR1)…

Neuronal growth regulator 1growth regulator 1…

Show Full Abstract

<i>Neuronal growth regulator 1</i> (<i>NEGR1</i>) is a candidate gene for human obesity, which encodes the neural cell adhesion and growth molecule. The aim of the current study was to recognize the non-synonymous SNPs (nsSNPs) with the highest predicted deleterious effect on protein function of the <i>NEGR1</i> gene. We have used five computational tools, namely, PolyPhen, SIFT, PROVEAN, MutPred and M-CAP, to predict the deleterious and pathogenic nsSNPs of the <i>NEGR1</i> gene. Homology modeling approach was used to model the native and mutant <i>NEGR1</i> protein models. Furthermore, structural validation was performed by the PROCHECK server to interpret the stability of the predicted models. We have predicted four potential deleterious nsSNPs, i.e., rs145524630 (Ala70Thr), rs267598710 (Pro168Leu), rs373419972 (Arg239Cys) and rs375352213 (Leu158Phe), which might be involved in causing obesity phenotypes. The predicted mutant models showed higher root mean square deviation and free energy values under the PyMoL and SWISS-PDB viewer, respectively. Additionally, the FTSite server predicted one nsSNP, i.e., rs145524630 (Ala70Thr) out of four identified nsSNPs found in the <i>NEGR1</i> protein-binding site. There were four potential deleterious and pathogenic nsSNPs, i.e., rs145524630, rs267598710, rs373419972 and rs375352213, identified from the above-mentioned tools. In future, further functional in vitro and in vivo analysis could lead to better knowledge about these nsSNPs on the influence of the <i>NEGR1</i> gene in causing human obesity. Hence, the present computational examination suggest that predicated nsSNPs may feasibly be a drug target and play an important role in contributing to human obesity.

Also flagged:congenital mirror movement disorderRAD51movement disordersAFchromosomeamino acid
Journal Article 2018-11-01 No Snippets Demirayak P, Onat OE, Gevrekci AÖ, Gülsüner S, Uysal H, Bilgen RS, Doerschner K, Özçelik TS, Boyacı H.
Show Full Abstract

<h4>Purpose</h4>Congenital mirror movement disorder (CMMD) is characterized by unintended, nonsuppressible, homologous mirroring activity contralateral to the movement on the intended side of the body. In healthy controls, unilateral movements are accompanied with predominantly contralateral cortical activity, whereas in CMMD, in line with the abnormal behavior, bilateral cortical activity is observed for unilateral motor tasks. However, task-related activities in subcortical structures, which are known to play critical roles in motor actions, have not been investigated in CMMD previously.<h4>Methods</h4>We investigated the functional activation patterns of the motor components in CMMD patients. By using linkage analysis and exome sequencing, common mutations were revealed in seven affected individuals from the same family. Next, using functional magnetic resonance imaging (fMRI) we investigated cortical and subcortical activity during manual motor actions in two right-handed affected brothers and sex, age, education, and socioeconomically matched healthy individuals.<h4>Results</h4>Genetic analyses revealed heterozygous RAD51 c.401C>T mutation which cosegregated with the phenotype in two affected members of the family. Consistent with previous literature, our fMRI results on these two affected individuals showed that mirror movements were closely related to abnormal cortical activity in M1 and SMA during unimanual movements. Furthermore, we have found previously unknown abnormal task-related activity in subcortical structures. Specifically, we have found increased and bilateral activity during unimanual movements in thalamus, striatum, and globus pallidus in CMMD patients.<h4>Conclusion</h4>These findings reveal further neural correlates of CMMD, and may guide our understanding of the critical roles of subcortical structures for unimanual movements in healthy individuals.

Also flagged:Listeriolysin Ophagosomepore-forming toxinLLOcell surface glycoproteins
Journal Article 2018-11-01 ✓ 2 Snippets Kühbacher A, Novy K, Quereda JJ, Sachse M, Moya-Nilges M, Wollscheid B, Cossart P, Pizarro-Cerdá J.
In-Text Gene Mentions

These 24 glycoproteins can be divided in four classes: (i) proteins that inhibit infection (positive infection Z-score) that were increased on the cell surface upon LLO treatment (SLC6A15, EDEM3) (Fig. 1B, left panel), (ii) proteins that are required for infection (negative infection Z-score) that were decreased on the cell surface upon LLO treatment (IL6ST, SLC3A2, FRAS1, AXL, SC29A1, LRRC4C) (Fig. 1B, left panel), (iii) proteins that are required for infection and are increased at the cell surface (NUP210, THY1, LAMP2, HYOU1) (Fig. 1B, center panel) and (iv) proteins that inhibit infection and are decreased at the cell surface (PTGFRN, BST2, CD70, PTPRF, PTK7, BTN2A1, DCBLD1, VASN, IGSF3, ITGA5, SLC1A5, GAPDH) (Fig. 1B, center panel).

…CD70, PTPRF, PTK7,BTN2A1, DCBLD1, VASN, IGSF3,…

Show Full Abstract

Listeria monocytogenes is a pathogenic bacterium that invades epithelial cells by activating host signaling cascades, which promote bacterial engulfment within a phagosome. The pore-forming toxin listeriolysin O (LLO), which is required for bacteria phagosomal escape, has also been associated with the activation of several signaling pathways when secreted by extracellular bacteria, including Ca2+ influx and promotion of L. monocytogenes entry. Quantitative host surfaceome analysis revealed significant quantitative remodeling of a defined set of cell surface glycoproteins upon LLO treatment, including a subset previously identified to play a role in the L. monocytogenes infection process. Our data further shows that the lysosomal-associated membrane proteins LAMP-1 and LAMP-2 are translocated to the cellular surface and those LLO-induced Ca2+ fluxes are required to trigger the surface relocalization of LAMP-1. Finally, we identify late endosomes/lysosomes as the major donor compartments of LAMP-1 upon LLO treatment and by perturbing their function, we suggest that these organelles participate in L. monocytogenes invasion.

Also flagged:RxrgKif1bSrmRxrbRxraGsta5
Journal Article 2018-11-01 ✓ 5 Snippets Hasan MN, Rana MM, Rana MM, Begum AA, Rahman M, Mollah MNH.
In-Text Gene Mentions

DCC

In the case of real life TGP data analysis, three DCCs (glibenclamide-low, perhexilline-low, and hexachlorobenzene-medium) for glutathione metabolism pathway dataset as well as two DCCs (acetaminophen-medium and methapyrilene-low) for PPAR signaling pathway dataset were incorrectly co-clustered by the Toxygates online platform, while only one DCC (hexachlorobenzene-low) for glutathione metabolism pathway was incorrectly co-clustered by the proposed LPHVM approach.

We observed that three DCCs (glibenclamide-low, perhexilline-low, and hexachlorobenzene-medium) for glutathione metabolism pathway dataset as well as two DCCs (acetaminophen-medium and methapyrilene-low) for PPAR signaling pathway dataset were incorrectly co-clustered by the Toxygates online platform, while only one DCC (hexachlorobenzene-low) for glutathione metabolism pathway was incorrectly co-clustered by the proposed LPHVM approach.

…corresponding to aDCCor downregulated corresponding…

…corresponding to anotherDCC.…

Show Full Abstract

Detection of biomarker genes and their regulatory doses of chemical compounds (DCCs) is one of the most important tasks in toxicogenomic studies as well as in drug design and development. There is an online computational platform "Toxygates" to identify biomarker genes and their regulatory DCCs by co-clustering approach. Nevertheless, the algorithm of that platform based on hierarchical clustering (HC) does not share gene-DCC two-way information simultaneously during co-clustering between genes and DCCs. Also it is sensitive to outlying observations. Thus, this platform may produce misleading results in some cases. The probabilistic hidden variable model (PHVM) is a more effective co-clustering approach that share two-way information simultaneously, but it is also sensitive to outlying observations. Therefore, in this paper we have proposed logistic probabilistic hidden variable model (LPHVM) for robust co-clustering between genes and DCCs, since gene expression data are often contaminated by outlying observations. We have investigated the performance of the proposed LPHVM co-clustering approach in a comparison with the conventional PHVM and Toxygates co-clustering approaches using simulated and real life TGP gene expression datasets, respectively. Simulation results show that the proposed method improved the performance over the conventional PHVM in presence of outliers; otherwise, it keeps equal performance. In the case of real life TGP data analysis, three DCCs (glibenclamide-low, perhexilline-low, and hexachlorobenzene-medium) for glutathione metabolism pathway dataset as well as two DCCs (acetaminophen-medium and methapyrilene-low) for PPAR signaling pathway dataset were incorrectly co-clustered by the Toxygates online platform, while only one DCC (hexachlorobenzene-low) for glutathione metabolism pathway was incorrectly co-clustered by the proposed LPHVM approach. Our findings from the real data analysis are also supported by the other findings in the literature.

Also flagged:Gastric Cancermalignant tumorscarcinomatumorcell growthluciferase
Journal Article 2018-11-01 ✓ 5 Snippets Yu MJ, Zhao N, Shen H, Wang H.
In-Text Gene Mentions

Moreover, a luciferase assay demonstrated a direct binding between the miR-130 and MRPL39, and the reintroduction of miR-130 abrogated the anti-tumor effect of MRPL39 on GC cells.<h4>Conclusion</h4>Taken together, these findings indicate that MRPL39 serves as a tumor suppressor by directly targeting miR-130 in GC, which suggests that it might be a novel biomarker in the diagnosis and prognosis of GC.

Recently, long noncoding RNAs (lncRNAs) have been implicated in the development and progression of GC.<h4>Materials and methods</h4>In the present study, we investigated the biological function and molecular mechanisms of lncRNA MRPL39 in GC.<h4>Results</h4>We found that MRPL39 was significantly downregulated in GC tissues and cell lines and that its expression level was negatively associated with carcinoma size, tumor, lymph node, metastasis (TNM) stage, and lymphatic metastasis.

Over-expression of MRPL39 in the GC cell lines BGC823 and SGC-7901 inhibited cell growth, proliferation, migration, and invasion.

…Long Noncoding RNAMRPL39Inhibits Gastric Cancer…

…mechanisms of lncRNAMRPL39in GC.<h4>Results</h4>We found…

Show Full Abstract

<h4>Background</h4>Gastric cancer (GC) is one of the most prevalent malignant tumors displaying both high incidence and mortality throughout much of the world. Recently, long noncoding RNAs (lncRNAs) have been implicated in the development and progression of GC.<h4>Materials and methods</h4>In the present study, we investigated the biological function and molecular mechanisms of lncRNA MRPL39 in GC.<h4>Results</h4>We found that MRPL39 was significantly downregulated in GC tissues and cell lines and that its expression level was negatively associated with carcinoma size, tumor, lymph node, metastasis (TNM) stage, and lymphatic metastasis. Patients with low MRPL39 expression levels revealed a short overall and disease-free survival period. Over-expression of MRPL39 in the GC cell lines BGC823 and SGC-7901 inhibited cell growth, proliferation, migration, and invasion. MiR-130, a putative target gene of MRPL39, displayed an inverse association with the expression of MRPL39 in GC tissues and cell lines. Moreover, a luciferase assay demonstrated a direct binding between the miR-130 and MRPL39, and the reintroduction of miR-130 abrogated the anti-tumor effect of MRPL39 on GC cells.<h4>Conclusion</h4>Taken together, these findings indicate that MRPL39 serves as a tumor suppressor by directly targeting miR-130 in GC, which suggests that it might be a novel biomarker in the diagnosis and prognosis of GC.

Also flagged:capecitabinecolon cancermethylene tetrahydrofolate reductaseMTHFRtumorscolon cancers
Journal Article 2018-11-01 ✓ 1 Snippet Matevska-Geshkovska N, Staninova-Stojovska M, Kapedanovska-Nestorovska A, Petrushevska-Angelovska N, Panovski M, Grozdanovska B, Mitreski N, Dimovski A.
In-Text Gene Mentions

…genes, such asDCC, SMAD4 (DPC4), SMAD2,…

Show Full Abstract

<h4>Purpose</h4>The aim of this study was to evaluate whether pretreatment analysis of selected molecular markers can be used for the prediction of disease-free survival (DFS)/overall survival (OS) of capecitabine adjuvant monotherapy in colon cancer patients.<h4>Patients and methods</h4>A total of 126 patients enrolled in a capecitabine Phase IV clinical trial were analyzed for microsatellite instability (MSI), 18q loss of heterozygosity (LOH), thymidylate synthase (TYMS) 5' variable number of tandem repeat (VNTR), and methylene tetrahydrofolate reductase (MTHFR) C677T variants. The significance in predicting 5-year DFS/OS was assessed by Kaplan-Meier and Cox regression analyses.<h4>Results</h4>The MSI-high (MSI-H) genotype was significantly associated with DFS (HR 0.205, 95% CI 0.05-0.88, <i>P</i>=0.033) and OS (HR 0.208, 95% CI 0.05-0.89, <i>P</i>=0.035) compared to the microsatellite stable genotype. In models stratified according to clinicopathologic characteristics, the MSI-H genotype remained a positive predictive factor for DFS/OS only in patients with stage III (<i>P</i>=0.023) and patients with tumors localized proximally to the splenic flexure (<i>P</i>=0.004). Distal colon cancers with 18q LOH have a greater survival rate when treated with capecitabine than patients with stable tumors (81.3% vs 50.0%, HR for relapse 0.348, 95% CI 0.13-0.97, <i>P</i>=0.043). TYMS 5'VNTR and MTHFR C677T variants were not associated with DFS or OS.<h4>Conclusion</h4>MSI and 18q LOH markers have the potential to be utilized in the selection of colon cancer patients eligible for capecitabine adjuvant monotherapy.

Also flagged:brain disorderssynapse formationsynapsesynapsesneuronal disordersneurodevelopmental disorders
Journal Article 2018-11-01 ✓ 1 Snippet Wilson ES, Newell-Litwa K.
In-Text Gene Mentions

Transdifferentiated medium spiny neurons from adult Huntington’s disease patients exhibit huntingtin (HTT) aggregates, DNA damage, mitochondrial dysfunction, and neurodegeneration (Victor et al., 2018).

Show Full Abstract

Many brain disorders exhibit altered synapse formation in development or synapse loss with age. To understand the complexities of human synapse development and degeneration, scientists now engineer neurons and brain organoids from human-induced pluripotent stem cells (hIPSC). These hIPSC-derived brain models develop both excitatory and inhibitory synapses and functional synaptic activity. In this review, we address the ability of hIPSC-derived brain models to recapitulate synapse development and insights gained into the molecular mechanisms underlying synaptic alterations in neuronal disorders. We also discuss the potential for more accurate human brain models to advance our understanding of synapse development, degeneration, and therapeutic responses.

Also flagged:extracellularWntTNFαinflammatory cytokineCytokineFah
Journal Article 2018-11-01 ✓ 1 Snippet Peng WC, Logan CY, Fish M, Anbarchian T, Aguisanda F, Álvarez-Varela A, Wu P, Jin Y, Zhu J, Li B, Grompe M, Wang B, Nusse R.
In-Text Gene Mentions

Serpinc1

Show Full Abstract

In the healthy adult liver, most hepatocytes proliferate minimally. However, upon physical or chemical injury to the liver, hepatocytes proliferate extensively in vivo under the direction of multiple extracellular cues, including Wnt and pro-inflammatory signals. Currently, liver organoids can be generated readily in vitro from bile-duct epithelial cells, but not hepatocytes. Here, we show that TNFα, an injury-induced inflammatory cytokine, promotes the expansion of hepatocytes in 3D culture and enables serial passaging and long-term culture for more than 6 months. Single-cell RNA sequencing reveals broad expression of hepatocyte markers. Strikingly, in vitro-expanded hepatocytes engrafted, and significantly repopulated, the injured livers of Fah<sup>-/-</sup> mice. We anticipate that tissue repair signals can be harnessed to promote the expansion of otherwise hard-to-culture cell-types, with broad implications.

Also flagged:MastocytosisKITmast cell activationcutaneous diseasehematologic neoplasmsystemic mastocytosis
Journal Article 2018-11-01 No Snippets Shomali W, Gotlib J.
Show Full Abstract

Mastocytosis is a rare disease characterized by KIT-driven expansion and accumulation of neoplastic mast cells in various tissues. Although mediator symptoms related to mast cell activation can impose a symptom burden in cutaneous disease and across the spectrum of systemic mastocytosis subtypes, the presence of an associated hematologic neoplasm and/or organ damage denotes advanced disease and the potential for increased morbidity and mortality. In addition to the revised 2016 World Health Organization classification of mastocytosis, a new diagnostic and treatment toolkit, tethered to enhanced molecular characterization and monitoring, is poised to transform the management of patients with advanced systemic mastocytosis (advSM). Although the efficacy of midostaurin and novel selective KIT D816V inhibitors, such as avapritinib (BLU-285), have validated KIT as a therapeutic target, the clinical and biologic heterogeneity of advSM requires that we reimagine the blueprint for tackling these diseases and use tools that move beyond KIT-centric approaches.

Also flagged:blood cancershematologic malignanciesleukemialeukemiashematologicB-lymphoblastic leukemia
Journal Article 2018-11-01 ✓ 1 Snippet Rau RE, Loh ML.
In-Text Gene Mentions

…, KMT2A ,MLLT10, TLX1 ,…

Show Full Abstract

Over the past decade, there has been exponential growth in the number of genome sequencing studies performed across a spectrum of human diseases as sequencing technologies and analytic pipelines improve and costs decline. Pediatric hematologic malignancies have been no exception, with a multitude of next generation sequencing studies conducted on large cohorts of patients in recent years. These efforts have defined the mutational landscape of a number of leukemia subtypes and also identified germ-line genetic variants biologically and clinically relevant to pediatric leukemias. The findings have deepened our understanding of the biology of many childhood leukemias. Additionally, a number of recent discoveries may positively impact the care of pediatric leukemia patients through refinement of risk stratification, identification of targetable genetic lesions, and determination of risk for therapy-related toxicity. Although incredibly promising, many questions remain, including the biologic significance of identified genetic lesions and their clinical implications in the context of contemporary therapy. Importantly, the identification of germ-line mutations and variants with possible implications for members of the patient's family raises challenging ethical questions. Here, we review emerging genomic data germane to pediatric hematologic malignancies.

Also flagged:α-thalassemiaα-globinchromosomeζ-globinerythropoiesisgestation
Journal Article 2018-11-01 No Snippets King AJ, Higgs DR.
Show Full Abstract

The α-thalassemia trait, associated with deletions removing both α-globin genes from 1 chromosome (genotype ζ αα/ζ--), is common throughout Southeast Asia. Consequently, many pregnancies in couples of Southeast Asian origin carry a 1 in 4 risk of producing a fetus inheriting no functional α-globin genes (ζ--/ζ--), leading to hemoglobin (Hb) Bart's hydrops fetalis syndrome (BHFS). Expression of the embryonic α-globin genes (ζ-globin) is normally limited to the early stages of primitive erythropoiesis, and so when the ζ-globin genes are silenced, at ∼6 weeks of gestation, there should be no α-like globin chains to pair with the fetal γ-globin chains of Hb, which consequently form nonfunctional tetramers (γ<sub>4</sub>) known as Hb Bart's. When deletions leave the ζ-globin gene intact, a low level of ζ-globin gene expression continues in definitive erythroid cells, producing small amounts of Hb Portland (ζ<sub>2</sub>γ<sub>2</sub>), a functional form of Hb that allows the fetus to survive up to the second or third trimester. Untreated, all affected individuals die at these stages of development. Prevention is therefore of paramount importance. With improvements in early diagnosis, intrauterine transfusion, and advanced perinatal care, there are now a small number of individuals with BHFS who have survived, with variable outcomes. A deeper understanding of the mechanism underlying the switch from ζ- to α-globin expression could enable persistence or reactivation of embryonic globin synthesis in definitive cells, thereby providing new therapeutic options for such patients.

Also flagged:hematological malignanciesalloimmunizationanemiaHbdeathoxygen
Journal Article 2018-11-01 ✓ 1 Snippet Cserti-Gazdewich C.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

The transfusion support of hematological malignancies considers 2 dimensions: the quantity of what we order (in terms of triggers, doses, targets, and intervals), and the special qualities thereof (with respect to depths of matching and appropriate product modifications). Meanwhile, transfusion-related enhancements in the quantity and quality of life may not be dose dependent but rather tempered by unintended patient harms and system strains from overexposure. Evidence and guidelines concur in endorsing clinically noninferior conservative red blood cell (RBC) transfusion care strategies (eg, triggering at hemoglobin <7-8 g/dL and in single-unit doses for stable, nonbleeding inpatients). However, the unique subpopulation of patients with hematological malignancies who are increasingly managed on an outpatient basis, and striving at least as much for quality of life as quantity of life, is left on the edges of these recommendations, with more questions than answers. If a sufficiently specific future wave of evidence can satisfy the concerns (and contest the assumptions) of the remaining proponents of liberalism, and if conservatism is broadly adopted, savings may be potentially immense. These savings can then be reinvested to address other gaps and inconsistencies in RBC transfusion care, such as the best achievable degrees of prophylactic antigen matching that can minimize alloimmunization-related service delays and reactions.

Also flagged:mismatch repair-frizzled-related protein 4SFRP4mismatch repaircolorectal cancerscolon cancer
Journal Article 2018-11-01 No Snippets Chen K, Liang H, Peng J, Zheng Y.
Show Full Abstract

<h4>Objective</h4>To investigate the expressions of secreted frizzled-related protein 4 (SFRP4) in stage Ⅱ DNA mismatch repair-deficient (dMMR) and mismatch repair- proficient (pMMR) colorectal cancers and explore their clinical significance.<h4>Methods</h4>We collected fresh stage Ⅱ colon cancer tissues with different MMR status detected by immunohistochemistry (IHC). The differentially expressed mRNAs between dMMR and pMMR tumors were identified by Affymetrix Human oeLncRNA gene chip, and the expression of SFRP4 in these cancer tissues and in colorectal cancer cell lines were detected using Western blotting and real- time quantitative PCR. The apoptosis rates of HCT116 cells with and without siRNA- mediated transient SFRP4 knockdown were determined using flow cytometry. We further investigated the expression pattern of Ki-67 and its correlation with SFRP4 expression.<h4>Results</h4>Compared with pMMR colon cancer tissues or cells, both dMMR colon cancer tissues (<i>P</i>=0.014) and cells (<i>P</i>=0.0079) showed significantly increased expression of SFRP4, which was in negative correlation with Ki-67 (<i>P</i>=0.041). In HCT116 cells, transient SFRP4 knockdown resulted in decreased cell apoptosis, including both early apoptosis (<i>P</i>=0.003) and late apoptosis (<i>P</i>=0.024).<h4>Conclusions</h4>Up-regulation of SFRP4 in dMMR stage Ⅱ colon cancer promotes apoptosis and inhibits proliferation of the cancer cells, and may improve the prognosis of dMMR colon cancer.

Also flagged:gastro-esophageal malignancespathogenesisgastro-esophageal cancerscancernucleotidesgastroesophageal cancers
Journal Article 2018-11-01 No Snippets Fanelli GN, Gasparini P, Coati I, Cui R, Pakula H, Chowdhury B, Valeri N, Loupakis F, Kupcinskas J, Cappellesso R, Fassan M.
Show Full Abstract

Despite continuing improvements in multimodal therapies, gastro-esophageal malignances remain widely prevalent in the population and is characterized by poor overall and disease-free survival rates. Due to the lack of understanding about the pathogenesis and absence of reliable markers, gastro-esophageal cancers are associated with delayed diagnosis. The increasing understanding about cancer's molecular landscape in the recent years, offers the possibility of identifying 'targetable' molecular events and in particular facilitates novel treatment strategies and development of biomarkers for early stage diagnosis. At least 98% of our genome is actively transcribed into non-coding RNAs encompassing long non-coding RNAs (lncRNAs) constituted of transcripts longer than 200 nucleotides with no protein-coding capacity. Many studies have demonstrated that lncRNAs are functional genomic elements playing pivotal roles in main oncogenic processes. LncRNA can act at multiple levels developing a complex molecular network that can modulate directly or indirectly the expression of genes involved in tumorigenesis. In this review, we focus on lncRNAs as emerging players in gastro-esophageal carcinogenesis and critically assess their potential as reliable noninvasive biomarkers and in next generation targeted therapies.

Also flagged:colorectal cancergene expressiontumoralbuminALBcoagulation factor II
Journal Article 2018-11-01 ✓ 3 Snippets Zhang T, Guo J, Gu J, Wang Z, Wang G, Li H, Wang J.
In-Text Gene Mentions

…C member 1 (SERPINC1), apolipoprotein A1 (APOA1),…

…ALB, F2, APOH,SERPINC1, APOA1, AMBP, APOC3,…

…ALB, F2, APOH,SERPINC1, APOA1, APOC3, AMBP,…

Show Full Abstract

Colorectal cancer (CRC) is one of the principal causes of cancer‑associated mortality worldwide. The high incidence of liver metastasis is the leading risk factor of mortality in patients with CRC, and the mechanisms of CRC liver metastasis are poorly understood. In the present study, 7 datasets, including 3 gene expression profile datasets and 4 microRNA (miRNA) expression profile datasets were downloaded from the NCBI Gene Expression Omnibus (GEO) database to identify potential key genes and miRNAs, which may be candidate biomarkers for CRC liver metastasis. Differentially expressed (DE) genes (DEGs) and DE miRNAs of primary CRC tumor tissues and liver metastatic CRC tumor tissues were selected using the GEO2R tool. Gene Ontology and Kyoto Encyclopedia of Gene and Genome pathway enrichment analyses were conducted using the Database for Annotation, Visualization and Integrated Discovery online database. Furthermore, Cytoscape with cytoHubba and the Molecular Complex Detection (MCODE) plug‑in were used to visualize a protein‑protein interaction (PPI) network for these DEGs, and to screen hub genes and gene modules in the PPI network. In addition, the online databases, TargetScan, miRanda, PITA, miRWalk and miRDB, were used to identify the target genes of the DE miRNAs. In the present study, 141 DEGs (97 upregulated and 44 downregulated) and 3 DE miRNAs (2 upregulated and 1 downregulated) were screened from the 3 gene expression microarray datasets and 4 miRNA expression microarray datasets, respectively. In total, 10 hub genes with a high degree of connectivity were selected from the PPI network, including albumin (ALB), coagulation factor II (F2), thrombin, apolipoprotein H (APOH), serpin family C member 1 (SERPINC1), apolipoprotein A1 (APOA1), α‑1‑microglobulin/bikunin precursor (AMBP), apolipoprotein C3 (APOC3), plasminogen (PLG), α‑2 HS glycoprotein (AHSG) and apolipoprotein B (APOB). The most important module was detected in the PPI network using the MCODE plug‑in. A total of 20 DEGs were identified to be potential target genes of these DE miRNAs, and novel miRNA‑DEGs regulatory axes were constructed. In vitro experiments were performed to demonstrate that miR‑885 promoted CRC cell migration by, at least partially, decreasing the expression of von Willebrand factor (vWF) and insulin‑like growth factor binding protein 5 (IGFBP5). In conclusion, by using integrated bioinformatics analysis and in vitro experiments, key candidate genes were identified and novel miRNA‑mRNA regulatory axes in CRC liver metastasis were constructed, which may improve understanding of the molecular mechanisms underlying CRC liver metastasis.

Also flagged:PolymethylmethacrylateHydroxyapatitevertebral compression fracturecallus formationbone formationcalcium
Journal Article 2018-11-01 No Snippets Komang-Agung IS, Hydravianto L, Sindrawati O, William PS.
Show Full Abstract

<b>Introduction:</b> Percutaneous vertebroplasty (PV) is one of the available treatments for vertebral compression fracture (VCF). Polymethylmethacrylate (PMMA) is the most common bone substitute used in the procedure, but it has several disadvantages. Bioceramic material, such as hydroxyapatite (HA), has better biological activity compared to PMMA. The aim of this study was to find an optimal biomaterial compound which offers the best mechanical and biological properties to be used in PV. <b>Materials and Methods:</b> This was an experimental study with goat <i>(Capra aegagrus hircus)</i> as an animal model. The animals' vertebral columns were injected with PMMA-HA compound. Animal samples were divided into four groups, and each group received a different proportion of PMMA:HA compound. The mechanical and biological effects of the compound on the bone were then analysed. The mechanical effect was assessed by measuring the vertebral body's compressive strength. Meanwhile, the biological effect was assessed by analysing the callus formation in the vertebral body. <b>Results:</b> The optimal callus formation and compressive strength was observed in the group receiving PMMA:HA with a 1:2 ratio. <b>Conclusion:</b> A mixture of PMMA and HA increases the quality of callus formation and the material's compressive strength. The optimum ratio of PMMA:HA in the compound is 1:2.

Also flagged:nasopharyngeal carcinomadeathEBV) infectiontumorviral infectionangiogenesis
Journal Article 2018-11-01 ✓ 1 Snippet Zhao CX, Zhu W, Ba ZQ, Xu HJ, Liu WD, Zhu B, Wang L, Song YJ, Yuan S, Ren CP.
In-Text Gene Mentions

ZNFX1

Show Full Abstract

Metastasis of nasopharyngeal carcinoma (NPC) remains a main cause of death for NPC patients even though great advances have been made in therapeutic approaches. An in-depth study into the molecular mechanisms of NPC metastasis will help us combat NPC. Epstein-Barr virus (EBV) infection is an evident feature of nonkeratinizing NPC and is strongly associated with tumor metastasis. Recently, long noncoding RNAs (lncRNAs) and microRNAs (miRNAs) have become a hot topic of research due to their epigenetic regulatory roles in NPC metastasis. The EBV products, lncRNAs and miRNAs can target each other and share several common signaling pathways, which form an interconnected, complex molecular regulatory network. In this review, we discuss the features of this regulatory network and summarize the molecular mechanisms of NPC metastasis, focusing on EBV, lncRNAs and miRNAs with updated knowledge.

Also flagged:Extracellular vesicles-communicationtumormultidrug resistancecancer
Journal Article 2018-11-01 No Snippets Yousafzai NA, Wang H, Wang Z, Zhu Y, Zhu L, Jin H, Wang X.
Show Full Abstract

Extracellular vesicles (EVs), named as exosomes, were recently found to play important roles in cell-cell communication by transducing various biochemical and genetic information. Exosomes, secreted from either tumor cells or stromal cells including immune cells, can eventually remodel tumor environment to promote tumor progression such as metastasis and multidrug resistance (MDR). Therefore, the detection or targeting of biochemical and genetic cargos like proteins, lipids, metabolites and various types of RNAs or DNAs are believed to be valuable for the diagnosis and treatment of human cancer. In this review, we will summarize recent progresses in the research of exosomes especially its biological and clinical relevance to MDR. By doing so, we hope it could be valuable for the prevention, detection and intervention of MDR which is one of the major challenges for the clinical management of human cancers.

Also flagged:StrokeMyocardial InfarctionMIdeathCASfocal cerebral ischemia
Journal Article 2018-11-01 ✓ 1 Snippet Jones MR, Howard G, Roubin GS, Blackshear JL, Cohen DJ, Cutlip DE, Leimgruber PP, Rhodes D, Prineas RJ, Glasser SP, Lal BK, Voeks JH, Brott TG, CREST Investigators.
In-Text Gene Mentions

Type 1 Infarction

Show Full Abstract

<h4>Background</h4>The Carotid Revascularization Endarterectomy versus Stenting Trial (CREST) previously reported increased mortality in patients who sustained a periprocedural stroke or cardiac event (myocardial infarction [MI] or biomarker only) in follow-up to 4 years. We now extend these observations to 10 years.<h4>Methods and results</h4>CREST is a randomized controlled trial designed to compare the outcomes of carotid stenting versus carotid endarterectomy. Proportional hazards models were used to assess the association between mortality and periprocedural stroke, MI, or biomarker-only events. For 10-year follow-up, patients with periprocedural stroke were at 1.74× the risk of death compared with those without stroke (adjusted hazard ratio [HR]=1.74; 95% CI, 1.21-2.50; P<0.003). This increased risk was driven by increased early (between 0 and 90 days) mortality (adjusted HR=14.41; 95% CI, 5.33-38.94; P<0.0001), with no significant increase in late (between 91 days and 10 years) mortality (adjusted HR=1.40; 95% CI, 0.93-2.10; P=0.11). Patients with a protocol MI were at 3.61× increased risk of death compared with those without MI (adjusted HR=3.61; 95% CI, 2.28-5.73; P<0.0001), with an increased hazard both early (adjusted HR=8.20; 95% CI, 1.86-36.2; P=0.006) and late (adjusted HR=3.40; 95% CI, 2.09-5.53; P<0.0001). Patients with a biomarker-only event were at 2.04× increased risk overall (adjusted HR=2.04; 95% CI, 1.09-3.84; P=0.03) than those without MI, with an increased early hazard (adjusted HR=8.44; 95% CI, 1.09-65.5; P=0.04) and a suggestive but nonsignificant association toward higher 91-day to 10-year risk (1.88; 95% CI, 0.97-3.64; P=0.062) contributing to the increased risk.<h4>Conclusions</h4>In the CREST trial, patients with periprocedural events demonstrate a substantial increase in future mortality to 10 years. For stroke, this risk is largely confined to an early time frame while periprocedural MI or biomarker-only events confer a continuous increased mortality for 10 years. Strategies to reduce periprocedural events and to optimize the evaluation and management of patients with cardiac events should be considered in efforts to reduce not only early but also long-term mortality.<h4>Clinical trial registration</h4>URL: https://www.clinicaltrials.gov . Unique identifier: NCT00004732.

Also flagged:liver fibrosiscirrhosischronic liver diseasewound-healingextracellularcollagen
Journal Article 2018-11-01 ✓ 2 Snippets Shayesteh M, Shayesteh AA, Motamedfar A, Tahmasebi M, Bagheri S, Gharibvand MM.
In-Text Gene Mentions

…one patient hadhemochromatosis, one patient had…

…of metals inhemochromatosisand Wilson's disease…

Show Full Abstract

<h4>Background</h4>Fibrotic tissue forms following chronic inflammation in the liver, which may progress over time to cirrhosis. Liver biopsy is the gold standard for the diagnosis of liver fibrosis, and there has been a considerable interest in developing noninvasive methods.<h4>Objectives</h4>In the present study, we evaluated the efficacy of the apparent diffusion coefficient (ADC) of the liver in the diagnosis and staging of liver fibrosis.<h4>Patients and methods</h4>This case-control study was conducted on 40 patients with chronic liver disease and 31 healthy controls who were subjected to diffusion-weighted magnetic resonance imaging (MRI). Diagnostic values for different stages of fibrosis were determined using receiver-operating characteristic (ROC) curves based on the sensitivity and specificity.<h4>Results</h4>Of 37 patients in the case group, 12 were males (32.4%) and 25 (67.5%) were females, whereas in the control group of 31 patients, 11 were males (35.5%) and 20 (64.5%) were females. In the ROC analysis, area under the curve separating stage one or lower fibrosis from stage two or greater fibrosis groups with a <i>b</i>-value of 600 s/mm<sup>2</sup> was 0.893 (98% confidence interval (CI): 0.795-0.955), and that with a <i>b</i>-value of 1000 s/mm<sup>2</sup> was 0.946 (98% CI: 0.813-0.946).<h4>Conclusion</h4>Our results are in line with the previous studies, which showed that liver ADC values could be considered as a method for the diagnosis and staging of liver fibrosis.

Also flagged:HDendocytosischoreabehavioraldeathwater
Journal Article 2018-11-01 No Snippets Naze S, Humble J, Zheng P, Barton S, Rangel-Barajas C, Rebec GV, Kozloski JR.
Show Full Abstract

Abnormal gamma band power across cortex and striatum is an important phenotype of Huntington's disease (HD) in both patients and animal models, but neither the origin nor the functional relevance of this phenotype is well understood. Here, we analyzed local field potential (LFP) activity in freely behaving, symptomatic R6/2 and Q175 mouse models and corresponding wild-type (WT) controls. We focused on periods of quiet rest, which show strong γ activity in HD mice. Simultaneous recording from motor cortex and its target area in dorsal striatum in the R6/2 model revealed exaggerated functional coupling over that observed in WT between the phase of delta frequencies (1-4 Hz) in cortex and striatum and striatal amplitude modulation of low γ frequencies (25-55 Hz; i.e., phase-amplitude coupling, PAC), but no evidence that abnormal cortical activity alone can account for the increase in striatal γ power. Both HD mouse models had stronger coupling of γ amplitude to δ phase and more unimodal phase distributions than their WT counterparts. To assess the possible role of striatal fast-spiking interneurons (FSIs) in these phenomena, we developed a computational model based on additional striatal recordings from Q175 mice. Changes in peak γ frequency and power ratio were readily reproduced by our computational model, accounting for several experimental findings reported in the literature. Our results suggest that HD is characterized by both a reorganization of cortico-striatal drive and specific population changes related to intrastriatal synaptic coupling.

Also flagged:CLBPCCPsynthesis
Journal Article 2018-11-01 No Snippets Coulter ID, Herman PM, Ryan GW, Hays RD, Hilton LG, Whitley MD.
Show Full Abstract

<h4>Objectives</h4>The purpose of this article is to report on the Center of Excellence for Research on Complementary and Alternative Medicine at RAND Corporation. The overall project examined the appropriateness of chiropractic spinal manipulation and mobilization for chronic low back pain and chronic cervical pain using the RAND and University of California Los Angeles Appropriateness Method, including patient preferences and costs, to acknowledge the importance of patient-centered care in clinical decision-making.<h4>Methods</h4>This article is a narrative summary of the overall project and its inter-related components (ie, 4 Research Project Grants and 2 centers), including the Data Collection Core, whose activities and learning will be the subject of a following series of methods articles.<h4>Results</h4>The project team faced many challenges in accomplishing data collection goals. The processes we developed to overcome barriers may be of use to other researchers and for practitioners who may want to participate in such studies in complementary and integrative health, which previously was known as complementary and alternative medicine.<h4>Conclusion</h4>For this large, complex, successful project, we gathered online survey data, collected charts, and abstracted chart data from thousands of chiropractic patients. The present article delineates the challenges and lessons that were learned during this project so that others may gain from the authors' experience. This information may be of use to future research that collects data from independent practitioners and their patients because it provides what is needed to be successful in such studies and may encourage participation.

Also flagged:Synthesesglycosaminoglycansextracellular regulatory proteinscell growthtissue homeostasisbinding
Journal Article 2018-11-01 ✓ 1 Snippet Köhling S, Blaszkiewicz J, Ruiz-Gómez G, Fernández-Bachiller MI, Lemmnitzer K, Panitz N, Beck-Sickinger AG, Schiller J, Pisabarro MT, Rademann J.
In-Text Gene Mentions

…blood coagulation inhibitorantithrombine-III(AT-III) 23 were…

Show Full Abstract

Binding of sulfated glycosaminoglycans (GAG) to a wide spectrum of extracellular regulatory proteins is crucial for physiological processes such as cell growth, migration, tissue homeostasis and repair. Thus, GAG derivatives exhibit great relevance in the development of innovative biomaterials for tissue regeneration therapies. We present a synthetic strategy for the preparation of libraries of defined sulfated oligohyaluronans as model GAG systematically varied in length, sulfation pattern and anomeric substitution in order to elucidate the effects of these parameters on GAG recognition by regulatory proteins. Through an experimental and computational approach using fluorescence polarization, ITC, docking and molecular dynamics simulations we investigate the binding of these functionalized GAG derivatives to ten representative regulatory proteins including IL-8, IL-10, BMP-2, sclerostin, TIMP-3, CXCL-12, TGF-β, FGF-1, FGF-2, and AT-III, and we establish structure-activity relationships for GAG recognition. Binding is mainly driven by enthalpy with only minor entropic contributions. In several cases binding is determined by GAG length, and in all cases by the position and number of sulfates. Affinities strongly depend on the anomeric modification of the GAG. Highest binding affinities are effected by anomeric functionalization with large fluorophores and by GAG dimerization. Our experimental and theoretical results suggest that the diversity of GAG binding sites and modes is responsible for the observed high affinities and other binding features. The presented new insights into GAG-protein recognition will be of relevance to guide the design of GAG derivatives with customized functions for the engineering of new biomaterials.

Also flagged:solanesol3-nitropropionic acidHuntington's diseasebehavioralcoenzyme-Q10HD
Journal Article 2018-11-01 ✓ 1 Snippet Mehan S, Monga V, Rani M, Dudi R, Ghimire K.
In-Text Gene Mentions

…interaction of mutantHttwith mitochondria (…

Show Full Abstract

<h4>Objective</h4>The aim of the present study was to evaluate the solanesol (SNL)-mediated coenzyme-Q10 restoration to ameliorate 3-nitropropionic (3-NP)-induced behavioral, biochemical, and histological changes which resemble Huntington's disease (HD)-like symptoms in men.<h4>Materials and methods</h4>Various behavioral and biochemical parameters were carried out to evaluate the activity of SNL on 3-NP-treated rats. To determine the therapeutic significance of SNL on HD, different behavioral tests such as memory task, locomotor activity, grip strength, and beam cross and some biochemical test along with histopathological findings were done.<h4>Results</h4>Chronic 3-NP, 10 mg/kg i.p., caused physical and mental abnormalities in animals, including memory impairment, weak grip strength, abnormal posture, and cognitive deficit. Biochemical analysis of brain homogenate in 3-NP-treated rats showed altered mitochondrial complexes, oxidative stress, and elevated lipid biomarkers. Neurohistological alterations of hippocampus, basal ganglia, and cerebral cortex of 3-NP-treated rats exhibit severe neuronal space, irregular damaged cells, and dense pyknotic nuclei-associated marked focal diffused gliosis. SNL administered for 15 days significantly improved motor performance and cognitive behavior task and restored the histopathological changes. Further, SNL treatment significantly improved mitochondrial complexes such as coenzyme-Q10 enzyme activity and attenuated inflammatory and oxidative damage of rat brain.<h4>Conclusion</h4>In the present research work, SNL (5, 10, and 15 mg/kg p.o.) provided notable neuroprotective effect, which was confirmed by behavioral paradigms and biochemical test. It restored the behavioral and biochemical alteration caused by 3-NP and confirmed the strong neuroprotective mechanism of SNL in 3-NP-intoxicated memory and cognitive abnormalities.

Also flagged:histidinestearic acidSABSPimidazoleDoxorubicin
Journal Article 2018-11-01 No Snippets Zhu J, Guo X, Guo T, Yang Y, Cui X, Pan J, Qu Y, Wang C.
Show Full Abstract

In this investigation, innovative pH-sensitive and amphiphilic nanoparticles (NPs) were synthesized by grafting histidine (His, pH sensitive molecule) and stearic acid (SA, hydrophobic segment) onto the polysaccharides of <i>Bletilla striata</i> (BSP). The His-SA-BSP was able to self-assemble into NPs with pH sensitivity. The acidic conditions could trigger the imidazole ionization and reverse the surface charge, while the electrostatic repulsion wrecked the structure and drove the NPs to a swollen state, as revealed by dynamic light scattering (DLS), transmission electron microscopy (TEM), and critical micelle concentration (CMC) analyses. By increasing the degree of substitution (DS) of His, the NPs showed improved pH sensitivity. The NPs could accelerate Doxorubicin (Dox) release to a remarkably greater extent (3-fold) at pH 5 than at pH 7.4. The CCK-8 assay demonstrated a good biocompatibility of the NPs towards different cell lines and a specific inhibition effect of Dox-loaded NPs against tumor cells. Furthermore, the NPs showed the improved cellular uptake of Dox towards MCF-7 by fluorescence microscopy and flow cytometry. Therefore, the new His-SA-BSP showed potential applications in drug nanocarrier systems.

Also flagged:tumorstumorcheckpointcancerGBbrain tumors
Journal Article 2018-11-01 No Snippets Le Moan N, Davis T, Leung P, Ng S, Winger J, Cary S, Butowski N, Krtolica A.
Show Full Abstract

Abstract <h4>BACKGROUND</h4> Intratumoral hypoxia is associated with resistance to chemo- and radio-therapies and poor patient outcomes. In addition, hypoxia promotes the immune escape of tumors by altering the recruitment and function of innate and adaptive immune effector and suppressor cells. Therefore, reversing tumor hypoxia to create an immunopermissive microenvironment may improve anti-tumor response, and combined with immunotherapy approaches such as checkpoint inhibitors (CPI) may increase therapeutic efficacy. OMX, an anti-cancer therapy designed to reverse tumor hypoxia, efficiently accumulates in orthotopic rodent GB and spontaneous canine brain tumors, reduces tumor hypoxia and enhances immunotherapeutic efficacy. <h4>METHODS</h4> We used in vivo bioluminescence imaging of tumor, immunohistochemistry, flow cytometry, and cytokine multiplex assays to evaluate OMX’s ability to immunosensitize the GL261 brain tumor microenvironment and promote tumor cures. <h4>RESULTS</h4> Following intravenous administration in brain tumor-bearing mice, OMX reduces tumor hypoxia, modulates the IFNg signaling pathway, enhances the infiltration of tumor-specific CX3CR1+ CD8 T cells into the tumor (using the EphA2 as a GL261-specific tumor antigen), increases the activation of cytotoxic T lymphocytes (CTLs), decreases Tim3 and Lag3 exhaustion markers on CD8 T cells, and reduces the number of immunosuppressive cells such as MDSCs and Tregs in the tumor. Similar immunological changes are observed when OMX is combined with anti-PD-1. In late-stage tumor-bearing mice, we observed a 40% tumor cure rate for the combination of OMX with anti-PD-1, while anti-PD-1 alone resulted only in 5% tumor cures. Following rechallenge with GL261 tumor cells injected on the other side of the brain, all mice treated with the combination of OMX with anti-PD-1 survived, indicating the presence of long-term immunological memory against glioma cells. <h4>CONCLUSION</h4> By delivering oxygen specifically to the hypoxic tumor microenvironment, OMX may restore anti-cancer immune responses in GB patients and synergize with radiotherapy and immunotherapy to enhance tumor control and improve patient outcomes.

Also flagged:PI3KAKTYKL-40Glioblastoma multiformeGBMbrain tumor
Journal Article 2018-11-01 No Snippets Chen A, Sharma V, Wang Q, Agnihotri S, Kohanbash G, Wang Y, Pollack I, DePinho R, Hu B.
Show Full Abstract

Abstract Glioblastoma multiforme (GBM), the most common and deadliest brain tumor with a median survival of 12–15 months, has been characterized by robust angiogenesis, high invasiveness, and universal recurrence. Genomics and transcriptomics studies defined three GBM subtypes (proneuronal, classical, mesenchymal), which are associated with genomic abnormalities, treatment response, and diversity in tumor microenvironment. However, molecular mechanisms of subtype-specific genotype in contribution to tumor phenotype are less understood. We have previously generated a de novo human GBM model by inactivation of p53 and activation of AKT signaling pathways in human neural stem/progenitor cells (hNSCs). Further characterization of this model indicates that the tumors recapitulate GBM’s classical histopathogical features and exhibit a molecular profile resembling the mesenchymal subtype. Comparative transcriptomic analysis revealed that YKL-40/CHI3L1, a secreted glycoprotein, is significantly upregulated during AKT activation induced malignant transformation of hNSCs in vitro and in vivo. Pharmacological inhibition of PI3K/AKT/mTOR signaling pathway results in decreasing YKL-40 mRNA expression and protein secretion level. Mechanistically, motif enrichment analysis and functional validation revealed that YKL-40 is bidirectionally regulated by a gene regulatory network with two transcription factors, BACH2 and CEBPB. Furthermore, YKL-40 significantly activates AKT-S6 and MAPK-ERK kinase signaling pathways, resulting in enhancing tumor cells proliferation, neurosphere and soft-agar colony formation, and tumor progression. In vivo silencing YKL-40 attenuates tumor angiogenesis and prolongs animal survival in the orthotopic xenograft mouse models. Interestingly, knocking down YKL-40 expression decreases microglia/macrophages infiltration in tumor mass. Both in vitro and in vivo validation indicate that PI3K/AKT/YKL-40 mediates tumor-associated microglia/macrophages recruitment and activation during tumor progression. Taken together, these results suggest that auto- and paracrine signaling of PI3K/AKT/YKL-40 affect tumor cells and tumor microenvironment contributing to glioblastoma progression, indicating YKL-40 as a predictive biomarker for evaluation of anti- PI3K/AKT/mTOR therapy, and a potential drug target for the treatment of this devastating disease.

Also flagged:HDAC1GlioblastomaGBMbrain cancertumorcancers
Journal Article 2018-11-01 No Snippets Yu H, Pavlyukov M, Minata M, Zhang S, Bastola S, Markert J, Bhat K, Wang M, Nakano I.
Show Full Abstract

Abstract Glioblastoma (GBM) is a malignant primary brain cancer without cure, due to the edge infiltrating tumor cells and non-complete resection. Although intratumoral heterogeneity is recognized in various cancers including GBM, its spatial distribution and intercellular crosstalk remain poorly understood. Previously, we identified two mutually exclusive glioma stem-like cells (GSCs) subtypes in GBM, termed mesenchymal (MES) and non-MES GSCs. Here, we tested the hypothesis that non-MES and MES GSCs have inter-cellular crosstalk to promote GBM aggressiveness and heterogeneity. We found that MES GSCs are preferentially located in the tumor core region, while non-MES GSCs subside in the tumor edge. Co-culture with MES GSC-containing cultures (glioma spheres) promoted both in vitro growth and in vivo tumorigenicity of non-MES ones. By a high throughput screening, several HDAC inhibitors selectively eliminated MES glioma spheres, while preserving non-MES glioma spheres. Among the HDAC family, HDAC1 is upregulated in GBM and associated with unfavorable outcome. Knockdown of HDAC1 blocked the intercellular pro-tumorigenic signal from MES glioma spheres to the non-MES counterparts. Mechanistically, CD109 is secreted from MES glioma spheres, thereby contributing intercellular pro-tumorigenic signals from MES to non-MES spheres. By RNA sequence, we found that HDAC1 regulates transcriptional activity of CD109 via binding to the promoter of CD109 together with the MES-specific transcription factor C/EBPb. To validate the intercellular signals in a single tumor, we established 6 clones of spheres from both tumor core and edge derived from the same GBM patient. The core lines contained those with higher resistance to irradiation (IR) treatment in comparison to the edge-derived counterparts. Furthermore, the core glioma spheres that showed higher MES signature promoted the growth and transformation of the non-MES like edge-derived glioma spheres both in vitro and in vivo. Collectively, our data identified HDAC1-CD109 dependent intercellular crosstalk from core like MES GCSs to edge like non-MES GSCs.

Also flagged:tumortumorsNF2PD-1PD-L1FOX-P3
Journal Article 2018-11-01 No Snippets Suppiah S, Karimi S, Mamatjan Y, Nassiri F, Aldape K, Zadeh G.
Show Full Abstract

Abstract <h4>INTRODUCTION</h4> Radiation-induced meningiomas (RIMS) are more clinically aggressive than their sporadic counterparts, with higher rates of tumor recurrence, multiplicity and neurological impairment. Our laboratory has previously demonstrated that RIMs have a distinct genomic profile with a subset of tumors harboring NF2 inactivation through genomic rearrangements. In this study we establish the clinical characteristics and immune microenvironment between RIMs with and without the NF2 alterations. <h4>METHODS</h4> A retrospective chart review was performed on 31 RIMs. Volumetric analysis was performed using ITK-SNAP on serial preoperative imaging to estimate tumor growth rate. Immunohistochemistry staining for PD-1, PD-L1, CD-3, CD-163, and FOX-P3 were performed. Results were correlated with whole exome sequencing and RNA sequencing data previously published. Pathway analysis was performed using Gene Set Enrichment Analysis (GSEA) on RNA sequencing data using the differentially expressed genes. <h4>RESULTS</h4> Clinically, NF2-altered tumors and NF2-WT (wildtype) tumors did not differ based on age at diagnosis, indication for previous radiation, WHO grade, histopathological subtype, extent of resection and tumor location. NF2-altered tumors had a significantly faster growth rate compared to NF2-WT tumors (3.8X faster, p>0.05). The difference in growth rate was independent of tumor grade. PD-L1 staining was negative on tumor cells in NF2-altered tumors and patchy positivity in 60% of NF2-WT tumors (p < 0.05). In contrast, 100% and 60% of tumors had PD-L1 positive immune cells in NF2-altered and NF2-WT tumors, respectively (p<0.05). The degree of CD3+ lymphocyte infiltration was lower in NF2-altered tumors (t=2.73, p<0.05). <h4>CONCLUSIONS</h4> Our findings suggest that there is a difference in the immune microenvironment between NF2-altered and NF2-WT RIMs. NF2-altered tumors have a lower degree of CD3+ lymphocyte infiltration and higher frequency of PD-L1 positive immune cells that are indicative of an immunosuppressed microenvironment. Further work is needed to elucidate pathways that may be targeted to manipulate the immune microenvironment.

Also flagged:GlioblastomaGBMtumorcancerExtracellular Vesiclesiron
Journal Article 2018-11-01 ✓ 5 Snippets Nesterova D, Mrowczynski O, Slagle-Webb B, Madhankumar A, Zacharia B, Nixon A, Connor J.
In-Text Gene Mentions

…TheHFEmutation is associated…

…lab showed thatHFEmutation confers phenotypic…

…phenotypic differences betweenHFEand wild-type (WT)…

…(WT) macrophages, withHFEmacrophages displaying increas…

…of WT andHFEmutant knock-in mice…

Show Full Abstract

Abstract In Glioblastoma (GBM), the tumor microenvironment is critical to cancer development and progression. Glioblastoma Extracellular Vesicles (GBM-EVs) have been shown to promote a tumor-supporting phenotype in macrophages, leading to surrounding immunosuppression and enhanced tumor growth. Microglia and macrophages contribute to iron homeostasis, essential for cellular energy production in rapidly dividing cells. The HFE mutation is associated with altered cellular iron homeostasis. It is the most common autosomal recessive polymorphism found in Caucasians and may be linked to worse patient prognosis in GBM. Our lab showed that HFE mutation confers phenotypic differences between HFE and wild-type (WT) macrophages, with HFE macrophages displaying increased migration and phagocytosis. How these phenotypic differences may present in response to GBM exosomes has not yet been explored. Primary macrophage cultures isolated from bone marrow of WT and HFE mutant knock-in mice were exposed to exosomes from different patient-derived cancer stem cells. Significant differences in macrophage viability 24 hours after exosome exposure were observed in response to GBM exosomes (p= 0.001). When exposed to GBM exosomes, WT macrophage viability consistently decreased while the viability of macrophages with the HFE mutation increased. There was no significant difference between the two genotype macrophage groups when exposed to U87 exosomes, supporting that the stem cells are modulating macrophage phenotype. These data suggest that genotypic differences in iron handling pay a critical role in macrophage response to GBM exosomes and may be responsible for differences seen in disease severity in patients with HFE mutations.

Also flagged:ICAM-1VCAM-1MCP-1Glioblastoma MultiformeGBMbrain
Journal Article 2018-11-01 No Snippets Macapagal J, Park T, Joret M, Rustenhoven J, Dieriks B, Faull R, Schweder P, Dragunow M.
Show Full Abstract

Abstract Glioblastoma Multiforme (GBM) is the most aggressive, fatal, yet most common form of brain malignancy in adults. Despite advances in immune-based treatments for other modes of cancer, GBM remains a challenge due to its ability to dampen immune responses via mechanisms not yet fully understood. With a median survival time of only 15 months following diagnosis, there is a strong push to find new targets for therapy. An emerging aspect of GBM’s pathogenesis is the idea of the tumour’s immunosuppressive microenvironment which comprises a mixture of malignant tumour cells, stroma, blood vessels and infiltrating inflammatory cells. These cells can alter their phenotypes to express less pro-inflammatory and more anti-inflammatory mediators. Despite advances in understanding the contribution of these cells in establishing an anti-inflammatory microenvironment, the contribution of pericytes, an important neurovascular mural cell that forms the blood-brain barrier, has been inadequately studied. Therefore, we investigated the changes in immune responses between the non-neoplastic brain and GBM-derived pericytes isolated directly from the same patient’s tissues obtained during neurosurgery. Our results show that cellular responses to pro-inflammatory stimuli such as Interleukin 1 beta (IL-1ß) were dampened in GBM-derived pericytes when compared to pericytes isolated from non-neoplastic brain tissue from the same patient. More specifically, GBM-derived pericytes showed lower induction of pro-inflammatory molecules, Intracellular Adhesion Molecule 1 (ICAM-1), Vascular Cell Adhesion Molecule (VCAM-1), and Monocyte Chemoattractant Protein 1 (MCP-1) when compared to normal brain pericytes. Due to the involvement of these molecules in immune cell recruitment and infiltration, this decreased response may contribute to the maintenance of GBM microenvironment immunosuppression. This highlights potential targets for alleviating such immunosuppression, which could enhance the success of immunotherapy-based treatments for GBM.

Also flagged:brain tumorstumorextracellulargliomatumorsNestin
Journal Article 2018-11-01 No Snippets Kingsmore K, Stine C, Cornelison R, Abler D, Rockne R, Munson J.
Show Full Abstract

Abstract Interstitial fluid flow around brain tumors is increased above normal levels. This force has been shown to drive tumor cell invasion in brain tumors and alter the extracellular matrix, vasculature, immune and cellular niches in non-nervous tissues in ways that promote tumor progression [1]. Here, by applying our dynamic contrast enhanced MRI method and analysis [2], we measured interstitial fluid flow in multiple patient cell line-derived xenograft models of glioma in mice (n=6–8 per group, four different lines). The range of interstitial velocity magnitudes is similar across these models (range from 0.1–2.6 micron/s), though intratumoral variability is high. We examined tumors by immunohistochemistry including tumor cells (proliferating cells, ki67; stem-like cells, Nestin and Sox2; apoptotic cells, Caspase 3/7), the cellular microenvironment (astrocytes, GFAP and GLAST; microglia/macrophages, Iba-1 and CX3CR1; blood vessels, CD31; neurons, NeuN and Neurofilament; oligodendrocytes, OSP1), and of the extracellular space (hyaluronan, HABP; tenascin C; white matter tracts, fluoromyelin; cytokines). Fluid flow pathways and rates are dictated by anatomical features of the brain in these models (i.e. blood vessels and white matter tracts). Blood vessel density did not significantly correlate with regions of higher velocities. Based on our observations we performed in vitro experiments in a 3D tissue engineered model of the glioma microenvironment [3] to assess invasion within the range of measured flow rates. Velocities were controlled using either microfluidic pump driven flow or pressure driven flow and cellular outcomes were assessed using flow cytometry and immunocytochemistry of the 3D gel system. The results of these studies will be discussed. 1) Munson, Shieh, Cancer Management Research (2014) 6: 317; 2) Kingsmore, Vaccari, Abler, et al. APL Bioengineering (In press); 3) Harris, Yuan, Munson, Methods (2018) 134:20–31.

Also flagged:Brain metastasesbrain tumorslung tumorgliomaCD133Sox2
Journal Article 2018-11-01 No Snippets Cazacu S, Jiang W, Xiang C, Hammoud Z, Scarpace L, Kalkanis S, Brodie C.
Show Full Abstract

Abstract Brain metastases are the most common secondary brain tumors in adults. Despite their high frequency and patient poor prognosis, very little research has been performed on lung tumor brain metastases, mainly due to the lack of appropriate experimental models. In this study, we isolated cancer stem cells (CSCs) from fresh specimens of lung tumor brain metastases. The CSCs were analyzed for sphere formation and limiting dilution analyses, stemness markers, ability to generate xenografts and for their interaction with microglia cells. We found that CSCs derived from brain metastases had a high sphere forming capacity and self-renewal ability comparable to that of glioma stem cells. The CSCs expressed the stemness markers, CD133, Sox2, Klf4, Aldh2a, CD44 and the lung tumor markers, cytokeratin 7, and CD166. Transplantation of the CSCs or organoids generated from the brain metastases formed xenografts that recapitulated the parental tumors. These xenografts were infiltrated by a large number of amoeboid microglia that expressed high levels of M2 markers. Using co-culture experiments, we further found that CSCs derived from brain metastasis induced the polarization of microglia to the M2 phenotype via secreted exosomes. Similarly, M2 micrglia cells increased the self-renewal and stemness of the CSCs. RNA seq analysis identified specific miRNAs and lncRNAs that were associated with the CSC-microglia interactions. Using specific reporters, antagomiRs and CRISPR/Cas9 we demonstrated that miR-21, miR-1246 and the lncRNA TALNEC2 played a major role in the M2 polarization of microglia cells both in vitro and in vivo. In conclusion, we generated CSCs and organoids from lung tumor-derived brain metastases and identified potential therapeutic targets for these tumors. The established CSCs can serve as valuable in vitro and in vivo models for analyzing mechanisms involved in brain metastasis, for studying the tumor-microenvironment interactions and for personalized high throughput screening of new and repurposed drugs.

Also flagged:gliomacancermethylationtumorgliomasIdh1
Journal Article 2018-11-01 No Snippets Amin S, Boudreau B, Martinez-Ledesma J, Anderson K, Kim H, Johnson K, Dickinson P, Packer R, Taylor A, Rossmeisl J, Heimberger A, Levine J, Verhaak R.
Show Full Abstract

Abstract Sporadic glioma occurs in companion dogs at frequencies comparable to humans. Genomic characterization of canine glioma has a distinct merit, in that age distribution at the time of diagnosis implies a pediatric disease while the animals are in the adult stage of life. This creates an opportunity to compare relative timing of driver events to that of human glioma, and to evaluate the importance of host context in the presence of driver alterations. Second, breed-specific elevated cancer risk enables increased sensitivity to the characterization of evolutionary conserved mammalian mutational processes in gliomagenesis. We performed whole genome, exome, transcriptome and methylation sequencing on 188 canine tumor and germline samples. As in human adult gliomas, we found frequently occurring alterations in Tp53 pathway, cell cycle pathway (Cdk4, Cdkn2a), and receptor tyrosine kinases (Egfr, Pdgfrα) in canine glioma. Common R132 mutations in the Idh1 gene reflected a remarkable and species-agnostic but cancer-specific driving effect. Frequent whole chromosome gains were observed in syntenic regions of chromosome 13, harboring Pdgfrα and Myc, but we found notable absence of 1p/19q co-deletion and Tert promoter mutations. We calculate mutational processes and highlight ones related to DNA damage repair and transcriptional strand bias in both species. We also estimate mutational rate and relative timing of mutations, and compare those to human glioma in mapping life history of glioma, i.e., are canine glioma more similar to adult or pediatric human glioma? We found coding mutation rate on the lower end of human adult glioma cases but with a broader spectrum (0.3–3 per MB), while subset of cases having mutations found in human pediatric cancer drivers, e.g., Kmt2c, Setd2, Bcor. In bringing together a large canine glioma genomic sequencing dataset and comparing to human glioma, our study provides unique insights into glioma etiology and the chronology of glioma-causing somatic alterations.

Also flagged:IronglioblastomaGBMbrain tumorstumorstumor
Journal Article 2018-11-01 ✓ 5 Snippets Nesterova D, Lee S, Stetson L, Lathia J, Rubin J, Waite K, Berens M, Connor J.
In-Text Gene Mentions

…TheHFEprotein is critical…

…the impact ofHFEexpression in glioblastoma…

…high expression ofHFEwas associated with…

…patients with highHFEexpression survival was…

…compared to lowHFEexpression.…

Show Full Abstract

Abstract Iron homeostasis is essential for cellular energy production particularly in rapidly dividing cells. The HFE protein is critical for regulating cellular iron uptake. To explore the impact of HFE expression in glioblastoma (GBM) and other brain tumors, we utilized TCGA GBM and GBMLGG databases from GlioVis. Within the GBMLGG database which includes lower grade tumors, high expression of HFE was associated with significantly poorer survival. In GBM patients with high HFE expression survival was also significantly worse compared to low HFE expression. There was a strong positive correlation between high HFE expression and tumor grade, with the highest expression in GBM. HFE expression was also correlated to GBM subtype. The lowest expression was in the proneural subtype and the highest in the mesenchymal subtype consistent again with high expression associated with worse prognosis. Normally MGMT methylation is associated with better outcome. However, when combined with high HFE expression there is a significant reduction in survival time (12.9 vs. 20.8 months). To identify the possible molecular basis for these survival differences, we interrogated the reverse phase protein array data (RPPA) for TCGA datasets and discovered a correlation between high HFE expression and expression of a number of proteins. Annexin-1 has the highest correlation of expression with HFE. This protein plays a critical role in innate immune response through the generation of proinflammatory mediators and modulates migration and the phagocytotic ability of neutrophils and macrophages. We have previously shown that mutations in the HFE protein alter macrophage phenotype. Mutations in the HFE gene, the most common autosomal recessive polymorphism found in Caucasians, reportedly impacts the progression of a number of diseases including GBMs. This study identifies HFE as a negative modulator of outcome in brain tumors.

Also flagged:GBMTGFβglioblastomaIDHstrand breakMGMT
Journal Article 2018-11-01 No Snippets Barcellos-Hoff M, Guix I, Moore J, Pujana M, Palomero L, Liu Q.
Show Full Abstract

Abstract Transforming growth factor β (TGFβ), which is distinctively overexpressed in glioblastoma (GBM) while undetectable in normal brain tissue, could underlie GBM intrinsic radioresistance by endorsing effective DNA damage responses. We showed that most (5/7) primary GBM explants respond to TGFβ and are radiosensitized by TGFβ inhibition, but a few were unresponsive in both assays (Neoplasia 18:795–805). To further examine the link between TGFβ and the DNA damage response we used microarray transcriptomes from 369 IDH wild-type GBM patients from The Cancer Genome Atlas Consortium (TCGA). Surprisingly, our study unveiled a very strong inverse correlation (Pearson’s correlation coefficient, PCC=-0.80; p<0.00001) between the single specimen gene set enrichment analysis (ssGSEA) using a signature for chronic TGFβ activity and one of alternative end-joining (alt-EJ), a backup pathway for DNA double-strand break repair that is error-prone and less effective. Notably, patients with the low TGFβ/high Alt-EJ profile exhibited significantly better progression-free survival (p<0.003) and overall survival (p<0.02). The same negative correlation of the TGFβ/Alt-EJ signature was evident in the GBM RNASeq TCGA data (PCC = -0.88, p<0.00001), which also showed that there was no correlation between TGFβ/alt-EJ and MGMT methylation status ssGSEA (p=0.8). These analyses are consistent with our hypothesis that high TGFβ in GBM opposes response to therapy and indicate that treatment with TGFβ inhibitors could potentially boost GBM therapeutic control. Moreover, since Alt-EJ depends on poly(ADP-ribose)polymerase 1 (PARP1), these data also suggest a novel mechanism by which to select patients that will be responsive to PARP inhibitors.

Also flagged:chromatinRNA polymeraseglioblastomaGBMtumorstranscription factor
Journal Article 2018-11-01 No Snippets Chu T, Rice E, Salamanca H, Wang Z, Longo S, Sweeney J, Verhave B, Bodman A, Corona R, Viapiano M, Chin L, Danko C.
Show Full Abstract

Abstract The human genome encodes a variety of poorly understood RNA species that play important roles in the etiology complex disease yet remain challenging to identify in clinical isolates. We recently developed chromatin run-on and sequencing (ChRO-seq), a novel technology that maps the location of RNA polymerase genome-wide using virtually any frozen tissue sample, including samples with degraded RNA that are intractable to conventional RNA-seq. Here we report an integrative analysis of ChRO-seq maps from 61 primary human glioblastoma (GBM) tumors with matching clinical data, obtained from a retrospective cohort of patients banked at SUNY Upstate Medical Center (Syracuse, NY) between 1987 and 2007 (characteristics: Male:Female ratio= 2:1; median age at diagnosis= 59 years; median KPS=80; median overall survival= 343 days). Using ChRO-seq we discovered the boundaries and expression levels of annotated and unknown genes, lincRNAs, and active distal enhancers. Surprisingly, active enhancers in primary GBMs closely resembled the patterns found in the normal human brain, suggesting that malignant GBM tissue remains similar to the cell of origin. Despite extensive overall similarity, approximately 12% of enhancers were unique to GBMs. These enhancers drive regulatory programs similar to those in the developing nervous system and are enriched for transcription factor binding sites that specify a stem-like cell fate. More importantly, we discovered a core group of immune-related transcription factors and their associated binding sites whose activity is highly predictive of clinical outcomes in primary GBMs (HR= 2.66; p = 3.8e-4). Finally, we used the characteristic signatures of cell-type-specific enhancer activation to deconvolve the proportion of immune cell types infiltrating each tumor. Our study uncovers new insights into the molecular etiology of GBM and introduces ChRO-seq as a useful approach to map regulatory programs contributing to complex and heterogeneous diseases.

Also flagged:agingmetabolismkynureninetryptophanIL-6IFNγ
Journal Article 2018-11-01 No Snippets Westbrook R, Le A, Lovett J, Khadeer M, Ferrucci L, Moaddel R, Walston J, Abadir P.
Show Full Abstract

Abstract Frailty is a syndrome of accelerated aging-related multisystemic decline that affects a subset of the most vulnerable older adults. While changes in metabolism have been implicated in development of frailty, comprehensive analyses of metabolic products that differentiate frail from resilient individuals and correlate with physical decline have not been investigated. We used LC/MS technology to profile 141 metabolites in a set of community-dwelling (age 20–97, N=120) individuals. After adjusting for age, the kynurenine/tryptophan ratio was the top metabolomic risk factor for frailty status, the top predictor of walking speed, IL-6, TNFαR1 and IFNγ levels. Increased kynurenine/tryptophan ratio was associated with weaker grip strength. Further dissection of the pathway revealed the accumulation of several kynurenine pathway intermediates with aging and frailty, including increased cytotoxic and neurotoxic 3-hydroxykynurenine, in frail patients compared to young. These discoveries may in part explain the link between inflammation and cognitive and physical decline in frailty.

Also flagged:Sarcopeniainsulinobesity
Journal Article 2018-11-01 No Snippets Pilling L, Melzer D.
Show Full Abstract

Abstract Sarcopenia is a core feature of frailty. We aimed to identify genetic variants associated with sarcopenia, to shed light on the underlying mechanisms. In 200,000 UK Biobank participants of European descent aged 60–70 years approximately 9% were identified as sarcopenic; i.e. having both low grip strength and muscle mass (European Working Group definition). Six loci were associated with sarcopenia at genome wide significance (p<5x10-8), some previously identified with traits such as fasting insulin levels and obesity. Over 100 independent signals were associated with low lean mass, where only seven were identified for low grip strength. Our results suggest that there are different pathways to low strength and low mass. When analyzing men and women separately, we observed differences in associated loci, suggesting sex-specific routes to sarcopenia.

Also flagged:Irongenetic disordersarcopeniafrailty
Journal Article 2018-11-01 ✓ 1 Snippet Melzer D, Pilling L, Atkins J, Tamosauskaite J.
In-Text Gene Mentions

…TheHFEgene C282Y mutation…

Show Full Abstract

Abstract Iron is essential for life but also causes oxidative damage. The HFE gene C282Y mutation causing excess iron accumulation is the most common genetic disorder in Americans, and is present in 1 in 150 northern Europeans. However, many middle aged adults with this variant appeared to be unaffected. We tested associations between C282Y homozygote status and frailty, sarcopenia, tiredness and chronic pain in a large volunteer sample from England, Wales and Scotland. Substantial excess morbidity was evident in both older men (aged 60 to 70) and older women, with C282Y homozygosity positively associated with greatly increased rates of Fried definition frailty, sarcopenia, frequent tiredness, plus chronic pain in various joints. As the iron excess is easily removed with blood donation, this cause of frailty may be preventable and treatable.

Also flagged:IGFBP-3MGMTIGF-1LDHSTATXIII
Journal Article 2018-11-01 ✓ 1 Snippet Srinivasan S, Spinks C, Sullivan D, Amor D, Smith M, Burgess T, Scarff K, Elliott J, Hunt C, Barns-Jenkins C, Holt C, Sandoval K, Kumar V, Ward L, Allen E, Collis S, Cowie S, Francis D, Delatycki M, Yiu E, Massie R, Pertile M, du Sart D, Bruno D, Archibald A, Velickovic Z, Fletcher N, Veedu R, Houston Z, Zhao Y, Howard C, Thurecht K, Winter M, Reza M, Hardy T, Zander-Fox D, Warkiani M, Thierry B, Fuller K, Hui H, Chuah H, Liang J, Siddiqi H, Radeski D, Erber W, Cheng L, Vella L, Doecke J, Sharples R, Shambrook M, Ellett L, Masters C, Horne M, Lawson V, Barnham K, Hill A, Fuller K, Hui H, Erber W, Burke D, Lynch D, Cooper A, Po J, Roberts T, de Souza P, Becker T, Calleja J, Sargeant E, Louey W, Yen T, Trambas C, Sikaris K, Lu Z, Law C, Lam C, Rudd D, Kwee H, Westaway J, Huerlimann R, Kosch T, Norton R, Watson D, Kandasamy Y, Harrop M, Kim M, Yim A, Su J, Czajko R, Mohr M, Chiang C, Herrmann M, Pusceddu I, Kleber M, März W, Herrmann W, Ibrahim M, Veerandran P, Umakanth M, Ward P, Chesher D, Ding L, Farrell C, Chung J, Horvath R, Stanford P, Law C, Lam C, Jones G, Chung J, Zakaria R, Greaves R, Koplin J, Pitt J, Tzanakos N, Roche P, Allen K, McGow C, O’Loughlin P, Morris H, Jiang C, Rushford K, Lam C, Law C, Liu K, Luu H, Nguyen H, Louey W, Lu Z, Sikaris K, Oostenbroek J, Flatman R, Ward G, Rowland K, Smith J, Nicolson J, Coonan N, Flatman R, Liu A, Clifford D, Gasparillo N, Taylor N, Kanowski D, Price L, Arunachalam S, Bonar R, Estepa F, Duncan E, Aizawa Y, Williams P, Tasevski V, Hyett J, Sherfan J, Herrmann M, Giuliani S, Barbieri V, Di Pierro A, Nascimento M, Yu C, Moore E, McDonald C, Simpson A, De Sousa S, Saleem M, Rankin W, Torpy D, Stranks J, Rankin W, Coates P, Coates P, Ehm M, Davis J, Gentzer W, Mirwaldt C, Muth D, Smith V, Snyder J, Zander N, Bandodkar S, Dale R, Alvarez S, Zeng L, Bandodkar A, Perera N, Chung J, Chung J, Chung J, Cox D, Foyn L, McWhinney B, McGill J, Stoodley S, Ungerer J, Cross C, Lodhia V, Perera N, Chung J, Fitzpatrick M, Nguyen V, Bonnitcha P, Chung J, Sullivan D, Foyn L, Connolly E, McWhinney B, Ungerer J, Burke A, Foyn L, McWhinney B, Huynh T, Ungerer J, Foyn L, McWhinney B, Tanchi P, Visser U, Verge C, Lafferty T, Reakes S, Pretorius C, Ungerer J, Huynh T, Damlakhi M, Connell A, Cocotsi C, O’Neill A, Sutton A, Lim C, McEntyre C, Card D, Sies C, Fitzgerald B, Newton S, Salib M, Hickman P, Pope J, Jenkins N, Black M, Schneider H, Potter J, Southcott E, Nouri-Girones F, Apostoloska S, Telford R, Hickman P, Potter J, Hickman P, Simpson A, Oakman C, Woods C, Ibrahim M, Veerandran P, Subasinghe S, Thompson S, Chesher D, Liu K, Louey W, Luu H, Nguyen H, Leung B, Sikaris K, Yen T, Lu Z, Trambas C, Tran D, Estoesta G, Stanford P, Manalansan D, Nguyen L, Salib M, Farrell C, Thompson I, Burley M, Hall D, Perry B, Woollard G, McWhinney B, Greaves R, Punyalack W, Dayanath B, Senarathne U, Vasiliadis C, Lam Q, Black M, Czajko R, Mohr M, Chiang C, De Leon R, Bodenham M, James B, Graham P, Gay S, Badrick T, Sikaris K, James B, Jones G, Calleja J, San Gil F, Choy K, Graham P, McPhie D, Prentice L, Vervaart P, Pillay N, Chai S, Horan M, Badrick T, Bennetts B, Hickman P, Koerbin G, Oakman C, Badrick T, Potter J, Sivaneson S, Ramaloo G, Rahman T, Giddy M, George S, Ramaloo G, Sivaneson S, Rahman T, Giddy M, George S.
In-Text Gene Mentions

HFE

Show Full Abstract

No abstract available.