Gene Literature Dashboard

Viewing December 2018 — 388 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← November 2018 January 2019 →
Also flagged:Breast CancerHeparanasedisaccharideglycopolymersglycopolymergrowth factors
Journal Article 2018-12-31 ✓ 1 Snippet Loka RS, Sletten ET, Barash U, Vlodavsky I, Nguyen HM.
In-Text Gene Mentions

ATIII

Show Full Abstract

Heparanase, the heparan sulfate polysaccharide degrading endoglycosidase enzyme, has been correlated with tumor angiogenesis and metastasis and therefore has become a potential target for anticancer drug development. In this systematic study, the sulfation pattern of the pendant disaccharide moiety on synthetic glycopolymers was synthetically manipulated to achieve optimal heparanase inhibition. Upon evaluation, a glycopolymer with 12 repeating units was determined to be the most potent inhibitor of heparanase (IC<sub>50</sub> = 0.10 ± 0.36 nM). This glycopolymer was further examined for cross-bioactivity using a solution-based competitive biolayer interferometry assay with other HS-binding proteins (growth factors, P-selectin, and platelet factor 4), which are responsible for mediating angiogenic activity, cell metastasis, and antibody-induced thrombocytopenia. The synthetic glycopolymer has low affinity for these HS-binding proteins in comparison to natural heparin. In addition, the glycopolymer possessed no proliferative properties toward human umbilical endothelial cells (HUVECs) and a potent antimetastatic effect against 4T1 mammary carcinoma cells. Thus, our study not only establishes a specific inhibitor of heparanase with high affinity but also illustrates the high effectiveness of this multivalent heparanase inhibitor in inhibiting experimental metastasis in vivo.

Also flagged:MLL1acute leukemiassolid tumorstumorprostate tumorsCD44
Journal Article 2018-12-31 ✓ 2 Snippets Parameswaran S, Vizeacoumar FS, Kalyanasundaram Bhanumathy K, Qin F, Islam MF, Toosi BM, Cunningham CE, Mousseau DD, Uppalapati MC, Stirling PC, Wu Y, Bonham K, Freywald A, Li H, Vizeacoumar FJ.
In-Text Gene Mentions

Interestingly, expression of most of the fusion partners including the high‐frequency partners like AFF1, MLLT1, MLLT3, MLLT10, ELL, and MLLT4, were positively correlated with MLL1 expression irrespective of the tumor type (Fig. S2).

…AFF1, MLLT1, MLLT3,MLLT10, ELL , and…

Show Full Abstract

Chromosomal rearrangements involving the mixed-lineage leukemia (MLL1) gene are common in a unique group of acute leukemias, with more than 100 fusion partners in this malignancy alone. However, do these fusions occur or have a role in solid tumors? We performed extensive network analyses of MLL1-fusion partners in patient datasets, revealing that multiple MLL1-fusion partners exhibited significant interactions with the androgen-receptor signaling pathway. Further exploration of tumor sequence data from TCGA predicts the presence of MLL1 fusions with truncated SET domain in prostate tumors. To investigate the physiological relevance of MLL1 fusions in solid tumors, we engineered a truncated version of MLL1 by fusing it with one of its known fusion partners, ZC3H13, to use as a model system. Functional characterization with cell-based assays revealed that MLL1-ZC3H13 fusion induced chromosomal instability, affected mitotic progression, and enhanced tumorsphere formation. The MLL1-ZC3H13 chimera consistently increased the expression of a cancer stem cell marker (CD44); in addition, we detected potential collateral lethality between DOT1L and MLL1 fusions. Our work reveals that MLL1 fusions are likely prevalent in solid tumors and exhibit a potential pro-tumorigenic role.

Also flagged:lipidMyocardial Infarctioncoronary artery diseasePHACTR1SLC22A3LPAL2
Journal Article 2018-12-31 ✓ 4 Snippets Banerjee S, Zeng L, Schunkert H, Söding J.
In-Text Gene Mentions
⭐ same-sentence co-mention

In the novel locus, there are three genes, DNAH10, ZNF664 and CCDC92, which are believed to be associated with multiple CAD risk factors such as high-density lipoprotein cholesterol level, triglycerides levels and waist-to-hip ratio [33–35] Here, B-LORE prioritized three SNPs (rs1187415, rs7961449 and rs6488913) in a region with strong LD.

⭐ same-sentence co-mention

…are three genes,DNAH10, ZNF664 and CCDC92,…

⭐ same-sentence co-mention

…three genes, DNAH10,ZNF664and CCDC92, which…

⭐ same-sentence co-mention

…DNAH10, ZNF664 andCCDC92, which are believed…

Show Full Abstract

Genetic variants in genome-wide association studies (GWAS) are tested for disease association mostly using simple regression, one variant at a time. Standard approaches to improve power in detecting disease-associated SNPs use multiple regression with Bayesian variable selection in which a sparsity-enforcing prior on effect sizes is used to avoid overtraining and all effect sizes are integrated out for posterior inference. For binary traits, the logistic model has not yielded clear improvements over the linear model. For multi-SNP analysis, the logistic model required costly and technically challenging MCMC sampling to perform the integration. Here, we introduce the quasi-Laplace approximation to solve the integral and avoid MCMC sampling. We expect the logistic model to perform much better than multiple linear regression except when predicted disease risks are spread closely around 0.5, because only close to its inflection point can the logistic function be well approximated by a linear function. Indeed, in extensive benchmarks with simulated phenotypes and real genotypes, our Bayesian multiple LOgistic REgression method (B-LORE) showed considerable improvements (1) when regressing on many variants in multiple loci at heritabilities ≥ 0.4 and (2) for unbalanced case-control ratios. B-LORE also enables meta-analysis by approximating the likelihood functions of individual studies by multivariate normal distributions, using their means and covariance matrices as summary statistics. Our work should make sparse multiple logistic regression attractive also for other applications with binary target variables. B-LORE is freely available from: https://github.com/soedinglab/b-lore.

Also flagged:ADtranscription factorsparasitic infectiontranscription factorZFHX3infectious disease
Journal Article 2018-12-31 No Snippets Xiang S, Huang Z, Wang T, Han Z, Yu CY, Ni D, Huang K, Zhang J.
Show Full Abstract

<h4>Background</h4>Gene co-expression network (GCN) mining is a systematic approach to efficiently identify novel disease pathways, predict novel gene functions and search for potential disease biomarkers. However, few studies have systematically identified GCNs in multiple brain transcriptomic data of Alzheimer's disease (AD) patients and looked for their specific functions.<h4>Methods</h4>In this study, we first mined GCN modules from AD and normal brain samples in multiple datasets respectively; then identified gene modules that are specific to AD or normal samples; lastly, condition-specific modules with similar functional enrichments were merged and enriched differentially expressed upstream transcription factors were further examined for the AD/normal-specific modules.<h4>Results</h4>We obtained 30 AD-specific modules which showed gain of correlation in AD samples and 31 normal-specific modules with loss of correlation in AD samples compared to normal ones, using the network mining tool lmQCM. Functional and pathway enrichment analysis not only confirmed known gene functional categories related to AD, but also identified novel regulatory factors and pathways. Remarkably, pathway analysis suggested that a variety of viral, bacteria, and parasitic infection pathways are activated in AD samples. Furthermore, upstream transcription factor analysis identified differentially expressed upstream regulators such as ZFHX3 for several modules, which can be potential driver genes for AD etiology and pathology.<h4>Conclusions</h4>Through our state-of-the-art network-based approach, AD/normal-specific GCN modules were identified using multiple transcriptomic datasets from multiple regions of the brain. Bacterial and viral infectious disease related pathways are the most frequently enriched in modules across datasets. Transcription factor ZFHX3 was identified as a potential driver regulator targeting the infectious diseases pathways in AD-specific modules. Our results provided new direction to the mechanism of AD as well as new candidates for drug targets.

Also flagged:MultidomainproteinslocalizationScribbleLAPcell division
Journal Article 2018-12-31 ✓ 1 Snippet Bonello TT, Peifer M.
In-Text Gene Mentions

…Erbin, Lano, andDensin-180( Santoni et…

Show Full Abstract

Key events ranging from cell polarity to proliferation regulation to neuronal signaling rely on the assembly of multiprotein adhesion or signaling complexes at particular subcellular sites. Multidomain scaffolding proteins nucleate assembly and direct localization of these complexes, and the protein Scribble and its relatives in the LAP protein family provide a paradigm for this. Scribble was originally identified because of its role in apical-basal polarity and epithelial integrity in <i>Drosophila melanogaster</i> It is now clear that Scribble acts to assemble and position diverse multiprotein complexes in processes ranging from planar polarity to adhesion to oriented cell division to synaptogenesis. Here, we explore what we have learned about the mechanisms of action of Scribble in the context of its multiple known interacting partners and discuss how this knowledge opens new questions about the full range of Scribble protein partners and their structural and signaling roles.

Also flagged:hydroxyapatitesHydroxyapatitealuminacollagencalcium orthophosphatecalcium phosphate
Journal Article 2018-12-31 No Snippets Resmim CM, Dalpasquale M, Vielmo NIC, Mariani FQ, Villalba JC, Anaissi FJ, Caetano MM, Tusi MM.
Show Full Abstract

Hydroxyapatite was obtained by bone calcinations. To study the calcination process, bovine and porcine bones were first autoclaved to remove fat and other non-bone tissues. They were then heated in an alumina pan in an oxidizing atmosphere of air, where simultaneous thermal analysis curves were recorded. To prepare the hydroxyapatites, bone samples were calcined at 850 °C and 1000 °C using a muffle furnace for 1 h. The obtained materials were powdered using mortar and pestle, and sifted in a sieve (60 mesh) without any additional purification or chemical treatment. The materials obtained were characterized by energy-dispersive X-ray spectroscopy, X-ray diffraction, and Fourier-transform infrared spectroscopy. The antimicrobial properties of these materials were determined through direct contact tests against Staphylococcus aureus. The natural hydroxyapatites obtained by bone calcination inhibited S. aureus growth, with the material obtained by calcination of bovine bones at 1000 °C, showing the best antimicrobial activity. These results indicated that bone wastes can be used to obtain hydroxyapatites with antimicrobial activity.

Also flagged:embryonal carcinomaCD44dendrite
Journal Article 2018-12-31 ✓ 5 Snippets Li W, Fang J, Shen J, Liu X, Hou J, Zhu Y, Ma X.
In-Text Gene Mentions

MicroRNA-135a-5p promotes neuronal differentiation of pluripotent embryonal carcinoma cells by repressing Sox6/CD44 pathway.

…cells by repressingSox6/CD44 pathway.…

…has uncovered thatSox6and CD44 genes…

…then found thatSox6directly bound to…

…Importantly, we identifiedSox6as a direct…

Show Full Abstract

MicroRNA-135a-5p has been reported to play a potential role in the generation of new neurons. However, the underlying targets of miR-135a-5p in regulating neuronal differentiation have been poorly understood. Our study recently has uncovered that Sox6 and CD44 genes were significantly downregulated during neuronal differentiation of P19 cells, a multipotent cell type. We then found that Sox6 directly bound to the promoter of CD44. Importantly, we identified Sox6 as a direct target of miR-135a-5p. Additionally, we demonstrated that miR-135a-5p is crucial for the neuronal differentiation of P19 cells. More significantly, we found that Sox6 overexpression could overturn miR-135a-5p-mediated neuronal differentiation and dendrite development. In conclusion, these findings indicated that miR-135a-5p/Sox6/CD44 axis provides an important molecular target mechanism for neurodifferentiation.

Also flagged:collagenproteasefermentationglucoseoligopeptidecalcium
Journal Article 2018-12-31 No Snippets Han K, Cao J, Wang J, Chen J, Yuan K, Pang F, Gu S, Huo N.
Show Full Abstract

Both the calcium and collagen in bone powder are hard to be absorbed by the body. Although enzymatic hydrolysis by protease increased the bio-availability of bone powder, it was a meaningful try to further increase Ca<sup>2+</sup> release, oligopeptide formation and antioxidant activity of the sheep bone hydrolysate (SBH) by lactic acid bacteria (LAB) fermentation. <i>Lactobacillus helveticus</i> was selected as the starter for its highest protease-producing ability among 5 tested LAB strains. The content of liberated Ca<sup>2+</sup> was measured as the responsive value in the response surface methodology (RSM) for optimizing the fermenting parameters. When SBH (adjusted to pH 6.1) supplemented with 1.0% glucose was inoculated 3.0% <i>L. helveticus</i> and incubated for 29.4 h at 36℃, Ca<sup>2+</sup> content in the fermented SBH significantly increased (p<0.01), and so did the degree of hydrolysis and the obtaining rate of oligopeptide. The viable counts of <i>L. helveticus</i> reached to 1.1×10<sup>10</sup> CFU/mL. Results of Pearson correlation analysis demonstrated that LAB viable counts, Ca<sup>2+</sup> levels, obtaining rates of oligopeptide and the yield of polypeptide were positively <i>correlated</i> with each other (p<0.01). The abilities of SBH to scavenge the free radicals of DPPH, OH and ABTS were also markedly enhanced after fermentation. In conclusion, <i>L. helveticus</i> fermentation can further boost the release of free Ca<sup>2+</sup> and oligopeptide, enhance the antioxidant ability of SBH. The <i>L. helveticus</i> fermented SBH can be developed as a novel functional dietary supplement product.

Also flagged:autism spectrum disorderreverse transcriptionpolymeraseParkinson diseasesgene expressionpathogenesis
Journal Article 2018-12-31 ✓ 2 Snippets Nt P, Ds M, Mm N, In M, Ti V.
In-Text Gene Mentions

Two proteins (DNAL1 and POLR2I) are described to take part in Huntington’s disease pathogenesis in an indirect manner, while interacting with or being influenced by, the product of the Huntingtin (HTT) gene.

…the Huntingtin (HTT) gene.…

Show Full Abstract

Circulating microRNAs (miRNAs) are emerging as promising diagnostic biomarkers for autism spectrum disorder (ASD), but their usefulness for detecting ASD remains unclear. Nowadays, development of promising biomarkers for ASD remains a challenge. Recently, dysregulation of the miRNAs expression in postmortem brain tissue, serum and peripheral blood, have been associated with ASD. Circulating miRNAs are known to be secreted by a number of different cells and can interpose delivery of information into receiver cells, thus affecting their functions. Based on this fact, it is supposed that serum miRNAs could be a novel class of biomarkers for prognosis or diagnosis of pathological disorders including ASD. In the current research, we investigated whether the expression patterns of circulating miRNAs showed dysregulation in subjects diagnosed with ASD. Expression levels of serum miR-328-3p and miR-3135a were analyzed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) method of subjects diagnosed with ASD in comparison with healthy control subjects. Our data showed that miR-328-3p and miR-3135a were substantially down-regulated in ASD patients than in those of healthy control subjects. Moreover, target gene analysis of altered serum miRNAs displayed that these molecules targeted 162 genes denoted as unique validated targets in the miRWalk database, 71 of which appear to participate in biological pathways involved in synaptic pathways and neurodegenerative condition such as Alzheimer, Huntington and Parkinson diseases. Finally, the results strongly suggested that dys-regulated serum miRNAs might be involved in molecular pathways associated with ASD and miR-328-3p and miR-3135a have the potential to be promising novel biomarkers for ASD.

Also flagged:methylationgestationanxietydepressioncorticotropin-releasing hormoneCRH
Journal Article 2018-12-31 ✓ 2 Snippets M R, B P.
In-Text Gene Mentions

We suggest describing this as HPA axis hyper-sensibility, as stress response is often quick, strong and too long in mothers with chronic stress loads (Figure 1).Most commonly studied genes related to stress response are NR3C1 which encodes the glucocorticoid receptor; 11B-HSD2 which encodes an enzyme to regulate the transmission of cortisol to the fetus at the maternal-fetal boundary; FKBP5 which encodes FK506, a negative regulator of cortisol response; BDNF, which influences neuronal development; and, serotonin transporter SLC6A4 which encodes 5-HTT protein, an important regulator of emotional behavior responses in early life experiences.

…SLC6A4 which encodes5-HTTprotein, an important…

Show Full Abstract

Preterm birth is the leading cause of mortality in newborn infants and can lead to significant neonatal morbidities. Spontaneous preterm birth accounts for at least 50.0% of all preterm births. We argue that chronic maternal stress load, which is an important risk factor for spontaneous preterm birth, could be represented by epigenetic signature of several specific genetic loci in the mother's blood. A literature search was done in PubMed with the following keywords: "DNA methylation," "epigenetics," "maternal stress" and "preterm birth" from year 2000 to 2017. We suggest that these genetic loci might be related to vulnerability and hypersensibility of stress response during pregnancy in women with preterm births. The mother's epi-genetic stress bioprofile was supposed to be a result of chronic maternal stress load since her birth. This epigenetic bioprofile might also be a potential biomarker for spontaneous preterm birth. DNA methylation changes are tissue-specific and human stress response manifests mostly through the central nervous system (CNS). Nevertheless, we found evidence that methylation changes of DNA isolated from blood leucocytes might be a reliable measure of stress-related epigenetic changes that occur in the CNS. Evaluating biological mechanisms through the development of simple assays based on epigenetic changes to measure chronic stress loads in expectant mothers can lead to our ability to prepare more effective measures for the prevention of preterm births, as well as leading to more effective treatment strategies for both expectant mothers and their newborns.

Also flagged:NEAT1iodinepapillary thyroid carcinomapapillary thyroid cancerFN1PTC
Journal Article 2018-12-30 No Snippets Liu C, Feng Z, Chen T, Lv J, Liu P, Jia L, Zhu J, Chen F, Yang C, Deng Z.
Show Full Abstract

Considering the resistance of papillary thyroid cancer (PTC) <sup>131</sup>I therapy, this study was designed to find a solution at molecular respect. By probing into lncRNA-NEAT1/miR-101-3p/FN1 axis and PI3K/AKT signaling pathway, this study provided a potential target for PTC therapy. <sup>131</sup>I-resistant cell lines were established by continuous treatment with median-lethal <sup>131</sup>I. Bioinformatic analysis was applied to filtrate possible lncRNA/miRNA/mRNA and related signaling pathway. Luciferase reporter assay was employed in the verification of the targeting relationship between lncRNA and miRNA as well as miRNA and mRNA. MTT assay and flow cytometry assay were performed to observe the impact of NEAT1/miR-101-3p/FN1 on cell viability and apoptosis in radioactivity iodine (RAI)-resistant PTC cell lines, respectively. Western blot and qRT-PCR were conducted to measure the expression of proteins and mRNAs in RAI-resistant PTC tissues and cells. Meanwhile, endogenous PTC mice model were constructed, in order to verify the relation between NEAT1 and RAI-resistance in vivo. NEAT1 was over-expressed in RAI-resistant PTC tissues and cell lines and could resist RAI by accelerating proliferation accompanied by suppressing apoptosis. It indicated that overexpressed NEAT1 restrained the damage of RAI to tumor in both macroscopic and microcosmic. Besides, NEAT1/miR-101-3p exhibited a negative correlation by directly targeting each other. The expression of FN1, an overexpressed downstream protein in RAI-resistance PTC tissues, could be tuned down by miR-101-3p, while the decrease could be restored by NEAT1. In conclusion, both in vitro and in vivo, NEAT1 suppression could inhibit <sup>131</sup>I resistance of PTC by upregulating miR-101-3p/FN1 expression and inactivated PI3K/AKT signaling pathway both in vitro and in vivo.

Also flagged:cytosineadenineguanineaxonalmitochondrialaxon
Journal Article 2018-12-30 ✓ 4 Snippets Nekrasov ED, Kiselev SL.
In-Text Gene Mentions

AIM: Huntington’s disease (HD) is an inherited disease caused by an expansion of cytosine-adenine-guanine (CAG) repeats in the huntingtin gene (HTT) that ultimately leads to neurodegeneration.

HD is caused by an expansion of cytosine-adenine-guanine (CAG) repeats in the huntingtin gene (HTT) that leads to a pathological elongation of polyglutamine repeats in the huntingtin protein[1].

…huntingtin gene (HTT) that ultimately…

…repeats in theHTTgene, does not…

Show Full Abstract

<b>AIM:</b> Huntington's disease (HD) is an inherited disease caused by an expansion of cytosine-adenine-guanine (CAG) repeats in the huntingtin gene (<i>HTT</i>) that ultimately leads to neurodegeneration. To study the molecular basis of this disease, induced pluripotent stem cells (iPSCs) generated from patients' fibroblasts were used to investigate axonal mitochondrial trafficking and the nature of nuclear indentations. <b>METHODS:</b> Pathological and control iPSCs generated from patients with a low number of repeats were differentiated in striatal neurons of the brain. Mitochondrial density was measured along the axon using tubulin beta 3 co-staining in pathological and control neurons. To investigate the connection of nuclear roundness with calcium dysregulation, several calcium inhibitors were used. Proteasome system inhibition was applied to mimic premature neuronal ageing. <b>RESULTS:</b> We found that the mitochondrial density was approximately 7.6 ± 0.2 in neurites in control neurons but was only 5.3 ± 0.2 in mutant neurons with 40-44 CAG repeats (p-value <0.005). Neuronal ageing induced by proteasome inhibitor MG132 significantly decreased the mitochondrial density by 15% and 25% in control and mutant neurons to 6.5 ± 0.1 (p-value < 0.005) and 4.0 ± 0.3 (p-value < 0.005), respectively. Thus, for the first time, an impairment of mitochondrial trafficking in pathological neurons with endogenous mutant huntingtin was demonstrated. We found that inhibiting the sarco/endoplasmic reticulum Ca2+-ATPase (SERCA), the ryanodine-receptor (RyR) or the inositol 1,4,5-trisphosphate receptor (IP3R) by specific inhibitors did not specifically affect the nuclear roundness or survival of pathological neurons differentiated from patient iPSCs. Therefore, nuclear calcium homeostasis is not directly associated with HD pathology. <b>CONCLUSION:</b> Identifying HD iPSCs and differentiating from them neurons provide a unique system for modelling the disease <i>in vitro</i>. Impairments of mitochondrial trafficking and nuclear roundness manifest long before the disease onset, while premature neuronal ageing enhances differences in mitochondrial distribution.

Also flagged:cancerbreast cancerBRCA1LINC008854BRCA2TP53
Journal Article 2018-12-29 No Snippets Hamdi Y, Ben Rekaya M, Jingxuan S, Nagara M, Messaoud O, Benammar Elgaaied A, Mrad R, Chouchane L, Boubaker MS, Abdelhak S, Boussen H, Romdhane L.
Show Full Abstract

<h4>Background</h4>Breast cancer is the most common cancer in women worldwide. Around 50% of breast cancer familial risk has been so far explained by known susceptibility alleles with variable levels of risk and prevalence. The vast majority of these breast cancer associated variations reported to date are from populations of European ancestry. In spite of its heterogeneity and genetic wealth, North-African populations have not been studied by the HapMap and the 1000Genomes projects. Thus, very little is known about the genetic architecture of these populations.<h4>Methods</h4>This study aimed to investigate a subset of common breast cancer loci in the general Tunisian population and to compare their genetic composition to those of other ethnic groups. We undertook a genome-wide haplotype study by genotyping 135 Tunisian subjects using the Affymetrix 6.0-Array. We compared Tunisian allele frequencies and linkage disequilibrium patterns to those of HapMap populations and we performed a comprehensive assessment of the functional effects of several selected variants.<h4>Results</h4>Haplotype analyses showed that at risk haplotypes on 2p24, 4q21, 6q25, 9q31, 10q26, 11p15, 11q13 and 14q32 loci are considerably frequent in the Tunisian population (> 20%). Allele frequency comparison showed that the frequency of rs13329835 is significantly different between Tunisian and all other HapMap populations. LD-blocks and Principle Component Analysis revealed that the genetic characteristics of breast cancer variants in the Tunisian, and so probably the North-African populations, are more similar to those of Europeans than Africans. Using eQTl analysis, we characterized rs9911630 as the most strongly expression-associated SNP that seems to affect the expression levels of BRCA1 and two long non coding RNAs (NBR2 and LINC008854). Additional in-silico analysis also suggested a potential functional significance of this variant.<h4>Conclusions</h4>We illustrated the utility of combining haplotype analysis in diverse ethnic groups with functional analysis to explore breast cancer genetic architecture in Tunisia. Results presented in this study provide the first report on a large number of common breast cancer genetic polymorphisms in the Tunisian population which may establish a baseline database to guide future association studies in North Africa.

Also flagged:inflammatory responseresponse to reactiveoxygencomplement activationblood coagulationTransport protein afamin
Journal Article 2018-12-29 ✓ 5 Snippets Ward LJ, Olausson P, Li W, Yuan XM.
In-Text Gene Mentions

…blood coagulation proteinsantithrombin-IIIand coagulation factor…

…of afamin andantithrombin-III, and 50 μg…

…ermo Fisher Scientific), anti-antithrombin-III(dilution 1:1000; PA5-29500,…

…heparin cofactor 2,antithrombin-IIIand coagulation factor…

…p < 0.001),antithrombin-III( p =…

Show Full Abstract

<h4>Background</h4>Atherosclerotic lesions are comprised of distinct regions with different proteomic profiles. Men and women develop differences in lesion phenotype, with lesions from women generally being more stable and less prone to rupture. We aimed to investigate the differences in proteomic profiles between sexes, including distinct lesion regions, to identify altered proteins that contribute to these differences observed clinically.<h4>Methods</h4>Carotid endarterectomy samples (ten men/ten women) were obtained, and intraplaque biopsies from three distinct regions (internal control, fatty streak and plaque) were analysed by tandem-mass spectrometry. Multivariate statistical modelling, using orthogonal partial least square-discriminant analysis, was used to discriminate the proteomes between men and women.<h4>Results</h4>Multivariate discriminant modelling revealed proteins from 16 functional groups that displayed sex-specific associations. Additional statistics revealed ten proteins that display region-specific alterations when comparing sexes, including proteins related to inflammatory response, response to reactive oxygen species, complement activation, transport and blood coagulation. Transport protein afamin and blood coagulation proteins antithrombin-III and coagulation factor XII were significantly increased in plaque region from women. Inflammatory response proteins lysozyme C and phospholipase A2 membrane-associated were significantly increased in plaque region from men. Limitations with this study are the small sample size, limited patient information and lack of complementary histology to control for cell type differences between sexes.<h4>Conclusions</h4>This pilot study, for the first time, utilises a multivariate proteomic approach to investigate sexual dimorphism in human atherosclerotic tissue, and provides an essential proteomic platform for further investigations to help understand sexual dimorphism and plaque vulnerability in atherosclerosis.

Also flagged:LipidPyroglutamic AcidIdebenoneneurodegenerative diseasesskin disordersester
Journal Article 2018-12-29 No Snippets Montenegro L, Panico AM, Santagati LM, Siciliano EA, Intagliata S, Modica MN.
Show Full Abstract

Idebenone (IDE), a strong antioxidant widely investigated for the treatment of neurodegenerative diseases and skin disorders, shows low oral and topical bioavailability due to its unfavorable physico-chemical properties. In this work, to improve IDE topical effectiveness, we explored a two-steps approach: (1) we synthesized an IDE ester (IDEPCA) with pyroglutamic acid, a molecule whose hydrating effects are well known; (2) we loaded IDEPCA into solid lipid nanocarriers (SLN). We evaluated in vitro antioxidant and anti-glycation activity and in vivo hydrating effects after topical application in human volunteers from gel vehicles of IDEPCA SLN in comparison to IDE SLN. All SLN showed good technological properties (mean particle size < 25 nm, polydispersity index < 0.300, good stability). The oxygen radical absorbance capacity assay showed that IDEPCA SLN and IDE SLN had similar antioxidant activity while IDEPCA SLN were more effective in the in vitro NO scavenging assay. Both IDEPCA and IDE SLN showed the same effectiveness in inhibiting the formation of advanced glycation end products. In vivo experiments pointed out a better hydrating effect of IDEPCA SLN in comparison to IDE SLN. These results suggest that the investigated approach could be a promising strategy to obtain topical formulations with increased hydrating effects.

Also flagged:CholesterolSynthesislipidmembranessteroidhydroxy
Journal Article 2018-12-29 No Snippets Albuquerque HMT, Santos CMM, Silva AMS.
Show Full Abstract

This review reports on the latest developments (since 2014) in the chemistry of cholesterol and its applications in different research fields. These applications range from drug delivery or bioimaging applications to cholesterol-based liquid crystals and gelators. A brief overview of the most recent synthetic procedures to obtain new cholesterol derivatives is also provided, as well as the latest anticancer, antimicrobial, and antioxidant new cholesterol-based derivatives. This review discusses not only the synthetic details of the preparation of new cholesterol derivatives or conjugates, but also gives a short summary concerning the specific application of such compounds.

Also flagged:actin-binding proteinESPNcell growthorganizationsensory transductioncell proliferation
Journal Article 2018-12-29 No Snippets Li SH, Lu HI, Huang WT, Chen YH, Lo CM, Lan YC, Lin WC, Tsai HT, Chen CH.
Show Full Abstract

<h4>Background</h4>ESPN (Espin), an actin filament-binding protein, plays an important role in regulating the organization, dimensions, dynamics, and signaling capacities of the actin filament-rich, microvillus-type specializations that mediate sensory transduction in various mechanosensory and chemosensory cells. Recent few studies show that ESPN regulates metastasis and cell proliferation in melanoma. However, the significance of ESPN in other cancers such as esophageal squamous cell carcinoma (ESCC) remains largely unknown.<h4>Methods</h4>Immunohistochemistry was performed in 169 patients with ESCC and correlated with clinicopathological features and survival. The functional role of ESPN in ESCC cells was determined by ESPN-mediated siRNA.<h4>Results</h4>Univariate analyses showed that high ESPN expression was associated with inferior overall survival (P = 0.005) and disease-free survival (P = 0.035). High ESPN expression was an independent prognosticator in multivariate analysis for overall survival (P = 0.009, hazard ratio = 1.688) and disease-free survival (P = 0.049, hazard ratio = 1.451). The 5-year overall survival rates were 30% and 54% in patients with high and low expression of ESPN, respectively. Inhibition of endogenous ESPN in ESCC cells decreased ESCC growth by reducing cell proliferating rates.<h4>Conclusions</h4>High ESPN expression is independently associated with poor prognosis in patients with ESCC and downregulation of ESPN inhibits ESCC cell growth. Our results suggest that ESPN may be a novel therapeutic target for patients with ESCC.

Also flagged:alginatealbumin5-amino salicylic acidBSAethylene glycolterpolymer
Journal Article 2018-12-29 No Snippets Das D, Pham HTT, Lee S, Noh I.
Show Full Abstract

Herein, we report a functionalized alginate(Alg)-based terpolymeric semi-interpenetrating (semi-IPN) hydrogel, synthesized via free radical polymerization for the delivery of bovine albumin serum (BSA) and 5-amino salicylic acid (5-ASA). To improve mechanical properties, and to modulate surface morphology of Alg, 2-hydroxyethyl acrylate (HEA) was grafted on alginate and then crosslinked using poly(ethylene glycol) diacrylate (PEGDA). The probable structure and compositions of the synthesized semi-IPN terpolymer were identified by FTIR, <sup>1</sup>H-HR-MAS NMR, and TGA analyses. Achievement of equilibrium swelling state (ESS) and higher elastic modulus values confirmed terpolymer gel formation in aqueous media. Differences in the ESS of the prepared gel at pH 2.5 and 7.4 signify its stimuli-responsive behaviour. The influence of PEGDA on swelling, mechanical properties, surface morphology, cell viability and proliferation, and BSA and 5-ASA delivery were characterized. SEM images show that higher % PEGDA resulted in smaller sized pores in the gel network. Texture analyses demonstrate that hardness, adhesiveness and chewiness of the gel were enhanced at higher PEGDA concentrations. Increases in PEGDA concentration also induced increases in osteoblastic cell viability and higher rates of cell proliferation compared with gels containing lower concentrations of PEGDA. The release results indicate that the gels containing higher concentrations of PEGDA more sustainably release BSA and 5-ASA at 5 days and 30 h, respectively. The experimental data revealed that the synthesized terpolymeric semi-IPN hydrogel may have useful biomedical applications, especially as a carrier of protein (BSA), or 5-ASA (a therapeutic option for conditions of the colon such as Crohn's Disease and Ulcerative Colitis).

Also flagged:infertilitystem cell developmentCardiovascular diseasesischemic heart diseasegrowth factorsCXCR4
Journal Article 2018-12-29 ✓ 2 Snippets Unknown Authors
In-Text Gene Mentions

… Ikaros, GATA1, and SOX6 have been identifie…

…y involving P62, GABARAPL1, and HTT genes. …

Show Full Abstract

No abstract available.

Also flagged:SLC40A1haemochromatosisHaemochromatosis type 4ferroportin diseaseautosomalgenetic disorder
Journal Article 2018-12-28 ✓ 2 Snippets Zhang W, Xu A, Li Y, Zhao S, Zhou D, Wu L, Zhang B, Zhao X, Wang Y, Wang X, Duan W, Wang Q, Nan Y, You H, Jia J, Ou X, Huang J, China Registry of Genetic/Metabolic Liver Diseases (CR-GMLD) Group.
In-Text Gene Mentions

Cellular localization of mutant FPN1, expression of FPN1 and intracellular ferritin were analysed by immunofluorescence and Western blotting.<h4>Results</h4>Of 22 unrelated cases with primary iron overload, three cases (3/22, 13.6%) harboured the SLC40A1 p.Y333H, with no missense mutations identified in any other classical haemochromatosis-related genes including HFE, HJV, HAMP and TFR2.

…atosis-related genes includingHFE, HJV, HAMP and…

Show Full Abstract

<h4>Background & aims</h4>Haemochromatosis type 4, also known as ferroportin disease, is an autosomal dominant genetic disorder caused by pathogenic mutations in the SLC40A1 gene, which encodes ferroportin 1 (FPN1). We have identified a novel SLC40A1 p.Y333H mutation in our previous study. In the present study, we tried to investigate the frequency and pathogenicity of the SLC40A1 p.Y333H mutation in haemochromatosis in China.<h4>Methods</h4>Patients were analysed for SLC40A1 p.Y333H as well as mutations in the other classic haemochromatosis-related genes by Sanger sequencing. To analyse iron export capacity of the SLC40A1 p.Y333H mutant, the 293T cells were transfected with the SLC40A1 p.Y333H construct and then treated with hepcidin after exposure to ferric ammonium citrate. Cellular localization of mutant FPN1, expression of FPN1 and intracellular ferritin were analysed by immunofluorescence and Western blotting.<h4>Results</h4>Of 22 unrelated cases with primary iron overload, three cases (3/22, 13.6%) harboured the SLC40A1 p.Y333H, with no missense mutations identified in any other classical haemochromatosis-related genes including HFE, HJV, HAMP and TFR2. Pedigree analysis showed that three probands and the son of one proband had haemochromatosis of stage 3, while the son of another proband with age of 16 showed elevated transferrin saturation but normal serum ferritin level. In vitro studies showed the mutant p.Y333H ferroportin was resistant to hepcidin, affecting the subsequent internalization and degradation of FPN1, and was associated with ferroportin gain of function.<h4>Conclusions</h4>The SLC40A1 p.Y333H mutation is associated with gain of function of ferroportin, representing one of the major aetiological factors of haemochromatosis in China.

Also flagged:antibodiesdigestiontrifluoroethanoltrypsinepidermal growth factor receptorEGFR
Journal Article 2018-12-28 ✓ 1 Snippet Zhang P, Gaffrey MJ, Zhu Y, Chrisler WB, Fillmore TL, Yi L, Nicora CD, Zhang T, Wu H, Jacobs J, Tang K, Kagan J, Srivastava S, Rodland KD, Qian WJ, Smith RD, Liu T, Wiley HS, Shi T.
In-Text Gene Mentions

PEBP1

Show Full Abstract

Heterogeneity in composition is inherent in all cell populations, even those containing a single cell type. Single-cell proteomics characterization of cell heterogeneity is currently achieved by antibody-based technologies, which are limited by the availability of high-quality antibodies. Herein we report a simple, easily implemented, mass spectrometry (MS)-based targeted proteomics approach, termed cLC-SRM (carrier-assisted liquid chromatography coupled to selected reaction monitoring), for reliable multiplexed quantification of proteins in low numbers of mammalian cells. We combine a new single-tube digestion protocol to process low numbers of cells with minimal loss together with sensitive LC-SRM for protein quantification. This single-tube protocol builds upon trifluoroethanol digestion and further minimizes sample losses by tube pretreatment and the addition of carrier proteins. We also optimized the denaturing temperature and trypsin concentration to significantly improve digestion efficiency. cLC-SRM was demonstrated to have sufficient sensitivity for reproducible detection of most epidermal growth factor receptor (EGFR) pathway proteins expressed at levels ≥30 000 and ≥3000 copies per cell for 10 and 100 mammalian cells, respectively. Thus, cLC-SRM enables reliable quantification of low to moderately abundant proteins in less than 100 cells and could be broadly useful for multiplexed quantification of important proteins in small subpopulations of cells or in size-limited clinical samples. Further improvements of this method could eventually enable targeted single-cell proteomics when combined with either SRM or other emerging ultrasensitive MS detection.

Also flagged:chromosomechromatinnucleotidetranscription factorbindinghistone
Journal Article 2018-12-28 No Snippets Vihinen M.
Show Full Abstract

<h4>Background</h4>Numerous different types of variations can occur in DNA and have diverse effects and consequences. The Variation Ontology (VariO) was developed for systematic descriptions of variations and their effects at DNA, RNA and protein levels.<h4>Results</h4>VariO use and terms for DNA variations are described in depth. VariO provides systematic names for variation types and detailed descriptions for changes in DNA function, structure and properties. The principles of VariO are presented along with examples from published articles or databases, most often in relation to human diseases. VariO terms describe local DNA changes, chromosome number and structure variants, chromatin alterations, as well as genomic changes, whether of genetic or non-genetic origin.<h4>Conclusions</h4>DNA variation systematics facilitates unambiguous descriptions of variations and their effects and further reuse and integration of data from different sources by both human and computers.

Also flagged:chromosomeleukaemiaCBFA2T3GLIS2acute myeloid leukaemiaAML
Journal Article 2018-12-28 No Snippets Masetti R, Bertuccio SN, Pession A, Locatelli F.
Show Full Abstract

The scenario of paediatric acute myeloid leukaemia (AML), particularly non-Down syndrome acute megakaryoblastic leukaemia (non-DS-AMKL), has been recently revolutionized by the advent of large-scale, genomic sequencing technologies. In this changing landscape, a significantly relevant discovery has been represented by the identification of the CBFA2T3-GLIS2 fusion gene, which is the result of a cryptic inversion of chromosome 16. It is the most frequent chimeric oncogene identified to date in non-DS-AMKL, although it seems not to be exclusively restricted to the French-American-British M7 subgroup. The CBFA2T3-GLIS2 fusion gene characterizes a subtype of leukaemia that is specific to paediatrics, having never been identified in adults. It characterizes an extremely aggressive leukaemia, as the presence of this fusion is associated with a grim outcome in almost all of the case series reported, with overall survival rates ranging between 15% and 30%. Although the molecular basis that underlies this leukaemia subtype is still far from being completely elucidated, unique functional properties induced by CBFA2T3-GLIS2 in the leukaemogenesis driving process have been recently identified. We here review the peculiarities of CBFA2T3-GLIS2-positive AML, describing its intriguing clinical and biological behaviour and providing some challenging targeting opportunities.

Also flagged:hepatocellular carcinomasialic acidglycoproteinsglycansmannoseGlycan
Journal Article 2018-12-28 ✓ 1 Snippet Gebrehiwot AG, Melka DS, Kassaye YM, Rehan IF, Rangappa S, Hinou H, Kamiyama T, Nishimura SI.
In-Text Gene Mentions

…rypsin, alpha-2-macroglobulin,antithrombin-III, apolipoproteins, ceruloplasm…

Show Full Abstract

<h4>Background</h4>Most glycomics studies have focused on understanding disease mechanisms and proposing serum markers for various diseases, yet the influence of ethnic variation on the identified glyco-biomarker remains poorly addressed. This study aimed to investigate the inter-ethnic serum N-glycan variation among US origin control, Japanese, Indian, and Ethiopian healthy volunteers.<h4>Methods</h4>Human serum from 54 healthy subjects of various ethnicity and 11 Japanese hepatocellular carcinoma (HCC) patients were included in the study. We employed a comprehensive glycoblotting-assisted MALDI-TOF/MS-based quantitative analysis of serum N-glycome and fluorescence HPLC-based quantification of sialic acid species. Data representing serum N-glycan or sialic acid levels were compared among the ethnic groups using SPSS software.<h4>Results</h4>Total of 51 N-glycans released from whole serum glycoproteins could be reproducibly quantified within which 33 glycoforms were detected in all ethnicities. The remaining N-glycans were detected weakly but exclusively either in the Ethiopians (13 glycans) or in all the other ethnic groups (5 glycans). Highest abundance (p < 0.001) of high mannose, core-fucosylated, hyperbranched/hypersialylated N-glycans was demonstrated in Ethiopians. In contrast, only one glycan (m/z 2118) significantly differed among all ethnicities being highest in Indians and lowest in Ethiopians. Glycan abundance trend in Ethiopians was generally close to that of Japanese HCC patients. Glycotyping analysis further revealed ethnic-based disparities mainly in the branched and sialylated structures. Surprisingly, some of the glycoforms greatly elevated in the Ethiopian subjects have been identified as serum biomarkers of various cancers. Sialic acid level was significantly increased primarily in Ethiopians, compared to the other ethnicities.<h4>Conclusion</h4>The study revealed ethnic-specific differences in healthy human serum N-glycome with highest abundance of most glycoforms in the Ethiopian ethnicity. The results strongly emphasized the need to consider ethnicity matching for accurate glyco-biomarker identification. Further large-scale study employing various ethnic compositions is needed to verify the current result.

Also flagged:HomeoproteinOtx2psychiatric disorderspsychiatric diseasesnucleusbrain development
Journal Article 2018-12-28 ✓ 1 Snippet Ruiz-Reig N, Rakotobe M, Bethus I, Le Menn G, Huditz HI, Marie H, Lamonerie T, D'Autréaux F.
In-Text Gene Mentions

DCC

Show Full Abstract

The habenulo-interpeduncular system (HIPS) is now recognized as a critical circuit modulating aversion, reward, and social behavior. There is evidence that dysfunction of this circuit leads to psychiatric disorders. Because psychiatric diseases may originate in developmental abnormalities, it is crucial to investigate the developmental mechanisms controlling the formation of the HIPS. Thus far, this issue has been the focus of limited studies. Here, we explored the developmental processes underlying the formation of the medial habenula (MHb) and its unique output, the interpeduncular nucleus (IPN), in mice independently of their gender. We report that the <i>Otx2</i> homeobox gene is essential for the proper development of both structures. We show that MHb and IPN neurons require <i>Otx2</i> at different developmental stages and, in both cases, <i>Otx2</i> deletion leads to disruption of HIPS subcircuits. Finally, we show that Otx2<sup>+</sup> neurons tend to be preferentially interconnected. This study reveals that synaptically connected components of the HIPS, despite radically different developmental strategies, share high sensitivity to <i>Otx2</i> expression.<b>SIGNIFICANCE STATEMENT</b> Brain reward circuits are highly complex and still poorly understood. In particular, it is important to understand how these circuits form as many psychiatric diseases may arise from their abnormal development. This work shows that <i>Otx2</i>, a critical evolutionary conserved gene implicated in brain development and a predisposing factor for psychiatric diseases, is required for the formation of the habenulo-interpeduncular system (HIPS), an important component of the reward circuit. Otx2 deletion affects multiple processes such as proliferation and migration of HIPS neurons. Furthermore, neurons expressing <i>Otx2</i> are preferentially interconnected. Therefore, <i>Otx2</i> expression may represent a code that specifies the connectivity of functional subunits of the HIPS. Importantly, the <i>Otx2</i> conditional knock-out animals used in this study might represent a new genetic model of psychiatric diseases.

Also flagged:bisamidinePolyglutamine (polyQ) diseasesneurodegenerative disordersdeathPolyQ diseasesautophagy
Journal Article 2018-12-28 ✓ 1 Snippet Hong H, Koon AC, Chen ZS, Wei Y, An Y, Li W, Lau MHY, Lau KF, Ngo JCK, Wong CH, Au-Yeung HY, Zimmerman SC, Chan HYE.
In-Text Gene Mentions

Htt

Show Full Abstract

Polyglutamine (polyQ) diseases are a group of dominantly inherited neurodegenerative disorders caused by the expansion of an unstable <i>CAG</i> repeat in the coding region of the affected genes. Hallmarks of polyQ diseases include the accumulation of misfolded protein aggregates, leading to neuronal degeneration and cell death. PolyQ diseases are currently incurable, highlighting the urgent need for approaches that inhibit the formation of disaggregate cytotoxic polyQ protein inclusions. Here, we screened for bisamidine-based inhibitors that can inhibit neuronal polyQ protein inclusions. We demonstrated that one inhibitor, AQAMAN, prevents polyQ protein aggregation and promotes de-aggregation of self-assembled polyQ proteins in several models of polyQ diseases. Using immunocytochemistry, we found that AQAMAN significantly reduces polyQ protein aggregation and specifically suppresses polyQ protein-induced cell death. Using a recombinant and purified polyQ protein (thioredoxin-Huntingtin-Q46), we further demonstrated that AQAMAN interferes with polyQ self-assembly, preventing polyQ aggregation, and dissociates preformed polyQ aggregates in a cell-free system. Remarkably, AQAMAN feeding of <i>Drosophila</i> expressing expanded polyQ disease protein suppresses polyQ-induced neurodegeneration <i>in vivo</i> In addition, using inhibitors and activators of the autophagy pathway, we demonstrated that AQAMAN's cytoprotective effect against polyQ toxicity is autophagy-dependent. In summary, we have identified AQAMAN as a potential therapeutic for combating polyQ protein toxicity in polyQ diseases. Our findings further highlight the importance of the autophagy pathway in clearing harmful polyQ proteins.

Also flagged:V5Biliary tract cancerTumorsKRASNRAScancer
Journal Article 2018-12-28 No Snippets Yoon KA, Woo SM, Kim YH, Kong SY, Han SS, Park SJ, Lee WJ.
Show Full Abstract

Biliary tract cancer (BTC) is one of the rare cancers and associated with poor prognosis. To understand genetic characteristics of BTC, we analyzed whole exome sequencing (WES) data and identified somatic mutations in the patients with BTC. Tumors and matched blood or normal samples were obtained from seven patients with cholangiocarcinoma who were underwent surgical resection. We discovered inactivating mutations of tumor suppressor genes including APC, TP53, and ARID1A genes in three patients. Activating mutations of KRAS and NRAS were also identified. Our analyses identified somatic mutations of Korean patients with BTC.

Also flagged:canceranemiairontumorscancer related anemiarespiratory disorders
Journal Article 2018-12-28 ✓ 1 Snippet Dang Z, Liu X, Wang X, Li M, Jiang Y, Wang X, Yang Z.
In-Text Gene Mentions

…6 However,hemochromatosisor cell injury…

Show Full Abstract

A systematic review and meta-analysis of previous randomized controlled trials of traditional Chinese medicine (TCM) supporting Qi and enriching blood in the treatment of cancer related anemia (CRA) in patients not receiving chemoradiotherapy were conducted. A total of 13 randomized controlled trials were included. Compared with the control group, better improvement was found for the level of hemoglobin (mean difference=4.57, 95% CI [1.38, 7.76], <i>P</i>=0.005) and overall therapeutic effect (risk ratio [RR]=1.31, 95% CI [1.18, 1.46], <i>P</i><0.000) in the TCM groups. The incidence of related adverse events was not increased in the TCM groups (RR=0.54, 95% CI [0.29, 0.99], <i>P</i>=0.05). However, due to the relatively low quality and the small sample sizes of the included studies, the results should be interpreted with a degree of caution. Nevertheless, TCM with the role of supporting Qi and enriching blood may be a safe and effective treatment for CRA in patients not receiving chemoradiotherapy and might be considered as an alternative treatment to conventional western medicine including iron supplements and erythropoietin.

Also flagged:schizophreniaserotonin-transporterSLC6A4brain dysfunctionpathogenesis5-hydroxytryptamine
Journal Article 2018-12-28 ✓ 5 Snippets Xu FL, Wang BJ, Yao J.
In-Text Gene Mentions

Pharmacological evidence indicated that 5-HTT was a site of action for several drugs with central nervous system effects10,11 and that 5-HTT was involved in the pathogenesis of schizophrenia.12,13 Therefore, the SLC6A4 gene is a candidate gene for the pathogenesis of schizophrenia.

…The serotonin transporter (5-HTT) has a crucial…

…that levels of5-HTTchange in schizophrenic…

…evidence indicated that5-HTTwas a site…

…11 and that5-HTTwas involved in…

Show Full Abstract

<h4>Background</h4>In order to explore the association between the <i>SLC6A4</i> gene and the risk of schizophrenia, an updated meta-analysis was conducted using a total of 46 scientific articles.<h4>Methods</h4>Through a literature search, papers studied included 35 articles on serotonin-transporter-linked polymorphic region (5-HTTLPR) with 8,752 cases and 10,610 controls, 17 articles on second intron variable number of tandem repeats with 7,284 cases and 8,544 controls, four studies on rs1042173 with 1,351 cases and 2,101 controls, and four studies on rs140700 with 1,770 cases and 2,386 controls. Pooled, subgroup, and sensitivity analyses were performed, and the results were visualized by forest and funnel plots.<h4>Results</h4>An association between 5-HTTLPR and the risk of schizophrenia was not found, except for an Indian subgroup analysis (<i>P<sub>z</sub></i> =0.014, OR =1.749, 95% CI =1.120-2.731). A 10 repeats/12 repeats (10R/12R) genotype was a protective factor against schizophrenia (<i>P<sub>z</sub></i> =0.020, OR =0.789, 95% CI =0.646-0.963), but a 12R/12R genotype was a risk factor for schizophrenia (<i>P<sub>z</sub></i> =0.004, OR =1.936, 95% CI =1.238-3.029) in the pooled analyses. In Caucasians, a GG genotype of rs1042173 may be a risk factor for schizophrenia (<i>P<sub>z</sub></i> =0.006, OR =1.299, 95% CI =1.079-1.565). No association was found between rs140700 and the risk for schizophrenia.<h4>Conclusion</h4>Through meta-analysis, we were able to gain insight into previously reported associations between SLC6A4 polymorphism and schizophrenia.

Also flagged:DEAD-box helicase 27tumortumorsDEAD-box RNA helicasecancercolorectal cancer
Journal Article 2018-12-28 ✓ 5 Snippets Yang C, Li D, Bai Y, Song S, Yan P, Wu R, Zhang Y, Hu G, Lin C, Li X, Huang L.
In-Text Gene Mentions

DEAD-box helicase 27 (DDX27) is a member of the DEAD-box RNA helicase family, and there have been only a few studies on DDX27 function in cancer cells.

We found that the knockdown of DDX27 increased the sensitivity to 5-FU and decreased the proliferation, sphere formation, gene expression of known CSC markers (CD44, CD133, EpCAM, LGR5), as well as the tumor-initiating potential of CRC cells.

Importantly, the silencing of DDX27 can weaken the tumor-initiating potential of CRC cells in vivo.

Sphere-formation assay and subcutaneous tumor-formation assay in immunodeficient mice are two different approaches that have typically been used to evaluate CSC phenotype and activity in published studies.19 These two approaches were used, and we determined that the knockdown of DDX27 expression in CRC cells reduced the self-renewing capacity of CSCs both in vitro and in vivo.

The information obtained from the Catalog Of Somatic Mutations In Cancer (COSMIC) database showed that DDX27 ranked fourth among the top ten genes, which were overexpressed in CRC samples, and large intestine cancer tissues had the highest overexpression percentages in various cancer samples (Figure 1A and B).

Show Full Abstract

<h4>Background</h4>Cancer stem cells (CSCs) are responsible for all important characteristics of tumors. DEAD-box helicase 27 (DDX27) is a member of the DEAD-box RNA helicase family, and there have been only a few studies on DDX27 function in cancer cells. This study is aimed at exploring whether DDX27 has any relation to tumorigenesis of colorectal cancer (CRC) and elucidating the potential mechanism.<h4>Methods</h4>Data from Catalog Of Somatic Mutations In Cancer, Gene Expression Omnibus, and The Cancer Genome Atlas databases reveal that DDX27 is overexpressed in CRC tissues. qRT-PCR and Western blots were used to evaluate the expression level of DDX27 in 40 paired clinical CRC samples. DDX27 was knockdown in HT29 and HCT116 cell line with shRNA. Then CCK-8, colony formation assay and flow cytometry assay were performed to examine proliferative ability, cell cycle and sensitivity to 5-fluorouracil. Sphere-formation assay and in vivo subcutaneous tumor-formation assay were used to assess self-renewal in vitro and vivo as well as the tumor-initiating potential.<h4>Results</h4>DDX27 is upregulated in CRC tissues and downregulation of DDX27 inhibits proliferation of colorectal cancer cell and promotes sensitivity to 5-fluorouracil. Downregulation of DDX27 can downregulate the gene expression of known CSC markers in CRC cells, inhibit sphere-formation ability, and promote colonosphere differentiation. Downregulation of DDX27 in CSCs can decrease the tumor-initiating ability of CRC cells in vivo.<h4>Conclusion</h4>DDX27 may play a tumorpromoter role of CRC by regulating the stem cell-like activity of CRC cells.

Also flagged:pseudoexfoliation syndromeextracellularglaucomablindnessAlzheimer diseaseheart disease
Journal Article 2018-12-28 ✓ 3 Snippets Sharma S, Chataway T, Klebe S, Griggs K, Martin S, Chegeni N, Dave A, Zhou T, Ronci M, Voelcker NH, Mills RA, Craig JE.
In-Text Gene Mentions

…a patient withhemochromatosiswere used as…

…a patient withhemochromatosis, used as positive…

…PRDX1, PRDX4, andPRDX6are members of…

Show Full Abstract

<h4>Purpose</h4>Pseudoexfoliation (PEX) syndrome is an age-related progressive disease of the extracellular matrix with ocular manifestations. PEX is clinically diagnosed by the presence of extracellular exfoliative deposits on the anterior surface of the ocular lens. PEX syndrome is a major risk factor for developing glaucoma, the leading cause of irreversible blindness in the world, and is often associated with the development of cataract. PEX reportedly coexists with Alzheimer disease and increases the risk of heart disease and stroke. PEX material deposited on the anterior surface of the ocular lens is highly proteinaceous, complex, and insoluble, making deciphering the protein composition of the material challenging. Thus, to date, only a small proportion of the protein composition of PEX material is known. The aim of this study was to decipher the protein composition of pathological PEX material deposited on the ocular lens in patients and advance the understanding of pathophysiology of PEX syndrome.<h4>Methods</h4>Liquid-chromatography and tandem mass spectrometry (LC-MS/MS) was employed to discover novel proteins in extracts of neat PEX material surgically isolated from patients (n = 4) with PEX syndrome undergoing cataract surgery. A sub-set of the identified proteins was validated with immunohistochemistry using lens capsule specimens from independent patients (n=3); lens capsules from patients with cataract but without PEX syndrome were used as controls (n=4). Expression of transcripts of the validated proteins in the human lens epithelium was analyzed with reverse transcription PCR (RT-PCR). Functional relationships among the proteins identified in this study and genes and proteins previously implicated in the disease were bioinformatically determined using InnateDB.<h4>Results</h4>Peptides corresponding to 66 proteins, including ten proteins previously known to be present in PEX material, were identified. Thirteen newly identified proteins were chosen for validation. Of those proteins, 12 were found to be genuine components of the material. The novel protein constituents include apolipoproteins (APOA1 and APOA4), stress response proteins (CRYAA and PRDX2), and blood-related proteins (fibrinogen and hemoglobin subunits), including iron-free hemoglobin. The gene expression data suggest that the identified stress-response proteins and hemoglobin are contributed by the lens epithelium and apolipoproteins and fibrinogen by the aqueous humor to the PEX material. Pathway analysis of the identified novel protein constituents and genes or proteins previously implicated in the disease reiterated the involvement of extracellular matrix organization and degradation, elastic fiber formation, and complement cascade in PEX syndrome. Network analysis suggested a central role of fibronectin in the pathophysiology of the disease. The identified novel protein constituents of PEX material also shed light on the molecular basis of the association of PEX syndrome with heart disease, stroke, and Alzheimer disease.<h4>Conclusions</h4>This study expands the understanding of the protein composition of pathological PEX material deposited on the ocular lens in patients with PEX syndrome and provides useful insights into the pathophysiology of this disease. This study together with the previous study by our group (Sharma et al. Experimental Eye Research 2009;89(4):479-85) demonstrate that using neat PEX material, devoid of the underlying lens capsule, for proteomics analysis is an effective approach for deciphering the protein composition of complex and highly insoluble extracellular pathological ocular deposits present in patients with PEX syndrome.

Also flagged:Undifferentiated pleomorphic sarcoma of bonebone sarcomabone sarcomaschondrosarcomaosteosarcomatumours
Journal Article 2018-12-27 ✓ 1 Snippet Ali NM, Niada S, Brini AT, Morris MR, Kurusamy S, Alholle A, Huen D, Antonescu CR, Tirode F, Sumathi V, Latif F.
In-Text Gene Mentions

histone chaperone complex

Show Full Abstract

Undifferentiated pleomorphic sarcoma of bone (UPSb) is a rare primary bone sarcoma that lacks a specific line of differentiation. There is very little information about the genetic alterations leading to tumourigenesis or malignant transformation. Distinguishing between UPSb and other malignant bone sarcomas, including dedifferentiated chondrosarcoma and osteosarcoma, can be challenging due to overlapping features. To explore the genomic and transcriptomic landscape of UPSb tumours, whole-exome sequencing (WES) and RNA sequencing (RNA-Seq) were performed on UPSb tumours. All tumours lacked hotspot mutations in IDH1/2 132 or 172 codons, thereby excluding the diagnosis of dedifferentiated chondrosarcoma. Recurrent somatic mutations in TP53 were identified in four of 14 samples (29%). Moreover, recurrent mutations in histone chromatin remodelling genes, including H3F3A, ATRX and DOT1L, were identified in five of 14 samples (36%), highlighting the potential role of deregulated chromatin remodelling pathways in UPSb tumourigenesis. The majority of recurrent mutations in chromatin remodelling genes identified here are reported in COSMIC, including the H3F3A G34 and K36 hotspot residues. Copy number alteration analysis identified gains and losses in genes that have been previously altered in UPSb or UPS of soft tissue. Eight somatic gene fusions were identified by RNA-Seq, two of which, CLTC-VMP1 and FARP1-STK24, were reported previously in multiple cancers. Five gene fusions were genomically characterised. Hierarchical clustering analysis, using RNA-Seq data, distinctly clustered UPSb tumours from osteosarcoma and other sarcomas, thus molecularly distinguishing UPSb from other sarcomas. RNA-Seq expression profiling analysis and quantitative reverse transcription-polymerase chain reaction showed an elevated expression in FGF23, which can be a potential molecular biomarker for UPSb. To our knowledge, this study represents the first comprehensive WES and RNA-Seq analysis of UPSb tumours revealing novel protein-coding recurrent gene mutations, gene fusions and identifying a potential UPSb molecular biomarker, thereby broadening the understanding of the pathogenic mechanisms and highlighting the possibility of developing novel targeted therapeutics. Copyright © 2018 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Also flagged:RNA helicaseDHX37ribosomecancergenetic diseasesribosomopathies
Journal Article 2018-12-27 ✓ 1 Snippet Choudhury P, Hackert P, Memet I, Sloan KE, Bohnsack MT, Bohnsack MT.
In-Text Gene Mentions

…helicases DDX51 andDDX27are implicated in…

Show Full Abstract

Ribosome synthesis is an essential cellular process, and perturbation of human ribosome production is linked to cancer and genetic diseases termed ribosomopathies. During their assembly, pre-ribosomal particles undergo numerous structural rearrangements, which establish the architecture present in mature complexes and serve as key checkpoints, ensuring the fidelity of ribosome biogenesis. RNA helicases are essential mediators of such remodelling events and here, we demonstrate that the DEAH-box RNA helicase DHX37 is required for maturation of the small ribosomal subunit in human cells. Our data reveal that the presence of DHX37 in early pre-ribosomal particles is monitored by a quality control pathway and that failure to recruit DHX37 leads to pre-rRNA degradation. Using an in vivo crosslinking approach, we show that DHX37 binds directly to the U3 small nucleolar RNA (snoRNA) and demonstrate that the catalytic activity of the helicase is required for dissociation of the U3 snoRNA from pre-ribosomal complexes. This is an important event during ribosome assembly as it enables formation of the central pseudoknot structure of the small ribosomal subunit. We identify UTP14A as a direct interaction partner of DHX37 and our data suggest that UTP14A can act as a cofactor that stimulates the activity of the helicase in the context of U3 snoRNA release.

Also flagged:adenine nucleotidemetabolismHuntington's diseaseHDneurodegenerative disorderendocytosis
Journal Article 2018-12-27 ✓ 2 Snippets Toczek M, Pierzynowska K, Kutryb-Zajac B, Gaffke L, Slominska EM, Slominska EM, Wegrzyn G, Smolenski RT.
In-Text Gene Mentions

Huntington's disease (HD) is a neurodegenerative disorder that is caused by expanded CAG repeats within the exon-1 of the huntingtin (HTT) gene.

…of the huntingtin (HTT) gene.…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder that is caused by expanded CAG repeats within the exon-1 of the huntingtin (HTT) gene. It has been shown that HTT interacts with the proteins involved in the gene transcription, endocytosis and metabolism, nevertheless the biochemical pathways by which mutant HTT causes a cellular dysfunction remain unclear. Thus, this study aimed to establish the role of mutant HTT expansion in energy and nucleotide metabolism deteriorations. We examined HEK 293 T cell line transfected with plasmids expressing wild-type (control) or mutant exon 1 of the HTT gene (HD). Analysis of intracellular concentration of adenosine triphosphate (ATP) and nicotinamide adenine dinucleotide (NAD<sup>+</sup>), as well as activities of intra- and extracellular enzymes of nucleotide catabolism (such as adenine monophosphate deaminase (AMPD), adenosine deaminase (ADA), purine nucleoside phosphorylase (PNP) and ectonucleoside triphosphate diphosphohydrolase (eNTPD), ecto-5'-nucleotidase (e5NT), ecto-adenosine deaminase (eADA) were performed with high pressure liquid chromatography. Protein concentration was measured with Bradford method. We found diminished intracellular ATP concentration (22.5 ± 1.7 in HD; 29.3 ± 1.4 nmol/mg protein in control), increased ADA activity (27.9 ± 1.0 in HD; 21.1 ± 1.6 nmol/min/mg protein in control) and reduced activities of eNTPD (2.4 ± 0.5 in HD; 5.8 ± 0.7 nmol/min/mg protein in control), e5NT (0.1 ± 0.01 in HD; 0.2 ± 0.01 nmol/min/mg protein in control) and eADA (0.3 ± 0.03 in HD; 0.4 ± 0.04 nmol/min/mg protein in control) while NAD<sup>+</sup> concentration, AMPD and PNP activities remained unchanged. This study highlights that the mutant HTT expansion resulted in depletion of cellular ATP concentration and reduced rates of extracellular nucleotide breakdown. In conclusion, such changes may contribute to the pathology of HD.

Also flagged:tumorcolorectal cancerpolymerasecancerpathogenesiscell proliferation
Journal Article 2018-12-27 ✓ 3 Snippets Li XN, Wang ZJ, Wang ZJ, Ye CX, Zhao BC, Li ZL, Yang Y.
In-Text Gene Mentions

Moreover, the results of KEGG analysis revealed that the host genes of significantly dysregulated circRNAs were involved in many important CRC-related pathways such as Deleted in Colorectal Carcinoma (DCC) mediated attractive signaling, Netrin-1 signaling, Loss of Function of SMAD2/3 in Cancer, SMAD2/3 MH2 Domain Mutants in Cancer, TGFBR1 LBD Mutants in Cancer, SMAD4 MH2 Domain Mutants in Cancer, and Loss of Function of SMAD4 in Cancer [30–33].

The host genes of differentially expressed circRNAs were mainly associated with superpathway of inositol phosphate compounds, FoxO signaling pathway, valine degradation, etc. Notably, the host genes of differentially expressed circRNAs were associated with important CRC-related pathways, such as Deleted in Colorectal Carcinoma (DCC) mediated attractive signaling, Netrin-1 signaling, Loss of Function of SMAD2/3 in Cancer, SMAD2/3 MH2 Domain Mutants in Cancer, TGFBR1 LBD Mutants in Cancer, SMAD4 MH2 Domain Mutants in Cancer, and Loss of Function of SMAD4 in Cancer.

…in Colorectal Carcinoma (DCC) mediated attractive signalin…

Show Full Abstract

<h4>Background</h4>Circular RNA (circRNA) is a novel class of noncoding RNAs with functions in various pathophysiological activities. However, the expression profiles and functions of circRNAs in colorectal cancer (CRC) remain largely unknown.<h4>Methods</h4>High-throughput RNA sequencing (RNA-seq) was performed to assess circRNA expression profiles in 4 paired CRC tissues, and significantly dysregulated circRNAs were validated by quantitative real-time polymerase chain reaction (qRT-PCR). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed to predict the potential functions of dysregulated circRNAs. Target miRNAs of circRNAs were predicted using miRanda software, and were further analyzed combining DIANA-miRPath v.3 platform (Reverse Search module) with KEGG pathways of COLORECTAL CANCER and MicroRNAs in cancer (Entry: map05210 and map05206). CircRNA-miRNA interaction networks were constructed using Cytoscape software. Expression levels of a significantly down-regulated circRNA, circDDX17 (hsa_circ_0002211), was detected by qRT-PCR in 60 paired CRC tissues. CircDDX17 was knockdown by siRNA, and the biological functions of circDDX17 were examined in CRC cell lines.<h4>Results</h4>Totally 448 differentially expressed circRNAs were identified, including 394 up-regulated and 54 down-regulated circRNAs. qRT-PCR validation confirmed the reliability of the RNA-Seq data. GO and KEGG analyses revealed that these dysregulated circRNAs were potentially implicated in CRC pathogenesis. Analyses by combining miRanda and miRPath softwares with KEGG pathways suggested that the miRNAs targeted by the top 10 dysregulated circRNAs were associated with the KEGG pathways of COLORECTAL CANCER and MicroRNAs in cancer, indicating that circRNA-miRNA interactions might play important functional roles in the initiation and progression of CRC. The results of qRT-PCR for circDDX17 in 60 paired CRC tissues showed that circDDX17 was significantly down-regulated in CRC tissues and associated with unfavorable clinicopathological parameters. In vitro experiments showed that silencing of circDDX17 promoted CRC cell proliferation, migration, invasion, and inhibited apoptosis.<h4>Conclusions</h4>In conclusion, we have identified numerous circRNAs that are dysregulated in CRC tissues compared with adjacent normal mucosa tissues. Bioinformatic analyses suggested that these dysregulated circRNAs might play important functional roles in CRC tumorigenesis. CircDDX17 functions as a tumor suppressor and could serve as a potential biomarker and a therapeutic target for CRC.

Also flagged:medulloblastomaPtchForetinibNucleic acidtumourcancer
Journal Article 2018-12-27 ✓ 1 Snippet Bertrand KC, Faria CC, Skowron P, Luck A, Garzia L, Wu X, Agnihotri S, Smith CA, Taylor MD, Mack SC, Rutka JT.
In-Text Gene Mentions

…, Flt4 ,Mllt10, and Asxl2…

Show Full Abstract

No abstract available.

Iron Metabolism in Cancer.

Also flagged:cell growthironlipidtumormetabolismcancer
Journal Article 2018-12-27 ✓ 1 Snippet Wang Y, Yu L, Ding J, Chen Y.
In-Text Gene Mentions

More iron-related proteins participating in tumor metastasis and angiogenesis include follows: collagen lysyl hydroxylases (LH1-3), a Fe2+- and 2-oxoglutarate (2-OG)-dependent oxygenases can maintain extracellular matrix homeostasis and cell migration potential [119]; β2-microglobulin (β2-M) interacts with its receptor, hemochromatosis (HFE) protein, stimulates iron responsive HIF-1α signaling pathway and promotes cancer bone and soft tissue migration [120]; inflammatory mediator Lcn2 increases tube formation, cell migration, and angiogenesis in rat brain endothelial cells via iron and ROS-dependent mechanisms [121].

Show Full Abstract

Demanded as an essential trace element that supports cell growth and basic functions, iron can be harmful and cancerogenic though. By exchanging between its different oxidized forms, iron overload induces free radical formation, lipid peroxidation, DNA, and protein damages, leading to carcinogenesis or ferroptosis. Iron also plays profound roles in modulating tumor microenvironment and metastasis, maintaining genomic stability and controlling epigenetics. in order to meet the high requirement of iron, neoplastic cells have remodeled iron metabolism pathways, including acquisition, storage, and efflux, which makes manipulating iron homeostasis a considerable approach for cancer therapy. Several iron chelators and iron oxide nanoparticles (IONPs) has recently been developed for cancer intervention and presented considerable effects. This review summarizes some latest findings about iron metabolism function and regulation mechanism in cancer and the application of iron chelators and IONPs in cancer diagnosis and therapy.

Also flagged:chromatincell differentiationdeterminationBmp2Disorders of Sexual Developmentchromosomal
Journal Article 2018-12-27 No Snippets Garcia-Moreno SA, Futtner CR, Salamone IM, Gonen N, Lovell-Badge R, Maatouk DM.
Show Full Abstract

Cis-regulatory elements are critical for the precise spatiotemporal regulation of genes during development. However, identifying functional regulatory sites that drive cell differentiation in vivo has been complicated by the high numbers of cells required for whole-genome epigenetic assays. Here, we identified putative regulatory elements during sex determination by performing ATAC-seq and ChIP-seq for H3K27ac in purified XX and XY gonadal supporting cells before and after sex determination in mice. We show that XX and XY supporting cells initiate sex determination with similar chromatin landscapes and acquire sex-specific regulatory elements as they commit to the male or female fate. To validate our approach, we identified a functional gonad-specific enhancer downstream of Bmp2, an ovary-promoting gene. This work increases our understanding of the complex regulatory network underlying mammalian sex determination and provides a powerful resource for identifying non-coding regulatory elements that could harbor mutations that lead to Disorders of Sexual Development.

Also flagged:MitochondriamitochondrialglucoseinsulinIRND3
Journal Article 2018-12-27 No Snippets Kraja AT, Liu C, Fetterman JL, Graff M, Have CT, Gu C, Yanek LR, Feitosa MF, Arking DE, Chasman DI, Young K, Ligthart S, Hill WD, Weiss S, Luan J, Giulianini F, Li-Gao R, Hartwig FP, Lin SJ, Wang L, Richardson TG, Yao J, Fernandez EP, Ghanbari M, Wojczynski MK, Lee WJ, Argos M, Armasu SM, Barve RA, Ryan KA, An P, Baranski TJ, Bielinski SJ, Bowden DW, Broeckel U, Christensen K, Chu AY, Corley J, Cox SR, Uitterlinden AG, Rivadeneira F, Cropp CD, Daw EW, van Heemst D, de las Fuentes L, Gao H, Tzoulaki I, Ahluwalia TS, de Mutsert R, Emery LS, Erzurumluoglu AM, Perry JA, Fu M, Forouhi NG, Gu Z, Hai Y, Harris SE, Hemani G, Hunt SC, Irvin MR, Jonsson AE, Justice AE, Kerrison ND, Larson NB, Lin KH, Love-Gregory LD, Mathias RA, Lee JH, Nauck M, Noordam R, Ong KK, Pankow J, Patki A, Pattie A, Petersmann A, Qi Q, Ribel-Madsen R, Rohde R, Sandow K, Schnurr TM, Sofer T, Starr JM, Taylor AM, Teumer A, Timpson NJ, de Haan HG, Wang Y, Weeke PE, Williams C, Wu H, Yang W, Zeng D, Witte DR, Weir BS, Wareham NJ, Vestergaard H, Turner ST, Torp-Pedersen C, Stergiakouli E, Sheu WH, Rosendaal FR, Ikram MA, Franco OH, Ridker PM, Perls TT, Pedersen O, Nohr EA, Newman AB, Linneberg A, Langenberg C, Kilpeläinen TO, Kardia SLR, Jørgensen ME, Jørgensen T, Sørensen TIA, Homuth G, Hansen T, Goodarzi MO, Deary IJ, Christensen C, Chen YI, Chakravarti A, Brandslund I, Bonnelykke K, Taylor KD, Wilson JG, Rodriguez S, Davies G, Horta BL, Thyagarajan B, Rao DC, Grarup N, Davila-Roman VG, Hudson G, Guo X, Arnett DK, Hayward C, Vaidya D, Mook-Kanamori DO, Tiwari HK, Levy D, Loos RJF, Dehghan A, Elliott P, Malik AN, Scott RA, Becker DM, de Andrade M, Province MA, Meigs JB, Rotter JI, North KE.
Show Full Abstract

Mitochondria (MT), the major site of cellular energy production, are under dual genetic control by 37 mitochondrial DNA (mtDNA) genes and numerous nuclear genes (MT-nDNA). In the CHARGEmtDNA+ Consortium, we studied genetic associations of mtDNA and MT-nDNA associations with body mass index (BMI), waist-hip-ratio (WHR), glucose, insulin, HOMA-B, HOMA-IR, and HbA1c. This 45-cohort collaboration comprised 70,775 (insulin) to 170,202 (BMI) pan-ancestry individuals. Validation and imputation of mtDNA variants was followed by single-variant and gene-based association testing. We report two significant common variants, one in MT-ATP6 associated (p ≤ 5E-04) with WHR and one in the D-loop with glucose. Five rare variants in MT-ATP6, MT-ND5, and MT-ND6 associated with BMI, WHR, or insulin. Gene-based meta-analysis identified MT-ND3 associated with BMI (p ≤ 1E-03). We considered 2,282 MT-nDNA candidate gene associations compiled from online summary results for our traits (20 unique studies with 31 dataset consortia's genome-wide associations [GWASs]). Of these, 109 genes associated (p ≤ 1E-06) with at least 1 of our 7 traits. We assessed regulatory features of variants in the 109 genes, cis- and trans-gene expression regulation, and performed enrichment and protein-protein interactions analyses. Of the identified mtDNA and MT-nDNA genes, 79 associated with adipose measures, 49 with glucose/insulin, 13 with risk for type 2 diabetes, and 18 with cardiovascular disease, indicating for pleiotropic effects with health implications. Additionally, 21 genes related to cholesterol, suggesting additional important roles for the genes identified. Our results suggest that mtDNA and MT-nDNA genes and variants reported make important contributions to glucose and insulin metabolism, adipocyte regulation, diabetes, and cardiovascular disease.

Also flagged:Chromatincell cycletumorsilencingnucleosomestem cell
Journal Article 2018-12-27 ✓ 5 Snippets Swygert SG, Kim S, Wu X, Fu T, Hsieh TH, Rando OJ, Eisenman RN, Shendure J, McKnight JN, Tsukiyama T.
In-Text Gene Mentions

Condensin-Dependent Chromatin Compactio…

Condensindepletion prevents the…

Condensin’s role in chromatin…

Condensin

DCC

Show Full Abstract

Quiescence is a stress-resistant state in which cells reversibly exit the cell cycle and suspend most processes. Quiescence is essential for stem cell maintenance, and its misregulation is implicated in tumor formation. One of the hallmarks of quiescent cells is highly condensed chromatin. Because condensed chromatin often correlates with transcriptional silencing, it has been hypothesized that chromatin compaction represses transcription during quiescence. However, the technology to test this model by determining chromatin structure within cells at gene resolution has not previously been available. Here, we use Micro-C XL to map chromatin contacts at single-nucleosome resolution genome-wide in quiescent Saccharomyces cerevisiae cells. We describe chromatin domains on the order of 10-60 kilobases that, only in quiescent cells, are formed by condensin-mediated loops. Condensin depletion prevents the compaction of chromatin within domains and leads to widespread transcriptional de-repression. Finally, we demonstrate that condensin-dependent chromatin compaction is conserved in quiescent human fibroblasts.

Also flagged:Translationrocaglamide Aeukaryotic translation initiation factor 4AeIF4Apolypurinetranslation factor
Journal Article 2018-12-27 ✓ 1 Snippet Iwasaki S, Iwasaki W, Takahashi M, Sakamoto A, Watanabe C, Shichino Y, Floor SN, Fujiwara K, Mito M, Dodo K, Sodeoka M, Imataka H, Honma T, Fukuzawa K, Ito T, Ingolia NT.
In-Text Gene Mentions

DCC

Show Full Abstract

A class of translation inhibitors, exemplified by the natural product rocaglamide A (RocA), isolated from Aglaia genus plants, exhibits antitumor activity by clamping eukaryotic translation initiation factor 4A (eIF4A) onto polypurine sequences in mRNAs. This unusual inhibitory mechanism raises the question of how the drug imposes sequence selectivity onto a general translation factor. Here, we determined the crystal structure of the human eIF4A1⋅ATP analog⋅RocA⋅polypurine RNA complex. RocA targets the "bi-molecular cavity" formed characteristically by eIF4A1 and a sharply bent pair of consecutive purines in the RNA. Natural amino acid substitutions found in Aglaia eIF4As changed the cavity shape, leading to RocA resistance. This study provides an example of an RNA-sequence-selective interfacial inhibitor fitting into the space shaped cooperatively by protein and RNA with specific sequences.

Also flagged:TumorcancerCD4CD8melanomatumors
Journal Article 2018-12-27 ✓ 1 Snippet Li H, van der Leun AM, Yofe I, Lubling Y, Gelbard-Solodkin D, van Akkooi ACJ, van den Braber M, Rozeman EA, Haanen JBAG, Blank CU, Horlings HM, David E, Baran Y, Bercovich A, Lifshitz A, Schumacher TN, Tanay A, Amit I.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Tumor immune cell compositions play a major role in response to immunotherapy, but the heterogeneity and dynamics of immune infiltrates in human cancer lesions remain poorly characterized. Here, we identify conserved intratumoral CD4 and CD8 T cell behaviors in scRNA-seq data from 25 melanoma patients. We discover a large population of CD8 T cells showing continuous progression from an early effector "transitional" into a dysfunctional T cell state. CD8 T cells that express a complete cytotoxic gene set are rare, and TCR sharing data suggest their independence from the transitional and dysfunctional cell states. Notably, we demonstrate that dysfunctional T cells are the major intratumoral proliferating immune cell compartment and that the intensity of the dysfunctional signature is associated with tumor reactivity. Our data demonstrate that CD8 T cells previously defined as exhausted are in fact a highly proliferating, clonal, and dynamically differentiating cell population within the human tumor microenvironment.

Also flagged:SPOPNanogProstate CancertumordegradationSox2
Journal Article 2018-12-27 ✓ 1 Snippet Zhang J, Chen M, Zhu Y, Dai X, Dang F, Ren J, Ren S, Shulga YV, Beca F, Gan W, Wu F, Lin YM, Zhou X, DeCaprio JA, Beck AH, Lu KP, Huang J, Zhao C, Sun Y, Gao X, Pandolfi PP, Wei W.
In-Text Gene Mentions

KLHL20

Show Full Abstract

Frequent SPOP mutation defines the molecular feature underlying one of seven sub-types of human prostate cancer (PrCa). However, it remains largely elusive how SPOP functions as a tumor suppressor in PrCa. Here, we report that SPOP suppresses stem cell traits of both embryonic stem cells and PrCa cells through promoting Nanog poly-ubiquitination and subsequent degradation. Mechanistically, Nanog, but not other pluripotency-determining factors including Oct4, Sox2, and Klf4, specifically interacts with SPOP via a conservative degron motif. Importantly, cancer-derived mutations in SPOP or at the Nanog-degron (S68Y) disrupt SPOP-mediated destruction of Nanog, leading to elevated cancer stem cell traits and PrCa progression. Notably, we identify the Pin1 oncoprotein as an upstream Nanog regulator that impairs its recognition by SPOP and thereby stabilizes Nanog. Thus, Pin1 inhibitors promote SPOP-mediated destruction of Nanog, which provides the molecular insight and rationale to use Pin1 inhibitor(s) for targeted therapies of PrCa patients with wild-type SPOP.

Also flagged:colon cancermalignant neoplasmsGene Expressioncolon cancersWntretinol
Journal Article 2018-12-27 No Snippets Yang W, Ma J, Zhou W, Li Z, Zhou X, Cao B, Zhang Y, Liu J, Yang Z, Zhang H, Zhao Q, Hong L, Fan D.
Show Full Abstract

<h4>Background</h4>Colon cancer is one of the leading malignant neoplasms worldwide. Until now, the concrete mechanisms of colonic cancerogenesis are largely unknown; identification of driven genes and pathways is, therefore, of great importance for monitoring and conquering this disease. This study aims to explore the potential biomarkers and therapeutic targets for colon cancer treatment.<h4>Methods</h4>The gene expression profile of GSE44076 from Gene Expression Omnibus database, including 98 primary colon cancers and 98 normal distant colon mucosa, was deeply analyzed. GEO2R tool was used to screen the differentially expressed genes (DEGs) between colon cancer tissues and normal samples. Gene Ontology analysis and Kyoto Encyclopedia of Genes and Genomes pathway analysis were performed for screening DEGs using Database for Annotation, Visualization and Integrated Discovery database and Panther database. Moreover, Search Tool for the Retrieval of Interacting Genes, Cytoscape software, and Molecular Complex Detection plug-in were used to visualize the protein-protein interaction of these DEGs.<h4>Results</h4>A total of 497 DEGs were obtained, including 129 upregulated genes mainly enriched in Hippo signaling pathway, Wnt signaling pathway, and cytokine-cytokine receptor interaction and 368 downregulated genes enriched in retinol metabolism, steroid hormone biosynthesis, drug metabolism, and chemical carcinogenesis. Using Molecular Complex Detection software, three important modules were selected from the protein-protein interaction network. Moreover, 20 hub genes with high degree of connectivity were selected, including COL1A1, CXCL5, GNG4, TIMP1, and so on. The Kaplan-Meier analysis for overall survival and correlation analysis were applied among the hub genes.<h4>Conclusion</h4>Taken together, DEGs, especially the hub genes such as COL1A1, might be the driven genes in colon cancer progression. More importantly, they might be the novel biomarkers for diagnosis and guiding therapeutic strategies of colon cance<b>r.</b>

Also flagged:hydroxyapatiteNanomaterialssynthesistransportationbiotoxicitymetabolism
Journal Article 2018-12-27 No Snippets Oberbek P, Bolek T, Chlanda A, Hirano S, Kusnieruk S, Rogowska-Tylman J, Nechyporenko G, Zinchenko V, Zinchenko V, Swieszkowski W, Puzyn T.
Show Full Abstract

Nanomaterials, such as hydroxyapatite nanoparticles show a great promise for medical applications due to their unique properties at the nanoscale. However, there are concerns about the safety of using these materials in biological environments. Despite a great number of published studies of nanoobjects and their aggregates or agglomerates, the impact of their physicochemical properties (such as particle size, surface area, purity, details of structure and degree of agglomeration) on living cells is not yet fully understood. Significant differences in these properties, resulting from different manufacturing methods, are yet another problem to be taken into consideration. The aim of this work was to investigate the correlation between the properties of nanoscale hydroxyapatite from different synthesis methods and biological activity represented by the viability of four cell lines: A549, CHO, BEAS-2B and J774.1 to assess the influence of the nanoparticles on immune, reproductive and respiratory systems.

Also flagged:Zincnon-alcoholic steatohepatitisNASHnon-fatty liverNon-alcoholic fatty liver disease
Journal Article 2018-12-27 ✓ 1 Snippet Kosari F, Jamali R, Ramim T, Mosavi Jahan Abad E.
In-Text Gene Mentions

…Wilson’s disease, andhemochromatosiswere excluded from…

Show Full Abstract

<h4>Background & objective</h4>The aim of this present study was to assess the relationship between serum zinc levels and liver histopathological findings in non-alcoholic steatohepatitis (NASH) patients.<h4>Methods</h4>This case-control study was performed in consecutively selected NASH patients who had been referred to a general hospital. The control group consisted of age and sex-matched individuals with normal physical examinations, laboratory findings, and liver ultrasounds. Serum zinc level was measured using atomic absorption spectrophotometry. Liver histopathological findings were determined based on non-alcoholic fatty liver activity score.<h4>Results</h4>A cohort of eighty biopsy-proven NASH patients and eighty controls were enrolled in the study. The mean serum zinc level was significantly lower in the NASH group compared with the controls. The mean serum zinc concen- tration was significantly lower in moderate and severe lobular inflammation groups than the mild group. After multiple adjustments for potential contributing variables, serum zinc level was associated with the severity of lobular inflam- mation. Nonetheless, it was not associated with liver steatosis and fibrosis. A serum zinc value of 89 (µg/dl) yielded a sensitivity and specificity of 93% and 86%, respectively, characterizing patients with lobular inflammation of less than two inflammatory foci per high-power field (HPF) from more advanced groups. Furthermore, a value of 79.55 (µg/dl) yielded a sensitivity and specificity of 87% and 100%, respectively, distinguishing those with a lobular inflammation grade of less than four foci per HPF from more advanced cases.<h4>Conclusion</h4>Serum zinc level might be associated with the severity of lobular inflammation in NASH.

Also flagged:HS6ST2myopianeurodevelopmental disorderoptic discbindingsulphotransferase
Journal Article 2018-12-26 ✓ 2 Snippets Paganini L, Hadi LA, Chetta M, Rovina D, Fontana L, Colapietro P, Bonaparte E, Pezzani L, Marchisio P, Tabano SM, Costanza J, Sirchia SM, Riboni L, Milani D, Miozzo M.
In-Text Gene Mentions

Gupta et al. reviewed the candidate genes related with inherited myopia and reported only two forms of non‐syndromic condition, one involving ZNF644 and the other related to SCO2 gene.8 High myopia and severe ID, presenting as isolated manifestations without other relevant dysmorphic or malformative features, have never been previously associated with a known clinical condition.

…condition, one involvingZNF644and the other…

Show Full Abstract

X-linked intellectual disability (XLID) refers to a clinically and genetically heterogeneous neurodevelopmental disorder, in which males are more heavily affected than females. Among the syndromic forms of XLID, identified by additional clinical signs as part of the disease spectrum, the association between XLID and severe myopia has been poorly characterized. We used whole exome sequencing (WES) to study two Italian male twins presenting impaired intellectual function and adaptive behavior, in association with severe myopia and mild facial dysmorphisms. WES analysis detected the novel, maternally inherited, mutation c.916G > C (G306R) in the X-linked heparan sulfate 6-O-sulfotransferase 2 (HS6ST2) gene. HS6ST2 transfers sulfate from adenosine 3'-phosphate, 5'-phosphosulfate to the sixth position of the N-sulphoglucosamine residue in heparan sulfate (HS) proteoglycans. Low HS sulfation levels are associated with defective optic disc and stalk morphogenesis during mammalian visual system development. The c.916G>C variant affects the HS6ST2 substrate binding site, and its effect was considered "deleterious" by in-silico tools. An in-vitro enzymatic assay showed that the HS6ST2 mutant isoform had significantly reduced sulphotransferase activity. Taken together, the results suggest that mutant HS6ST2 is possibly involved in the development of myopia and cognitive impairment, characteristics of the probands reported here.

Also flagged:HuntingtinPeptidesPolyglutaminepeptidehydrogenperoxide
Journal Article 2018-12-26 ✓ 4 Snippets Ceccon A, Tugarinov V, Clore GM.
In-Text Gene Mentions

…amphiphilic domain without (httNT ) or…

…) or with (httNT Q 10…

…decrease aggregation ofhttNT Q 10…

…kinetics of nonaggregatinghttNT to TiO…

Show Full Abstract

Polyglutamine expansion within the N-terminal region of the huntingtin protein results in the formation of intracellular aggregates responsible for Huntington's disease, a fatal neurodegenerative condition. The interaction between TiO<sub>2</sub> nanoparticles and huntingtin peptides comprising the N-terminal amphiphilic domain without (htt<sup>NT</sup>) or with (htt<sup>NT</sup>Q<sub>10</sub>) a ten-residue C-terminal polyglutamine tract, is investigated by NMR spectroscopy. TiO<sub>2</sub> nanoparticles decrease aggregation of htt<sup>NT</sup>Q<sub>10</sub> by catalyzing the oxidation of Met<sup>7</sup> to a sulfoxide, resulting in an aggregation-incompetent peptide. The oxidation agent is hydrogen peroxide generated on the surface of the TiO<sub>2</sub> nanoparticles either by UV irradiation or at low steady-state levels in the dark. The binding kinetics of nonaggregating htt<sup>NT</sup> to TiO<sub>2</sub> nanoparticles is characterized by quantitative analysis of <sup>15</sup>N dark state exchange saturation transfer and lifetime line broadening NMR data. Binding involves a sparsely populated intermediate that experiences hindered rotational diffusion relative to the free state. Catalysis of methionine oxidation within the N-terminal domain of the huntingtin protein may potentially provide a strategy for delaying the onset of Huntington's disease.

Also flagged:Ciliopathiescardiovascular disordersfenoldopamciliumreflex tachycardiaciliopathy
Journal Article 2018-12-26 No Snippets Pala R, Mohieldin AM, Shamloo K, Sherpa RT, Kathem SH, Zhou J, Luan Z, Zheng JG, Ahsan A, Nauli SM.
Show Full Abstract

Ciliopathies caused by abnormal function of primary cilia include expanding spectrum of kidney, liver, and cardiovascular disorders. There is currently no treatment available for patients with cilia dysfunction. Therefore, we generated and compared two different (metal and polymer) cilia-targeted nanoparticle drug delivery systems (CTNDDS), CT-DAu-NPs and CT-PLGA-NPs, for the first time. These CTNDDS loaded with fenoldopam were further compared to fenoldopam-alone. Live-imaging of single-cell-single-cilium analysis confirmed that CTNDDS specifically targeted to primary cilia. While CTNDDS did not show any advantages over fenoldopam-alone in cultured cells in vitro, CTNDDS delivered fenoldopam more superior than fenoldopam-alone by eliminating the side effect of reflex tachycardia in murine models. Although slow infusion was required for fenoldopam-alone in mice, bolus injection was possible for CTNDDS. Though there were no significant therapeutic differences between CT-DAu-NPs and CT-PLGA-NPs, CT-PLGA-NPs tended to correct ciliopathy parameters closer to normal physiological levels, indicating CT-PLGA-NPs were better cargos than CT-DAu-NPs. Both CTNDDS showed no systemic adverse effect. In summary, our studies provided scientific evidence that existing pharmacological agent could be personalized with advanced nanomaterials to treat ciliopathy by targeting cilia without the need of generating new drugs.

Also flagged:deathneuropsychiatric disordersgene expressionNeurological Disordersage-related diseasesbehavioral
Journal Article 2018-12-26 ✓ 1 Snippet Park JE, Silva AC.
In-Text Gene Mentions

HTT

Show Full Abstract

Research with non-human primates (NHP) has been essential and effective in increasing our ability to find cures for a large number of diseases that cause human suffering and death. Extending the availability and use of genetic engineering techniques to NHP will allow the creation and study of NHP models of human disease, as well as broaden our understanding of neural circuits in the primate brain. With the recent development of efficient genetic engineering techniques that can be used for NHP, there's increased hope that NHP will significantly accelerate our understanding of the etiology of human neurological and neuropsychiatric disorders. In this article, we review the present state of genetic engineering tools used in NHP, from the early efforts to induce exogeneous gene expression in macaques and marmosets, to the latest results in producing germline transmission of different transgenes and the establishment of knockout lines of specific genes. We conclude with future perspectives on the further development and employment of these tools to generate genetically engineered NHP.

Also flagged:Huntington's DiseasemelanopsinblindnessAlzheimer's diseaseagingcircadian rhythms
Journal Article 2018-12-26 ✓ 1 Snippet Lin MS, Liao PY, Chen HM, Chang CP, Chen SK, Chern Y.
In-Text Gene Mentions

HTT

Show Full Abstract

Intrinsically photosensitive retinal ganglion cells (ipRGCs), which express the photopigment melanopsin, are photosensitive neurons in the retina and are essential for non-image-forming functions, circadian photoentrainment, and pupillary light reflexes. Five subtypes of ipRGCs (M1-M5) have been identified in mice. Although ipRGCs are spared in several forms of inherited blindness, they are affected in Alzheimer's disease and aging, which are associated with impaired circadian rhythms. Huntington's disease (HD) is an autosomal neurodegenerative disease caused by the expansion of a CAG repeat in the <i>huntingtin</i> gene. In addition to motor function impairment, HD mice also show impaired circadian rhythms and loss of ipRGC. Here, we found that, in HD mouse models (R6/2 and N171-82Q male mice), the expression of melanopsin was reduced before the onset of motor deficits. The expression of retinal T-box brain 2, a transcription factor essential for ipRGCs, was associated with the survival of ipRGCs. The number of M1 ipRGCs in R6/2 male mice was reduced due to apoptosis, whereas non-M1 ipRGCs were relatively resilient to HD progression. Most importantly, the reduced innervations of M1 ipRGCs, which was assessed by X-gal staining in R6/2-OPN4<sup>Lacz/+</sup> male mice, contributed to the diminished light-induced c-fos and vasoactive intestinal peptide in the suprachiasmatic nuclei (SCN), which may explain the impaired circadian photoentrainment in HD mice. Collectively, our results show that M1 ipRGCs were susceptible to the toxicity caused by mutant Huntingtin. The resultant impairment of M1 ipRGCs contributed to the early degeneration of the ipRGC-SCN pathway and disrupted circadian regulation during HD progression.<b>SIGNIFICANCE STATEMENT</b> Circadian disruption is a common nonmotor symptom of Huntington's disease (HD). In addition to the molecular defects in the suprachiasmatic nuclei (SCN), the cause of circadian disruption in HD remains to be further explored. We hypothesized that ipRGCs, by integrating light input to the SCN, participate in the circadian regulation in HD mice. We report early reductions in melanopsin in two mouse models of HD, R6/2, and N171-82Q. Suppression of retinal T-box brain 2, a transcription factor essential for ipRGCs, by mutant Huntingtin might mediate the reduced number of ipRGCs. Importantly, M1 ipRGCs showed higher susceptibility than non-M1 ipRGCs in R6/2 mice. The resultant impairment of M1 ipRGCs contributed to the early degeneration of the ipRGC-SCN pathway and the circadian abnormality during HD progression.

Also flagged:Huntington's diseaseHDmembranetraumatic brain injuryinducible nitric oxide synthaseimmune‐based disorders
Journal Article 2018-12-25 ✓ 5 Snippets Giampà C, Alvino A, Magatti M, Silini AR, Cardinale A, Paldino E, Fusco FR, Parolini O.
In-Text Gene Mentions

Huntington's disease (HD) is a fatal, incurable autosomal dominant neurodegenerative disorder caused by instable expansion of polyglutamine (polyQ) tract within the resulting mutated HTT protein (mHTT).1 Huntington's disease pathology is characterized by a massive loss of neurons in the striatal part of the basal ganglia2 that consequently causes motor and cognitive dysfunction.

As a matter of fact, there is substantial evidence that the expression of mutant HTT protein results in a pro‐inflammatory activation of microglia which influences disease onset and progression.3 More specifically, inflammatory cytokines have been detected in the striatum of HD patients compared with that of healthy individuals4 and also in the plasma and cerebrospinal fluid of HD patients.3 Furthermore, pro‐inflammatory (M1) microglia relevant biomarkers have been detected in the brains of HD patients, which indicates that M1 microglia may play a crucial role in the pathogenesis of HD.5 These findings indicate that central and peripheral inflammation may represent a critical juncture in the progression and amplification of HD pathology that, if understood, could support the development of anti‐inflammatory‐based treatment options.

Inflammation significantly impacts the progression of Huntington's disease (HD) and the mutant HTT protein determines a pro‐inflammatory activation of microglia.

…and the mutantHTTprotein determines a…

…the resulting mutatedHTTprotein (mHTT).…

Show Full Abstract

Inflammation significantly impacts the progression of Huntington's disease (HD) and the mutant HTT protein determines a pro-inflammatory activation of microglia. Mesenchymal stem/stromal cells (MSC) from the amniotic membrane (hAMSC), and their conditioned medium (CM-hAMSC), have been shown to possess protective effects in vitro and in vivo in animal models of immune-based disorders and of traumatic brain injury, which have been shown to be mediated by their immunomodulatory properties. In this study, in the R6/2 mouse model for HD we demonstrate that mice treated with CM-hAMSC display less severe signs of neurological dysfunction than saline-treated ones. CM-hAMSC treatment significantly delayed the development of the hind paw clasping response during tail suspension, reduced deficits in rotarod performance, and decreased locomotor activity in an open field test. The effects of CM-hAMSC on neurological function were reflected in a significant amelioration in brain pathology, including reduction in striatal atrophy and the formation of striatal neuronal intranuclear inclusions. In addition, while no significant increase was found in the expression of BDNF levels after CM-hAMSC treatment, a significant decrease of microglia activation and inducible nitric oxide synthase levels were observed. These results support the concept that CM-hAMSC could act by modulating inflammatory cells, and more specifically microglia.

Also flagged:photonvisionsignal transmissionciliumconnecting ciliumbasal body
Journal Article 2018-12-25 No Snippets Baehr W, Hanke-Gogokhia C, Sharif A, Reed M, Dahl T, Frederick JM, Ying G.
Show Full Abstract

Photoreceptors are polarized neurons, with very specific subcellular compartmentalization and unique requirements for protein expression and trafficking. Each photoreceptor contains an outer segment, the site of photon capture that initiates vision, an inner segment that houses the biosynthetic machinery and a synaptic terminal for signal transmission to downstream neurons. Outer segments and inner segments are connected by a connecting cilium (CC), the equivalent of a transition zone (TZ) of primary cilia. The connecting cilium is part of the basal body/axoneme backbone that stabilizes the outer segment. This report will update the reader on late developments in photoreceptor ciliogenesis and transition zone formation, specifically in mouse photoreceptors, focusing on early events in photoreceptor ciliogenesis. The connecting cilium, an elongated and narrow structure through which all outer segment proteins and membrane components must traffic, functions as a gate that controls access to the outer segment. Here we will review genes and their protein products essential for basal body maturation and for CC/TZ genesis, sorted by phenotype. Emphasis is given to naturally occurring mouse mutants and gene knockouts that interfere with CC/TZ formation and ciliogenesis.

bioRxiv 2018-12-25 Preprint (No Snippets API) Arvinden VR, Magendhra Rao AKD, Meenakumari B, Ramanathan P, Sundersingh S, Sridevi V, Rajkumar T, Herceg Z, Mani S.
Show Full Abstract

<h4>Background:</h4> Breast cancer is a major cause of cancer related death in women worldwide. Molecular diagnostic markers that are detectable in early-stage breast cancer can aid in effective clinical intervention. Circular RNAs are a recently identified group of non-coding RNA with potential role in cancer development and progression. In this study, we aimed to identify circular RNAs specific for early stage breast cancer. <h4>Method:</h4> Circular RNA expression profile was analyzed in early-stage breast cancer tissues (N=5), matched normal counterparts (N=5) and absolute normal samples (N=5) by RNA-sequencing that enables a comprehensive analysis of RNA expression across the transcriptome. Two different algorithms, find_circ and DCC were used to identify the differentially expressed circular RNAs. <h4>Results:</h4> A total of 58 and 87 circular RNAs were found to be differentially expressed by find_circ and DCC algorithms, respectively, among which 26 circular RNAs were common. Hsa_circ_0001946 (CDR1-as) was found to be upregulated in early stage breast cancer along with other novel circular RNAs (hsa_circ_0008225, hsa_circ_0007766, hsa_circ_0016601). We also found that a few of the identified circular RNAs harbor microRNA binding sites which can lead to microRNA sponging activity and pre-microRNA sequences which can generate mature microRNAs. The identified circular RNAs that are differentially regulated in early stage breast cancer can be of potential diagnostic/prognostic importance. <h4>Conclusion:</h4> Circular RNA are differentially expressed in the early-stage breast cancer with potential application in early diagnosis and prognosis. The differentially expressed circular RNA can sequester microRNA and can act as microRNA precursor as well.

Also flagged:Mitochondriadeathagingneurodegenerative disordersmitochondrialPINK1
Journal Article 2018-12-24 ✓ 1 Snippet Baranov SV, Baranova OV, Yablonska S, Suofu Y, Vazquez AL, Kozai TDY, Cui XT, Ferrando LM, Larkin TM, Tyurina YY, Kagan VE, Carlisle DL, Kristal BS, Friedlander RM.
In-Text Gene Mentions

HTT

Show Full Abstract

Neuritic retraction in the absence of overt neuronal death is a shared feature of normal aging and neurodegenerative disorders, but the intracellular mechanisms modulating this process are not understood. We propose that cumulative distal mitochondrial protein damage results in impaired protein import, leading to mitochondrial dysfunction and focal activation of the canonical apoptosis pathway in neurites. This is a controlled process that may not lead to neuronal death and, thus, we term this phenomenon "neuritosis." Consistent with our hypothesis, we show that in primary cerebrocortical neurons, mitochondrial distance from the soma correlates with increased mitochondrial protein damage, PINK1 accumulation, reactive oxygen species production, and decreased mitochondrial membrane potential and depolarization threshold. Furthermore, we demonstrate that the distance-dependent mitochondrial membrane potential gradient exists in vivo in mice. We demonstrate that impaired distal mitochondria have a lower threshold for focal/nonlethal neuritic caspase-3 activation in normal neurons that is exacerbated in aging, stress, and neurodegenerative conditions, thus delineating a fundamental mechanistic underpinning for synaptic vulnerability.

Also flagged:cysteinepeptidessaltcellulose-CysPeroxiredoxin 6
Journal Article 2018-12-24 ✓ 5 Snippets Zhou S, Dodia C, Feinstein SI, Harper S, Forman HJ, Speicher DW, Fisher AB.
In-Text Gene Mentions

Prdx6

The major finding of the present study was that the addition of GSH to the medium that was used for assay of the PLA2 activity of Prdx6 resulted in: a) a physical change of protein structure, as shown by tryptophan fluorescence and far UV circular dichroism; b) the irreversible oxidation of the protein to the sulfinic acid (as indicated by MS analysis); and, c) an increase of its PLA2 activity at neutral pH.

Prdx6 has three tryptophan residues, two of which are in close proximity to the enzymatically active sites for peroxidase (C47) and PLA2 (S32) activities [12].

The formation of a sulfinic acid at Cys47 of Prdx6 was confirmed by alkylation of the cysteine residues in Prdx6 with iodoacetamide, followed by denaturation, reduction, and alkylation with acrylamide, trypsin digestion, and then analysis by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in order to determine the levels of reduced, accessible cysteine (see Supplemental Figure S2).

The purified Prdx6 fraction was concentrated using a 10 kDa molecular mass cut-off Amicon Ultra filter (Millipore, Billerica, MA, USA) followed by dialysis against 50 mM Tris-HCl buffer (pH 8) containing 1 mM EDTA, 3% glycerol, and 1 mM TCEP with a 10 kDa molecular mass cut-off Slide-A-Lyzer® dialysis cassette (Pierce, Rockford, IL, USA).

Show Full Abstract

The expression of the phospholipase A₂ activity (aiPLA₂) of peroxiredoxin 6 (Prdx6) in the cell cytoplasm is physiologically relevant for the repair of peroxidized cell membranes, but aiPLA₂ assay <i>in vitro</i> indicates that, unlike assay at pH 4, activity at cytosolic pH is essentially absent with non-oxidized substrate. However, the addition of glutathione (GSH) to the assay medium significantly increased aiPLA₂ activity at cytosolic pH, while oxidized GSH (GSSG) and several other thiols had no effect. By mass spectroscopy (ESI MS), the addition of GSH to Prdx6 paradoxically led to oxidation of its conserved Cys47 residue to a sulfinic acid. The effect of GSH on PLA₂ activity was abolished by incubation under anaerobic conditions, confirming that auto-oxidation of the protein was the mechanism for the GSH effect. Analysis by circular dichroism (CD) and tryptophan fluorescence showed alterations of the protein structure in the presence of GSH. Independently of GSH, the oxidation of Prdx6 by exposure to H₂O₂ or the presence of oxidized phospholipid as substrate also significantly increased aiPLA₂ activity at pH 7. We conclude that the oxidation of the peroxidatically active Cys47 of Prdx6 results in an increase of aiPLA₂ activity at pH 7 without effect on the activity of the enzyme at pH 4.

Also flagged:intestinal diseasesinflammatory bowel diseasecolon cancerlumenmucusWnt
Journal Article 2018-12-24 No Snippets Dutton JS, Hinman SS, Kim R, Wang Y, Allbritton NL.
Show Full Abstract

The development of physiologically relevant intestinal models fueled by breakthroughs in primary cell-culture methods has enabled successful recapitulation of key features of intestinal physiology. These advances, paired with engineering methods, for example incorporating chemical gradients or physical forces across the tissues, have yielded ever more sophisticated systems that enhance our understanding of the impact of the host microbiome on human physiology as well as on the genesis of intestinal diseases such as inflammatory bowel disease and colon cancer. In this review we highlight recent advances in the development and usage of primary cell-derived intestinal models incorporating monolayers, organoids, microengineered platforms, and macrostructured systems, and discuss the expected directions of the field.

Also flagged:boutonsGFAPVGATsynaptic vesiclesnucleiubiquitin
Journal Article 2018-12-24 ✓ 5 Snippets Chen S, Yu C, Rong L, Li CH, Qin X, Ryu H, Park H.
In-Text Gene Mentions

Together with other reports suggesting that mutant HTT proteins modulate N-type voltage-gated Ca2+ channels through their interaction with N-type voltage-gated Ca2+ channels and their binding proteins (Miller et al., 2003; Swayne et al., 2005; Silva et al., 2017), our results suggest that N-type voltage-gated Ca2+ channels, play an important role in the increased presynaptic Ca2+ influx and synaptic vesicle release in cortical neurons from HD mice.

Huntington’s disease (HD) is an inherited neurodegenerative disorder caused by the abnormal expansion of CAG repeats in the huntingtin (HTT) gene, which leads to progressive loss of neurons starting in the striatum and cortex.

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by an increase in CAG trinucleotide repeats in the huntingtin (HTT) gene, giving rise to an expanded polyglutamine (polyQ) domain in the N-terminal of the encoded HTT protein (MacDonald et al., 1993).

Although the HTT gene is ubiquitously expressed throughout the human body, the medium spiny neurons (MSNs) in the striatum and the pyramidal neurons in the cortex are most vulnerable neurons in HD (Vonsattel and DiFiglia, 1998).

The increased peak intensity in HD neurons, together with no change in Ca2+ clearance, suggests a possible association between the mutant HTT protein and voltage-gated Ca2+ channels during electrical stimulation.

Show Full Abstract

Huntington's disease (HD) is an inherited neurodegenerative disorder caused by the abnormal expansion of CAG repeats in the <i>huntingtin</i> (<i>HTT</i>) gene, which leads to progressive loss of neurons starting in the striatum and cortex. One possible mechanism for this selective loss of neurons in the early stage of HD is altered neurotransmission at synapses. Despite the recent finding that presynaptic terminals play an important role in HD, neurotransmitter release at synapses in HD remains poorly understood. Here, we measured synaptic vesicle release in real time at single presynaptic terminals during electrical field stimulation. We found the increase in synaptic vesicle release at presynaptic terminals in primary cortical neurons in a knock-in mouse model of HD (zQ175). We also found the increase in Ca<sup>2+</sup> influx at presynaptic terminals in HD neurons during the electrical stimulation. Consistent with increased Ca<sup>2+</sup>-dependent neurotransmission in HD neurons, the increase in vesicle release and Ca<sup>2+</sup> influx was rescued with Ca<sup>2+</sup> chelators or by blocking N-type voltage-gated Ca<sup>2+</sup> channels, suggesting N-type voltage-gated Ca<sup>2+</sup> channels play an important role in HD. Taken together, our results suggest that the increased synaptic vesicles release due to increased Ca<sup>2+</sup> influx at presynaptic terminals in cortical neurons contributes to the selective neurodegeneration of these neurons in early HD and provide a possible therapeutic target.

Also flagged:chemokineCCL2heparan sulfatehexasaccharideschemokinesglycosaminoglycans
Journal Article 2018-12-23 ✓ 1 Snippet Winkler S, Derler R, Gesslbauer B, Krieger E, Kungl AJ.
In-Text Gene Mentions

…the previously ligandedATIIIstructure was used…

Show Full Abstract

<h4>Background</h4>Binding of chemokines to glycosaminoglycans (GAGs) is a crucial step in leukocyte recruitment to inflamed tissues.<h4>Methods</h4>A disaccharide compositional analysis of the HS dp6 fraction in combination with MS analysis of the CCL2-depleted dp6 fraction was the basis for target GAG ligand structure suggestions. Four experimentally-derived heparan sulfate hexasaccharides, two potentially chemokine-specific and two unspecific, have been docked to CCL2. Subsequent 300 ns molecular dynamics simulations were used to improve the docked complexes.<h4>Results</h4>Hexasaccharides with four sulfations and no acetylations are suggested for selective and high affinity chemokine binding. Using the Antithromin-III/heparin complex as positive control for docking, we were able to recover the correct complex structure only if the previously liganded ATIII structure was used as input. Since the liganded structure is not known for a CCL2-GAG complex, we investigated if molecular dynamics simulations could improve initial docking results. We found that all four GAG oligosaccharides ended up in close contact with the known binding residues after about 100 ns simulation time.<h4>Conclusions</h4>A discrimination of specific vs. unspecific CCL2 GAG ligands is not possible by this approach. Long-time molecular dynamics simulations are, however, well suited to capture the delicate enthalpy/entropy balance of GAG binding and improve results obtained from docking.<h4>General significance</h4>With the comparison of two methods, MS-based ligand identification and molecular modelling, we have shown the current limitations of our molecular understanding of complex ligand binding which is could be due to the numerical inaccessibility of ligand-induced protein conformational changes.

Also flagged:serotonin transporters5-HT transporternicotineserotonin5methylation
Journal Article 2018-12-23 ✓ 4 Snippets Smolka MN, Reimold M, Kobiella A, Reischl G, Rietschel M, Heinz A.
In-Text Gene Mentions

…on 5-HT transporter (5-HTT) expression, studies in…

…homeostatic adaptations in5-HTTavailability that moderate…

…To test whether5-HTTavailability in the…

…on in vivo5-HTTavailability (BP<sub>ND</sub>)…

Show Full Abstract

Although preclinical studies clearly indicate an effect of 5-HTTLPR genotype on 5-HT transporter (5-HTT) expression, studies in humans provided inconclusive results, hypothetically due to environmental factors and differences in individual behavior. For example, nicotine and other constituents of tobacco smoke elevate serotonin (5-HT) levels in the brain and may thereby cause homeostatic adaptations in 5-HTT availability that moderate effects of 5-HTTLPR genotype. To test whether 5-HTT availability in the midbrain is affected by smoking status and 5-HTTLPR genotype, we pooled data from prior studies on in vivo 5-HTT availability (BP<sub>ND</sub>) measured with positron emission tomography (PET) and [<sup>11</sup>C]DASB. In total, we reanalyzed 5-HTT availability in 116 subjects using ANCOVA statistics. ROI analysis revealed that current smokers and non-smokers do not differ in midbrain BP<sub>ND</sub>. Interestingly, smoking status significantly interacted with 5-HTTLPR genotype: active smoking was associated with reduced 5-HTT availability only in LL subjects but not in carriers of the S-allele. From the perspective of genotype effects, non-smokers showed the expected association with 5-HTTLPR, i.e. higher 5-HTT availability in LL subjects compared to carriers of the S-allele, whereas this pattern was actually reversed for active smokers. Our study indicates that smoking status moderates the association of 5-HTTLPR genotype and 5-HTT expression, which may help to explain inconsistent findings in previous studies. Regarding the mechanism, we suggest that smoking may induce epigenetic processes such as methylation of SLC6A4, which can differ depending on its genetic constitution.

Also flagged:clenbuterolmethacrylic acidphenylephrineCLBpulmonary diseaseβ2-adrenoceptor
Journal Article 2018-12-23 No Snippets Zhang B, Fan X, Zhao D.
Show Full Abstract

Molecular imprinting technology (MIT) offers an effective technique for efficient separation and enrichment of specific analytes from complicated matrices and has been used for illicit veterinary drug detectionin recent years due to its high selectivity, good chemical stability, and simple preparation. The development of in silico-based approaches has enabled the simulation of molecularly imprinted polymers (MIPs) to facilitate the selection of imprinting conditions such as template, functional monomer, and the best suitable solvent. In this work, using density functional theory (DFT), the molecularly imprinted polymers of clenbuterol and its metabolites were designed by computer-aided at B3LYP/6-31 + G (d, p) level. Screening molecular imprinting components such as functional monomers, cross-linkers, and solvents has been achieved in the computational simulation considerations. The simulation results showed that methacrylic acid (MAA) is the best functional monomer; the optimal imprinting ratio for both clenbuterol (CLB) and its dummy template molecule of phenylephrine (PE) to functional monomer is 1:3, while the optimal imprinting ratio for the two dummy template molecules of CLB's metabolites is 1:5. Choosin gethyleneglycol dimethacrylate (EDGMA) as a crosslinker and aprotic solvents could increase the selectivity of the molecularly imprinted system. Atoms in Molecules (AIM) topology analysis was applied to investigate the template-monomer complexes bonding situation and helped to explain the nature of the reaction in the imprinting process. These theoretical predictions were also verified by the experimental results and found to be in good agreement with the computational results. The computer-simulated imprinting process compensates for the lack of clarity in the mechanism of the molecular imprinting process, and provides an important reference and direction for developing better recognition pattern towards CLB and its metabolite analytes in swine urine samples at the same time.

Also flagged:ironanaemiamineralsiron deficiencynutrient deficiencyiron‐deficiency anaemia
Journal Article 2018-12-22 ✓ 1 Snippet Garcia-Casal MN, Peña-Rosas JP, De-Regil LM, Gwirtz JA, Pasricha SR.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Background</h4>Approximately 800 million women and children have anaemia, a condition thought to cause almost 9% of the global burden of years lived with disability. Around half this burden could be amenable to interventions that involve the provision of iron. Maize (corn) is one of the world's most important cereal grains and is cultivated across most of the globe. Several programmes around the world have fortified maize flour and other maize-derived foodstuffs with iron and other vitamins and minerals to combat anaemia and iron deficiency.<h4>Objectives</h4>To assess the effects of iron fortification of maize flour, corn meal and fortified maize flour products for anaemia and iron status in the general population.<h4>Search methods</h4>We searched the following international and regional sources in December 2017 and January 2018: Cochrane Central Register of Controlled Trials (CENTRAL); MEDLINE; MEDLINE (R) In Process; Embase; Web of Science (both the Social Science Citation Index and the Science Citation Index); CINAHL Ebsco; POPLINE; AGRICOLA (agricola.nal.usda.gov); BIOSIS (ISI); Bibliomap and TRoPHI; IBECS; Scielo; Global Index Medicus - AFRO (includes African Index Medicus); EMRO (includes Index Medicus for the Eastern Mediterranean Region); LILACS; PAHO (Pan American Health Library); WHOLIS (WHO Library); WPRO (includes Western Pacific Region Index Medicus); IMSEAR, Index Medicus for the South-East Asian Region; IndMED, Indian medical journals; and the Native Health Research Database. We searched clinicaltrials.gov and the International Clinical Trials Registry Platform (ICTRP) for any ongoing or planned studies on 17 January 2018 and contacted authors of such studies to obtain further information or eligible data if available.For assistance in identifying ongoing or unpublished studies, we also contacted relevant international organisations and agencies working in food fortification on 9 August 2016.<h4>Selection criteria</h4>We included cluster- or individually randomised controlled trials and observational studies. Interventions included (central/industrial) fortification of maize flour or corn meal with iron alone or with other vitamins and minerals and provided to individuals over 2 years of age (including pregnant and lactating women) from any country.<h4>Data collection and analysis</h4>Two review authors independently assessed the eligibility of studies for inclusion, extracted data from included studies and assessed the risk of bias of the included studies. Trial designs with a comparison group were included to assess the effects of interventions. Trial designs without a control or comparison group (uncontrolled before-and-after studies) were included for completeness but were not considered in assessments of the overall effectiveness of interventions or used to draw conclusions regarding the effects of interventions in the review.<h4>Main results</h4>Our search yielded 4529 records. After initial screening of titles and abstracts, we reviewed the full text of 75 studies (80 records). We included 5 studies and excluded 70. All the included studies assessed the effects of providing maize products fortified with iron plus other vitamins and minerals versus unfortified maize flour. No studies compared this intervention to no intervention or looked at the relative effect of flour and products fortified with iron alone (without other vitamins and minerals). Three were randomised trials involving 2610 participants, and two were uncontrolled before-and-after studies involving 849 participants.Only three studies contributed data for the meta-analysis and included children aged 2 to 11.9 years and women. Compared to unfortified maize flour, it is uncertain whether fortifying maize flour or corn meal with iron and other vitamins and minerals has any effect on anaemia (risk ratio (RR) 0.90, 95% confidence interval (CI) 0.58 to 1.40; 2 studies; 1027 participants; very low-certainty evidence), or on the risk of iron deficiency (RR 0.75, 95% CI 0.49 to 1.15; 2 studies; 1102 participants; very low-certainty evidence), haemoglobin concentration (mean difference (MD) 1.25 g/L, 95% CI -2.36 to 4.86 g/L; 3 studies; 1144 participants; very low-certainty evidence) or ferritin concentrations (MD 0.48 µg/L, 95% CI -0.37 to 1.33 µg/L; 1 study; 584 participants; very low-certainty evidence).None of the studies reported on any adverse effects. We judged the certainty of the evidence to be very low based on GRADE, so we are uncertain whether the results reflect the true effect of the intervention. We downgraded evidence due to high risk of selection bias and unclear risk of performance bias in one of two included studies, high heterogeneity and wide CIs crossing the line of no effect for anaemia prevalence and haemoglobin concentration.<h4>Authors' conclusions</h4>It is uncertain whether fortifying maize flour with iron and other vitamins and minerals reduces the risk of anaemia or iron deficiency in children aged over 2 years or in adults. Moreover, the evidence is too uncertain to conclude whether iron-fortified maize flour, corn meal or fortified maize flour products have any effect on reducing the risk of anaemia or on improving haemoglobin concentration in the population.We are uncertain whether fortification of maize flour with iron reduces anaemia among the general population, as the certainty of the evidence is very low. No studies reported on any adverse effects.Public organisations funded three of the five included studies, while the private sector gave grants to universities to perform the other two. The presence of industry funding for some of these trials did not appear to positively influence results from these studies.The reduced number of studies, including only two age groups (children and women of reproductive age), as well as the limited number of comparisons (only one out of the four planned) constitute the main limitations of this review.

Also flagged:AMPD2systemic lupus erythematosusSLEautoimmune diseaseimmunometabolismpathogenesis
Journal Article 2018-12-22 No Snippets Guo G, Wang H, Shi X, Ye L, Wu K, Lin K, Ye S, Li B, Zhang H, Lin Q, Ye S, Xue X, Chen C.
Show Full Abstract

<h4>Background</h4>Systemic lupus erythematosus (SLE) is a multisystemic autoimmune disease with various clinical manifestations. MicroRNAs (miRNAs) and immunometabolism are recognized as key elements in SLE pathogenesis; however, the relationship between miRNAs in peripheral blood mononuclear cells (PBMCs) and metabolism in SLE remains unclear.<h4>Methods</h4>We detected PBMC miRNA and mRNA profiles from 3 pooled SLE patients and 3 healthy controls (HCs) using next-generation sequencing, predicted miRNA targets in dysregulated mRNAs, predicted functions and interactions of differentially expressed genes using bioinformatics analysis, validated candidate miRNAs using qRT-PCR, and investigated the association between the expression of candidate miRNAs and SLE clinical characteristics. Moreover, we validated the direct and transcriptional regulatory effect of NovelmiRNA-25 on adenosine monophosphate deaminase 2 (AMPD2) using a dual-luciferase reporter assay and western blot and confirmed AMPD2 mRNA and protein expression in PBMCs using qRT-PCR and western blot, respectively.<h4>Results</h4>Multilayer integrative analysis of microRNA and mRNA regulation showed that 10 miRNAs were down-regulated and 19 miRNAs were up-regulated in SLE patient PBMCs compared with HCs. Bioinformatics analysis of regulatory networks between miRNAs and mRNAs showed that 19 miRNAs were related to metabolic processes. Two candidate miRNAs, NovelmiRNA-25 and miR-1273h-5p, which were significantly increased in the PBMCs of SLE patients (P < 0.05), represented diagnostic biomarkers with sensitivities of 94.74% and 89.47%, respectively (area under the curve = 0.574 and 0.788, respectively). NovelmiRNA-25 expression in PBMCs was associated with disease activity in SLE patients, in both active and stable groups (P < 0.05). NovelmiRNA-25 overexpression downregulated AMPD2 expression in HEK293T cells through direct targeting of the AMPD2 3'UTR (P < 0.01), while inhibition of NovelmiRNA-25 activity led to increased AMPD2 expression (P < 0.01). NovelmiRNA-25 overexpression also downregulated AMPD2 protein expression in HEK293T cells; AMPD2 protein expression in SLE patient PBMCs was decreased. Our results show that differentially expressed miRNAs play an important role in SLE.<h4>Conclusions</h4>Our data demonstrate a novel mechanism in SLE development that involves the targeting of AMPD2 expression by NovelmiRNA-25. miRNAs may serve as novel biomarkers for the diagnosis and evaluation of disease activity of SLE and represent potential therapeutic targets for this disease.

Also flagged:granulocyte colony stimulating factoralcoholic hepatitissteroidalcoholliver diseasesCorticosteroids
Journal Article 2018-12-22 ✓ 1 Snippet Cho Y, Park YS, Kim HY, Kim W, Lee HJ, Kim DJ.
In-Text Gene Mentions

…Portal vein thrombosis,hemochromatosis, autoimmune hepatitis, Wilson…

Show Full Abstract

<h4>Background</h4>Alcoholic hepatitis (AH) has the most severe presentation among alcohol-related liver diseases. Corticosteroids are the most widely recommended treatment for severe AH. However, more innovative, refined treatment measures are required because of its high mortality despite corticosteroid treatment. This study aims to determine whether granulocyte colony stimulating factor (G-CSF) treatment increases short-term survival in patients with severe AH refractory to corticosteroid treatment.<h4>Methods/design</h4>Patients with severe AH whose Maddrey's discriminant function (MDF) score is ≥ 32 and who will be treated with prednisolone (40 mg/day) for 1 week will be screened. Among them, 190 subjects with a partial response (PR) (Lille score 0.16-0.56), and 78 subjects with a null response (NR) (Lille score ≥ 0.56) will be enrolled. Subjects with PR will be randomized to steroid plus placebo or steroid plus 12 G-CSF injections (5 μg/kg/day for 5 days followed by every 3 days) at a ratio of 1:1. Subjects with a NR will be randomized to the placebo or G-CSF group (1:1). Study subjects in the PR group will be treated with prednisolone for 28 days followed by dose tapering for an additional 2 weeks. The primary endpoint is the 2-month survival rate in the NR group and the 6-month survival rate in the PR group. Child-Turcotte-Pugh, model for end-stage liver disease score, and the change in the proportion of peripheral circulating CD34-positive cells will be analyzed as risk factors for mortality. Preliminary safety data for the initial 10 study subjects enrolled in the PR study will be assessed to determine whether the PR study would be continued, according to the G-CSF-mobilized, peripheral-blood stem cell donor assessment protocol of the National Marrow Donor Program.<h4>Discussion</h4>We hypothesized that G-CSF would prolong short-term survival of patients with severe AH refractory to corticosteroid treatment. This is a proof-of-concept trial designed to assess the efficacy of Lille-score-guided G-CSF treatment. This trial is also designed to identify a special subgroup in whom G-CSF rescue treatment would improve liver function and prolong survival.<h4>Trial registration</h4>ClinicalTrials.gov, NCT02442180 . Prospectively registered on 13 May 2015.

Also flagged:osteoarthritistranexamic acidheparinvenous thrombosisrivaroxabanknee osteoarthritis
Journal Article 2018-12-22 ✓ 1 Snippet Hu Y, Li Q, Wei BG, Zhang XS, Torsha TT, Xiao J, Shi ZJ.
In-Text Gene Mentions

…its interaction withantithrombin-III(AT-III).…

Show Full Abstract

<h4>Background</h4>Total knee arthroplasty is regarded as the most effective treatment for severe knee osteoarthritis. The influential factors of blood loss in total knee arthroplasty remain controversial. The study aims to explore the influential factors of blood loss in total knee arthroplasty comprehensively.<h4>Material and methods</h4>Three hundred and four osteoarthritis patients undergoing unilateral primary total knee arthroplasty were enrolled. Demographic characteristics, laboratory results, surgical protocol, and hemostatic and anticoagulation drugs were collected. Estimation of blood loss was calculated using the Gross equation. Multivariable stepwise linear regression analysis was performed to find out the influential factors.<h4>Results</h4>Total blood loss reached the biggest volume (1346 ± 671 mL) in the post-operative third day. Hidden blood loss reached 465 ± 358 mL. Gender, tranexamic acid, prosthesis type, and drainage were proven to be positively correlated with the total blood loss (all P < 0.05). Male appeared to suffer more surgical blood loss than female. Posterior cruciate stabilizing prosthesis might lead to more surgical blood loss than posterior cruciate retaining prosthesis. Tranexamic acid could effectively reduce total blood loss while drainage might increase bleeding. Gender and anticoagulation drugs were correlated with hidden blood loss (both P < 0.05). Low molecular weight heparin resulted in less hidden blood loss than rivaroxaban.<h4>Conclusions</h4>Posterior cruciate retaining prosthesis and topical use of tranexamic acid were preferred to reduce total blood loss. Drainage was not recommended due to the risk of increasing bleeding. Low molecular weight heparin was recommended to prevent venous thrombosis.

Also flagged:autosomal dominant hereditary spastic paraplegiaCharcot-Marie-Tooth disease 2bindingamyotrophic lateral sclerosisALSsyndrome
Journal Article 2018-12-22 ✓ 1 Snippet Filosto M, Piccinelli SC, Palmieri I, Necchini N, Valente M, Zanella I, Biasiotto G, Lorenzo DD, Cereda C, Padovani A.
In-Text Gene Mentions

…, HEXA ,HFE, HGSNAT ,…

Show Full Abstract

<i>KIF5A</i> encodes the heavy chain A of kinesin; A motor protein involved in motility functions within neuron. Mutations in the <i>KIF5A</i> N-terminal motor domain are known to cause SPG10; An autosomal dominant hereditary spastic paraplegia (HSP), as well as rare Charcot-Marie-Tooth disease 2 (CMT2) cases. Recently C-terminal cargo-binding tail domain mutations have been associated with an amyotrophic lateral sclerosis (ALS) phenotype. Here we describe a subject presenting with an atypical slowly progressive motor syndrome evolving over a period of 4 years; Characterized by walking difficulties; Muscle hypotrophy mainly involving upper limbs and pyramidal signs confined to the lower limbs. Electromyography demonstrated chronic neurogenic damage and active denervation while electroneurography showed slowly worsening axonal damage. We identified the novel heterozygote variant c.2341A>G in the exon 21 of the <i>KIF5A</i> gene resulting in the amino acid change p.Lys781Glu. The residue Lys781 is located within the terminal region of the stalk domain and is highly evolutionary conserved. Our findings confirm that mutations in <i>KIF5A</i> cause ALS-like phenotypes. However, the stalk domain mutation described here appears to result in an "intermediate" slowly progressive phenotype having aspects resembling ALS as well as HSP and axonal neuropathy. We suggest that <i>KIF5A</i> gene should be considered as a candidate gene in all atypical progressive motor syndromes.

Also flagged:replication forkchromosomesorganizationof ChromosomecohesinSMC5
Journal Article 2018-12-22 ✓ 1 Snippet Palecek JJ.
In-Text Gene Mentions

Condensinsplay key roles…

Show Full Abstract

The genome replication process is challenged at many levels. Replication must proceed through different problematic sites and obstacles, some of which can pause or even reverse the replication fork (RF). In addition, replication of DNA within chromosomes must deal with their topological constraints and spatial organization. One of the most important factors organizing DNA into higher-order structures are Structural Maintenance of Chromosome (SMC) complexes. In prokaryotes, SMC complexes ensure proper chromosomal partitioning during replication. In eukaryotes, cohesin and SMC5/6 complexes assist in replication. Interestingly, the SMC5/6 complexes seem to be involved in replication in many ways. They stabilize stalled RFs, restrain RF regression, participate in the restart of collapsed RFs, and buffer topological constraints during RF progression. In this (mini) review, I present an overview of these replication-related functions of SMC5/6.

Also flagged:asialoglycoprotein receptorcurcuminHepatocellular cellular carcinomaliver cancercell surfaceGalactosamine
Journal Article 2018-12-22 ✓ 1 Snippet Yousef S, Alsaab HO, Sau S, Iyer AK.
In-Text Gene Mentions

…iron overload inhemochromatosis[8] and type…

Show Full Abstract

Hepatocellular cellular carcinoma (HCC) is one of the most challenging liver cancer subtypes. Due to lack of cell surface biomarkers and highly metastatic nature, early detection and targeted therapy of HCC is an unmet need. Galactosamine (Gal) is among the few selective ligands used for targeting HCCs due to its high binding affinity to asialoglycoprotein receptors (ASGPRs) overexpressed in HCC. In the present work, we engineered nanoscale G4 polyamidoamine (PAMAM) dendrimers anchored to galactosamine and loaded with the potent anticancer curcumin derivative (CDF) as a platform for targeted drug delivery to HCC. <i>In vivo</i> targeting ability and bio-distribution of PAMAM-Gal were assessed via its labeling with the clinically used, highly contrast, near infrared (NIR) dye: S0456, with testing of the obtained conjugate in aggressive HCC xenograft model. Our results highlighted the targeted dendrimer PAMAM-Gal ability to achieve selective high cellular uptake via ASGPR mediated endocytosis and significantly enhance the delivery of CDF into the studied HCC cell lines. Cytotoxicity MTT assays in HCC cell lines, interestingly highlighted, the comparative high potency of CDF, where CDF was more potent as a chemotherapeutic anticancer small molecule than the currently in use Doxorubicin, Sorafenib and Cisplatin chemotherapeutic agents. In conclusion the proof-of-concept study using nanoscale PAMAM-Gal dendrimer has demonstrated its competency as an efficient delivery system for selective delivery of potent CDF for HCC anticancer therapy as well as HCC diagnosis via NIR imaging.

Also flagged:kidney canceradultcancersdiseases of thepathogenesisurological malignancies
Journal Article 2018-12-22 ✓ 1 Snippet Lin L, Yu Q, Zheng J, Cai Z, Tian R.
In-Text Gene Mentions

…[ 54 ],neuronal growth regulator 1growth regulator 1…

Show Full Abstract

<h4>Background</h4>Urine has evolved as a promising body fluids in clinical proteomics because it can be easily and noninvasively obtained and can reflect physiological and pathological status of the human body. Many efforts have been made to characterize more urinary proteins in recent years, but few have focused on the analysis throughput and detection reproducibility. Increasing the urine proteomic profiling throughput and reproducibility is urgently needed for discovering potential biomarker in large cohorts.<h4>Methods</h4>In this study, we developed a fast and robust workflow for streamlined urinary proteome analysis. The workflow integrate highly efficient sample preparation technique and urinary specific data-independent acquisition (DIA) approach. The performance of the workflow was systematically evaluated and the workflow was subsequently applied in a proof-of-concept urine proteome study of 21 kidney cancer (KC) patients and 22 healthy controls.<h4>Results</h4>With this workflow, the entire sample preparation process takes less than 3 h and allows multiplexing on standard centrifuges. Without pre-fractionation, our newly developed DIA method allows quantitative analysis of ~ 1000 proteins within 80 min of MS time (~ 15 samples/day). The quantitation accuracy of the whole workflow was excellent with median CV of 9.1%. The preliminary study on KC identified 125 significantly changed proteins.<h4>Conclusions</h4>The result suggested the feasibility of applying the high throughput workflow in extensive urinary proteome profiling and clinical relevant biomarker discovery.

Also flagged:PirinAndrogenCRPCcancerpathogenesisPCa
Journal Article 2018-12-21 No Snippets Arai T, Kojima S, Yamada Y, Sugawara S, Kato M, Yamazaki K, Naya Y, Ichikawa T, Seki N.
Show Full Abstract

Androgen deprivation therapy is frequently used to treat prostate cancer (PCa), but resistance can occur, a condition known as castration-resistant prostate cancer (CRPC). Thus, novel approaches for identification of CRPC are important for designing effective PCa treatments. Analysis of microRNA (miRNA) expression signatures by RNA sequencing showed that both passenger and guide strands of the miR-455-duplex (miR-455-5p and miR-455-3p, respectively) acted as antitumor miRNAs in PCa cells. The involvement of miRNA passenger strands in cancer pathogenesis is a novel concept for miRNA functionality. Based on a large patient cohort in The Cancer Genome Atlas, expression of eight miR-455-5p/-3p target genes (PIR: P = 0.0137, LRP8: P = 0.0495, IGFBP3: P = 0.0172, DMBX1: P = 0.0175, CCDC64: P = 0.0446, TUBB1: P = 0.0149, KIF21B: P = 0.0336, and NFAM1: P = 0.0013) was significantly associated with poor prognosis of PCa patients. Here, we focused on PIR (pirin), a highly conserved member of the cupin superfamily. PIR expression was directly regulated by miR-455-5p, and PIR overexpression was detected in hormone-sensitive prostate cancer (HSPC) surgical specimens and CRPC autopsy specimens. Loss-of-function assays using siRNA or an inhibitor (bisamide) showed that downregulation of PIR expression blocked cancer cell migration and invasion. Moreover, the miR-455-5p/PIR axis contributed to cancer cell aggressiveness. These results suggest that PIR might be a promising diagnostic marker for HSPC and CRPC. Furthermore, CRPC treatment strategies targeting PIR may be possible in the future. Identification of antitumor miRNAs, including miRNA passenger strands, may contribute to the development of new diagnostic markers and therapeutic strategies for CRPC.

Also flagged:CORINcoilbrain-derived neurotrophic factorGlutamineF12tyrosine
Journal Article 2018-12-21 ✓ 3 Snippets Chen Y, Dolt KS, Kriek M, Baker T, Downey P, Drummond NJ, Canham MA, Natalwala A, Rosser S, Kunath T.
In-Text Gene Mentions

SOX6

…catactgcgcctgaacacaa Probe 41;SOX6F‐gcttctggactcagcccttta, R‐ggc…

…markers NURR1 ,SOX6, DAT ,…

Show Full Abstract

An emerging treatment for Parkinson's disease (PD) is cell replacement therapy. Authentic midbrain dopaminergic (mDA) neuronal precursors can be differentiated from human embryonic stem cells (hESCs) and human induced pluripotent stem cells (iPSCs). These laboratory-generated mDA cells have been demonstrated to mature into functional dopaminergic neurons upon transplantation into preclinical models of PD. However, clinical trials with human fetal mesenchephalic cells have shown that cell replacement grafts in PD are susceptible to Lewy body formation suggesting host-to-graft transfer of α-synuclein pathology. Here, we have used CRISPR/Cas9n technology to delete the endogenous SNCA gene, encoding for α-synuclein, in a clinical-grade hESC line to generate SNCA<sup>+/-</sup> and SNCA<sup>-/-</sup> cell lines. These hESC lines were first differentiated into mDA neurons, and then challenged with recombinant α-synuclein preformed fibrils (PFFs) to seed the formation for Lewy-like pathology as measured by phosphorylation of serine-129 of α-synuclein (pS129-αSyn). Wild-type neurons were fully susceptible to the formation of protein aggregates positive for pS129-αSyn, while SNCA<sup>+/-</sup> and SNCA<sup>-/-</sup> neurons exhibited significant resistance to the formation of this pathological mark. This work demonstrates that reducing or completely removing SNCA alleles by CRISPR/Cas9n-mediated gene editing confers a measure of resistance to Lewy pathology.

Also flagged:disulfideiminec-MYCcancer
Journal Article 2018-12-21 No Snippets Jana S, Panda D, Saha P, Pantos GD, Dash J.
Show Full Abstract

Dynamic combinatorial chemistry (DCC) has emerged as a promising strategy for template-driven selection of high-affinity ligands for biological targets from equilibrating combinatorial libraries. However, only a few examples using disulfide-exchange-based DCC are reported for nucleic acid targets. Herein, we have demonstrated that gold-coated magnetic nanoparticle-conjugated DNA targets can be used as templates for dynamic selection of ligands from an imine-based combinatorial library. The implementation of DCC using DNA nanotemplates enables efficient identification of the lead compounds, from the dynamic combinatorial library via magnetic decantation. It further allows quick separation of DNA nanotemplates for reuse in DCC reactions. The identified lead compound exhibits significant quadruplex versus duplex DNA selectivity and suppresses promoter activity of c-MYC gene that contains G-quadruplex DNA forming sequence in the upstream promoter region. Further cellular experiments indicated that the lead compound is able to permeate into cell nuclei and trigger a DNA damage response in cancer cells.

Also flagged:BDNFconstipationpeptideserotoninbrain-derived neurotrophic factor
Journal Article 2018-12-21 ✓ 2 Snippets Riezzo G, Chimienti G, Orlando A, D'Attoma B, Clemente C, Russo F.
In-Text Gene Mentions

The aims of this study were to investigate: (1) the effects of long-term administration of Lactobacillus reuteri (LR) DSM 17938 on the serum levels of serotonin (5-HT) and brain-derived neurotrophic factor (BDNF); (2) the possible link between 5-HT, BDNF, and specific constipation-related symptoms; (3) whether genetic variability at the 5-HTT gene-linked polymorphic region (5-HTTLPR) and BDNF Val66Met loci could be associated with serum 5-HT and BDNF variations.

…variability at the5-HTTgene-linked polymorphic region…

Show Full Abstract

Accumulated evidence shows that some probiotic strains ameliorate functional constipation (FC) via the modulation of specific gastrointestinal peptide pathways. The aims of this study were to investigate: (1) the effects of long-term administration of Lactobacillus reuteri (LR) DSM 17938 on the serum levels of serotonin (5-HT) and brain-derived neurotrophic factor (BDNF); (2) the possible link between 5-HT, BDNF, and specific constipation-related symptoms; (3) whether genetic variability at the 5-HTT gene-linked polymorphic region (5-HTTLPR) and BDNF Val66Met loci could be associated with serum 5-HT and BDNF variations. LR DSM 17938 was administered to 56 FC patients for 105 days in a randomised, double-blind manner. The fasting blood samples were collected during the randomisation visit (V<sub>1</sub>), at day 15 (induction period, V<sub>2</sub>), day 60 (intermediate evaluation, V<sub>3</sub>), and day 105 (V<sub>4</sub>) and the Constipaq questionnaire (the sum of Constipation Scoring System (CSS) and patient assessment constipation quality of life (PAC-QoL)) was administered. A group of healthy subjects was enrolled as controls (HC). At V1, the mean serum 5-HT level in the whole patient group was significantly higher (P=0.027) than in HC subjects, while serum BDNF did not. At the end of probiotic administration (V4), 5-HT and BDNF levels were significantly lower than the initial values (V1) (P=0.008 and P=0.015, respectively). 5-HT and BDNF serum concentration were significantly associated (r=0.355; P=0.007). Neither 5-HT nor BDNF serum levels correlated with the CSS item scores and with the PAC-QoL. Lastly, the regression analysis demonstrated that the presence of the S allele of the 5-HTTLPR accounted for the reduction in the 5-HT concentration at V4. In conclusion, the long-term administration of LR DSM 17938 demonstrated that such a probiotic strain could improve FC by affecting 5-HT and BDNF serum concentrations.

Also flagged:transcription factorsglucocorticoidstranscription factorhistonemodificationschromatin
Journal Article 2018-12-21 No Snippets Johnson GD, Barrera A, McDowell IC, D'Ippolito AM, Majoros WH, Vockley CM, Wang X, Allen AS, Reddy TE.
Show Full Abstract

Environmental stimuli commonly act via changes in gene regulation. Human-genome-scale assays to measure such responses are indirect or require knowledge of the transcription factors (TFs) involved. Here, we present the use of human genome-wide high-throughput reporter assays to measure environmentally-responsive regulatory element activity. We focus on responses to glucocorticoids (GCs), an important class of pharmaceuticals and a paradigmatic genomic response model. We assay GC-responsive regulatory activity across >10<sup>8</sup> unique DNA fragments, covering the human genome at >50×. Those assays directly detected thousands of GC-responsive regulatory elements genome-wide. We then validate those findings with measurements of transcription factor occupancy, histone modifications, chromatin accessibility, and gene expression. We also detect allele-specific environmental responses. Notably, the assays did not require knowledge of GC response mechanisms. Thus, this technology can be used to agnostically quantify genomic responses for which the underlying mechanism remains unknown.

Also flagged:Netrin-1axonsLocalizationcytoplasmcholine acetyltransferaseChAT
Journal Article 2018-12-21 ✓ 5 Snippets Ko SY, Price JT, Blatch GL, Nurgali K.
In-Text Gene Mentions

DCC and Netrin-1 on various types of enteric neurons and their role in the mature enteric nervous

colorectal cancer (DCC

…unoreactivity Coexpresses WithDCCand Has a…

…in colorectal cancer (DCC) present on axons…

…Localization ofDCCand Netrin-1 on…

Show Full Abstract

Netrin-1 is a potent axonal and neuronal guidance cue in the developing nervous system. Netrin-1 functions are mediated by its receptors, such as deleted in colorectal cancer (DCC) present on axons and neurons. Localization of DCC and Netrin-1 on various types of enteric neurons and their role in the mature enteric nervous system is unknown. The results of our study revealed that almost all enteric neurons and processes express DCC and Netrin-1 in the adult mice. Netrin-1-like-immunoreactivity (IR) was detected in the cytoplasm of neurons with some showing strong or weak staining. The majority of Netrin-1-like-immunoreactive enteric neurons were choline acetyltransferase (ChAT)-positive. However, ~19% of neurons were strongly Netrin-1-like-positive but ChAT-negative while ~8% of neurons were Netrin-1-like-negative but strongly ChAT-positive. In contrast, almost all nitric oxide synthase (nNOS)-positive enteric neurons displayed strong Netrin-1-like-IR. This differential intensity of Netrin-1 expression in the myenteric neurons might determine major neuronal subtypes regulating intestinal motility, ChAT-IR excitatory, and nNOS-IR inhibitory muscle motor and interneurons. This is the first study demonstrating the localization of DCC and Netrin-1 in the colonic myenteric plexus of the adult mice and their expression level determining two major neuronal subtypes regulating intestinal motility.

Also flagged:ironsixseciron overloadliver diseaseliver cirrhosis
Journal Article 2018-12-21 ✓ 1 Snippet McKay A, Wilman HR, Dennis A, Kelly M, Gyngell ML, Neubauer S, Bell JD, Banerjee R, Thomas EL.
In-Text Gene Mentions

…however reports ofhemochromatosiswithin Asian populations…

Show Full Abstract

The burden of liver disease continues to increase in the UK, with liver cirrhosis reported to be the third most common cause of premature death. Iron overload, a condition that impacts liver health, was traditionally associated with genetic disorders such as hereditary haemochromatosis, however, it is now increasingly associated with obesity, type-2 diabetes and non-alcoholic fatty liver disease. The aim of this study was to assess the prevalence of elevated levels of liver iron within the UK Biobank imaging study in a cohort of 9108 individuals. Magnetic resonance imaging (MRI) was undertaken at the UK Biobank imaging centre, acquiring a multi-echo spoiled gradient-echo single-breath-hold MRI sequence from the liver. All images were analysed for liver iron and fat (expressed as proton density fat fraction or PDFF) content using LiverMultiScan. Liver iron was measured in 97.3% of the cohort. The mean liver iron content was 1.32 ± 0.32 mg/g while the median was 1.25 mg/g (min: 0.85 max: 6.44 mg/g). Overall 4.82% of the population were defined as having elevated liver iron, above commonly accepted 1.8 mg/g threshold based on biochemical iron measurements in liver specimens obtained by biopsy. Further analysis using univariate models showed elevated liver iron to be related to male sex (p<10(-16), r2 = 0.008), increasing age (p<10(-16), r2 = 0.013), and red meat intake (p<10(-16), r2 = 0.008). Elevated liver fat (>5.6% PDFF) was associated with a slight increase in prevalence of elevated liver iron (4.4% vs 6.3%, p = 0.0007). This study shows that population studies including measurement of liver iron concentration are feasible, which may in future be used to better inform patient stratification and treatment.

Also flagged:RhoRanβ-actin16S rRNABaqA-SH6BaqA
Journal Article 2018-12-21 No Snippets Nguyen HT, Nguyen TT, Pham HTT, Nguyen QTN, Tran MT, Nguyen AH, Phan TN, Bui HTV, Dao HTT, Nguyen ATV.
Show Full Abstract

Bacillus aquimaris SH6 spores produce carotenoids that are beneficial to white-leg shrimp (Litopenaeus vannamei) health. However, the optimal dose and mechanisms behind these effects are not well understood. We investigated the fate of SH6 spores in the gut of L. vannamei. Shrimp were divided into six groups administrated with either feed only (negative control) or SH6 spores at 5 × 106 CFU/g pellet (high dose, SH6 spore-H group), 1 × 106 CFU/g pellet (medium dose, SH6 spore-M group), 2 × 105 CFU/g pellet (low dose, SH6 spore-L group), astaxanthin at 0.5 mg/g pellet (Carophyll group), or carotenoids from SH6 vegetative cells at 5 μg/g pellet (SH6 carotenoid group). The growth rate was highest in SH6 spore-H (3.38%/day), followed by SH6 spore-M (2.84%/day) and SH6 spore-L (2.25%/day), which was significantly higher than the control (1.45%/day), Carophyll (1.53%/day) or SH6 carotenoid (1.57%/day) groups. The astaxanthin levels (1.9-2.0 μg/g shrimp) and red-colour scores (21-22) in SH6 spore-H/M were higher than the control (astaxanthin: 1.2 μg/g shrimp; red score: 20) or SH6 spore-L, but lower than the Carophyll and SH6 carotenoids. Feeding with medium and high doses of SH6 spores after 28 days resulted in respective 1.3-2-fold increases in phenol oxidase activity and 8-9 fold increases in Rho mRNA expression compared to the control and low dose group. The live-counts of SH6 in the gut gradually increased during the 28-day feeding period with SH6 spores at different concentrations, starting from 4.1, 8.2, and 5.4 × 104 CFU/g gut at day 1 and reaching 5.3, 5.1, and 4.4 × 105 CFU/g gut in the SH6-H/M/L groups, respectively, at day 28. Gut microbiota became more diversified, resulting in a 2-8-fold increase in total bacterial live-counts compared to the controls. SH6 spore germination was detected by measuring the mRNA expression of a specific sequence coding for SH6 amylase at 4 h, reaching saturation at 24 h. Our results confirm that SH6 spores colonize and germinate in the gut to improve the microbial diversity and boost the immune system of shrimp, exhibiting beneficial effects at >1 × 106 CFU/g pellet.

Also flagged:prionoligoadenylate synthetaseribonuclease Lvirus infectionsoligoadenylate synthetase-ribonuclease LOAS
Journal Article 2018-12-21 ✓ 5 Snippets Rovnak J, Clair LAS, Krieger K, Lian E, Perera R, Cohrs RJ.
In-Text Gene Mentions

…studies identified cellularVRK2as an upstream…

…by B1 and/orVRK2deletion.…

VRK2deletion alone did…

…both B1 andVRK2resulted in a…

…data suggests thatVRK2functions to phosphorylate…

Show Full Abstract

This autumn, approximately 100 scientists and students from the Rocky Mountain area along with invited speakers attended the 18th annual meeting of the Rocky Mountain Virology Association that was held at the Colorado State University Mountain Campus. The two-day gathering featured 31 talks and 33 posters all of which focused on specific areas of current virology and prion protein research. Since the keynote presentation focused on the oligoadenylate synthetase-ribonuclease L pathway the main area of focus was on host⁻virus interactions, however other areas of interest included virus vectors, current models of virus infections, prevention and treatment of virus infections, separate sessions on RNA viruses and prion proteins, and a special talk highlighting various attributes of targeted next-generation sequencing. The meeting was held at the peak of the fall Aspen colors surrounded by five mountains >11000 ft (3.3 km) where the secluded campus provided the ideal setting for extended discussions and outdoor exercise. On behalf of the Rocky Mountain Virology Association, this report summarizes 42 selected presentations.

Also flagged:GJA1ADtaumetabolismApoe
Journal Article 2018-12-21 ✓ 1 Snippet Kajiwara Y, Wang E, Wang M, Sin WC, Brennand KJ, Schadt E, Naus CC, Buxbaum J, Zhang B.
In-Text Gene Mentions

…EMX2, GJA1, PPAP2B,PRDX6and SPARCL1 )…

Show Full Abstract

GJA1 (connexin43) has been predicted as the top key driver of an astrocyte enriched subnetwork associated with Alzheimer's disease (AD). In this study, we comprehensively examined GJA1 expression across 29 transcriptomic and proteomic datasets from post-mortem AD and normal control brains. We demonstrated that GJA1 was strongly associated with AD amyloid and tau pathologies and cognitive functions. RNA sequencing analysis of Gja1-/- astrocytes validated that Gja1 regulated the subnetwork identified in AD, and many genes involved in Aβ metabolism. Astrocytes lacking Gja1 showed reduced Apoe protein levels as well as impaired Aβ phagocytosis. Consistent with this, wildtype neurons co-cultured with Gja1-/- astrocytes contained higher levels of Aβ species than those with wildtype astrocytes. Moreover, Gja1-/- astrocytes was more neuroprotective under Aβ stress. Our results underscore the importance of GJA1 in AD pathogenesis and its potential for further investigation as a promising pharmacological target in AD.

Also flagged:gene expressionRNase RgliomabindingRNA-binding proteinssynapses
Journal Article 2018-12-21 No Snippets Yang Q, Wu J, Zhao J, Xu T, Zhao Z, Song X, Han P.
Show Full Abstract

<h4>Background</h4>Circular RNAs (circRNAs) have recently been found to be expressed in human brain tissue, and many lines ofevidence indicate that circRNAs play regulatory roles in neurodevelopment. Proliferation and differentiation of neural stem cells (NSCs) are critical parts during development of central nervous system (CNS).To date, there have been no reports ofcircRNA expression profiles during the differentiation of mouse NSCs. We hypothesizethat circRNAs mayregulate gene expression in the proliferation anddifferentiation of NSCs.<h4>Results</h4>In this study, we obtained NSCs from the wild-type C57BL/6 J mouse fetal cerebral cortex. We extracted total RNA from NSCs in different differentiation stagesand then performed RNA-seq. By analyzing the RNA-Seq data, we found 37circRNAs and 4182 mRNAs differentially expressedduringthe NSC differentiation. Gene Ontology (GO) enrichment analysis of thecognate linear genes of these circRNAsrevealed that some enriched GO terms were related to neural activity. Furthermore, we performed a co-expression network analysis of these differentially expressed circRNAs and mRNAs. The result suggested a stronger GO enrichmentin neural features for both the cognate linear genes of circRNAs and differentially expressed mRNAs.<h4>Conclusion</h4>We performed the first circRNA investigation during the differentiation of mouse NSCs. Wefound that12 circRNAs might have regulatory roles duringthe NSC differentiation, indicating that circRNAs might be modulated during NSC differentiation.Our network analysis suggested the possible complex circRNA-mRNA mechanisms during differentiation, and future experimental workis need to validate these possible mechanisms.

Also flagged:Serotonin transportercocaineDATDopamineneuropsychiatric disordersattention-deficit/hyperactivity disorder
Journal Article 2018-12-21 ✓ 1 Snippet Stewart A, Davis GL, Gresch PJ, Katamish RM, Peart R, Rabil MJ, Gowrishankar R, Carroll FI, Hahn MK, Blakely RD.
In-Text Gene Mentions

…primary antibody (1:2000; 5-HTT-GP-Af1400, RRID: AB_2571777, …

Show Full Abstract

Dopamine (DA) signaling dysfunction is believed to contribute to multiple neuropsychiatric disorders including attention-deficit/hyperactivity disorder (ADHD). The rare DA transporter (DAT) coding substitution Ala559Val found in subjects with ADHD, bipolar disorder and autism, promotes anomalous DA efflux in vitro and, in DAT Val559 mice, leads to increased reactivity to imminent handling, waiting impulsivity, and enhanced motivation for reward. Here, we report that, in contrast to amphetamine and methylphenidate, which induce significant locomotor activation, cocaine administration to these mice elicits no locomotor effects, despite retention of conditioned place preference (CPP). Additionally, cocaine fails to elevate extracellular DA. Given that amphetamine and methylphenidate, unlike cocaine, lack high-affinity interactions with the serotonin (5-HT) transporter (SERT), we hypothesized that the lack of cocaine-induced hyperlocomotion in DAT Val559 mice arises from SERT blockade and augmented 5-HT signaling relative to cocaine actions on wildtype animals. Consistent with this idea, the SERT blocker fluoxetine abolished methylphenidate-induced locomotor activity in DAT Val559 mice, mimicking the effects seen with cocaine. Additionally, a cocaine analog (RTI-113) with greater selectivity for DAT over SERT retains locomotor activation in DAT Val559 mice. Furthermore, genetic elimination of high-affinity cocaine interactions at SERT in DAT Val559 mice, or specific inhibition of 5-HT<sub>2C</sub> receptors in these animals, restored cocaine-induced locomotion, but did not restore cocaine-induced elevations of extracellular DA. Our findings reveal a significant serotonergic plasticity arising in the DAT Val559 model that involves enhanced 5-HT<sub>2C</sub> signaling, acting independently of striatal DA release, capable of suppressing the activity of cocaine-sensitive motor circuits.

Also flagged:translation factortranslationalcell proliferationTranslationcanceramino acid
Journal Article 2018-12-21 ✓ 1 Snippet Zhang Z, Ye Y, Gong J, Ruan H, Liu CJ, Xiang Y, Cai C, Guo AY, Ling J, Diao L, Weinstein JN, Han L.
In-Text Gene Mentions

…TARS , andDARS2(Supplementary Figure 6B…

Show Full Abstract

The protein translational system, including transfer RNAs (tRNAs) and several categories of enzymes, plays a key role in regulating cell proliferation. Translation dysregulation also contributes to cancer development, though relatively little is known about the changes that occur to the translational system in cancer. Here, we present global analyses of tRNAs and three categories of enzymes involved in translational regulation in ~10,000 cancer patients across 31 cancer types from The Cancer Genome Atlas. By analyzing the expression levels of tRNAs at the gene, codon, and amino acid levels, we identified unequal alterations in tRNA expression, likely due to the uneven distribution of tRNAs decoding different codons. We find that overexpression of tRNAs recognizing codons with a low observed-over-expected ratio may overcome the translational bottleneck in tumorigenesis. We further observed overall overexpression and amplification of tRNA modification enzymes, aminoacyl-tRNA synthetases, and translation factors, which may play synergistic roles with overexpression of tRNAs to activate the translational systems across multiple cancer types.

Also flagged:liver cancercell proliferationluciferaseZEB2cell cycleepithelial-mesenchymal transition
Journal Article 2018-12-21 ✓ 2 Snippets Zhang X, Xu X, Ge G, Zang X, Shao M, Zou S, Zhang Y, Mao Z, Zhang J, Mao F, Qian H, Xu W.
In-Text Gene Mentions

However, miR-498 is found to act as an oncogenic miRNA that targets cell cycle progression 1 (CCPG1) in retinoblastoma (20).

…cycle progression 1 (CCPG1) in retinoblastoma (…

Show Full Abstract

MicroRNAs (miRNAs) play critical roles in the growth, metastasis and therapeutic resistance of liver cancer. Accumulating evidence suggests that miR‑498 is aberrantly expressed in several human malignancies. However, the role and underlying mechanism of miR‑498 in liver cancer remain unclear. In the present study, we investigated the potential roles and clinical value of miR‑498 in liver cancer. We found that the miR‑498 expression level was significantly lower in liver cancer patient tissues than that in healthy control tissues. The expression of miR‑498 was also decreased in liver cancer cell lines compared to that noted in a normal human normal liver cell line. miR‑498 overexpression markedly inhibited liver cancer cell proliferation, migration and invasion. miR‑498 overexpression induced cell cycle arrest and apoptosis while it suppressed epithelial‑mesenchymal transition (EMT) in liver cancer cells. Bioinformatic analysis and luciferase reporter assay further identified zinc finger E‑box binding homeobox 2 (ZEB2) as a novel target of miR‑498. Furthermore, ZEB2 knockdown recapitulated the inhibitory effects of miR‑498 overexpression in liver cancer cells. ZEB2 overexpression rescued the inhibition of liver cancer cell proliferation, migration, and invasion by miR‑498, indicating that ZEB2 acts as a downstream effector of miR‑498 in liver cancer cells. Thus, we demonstrated that miR‑498 suppresses the growth and metastasis of liver cancer cells, partly at least, by directly targeting ZEB2, suggesting that miR‑498 may serve as a potential biomarker for the diagnosis and therapy of liver cancer.

Also flagged:Folic acid receptoralbuminprostate cancerfolic acid(FA) receptor
Journal Article 2018-12-21 No Snippets Sun Y, Zhao Y, Teng S, Hao F, Zhang H, Meng F, Zhao X, Zheng X, Bi Y, Yao Y, Lee RJ, Teng L.
Show Full Abstract

<h4>Background</h4>We previously developed cabazitaxel (CTX)-loaded human serum albumin nanoparticles (NPs-CTX) via a self-assembly method, and these NPs showed efficacy in prostate cancer therapy. Many studies have shown that the levels of folic acid (FA) receptor on the surface of various tumor cells are high. Therefore, FA-modified NPs-CTX may have enhanced antitumor effects compared with unmodified NPs-CTX.<h4>Methods</h4>NPs-CTX were first prepared via self-assembly, and FA was conjugated on the surface of NPs-CTX through the -NH<sub>2</sub> groups of the NPs to produce FA-NPs-CTX. The FA-NPs-CTX were evaluated in tumor cells with high FA receptor (FR) expression in vitro and in vivo.<h4>Results</h4>Both NPs-CTX and FA-NPs-CTX exhibited good stability and morphology. Drug release from the NPs was not affected by FA conjugation. Compared with CTX dissolved in a mixture of Tween 80 and 13% ethanol (w/w) at a ratio of 1:4 (v/v) (Tween-CTX), the two nanoformulations had lower lytic activity against normal red blood cells. However, FA-NPs-CTX showed greater inhibition of tumor cells with overexpressed FR, compared with NPs-CTX, in the cytotoxicity experiments. Moreover, the cellular uptake of FA-NPs-CTX was enhanced through FR-mediated endocytosis in HeLa cells in vitro and HeLa xenograft tumors in vivo. Although Tween-CTX exhibited tumor growth inhibition similar to FA-NPs-CTX in vivo, this inhibition also caused adverse side effects; the median lethal dose (LD50) of Tween-CTX to mice was 5.68 mg/kg, while FA-NPs-CTX-treated mice survived at doses exceeding 400 mg/kg.<h4>Conclusion</h4>The results showed that FA-NPs-CTX caused inhibition of tumor growth in a manner similar to that of Tween-CTX; however, the safety and tolerability of CTX were greatly improved by FA conjugation compared with those of Tween-CTX. In summary, FA-NPs-CTX have great potential in CTX delivery, and this formulation is a promising candidate for the treatment of cancers with high FR levels.

Also flagged:Faspulmonary inflammationallergic inflammationmucuscell differentiationERK
Journal Article 2018-12-21 ✓ 4 Snippets Han M, Hu R, Ma J, Zhang B, Chen C, Li H, Yang J, Huang G.
In-Text Gene Mentions

…( 22 ),Tnfsf4( 8 ),…

…Il6 , andTnfsf4, which had…

…of Il6 andTnfsf4, while Fas…

…for Il6 andTnfsf4expression in DCs…

Show Full Abstract

Fas-Fas ligand (FasL) signaling plays an important role in the development of allergic inflammation, but the cellular and molecular mechanisms are still not well known. By using the bone marrow-derived dendritic cell (BMDC) transfer-induced pulmonary inflammation model, we found that house dust mite (HDM)-stimulated FAS-deficient BMDCs induced higher Th2-mediated allergic inflammation, associated with increased mucus production and eosinophilic inflammation. Moreover, FAS-deficient BMDCs promoted Th2 cell differentiation upon HDM stimulation <i>in vitro</i>. Compared to wild-type BMDCs, the Fas-deficient BMDCs had increased ERK activity and decreased IL-12 production upon HDM stimulation. Inhibition of ERK activity could largely increase IL-12 production, consequently restored the increased Th2 cytokine expression of OT-II CD4<sup>+</sup> T cells activated by Fas-deficient BMDCs. Thus, our results uncover an important role of DC-specific Fas signaling in Th2 differentiation and allergic inflammation, and modulation of Fas signaling in DCs may offer a useful strategy for the treatment of allergic inflammatory diseases.

Also flagged:NeuropeptideNeuropeptidesamino acidgalanintranslationalmethylation
Journal Article 2018-12-21 ✓ 1 Snippet Hökfelt T, Barde S, Xu ZD, Kuteeva E, Rüegg J, Le Maitre E, Risling M, Kehr J, Ihnatko R, Theodorsson E, Palkovits M, Deakin W, Bagdy G, Juhasz G, Prud'homme HJ, Mechawar N, Diaz-Heijtz R, Ögren SO.
In-Text Gene Mentions

The 5-HTT and GalR2 receptor act jointly in the development of depression (Gonda et al., 2018).

Show Full Abstract

Neuropeptides are auxiliary messenger molecules that always co-exist in nerve cells with one or more small molecule (classic) neurotransmitters. Neuropeptides act both as transmitters and trophic factors, and play a role particularly when the nervous system is challenged, as by injury, pain or stress. Here neuropeptides and coexistence in mammals are reviewed, but with special focus on the 29/30 amino acid galanin and its three receptors GalR1, -R2 and -R3. In particular, galanin's role as a co-transmitter in both rodent and human noradrenergic locus coeruleus (LC) neurons is addressed. Extensive experimental animal data strongly suggest a role for the galanin system in depression-like behavior. The translational potential of these results was tested by studying the galanin system in <i>postmortem</i> human brains, first in normal brains, and then in a comparison of five regions of brains obtained from depressed people who committed suicide, and from matched controls. The distribution of galanin and the four galanin system transcripts in the normal human brain was determined, and selective and parallel changes in levels of transcripts and DNA methylation for galanin and its three receptors were assessed in depressed patients who committed suicide: <i>upregulation</i> of transcripts, e.g., for galanin and GalR3 in LC, paralleled by a <i>decrease</i> in DNA methylation, suggesting involvement of epigenetic mechanisms. It is hypothesized that, when exposed to severe stress, the noradrenergic LC neurons fire in bursts and release galanin from their soma/dendrites. Galanin then acts on somato-dendritic, inhibitory galanin autoreceptors, opening potassium channels and inhibiting firing. The purpose of these autoreceptors is to act as a 'brake' to prevent overexcitation, a brake that is also part of <i>resilience</i> to stress that protects against depression. Depression then arises when the inhibition is too strong and long lasting - a maladaption, allostatic load, leading to depletion of NA levels in the forebrain. It is suggested that disinhibition by a galanin antagonist may have antidepressant activity by restoring forebrain NA levels. A role of galanin in depression is also supported by a recent candidate gene study, showing that variants in genes for galanin and its three receptors confer increased risk of depression and anxiety in people who experienced childhood adversity or recent negative life events. In summary, galanin, a neuropeptide coexisting in LC neurons, may participate in the mechanism underlying resilience against a serious and common disorder, MDD. Existing and further results may lead to an increased understanding of how this illness develops, which in turn could provide a basis for its treatment.

Also flagged:Angiopoietin like protein 8ANGPTL8glucoselipidinsulinInsulin Resistance
Journal Article 2018-12-21 No Snippets Siddiqa A, Cirillo E, Tareen SHK, Ali A, Kutmon M, Eijssen LMT, Ahmad J, Evelo CT, Coort SL.
Show Full Abstract

Angiopoietin like protein 8 (ANGPTL8) is a newly identified hormone with unique nature due to its ability to regulate both glucose and lipid metabolic pathways. It is characterized as an important molecular player of insulin induced nutrient storage and utilization pathway during fasting to re-feeding metabolic transition. Several studies have contributed to increase our knowledge regarding its function and mechanism of action. Moreover, its altered expression levels have been observed in Insulin Resistance, Diabetes Mellitus (Types I & II) and Non Alcohlic Fatty Liver Disease emphasizing its assessment as a drug target. However, there is still a great deal of information that remains to be investigated including its associated biological processes, partner proteins in these processes, its regulators and its association with metabolic pathogenesis. In the current study, the analysis of a transcriptomic data set was performed for functional assessment of ANGPTL8 in liver. Weighted Gene Co-expression Network Analysis coupled with pathway analysis tools was performed to identify genes that are significantly co-expressed with ANGPTL8 in liver and investigate their presence in biological pathways. Gene ontology term enrichment analysis was performed to select the gene ontology classes that over-represent the hepatic ANGPTL8-co-expressed genes. Moreover, the presence of diabetes linked SNPs within the genes set co-expressed with ANGPTL8 was investigated. The co-expressed genes of ANGPTL8 identified in this study (<i>n</i> = 460) provides narrowed down list of molecular targets which are either co-regulated with it and/or might be regulation partners at different levels of interaction. These results are coherent with previously demonstrated roles and regulators of ANGPTL8. Specifically, thirteen co-expressed genes (MAPK8, CYP3A4, PIK3R2, PIK3R4,PRKAB2, G6PC, MAP3K11, FLOT1, PIK3C2G, SHC1, SLC16A2, and RAPGEF1) are also present in the literature curated pathway of ANGPTL8 (WP3915). Moreover, the gene-SNP analysis of highly associated biological processes with ANGPTL8 revealed significant genetic signals associated to Diabetes Mellitus and similar phenotypic traits. It provides meaningful insights on the influencing genes involved and co-expressed in these pathways. Findings of this study have implications in functional characterization of ANGPTL8 with emphasis on the identified genes and pathways and their possible involvement in the pathogenesis of Diabetes Mellitus and Insulin Resistance.

Also flagged:KLHL5KLHLE3 ligasebindingCullin-3CUL3
Journal Article 2018-12-21 ✓ 1 Snippet Schleifer RJ, Li S, Nechtman W, Miller E, Bai S, Sharma A, She JX.
In-Text Gene Mentions

KLHL20complexes with DAPK…

Show Full Abstract

KLHL family genes are noted for their involvement in the E3 ligase ubiquitination pathway through binding with Cullin-3 (CUL3) resulting in degradation of specific binding partners. KLHLs are thus intriguing genes for cancer as they can directly influence the degradation of therapeutically relevant cell cycle regulators such as Aurora Kinase, PLK1, or CDK1. However, most KLHL family members remain understudied within the literature. This study explores the relationship of expression of KLHL member, <i>KLHL5</i>, with the pharmacologic effect of anti-cancer drugs. <i>KLHL5</i> knockdown decreased the proliferation and viability of cancer cells and sensitized cancer cells to numerous anti-cancer drugs. Drugs related to cell cycle including Akt/PI3K/mTOR inhibitors were especially sensitized by <i>KLHL5</i> knockdown. The potential of KLHL5 as a prognostic or diagnostic cancer marker was compared to other KLHLs through a pan-cancer study of The Cancer Genome Atlas (TCGA) tumor groups. While KLHL5 expression shows marginal dysregulation in cancer, other KLHLs exhibit significant dysregulation in all cancer types, and exceptionally in renal carcinomas. This study advocates for further study of KLHLs as potential alternative therapeutic targets, since while <i>KLHL5</i> is a novel gene impacting anticancer drug effects, others may have a similar impact on drug effect while having greater potential as diagnostic or prognostic markers.

Also flagged:coccidiosisinfectionADD3NAV2PLXNA2PTPRF
Journal Article 2018-12-21 ✓ 1 Snippet Giles T, van Limbergen T, Sakkas P, Belkhiri A, Maes D, Kyriazakis I, Mendez J, Barrow P, Foster N, Foster N.
In-Text Gene Mentions

…Four genes (ADD3,MLLT10, NAV2 and PLXNA2)…

Show Full Abstract

We analysed intestinal tissues from groups of fast growing (Ross 308) broilers with natural or experimental coccidiosis, by genomic microarray. We identified genes that were differentially expressed (DE) in all groups and analysed expression of a panel of these, by qPCR, in Ross 308 and slow growing (Ranger classic) broilers, infected with 2500 or 7000 oocysts of Eimeria maxima for 6 or 13 days post-infection (dpi). Four genes (ADD3, MLLT10, NAV2 and PLXNA2) were upregulated (P <0.05) in Ross 308 but were not DE in Ranger Classic at 6 dpi with 2500 oocysts. Six genes (PTPRF, NCOR1, CSF3, SGK1, CROR and CD1B) were upregulated (P <0.05) in both Ross 308 and Ranger Classic infected with 2500 oocysts at 6 dpi but were not DE at 6 dpi with 7000 oocysts. At 13 dpi with 7000 oocysts, NAV2 and NCOR1 were upregulated in Ross 308 (P <0.05) and PTPRF was upregulated in both genotypes (P <0.05). DE of immune genes within the biomarker panel also occurred, with CSF3 upregulated in both genotypes infected with 2500 oocysts at 6 dpi and in Ranger Classic infected with 7000 oocysts, at 6 and 13 dpi (P <0.05). IL-22 was down-regulated in Ranger Classic infected with 2500 or 7000 oocysts at 6 dpi (P <0.05) but upregulated in both genotypes at 13 dpi (P <0.05). CD72 was down-regulated in Ranger Classic infected with 2500 oocysts at 6 dpi and with 7000 oocysts at 6 and 13 dpi (P <0.05). CD72 was upregulated in Ross 308 infected with 2500 oocysts at 6 dpi but was down-regulated following infection with 7000 oocysts at 13 dpi (P <0.05). In conclusion, differential gene expression occurs in fast and slow growing broiler genotypes with coccidiosis. In addition, we highlight a potential genetic biomarker panel for early diagnosis of coccidiosis.

Also flagged:serine/threonine mitotic kinasecancercell proliferationVRK1phosphorylationadenosine triphosphate
Journal Article 2018-12-20 ✓ 1 Snippet Ngow YS, Rajan S, Ye H, Yoon HS.
In-Text Gene Mentions

VRK2

Show Full Abstract

Vaccinia-related kinase 1 (VRK1), a serine/threonine mitotic kinase, is widely over-expressed in dividing cells and regarded as a cancer drug target primarily due to its function as an early response gene in cell proliferation. However, the mechanism of VRK1 phosphorylation and substrate activation is not well understood. More importantly even the molecular basis of VRK1 interaction with its cofactor, adenosine triphosphate (ATP), is unavailable to-date. As designing specific inhibitors remains to be the major challenge in kinase research, such a molecular understanding will enable us to design ATP-competitive specific inhibitors of VRK1. Here we report the molecular characterization of VRK1 in complex with AMP-PNP, a non-hydrolyzable ATP-analog, using NMR titration followed by the co-crystal structure determined upto 2.07 Å resolution. We also carried out the structural comparison of the AMP-PNP bound-form with its apo and inhibitor-bound counterparts, which has enabled us to present our rationale toward designing VRK1-specific inhibitors.

Also flagged:OX40LOX40systemic lupus erythematosusSLEcell activationcell proliferation
Journal Article 2018-12-20 No Snippets Jacquemin C, Augusto JF, Scherlinger M, Gensous N, Forcade E, Douchet I, Levionnois E, Richez C, Lazaro E, Duffau P, Truchetet ME, Seneschal J, Couzi L, Pellegrin JL, Viallard JF, Schaeverbeke T, Pascual V, Contin-Bordes C, Blanco P.
Show Full Abstract

Tregs are impaired in human systemic lupus erythematosus (SLE) and contribute to effector T cell activation. However, the mechanisms responsible for the Treg deficiency in SLE remain unclear. We hypothesized that the OX40L/OX40 axis is implicated in Treg and regulatory follicular helper T (Tfr) cell dysfunction in human SLE. OX40L/OX40 axis engagement on Tregs and Tfr cells not only specifically impaired their ability to regulate effector T cell proliferation, but also their ability to suppress T follicular helper (Tfh) cell-dependent B cell activation and immunoglobulin secretion. Antigen-presenting cells from patients with active SLE mediated Treg dysfunction in an OX40L-dependent manner, and OX40L-expressing cells colocalized with Foxp3+ cells in active SLE skin lesions. Engagement of the OX40L/OX40 axis resulted in Foxp3 downregulation in Tregs, and expression in SLE Tregs correlated with the proportion of circulating OX40L-expressing myeloid DCs. These data support that OX40L/OX40 signals are implicated in Treg dysfunction in human SLE. Thus, blocking the OX40L/OX40 axis appears to be a promising therapeutic strategy.

Also flagged:SpermatogenesisGonadotropinPGPchorionic gonadotropincongenital hypogonadotropic hypogonadismtestosterone
Journal Article 2018-12-20 ✓ 1 Snippet Zhang L, Cai K, Wang Y, Ji W, Cheng Z, Chen G, Liao Z.
In-Text Gene Mentions

…tumors, systemic diseases,hemochromatosis, and malnutrition.…

Show Full Abstract

The objective of this study was to compare the effect of pulsatile gonadorelin pump (PGP) and cyclical gonadotropin (human chorionic gonadotropin [HCG]/human menopausal gonadotropin [HMG]) therapy (CGT) on spermatogenesis in congenital hypogonadotropic hypogonadism (CHH) men. Twenty-eight azoospermic CHH males were included in this nonrandomized study. Ten received PGP and 18 received CGT. The primary endpoint was the earliest time spermatogenesis occurred during 24 months of treatment. Spermatogenesis time was significant earlier in the PGP group than the CGT group (median of 6 and 14 months, respectively, χ<sup>2</sup> = 6.711, p = .01). Spermatogenesis occurred in 90% of the PGP group and 83.3% of the CGT group and showed statistically insignificant difference in the superiority analysis and the no-inferior test. Contributing factors significant for spermatogenesis were previous HCG/or testosterone treatment and the peak serum luteinizing hormone level of triptorelin stimulation test at baseline. Although testis volume and penile length increased significantly from baseline, the differences between the two therapies were not significant. There was a tendency for high serum testosterone level, associated with more facial acne and breast tenderness in the CGT group. Skin allergic erythema scleroma was a common side effect of the PGP. In summary, PGP resulted in earlier spermatogenesis and more desirable testosterone levels than CGT.

Also flagged:mitochondrialironmitochondrial transmembrane proteinsbiosynthesismetabolismsideroflexin 2
Journal Article 2018-12-20 ✓ 2 Snippets Mon EE, Wei FY, Ahmad RNR, Yamamoto T, Moroishi T, Tomizawa K.
In-Text Gene Mentions

…is mediated byCdk5 regulatory subunit-associated protein 1regulatory subunit-associated …

…subunit-associated protein 1 (CDK5RAP1), a mitochondrial iron–sulfur…

Show Full Abstract

Mitochondrial iron is indispensable for heme biosynthesis and iron-sulfur cluster assembly. Several mitochondrial transmembrane proteins have been implicated to function in the biosynthesis of heme and iron-sulfur clusters by transporting reaction intermediates. However, several mitochondrial proteins related to iron metabolism remain uncharacterized. Here, we show that human sideroflexin 2 (SFXN2), a member of the SFXN protein family, is involved in mitochondrial iron metabolism. SFXN2 is an evolutionarily conserved protein that localized to mitochondria via its transmembrane domain. SFXN2-knockout (KO) cells had an increased mitochondrial iron content, which was associated with decreases in the heme content and heme-dependent enzyme activities. By contrast, the activities of iron-sulfur cluster-dependent enzymes were unchanged in SFXN2-KO cells. Moreover, abnormal iron metabolism impaired mitochondrial respiration in SFXN2-KO cells and accelerated iron-mediated death of these cells. Our findings demonstrate that SFXN2 functions in mitochondrial iron metabolism by regulating heme biosynthesis.

Also flagged:response to stressneuroticismmajor depressive disorderresponse to-related illnessesdepression
Journal Article 2018-12-20 No Snippets Arnau-Soler A, Adams MJ, Generation Scotland, Major Depressive Disorder Working Group of the Psychiatric Genomics Consortium, Hayward C, Thomson PA.
Show Full Abstract

Individual response to stress is correlated with neuroticism and is an important predictor of both neuroticism and the onset of major depressive disorder (MDD). Identification of the genetics underpinning individual differences in response to negative events (stress-sensitivity) may improve our understanding of the molecular pathways involved, and its association with stress-related illnesses. We sought to generate a proxy for stress-sensitivity through modelling the interaction between SNP allele and MDD status on neuroticism score in order to identify genetic variants that contribute to the higher neuroticism seen in individuals with a lifetime diagnosis of depression compared to unaffected individuals. Meta-analysis of genome-wide interaction studies (GWIS) in UK Biobank (N = 23,092) and Generation Scotland: Scottish Family Health Study (N = 7,155) identified no genome-wide significance SNP interactions. However, gene-based tests identified a genome-wide significant gene, ZNF366, a negative regulator of glucocorticoid receptor function implicated in alcohol dependence (p = 1.48x10-7; Bonferroni-corrected significance threshold p < 2.79x10-6). Using summary statistics from the stress-sensitivity term of the GWIS, SNP heritability for stress-sensitivity was estimated at 5.0%. In models fitting polygenic risk scores of both MDD and neuroticism derived from independent GWAS, we show that polygenic risk scores derived from the UK Biobank stress-sensitivity GWIS significantly improved the prediction of MDD in Generation Scotland. This study may improve interpretation of larger genome-wide association studies of MDD and other stress-related illnesses, and the understanding of the etiological mechanisms underpinning stress-sensitivity.

Also flagged:chromosomemembranegestationlocalizationendothelial cell migrationangiogenesis
Journal Article 2018-12-20 No Snippets Dini P, Daels P, Loux SC, Esteller-Vico A, Carossino M, Scoggin KE, Ball BA.
Show Full Abstract

<h4>Background</h4>The human chromosome 14 microRNA cluster (C14MC) is a conserved microRNA (miRNA) cluster across eutherian mammals, reported to play an important role in placental development. However, the expression kinetics and function of this cluster in the mammalian placenta are poorly understood. Here, we evaluated the expression kinetics of the equine C24MC, ortholog to the human C14MC, in the chorioallantoic membrane during the course of gestation.<h4>Results</h4>We demonstrated that C24MC-associated miRNAs presented a higher expression level during early stages of pregnancy, followed by a decline later in gestation. Evaluation of one member of C24MC (miR-409-3p) by in situ hybridization demonstrated that its cellular localization predominantly involved the chorion and allantoic epithelium and vascular endothelium. Additionally, expression of predicted target transcripts for C24MC-associated miRNAs was evaluated by RNA sequencing. Expression analysis of a subset of predicted mRNA targets showed a negative correlation with C24MC-associated miRNAs expression levels during gestation, suggesting the reciprocal control of these target transcripts by this miRNA cluster. Predicted functional analysis of these target mRNAs indicated enrichment of biological pathways related to embryonic development, endothelial cell migration and angiogenesis. Expression patterns of selected target mRNAs involved in angiogenesis were confirmed by RT-qPCR.<h4>Conclusion</h4>This is the first report evaluating C24MC kinetics during pregnancy. The findings presented herein suggest that the C24MC may modulate angiogenic transcriptional profiles during placental development in the horse.

Also flagged:Lupus ErythematosusSLEautoantibodiesHydroxychloroquinelupusimmune responses
Journal Article 2018-12-20 No Snippets Olsen NJ, James JA, Arriens C, Ishimori ML, Wallace DJ, Kamen DL, Chong BF, Liao D, Chinchilli VM, Karp DR.
Show Full Abstract

<h4>Background</h4>Onset of systemic lupus erythematosus (SLE) is preceded by a preclinical phase characterized by expression of autoantibodies and nonspecific clinical symptoms. Hydroxychloroquine is a treatment for lupus that is widely used based on longstanding experience and a very good safety profile. Existing data suggest that treatment with hydroxychloroquine may postpone the onset of disease. However, prospective studies that prove and quantify the efficacy of hydroxychloroquine in the preclinical phase of lupus have not been done. This study will test the hypothesis that early hydroxychloroquine use can prevent accumulation of clinical abnormalities and modify immune responses that define SLE.<h4>Methods</h4>A randomized, double-blind, placebo-controlled trial of hydroxychloroquine vs placebo will be conducted. Participants will have incomplete lupus erythematosus as defined by the presence of antinuclear antibody (ANA) positivity at a titer of 1:80 or greater, as well as one or two additional criteria from the 2012 Systemic Lupus International Collaborating Clinics (SLICC) classification criteria. The age range will be 15-45 years and the treatment phase will be 96 weeks. The primary endpoint will be the increase in the number of features of SLE defined by the 2012 SLICC classification schema. Secondary outcomes will include the proportion of participants who transition to a classification of SLE as defined by SLICC criteria.<h4>Discussion</h4>A major challenge for improving therapies in patients with SLE is early detection of disease. The ANA test that is widely used to screen for SLE has low specificity and interpretation of its significance is challenging. The Study of Anti-Malarials in Incomplete Lupus Erythematosus (SMILE) trial will provide insights into the appropriate target population for intervention, and will assess whether hydroxychloroquine can slow progression as measured by the accumulation of criteria. Ophthalmologic safety in this population will be assessed. The study will investigate candidate biomarkers that will guide treatment decisions and will accumulate a specimen biobank that will be available to the lupus research community for further in-depth mechanistic studies. This trial is a first step toward testing the feasibility of disease prevention strategies in SLE.<h4>Trial registration</h4>ClinicalTrials.gov, NCT 03030118 . Registered on 24 January 2017.

Also flagged:autoimmune diseasesautoimmune diseaseceliac diseaserheumatoid arthritisRAsystemic sclerosis
Journal Article 2018-12-20 ✓ 3 Snippets Márquez A, Kerick M, Zhernakova A, Gutierrez-Achury J, Chen WM, Onengut-Gumuscu S, González-Álvaro I, Rodriguez-Rodriguez L, Rios-Fernández R, González-Gay MA, Coeliac Disease Immunochip Consortium, Rheumatoid Arthritis Consortium International for Immunochip (RACI), International Scleroderma Group, Type 1 Diabetes Genetics Consortium, Mayes MD, Raychaudhuri S, Rich SS, Wijmenga C, Martín J.
In-Text Gene Mentions

Using this strategy, we identified four novel single-disease genome-wide associations, one for CeD (rs6806528 at FRMD4B), two for SSc (rs4258254 at TNFSF4 and rs17849502 at NCF2), and one for T1D (rs4238595 at UMOD) (Fig. 1, Additional file 2: Figures S6-S8, and Additional file 1: Table S5).

…SSc (rs4258254 atTNFSF4and rs17849502 at…

…the immune response,TNFSF4, is located…

Show Full Abstract

<h4>Background</h4>In recent years, research has consistently proven the occurrence of genetic overlap across autoimmune diseases, which supports the existence of common pathogenic mechanisms in autoimmunity. The objective of this study was to further investigate this shared genetic component.<h4>Methods</h4>For this purpose, we performed a cross-disease meta-analysis of Immunochip data from 37,159 patients diagnosed with a seropositive autoimmune disease (11,489 celiac disease (CeD), 15,523 rheumatoid arthritis (RA), 3477 systemic sclerosis (SSc), and 6670 type 1 diabetes (T1D)) and 22,308 healthy controls of European origin using the R package ASSET.<h4>Results</h4>We identified 38 risk variants shared by at least two of the conditions analyzed, five of which represent new pleiotropic loci in autoimmunity. We also identified six novel genome-wide associations for the diseases studied. Cell-specific functional annotations and biological pathway enrichment analyses suggested that pleiotropic variants may act by deregulating gene expression in different subsets of T cells, especially Th17 and regulatory T cells. Finally, drug repositioning analysis evidenced several drugs that could represent promising candidates for CeD, RA, SSc, and T1D treatment.<h4>Conclusions</h4>In this study, we have been able to advance in the knowledge of the genetic overlap existing in autoimmunity, thus shedding light on common molecular mechanisms of disease and suggesting novel drug targets that could be explored for the treatment of the autoimmune diseases studied.

Also flagged:rheumatoid arthritisinterferonDNasehypersensitivitychromatinhistone
Journal Article 2018-12-20 No Snippets Acosta-Herrera M, Kerick M, González-Serna D, Myositis Genetics Consortium, Scleroderma Genetics Consortium, Wijmenga C, Franke A, Gregersen PK, Padyukov L, Worthington J, Vyse TJ, Alarcón-Riquelme ME, Mayes MD, Martin J.
Show Full Abstract

<h4>Objective</h4>Immune-mediated inflammatory diseases (IMIDs) are heterogeneous and complex conditions with overlapping clinical symptoms and elevated familial aggregation, which suggests the existence of a shared genetic component. In order to identify this genetic background in a systematic fashion, we performed the first cross-disease genome-wide meta-analysis in systemic seropositive rheumatic diseases, namely, systemic sclerosis, systemic lupus erythematosus, rheumatoid arthritis and idiopathic inflammatory myopathies.<h4>Methods</h4>We meta-analysed ~6.5 million single nucleotide polymorphisms in 11 678 cases and 19 704 non-affected controls of European descent populations. The functional roles of the associated variants were interrogated using publicly available databases.<h4>Results</h4>Our analysis revealed five shared genome-wide significant independent <i>loci</i> that had not been previously associated with these diseases: <i>NAB1</i>, <i>KPNA4-ARL14</i>, <i>DGQK</i>, <i>LIMK1</i> and <i>PRR12</i>. All of these <i>loci</i> are related with immune processes such as interferon and epidermal growth factor signalling, response to methotrexate, cytoskeleton dynamics and coagulation cascade. Remarkably, several of the associated <i>loci</i> are known key players in autoimmunity, which supports the validity of our results. All the associated variants showed significant functional enrichment in DNase hypersensitivity sites, chromatin states and histone marks in relevant immune cells, including shared expression quantitative trait <i>loci</i>. Additionally, our results were significantly enriched in drugs that are being tested for the treatment of the diseases under study.<h4>Conclusions</h4>We have identified shared new risk <i>loci</i> with functional value across diseases and pinpoint new potential candidate <i>loci</i> that could be further investigated. Our results highlight the potential of drug repositioning among related systemic seropositive rheumatic IMIDs.

Also flagged:JARID2cell differentiationmethylationhistonePolycomb repressive complex‐2PRC 2
Journal Article 2018-12-20 ✓ 1 Snippet Al-Raawi D, Jones R, Wijesinghe S, Halsall J, Petric M, Roberts S, Hotchin NA, Kanhere A.
In-Text Gene Mentions

…two major complexes,polycomb repressive complex‐1repressive complex‐1 (PRC1)…

Show Full Abstract

Polycomb repressive complex-2 (PRC2) is a group of proteins that play an important role during development and in cell differentiation. PRC2 is a histone-modifying complex that catalyses methylation of lysine 27 of histone H3 (H3K27me3) at differentiation genes leading to their transcriptional repression. JARID2 is a co-factor of PRC2 and is important for targeting PRC2 to chromatin. Here, we show that, unlike in embryonic stem cells, in lineage-committed human cells, including human epidermal keratinocytes, JARID2 predominantly exists as a novel low molecular weight form, which lacks the N-terminal PRC2-interacting domain (ΔN-JARID2). We show that ΔN-JARID2 is a cleaved product of full-length JARID2 spanning the C-terminal conserved jumonji domains. JARID2 knockout in keratinocytes results in up-regulation of cell cycle genes and repression of many epidermal differentiation genes. Surprisingly, repression of epidermal differentiation genes in JARID2-null keratinocytes can be rescued by expression of ΔN-JARID2 suggesting that, in contrast to PRC2, ΔN-JARID2 promotes activation of differentiation genes. We propose that a switch from expression of full-length JARID2 to ΔN-JARID2 is important for the up-regulation differentiation genes.

Also flagged:methylationcardiovascular diseasesbreast cancerreproductionliver diseasesosteoporosis
Journal Article 2018-12-20 No Snippets Corella D, Coltell O, Portolés O, Sotos-Prieto M, Fernández-Carrión R, Ramirez-Sabio JB, Zanón-Moreno V, Mattei J, Sorlí JV, Ordovas JM.
Show Full Abstract

Precision nutrition aims to make dietary recommendations of a more personalized nature possible, to optimize the prevention or delay of a disease and to improve health. Therefore, the characteristics (including sex) of an individual have to be taken into account as well as a series of omics markers. The results of nutritional genomics studies are crucial to generate the evidence needed so that precision nutrition can be applied. Although sex is one of the fundamental variables for making recommendations, at present, the nutritional genomics studies undertaken have not analyzed, systematically and with a gender perspective, the heterogeneity/homogeneity in gene-diet interactions on the different phenotypes studied, thus there is little information available on this issue and needs to be improved. Here we argue for the need to incorporate the gender perspective in nutritional genomics studies, present the general context, analyze the differences between sex and gender, as well as the limitations to measuring them and to detecting specific sex-gene or sex-phenotype associations, both at the specific gene level or in genome-wide-association studies. We analyzed the main sex-specific gene-diet interactions published to date and their main limitations and present guidelines with recommendations to be followed when undertaking new nutritional genomics studies incorporating the gender perspective.

Also flagged:Autophagycell growthextracellularproteostasisprotein synthesischaperones
Journal Article 2018-12-20 No Snippets Dong Z, Cui H.
Show Full Abstract

In normal physiological condition, the maintenance of cellular proteostasis is a prerequisite for cell growth, functioning, adapting to changing micro-environments, and responding to extracellular stress. Cellular proteostasis is maintained by specific proteostasis networks (PNs) to prevent protein misfolding, aggregating, and accumulating in subcellular compartments. Commonly, the PNs are composed of protein synthesis, molecular chaperones, endoplasmic reticulum (ER), unfolded protein response (UPR), stress response pathways (SRPs), secretions, ubiquitin proteasome system (UPS), and autophagy-lysosomal pathways (ALPs). Although great efforts have been made to explore the underlying detailed mechanisms of proteostasis, there are many questions remain to explore, especially in proteostasis regulated by the ALPs. Proteostasis out-off-balance is correlated with various human diseases such as diabetes, stroke, inflammation, hypertension, pulmonary fibrosis, and Alzheimer's disease<i>.</i> , enhanced regulation of PNs is observed in tumors, thereby indicating that proteostasis may play a pivotal role in tumorigenesis and cancer development. Recently, inhibitors targeting the UPS have shown to be failed in solid tumor treatment. However, there is growing evidence showing that the ALPs play important roles in regulation of proteostasis alone or with a crosstalk with other PNs in tumors. In this review, we provide insights into the proteostatic process and how it is regulated by the ALPs, such as macroautophagy, aggrephagy, chaperone-mediated autophagy, microautophagy, as well as mitophagy during tumor development.

Also flagged:Homeostasisstem cell homeostasisspermatogenesisfibroblast growth factorsFGFsFGF
Journal Article 2018-12-20 No Snippets Kitadate Y, Jörg DJ, Tokue M, Maruyama A, Ichikawa R, Tsuchiya S, Segi-Nishida E, Nakagawa T, Uchida A, Kimura-Yoshida C, Mizuno S, Sugiyama F, Azami T, Ema M, Noda C, Kobayashi S, Matsuo I, Kanai Y, Nagasawa T, Sugimoto Y, Takahashi S, Simons BD, Yoshida S.
Show Full Abstract

In many tissues, homeostasis is maintained by physical contact between stem cells and an anatomically defined niche. However, how stem cell homeostasis is achieved in environments where cells are motile and dispersed among their progeny remains unknown. Using murine spermatogenesis as a model, we find that spermatogenic stem cell density is tightly regulated by the supply of fibroblast growth factors (FGFs) from lymphatic endothelial cells. We propose that stem cell homeostasis is achieved through competition for a limited supply of FGFs. We show that the quantitative dependence of stem cell density on FGF dosage, the biased localization of stem cells toward FGF sources, and stem cell dynamics during regeneration following injury can all be predicted and explained within the framework of a minimal theoretical model based on "mitogen competition." We propose that this model provides a generic and robust mechanism to support stem cell homeostasis in open, or facultative, niche environments.

Also flagged:sugarethanolfermentationorganic acidscelluloseglucose
Journal Article 2018-12-20 No Snippets Ambye-Jensen M, Balzarotti R, Thomsen ST, Fonseca C, Kádár Z.
Show Full Abstract

<h4>Background</h4>Ensiling cannot be utilized as a stand-alone pretreatment for sugar-based biorefinery processes but, in combination with hydrothermal processing, it can enhance pretreatment while ensuring a stable long-term storage option for abundant but moist biomass. The effectiveness of combining ensiling with hydrothermal pretreatment depends on biomass nature, pretreatment, and silage conditions.<h4>Results</h4>In the present study, the efficiency of the combined pretreatment was assessed by enzymatic hydrolysis and ethanol fermentation, and it was demonstrated that ensiling of sugarcane bagasse produces organic acids that can partly degrade biomass structure when in combination with hydrothermal treatment, with the consequent improvement of the enzymatic hydrolysis of cellulose and of the overall 2G bioethanol process efficiency. The optimal pretreatment conditions found in this study were those using ensiling and/or hydrothermal pretreatment at 190 °C for 10 min as this yielded the highest overall glucose recovery yield and ethanol yield from the raw material (0.28-0.30 g/g and 0.14 g/g, respectively).<h4>Conclusion</h4>Ensiling prior to hydrothermal pretreatment offers a controlled solution for wet storage and long-term preservation for sugarcane bagasse, thus avoiding the need for drying. This preservation method combined with long-term storage practice can be an attractive option for integrated 1G/2G bioethanol plants, as it does not require large capital investments or energy inputs and leads to comparable or higher overall sugar recovery and ethanol yields.

Also flagged:esophageal squamous cell carcinomagene expressioninflammatory responsepro-inflammatory cytokinesESCCCCL2
Journal Article 2018-12-20 No Snippets Pan P, Dombkowski AA, Wang LS, Stoner GD.
Show Full Abstract

<h4>Background</h4>Large epidemiological studies have shown that diets high in fruits reduce the risk of esophageal squamous cell carcinoma (ESCC).<h4>Objective</h4>The current study investigated the effects of black raspberries (BRBs) on gene expression during the development of preneoplastic esophagi in rats.<h4>Methods</h4>Using a post-initiation protocol, F344 rats were injected with <i>N</i>-nitrosomethylbenzylamine (NMBA) and then fed either a control diet or 5% BRBs. At weeks 9, 15, and 35, we euthanized subgroups of the rats and collected preneoplastic esophagi to isolate RNA samples for DNA microarray.<h4>Results</h4>Along the development of NMBA-induced preneoplastic esophagi, NMBA injections led to differential expression of 1181 genes comparing to control rats, and dietary BRBs modulated 428 genes in esophagi from NMBA-treated rats. There are 137 common genes between 1181 and 428 gene sets, and BRBs significantly reversed the expression of 133 genes. These genes are associated with multiple gene oncology functions. BRBs induced an 8.8-fold gene enrichment on the pathway of inflammatory response and regulated 10 genes involved in this pathway. Among them, BRBs significantly reversed the expression of pro-inflammatory cytokines, such as <i>CCL2</i>, <i>S100A8</i>, and <i>IL19</i>.<h4>Conclusions</h4>BRBs exhibit strong anti-inflammatory effects against NMBA-induced rat esophageal tumorigenesis.

Also flagged:IronTraumatic Brain Injuryneurodegenerative diseasesmultiple sclerosisagingpathogenesis
Journal Article 2018-12-20 ✓ 1 Snippet Daglas M, Adlard PA.
In-Text Gene Mentions

…uman hemochromatosis protein (HFE), inflammatory mediator IL-6,…

Show Full Abstract

Traumatic brain injury (TBI) consists of acute and long-term pathophysiological sequelae that ultimately lead to cognitive and motor function deficits, with age being a critical risk factor for poorer prognosis. TBI has been recently linked to the development of neurodegenerative diseases later in life including Alzheimer's disease, Parkinson's disease, chronic traumatic encephalopathy, and multiple sclerosis. The accumulation of iron in the brain has been documented in a number of neurodegenerative diseases, and also in normal aging, and can contribute to neurotoxicity through a variety of mechanisms including the production of free radicals leading to oxidative stress, excitotoxicity and by promoting inflammatory reactions. A growing body of evidence similarly supports a deleterious role of iron in the pathogenesis of TBI. Iron deposition in the injured brain can occur via hemorrhage/microhemorrhages (heme-bound iron) or independently as labile iron (non-heme bound), which is considered to be more damaging to the brain. This review focusses on the role of iron in potentiating neurodegeneration in TBI, with insight into the intersection with neurodegenerative conditions. An important implication of this work is the potential for therapeutic approaches that target iron to attenuate the neuropathology/phenotype related to TBI and to also reduce the associated risk of developing neurodegenerative disease.

Also flagged:benign prostatic hyperplasiaageingvitamin Etocopherolalpha-lipoic acidtocopherol ester
Journal Article 2018-12-20 No Snippets Levin RM, Schuler C, Leggett RE, Hass MA.
Show Full Abstract

<h4>Objective</h4>Obstructive bladder dysfunction (OBD) caused by benign prostatic hyperplasia is a common medical problem in ageing men. As the prostate enlarges and compresses the urethra, the bladder wall thickness and the bladder is termed "compensated" because its function is still relatively normal. Subsequently, bladder function begins to fail and this change is termed "decompensation." The extent of decompensation progresses from mild through severe. Bladder decompensation is mediated by cyclical ischemia followed by reperfusion (I/R) resulting in an increased generation of free radicals and oxidative stress. Previous studies demonstrated that both vitamin E (tocopherol) and alpha-lipoic acid (LA) showed significant antioxidant activity in experimental urinary bladder oxidative stress models. We hypothesized that co-drugs derived from these antioxidants would result in enhanced antioxidant activity relative to either individual compound for the treatment of oxidative stress in the lower urinary tract.<h4>Material and methods</h4>Two ester co-drugs of TOC and LA, tocopherol ester (α-TOCE) and δ-TOCE were synthesized. Six adult male New Zealand White (NZW) rabbits were divided into two groups of three rabbits each. Eight full thickness strips from each rabbit bladder were taken for in vitro I/R experiments. The strips from the first set were control rabbits (24 strips). Six strips were not incubated, while the remaining strips were incubated in α-TOCE dissolved in 1% (n=6) or 2.5% ethanol (n=6) solutions. These strips were not subjected to in vitro I/R. The strips from the second set were processed as follows: 6 strips were not incubated, while the remaining strips were incubated in α-TOCE dissolved in 1% (n=6) or in δ-TOCE dissolved in 2.5% ethanol. These strips were subjected to 1 hour in vitro ischemia followed by two hours reperfusion.<h4>Results</h4>Preliminary studies demonstrated that neither antioxidant had any effect on the contractile responses to 1% or 2.5% ethanol. Neither antioxidant had any effect on the control contractile responses. Both antioxidants protected the tissue from the initial effects of ischemia. Both antioxidants had significant protective effects on the contractile responses to all forms of stimulation after the reperfusion period.<h4>Conclusion</h4>Incubation with both antioxidants had similar protective effects on responses both to ischemia and to reperfusion.

Also flagged:Acute Retroviral Syndromeacute hepatitisantibodyribonucleic acidtransaminitisCD4
Journal Article 2018-12-20 ✓ 2 Snippets Abu-Heija AA, Shatta M, Yeddi A, Ravi AK, Mutchnick M.
In-Text Gene Mentions

…ncluding autoimmune hepatitis,hemochromatosis, Wilson’s disease, and…

…testing (C282Y) forhemochromatosiswas negative.…

Show Full Abstract

Acute retroviral syndrome (ARS) can present as a wide array of clinical manifestations. Establishing a diagnosis early in the disease course can provide an opportunity to minimize immunosuppression and limit further transmission of human immunodeficiency virus (HIV). We present a case of a previously healthy young male who presented with acute hepatitis, as a manifestation of ARS. Initial HIV antigen/antibody testing was negative; however, a high index of suspicion prompted HIV ribonucleic acid (RNA) virologic testing revealing >10 million RNA copies/mL. Anti-retroviral treatment was initiated, along with supportive measures, accomplishing resolution of the transaminitis and the restoration of CD4 counts within normal at one month. Early in the disease course, HIV screening immunoassay could still be negative; hence, confirmatory testing with HIV RNA virologic testing should be pursued when clinical suspicion is high. Prompt diagnosis and treatment can improve outcome and curtail viral transmission.

Also flagged:TNFAPCViral Infectionimmune responsechronic lymphocytic choriomeningitisinfection
Journal Article 2018-12-20 No Snippets Wang KC, Chu KL, Batista NV, Watts TH.
Show Full Abstract

There is currently much interest in how different APC subsets shape the immune response. We recently described a division of labor between classical dendritic cells (cDC) and inflammatory monocyte-derived APC in provision of costimulatory ligands to T cells early during chronic lymphocytic choriomeningitis clone 13 (LCMV 13) infection in mice. At day 2 of LCMV 13 infection, cDC preferentially express CD80 and CD86, whereas TNF superfamily ligands GITRL, 4-1BBL, CD70, and OX40L are preferentially induced by type I IFN on inflammatory monocyte-derived APC, with minimal expression on cDC. In this study, we further investigate the expression of TNF and B7 family ligands on APC over the course of LCMV 13 infection. OX40L and 4-1BBL remain above baseline through the chronic stage of infection, with predominant expression on inflammatory APC compared with cDC in the spleen, partially blocked by anti-IFN-γR Ab pretreatment. Conversely, CD70, like GITRL, returns to baseline on the APC within a few days postinfection. In the lung, TNF family ligands were also preferentially expressed on inflammatory monocyte-derived APC. CD86 was generally higher on cDC than inflammatory APC in the spleen, but in the lung CD86 was highest on inflammatory APC. Moreover, in the spleen, CD80 levels on different APC subsets fluctuated over the course of the infection. We also show that LPS induction of TNF superfamily ligands is largely mediated through type I IFN. This study highlights the importance of IFNs and monocyte-derived APC in TNF superfamily ligand expression in both secondary lymphoid organs and tissues during chronic viral infection.

bioRxiv 2018-12-20 Preprint (No Snippets API) Johnston KJ, Adams MJ, Nicholl BI, Ward J, Strawbridge RJ, McIntosh A, Smith DJ, Bailey ME.
Show Full Abstract

Chronic pain is highly prevalent worldwide, with a significant socioeconomic burden, and also contributes to excess mortality. Chronic pain is a complex trait that is moderately heritable and genetically, as well as phenotypically, correlated with major depressive disorder (MDD). Use of the Conditional False Discovery Rate (cFDR) approach, which leverages pleiotropy identified from existing GWAS outputs, has been successful in discovering novel associated variants in related phenotypes. Here, genome-wide association study outputs for both von Korff chronic pain grade as a quasi-quantitative trait and for MDD were used to identify variants meeting a cFDR threshold for each outcome phenotype separately, as well as a conjunctional cFDR (ccFDR) threshold for both phenotypes together. Using a moderately conservative threshold, we identified a total of 11 novel single nucleotide polymorphisms (SNPs), six of which were associated with chronic pain grade and nine of which were associated with MDD. Four SNPs on chromosome 14 were associated with both chronic pain grade and MDD. SNPs associated only with chronic pain grade were located within SLC16A7 on chromosome 12. SNPs associated only with MDD were located either in a gene-dense region on chromosome 1 harbouring LINC01360, LRRIQ3, FPGT and FPGT-TNNI3K , or within/close to LRFN5 on chromosome 14. The SNPs associated with both outcomes were also located within LRFN5 . Several of the SNPs on chromosomes 1 and 14 were identified as being associated with expression levels of nearby genes in the brain and central nervous system. Overall, using the cFDR approach, we identified several novel genetic loci associated with chronic pain and we describe likely pleiotropic effects of a recently identified MDD locus on chronic pain. <h4>Author Summary</h4> Genetic variants explaining variation in complex traits can often be associated with more than one trait at once (‘pleiotropy’). Taking account of this pleiotropy in genetic studies can increase power to find sites in the genome harbouring trait-associated variants. In this study we used the suspected underlying pleiotropy between chronic pain and major depressive disorder to discover novel variants associated with chronic pain, and to investigate genetic variation that may be shared between the two disorders.

Also flagged:Complement component 5hemostasiscoagulationcentral complement component 5C5lepirudin
Journal Article 2018-12-19 ✓ 1 Snippet Landsem A, Fure H, Krey Ludviksen J, Christiansen D, Lau C, Mathisen M, Bergseth G, Nymo S, Lappegård KT, Woodruff TM, Espevik T, Mollnes TE, Brekke OL.
In-Text Gene Mentions

…C and STACHROM®ATIII(Diagnostica Stago) were…

Show Full Abstract

There is a close cross-talk between complement, Toll-like receptors (TLRs) and coagulation. The role of the central complement component 5 (C5) in physiological and pathophysiological hemostasis has not, however, been fully elucidated. This study examined the effects of C5 in normal hemostasis and in Escherichia coli-induced coagulation and tissue factor (TF) up-regulation. Fresh whole blood obtained from six healthy donors and one C5-deficient individual (C5D) was anti-coagulated with the thrombin inhibitor lepirudin. Blood was incubated with or without E. coli in the presence of the C5 inhibitor eculizumab, a blocking anti-CD14 monoclonal antibody (anti-CD14) or the TLR-4 inhibitor eritoran. C5D blood was reconstituted with purified human C5. TF mRNA was measured by quantitative polymerase chain reaction (qPCR) and monocyte TF and CD11b surface expression by flow cytometry. Prothrombin fragment 1+2 (PTF1·2) in plasma and microparticles exposing TF (TF-MP) was measured by enzyme-linked immunosorbent assay (ELISA). Coagulation kinetics were analyzed by rotational thromboelastometry and platelet function by PFA-200. Normal blood with eculizumab as well as C5D blood with or without reconstitution with C5 displayed completely normal biochemical hemostatic patterns. In contrast, E. coli-induced TF mRNA and TF-MP were significantly reduced by C5 inhibition. C5 inhibition combined with anti-CD14 or eritoran completely inhibited the E. coli-induced monocyte TF, TF-MP and plasma PTF1·2. Addition of C5a alone did not induce TF expression on monocytes. In conclusion, C5 showed no impact on physiological hemostasis, but substantially contributed to E. coli-induced procoagulant events, which were abolished by the combined inhibition of C5 and CD14 or TLR-4.

Also flagged:skin cancerProtein synthesiscancertranslation initiation factorstranslationalamino acids
Journal Article 2018-12-19 No Snippets Grafanaki K, Anastasakis D, Kyriakopoulos G, Skeparnias I, Georgiou S, Stathopoulos C.
Show Full Abstract

Protein synthesis is a central and dynamic process, frequently deregulated in cancer through aberrant activation or expression of translation initiation factors and tRNAs. The discovery of tRNA-derived fragments, a new class of abundant and, in some cases stress-induced, small Noncoding RNAs has perplexed the epigenomics landscape and highlights the emerging regulatory role of tRNAs in translation and beyond. Skin is the biggest organ in human body, which maintains homeostasis of its multilayers through regulatory networks that induce translational reprogramming, and modulate tRNA transcription, modification and fragmentation, in response to various stress signals, like UV irradiation. In this review, we summarize recent knowledge on the role of translation regulation and tRNA biology in the alarming prevalence of skin cancer.

Also flagged:Non-small cell lung cancercancerMNPPro-SunitinibS21
Journal Article 2018-12-19 No Snippets Karnthaler-Benbakka C, Koblmüller B, Mathuber M, Holste K, Berger W, Heffeter P, Kowol CR, Keppler BK.
Show Full Abstract

Since several decades, the prodrug concept has raised considerable interest in cancer research due to its potential to overcome common problems associated with chemotherapy. However, for small-molecule tyrosine kinase inhibitors, which also cause severe side effects, hardly any strategies to generate prodrugs for therapeutic improvement have been reported so far. Here, we present the synthesis and biological investigation of a cathepsin B-cleavable prodrug of the VEGFR inhibitor sunitinib. Cell viability assays and Western blot analyses revealed, that, in contrast to the non-cathepsin B-cleavable reference compound, the prodrug shows activity comparable to the original drug sunitinib in the highly cathepsin B-expressing cell lines Caki-1 and RU-MH. Moreover, a cathepsin B cleavage assay confirmed the desired enzymatic activation of the prodrug. Together, the obtained data show that the concept of cathepsin B-cleavable prodrugs can be transferred to the class of targeted therapeutics, allowing the development of optimized tyrosine kinase inhibitors for the treatment of cancer.

Also flagged:Hoxa1SP1E2F1p53MYCcell proliferation
Journal Article 2018-12-19 No Snippets Ge SX, Son EW, Yao R.
Show Full Abstract

<h4>Background</h4>RNA-seq is widely used for transcriptomic profiling, but the bioinformatics analysis of resultant data can be time-consuming and challenging, especially for biologists. We aim to streamline the bioinformatic analyses of gene-level data by developing a user-friendly, interactive web application for exploratory data analysis, differential expression, and pathway analysis.<h4>Results</h4>iDEP (integrated Differential Expression and Pathway analysis) seamlessly connects 63 R/Bioconductor packages, 2 web services, and comprehensive annotation and pathway databases for 220 plant and animal species. The workflow can be reproduced by downloading customized R code and related pathway files. As an example, we analyzed an RNA-Seq dataset of lung fibroblasts with Hoxa1 knockdown and revealed the possible roles of SP1 and E2F1 and their target genes, including microRNAs, in blocking G1/S transition. In another example, our analysis shows that in mouse B cells without functional p53, ionizing radiation activates the MYC pathway and its downstream genes involved in cell proliferation, ribosome biogenesis, and non-coding RNA metabolism. In wildtype B cells, radiation induces p53-mediated apoptosis and DNA repair while suppressing the target genes of MYC and E2F1, and leads to growth and cell cycle arrest. iDEP helps unveil the multifaceted functions of p53 and the possible involvement of several microRNAs such as miR-92a, miR-504, and miR-30a. In both examples, we validated known molecular pathways and generated novel, testable hypotheses.<h4>Conclusions</h4>Combining comprehensive analytic functionalities with massive annotation databases, iDEP ( http://ge-lab.org/idep/ ) enables biologists to easily translate transcriptomic and proteomic data into actionable insights.

Also flagged:hereditary disorderpsychiatricHDangiogenesisautosomal dominant neurodegenerative disordercytosine
Journal Article 2018-12-19 ✓ 5 Snippets Denis HL, Lamontagne-Proulx J, St-Amour I, Mason SL, Rowley JW, Cloutier N, Tremblay MÈ, Vincent AT, Gould PV, Chouinard S, Weyrich AS, Rondina MT, Barker RA, Boilard E, Cicchetti F.
In-Text Gene Mentions

hCTRL, healthy control group; HD, Huntington’s disease; Htt, Huntingtin; mHtt, mutant Htt; OCS, open-canalicular system; pre-HD, pre-manifest; α, alpha granule.

Levels of total Htt were similar in resting platelets between patients with HD and healthy control subjects (figure 3B, *p<0.05, ***p<0.001, total Htt, power statistic=0.71).

HBA1/2, haemoglobin subunit alpha 1/2; HBG1/2, haemoglobin subunit gamma 1/2; hCTRL, healthy control group; Htt, Huntingtin; HD, Huntington’s disease; PBMC, peripheral blood mononuclear cell (lymphocytes and monocytes); pre-HD, premanifest; RBC, red blood cells; RNA, ribonucleic acid:SLC25A43-39-37, solute carrier family 25 member 43-39-37.

In comparison, levels of total Htt decreased in healthy control subjects, but not in patients with HD, when platelets were activated with thrombin or collagen (figure 3C–D, #,*p<0.05, power statistic ≥0.80).

…mouse anti-total huntingtin (Htt) (1:1000, Millipore Sigma:…

Show Full Abstract

Huntington's disease (HD) is a hereditary disorder that typically manifests in adulthood with a combination of motor, cognitive and psychiatric problems. The pathology is caused by a mutation in the huntingtin gene which results in the production of an abnormal protein, mutant huntingtin (mHtt). This protein is ubiquitously expressed and known to confer toxicity to multiple cell types. We have recently reported that HD brains are also characterised by vascular abnormalities, which include changes in blood vessel density/diameter as well as increased blood-brain barrier (BBB) leakage.<h4>Objectives</h4>Seeking to elucidate the origin of these vascular and BBB abnormalities, we studied platelets that are known to play a role in maintaining the integrity of the vasculature and thrombotic pathways linked to this, given they surprisingly contain the highest concentration of mHtt of all blood cells.<h4>Methods</h4>We assessed the functional status of platelets by performing ELISA, western blot and RNA sequencing in a cohort of 71 patients and 68 age- and sex-matched healthy control subjects. We further performed haemostasis and platelet depletion tests in the R6/2 HD mouse model.<h4>Results</h4>Our findings indicate that the platelets in HD are dysfunctional with respect to the release of angiogenic factors and functions including thrombosis, angiogenesis and vascular haemostasis.<h4>Conclusion</h4>Taken together, our results provide a better understanding for the impact of mHtt on platelet function.

Also flagged:matingwaterconjugationchromosomeclustered regularly interspaced short palindromic repeatCRISPR
Journal Article 2018-12-19 No Snippets Sakuda A, Suzuki-Minakuchi C, Okada K, Nojiri H.
Show Full Abstract

Understanding the mechanisms underlying plasmid behavior under conditions of various environments is important to predict the fate of plasmids in nature. Most previous studies on plasmid transfer employed two strains: one as a donor and the other as a recipient. However, in natural environments, there are usually different recipient cells available to which plasmid can be transferred. In this study, to reveal the underlying mechanisms, we assessed the transferability of plasmids from one donor strain to either of two recipient candidates as the most simplified model. We used <i>Pseudomonas putida</i> KT2440 and <i>Pseudomonas resinovorans</i> CA10dm4 as model hosts and pCAR1 (IncP-7), NAH7 (IncP-9), pB10 (IncP-1β), and R388 (IncW) as model plasmids. As expected, in most cases these plasmids were generally transferred more frequently to a recipient of the same species than to a recipient of a different one under conditions of liquid and filter mating, although NAH7 was transferred from <i>P. resinovorans</i> more frequently to <i>P. putida</i> than to <i>P. resinovorans</i> during filter mating. With the exception of pCAR1, which was less affected, the coexistence of other recipients enhanced the preferences of conjugative transfer to the same species. In particular, preferences corresponding to transfer from <i>P. putida</i> to a different recipient (<i>P. resinovorans</i>) were reduced by the presence of a coexisting same recipient (<i>P. putida</i>) during transfer of NAH7 in liquid and transfer of R388 in filter mating. We determined that large cell aggregates and substances secreted into culture supernatant were not responsible for this phenomenon. Overall, the results of this study suggest the existence of unknown factors determining optimal plasmid transfer to native recipients.<b>IMPORTANCE</b> Most previous studies on plasmid conjugal transfer employed experimental setups with two strains: one as a donor and the other as a recipient. However, the results obtained sometimes failed to agree with observations obtained under natural environmental conditions or in a model microcosm using natural soil and water samples. Therefore, we consider that there is a "gap" in our understanding of plasmid behavior in the context of bacterial consortia that exist under the actual environmental conditions. In this study, we clearly showed that the conjugation selectivity of a plasmid can be affected by the recipient candidates existing around the donor strain by the use of a simplified experimental setup with one strain as the donor and two strains as recipients. These phenomena could not be explained by factors known to affect plasmid transfer as suggested by previous studies. Therefore, we suggest the presence of novel elements regulating plasmid transfer within consortia.

Also flagged:LipophenolAge-related macular degenerationoxygenlipidpolyphenolslipophenols
Journal Article 2018-12-19 No Snippets Moine E, Brabet P, Guillou L, Durand T, Vercauteren J, Crauste C.
Show Full Abstract

Age-related macular degeneration (AMD) is a multifactorial pathology and its progression is exacerbated by oxidative stress. Oxidation and photo-oxidation reactions modify lipids in retinal cells, contribute to tissue injury, and lead to the formation of toxic adducts. In particular, autofluorescent pigments such as <i>N</i>-retinylidene-<i>N</i>-retinylethanolamine (A2E) accumulate as lipofuscin in retinal pigment epithelial cells, contribute to the production of additional reactive oxygen species (ROS), and lead to cell degeneration. In an effort to develop efficient antioxidants to reduce damage caused by lipid oxidation, various natural polyphenols were structurally modified to increase their lipophilicity (lipophenols). In this study, resveratrol, phloroglucinol, quercetin and catechin were selected and conjugated to various polyunsaturated fatty acids (PUFAs) using classical chemical strategies or enzymatic reactions. After screening for cytotoxicity, the capacity of the synthesized lipophenols to reduce ROS production was evaluated in ARPE-19 cells subjected to H₂O₂ treatment using a dichlorofluorescein diacetate probe. The positions of the PUFA on the polyphenol core appear to influence the antioxidant effect. In addition, two lipophenolic quercetin derivatives were evaluated to highlight their potency in protecting ARPE-19 cells against A2E photo-oxidation toxicity. Quercetin conjugated to linoleic or α-linolenic acid were promising lipophilic antioxidants, as they protected ARPE-19 cells from A2E-induced cell death more effectively than the parent polyphenol, quercetin.

Also flagged:NUMA1infectionsnon-structural protein 1NS1antibodiesnuclear mitotic apparatus protein 1
Journal Article 2018-12-19 No Snippets Rahim MN, Klewes L, Zahedi-Amiri A, Mai S, Coombs KM.
Show Full Abstract

Influenza A virus (IAV) infections remain a major human health threat. IAV has enormous genetic plasticity and can rapidly escape virus-targeted anti-viral strategies. Thus, there is increasing interest to identify host proteins and processes the virus requires for replication and maturation. The IAV non-structural protein 1 (NS1) is a critical multifunctional protein that is expressed to high levels in infected cells. Host proteins that interact with NS1 may serve as ideal targets for attenuating IAV replication. We previously developed and characterized broadly cross-reactive anti-NS1 monoclonal antibodies. For the current study, we used these mAbs to co-immunoprecipitate native IAV NS1 and interacting host proteins; 183 proteins were consistently identified in this NS1 interactome study, 124 of which have not been previously reported. RNAi screens identified 11 NS1-interacting host factors as vital for IAV replication. Knocking down one of these, nuclear mitotic apparatus protein 1 (NUMA1), dramatically reduced IAV replication. IAV genomic transcription and translation were not inhibited but transport of viral structural proteins to the cell membrane was hindered during maturation steps in NUMA1 knockdown (KD) cells.

Also flagged:acetaminophendiclofenacgene expressiontransportersmitochondriaendoplasmic reticulum
Journal Article 2018-12-19 ✓ 1 Snippet Vickers AEM, Ulyanov AV, Fisher RL.
In-Text Gene Mentions

…of antioxidant activity,PRDX6and GPXs ;…

Show Full Abstract

Human liver slice function was stressed by daily dosing of acetaminophen (APAP) or diclofenac (DCF) to investigate injury and repair. Initially, untreated human liver and kidney slices were evaluated with the global human U133A array to assess the extended culture conditions. Then, drug induced injury and signals of repair in human liver slices exposed to APAP or DCF (1 mM) were evaluated via specific gene expression arrays. In culture, the untreated human liver and kidney slices remained differentiated and gene expression indicated that repair pathways were activated in both tissues. Morphologically the human liver slices exhibited evidence of repair and regeneration, while kidney slices did not. APAP and DCF exposure caused a direct multi-factorial response. APAP and DCF induced gene expression changes in transporters, oxidative stress and mitochondria energy. DCF caused a greater effect on heat shock and endoplasmic reticulum (ER) stress gene expression. Concerning wound repair, APAP caused a mild repression of gene expression; DCF suppressed the expression of matrix collagen genes, the remodeling metalloproteases, cell adhesion integrins, indicating a greater hinderance to wound repair than APAP. Thus, human liver slices are a relevant model to investigate the mechanisms of drug-induced injury and repair.

Also flagged:Peptidebis-acrylateacrylic acidtriclosanwateraxonal
Journal Article 2018-12-19 ✓ 1 Snippet Zhu J, Han H, Ye TT, Li FX, Wang XL, Yu JY, Wu DQ.
In-Text Gene Mentions

…In detail, AAc (2 equiv), HOBt (4 equiv) and DCC (2.2 equiv) in DMF (3 mL) were added and reacted with peptidyl resin for 6 h at room temperature.…

Show Full Abstract

The stimuli-sensitive and biodegradable hydrogels are promising biomaterials as controlled drug delivery systems for diverse biomedical applications. In this study, we construct hybrid hydrogels combined with peptide-based bis-acrylate and acrylic acid (AAc). The peptide-based bis-acrylate/AAc hybrid hydrogel displays an interconnected and porous structure by scanning electron microscopy (SEM) observation and exhibits pH-dependent swelling property. The biodegradation of hybrid hydrogels was characterized by SEM and weight loss, and the results showed the hydrogels have a good enzymatic biodegradation property. The mechanical and cytotoxicity properties of the hydrogels were also tested. Besides, triclosan was preloaded during the hydrogel formation for drug release and antibacterial studies. In summary, the peptide-based bis-acrylate/AAc hydrogel with stimuli sensitivity and biodegradable property may be excellent candidates as drug delivery systems for antibacterial wound dressing application.

Also flagged:agingmitochondrial ATP synthasebrainATP-synthasemetabolismneurotransmission
Journal Article 2018-12-19 No Snippets Jové M, Pradas I, Dominguez-Gonzalez M, Ferrer I, Pamplona R.
Show Full Abstract

The human brain is a target of the aging process like other cell systems of the human body. Specific regions of the human brain exhibit differential vulnerabilities to the aging process. Yet the underlying mechanisms that sustain the preservation or deterioration of neurons and cerebral functions are unknown. In this review, we focus attention on the role of lipids and the importance of the cross-regionally different vulnerabilities in human brain aging. In particular, we first consider a brief approach to the lipidomics of human brain, the relationship between lipids and lipoxidative damage, the role of lipids in human brain aging, and the specific targets of lipoxidative damage in human brain and during aging. It is proposed that the restricted set of modified proteins and the functional categories involved may be considered putative collaborative factors contributing to neuronal aging, and that mitochondrial ATP synthase is a key lipoxidative target in human brain aging.

Also flagged:Vanishing Bile Duct SyndromeUterine Cancercholestasisautoimmune disordersgenetic disordersparaneoplastic systemic sclerosis
Journal Article 2018-12-19 ✓ 1 Snippet Sedhom D, Herrmann A, D'Souza M, Fyfe B, Zaldana F, Schlesinger N, Rustgi V.
In-Text Gene Mentions

…were normal, makinghemochromatosisunlikely.…

Show Full Abstract

Vanishing bile duct syndrome (VBDS) is a rare entity of acquired disorders resulting in cholestasis secondary to progressive destruction of intrahepatic bile ducts. The syndrome has been described in the setting of autoimmune disorders, medication toxicities, genetic disorders, infectious etiologies, and in rare cases, neoplastic processes. There are no known case reports of VBDS in the setting of uterine malignancy. We present a case of VBDS in a patient with underlying uterine cancer complicated by paraneoplastic systemic sclerosis.

Also flagged:RapamycinLynch SyndromePseudopapillary Neoplasm of the PancreasSolid pseudopapillary neoplasmspancreasexocrine neoplasms
Journal Article 2018-12-19 ✓ 1 Snippet Cuglievan B, Subbiah V, Wang H, Morani A, Meric-Bernstam F, Holla V, Herzog CE.
In-Text Gene Mentions

Recently, Guo et al24 conducted whole-genome sequencing analysis on nine patients’ SPNs and identified numerous genetic mutations, including USP9X, EP400, PDK1, MED12, HTT and AR. MET germline mutations have been associated with renal cell and hepatocellular carcinomas, breast, colorectal, gastric, and lung cancer.

Show Full Abstract

No abstract available.

Also flagged:bindinglocalizationsautophagydegradationlysosomep62
Journal Article 2018-12-18 No Snippets Sánchez-Martín P, Sánchez-Martín P, Saito T, Komatsu M.
Show Full Abstract

p62 is a stress-inducible protein able to change among binding partners, cellular localizations and form liquid droplet structures in a context-dependent manner. This protein is mainly defined as a cargo receptor for selective autophagy, a process that allows the degradation of detrimental and unnecessary components through the lysosome. Besides this role, its ability to interact with multiple binding partners allows p62 to act as a main regulator of the activation of the Nrf2, mTORC1, and NF-κB signaling pathways, linking p62 to the oxidative defense system, nutrient sensing, and inflammation, respectively. In the present review, we will present the molecular mechanisms behind the control p62 exerts over these pathways, their interconnection and how their deregulation contributes to cancer progression.

Also flagged:hg19CpGCannabinoidmethylationtetrahydrocannabinolCancer
Journal Article 2018-12-18 No Snippets Murphy SK, Itchon-Ramos N, Visco Z, Huang Z, Grenier C, Schrott R, Acharya K, Boudreau MH, Price TM, Raburn DJ, Corcoran DL, Lucas JE, Mitchell JT, McClernon FJ, Cauley M, Hall BJ, Levin ED, Kollins SH.
Show Full Abstract

Little is known about the reproductive effects of paternal cannabis exposure. We evaluated associations between cannabis or tetrahydrocannabinol (THC) exposure and altered DNA methylation in sperm from humans and rats, respectively. DNA methylation, measured by reduced representation bisulfite sequencing, differed in the sperm of human users from non-users by at least 10% at 3,979 CpG sites. Pathway analyses indicated Hippo Signaling and Pathways in Cancer as enriched with altered genes (Bonferroni p < 0.02). These same two pathways were also enriched with genes having altered methylation in sperm from THC-exposed versus vehicle-exposed rats (p < 0.01). Data validity is supported by significant correlations between THC exposure levels in humans and methylation for 177 genes, and substantial overlap in THC target genes in rat sperm (this study) and genes previously reported as having altered methylation in the brain of rat offspring born to parents both exposed to THC during adolescence. In humans, cannabis use was also associated with significantly lower sperm concentration. Findings point to possible pre-conception paternal reproductive risks associated with cannabis use.

Also flagged:periampullary cancerPeriampullary adenocarcinomaampullary adenocarcinomaAAdistal cholangiocarcinomaduodenal adenocarcinoma
Journal Article 2018-12-18 ✓ 4 Snippets Hester CA, Dogeas E, Augustine MM, Mansour JC, Polanco PM, Porembka MR, Wang SC, Zeh HJ, Yopp AC.
In-Text Gene Mentions

…AA, 3732 (3%)DCC, 7142 (6%) DA,…

…DA,DCC, and PDAC were…

…95% CI, 0.67-0.75);DCCand PDAC were…

…DA, but notDCC, demonstrated significantly i…

Show Full Abstract

<h4>Background and objectives</h4>Periampullary adenocarcinoma (PAC) is stratified anatomically: ampullary adenocarcinoma (AA), distal cholangiocarcinoma (DCC), duodenal adenocarcinoma (DA), and pancreatic ductal adenocarcinoma (PDAC). We aimed to determine differences in incidence, prognosis, and treatment in stage-matched PAC patients in a longitudinal study.<h4>Methods</h4>PAC patients were identified in The National Cancer Database from 2004 to 2012. Clinicopathological variables were compared between subtypes. Covariate-adjusted treatment use and OS were compared.<h4>Results</h4>The 116 705 patients with PAC were identified: 1320 (9%) AA, 3732 (3%) DCC, 7142 (6%) DA, and 95 511 (82%) PDAC. DA, DCC, and PDAC were associated with worse survival compared with AA (hazard ratio [HR], 1.10; 95% CI, 1.1-1.1; HR, 1.50; 95% CI, 1.4-1.6, and HR, 1.90; 95% CI, 1.8-1.9). Among resected patients, DA was associated with improved survival compared with AA (HR, 0.70; 95% CI, 0.67-0.75); DCC and PDAC were associated with worse survival (HR, 1.41; 95% CI, 1.31-1.53 and HR, 2.041; 95% CI, 1.07-2.12). Resected AA, PDAC, and DA, but not DCC, demonstrated significantly improved survival over the studied period. While all patients had increased adjuvant therapy (AT) receipt over time (P < 0.001), only patients with PDAC had increased neoadjuvant therapy (NAT) receipt ( P < 0.001).<h4>Conclusion</h4>Resected PDAC, AA, and DA were associated with clinically significant improved survival over time, mirroring a concurrent associated increased receipt of AT.

Also flagged:Gene expressioncolorectal cancertumorstumorgene-expressionextracellular
Journal Article 2018-12-18 ✓ 2 Snippets Barresi V, Cinnirella G, Valenti G, Spampinato G, Musso N, Castorina S, Condorelli DF.
In-Text Gene Mentions

The stem-cell marker OLFM4 was significantly upregulated in all CRC subgroups, but FC values were much higher in HB and LB (26- and 74-fold increase respectively) in comparison to MSI tumors (3.5-fold increase).

…The stem-cell markerOLFM4was significantly upregulated…

Show Full Abstract

<h4>Background</h4>Broad copy number aberrations (BCNAs) represent a common form of genome instability in colorectal cancer (CRC). CRCs show large variations in their level of aneuploidy: microsatellite-instable (MSI) tumors are known to have a near-diploid karyotype while microsatellite-stable (MSS) tumors show high level of chromosomal instability. However, MSS tumors have great heterogeneity in the number of BCNAs, with a minor percentage of samples showing an almost normal karyotype. In the present work we subdivided MSS CRCs according to a "BCNA score" and characterized their transcriptome profiles, considered as a proxy to their phenotypic features.<h4>Methods</h4>Microsatellite testing, genome-wide DNA copy number and whole-transcript expression analysis (HTA) were performed on 33 tumor samples and 25 normal colonic tissue samples from 32 CRC patients. 15.1% of the samples were MSI tumors (n = 5), whereas 84.9% were MSS tumors (n = 28). Gene expression data of 34 additional MSI tumors was retrieved from a public functional genomics data repository.<h4>Results</h4>Using as a threshold the first quartile of the BCNA score distribution, MSS samples were classified as low-BCNA (LB, n = 7) or high-BCNA (HB, n = 21). LB tumors were enriched for mucinous CRCs and their gene-expression profile resembled that of MSI samples for what concerns a subset of genes involved in secretory processes, mucosal protection, and extracellular matrix remodeling. HB tumors were predominantly non-mucinous adenocarcinomas and showed overexpression of a subset of genes typical of surface colonocytes and EGF signaling. A large percentage of unclassified samples according to the consensus molecular subtypes (CMS) classifier was found in the LB group (43%), whereas 76% HB tumors belonged to CMS2.<h4>Conclusions</h4>A classification of colorectal tumors based on the number of BCNAs identifies two groups of MSS tumors which differ for histopathology and gene expression profile. Such information can be exploited for its translational relevance in different aspects of CRC clinical management.

Also flagged:endoplasmic reticulumchaperoneBiPdegradationorganelleheat shock protein 70
Journal Article 2018-12-18 No Snippets Pobre KFR, Poet GJ, Hendershot LM.
Show Full Abstract

The endoplasmic reticulum (ER) represents the entry point into the secretory pathway where nascent proteins encounter a specialized environment for their folding and maturation. Inherent to these processes is a dedicated quality-control system that detects proteins that fail to mature properly and targets them for cytosolic degradation. An imbalance in protein folding and degradation can result in the accumulation of unfolded proteins in the ER, resulting in the activation of a signaling cascade that restores proper homeostasis in this organelle. The ER heat shock protein 70 (Hsp70) family member BiP is an ATP-dependent chaperone that plays a critical role in these processes. BiP interacts with specific ER-localized DnaJ family members (ERdjs), which stimulate BiP's ATP-dependent substrate interactions, with several ERdjs also binding directly to unfolded protein clients. Recent structural and biochemical studies have provided detailed insights into the allosteric regulation of client binding by BiP and have enhanced our understanding of how specific ERdjs enable BiP to perform its many functions in the ER. In this review, we discuss how BiP's functional cycle and interactions with ERdjs enable it to regulate protein homeostasis in the ER and ensure protein quality control.

Also flagged:CXCL2hepatocellular carcinomamethylationgene expressionchemokinetumor
Journal Article 2018-12-18 ✓ 1 Snippet Subat S, Mogushi K, Yasen M, Kohda T, Ishikawa Y, Tanaka H.
In-Text Gene Mentions

POU3F2

Show Full Abstract

<h4>Purpose</h4>Recent genetic studies have suggested that tumor suppressor genes are often silenced during carcinogenesis via epigenetic modification caused by methylation of promoter CpG islands. Here, we characterized genes inactivated by DNA methylation in human hepatocellular carcinoma (HCC) to identify the genes and pathways involved in DNA methylation in hepatocellular carcinoma.<h4>Methods</h4>Eight HCC-derived cell lines were treated with a DNA demethylating agent, 5-aza-2'-deoxycytidine. Additionally, 100 pairs of primary HCC and adjacent non-cancerous tissues as well as 15 normal liver tissues were analyzed by comprehensive gene expression analysis using microarrays. Moreover, gene set enrichment analysis identified the major molecular pathways associated with DNA methylation. Validation of gene expression and DNA methylation status was performed by real-time PCR after bisulfite modification.<h4>Results</h4>We showed that CXCL2, an immune-related chemokine, expression was significantly downregulated in tumor tissues and also significantly upregulated by DAC treatment in cell lines. Furthermore, we observed a statistically significant difference in methylation status between normal liver tissues and tumor tissues (P < 0.05). In addition, tumors with higher CXCL2 expression included significantly more numbers of multiple tumors than the lower expression group.<h4>Conclusions</h4>We identified CXCL2, an immune-related chemokine, decreased in hepatocellular carcinoma and the regulation mechanism may be controlled by methylation. Further studies should be warranted to examine if and to what extent the gene is actually suppressed by methylation and if there is a possibility that the CXCL2 axis plays a role for diagnosis and treatment of hepatocellular carcinoma.

Also flagged:SimvastatinStatinsinflammatory responselactic acidacidpolyethylene glycol
Journal Article 2018-12-18 No Snippets Wang CZ, Wang YH, Lin CW, Lee TC, Fu YC, Ho ML, Wang CK.
Show Full Abstract

The fragile nature of porous bioceramic substitutes cannot match the toughness of bone, which limits the use of these materials in clinical load-bearing applications. Statins can enhance bone healing, but it could show rhabdomyolysis/inflammatory response after overdosing. In this study, the drug-containing bone grafts were developed from poly(lactic acid-co-glycolic acid)-polyethylene glycol (PLGA-PEG) nanoparticles encapsulating simvastatin (SIM) (SIM-PP NPs) loaded within an appropriately mechanical bioceramic scaffold (BC). The combination bone graft provides dual functions of osteoconduction and osteoinduction. The mechanical properties of the bioceramic are enhanced mainly based on the admixture of a combustible reverse-negative thermoresponsive hydrogel (poly(<i>N</i>-isopropylacrylamide base). We showed that SIM-PP NPs can increase the activity of alkaline phosphatase and osteogenic differentiation of bone marrow stem cells. To verify the bone-healing efficacy of this drug-containing bone grafts, a nonunion radial endochondral ossification bone defect rabbit model (<i>N</i> = 3/group) and a nonunion calvarial intramembranous defect Sprague Dawley (SD) rat model (<i>N</i> = 5/group) were used. The results indicated that SIM-PP NPs combined with BC can improve the healing of nonunion bone defects of the radial bone and calvarial bone. Therefore, the BC containing SIM-PP NPs may be appropriate for clinical use as a synthetic alternative to autologous bone grafting that can overcome the problem of determining the clinical dosage of simvastatin drugs to promote bone healing.

Also flagged:morphineMelatoningene expressionreverse transcriptionpolymeraseaddiction
Journal Article 2018-12-18 No Snippets Cheng YC, Tsai RY, Sung YT, Chen IJ, Tu TY, Mao YY, Wong CS.
Show Full Abstract

Tolerance and associated hyperalgesia induced by long‑term morphine administration substantially restrict the clinical use of morphine in pain treatment. Melatonin, a neurohormone released by the pineal gland, has been demonstrated to attenuate anti‑nociceptive morphine tolerance. The present study investigates differentially expressed genes in the process of morphine tolerance and altered gene expression subsequent to melatonin treatment in chronic morphine‑infused ratspinal cords. Morphine tolerance was induced in male Wistar rats by intrathecal morphine infusion (the MO group). Melatonin (the MOMa group) was administered to overcome the effects derived by morphine. The mRNA collected from L5‑S3 of the spinal cord was extracted and analysed by rat expression microarray. Principal component analysis and clustering analysis revealed that the overall gene profiles were different in morphine and melatonin treatments. Subsequent to Gene Ontology analysis, the biological processes of differentially expressed genes of MO and MOMa compared with the control group were constructed. Furthermore, a panel of genes exclusively expressed following melatonin treatment and another panel of genes with inverse expression between the MO and MOMa group were also established. Subsequent to PANTHER pathway analysis, a group of genes with inverse expression following melatonin administrated compared with morphine alone were identified. The expression levels of genes of interest were also confirmed using a reverse transcription‑quantitative polymerase chain reaction. The gene panel that was constructed suggests a potential signaling pathway in morphine tolerance development and is valuable for investigating the mechanism of morphine tolerance and the regulatory gene profiles of melatonin treatment. These results may contribute to the discovery of potential drug targets in morphine tolerance treatments in the future.

Also flagged:Carbapenemwaterinfectioninfectionscarbapenemaseisopropanol
Journal Article 2018-12-18 No Snippets Aranega-Bou P, George RP, Verlander NQ, Paton S, Bennett A, Moore G, TRACE Investigators' Group.
Show Full Abstract

<h4>Background</h4>Hospital sinks, waste traps and drains can harbour carbapenem-resistant Enterobacteriaceae (CRE).<h4>Aim</h4>To investigate the dispersal of CRE from sinks in which water delivered from the tap flows directly into the drain and from clinical handwash basins with the drain at the rear. The effect of fast and slow drainage rates was also assessed.<h4>Methods</h4>Waste traps, known to be colonized with CRE, were taken from a hospital and installed within a model laboratory system. New waste traps were also installed and artificially inoculated with CRE. The potential for bacteria to be dispersed from sinks was assessed using cyclone air samplers and/or settle plates.<h4>Findings</h4>When the waste traps were artificially contaminated and CRE colonization was confined to the waste trap water, significantly fewer bacteria were dispersed from sinks that drained quickly (P = 0.004) and/or from rear-draining sinks (P = 0.002). When the waste traps were naturally contaminated and CRE colonized the trap, pipework and drain, there was significant interaction between sink drainage and position of the drain (P < 0.001). When drainage was slow, dispersal from rear-draining sinks was almost 30-fold less than from sinks with the drain underneath the tap (P < 0.001). When drainage was fast, rear-draining sinks again released comparatively fewer CRE, although, in this case, the difference was not statistically significant (P = 0.7). Contaminated splashes travelled up to 1 m from the sink.<h4>Conclusion</h4>Slow drainage rates and sink designs with the drain directly underneath the tap increase the risk of CRE present in waste traps and drains contaminating the ward environment.

Also flagged:dental cariesnanoparticlecalcium phosphatedecayinfectious diseaseminerals
Journal Article 2018-12-18 No Snippets Balhaddad AA, Kansara AA, Hidan D, Weir MD, Xu HHK, Melo MAS.
Show Full Abstract

Millions of people worldwide suffer from a toothache due to tooth cavity, and often permanent tooth loss. Dental caries, also known as tooth decay, is a biofilm-dependent infectious disease that damages teeth by minerals loss and presents a high incidence of clinical restorative polymeric fillings (tooth colored fillings). Until now, restorative polymeric fillings present no bioactivity. The complexity of oral biofilms contributes to the difficulty in developing effective novel dental materials. Nanotechnology has been explored in the development of bioactive dental materials to reduce or modulate the activities of caries-related bacteria. Nano-structured platforms based on calcium phosphate and metallic particles have advanced to impart an anti-caries potential to restorative materials. The bioactivity of these platforms induces prevention of mineral loss of the hard tooth structure and antibacterial activities against carries-related pathogens. It has been suggested that this bioactivity could minimize the incidence of caries around restorations (CARS) and increase the longevity of such filling materials. The last few years witnessed growing numbers of studies on the preparation evaluations of these novel materials. Herein, the caries disease process and the role of pathogenic caries-related biofilm, the increasing incidence of CARS, and the recent efforts employed for incorporation of bioactive nanoparticles in restorative polymer materials as useful strategies for prevention and management of caries-related-bacteria are discussed. We highlight the status of the most advanced and widely explored interaction of nanoparticle-based platforms and calcium phosphate compounds with an eye toward translating the potential of these approaches to the dental clinical reality.

Also flagged:control proteinsSGTAchaperoneBAG6UBL4ATRC35
Journal Article 2018-12-18 No Snippets Benarroch R, Austin JM, Ahmed F, Isaacson RL.
Show Full Abstract

SGTA is a co-chaperone that, in collaboration with the complex of BAG6/UBL4A/TRC35, facilitates the biogenesis and quality control of hydrophobic proteins, protecting them from the aqueous cytosolic environment. This work includes targeting tail-anchored proteins to their resident membranes, sorting of membrane and secretory proteins that mislocalize to the cytoplasm and endoplasmic reticulum-associated degradation of misfolded proteins. Since these functions are all vital for the cell's continued proteostasis, their disruption poses a threat to the cell, with a particular risk of protein aggregation, a phenomenon that underpins many diseases. Although the specific disease implications of machinery involved in quality control of hydrophobic substrates are poorly understood, here we summarize much of the available information on this topic.

Also flagged:chronicsystemic autoimmune diseasepathogenesissarthritisinterstitial nephritis
Journal Article 2018-12-18 ✓ 1 Snippet Argyropoulou OD, Tzioufas AG.
In-Text Gene Mentions

…was also identified;TNFSF4/Ox40L, TNFSF10/TRAIL, TNFSF13…

Show Full Abstract

Primary Sjögren's syndrome (pSS) is a chronic systemic autoimmune disease with a diverse clinical picture, extending from exocrine involvement to extraglandular manifestations. Although pSS remains a disease of unknown etiology, an interaction between genetic susceptibility and environmental triggers is thought to play a key role in disease initiation and progress. Despite the extensive research during the past years, the pathogenetic mechanisms are still elusive and effective therapeutic intervention is still missing. This review aims to provide an overview of the recent literature on the pathogenesis, clinical features and new therapeutic aspects of pSS.

Also flagged:polymeraseNS5BRNA-dependent RNA polymeraseRdRpcysteinebinding
Journal Article 2018-12-18 No Snippets Shunmugam L, Soliman MES.
Show Full Abstract

<i>Background</i>: Concerns have been raised over the emerging pandemic status of hepatitis C virus (HCV). Current available drugs lack specificity, stability and potency. The HCV NS5B RNA-dependent RNA polymerase (RdRp) is a vital component in viral replication and is often targeted in antiviral therapies. Recent experimental procedures have led to the discovery of a novel covalent RdRp inhibitor, compound 47, which selectively targets cysteine 366 of the HCV RdRp and exhibits promising pharmacokinetic outcomes. Selective covalent inhibition of HCV is, however, a highly neglected subject in the literature, that is reinforced by the lack of efficient structure-based drug design protocols. In this paper, an atomistic insight into a novel selective approach to inhibit HCV RdRp is provided. <i>Methodology</i>/<i>Results</i>: Covalent molecular dynamic analyses revealed the inhibitory mechanism of compound 47 on the RdRp. Inhibitor binding induced distinctive internal movements resulting in the disruption of normal physiological interdomain interactions. <i>Conclusion</i>: Compound 47 stimulates reorganization of key protein elements required for RNA transcription, thus hampering viral replication as well as disrupting the overall conformation of HCV. This study will open new lines of approach for the design of novel selective inhibitors against HCV as well as other viral families.

Also flagged:Acute megakaryoblastic leukemiaoncogenesKMT2ASEPT9Down syndromeAML
Journal Article 2018-12-17 ✓ 1 Snippet Forlenza CJ, Zhang Y, Yao J, Benayed R, Steinherz P, Ramaswamy K, Kessel R, Roshal M, Shukla N.
In-Text Gene Mentions

…MLLT9 , andMLLT10( de Rooij…

Show Full Abstract

Acute megakaryoblastic leukemia (AMKL) constitutes ∼5%-15% of cases of non-Down syndrome AML in children, and in the majority of cases, chimeric oncogenes resulting from recurrent gene rearrangements are identified. Based on these rearrangements, several molecular subsets have been characterized providing important prognostic information. One such subset includes a group of patients with translocations involving the <i>KMT2A</i> gene, which has been associated with various fusion partners in patients with AMKL. Here we report the molecular findings of a 2-yr-old girl with AMKL and t(11;17)(q23;25) found to have a <i>KMT2A-SEPT9</i> fusion identified through targeted RNA sequencing. A <i>KMT2A-SEPT9</i> fusion in this subset of patients has not previously been reported.

Also flagged:Membrane15-lipoxygenasedeathphosphatidylethanolamine binding protein-1phospholipids
Journal Article 2018-12-17 ✓ 2 Snippets Anthonymuthu TS, Kenny EM, Shrivastava I, Tyurina YY, Hier ZE, Ting HC, Dar HH, Tyurin VA, Nesterova A, Amoscato AA, Mikulska-Ruminska K, Rosenbaum JC, Mao G, Zhao J, Conrad M, Kellum JA, Wenzel SE, VanDemark AP, Bahar I, Kagan VE, Bayır H.
In-Text Gene Mentions

…the complex withPEBP1.…

…hanolamine binding protein-1 (PEBP1) complex is a…

Show Full Abstract

sn2-15-Hydroperoxy-eicasotetraenoyl-phosphatidylethanolamines ( sn2-15-HpETE-PE) generated by mammalian 15-lipoxygenase/phosphatidylethanolamine binding protein-1 (15-LO/PEBP1) complex is a death signal in a recently identified type of programmed cell demise, ferroptosis. How the enzymatic complex selects sn2-ETE-PE as the substrate among 1 of ∼100 total oxidizable membrane PUFA phospholipids is a central, yet unresolved question. To unearth the highly selective and specific mechanisms of catalytic competence, we used a combination of redox lipidomics, mutational and computational structural analysis to show they stem from (i) reactivity toward readily accessible hexagonally organized membrane sn2-ETE-PEs, (ii) relative preponderance of sn2-ETE-PE species vs other sn2-ETE-PLs, and (iii) allosteric modification of the enzyme in the complex with PEBP1. This emphasizes the role of enzymatic vs random stochastic free radical reactions in ferroptotic death signaling.

Also flagged:extracellularITGA5phosphorylationFAKPI3KAKT
Journal Article 2018-12-17 No Snippets Wang H, Ning T, Song C, Luo X, Xu S, Zhang X, Deng Z, Ma D, Wu B.
Show Full Abstract

Our previous study showed that knocking down integrin α5 (ITGA5) expression by using a lentiviral vector in human dental pulp stem cells (DPSCs) led to weakening proliferation and migration capacity while enhanced odontogenic differentiation. To seek for possible clinical application, we investigated the effect of the ITGA5 priming synthetic cyclic peptide (SCP; GA-CRRETAWAC-GA) on proliferation, migration, and the odontogenic differentiation of DPSCs. Remarkably, the involved mechanism was explored by isobaric tag for relative and absolute quantitation proteomic technique, and the in vivo effect of ITGA5 was investigated by nude mice subcutaneous transplantation of cell and hydroxyapatite/β-tricalcium phosphate complex. Results showed that SCP weakened the proliferation and migration capacity while enhanced odontogenic differentiation of DPSCs as lentivirus. The phosphorylation of FAK, PI3K/AKT, and MEK1/2/ERK1/2, along with IGF2/IGFBP2 and Wnt/β-catenin signaling pathway play an important role in this process. Proteomic Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analysis revealed the key role of extracellular matrix (ECM) and ECM-receptor activity pathway were involved. ECM constituents, secreted protein acidic and cysteine-rich (SPARC), lumican, vitronectin, prolargin, decorin, collagen type VI α1 chain (COL6A1), COL6A2, COL14A1, and COL5A1 were upregulated in the ITGA5-silenced group. Inhibited expression of ITGA5 in DPSCs increased osteoid tissue formation and stronger related genes expression in vivo. In conclusion, the ITGA5 priming peptide could promote DPSCs odontogenic differentiation as lentivirus. Proteomics and bioinformatic analysis revealed that this may be due to the deposition of ECM and amplified ECM-receptor activity, which could fuel the application process of utilizing priming ITGA5 on dental clinical practice.

Also flagged:Methylationcancerepithelial ovarian cancerovarian cancergene expressionMAPT
Journal Article 2018-12-17 ✓ 1 Snippet Yang Y, Wu L, Shu X, Lu Y, Shu XO, Cai Q, Beeghly-Fadiel A, Li B, Ye F, Berchuck A, Anton-Culver H, Banerjee S, Benitez J, Bjørge L, Brenton JD, Butzow R, Campbell IG, Chang-Claude J, Chen K, Cook LS, Cramer DW, deFazio A, Dennis J, Doherty JA, Dörk T, Eccles DM, Edwards DV, Fasching PA, Fortner RT, Gayther SA, Giles GG, Glasspool RM, Goode EL, Goodman MT, Gronwald J, Harris HR, Heitz F, Hildebrandt MA, Høgdall E, Høgdall CK, Huntsman DG, Kar SP, Karlan BY, Kelemen LE, Kiemeney LA, Kjaer SK, Koushik A, Lambrechts D, Le ND, Levine DA, Massuger LF, Matsuo K, May T, McNeish IA, Menon U, Modugno F, Monteiro AN, Moorman PG, Moysich KB, Ness RB, Nevanlinna H, Olsson H, Onland-Moret NC, Park SK, Paul J, Pearce CL, Pejovic T, Phelan CM, Pike MC, Ramus SJ, Riboli E, Rodriguez-Antona C, Romieu I, Sandler DP, Schildkraut JM, Setiawan VW, Shan K, Siddiqui N, Sieh W, Stampfer MJ, Sutphen R, Swerdlow AJ, Szafron LM, Teo SH, Tworoger SS, Tyrer JP, Webb PM, Wentzensen N, White E, Willett WC, Wolk A, Woo YL, Wu AH, Yan L, Yannoukakos D, Chenevix-Trench G, Sellers TA, Pharoah PDP, Zheng W, Long J.
In-Text Gene Mentions

MLLT10

Show Full Abstract

DNA methylation is instrumental for gene regulation. Global changes in the epigenetic landscape have been recognized as a hallmark of cancer. However, the role of DNA methylation in epithelial ovarian cancer (EOC) remains unclear. In this study, high-density genetic and DNA methylation data in white blood cells from the Framingham Heart Study (<i>N</i> = 1,595) were used to build genetic models to predict DNA methylation levels. These prediction models were then applied to the summary statistics of a genome-wide association study (GWAS) of ovarian cancer including 22,406 EOC cases and 40,941 controls to investigate genetically predicted DNA methylation levels in association with EOC risk. Among 62,938 CpG sites investigated, genetically predicted methylation levels at 89 CpG were significantly associated with EOC risk at a Bonferroni-corrected threshold of <i>P</i> < 7.94 × 10<sup>-7</sup>. Of them, 87 were located at GWAS-identified EOC susceptibility regions and two resided in a genomic region not previously reported to be associated with EOC risk. Integrative analyses of genetic, methylation, and gene expression data identified consistent directions of associations across 12 CpG, five genes, and EOC risk, suggesting that methylation at these 12 CpG may influence EOC risk by regulating expression of these five genes, namely <i>MAPT, HOXB3, ABHD8, ARHGAP27</i>, and <i>SKAP1</i>. We identified novel DNA methylation markers associated with EOC risk and propose that methylation at multiple CpG may affect EOC risk via regulation of gene expression. SIGNIFICANCE: Identification of novel DNA methylation markers associated with EOC risk suggests that methylation at multiple CpG may affect EOC risk through regulation of gene expression.

Also flagged:transmembranematriptase-2MT2trypsin-like serine proteaseiron-regulatory hormonebone morphogenetic protein
Journal Article 2018-12-17 ✓ 1 Snippet Mao P, Wortham AM, Enns CA, Zhang AS.
In-Text Gene Mentions

HFE

Show Full Abstract

Matriptase-2 (MT2) is a type-II transmembrane, trypsin-like serine protease that is predominantly expressed in the liver. It is a key suppressor for the expression of hepatic hepcidin, an iron-regulatory hormone that is induced via the bone morphogenetic protein signaling pathway. A current model predicts that MT2 suppresses hepcidin expression by cleaving multiple components of the induction pathway. MT2 is synthesized as a zymogen that undergoes autocleavage for activation and shedding. However, the biologically active form of MT2 and, importantly, the contributions of different MT2 domains to its function are largely unknown. Here we examined the activities of truncated MT2 that were generated by site-directed mutagenesis or Gibson assembly master mix, and found that the stem region of MT2 determines the specificity and efficacy for substrate cleavage. The transmembrane domain allowed MT2 activation after reaching the plasma membrane, and the cytoplasmic domain facilitated these processes. Further <i>in vivo</i> rescue studies indicated that the entire extracellular and transmembrane domains of MT2 are required to correct the low-hemoglobin, low-serum iron, and high-hepcidin status in <i>MT2</i><sup>-/-</sup> mice. Unlike in cell lines, no autocleavage of MT2 was detected <i>in vivo</i> in the liver, implying that MT2 may also function independently of its proteolytic activity. In conjunction with our previous studies implicating the cytoplasmic domain as an intracellular iron sensor, these observations reveal the importance of each MT2 domain for MT2-mediated substrate cleavage and for its biological function.

Also flagged:ProcollagensautophagylumenER proteinscollagenCANX
Journal Article 2018-12-17 ✓ 2 Snippets Forrester A, De Leonibus C, Grumati P, Fasana E, Piemontese M, Staiano L, Fregno I, Raimondi A, Marazza A, Bruno G, Iavazzo M, Intartaglia D, Seczynska M, van Anken E, Conte I, De Matteis MA, Dikic I, Molinari M, Settembre C.
In-Text Gene Mentions

…SEC62, RTN3 andCCPG1proteins have been…

…the disruption ofCCPG1‐mediated ER‐phagy leads to…

Show Full Abstract

Autophagy is a cytosolic quality control process that recognizes substrates through receptor-mediated mechanisms. Procollagens, the most abundant gene products in Metazoa, are synthesized in the endoplasmic reticulum (ER), and a fraction that fails to attain the native structure is cleared by autophagy. However, how autophagy selectively recognizes misfolded procollagens in the ER lumen is still unknown. We performed siRNA interference, CRISPR-Cas9 or knockout-mediated gene deletion of candidate autophagy and ER proteins in collagen producing cells. We found that the ER-resident lectin chaperone Calnexin (CANX) and the ER-phagy receptor FAM134B are required for autophagy-mediated quality control of endogenous procollagens. Mechanistically, CANX acts as co-receptor that recognizes ER luminal misfolded procollagens and interacts with the ER-phagy receptor FAM134B. In turn, FAM134B binds the autophagosome membrane-associated protein LC3 and delivers a portion of ER containing both CANX and procollagen to the lysosome for degradation. Thus, a crosstalk between the ER quality control machinery and the autophagy pathway selectively disposes of proteasome-resistant misfolded clients from the ER.

Also flagged:NeurodevelopmentalautismMAPK3chromosomeCHD4WDFY4
Journal Article 2018-12-17 ✓ 1 Snippet Coe BP, Stessman HAF, Sulovari A, Geisheker MR, Bakken TE, Lake AM, Dougherty JD, Lein ES, Hormozdiari F, Bernier RA, Eichler EE.
In-Text Gene Mentions

…( DLG2 ,HTT, AP2A2 ,…

Show Full Abstract

We combined de novo mutation (DNM) data from 10,927 individuals with developmental delay and autism to identify 253 candidate neurodevelopmental disease genes with an excess of missense and/or likely gene-disruptive (LGD) mutations. Of these genes, 124 reach exome-wide significance (P < 5 × 10<sup>-7</sup>) for DNM. Intersecting these results with copy number variation (CNV) morbidity data shows an enrichment for genomic disorder regions (30/253, likelihood ratio (LR) +1.85, P = 0.0017). We identify genes with an excess of missense DNMs overlapping deletion syndromes (for example, KIF1A and the 2q37 deletion) as well as duplication syndromes, such as recurrent MAPK3 missense mutations within the chromosome 16p11.2 duplication, recurrent CHD4 missense DNMs in the 12p13 duplication region, and recurrent WDFY4 missense DNMs in the 10q11.23 duplication region. Network analyses of genes showing an excess of DNMs highlights functional networks, including cell-specific enrichments in the D1<sup>+</sup> and D2<sup>+</sup> spiny neurons of the striatum.

Also flagged:PeptideCarbonNanotubes2,4,6-trinitrotoluenesingle-walled carbon nanotubescarboxylic acid
Journal Article 2018-12-17 No Snippets Wang J, Du S, Onodera T, Yatabe R, Tanaka M, Okochi M, Toko K.
Show Full Abstract

In this study, we developed a surface plasmon resonance (SPR) sensor chip based on 2,4,6-trinitrotoluene (TNT) recognition peptide-modified single-walled carbon nanotubes (SWCNTs). The carboxylic acid-functionalized SWCNTs were immobilized on a 3-aminopropyltriethoxysilane (APTES)-modified SPR Au chip surface. Through π-stacking between the aromatic amino acids and SWCNTs, the TNT recognition peptide TNTHCDR3 was immobilized onto the surface of the SWCNTs. The peptide⁻SWCNTs-modified sensor surface was confirmed and evaluated by atomic force microscope (AFM) observation. The peptide⁻SWCNTs hybrid SPR sensor chip exhibited enhanced sensitivity with a limit of detection (LOD) of 772 ppb and highly selective detection compared with commercialized carboxymethylated dextran matrix sensor chips.

Also flagged:Non-Alcoholic Fatty Liver DiseaseNAFLDcirrhosisnon-alcoholic steatohepatitisNASHglucose
Journal Article 2018-12-17 ✓ 1 Snippet Denkmayr L, Feldman A, Stechemesser L, Eder SK, Zandanell S, Schranz M, Strasser M, Huber-Schönauer U, Buch S, Hampe J, Paulweber B, Lackner C, Haufe H, Sotlar K, Datz C, Aigner E.
In-Text Gene Mentions

…liver diseases likehemochromatosisor hepatitis C…

Show Full Abstract

A small proportion of lean patients develop non-alcoholic fatty liver disease (NAFLD). We aimed to report the histological picture of lean NAFLD in comparison to overweight and obese NAFLD patients. Biopsy and clinical data from 466 patients diagnosed with NAFLD were stratified to groups according to body mass index (BMI): lean (BMI ≤ 25.0 kg/m², <i>n</i> confirmed to be appropriate = 74), overweight (BMI > 25.0 ≤ 30.0 kg/m², <i>n</i> = 242) and obese (BMI > 30.0 kg/m², <i>n</i> = 150). Lean NAFLD patients had a higher rate of lobular inflammation compared to overweight patients (12/74; 16.2% vs. 19/242; 7.9%; <i>p</i> = 0.011) but were similar to obese patients (25/150; 16.7%). Ballooning was observed in fewer overweight patients (38/242; 15.7%) compared to lean (19/74; 25.7%; <i>p</i> = 0.014) and obese patients (38/150; 25.3%; <i>p</i> = 0.006). Overweight patients had a lower rate of portal and periportal fibrosis (32/242; 13.2%) than lean (19/74; 25.7%; <i>p</i> = 0.019) and obese patients (37/150; 24.7%; <i>p</i> = 0.016). The rate of cirrhosis was higher in lean patients (6/74; 8.1%) compared to overweight (4/242; 1.7%; <i>p</i> = 0.010) and obese patients (3/150; 2.0% <i>p</i> = 0.027). In total, 60/466; 12.9% patients were diagnosed with non-alcoholic steatohepatitis (NASH). The rate of NASH was higher in lean (14/74; 18.9% <i>p</i> = 0.01) and obese (26/150; 17.3%; <i>p</i> = 0.007) compared to overweight patients (20/242; 8.3%)). Among lean patients, fasting glucose, INR and use of thyroid hormone replacement therapy were independent predictors of NASH in a multivariate model. Lean NAFLD patients were characterized by a severe histological picture similar to obese patients but are more progressed compared to overweight patients. Fasting glucose, international normalized ratio (INR) and the use of thyroid hormone replacement may serve as indicators for NASH in lean patients.

Also flagged:collagensynthesisagingwatertype I procollagenmatrix metalloproteinase-1
Journal Article 2018-12-17 No Snippets Yang JE, Ngo HTT, Hwang E, Seo SA, Park SW, Yi TH.
Show Full Abstract

Exposure of skin to UVB radiation is associated with skin thickening, erythema, deep wrinkles, and marked losses of elasticity, resilience, and hydration. To find effective anti-aging materials, scientists have studied not only natural nutritional sources, but also biotransformed metabolites. Although Hibiscus syriacus L., the national flower of Korea has been used extensively throughout history, it has not yet been examined for possible anti-aging effects. In this study, skin anti-aging effects of H. syriacus L. water extract (HSL) and enzyme-treated H. syriacus L. extract (ETH) were investigated in normal human dermal fibroblasts (NHDFs) in vitro and in hairless mice in vivo. In UVB-irradiated NHDFs, higher level of type I procollagen and lower levels of matrix metalloproteinase-1 (MMP-1), mitogen-activated protein kinases (MAPKs), and activator protein-1 (AP-1) expression were identified after treatment with HSL and ETH. In photoaged hairless mice, skin thickening and the density of collagen fibers and filaggrin improved after oral administration of HSL and ETH. ETH 1% significantly inhibited melanin content, erythema index (EI), transepidermal water loss (TEWL), stratum corneum (SC) hydration, and wrinkle formation. Palmitic acid and linoleic acid were more abundant in ETH than in HSL. Taken together, both HSL and ETH protect skin from UVB-induced premature photoaging, and enzymatic biotransformed products like ETH have potential for use as valuable functional foods.

Also flagged:bosentanβ-thalassemiathalassemiapulmonary arterial hypertensionthalassemia intermediaendothelin-1
Journal Article 2018-12-17 ✓ 1 Snippet Karami H, Darvishi-Khezri H, Kosaryan M, Akbarzadeh R, Dabirian M.
In-Text Gene Mentions

…protein S, andantithrombin-III, elevated platelet activator…

Show Full Abstract

<h4>Introduction</h4>Pulmonary arterial hypertension (PAH) is relatively prevalent in patients with thalassemia. PAH treatment is necessary as the prevalence of Doppler-estimated PAH and the resultant mortality is high in such patients.<h4>Materials and methods</h4>This study aimed at evaluating the effect of bosentan therapy on patients with thalassemia suspected of PAH. Based on pulsed Doppler echocardiography, all the cases were suspected of severe PAH. Consequently, bosentan was initiated at a dose of 62.5 mg twice a day for 4 weeks, which was increased to 62.5-125 mg twice a day, if no adverse side effects were observed.<h4>Results</h4>The results of this study showed that pulmonary artery pressure (PAP) decreased after the administration of bosentan in three cases, from 160 to 120, 110 to 65, and 60 to 25 mmHg; in other words, the PAP reduced in the mentioned cases by 25%, 36.4%, and 58.4%, respectively.<h4>Conclusion</h4>In this study, PAP improved after bosentan therapy in patients with β-thalassemia suspected of PAH; however, further studies are required to confirm the findings.

Also flagged:ironthalassemia intermediaalanine aminotransferaseALTthalassemia majorthalassemia
Journal Article 2018-12-17 ✓ 1 Snippet Al-Momen H, Jasim SK, Hassan QA, Ali HH.
In-Text Gene Mentions

…LIC or truehemochromatosisin patients with…

Show Full Abstract

<h4>Background</h4>Iron overload is a risk factor affecting all patients with thalassemia intermedia (TI). We aimed to determine whether there is a relationship of serum ferritin (SF) and alanine aminotransferase (ALT) with liver iron concentration (LIC) determined by R2 magnetic resonance imaging (R2-MRI), to estimate the most relevant degree of iron overload and best time to chelate in patients with TI.<h4>Methods</h4>In this cross-sectional study, 119 patients with TI (mean age years) were randomly selected and compared with 120 patients who had a diagnosis of thalassemia major (TM). Correlations of LIC, as determined by R2-MRI, with SF and ALT levels, were assessed in all participants. A <i>P</i>-value <0.05 was considered statistically significant.<h4>Results</h4>SF and LIC levels were lower in patients with TI than in those with TM; only ferritin values were significant. We found a statistically significant relationship between SF and LIC, with cut-off estimates of SF in patients with TI who had splenectomy and those who entered puberty spontaneously (916 and 940 ng/mL, respectively) with LIC >5 mg Fe/g dry weight (<i>P</i><0.0001). A significant relationship was also found for patients with TI who had elevated ALT level (63.5 U/L), of 3.15 times the upper normal laboratory limit, using a cut-off for LIC ≥5 mg Fe/g dry weight.<h4>Conclusion</h4>We determined the cut-off values for ALT and SF indicating the best time to start iron chelation therapy in patients with TI, and found significant correlations among iron overload, SF, and ALT.

Also flagged:neuronal migrationneurological disordercognitionorganizationMigrationneurogenesis
Journal Article 2018-12-17 ✓ 1 Snippet Rahimi-Balaei M, Bergen H, Kong J, Marzban H.
In-Text Gene Mentions

During development of pontine nuclei in the hindbrain, neurons reach the midline and Netrin-1 acts as a midline attractant and these neurons themselves express deleted in colorectal cancer (DCC), a Netrin-1 receptor), to assist these neurons to reach the midline (Yee et al., 1999).

Show Full Abstract

Neuronal migration is a fundamental process in central nervous system (CNS) development. The assembly of functioning neuronal circuits relies on neuronal migration occurring in the appropriate spatio-temporal pattern. A defect in the neuronal migration may result in a neurological disorder. The cerebellum, as a part of the CNS, plays a pivotal role in motor coordination and non-motor functions such as emotion, cognition and language. The excitatory and inhibitory neurons within the cerebellum originate from different distinct germinal zones and migrate through complex routes to assemble in a well-defined neuronal organization in the cerebellar cortex and nuclei. In this review article, the neuronal migration modes and pathways from germinal zones to the final position in the cerebellar cortex and nuclei will be described. The cellular and molecular mechanisms involved in cerebellar neuronal migration during development will also be reviewed. Finally, some diseases and animal models associated with defects in neuronal migration will be presented.

Also flagged:Multiple SclerosisMSneurological disorderpathogenesisSTAT3chronic autoimmune disease of the
Journal Article 2018-12-17 No Snippets Paraboschi EM, Cardamone G, Soldà G, Duga S, Asselta R.
Show Full Abstract

Multiple sclerosis (MS) is the most common neurological disorder in young adults. Despite extensive studies, only a fraction of MS heritability has been explained, with association studies focusing primarily on protein-coding genes, essentially for the difficulty of interpreting non-coding features. However, non-coding RNAs (ncRNAs) and functional elements, such as super-enhancers (SE), are crucial regulators of many pathways and cellular mechanisms, and they have been implicated in a growing number of diseases. In this work, we searched for possible enrichments in non-coding elements at MS genome-wide associated loci, with the aim to highlight their possible involvement in the susceptibility to the disease. We first reconstructed the linkage disequilibrium (LD) structure of the Italian population using data of 727,478 single-nucleotide polymorphisms (SNPs) from 1,668 healthy individuals. The genomic coordinates of the obtained LD blocks were intersected with those of the top hits identified in previously published MS genome-wide association studies (GWAS). By a bootstrapping approach, we hence demonstrated a striking enrichment of non-coding elements, especially of circular RNAs (circRNAs) mapping in the 73 LD blocks harboring MS-associated SNPs. In particular, we found a total of 482 circRNAs (annotated in publicly available databases) vs. a mean of 194 ± 65 in the random sets of LD blocks, using 1,000 iterations. As a proof of concept of a possible functional relevance of this observation, we experimentally verified that the expression levels of a circRNA derived from an MS-associated locus, i.e., hsa_circ_0043813 from the <i>STAT3</i> gene, can be modulated by the three genotypes at the disease-associated SNP. Finally, by evaluating RNA-seq data of two cell lines, SH-SY5Y and Jurkat cells, representing tissues relevant for MS, we identified 18 (two novel) circRNAs derived from MS-associated genes. In conclusion, this work showed for the first time that MS-GWAS top hits map in LD blocks enriched in circRNAs, suggesting circRNAs as possible novel contributors to the disease pathogenesis.

Also flagged:matingspermatogenesismatingsmale fertilityTEX14SEP4
Journal Article 2018-12-17 ✓ 2 Snippets Zhang C, MacNeil MD, Kemp RA, Dyck MK, Plastow GS.
In-Text Gene Mentions

A few genes in Haplotype 14 and Haplotype 17 are involved in tumor necrosis, e.g., FASLG (Fas Ligand), TNFSF4 (TNF Superfamily Member 4) and TNFSF18 (TNF Superfamily Member 18), or tumor suppression, e.g., RNF43 (Ring Finger Protein 43) and PCSK2 (Proprotein Convertase Subtilisin/Kexin Type 2).

…FASLG (Fas Ligand),TNFSF4(TNF Superfamily Member…

Show Full Abstract

Lethal recessive alleles that act prenatally may be detected from the absence of homozygous individuals in a population. However, these alleles may be maintained at relatively low frequencies in populations as heterozygotes. In pigs, they may reduce litter size. This study aimed to detect putative lethal variants in the Duroc breed. Phenotypes for the numbers of piglets born (TNB), born live (BA), alive at 24 h (L24), stillborn (SB), and born as mummified fetuses (MM) were available from 5340 recorded litters which resulted from mating of 192 genotyped boars with sows of unknown genotype (dataset 1). An additional 50 litters were produced from parents that were both genotyped (dataset 2). Imputed genotypes of 650K SNPs for 1359 Duroc boars were used in this study. One significant SNP (Bonferroni corrected <i>P</i> = 5.5E-06) was located on SSC14 with 45.3 homozygous individuals expected but none observed. This SNP was significant for mummified fetuses. One hundred fifty two haplotypes were also found to potentially harbor recessive lethal mutations. Twenty-one haplotypes had a significant harmful effect on at least one trait. Two regions, located on SSC8 (144.9-145.5 Mb) and SSC9 (19-19.4 Mb) had significant effects on fertility traits in both datasets. Additionally, regions on SSC1 (82.0-82.8 Mb), SSC3 (73.3-73.7 and 87.1-87.5 Mb) and SSC12 (35.8-36.2 and 50.0-50.5 Mb) had significant deleterious effects on TNB or BA or L24 in dataset 1. Finally, a region on SSC17 (28.7-29.3 Mb) had significant effects on TNB, BA and L24 in dataset 2. A few candidate genes identified within these regions were described as being involved in spermatogenesis and male fertility (<i>TEX14, SEP4</i>, and <i>HSF5</i>), or displayed recessive lethality (<i>CYP26B1</i>, <i>SCD5</i>, and <i>PCF11</i>) in other species. The putative loci detected in this study provide valuable information to potentially increase Duroc litter size by avoiding carrier-by-carrier matings in breeding programs. Further study of the identified candidate genes responsible for such lethal effects may lead to new insights into functions regulating pig fertility.

Also flagged:G Protein-Coupled Receptorspulmonary arterial hypertensionGPCRspathogenesisleft ventricular (LV) failurebeta-adrenergic receptor
Journal Article 2018-12-17 No Snippets Viswanathan G, Mamazhakypov A, Schermuly RT, Rajagopal S.
Show Full Abstract

Pressure overload of the right ventricle (RV) in pulmonary arterial hypertension (PAH) leads to RV remodeling and failure, an important determinant of outcome in patients with PAH. Several G protein-coupled receptors (GPCRs) are differentially regulated in the RV myocardium, contributing to the pathogenesis of RV adverse remodeling and dysfunction. Many pharmacological agents that target GPCRs have been demonstrated to result in beneficial effects on left ventricular (LV) failure, such as beta-adrenergic receptor and angiotensin receptor antagonists. However, the role of such drugs on RV remodeling and performance is not known at this time. Moreover, many of these same receptors are also expressed in the pulmonary vasculature, which could result in complex effects in PAH. This manuscript reviews the role of GPCRs in the RV remodeling and dysfunction and discusses activating and blocking GPCR signaling to potentially attenuate remodeling while promoting improvements of RV function in PAH.

Also flagged:Sendai virus infectiongene expressionTmem119innate immunityinflammatory responsePI3K
Journal Article 2018-12-17 No Snippets Wei W, Kong W.
Show Full Abstract

Sendai virus (SeV) has been used as a model strain to reveal molecular features of paramyxovirus biology. In this study, we comprehensively analyzed the gene profiling of murine macrophages and airway epithelial cells in response to SeV using gene expression data. The significantly differentially expressed genes (DEGs) were screened by GEO2R. Gene ontology (GO) and pathway enrichment analyses were performed by DAVID. The protein-protein interaction (PPI) map of DEGs was constructed by STRING. The modules of PPI network are produced by molecular complex detection (MCODE) plug-in of Cytoscape. In total, 241 up- and 83 downregulated DEGs were identified in airway epithelial cells while 130 up- and 148 downregulated in macrophage. Particularly, Tmem119 and Colla2 are significantly downregulated in airway epithelial cells and macrophages, respectively. Functional enrichment analysis showed that upregulated DEGs are clustered in innate immunity and inflammatory response in both cell types, whereas downregulated DEGs are involved in host metabolic pathway in airway epithelial cells. PI3K-AKT signaling pathway is downregulated in macrophages. PPI network analysis indicated that some high degree of nodes exist in both cell types, such as Stat1, Tnf, and Cxcl10. In conclusion, SeV infection can induce different host cell responses in airway epithelial cells and macrophages.

Also flagged:SynthesisSilicaaminethiolsilanespolyethylene glycol
Journal Article 2018-12-17 No Snippets von Baeckmann C, Guillet-Nicolas R, Renfer D, Kählig H, Kleitz F.
Show Full Abstract

Mesoporous silica nanoparticles (MSNs) are considered as promising next-generation nanocarriers for health-related applications. However, their effectiveness mostly relies on their efficient and surface-specific functionalization. In this contribution, we explored different strategies for the rational multistep synthesis of functional MCM-48-type MSNs with selectively created active inner and/or external surfaces. Functional groups were first installed using a combination of (delayed) co-condensation and post-grafting procedures. Both amine [(3-aminopropyl)triethoxysilane (APTS)] and thiol [(3-mercaptopropyl)trimethoxysilane (MPTS)] silanes were used, in various addition sequences. Following this, the different platforms were further functionalized with polyethylene glycol and/or with a pro-chelate ligand used as a magnetic resonance imaging contrast agent (diethylenetriaminepentaacetic acid chelates) and/or loaded with quercetin and/or grafted with an organic dye (rhodamine). The efficiency of the multiple grafting strategies and the effects on the MSN carrier properties are presented. Finally, the colloidal stability of the different systems was evaluated in physiological media, and preliminary tests were performed to verify their drug release capability. The use of MPTS appeared beneficial when compared to APTS in delayed co-condensation procedures to preserve both selective distribution of the functional groups, reactive functionality, and pore ordering. Our results provide in-depth insights into the efficient design of (multi)functional MSNs and especially on the crucial role played by the sequence of step-by-step functionalization methods aiming to produce multipurpose and stable bioplatforms.

Also flagged:OX40OX40Lantibodiesautoimmune diseasestype II transmembrane proteintumor necrosis factor
Journal Article 2018-12-16 ✓ 1 Snippet An J, Ding S, Hu X, Sun L, Gu Y, Xu Y, Hu Y, Liu C, Zhang X.
In-Text Gene Mentions

…OX40L (CD252,TNFSF4), a type II…

Show Full Abstract

OX40L (CD252, TNFSF4), a type II transmembrane protein which like other tumor necrosis factor ligands, involved in the costimulation and differentiation of T cells, functions as a positive signal in immune response. To investigate the biological function of soluble OX40L (sOX40L), three functional anti-OX40L monoclonal antibodies (mAbs) 3D2, 3F7 and 2H3 were obtained by hybridoma technology. Besides, specificity of the mAbs was further demonstrated by ELISA, Western blot and Immunofluorescence experiments. We also developed a novel enzyme-linked immunosorbent assay (ELISA) based on two anti-human OX40L antibodies 3D2 and 3F7 with different epitopes. Using the ELISA system, we found that sOX40L in the sera of healthy donors increases in an age-dependent manner and that enhanced sOX40L expression in some autoimmune diseases especially in rheumatoid arthritis (RA) patients, suggesting the potential diagnostic significance of sOX40L in the autoimmune diseases. Together, these data demonstrate that the existence of circulating sOX40L in human sera might play an important role in immunoregulation.

Also flagged:Acute Kidney InjuryextracellularvesiclesmicrovesiclesExtracellular vesiclesrenal ischemia-reperfusion injury
Journal Article 2018-12-16 No Snippets Tsuji K, Kitamura S, Wada J.
Show Full Abstract

A kidney has the ability to regenerate itself after a variety of renal injuries. Mesenchymal stem cells (MSCs) have been shown to ameliorate tissue damages during renal injuries and diseases. The regenerations induced by MSCs are primarily mediated by the paracrine release of soluble factors and extracellular vesicles, including exosomes and microvesicles. Extracellular vesicles contain proteins, microRNAs, and mRNAs that are transferred into recipient cells to induce several repair signaling pathways. Over the past few decades, many studies identified trophic factors from MSCs, which attenuate renal injury in a variety of animal acute kidney injury models, including renal ischemia-reperfusion injury and drug-induced renal injury, using microarray and proteomic analysis. Nevertheless, these studies have revealed the heterogeneity of trophic factors from MSCs that depend on the cell origins and different stimuli including hypoxia, inflammatory stimuli, and aging. In this review article, we summarize the secretomes and regenerative mechanisms induced by MSCs and highlight the possible heterogeneity of trophic factors from different types of MSC and different circumstances for renal regeneration.

Also flagged:Pancreatic carcinomapancreatic cancergestational diabetesPancreatic adenocarcinomagestational diabetes mellitusdisseminated intravascular coagulation
Journal Article 2018-12-15 ✓ 2 Snippets Shi AW, Shen XF, Ding HJ, Liu YQ, Meng L, Kalionis B.
In-Text Gene Mentions

…her anti-thrombin III (ATIII; 108.2%) and D-dimer…

…time (APTT), andATIIIwere all normal.…

Show Full Abstract

<h4>Background</h4>Gestational diabetes mellitus is strongly related to the risk of pancreatic cancer in pregnant women, but gestational diabetes can precede a diagnosis of pancreatic cancer by many years. Women with a history of gestational diabetes showed a relative risk of pancreatic cancer of 7.1. Pancreatic adenocarcinoma is one of the most common malignancies associated with thromboembolic events. A clinical study showed that thromboembolic events were detected in 36% of patients diagnosed as having pancreatic cancer. Studies showed that gestational diabetes mellitus could be one of the important risk factors for pancreatic cancer.<h4>Case presentation</h4>Gestational diabetes mellitus is associated with increased risk of breast and pancreatic cancer. This case report describes a 29-year-old Chinese woman who presented with: gestational diabetes mellitus; International Society on Thrombosis and Haemostasis criteria suggested disseminated intravascular coagulation with a score of 5; hemolysis, elevated liver enzymes, low platelet count syndrome; and pulmonary hypertension. After an intravenous injection of fibrinogen, she gave birth to a normal baby and following delivery, her blood pressure reached 180/110 mmHg. Laboratory analysis results showed elevated lactic dehydrogenase, decreased platelets and fibrinogen, and urine protein was positive. She was transfused with fresh frozen plasma, blood coagulation factor, and fibrinogen. Subsequently, she was transferred to a maternity intensive care unit, where magnesium sulfate seizure prophylaxis was continued for 24 hours to keep her magnesium level at a low therapeutic range. However, continuous oxygen therapy was needed to maintain her oxygenation. Further laboratory investigations revealed elevated carcinoembryonic antigen, carbohydrate antigen 19-9, and carbohydrate antigen 72-4. Positron emission tomography-computed tomography showed malignant carcinoma in the head of her pancreas with lymph node involvement along with bone, peritoneal, and left adrenal metastasis, as well as double lung lymphangitic carcinomatosis.<h4>Conclusion</h4>A differential diagnosis of digestive system neoplasm should be considered when a pregnant patient presents with gestational diabetes mellitus and disseminated intravascular coagulation, where the disseminated intravascular coagulation has no specific cause and cannot be readily resolved.

Also flagged:serotonin transporterserotonin
Journal Article 2018-12-15 ✓ 5 Snippets Krause ET, Kjaer JB, Dudde A, Schrader L, Phi-van L.
In-Text Gene Mentions

The serotonin transporter gene (5-HTT) is involved in the regulation of the neural serotonin.

…the serotonin transporter (5-HTT) gene in adult…

…serotonin transporter gene (5-HTT) is involved in…

…Polymorphisms in the5-HTTgene have been…

…changes of the5-HTTare accompanied in…

Show Full Abstract

The serotonin transporter gene (5-HTT) is involved in the regulation of the neural serotonin. Polymorphisms in the 5-HTT gene have been described in many species to be involved in physiological processes and emotions. A functional polymorphism in the 5´-flanking region of the 5-HTT gene is known from chickens, with a deletion-allele (D), which is associated with an increased 5-HTT expression, in comparison to the wild-type-allele (W). In domestic populations, the majority of hens carry the W-allele. The regulatory changes of the 5-HTT are accompanied in chickens, as in humans, by modulations of fear. Beside these effects on fear, the understanding of potential functional consequences on the social behaviour in the gregarious chicken is lacking. Thus, we here investigated whether the 5-HTT polymorphism with three genotypes (WW, WD, DD), is not only linked to fear-related behaviour, but affects also socio-positive and -negative behaviours of adult hens. Our data confirmed the effects on fear-related behaviour. WW hens showed highest levels of fear. Interestingly, no differences in the social behaviours were present between the hens of the different 5-HTT genotypes. We further discuss implications for potential evolutionary pathways via natural selection and / or artificial selection through domestication of the 5-HTT polymorphism, which might have enabled a stable social lifestyle in the wild ancestors of modern chickens.

Also flagged:IronAgingtelomerestelomerepolymeraseC-reactive protein
Journal Article 2018-12-15 ✓ 2 Snippets Liu B, Sun Y, Xu G, Snetselaar LG, Ludewig G, Wallace RB, Bao W.
In-Text Gene Mentions

HFE

hemochromatosis

Show Full Abstract

<h4>Background</h4>Excess iron levels can induce oxidative stress and could therefore affect telomere attrition. However, little is known about the impact of body iron status on telomere length.<h4>Objective</h4>Our aim was to examine the association between serum ferritin concentrations, an indicator of body iron status, and leukocyte telomere length in US adults.<h4>Design</h4>We conducted a nationwide, population-based, cross-sectional study.<h4>Participants/setting</h4>We used data from the National Health and Nutrition Examination Survey (NHANES) 1999-2002. We included 7,336 adults aged 20 years or older who had available data on serum ferritin levels and telomere length. High ferritin levels were defined as a serum ferritin level >200 ng/mL (449.4 pmol/L) in women and >300 ng/mL (674.1 pmol/L) in men. Low ferritin levels were defined as a serum ferritin level <30 ng/mL (67.4 pmol/L).<h4>Main outcome measures</h4>Leukocyte telomere length was assayed using the quantitative polymerase chain reaction method.<h4>Statistical analyses</h4>Linear regression with survey weights was performed to estimate the association between serum ferritin levels and telomere length.<h4>Results</h4>The prevalence of adults with high and low serum ferritin levels was 10.9% and 17.6%, respectively. High ferritin levels were inversely associated with telomere length compared to normal ferritin levels. After adjustment for demographic, socioeconomic and lifestyle factors, body mass index, C-reactive protein, and leukocyte cell type composition, the β coefficient for log-transformed telomere length was -0.020 (standard error [SE]=0.009; P=0.047). The association was stronger in adults aged 65 years or older (β coefficient -0.081, SE=0.017; P<0.001) than in adults 20 to 44 years old (β coefficient -0.023, SE=0.019; P=0.24) or adults aged 45 to 64 years old (β coefficient 0.024, SE=0.015; P=0.10) (P for interaction 0.003). Low ferritin levels were not significantly associated with telomere length compared with normal ferritin levels.<h4>Conclusions</h4>In a US nationally representative population, high body iron status was associated with shorter telomeres, especially in adults aged 65 years or older.

Also flagged:Extracellulartumorcollagenorganizationcancerfibroadenoma
Journal Article 2018-12-14 No Snippets Angel PM, Schwamborn K, Comte-Walters S, Clift CL, Ball LE, Mehta AS, Drake RR.
Show Full Abstract

<h4>Purpose</h4>A new method accessing proteins from extracellular matrix by imaging mass spectrometry (ECM IMS) has been recently reported. ECM IMS is evaluated for use in exploring breast tissue pathologies.<h4>Experimental design</h4>A tissue microarray (TMA) is analyzed that has 176 cores of biopsies and lumpectomies spanning breast pathologies of inflammation, hyperplasia, fibroadenoma, invasive ductal carcinoma, and invasive lobular carcinoma and normal adjacent to tumor (NAT). NAT is compared to subtypes by area under the receiver operating curve (ROC) >0.7. A lumpectomy is also characterized for collagen organization by microscopy and stromal protein distribution by IMS. LC-based high-resolution accurate mass (HRAM) proteomics is used to identify proteins from the lumpectomy.<h4>Results</h4>TMA analysis shows distinct spectral signatures reflecting a heterogeneous tissue microenvironment. Ninety-four peaks show an ROC > 0.7 compared to NAT; NAT has overall higher intensities. Lumpectomy analysis by IMS visualizes a complex central tumor region with distal tumor regions. A total of 39 stromal proteins are identified by HRAM LC-based proteomics. Accurate mass matches between image data and LC-based proteomics demonstrate a heterogeneous collagen type environment in the central tumor.<h4>Conclusions</h4>Data portray the heterogeneous stromal microenvironment of breast pathologies, including alteration of multiple collagen-type patterns. ECM IMS is a promising new tool for investigating the stromal microenvironment of breast tissue including cancer.

Also flagged:ABHD11colorectal cancertumorcancersbiotinluciferase
Journal Article 2018-12-14 ✓ 1 Snippet Lei X, Li L, Duan X.
In-Text Gene Mentions

…survival by counteractingSTAU1-mediated mRNA destabilization…

Show Full Abstract

Recently, lncRNA has been verified to regulate the development and progression of tumor. LncRNA ABHD11-AS1 has been proven to serve as an oncogene in several cancers. However, the role of ABHD11-AS1 in colorectal cancer remains totally unknown. In the present study, qRT-PCR assay revealed that ABHD11-AS1 expression was markedly higher in colorectal cancer tissues and cell lines. In addition, patients who displayed overexpression of ABHD11-AS1 showed a significantly poorer progression free survival (PFS) and overall survival (OS) by Kaplan-Meier analysis. Loss-of-function experiments suggested that silencing of ABHD11-AS1 expression could significantly reduce the proliferation, colony formation, migration and invasion of colorectal cancer cells, and increase cell apoptosis. Moreover, bioinformatics analysis, biotin pull-down assay, luciferase reporter assay, and RIP assay disclosed that ABHD11-AS1 straightly interacted with miR-133a. We also found that SOX4 was a downstream target of miR-133a and ABHD11-AS1 subsequently exerted its biological effects via modulating the expression of SOX4 in colorectal cancer cells. Collectively, these findings manifested that the ABHD11-AS1/miR-133a/SOX4 axis may be a cogitable and promising therapeutic target for colorectal cancer.

Also flagged:IgA nephropathyidiopathic glomerular diseasesendkidney diseaseIgANimmune response
Journal Article 2018-12-14 ✓ 5 Snippets Guo Z, Wang Z, Lu C, Yang S, Sun H, Reziw, Guo Y, Sun W, Yue H.
In-Text Gene Mentions

In addition, ADIPOQ and SERPINC1 have reported to be upregulated in the urine and plasma of IgAN in previous studies [10, 24, 35].

By IPA analysis, four proteins, including ICAM1, TIMP1, ADIPOQ and SERPINC1 were functional related to IgAN or kidney injury in previous studies.

ICAM1, TIMP1, SERPINC1 and ADIPOQ were upregulated in Uygur IgAN.

SERPINC1, ADIPOQ, ICAM1, and TIMP1 were all upregulated in the Uygur IgAN patients (Fig 4a-d and Table 3).

SERPINC1 and ICAM1 were identified as the candidate biomarkers with excellent area-under-the-curve (AUC) values (0.84) for distinguishing Uygur IgAN from normal controls.

Show Full Abstract

<h4>Background</h4>IgA nephropathy (IgAN) is one of the most common forms of idiopathic glomerular diseases and might lead to end-stage kidney disease. Accurate and non-invasive biomarkers for early diagnosis are required for early intervention and consequent therapy for IgAN patients. Because variance in the disease incidence and predisposing genes of IgAN has been detected among different ethnicities, the ethnicity factor should be considered in IgAN biomarker discovery. The differences in the protein profiles and pathological mechanisms of IgAN in patients of Uygur ethnicity need to be clearly illustrated.<h4>Methods</h4>In this study, we used urinary proteomics to discover candidate biomarkers of IgAN in patients of Uygur ethnicity. The urinary proteins from Uygur normal control and Uygur IgAN patients were extracted and analyzed using 2D-LC-MS/MS and isobaric tags for relative and absolute quantitation (iTRAQ) analysis.<h4>Results</h4>A total of 277 proteins were found to be differentially represented in Uygur IgAN compared with the respective normal controls. The bioinformatics analysis revealed that the immune response, cell survival, and complement system were activated in Uygur IgAN. Many differentially expressed proteins were found to be related to nephropathy and kidney injuries. Four candidate biomarkers were validated by Western blot, and these results were consistent with the iTRAQ results. ICAM1, TIMP1, SERPINC1 and ADIPOQ were upregulated in Uygur IgAN. Bioinformatic analysis revealed that the increase of ICAM1 and TIMP1 might be caused by IgAN, but the increase of SERPINC1 and ADIPOQ might be caused by proteinuria. SERPINC1 and ICAM1 were identified as the candidate biomarkers with excellent area-under-the-curve (AUC) values (0.84) for distinguishing Uygur IgAN from normal controls.<h4>Conclusions</h4>Using urinary proteomic analysis, we identified several candidate biomarkers for IgAN in patients of Uygur ethnicity. These results will prove helpful for exploring the pathological mechanism of IgAN in patients of Uygur ethnicity and for developing better treatments for these patients.

Also flagged:keyyoucell aggregationCB2howdelta-protocadherin
Journal Article 2018-12-14 ✓ 1 Snippet Bisogni AJ, Ghazanfar S, Williams EO, Marsh HM, Yang JY, Lin DM.
In-Text Gene Mentions

…expressing PCDH10 and/orPCDH17with PCDH19 affected…

Show Full Abstract

The delta-protocadherins (δ-Pcdhs) play key roles in neural development, and expression studies suggest they are expressed in combination within neurons. The extent of this combinatorial diversity, and how these combinations influence cell adhesion, is poorly understood. We show that individual mouse olfactory sensory neurons express 0-7 δ-Pcdhs. Despite this apparent combinatorial complexity, K562 cell aggregation assays revealed simple principles that mediate tuning of δ-Pcdh adhesion. Cells can vary the number of δ-Pcdhs expressed, the level of surface expression, and which δ-Pcdhs are expressed, as different members possess distinct apparent adhesive affinities. These principles contrast with those identified previously for the clustered protocadherins (cPcdhs), where the particular combination of cPcdhs expressed does not appear to be a critical factor. Despite these differences, we show δ-Pcdhs can modify cPcdh adhesion. Our studies show how intra- and interfamily interactions can greatly amplify the impact of this small subfamily on neuronal function.

Also flagged:Glucosylceramideacylglycolipid transfer proteinGLTPcytoplasmphenylalanines
Journal Article 2018-12-14 No Snippets Backman APE, Halin J, Nurmi H, Möuts A, Kjellberg MA, Mattjus P.
Show Full Abstract

The glycolipid transfer protein, GLTP, can be found in the cytoplasm, and it has a FFAT-like motif (two phenylalanines in an acidic tract) that targets it to the endoplasmic reticulum (ER). We have previously shown that GLTP can bind to a transmembrane ER protein, vesicle-associated membrane protein-associated protein A (VAP-A), which is involved in a wide range of ER functions. We have addressed the mechanisms that might regulate the association between GLTP and the VAP proteins by studying the capacity of GLTP to recognize different N-linked acyl chain species of glucosylceramide. We used surface plasmon resonance and a lipid transfer competition assay to show that GLTP prefers shorter N-linked fully saturated acyl chain glucosylceramides, such as C8, C12, and C16, whereas long C18, C20, and C24-glucosylceramides are all bound more weakly and transported more slowly than their shorter counterparts. Changes in the intrinsic GLTP tryptophan fluorescence blueshifts, also indicate a break-point between C16- and C18-glucosylceramide in the GLTP sensing ability. It has long been postulated that GLTP would be a sensor in the sphingolipid synthesis machinery, but how this mechanistically occurs has not been addressed before. It is unclear what proteins the GLTP VAP association would influence. Here we found that if GLTP has a bound GlcCer the association with VAP-A is weaker. We have also used a formula for identifying putative FFAT-domains, and we identified several potential VAP-interactors within the ceramide and sphingolipid synthesis pathways that could be candidates for regulation by GLTP.

Also flagged:Friedreich ataxiaHDACFRDAneurodegenerative disordertranscriptional silencingmitochondrial
Journal Article 2018-12-14 ✓ 1 Snippet Lai JI, Nachun D, Petrosyan L, Throesch B, Campau E, Gao F, Baldwin KK, Coppola G, Gottesfeld JM, Soragni E.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Friedreich ataxia (FRDA) is a neurodegenerative disorder caused by transcriptional silencing of the frataxin (<i>FXN</i>) gene, resulting in loss of the essential mitochondrial protein frataxin. Based on the knowledge that a GAA·TTC repeat expansion in the first intron of <i>FXN</i> induces heterochromatin, we previously showed that 2-aminobenzamide-type histone deacetylase inhibitors (HDACi) increase <i>FXN</i> mRNA levels in induced pluripotent stem cell (iPSC)-derived FRDA neurons and in circulating lymphocytes from patients after HDACi oral administration. How the reduced expression of frataxin leads to neurological and other systemic symptoms in FRDA patients remains unclear. Similar to other triplet-repeat disorders, it is unknown why FRDA affects only specific cell types, primarily the large sensory neurons of the dorsal root ganglia and cardiomyocytes. The combination of iPSC technology and genome-editing techniques offers the unique possibility to address these questions in a relevant cell model of FRDA, obviating confounding effects of variable genetic backgrounds. Here, using "scarless" gene-editing methods, we created isogenic iPSC lines that differ only in the length of the GAA·TTC repeats. To uncover the gene expression signatures due to the GAA·TTC repeat expansion in FRDA neuronal cells and the effect of HDACi on these changes, we performed RNA-seq-based transcriptomic analysis of iPSC-derived central nervous system (CNS) and isogenic sensory neurons. We found that cellular pathways related to neuronal function, regulation of transcription, extracellular matrix organization, and apoptosis are affected by frataxin loss in neurons of the CNS and peripheral nervous system and that these changes are partially restored by HDACi treatment.

Also flagged:Co-repressortranscription factorhistone deacetylaseHDACchromatinhistone
Journal Article 2018-12-14 ✓ 2 Snippets Adams GE, Chandru A, Cowley SM.
In-Text Gene Mentions

…to assemble HDAC1/2,chromatin adaptorsadaptors and transcription…

…the Sin3A component,Suds3, also causes G2/M…

Show Full Abstract

At face value, the Sin3 histone deacetylase (HDAC) complex appears to be a prototypical co-repressor complex, that is, a multi-protein complex recruited to chromatin by DNA bound repressor proteins to facilitate local histone deacetylation and transcriptional repression. While this is almost certainly part of its role, Sin3 stubbornly refuses to be pigeon-holed in quite this way. Genome-wide mapping studies have found that Sin3 localises predominantly to the promoters of actively transcribed genes. While Sin3 knockout studies in various species result in a combination of both up- and down-regulated genes. Furthermore, genes such as the stem cell factor, <i>Nanog</i>, are dependent on the direct association of Sin3 for active transcription to occur. Sin3 appears to have properties of a co-repressor, co-activator and general transcription factor, and has thus been termed a co-regulator complex. Through a series of unique domains, Sin3 is able to assemble HDAC1/2, chromatin adaptors and transcription factors in a series of functionally and compositionally distinct complexes to modify chromatin at both gene-specific and global levels. Unsurprisingly, therefore, Sin3/HDAC1 have been implicated in the regulation of numerous cellular processes, including mammalian development, maintenance of pluripotency, cell cycle regulation and diseases such as cancer.

Also flagged:cadherinsoxygenchronic inflammatory diseasescalcium-dependent adhesion proteinscadherinmitochondria
Journal Article 2018-12-14 No Snippets Colás-Algora N, Millán J.
Show Full Abstract

The vasculature is the paradigm of a compartment generated by parallel cellular barriers that aims to transport oxygen, nutrients and immune cells in complex organisms. Vascular barrier dysfunction leads to fatal acute and chronic inflammatory diseases. The endothelial barrier lines the inner side of vessels and is the main regulator of vascular permeability. Cadherins comprise a superfamily of 114 calcium-dependent adhesion proteins that contain conserved cadherin motifs and form cell-cell junctions in metazoans. In mature human endothelial cells, only VE (vascular endothelial)-cadherin and N (neural)-cadherin have been investigated in detail. Although both cadherins are essential for regulating endothelial permeability, no comprehensive expression studies to identify which other family members could play a relevant role in endothelial cells has so far been performed. Here, we have reviewed gene and protein expression databases to analyze cadherin expression in mature human endothelium and found that at least 24 cadherin superfamily members are significantly expressed. Based on data obtained from other cell types, organisms and experimental models, we discuss their potential functions, many of them unrelated to the formation of endothelial cell-cell junctions. The expression of this new set of endothelial cadherins highlights the important but still poorly defined roles of planar cell polarity, the Hippo pathway and mitochondria metabolism in human vascular homeostasis.

Also flagged:Irontissue homeostasiserythropoiesismetabolismPhagocytosissynthesis
Journal Article 2018-12-14 ✓ 1 Snippet Sukhbaatar N, Weichhart T.
In-Text Gene Mentions

In hemochromatosis patients with HFE gene mutations or in HFE-deficient mice, hepcidin synthesis is inappropriately low that induces systemic iron overload [65,71].

Show Full Abstract

Macrophages are sentinel cells of the innate immune system and have important functions in development, tissue homeostasis, and immunity. These phylogenetically ancient cells also developed a variety of mechanisms to control erythropoiesis and the handling of iron. Red pulp macrophages in the spleen, Kupffer cells in the liver, and central nurse macrophages in the bone marrow ensure a coordinated metabolism of iron to support erythropoiesis. Phagocytosis of senescent red blood cells by macrophages in the spleen and the liver provide a continuous delivery of recycled iron under steady-state conditions and during anemic stress. Central nurse macrophages in the bone marrow utilize this iron and provide a cellular scaffold and niche to promote differentiation of erythroblasts. This review focuses on the role of the distinct macrophage populations that contribute to efficient iron metabolism and highlight important cellular and systemic mechanisms involved in iron-regulating processes.

Also flagged:RASRHEBGTPaseRAS GTPasesRAS homolog protein enriched in brainmembrane
Journal Article 2018-12-14 ✓ 4 Snippets Schöneborn H, Raudzus F, Coppey M, Neumann S, Heumann R.
In-Text Gene Mentions

TIAM1 promotes neuronal protrusion and axon guidance through CDC42 and guidance receptor UNC-40/deleted in colorectal cancer (DCC) [69] as well as neurite extension and cell migration [70,71].

In HD, the protein huntingtin (HTT) contains an expanded poly-glutamine (poly-Q) tract.

In the case of HD, the poly-Q tract potentiates the signaling because a ternary complex of HTT-RHEB-mTOR is formed, leading to enhanced mTORC1 activity [148].

…in colorectal cancer (DCC) [ 69 ]…

Show Full Abstract

Cellular activation of RAS GTPases into the GTP-binding "ON" state is a key switch for regulating brain functions. Molecular protein structural elements of rat sarcoma (RAS) and RAS homolog protein enriched in brain (RHEB) GTPases involved in this switch are discussed including their subcellular membrane localization for triggering specific signaling pathways resulting in regulation of synaptic connectivity, axonal growth, differentiation, migration, cytoskeletal dynamics, neural protection, and apoptosis. A beneficial role of neuronal H-RAS activity is suggested from cellular and animal models of neurodegenerative diseases. Recent experiments on optogenetic regulation offer insights into the spatiotemporal aspects controlling RAS/mitogen activated protein kinase (MAPK) or phosphoinositide-3 kinase (PI3K) pathways. As optogenetic manipulation of cellular signaling in deep brain regions critically requires penetration of light through large distances of absorbing tissue, we discuss magnetic guidance of re-growing axons as a complementary approach. In Parkinson's disease, dopaminergic neuronal cell bodies degenerate in the substantia nigra. Current human trials of stem cell-derived dopaminergic neurons must take into account the inability of neuronal axons navigating over a large distance from the grafted site into striatal target regions. Grafting dopaminergic precursor neurons directly into the degenerating substantia nigra is discussed as a novel concept aiming to guide axonal growth by activating GTPase signaling through protein-functionalized intracellular magnetic nanoparticles responding to external magnets.

Also flagged:osteosarcomacell cyclephosphorylationcell adhesionbone cancertumor
Journal Article 2018-12-14 No Snippets Sun K, Zhao J.
Show Full Abstract

The present study was conducted to establish a risk assessment model for evaluating osteosarcoma prognosis based on prognosis-associated long non-coding RNA (lncRNA) expression. Human osteosarcoma expression profiles were obtained from the NCBI GEO and EBI ArrayExpress databases and differently expressed lncRNAs between good and poor prognosis groups were evaluated using Student's t-test and Wilcoxon rank test in R (v. 3.1.0). A multivariate Cox regression was used to establish a risk assessment system based on lncRNA expression levels, with the associated regression coefficients used as the weight. Survival analysis and receiver operating characteristic (ROC) curves were constructed to verify the accuracy of the risk assessment model. Associations between the prognosis, risk assessment model and clinical features were also investigated using univariate and multivariate Cox regression analyses. Furthermore, differentially expressed genes associated with the lncRNAs in the risk assessment model were identified, and functional enrichment analysis was performed. A total of 9 from the 211 differentially expressed lncRNAs were selected to establish the risk assessment model. The risk assessment model exhibited a good prognostic prediction ability, with high area under the curve values in the training and validation sets. Additionally, the calculated risk score based on the 9 selected lncRNAs was identified to be an independent prognostic factor for osteosarcoma. Furthermore, differentially expressed genes were primarily enriched in the cell cycle, oxidative phosphorylation and cell adhesion processes. The present study described a risk assessment model based on 9 significantly differentially expressed lncRNAs, which was identified to have a high accuracy in potentially predicting patient prognosis.

Also flagged:behaviouralmatingmetalsAChEcalciumhomeostasis
Journal Article 2018-12-14 ✓ 3 Snippets Legradi JB, Di Paolo C, Kraak MHS, van der Geest HG, Schymanski EL, Williams AJ, Dingemans MML, Massei R, Brack W, Cousin X, Begout ML, van der Oost R, Carion A, Suarez-Ulloa V, Silvestre F, Escher BI, Engwall M, Nilén G, Keiter SH, Pollet D, Waldmann P, Kienle C, Werner I, Haigis AC, Knapen D, Vergauwen L, Spehr M, Schulz W, Busch W, Leuthold D, Scholz S, Vom Berg CM, Basu N, Murphy CA, Lampert A, Kuckelkorn J, Grummt T, Hollert H.
In-Text Gene Mentions

Development of eco-neurotoxicity AOPs currently focuses on interference with cholinergic pathways leading to colony loss in bees and acute mortality in multiple species [309, 310], serotonergic (5-hydroxytryptamine transporter, 5-HTT) pathways leading to population changes in bivalves [311], and histamine, glutamate and GABA pathways, while some well-characterized pathways in mammals are currently lacking.

…hydroxytryptamine transporter,5-HTT) pathways leading to…

…e; AChE, acetylcholinesterase;5-HTT, 5-hydroxytryptamine (seroton…

Show Full Abstract

The numbers of potential neurotoxicants in the environment are raising and pose a great risk for humans and the environment. Currently neurotoxicity assessment is mostly performed to predict and prevent harm to human populations. Despite all the efforts invested in the last years in developing novel in vitro or in silico test systems, in vivo tests with rodents are still the only accepted test for neurotoxicity risk assessment in Europe. Despite an increasing number of reports of species showing altered behaviour, neurotoxicity assessment for species in the environment is not required and therefore mostly not performed. Considering the increasing numbers of environmental contaminants with potential neurotoxic potential, eco-neurotoxicity should be also considered in risk assessment. In order to do so novel test systems are needed that can cope with species differences within ecosystems. In the field, online-biomonitoring systems using behavioural information could be used to detect neurotoxic effects and effect-directed analyses could be applied to identify the neurotoxicants causing the effect. Additionally, toxic pressure calculations in combination with mixture modelling could use environmental chemical monitoring data to predict adverse effects and prioritize pollutants for laboratory testing. Cheminformatics based on computational toxicological data from in vitro and in vivo studies could help to identify potential neurotoxicants. An array of in vitro assays covering different modes of action could be applied to screen compounds for neurotoxicity. The selection of in vitro assays could be guided by AOPs relevant for eco-neurotoxicity. In order to be able to perform risk assessment for eco-neurotoxicity, methods need to focus on the most sensitive species in an ecosystem. A test battery using species from different trophic levels might be the best approach. To implement eco-neurotoxicity assessment into European risk assessment, cheminformatics and in vitro screening tests could be used as first approach to identify eco-neurotoxic pollutants. In a second step, a small species test battery could be applied to assess the risks of ecosystems.

Also flagged:tumorantibodiesCD68CD163CD206CD11b
Journal Article 2018-12-14 No Snippets Saylor J, Ma Z, Goodridge HS, Huang F, Cress AE, Pandol SJ, Shiao SL, Vidal AC, Wu L, Nickols NG, Gertych A, Knudsen BS.
Show Full Abstract

An array of phenotypically diverse myeloid cells and macrophages (MC&M) resides in the tumor microenvironment, requiring multiplexed detection systems for visualization. Here we report an automated, multiplexed staining approach, named PLEXODY, that consists of five MC&M-related fluorescently-tagged antibodies (anti - CD68, - CD163, - CD206, - CD11b, and - CD11c), and three chromogenic antibodies, reactive with high- and low-molecular weight cytokeratins and CD3, highlighting tumor regions, benign glands and T cells. The staining prototype and image analysis methods which include a pixel/area-based quantification were developed using tissues from inflamed colon and tonsil and revealed a unique tissue-specific composition of 14 MC&M-associated pixel classes. As a proof-of-principle, PLEXODY was applied to three cases of pancreatic, prostate and renal cancers. Across digital images from these cancer types we observed 10 MC&M-associated pixel classes at frequencies greater than 3%. Cases revealed higher frequencies of single positive compared to multi-color pixels and a high abundance of CD68+/CD163+ and CD68+/CD163+/CD206+ pixels. Significantly more CD68+ and CD163+ vs. CD11b+ and CD11c+ pixels were in direct contact with tumor cells and T cells. While the greatest percentage (~70%) of CD68+ and CD163+ pixels was 0-20 microns away from tumor and T cell borders, CD11b+ and CD11c+ pixels were detected up to 240 microns away from tumor/T cell masks. Together, these data demonstrate significant differences in densities and spatial organization of MC&M-associated pixel classes, but surprising similarities between the three cancer types.

Also flagged:developmental delayintellectual disabilityautism spectrum disordersgenetic syndromesDDID
Journal Article 2018-12-14 ✓ 1 Snippet Arican P, Olgac Dundar N, Ozyilmaz B, Cavusoglu D, Gencpinar P, Erdogan KM, Saka Guvenc M.
In-Text Gene Mentions

PLCL1

Show Full Abstract

Chromosomal microarray (CMA) analysis for discovery of copy number variants (CNVs) is now recommended as a first-line diagnostic tool in patients with unexplained developmental delay/intellectual disability (DD/ID) and autism spectrum disorders. In this study, we present the results of CMA analysis in patients with DD/ID. Of 210 patients, pathogenic CNVs were detected in 26 (12%) and variants of uncertain clinical significance in 36 (17%) children. The diagnosis of well-recognized genetic syndromes was achieved in 12 patients. CMA analysis revealed pathogenic de novo CNVs, such as 11p13 duplication with new clinical features. Our results support the utility of CMA as a routine diagnostic test for unexplained DD/ID.

Also flagged:-induced liver injuryDILIinjuryacute liver failuredeathLiver Injury
Journal Article 2018-12-14 ✓ 1 Snippet Xiao X, Tang J, Mao Y, Li X, Wang J, Liu C, Sun K, Ye Y, Zou Z, Peng C, Yang L, Guo Y, Bai Z, He T, Jing J, Li F, An N.
In-Text Gene Mentions

…-antitrypsin deficiency andhemochromatosis50 .…

Show Full Abstract

No abstract available.

Also flagged:vinylidene fluorideMembranemembraneswaterporetransmembrane
Journal Article 2018-12-14 No Snippets Shen S, Hao Y, Zhang Y, Zhang G, Zhou X, Bai RB.
Show Full Abstract

In this study, poly(vinylidene fluoride) (PVDF) membrane was modified through a novel approach by first blending an active component (poly(vinylidene fluoride-<i>co</i>-chlorotrifluoroethylene), P(VDF-<i>co</i>-CTFE)) with the PVDF base material, followed by surface grafting of the membrane on the active component to obtain a triblock copolymer functional structure. The prepared membranes were characterized by various analyses, including Fourier-transform infrared, X-ray photoelectron spectroscopy, atomic force microscopy, scanning electron microscope, and filtration tests. It was found that the modified membrane surface showed a much better hydrophilicity (water contact angle of 67.3°) and oleophobicity (oil contact angle of 129.7°). The modification reduced the average surface pore size (from 0.1495 to 0.1072 μm) and thus lowered the pure water flux (from 364.0 to 224.6 L m<sup>-2</sup> h<sup>-1</sup> at 0.10 MPa of transmembrane pressure), but significantly increased the relative flux recovery (RFR) and the retention efficiency of the modified membrane during the filtration of bovine serum albumin solution and oil/water emulsion. For example, the modified membranes showed 98.6% oil retention (at feed concentration of 0.4 g L<sup>-1</sup>), 92.7% RFR by simple water flushing after filtration, and a consistently high oil removal of 96% or above during a five-cycle-continuous filtration test, as compared to 30.4% oil retention and 51.8% RFR for unmodified PVDF/P(VDF-<i>co</i>-CTFE) blend membrane.

bioRxiv 2018-12-14 Preprint (No Snippets API) Jaaro-Peled H, Kumar S, Hughes D, Kim S, Zoubovsky S, Hirota-Tsuyada Y, Zala D, Sumitomo A, Bruyere J, Katz BM, Huang B, Flores R, Narayan S, Hou Z, Economides AN, Hikida T, Wetsel WC, Deisseroth K, Mori S, Brandon NJ, Tanaka M, Ishizuka K, Houslay MD, Saudou F, Dzirasa K, Sawa A, Tomoda T.
Show Full Abstract

Sensorimotor information processing that underlies normal cognitive and behavioral traits is dysregulated across a subset of neurological and psychiatric disorders. The cross-disease deficit in sensorimotor gating poses a unique opportunity to integrate hierarchical findings at molecular, cellular, through circuitry levels to obtain an in-depth mechanistic understanding of this process that contributes to brain physiology and pathophysiology beyond categorical segmentation of brain disorders. Based on circuitry recording with wild-type mice, we demonstrated that the cortico-striatal projection mediates sensorimotor gating responses during prepulse inhibition (PPI) task. We also found that these circuitry responses were disrupted in Disc1 locus-impairment (LI) mice, a model representing neuropsychiatric conditions. Thus, we hypothesized that Disc1-mediated molecular and cellular machinery along the cortico-striatal circuit may regulate sensorimotor gating. Anatomical and biochemical analyses of Disc1- LI mice revealed attenuated Bdnf transport along the cortico-striatal circuit. Pharmacologically augmenting Bdnf transport by chronic lithium administration, in part via Ser-421 phosphorylation of Huntingtin (Htt) and its integration into the motor machinery, restored the striatal Bdnf levels and PPI deficits in Disc1 -LI mice, suggesting that the Bdnf transport attenuation mechanistically underlies the circuitry and behavioral deficits. These results also shed light on a novel mechanism and utility of lithium that is currently used as a major mood stabilizer in clinical settings. Collectively, the present study illustrates integrative biological mechanisms for sensorimotor gating, underscoring the cross-disease nature of this behavioral dimension and translational utility of the findings under the era of precision medicine in brain disorders.

Also flagged:digestionGI diseasemucusgene expressiontumorcopper
Journal Article 2018-12-13 No Snippets Zwick RK, Ohlstein B, Klein OD.
Show Full Abstract

The gastrointestinal (GI) tract renews frequently to sustain nutrient digestion and absorption in the face of consistent tissue stress. In many species, proliferative intestinal stem cells (ISCs) are responsible for the repair of the damage arising from chemical and mechanical aspects of food breakdown and exposure to pathogens. As the cellular source of all mature cell types of the intestinal epithelium throughout adulthood, ISCs hold tremendous therapeutic potential for understanding and treating GI disease in humans. This review focuses on recent advances in our understanding of ISC identity, behavior, and regulation during homeostasis and injury-induced repair, as revealed by two major animal models used to study regeneration of the small intestine: Drosophila melanogaster and Mus musculus. We emphasize recent findings from Drosophila that are likely to translate to the mammalian GI system, as well as challenging topics in mouse ISC biology that may be ideally suited for investigation in flies. For context, we begin by reviewing major physiological similarities and distinctions between the Drosophila midgut and mouse small intestine.

Also flagged:bindingB-RafPARP1androgen receptorARpoly(ADP-ribose) polymerase 1
Journal Article 2018-12-13 No Snippets Shaw J, Dale I, Hemsley P, Leach L, Dekki N, Orme JP, Talbot V, Narvaez AJ, Bista M, Martinez Molina D, Dabrowski M, Main MJ, Gianni D.
Show Full Abstract

Methods to measure cellular target engagement are increasingly being used in early drug discovery. The Cellular Thermal Shift Assay (CETSA) is one such method. CETSA can investigate target engagement by measuring changes in protein thermal stability upon compound binding within the intracellular environment. It can be performed in high-throughput, microplate-based formats to enable broader application to early drug discovery campaigns, though high-throughput forms of CETSA have only been reported for a limited number of targets. CETSA offers the advantage of investigating the target of interest in its physiological environment and native state, but it is not clear yet how well this technology correlates to more established and conventional cellular and biochemical approaches widely used in drug discovery. We report two novel high-throughput CETSA (CETSA HT) assays for B-Raf and PARP1, demonstrating the application of this technology to additional targets. By performing comparative analyses with other assays, we show that CETSA HT correlates well with other screening technologies and can be applied throughout various stages of hit identification and lead optimization. Our results support the use of CETSA HT as a broadly applicable and valuable methodology to help drive drug discovery campaigns to molecules that engage the intended target in cells.

Also flagged:Wilms tumorstumorsmethylationTRIM28KAP1tumor
Journal Article 2018-12-13 ✓ 1 Snippet Armstrong AE, Gadd S, Huff V, Gerhard DS, Dome JS, Perlman EJ.
In-Text Gene Mentions

…factors (including thehistone deacetylase complexdeacetylase complex NuRD…

Show Full Abstract

This study explores the genomic alterations that contribute to the formation of a unique subset of low-risk, epithelial differentiated, favorable histology Wilms tumors (WT), tumors that have been characterized by their expression of post-induction renal developmental genes (Subset 1 WT). We demonstrate copy neutral loss of heterozygosity involving 19q13.32-q13.43, unaccompanied by evidence for imprinting by DNA methylation. We further identified loss-of-function somatic mutations in TRIM28 (also known as KAP1), located at 19q13, in 8/9 Subset 1 tumors analyzed. An additional germline TRIM28 mutation was identified in one patient. Retrospective evaluation of previously analyzed WT outside of Subset 1 identified an additional tumor with anaplasia and both TRIM28 and TP53 mutations. A major function of TRIM28 is the repression of endogenous retroviruses early in development. We depleted TRIM28 in HEK293 cells, which resulted in increased expression of endogenous retroviruses, a finding also demonstrated in TRIM28-mutant WT. TRIM28 has been shown by others to be active during early renal development, and to interact with WTX, another gene recurrently mutated in WT. Our findings suggest that inactivation of TRIM28 early in renal development contributes to the formation of this unique subset of FHWTs, although the precise manner in which TRIM28 impacts both normal renal development and oncogenesis remains elusive.

Also flagged:osteoglycinsmallleucine-rich proteoglycansextracellularOGN
Journal Article 2018-12-13 ✓ 1 Snippet Costa RA, Martins RST, Capilla E, Anjos L, Power DM.
In-Text Gene Mentions

…sites (e.g. Sox5,Sox6, Sox9, Tcf/Lef1, Nkx3.2…

Show Full Abstract

<h4>Background</h4>Osteoglycin (OGN, a.k.a. mimecan) belongs to cluster III of the small leucine-rich proteoglycans (SLRP) of the extracellular matrix (ECM). In vertebrates OGN is a characteristic ECM protein of bone. In the present study we explore the evolution of SLRP III and OGN in teleosts that have a skeleton adapted to an aquatic environment.<h4>Results</h4>The SLRP gene family has been conserved since the separation of chondrichthyes and osteichthyes. Few gene duplicates of the SLRP III family exist even in the teleosts that experienced a specific whole genome duplication. One exception is ogn for which duplicate copies were identified in fish genomes. The ogn promoter sequence and in vitro mesenchymal stem cell (MSC) cultures suggest the duplicate ogn genes acquired divergent functions. In gilthead sea bream (Sparus aurata) ogn1 was up-regulated during osteoblast and myocyte differentiation in vitro, while ogn2 was severely down-regulated during bone-derived MSCs differentiation into adipocytes in vitro.<h4>Conclusions</h4>Overall, the phylogenetic analysis indicates that the SLRP III family in vertebrates has been under conservative evolutionary pressure. The retention of the ogn gene duplicates in teleosts was linked with the acquisition of different functions. The acquisition by OGN of functions other than that of a bone ECM protein occurred early in the vertebrate lineage.

Also flagged:APPADsynaptic vesicleproteosomePRPF8GRIA1
Journal Article 2018-12-13 No Snippets Cáceres A, González JR.
Show Full Abstract

<h4>Background</h4>Genes corregulate their overall transcript volumes to perform their physiological functions. However, it is unknown if they additionally coregulate their transcript diversities. We studied the reliability, consistency and functional associations of co-splicing correlations of genes of interest, across two independent studies, multiple tissues and two statistical methods. We thoroughly investigated the reproducibility of co-splicing correlations of APP, the candidate gene of Azheimer's disease (AD). We then studied how co-splicing correlations in different tissues contributed to predict functional interactions of three other genes and finally computed co-splicing frequency for 17 thousand genes across 52 human tissues.<h4>Results</h4>We replicated co-splicing correlations between APP and 5 AD-related genes and reproduced expected enrichment of APP co-splicing in synaptic vesicle cycle and proteosome pathways. We observed novel associations for tissue vulnerability to disease with enrichment in APP co-splicing, co-expression and epistasis in AD. APP co-splicing was the strongest predictor and replicated between studies. We confirmed known gene interactions of PRPF8 and GRIA1 in testis and brain cortex, and observed a novel interaction of FGFR2, in breast and prostate, modulated by cancer risk-variants. We produced a co-splicing map across 52 human tissues to help predict the function of over 17 thousand genes.<h4>Conclusions</h4>We show that coregulation of transcript diversities provides novel biological insights in gene physiology and helps to interpret GWAS results. Co-splicing correlations are reliable and frequent and should be further pursued to help predict gene function. Our results additionally support current AD interventions aiming at the ubiquitin proteosome pathway but unveil the need to consider transcript diversity in addition to volume to assess treatment response and susceptibility to the disease.

Also flagged:methylationcell cycleHIV infectiongene expressioncytosine-guanine dinucleotidescytosines
Journal Article 2018-12-13 No Snippets Zhang X, Hu Y, Aouizerat BE, Peng G, Marconi VC, Corley MJ, Hulgan T, Bryant KJ, Zhao H, Krystal JH, Justice AC, Xu K.
Show Full Abstract

<h4>Background</h4>The effects of tobacco smoking on epigenome-wide methylation signatures in white blood cells (WBCs) collected from persons living with HIV may have important implications for their immune-related outcomes, including frailty and mortality. The application of a machine learning approach to the analysis of CpG methylation in the epigenome enables the selection of phenotypically relevant features from high-dimensional data. Using this approach, we now report that a set of smoking-associated DNA-methylated CpGs predicts HIV prognosis and mortality in an HIV-positive veteran population.<h4>Results</h4>We first identified 137 epigenome-wide significant CpGs for smoking in WBCs from 1137 HIV-positive individuals (p < 1.70E-07). To examine whether smoking-associated CpGs were predictive of HIV frailty and mortality, we applied ensemble-based machine learning to build a model in a training sample employing 408,583 CpGs. A set of 698 CpGs was selected and predictive of high HIV frailty in a testing sample [(area under curve (AUC) = 0.73, 95%CI 0.63~0.83)] and was replicated in an independent sample [(AUC = 0.78, 95%CI 0.73~0.83)]. We further found an association of a DNA methylation index constructed from the 698 CpGs that were associated with a 5-year survival rate [HR = 1.46; 95%CI 1.06~2.02, p = 0.02]. Interestingly, the 698 CpGs located on 445 genes were enriched on the integrin signaling pathway (p = 9.55E-05, false discovery rate = 0.036), which is responsible for the regulation of the cell cycle, differentiation, and adhesion.<h4>Conclusion</h4>We demonstrated that smoking-associated DNA methylation features in white blood cells predict HIV infection-related clinical outcomes in a population living with HIV.

Also flagged:band 3Malariapathogenesisanion-exchangerAE1immune response
Journal Article 2018-12-13 ✓ 1 Snippet Almukadi H, Schwake C, Kaiser MM, Mayer DCG, Schiemer J, Baldwin MR, Hegde S, Lu Y, Hanada T, Chishti AH.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Malaria remains a major global threat to human health and economic development. Microvascular lesions caused by <i>Plasmodium falciparum</i>-infected human erythrocytes/red blood cells are hallmarks of severe pathogenesis contributing to high mortality, particularly in children from sub-Saharan Africa. In this study, we used a phage display complementary DNA library screening strategy to identify <i>P falciparum</i> glutamic acid-rich protein (PfGARP) as a secreted ligand that recognizes an ectodomain of human erythrocyte anion-exchanger, band 3/AE1, as a host receptor. Domain mapping of PfGARP revealed distinct nonoverlapping repeats encoding the immune response epitopes and core erythrocyte-binding activity. Synthetic peptides derived from the erythrocyte-binding repeats of PfGARP induced erythrocyte aggregation reminiscent of the rosetting phenomenon. Using peptides derived from the immunogenic repeats, a quantitative immunoassay was developed to detect a selective immune response against PfGARP in human plasma samples obtained from patients in rural Mali, suggesting the feasibility of PfGARP as a potential biomarker of disease progression. Collectively, our results suggest that PfGARP may play a functional role in enhancing the adhesive properties of human erythrocytes by engaging band 3 as a host receptor. We propose that immunological and pharmacological inhibition of PfGARP may unveil new therapeutic options for mitigating lesions in cerebral and pregnancy-associated malaria.

Also flagged:Schizophreniabipolar disordergene expressionglial cell differentiationtranscription factorsneuropsychiatric disorders
Journal Article 2018-12-13 ✓ 5 Snippets Chen C, Meng Q, Xia Y, Ding C, Wang L, Dai R, Cheng L, Gunaratne P, Gibbs RA, Min S, Coarfa C, Reid JG, Zhang C, Jiao C, Jiang Y, Giase G, Thomas A, Fitzgerald D, Brunetti T, Shieh A, Xia C, Wang Y, Wang Y, Badner JA, Gershon ES, White KP, Liu C.
In-Text Gene Mentions

We found that the most connected transcription factor gene <i>POU3F2</i>, also identified on a genome-wide association study for bipolar disorder, could regulate the miRNA <i>hsa-miR-320e</i> and other putative target mRNAs.

Thus, we identified a brain gene expression module that was enriched for rare coding variants in genes associated with schizophrenia and that contained the putative bipolar disorder risk gene <i>POU3F2</i> The transcription factor <i>POU3F2</i> may be a key regulator of gene expression in this disease-associated gene coexpression module.

POU3F2is a regulator…

…connected transcription factorPOU3F2, a gene…

…disorder risk genePOU3F2as a key…

Show Full Abstract

Schizophrenia and bipolar disorder are complex psychiatric diseases with risks contributed by multiple genes. Dysregulation of gene expression has been implicated in these disorders, but little is known about such dysregulation in the human brain. We analyzed three transcriptome datasets from 394 postmortem brain tissue samples from patients with schizophrenia or bipolar disorder or from healthy control individuals without a known history of psychiatric disease. We built genome-wide coexpression networks that included microRNAs (miRNAs). We identified a coexpression network module that was differentially expressed in the brain tissue from patients compared to healthy control individuals. This module contained genes that were principally involved in glial and neural cell genesis and glial cell differentiation, and included schizophrenia risk genes carrying rare variants. This module included five miRNAs and 545 mRNAs, with six transcription factors serving as hub genes in this module. We found that the most connected transcription factor gene <i>POU3F2</i>, also identified on a genome-wide association study for bipolar disorder, could regulate the miRNA <i>hsa-miR-320e</i> and other putative target mRNAs. These regulatory relationships were replicated using PsychENCODE/BrainGVEX datasets and validated by knockdown and overexpression experiments in SH-SY5Y cells and human neural progenitor cells in vitro. Thus, we identified a brain gene expression module that was enriched for rare coding variants in genes associated with schizophrenia and that contained the putative bipolar disorder risk gene <i>POU3F2</i> The transcription factor <i>POU3F2</i> may be a key regulator of gene expression in this disease-associated gene coexpression module.

Also flagged:tauFTLDMAPTtauopathyCas9gamma-aminobutyric acid (GABA) receptors
Journal Article 2018-12-13 ✓ 1 Snippet Jiang S, Wen N, Li Z, Dube U, Del Aguila J, Budde J, Martinez R, Hsu S, Fernandez MV, Cairns NJ, Dominantly Inherited Alzheimer Network (DIAN), International FTD-Genomics Consortium (IFGC), Harari O, Cruchaga C, Karch CM.
In-Text Gene Mentions

…, CUX1 ,POU3F2); layer 4…

Show Full Abstract

Mutations in the microtubule-associated protein tau (MAPT) gene cause autosomal dominant frontotemporal lobar degeneration with tau inclusions (FTLD-tau). MAPT p.R406W carriers present clinically with progressive memory loss and neuropathologically with neuronal and glial tauopathy. However, the pathogenic events triggered by the expression of the mutant tau protein remain poorly understood. To identify the genes and pathways that are dysregulated in FTLD-tau, we performed transcriptomic analyses in induced pluripotent stem cell (iPSC)-derived neurons carrying MAPT p.R406W and CRISPR/Cas9-corrected isogenic controls. We found that the expression of the MAPT p.R406W mutation was sufficient to create a significantly different transcriptomic profile compared with that of the isogeneic controls and to cause the differential expression of 328 genes. Sixty-one of these genes were also differentially expressed in the same direction between MAPT p.R406W carriers and pathology-free human control brains. We found that genes differentially expressed in the stem cell models and human brains were enriched for pathways involving gamma-aminobutyric acid (GABA) receptors and pre-synaptic function. The expression of GABA receptor genes, including GABRB2 and GABRG2, were consistently reduced in iPSC-derived neurons and brains from MAPT p.R406W carriers. Interestingly, we found that GABA receptor genes, including GABRB2 and GABRG2, are significantly lower in symptomatic mouse models of tauopathy, as well as in brains with progressive supranuclear palsy. Genome wide association analyses reveal that common variants within GABRB2 are associated with increased risk for frontotemporal dementia (P < 1 × 10<sup>-3</sup>). Thus, our systems biology approach, which leverages molecular data from stem cells, animal models, and human brain tissue can reveal novel disease mechanisms. Here, we demonstrate that MAPT p.R406W is sufficient to induce changes in GABA-mediated signaling and synaptic function, which may contribute to the pathogenesis of FTLD-tau and other primary tauopathies.

Also flagged:Lkb1Gene expressionLPSmycoplasmakinaseNF-κB
Journal Article 2018-12-13 ✓ 1 Snippet Chen S, Fang L, Guo W, Zhou Y, Yu G, Li W, Dong K, Liu J, Luo Y, Wang B, Li Z, Zhao C, Sun Z, Shen Y, Leng Q, Zhou D, Han Z, Huang H, Ren H, Xu G, Feng X.
In-Text Gene Mentions

…of Ox40l (Tnfsf4) 29 –…

Show Full Abstract

To balance immunity and tolerance, the endogenous pool of Foxp3<sup>+</sup> regulatory T (T<sub>reg</sub>) cells is tightly controlled, but the underlying mechanisms of this control remain poorly understood. Here we show that the number of T<sub>reg</sub> cells is negatively regulated by the kinase Lkb1 in dendritic cells (DCs). Conditional knockout of the Lkb1 gene in DCs leads to excessive T<sub>reg</sub> cell expansion in multiple organs and dampens antigen-specific T cell immunity. Lkb1-deficient DCs are capable of enhancing, compared with wild-type DCs, T<sub>reg</sub> cell proliferation via cell-cell contact involving the IKK/IKBα-independent activation of the NF-κB/OX40L pathway. Intriguingly, treating wild-type mice with lipopolysaccharide selectively depletes Lkb1 protein in DCs, resulting in T<sub>reg</sub> cell expansion and suppressed inflammatory injury upon subsequent challenge. Loss of Lkb1 does not obviously upregulate proinflammatory molecules expression on DCs. We thus identify Lkb1 as a regulatory switch in DCs for controlling T<sub>reg</sub> cell homeostasis, immune response and tolerance.

Also flagged:Post-translational modificationsBeclin 1Autophagydegradationcancermacroautophagy
Journal Article 2018-12-13 No Snippets Hill SM, Wrobel L, Rubinsztein DC.
Show Full Abstract

Autophagy is a conserved intracellular degradation pathway essential for protein homeostasis, survival and development. Defects in autophagic pathways have been connected to a variety of human diseases, including cancer and neurodegeneration. In the process of macroautophagy, cytoplasmic cargo is enclosed in a double-membrane structure and fused to the lysosome to allow for digestion and recycling of material. Autophagosome formation is primed by the ULK complex, which enables the downstream production of PI(3)P, a key lipid signalling molecule, on the phagophore membrane. The PI(3)P is generated by the PI3 kinase (PI3K) complex, consisting of the core components VPS34, VPS15 and Beclin 1. Beclin 1 is a central player in autophagy and constitutes a molecular platform for the regulation of autophagosome formation and maturation. Post-translational modifications of Beclin 1 affect its stability, interactions and ability to regulate PI3K activity, providing the cell with a plethora of strategies to fine-tune the levels of autophagy. Being such an important regulator, Beclin 1 is a potential target for therapeutic intervention and interfering with the post-translational regulation of Beclin 1 could be one way of manipulating the levels of autophagy. In this review, we provide an overview of the known post-translational modifications of Beclin 1 that govern its role in autophagy and how these modifications are maintained by input from several upstream signalling pathways. ▓.

Also flagged:Periodontitismetabolic syndromeobesityCGASA2BP1TENM2
Journal Article 2018-12-13 ✓ 5 Snippets Moon KH.
In-Text Gene Mentions

Specifically, if any one of TENM2, A2BP1, LDLRAD4, SLC9C2, or MFSD1 was observed in the patients with periodontitis, obesity and blood pressure have to be treated simultaneously.

Therefore, if any of TENM2, A2BP1, LDLRAD4, SLC9C2, and MFSD1 is detected in the patients with periodontitis, obesity and blood pressure have to be treated simultaneously.

The present study discovered that five genes (A2BP1, TENM2, LDLRAD4, SLC9C2, and MFSD1) were associated with metabolic traits such as obesity and high blood pressures.

Interestingly, a genetic study on CGAS of the Korean periodontitis has focused upon ten periodontitis genes (TENM2, LDLRAD4, SLC9C2, RASGRP4, MFSD1, IL4, NMUR2, GPR141, GLK, and A2BP1) identified as the potential candidate genes with genetic risk factors (see Table 1) (Hong et al. 2015).

A total 10,268 SNPs of ten targeted periodontitis genes were analyzed among 2649 SNPs in five genes (TENM2, LDLRAD4, SLC9C2, MFSD1, and A2BP1), and their statistical differences (p < 0.05) are listed (Supplementary Table 1).

Show Full Abstract

Periodontitis has been reported to relate to metabolic syndrome traits such as obesity, blood pressure, and so on. However, the relation between periodontitis and metabolic syndrome remains unclear. The present study aimed to confirm common genetic factors between periodontitis and metabolic traits using Candidate gene association study (CGAS) in the Korean population. Based on the analysis of CGAS, this study performed linear regression analyses to examine the single-nucleotide polymorphisms (SNPs) between periodontitis and metabolic syndrome traits. Among the analyzed SNPs, 2649 SNPs in five genes (TENM2, LDLRAD4, SLC9C2, MFSD1, and A2BP1) showed a statistical significance at p < 0.05. Interestingly, A2BP1 and TENM2 were related to obesity. Also, elevated levels of LDLRAD4, SLC9C2, and MFSD1 were observed in the patients with high blood pressure. Taken together, the present study suggests that some of the SNPs are related to periodontitis. Therefore, if any of TENM2, A2BP1, LDLRAD4, SLC9C2, and MFSD1 is detected in the patients with periodontitis, obesity and blood pressure have to be treated simultaneously.

Also flagged:Myocardial infarctionMIcoronary heart diseasedeathheart attackheart failure
Journal Article 2018-12-13 No Snippets Huang K, Hu S, Cheng K.
Show Full Abstract

Myocardial infarction (MI), caused by coronary heart disease (CHD), remains one of the most common causes of death in the United States. Over the last few decades, scientists have invested considerable resources on the study and development of cell therapies for myocardial regeneration after MI. However, due to a number of limitations, they are not yet readily available for clinical applications. Mounting evidence supports the theory that paracrine products are the main contributors to the regenerative effects attributed to these cell therapies. The next generation of cell-based MI therapies will identify and isolate cell products and derivatives, integrate them with biocompatible materials and technologies, and use them for the regeneration of damaged myocardial tissue. This review discusses the progress made thus far in pursuit of this new generation of cell therapies. Their fundamental regenerative mechanisms, their potential to combine with other therapeutic products, and their role in shaping new clinical approaches for heart tissue engineering, are addressed.

Also flagged:type 2 diabetes mellitusDEFB1bindingβ‐defensin 1transcription factorIkaros
Journal Article 2018-12-13 ✓ 1 Snippet Martinez-Rios MA, Vargas-Alarcon G, Peña-Duque MA, Perez-Mendez O, Rodriguez-Perez JM, Perez-Hernandez N, Herrera-Maya G, Posadas-Sanchez R, Posadas-Romero C, Fragoso JM.
In-Text Gene Mentions

…diabetes due tohemochromatosis, cystic fibrosis, or…

Show Full Abstract

<h4>Background</h4>The aim of this study was to establish the association of two polymorphisms of the β-defensin 1 gene (DEFB1, OMIM#602056) with the risk of developing type 2 diabetes mellitus (T2DM) in a group of Mexican patients.<h4>Methods</h4>The 5'UTR -20 G/A, and -44 C/G polymorphisms of DEFB1 gene were genotyped by 5' exonuclease TaqMan assays in a group of 252 patients with T2DM and 522 healthy control.<h4>Results</h4>Under dominant and additive models adjusted for the risk factors, the C allele of the -44 C/G polymorphism was associated with increased risk of T2DM (OR = 1.63, 95% CI = 1.07-2.48, pC<sub>dom</sub>  = 0.021 and OR = 1.42, 95% CI = 1.05-1.91, pC<sub>add</sub>  = 0.023, respectively). In addition, the linkage disequilibrium analysis showed that AC haplotype was associated with an increased risk of developing T2DM (OR = 4.39, p = 0.04). The in-silico analysis showed that the -44 C allele produces a binding site for the transcription factor Ikaros (IK).<h4>Conclusion</h4>This study demonstrates that the C allele of -44 C/G polymorphism, as well as haplotype AC are associated with the presence of T2DM in the Mexican population. The variation in this polymorphism of the DEFB1 gene could increase the migration of the macrophages to pancreatic islets accelerate the β-cell dysfunction in T2DM.

Also flagged:tumor5-fluorouracilThymidine phosphorylaseTPcancerHT-
Journal Article 2018-12-13 No Snippets Sawdon AJ, Zhang J, Wang X, Peng CA.
Show Full Abstract

The compound 5'-deoxy-5-fluorouridine (5'-DFUR) is a prodrug of the anti-tumor drug 5-fluorouracil (5-FU). Thymidine phosphorylase (TP) is an enzyme that can convert 5'-DFUR to its active form 5-FU and the expression of TP is upregulated in various cancer cells. In this study, 5'-DFUR associated with amphiphilic copolymer poly(ε-caprolactone)-methoxy poly(ethylene glycol) (5'-DFUR-PCL-MPEG) was synthesized, characterized, and self-assembled into functional polymeric micelles. To demonstrate that the prodrug 5'-DFUR could convert into cytotoxic 5-fluorouracil (5-FU) by endogenous TP, HT-29 colorectal cancer cells were treated with 5'-DFUR-PCL-MPEG polymeric micelles for various time periods. Chemotherapeutic drugs doxorubicin (DOX) and 7-ethyl-10-hydroxycamptothecin (SN-38) were also encapsulated separately into 5'-DFUR-PCL-MPEG polymeric micelles to create a dual drug-loaded system. HT-29 cells were treated with DOX or SN-38 encapsulated 5'-DFUR-PCL-MPEG polymeric micelles to examine the efficacy of dual drug-loaded micelles. As a result, HT-29 cells treated with 5'-DFUR-PCL-MPEG polymeric micelles showed up to 40% cell death rate after a 72-h treatment. In contrast, HT-29 cells challenged with DOX or SN-38 encapsulated 5'-DFUR-incorporated polymeric micelles showed 36% and 31% in cell viability after a 72-h treatment, respectively.

Also flagged:mineralagingmetalstitaniumcobaltchromium
Journal Article 2018-12-13 No Snippets Diaz-Rodriguez P, Sánchez M, Landin M.
Show Full Abstract

The mimesis of biological systems has been demonstrated to be an adequate approach to obtain tissue engineering scaffolds able to promote cell attachment, proliferation, and differentiation abilities similar to those of autologous tissues. Bioceramics are commonly used for this purpose due to their similarities to the mineral component of hard tissues as bone. Furthermore, biomimetic scaffolds are frequently loaded with diverse therapeutic molecules to enhance their biological performance, leading to final products with advanced functionalities. In this review, we aim to describe the already developed bioceramic-based biomimetic systems for drug loading and local controlled release. We will discuss the mechanisms used for the inclusion of therapeutic molecules on the designed systems, paying special attention to the identification of critical parameters that modulate drug loading and release kinetics on these scaffolds.

Also flagged:Neurodegenerative Diseaseschronic diseaseNeurological diseasesdisorders of thedevelopmental disorderscerebral palsy
Journal Article 2018-12-13 No Snippets García JC, Bustos RH.
Show Full Abstract

Genetics has led to a new focus regarding approaches to the most prevalent diseases today. Ascertaining the molecular secrets of neurodegenerative diseases will lead to developing drugs that will change natural history, thereby affecting the quality of life and mortality of patients. The sequencing of candidate genes in patients suffering neurodegenerative pathologies is faster, more accurate, and has a lower cost, thereby enabling algorithms to be proposed regarding the risk of neurodegeneration onset in healthy persons including the year of onset and neurodegeneration severity. Next generation sequencing has resulted in an explosion of articles regarding the diagnosis of neurodegenerative diseases involving exome sequencing or sequencing a whole gene for correlating phenotypical expression with genetic mutations in proteins having key functions. Many of them occur in neuronal glia, which can trigger a proinflammatory effect leading to defective proteins causing sporadic or familial mutations. This article reviews the genetic diagnosis techniques and the importance of bioinformatics in interpreting results from neurodegenerative diseases. Risk scores must be established in the near future regarding diseases with a high incidence in healthy people for defining prevention strategies or an early start for giving drugs in the absence of symptoms.

Also flagged:myelinHDgene expressiontranscription factorsSOX10MYRF
Journal Article 2018-12-13 ✓ 1 Snippet Osipovitch M, Asenjo Martinez A, Mariani JN, Cornwell A, Dhaliwal S, Zou L, Chandler-Militello D, Wang S, Li X, Benraiss SJ, Agate R, Lampp A, Benraiss A, Windrem MS, Goldman SA.
In-Text Gene Mentions

HTT

Show Full Abstract

Huntington's disease (HD) is characterized by hypomyelination and neuronal loss. To assess the basis for myelin loss in HD, we generated bipotential glial progenitor cells (GPCs) from human embryonic stem cells (hESCs) derived from mutant Huntingtin (mHTT) embryos or normal controls and performed RNA sequencing (RNA-seq) to assess mHTT-dependent changes in gene expression. In human GPCs (hGPCs) derived from 3 mHTT hESC lines, transcription factors associated with glial differentiation and myelin synthesis were sharply downregulated relative to normal hESC GPCs; NKX2.2, OLIG2, SOX10, MYRF, and their downstream targets were all suppressed. Accordingly, when mHTT hGPCs were transplanted into hypomyelinated shiverer mice, the resultant glial chimeras were hypomyelinated; this defect could be rescued by forced expression of SOX10 and MYRF by mHTT hGPCs. The mHTT hGPCs also manifested impaired astrocytic differentiation and developed abnormal fiber architecture. White matter involution in HD is thus a product of the cell-autonomous, mHTT-dependent suppression of glial differentiation.

Also flagged:chromatinnucleosomeschizophreniatranscription factorsgene expressionbrain disorders
Journal Article 2018-12-13 No Snippets Rhie SK, Schreiner S, Witt H, Armoskus C, Lay FD, Camarena A, Spitsyna VN, Guo Y, Berman BP, Evgrafov OV, Knowles JA, Farnham PJ.
Show Full Abstract

As part of PsychENCODE, we developed a three-dimensional (3D) epigenomic map of primary cultured neuronal cells derived from olfactory neuroepithelium (CNON). We mapped topologically associating domains and high-resolution chromatin interactions using Hi-C and identified regulatory elements using chromatin immunoprecipitation and nucleosome positioning assays. Using epigenomic datasets from biopsies of 63 living individuals, we found that epigenetic marks at distal regulatory elements are more variable than marks at proximal regulatory elements. By integrating genotype and metadata, we identified enhancers that have different levels corresponding to differences in genetic variation, gender, smoking, and schizophrenia. Motif searches revealed that many CNON enhancers are bound by neuronal-related transcription factors. Last, we combined 3D epigenomic maps and gene expression profiles to predict enhancer-target gene interactions on a genome-wide scale. This study not only provides a framework for understanding individual epigenetic variation using a primary cell model system but also contributes valuable data resources for epigenomic studies of neuronal epithelium.

Also flagged:Gene ExpressionEndoplasmic ReticulumProtein disulfide isomerasesdisulfidecysteinelumen
Journal Article 2018-12-13 No Snippets Özcelik D, Seto A, Rakic B, Farzam A, Supek F, Pezacki JP.
Show Full Abstract

Protein disulfide isomerases (PDIs) catalyze disulfide bond formation between protein cysteine residues during protein folding in the endoplasmic reticulum (ER) lumen and are essential for maintaining ER homoeostasis. The life cycle of the hepatitis C virus (HCV) is closely associated with the ER. Synthesis and maturation of HCV proteins occur in the ER membrane and are mediated by multiple host cell factors that include also PDI. Here, we present a study investigating the effect of PDI inhibition on Huh7 human hepatoma cells harboring an HCV subgenomic replicon using the abscisic acid-derived PDI inhibitor origamicin. Transcriptional profiling shows that origamicin changed the expression levels of genes involved in the oxidative and ER stress responses and the unfolded protein response, as indicated by the upregulation of antioxidant enzymes and chaperone proteins, the downregulation of cell-cycle proteins, and induction of apoptosis-associated genes. Our data suggest that origamicin negatively impacts HCV replication by causing an imbalance in cellular homoeostasis and induction of stress responses. These insights suggest that inhibition of PDIs by low-molecular-weight inhibitors could be a promising approach to the discovery of novel antiviral compounds.

Also flagged:Creutzfeldt-Jakob DiseaseSporadicCJDprion diseaseneurodegenerative disorderscognitive impairment
Journal Article 2018-12-13 ✓ 1 Snippet Warden DR, Dennison JV, Limback J, Shroff SM, Messina SA.
In-Text Gene Mentions

…a history ofhemochromatosis, type 2 diabetes…

Show Full Abstract

Sporadic Creutzfeldt-Jakob disease (CJD) is the most common prion disease, resulting in rapid neurocognitive decline, and is universally lethal. CJD has a confounding clinical presentation with similarities which overlap with many other neurodegenerative disorders. Brain biopsy is the current gold standard; however, less-invasive initial screening tests are also utilized. These include brain magnetic resonance imaging (MRI), electroencephalography (EEG), and cerebrospinal fluid (CSF) laboratory studies. Five patients presented to our facility with varying levels of nonspecific cognitive impairment and movement disorders. CJD was initially suggested after review of each patient's brain MRI. The T2-weighted fluid attenuation inversion recovery and diffusion-weighted images in each case demonstrated varied classic patterns of signal abnormality involving the cortex, basal ganglia, thalami, and brainstem. EEG and CSF studies were confirmatory in three and four patients, respectively (EEG not performed in one patient). One death occurred two months after initial presentation, and the other four patients were transferred to hospice three, four, nine, and 20 months after initial presentation. Radiological evaluation is an invaluable component of the workup for nonspecific neurodegenerative disorders because brain MRI may suggest the initial diagnosis of CJD, as demonstrated in our presented cases. Familiarity with the spectrum of classic MRI findings suggestive of sporadic CJD can improve radiologists' role in early detection of the most common prion disease. Clinicians may benefit from understanding the utility of the newer CSF laboratory studies (Real-time quaking-induced conversion, T-tau, and 14-3-3 protein), which are far less invasive than the gold standard of brain biopsy. Early diagnosis can help save medical resources and guide clinicians to form appropriate plans of care with the patient and family.

Also flagged:Batten diseasePPT1TPP1NCL1NCL2lysosomal storage disorder
Journal Article 2018-12-12 No Snippets Sheth J, Mistri M, Bhavsar R, Pancholi D, Kamate M, Gupta N, Kabra M, Mehta S, Nampoothiri S, Thakker A, Jain V, Shah R, Sheth F.
Show Full Abstract

<h4>Background</h4>Neuronal ceroid lipofuscinoses type I and type II (NCL1 and NCL2) also known as Batten disease are the commonly observed neurodegenerative lysosomal storage disorder caused by mutations in the PPT1 and TPP1 genes respectively. Till date, nearly 76 mutations in PPT1 and approximately 140 mutations, including large deletion/duplications, in TPP1 genes have been reported in the literature. The present study includes 34 unrelated Indian patients (12 females and 22 males) having epilepsy, visual impairment, cerebral atrophy, and cerebellar atrophy.<h4>Methods</h4>The biochemical investigation involved measuring the palmitoyl protein thioesterase 1 and tripeptidy peptidase l enzyme activity from the leukocytes. Based on the biochemical analysis all patients were screened for variations in either PPT1 gene or TPP1 gene using bidirectional Sanger sequencing. In cases where Sanger sequencing results was uninformative Multiplex Ligation-dependent Probe Amplification technique was employed. The online tools performed the protein homology modeling and orthologous conservation of the novel variants.<h4>Results</h4>Out of 34 patients analyzed, the biochemical assay confirmed 12 patients with NCL1 and 22 patients with NCL2. Molecular analysis of PPT1 gene in NCL1 patients revealed three known mutations (p.Val181Met, p.Asn110Ser, and p.Trp186Ter) and four novel variants (p.Glu178Asnfs*13, p.Pro238Leu, p.Cys45Arg, and p.Val236Gly). In the case of NCL2 patients, the TPP1 gene analysis identified seven known mutations and eight novel variants. Overall these 15 variants comprised seven missense variants (p.Met345Leu, p.Arg339Trp, p.Arg339Gln, p.Arg206Cys, p.Asn286Ser, p.Arg152Ser, p.Tyr459Ser), four frameshift variants (p.Ser62Argfs*19, p.Ser153Profs*19, p.Phe230Serfs*28, p.Ile484Aspfs*7), three nonsense variants (p.Phe516*, p.Arg208*, p.Tyr157*) and one intronic variant (g.2023_2024insT). No large deletion/duplication was identified in three NCL1 patients where Sanger sequencing study was normal.<h4>Conclusion</h4>The given study reports 34 patients with Batten disease. In addition, the study contributes four novel variants to the spectrum of PPT1 gene mutations and eight novel variants to the TPP1 gene mutation data. The novel pathogenic variant p.Pro238Leu occurred most commonly in the NCL1 cohort while the occurrence of a known pathogenic mutation p.Arg206Cys dominated in the NCL2 cohort. This study provides an insight into the molecular pathology of NCL1 and NCL2 disease for Indian origin patients.

Also flagged:PregnanciesOvert Type 2 Diabetestype 2 diabetesinsulinhypoglycemiahyperbilirubinemia
Journal Article 2018-12-12 No Snippets Berry DC, Thomas SD, Dorman KF, Ivins AR, de Los Angeles Abreu M, Young L, Boggess K.
Show Full Abstract

<h4>Background</h4>Annually in the US, over 100,000 pregnant women with overt type 2 diabetes give birth. Strict maternal glycemic control is the key to optimizing infant outcomes. Medical treatment of type 2 diabetes in pregnancy is generally restricted to insulin, as data on the safety and efficacy of oral hypoglycemic agents in pregnancy are limited. However, over one-third of infants born to women with type 2 diabetes experience an adverse outcome, such as premature delivery, large-for-gestational age, hypoglycemia, hyperbilirubinemia, or birth trauma, suggesting that current treatment regimens fall short of optimizing outcomes. Metformin is the pharmacologic treatment of choice for type 2 diabetes outside of pregnancy. Metformin is favored over insulin because it results in less weight gain, fewer hypoglycemic episodes, and is administered orally rather than injected. However, metformin is not typically used for treatment of type 2 diabetes complicating pregnancy, mainly because no large clinical studies have been conducted to examine its use in this context.<h4>Methods/design</h4>This is a randomized double-blind multi-center clinical trial of insulin plus metformin versus insulin plus placebo for the treatment of type 2 diabetes complicating pregnancy. A total of 1200 women with type 2 diabetes will be randomized between 10 weeks 0 days' and 20 weeks 6 days' gestation and followed until 30 days after delivery. Neonate outcomes will be followed until 30 days of age. The primary aim is to compare the effect of insulin and metformin versus insulin and placebo on composite adverse neonatal outcomes, comprising perinatal mortality, preterm delivery, neonatal hypoglycemia, hyperbilirubinemia, large-for-gestational age small for gestational age, low birth weight, and/or birth trauma. Key secondary aims are to compare treatment groups for neonatal fat mass and rate of maternal hypoglycemia. Additional aims are to assess the side effects and safety of insulin and metformin among pregnant women with overt type 2 diabetes and to compare gestational weight gain among women treated with metformin plus insulin versus insulin alone.<h4>Discussion</h4>Successful completion of this study will result in high-quality, contemporary evidence for management of overt type 2 diabetes complicating pregnancy to improve neonatal outcomes.<h4>Trial registration</h4>NCT02932475 (05/17/2016).

Also flagged:Enoyl-CoA hydratase, short chain 1cardiomyopathydilated cardiomyopathyBAG1ITGAVRHOD
Journal Article 2018-12-12 No Snippets Campbell NV, Weitzenkamp DA, Campbell IL, Schmidt RF, Hicks C, Morgan MJ, Irwin DC, Tentler JJ.
Show Full Abstract

<h4>Background</h4>Large-scale "omics" datasets have not been leveraged and integrated with functional analyses to discover potential drivers of cardiomyopathy. This study addresses the knowledge gap.<h4>Methods</h4>We coupled RNA sequence (RNA-Seq) variant detection and transcriptome profiling with pathway analysis to model drug refractory dilated cardiomyopathy (drDCM) using the BaseSpace sequencing hub and Ingenuity Pathway Analysis. We used RNA-Seq case-control datasets (n = 6 cases, n = 4 controls), exome sequence familial DCM datasets (n = 3 Italians, n = 5 Italians, n = 5 Chinese), and controls from the HapMap project (n = 5 Caucasians, and n = 5 Asians) for disease modeling and putative mutation discovery. Variant replication datasets: n = 128 cases and n = 15 controls. Source of datasets: NCBI Sequence Read Archive.<h4>Statistics</h4>Pairwise differential expression analyses to determine differentially expressed genes and t-tests to calculate p-values. We adjusted for false discovery rates and reported q-values. We used chi-square tests to assess independence among variables, the Fisher's Exact Tests and overlap p-values for the pathways and p-scores to rank network.<h4>Results</h4>Data revealed that ECHS1(enoyl-CoA hydratase, short chain 1(log<sub>2</sub>(foldchange) = 1.63329) hosts a mirtron, MIR3944 expressed in drDCM (FPKM = 5.2857) and not in controls (FPKM = 0). Has-miR3944-3p is a putative target of BAG1 (BCL2 associated athanogene 1(log<sub>2</sub>(foldchange) = 1.31978) and has-miR3944-5p of ITGAV (integrin subunit alpha V(log<sub>2</sub>(foldchange) = 1.46107) and RHOD (ras homolog family member D(log<sub>2</sub>(foldchange) = 1.28851). There is an association between ECHS1:11 V/A(rs10466126) and drDCM (p = 0.02496). The interaction (p = 2.82E-07) between ECHS1:75 T/I(rs1049951) and ECHS1:rs10466126 is associated with drDCM (p < 2.2e-16). ECHS1:rs10466126 and ECHS1:rs1049951 are in linkage disequilibrium (D' = 1). The interaction (p = 7.84E-08) between ECHS1:rs1049951 and the novel ECHS1:c.41insT variant is associated with drDCM (p < 2.2e-16). The interaction (p = 0.001096) between DBT (Dihydrolipoamide branched chain transacylase E2):384G/S(rs12021720) and ECHS1:rs10466126 is associated with drDCM (p < 2.2e-16). At the mRNA level, there is an association between ECHS1 (log<sub>2</sub>(foldchange) = 1.63329; q = 0.013927) and DBT (log<sub>2</sub>(foldchange) = 0.955072; q = 0.0368792) with drDCM. ECHS1 is involved in valine (-log (p = 3.39E00)), isoleucine degradation (p = 0.00457), fatty acid β-oxidation (-log(p) = 2.83E00), and drug metabolism:cytochrome P450 (z-score = 2.07985196) pathways. The mitochondria (-log(p) = 8.73E00), oxidative phosphorylation (-log(p) = 5.35E00) and TCA-cycle II (-log(p) = 2.70E00) are dysfunctional.<h4>Conclusions</h4>We introduce an integrative data strategy that considers the interplay between the DNA, mRNA, and associated pathways, which represents a possible diagnostic, prognostic, biomarker, and personalized treatment discovery approach in genomically heterogeneous diseases.

Also flagged:TDP-43FUSlacZRFPTCERG1TAR DNA-binding protein-43
Journal Article 2018-12-12 ✓ 2 Snippets Pons M, Prieto S, Miguel L, Frebourg T, Campion D, Suñé C, Lecourtois M.
In-Text Gene Mentions

TCERG1 could play a neuroprotective role in HD because its overexpression rescues neuronal cell death due to mutant HTT neurotoxicity [3].

…with the huntingtin (HTT) protein and has…

Show Full Abstract

TAR DNA-binding protein-43 (TDP-43) is a ubiquitously expressed DNA-/RNA-binding protein that has been linked to numerous aspects of the mRNA life cycle. Similar to many RNA-binding proteins, TDP-43 expression is tightly regulated through an autoregulatory negative feedback loop. Cell function and survival depend on the strict control of TDP-43 protein levels. TDP-43 has been identified as the major constituent of ubiquitin-positive inclusions in patients with Amyotrophic Lateral Sclerosis (ALS) and Frontotemporal Lobar Degeneration (FTLD). Several observations argue for a pathogenic role of elevated TDP-43 levels in these disorders. Modulation of the cycle of TDP-43 production might therefore provide a new therapeutic strategy. Using a Drosophila model mimicking key features of the TDP-43 autoregulatory feedback loop, we identified CG42724 as a genetic modulator of TDP-43 production in vivo. We found that CG42724 protein influences qualitatively and quantitatively the TDP-43 mRNA transcript pattern. CG42724 overexpression promotes the production of transcripts that can be efficiently released into the cytoplasm for protein translation. Importantly, we showed that TCERG1, the human homolog of the Drosophila CG42724 protein, also caused an increase of TDP-43 protein steady-state levels in mammalian cells. Therefore, our data suggest the possibility that targeting TCERG1 could be therapeutic in TDP-43 proteinopathies.

Also flagged:oxygenaxonsynapsetranscription factorHIF1αresponse to hypoxia
Journal Article 2018-12-12 No Snippets Bonkowsky JL, Son JH.
Show Full Abstract

The developing nervous system depends upon precise regulation of oxygen levels. Hypoxia, the condition of low oxygen concentration, can interrupt developmental sequences and cause a range of molecular, cellular and neuronal changes and injuries. The roles and effects of hypoxia on the central nervous system (CNS) are poorly characterized, even though hypoxia is simultaneously a normal component of development, a potentially abnormal environmental stressor in some settings, and a clinically important complication, for example of prematurity. Work over the past decade has revealed that hypoxia causes specific disruptions in the development of CNS connectivity, altering axon pathfinding and synapse development. The goals of this article are to review hypoxia's effects on the development of CNS connectivity, including its genetic and molecular mediators, and the changes it causes in CNS circuitry and function due to regulated as well as unintended mechanisms. The transcription factor HIF1α is the central mediator of the CNS response to hypoxia (as it is elsewhere in the body), but hypoxia also causes a dysregulation of gene expression. Animals appear to have evolved genetic and molecular responses to hypoxia that result in functional behavioral alterations to adapt to the changes in oxygen concentration during CNS development. Understanding the molecular pathways underlying both the normal and abnormal effects of hypoxia on CNS connectivity may reveal novel insights into common neurodevelopmental disorders. In addition, this Review explores the current gaps in knowledge, and suggests important areas for future studies.

Also flagged:Breast CancerPIWIbreast tumorstumornuclear paraspeckle assembly transcript 1NEAT1
Journal Article 2018-12-12 No Snippets Klinge CM.
Show Full Abstract

Non-coding RNAs (ncRNAs) are regulators of intracellular and intercellular signaling in breast cancer. ncRNAs modulate intracellular signaling to control diverse cellular processes, including levels and activity of estrogen receptor α (ERα), proliferation, invasion, migration, apoptosis, and stemness. In addition, ncRNAs can be packaged into exosomes to provide intercellular communication by the transmission of microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) to cells locally or systemically. This review provides an overview of the biogenesis and roles of ncRNAs: small nucleolar RNA (snRNA), circular RNAs (circRNAs), PIWI-interacting RNAs (piRNAs), miRNAs, and lncRNAs in breast cancer. Since more is known about the miRNAs and lncRNAs that are expressed in breast tumors, their established targets as oncogenic drivers and tumor suppressors will be reviewed. The focus is on miRNAs and lncRNAs identified in breast tumors, since a number of ncRNAs identified in breast cancer cells are not dysregulated in breast tumors. The identity and putative function of selected lncRNAs increased: nuclear paraspeckle assembly transcript 1 (<i>NEAT1</i>), metastasis-associated lung adenocarcinoma transcript 1 (<i>MALAT1</i>), steroid receptor RNA activator 1 (<i>SRA1</i>), colon cancer associated transcript 2 (<i>CCAT2</i>), colorectal neoplasia differentially expressed (<i>CRNDE</i>), myocardial infarction associated transcript (<i>MIAT</i>), and long intergenic non-protein coding RNA, Regulator of Reprogramming (<i>LINC-ROR</i>); and decreased levels of maternally-expressed 3 (<i>MEG3</i>) in breast tumors have been observed as well. miRNAs and lncRNAs are considered targets of therapeutic intervention in breast cancer, but further work is needed to bring the promise of regulating their activities to clinical use.

Also flagged:cystic fibrosisCarbonATP9IR1LevantinePD
Journal Article 2018-12-12 ✓ 1 Snippet Esposito U, Das R, Syed S, Pirooznia M, Elhaik E.
In-Text Gene Mentions

…cystic fibrosis andhemochromatosisin ancient Irish…

Show Full Abstract

The rapid accumulation of ancient human genomes from various areas and time periods potentially enables the expansion of studies of biodiversity, biogeography, forensics, population history, and epidemiology into past populations. However, most ancient DNA (aDNA) data were generated through microarrays designed for modern-day populations, which are known to misrepresent the population structure. Past studies addressed these problems by using ancestry informative markers (AIMs). It is, thereby, unclear whether AIMs derived from contemporary human genomes can capture ancient population structures, and whether AIM-finding methods are applicable to aDNA, provided that the high missingness rates in ancient-and oftentimes haploid-DNA can also distort the population structure. Here, we define ancient AIMs (aAIMs) and develop a framework to evaluate established and novel AIM-finding methods in identifying the most informative markers. We show that aAIMs identified by a novel principal component analysis (PCA)-based method outperform all of the competing methods in classifying ancient individuals into populations and identifying admixed individuals. In some cases, predictions made using the aAIMs were more accurate than those made with a complete marker set. We discuss the features of the ancient Eurasian population structure and strategies to identify aAIMs. This work informs the design of single nucleotide polymorphism (SNP) microarrays and the interpretation of aDNA results, which enables a population-wide testing of primordialist theories.

Also flagged:postpartum depressionpsychiatric disordermaternal depressionbehavioralDepressionmelancholia
Journal Article 2018-12-12 No Snippets Payne JL, Maguire J.
Show Full Abstract

This review aims to summarize the diverse proposed pathophysiological mechanisms contributing to postpartum depression, highlighting both clinical and basic science research findings. The risk factors for developing postpartum depression are discussed, which may provide insight into potential neurobiological underpinnings. The evidence supporting a role for neuroendocrine changes, neuroinflammation, neurotransmitter alterations, circuit dysfunction, and the involvement of genetics and epigenetics in the pathophysiology of postpartum depression are discussed. This review integrates clinical and preclinical findings and highlights the diversity in the patient population, in which numerous pathophysiological changes may contribute to this disorder. Finally, we attempt to integrate these findings to understand how diverse neurobiological changes may contribute to a common pathological phenotype. This review is meant to serve as a comprehensive resource reviewing the proposed pathophysiological mechanisms underlying postpartum depression.

Also flagged:P-gpbreast cancercisplatinmultidrug resistancecancerfertilization
Journal Article 2018-12-12 No Snippets Côrte-Real L, Karas B, Gírio P, Moreno A, Avecilla F, Marques F, Buckley BT, Cooper KR, Doherty C, Falson P, Garcia MH, Valente A.
Show Full Abstract

Two new ruthenium complexes, [Ru(η<sup>5</sup>-Cp)(PPh<sub>3</sub>)(2,2'-bipy-4,4'-R)]<sup>+</sup> with R = -CH<sub>2</sub>OH (Ru1) or dibiotin ester (Ru2) were synthesized and fully characterized. Both compounds were tested against two types of breast cancer cells (MCF7 and MDA-MB-231), showing better cytotoxicity than cisplatin in the same experimental conditions. Since multidrug resistance (MDR) is one of the main problems in cancer chemotherapy, we have assessed the potential of these compounds to overcome resistance to treatments. Ru2 showed exceptional selectivity as P-gp inhibitor, while Ru1 is possibly a substrate. In vivo studies in zebrafish showed that Ru2 is well tolerated up to 1.17 mg/L, presenting a LC<sub>50</sub> of 5.73 mg/L at 5 days post fertilization.

Also flagged:Huntington diseaseHDTetrabenazinedeutetrabenazinechoreaHuntingtin
Journal Article 2018-12-12 ✓ 2 Snippets Mestre TA.
In-Text Gene Mentions

Huntingtin-lowering strategies are of particular interest by targeting the mRNA of the huntingtin (HTT) gene at the core of HD biology.

…of the huntingtin (HTT) gene at the…

Show Full Abstract

<h4>Introduction</h4>Huntington disease (HD) is a rare genetic neurodegenerative condition. The availability of a genetic diagnosis makes HD an attractive model for the development of therapies that can delay or, at best, halt the progression of neurodegenerative conditions. Tetrabenazine and deutetrabenazine are the only treatment options with a formal indication (chorea) for this patient population.<h4>Methods</h4>Literature review on HD and clinical trials using the medical databases Pubmed, Web of Science, and clinical trial registries. Recent clinical trials conducted with the goal of disease-modification or new symptomatic treatment indications were included. Non-pharmacological interventions were excluded.<h4>Results</h4>Therapeutic approaches aiming at disease-modification include huntingtin-lowering strategies, the modulation of huntingtin homeostasis and neuroinflammation. Huntingtin-lowering strategies are of particular interest by targeting the mRNA of the huntingtin (HTT) gene at the core of HD biology. Antisense oligonucleotides (ASO) are the only huntingtin-lowering strategies in clinical development. The initial results suggest that the first non-allele specific ASO was safe and associated with a reduction in the levels of mutated huntingtin protein (mHTT). Other clinical trials for disease-modification in HD have generated negative results or are ongoing. Assays to measure CSF mHTT and brain nuclear imaging specific to HD can support the rational development of these therapies. Novel symptomatic treatment indications explored in clinical trials include motor disability, irritability and apathy.<h4>Conclusions</h4>The years ahead are promising for novel and revolutionary therapies aimed at core disease mechanisms in HD. Clinical research platforms such as Enroll-HD are expected to potentiate the conduction of clinical trials in HD.

Also flagged:Personality DisorderMethamphetamine DependenceMethamphetaminepersonality disordersantisocial personality disorderobsessive-compulsive
Journal Article 2018-12-12 ✓ 1 Snippet Zhang C, Luo T, Liu L, Dong H, Hao W.
In-Text Gene Mentions

…serotonin receptor gene (5-HTT) was associated with…

Show Full Abstract

Methamphetamine use is popular and rapidly increasing in China, and the co-occurrence of personality disorders has an impact on treatment outcomes and may increase vulnerability of developing dependence. The aim of the present study was to investigate the prevalence rates of personality disorders in methamphetamine users and further explore the association between personality disorders and methamphetamine use status. Five hundred and seventy-seven male methamphetamine users were recruited. The self-developed questionnaire was used for demographics, and a Structural Clinical Interview for Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) (SCID-I/II) was performed covering psychiatric diagnosis. Our study found the prevalence of antisocial personality disorder in male methamphetamine users was 71.4%, followed by borderline (20.2%) and obsessive-compulsive (17.9%) personality disorder. Borderline and antisocial personality disorders were found to be risk factors of methamphetamine dependence (adjusted odds ratio = 2.891, <i>p</i> = 0.007 and adjusted odds ratio = 1.680, <i>p</i> = 0.042). These findings suggested personality disorders were highly prevalent in male methamphetamine users, and the comorbidity of antisocial and borderline personality disorders are especially associated with methamphetamine dependence.

Also flagged:glucocorticoidcortisolandrogensdehydroepiandrosteroneintra-uterine growth restrictionIUGR
Journal Article 2018-12-12 No Snippets Watterberg KL, Hintz SR, Do B, Vohr BR, Lowe J, Newman JE, Wallace D, Lacy CB, Davis EP, Granger DA, Shankaran S, Payne A, Higgins RD, SUPPORT Study Group of the Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Background</h4>Low birth weight in term-born individuals correlates with adverse cardiometabolic outcomes; excess glucocorticoid exposure has been linked to these relationships. We hypothesized that cortisol and adrenal androgens would correlate inversely with birthweight and directly with markers of cardiometabolic risk in school-aged children born extremely preterm; further, preterm-born would have increased cortisol and adrenal androgens compared to term-born children.<h4>Methods</h4>Saliva samples were obtained at age 6 from 219 preterm-born children followed since birth and 40 term-born children and analyzed for dehydroepiandrosterone (DHEA) and cortisol. Cortisol was also measured at home (awakening, 30' later, evening).<h4>Results</h4>For preterm-born children, cortisol and DHEA correlated inversely with weight and length Z-scores at 36 weeks PMA and positively with systolic BP. DHEA was higher in preterm-born than term-born children (boys p < 0.01; girls p = 0.04). Cortisol was similar between preterm-born and term-born at study visit; however, preterm-born children showed a blunted morning cortisol. In term-born children, DHEA correlated with BMI (p = 0.04), subscapular, and abdominal skinfold thicknesses (both p < 0.01).<h4>Conclusion</h4>Cortisol and DHEA correlated inversely with early postnatal growth and directly with systolic BP in extremely preterm-born children, suggesting perinatal programming. Blunted morning cortisol may reflect NICU stress, as seen after other adverse childhood experiences (ACEs).

Also flagged:dopaminetyrosine hydroxylaseTHglutamate decarboxylaseGADnucleus
Journal Article 2018-12-11 ✓ 1 Snippet Breton JM, Charbit AR, Snyder BJ, Fong PTK, Dias EV, Himmels P, Lock H, Margolis EB.
In-Text Gene Mentions

Sox6

Show Full Abstract

The ventral tegmental area (VTA) is a heterogeneous midbrain structure that contains dopamine (DA), GABA, and glutamate neurons that project to many different brain regions. Here, we combined retrograde tracing with immunocytochemistry against tyrosine hydroxylase (TH) or glutamate decarboxylase (GAD) to systematically compare the proportion of dopaminergic and GABAergic VTA projections to 10 target nuclei: anterior cingulate, prelimbic, and infralimbic cortex; nucleus accumbens core, medial shell, and lateral shell; anterior and posterior basolateral amygdala; ventral pallidum; and periaqueductal gray. Overall, the non-dopaminergic component predominated VTA efferents, accounting for more than 50% of all projecting neurons to each region except the nucleus accumbens core. In addition, GABA neurons contributed no more than 20% to each projection, with the exception of the projection to the ventrolateral periaqueductal gray, where the GABAergic contribution approached 50%. Therefore, there is likely a significant glutamatergic component to many of the VTA's projections. We also found that VTA cell bodies retrogradely labeled from the various target brain regions had distinct distribution patterns within the VTA, including in the locations of DA and GABA neurons. Despite this patterned organization, VTA neurons comprising these different projections were intermingled and never limited to any one subregion. These anatomical results are consistent with the idea that VTA neurons participate in multiple distinct, parallel circuits that differentially contribute to motivation and reward. While attention has largely focused on VTA DA neurons, a better understanding of VTA subpopulations, especially the contribution of non-DA neurons to projections, will be critical for future work.

Also flagged:olfactomedin 4sepsisneutrophildeathinfectionextracellular
Journal Article 2018-12-11 ✓ 5 Snippets Alder MN, Mallela J, Opoka AM, Lahni P, Hildeman DA, Wong HR.
In-Text Gene Mentions

Several groups haveidentified a subset of human neutrophils that express olfactomedin 4 (OLFM4) andincreased OLFM4+ neutrophils during sepsis is correlated with worse outcome,suggesting these neutrophils or the OLFM4 they secrete may be pathogenic.

Olfactomedin 4 (OLFM4) is a glycoprotein that was identified as a target for theimportant myeloid transcription factor PU.1 and shown to be expressed ingastrointestinal tumour cells.8,9 In tumour cells, it was shownthat OLFM4 had anti-apoptotic properties which may explain its increased expressionin gastrointestinal tumour cells.10, –12 Recently, OLFM4 has been shownto signal via the Frizzled receptors and to compete with Wnt ligands to decrease Wntsignalling in intestinal adenocarcinomas.13 Apart from tumours, Lgr-5 expressing stem cells that reside at the base ofintestinal and colonic crypts also express OLFM4.

We found that OLFM4 null mice are protected when challenged with the CLP model ofpolymicrobial sepsis.

Both of these findings are similar tohuman OLFM4+ and OLFM4− neutrophils.16 Because others have reported that OLFM4 associates with NETs, we tested ifOLFM4 associated with NETs in mice.

In healthy human donors, approximately 25% of neutrophils expressOLFM4.15,16 Our group and others recently identified OLFM4 as one of themost up-regulated genes, in terms of fold increase, during sepsis.17 We also showed that increased percentage of neutrophils expressing OLFM4 atthe time of presentation to the intensive care unit independently associated with apoor outcome from septic shock.18 In mice, OLFM4 has been shown to be expressed in the bone marrow, prostateand gut, and furthermore, mice null for OLFM4 have been shown to be protected fromdeath by intraperitoneal injection of bacteria, suggesting OLFM4 participates inimmune responses.9,19, –21 These same studies found thatOLFM4 inhibited cathepsin C, leading the authors to conclude that lack of OLFM4 ledto increased antimicrobial activities of cathepsin C and provided protection to theanimal from bacterial challenge.22 However, when the OLFM4 null mouse was crossed onto a cathepsin C null mouse,lack of OLFM4 still provided protection from bacterial challenge, suggesting OLFM4participated in other immune mechanisms.

Show Full Abstract

Neutrophils are the most abundant immune cell of the innate immune system and participate in essential immune functions. Heterogeneity within neutrophils has been documented, but it is difficult to distinguish if these are altered activation states of a single population or separate subpopulations of neutrophils determined at the time of differentiation. Several groups have identified a subset of human neutrophils that express olfactomedin 4 (OLFM4) and increased OLFM4+ neutrophils during sepsis is correlated with worse outcome, suggesting these neutrophils or the OLFM4 they secrete may be pathogenic. We tested if mice could be used as a model to study OLFM4+ neutrophils. We found the OLFM4 expressing subset of neutrophils is conserved in mice. Depending on the strain, 7-35% of murine neutrophils express OLFM4 and expression is determined early in neutrophil differentiation. OLFM4+ neutrophils phagocytose and transmigrate with similar efficiency as OLFM4- neutrophils. Here we show that within neutrophil extracellular traps (NETs) OLFM4+ and OLFM4- neutrophils undergo NETosis and OLFM4 colocalizes. Finally, we generated an OLFM4 null mouse and show that these mice are protected from death when challenged with sepsis, providing further evidence that the OLFM4 expressing subpopulation of neutrophils, or the OLFM4 they secrete, may be pathogenic during overwhelming infection.

Also flagged:lactationPARMFPorgan developmentAKTSHH
Journal Article 2018-12-11 No Snippets Vailati-Riboni M, Bucktrout RE, Zhan S, Geiger A, McCann JC, Akers RM, Loor JJ.
Show Full Abstract

<h4>Background</h4>To reduce costs of rearing replacement heifers, researchers have focused on decreasing age at breeding and first calving. To increase returns upon initiation of lactation the focus has been on increasing mammary development prior to onset of first lactation. Enhanced plane of nutrition pre-weaning may benefit the entire replacement heifer operation by promoting mammary gland development and greater future production.<h4>Methods</h4>Twelve Holstein heifer calves (< 1 week old) were reared on 1 of 2 dietary treatments (n = 6/group) for 8 weeks: a control group fed a restricted milk replacer at 0.45 kg/d (R, 20% crude protein, 20% fat), or an accelerated group fed an enhanced milk replacer at 1.13 kg/d (EH, 28% crude protein, 25% fat). At weaning (8 weeks), calves were euthanized and sub-samples of mammary parenchyma (PAR) and mammary fat pad (MFP) were harvested upon removal from the body. Total RNA from both tissues was extracted and sequenced using the Illumina HiSeq2500 platform. The Dynamic Impact Approach (DIA) and Ingenuity Pathway Analysis (IPA) were used for pathway analysis and functions, gene networks, and cross-talk analyses of the two tissues.<h4>Results</h4>When comparing EH vs R 1561 genes (895 upregulated, 666 downregulated) and 970 genes (506 upregulated, 464 downregulated) were differentially expressed in PAR and MFP, respectively. DIA and IPA results highlight a greater proliferation and differentiation activity in both PAR and MFP, supported by an increased metabolic activity. When calves were fed EH, the PAR displayed transcriptional signs of greater overall organ development, with higher ductal growth and branching, together with a supportive blood vessel and nerve network. These activities were mediated by intracellular cascades, such as AKT, SHH, MAPK, and Wnt, probably activated by hormones, growth factors, and endogenous molecules. The analysis also revealed strong communication between MFP and PAR.<h4>Conclusion</h4>The transcriptomics and bioinformatics approach highlighted key mechanisms that mediate the mammary gland response to a higher plane of nutrition in the pre-weaning period.

Also flagged:mevalonic acidHMG-CoA reductaseHMGCRHMG-CoA synthase 1HMGCS1cholesterol
Journal Article 2018-12-11 ✓ 1 Snippet Bhardwaj A, Singh H, Trinidad CM, Albarracin CT, Hunt KK, Bedrosian I.
In-Text Gene Mentions

Tumor suppressor gene LKB1suppressor gene LKB1,…

Show Full Abstract

<h4>Background</h4>Prevention of triple-negative breast cancer (TNBC) is hampered by lack of knowledge about the drivers of tumorigenesis.<h4>Methods</h4>To identify molecular markers and their downstream networks that can potentially be targeted for TNBC prevention, we analyzed small RNA and RNA sequencing of a cell line model that represent early stages of TNBC development. We have identified direct gene targets of isomiRNA-140-3p and by using cell-based and in vivo model systems we have demonstrated the utility of targeting downstream pathways for prevention of TNBC.<h4>Results</h4>These analyses showed that 5'isomiRNA of miR-140-3p (miR-140-3p-1) and its novel direct gene targets, HMG-CoA reductase (HMGCR) and HMG-CoA synthase 1(HMGCS1), key enzymes in the cholesterol biosynthesis pathway, were deregulated in the normal-to-preneoplastic transition. Upregulation in the cholesterol pathway creates metabolic vulnerability that can be targeted. Consistent with this hypothesis, we found direct targeting of miR-140-3p-1 and its downstream pathway by fluvastatin to inhibit growth of these preneoplastic MCF10.AT1 cells. However, although, fluvastatin inhibited the growth of MCF10.AT1-derived xenografts, histological progression remained unchanged. The cholesterol pathway is highly regulated, and HMGCR enzymatic activity inhibition is known to trigger a feedback response leading to restoration of the pathway. Indeed, we found fluvastatin-induced HMGCR transcript levels to be directly correlated with the degree of histological progression of lesions, indicating that the extent of cholesterol pathway suppression directly correlates with abrogation of the tumorigenic process. To block the HMGCR feedback response to statins, we treated resistant preneoplastic cells with an activator of AMP-activated protein kinase (AMPK), a brake in the cholesterol feedback pathway. AMPK activation by aspirin and metformin effectively abrogated the statin-induced aberrant upregulation of HMGCR and sensitized these resistant cells to fluvastatin.<h4>Conclusions</h4>These results suggest the potential use of combined treatment with statin and aspirin for prevention of TNBC.

Also flagged:oxygenHuntington's diseaseHDHuntingtinendoplasmic reticulumnucleus
Journal Article 2018-12-11 ✓ 3 Snippets Son S, Bowie LE, Maiuri T, Hung CLK, Desmond CR, Xia J, Truant R.
In-Text Gene Mentions

Huntington's disease (HD) is a neurodegenerative, age-onset disorder caused by a CAG DNA expansion in exon 1 of the <i>HTT</i> gene, resulting in a polyglutamine expansion in the huntingtin protein.

…1 of theHTTgene, resulting in…

HTT

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative, age-onset disorder caused by a CAG DNA expansion in exon 1 of the <i>HTT</i> gene, resulting in a polyglutamine expansion in the huntingtin protein. Nuclear accumulation of mutant huntingtin is a hallmark of HD, resulting in elevated mutant huntingtin levels in cell nuclei. Huntingtin is normally retained at the endoplasmic reticulum via its N17 amphipathic α-helix domain but is released by oxidation of Met-8 during reactive oxygen species (ROS) stress. Huntingtin enters the nucleus via an importin β1- and 2-dependent proline-tyrosine nuclear localization signal (PY-NLS), which has a unique intervening sequence in huntingtin. Here, we have identified the high-mobility group box 1 (HMGB1) protein as an interactor of the intervening sequence within the PY-NLS. Nuclear levels of HMGB1 positively correlated with varying levels of nuclear huntingtin in both HD and normal human fibroblasts. We also found that HMGB1 interacts with the huntingtin N17 region and that this interaction is enhanced by the presence of ROS and phosphorylation of critical serine residues in the N17 region. We conclude that HMGB1 is a huntingtin N17/PY-NLS ROS-dependent interactor, and this protein bridging is essential for relaying ROS sensing by huntingtin to its nuclear entry during ROS stress. ROS may therefore be a critical age-onset stress that triggers nuclear accumulation of mutant huntington in Huntington's disease.

Also flagged:Transferrin receptor 1ironTfrcAlbHampmicrocytosis
Journal Article 2018-12-11 ✓ 1 Snippet Fillebeen C, Charlebois E, Wagner J, Katsarou A, Mui J, Vali H, Garcia-Santos D, Ponka P, Presley J, Pantopoulos K.
In-Text Gene Mentions

…its interaction withHfe.…

Show Full Abstract

Transferrin receptor 1 (Tfr1) mediates uptake of circulating transferrin-bound iron to developing erythroid cells and other cell types. Its critical physiological function is highlighted by the embryonic lethal phenotype of Tfr1-knockout (Tfrc<sup>-/-</sup>) mice and the pathologies of several tissue-specific knockouts. We generated Tfrc<sup>Alb-Cre</sup> mice bearing hepatocyte-specific ablation of Tfr1 to explore implications in hepatocellular and systemic iron homeostasis. Tfrc<sup>Alb-Cre</sup> mice are viable and do not display any apparent liver pathology. Nevertheless, their liver iron content (LIC) is lower compared with that of control Tfrc<sup>fl/fl</sup> littermates as a result of the reduced capacity of Tfr1-deficient hepatocytes to internalize iron from transferrin. Even though liver Hamp messenger RNA (mRNA) and serum hepcidin levels do not differ between Tfrc<sup>Alb-Cre</sup> and Tfrc<sup>fl/fl</sup> mice, Hamp/LIC and hepcidin/LIC ratios are significantly higher in the former. Importantly, this is accompanied by modest hypoferremia and microcytosis, and it predisposes Tfrc<sup>Alb-Cre</sup> mice to iron-deficiency anemia. Tfrc<sup>Alb-Cre</sup> mice appropriately regulate Hamp expression following dietary iron manipulations or holo-transferrin injection. Holo-transferrin also triggers proper induction of Hamp mRNA, ferritin, and Tfr2 in primary Tfrc<sup>Alb-Cre</sup> hepatocytes. We further show that these cells can acquire <sup>59</sup>Fe from <sup>59</sup>Fe-transferrin, presumably via Tfr2. We conclude that Tfr1 is redundant for basal hepatocellular iron supply but essential for fine-tuning hepcidin responses according to the iron load of hepatocytes. Our data are consistent with an inhibitory function of Tfr1 on iron signaling to hepcidin via its interaction with Hfe. Moreover, they highlight hepatocellular Tfr1 as a link between cellular and systemic iron-regulatory pathways.

Also flagged:Ironmitochondrialphosphorylationoxygenglucoseaspartic acid
Journal Article 2018-12-11 ✓ 1 Snippet Volani C, Paglia G, Smarason SV, Pramstaller PP, Demetz E, Pfeifhofer-Obermair C, Weiss G.
In-Text Gene Mentions

…often reported byhemochromatosispatients [ 10…

Show Full Abstract

Iron is an essential co-factor for several metabolic processes, including the Krebs cycle and mitochondrial oxidative phosphorylation. Therefore, maintaining an appropriate iron balance is essential to ensure sufficient energy production and to avoid excessive reactive oxygen species formation. Iron overload impairs mitochondrial fitness; however, little is known about the associated metabolic changes. Here we aimed to characterize the metabolic signature triggered by dietary iron overload over time in a mouse model, where mice received either a standard or a high-iron diet. Metabolic profiling was assessed in blood, plasma and liver tissue. Peripheral blood was collected by means of volumetric absorptive microsampling (VAMS). Extracted blood and tissue metabolites were analyzed by liquid chromatography combined to high resolution mass spectrometry. Upon dietary iron loading we found increased glucose, aspartic acid and 2-/3-hydroxybutyric acid levels but low lactate and malate levels in peripheral blood and plasma, pointing to a re-programming of glucose homeostasis and the Krebs cycle. Further, iron loading resulted in the stimulation of the urea cycle in the liver. In addition, oxidative stress was enhanced in circulation and coincided with increased liver glutathione and systemic cysteine synthesis. Overall, iron supplementation affected several central metabolic circuits over time. Hence, in vivo investigation of metabolic signatures represents a novel and useful tool for getting deeper insights into iron-dependent regulatory circuits and for monitoring of patients with primary and secondary iron overload, and those ones receiving iron supplementation therapy.

Also flagged:colorectal cancercarcinomacolorectal tumorinflammatory responsestumorcancer
Journal Article 2018-12-11 ✓ 1 Snippet Kelly D, Yang L, Pei Z.
In-Text Gene Mentions

…in KRAS2 (12p),DCC(18q), and p53…

Show Full Abstract

The gut microbiota has emerged as an environmental contributor to colorectal cancer (CRC) in both animal models and human studies. It is now generally accepted that bacteria are ubiquitous colonizers of all exposed human body surfaces, including the entire alimentary tract (5). Recently, the concept that a normal bacterial microbiota is essential for the development of inflammation-induced carcinoma has emerged from studies of well-known colonic bacterial microbiota. This review explores the evidence for a role of fusobacteria, an anaerobic gram-negative bacterium that has repeatedly been detected at colorectal tumor sites in higher abundance than surrounding histologically normal tissue. Mechanistic studies provide insight on the interplay between fusobacteria, other gut microbiota, barrier functions, and host responses. Studies have shown that fusobacteria activate host inflammatory responses designed to protect against pathogens that promote tumor growth. We discuss how future research identifying the pathophysiology underlying fusobacteria colon colonization during colorectal cancer may lead to new therapeutic targets for cancer. Furthermore, disease-protective strategies suppressing tumor development by targeting the local tumor environment via bacteria represent another exciting avenue for researchers and are highlighted in this review.

Also flagged:Autoimmune EncephalomyelitisMultiple sclerosisMSautoimmune diseaseexperimental autoimmune encephalomyelitispathogenesis
Journal Article 2018-12-11 No Snippets Venkatesha SH, Dudics S, Song Y, Mahurkar A, Moudgil KD.
Show Full Abstract

Multiple sclerosis (MS) is a debilitating autoimmune disease affecting over 2.3 million people worldwide, and it is characterized by inflammation and demyelination of nerve cells. The currently available biomarkers for the diagnosis and management of MS have inherent limitations, therefore, additional new biomarkers are needed. We studied the microRNA (miRNA) profile of splenocytes of mice having experimental autoimmune encephalomyelitis (EAE), a model of human MS. A miRNA-microarray analysis revealed increased expression of nine miRNAs (let-7e, miR-23b, miR-31, miR-99b, miR-125a, miR-146b, miR-155, miR-193b, and miR-221) following EAE development. Interestingly, serum levels of miR-99b, miR-125a, and miR-146b were significantly higher in EAE mice compared to normal mice. Bioinformatics analysis revealed the experimentally validated as well as predicted gene targets of specific miRNAs that are important for disease progression in MS. Specifically, we observed inverse correlation in the levels of miR-99b versus <i>LIF</i>, and between miR-125a versus <i>BDNF</i> and <i>LIF</i>. Our results suggest that above-mentioned miRNAs may play a crucial role in the pathogenesis of MS, and that miR-99b, miR-125a, and miR-146b in particular may serve as useful biomarkers for disease activity.

Also flagged:Chromatinhistonepost-translational modificationsnucleosomechaperonesreplication fork
Journal Article 2018-12-11 No Snippets Fournier LA, Kumar A, Stirling PC.
Show Full Abstract

Eukaryotic DNA replication occurs in the context of chromatin. Recent years have seen major advances in our understanding of histone supply, histone recycling and nascent histone incorporation during replication. Furthermore, much is now known about the roles of histone remodellers and post-translational modifications in replication. It has also become clear that nucleosome dynamics during replication play critical roles in genome maintenance and that chromatin modifiers are important for preventing DNA replication stress. An understanding of how cells deploy specific nucleosome modifiers, chaperones and remodellers directly at sites of replication fork stalling has been building more slowly. Here we will specifically discuss recent advances in understanding how chromatin composition contribute to replication fork stability and restart.

Also flagged:Drp1Fis1mitochondrialHuntington's diseaseHDHuntingtin
Journal Article 2018-12-11 ✓ 5 Snippets Joshi AU, Ebert AE, Haileselassie B, Mochly-Rosen D.
In-Text Gene Mentions

Huntington's disease (HD) is a fatal hereditary neurodegenerative disorder, best known for its clinical triad of progressive motor impairment, cognitive deficits and psychiatric disturbances, is caused by CAG-repeat expansion in exon 1 of Huntingtin (HTT).

However, in addition to the neurological disease, mutant HTT (mHTT), which is ubiquitously expressed in all tissues, impairs other organ systems.

…1 of Huntingtin (HTT).…

…neurological disease, mutantHTT(mHTT), which is…

HTT

Show Full Abstract

Huntington's disease (HD) is a fatal hereditary neurodegenerative disorder, best known for its clinical triad of progressive motor impairment, cognitive deficits and psychiatric disturbances, is caused by CAG-repeat expansion in exon 1 of Huntingtin (HTT). However, in addition to the neurological disease, mutant HTT (mHTT), which is ubiquitously expressed in all tissues, impairs other organ systems. Not surprisingly, cardiovascular dysautonomia as well as the deterioration of circadian rhythms are among the earliest detectable pathophysiological changes in individuals with HD. Mitochondrial dysfunction in the brain and skeletal muscle in HD has been well documented, as the disease progresses. However, not much is known about mitochondrial abnormalities in the heart. In this study, we describe a role for Drp1/Fis1-mediated excessive mitochondrial fission and dysfunction, associated with lysosomal dysfunction in H9C2 expressing long polyglutamine repeat (Q73) and in human iPSC-derived cardiomyocytes transfected with Q77. Expression of long polyglutamine repeat led to reduced ATP production and mitochondrial fragmentation. We observed an increased accumulation of damaged mitochondria in the lysosome that was coupled with lysosomal dysfunction. Importantly, reducing Drp1/Fis1-mediated mitochondrial damage significantly improved mitochondrial function and cell survival. Finally, reducing Fis1-mediated Drp1 recruitment to the mitochondria, using the selective inhibitor of this interaction, P110, improved mitochondrial structure in the cardiac tissue of R6/2 mice. We suggest that drugs focusing on the central nervous system will not address mitochondrial function across all organs, and therefore will not be a sufficient strategy to treat or slow down HD disease progression.

Also flagged:TNF-like Ligand 1AInflammatory bowel diseaseTNFSF15colitisCX3CR1interleukin 22
Journal Article 2018-12-11 ✓ 1 Snippet Castellanos JG, Woo V, Viladomiu M, Putzel G, Lima S, Diehl GE, Marderstein AR, Gandara J, Perez AR, Withers DR, Targan SR, Shih DQ, Scherl EJ, Longman RS.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

Inflammatory bowel disease (IBD) results from a dysregulated interaction between the microbiota and a genetically susceptible host. Genetic studies have linked TNFSF15 polymorphisms and its protein TNF-like ligand 1A (TL1A) with IBD, but the functional role of TL1A is not known. Here, we found that adherent IBD-associated microbiota induced TL1A release from CX3CR1<sup>+</sup> mononuclear phagocytes (MNPs). Using cell-specific genetic deletion models, we identified an essential role for CX3CR1<sup>+</sup>MNP-derived TL1A in driving group 3 innate lymphoid cell (ILC3) production of interleukin-22 and mucosal healing during acute colitis. In contrast to this protective role in acute colitis, TL1A-dependent expression of co-stimulatory molecule OX40L in MHCII<sup>+</sup> ILC3s during colitis led to co-stimulation of antigen-specific T cells that was required for chronic T cell colitis. These results identify a role for ILC3s in activating intestinal T cells and reveal a central role for TL1A in promoting ILC3 barrier immunity during colitis.

Also flagged:Colorectal Cancercancercell differentiationcolorectal adenomascell migrationcell cycle
Journal Article 2018-12-11 ✓ 5 Snippets Huang WS, Huang CY, Hsieh MC, Kuo YH, Tung SY, Shen CH, Hsieh YY, Teng CC, Lee KC, Lee KF, Kuo HC.
In-Text Gene Mentions

Our findings demonstrated that PRDX6 expression plays a characteristic growth-promoting role in CRC metastasis.

PRDX6 Correlates with Migration and Invasiveness of Colorectal Cancer

PRDX6 in CRC

PRDX6 and transient transfection with pCMV-6-PRDX6 plasmid were used to examine the role of PRDX6 in the proliferation capacity and invasiveness of CRC

PRDX6 was significantly up-expressed in different comparisons of metastasis of colorectal adenomas in node-positive CRC

Show Full Abstract

<h4>Background/aims</h4>Colorectal cancer (CRC) is the third most common type of cancer and the second leading cause of cancer-related deaths worldwide. PRDXs are antioxidant enzymes that play an important role in cell differentiation, proliferation and apoptosis and have diverse functions in malignancy development. However, the mechanism of aberrant overexpression of PRDX6 in CRC remains unclear.<h4>Methods</h4>Boyden chamber assay, flow cytometry and a lentiviral shRNA targeting PRDX6 and transient transfection with pCMV-6-PRDX6 plasmid were used to examine the role of PRDX6 in the proliferation capacity and invasiveness of CRC cells. Immunohistochemistry (IHC) with tissue array containing 40 paraffin- embedded CRC tissue specimens and Western blot assays were used to detect target proteins.<h4>Results</h4>PRDX6 was significantly up-expressed in different comparisons of metastasis of colorectal adenomas in node-positive CRC (P = 0.03). In in vitro HCT-116, PRDX6 silencing markedly suppressed CRC cell migration and invasiveness while also inducing cell cycle arrest as well as the generation of reactive oxygen species (ROS); specific overexpression of PRDX6 had the opposite effect. Mechanistically, the PRDX6 inactivation displayed decreased levels of PRDX6, N-cadherin, β-catenin, Vimentin, Slug, Snail and Twist-1 through the activation of the PI3K/ AKT/p38/p50 pathways, but they were also significantly inhibited by PRDX6 transfectants. There was also increased transcriptional activation of dimethylation of histone H3 lysine 4 (H3K4me3) of PRDX6 promoter via the activation of the PI3K/Akt/NFkB pathways.<h4>Conclusion</h4>Our findings demonstrated that PRDX6 expression plays a characteristic growth-promoting role in CRC metastasis. This study suggests that PRDX6 may serve as a biomarker of node-positive status and may have a role as an important endogenous regulator of cancer cell tumorigenicity in CRC. PRDX6 may also be an effective therapeutic target.

Also flagged:lung cancersex determining region Y-related high mobility group-box 6cell cycleluciferasecell differentiationadenocarcinoma
Journal Article 2018-12-11 ✓ 5 Snippets Zhou Y, Zheng X, Chen LJ, Xu B, Jiang JT.
In-Text Gene Mentions

The results of the present study suggest that miR-181b may function as a tumor inhibitor in the development of lung cancer via targeting Sox6 to decrease the proliferation and metastasis of lung cancer cells.

The luciferase activity of a Sox6 3'-untranslated region-based reporter construct was significantly lower when transfected with miR-181b (P < 0.05), which suggests that Sox6 is a direct target of miR-181b.<h4>Conclusion</h4>The results of the present study suggest that miR-181b may function as a tumor inhibitor in the development of lung cancer via targeting Sox6 to decrease the proliferation and metastasis of lung cancer cells.

…mobility group-box 6 (Sox6).…

…miR-181b mimic or si-Sox6, the proliferation, migration…

…cycle-related proteins andSox6were analyzed by…

Show Full Abstract

<h4>Background</h4>The aim of the study was to measure the expression of microRNA (miR)-181b in patients with lung cancer, investigate its biological function and elucidate the underlying mechanisms associated with the development of lung cancer.<h4>Methods</h4>miR-181b expression in tissues was measured via RT-qPCR. After A549 cells were transfected with miR-181b mimic or si-Sox6, the proliferation, migration and cell cycle distribution of A549 were evaluated using cell counting kit-8 assay, transwell assay and flow cytometry. The levels of cell cycle-related proteins and Sox6 were analyzed by western blotting. Gene targets of miR-181b were predicted via bioinformatics analysis and verified using a dual-luciferase reporter gene assay.<h4>Results</h4>Expression of miR-181b was significantly downregulated in lung cancer tissues (P < 0.05), and was inversely correlated with the degree of cell differentiation and clinical stages of lung cancer (both P < 0.05). Additionally, the expression of miR-181b was significantly lower in adenocarcinoma compared with squamous cell carcinoma in the lungs (P < 0.05). Overexpression of miR-181b significantly decreased the protein level of Sox6 and significantly suppressed the cell proliferation and metastasis (both P < 0.05); this effect was also observed in A549 cells transfected with si-Sox6. The luciferase activity of a Sox6 3'-untranslated region-based reporter construct was significantly lower when transfected with miR-181b (P < 0.05), which suggests that Sox6 is a direct target of miR-181b.<h4>Conclusion</h4>The results of the present study suggest that miR-181b may function as a tumor inhibitor in the development of lung cancer via targeting Sox6 to decrease the proliferation and metastasis of lung cancer cells.

Also flagged:T2R38 Bitter Taste ReceptorG-protein-coupled bitter taste receptorT2R38T2R38 receptorimmune responseCD3
Journal Article 2018-12-11 No Snippets Tran HTT, Herz C, Ruf P, Stetter R, Lamy E.
Show Full Abstract

The human G-protein-coupled bitter taste receptor T2R38 has recently been demonstrated to be expressed on peripheral blood neutrophils, monocytes and lymphocytes. To further define a potential contribution of the T2R38 receptor in adaptive immune response, the objective of this study was to analyze its expression in resting and activated lymphocytes and T cell subpopulations. Freshly isolated PBMC from healthy donors were used for expression analysis by flow cytometry. Quantum™ MESF beads were applied for quantification in absolute fluorescence units. Activation methods of T cells were anti-CD3/CD28, phytohaemagglutinin (PHA) or phorbol 12-myristate 13-acetate (PMA) together with ionomycin. Lymphocytes from young donors expressed higher levels of T2R38 compared to the elderly. CD3+ T cells expressed higher levels that CD19+ B cells. Receptor expression followed T cell activation with an upregulation within 24 h and a peak at 72 h. Higher levels of T2R38 were produced in lymphocytes by stimulation with anti-CD3/CD28 compared to PHA or PMA/ionomycin. Both subpopulations of CD4+ as well as CD8+ T cells were found to express the T2R38 receptor; this was higher in CD4+ than CD8+ cells; the amount of T2R38 in central and effector memory cells was higher as compared to naïve cells, although this was not statistically significant for CD8+ cells without prior activation by anti-CD3/CD28. Upon treatment of PBMC with the natural T2R38 agonist goitrin Calcium flux was activated in the lymphocyte population with functional T2R38 receptor at >20 μM which was completely blocked by phospholipase Cβ-2 inhibitor U73211. Further, goitrin selectively inhibited TNF-alpha secretion in PBMC with functional T2R38. This quantitative analysis of T2R38 expression in distinct PBMC subsets may provide a basis for understanding the significance of bitter compounds in immune modulation. Whether these findings can have implications for the treatment of inflammatory and immunologic disorders by bitter tasting pharmaceuticals or foods needs further investigation.

Also flagged:agingSenescence-AcceleratedmethylationmethylcytosinehistoneHistone DeACetylase
Journal Article 2018-12-11 ✓ 4 Snippets Cosín-Tomás M, Álvarez-López MJ, Companys-Alemany J, Kaliman P, González-Castillo C, Ortuño-Sahagún D, Pallàs M, Griñán-Ferré C.
In-Text Gene Mentions

…2011 ); whereasTen-Eleven Translocation Methylcytosine DioxygenasesTranslocation Methylcytosine D…

…:let-7c-5p, Nup160:miR-29a-3p,Pou3f2:miR-146a-5p , and Socs6:miR-1…

…by RT-PCR: P2rx1:let-7e-5p;Pou3f2:miR-146a-5p; Hmgb20:miR-26b-5…

…its target genePou3f2, which is…

Show Full Abstract

A growing body of research shows that epigenetic mechanisms are critically involved in normal and pathological aging. The Senescence-Accelerated Mouse Prone 8 (SAMP8) can be considered a useful tool to better understand the dynamics of the global epigenetic landscape during the aging process since its phenotype is not fully explained by genetic factors. Here we investigated dysfunctional age-related transcriptional profiles and epigenetic programming enzymes in the hippocampus of 2- and 9-month-old SAMP8 female mice using the Senescent-Accelerated Resistant 1 (SAMR1) mouse strain as control. SAMP8 mice presented 1,062 genes dysregulated at 2 months of age, and 1,033 genes at 9 months, with 92 genes concurrently dysregulated at both ages compared to age-matched SAMR1. SAMP8 mice showed a significant decrease in global DNA methylation (5-mC) at 2 months while hydroxymethylation (5-hmC) levels were increased in SAMP8 mice at 2 and 9 months of age compared to SAMR1. These changes were accompanied by changes in the expression of several enzymes that regulate 5-mC and methylcytosine oxidation. Acetylated H3 and H4 histone levels were significantly diminished in SAMP8 mice at 2-month-old compared to SAMR1 and altered Histone DeACetylase (HDACs) profiles were detected in both young and old SAMP8 mice. We analyzed 84 different mouse miRNAs known to be altered in neurological diseases or involved in neuronal development. Compared with SAMR1, SAMP8 mice showed 28 and 17 miRNAs differentially expressed at 2 and 9 months of age, respectively; 6 of these miRNAs overlapped at both ages. We used several bioinformatic approaches to integrate our data in mRNA:miRNA regulatory networks and functional predictions for young and aged animals. In sum, our study reveals interplay between epigenetic mechanisms and gene networks that seems to be relevant for the progression toward a pathological aging and provides several potential markers and therapeutic candidates for Alzheimer's Disease (AD) and age-related cognitive impairment.

Also flagged:TumorEsophageal Adenocarcinomacancermalignant diseaseEsophageal cancerPSA
Journal Article 2018-12-11 No Snippets Kosovec JE, Zaidi AH, Pounardjian TS, Jobe BA.
Show Full Abstract

Esophageal adenocarcinoma (EAC) is a lethal cancer requiring improved screening strategies and treatment options due to poor detection methods, aggressive progression, and therapeutic resistance. Emerging circulating tumor DNA (ctDNA) technologies may offer a unique non-invasive strategy to better characterize the highly heterogeneous cancer and more clearly establish the genetic modulations leading to disease progression. The presented review describes the potential advantages of ctDNA methodologies as compared to current clinical strategies to improve clinical detection, enhance disease surveillance, evaluate prognosis, and personalize treatment. Specifically, we describe the ctDNA-targetable genetic markers of prognostic significance to stratify patients into risk of progression from benign to malignant disease and potentially offer cost-effective screening of established cancer. We also describe the application of ctDNA to more effectively characterize the heterogeneity and particular mutagenic resistance mechanisms in real-time to improve prognosis and therapeutic monitoring strategies. Lastly, we discuss the inconsistent clinical responses to currently approved therapies for EAC and the role of ctDNA to explore the dynamic regulation of novel targeted and immunotherapies to personalize therapy and improve patient outcomes. Although there are clear limitations of ctDNA technologies for immediate clinical deployment, this review presents the prospective role of such applications to potentially overcome many of the notable hurdles to treating EAC patients. A deeper understanding of complex EAC tumor biology may result in the progress toward improved clinical outcomes.

Also flagged:Huntington's DiseaseHDbindingHuntington diseasemental disordersprogressive dementia
Journal Article 2018-12-11 ✓ 3 Snippets Dai W, Chen HY, Chen CY.
In-Text Gene Mentions

Huntington's disease (HD) gene product Huntingtin (Htt) selectively induces new forms of necrotic cell death, in which the endoplasmic reticulum (ER) expands and the cell body asymmetric balloon is ultimately cracked.

…gene product Huntingtin (Htt) selectively induces new…

Htt:…

Show Full Abstract

Several pathways are crucial in Huntington's disease (HD). Based on the concept of multitargets, network pharmacology-based analysis was employed to find out related proteins in disease network. The network target method aims to find out related mechanism of efficacy substances in rational design way. Traditional Chinese medicine prescriptions would be used for research and development against HD. Virtual screening was performed to obtain drug molecules with high binding capacity from traditional Chinese medicine (TCM) database@Taiwan. Quantitative structure-activity relationship (QSAR) models were conducted by MLR, SVM, CoMFA, and CoMSIA, constructed to predict the bioactivities of candidates. The compounds with high-dock score were further analyzed compared with control. Traditional Chinese medicine reported in the literature could be the training set provided for constructing novel formula by SVM model. We tried to find a novel formula that can bind well with these targets at the same time, which indicates our design could be highly related to the HD. Additionally, the candidates would validate by a long-term molecular dynamics (MD) simulation, 5 microseconds. Thus, we suggested the herbs <i>Brucea javanica, Holarrhena antidysenterica</i>, <i>Dichroa febrifuga, Erythrophleum guineense,</i> etc. which contained active compounds might be a novel medicine formula toward Huntington's disease.

Also flagged:amantadineSSAT-1lung cancercell growthdeathcancer
Journal Article 2018-12-11 No Snippets Maksymiuk AW, Tappia PS, Sitar DS, Akhtar PS, Khatun N, Parveen R, Ahmed R, Ahmed RB, Cheng B, Huang G, Bach H, Hiebert B, Ramjiawan B.
Show Full Abstract

<h4>Aim</h4>Spermidine/spermine N<sup>1</sup>-acetyltransferase (SSAT-1) plays a critical role in cell growth, proliferation and death, and is known to be activated in human cancer cells. Amantadine, a US FDA-approved antiviral drug, is a substrate for SSAT-1 and can be used to indirectly measure SSAT-1 activity because of its conversion to acetylamantadine (AA). This study was undertaken to further validate SSAT-1 activity in breast and lung cancer patients.<h4>Results</h4>An increase in the urinary concentration of AA in lung and breast cancer patients was observed. The 0-2 h collection time point was determined to be optimal in revealing significant differences in urinary AA concentration between healthy controls and cancer patients.<h4>Conclusion</h4>The high urine concentration of AA could be used as a simple and useful test for the detection of breast and lung cancer.

Also flagged:Iron-related disordersironFPNexporterHIF-2αdeficiency
Journal Article 2018-12-10 ✓ 1 Snippet Schwartz AJ, Das NK, Ramakrishnan SK, Jain C, Jurkovic MT, Wu J, Nemeth E, Lakhal-Littleton S, Colacino JA, Shah YM.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Iron-related disorders are among the most prevalent diseases worldwide. Systemic iron homeostasis requires hepcidin, a liver-derived hormone that controls iron mobilization through its molecular target ferroportin (FPN), the only known mammalian iron exporter. This pathway is perturbed in diseases that cause iron overload. Additionally, intestinal HIF-2α is essential for the local absorptive response to systemic iron deficiency and iron overload. Our data demonstrate a hetero-tissue crosstalk mechanism, whereby hepatic hepcidin regulated intestinal HIF-2α in iron deficiency, anemia, and iron overload. We show that FPN controlled cell-autonomous iron efflux to stabilize and activate HIF-2α by regulating the activity of iron-dependent intestinal prolyl hydroxylase domain enzymes. Pharmacological blockade of HIF-2α using a clinically relevant and highly specific inhibitor successfully treated iron overload in a mouse model. These findings demonstrate a molecular link between hepatic hepcidin and intestinal HIF-2α that controls physiological iron uptake and drives iron hyperabsorption during iron overload.

Also flagged:parvalbuminPVHDmembraneaction potentialneurodegenerative disorder
Journal Article 2018-12-10 ✓ 1 Snippet Holley SM, Galvan L, Kamdjou T, Cepeda C, Levine MS.
In-Text Gene Mentions

HTT

Show Full Abstract

The pathological hallmark of Huntington's disease (HD) is the massive loss of striatal and cortical neurons. Until recently, it was believed that striatal interneurons were spared from degeneration. This view has changed after the demonstration that parvalbumin (PV)-expressing interneurons also are vulnerable in humans. Here we compared morphological and functional changes of striatal fast-spiking interneurons (FSIs) and low-threshold spiking (LTS) interneurons in the Q175 mouse model of HD at presymptomatic (2 months) and symptomatic (12 months) stages of the disease. Electrophysiological intrinsic and synaptic properties of FSIs were significantly altered in symptomatic mice compared to wild-type (WT) littermates. Overall, FSIs became more excitable with disease progression. Sholl analysis also revealed a significant loss of dendritic complexity and excitatory synaptic inputs. The basic membrane and synaptic properties of LTS interneurons were similar in Q175 and WT mice regardless of disease stage. The resilience of LTS interneurons could be related to their sparsity of excitatory synaptic inputs compared with FSIs. However, in symptomatic mice, a subpopulation of LTS interneurons displayed an increase in action potential firing within oscillating bursts. Thus, we conclude that while both FSI and LTS interneurons demonstrate increases in excitability, the HD mutation differentially affects their membrane and synaptic properties as well as their ability to respond to compensatory challenges presented during the late stage of the disease. Alterations in GABAergic interneuron intrinsic activity and responsiveness to incoming signals may significantly affect SPN output thus contributing to abnormal motor movements in patients afflicted with HD.

Also flagged:Ironbone morphogenetic proteinBMPSMADerythropoiesisBMP2
Journal Article 2018-12-10 ✓ 2 Snippets Wang CY, Canali S, Bayer A, Dev S, Agarwal A, Babitt JL.
In-Text Gene Mentions

HFE

Hfe localizing protein beta-2-microglublin

Show Full Abstract

The bone morphogenetic protein (BMP)-SMAD signaling pathway is a key transcriptional regulator of hepcidin in response to tissue iron stores, serum iron, erythropoietic drive and inflammation to increase the iron supply when needed for erythropoiesis, but to prevent the toxicity of iron excess. Recently, BMP2 was reported to play a non-redundant role in hepcidin regulation in addition to BMP6. Here, we used a newly validated BMP2 ELISA assay and mice with a global or endothelial conditional knockout (CKO) of Bmp2 or Bmp6 to examine how BMP2 is regulated and functionally contributes to hepcidin regulation by its major stimuli. Erythropoietin (EPO) did not influence BMP2 expression in control mice, and still suppressed hepcidin in Bmp2 CKO mice. Lipopolysaccharide (LPS) reduced BMP2 expression in control mice, but still induced hepcidin in Bmp2 CKO mice. Chronic dietary iron loading that increased liver iron induced BMP2 expression, whereas acute oral iron gavage that increased serum iron without influencing liver iron did not impact BMP2. However, hepcidin was still induced by both iron loading methods in Bmp2 CKO mice, although the degree of hepcidin induction was blunted relative to control mice. Conversely, acute oral iron gavage failed to induce hepcidin in Bmp6 <sup>-/-</sup> or CKO mice. Thus, BMP2 has at least a partially redundant role in hepcidin regulation by serum iron, tissue iron, inflammation and erythropoietic drive. In contrast, BMP6 is absolutely required for hepcidin regulation by serum iron.

Also flagged:defectsmofchromosomeshistone H4discTip60
Journal Article 2018-12-10 ✓ 5 Snippets Copur Ö, Gorchakov A, Finkl K, Kuroda MI, Müller J.
In-Text Gene Mentions

…requirement for theDCCfor dosage compensation?…

…males lacking theDCCsubunits Msl-1, Msl-2,…

…it into theDCC( 29 )…

…Msl-1 or otherDCCsubunits results in…

…on the otherDCCsubunits as during…

Show Full Abstract

Acetylation of histone H4 at lysine 16 (H4K16) modulates nucleosome-nucleosome interactions and directly affects nucleosome binding by certain proteins. In <i>Drosophila</i>, H4K16 acetylation by the dosage compensation complex subunit Mof is linked to increased transcription of genes on the single X chromosome in males. Here, we analyzed <i>Drosophila</i> containing different H4K16 mutations or lacking Mof protein. An H4K16A mutation causes embryonic lethality in both sexes, whereas an H4K16R mutation permits females to develop into adults but causes lethality in males. The acetyl-mimic mutation H4K16Q permits both females and males to develop into adults. Complementary analyses reveal that males lacking maternally deposited and zygotically expressed Mof protein arrest development during gastrulation, whereas females of the same genotype develop into adults. Together, this demonstrates the causative role of H4K16 acetylation by Mof for dosage compensation in <i>Drosophila</i> and uncovers a previously unrecognized requirement for this process already during the onset of zygotic gene transcription.

Also flagged:oxygenironHepcidinmetabolismoxygen-regulated transcription factorhypoxia-inducible factor 2α
Journal Article 2018-12-10 No Snippets Lee FS.
Show Full Abstract

Hepcidin is the master regulator of iron metabolism. It plays a key role in the regulation of iron transport across the duodenal epithelium, which in turn is dependent on the oxygen-regulated transcription factor hypoxia-inducible factor 2α (HIF-2α). In this issue of the JCI, Schwartz and colleagues show that duodenal HIF-2α is itself regulated by hepcidin, thereby indicating that this transcription factor is not only regulated by oxygen, but also by iron. This work indicates that the crosstalk between liver hepcidin and intestinal HIF-2α plays an important role during iron overload, systemic iron deficiency, and anemia.

Also flagged:siliconbindingpolyelectrolytesallylamine hydrochloridemethacrylic acidorganosilane
Journal Article 2018-12-10 No Snippets Mariani S, Robbiano V, Strambini LM, Debrassi A, Egri G, Dähne L, Barillaro G.
Show Full Abstract

Nanostructured materials premise to revolutionize the label-free biosensing of analytes for clinical applications, leveraging the deeper interaction between materials and analytes with comparable size. However, when the characteristic dimension of the materials reduces to the nanoscale, the surface functionalization for the binding of bioreceptors becomes a complex issue that can affect the performance of label-free biosensors. Here we report on an effective and robust route for surface biofunctionalization of nanostructured materials based on the layer-by-layer (LbL) electrostatic nano-assembly of oppositely-charged polyelectrolytes, which are engineered with bioreceptors to enable label-free detection of target analytes. LbL biofunctionalization is demonstrated using nanostructured porous silicon (PSi) interferometers for affinity detection of streptavidin in saliva, through LbL nano-assembly of a bi-layer of positively-charged poly(allylamine hydrochloride) (PAH) and negatively-charged biotinylated poly(methacrylic acid) (b-PMAA). High sensitivity in streptavidin detection is achieved, with high selectivity and stability, down to a detection limit of 600 fM.

Also flagged:horminoneMu2Teladenosine diphosphateplatelet aggregationPC
Journal Article 2018-12-10 ✓ 1 Snippet Kasimu R, Wang X, Wang X, Hu J, Wang X, Mu Y.
In-Text Gene Mentions

…(6-keto-PGF 1α ),antithrombin-III(AT-III), protein C…

Show Full Abstract

Salvia deserta Schang (SDS) belongs to the same family as Salvia miltiorrhiza bunge, one of the antithrombotic Chinese herbal medicines. In our study, EtOAc root extracts were analyzed for their effects on adenosine diphosphate (ADP)-induced platelet aggregation in rabbits and FeCl<sub>3</sub>-induced rat common carotid artery thrombosis as well as on rat blood plasma concentrations of thromboxane B2 (TXB<sub>2</sub>), 6-keto-prostaglandin F1 alpha (6-keto-PGF<sub>1α</sub>), antithrombin-III (AT-III), protein C (PC), plasminogen (PLG), plasminogen activator inhibitor (PAI-1), von Willebrand factor (vWF) and tissue-type plasminogen activator (t-PA). EtOAc extracts from SDS roots had significant inhibitory effects on ADP-induced maximum platelet aggregation rate (10.2 ± 2.6 vs control 35.7 ± 5.2; P < 0.05), reduced the FeCl<sub>3</sub>-induced rat common carotid artery thrombus weight and thrombus area ratio (P < 0.05), significantly decreased plasma TXB<sub>2</sub>, vWF and PAI-1 levels and increased 6-keto-PGF<sub>1α</sub> and t-PA levels in a dose dependent manner (all P < 0.05). Thus, the ratio of TXB<sub>2</sub>/6-keto-PGF<sub>1α</sub> was significantly decreased (P < 0.05), while the ratio of t-PA/PAI-1 was significantly increased (P < 0.05). In addition, enhanced AT-III and PC activities indicated coagulation inactivation effects of EtOAc SDS root extracts. EtOAc extraction from SDS showed antithrombotic effects, which are likely due to platelet adhesion and aggregation inhibition as well as anticoagulant activities.

Also flagged:methyltranferasesaminoglycosidesamikacingentamicintobramycinpolymerase
Journal Article 2018-12-10 No Snippets Cassu-Corsi D, Martins WM, Nicoletti AG, Almeida LG, Vasconcelos AT, Gales AC.
Show Full Abstract

OBJECTIVES The emergence of 16S rRNA methyltranferases (16 RMTAses) has jeopardised the clinical use of aminoglycosides. RmtB is one of the most frequently reported in Gram-negatives worldwide. In this study, we aimed to estimate the frequency of 16S RMTAses encoding genes in Enterobacteriaceae isolated in a three-month period from a tertiary Brazilian hospital. METHODS All Gram-negatives classified as resistant to amikacin, gentamicin, and tobramycin by agar screening were selected for analysis. The presence of 16SRMTases encoding genes was verified by polymerase chain reaction (PCR). Antimicrobial susceptible profile was determined by broth microdilution. The genetic relationship among these isolates was accessed by pulsed field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Selected RmtB-producing isolates were characterised by whole genome sequencing (WGS) analysis. RESULTS Twenty-two of 1,052 (2.1%) Enterobacteriaceae were detected as producers of RmtB-1 [Klebsiella pneumoniae (n = 21) and Proteus mirabilis (n = 1)]. blaKPC-2 was identified among 20 RmtB-1-producing K. pneumoniae isolates that exhibited an identical PFGE and MLST (ST258) patterns. Two K. pneumoniae isolates, the A64216 (not harboring bla KPC-2), A64477 (harboring bla KPC-2) and one P. mirabilis isolate (A64421) were selected for WGS. rmtB-1 and bla KPC-2 genes were carried by distinct plasmids. While a plasmid belonging to the IncFIIk group harbored rmtB-1 in K. pneumoniae, this gene was carried by a non-typable plasmid in P. mirabilis. In the three analysed plasmids, rmtB-1 was inserted on a transposon, downstream a Tn2. CONCLUSION Our findings suggested that the rmtB-1 was harbored by plasmids distinct from those previously reported in Bolivia and China. It suggests that multiple mobilization events might have occurred in South America.

Also flagged:TuberculosisATPasesinfectioncytosolmitochondrialClpP
Journal Article 2018-12-10 ✓ 1 Snippet Fraga H, Rodriguez B, Bardera A, Cid C, Akopian T, Kandror O, Park A, Colmenarejo G, Lelievre J, Goldberg A.
In-Text Gene Mentions

DCC

Show Full Abstract

Tuberculosis affects about 100 million people worldwide and causes nearly 2 million deaths annually. It has been estimated that one third of all humans is infected with latent Mycobacterium tuberculosis (Mtb). Moreover, Mtb has become increasingly resistant to available antibiotics. Consequently, it is important to identify and characterize new therapeutic targets in Mtb and to synthesize selective inhibitors. ClpP1, ClpP2 and their associated regulatory ATPases, ClpX and ClpC1 are required for the growth of Mtb and for its virulence during murine infection and are highly attractive drug targets, especially since they are not present in the cytosol of mammalian cells, and they differ markedly from the mitochondrial ClpP complex. The importance of these proteins in Mtb is emphasized by the existence of several natural antibiotics targeting this system. In order to find new inhibitors of ClpC1P1P2 system, we developed an assay based on the ATP-dependent degradation of a fluorescent protein substrate. The hits obtained were further characterized with a set of secondary assays to identify precise targets within a complex. A large library of compounds was screened and led to the identification of a ClpC1 ATPase inhibitor demonstrating that this approach can be used in future searches for anti-TB agents.

Also flagged:MIP-3-alphaGAPDHprotein 3protein 2IFNKRT8
Journal Article 2018-12-10 ✓ 3 Snippets Schmautz C, Müller N, Auer M, Ballweg I, Pfaffl MW, Kliem H.
In-Text Gene Mentions

…this assumption byDCCwas not given.…

…data of theDCC(Additional file 5…

…share of theDCC(Additional file 5…

Show Full Abstract

<h4>Background</h4>New treatment options are needed to prevent relapses following failed antibiotic therapies of <i>Clostridium difficile</i> infections (CDI) in humans. The concomitant therapy with an anti-<i>C. difficile</i> IgA containing whey protein concentrate can support the sustainable recovery of CDI patients. For 31 weeks, nine dairy cows were continuously vaccinated with several anti-<i>C. difficile</i> vaccines by certain routes of administration to produce anti-<i>C. difficile</i> IgA enriched milk. The study aimed at finding decisive differences between low responder (LR) and high responder (HR) cows (> 8.0 µg ml<sup>-1</sup> total milk <i>C. difficile</i> specific IgA) concerning their immune response to vaccination on cellular and molecular biological levels.<h4>Results</h4>The results of total and differential cell counting (DCC) in blood and milk and the outcomes of the gene expression analysis of selected immune factors were assessed relating to the usage of two vaccine batches for injection (<i>MucoCD</i>-<i>I</i> batch A and B), marking two immunization (IM) periods, and compared to a control group (Ctr). The <i>MucoCD</i>-<i>I</i> batch A caused short-term leukopenia followed by leukocytosis in the blood of LR and HR. The total somatic cell counts in milk were not altered by the treatment. The DCC revealed that the leukocytes of the treated groups were partly impaired by the treatment. The gene expression analysis exposed cumulative and sustainable differences (<i>p</i> < 0.05) between LR and HR for the genes encoding for <i>lactoferrin</i>, <i>CXCL8</i>, <i>IL1β</i>, <i>IL2</i>, <i>IL6</i>, <i>IL12β</i>, <i>IFNγ</i>, <i>CD4</i> and <i>CD163</i>. The regulation of the epithelial IgA cell receptor <i>PIGR</i> was not impaired by the IM. In contrast to the vaccination with <i>MucoCD</i>-<i>I</i> batch A, the second IM period with <i>MucoCD</i>-<i>I</i> batch B resulted in mitigation and synchronization of the treated groups' immune responses.<h4>Conclusions</h4>The inversely regulated cytokines in the blood and milk cells of the treated groups led to a variously directed, local T cell response resulting in their different production intensities of <i>C. difficile</i> specific IgA in milk.

Also flagged:autophagypancreatic cancerchloroquine diphosphatepancreatic adenocarcinomasolid tumorsmalignant tumors
Journal Article 2018-12-10 No Snippets Wei DM, Jiang MT, Lin P, Yang H, Dang YW, Yu Q, Liao DY, Luo DZ, Chen G.
Show Full Abstract

Autophagy has been reported to be involved in the occurrence and development of pancreatic cancer. However, the mechanism of autophagy‑associated non‑coding RNAs (ncRNAs) in pancreatic cancer remains largely unknown. In the present study, microarrays were used to detect differential expression of mRNAs, microRNAs (miRNAs), long ncRNAs (lncRNAs) and circular RNAs (circRNAs) post autophagy suppression by chloroquine diphosphate in PANC‑1 cells. Collectively, 3,966 mRNAs, 3,184 lncRNAs and 9,420 circRNAs were differentially expressed. Additionally, only two miRNAs (hsa‑miR‑663a‑5p and hsa‑miR‑154‑3p) were underexpressed in the PANC‑1 cells in the autophagy‑suppression group. Furthermore, miR‑663a‑5p with 9 circRNAs, 8 lncRNAs and 46 genes could form a prospective ceRNA network associated with autophagy in pancreatic cancer cells. In addition, another ceRNA network containing miR‑154‑3p, 5 circRNAs, 2 lncRNAs and 11 genes was also constructed. The potential multiple ceRNA, miRNA and mRNA associations may serve pivotal roles in the autophagy of pancreatic cancer cells, which lays the theoretical foundation for subsequent investigations on pancreatic cancer.

Also flagged:Serotonin ReceptorGene Expressionneurodegenerative disorderHDbehavioralserotonin (5-HT) receptor
Journal Article 2018-12-10 ✓ 1 Snippet Zajac MS, Renoir T, Perreau VM, Li S, Adams W, van den Buuse M, Hannan AJ.
In-Text Gene Mentions

…also known as5-HTTor Slc6a4) was…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by a tandem repeat mutation encoding an expanded polyglutamine tract in the huntingtin protein, which leads to cognitive, psychiatric and motor dysfunction. Exposure to environmental enrichment (EE), which enhances levels of cognitive stimulation and physical activity, has therapeutic effects on cognitive, affective and motor function of transgenic HD mice. The present study investigated gene expression changes and behavioral pharmacology in male and female R6/1 transgenic HD mice at an early time-point in HD progression associated with onset of cognitive and affective abnormalities, following EE and exercise (wheel running) interventions. We have demonstrated changes in expression levels of the serotonin (5-HT) receptor Htr1a, Htr1b, Htr2a and Htr2c genes (encoding the 5-HT<sub>1A</sub>, 5-HT<sub>1B</sub>, 5-HT<sub>2A</sub> and 5-HT<sub>2C</sub> receptors, respectively) in HD brains at 8 weeks of age, using quantitative real-time PCR. In contrast, expression of the serotonin transporter (SerT, also known as 5-HTT or Slc6a4) was not altered in these brains. Furthermore, we identified region-specific, sex-specific and environmentally regulated (comparing EE, exercise and standard housing conditions) impacts on gene expression of particular 5-HT receptors, as well as SerT. For example, SerT gene expression was upregulated by exercise (wheel running from 6 to 8 weeks of age) in the hippocampus. Interestingly, when EE was introduced from 6 to 8 weeks of age, Htr2a gene expression was upregulated in the cortex, striatum and hippocampus of male mice. EE also rescued the functional activity of 5-HT<sub>2</sub> receptors as observed in the head-twitch test, reflecting sexually dimorphic effects of environmental stimulation. These findings demonstrate that disruption of the serotonergic system occurs early in HD pathogenesis and, together with previous findings, show that the timing and duration of environmental interventions are critical in terms of their ability to modify gene expression. This study is the first to show that EE is able to selectively enhance both gene expression of a neurotransmitter receptor and the functional consequences on behavioral pharmacology, and links this molecular modulation to the therapeutic effects of environmental stimulation in this neurodegenerative disease.

Also flagged:TGF-β1chronic kidney failurediabetic nephropathymethylationKLF7Gja4
Journal Article 2018-12-10 No Snippets Wang B, Ji G, Naeem H, Wang J, Kantharidis P, Powell D, Ricardo SD.
Show Full Abstract

<b>Aims/Hypothesis:</b> Transforming growth factor-beta (TGF-β1) plays an important regulatory role in the progression of chronic kidney failure. Further, damage to kidney glomerular mesangial cells is central to the progression of diabetic nephropathy. The aim of this study was to explore the genetic associations between mRNA, microRNA, and epigenetics in mesangial cells in response to TGF-β1. <b>Methods:</b> The regulatory effects of TGF-β1 on mesangial cells were investigated at different molecular levels by treating mesangial cells with TGF-β1 for 3 days followed by genome-wide miRNA, RNA, DNA methylation, and H3K27me3 expression profiling using next generation sequencing (NGS). <b>Results:</b> Our results provide the first comprehensive, computationally integrated report of RNA-Seq, miRNA-Seq, and epigenomic analyses across all genetic variations, confirming the occurrence of DNA methylation and H3K27me3 in response to TGF-β1. Our findings show that the expression of KLF7 and Gja4 are involved in TGF-β1 regulated DNA methylation. Our data also provide evidence of the association between epigenetic changes and the expression of genes closely related to TGF-β1 regulation. <b>Conclusion:</b> This study has advanced our current knowledge of mechanisms that contribute to the expression of TGF-β1-regulated genes involved in the pathogenesis of kidney disease. The molecular underpinnings of TGF-β1 stimulation of kidney cells was determined, thereby providing a robust platform for further target exploration.

Also flagged:acute lymphoblastic leukemiaALLpediatric cancerchromosomepathogenesisantibodies
Journal Article 2018-12-10 No Snippets Mohseni M, Uludag H, Brandwein JM.
Show Full Abstract

Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer and also occurs in adults. Although the outcomes of multi-agent chemotherapy regimens have greatly improved, high toxicity and relapses in many patients necessitate the development of novel therapeutic approaches. Advances in molecular profiling and cytogenetics have identified a broad range of genetic abnormalities, including gene mutations, chromosome translocations and aneuploidy, which has provided a more comprehensive understanding of the biology and pathogenesis of ALL. This understanding has also led to new targeted therapeutic approaches, including the use of selective small molecule inhibitors, nucleic acid-based therapies and immune-based therapies mediated by specific monoclonal antibodies and cellular immunotherapy, which are poised to revolutionize the treatment of various ALL subtypes. The main focus of this review is to highlight the latest advances in ALL biology, including the identification of prognostic factors and putative therapeutic targets. We also review the current status of, and ongoing progress in, the development of targeted therapies for ALL.

bioRxiv 2018-12-10 Preprint (No Snippets API) Harding RJ, Loppnau P, Ackloo S, Lemak A, Hutchinson A, Hunt B, Holehouse AS, Ho JC, Fan L, Toledo-Sherman L, Seitova A, Arrowsmith CH.
Show Full Abstract

<h4>ABSTRACT</h4> The gene mutated in Huntington’s disease (HD) patients encodes the 348 kDa huntingtin (HTT) protein. The pathogenic HD CAG-expansion mutation causes a polyglutamine (polyQ) tract at the N-terminus of the HTT protein to expand above a critical threshold of ~35 glutamine residues. The effect of HD mutations on HTT is not well understood, in part due to difficulties in carrying out biochemical, biophysical and structural studies of this large protein. To facilitate such studies, we have generated expression constructs for the scalable production of HTT in multiple eukaryotic expression systems. Our set of HTT expression clones comprises both N and C-terminally FLAG-tagged HTT constructs with polyQ lengths representative of the general population, HD patients, juvenile HD patients as well as the more extreme polyQ expansions used in some HD tissue and animal models. These reagents yield milligram quantities of pure recombinant HTT protein, including many of the previously mapped posttranslational modifications. We have characterised both apo and HTT-HAP40 complex samples produced using this HD resource, demonstrating that this toolkit can be used to generate physiologically meaningful complexes of HTT. We demonstrate how these resources can produce sufficient material for protein-intensive experiments such as small angle X-ray scattering (SAXS), providing biochemical insight into HTT protein structure. The work outlined in this manuscript and the tools generated, lay a foundation for further biochemical and structural work on the HTT protein and its functional interactions with other biomolecules.

bioRxiv 2018-12-10 Preprint (No Snippets API) Sundararajan L, Smith CJ, Watson JD, Millis BA, Tyska MJ, Miller DM.
Show Full Abstract

<h4>SUMMARY</h4> Dendrite growth is constrained by the self-avoidance response but the downstream pathways that balance these opposing mechanisms are unknown. We have proposed that the diffusible cue UNC-6(Netrin) is captured by UNC-40 (DCC) for a short-range interaction with UNC-5 to trigger self-avoidance in the C. elegans PVD neuron. Here we report that the actin-polymerizing proteins UNC-34(Ena/VASP), WSP-1(WASP), UNC-73(Trio), MIG-10(Lamellipodin) and the Arp2/3 complex effect dendrite retraction in the self-avoidance response mediated by UNC-6(Netrin). The paradoxical idea that actin polymerization results in shorter rather than longer dendrites is explained by our finding that NMY-1 (non-muscle myosin II) is necessary for retraction and could therefore mediate this effect in a contractile mechanism. Our results also show that dendrite length is determined by the antagonistic effects on the actin cytoskeleton of separate sets of effectors for retraction mediated by UNC-6(Netrin) versus outgrowth promoted by the DMA-1 receptor. Thus, our findings suggest that the dendrite length depends on an intrinsic mechanism that balances distinct modes of actin assembly for growth versus retraction.

Also flagged:behavioral disordersreverse transcription-polymeraseglobingene expressionoligodendrogliomas
Journal Article 2018-12-09 ✓ 2 Snippets Wilson RS, Nairn AC.
In-Text Gene Mentions

Patients with HD exhibit a preferential loss of D2 MSNs, and an accumulation of the mutant form of Huntingtin (HTT) protein occurs in human neurons and astrocytes [5,44,45].

…form of Huntingtin (HTT) protein occurs in…

Show Full Abstract

Cell-type-specific analysis has become a major focus for many investigators in the field of neuroscience, particularly because of the large number of different cell populations found in brain tissue that play roles in a variety of developmental and behavioral disorders. However, isolation of these specific cell types can be challenging due to their nonuniformity and complex projections to different brain regions. Moreover, many analytical techniques used for protein detection and quantitation remain insensitive to the low amounts of protein extracted from specific cell populations. Despite these challenges, methods to improve proteomic yield and increase resolution continue to develop at a rapid rate. In this review, we highlight the importance of cell-type-specific proteomics in neuroscience and the technical difficulties associated. Furthermore, current progress and technological advancements in cell-type-specific proteomics research are discussed with an emphasis in neuroscience.

bioRxiv 2018-12-09 Preprint (No Snippets API) Park C, De T, Xu Y, Zhong Y, Gamazon E, Smithberger E, Alarcon C, Perera M.
Show Full Abstract

<h4>ABSTRACT</h4> <h4>Background</h4> African Americans (AAs) are an admixed population with portions of their genome derived from West Africans and Europeans. In AAs, the proportion of West African ancestry (WAA) can vary widely and may explain the genetic drivers of disease, specifically those that disproportionately affect this understudied population. To examine the relationship between the proportion of WAA and gene expression, we used high dimensional data obtained from AA primary hepatocytes, a tissue important in disease and drug response. <h4>Methods</h4> RNA sequencing (Illumina HiSeq Platform) was conducted on 60 AA-derived primary hepatocytes, with methylation profiling (Illumina MethylationEPIC BeadChip) of 44 overlapping samples. WAA for each sample was calculated using fastSTRUCTURE and correlated to both gene expression and DNA methylation. The GTEx consortium (n = 15) was used for replication and a second cohort (n = 206) was using used for validation using differential gene expression between AAs and European-Americans. <h4>Results</h4> We identified 131 genes associated with WAA (FDR< 0.1), of which 28 gene expression traits were replicated (FDR<0.1) and enriched in angiogenesis and inflammatory pathways (FDR<0.1). These 28 replicated gene expression traits represented 257 GWAS catalog phenotypes. Among the PharmGKB pharmacogenes, VDR, PTGIS, ALDH1A1, CYP2C19 and P2RY1 were associated with WAA ( p < 0.05) with replication of CYP2C19 and VDR in GTEx. Association of DNA methylation with WAA identified 1037 differentially methylated regions (FDR<0.05), with hypomethylated genes enriched in drug response pathways. Overlapping of differentially methylated regions with the 131 significantly correlated gene expression traits identified 5 genes with concordant directions of effect: COL26A1, HIC1, MKNK2, RNF135, SNAI1 and TRIM39 . <h4>Conclusions</h4> We conclude that WAA contributes to variability in hepatic gene expression and DNA methylation with identified genes indicative of diseases disproportionately affecting AAs. Specifically, WAA-associated genes were linked to previously identified loci in cardiovascular disease ( PTGIS, PLAT ), renal disease ( APOL1 ) and drug response ( CYP2C19 ).

Also flagged:Infectionsliver diseasecirrhosisacute liver failurehepatocellular carcinomainfection
Journal Article 2018-12-08 ✓ 4 Snippets Mohanraj B, Rangnekar A, Timpone J.
In-Text Gene Mentions

…most notable inhemochromatosis, it has also…

…conditions such ashemochromatosis.…

…with cirrhosis andhemochromatosisare at risk…

…in patients withhemochromatosisand cirrhosis […

Show Full Abstract

No abstract available.

bioRxiv 2018-12-08 Preprint (No Snippets API) Wong E, Glasgow SD, Trigiani LJ, Chitsaz D, Rymar V, Sadikot A, Ruthazer ES, Hamel E, Kennedy TE.
Show Full Abstract

Netrin-1 was initially characterized as an axon guidance molecule that is essential for normal embryonic neural development; however, many types of neurons continue to express netrin-1 in the post-natal and adult mammalian brain. Netrin-1 and the netrin receptor DCC are both enriched at synapses. In the adult hippocampus, activity-dependent secretion of netrin-1 by neurons potentiates glutamatergic synapse function, and is critical for long-term potentiation, an experimental cellular model of learning and memory. Here, we assessed the impact of neuronal expression of netrin-1 in the adult brain on behavior using tests of learning and memory. We show that adult mice exhibit impaired spatial memory following conditional deletion of netrin-1 from glutamatergic neurons in the hippocampus and neocortex. Further, we provide evidence that mice with conditional deletion of netrin-1 do not display aberrant anxiety-like phenotypes and show a reduction in self-grooming behaviour. These findings reveal a critical role for netrin-1 expressed by neurons in the regulation of spatial memory formation.

Also flagged:liver cancercat-eye syndromeCopper ToxicosisWilson diseaseCTCRF
Journal Article 2018-12-07 ✓ 1 Snippet Xu K, Zhou Z, Gong T, Hao T, Liu W.
In-Text Gene Mentions

…and affixes, e.g.,hemo-chromatosis.…

Show Full Abstract

<h4>Background</h4>Disease named entity recognition (NER) is a fundamental step in information processing of medical texts. However, disease NER involves complex issues such as descriptive modifiers in actual practice. The accurate identification of disease NER is a still an open and essential research problem in medical information extraction and text mining tasks.<h4>Methods</h4>A hybrid model named Semantics Bidirectional LSTM and CRF (SBLC) for disease named entity recognition task is proposed. The model leverages word embeddings, Bidirectional Long Short Term Memory networks and Conditional Random Fields. A publically available NCBI disease dataset is applied to evaluate the model through comparing with nine state-of-the-art baseline methods including cTAKES, MetaMap, DNorm, C-Bi-LSTM-CRF, TaggerOne and DNER.<h4>Results</h4>The results show that the SBLC model achieves an F1 score of 0.862 and outperforms the other methods. In addition, the model does not rely on external domain dictionaries, thus it can be more conveniently applied in many aspects of medical text processing.<h4>Conclusions</h4>According to performance comparison, the proposed SBLC model achieved the best performance, demonstrating its effectiveness in disease named entity recognition.

Also flagged:deltaGFPtriotracernucleiPerchlorate
Journal Article 2018-12-07 ✓ 5 Snippets Yi SW, Kim HJ, Oh HJ, Shin H, Lee JS, Park JS, Park KH.
In-Text Gene Mentions

DCC

…genesis-inducing factors SOX5,SOX6, and SOX9.…

…SOX5 (specifically L-SOX5),SOX6, and SOX9 […

…L-SOX5 andSOX6are excited at…

…pDNA of SOX5,SOX6, and SOX9 are…

Show Full Abstract

<h4>Background</h4>During differentiation of stem cells, it is recognized that molecular mechanisms of transcription factors manage stem cells towards the intended lineage. In this study, using microarray-based technology, gene expression profiling was examined during the process of chondrogenic differentiation of human mesenchymal stem cells (hMSCs). To induce chondrogenic differentiation of hMSCs, the cationic polymer polyethyleneimine (PEI) was coupled with the synthetic glucocorticoid dexamethasone (DEX). DEX/PEI could be polyplexed with anionic plasmid DNAs (pDNAs) harboring the chondrogenesis-inducing factors SOX5, SOX6, and SOX9. These are named differentiation-inducing nanoparticles (DI-NPs).<h4>Methods</h4>A DI-NP system for inducing chondrogenic differentiation was designed and characterized by dynamic light scattering and scanning electron microscopy (SEM). Chondrogenic induction of hMSCs was evaluated using various tools such as reverse-transcription polymerase chain reaction (RT-PCR), Western blotting, confocal fluorescent microscopy, and immunohistochemistry analysis. The gene expression profiling of DI-NP-treated hMSCs was performed by microarray analysis.<h4>Results</h4>The hMSCs were more efficiently transfected with pDNAs using DI-NPs than using PEI. Moreover, microarray analysis demonstrated the gene expression profiling of hMSCs transfected with DI-NPs. Chondrogenic factors including SOX9, collagen type II (COLII), Aggrecan, and cartilage oligometric matrix protein (COMP) were upregulated while osteogenic factors including collagen type I (COLI) was downregulated. Chondrogenesis-induced hMSCs were better differentiated as assessed by RT-PCR, Western blotting analyses, and immunohistochemistry.<h4>Conclusion</h4>DI-NPs are good gene delivery carriers and induce chondrogenic differentiation of hMSCs. Additionally, comprehensive examination of the gene expression was attempted to identify specific genes related to differentiation by microarray analysis.

Also flagged:Agingmesenchymal stem cell differentiationosteogenesischondrogenesisstem cell differentiationbone formation
Journal Article 2018-12-07 No Snippets Fariyike B, Singleton Q, Hunter M, Hill WD, Isales CM, Hamrick MW, Fulzele S.
Show Full Abstract

MicroRNA's are small non-coding RNAs that regulate the expression of genes by targeting the 3' UTR's of mRNA. Studies reveal that miRNAs play a pivotal role in normal musculoskeletal function such as mesenchymal stem cell differentiation, survivability and apoptosis, osteogenesis, and chondrogenesis. Changes in normal miRNA expression have been linked to a number of pathological disease processes. Additionally, with aging, it is noted that there is dysregulation in the normal function of stem cell differentiation, bone formation/degradation, chondrocyte function, and muscle degeneration. Due to the change in expression of miRNA in degenerative musculoskeletal pathology, it is believed that these molecules may be at least partially responsible for cellular dysfunction. A number of miRNAs have already been identified to play a role in osteoarthritis, osteoporosis and sarcopenia. One miRNA that has become of interest recently is miRNA 141. The purpose of this article is to review the current literature available on miRNA 141 and how it could play a role in osteoporosis, osteoarthritis and musculoskeletal pathology overall.

Also flagged:LyseninOlig2Arginase-1prodemyelinationlls
Journal Article 2018-12-07 No Snippets Gabandé-Rodríguez E, Pérez-Cañamás A, Soto-Huelin B, Mitroi DN, Sánchez-Redondo S, Martínez-Sáez E, Venero C, Peinado H, Ledesma MD.
Show Full Abstract

Neuropathic lysosomal storage disorders (LSDs) present with activated pro-inflammatory microglia. However, anti-inflammatory treatment failed to improve disease pathology. We characterise the mechanisms underlying microglia activation in Niemann-Pick disease type A (NPA). We establish that an NPA patient and the acid sphingomyelinase knockout (ASMko) mouse model show amoeboid microglia in neurodegeneration-prone areas. <i>In vivo</i> microglia ablation worsens disease progression in ASMko mice. We demonstrate the coexistence of different microglia phenotypes in ASMko brains that produce cytokines or counteract neuronal death by clearing myelin debris. Overloading microglial lysosomes through myelin debris accumulation and sphingomyelin build-up induces lysosomal damage and cathepsin B extracellular release by lysosomal exocytosis. Inhibition of cathepsin B prevents neuronal death and behavioural anomalies in ASMko mice. Similar microglia phenotypes occur in a Niemann-Pick disease type C mouse model and patient. Our results show a protective function for microglia in LSDs and how this is corrupted by lipid lysosomal overload. Data indicate cathepsin B as a key molecule mediating neurodegeneration, opening research pathways for therapeutic targeting of LSDs and other demyelinating diseases.

Also flagged:chromatinnucleosome binding proteinsHMGN1HMGN2ASCL1transcription factor
Journal Article 2018-12-07 ✓ 1 Snippet He B, Deng T, Zhu I, Furusawa T, Zhang S, Tang W, Postnikov Y, Ambs S, Li CC, Livak F, Landsman D, Bustin M.
In-Text Gene Mentions

…respect, HMGNs resemblechromatin modifiersmodifiers such as…

Show Full Abstract

The dynamic nature of the chromatin epigenetic landscape plays a key role in the establishment and maintenance of cell identity, yet the factors that affect the dynamics of the epigenome are not fully known. Here we find that the ubiquitous nucleosome binding proteins HMGN1 and HMGN2 preferentially colocalize with epigenetic marks of active chromatin, and with cell-type specific enhancers. Loss of HMGNs enhances the rate of OSKM induced reprogramming of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem cells (iPSCs), and the ASCL1 induced conversion of fibroblast into neurons. During transcription factor induced reprogramming to pluripotency, loss of HMGNs accelerates the erasure of the MEF-specific epigenetic landscape and the establishment of an iPSCs-specific chromatin landscape, without affecting the pluripotency potential and the differentiation potential of the reprogrammed cells. Thus, HMGN proteins modulate the plasticity of the chromatin epigenetic landscape thereby stabilizing, rather than determining cell identity.

Also flagged:Hbiron deficiencyTMPRSS6BTBD9restless leg syndromeTF
Journal Article 2018-12-07 ✓ 5 Snippets Sørensen E, Rigas AS, Didriksen M, Burgdorf KS, Thørner LW, Pedersen OB, Hjalgrim H, Petersen MS, Erikstrup C, Ullum H.
In-Text Gene Mentions

The examined genes and single-nucleotide polymorphisms were 1) TMPRSS6, involved in regulation of hepcidin: rs855791; 2) HFE, associated with hemochromatosis: rs1800562 and rs1799945; 3) BTBD9, associated with restless leg syndrome: rs9357271; and 4) TF, encoding transferrin: rs2280673 and rs1830084.

…hepcidin: rs855791; 2)HFE, associated with hemochromato…

…HFE, associated withhemochromatosis: rs1800562 and rs1799945;…

…ion models.<h4>Results</h4>TheHFE,rs1800562 G-allele and the…

…G-allele and theHFErs1799945 C-allele were…

Show Full Abstract

<h4>Background</h4>Blood donors have an increased risk of low hemoglobin (Hb) levels due to iron deficiency. Therefore, knowledge of genetic variants associated with low Hb could facilitate individualized donation intervals. We have previously reported three specific single-nucleotide polymorphisms that were associated with ferritin levels in blood donors. In this study, we investigated the effect of these single-nucleotide polymorphisms on Hb levels in 15,567 Danish blood donors.<h4>Study design and methods</h4>We studied 15,567 participants in the Danish Blood Donor Study. The examined genes and single-nucleotide polymorphisms were 1) TMPRSS6, involved in regulation of hepcidin: rs855791; 2) HFE, associated with hemochromatosis: rs1800562 and rs1799945; 3) BTBD9, associated with restless leg syndrome: rs9357271; and 4) TF, encoding transferrin: rs2280673 and rs1830084. Associations with Hb levels and risk of Hb deferral were assessed in multivariable linear and logistic regression models.<h4>Results</h4>The HFE,rs1800562 G-allele and the HFE rs1799945 C-allele were associated with lower Hb levels in men and women, and with an increased risk of Hb below 7.8 mmol/L (12.5 g/dL) in women. Only the rs1799945 C-allele increased the risk of Hb below 8.4 mmol/L (13.5 g/dL) in men. In TMPRSS6, the rs855791 T-allele was associated with lower Hb levels in both men and women, and with an increased risk of low Hb among women.<h4>Conclusion</h4>With this study we demonstrate that HFE and TMPRSS6 are associated with Hb levels and risk of Hb below the limit of deferral. Thus, genetic testing may be useful in a future assay for personalized donation intervals.

Also flagged:Hepatocellular carcinomatumoroncogenespathogenesisinfectionnonalcoholic fatty liver disease
Journal Article 2018-12-07 No Snippets Sadri Nahand J, Bokharaei-Salim F, Salmaninejad A, Nesaei A, Mohajeri F, Moshtzan A, Tabibzadeh A, Karimzadeh M, Moghoofei M, Marjani A, Yaghoubi S, Keyvani H.
Show Full Abstract

Hepatocellular carcinoma (HCC) is known as one of the major health problems worldwide. Pathological analysis indicated that a variety of risk factors including genetical (i.e., alteration of tumor suppressors and oncogenes) and environmental factors (i.e., viruses) are involved in beginning and development of HCC. The understanding of these risk factors could guide scientists and clinicians to design effective therapeutic options in HCC treatment. Various viruses such as hepatitis B virus (HBV) and hepatitis C virus (HCV) via targeting several cellular and molecular pathways involved in HCC pathogenesis. Among various cellular and molecular targets, microRNAs (miRNAs) have appeared as key players in HCC progression. miRNAs are short noncoding RNAs which could play important roles as oncogenes or tumor suppressors in several malignancies such as HCC. Deregulation of many miRNAs (i.e., miR-222, miR-25, miR-92a, miR-1, let-7f, and miR-21) could be associated with different stages of HCC. Besides miRNAs, exosomes are other particles which are involved in HCC pathogenesis via targeting different cargos, such as DNAs, RNAs, miRNAs, and proteins. In this review, we summarize the current knowledge of the role of miRNAs and exosomes as important players in HCC pathogenesis. Moreover, we highlighted HCV- and HBV-related miRNAs which led to HCC progression.

The Evolution of PharmVar.

Also flagged:CYP2D6polymeraseCYP2C9CYP2C19amino acidCYP1A1
Journal Article 2018-12-07 No Snippets Gaedigk A, Sangkuhl K, Whirl-Carrillo M, Twist GP, Klein TE, Miller NA, PharmVar Steering Committee.
Show Full Abstract

No abstract available.

Also flagged:thioglycolic acidgold nanoparticlesoxygenAbirateronesteroid 17alpha-monooxygenase17alpha-hydrolase
Journal Article 2018-12-07 No Snippets Stolarczyk EU, Sidoryk K, Cybulski M, Kubiszewski M, Stolarczyk K.
Show Full Abstract

The aim of our work was to synthetize of a new analogue of abiraterone-thiolated abiraterone (HS-AB) and design a gold surface monolayer, bearing in mind recent advances in tuning monolayer structures and using them as efficient drug delivery systems. Therapeutic self-assembled monolayers (TSAMs) were prepared by chemically attaching HS-AB to gold surfaces. Their properties were studied by voltammetry and atomic force microscopy (AFM). A gold electrode with immobilized thioglycolic acid (HS-GA) was used for comparison. The surface concentration of HS-AB on the gold surface was 0.572 nmol/cm², determined from the area of the voltammetric reduction peaks (desorption process). The area per one molecule estimated from the voltammetry experiments was 0.291 nmol/cm². The capacity of thus prepared electrode was also tested. The calculated capacity for the HS-AB modified electrode is 2.90 μF/cm². The obtained value indicates that the monolayer on the gold electrode is quite well ordered and well-packed. AFM images show the formation of gold nanoparticles as a result of immersing the HS-AB modified gold electrode in an aqueous solution containing 1 mM HAuCl₄·3H₂O. These structures arise as a result of the interaction between the HS-AB compound adsorbed on the electrode and the AuCl₄<sup>-</sup> ions. The voltammetric experiments also confirm the formation of gold structures with specific catalytic properties in the process of oxygen reduction.

Also flagged:Protein SynthesisPhosphorylationdeathpathogenesisheat-related diseasescytoplasmic
Journal Article 2018-12-07 No Snippets Park S, Lim Y, Lee D, Elvira R, Lee JM, Lee MR, Han J.
Show Full Abstract

Global warming poses a considerable threat to human health, necessitating a proper understanding of mechanisms underlying cell death in the pathogenesis of heat-related diseases. Although mechanisms governing cytoplasmic response to heat are well understood, processes regulating cellular response to disruption of proteostasis in the endoplasmic reticulum (ER) due to heat stress remain unclear. The current study reveals that hyperthermic conditions may lead to a disturbance of ER homeostasis, also known as ER stress. Subsequent activation of the unfolded protein response (UPR) resulted in concomitant induction of cell death. Among the three UPR signaling pathways, the eIF2α phosphorylation pathway, and not the IRE1α/ATF6α pathways, is likely the main contributor to cell death under heat stress. Considering the role of eIF2α in translational control, we investigated the protective effect of translation rate on heat stress-mediated cell death. When protein synthesis was attenuated using cycloheximide or homoharringtonine, cell death due to heat stress was significantly reduced. In summation, we propose that transient modulation of protein synthesis by eIF2α phosphorylation has a pivotal role in protecting cells from heat stress-induced apoptosis. Therefore, pharmacological agents that promote eIF2α phosphorylation or reduce ER stress may contribute to the development of promising therapeutic approaches against heat-related diseases.

Also flagged:excretionmalignantarachidonic acidmetabolismsteroidbiosynthesis
Journal Article 2018-12-07 ✓ 4 Snippets Zhang Y, Gao J, Zhang Q, Wang K, Yao W, Bao B, Zhang L, Tang Y.
In-Text Gene Mentions

…HSP90AA1, ANXA2,PRDX6, PCNA, SOD2 and…

…is, HSP90AA1, ANXA2,PRDX6, PCNA, SOD2 and…

PRDX6and SOD2 were…

…were HSP90AA1, ANXA2,PRDX6, PCNA, SOD2 and…

Show Full Abstract

<i>Euphorbia kansui</i> stir-fried with vinegar (V-kansui) has promising biological activities toward treating malignant ascites with reduced toxicity compared to crude kansui. But the mechanism concerning promoting the excretion of ascites has not been systematically studied. The purpose of this paper was to investigate the possible mechanism of V-kansui in treating malignant ascites, including metabolic pathways and molecular mechanism using an integrated serum and urine metabolomics coupled with network pharmacology. Serum and urine samples of rats were collected and analyzed by ultra-high-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF/MS). A comparison with crude kansui was also made to demonstrate the feasibility of processing. Principle component analysis (PCA) and orthogonal partial least square discriminate analysis (OPLS-DA) were conducted to discriminate the groups, search important variables and reveal the possible pathways. A compound-target-metabolite network was finally constructed to identify the crucial targets to further understand the molecular mechanism. Sixteen significant metabolites contributing to the discrimination of model and control groups were tentatively screened out. They were mainly involved in the arachidonic acid metabolism, steroid hormone biosynthesis and primary bile acid to possibly reduce inflammatory and modulate the renin-angiotensin-aldosterone system to achieve treating malignant ascites. A bio-network starting from the compounds and ending in the metabolites was constructed to elucidate the molecular mechanism. HSP90AA1, ANXA2, PRDX6, PCNA, SOD2 and ALB were identified as the potential key targets that were responsible for the treatment of malignant ascites by the parameter combining the average shortest path length and betweenness centrality. The correlated 17 compounds were considered as the potential active ingredients in V-kansui. In addition, the metabolomics showed that the effect of V-kansui was almost in accordance with crude kansui. These results systematically revealed the mechanism of V-kansui against malignant ascites for the first time using metabolomics coupled with network pharmacology. V-kansui could be a promising safe and therapeutic medicine for the excretion of ascites.

Also flagged:Methylneurodegenerative diseasessynapsin 1SYN1postsynaptic density protein 95PSD-95
Journal Article 2018-12-07 ✓ 1 Snippet Pan JP, Hu Y, Wang JH, Xin YR, Jiang JX, Chen KQ, Yang CY, Gao Q, Xiao F, Yan L, Luo HM.
In-Text Gene Mentions

…have found thattransforming coiled coil acid repeat protein 3coiled coil acid…

Show Full Abstract

Neural stem cells (NSCs) have been shown as a potential source for replacing degenerated neurons in neurodegenerative diseases. However, the therapeutic potential of these cells is limited by the lack of effective methodologies for controlling their differentiation. Inducing endogenous pools of NSCs by small molecule can be considered as a potential approach of generating the desired cell types in large numbers. Here, we reported the characterization of a small molecule (Methyl 3,4-dihydroxybenzoate; MDHB) that selectively induces hippocampal NSCs to differentiate into cholinergic motor neurons which expressed synapsin 1 (SYN1) and postsynaptic density protein 95 (PSD-95). Studies on the mechanisms revealed that MDHB induced the hippocampal NSCs differentiation into cholinergic motor neurons by inhibiting AKT phosphorylation and activating autophosphorylation of GSK3β at tyrosine 216. Furthermore, we found that MDHB enhanced β-catenin degradation and abolished its entering into the nucleus. Collectively, this report provides the strong evidence that MDHB promotes NSCs differentiation into cholinergic motor neurons by enhancing gene <i>Isl1</i> expression and inhibiting cell cycle progression. It may provide a basis for pharmacological effects of MDHB directed on NSCs.

Also flagged:Cancerdeathcancersgastric cancerbladder cancerbreast cancer
Journal Article 2018-12-07 ✓ 1 Snippet Chalbatani GM, Dana H, Memari F, Gharagozlou E, Ashjaei S, Kheirandish P, Marmari V, Mahmoudzadeh H, Mozayani F, Maleki AR, Sadeghian E, Nia EZ, Miri SR, Nia NZ, Rezaeian O, Eskandary A, Razavi N, Shirkhoda M, Rouzbahani FN.
In-Text Gene Mentions

Researchers showed a possible interaction with Tumor Necrosis Factor Superfamily Member 4 (TNFSF4) hypothesizing that piRABC may promote Bladder Cancer cell apoptosis by up regulation of TNFSF4 [63].

Show Full Abstract

Cancer is the second leading cause of death globally. piRNAs, which are a novel type of identified small noncoding RNA (ncRNA), play a crucial role in cancer genomics. In recent years, a relatively large number of studies have demonstrated that several piRNA are aberrantly expressed in various kinds of cancers including gastric cancer, bladder cancer, breast cancer, colorectal cancer and Lung cancer and may probably serve as a novel therapeutic target and biomarker for cancer treatment. The present review summarized current advances in our knowledge of the roles of piRNAs in cancer.

Also flagged:carbon monoxideARDSsepsismitochondrialAcute respiratory distress syndromeacute lung injury
Journal Article 2018-12-06 No Snippets Fredenburgh LE, Perrella MA, Barragan-Bradford D, Hess DR, Peters E, Welty-Wolf KE, Kraft BD, Harris RS, Maurer R, Nakahira K, Oromendia C, Davies JD, Higuera A, Schiffer KT, Englert JA, Dieffenbach PB, Berlin DA, Lagambina S, Bouthot M, Sullivan AI, Nuccio PF, Kone MT, Malik MJ, Porras MAP, Finkelsztein E, Winkler T, Hurwitz S, Serhan CN, Piantadosi CA, Baron RM, Thompson BT, Choi AM.
Show Full Abstract

<h4>Background</h4>Acute respiratory distress syndrome (ARDS) is a prevalent disease with significant mortality for which no effective pharmacologic therapy exists. Low-dose inhaled carbon monoxide (iCO) confers cytoprotection in preclinical models of sepsis and ARDS.<h4>Methods</h4>We conducted a phase I dose escalation trial to assess feasibility and safety of low-dose iCO administration in patients with sepsis-induced ARDS. Twelve participants were randomized to iCO or placebo air 2:1 in two cohorts. Four subjects each were administered iCO (100 ppm in cohort 1 or 200 ppm in cohort 2) or placebo for 90 minutes for up to 5 consecutive days. Primary outcomes included the incidence of carboxyhemoglobin (COHb) level ≥10%, prespecified administration-associated adverse events (AEs), and severe adverse events (SAEs). Secondary endpoints included the accuracy of the Coburn-Forster-Kane (CFK) equation to predict COHb levels, biomarker levels, and clinical outcomes.<h4>Results</h4>No participants exceeded a COHb level of 10%, and there were no administration-associated AEs or study-related SAEs. CO-treated participants had a significant increase in COHb (3.48% ± 0.7% [cohort 1]; 4.9% ± 0.28% [cohort 2]) compared with placebo-treated subjects (1.97% ± 0.39%). The CFK equation was highly accurate at predicting COHb levels, particularly in cohort 2 (R2 = 0.9205; P < 0.0001). Circulating mitochondrial DNA levels were reduced in iCO-treated participants compared with placebo-treated subjects.<h4>Conclusion</h4>Precise administration of low-dose iCO is feasible, well-tolerated, and appears to be safe in patients with sepsis-induced ARDS. Excellent agreement between predicted and observed COHb should ensure that COHb levels remain in the target range during future efficacy trials.<h4>Trial registration</h4>ClinicalTrials.gov NCT02425579.<h4>Funding</h4>NIH grants P01HL108801, KL2TR002385, K08HL130557, and K08GM102695.

Also flagged:autismAutism spectrum disordergenetic disordersgene expressionneurodevelopmental disorderASD syndrome
Journal Article 2018-12-06 No Snippets Lee SC, Quinn TP, Lai J, Kong SW, Hertz-Picciotto I, Glatt SJ, Crowley TM, Venkatesh S, Nguyen T.
Show Full Abstract

Autism spectrum disorder (ASD) is a markedly heterogeneous condition with a varied phenotypic presentation. Its high concordance among siblings, as well as its clear association with specific genetic disorders, both point to a strong genetic etiology. However, the molecular basis of ASD is still poorly understood, although recent studies point to the existence of sex-specific ASD pathophysiologies and biomarkers. Despite this, little is known about how exactly sex influences the gene expression signatures of ASD probands. In an effort to identify sex-dependent biomarkers and characterize their function, we present an analysis of a single paired-end postmortem brain RNA-Seq data set and a meta-analysis of six blood-based microarray data sets. Here, we identify several genes with sex-dependent dysregulation, and many more with sex-independent dysregulation. Moreover, through pathway analysis, we find that these sex-independent biomarkers have substantially different biological roles than the sex-dependent biomarkers, and that some of these pathways are ubiquitously dysregulated in both postmortem brain and blood. We conclude by synthesizing the discovered biomarker profiles with the extant literature, by highlighting the advantage of studying sex-specific dysregulation directly, and by making a call for new transcriptomic data that comprise large female cohorts.

Also flagged:toRNA-binding proteinsgene expressioncancerbindingribonucleoprotein
Journal Article 2018-12-06 No Snippets Parham LR, Williams PA, Chatterji P, Whelan KA, Hamilton KE.
Show Full Abstract

Intestinal epithelial cells are among the most rapidly proliferating cell types in the human body. There are several different subtypes of epithelial cells, each with unique functional roles in responding to the ever-changing environment. The epithelium's ability for rapid and customized responses to environmental changes requires multitiered levels of gene regulation. An emerging paradigm in gastrointestinal epithelial cells is the regulation of functionally related mRNA families, or regulons, via RNA-binding proteins (RBPs). RBPs represent a rapid and efficient mechanism to regulate gene expression and cell function. In this review, we will provide an overview of intestinal epithelial RBPs and how they contribute specifically to intestinal epithelial stem cell dynamics. In addition, we will highlight key gaps in knowledge in the global understanding of RBPs in gastrointestinal physiology as an opportunity for future studies.

Also flagged:Prdx1Prdx2red cell disorderbeta globinsynthesisiron
Journal Article 2018-12-06 ✓ 5 Snippets Romanello KS, Teixeira KKL, Silva JPMO, Nagamatsu ST, Bezerra MAC, Domingos IF, Martins DAP, Araujo AS, Lanaro C, Breyer CA, Ferreira RA, Franco-Penteado C, Costa FF, Malavazi I, Netto LES, de Oliveira MA, Cunha AF.
In-Text Gene Mentions

In humans, six isoforms of Prdxs (Prdx1-6) have been described and their subdivision is based on catalytic mechanism and number of cysteines involved in the enzymatic catalysis in typical 2-Cys Prdxs (Prdx1-4), 2-Cys atypical Prdx (Prdx5) and 1-Cys Prdx (Prdx6) [14–17].

…and 1-Cys Prdx (Prdx6) [ 14 –…

…(Prdx1, Prdx2, andPrdx6), mitochondria (Prdx3 and…

…Prdx1, Prdx2, andPrdx6are found, since…

… Abnova #H00007001-M01); anti-Prdx6(dilution 1:5,000, Abnova…

Show Full Abstract

β-thalassemia is a worldwide distributed monogenic red cell disorder, characterized by an absent or reduced beta globin chain synthesis. The unbalance of alpha-gamma chain and the presence of pathological free iron promote severe oxidative damage, playing crucial a role in erythrocyte hemolysis, exacerbating ineffective erythropoiesis and decreasing the lifespan of red blood cells (RBC). Catalase, glutathione peroxidase and peroxiredoxins act together to protect RBCs from hydrogen peroxide insult. Among them, peroxiredoxins stand out for their overall abundance and reactivity. In RBCs, Prdx2 is the third most abundant protein, although Prdxs 1 and 6 isoforms are also found in lower amounts. Despite the importance of these enzymes, Prdx1 and Prdx2 may have their peroxidase activity inactivated by hyperoxidation at high hydroperoxide concentrations, which also promotes the molecular chaperone activity of these proteins. Some studies have demonstrated the importance of Prdx1 and Prdx2 for the development and maintenance of erythrocytes in hemolytic anemia. Now, we performed a global analysis comparatively evaluating the expression profile of several antioxidant enzymes and their physiological reducing agents in patients with beta thalassemia intermedia (BTI) and healthy individuals. Furthermore, increased levels of ROS were observed not only in RBC, but also in neutrophils and mononuclear cells of BTI patients. The level of transcripts and the protein content of Prx1 were increased in reticulocyte and RBCs of BTI patients and the protein content was also found to be higher when compared to beta thalassemia major (BTM), suggesting that this peroxidase could cooperate with Prx2 in the removal of H2O2. Furthermore, Prdx2 production is highly increased in RBCs of BTM patients that present high amounts of hyperoxidized species. A significant increase in the content of Trx1, Srx1 and Sod1 in RBCs of BTI patients suggested protective roles for these enzymes in BTI patients. Finally, the upregulation of Nrf2 and Keap1 transcription factors found in BTI patients may be involved in the regulation of the antioxidant enzymes analyzed in this work.

Also flagged:foot and mouth diseasecommunicable diseasePolymeraseenterovirus infectionmouth ulcerscoxsackievirus infection
Journal Article 2018-12-06 No Snippets Upala P, Apidechkul T, Suttana W, Kullawong N, Tamornpark R, Inta C.
Show Full Abstract

<h4>Background</h4>Hand, foot and mouth disease (HFMD) is a major communicable disease in children ≤6 years old, particularly in several countries in the Asia-Pacific Region, including Thailand. HFMD impacts public health and the economy, especially in northern Thailand.<h4>Methods</h4>A prospective cohort study was conducted to estimate the incidence rate and to identify the serotype and clinical features of HFMD among children in northern Thailand. A validated questionnaire and throat swab were used for data collection. Polymerase chain reaction (PCR) was used to detect human enterovirus and identify its serotypes. Participants were recruited from 14 hospitals in two provinces in northern Thailand, specifically, Chiang Rai and Pha Yao Province, between January 1, 2016, and December 31, 2016. Chi-square or Fisher's exact test was used to detect the associations of signs and symptoms with HFMD serotype. Logistic regression was used to detect the associations of variables with a positive enterovirus at alpha = 0.05.<h4>Result</h4>In total, 612 children aged ≤6 years from Chiang Rai and Pha Yao Province who were diagnosed with HFMD by a throat swab were recruited for the analysis. Approximately half of the cohort was male (57.2%), 57.5% was aged < 2 years, and 57.5% lived in rural areas. The incidence rate was 279.72/100,000 person-years in Chiang Rai Province and 321.24 per 100,000 person-years in Pha Yao Province. Additionally, 42.5% of children were positive for human enterovirus; among these children, 56.1% were positive for enterovirus-A (EV-A), 17.7% were positive for coxsackievirus (CV), and 26.2% were positive for other human RNA enteroviruses. During the study period, 21 distinct outbreaks of HFMD were recognized. Four to five patients (total 92 patients) were selected from each outbreak for identifying its serotype; enterovirus-A71 (EV-A71) was detected in 34.8% of HFMD cases, coxsackievirus-A16 (CV-A16) in 26.1%, coxsackivirus-A6 (CV-A6) in 15.2%, coxsackievirus-A10 (CV-A10) in 10.9%, coxsackievirus-A4 (CV-A4) in 2.2%, coxsackievirus-B2 (CV-B2) in 2.2%, human rhinovirus in 2.2%, and unknown serotype in 6.4%. Multivariable analysis demonstrated that a history of breastfeeding for ≤6 months was associated with a higher chance of enterovirus infection than a history of breastfeeding > 6 months, and children who had mother who worked as farmers, daily wage employees, and unprofessional skilled jobs had a greater chance of enterovirus infection than those who had unemployed mothers. Coxsackievirus-infected children had a higher rate of rashes on the buttocks, knee, and elbow and fever but a lower rate of lethargy and malaise than EV-A71-infected children.<h4>Conclusions</h4>EV-A71 is a major cause of HFMD in children < 6 years old in northern Thailand, but rash, fever, and mouth ulcers are mostly found in participants with coxsackievirus infection. Breastfeeding should be promoted during early childhood for at least 6 months to prevent HFMD particularly those mother who are working in unprofessional skill jobs.

Also flagged:pathogenesisinflammatory bowel diseasesulcerative Colitiscell proliferationinflammatory responsesinflammatory bowel disease
Journal Article 2018-12-06 No Snippets Yarani R, Mirza AH, Kaur S, Pociot F.
Show Full Abstract

Dysregulation of long noncoding RNA (lncRNA) expression is linked to the development of various diseases. Recently, an emerging body of evidence has indicated that lncRNAs play important roles in the pathogenesis of inflammatory bowel diseases (IBDs), including Crohn's disease (CD) and ulcerative Colitis (UC). In IBD, lncRNAs have been shown to be involved in diverse processes, including the regulation of intestinal epithelial cell apoptosis, association with lipid metabolism, and cell-cell interactions, thereby enhancing inflammation and the functional regulation of regulatory T cells. In this review, we aim to summarize the current knowledge regarding the role of lncRNAs in IBD and highlight potential avenues for future investigation. We also collate potentially immune-relevant, IBD-associated lncRNAs identified through a built-by association analysis with respect to their neighboring protein-coding genes within IBD-susceptible loci. We further underscore their importance by highlighting their enrichment for various aspects of immune system regulation, including antigen processing/presentation, immune cell proliferation and differentiation, and chronic inflammatory responses. Finally, we summarize the potential of lncRNAs as diagnostic biomarkers in IBD.

Also flagged:chromatinlysosomal storage disordersmicrogliopathiesimmuno-deficienciestranscription factorTF
Journal Article 2018-12-06 ✓ 1 Snippet Shemer A, Grozovski J, Tay TL, Tao J, Volaski A, Süß P, Ardura-Fabregat A, Gross-Vered M, Kim JS, David E, Chappell-Maor L, Thielecke L, Glass CK, Cornils K, Prinz M, Jung S.
In-Text Gene Mentions

…nucleosome remodeling anddeacetylase corepressor complexcorepressor complex (NurD).…

Show Full Abstract

Microglia are yolk sac-derived macrophages residing in the parenchyma of brain and spinal cord, where they interact with neurons and other glial. After different conditioning paradigms and bone marrow (BM) or hematopoietic stem cell (HSC) transplantation, graft-derived cells seed the brain and persistently contribute to the parenchymal brain macrophage compartment. Here we establish that graft-derived macrophages acquire, over time, microglia characteristics, including ramified morphology, longevity, radio-resistance and clonal expansion. However, even after prolonged CNS residence, transcriptomes and chromatin accessibility landscapes of engrafted, BM-derived macrophages remain distinct from yolk sac-derived host microglia. Furthermore, engrafted BM-derived cells display discrete responses to peripheral endotoxin challenge, as compared to host microglia. In human HSC transplant recipients, engrafted cells also remain distinct from host microglia, extending our finding to clinical settings. Collectively, our data emphasize the molecular and functional heterogeneity of parenchymal brain macrophages and highlight potential clinical implications for HSC gene therapies aimed to ameliorate lysosomal storage disorders, microgliopathies or general monogenic immuno-deficiencies.

Also flagged:Synthesisnitrophenylcurcuminoidscyclooxygenase-1proteinase-activated receptor 1vitamin K epoxide reductase
Journal Article 2018-12-06 ✓ 2 Snippets Ahmed T, Khan AU, Abbass M, Filho ER, Ud Din Z, Khan A.
In-Text Gene Mentions

…I 2 ,antithrombin-III, factor-II and factor-X.…

…coagulation process areantithrombin-III(AT-III, PDB-ID: 2B4X),…

Show Full Abstract

In this study dibenzylidene ketone derivatives (2E,5E)-2-(4-methoxybenzylidene)-5-(4-nitrobenzylidene) cyclopentanone (AK-1a) and (1E,4E)-4-(4-nitrobenzylidene)-1-(4-nitrophenyl) oct-1-en-3-one (AK-2a) were newly synthesized, inspired from curcuminoids natural origin. Novel scheme was used for synthesis of AK-1a and AK-2a. The synthesized compounds were characterized by spectroscopic techniques. AK-1a and AK-2a showed high computational affinities (E-value > - 9.0 kcal/mol) against cyclooxygenase-1, cyclooxygenase-2, proteinase-activated receptor 1 and vitamin K epoxide reductase. AK-1a and AK-2a showed moderate docking affinities (E-value > - 8.0 kcal/mol) against mu receptor, kappa receptor, delta receptor, human capsaicin receptor, glycoprotein IIb/IIIa, prostacyclin receptor I<sub>2</sub>, antithrombin-III, factor-II and factor-X. AK-1a and AK-2a showed lower affinities (E-value > - 7.0 kcal/mol) against purinoceptor-3, glycoprotein-VI and purinergic receptor P<sub>2</sub>Y<sub>12</sub>. In analgesic activity, AK-1a and AK-2a decreased numbers of acetic acid-induced writhes (P < 0.001 vs. saline group) in mice. AK-1a and AK-2a significantly prolonged the latency time of mice (P < 0.05, P < 0.01 and P < 0.001 vs. saline group) in hotplate assay. AK-1a and AK-2a inhibited arachidonic acid and adenosine diphosphate induced platelet aggregation with IC<sub>50</sub> values of 65.2, 37.7, 750.4 and 422 µM respectively. At 30, 100, 300 and 1000 µM concentrations, AK-1a and AK-2a increased plasma recalcification time (P < 0.001 and P < 0.001 vs. saline group) respectively. At 100, 300 and 1000 µg/kg doses, AK-1a and AK-2a effectively prolonged bleeding time (P < 0.001 and P < 0.01 vs. saline group) respectively. Thus in-silico, in-vitro and in-vivo investigation of AK-1a and AK-2a reports their analgesic, antiplatelet and anticoagulant actions.

Also flagged:coronary artery diseasecardiovascular diseaseCytoskeletonRegulation of cell cycleSmooth Muscle Cell Differentiationmetabolic process
Journal Article 2018-12-06 No Snippets Lo Sardo V, Chubukov P, Ferguson W, Kumar A, Teng EL, Duran M, Zhang L, Cost G, Engler AJ, Urnov F, Topol EJ, Torkamani A, Baldwin KK.
Show Full Abstract

The 9p21.3 cardiovascular disease locus is the most influential common genetic risk factor for coronary artery disease (CAD), accounting for ∼10%-15% of disease in non-African populations. The ∼60 kb risk haplotype is human-specific and lacks coding genes, hindering efforts to decipher its function. Here, we produce induced pluripotent stem cells (iPSCs) from risk and non-risk individuals, delete each haplotype using genome editing, and generate vascular smooth muscle cells (VSMCs). Risk VSMCs exhibit globally altered transcriptional networks that intersect with previously identified CAD risk genes and pathways, concomitant with aberrant adhesion, contraction, and proliferation. Unexpectedly, deleting the risk haplotype rescues VSMC stability, while expressing the 9p21.3-associated long non-coding RNA ANRIL induces risk phenotypes in non-risk VSMCs. This study shows that the risk haplotype selectively predisposes VSMCs to adopt a cell state associated with CAD phenotypes, defines new VSMC-based networks of CAD risk genes, and establishes haplotype-edited iPSCs as powerful tools for functionally annotating the human genome.

Also flagged:cognitioncell proliferationcanceragarosedinucleotidetrinucleotide
Journal Article 2018-12-06 No Snippets Wirthlin M, Lima NCB, Guedes RLM, Soares AER, Almeida LGP, Cavaleiro NP, Loss de Morais G, Chaves AV, Howard JT, Teixeira MM, Schneider PN, Santos FR, Schatz MC, Felipe MS, Miyaki CY, Aleixo A, Schneider MPC, Jarvis ED, Vasconcelos ATR, Prosdocimi F, Mello CV.
Show Full Abstract

Parrots are one of the most distinct and intriguing groups of birds, with highly expanded brains [1], highly developed cognitive [2] and vocal communication [3] skills, and a long lifespan compared to other similar-sized birds [4]. Yet the genetic basis of these traits remains largely unidentified. To address this question, we have generated a high-coverage, annotated assembly of the genome of the blue-fronted Amazon (Amazona aestiva) and carried out extensive comparative analyses with 30 other avian species, including 4 additional parrots. We identified several genomic features unique to parrots, including parrot-specific novel genes and parrot-specific modifications to coding and regulatory sequences of existing genes. We also discovered genomic features under strong selection in parrots and other long-lived birds, including genes previously associated with lifespan determination as well as several hundred new candidate genes. These genes support a range of cellular functions, including telomerase activity; DNA damage repair; control of cell proliferation, cancer, and immunity; and anti-oxidative mechanisms. We also identified brain-expressed, parrot-specific paralogs with known functions in neural development or vocal-learning brain circuits. Intriguingly, parrot-specific changes in conserved regulatory sequences were overwhelmingly associated with genes that are linked to cognitive abilities and have undergone similar selection in the human lineage, suggesting convergent evolution. These findings bring novel insights into the genetics and evolution of longevity and cognition, as well as provide novel targets for exploring the mechanistic basis of these traits.

Also flagged:cancerColorectal CancerL1TD1EFCAB2PPP1R21immune response
Journal Article 2018-12-06 ✓ 1 Snippet Lu Y, Kweon SS, Tanikawa C, Jia WH, Xiang YB, Cai Q, Zeng C, Schmit SL, Shin A, Matsuo K, Jee SH, Kim DH, Kim J, Wen W, Shi J, Guo X, Li B, Wang N, Zhang B, Li X, Shin MH, Li HL, Ren Z, Oh JH, Oze I, Ahn YO, Jung KJ, Conti DV, Schumacher FR, Rennert G, Jenkins MA, Campbell PT, Hoffmeister M, Casey G, Gruber SB, Gao J, Gao YT, Pan ZZ, Kamatani Y, Zeng YX, Shu XO, Long J, Matsuda K, Zheng W.
In-Text Gene Mentions

SHISA6

Show Full Abstract

<h4>Background & aims</h4>Genome-wide association studies (GWASs) have associated approximately 50 loci with risk of colorectal cancer (CRC)-nearly one third of these loci were initially associated with CRC in studies conducted in East Asian populations. We conducted a GWAS of East Asians to identify CRC risk loci and evaluate the generalizability of findings from GWASs of European populations to Asian populations.<h4>Methods</h4>We analyzed genetic data from 22,775 patients with CRC (cases) and 47,731 individuals without cancer (controls) from 14 studies in the Asia Colorectal Cancer Consortium. First, we performed a meta-analysis of 7 GWASs (10,625 cases and 34,595 controls) and identified 46,554 promising risk variants for replication by adding them to the Multi-Ethnic Global Array (MEGA) for genotype analysis in 6445 cases and 7175 controls. These data were analyzed, along with data from an additional 5705 cases and 5961 controls genotyped using the OncoArray. We also obtained data from 57,976 cases and 67,242 controls of European descent. Variants at identified risk loci were functionally annotated and evaluated in correlation with gene expression levels.<h4>Results</h4>A meta-analyses of all samples from people of Asian descent identified 13 loci and 1 new variant at a known locus (10q24.2) associated with risk of CRC at the genome-wide significance level of P < 5 × 10<sup>-8</sup>. We did not perform experiments to replicate these associations in additional individuals of Asian ancestry. However, the lead risk variant in 6 of these loci was also significantly associated with risk of CRC in European descendants. A strong association (44%-75% increase in risk per allele) was found for 2 low-frequency variants: rs201395236 at 1q44 (minor allele frequency, 1.34%) and rs77969132 at 12p11.21 (minor allele frequency, 1.53%). For 8 of the 13 associated loci, the variants with the highest levels of significant association were located inside or near the protein-coding genes L1TD1, EFCAB2, PPP1R21, SLCO2A1, HLA-G, NOTCH4, DENND5B, and GNAS. For other intergenic loci, we provided evidence for the possible involvement of the genes ALDH7A1, PRICKLE1, KLF5, WWOX, and GLP2R. We replicated findings for 41 of 52 previously reported risk loci.<h4>Conclusions</h4>We showed that most of the risk loci previously associated with CRC risk in individuals of European descent were also associated with CRC risk in East Asians. Furthermore, we identified 13 loci significantly associated with risk for CRC in Asians. Many of these loci contained genes that regulate the immune response, Wnt signaling to β-catenin, prostaglandin E2 catabolism, and cell pluripotency and proliferation. Further analyses of these genes and their variants is warranted, particularly for the 8 loci for which the lead CRC risk variants were not replicated in persons of European descent.

Also flagged:Wilms TumorsChromosomeWT1tumorsgene expressionHACE1
Journal Article 2018-12-06 ✓ 2 Snippets Haruta M, Arai Y, Okita H, Tanaka Y, Takimoto T, Sugino RP, Yamada Y, Kamijo T, Oue T, Fukuzawa M, Koshinaga T, Kaneko Y.
In-Text Gene Mentions

…( ZBED6CL andSLC9C2) on non-16q…

…IGF2 expression), andSLC9C2[putative Na(+)/H(+) exchanger…

Show Full Abstract

To identify prognostic factors, array CGH (aCGH) patterns and mutations in WT1 and 9 other genes were analyzed in 128 unilateral Wilms tumors (WTs). Twenty patients had no aCGH aberrations, and 31 had WT1 alterations [silent and WT1 types: relapse-free survival (RFS), 95% and 83%, respectively]. Seventy-seven patients had aCGH changes without WT1 alterations (nonsilent/non-WT1 type) and were subtyped into those with or without +12, 11q-, 16q-, or HACE1 loss. RFS was better for those with than those without +12 (P = .010) and worse for those with than those without 11q-, 16q-, or HACE1 loss (P = .001, .025, or 1.2E-04, respectively). Silent and WT1 type and 8 subtype tumors were integrated and classified into 3 risk groups: low risk for the silent type and +12 subgroup; high risk for the no +12 plus 11q-, 16q-, or HACE1 loss subgroup; intermediate risk for the WT1 type and no +12 plus no 11q-, 16q-, or HACE1 loss subgroup. Among the 27 WTs examined, the expression of 146 genes on chromosome 12 was stronger in +12 tumors than in no +12 tumors, while that of 10 genes on 16q was weaker in 16q- tumors than in no 16q- tumors. Overexpression in 75 out of 146 upregulated genes and underexpression in 7 out of 10 downregulated genes correlated with better and worse overall survival, respectively, based on the public database. +12 was identified as a potential new marker predicting a favorable outcome, and chromosome abnormalities may be related to altered gene expression associated with these abnormalities.

Also flagged:gene expressionparvalbuminvision
Journal Article 2018-12-06 No Snippets Mukamel EA, Ngai J.
Show Full Abstract

The diversity of brain cell types was one of the earliest observations in modern neuroscience and continues to be one of the central concerns of current neuroscience research. Despite impressive recent progress, including single cell transcriptome and epigenome profiling as well as anatomical methods, we still lack a complete census or taxonomy of brain cell types. We argue this is due partly to the conceptual difficulty in defining a cell type. By considering the biological drivers of cell identity, such as networks of genes and gene regulatory elements, we propose a definition of cell type that emphasizes self-stabilizing regulation. We explore the predictions and hypotheses that arise from this definition. Integration of data from multiple modalities, including molecular profiling of genes and gene products, epigenetic landscape, cellular morphology, connectivity, and physiology, will be essential for a meaningful and broadly useful definition of brain cell types.

Also flagged:Deep Vein ThrombosisDVTpulmonary embolismPEvenous insufficiencyosteoarthritis
Journal Article 2018-12-06 ✓ 1 Snippet Kim JS.
In-Text Gene Mentions

…and a decreasedantithrombin-IIIlevel were significantly…

Show Full Abstract

In Western patient populations, the reported incidence of imaging-demonstrated deep vein thrombosis (DVT) after total hip arthroplasty (THA) is as high as 70% without prophylaxis. The reported rates of symptomatic pulmonary embolism (PE) after THA in recent studies range from 0.6% to 1.5%, and the risk of fatal PE ranges from 0.11% to 0.19% in the absence of prophylaxis. Predisposing factors to DVT in western patients include advanced age, previous venous insufficiency, osteoarthritis, obesity, hyperlipidemia, dietary and genetic factors. However, Asian patients who have undergone THA have a strikingly low prevalence of DVT and virtually no postoperative PE. Some authors suggest low clinical prothrombotic risk factors and the absence of some DVT-related genetic factors in Asian patient populations decrease the risk of DVT, PE or both. In Korea, the prevalence of DVT after THA without thromboprophylaxis have ranges from 6.8% to 43.8%, and asymptomatic PE have ranges from 0% to 12.9%; there have been only two reported cases of fatal PE. Deep-wound infections resulting from postoperative hematomas or prolonged wound drainage have been reported with routine thromboprophylaxis. The prevalence of DVT differs varies based on patient ethnicity. Guidelines for the use of thromboprophylaxis were altered and focus on the potential value of outcomes compared with possible complications (e.g., bleeding).

Also flagged:Calciumcarbonateapatitehydroxyapatiteformationmineral
Journal Article 2018-12-06 No Snippets Zakaria MN, Cahyanto A, El-Ghannam A.
Show Full Abstract

<h4>Background</h4>Carbonate apatite (CO<sub>3</sub>Ap) and silica-calcium phosphate composite (SCPC) are bone substitutes with good prospect for dental application. SCPC creates a hydroxyapatite surface layer and stimulate bone cell function while, CO<sub>3</sub>Ap induce apatite crystal formation with good adaptation providing good seal between cement and the bone. Together, these materials will add favorable properties as a pulp capping material to stimulate mineral barrier and maintain pulp vitality. The aim of this study is to investigate modification of CO<sub>3</sub>Ap cement combined with SCPC, later term as CO<sub>3</sub>Ap-SCPC cement (CAS) in means of its chemical (Calcium release) and physical properties (setting time, DTS and pH value).<h4>Methods</h4>The study consist of three groups; group 1 (100% calcium hydroxide, group 2 CO<sub>3</sub>Ap (60% DCPA: 40% vaterite, and group 3 CAS (60% DCPA: 20% vaterite: 20% SCPC. Distilled water was employed as a solution for group 1, and 0.2 mol/L Na<sub>3</sub>PO<sub>4</sub> used for group 2 and group 3.Samples were evaluated with respect to important properties for pulp capping application such as pH, setting time, mechanical strength and calcium release evaluation.<h4>Results</h4>The fastest setting time was in CO<sub>3</sub>Ap cement group without SCPC, while the addition of 20% SCPC slightly increase the pH value but did not improved the cement mechanical strength, however, the mechanical strength of both CO<sub>3</sub>Ap groups were significantly higher than calcium hydroxide. All three groups released calcium ions and had alkaline pH. Highest pH level, as well as calcium released level, was in the control group.<h4>Conclusion</h4>The CAS cement had good mechanical and acceptable chemical properties for pulp capping application compared to calcium hydroxide as a gold standard. However, improvements and in vivo studies are to be carried out with the further development of this material.

Also flagged:Gene ExpressionCancerEwing sarcomabone tumortumorAP-1
Journal Article 2018-12-06 No Snippets Hotfilder M, Mallela N, Seggewiß J, Dirksen U, Korsching E.
Show Full Abstract

One of the still open questions in Ewing sarcoma, a rare bone tumor with weak therapeutic options, is to identify the tumor-driving cell (sub) population and to understand the specifics in the biological network of these cells. This basic scientific insight might foster the development of more specific therapeutic target patterns. The experimental approach is based on a side population (SP) of Ewing cells, based on the model cell line CADO-ES1. The SP is established by flow cytometry and defined by the idea that tumor stem-like cells can be identified by the time-course in clearing a given artificial dye. The SP was characterized by a higher colony forming activity, by a higher differentiation potential, by higher resistance to cytotoxic drugs, and by morphology. Several SP and non-SP cell fractions and bone marrow-derived mesenchymal stem cell reference were analyzed by short read sequencing of the full transcriptome. The double-differential analysis leads to an altered expression structure of SP cells centered around the AP-1 and APC/c complex. The SP cells share only a limited proportion of the full mesenchymal stem cell stemness set of genes. This is in line with the expectation that tumor stem-like cells share only a limited subset of stemness features which are relevant for tumor survival.

Also flagged:TirucallaneTriterpenoidstriterpenoidPregnane–X–Receptortirucallanesprotoxylogranatin B
Journal Article 2018-12-06 No Snippets Jiang ZP, Luan ZL, Liu RX, Zhang Q, Ma XC, Shen L, Wu J.
Show Full Abstract

Ten new triterpenoid compounds with structure diversity of the C-17 side-chain, including nine tirucallanes, named xylocarpols A⁻E (<b>1</b>⁻<b>5</b>) and agallochols A⁻D (<b>6</b>⁻<b>9</b>), and an apotirucallane, named 25-dehydroxy protoxylogranatin B (<b>10</b>), were isolated from the mangrove plants <i>Xylocarpus granatum</i>, <i>Xylocarpus moluccensis</i>, and <i>Excoecaria agallocha</i>. The structures of these compounds were established by HR-ESIMS and extensive one-dimensional (1D) and two-dimensional (2D) NMR investigations. The absolute configurations of <b>1</b> and <b>2</b> were unequivocally determined by single-crystal X-ray diffraction analyses, conducted with Cu K<i>α</i> radiation; whereas those of <b>4</b>, <b>6</b>⁻<b>8</b> were assigned by a modified Mosher's method and the comparison of experimental electronic circular dichroism (ECD) spectra. Most notably, <b>5</b>, <b>6</b>, <b>7</b>, and <b>9</b> displayed potent activation effects on farnesoid⁻X⁻receptor (FXR) at the concentration of 10.0 μM; <b>10</b> exhibited very significant agonistic effects on pregnane⁻X⁻receptor (PXR) at the concentration of 10.0 nM.

Also flagged:Lipoproteinslipidapolipoproteinsphospholipidcholesterolamino acid
Journal Article 2018-12-06 ✓ 1 Snippet Afonso CB, Spickett CM.
In-Text Gene Mentions

…of Apolipoprotein E-III (ApoE-III) (normally present in…

Show Full Abstract

Lipoproteins are essential systemic lipid transport particles, composed of apolipoproteins embedded in a phospholipid and cholesterol monolayer surrounding a cargo of diverse lipid species. Many of the lipids present are susceptible to oxidative damage by lipid peroxidation, giving rise to the formation of reactive lipid peroxidation products (rLPPs). In view of the close proximity of the protein and lipid moieties within lipoproteins, the probability of adduct formation between rLPPs and amino acid residues of the proteins, a process called lipoxidation, is high. There has been interest for many years in the biological effects of such modifications, but the field has been limited to some extent by the availability of methods to determine the sites and exact nature of such modification. More recently, the availability of a wide range of antibodies to lipoxidation products, as well as advances in analytical techniques such as liquid chromatography tandem mass spectrometry (LC-MSMS), have increased our knowledge substantially. While most work has focused on LDL, oxidation of which has long been associated with pro-inflammatory responses and atherosclerosis, some studies on HDL, VLDL and Lipoprotein(a) have also been reported. As the broader topic of LDL oxidation has been reviewed previously, this review focuses on lipoxidative modifications of lipoproteins, from the historical background through to recent advances in the field. We consider the main methods of analysis for detecting rLPP adducts on apolipoproteins, including their advantages and disadvantages, as well as the biological effects of lipoxidized lipoproteins and their potential roles in diseases.

Also flagged:cytochrome P450 2E1ethanolHIVAIDSelvitegravirdarunavir
Journal Article 2018-12-06 ✓ 5 Snippets Gong Y, Rao PSS, Sinha N, Ranjit S, Cory TJ, Kumar S.
In-Text Gene Mentions

…of antioxidant enzymePRDX6.…

…Proteintech; Rosemont, IL),PRDX6(1:400, Proteintech), SOD1…

…SOD1, SOD2, andPRDX6, which are known…

…decrease (~20%) ofPRDX6protein expression was…

…decreased expression ofPRDX6after chronic ethanol…

Show Full Abstract

<h4>Background</h4>Alcohol consumption is considered to be a major health problem among people living with HIV/AIDS. Our previous reports have shown that ethanol reduced intracellular concentrations of antiretroviral drugs elvitegravir and darunavir in the HIV-1-infected U1 cell line. Ethanol also increased HIV-1 replication despite the presence of elvitegravir. Our previous finding has also shown that the levels of cytochrome P450 enzyme 2E1 (CYP2E1) and oxidative stress in blood monocytes were induced, while the concentration of alcohol in the plasma was reduced in HIV-1-infected alcohol users compared to uninfected alcohol users. However, the role of CYP2E1 in ethanol-enhanced oxidative stress and HIV-1 replication is still unclear.<h4>Methods</h4>This study examined the chronic effects (14 days) of ethanol on HIV viral load, oxidative DNA damage, expression of CYP2E1, expression of antioxidant enzymes (AOEs), expression of reactive oxygen species (ROS) in human monocyte-derived macrophages (MDM). Further, to evaluate the role of CYP2E1 in mediating ethanol-induced viral replication, CYP2E1 siRNA and CYP2E1 selective inhibitor were used in the HIV-1-infected U1 cell line following ethanol treatment.<h4>Results</h4>Chronic ethanol exposure demonstrated an increase in oxidative DNA damage and CYP2E1 expression in both non-infected and HIV-1-infected MDM. Our results showed that ethanol chronic exposure increased HIV-1 replication by ~3-fold in HIV-1-infected MDM. This ethanol-enhanced HIV-1 replication was associated with an increased oxidative DNA damage, an increased expression of CYP2E1, and a decreased expression of antioxidant enzyme PRDX6. In HIV-1-infected U1 cell line, we observed a decreased viral replication (~30%) and a decreased DNA damage (~100%) after repression of CYP2E1 by siRNA, upon ethanol exposure. We also observed a decreased viral replication (~25%) after inhibition of CYP2E1 by using selective CYP2E1 inhibitor.<h4>Conclusions</h4>The data suggest that chronic ethanol exposure increases HIV-1 replication in MDM, at least in part, through CYP2E1-mediated oxidative stress. These results are clinically relevant to potentially find effective treatment strategies for HIV-1-infected alcohol users.

Also flagged:AutophagyProtein Secretionorganelle degradationcytoplasmicresponse to stresssecretion
Journal Article 2018-12-06 No Snippets Cotzomi-Ortega I, Aguilar-Alonso P, Reyes-Leyva J, Maycotte P.
Show Full Abstract

Autophagy is a protein and organelle degradation pathway important for the maintenance of cytoplasmic homeostasis and for providing nutrients for survival in response to stress conditions. Recently, autophagy has been shown to be important for the secretion of diverse proteins involved in inflammation, intercellular signaling, and cancer progression. The role of autophagy in cancer depends on the stage of tumorigenesis, serving a tumor-suppressor role before transformation and a tumor-survival function once a tumor is established. We review recent evidence demonstrating the complexity of autophagy regulation during cancer, considering the interaction of autophagy with protein secretion pathways. Autophagy manipulation during cancer treatment is likely to affect protein secretion andinter-cellular signaling either to the neighboring cancer cells or to the antitumoral immune response. This will be an important consideration during cancer therapy since several clinical trials are trying to manipulate autophagy in combination with chemotherapy for the treatment of diverse types of cancers.

Also flagged:cancerscancerbladder urothelial carcinomabreast invasive carcinomahead and neck squamous cell carcinomarenal clear cell carcinoma
Journal Article 2018-12-06 No Snippets Li X, Yu X, He Y, Meng Y, Liang J, Huang L, Du H, Wang X, Liu W.
Show Full Abstract

<h4>Background</h4>Accumulating evidences demonstrated that microRNA-target gene pairs were closely related to tumorigenesis and development. However, the correlation between miRNA and target gene was insufficiently understood, especially its changes between tumor and normal tissues.<h4>Objectives</h4>The aim of this study was to evaluate the changes of correlation of miRNAs-target pairs between normal and tumor.<h4>Materials and methods</h4>5680 mRNA and 5740 miRNA expression profiles of 11 major human cancers were downloaded from the Cancer Genome Atlas (TCGA). The 11 cancer types were bladder urothelial carcinoma, breast invasive carcinoma, head and neck squamous cell carcinoma, kidney chromophobe, kidney renal clear cell carcinoma, kidney renal papillary cell carcinoma, liver hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, stomach adenocarcinoma, and thyroid carcinoma. For each cancer type, we firstly obtained differentially expressed miRNAs (DEMs) and genes (DEGs) in tumor and then acquired critical miRNA-target gene pairs by combining DEMs, DEGs and two experimentally validated miRNA-target interaction databases, miRTarBase and miRecords. We collected samples with both miRNA and mRNA expression values and performed a correlation analysis by Pearson method for miRNA-target pairs in normal and tumor, respectively.<h4>Results</h4>We totally got 4743 critical miRNA-target pairs across 11 cancer types, and 4572 of them showed weaker correlation in tumor than in normal. The average correlation coefficients of miRNA-target pairs were different greatly between normal (-0.38 ~ -0.61) and tumor (-0.04 ~ -0.26) for 11 cancer type. The pan-cancer network, which consisted of 108 edges connecting 35 miRNAs and 89 target genes, showed the interactions of pairs appeared in multicancers.<h4>Conclusions</h4>This comprehensive analysis revealed that correlation between miRNAs and target genes was greatly reduced in tumor and these critical pairs we got were involved in cellular adhesion, proliferation, and migration. Our research could provide opportunities for investigating cancer molecular regulatory mechanism and seeking therapeutic targets.

Also flagged:nucleasesoligodeoxynucleotidestranscription activator-like effector nucleaseszinc-finger nucleasesCas9nuclease
Journal Article 2018-12-06 ✓ 1 Snippet Saha SK, Saikot FK, Rahman MS, Jamal MAHM, Rahman SMK, Islam SMR, Kim KH.
In-Text Gene Mentions

NHEJ with programmable nucleases was successfully used to inactivate the HTT gene in HD and the FGFR3 gene in achondroplasia.

Show Full Abstract

Targeted genome editing is an advanced technique that enables precise modification of the nucleic acid sequences in a genome. Genome editing is typically performed using tools, such as molecular scissors, to cut a defined location in a specific gene. Genome editing has impacted various fields of biotechnology, such as agriculture; biopharmaceutical production; studies on the structure, regulation, and function of the genome; and the creation of transgenic organisms and cell lines. Although genome editing is used frequently, it has several limitations. Here, we provide an overview of well-studied genome-editing nucleases, including single-stranded oligodeoxynucleotides (ssODNs), transcription activator-like effector nucleases (TALENs), zinc-finger nucleases (ZFNs), and CRISPR-Cas9 RNA-guided nucleases (CRISPR-Cas9). To this end, we describe the progress toward editable nuclease-based therapies and discuss the minimization of off-target mutagenesis. Future prospects of this challenging scientific field are also discussed.

Also flagged:homocysteinemetabolismeye diseasesvisionRetinovascular diseasediabetic retinopathy
Journal Article 2018-12-05 No Snippets Singh M, George AK, Homme RP, Majumder A, Laha A, Sandhu HS, Tyagi SC.
Show Full Abstract

<h4>Purpose</h4>To characterize the global profile of circular RNAs (circRNAs) and their differential expression levels in homocysteine (Hcy)-treated ARPE-19 cells, a line of human retinal pigment epithelial (RPE) cells.<h4>Materials and methods</h4>We treated ARPE-19 cells with and without Hcy to investigate the influence of Hcy on circRNA expression levels using dedicated human circRNA microarrays.<h4>Results</h4>A total of 12,233 circRNAs were identified out of them 54 were differentially expressed (17 were down-regulated, and 37 were up-regulated) with a fold change >2.0 (p < 0.05) in Hcy-treated versus untreated cells.<h4>Conclusions</h4>To our knowledge, this is the first report profiling circRNAs in human RPE cells post-Hcy treatment mimicking hyperhomocysteinemic (HHcy) conditions that negatively affect retinal biology and vision. These findings are of potential clinical significance as they will help understand Hcy metabolism and HHcy-mediated diseases and identify potential diagnostic and therapeutic targets for eye diseases that are caused by elevated Hcy concentrations.

Also flagged:lipidmembranesmembranewaterethylene glycolethylene glycol)s
Journal Article 2018-12-05 No Snippets Liu C, Ewert KK, Wonder E, Kohl P, Li Y, Qiao W, Safinya CR.
Show Full Abstract

Complex materials often achieve their remarkable functional properties by hierarchical assembly of building blocks via competing and/or synergistic interactions. Here, we describe the properties of new double-end-anchored poly(ethylene glycol)s (DEA-PEGs)-macromolecules designed to impart hydrophobically mediated tethering attractions between charged lipid membranes. We synthesized DEA-PEGs (MW 2000 (2K) and 4.6K) with two double-tail (symmetric) or a double-tail and a single-tail (asymmetric) hydrophobic end anchors and characterized their equilibrium and kinetic properties using small-angle X-ray scattering. Control multilayer membranes without and with PEG lipid (i.e., single-end-anchored PEG) swelled continuously, with the interlayer spacing increasing between 30 and 90 wt % water content due to electrostatic as well as, in the case of PEG lipid, steric repulsion. In contrast, interlayer spacings in lamellar membrane hydrogels containing DEA-PEGs expanded over a limited water dilution range and reached a "locked" state, which displayed a near constant membrane wall-to-wall spacing (δ<sub>w</sub>) with further increases in water content. Remarkably, the locked state displays a simple relation to the PEG radius of gyration δ<sub>w</sub> ≈ 1.6 R<sub>G</sub> for both 2K and 4.6K PEG. Nevertheless, δ<sub>w</sub> being considerably less than the physical size of PEG (2(5/3)<sup>1/2</sup> R<sub>G</sub>) is highly unexpected and implies that, compared to free PEG, anchoring of the PEG tether at both ends leads to a considerable distortion of the PEG conformation confined between layers. Significantly, the lamellar hydrogel may be designed to reversibly transition from a locked to an unlocked (membrane unbinding) state by variations in the DEA-PEG concentration, controlling the strength of the interlayer attractions due to bridging conformations. The findings with DEA-PEGs have broad implications for hydrophobic-mediated assembly of lipid- or surfactant-coated building blocks with distinct shape and size, at predictable spacing, in aqueous environments.

Also flagged:chronic pelvic pain syndromePaintissue remodelingMMP2MMP9NGAL
Journal Article 2018-12-05 No Snippets Woodworth DC, Dagher A, Curatolo A, Sachdev M, Ashe-McNalley C, Naliboff BD, Labus JS, Landis JR, Kutch JJ, Mayer EA, Lee RS, Moses MA, Ellingson BM, MAPP Research Network.
Show Full Abstract

The Multidisciplinary Approach to the Study of Chronic Pelvic Pain (MAPP) Research Network has yielded neuroimaging and urinary biomarker findings that highlight unique alterations in brain structure and in urinary proteins related to tissue remodeling and vascular structure in patients with Urological Chronic Pelvic Pain Syndrome (UCPPS). We hypothesized that localized changes in diffusion tensor imaging (DTI) measurements might be associated with corresponding changes in urinary protein levels in UCPPS. To test this hypothesis, we created statistical parameter maps depicting the linear correlation between DTI measurements (fractional anisotropy (FA) and apparent diffusion coefficient (ADC)) and urinary protein quantification (MMP2, MMP9, NGAL, MMP9/NGAL complex, and VEGF) in 30 UCPPS patients from the MAPP Research Network, after accounting for clinical covariates. Results identified a brainstem region that showed a strong correlation between both ADC (R2 = 0.49, P<0.0001) and FA (R2 = 0.39, P = 0.0002) with urinary MMP9 levels as well as a correlation between both ADC (R2 = 0.42, P = 0.0001) and FA (R2 = 0.29, P = 0.0020) and urinary MMP9/NGAL complex. Results also identified significant correlations between FA and urinary MMP9 in white matter adjacent to sensorimotor regions (R2 = 0.30, P = 0.002; R2 = 0.36, P = 0.0005, respectively), as well as a correlation in similar sensorimotor regions when examining ADC and urinary MMP2 levels (R2 = 0.42, P<0.0001) as well as FA and urinary MMP9/NGAL complex (R2 = 0.33, P = 0.0008). A large, diffuse cluster of white matter was identified as having a strong correlation between both ADC (R2 = 0.35, P = 0.0006) and FA (R2 = 0.43, P<0.0001) with urinary NGAL levels. In contrast, no significant association between DTI measurements and VEGF was observed. Results suggest that elevated MMP9 or MMP9/NGAL in UCPPS may be related to degenerative neuronal changes in brainstem nuclei through excitotoxicity, while also facilitating synaptic plasticity in sensorimotor regions.

Also flagged:gene expressionRAScancerKRASLUADCOAD
Journal Article 2018-12-05 No Snippets Yi M, Zhu R, Stephens RM.
Show Full Abstract

Accurate assessment of the association between continuous variables such as gene expression and survival is a critical aspect of precision medicine. In this report, we provide a review of some of the available survival analysis and validation tools by referencing published studies that have utilized these tools. We have identified pitfalls associated with the assumptions inherent in those applications that have the potential to impact scientific research through their potential bias. In order to overcome these pitfalls, we have developed a novel method that enables the logrank test method to handle continuous variables that comprehensively evaluates survival association with derived aggregate statistics. This is accomplished by exhaustively considering all the cutpoints across the full expression gradient. Direct side-by-side comparisons, global ROC analysis, and evaluation of the ability to capture relevant biological themes based on current understanding of RAS biology all demonstrated that the new method shows better consistency between multiple datasets of the same disease, better reproducibility and robustness, and better detection power to uncover biological relevance within the selected datasets over the available survival analysis methods on univariate gene expression and penalized linear model-based methods.

Also flagged:Huntington's diseaseHDautosomal dominant progressive neurodegenerative diseasecognitive impairmentsglutamategamma-amino butyric acid
Journal Article 2018-12-05 ✓ 5 Snippets Hsu YT, Chang YG, Chern Y.
In-Text Gene Mentions

Therefore, mutant HTT might interfere with the transcriptional machinery to reduce the expression levels of KCC2 and GABAA receptor subunits in HD brains.

Huntington's disease (HD) is a progressive and autosomal dominant neurodegenerative disorder that is caused by a CAG repeat expansion in exon 1 of the huntingtin (htt) gene on the short arm of chromosome 4.

The interaction of HTT and KCC2 was demonstrated in the hippocampus of wild-type and HD mice (R6/2) using coimmunoprecipitation assays.

Neuronal intranuclear inclusions of mutant HTT protein are the characteristic neuropathology of HD, and these inclusions cause extensive cell loss throughout the brain, especially the striatum and cortex.

In contrast to the R6 lines of HD mice, seizures are not present in another early onset HD mouse model, N171-82Q mice, which carry a cDNA fragment encoding an N-terminal fragment of HTT with 82 glutamines and express mHTT only in neurons [43].

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant progressive neurodegenerative disease that is characterized by a triad of motor, psychiatric and cognitive impairments. There is still no effective therapy to delay or halt the disease progress. The striatum and cortex are two particularly affected brain regions that exhibit dense reciprocal excitatory glutamate and inhibitory gamma-amino butyric acid (GABA) connections. Imbalance between excitatory and inhibitory signalling is known to greatly affect motor and cognitive processes. Emerging evidence supports the hypothesis that disrupted GABAergic circuits underlie HD pathogenesis. In the present review, we focused on the multiple defects recently found in the GABAergic inhibitory system, including altered GABA level and synthesis, abnormal subunit composition and distribution of GABA<sub>A</sub> receptors and aberrant GABA<sub>A</sub> receptor-mediated signalling. In particular, the important role of cation-chloride cotransporters (i.e. NKCC1 and KCC2) is discussed. Recent studies also suggest that neuroinflammation contributes significantly to the abnormal GABAergic inhibition in HD. Thus, GABA<sub>A</sub> receptors and cation-chloride cotransporters are potential therapeutic targets for HD. Given the limited availability of therapeutic treatments for HD, a better understanding of GABAergic dysfunction in HD could provide novel therapeutic opportunities.

Also flagged:Patent ductus arteriosusChorioamnionitisgentamicinsepsisbronchopulmonary dysplasiaTFAP2B
Journal Article 2018-12-05 ✓ 1 Snippet Dagle JM, Ryckman KK, Spracklen CN, Momany AM, Cotten CM, Levy J, Page GP, Bell EF, Carlo WA, Shankaran S, Goldberg RN, Ehrenkranz RA, Tyson JE, Stoll BJ, Murray JC, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
In-Text Gene Mentions

PTGIS

Show Full Abstract

<h4>Objective</h4>Patent ductus arteriosus (PDA) is a commonly observed condition in preterm infants. Prior studies have suggested a role for genetics in determining spontaneous ductal closure. Using samples from a large neonatal cohort we tested the hypothesis that common genetic variations are associated with PDA in extremely preterm infants.<h4>Study design</h4>Preterm infants (n = 1013) enrolled at NICHD Neonatal Research Network sites were phenotyped for PDA. DNA was genotyped for 1634 single nucleotide polymorphisms (SNPs) from candidate genes. Analyses were adjusted for ancestral eigenvalues and significant epidemiologic variables.<h4>Results</h4>SNPs in several genes were associated with the clinical diagnosis of PDA and with surgical ligation in extremely preterm neonates diagnosed with PDA (p < 0.01). None of the associations were significant after correction for multiple comparisons.<h4>Conclusion</h4>We identified several common genetic variants associated with PDA. These findings may inform further studies on genetic risk factors for PDA in preterm infants.

Also flagged:gadoliniumwaterAnderson-Fabry diseasecardiac amyloidosisironheart failure
Journal Article 2018-12-05 ✓ 1 Snippet Granitz M, Motloch LJ, Granitz C, Meissnitzer M, Hitzl W, Hergan K, Schlattau A.
In-Text Gene Mentions

…iron deposits inhemochromatosis[ 5 –…

Show Full Abstract

<h4>Background</h4>Myocardial native T1 and T2 mapping are promising techniques for quantitative assessment of diffuse myocardial pathologies; however, due to conflicting data regarding normal values, routine clinical implementation of this method is still challenging.<h4>Methods</h4>To evaluate this situation during daily clinical practice the characteristics of normal values obtained in 60 healthy volunteers who underwent magnetic resonance imaging (MRI) scans on 1.5T and 3T scanners were studied. The T1 modified look-locker inversion recovery (MOLLI; 5(3)3; modified for higher heart rates) and T2 navigator gated black-blood prepared gradient-spin-echo (GraSE) sequences were used.<h4>Results</h4>While age and body mass index did not affect relaxation times, a gender and heart rate dependency was found showing higher T1 and T2 values in females, whereas at higher heart rates a prolongation of T1 and a shortening of T2 relaxation times was found. Particularly prone to artifacts were T2 measurements at 3T and the inferolateral wall. In the individual setting mean relaxation times for T1 were 995.8 ± 30.9 ms at 1.5T and 1183.8 ± 37.5 ms at 3T and 55.8 ± 2.8 ms at 1.5T and 51.6 ± 3 ms at 3T for T2 indicating a high dependency of reference values on MRI protocol when compared to the literature. Furthermore, as presumed mean T1 and T2 values correlated in the same individual.<h4>Conclusions</h4>The T1 and T2 relaxation times depend on physiological factors and especially on MRI protocols. Therefore, reference values should be validated individually in every radiological institution before implementing mapping protocols in daily clinical practice. Correlation of mean T1 and T2 values in the same proband at both field strengths indicates intraindividual reproducibility.

Also flagged:TTC17cancersesophageal squamous cell carcinomaESCCpolymerasewound-healing
Journal Article 2018-12-05 ✓ 1 Snippet Wang Q, Zhang Q, Sun H, Tang W, Yang L, Xu Z, Liu Z, Jin H, Cao X.
In-Text Gene Mentions

…the study ofDCC(a tumor suppressor…

Show Full Abstract

<h4>Background</h4>Circular RNAs (circRNAs), a special class of noncoding RNAs with the characteristic of covalent closed-loop structure, have been widely found in various organisms. Growing evidence has shown that circRNAs play a crucial role in regulating biological functions of cancers. However, the specific role of circRNAs in esophageal squamous cell carcinoma (ESCC) remains largely unknown.<h4>Aim</h4>The present study aims to investigate the effects of circ-TTC17 in ESCC clinical samples as well as cells.<h4>Methods</h4>Sanger sequencing and agarose gel electrophoresis were used to verify the specificity of circ-TTC17. Expression levels of circ-TTC17 in ESCC cells, plasma, and tissues were measured by quantitative real-time polymerase chain reaction. A colony formation experiment, CCK-8 assay, and wound-healing assay were applied to detect the functions of circ-TTC17 in KYSE30 and KYSE450 cells. A nucleus-cytoplasm fractionation experiment was used to probe the location of circ-TTC17 in ESCC cells. Finally, a network of circ-TTC17 with its targeted miRNAs interactions and corresponding mRNAs was analyzed and framed by bioinformatics.<h4>Results</h4>The expression level of circ-TTC17 was found to be significantly higher in ESCC cells, plasma, and tissues compared with normal cases. In vitro experiments indicated that circ-TTC17 promoted proliferation and migration of ESCC cells. Bioinformatics predictions showed that circ-TTC17 might regulate progress of ESCC by acting as a sponge for microRNAs (miRNAs).<h4>Conclusions</h4>The results of this study demonstrate that upregulated circ-TTC17 plays a key role in promoting proliferation and migration of ESCC cells and has potential to become a novel biomarker for diagnosis, treatment, and prognosis of ESCC in the future.

Also flagged:Gene Expressioncancerhematopoiesisgene-expressionnucleusApoe
Journal Article 2018-12-05 ✓ 1 Snippet Wu Y, Tamayo P, Zhang K.
In-Text Gene Mentions

DCC

Show Full Abstract

High-throughput single-cell gene expression profiling has enabled the definition of new cell types and developmental trajectories. Visualizing these datasets is crucial to biological interpretation, and a popular method is t-stochastic neighbor embedding (t-SNE), which visualizes local patterns well but distorts global structure, such as distances between clusters. We developed similarity weighted nonnegative embedding (SWNE), which enhances interpretation of datasets by embedding the genes and factors that separate cell states on the visualization alongside the cells and maintains fidelity when visualizing local and global structure for both developmental trajectories and discrete cell types. SWNE uses nonnegative matrix factorization to decompose the gene expression matrix into biologically relevant factors; embeds the cells, genes, and factors in a 2D visualization; and uses a similarity matrix to smooth the embeddings. We demonstrate SWNE on single-cell RNA-seq data from hematopoietic progenitors and human brain cells. SWNE is available as an R package at github.com/yanwu2014/swne.

Also flagged:laccasemulticopper oxidaseLaccase-like multicopper oxidasesoxidasesphenolic compoundsLMCO
Journal Article 2018-12-05 ✓ 1 Snippet Zerva A, Koutroufini E, Kostopoulou I, Detsi A, Topakas E.
In-Text Gene Mentions

…isoforms of thehistone deacetylase complexdeacetylase complex (HDAC).…

Show Full Abstract

Laccase-like multicopper oxidases (LMCOs) are a heterogeneous group of oxidases, acting mainly on phenolic compounds and which are widespread among many microorganisms, including Basidiomycetes and Ascomycetes. Here, we report the cloning, heterologous expression, purification and characterization of a novel LMCO from the thermophilic fungus Thermothelomyces thermophila. The 1953 bp lmco gene sequence comprises of 3 exons interrupted by 2 introns and according to the LccED database the translated sequence belongs to superfamily 6 of multicopper oxidases. After removal of the introns, the gene was transformed into Pichia pastoris, under the control of the alcohol oxidase (AOX1) promoter. The heterologous enzyme was purified with an apparent molecular weight of 80 kDa. TtLMCO1 displayed optimum activity at pH 4 and 50 °C and appeared thermostable up to 50 °C. A variety of phenolic compounds were oxidized by TtLMCO1, including standard laccase substrates such as ABTS and 2,6 dimethoxyphenol. The UV/Vis spectrum of purified TtLMCO1 indicates that it belongs to yellow laccase-like oxidases. The enzyme was used for the bioconversion of 2',3,4-trihydroxychalcone to 3',4'-dihydroxy-aurone, a bioactive aurone recently shown to possess inhibitory activity against several isoforms of the histone deacetylase complex (HDAC). Overall, the thermophilic yellow LMCO TtLMCO1 presents a number of superior properties with potential use in industrial biocatalysis.

Also flagged:PeptidesNicotinamide adenine phosphate (NADPH) oxidase type 2Nox2oxygenacute inflammatory diseasesRac
Journal Article 2018-12-05 ✓ 5 Snippets Fisher AB, Dodia C, Feinstein SI.
In-Text Gene Mentions

Lipid binding of phosphorylated Prdx6 at the cell membrane is primarily to phosphatidylcholine and the PLA2 activity of Prdx6 with this substrate generates lysophosphatidylcholine (LPC) that, in turn, can be converted via lysophospholipase D activity to lysophosphatidic acid (LPA).

Following these initial observations, we identified a 16 amino acid (aa) peptide sequence in SP-A that binds to Prdx6 and inhibits its aiPLA2 activity [26].

Based on protein docking software, we previously identified a 16 amino acid (aa) peptide derived from rat SP-A as the Prdx6 binding motif.

…SP-A as thePrdx6binding motif.…

…of peroxiredoxin 6 (Prdx6), called aiPLA 2…

Show Full Abstract

Nicotinamide adenine phosphate (NADPH) oxidase type 2 (Nox2), a major source of reactive oxygen species in lungs, plays an important role in tissue damage associated with acute inflammatory diseases. The phospholipase A₂ (PLA₂) activity of peroxiredoxin 6 (Prdx6), called aiPLA₂, is required for Nox2 activation through its role in the cellular generation of Rac, a key cytosolic component of the activation cascade. Lung surfactant protein A (SP-A) binds to Prdx6, inhibits its aiPLA₂ activity, and prevents activation of Nox2. Based on protein docking software, we previously identified a 16 amino acid (aa) peptide derived from rat SP-A as the Prdx6 binding motif. We now identify the minimal effective sequences of rat/mouse and human SP-A as 9-aa sequences that we have called PLA₂-inhibitory peptide (PIP).These sequences are PIP-1, rat/mouse; PIP-2, human; and PIP-3, a hybrid of PIPs 1&amp;2. aiPLA₂ activity in vitro was inhibited by 50% with ~7⁻10 µg PIP/µg Prdx6. Inhibition of the aiPLA₂ activity and Nox2 activation of lungs in vivo was similar for intratracheal (IT) and intravenous (IV) administration of PIP-2, but required its incorporation into liposomes as a delivery vehicle; tissue ½ time for decrease of the in vivo inhibition of aiPLA₂ activity after PIP-2 administration was ~50 h. These properties suggest that PIP-2 could be an effective therapeutic agent to prevent tissue injury associated with lung inflammation.

Also flagged:Carbongold nanoparticlescarboxylic group-carbon nanotubeschitosan
Journal Article 2018-12-05 No Snippets Wang Y, Zhang L, Peng D, Xie S, Chen D, Pan Y, Tao Y, Yuan Z.
Show Full Abstract

T-2 toxin (T-2) is one of major concern mycotoxins acknowledged as an unavoidable contaminant in human foods, animal feeds and also agriculture products. Thus, a facile and sensitive method is essential for accurate T-2 toxin detection. In our work, a specific electrochemical immunosensor based on gold nanoparticles/carboxylic group-functionalized single-walled carbon nanotubes/chitosan (AuNPs/cSWNTs/CS) composite was established. The mechanism of the electrochemical immunosensor was an indirect competitive binding to a given amount of anti-T-2 between free T-2 and T-2-bovine serum albumin, which was conjugated on covalently functionalized cSWNTs decorated on the glass carbon electrode. Afterwards, the alkaline phosphatase labeled anti-mouse secondary antibody was bound to the electrode surface by reacting with the primary antibody. Lastly, alkaline phosphatase catalyzed the hydrolysis of the substrate α-naphthyl phosphate, which produced an electrochemical signal. Compared with conventional methods, the established immunosensor was more sensitive and simpler. Under optimal conditions, this method could quantitatively detect T-2 from 0.01 to 100 μg·L<sup>-1</sup> with a detection limit of 0.13 μg·L<sup>-1</sup> and favorable recovery 91.42⁻102.49%. Moreover, the immunosensor was successfully applied to assay T-2 in feed and swine meat, which showed good correlation with the results obtained from liquid chromatography-tandem mass spectrometry (LC-MS/MS).

Also flagged:SynthesisPaclitaxelcancerglucosesuccinateβ-glucuronidase
Journal Article 2018-12-05 No Snippets Mao Y, Zhang Y, Luo Z, Zhan R, Xu H, Chen W, Huang H.
Show Full Abstract

Paclitaxel (PTX) is a famous anti-cancer drug with poor aqueous solubility. In clinical practices, Cremophor EL (polyethoxylated castor oil), a toxic surfactant, is used for dissolution of PTX, which accounts for serious side effects. In the present study, a single glucose-conjugated PTX prodrug (SG-PTX) and a double glucose-conjugated PTX prodrug (DG-PTX) were synthesized with a glycosylated strategy via succinate linkers. Both of the two prodrugs presented significant solubility improvement and drug-like lipophilicities. Compared to DG-PTX, SG-PTX manifested more promising release of the parent drug in serum. A high percentage of PTX released from SG-PTX could be detected after enzymatic hydrolysis of β-glucuronidase. Besides, both of the two prodrugs exhibited effective cytotoxicity against breast cancer cells and ovarian cancer cells, but presented reduced cytotoxicity against normal breast cells. Moreover, SG-PTX manifested impressive solubility in a low toxic formulation (without ethanol) with a different percentage of Cremophor EL. These results indicated that glycosylation is a promising strategy for PTX modification and SG-PTX may be a feasible and potential type of PTX prodrug. In addition, ethanol-free formulation with a low percentage of Cremophor EL might have the potential to develop a safer formulation for further studies of glycosylated PTX prodrugs.

Also flagged:Calciummineralizationmetabolismmineralwaterhydroxyapatite
Journal Article 2018-12-05 No Snippets Vannucci L, Fossi C, Quattrini S, Guasti L, Pampaloni B, Gronchi G, Giusti F, Romagnoli C, Cianferotti L, Marcucci G, Brandi ML.
Show Full Abstract

Calcium is an essential element that plays numerous biological functions in the human body, of which one of the most important is skeleton mineralization. Bone is a mineralized connective tissue in which calcium represents the major component, conferring bone strength and structure. Proper dietary calcium intake is important for bone development and metabolism, and its requirement can vary throughout life. The mineral composition of drinking water is becoming relevant in the modulation of calcium homeostasis. In fact, calcium present in mineral drinking waters is an important quantitative source of calcium intake. This, together with its excellent bioavailability, contributes to the maintenance of the bone health. This article aims to examine studies that assessed the bioavailability of the calcium contained in calcium-rich mineral waters and their impact on bone health, including original data collected in a recent study in humans.

Also flagged:dementiacognitionbehavioralcognitive impairmentinfectionsaggression
Journal Article 2018-12-05 No Snippets Lau BHP, Lou VW, Cheung KSL.
Show Full Abstract

<h4>Objective</h4>This study investigates the feasibility of using the Exemplary Care Scale (ECS) among Chinese dementia familial caregivers, and reports its psychometric properties.<h4>Method</h4>Back translation was used to develop the Chinese version of ECS (C-ECS). Three hundred and ninety-seven dyads of caregivers and their relatives with dementia responded to an assessment battery which included questions on care recipients' cognition, behavioral and psychological symptoms, daily activities assistance, social support, and caregiver well-being.<h4>Results</h4>Results of an exploratory principal component analysis revealed two subscales in the 11-item C-ECS: considerate caregiving and preserving esteem. C-ECS and its subscales demonstrated sufficient reliability, as well as criteria-related validity through its association with care recipient's cognition and health, and caregivers' well-being and social support.<h4>Discussion</h4>Our findings provide preliminary support to C-ECS as a reliable and valid measure of exemplary caregiving among Hong Kong Chinese familial dementia caregivers. In the light of the increasing importance of familial care in dementia care planning, we recommend the use of this brief scale in regular caregiver assessment in research and service delivery.

Also flagged:NELFCDcolorectal cancercells proliferationchromosomecell proliferationtumor
Journal Article 2018-12-05 ✓ 4 Snippets Song S, Li D, Yang C, Yan P, Bai Y, Zhang Y, Hu G, Lin C, Li X.
In-Text Gene Mentions

Silencing DDX27 exerted the opposite effects in vitro and significantly inhibited murine xenograft tumor growth and lung metastasis in vivo.20 TM9SF4 (20q11.21) has been found to modulate tumor pH alterations, which are associated with drug resistance and invasiveness of colon cancer cells.21 PALGL2 (20q11.21) has also been reported to serve as a tumor oncogene in the development and progression of CRC.22

…12DDX27(20q13.13) has been…

…Ectopic expression ofDDX27increased CRC cell…

…SilencingDDX27exerted the opposite…

Show Full Abstract

<h4>Purpose</h4>Negative elongation factor complex member C/D (NELFCD), mapped to chromosome 20q13.32, has been found to be significantly overexpressed in colorectal cancer (CRC) by our previous research. However, whether its overexpression contributes to CRC development is unknown. We aimed to explore the biological and clinical roles of NELFCD in CRC.<h4>Materials and methods</h4>The expression of NELFCD was detected by qRT-PCR and Western blot. The biological function of NELFCD on CRC cell proliferation, migration, invasion, and apoptosis was detected by cell counting kit-8, plate colony formation assay, transwell migration and invasion assays, and flow cytometry in vitro and by murine xenograft tumor growth in vivo. Moreover, we evaluated the correction between its expression level and clinicopathologic parameters.<h4>Results</h4>We found NELFCD was overexpressed in 50 pairs of CRC tissues in comparison to the adjacent nontumor tissues (<i>P</i><0.05). Knockdown of NELFCD significantly impaired cell proliferation, migration and invasion abilities, facilitated cell apoptosis in vitro, and inhibited tumorigenesis of CRC cells in vivo. NELFCD levels were remarkably connected with tumor location in CRC patients.<h4>Conclusion</h4>NELFCD is overexpressed and plays an oncogenic role in CRC. Targeting NELFCD may provide a potential therapeutic option for NELFCD-amplified tumors.

Also flagged:hepatocellular carcinomaliver cancerBIRC5CDC20PLK1CENPH
Journal Article 2018-12-05 ✓ 1 Snippet Menyhárt O, Nagy Á, Győrffy B.
In-Text Gene Mentions

…, NAA10 andPEBP1).…

Show Full Abstract

<i>Background:</i> Potential prognostic biomarker candidates for hepatocellular carcinoma (HCC) are abundant, but their generalizability is unexplored. We cross-validated markers of overall survival (OS) and vascular invasion in independent datasets. <i>Methods:</i> The literature search yielded 318 genes related to survival and 52 related to vascular invasion. Validation was performed in three datasets (RNA-seq, <i>n</i> = 371; Affymetrix arrays, <i>n</i> = 91; Illumina gene chips, <i>n</i> = 135) by uni- and multivariate Cox regression and Mann-Whitney <i>U</i>-test, separately for Asian and Caucasian patients. <i>Results:</i> One hundred and eighty biomarkers remained significant in Asian and 128 in Caucasian subjects at <i>p</i> < 0.05. After multiple testing correction <i>BIRC5</i> (<i>p</i> = 1.9 × 10<sup>-10</sup>), <i>CDC20</i> (<i>p</i> = 2.5 × 10<sup>-9</sup>) and <i>PLK1</i> (<i>p</i> = 3 × 10<sup>-9</sup>) endured as best performing genes in Asian patients; however, none remained significant in the Caucasian cohort. In a multivariate analysis, significance was reached by stage (<i>p</i> = 0.0018) and expression of <i>CENPH</i> (<i>p</i> = 0.0038) and <i>CDK4</i> (<i>p</i> = 0.038). <i>KIF18A</i> was the only gene predicting vascular invasion in the Affymetrix and Illumina cohorts (<i>p</i> = 0.003 and <i>p</i> = 0.025, respectively). <i>Conclusion:</i> Overall, about half of biomarker candidates failed to retain prognostic value and none were better than stage predicting OS. Impact: Our results help to eliminate biomarkers with limited capability to predict OS and/or vascular invasion.

Also flagged:ironDiabetes mellituspotassium cyanoferratediabetesType 2 DMType 2 diabetes
Journal Article 2018-12-05 ✓ 1 Snippet Ortiz-Arrambide MA, Juarez-Ibarra KI, Malagón-Santiago GI, Cruz-Fierro N, De La Garza-Ramos MA.
In-Text Gene Mentions

…The humanhemochromatosisprotein controls the…

Show Full Abstract

Diabetes mellitus (DM) is a frequent worldwide disease. There are currently more than 46 million people who suffer this disease in North America and the Caribbean. The objective of this study was to determine if there is an association between DM and the presence of iron precipitates (Fe<sup>2+</sup>) in dental structure. The third molar was extracted for reasons that merit extraction from 40 individuals with and without DM to analyze dentin tissue. Horizontal and longitudinal slices of tooth samples were made and later stained with 10% potassium cyanoferrate. The samples were observed by optical microscope to identify basophilic elements. A nonparametric Spearman correlation was performed to find an association between the quantitative (gender, group, and dentinal tissue) and qualitative variables (gender). The Mann-Whitney U test was used to find differences in the means of the nonparametric variables in two different groups in relation to the <i>P</i> value (<0.05). Iron elements were found in the predentin and circumpulpal dentin areas, and the results obtained showed a statistically significant difference between dentin tissue from patients with diabetes and those without. Individuals with Type 2 DM are prone to present iron precipitates in predentin and circumpulpal dentin tissue. Few iron elements were found in dental organs of individuals without DM.

Also flagged:Carbohydrateanilineacute promyelocytic leukemiasolid tumorsarsenicarsenic trioxide
Journal Article 2018-12-05 No Snippets Fu B, Wang X, Li Y, Hu J, Lu D, Li W, Zheng K, Qin C.
Show Full Abstract

Arsenic trioxide (As<sub>2</sub>O<sub>3</sub>) has been approved for the treatment of acute promyelocytic leukemia (APL); however, its use in the treatment of solid tumors is limited due to its pharmacokinetic properties. Organic arsenic compounds provide better options for pharmaceutical optimization. <i>p</i>-Aminophenyl arsenoxide (<i>p</i>-APAO), an organic arsenic compound, was found to interact with the promyelocytic leukemia-retinoic acid receptor alpha (PML-RARα) fusion protein in a similar manner to arsenic trioxide. Analogs of <i>p</i>-APAO such as 4-(1,3,2-dithiarsolan-2-yl)aniline (<i>p</i>-APDTAs) were recently found to show improved cytotoxicity toward several solid tumor cell lines with lower toxicity to normal cells. Here, we synthesized a carbohydrate-conjugated 4-(1,3,2-dithiarsolan-2-yl)aniline (<i>p</i>-APDTAs) and showed that it exhibited reduced cytotoxicity to normal cells, suggesting a feasible approach to improve the therapeutic index of arsenic-containing compounds as chemotherapeutic agents.

Also flagged:insulin resistancediabetes mellitusIRtoinsulinglucose
Journal Article 2018-12-04 ✓ 1 Snippet Kim KS, Kim SJ, Kim S, Choi DW, Ju YJ, Park EC.
In-Text Gene Mentions

…levels, hepatitis C,hemochromatosis, or hypercortisolism are…

Show Full Abstract

<h4>Background</h4>A more sedentary lifestyle can result in insulin resistance. However, few research studies have assessed the association between insulin resistance and sedentary lifestyle in Asian populations. Therefore, this study aimed to investigate the association of sedentary time with insulin resistance. In addition, we also investigate the moderate effect of employment status, moderate-to-vigorous physical activity (MVPA), and body mass index (BMI) in this association.<h4>Methods</h4>Data from 2573 individuals who participated in the 2015 Korean National Health and Nutrition Examination Survey were analyzed. Sedentary time was measured using self-administered questionnaires, and IR data were estimated using the homeostasis model assessment-insulin resistance index (HOMA-IR). Adjusted odds ratio (OR) and 95% confidence intervals (CIs) from a multivariable logistic regression model were generated for all participants. Subgroup analysis was only performed between sedentary time and HOMA-IR stratified by employment status, because moderate effects were not significant in the tests for interaction for MVPA and BMI. For all analyses, the individuals were categorized as having high or normal HOMA-IR values (> 1.6 and ≤ 1.6, respectively).<h4>Results</h4>A HOMA-IR > 1.6 was observed in 40.3% of the sedentary time Q1 (low) group (< 5.0 h/day), 41.4% of the sedentary time Q2 (middle-low) group, 44.2% of the sedentary time Q3 (middle-high) group, and 48.4% of the sedentary time Q4 (high) group (≥10.0 h/day). When the low level sedentary time group was used as the reference group, the high level sedentary time group was significantly associated with high IR value (HOMA-IR > 1.6) (OR = 1.40, 95% CI: 1.060-1.838). However, this association was not significant across the other sedentary time groups. Moreover, participants reporting a high sedentary time and were employed had 1.67 times the odds of having a high IR value (HOMA-IR > 1.6) compared to those who reported having a low sedentary time and were employed (OR = 1.67, 95% CI: 1.184-2.344). In the unemployed participants, sedentary time was not associated with IR.<h4>Conclusions</h4>High sedentary time (≥10.0 h/day) was associated with elevated HOMA-IR among Korean adults without diabetes mellitus. Furthermore, the association between high sedentary time and HOMA-IR values was more pronounced in the employed population.

Also flagged:Amyotrophic lateral sclerosisALSfrontotemporal lobar degenerationFTLDneurodegenerative disordersTAR DNA binding protein 43 kDa
Journal Article 2018-12-04 ✓ 1 Snippet Jawaid A, Khan R, Polymenidou M, Schulz PE.
In-Text Gene Mentions

Huntington’s disease (HD) is a hereditary NDD caused by elongated CAG repeats in the Huntingtin (Htt) gene that lead to progressive increases in choreic movements and to neuropsychiatric dysfunction [146].

Show Full Abstract

Amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD) are two fatal neurodegenerative disorders with considerable clinical, pathological and genetic overlap. Both disorders are characterized by the accumulation of pathological protein aggregates that contain a number of proteins, most notably TAR DNA binding protein 43 kDa (TDP-43). Surprisingly, recent clinical studies suggest that dyslipidemia, high body mass index, and type 2 diabetes mellitus are associated with better clinical outcomes in ALS. Moreover, ALS and FTLD patients have a significantly lower incidence of cardiovascular disease, supporting the idea that an unfavorable metabolic profile may be beneficial in ALS and FTLD. The two most widely studied ALS/FTLD models, super-oxide dismutase 1 (SOD1) and TAR DNA binding protein of 43 kDA (TDP-43), reveal metabolic dysfunction and a positive effect of metabolic strategies on disease onset and/or progression. In addition, molecular studies reveal a role for ALS/FTLD-associated proteins in the regulation of cellular and whole-body metabolism. Here, we systematically evaluate these observations and discuss how changes in cellular glucose/lipid metabolism may result in abnormal protein aggregations in ALS and FTLD, which may have important implications for new treatment strategies for ALS/FTLD and possibly other neurodegenerative conditions.

Also flagged:irongenetic disordermetalsHereditary hemochromatosisiron storage diseasescysteine
Journal Article 2018-12-04 ✓ 5 Snippets Kim P, Weiskirchen S, Uerlings R, Kueppers A, Stellmacher F, Viveiros A, Zoller H, Weiskirchen R.
In-Text Gene Mentions

As hemochromatosis can also be caused by other mutation in the HFE gene or so called non-HFE hemochromatosis genes (HJV, HAMP, TFR2), homozygosity for p.Cys282Tyr is neither sufficient nor necessary for the diagnosis hemochromatosis.

Homozygozity for the c845G > A mutation within the HFE gene (OMIM: 613609) causing a substitution of the cysteine with a tyrosine residue in position 282 of the HFE gene product (p.Cys282Tyr) is, by far, the most frequent genetic form of iron overload.

…polymorphism in theHFEgene) has a…

…mutation within theHFEgene (OMIM: 613609)…

…282 of theHFEgene product (p.Cys282Tyr)…

Show Full Abstract

<h4>Background</h4>Hereditary hemochromatosis is the most frequent, identified, genetic disorder in Caucasians affecting about 1 in 1000 people of Northern European ancestry, where the associated genetic defect (homozygosity for the p.Cys282Tyr polymorphism in the HFE gene) has a prevalence of approximately 1:200. The disorder is characterized by excess iron stores in the body. Due to the incomplete disease penetrance of disease-associated genotype, genetic testing and accurate quantification of hepatic iron content by histological grading of stainable iron, quantitative chemical determination of iron, or imaging procedures are important in the evaluation and staging of hereditary hemochromatosis.<h4>Methods</h4>We here established novel laser ablation inductively coupled plasma mass spectrometry protocols for hepatic metal bio-imaging for diagnosis of iron overload.<h4>Results</h4>We demonstrate that these protocols are a significant asset in the diagnosis of iron overload allowing iron measurements and simultaneous determination of various other metals and metalloids with high sensitivity, spatial resolution, and quantification ability.<h4>Conclusions</h4>The simultaneous measurement of various metals and metalloids offers unique opportunities for deeper understanding of metal imbalances. Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) is a highly powerful and sensitive technique for the analysis of a variety of solid samples with high spatial resolution. We conclude that this method is an important add-on to routine diagnosis of iron overload and associated hepatic metal dysbalances resulting thereof.

Also flagged:EGFEGFRNetrin-4glioblastomacentral nervous system tumortemozolomide
Journal Article 2018-12-04 ✓ 1 Snippet Li L, Huang Y, Gao Y, Shi T, Xu Y, Li H, Hyytiäinen M, Keski-Oja J, Jiang Q, Hu Y, Du Z.
In-Text Gene Mentions

…M re-organization, and netrin/DCCrelated caspase activation.…

Show Full Abstract

<h4>Background</h4>Glioblastoma multiforme (GBM) is the most malignant central nervous system tumor. Alkylating agent, temozolomide (TMZ), is currently the first-line chemotherapeutic agent for GBM. However, the sensitivity of GBM cells to TMZ is affected by many factors. And, several clinic trials, including co-administration of TMZ with other drugs, have failed in successful treatment of GBM. We have previously reported that Netrin-4 (NTN4), a laminin-like axon guidance protein, plays a protective role in GBM cell senescence upon TMZ-triggered DNA damage. However, the master regulator of NTN4 needs further elucidation. Epidermal growth factor/Epidermal growth factor receptor (EGF/EGFR) can modulate the expression of various extracellular matrix related molecules, and prevent DNA damage in GBM cells. In this study, we investigated the relationship between EGF/EGFR signaling and NTN4, and explored their effect on therapeutic efficacy in GBM cells upon TMZ treatment.<h4>Methods</h4>Co-expression analysis were performed by using the RNA sequencing data from NIH 934 cell lines and from single cell RNA sequencing data of GBM tumor. The co-expressing genes were used for GO enrichment and signaling pathway enrichment. mRNA expression of the target genes were quantified by qPCR, and cell senescence were investigated by Senescence-Associated Beta-Galactosidase Staining. Protein phosphorylation were observed and analyzed by immunoblotting. The RNA sequencing data and clinical information of TMZ treated patients were extracted from TCGA-glioblastoma project, and then used for Kaplan-Meier survival analysis.<h4>Results</h4>Analysis of RNA sequencing data revealed a potential co-expression relationship between NTN4 and EGFR. GO enrichment of EGFR-correlated genes indicated that EGFR regulates GBM cells in a manner similar to that in central nervous system development and neural cell differentiation. Pathway analysis suggested that EGFR and its related genes contribute to cell adhesion, extracellular matrix (ECM) organization and caspase related signaling. We also show that EGF stimulates NTN4 expression in GBM cells and cooperates with NTN4 to attenuate GBM cell senescence induced by DNA damage, possibly via AKT and ERK. Clinical analysis showed that co-expression of EGFR and NTN4 significantly predicts poor survival in TMZ-treated GBM patients.<h4>Conclusions</h4>This study indicates that EGF/EGFR regulates and cooperates with NTN4 in DNA damage resistance in GBM. Therefore, our findings provide a potential therapeutic target for GBM.

Also flagged:DMTNcolorectal cancercytoskeletonRac1GSTARHGEF2
Journal Article 2018-12-04 ✓ 1 Snippet Ye YP, Jiao HL, Wang SY, Xiao ZY, Zhang D, Qiu JF, Zhang LJ, Zhao YL, Li TT, Li-Liang, Liao WT, Ding YQ.
In-Text Gene Mentions

…as APC, p53,DCC, and PTEN, occur…

Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) is one of the most common digestive malignant tumors, and DMTN is a transcriptionally differentially expressed gene that was identified using CRC mRNA sequencing data from The Cancer Genome Atlas (TCGA). Our preliminary work suggested that the expression of DMTN was downregulated in CRC, and the Rac1 signaling pathway was significantly enriched in CRC tissues with low DMTN expression. However, the specific functions and underlying molecular mechanisms of DMTN in the progression of CRC and the upstream factors regulating the downregulation of the gene remain unclear.<h4>Methods</h4>DMTN expression was analyzed in CRC tissues, and the relationship between DMTN expression and the clinicopathological parameters was analyzed. In vitro and in vivo experimental models were used to detect the effects of DMTN dysregulation on invasion and metastasis of CRC cells. GSEA assay was performed to explore the mechanism of DMTN in invasion and metastasis of CRC. Westernblot, Co-IP and GST-Pull-Down assay were used to detect the interaction between DMTN and ARHGEF2, as well as the activation of the RAC1 signaling. Bisulfite genomic sequence (BSP) assay was used to test the degree of methylation of DMTN gene promoter in CRC tissues.<h4>Results</h4>We found that the expression of DMTN was significantly decreased in CRC tissues, and the downregulation of DMTN was associated with advanced progression and poor survival and was regarded as an independent predictive factor of CRC patient prognosis. The overexpression of DMTN inhibited, while the knockdown of DMTN promoted, invasion and metastasis in CRC cells. Moreover, hypermethylation and the deletion of DMTN relieved binding to the ARHGEF2 protein, activated the Rac1 signaling pathway, regulated actin cytoskeletal rearrangements, and promoted the invasion and metastasis of CRC cells.<h4>Conclusion</h4>Our study demonstrated that the downregulation of DMTN promoted the metastasis of colorectal cancer cells by regulating the actin cytoskeleton through RAC1 signaling activation, potentially providing a new therapeutic target to enable cancer precision medicine for CRC patients.

Also flagged:replication forksreplication forkHomologousRAD51BRCA1BRCA2
Journal Article 2018-12-04 ✓ 1 Snippet Patel DR, Weiss RS.
In-Text Gene Mentions

MMS22L

Show Full Abstract

Eukaryotic cells continuously experience DNA damage that can perturb key molecular processes like DNA replication. DNA replication forks that encounter DNA lesions typically slow and may stall, which can lead to highly detrimental fork collapse if appropriate protective measures are not executed. Stabilization and protection of stalled replication forks ensures the possibility of effective fork restart and prevents genomic instability. Recent efforts from multiple laboratories have highlighted several proteins involved in replication fork remodeling and DNA damage response pathways as key regulators of fork stability. Homologous recombination factors such as RAD51, BRCA1, and BRCA2, along with components of the Fanconi Anemia pathway, are now known to be crucial for stabilizing stalled replication forks and preventing nascent strand degradation. Several checkpoint proteins have additionally been implicated in fork protection. Ongoing work in this area continues to shed light on a sophisticated molecular pathway that balances the action of DNA resection and fork protection to maintain genomic integrity, with important implications for the fate of both normal and malignant cells following replication stress.

Also flagged:antibodiesantibodybindingα-synucleinα-synneurological disorders
Journal Article 2018-12-04 ✓ 3 Snippets Mahajan SP, Meksiriporn B, Waraho-Zhmayev D, Weyant KB, Kocer I, Butler DC, Messer A, Escobedo FA, DeLisa MP.
In-Text Gene Mentions

…of eight huntingtin (htt)-specific scFv clones isolate…

…preventing aggregation ofhttin a yeast…

…to efficiently blockhttaggregation in cultured…

Show Full Abstract

Improving the affinity of protein-protein interactions is a challenging problem that is particularly important in the development of antibodies for diagnostic and clinical use. Here, we used structure-based computational methods to optimize the binding affinity of V<sub>H</sub>NAC1, a single-domain intracellular antibody (intrabody) from the camelid family that was selected for its specific binding to the nonamyloid component (NAC) of human α-synuclein (α-syn), a natively disordered protein, implicated in the pathogenesis of Parkinson's disease (PD) and related neurological disorders. Specifically, we performed ab initio modeling that revealed several possible modes of V<sub>H</sub>NAC1 binding to the NAC region of α-syn as well as mutations that potentially enhance the affinity between these interacting proteins. While our initial design strategy did not lead to improved affinity, it ultimately guided us towards a model that aligned more closely with experimental observations, revealing a key residue on the paratope and the participation of H4 loop residues in binding, as well as confirming the importance of electrostatic interactions. The binding activity of the best intrabody mutant, which involved just a single amino acid mutation compared to parental V<sub>H</sub>NAC1, was significantly enhanced primarily through a large increase in association rate. Our results indicate that structure-based computational design can be used to successfully improve the affinity of antibodies against natively disordered and weakly immunogenic antigens such as α-syn, even in cases such as ours where crystal structures are unavailable.

Also flagged:cytosinethymineguanineadenineAICDAAPOBEC
Journal Article 2018-12-04 ✓ 4 Snippets Yoon JH, Kim O, Eun JW, Choi SS, Ashktorab H, Smoot DT, Nam SW, Park WS.
In-Text Gene Mentions

In real-time RT-PCR, immunoblot, and immunofluorescent analyses, tumors derived from mice implanted with HFE-145shNKX6.3#1 and HFE-145shNKX6.3#2 cells exhibited reduced E-cadherin and p21 expression but increased activity of NFκB p65, AICDA, CBFβ, APOBEC3B, RhoA and p-Akt with decreased and fragmented expression of EP300 (Fig. 5C–E).

Compared with HFE-145 immortalized gastric epithelial cells (fold change, mean ± SD: 1.00 ± 0.02) and non-neoplastic gastric mucosae (fold change, 0.91 ± 0.18), nine cancer cell lines (fold change, 0.23 ± 0.04, P < 0.01) and gastric cancer tissues (fold change, 0.14 ± 0.05, P < 0.01) showed reduced NKX6.3 expression (Supplementary Fig. S1A).

In tumor sphere assay in vitro, depletion of NKX6.3 dramatically increased sphere number and size in HFE-145 cells (Fig. 4F).

Sequencing HFE-145shNKX6.3#1 and HFE-145shNKX6.3#2 tumors confirmed that NKX6.3 depletion caused mutations in RhoA, PIK3CA, TP53, CDH1, EP300 genes (Fig. 5F).

Show Full Abstract

NKX family members are involved in a variety of developmental processes such as cell fate determination in the central nervous system, gastrointestinal tract, and pancreas. However, whether NKX6.3 contributes to gastric carcinogenesis remains unclear. The objective of this study was to examine roles of NKX6.3 depletion in mutagenesis and gastric carcinogenesis, focusing on its effects on genetic alterations and expression of genes. Our results revealed that NKX6.3 depletion induced multiple genetic mutations in coding regions, including high frequency of point mutations such as cytosine-to-thymine and guanine-to-adenine transitions caused by aberrant expression of AICDA/APOBEC family in human gastric epithelial cells. Interestingly, NKX6.3 downregulated AICDA/APOBEC family, NFκB, and CBFβ genes by acting as a transcription factor while inhibiting deaminase activity in gastric epithelial cells. Functional relevance of NKX6.3 was validated in xenograft mice injected with NKX6.3 depleting cells. NKX6.3 depletion resulted in tumor formation and mutations of tumor-associated genes, including p53 and E-cadherin. Moreover, expression levels of NKX6.3 and its target genes were analyzed in tumors derived from mice implanted with NKX6.3 depleting cells and tissue samples of gastric cancer patients. Our results indicate that NKX6.3 depletion in gastric epithelial cells activates AICDA/APOBEC family, leading to accumulation of genetic mutations and eventually driving the development of gastric cancers.

Also flagged:coumarinacetylcholinesterasebutyrylcholinesterasemonoamine oxidase ACoumarinsbenzopyrone
Journal Article 2018-12-04 No Snippets Yusufzai SK, Khan MS, Sulaiman O, Osman H, Lamjin DN.
Show Full Abstract

Coumarins are the phytochemicals, which belong to the family of benzopyrone, that display interesting pharmacological properties. Several natural, synthetic and semisynthetic coumarin derivatives have been discovered in decades for their applicability as lead structures as drugs. Coumarin based conjugates have been described as potential AChE, BuChE, MAO and β-amyloid inhibitors. Therefore, the objective of this review is to focus on the construction of these pharmacologically important coumarin analogues with anti-Alzheimer's activities, highlight their docking studies and structure-activity relationships based on their substitution pattern with respect to the selected positions on the chromen ring by emphasising on the research reports conducted in between year 1968 to 2017.

Also flagged:Dynamin-related protein 1pathogenesisneurodegenerative diseasesMitochondriaDrp1mitochondrial
Journal Article 2018-12-04 ✓ 4 Snippets Qi Z, Huang Z, Xie F, Chen L.
In-Text Gene Mentions

Here, we will give a detailed review about the recent developments in regards to dynamin-related protein 1 (Drp1) induced unbalanced mitochondrial dynamics, excessive mitochondrial division, and neuronal injury in neural system dysfunctions and neurodegenerative diseases, including the Drp1 knockout induced mice embryonic death, the dysfunction of the Drp1-dependent mitochondrial division induced neuronal cell apoptosis and impaired neuronal axonal transportation, the abnormal interaction between Drp1 and amyloid β (Aβ) in Alzheimer's disease (AD), the mutant Huntingtin (Htt) in Huntington's disease (HD), and the Drp1-associated pathogenesis of other neurodegenerative diseases such as Parkinson's disease (PD) and amyotrophic lateral sclerosis (ALS). Drp1 is required for mitochondrial division determining the size, shape, distribution, and remodeling as well as maintaining of mitochondrial integrity in mammalian cells.

Recent studies also revealed that the Drp1 can interact with Aβ, phosphorylated τ, and mutant Htt affecting the mitochondrial shape, size, distribution, axonal transportation, and energy production in the AD and HD neuronal cells.

…the mutant Huntingtin (Htt) in Huntington's disease…

…τ, and mutantHttaffecting the mitochondrial…

Show Full Abstract

Mitochondria play a key role in the maintenance of neuronal function by continuously providing energy. Here, we will give a detailed review about the recent developments in regards to dynamin-related protein 1 (Drp1) induced unbalanced mitochondrial dynamics, excessive mitochondrial division, and neuronal injury in neural system dysfunctions and neurodegenerative diseases, including the Drp1 knockout induced mice embryonic death, the dysfunction of the Drp1-dependent mitochondrial division induced neuronal cell apoptosis and impaired neuronal axonal transportation, the abnormal interaction between Drp1 and amyloid β (Aβ) in Alzheimer's disease (AD), the mutant Huntingtin (Htt) in Huntington's disease (HD), and the Drp1-associated pathogenesis of other neurodegenerative diseases such as Parkinson's disease (PD) and amyotrophic lateral sclerosis (ALS). Drp1 is required for mitochondrial division determining the size, shape, distribution, and remodeling as well as maintaining of mitochondrial integrity in mammalian cells. In addition, increasing reports indicate that the Drp1 is involved in some cellular events of neuronal cells causing some neural system dysfunctions and neurodegenerative diseases, including impaired mitochondrial dynamics, apoptosis, and several posttranslational modification induced increased mitochondrial divisions. Recent studies also revealed that the Drp1 can interact with Aβ, phosphorylated τ, and mutant Htt affecting the mitochondrial shape, size, distribution, axonal transportation, and energy production in the AD and HD neuronal cells. These changes can affect the health of mitochondria and the function of synapses causing neuronal injury and eventually leading to the dysfunction of memory, cognitive impairment, resting tremor, posture instability, involuntary movements, and progressive muscle atrophy and paralysis in patients.

Also flagged:obesityFTOcardiovascular diseaseCVDiron deficiency anemiaIDA
Journal Article 2018-12-04 ✓ 1 Snippet Justice AE, Chittoor G, Blanco E, Graff M, Wang Y, Albala C, Santos JL, Angel B, Lozoff B, Voruganti VS, North KE, Gahagan S.
In-Text Gene Mentions

OLFM4

Show Full Abstract

<h4>Background</h4>While the genetic contribution to obesity is well established, few studies have examined how genetic variants influence standardized body mass index Z-score (BMIz) in Hispanics/Latinos, especially across childhood and adolescence.<h4>Objectives</h4>We estimated the effect of established BMIz loci in Chilean children of the Santiago Longitudinal Study (SLS).<h4>Methods</h4>We examined associations with BMIz at age 10 for 15 loci previously identified in European children. For significant loci, we performed association analyses at ages 5 and 16 years, for which we have smaller sample sizes. We tested associations of unweighted genetic risk scores (GRSs) for previously identified tag variants (GRS_EUR) and from the most significant variants in SLS at each locus (GRS_SLS).<h4>Results</h4>We generalized five variants at age 10 (P < 0.05 and directionally consistent), including rs543874 that reached Bonferroni-corrected significance. The effect on BMIz was greatest at age 10 for all significant loci, except FTO, which exhibited an increase in effect from ages 5 to 16. Both GRSs were associated with BMIz (P < 0.0001), but GRS_SLS explained a much greater proportion of the variation (13.63%).<h4>Conclusion</h4>Our results underscore the importance of conducting genetic investigations across life stages and selecting ancestry appropriate tag variants in future studies for disease prediction and clinical evaluation.

Also flagged:CancercancersDrug Resistancemetabolismcell surface receptorsdegradation
Journal Article 2018-12-04 No Snippets Leary M, Heerboth S, Lapinska K, Sarkar S.
Show Full Abstract

Cancer drug resistance is an enormous problem. It is responsible for most relapses in cancer patients following apparent remission after successful therapy. Understanding cancer relapse requires an understanding of the processes underlying cancer drug resistance. This article discusses the causes of cancer drug resistance, the current combination therapies, and the problems with the combination therapies. The rational design of combination therapy is warranted to improve the efficacy. These processes must be addressed by finding ways to sensitize the drug-resistant cancers cells to chemotherapy, and to prevent formation of drug resistant cancer cells. It is also necessary to prevent the formation of cancer progenitor cells by epigenetic mechanisms, as cancer progenitor cells are insensitive to standard therapies. In this article, we emphasize the role for the rational development of combination therapy, including epigenetic drugs, in achieving these goals.

Also flagged:Plasma membranemitochondrial membraneMenadioneage-dependent disordermembranesmembrane
Journal Article 2018-12-04 ✓ 5 Snippets Lovatt M, Adnan K, Peh GSL, Mehta JS.
In-Text Gene Mentions

Prdx6

Prdx6is an antioxidant…

…the role ofPrdx6in corneal endothelial…

…data reveal thatPrdx6is expressed at…

…RNAi-mediated knockdown ofPrdx6revealed a role…

Show Full Abstract

The inner layer of the cornea, the corneal endothelium, is post-mitotic and unable to regenerate if damaged. The corneal endothelium is one of the most transplanted tissues in the body. Fuchs' endothelial corneal dystrophy (FECD) is the leading indication for corneal endothelial transplantation. FECD is thought to be an age-dependent disorder, with a major component related to oxidative stress. Prdx6 is an antioxidant with particular affinity for repairing peroxidised cell membranes. To address the role of Prdx6 in corneal endothelial cells, we used a combination of biochemical and functional studies. Our data reveal that Prdx6 is expressed at unusually high levels at the plasma membrane of corneal endothelial cells. RNAi-mediated knockdown of Prdx6 revealed a role for Prdx6 in lipid peroxidation. Furthermore, following induction of oxidative stress with menadione, Prdx6-deficient cells had defective mitochondrial membrane potential and were more sensitive to cell death. These data reveal that Prdx6 is compartmentalised in corneal endothelial cells and has multiple functions to preserve cellular integrity.

Also flagged:Tnnc1Tnnc2GAPDHOligonucleotideTnni1Srl
Journal Article 2018-12-04 ✓ 2 Snippets Ma M, Cai B, Jiang L, Abdalla BA, Li Z, Nie Q, Zhang X.
In-Text Gene Mentions

Sox6

…muscle genes (includingSox6, Tnnc1 ,…

Show Full Abstract

Emerging studies indicate important roles for non-coding RNAs (ncRNAs) as essential regulators in myogenesis, but relatively less is known about their function. In our previous study, we found that lncRNA-Six1 can regulate <i>Six1</i> in <i>cis</i> to participate in myogenesis. Here, we studied a microRNA (miRNA) that is specifically expressed in chickens (miR-1611). Interestingly, miR-1611 was found to contain potential binding sites for both lncRNA-Six1 and <i>Six1</i>, and it can interact with lncRNA-Six1 to regulate <i>Six1</i> expression. Overexpression of miR-1611 represses the proliferation and differentiation of myoblasts. Moreover, miR-1611 is highly expressed in slow-twitch fibers, and it drives the transformation of fast-twitch muscle fibers to slow-twitch muscle fibers. Together, these data demonstrate that miR-1611 can mediate the regulation of Six1 by lncRNA-Six1, thereby affecting proliferation and differentiation of myoblasts and transformation of muscle fiber types.

Also flagged:CREBdepressionMajor depressive disordersmajor depressive disorderaxonogenesisCALM
Journal Article 2018-12-04 ✓ 3 Snippets Huang C, Yang X, Zeng B, Zeng L, Gong X, Zhou C, Xia J, Lian B, Qin Y, Yang L, Liu L, Xie P.
In-Text Gene Mentions

CACNA1E as a promoter of CREB signaling in microbiota-induced depression

…olfactory bulb suggestsCACNA1Eas a promoter…

…that, the down-regulatedCACNA1Eand its downstream…

Show Full Abstract

Major depressive disorders impact approximately 17% of the population worldwide, whose high morbidity and considerable adversity have resulted in enormous social and economic burden. In addition, clinically depressed patients often show reduced volume of olfactory bulb (OB) and decreased olfactory sensitivity. Although mounting evidence conveyed that the gut microbiota may implicate the pathophysiology of major depressive disorder (MDD) via the microbe-gut-brain axis, knowledge about its distinctive molecular mechanism is rudimentary. Herein, iTRAQ coupled with LC-MS/MS was applied to compare the OB proteome between "pathological microbiota" and "healthy microbiota" germ-free mice. A set of 367 proteins were differentially identified in the OB, including 119 up-regulated and 248 down-regulated proteins compared with the levels in controls. A combined analysis with significantly changed OB proteins from CUMS depression model supported the role of CREB signaling, whose dysregulation is likely to disrupt the axonogenesis of OB under microbiota condition. With that, the down-regulated CACNA1E and its downstream proteins (CALM/ CaMKII/ CREB/ BDNF) in CREB pathway were validated by Western blot. Meanwhile, the canonical pathways involved Nuclear Receptor Signaling highlighted the fecal microbiota transplantation (FMT) model, which would be a new breakthrough for depressive research. These findings enrich the previous research achievements about the gut microbiota in psychiatric disorders, providing a creative insight into the intricate mechanisms of OB dysfunction in depression. SIGNIFICANCE: Emerging evidence has shown that gut microbiota can greatly influence brain functions and even behaviors. As one of the post-developmental neurogenesis areas for the adult brain, the OB is becoming increasingly important in the study of the pathogenesis of depression. Using an iTRAQ-based proteomics, we identified 367 altered proteins in the OB of fecal microbiota transplanted mouse, which provide a novel insight for further research of the "microbiota-gut-brain axis". In addition, combined analyses with the CUMS depression model and the validation of key proteins by Western blot may assist in the investigation of OB dysfunction in mental sickness.

Also flagged:phosphorylation-transcriptional modificationsmitochondrialmitochondrial gene expressionnucleotidesgene expression
Journal Article 2018-12-04 ✓ 1 Snippet Rebelo-Guiomar P, Powell CA, Van Haute L, Minczuk M.
In-Text Gene Mentions

…(i 6 A37),CDK5RAP1(ms 2 i…

Show Full Abstract

Correct expression of the mitochondrially-encoded genes is critical for the production of the components of the oxidative phosphorylation machinery. Post-transcriptional modifications of mitochondrial transcripts have been emerging as an important regulatory feature of mitochondrial gene expression. Here we review the current knowledge on how the mammalian mitochondrial epitranscriptome participates in regulating mitochondrial homeostasis. In particular, we focus on the latest breakthroughs made towards understanding the roles of the modified nucleotides in mitochondrially-encoded ribosomal and transfer RNAs, the enzymes responsible for introducing these modifications and on recent transcriptome-wide studies reporting modifications to mitochondrial messenger RNAs. This article is part of a Special Issue entitled: mRNA modifications in gene expression control edited by Dr. Matthias Soller and Dr. Rupert Fray.

Also flagged:malignant tumorbladder cancerGene Expressionnuclear divisionspindlebinding
Journal Article 2018-12-04 No Snippets Gao X, Chen Y, Chen M, Wang S, Wen X, Zhang S.
Show Full Abstract

<h4>Background</h4>Bladder cancer is a malignant tumor in the urinary system with high mortality and recurrence rates. However, the causes and recurrence mechanism of bladder cancer are not fully understood. In this study, we used integrated bioinformatics to screen for key genes associated with the development of bladder cancer and reveal their potential molecular mechanisms.<h4>Methods</h4>The GSE7476, GSE13507, GSE37815 and GSE65635 expression profiles were downloaded from the Gene Expression Omnibus database, and these datasets contain 304 tissue samples, including 81 normal bladder tissue samples and 223 bladder cancer samples. The RobustRankAggreg (RRA) method was utilized to integrate and analyze the four datasets to obtain integrated differentially expressed genes (DEGs), and the gene ontology (GO) functional annotation and Kyoto encyclopedia of genes and genomes (KEGG) pathway analysis were performed. Protein-protein interaction (PPI) network and module analyses were performed using Cytoscape software. The OncoLnc online tool was utilized to analyze the relationship between the expression of hub genes and the prognosis of bladder cancer.<h4>Results</h4>In total, 343 DEGs, including 111 upregulated and 232 downregulated genes, were identified from the four datasets. GO analysis showed that the upregulated genes were mainly involved in mitotic nuclear division, the spindle and protein binding. The downregulated genes were mainly involved in cell adhesion, extracellular exosomes and calcium ion binding. The top five enriched pathways obtained in the KEGG pathway analysis were focal adhesion (FA), PI3K-Akt signaling pathway, proteoglycans in cancer, extracellular matrix (ECM)-receptor interaction and vascular smooth muscle contraction. The top 10 hub genes identified from the PPI network were vascular endothelial growth factor A (VEGFA), TOP2A, CCNB1, Cell division cycle 20 (CDC20), aurora kinase B, ACTA2, Aurora kinase A, UBE2C, CEP55 and CCNB2. Survival analysis revealed that the expression levels of ACTA2, CCNB1, CDC20 and VEGFA were related to the prognosis of patients with bladder cancer. In addition, a KEGG pathway analysis of the top 2 modules identified from the PPI network revealed that Module 1 mainly involved the cell cycle and oocyte meiosis, while the analysis in Module 2 mainly involved the complement and coagulation cascades, vascular smooth muscle contraction and FA.<h4>Conclusions</h4>This study identified key genes and pathways in bladder cancer, which will improve our understanding of the molecular mechanisms underlying the development and progression of bladder cancer. These key genes might be potential therapeutic targets and biomarkers for the treatment of bladder cancer.

Also flagged:AlcoholChromosomealcohol use disordersnucleusserotonin receptorG-protein coupled receptor
Journal Article 2018-12-04 No Snippets Spence JP, Reiter JL, Qiu B, Gu H, Garcia DK, Zhang L, Graves T, Williams KE, Bice PJ, Zou Y, Lai Z, Yong W, Liang T.
Show Full Abstract

Humans show sex differences related to alcohol use disorders (AUD). Animal model research has the potential to provide important insight into how sex differences affect alcohol consumption, particularly because female animals frequently drink more than males. In previous work, inbred strains of the selectively bred alcohol-preferring (P) and non-preferring (NP) rat lines revealed a highly significant quantitative trait locus (QTL) on rat chromosome 4, with a logarithm of the odds score of 9.2 for alcohol consumption. Recently, interval-specific congenic strains (ISCS) were developed by backcrossing the congenic P.NP line to inbred P (iP) rats to further refine the chromosome 4 QTL region. Two ISCS sub-strains, ISCS-A and ISCS-B, were obtained with a narrowed QTL, where the smallest region of overlap consisted of 8.9 Mb in ISCS-B. Interestingly, we found that females from both ISCS lines consumed significantly less alcohol than female iP controls (<i>p</i> < 0.05), while no differences in alcohol consumption were observed between male ISCS and iP controls. RNA-sequencing was performed on the nucleus accumbens of alcohol-naïve female ISCS-B and iP rats, which revealed differentially expressed genes (DEG) with greater than 2-fold change and that were functionally relevant to behavior. These DEGs included down-regulation of <i>Oxt, Asb4, Gabre, Gabrq, Chat, Slc5a7, Slc18a8, Slc10a4</i>, and <i>Ngfr</i>, and up-regulation of <i>Ttr, Msln, Mpzl2, Wnt6, Slc17a7, Aldh1a2</i>, and <i>Gstm2</i>. Pathway analysis identified significant alterations in gene networks controlling nervous system development and function, as well as cell signaling, GABA and serotonin receptor signaling and G-protein coupled receptor signaling. In addition, β-estradiol was identified as the most significant upstream regulator. The expression levels of estrogen-responsive genes that mapped to the QTL interval and have been previously associated with alcohol consumption were measured using RT-qPCR. We found that expression of the <i>Adcyap1r1</i> gene, encoding the pituitary adenylate cyclase-activating polypeptide type 1 (PAC<sub>1</sub>) receptor, was upregulated in female ISCS-B compared to female iP controls, while no differences were exhibited in males. In addition, sequence variants in the <i>Adcyap1r1</i> promoter region showed a differential response to estrogen stimulation <i>in vitro</i>. These findings demonstrate that rat chromosome 4 QTL contains genetic variants that respond to estrogen and are associated with female alcohol consumption.

Also flagged:Aceruloplasminemiahereditary disorderceruloplasminironerythropoiesisdiabetes
Journal Article 2018-12-04 ✓ 1 Snippet Piperno A, Alessio M.
In-Text Gene Mentions

The total pancreatic- and per islet-insulin content were low in Hfe-KO mice (Huang et al., 2011), suggesting an iron-related beta-cell oxidative stress and decreased insulin secretory capacity secondary to beta-cell apoptosis and desensitization of glucose-induced insulin secretion (Backe et al., 2016).

Show Full Abstract

Aceruloplasminemia is an ultra-rare hereditary disorder caused by defective production of ceruloplasmin. Its phenotype is characterized by iron-restricted erythropoiesis and tissue iron overload, diabetes, and progressive retinal and neurological degeneration. Ceruloplasmin is a ferroxidase that plays a critical role in iron homeostasis through the oxidation and mobilization of iron from stores and subsequent incorporation of ferric iron into transferrin (Tf), which becomes available for cellular uptake via the Tf receptor. In addition, ceruloplasmin has antioxidant properties preventing the production of deleterious reactive oxygen species via the Fenton reaction. Some recent findings suggest that aceruloplasminemia phenotypes can be more heterogeneous than previously believed, varying within a wide range. Within this large heterogeneity, microcytosis with or without anemia, low serum iron and high serum ferritin, and diabetes are the early hallmarks of the disease, while neurological manifestations appear 10-20 years later. The usual therapeutic approach is based on iron chelators that are efficacious in reducing systemic iron overload. However, they have demonstrated poor efficacy in counteracting the progression of neurologic manifestations, and also often aggravate anemia, thereby requiring drug discontinuation. Open questions remain regarding the mechanisms leading to neurological manifestation and development of diabetes, and iron chelation therapy (ICT) efficacy. Recent studies in animal models of aceruloplasminemia support the possibility of new therapeutic approaches by parenteral ceruloplasmin administration. In this review we describe the state of the art of aceruloplasminemia with particular attention on the pathogenic mechanisms of the disease and therapeutic approaches, both current and perspective.

Also flagged:disulfidetumordoxorubicincancerpolyesterpoly( l -lactic acid
Journal Article 2018-12-04 No Snippets Yan J, Zhang H, Cheng F, He Y, Su T, Zhang X, Zhang M, Zhu Y, Li C, Cao J, He B.
Show Full Abstract

<h4>Background</h4>Stability, enhanced drug-loading efficiency (DLE), and specific accumulation of therapeutics at tumor sites remain major challenges for successful cancer therapy.<h4>Purpose</h4>This study describes a newly developed intelligent nanosystem that integrates stealthy, active targeting, stimulus-responsiveness, and π-π interaction properties in a single carrier, based on the multifunctional star-shaped biodegradable polyester.<h4>Patients and methods</h4>This highly stable, smart nanocarrier with spherical structures and a low critical micelle concentration (CMC) can provide spacious harbor and strong π-π interaction and hydrophobic interactions for hydrophobic doxorubicin (DOX). Its structure and morphology were characterized by proton nuclear magnetic resonance (1H-NMR) spectra, Fourier transform infrared (FTIR) spectra, Gel permeation chromatography (GPC), dynamic light scattering (DLS), scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Antitumor effciency of polymeric micelles using CCK-8 assay, and the intracellular-activated delivery system was tracked by confocal laser scanning microscopy (CLSM) and flow cytometry.<h4>Results</h4>The synthesized copolymer can be self-assembled into nanoparticles with size of 50 nm and critical micellar concentration of 2.10 µg/mL. The drug-loading content of nanoparticles can be enhanced to 17.35%. Additionally, the stimulus-responsive evaluation and drug release study showed that the nanocarrier can rapidly respond to the intracellular reductive environment and dissociate for drug release. An in vitro study demonstrated that the nanocarrier can ferry doxorubicin selectively into tumor tissue, rapidly enter cancer cells, and controllably release its payload in response to an intracellular reductive environment, resulting in excellent antitumor activity in vitro.<h4>Conclusion</h4>This study provides a facile and versatile approach for the design of multifunctional star-shaped biodegradable polyester nanovehicles for effective cancer treatment.

Also flagged:type 2 diabetes mellitushypothyroidisminsulinhypertensioncoronary artery diseasestroke
Journal Article 2018-12-04 ✓ 1 Snippet Alsolami AA, Alshali KZ, Albeshri MA, Alhassan SH, Qazli AM, Almalki AS, Bakarman MA, Mukhtar AM.
In-Text Gene Mentions

…infiltration due tohemochromatosis, certain medications (thalido…

Show Full Abstract

<h4>Objectives</h4>Type 2 diabetes mellitus (DM-II) is highly prevalent in Saudi Arabia and only few studies have assessed it as a risk factor for hypothyroidism. This study aimed to examine the association between DM-II and hypothyroidism.<h4>Subjects and methods</h4>We conducted a hospital-based case-control study. As cases, we included all adults admitted to King Abdulaziz University Hospital (KAUH) with laboratory-confirmed hypothyroidism. As controls, we drew a random sample of patients admitted to the orthopedic clinic at KAUH with laboratory-confirmed absence of hypothyroidism. We extracted data from the medical records regarding age, sex, presence of DM-II, HbA1c, comorbidities, treatment, and complications. We used multivariate logistic regression to identify factors associated with hypothyroidism.<h4>Results</h4>We included 121 cases and 121 controls. In comparison to controls, cases were older (<i>P</i>=0.005), had higher prevalence of DM-II (<i>P</i><0.001), had higher levels of HbA1c (<i>P</i>=0.03), used insulin (<i>P</i><0.001) and oral hypoglycemic drugs (<i>P</i><0.001) more often, and suffered more often from hypertension (<i>P</i><0.001), coronary artery disease (CAD) (<i>P</i><0.001), stroke (<i>P</i>=0.04), diabetic foot (<i>P</i><0.001), and nephropathy (<i>P</i><0.001). According to multivariate regression, the risk of hypothyroidism was significantly increased among patients with DM-II (OR=4.14; 95% CI=20.20-7.80; <i>P</i><0.001) and CAD (OR=14.15; 95% CI=1.80-111.43; <i>P</i>=0.01).<h4>Conclusion</h4>Patients with DM-II were at increased risk of developing hypothyroidism. Adequate management and control of DM-II might reduce the risk of developing hypothyroidism. Further research using a prospective cohort study design is needed to confirm these findings.<h4>Key messages</h4>Patients with DM-II had an increased risk of developing hypothyroidism.

Also flagged:Fatty Acid Amide HydrolaseFAAHThyroid hormonedemyelinating diseases ofamidesobetirome
Journal Article 2018-12-04 No Snippets Meinig JM, Ferrara SJ, Banerji T, Banerji T, Sanford-Crane HS, Bourdette D, Scanlan TS.
Show Full Abstract

Thyroid hormone (TH) action is of clinical interest in treating demyelinating diseases of the central nervous system (CNS). Two amide prodrugs of sobetirome, a potent thyroid hormone agonist, were previously shown to significantly improve CNS selective distribution of the parent drug through hydrolysis in the CNS by fatty acid amide hydrolase (FAAH). This concept is elaborated upon here with a series of 29 amide prodrugs targeting FAAH. We identify that conservative aliphatic modifications such as the <i>N</i>-methyl (<b>4</b>), <i>N</i>-ethyl (<b>5</b>), <i>N</i>-fluoroethyl (<b>15</b>), and <i>N</i>-cyclopropyl (<b>18</b>) substantially favor selective CNS distribution of the parent drug in mice. Additionally, lead compounds exhibit moderate to good rates of hydrolysis at FAAH in vitro suggesting both enzymatic and physicochemical properties are important parameters for optimization. Both <b>4</b> and <b>15</b> were orally bioavailable while retaining appreciable CNS parent drug delivery following an oral dose. The pharmacokinetic parameters of <b>4</b> over 24 h postdose (i.v. and p.o.) were determined.

Also flagged:neurological diseasesRANspinocerebellar ataxia type 8SCA8myotonic dystrophy type 1translational initiation
Journal Article 2018-12-03 No Snippets Zu T, Pattamatta A, Ranum LPW.
Show Full Abstract

More than 40 different neurological diseases are caused by microsatellite repeat expansions that locate within translated or untranslated gene regions, including 5' and 3' untranslated regions (UTRs), introns, and protein-coding regions. Expansion mutations are transcribed bidirectionally and have been shown to give rise to proteins, which are synthesized from three reading frames in the absence of an AUG initiation codon through a novel process called repeat-associated non-ATG (RAN) translation. RAN proteins, which were first described in spinocerebellar ataxia type 8 (SCA8) and myotonic dystrophy type 1 (DM1), have now been reported in a growing list of microsatellite expansion diseases. This article reviews what is currently known about RAN proteins in microsatellite expansion diseases and experiments that provide clues on how RAN translation is regulated.

Also flagged:RhoGAPRhoAF-actinepidermalcell migrationsmembrane
Journal Article 2018-12-03 ✓ 1 Snippet Wallace AG, Raduwan H, Carlet J, Soto MC.
In-Text Gene Mentions

DCC

Show Full Abstract

During embryonic morphogenesis, cells and tissues undergo dramatic movements under the control of F-actin regulators. Our studies of epidermal cell migrations in developing <i>Caenorhabditis</i><i>elegans</i> embryos have identified multiple plasma membrane signals that regulate the Rac GTPase, thus regulating WAVE and Arp2/3 complexes, to promote branched F-actin formation and polarized enrichment. Here, we describe a pathway that acts in parallel to Rac to transduce membrane signals to control epidermal F-actin through the GTPase RHO-1/RhoA. RHO-1 contributes to epidermal migration through effects on underlying neuroblasts. We identify signals to regulate RHO-1-dependent events in the epidermis. HUM-7, the <i>C. elegans</i> homolog of human MYO9A and MYO9B, regulates F-actin dynamics during epidermal migration. Genetics and biochemistry support that HUM-7 behaves as a GTPase-activating protein (GAP) for the RHO-1/RhoA and CDC-42 GTPases. Loss of HUM-7 enhances RHO-1-dependent epidermal cell behaviors. We identify SAX-3/ROBO as an upstream signal that contributes to attenuated RHO-1 activation through its regulation of HUM-7/Myo9. These studies identify a new role for RHO-1 during epidermal cell migration, and suggest that RHO-1 activity is regulated by SAX-3/ROBO acting on the RhoGAP HUM-7.

Also flagged:Gene expressionchromosomechromosomesGrip1vesicleexocytosis
Journal Article 2018-12-03 ✓ 2 Snippets Monir MM, Khatun M, Mollah MNH.
In-Text Gene Mentions

…variants of genesUnc13c, and Grip1…

Unc13cis responsible for…

Show Full Abstract

Interval mapping approaches have been playing significant role for quantitative trait locus (QTL) mapping to discover genetic architecture of diseases or traits with molecular markers. Composite interval mapping (CIM) is one of the superior approaches of the interval mapping for discovering both linked and unlinked putative QTL positions. However, estimators of this approach are not robust against phenotypic outliers. As a result, it fails to detect true QTL positions in presence of outliers. In this study, we investigated the performance of β-Composite Interval Mapping (BetaCIM) for detecting both linked and unlinked important QTLs positions from the robustness points of views. Performance of this approach depends on the value of tuning parameter β. It reduces to the classical CIM approach for β →0. We described and formulated the cross-validation procedure for selecting trait specific optimum value of β. It was observed that the optimum value of β depends on both amount of contaminated observations and their scatteredness. BetaCIM approach discover similar QTL positions as classical IM/CIM in absence of phenotypic outliers, but gives better results in presence of phenotypic outliers in terms of detecting true QTLs and effects estimation. We formulated the generalized forms of robust QTL analysis and developed an R-package named "BetaCIM" by implementing this robust approach. Left and right kidney weight data sets of mouse intercross population (129 S1/SvlmJ × A/J) were analyzed by using BetaCIM, CIM, and IM approaches. For right kidney weight (RKW) CIM and BetaCIM provided similar LOD score profile, and both approaches identified 3 QTL positions. IM approach also identified 3 QTL positions. For left kidney weight (LKW), there was evidence of one outlying observation; and in this case the BetaCIM approach identified 2 QTL positions. However, none of the QTLs were significant by CIM and IM approaches at 5% level of significance. Gene expression ontology (GEO) search showed that the candidate genes (Otof and A330033J07Rik) of the identified QTLs for LKW were expressed in kidney. Both simulation and real data analysis results showed that BetaCIM approach improves the performance over the existing methods in presence of phenotypic outliers. Otherwise, it keeps almost equal performance.

Also flagged:viral infectionsironHCV infectionBMPSMADBMP6
Journal Article 2018-12-03 ✓ 1 Snippet Eddowes LA, Al-Hourani K, Ramamurthy N, Frankish J, Baddock HT, Sandor C, Ryan JD, Fusco DN, Arezes J, Giannoulatou E, Boninsegna S, Chevaliez S, Owens BMJ, Sun CC, Fabris P, Giordani MT, Martines D, Vukicevic S, Crowe J, Lin HY, Rehwinkel J, McHugh PJ, Binder M, Babitt JL, Chung RT, Lawless MW, Armitage AE, Webber C, Klenerman P, Drakesmith H.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Understanding the control of viral infections is of broad importance. Chronic hepatitis C virus (HCV) infection causes decreased expression of the iron hormone hepcidin, which is regulated by hepatic bone morphogenetic protein (BMP)/SMAD signalling. We found that HCV infection and the BMP/SMAD pathway are mutually antagonistic. HCV blunted induction of hepcidin expression by BMP6, probably via tumour necrosis factor (TNF)-mediated downregulation of the BMP co-receptor haemojuvelin. In HCV-infected patients, disruption of the BMP6/hepcidin axis and genetic variation associated with the BMP/SMAD pathway predicted the outcome of infection, suggesting that BMP/SMAD activity influences antiviral immunity. Correspondingly, BMP6 regulated a gene repertoire reminiscent of type I interferon (IFN) signalling, including upregulating interferon regulatory factors (IRFs) and downregulating an inhibitor of IFN signalling, USP18. Moreover, in BMP-stimulated cells, SMAD1 occupied loci across the genome, similar to those bound by IRF1 in IFN-stimulated cells. Functionally, BMP6 enhanced the transcriptional and antiviral response to IFN, but BMP6 and related activin proteins also potently blocked HCV replication independently of IFN. Furthermore, BMP6 and activin A suppressed growth of HBV in cell culture, and activin A inhibited Zika virus replication alone and in combination with IFN. The data establish an unappreciated important role for BMPs and activins in cellular antiviral immunity, which acts independently of, and modulates, IFN.

Also flagged:colorectal cancerCHD1Krüppel-like factorsHedgehogadenomanucleotide
Journal Article 2018-12-03 ✓ 1 Snippet Huyghe JR, Bien SA, Harrison TA, Kang HM, Chen S, Schmit SL, Conti DV, Qu C, Jeon J, Edlund CK, Greenside P, Wainberg M, Schumacher FR, Smith JD, Levine DM, Nelson SC, Sinnott-Armstrong NA, Albanes D, Alonso MH, Anderson K, Arnau-Collell C, Arndt V, Bamia C, Banbury BL, Baron JA, Berndt SI, Bézieau S, Bishop DT, Boehm J, Boeing H, Brenner H, Brezina S, Buch S, Buchanan DD, Burnett-Hartman A, Butterbach K, Caan BJ, Campbell PT, Carlson CS, Castellví-Bel S, Chan AT, Chang-Claude J, Chanock SJ, Chirlaque MD, Cho SH, Connolly CM, Cross AJ, Cuk K, Curtis KR, de la Chapelle A, Doheny KF, Duggan D, Easton DF, Elias SG, Elliott F, English DR, Feskens EJM, Figueiredo JC, Fischer R, FitzGerald LM, Forman D, Gala M, Gallinger S, Gauderman WJ, Giles GG, Gillanders E, Gong J, Goodman PJ, Grady WM, Grove JS, Gsur A, Gunter MJ, Haile RW, Hampe J, Hampel H, Harlid S, Hayes RB, Hofer P, Hoffmeister M, Hopper JL, Hsu WL, Huang WY, Hudson TJ, Hunter DJ, Ibañez-Sanz G, Idos GE, Ingersoll R, Jackson RD, Jacobs EJ, Jenkins MA, Joshi AD, Joshu CE, Keku TO, Key TJ, Kim HR, Kobayashi E, Kolonel LN, Kooperberg C, Kühn T, Küry S, Kweon SS, Larsson SC, Laurie CA, Le Marchand L, Leal SM, Lee SC, Lejbkowicz F, Lemire M, Li CI, Li L, Lieb W, Lin Y, Lindblom A, Lindor NM, Ling H, Louie TL, Männistö S, Markowitz SD, Martín V, Masala G, McNeil CE, Melas M, Milne RL, Moreno L, Murphy N, Myte R, Naccarati A, Newcomb PA, Offit K, Ogino S, Onland-Moret NC, Pardini B, Parfrey PS, Pearlman R, Perduca V, Pharoah PDP, Pinchev M, Platz EA, Prentice RL, Pugh E, Raskin L, Rennert G, Rennert HS, Riboli E, Rodríguez-Barranco M, Romm J, Sakoda LC, Schafmayer C, Schoen RE, Seminara D, Shah M, Shelford T, Shin MH, Shulman K, Sieri S, Slattery ML, Southey MC, Stadler ZK, Stegmaier C, Su YR, Tangen CM, Thibodeau SN, Thomas DC, Thomas SS, Toland AE, Trichopoulou A, Ulrich CM, Van Den Berg DJ, van Duijnhoven FJB, Van Guelpen B, van Kranen H, Vijai J, Visvanathan K, Vodicka P, Vodickova L, Vymetalkova V, Weigl K, Weinstein SJ, White E, Win AK, Wolf CR, Wolk A, Woods MO, Wu AH, Zaidi SH, Zanke BW, Zhang Q, Zheng W, Zheng W, Scacheri PC, Potter JD, Bassik MC, Kundaje A, Casey G, Moreno V, Abecasis GR, Nickerson DA, Gruber SB, Hsu L, Peters U.
In-Text Gene Mentions

…2q33.1, near genesPLCL1and SATB2 ,…

Show Full Abstract

To further dissect the genetic architecture of colorectal cancer (CRC), we performed whole-genome sequencing of 1,439 cases and 720 controls, imputed discovered sequence variants and Haplotype Reference Consortium panel variants into genome-wide association study data, and tested for association in 34,869 cases and 29,051 controls. Findings were followed up in an additional 23,262 cases and 38,296 controls. We discovered a strongly protective 0.3% frequency variant signal at CHD1. In a combined meta-analysis of 125,478 individuals, we identified 40 new independent signals at P < 5 × 10<sup>-8</sup>, bringing the number of known independent signals for CRC to ~100. New signals implicate lower-frequency variants, Krüppel-like factors, Hedgehog signaling, Hippo-YAP signaling, long noncoding RNAs and somatic drivers, and support a role for immune function. Heritability analyses suggest that CRC risk is highly polygenic, and larger, more comprehensive studies enabling rare variant analysis will improve understanding of biology underlying this risk and influence personalized screening strategies and drug development.

Also flagged:XADNMRpicolylamineGraphene oxideoxygenwater
Journal Article 2018-12-03 No Snippets Javed H, Islam A, Chauhan A, Kumar S, Kumar S.
Show Full Abstract

Graphene oxide (GO) was immobilized innovatively through azo spacer arm onto the surface of polymeric Amberlite XAD-16 resin in order to expose all oxygen functionalities freely available for metal ions coordination and further modification with picolylamine which governs selectivity. The GO Amberlite XAD-16 picolylamine enables the development of SPE column coupled with ICP-OES for preconcentration and determination of Pb (II) and Cu (II) in water and fish samples. Elution was performed by mild acid (2M HCl) no other carcinogenic organic solvent was used, prevents ligand leaching. Under optimized conditions, the preconcentration factors of 150 and detection limits 1.434 and 0.048 µg L<sup>-1</sup> for Pb (II) and Cu (II)  were obtained respectively.

Also flagged:CystinosinThiolMetabolismHomeostasistransmembraneprotein
Journal Article 2018-12-03 No Snippets Sumayao R, Newsholme P, McMorrow T.
Show Full Abstract

Cystinosin is a lysosomal transmembrane protein which facilitates transport of the disulphide amino acid cystine (CySS) from the lysosomes of the cell. This protein is encoded by the CTNS gene which is defective in the lysosomal storage disorder, cystinosis. Because of the apparent involvement of cystinosin in the intermediary thiol metabolism, its discovery has fuelled investigations into its role in modulating cellular redox homeostasis. The kidney proximal tubular cells (PTCs) have become the focus of various studies on cystinosin since the protein is highly expressed in these cells and kidney proximal tubular transport dysfunction is the foremost clinical manifestation of cystinosis. The lysosomal CySS pool is a major source of cytosolic cysteine (Cys), the limiting amino acid for the synthesis of an important antioxidant glutathione (GSH) via the γ-glutamyl cycle. Therefore, loss of cystinosin function is presumed to lead to cytosolic deficit of Cys which may impair GSH synthesis. However, studies using in vitro models lacking cystinosin yielded inconsistent results and failed to establish the mechanistic role of cystinosin in modulating GSH synthesis and redox homeostasis. Because of the complexity of the metabolic micro- and macro-environment in vivo, using in vitro models alone may not be able to capture the complete sequence of biochemical and physiological events that occur as a consequence of loss of cystinosin function. The coexistence of pathways for the overall handling and disposition of GSH, the modulation of CTNS gene by intracellular redox status and the existence of a non-canonical isoform of cystinosin may constitute possible rescue mechanisms in vivo to remediate redox perturbations in renal PTCs. Importantly, the mitochondria seem to play a critical role in orchestrating redox imbalances initiated by cystinosin dysfunction. Non-invasive techniques such as in vivo magnetic resonance imaging with the aid of systems biology approaches may provide invaluable mechanistic insights into the role of cystinosin in the essential intermediary thiol metabolism and in the overall regulation cellular redox homeostasis.

Also flagged:BDNFscopolaminereserpinedepressionTPH1monoamine
Journal Article 2018-12-03 ✓ 5 Snippets Yu H, Lv D, Shen M, Zhang Y, Zhou D, Chen Z, Wang C.
In-Text Gene Mentions

In addition, the reserpine-induced decreases in serotonin transporter (5-HTT), brain-derived neurotrophic factor (BDNF) and tryptophan hydroxylase 1 (TPH1) in mouse hippocampus and prefrontal cortex (PFC) were significantly reversed by scopolamine.

BDNF mediates the protective effects of scopolamine in reserpine-induced depression-like behaviors via up-regulation of 5-HTT and TPH1.

…via up-regulation of5-HTTand TPH1.…

…in serotonin transporter (5-HTT), brain-derived neurotrophic …

…partially by regulating5-HTT, BDNF and TPH1…

Show Full Abstract

Reserpine treatment in rodents has been shown to induce depression-like behaviors that mimic monoamine dysfunction implicated in the development of depression. Herein, we aimed to demonstrate the antidepressant-like activities of scopolamine, the muscarinic receptor antagonist, in a reserpine-induced mouse model. Mice were injected with 1.5 mg/kg (i.p.) of reserpine for 10 days, and the depression-like state was confirmed via the open field test (OFT) and forced swimming test (FST). Then, the mice were treated with scopolamine (25 µg/kg, i.p.) or saline for 3 days. Ten days of reserpine treatment resulted in a significant decrease in locomotor activity and an increase in immobility time in the OFT and FST, respectively, indicating that ten days of reserpine administration significantly induced depression-like behaviors in mice. However, scopolamine rapidly ameliorated the increase in immobility time in the FST and had no effect on locomotor activity in the OFT. In addition, the reserpine-induced decreases in serotonin transporter (5-HTT), brain-derived neurotrophic factor (BDNF) and tryptophan hydroxylase 1 (TPH1) in mouse hippocampus and prefrontal cortex (PFC) were significantly reversed by scopolamine. Our study provides evidence that scopolamine rapidly attenuates reserpine-induced depression in mice partially by regulating 5-HTT, BDNF and TPH1 in the hippocampus and PFC of mice.

Also flagged:Vitamin D Receptor4cognitiontranscription factorstranscription factorgene expression
Journal Article 2018-12-03 No Snippets Petschner P, Balogh N, Adori C, Tamasi V, Kumar S, Juhasz G, Bagdy G.
Show Full Abstract

The active ingredient of ecstasy, ±3,4-methylenedioxymethamphetamine (MDMA), in addition to its initial reinforcing effects, induces selective and non-selective brain damage. Evidences suggest that the hippocampus (HC), a central region for cognition, may be especially vulnerable to impairments on the long-run, nevertheless, transcription factors that may precede and regulate such chronic changes remained uninvestigated in this region. In the current study, we used gene-set enrichment analysis (GSEA) to reveal possible transcription factor candidates responsible for enhanced vulnerability of HC after MDMA administration. Dark Agouti rats were intraperitoneally injected with saline or 15 mg/kg MDMA. Three weeks later HC gene expression was measured by Illumina whole-genome beadarrays and GSEA was performed with MSigDB transcription factor sets. The number of significantly altered genes on the genome level (significance < 0.001) in up/downregulated sets was also counted. MDMA upregulated one, and downregulated 13 gene sets in the HC of rats, compared to controls, including Pax4, Pitx2, FoxJ2, FoxO1, Oct1, Sp3, AP3, FoxO4, and vitamin D receptor (VDR)-regulated sets (<i>q</i>-value <0.05). VDR-regulated set contained the second highest number of significantly altered genes, including among others, Camk2n2, Gria3, and Grin2a. Most identified transcription factors are implicated in the response to ischemia confirming that serious hypoxia/ischemia occurs in the HC after MDMA administration, which may contribute to the selective vulnerability of this brain region. Moreover, our results also raise the possibility that vitamin D supplementation, in addition to the commonly used antioxidants, could be a potential alternative method to attenuate MDMA-induced chronic hippocampal impairments.

Also flagged:Monoaminethermoregulationmonoaminesmetabolismhormonebehavioral
Journal Article 2018-12-03 ✓ 1 Snippet Sanhueza N, Donoso A, Aguilar A, Farlora R, Carnicero B, Míguez JM, Tort L, Valdes JA, Boltana S.
In-Text Gene Mentions

Our RNA-seq results show that genes related to the biosynthesis of dopamine and serotonin, such as dcc (124 and 156 dph), tph1 (71 and 156 dph) and tph2 (71 and 124 dph) were upregulated in the group of fish with access to thermal gradient (WTR), while genes involved in the degradation of monoamines, such as monoamine oxidase a (maoa) and aldehyde dehydrogenase 2 family (aldh2) were downregulated in the same group of fish at 156 dph.

Show Full Abstract

Fish are ectotherm organisms that move through different thermal zones according to their physiological requirements and environmental availability, a behavior known as thermoregulation. Thermoregulation in ectothermic animals is influenced by their ability to effectively respond to thermal variations. While it is known that ectotherms are affected by thermal changes, it remains unknown how physiological and/or metabolic traits are impacted by modifications in the thermal environment. In captivity (land-based infrastructures or nets located in the open sea), fish are often restricted to spatially constant temperature conditions within the containment unit and cannot choose among different thermal conditions for thermoregulation. In order to understand how spatial variation of temperature may affect fish welfare and stress, we designed an experiment using either restricted or wide thermal ranges, looking for changes at hormonal and molecular levels. Also, thermal variability impact on fish behavior was measured. Our results showed that in Atlantic salmon (<i>Salmo salar</i>), a wide thermal range (ΔT 6.8°C) was associated with significant increases in monoamines hormone levels and in the expression of clock genes. Aggressive and territoriality behavior decreased, positively affecting parameters linked to welfare, such as growth and fin damage. In contrast, a restricted thermal range (ΔT 1.4°C) showed the opposite pattern in all the analyzed parameters, therefore, having detrimental effects on welfare. In conclusion, our results highlight the key role of thermal range amplitude on fish behavior and on interactions with major metabolism-regulating processes, such as hormone performance and molecular regulatory mechanisms that have positive effects on the welfare.

Also flagged:ironiron deficiencyintraventricular hemorrhagelate-onset sepsisnecrotizing enterocolitisNEC
Journal Article 2018-12-03 ✓ 2 Snippets Ghirardello S, Di Tommaso M, Fiocchi S, Locatelli A, Perrone B, Pratesi S, Saracco P.
In-Text Gene Mentions

The authors observed that neonates in the DCC group had higher hemoglobin concentration at birth (13.4 vs. 10.2 g/dl; p = 0.0003), lower incidence of anemia (Hb> 12 g/dl: 70.6% vs. 25%, p = 0.004), reduced need for exchange transfusion without increasing the rate of pathologic hyperbilirubinemia.

…) showed thatDCCpromotes a smoother…

Show Full Abstract

At delivery, if the cord is not clamped, blood continues to pass from the placenta to the newborn during the first minutes of life, allowing the transfer of 25-35 ml/kg of placental blood to the newborn, depending on gestational age, the timing of cord clamping, the position of the infant at birth, the onset of respiration, and administration of uterotonics to the mother. However, deriving benefits from delayed cord clamping (DCC) are not merely related to placental-to-fetal blood transfusion; establishing spontaneous ventilation before cutting the cord improves venous return to the right heart and pulmonary blood flow, protecting the newborn from the transient low cardiac output, and systemic arterial pressure fluctuations. Recent meta-analyses showed that delayed cord clamping reduces mortality and red blood cell transfusions in preterm newborns and increases iron stores in term newborns. Various authors suggested umbilical cord milking (UCM) as a safe alternative when delayed cord clamping is not feasible. Many scientific societies recommend waiting 30-60 s before clamping the cord for both term and preterm newborns not requiring resuscitation. To improve the uptake of placental transfusion strategies, in 2016 an Italian Task Force for the Management of Umbilical Cord Clamping drafted national recommendations for the management of cord clamping in term and preterm deliveries. The task force performed a detailed review of the literature using the GRADE methodological approach. The document analyzed all clinical scenarios that operators could deal with in the delivery room, including cord blood gas analysis during delayed cord clamping and time to cord clamping in the case of umbilical cord blood banking. The panel intended to promote a more physiological and individualized approach to cord clamping, specifically for the most preterm newborn. A feasible option to implement delayed cord clamping in very preterm deliveries is to move the neonatologist to the mother's bedside to assess the newborn's clinical condition at birth. This option could safely guarantee the first steps of stabilization before clamping the cord and allow DCC in the first 30 s of life, without delaying resuscitation. Contra-indications to placental transfusion strategies are clinical situations that may endanger mother 's health and those that may delay immediate newborn's resuscitation when required.

Also flagged:Hepatocellular CarcinomaLiver DiseasecirrhosistumorLiver CancerSubstance abuse
Journal Article 2018-12-03 ✓ 1 Snippet Dakhoul L, Gawrieh S, Jones KR, Ghabril M, McShane C, Orman E, Vilar-Gomez E, Chalasani N, Nephew L.
In-Text Gene Mentions

…metabolic liver diseases (hemochromatosisand alpha‐1 antitrypsin…

Show Full Abstract

Black patients have higher mortality and are less likely to receive liver transplantation for hepatocellular carcinoma (HCC) than white patients. Reasons for these disparities have not been fully elucidated. Comorbid disease, liver disease severity, cirrhosis etiologies, and tumor characteristics were compared between black and white patients with HCC seen at the Indiana University Academic Medical Center from January 2000 to June 2014. Logistic regression was used to investigate the primary outcome, which was liver transplantation. Log-rank testing was used to compare survival between the two groups. Subgroup analysis explored reasons for failure to undergo liver transplantation in patients within Milan criteria. The cohort included 1,032 (86%) white and 164 (14%) black patients. Black and white patients had similar Model for End-Stage Liver Disease (MELD) and Child-Pugh scores (CPSs). There was a trend toward larger tumor size (5.3 cm versus 4.7 cm; <i>P</i> = 0.05) in black patients; however, Barcelona Clinic Liver Cancer (BCLC) staging and Milan criteria were similar. Black patients were less likely to undergo liver transplantation than white patients; this was a disparity that was not attenuated (odds ratio [OR], 0.43; 95% confidence interval [CI], 0.21-0.90) on multivariable analysis. Substance abuse was more frequently cited as the reason black patients within Milan criteria failed to undergo transplantation compared to white patients. Survival was similar between the two groups. <i>Conclusion:</i> Racial differences in patient and tumor characteristics were small and did not explain the disparity in liver transplantation. Higher rates of substance abuse in black patients within Milan criteria who failed to undergo transplantation suggest social factors contribute to this disparity in this cohort.

Also flagged:degenerative diseasesosteoarthritismembraneOAageingextracellular
Journal Article 2018-12-03 No Snippets Uzieliene I, Urbonaite G, Tachtamisevaite Z, Mobasheri A, Bernotiene E.
Show Full Abstract

Menstrual blood is a unique body fluid that contains mesenchymal stem cells (MSCs). These cells have attracted a great deal of attention due to their exceptional advantages including easy access and frequently accessible sample source and no need for complex ethical and surgical interventions, as compared to other tissues. Menstrual blood-derived MSCs possess all the major stem cell properties and even have a greater proliferation and differentiation potential as compared to bone marrow-derived MSCs, making them a perspective tool in a further clinical practice. Although the potential of menstrual blood stem cells to differentiate into a large variety of tissue cells has been studied in many studies, their chondrogenic properties have not been extensively explored and investigated. Articular cartilage is susceptible to traumas and degenerative diseases, such as osteoarthritis, and has poor self-regeneration capacity and therefore requires more effective therapeutic technique. MSCs seem promising candidates for cartilage regeneration; however, no clinically effective stem cell-based repair method has yet emerged. This chapter focuses on studies in the field of menstrual blood-derived MSCs and their chondrogenic differentiation potential and suitability for application in cartilage regeneration. Although a very limited number of studies have been made in this field thus far, these cells might emerge as an efficient and easily accessible source of multipotent cells for cartilage engineering and cell-based chondroprotective therapy.

Also flagged:apatitecalciumhydroxylmineralizationironphoton
Journal Article 2018-12-03 No Snippets Hesse B, Stier D, Cotte M, Forien JB, Zaslansky P.
Show Full Abstract

For biomedical research, successful imaging of calcified microstructures often relies on absorption differences between features, or on employing dies with selective affinity to areas of interest. When texture is concerned, e.g. for crystal orientation studies, polarization induced contrast is of particular interest. This requires sufficient interaction of the incoming radiation with the volume of interest in the sample to produce orientation-based contrast. Here we demonstrate polarization induced contrast at the calcium K-edge using submicron sized monochromatic synchrotron X-ray beams. We exploit the orientation dependent subtle absorption differences of hydroxyl-apatite crystals in teeth, with respect to the polarization field of the beam. Interaction occurs with the fully mineralized samples, such that differences in density do not contribute to the contrast. Our results show how polarization induced contrast X-ray fluorescence mapping at specific energies of the calcium K-edge reveals the micrometer and submicrometer crystal arrangements in human tooth tissues. This facilitates combining both high spatial resolution and large fields of view, achieved in relatively short acquisition times in reflection geometry. In enamel we observe the varying crystal orientations of the micron sized prisms exposed on our prepared surface. We easily reproduce crystal orientation maps, typically observed in polished thin sections. We even reveal maps of submicrometer mineralization fronts in spherulites in intertubular dentine. This Ca K-edge polarization sensitive method (XRF-PIC) does not require thin samples for transmission nor extensive sample preparation. It can be used on both fresh, moist samples as well as fossilized samples where the information of interests lies in the crystal orientations and where the crystalline domains extend several micrometers beneath the exposed surface.

Also flagged:mitochondrialmitochondriametabolismmitophagydeathneurodegenerative diseases
Journal Article 2018-12-03 No Snippets Gao F, Zhang J.
Show Full Abstract

Mitochondria homeostasis is sustained by the mitochondrial quality control (MQC) system, which is crucial for cellular health, especially in the maintenance of functional mitochondria. A healthy mitochondria network is essential for life as it regulates cellular metabolism processes, particularly ATP production. Mitochondrial dynamics and mitophagy are two highly integrated processes in MQC system that determines whether damaged mitochondria will be repaired or degraded. Neurons are highly differentiated cells which demand high energy consumption. Therefore, compromised MQC processes and the accumulation of dysfunctional mitochondria may be the main cause of neuronal death and lead to neurodegeneration. Here, we focus on the inseparable relationship of mitochondria dynamics and mitophagy and how their dysfunction may lead to neurodegenerative diseases.

The genetic basis of disease.

Also flagged:cancercomplex disorderschromosomesmetaphasecell cyclecentromere
Journal Article 2018-12-02 ✓ 1 Snippet Jackson M, Marks L, May GHW, Wilson JB.
In-Text Gene Mentions

Huntington disease (HD) is one of the trinucleotide repeat expansion disorders where the CAG repeat encodes a polyglutamine tract within the coding region of the huntingtin gene HTT on chromosome 4p16.

Show Full Abstract

Genetics plays a role, to a greater or lesser extent, in all diseases. Variations in our DNA and differences in how that DNA functions (alone or in combinations), alongside the environment (which encompasses lifestyle), contribute to disease processes. This review explores the genetic basis of human disease, including single gene disorders, chromosomal imbalances, epigenetics, cancer and complex disorders, and considers how our understanding and technological advances can be applied to provision of appropriate diagnosis, management and therapy for patients.

Also flagged:Colorectal Cancercancertolung cancerbreast cancertumours
Journal Article 2018-12-02 ✓ 2 Snippets Chauvin A, Boisvert FM.
In-Text Gene Mentions

In CRC, the loss of chromosome 18q heterozygosity, containing the SMAD4 and DCC genes, as well as the loss of other tumour suppressor genes, such as APC, TP53 or PTEN, is most often observed.

…the SMAD4 andDCCgenes, as well…

Show Full Abstract

Colorectal cancer is the third most common and the fourth most lethal cancer worldwide. In most of cases, patients are diagnosed at an advanced or even metastatic stage, thus explaining the high mortality. The lack of proper clinical tests and the complicated procedures currently used for detecting this cancer, as well as for predicting the response to treatment and the outcome of a patient's resistance in guiding clinical practice, are key elements driving the search for biomarkers. In the present overview, the different biomarkers (diagnostic, prognostic, treatment resistance) discovered through proteomics studies in various colorectal cancer study models (blood, stool, biopsies), including the different proteomic techniques used for the discovery of these biomarkers, are reviewed, as well as the various tests used in clinical practice and those currently in clinical phase. These studies define the limits and perspectives related to proteomic biomarker research for personalised medicine in colorectal cancer.

Also flagged:benzamidepicolinamidedimethylamineacetylcholinesteraseAChEbutyrylcholinesterase
Journal Article 2018-12-01 No Snippets Gao XH, Liu LB, Liu HR, Tang JJ, Kang L, Wu H, Cui P, Yan J.
Show Full Abstract

A series of benzamide and picolinamide derivatives containing dimethylamine side chain (4a-4c and 7a-7i) were synthesised and evaluated for acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) inhibitory activity in vitro. Structure-activity relationship investigation revealed that the substituted position of dimethylamine side chain markedly influenced the inhibitory activity and selectivity against AChE and BChE. In addition, it seemed that the bioactivity of picolinamide amide derivatives was stronger than that of benzamide derivatives. Among them, compound 7a revealed the most potent AChE inhibitory activity (IC<sub>50</sub>: 2.49 ± 0.19 μM) and the highest selectivity against AChE over BChE (Ratio: 99.40). Enzyme kinetic study indicated that compound 7a show a mixed-type inhibition against AChE. The molecular docking study revealed that this compound can bind with both the catalytic site and the peripheral site of AChE.

Also flagged:NsynthesiscarbazoleheterocyclesTopoisomerases Imetastatic breast cancer
Journal Article 2018-12-01 No Snippets Sinicropi MS, Iacopetta D, Rosano C, Randino R, Caruso A, Saturnino C, Muià N, Ceramella J, Puoci F, Rodriquez M, Longo P, Plutino MR.
Show Full Abstract

Synthetic or natural carbazole derivatives constitute an interesting class of heterocycles, which showed several pharmaceutical properties and occupied a promising place as antitumour tools in preclinical studies. They target several cellular key-points, e.g. DNA and Topoisomerases I and II. The most studied representative, i.e. Ellipticine, was introduced in the treatment of metastatic breast cancer. However, because of the onset of dramatic side effects, its use was almost dismissed. Many efforts were made in order to design and synthesise new carbazole derivatives with good activity and reduced side effects. The major goal of the present study was to synthesise a series of new N-thioalkylcarbazole derivatives with anti-proliferative effects. Two compounds, 5a and 5c, possess an interesting anti-proliferative activity against breast and uterine cancer cell lines without affecting non-tumoural cell lines viability. The most active compound (5c) induces cancer cells death triggering the intrinsic apoptotic pathway by inhibition of Topoisomerase II.

Also flagged:regulation ofgene expressionhistone demethylaseshistonecancerdemethylation
Journal Article 2018-12-01 No Snippets Lin H, Li Q, Li Q, Zhu J, Gu K, Jiang X, Hu Q, Feng F, Qu W, Chen Y, Sun H.
Show Full Abstract

Histone demethylation is a vital process in epigenetic regulation of gene expression. A number of histone demethylases are present to control the methylated states of histone. Among these enzymes, KDM4s are one subfamily of JmjC KDMs and play important roles in both normal and cancer cells. The discovery of KDM4s inhibitors is a potential therapeutic strategy against different diseases including cancer. Here, we summarize the development of KDM4s inhibitors and some related pharmaceutical information to provide an update of recent progress in KDM4s inhibitors.

Also flagged:metabolismnucleotidesbindingRNA-binding proteinsRBPHuR
Journal Article 2018-12-01 ✓ 1 Snippet Munteanu A, Mukherjee N, Ohler U.
In-Text Gene Mentions

RC3H1

Show Full Abstract

<h4>Motivation</h4>RNA-binding proteins (RBPs) regulate every aspect of RNA metabolism and function. There are hundreds of RBPs encoded in the eukaryotic genomes, and each recognize its RNA targets through a specific mixture of RNA sequence and structure properties. For most RBPs, however, only a primary sequence motif has been determined, while the structure of the binding sites is uncharacterized.<h4>Results</h4>We developed SSMART, an RNA motif finder that simultaneously models the primary sequence and the structural properties of the RNA targets sites. The sequence-structure motifs are represented as consensus strings over a degenerate alphabet, extending the IUPAC codes for nucleotides to account for secondary structure preferences. Evaluation on synthetic data showed that SSMART is able to recover both sequence and structure motifs implanted into 3'UTR-like sequences, for various degrees of structured/unstructured binding sites. In addition, we successfully used SSMART on high-throughput in vivo and in vitro data, showing that we not only recover the known sequence motif, but also gain insight into the structural preferences of the RBP.<h4>Availability and implementation</h4>SSMART is freely available at https://ohlerlab.mdc-berlin.de/software/SSMART_137/.<h4>Supplementary information</h4>Supplementary data are available at Bioinformatics online.

Also flagged:Donepezilconjugationbenzylpiperidinebenzylpiperazinebenzimidazolebenzofuran
Journal Article 2018-12-01 No Snippets Piemontese L, Tomás D, Hiremathad A, Capriati V, Candeias E, Cardoso SM, Chaves S, Santos MA.
Show Full Abstract

A new series of multifunctional hybrids, based on the structure of the donepezil (DNP) drug, have been developed and evaluated as potential anti Alzheimer's disease (AD) agents. The rationale of this study was the conjugation of a benzylpiperidine/benzylpiperazine moiety with derivatives of bioactive heterocyclics (benzimidazole or benzofuran), to mimic the main structure of DNP and to endow the hybrids with additional relevant properties such as inhibition of amyloid beta (Aβ) peptide aggregation, antioxidant activity and metal chelation. Overall, they showed good activity for AChE inhibition (IC<sub>50</sub>=4.0-30.0 μΜ) and moderate ability for inhibition of Aβ<sub>1-42</sub> self-mediated aggregation. The hybrids containing chelating groups showed improvement in the inhibition of Cu-induced Aβ<sub>42</sub> aggregation and the antioxidant capacity. Moreover, neuroprotective effects of these compounds were evidenced in neuroblastoma cells after Aβ<sub>1-42</sub> induced toxicity. Structure-activity relationship allowed the identification of some promising compounds and the main determinant structural features for the targeted properties.

Also flagged:transportationmethylationgestationcytosineguanineadenine
Journal Article 2018-12-01 No Snippets Littlejohn BP, Price DM, Neuendorff DA, Carroll JA, Vann RC, Riggs PK, Riley DG, Long CR, Welsh TH, Randel RD.
Show Full Abstract

The objective of this experiment was to identify genome-wide differential methylation of DNA in young prenatally stressed (PNS) bull calves. Mature Brahman cows (n = 48) were transported for 2-h periods at 60 ± 5, 80 ± 5, 100 ± 5, 120 ± 5, and 140 ± 5 d of gestation or maintained as nontransported Controls (n = 48). Methylation of DNA from white blood cells from a subset of 28-d-old intact male offspring (n = 7 PNS; n = 7 Control) was assessed via reduced representation bisulfite sequencing. Samples from PNS bulls contained 16,128 CG, 226 CHG, and 391 CHH (C = cytosine; G = guanine; H = either adenine, thymine, or cytosine) sites that were differentially methylated compared to samples from Controls. Of the CG sites, 7,407 were hypermethylated (at least 10% more methylated than Controls; P ≤ 0.05) and 8,721 were hypomethylated (at least 10% less methylated than Controls; P ≤ 0.05). Increased DNA methylation in gene promoter regions typically results in decreased transcriptional activity of the region. Therefore, differentially methylated CG sites located within promoter regions (n = 1,205) were used to predict (using Ingenuity Pathway Analysis software) alterations to canonical pathways in PNS compared with Control bull calves. In PNS bull calves, 113 pathways were altered (P ≤ 0.05) compared to Controls. Among these were pathways related to behavior, stress response, metabolism, immune function, and cell signaling. Genome-wide differential DNA methylation and predicted alterations to pathways in PNS compared with Control bull calves suggest epigenetic programming of biological systems in utero.

Also flagged:energy deficiency disordersmitochondrialmitochondrial diseasePrimary Mitochondrial Diseasemitochondrial oxidative phosphorylationMitochondria
Journal Article 2018-12-01 No Snippets McCormick EM, Zolkipli-Cunningham Z, Falk MJ.
Show Full Abstract

<h4>Purpose of review</h4>Primary mitochondrial disease (PMD) is a genetically and phenotypically diverse group of inherited energy deficiency disorders caused by impaired mitochondrial oxidative phosphorylation (OXPHOS) capacity. Mutations in more than 350 genes in both mitochondrial and nuclear genomes are now recognized to cause primary mitochondrial disease following every inheritance pattern. Next-generation sequencing technologies have dramatically accelerated mitochondrial disease gene discovery and diagnostic yield. Here, we provide an up-to-date review of recently identified, novel mitochondrial disease genes and/or pathogenic variants that directly impair mitochondrial structure, dynamics, and/or function.<h4>Recent findings</h4>A review of PubMed publications was performed from the past 12 months that identified 16 new PMD genes and/or pathogenic variants, and recognition of expanded phenotypes for a wide variety of mitochondrial disease genes.<h4>Summary</h4>Broad-based exome sequencing has become the standard first-line diagnostic approach for PMD. This has facilitated more rapid and accurate disease identification, and greatly expanded understanding of the wide spectrum of potential clinical phenotypes. A comprehensive dual-genome sequencing approach to PMD diagnosis continues to improve diagnostic yield, advance understanding of mitochondrial physiology, and provide strong potential to develop precision therapeutics targeted to diverse aspects of mitochondrial disease pathophysiology.

Also flagged:opioidOPRM1ATP-binding cassette subfamily B member 1CYP2D6catechol- O -methyl transferaseABCC3
Journal Article 2018-12-01 No Snippets Packiasabapathy S, Horn N, Sadhasivam S.
Show Full Abstract

<h4>Purpose of review</h4>The current review will discuss the current literature on genetics of pain and analgesia, with special emphasis on perioperative setting. We will also discuss pharmacogenetics-based management guidelines, current clinical status and future perspectives.<h4>Recent findings</h4>Recent literature suggests that the interindividual variability in pain and postoperative analgesic response is at least in part because of one's genetic make-up. Some of the well characterized polymorphisms that are associated with surgical pain and opioid-related postoperative adverse outcomes are described in catechol-O-methyl transferase, CYP2D6 and μ-opioid receptor (OPRM1), ATP-binding cassette subfamily B member 1, ABCC3, organic cation transporter 1 genes. Clinical Pharmacogenetics Implementation Consortium has put forth recommendations on CYP2D6 genotype-based opioid selection and dosing. The list of drug-gene pairs studied continue to expand.<h4>Summary</h4>Pharmacogenetic approach marks the dawn of personalized pain medicine both in perioperative and chronic pain settings.

Also flagged:NEAT1polyglutamineneurodegenerative disorderspathogenesispolyQ disordersnuclear paraspeckle assembly transcript 1
Journal Article 2018-12-01 No Snippets Cheng C, Spengler RM, Keiser MS, Monteys AM, Rieders JM, Ramachandran S, Davidson BL.
Show Full Abstract

Polyglutamine (polyQ) repeat diseases are a class of neurodegenerative disorders caused by CAG-repeat expansion. There are diverse cellular mechanisms behind the pathogenesis of polyQ disorders, including transcriptional dysregulation. Interestingly, we find that levels of the long isoform of nuclear paraspeckle assembly transcript 1 (Neat1L) are elevated in the brains of mouse models of spinocerebellar ataxia types 1, 2, 7 and Huntington's disease (HD). Neat1L was also elevated in differentiated striatal neurons derived from HD knock-in mice and in HD patient brains. The elevation was mutant Huntingtin (mHTT) dependent, as knockdown of mHTT in vitro and in vivo restored Neat1L to normal levels. In additional studies, we found that Neat1L is repressed by methyl CpG binding protein 2 (MeCP2) by RNA-protein interaction but not by occupancy of MeCP2 at its promoter. We also found that NEAT1L overexpression protects from mHTT-induced cytotoxicity, while reducing it enhanced mHTT-dependent toxicity. Gene set enrichment analysis of previously published RNA sequencing data from mouse embryonic fibroblasts and cells derived from HD patients shows that loss of NEAT1L impairs multiple cellular functions, including pathways involved in cell proliferation and development. Intriguingly, the genes dysregulated in HD human brain samples overlap with pathways affected by a reduction in NEAT1, confirming the correlation of NEAT1L and HD-induced perturbations. Cumulatively, the role of NEAT1L in polyQ disease model systems and human tissues suggests that it may play a protective role in CAG-repeat expansion diseases.

Also flagged:bindingRNA-binding proteinRoquinimmune responsesregulation ofgene expression
Journal Article 2018-12-01 ✓ 5 Snippets Braun J, Fischer S, Xu ZZ, Sun H, Ghoneim DH, Gimbel AT, Plessmann U, Urlaub H, Mathews DH, Weigand JE.
In-Text Gene Mentions

…highly similar paralogs,Roquin-1and Roquin-2 (…

…and Roquin-2 (RC3H1and RC3H2 ),…

Roquin-1was first discovered…

…However, knockout ofRoquin-1or Roquin-2 causes…

…structural analyses ofRoquin-1or Roquin-2 in…

Show Full Abstract

Post-transcriptional gene regulation controls the amount of protein produced from a specific mRNA by altering both its decay and translation rates. Such regulation is primarily achieved by the interaction of trans-acting factors with cis-regulatory elements in the untranslated regions (UTRs) of mRNAs. These interactions are guided either by sequence- or structure-based recognition. Similar to sequence conservation, the evolutionary conservation of a UTR's structure thus reflects its functional importance. We used such structural conservation to identify previously unknown cis-regulatory elements. Using the RNA folding program Dynalign, we scanned all UTRs of humans and mice for conserved structures. Characterizing a subset of putative conserved structures revealed a binding site of the RNA-binding protein Roquin. Detailed functional characterization in vivo enabled us to redefine the binding preferences of Roquin and identify new target genes. Many of these new targets are unrelated to the established role of Roquin in inflammation and immune responses and thus highlight additional, unstudied cellular functions of this important repressor. Moreover, the expression of several Roquin targets is highly cell-type-specific. In consequence, these targets are difficult to detect using methods dependent on mRNA abundance, yet easily detectable with our unbiased strategy.

Also flagged:Tc1chromatin remodelinghistonemethylationgene expressionGp-9
Journal Article 2018-12-01 No Snippets Lee CC, Wang J.
Show Full Abstract

Transposable elements (TEs) are present in almost all organisms and affect the host in various ways. TE activity can increase genomic variation and thereby affect host evolution. Currently active TEs are particularly interesting because they are likely generating new genomic diversity. These active TEs have been poorly studied outside of model organisms. In this study, we aimed to identify currently active TEs of a notorious invasive species, the red imported fire ant Solenopsis invicta. Using RNA profiling of male and female germline tissues, we found that the majority of TE-containing transcripts in the fire ant germline belong to the IS630-Tc1-Mariner superfamily. Subsequent genomic characterization of fire ant mariner content, molecular evolution analysis, and population comparisons revealed a highly expressed and highly polymorphic mariner element that is rapidly expanding in the fire ant genome. Additionally, using comparative genomics of multiple insect species we showed that this mariner has undergone several recent horizontal transfer events (<5.1 My). Our results document a rare case of a currently active TE originating from horizontal transfer.

Also flagged:HypertensionobesitysugarFTOcardiovascular diseasecancer
Journal Article 2018-12-01 ✓ 2 Snippets Ding M, Ellervik C, Huang T, Jensen MK, Curhan GC, Pasquale LR, Kang JH, Wiggs JL, Hunter DJ, Willett WC, Rimm EB, Kraft P, Chasman DI, Qi L, Hu FB, Qi Q.
In-Text Gene Mentions

neuronal growth regulator 1

NEGR1

Show Full Abstract

<h4>Background</h4>It is unknown whether dietary quality modifies genetic association with body mass index (BMI).<h4>Objective</h4>This study examined whether dietary quality modifies genetic association with BMI.<h4>Design</h4>We calculated 3 diet quality scores including the Alternative Healthy Eating Index 2010 (AHEI-2010), the Alternative Mediterranean Diet score (AMED), and the Dietary Approach to Stop Hypertension (DASH) diet score. We examined the interactions of a genetic risk score (GRS) based on 97 BMI-associated variants with the 3 diet quality scores on BMI in 30,904 participants from 3 large cohorts.<h4>Results</h4>We found significant interactions between total GRS and all 3 diet scores on BMI assessed after 2-3 y, with an attenuated genetic effect observed in individuals with healthier diets (AHEI: P-interaction = 0.003; AMED: P = 0.001; DASH: P = 0.004). For example, the difference in BMI (kg/m2) per 10-unit increment of the GRS was smaller among participants in the highest tertile of AHEI score compared with those in the lowest tertile (0.84; 95% CI: 0.72, 0.96 compared with 1.14; 95% CI: 0.99, 1.29). Results were consistent across the 3 cohorts with no significant heterogeneity. The interactions with diet scores on BMI appeared more significant for central nervous system GRSs (P < 0.01 for 3 diet scores) than for non-central nervous system GRSs (P > 0.05 for 3 diet scores).<h4>Conclusions</h4>A higher diet quality attenuated genetic predisposition to obesity. These findings underscore the importance of maintaining a healthful diet for the prevention of obesity, particularly for those individuals with a strong genetic predisposition to obesity. This trial was registered with the Clinical Trial Registry as NCT03577639.

Also flagged:cancertumorreverse-transcriptioncancersleukemialymphoma
Journal Article 2018-12-01 No Snippets Segaliny AI, Li G, Kong L, Ren C, Chen X, Wang JK, Baltimore D, Wu G, Zhao W.
Show Full Abstract

Adoptive T cell transfer, in particular TCR T cell therapy, holds great promise for cancer immunotherapy with encouraging clinical results. However, finding the right TCR T cell clone is a tedious, time-consuming, and costly process. Thus, there is a critical need for single cell technologies to conduct fast and multiplexed functional analyses followed by recovery of the clone of interest. Here, we use droplet microfluidics for functional screening and real-time monitoring of single TCR T cell activation upon recognition of target tumor cells. Notably, our platform includes a tracking system for each clone as well as a sorting procedure with 100% specificity validated by downstream single cell reverse-transcription PCR and sequencing of TCR chains. Our TCR screening prototype will facilitate immunotherapeutic screening and development of T cell therapies.

Also flagged:Huntington's diseaseHDATF7IPhistone H3 methyltransferaseSETDB1heterochromatin
Journal Article 2018-12-01 ✓ 5 Snippets Irmak D, Fatima A, Gutiérrez-Garcia R, Rinschen MM, Wagle P, Altmüller J, Arrigoni L, Hummel B, Klein C, Frese CK, Sawarkar R, Rada-Iglesias A, Vilchez D.
In-Text Gene Mentions

Here we use human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) from patients with Huntington's disease (HD-iPSCs) to shed light into the normal function of huntingtin (HTT) and its demise in disease.

Notably, mutant expanded polyglutamine repeats in HTT diminish its interaction with ATF7IP-SETDB1 complex and trigger H3K9me3 in HD-iPSCs.

…function of huntingtin (HTT) and its demise…

…We find thatHTTbinds ATF7IP, a…

HTTinhibits the interaction…

Show Full Abstract

Pluripotent stem cells are invaluable resources to study development and disease, holding a great promise for regenerative medicine. Here we use human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) from patients with Huntington's disease (HD-iPSCs) to shed light into the normal function of huntingtin (HTT) and its demise in disease. We find that HTT binds ATF7IP, a regulator of the histone H3 methyltransferase SETDB1. HTT inhibits the interaction of the ATF7IP-SETDB1 complex with other heterochromatin regulators and transcriptional repressors, maintaining low levels of H3K9 trimethylation (H3K9me3) in hESCs. Loss of HTT promotes global increased H3K9me3 levels and enrichment of H3K9me3 marks at distinct genes, including transcriptional regulators of neuronal differentiation. Although these genes are normally expressed at low amounts in hESCs, HTT knockdown (KD) reduces their induction during neural differentiation. Notably, mutant expanded polyglutamine repeats in HTT diminish its interaction with ATF7IP-SETDB1 complex and trigger H3K9me3 in HD-iPSCs. Conversely, KD of ATF7IP in HD-iPSCs reduces H3K9me3 alterations and ameliorates gene expression changes in their neural counterparts. Taken together, our results indicate ATF7IP as a potential target to correct aberrant H3K9me3 levels induced by mutant HTT.

Also flagged:protein disulfide-isomerase A1PDIA1peroxiredoxin 6glucose-regulated protein 78 kDaGRP78redox homeostasis
Journal Article 2018-12-01 ✓ 2 Snippets Nishad S, Ghosh A.
In-Text Gene Mentions

…(PDIA1), peroxiredoxin 6 (PRDX6) and glucose-regulated protei…

…PDIA1 andPRDX6are known to…

Show Full Abstract

There remain significant uncertainties in estimation of risks with low doses of radiation. The small coastal belt in the southwestern state of Kerala, India, extending from Neendakara in the south to Purakkad in the north is one of the most extensively studied high-level natural background radiation areas (HLNRAs) of the world to address these concerns. The natural radioactivity here is due to occurrence of monazite sand bearing placer deposits along the coastline. In this study, proteomic approach was employed to study the response of human peripheral blood mononuclear cells (PBMCs) from individuals residing in HLNRA (N = 10; mean radiation dose: 15.60 ± 3.04 mGy/y) vis-à-vis responses in individuals from adjoining normal-level natural background radiation areas (NLNRA; N = 10; mean radiation dose: ≤1.50 mGy/y) using two-dimensional gel electrophoresis coupled with mass spectrometry. A total of 15 proteins were found to be statistically altered in individuals from HLNRA when compared to individuals from NLNRA (P ≤ 0.05). Most of the changes in expression were small. The mean coefficient of variation for the differentially altered proteins was found to be ~34%. Pathway enrichment analysis with Database for Annotation, Visualization and Integrated Discovery distinguished 44 biological processes significantly (P ≤ 0.05) modulated in HLNRA samples. More importantly, when challenged with an ex vivo dose of 2 Gy, HLNRA PBMCs responded with an up-regulation of many protective pro-survival proteins such as protein disulfide-isomerase A1 (PDIA1), peroxiredoxin 6 (PRDX6) and glucose-regulated protein 78 kDa (GRP78). PDIA1 and PRDX6 are known to play an important role in redox homeostasis. GRP78 is considered the master regulator of unfolded protein response that aims to restore endoplasmic reticulum homeostasis and thus, regulate cell survival. Principal component analysis identified clear clusters based on radiation dose. The expression changes of key proteins were validated by western blotting using additional samples from HLNRA and NLNRA. This indicates that the human cells respond to low dose of ionising radiation through dynamic changes in the proteome to maintain adaptive homeostasis. These findings emphasise that the dose-response relationship at low doses of radiation may not be linear and, thus, provide mechanistic challenge to the linear-no-threshold hypothesis.

Also flagged:osteoarthritisOANTF3neurotrophin-3nerve growth factorjoint disease
Journal Article 2018-12-01 ✓ 1 Snippet Coutinho de Almeida R, Ramos YFM, Mahfouz A, den Hollander W, Lakenberg N, Houtman E, van Hoolwerff M, Suchiman HED, Rodríguez Ruiz A, Slagboom PE, Mei H, Kiełbasa SM, Nelissen RGHH, Reinders M, Meulenbelt I.
In-Text Gene Mentions

…The genesDCC(FC=0.1, FDR=3.3×10 −11…

Show Full Abstract

<h4>Objective</h4>To uncover the microRNA (miRNA) interactome of the osteoarthritis (OA) pathophysiological process in the cartilage.<h4>Methods</h4>We performed RNA sequencing in 130 samples (n=35 and n=30 pairs for messenger RNA (mRNA) and miRNA, respectively) on macroscopically preserved and lesioned OA cartilage from the same patient and performed differential expression (DE) analysis of miRNA and mRNAs. To build an OA-specific miRNA interactome, a prioritisation scheme was applied based on inverse Pearson's correlations and inverse DE of miRNAs and mRNAs. Subsequently, these were filtered by those present in predicted (TargetScan/microT-CDS) and/or experimentally validated (miRTarBase/TarBase) public databases. Pathway enrichment analysis was applied to elucidate OA-related pathways likely mediated by miRNA regulatory mechanisms.<h4>Results</h4>We found 142 miRNAs and 2387 mRNAs to be differentially expressed between lesioned and preserved OA articular cartilage. After applying prioritisation towards likely miRNA-mRNA targets, a regulatory network of 62 miRNAs targeting 238 mRNAs was created. Subsequent pathway enrichment analysis of these mRNAs (or genes) elucidated that genes within the 'nervous system development' are likely mediated by miRNA regulatory mechanisms (familywise error=8.4×10<sup>-5</sup>). Herein <i>NTF3</i> encodes neurotrophin-3, which controls survival and differentiation of neurons and which is closely related to the nerve growth factor.<h4>Conclusions</h4>By an integrated approach of miRNA and mRNA sequencing data of OA cartilage, an OA miRNA interactome and related pathways were elucidated. Our functional data demonstrated interacting levels at which miRNA affects expression of genes in the cartilage and exemplified the complexity of functionally validating a network of genes that may be targeted by multiple miRNAs.

Also flagged:Endocannabinoid-metabolizing enzymeslipopolysaccharideendocannabinoidpro-inflammatory cytokineIL-6fatty acid amide hydrolase
Journal Article 2018-12-01 ✓ 1 Snippet Szafran BN, Lee JH, Borazjani A, Morrison P, Zimmerman G, Andrzejewski KL, Ross MK, Kaplan BLF.
In-Text Gene Mentions

…in the humanHTTgene, which is…

Show Full Abstract

Endocannabinoid-metabolizing enzymes are downregulated in response to lipopolysaccharide (LPS)-induced inflammation in mice, which may serve as a negative feedback mechanism to increase endocannabinoid levels and reduce inflammation. Increased plasma levels of the pro-inflammatory cytokine interleukin-6 (IL-6) and decreased fatty acid amide hydrolase (FAAH) activity in peripheral lymphocytes from individuals diagnosed with Huntington's disease (HD) suggests that a similar negative feedback system between inflammation and the endocannabinoid system operates in humans. We investigated whether CpG- (unmethylated bacterial DNA) and LPS-induced IL-6 levels in peripheral blood mononuclear cells (PBMCs) from non-HD and HD individuals modulated the activities of endocannabinoid hydrolases monoacylglycerol lipase (MAGL) and carboxylesterase (CES). Baseline plasma IL-6 levels and 2-arachidonoylglycerol (2-AG) hydrolytic activity in PBMC lysates were not different in HD and non-HD individuals. Inhibition of MAGL and CES1 activity in PBMCs using the inhibitors JZL184 and WWL113, respectively, demonstrated that MAGL was the dominant 2-AG hydrolytic enzyme in PBMCs, regardless of disease state. Correlative analyses of 2-AG hydrolytic activity versus enzyme abundance confirmed this conclusion. Flow cytometric analysis of PBMCs showed that MAGL and CES1 were primarily expressed in monocytes and to a lesser extent in lymphocytes. In conclusion, these data suggest that IL-6 did not influence 2-AG hydrolytic activity in human PBMCs; however, monocytic MAGL was shown to be the predominant 2-AG hydrolytic enzyme.

Also flagged:photonphosphorescenceoxygenretinal diseases-platinum
Journal Article 2018-12-01 ✓ 1 Snippet Şencan İ, Esipova TV, Yaseen MA, Fu B, Boas DA, Vinogradov SA, Shahidi M, Sakadžić S.
In-Text Gene Mentions

C57BL/six mice

Show Full Abstract

Impaired oxygen delivery and/or consumption in the retinal tissue underlies the pathophysiology of many retinal diseases. However, the essential tools for measuring oxygen concentration in retinal capillaries and studying oxygen transport to retinal tissue are still lacking. We show that two-photon phosphorescence lifetime microscopy can be used to map absolute partial pressures of oxygen (pO2) in the retinal capillary plexus. Measurements were performed at various retinal depths in anesthetized mice under systemic normoxic and hyperoxic conditions. We used a newly developed two-photon phosphorescent oxygen probe, based on a two-photon absorbing platinum tetraphthalimidoporphyrin, and commercially available optics without correction for optical aberrations of the eye. The transverse and axial distances within the tissue volume were calibrated using a model of the eye's optical system. We believe this is the first demonstration of in vivo depth-resolved imaging of pO2 in retinal capillaries. Application of this method has the potential to advance our understanding of oxygen delivery on the microvascular scale and help elucidate mechanisms underlying various retinal diseases.

Also flagged:Cas9neurological diseasescell cycleneurological disordersCRISPRGeminin
Journal Article 2018-12-01 ✓ 3 Snippets Yang S, Li S, Li XJ.
In-Text Gene Mentions

To further confirm the efficiency of GCas9 in genome editing, we tested its effect on the expression of mutant huntingtin (HTT) in HD knockin (HD140Q) mice and compared with WT Cas9 that has been previously demonstrated to efficiently eliminate HTT aggregates (Yang et al., 2017a), Delivery of AAV-GCas9 (1 × 1013vg) with AAV-htt-gRNA (0.25 × 1013 vg; T1 and T3 gRNAs; same as used in our previous study) was able to produce a similar level of reduction of HTT accumulation or aggregates as AAV-Cas9 (1 × 1013 vg) with AAV-htt-gRNA (0.25 × 1013 vg) in the injected striatum (Figures2E and 2F).

…-gRNA and AAV-htt-gRNA were described…

…vg) with AAV-htt-gRNA (0.25 ×…

Show Full Abstract

Virus-mediated expression of CRISPR/Cas9 is commonly used for genome editing in animal brains to model or treat neurological diseases, but the potential neurotoxicity of overexpressing bacterial Cas9 in the mammalian brain remains unknown. Through RNA sequencing (RNA-seq) analysis, we find that virus-mediated expression of Cas9 influences the expression of genes involved in neuronal functions. Reducing the half-life of Cas9 by tagging with geminin, whose expression is regulated by the cell cycle, maintains the genome editing capacity of Cas9 but significantly alleviates neurotoxicity. Thus, modification of Cas9 by shortening its half-life can help develop CRISPR/Cas9-based therapeutic approaches for treating neurological disorders.

Also flagged:HDACcell-cycle-relatedDREAMchromatincell cyclecorepressor
Journal Article 2018-12-01 ✓ 1 Snippet Bainor AJ, Saini S, Calderon A, Casado-Polanco R, Giner-Ramirez B, Moncada C, Cantor DJ, Ernlund A, Litovchick L, David G.
In-Text Gene Mentions

…ARID4B, ING1, ING2,SUDS3, SAP30, SAP30L, BRMS1L,…

Show Full Abstract

The mammalian DREAM complex is responsible for the transcriptional repression of hundreds of cell-cycle-related genes in quiescence. How the DREAM complex recruits chromatin-modifying entities to aid in its repression remains unknown. Using unbiased proteomics analysis, we have uncovered a robust association between the chromatin-associated Sin3B protein and the DREAM complex. We have determined that genetic inactivation of Sin3B results in the de-repression of DREAM target genes during quiescence but is insufficient to allow quiescent cells to resume proliferation. However, inactivation of APC/C<sup>CDH1</sup> was sufficient for Sin3B<sup>-/-</sup> cells, but not parental cells, to re-enter the cell cycle. These studies identify Sin3B as a transcriptional corepressor associated with the DREAM complex in quiescence and reveals a functional cooperation between E2F target repression and APC/C<sup>CDH1</sup> in the negative regulation of cell-cycle progression.

Also flagged:ENOEFNA1EFNA3EMCNSCG2PLXDC1
Journal Article 2018-12-01 ✓ 1 Snippet Gomes AM, Kurochkin I, Chang B, Daniel M, Law K, Satija N, Lachmann A, Wang Z, Ferreira L, Ma'ayan A, Chen BK, Papatsenko D, Lemischka IR, Moore KA, Pereira CF.
In-Text Gene Mentions

…(e.g., ITGA2 ,PLCL1, ADRA1B ,…

Show Full Abstract

During development, hematopoietic stem and progenitor cells (HSPCs) arise from specialized endothelial cells by a process termed endothelial-to-hematopoietic transition (EHT). The genetic program driving human HSPC emergence remains largely unknown. We previously reported that the generation of hemogenic precursor cells from mouse fibroblasts recapitulates developmental hematopoiesis. Here, we demonstrate that human fibroblasts can be reprogrammed into hemogenic cells by the same transcription factors. Induced cells display dynamic EHT transcriptional programs, generate hematopoietic progeny, possess HSPC cell surface phenotype, and repopulate immunodeficient mice for 3 months. Mechanistically, GATA2 and GFI1B interact and co-occupy a cohort of targets. This cooperative binding is reflected by engagement of open enhancers and promoters, initiating silencing of fibroblast genes and activating the hemogenic program. However, GATA2 displays dominant and independent targeting activity during the early phases of reprogramming. These findings shed light on the processes controlling human HSC specification and support generation of reprogrammed HSCs for clinical applications.

Also flagged:gene expressiontranscriptional regulatorscell divisiontranscription factorsprotein kinasesreproduction
Journal Article 2018-12-01 ✓ 1 Snippet Degani G, Hurvitz A, Eliraz Y, Meerson A.
In-Text Gene Mentions

…anscription factors (includingsox6and sox30) and…

Show Full Abstract

The Russian sturgeon (Acipenser gueldenstaedtii) is a primitive freshwater fish and a source of caviar. In the present study, the gonadal transcriptomes of male and female Russian sturgeons grown in stable aquaculture conditions were analyzed. RNA sequencing of whole-gonad transcriptomes from pools of 4-year old fish (five females, four males), resulted in the identification of 28,170 unique transcripts. Of these, 16,191 could be annotated by similarity to gene sequences from other species. There were 392 transcripts that showed differential abundance by a factor of 20-fold or more between the sexes; 272 of these were annotated; of these, 175 and 97 were in greater abundance in ovaries and testes, respectively. Functional annotation and clustering of the genes with differential abundances of mRNA allowed for identification of several clusters. Thus, a group of transcriptional regulators and factors involved in cell division, especially septins, were in greater abundance in the ovaries; while a different set of transcription factors (including sox6 and sox30) and a group of protein kinases were in greater abundance in the testes. The transcript abundances of nine highly abundant candidate transcripts, as well as of two additional genes previously known to be involved in reproduction, cyp19 (p450 aromatase) and foxl2, were assessed in the individual samples by qRT-PCR. Of these, five (including cyp19 and foxl2) were in greater abundance in ovaries, while the abundance of ighm1 mRNA was greater in testes. Phylogenetic analysis based on the k1c18 keratin gene placed the sturgeon sequence nearest those of other primitive fish species, supporting the ancient origin of the sturgeon. In conclusion, this study details transcriptome differences between male and female sturgeon and identifies key genes that may contribute to sexual determination and differentiation.

Also flagged:acute leukemiaMPALpathogenesisPHF6DNMT3Amixed phenotype acute leukemia
Journal Article 2018-12-01 ✓ 1 Snippet Xiao W, Bharadwaj M, Levine M, Farnhoud N, Pastore F, Getta BM, Hultquist A, Famulare C, Medina JS, Patel MA, Gao Q, Lewis N, Pichardo J, Baik J, Shaffer B, Giralt S, Rampal R, Devlin S, Cimera R, Zhang Y, E Arcila M, Papaemmanuil E, Levine RL, Roshal M.
In-Text Gene Mentions

MLLT10

Show Full Abstract

The genetic aberrations that drive mixed phenotype acute leukemia (MPAL) remain largely unknown, with the exception of a small subset of MPALs harboring <i>BCR</i> <i>-ABL1</i> and <i>MLL</i> translocations. We performed clinicopathologic and genetic evaluation of 52 presumptive MPAL cases at Memorial Sloan Kettering Cancer Center. Only 29 out of 52 (56%) cases were confirmed to be bona fide MPAL according to the 2016 World Heath Organization classification. We identified <i>PHF6</i> and <i>DNMT3A</i> mutations as the most common recurrent mutations in MPAL, each occurring in 6 out of 26 (23%) cases. These mutations are mutually exclusive of each other and <i>BCR-ABL1</i>/<i>MLL</i> translocations. <i>PHF6</i>- and <i>DNMT3A</i>-mutated MPAL showed marked predilection for T-lineage differentiation (5/6 <i>PHF6</i> mutated, 6/6 <i>DNMT3A</i> mutated). <i>PHF6</i>-mutated MPAL occurred in a younger patient cohort compared with <i>DNMT3A</i>-mutated cases (median age, 27 years vs 61 years, <i>P</i> < .01). All 3 MPAL cases with both T- and B-lineage differentiation harbored <i>PHF6</i> mutations. MPAL with T-lineage differentiation was associated with nodal or extramedullary involvement (9/15 [60%] vs 0, <i>P</i> = .001) and a higher relapse incidence (78% vs 22%, <i>P</i> = .017) compared with those without T-lineage differentiation. Sequencing studies on flow-cytometry-sorted populations demonstrated that <i>PHF6</i> mutations are present in all blast compartments regardless of lineage differentiation with high variant allele frequency, implicating <i>PHF6</i> as an early mutation in MPAL pathogenesis. In conclusion, <i>PHF6</i> and <i>DNMT3A</i> mutations are the most common somatic alterations identified in MPAL and appear to define 2 distinct subgroups of MPAL with T-lineage differentiation with inferior outcomes.

Also flagged:methylationcytosinegene expressiontumorschronic diseasesdeath
Journal Article 2018-12-01 ✓ 2 Snippets Bearer EL, Mulligan BS.
In-Text Gene Mentions

…transgenic models ( 5-Httknockout in mouse…

…For the 5-htt( sert/slc6a4 )-knockout…

Show Full Abstract

<h4>Background</h4>Adverse Childhood Experiences (ACEs), which include traumatic injury, are associated with poor health outcomes in later life, yet the biological mechanisms mediating this association are unknown. Neurocircuitry, immune system and hormone regulation differ from normal in adults reporting ACEs. These systems could be affected by epigenetic changes, including methylation of cytosine (5mC) in genomic DNA, activated by ACEs. Since 5mC levels influence gene expression and can be long-lasting, altered 5mC status at specific sites or throughout the genome is hypothesized to influence mental and physical outcomes after ACE(s). Human and animal studies support this, with animal models allowing experiments for attributing causality. Here we provide a lengthy introduction and background on 5mC and the impact of early life adversity.<h4>Objective</h4>Next we address the issue of a mixture of cell types in saliva, the most accessible biospecimen for 5mC analysis. Typical human bio-specimens for 5mC analysis include saliva or buccal swabs, whole blood or types of blood cells, tumors and post-mortem brain. In children saliva is the most accessible biospecimen, but contains a mixture of keratinocytes and white blood cells, as do buccal swabs. Even in saliva from the same individual at different time points, cell composition may differ widely. Similar issues affect analysis in blood, where nucleated cells represent a wide array of white blood cell types. Unless variations in ratios of these cells between each sample are included in the analysis, results can be unreliable.<h4>Methods</h4>Several different biochemical assays are available to test for site-specific methylation levels genome-wide, each producing different information, with high-density arrays being the easiest to use, and bisulfite whole genome sequencing the most comprehensive. We compare results from different assays and use high-throughput computational processing to deconvolve cell composition in saliva samples.<h4>Results</h4>Here we present examples demonstrating the critical importance of determining the relative contribution of blood cells versus keratinocytes to the 5mC profile found in saliva. We further describe a strategy to perform a reference-based computational correction for cell composition, and therefore to identify differential methylation patterns due to experience, or for the diagnosis of phenotypes that correlate between traits, such as hormone levels, trauma status and various mental health outcomes.<h4>Conclusion</h4>Specific sites that respond to adversity with altered methylation levels in either blood cells, keratinocytes or both can be identified by this rigorous approach, which will then be useful as diagnostic biomarkers and therapeutic targets.

Also flagged:agingstem cellβ-galactosidasehistoneWntcell proliferation
Journal Article 2018-12-01 ✓ 1 Snippet Uchida R, Saito Y, Nogami K, Kajiyama Y, Suzuki Y, Kawase Y, Nakaoka T, Muramatsu T, Kimura M, Saito H.
In-Text Gene Mentions

…cell markers, includingOlfm4, were also…

Show Full Abstract

To understand the molecular features underlying stem cell aging, we established intestinal epithelial organoids derived from both young and aged mice and investigated alterations in their senescence and epigenetic status. Senescence-related changes including accumulation of senescence-associated β-galactosidase and up-regulation of <i>Cdkn1a</i> (<i>p21)</i> by DNA demethylation were observed in intestinal epithelial organoids derived from aged mice. We also demonstrated that the important stem cell marker <i>Lgr5</i> was epigenetically silenced by trimethylation of histone H3 lysine 27, inducing suppression of Wnt signaling and a decrease of cell proliferation in organoids from aged mice. We further treated intestinal epithelial organoids from aged mice with nicotinamide mononucleotide (NMN), a key NAD<sup>+</sup> intermediate. As a result, the organoids showed a higher NAD<sup>+</sup> level, increased cell proliferative ability, activation of <i>Lgr5</i> and suppression of senescence-associated genes, indicating that treatment with NMN could ameliorate senescence-related changes in intestinal epithelia. These findings suggest that organoids derived from aged animals could be a powerful research tool for investigating the molecular mechanisms underlying stem cell aging and for development of some form of anti-aging intervention, thus contributing to prolongation of healthy life expectancy.

Also flagged:watergastroenteritisreverse transcriptionpolymeraseVP6
Journal Article 2018-12-01 No Snippets Marinho ANR, Rocha DCC, Kanai YK, Alves CM, Costa DC, Sousa AH, Barros BCV, Bonfim MCMS, Mascarenhas JDP.
Show Full Abstract

The contamination of mussels and oysters by viruses and bacteria is often associated with water contamination and gastroenteritis in humans. The present study evaluated viral and bacterial contamination in 380 samples, from nine mollusk-producing regions in coastal water north of the Brazilian Amazon. Rotavirus contamination was studied for groups A to H, using a two-step SYBR Green RT-qPCR (quantitative reverse transcription polymerase chain reaction), and bacterial families Enterobacteriaceae, Vibrionaceae, and Aeromonadaceae by classical and molecular methods. From the 19 pools analyzed, 26.3% (5/19) were positive for group A Rotavirus, I2 genotype for VP6 region, without amplifications for groups B-H. Bacteriological analysis identified Escherichia coli isolates in 89.5% (17/19) with identification of atypical enteropathogenic E. coli aEPEC in 10.5% (2/19), Salmonella (Groups C1 and G) (10.5%, 2/19), Vibrio alginolyticus (57.9%, 11/19) V. parahaemolyticus (63.2%, 12/19), V. fluvialis (42.1%, 8/19), V. vulnificus (10.5%, 2/19), V. cholerae non-O1, non O139(10.5%, 2/19) and Aeromonas salmonicida (52.6%, 10/19). All the samples investigated presented some level of contamination by enterobacteria, rotavirus, or both, and these results may reflect the level of contamination in the Northern Amazon Region, due to the natural maintenance of some of these agents or by the proximity with human populations and their sewer.

Also flagged:TRIM5αrestriction factorretroviral capsidsubiquitinreverse transcriptionTRIM5
Journal Article 2018-12-01 No Snippets Sundquist WI, Pornillos O.
Show Full Abstract

The restriction factor TRIM5α recognizes incoming retroviral capsids and blocks virus replication. In this issue of Cell Host & Microbe, Fletcher et al. (2018) show how the TRIM5α RING domain mediates formation of various ubiquitin conjugates that differentially regulate TRIM5α turnover, inhibition of viral reverse transcription, and innate immune activation.

Also flagged:skin diseaseGrave's diseasepigmentationhyperpigmentationthyroid-stimulating hormoneTSH receptor
Journal Article 2018-12-01 ✓ 3 Snippets Song X, Shen Y, Zhou Y, Lou Q, Han L, Ho JK, Ren Y.
In-Text Gene Mentions

…Addison's disease andhemochromatosis.…

…Addison's disease andhemochromatosis, are referring to…

…, 14 ]Hemochromatosisrelated pigmentation is…

Show Full Abstract

<h4>Rationale</h4>Hyperpigmentation is a common skin disease. However, there are few reported cases of Grave's disease with diffuse hyperpigmentation. We hereby described a rare case with diffuse hyperpigmentation induced by Grave's disease.<h4>Patient concerns</h4>A 42-year-old Chinese woman with accumulated general pigmentation of skin was admitted to our hospital in October 2017. On examination, hyperpigmentation was observed throughout the whole body, especially on the extremities and the face.<h4>Diagnoses</h4>The patient has elevated levels of serum free thyroxine (FT4), free triiodothyronine (FT3), reduced levels of thyroid-stimulating hormone (TSH) and positive anti-TSH receptor antibody (TRAb). She presented with grade I goiter and a diffusely increased thyroid uptake to 18.5% in thyroid scan. Histopathological examination demonstrated melanin pigmentation in the pigmented skin area. The patient was diagnosed with hyperpigmentation induced by Grave's disease.<h4>Interventions</h4>The patient was treated with oral methimazole (15 mg/day) for thyroid dysfunction and beta blocker for symptom control.<h4>Outcomes</h4>After a period of treatment with methimazole and beta blocker, symptoms of hyperthyroidism ameliorated and hyperpigmentation abated.<h4>Lessons</h4>Our studies proposed that in this case the diffuse hyperpigmentation in Grave's disease was caused by elevated adrenocorticotropic hormone (ACTH) as well as anti- TSH receptor stimulating antibody instead of enhanced capillary fragility. Other potential mechanisms for skin pigmentation in hyperthyroidism still need further exploration.

Also flagged:zinc finger antisense 1cancerscancerTumornucleotidesamino acids
Journal Article 2018-12-01 ✓ 5 Snippets Leng Y, Luo Q, Chen X, Chen F, Wang X, Pan Y.
In-Text Gene Mentions

Further functional assays indicated that ZFAS1 overexpression inhibited cell migration and invasion by regulating epithelial.[29] Other studies reported that overexpression of ZNFX1-AS1 inhibited the cell proliferation and colony formation in HCC cell lines and also induced HCC cell apoptosis via regulating the methylation of miR-9.[8] In breast cancer, knockdown of cytoplasmic ZFAS1 by siRNA in mouse mammary epithelial cell lines increases proliferation.[30] No studies have reported that ZFAS1 exerts tumor suppressor function in other tumors by regulating protein expression.

The search strategy included the following terms: “ZFAS1”, “ZXFX1 antisense RNA1”, “ZNFX1-AS1”, and “cancer”, “tumor”, “neoplasm”, “carcinoma”.

The ZFAS1 locus is host to 3 C/D-box snoRNAs and its transcription initiates from the antisense strand near the 5′ end of the protein-coding gene ZNFX1.[7] It was originally identified as a tumor suppressor gene in human breast[7] and liver cancers.[8] However, in recent years, increasing evidences have demonstrated that lncRNA ZFAS1 was upregulated in various cancers such as colorectal cancer,[9] glioma[10] and gastric cancer.[11] The upregulation of ZFAS1 may promote tumor cell proliferation, invasion, and metastasis.

…also known asZNFX1antisense RNA1 or…

…antisense RNA1 orZNFX1-AS1, exhibited a 10-fold…

Show Full Abstract

<h4>Background</h4>An increasing number of studies have recently highlighted the role of zinc finger antisense 1(ZFAS1) as a prognostic marker in cancers. However, these results remain controversial. Hence, a meta-analysis was conducted to further investigate the effects of ZFAS1 expression on clinicopathological features and survival outcomes.<h4>Method</h4>All eligible studies were searched from PubMed, Embase, Web of Science, and the Cochrane Library. All included articles evaluated the relationship between the expression levels of ZFAS1 and survival, or the range of pathological features in cancer patients. Pooled hazard ratios (HRs) with 95% confidence intervals (CIs) were computed to evaluate the effect of ZFAS1 expression on overall survival (OS), relapse-free survival (RFS), and disease-free survival (DFS). The relationship between ZFAS1 expression and clinicopathological features was determined through pooled odds ratios (ORs) and 95% CIs.<h4>Results</h4>In total 8 studies, which comprised of 820 patients, were qualified for analysis. Results revealed that the overexpression of ZFAS1 was significantly associated with poor OS (HR = 1.97, 95% CI: 1.53-2.54), worse RFS (HR = 1.95, 95% CI: 1.24-3.04) and worse DFS (HR = 2.35, 95% CI: 1.43-3.88) in cancers. Further subgroup analysis revealed that ZFAS1 overexpression was significantly correlated with poor OS in different cancer types, HR obtain methods and sample sizes. In addition, this meta-analysis revealed that the upregulated expression of ZFAS1 was significantly associated with lymph node metastasis, Tumor Node Metastasis (TNM) stage, and tumor size.<h4>Conclusions</h4>This meta-analysis revealed that the expression of ZFAS1 was associated with tumor prognosis. ZFAS1 could be used as a predictor for tumor progression in various cancers.

Also flagged:neuropsychiatric disordersautismdevelopmenthistonechromatinTranscription factor
Journal Article 2018-12-01 No Snippets Amiri A, Coppola G, Scuderi S, Wu F, Roychowdhury T, Liu F, Pochareddy S, Shin Y, Safi A, Song L, Zhu Y, Sousa AMM, PsychENCODE Consortium, Gerstein M, Crawford GE, Sestan N, Abyzov A, Vaccarino FM.
Show Full Abstract

Genes implicated in neuropsychiatric disorders are active in human fetal brain, yet difficult to study in a longitudinal fashion. We demonstrate that organoids from human pluripotent cells model cerebral cortical development on the molecular level before 16 weeks postconception. A multiomics analysis revealed differentially active genes and enhancers, with the greatest changes occurring at the transition from stem cells to progenitors. Networks of converging gene and enhancer modules were assembled into six and four global patterns of expression and activity across time. A pattern with progressive down-regulation was enriched with human-gained enhancers, suggesting their importance in early human brain development. A few convergent gene and enhancer modules were enriched in autism-associated genes and genomic variants in autistic children. The organoid model helps identify functional elements that may drive disease onset.

Also flagged:varicose veinpathogenesisvaricose veinsobesitydeep vein thrombosisvaricose vein disease
Journal Article 2018-12-01 ✓ 2 Snippets Fukaya E, Flores AM, Lindholm D, Gustafsson S, Zanetti D, Ingelsson E, Leeper NJ.
In-Text Gene Mentions

hemochromatosis

HFE

Show Full Abstract

<h4>Background</h4>Varicose veins are a common problem with no approved medical therapies. Although it is believed that varicose vein pathogenesis is multifactorial, there is limited understanding of the genetic and environmental factors that contribute to their formation. Large-scale studies of risk factors for varicose veins may highlight important aspects of pathophysiology and identify groups at increased risk for disease.<h4>Methods</h4>We applied machine learning to agnostically search for risk factors of varicose veins in 493 519 individuals in the UK Biobank. Predictors were further studied with univariable and multivariable Cox regression analyses (2441 incident events). A genome-wide association study of varicose veins was also performed among 337 536 unrelated individuals (9577 cases) of white British descent, followed by expression quantitative loci and pathway analyses. Because height emerged as a new candidate risk factor, we performed mendelian randomization analyses to assess a potential causal role for height in varicose vein development.<h4>Results</h4>Machine learning confirmed several known (age, sex, obesity, pregnancy, history of deep vein thrombosis) and identified several new risk factors for varicose vein disease, including height. After adjustment for traditional risk factors in Cox regression, greater height remained independently associated with varicose veins (hazard ratio for upper versus lower quartile, 1.74; 95% CI, 1.51-2.01; P<0.0001). A genome-wide association study identified 30 new genome-wide significant loci, identifying pathways involved in vascular development and skeletal/limb biology. Mendelian randomization analysis provided evidence that increased height is causally related to varicose veins (inverse-variance weighted: odds ratio, 1.26; P=2.07×10<sup>-16</sup>).<h4>Conclusions</h4>Using data from nearly a half-million individuals, we present a comprehensive genetic and epidemiological study of varicose veins. We identified novel clinical and genetic risk factors that provide pathophysiological insights and could help future improvements of treatment of varicose vein disease.

Also flagged:Wars2mitochondrialhearinghypertrophic cardiomyopathyfibroblast growth factor 21FGF21
Journal Article 2018-12-01 ✓ 5 Snippets Agnew T, Goldsworthy M, Aguilar C, Morgan A, Simon M, Hilton H, Esapa C, Wu Y, Cater H, Bentley L, Scudamore C, Poulton J, Morten KJ, Thompson K, He L, Brown SDM, Taylor RW, Bowl MR, Cox RD.
In-Text Gene Mentions

A heart and skeletal muscle-specific aspartyl-tRNA synthetase 2 (Dars2) knockout (Dars2-KOCkmm) mouse with fatal cardiomyopathy has been reported (Dogan et al., 2014).

Dogan et al. (2014) showed that knocking out Dars2 caused tissue-specific activation of the UPRmt, leading to ATF4-dependent Fgf21 expression in the heart of Dars2Ckmm mice before respiratory chain dysfunction and concluding that mitochondrial proteostasis was the primary stress. We also demonstrated that activation of the ISR was a cardiac-specific response to inhibition of mitochondrial translation in Wars2V117L/V117L mice, resulting in increased Fgf21 gene expression. However, in contrast with the Dogan et al. (2014) findings, we showed that activation of the ISR was independent of UPRmt activation, was progressive with age, and was coincident with progressive CI respiratory chain deficiency. Several studies have demonstrated activation of the ISR upon progressive respiratory chain deficiency independent of activation of the UPRmt. Inhibition of expression of the mitochondrial genome via mtDNA depletion or inhibition of mitochondrial translation through doxycycline treatment caused respiratory complex deficiencies and activation of the ISR independent of UPRmt activation in vitro (Michel et al., 2015). Furthermore, activation of the ISR due to doxycycline treatment depended on the eIF2α kinase GCN2 (Michel et al., 2015). Activation of the ISR in the heart of Wars2V117L/V117L mice is thus due to progressive respiratory chain dysfunction, is independent of the UPRmt, and may occur via GCN2-dependent phosphorylation of eIF2α.

…synthetase 2 (Dars2) knockout (Dars2-KO…

…Dars2 ) knockout (Dars2-KO Ckmm ) mouse…

…Complete loss ofDars2function caused disrupted…

Show Full Abstract

Mutations in genes essential for mitochondrial function have pleiotropic effects. The mechanisms underlying these traits yield insights into metabolic homeostasis and potential therapies. Here we report the characterization of a mouse model harboring a mutation in the tryptophanyl-tRNA synthetase 2 (Wars2) gene, encoding the mitochondrial-localized WARS2 protein. This hypomorphic allele causes progressive tissue-specific pathologies, including hearing loss, reduced adiposity, adipose tissue dysfunction, and hypertrophic cardiomyopathy. We demonstrate the tissue heterogeneity arises as a result of variable activation of the integrated stress response (ISR) pathway and the ability of certain tissues to respond to impaired mitochondrial translation. Many of the systemic metabolic effects are likely mediated through elevated fibroblast growth factor 21 (FGF21) following activation of the ISR in certain tissues. These findings demonstrate the potential pleiotropy associated with Wars2 mutations in patients.

Also flagged:colorectal cancercancerdeathepidermal growth factor receptorantibodieschromosome
Journal Article 2018-12-01 No Snippets Vacante M, Borzì AM, Basile F, Biondi A.
Show Full Abstract

Colorectal cancer (CRC) is a major cause of cancer death worldwide. CRC has poor prognosis and there is a crucial need for new diagnostic and prognostic biomarkers to avoid CRC-related deaths. CRC can be considered a sporadic disease in most cases (75%-80%), but it has been suggested that crosstalk between gene mutations (<i>i.e</i>., mutations of <i>BRAF</i>, <i>KRAS</i>, and <i>p53</i> as well as microsatellite instability) and epigenetic alterations (<i>i.e</i>., DNA methylation of CpG island promoter regions) could play a pivotal role in cancer development. A number of studies have focused on molecular testing to guide targeted and conventional treatments for patients with CRC, sometimes with contrasting results. Some of the most useful innovations in the management of CRC include the possibility to detect the absence of <i>KRAS</i>, <i>BRAF</i>, <i>NRAS</i> and <i>PIK3CA</i> gene mutations with the subsequent choice to administer targeted adjuvant therapy with anti-epidermal growth factor receptor antibodies. Moreover, CRC patients can benefit from tests for microsatellite instability and for the detection of loss of heterozygosity of chromosome 18q that can be helpful in guiding therapeutic decisions as regards the administration of 5-FU. The aim of this review was to summarize the most recent evidence on the possible use of genetic or epigenetic biomarkers for diagnosis, prognosis and response to therapy in CRC patients.

Also flagged:Ironstrokeischemic strokecardioembolic strokeiron deficiencytransmembrane protease, serine 6
Journal Article 2018-12-01 ✓ 4 Snippets Gill D, Monori G, Tzoulaki I, Dehghan A.
In-Text Gene Mentions

To be included in our main analysis, SNPs were selected by their genome-wide significant association with increased serum iron, ferritin, and transferrin saturation and decreased transferrin levels, to represent increased systemic iron status.14 The aforementioned meta-analysis by the Genetics of Iron Status consortium found that 11 loci related to these biomarkers of iron status at genome-wide significance (P<5×10-8; Table I in the online-only Data Supplement).13 Of these, 3 loci were associated with concordant changes in all 4 biomarkers at genome-wide significance, indicating a consistent association with systemic iron status (Table): rs1800562 and rs1799945 in the hemochromatosis (HFE) gene and rs855791 in the transmembrane protease, serine 6 (TMPRSS6) gene.13 Therefore, these SNPs were included in the main MR analysis as instruments to represent systemic iron status.

…rs1799945 in thehemochromatosis( HFE )…

…the hemochromatosis (HFE) gene and…

…SNPs in theHFEgene (linkage disequilibrium,…

Show Full Abstract

Background and Purpose- Both iron deficiency and excess have been associated with stroke risk in observational studies. However, such associations may be attributable to confounding from environmental factors. This study uses the Mendelian randomization technique to overcome these limitations by investigating the association between genetic variants related to iron status and stroke risk. Methods- A study of 48 972 subjects performed by the Genetics of Iron Status consortium identified genetic variants with concordant relations to 4 biomarkers of iron status (serum iron, transferrin saturation, ferritin, and transferrin) that supported their use as instruments for overall iron status. Genetic estimates from the MEGASTROKE consortium were used to investigate the association between the same genetic variants and stroke risk. The 2-sample ratio method Mendelian randomization approach was used for the main analysis, with the MR-Egger and weighted median techniques used in sensitivity analyses. Results- The main results, reported as odds ratio (OR) of stroke per SD unit increase in genetically determined iron status biomarker, showed a detrimental effect of increased iron status on stroke risk (serum iron OR, 1.07; 95% CI, 1.01-1.14; [log-transformed] ferritin OR, 1.18; 95% CI, 1.02-1.36; and transferrin saturation OR, 1.06; 95% CI, 1.01-1.11). A higher transferrin, indicative of lower iron status, was also associated with decreased stroke risk (OR, 0.92; 95% CI, 0.86-0.99). Examining ischemic stroke subtypes, we found the detrimental effect of iron status to be driven by cardioembolic stroke. These results were supported in statistical sensitivity analyses more robust to the inclusion of pleiotropic variants. Conclusions- This study provides Mendelian randomization evidence that higher iron status is associated with increased stroke risk and, in particular, cardioembolic stroke. Further work is required to investigate the underlying mechanism and whether this can be targeted in preventative strategies.

Also flagged:Dyslipidemiacardiovascular diseasesfamilial hypercholesterolemialipoproteincholesteroltriglycerides
Journal Article 2018-12-01 ✓ 1 Snippet Noubiap JJ, Mato EPM, Guewo-Fokeng M, Kaze AD, Boulenouar H, Wonkam A.
In-Text Gene Mentions

ZNF664

Show Full Abstract

Identification of genetic/genomic factors contributing to dyslipidemia is of great interest to prevention and reduction of the onset and burden of cardiovascular diseases in Africa. This systematic review summarizes available data on genetic variants associated with dyslipidemia in populations within Africa. A PubMed and EMBASE database search was conducted to identify all studies published until June 2018 on genetic susceptibility to dyslipidemia in African-based populations, excluding familial hypercholesterolemia. All studies on genetic predispositions of dyslipidemia and respecting the preestablished inclusion criteria were included in this systematic review. Because of high heterogeneity, the data were summarized narratively. Twenty-two studies investigated mostly the targeted genetic variants. A total of 51 polymorphisms in 28 susceptibility genes to dyslipidemia have been associated with a particular trait in the African populations, and through variable effects. Most polymorphisms investigated in Northern Africa seemed to have consistent effects on increasing the level of low-density lipoprotein cholesterol (LDL-C), total cholesterol, and triglycerides in patients with diabetes, myocardial infarction, coronary artery disease, and metabolic syndrome. By contrast, only Ser447Ter and C49620T variants were associated with increased LDL-C in sub-Saharan Africa. Despite few studies available in this context in the literature, certain genetic variants were consistently associated with dyslipidemia especially in Northern Africa as highlighted in this analysis. Further data, particularly from genome-wide association studies, would help establish an African-specific reference for genetic susceptibility markers of dyslipidemia.

Also flagged:TNFRSFCD27OX40IL-17ATNF receptorskin inflammation
Journal Article 2018-12-01 No Snippets Remedios KA, Zirak B, Sandoval PM, Lowe MM, Boda D, Henley E, Bhattrai S, Scharschmidt TC, Liao W, Naik HB, Rosenblum MD.
Show Full Abstract

Regulatory T cells (T<sub>regs</sub>) are closely related to T<sub>H</sub>17 cells and use aspects of the T<sub>H</sub>17-differentiation program for optimal immune regulation. In several chronic inflammatory human diseases, T<sub>regs</sub> express IL-17A, suggesting that dysregulation of T<sub>H</sub>17-associated pathways in T<sub>regs</sub> may result in either loss of suppressive function and/or conversion into pathogenic cells. The pathways that regulate the T<sub>H</sub>17 program in T<sub>regs</sub> are poorly understood. We have identified two TNF receptor superfamily (TNFRSF) members, CD27 and OX40, that are preferentially expressed by skin-resident T<sub>regs</sub> Both CD27 and OX40 signaling suppressed the expression of T<sub>H</sub>17-associated genes from T<sub>regs</sub> in a cell-intrinsic manner in vitro and in vivo. However, only OX40 played a nonredundant role in promoting T<sub>reg</sub> accumulation. T<sub>regs</sub> that lacked both CD27 and OX40 were defective in controlling skin inflammation and expressed high levels of IL-17A, as well as the master T<sub>H</sub>17 transcription factor, RORγt. Last, we found that CD27 expression was inversely correlated with T<sub>reg</sub> IL-17 production in skin of patients with psoriasis and hidradenitis suppurativa. Together, our results suggest that TNFRSF members play both redundant and distinct roles in regulating T<sub>reg</sub> plasticity in tissues.

Also flagged:TuberculosisIL-23IFN-γIL-12Rβ1TYK2IL-12
Journal Article 2018-12-01 ✓ 2 Snippets Boisson-Dupuis S, Ramirez-Alejo N, Li Z, Patin E, Rao G, Kerner G, Lim CK, Krementsov DN, Hernandez N, Ma CS, Zhang Q, Markle J, Martinez-Barricarte R, Payne K, Fisch R, Deswarte C, Halpern J, Bouaziz M, Mulwa J, Sivanesan D, Lazarov T, Naves R, Garcia P, Itan Y, Boisson B, Checchi A, Jabot-Hanin F, Cobat A, Guennoun A, Jackson CC, Pekcan S, Caliskaner Z, Inostroza J, Costa-Carvalho BT, de Albuquerque JAT, Garcia-Ortiz H, Orozco L, Ozcelik T, Abid A, Rhorfi IA, Souhi H, Amrani HN, Zegmout A, Geissmann F, Michnick SW, Muller-Fleckenstein I, Fleckenstein B, Puel A, Ciancanelli MJ, Marr N, Abolhassani H, Balcells ME, Condino-Neto A, Strickler A, Abarca K, Teuscher C, Ochs HD, Reisli I, Sayar EH, El-Baghdadi J, Bustamante J, Hammarström L, Tangye SG, Pellegrini S, Quintana-Murci L, Abel L, Casanova JL.
In-Text Gene Mentions

hemochromatosis

HFE

Show Full Abstract

Inherited IL-12Rβ1 and TYK2 deficiencies impair both IL-12- and IL-23-dependent IFN-γ immunity and are rare monogenic causes of tuberculosis, each found in less than 1/600,000 individuals. We show that homozygosity for the common <i>TYK2</i> P1104A allele, which is found in about 1/600 Europeans and between 1/1000 and 1/10,000 individuals in regions other than East Asia, is more frequent in a cohort of patients with tuberculosis from endemic areas than in ethnicity-adjusted controls (<i>P</i> = 8.37 × 10<sup>-8</sup>; odds ratio, 89.31; 95% CI, 14.7 to 1725). Moreover, the frequency of P1104A in Europeans has decreased, from about 9% to 4.2%, over the past 4000 years, consistent with purging of this variant by endemic tuberculosis. Surprisingly, we also show that TYK2 P1104A impairs cellular responses to IL-23, but not to IFN-α, IL-10, or even IL-12, which, like IL-23, induces IFN-γ via activation of TYK2 and JAK2. Moreover, TYK2 P1104A is properly docked on cytokine receptors and can be phosphorylated by the proximal JAK, but lacks catalytic activity. Last, we show that the catalytic activity of TYK2 is essential for IL-23, but not IL-12, responses in cells expressing wild-type JAK2. In contrast, the catalytic activity of JAK2 is redundant for both IL-12 and IL-23 responses, because the catalytically inactive P1057A JAK2, which is also docked and phosphorylated, rescues signaling in cells expressing wild-type TYK2. In conclusion, homozygosity for the catalytically inactive P1104A missense variant of <i>TYK2</i> selectively disrupts the induction of IFN-γ by IL-23 and is a common monogenic etiology of tuberculosis.

Also flagged:gene expressionBETco-activatorsmultiple myelomatranscription factorE2F1
Journal Article 2018-12-01 ✓ 1 Snippet Fulciniti M, Lin CY, Samur MK, Lopez MA, Singh I, Lawlor MA, Szalat RE, Ott CJ, Avet-Loiseau H, Anderson KC, Young RA, Bradner JE, Munshi NC.
In-Text Gene Mentions

…the recruitment ofchromatin modifiermodifier proteins and…

Show Full Abstract

The relationship between promoter proximal transcription factor-associated gene expression and super-enhancer-driven transcriptional programs are not well defined. However, their distinct genomic occupancy suggests a mechanism for specific and separable gene control. We explored the transcriptional and functional interrelationship between E2F transcription factors and BET transcriptional co-activators in multiple myeloma. We found that the transcription factor E2F1 and its heterodimerization partner DP1 represent a dependency in multiple myeloma cells. Global chromatin analysis reveals distinct regulatory axes for E2F and BETs, with E2F predominantly localized to active gene promoters of growth and/or proliferation genes and BETs disproportionately at enhancer-regulated tissue-specific genes. These two separate gene regulatory axes can be simultaneously targeted to impair the myeloma proliferative program, providing an important molecular mechanism for combination therapy. This study therefore suggests a sequestered cellular functional control that may be perturbed in cancer with potential for development of a promising therapeutic strategy.

Also flagged:disseminated intravascularcoagulationDisseminated intravascular coagulationhemostatic disorderhemostasisDIC syndrome
Journal Article 2018-12-01 ✓ 2 Snippets Maden M, Yildiz R, Çöl R, Arican M, Ider M, Garip M, Tras B.
In-Text Gene Mentions

…ombin-anti- thrombin complex),ATIII(antithrombin III), PAI-1…

…increase in serumATIIIconcentrations before and…

Show Full Abstract

Disseminated intravascular coagulation (DIC) is a complex, dynamic and hemostatic disorder which develops secondarily to a disease characterized with an imbalance in the pro-coagulant and anti-coagulant components of hemostasis. The aim of the study is to evaluate hemostatic dysfunc- tion and the DIC syndrome in cattle with displaced abomasum (DA), with using the hematologic analyses and an extensive coagulation profile in the 96 hour-period including before and after surgery. The animal material of the study consisted of 12 dairy cows diagnosed with displaced abomasum (9 LDA and 3 RDA without volvulus) in the 2-4 week period after parturation and with no other post-partum disease. In dairy cows diagnosed with DA, hematological, coagulomet- ric (PT, APTT, Fibrinogen) and coagulation factor analyses [D-Dimer, TAT (thrombin-anti- thrombin complex), ATIII (antithrombin III), PAI-1 (plazminogen activator inhibitor-1] were performed in blood samples obtained before the operation as well as 30 minutes, 60 minutes and 2, 5, 10, 24, 48, 72 and 96 hours after the operation. In the DA cases, abnormalities were found in 6 of the 8 coagulation parameters. In the LDA and RDA groups, prolonged PT (sec), PT (INR) and APTT, hypofibrinogenemia, an increase in serum D-Dimer concentration at 72 and 96 hours after the operation and an increase in serum ATIII concentrations before and 30, 60 minutes and 2, 5, 72 and 96 hours after the operation was found (p⟨0.05). Hemostatic dysfunction and the risk of DIC developing in DA cases and continuing in the post-operative period was determined.

Also flagged:myelinmyelinationspinal cord injuryneurotrophin-3NT-3collagen
Journal Article 2018-12-01 ✓ 1 Snippet Milbreta U, Lin J, Pinese C, Ong W, Chin JS, Shirahama H, Mi R, Williams A, Bechler ME, Wang J, Ffrench-Constant C, Hoke A, Chew SY.
In-Text Gene Mentions

Sox6

Show Full Abstract

The loss of oligodendrocytes (OLs) and subsequently myelin sheaths following injuries or pathologies in the CNS leads to debilitating functional deficits. Unfortunately, effective methods of remyelination remain limited. Here, we present a scaffolding system that enables sustained non-viral delivery of microRNAs (miRs) to direct OL differentiation, maturation, and myelination. We show that miR-219/miR-338 promoted primary rat OL differentiation and myelination in vitro. Using spinal cord injury as a proof-of-concept, we further demonstrate that miR-219/miR-338 could also be delivered non-virally in vivo using an aligned fiber-hydrogel scaffold to enhance remyelination after a hemi-incision injury at C5 level of Sprague-Dawley rats. Specifically, miR-219/miR-338 mimics were incorporated as complexes with the carrier, TransIT-TKO (TKO), together with neurotrophin-3 (NT-3) within hybrid scaffolds that comprised poly(caprolactone-co-ethyl ethylene phosphate) (PCLEEP)-aligned fibers and collagen hydrogel. After 1, 2, and 4 weeks post-treatment, animals that received NT-3 and miR-219/miR-338 treatment preserved a higher number of Olig2<sup>+</sup> oligodendroglial lineage cells as compared with those treated with NT-3 and negative scrambled miRs (Neg miRs; p < 0.001). Additionally, miR-219/miR-338 increased the rate and extent of differentiation of OLs. At the host-implant interface, more compact myelin sheaths were observed when animals received miR-219/miR-338. Similarly within the scaffolds, miR-219/miR-338 samples contained significantly more myelin basic protein (MBP) signals (p < 0.01) and higher myelination index (p < 0.05) than Neg miR samples. These findings highlight the potential of this platform to promote remyelination within the CNS.

Also flagged:PurinesDiamondCaffeineAdenosineSilverPurine
Journal Article 2018-12-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

HTT

Show Full Abstract

No abstract available.

Also flagged:Autoimmune hepatitishuman leucocyte antigenaminotransferasesgamma globulinsautoantibodieschronic hepatitis
Journal Article 2018-12-01 ✓ 1 Snippet Lowe D, John S.
In-Text Gene Mentions

…such Wilson’s disease,hemochromatosisand alpha 1…

Show Full Abstract

Autoimmune hepatitis affects patients of all ages and gender, across all geographic regions. Although still rare, its incidence and prevalence are increasing. Genetic predisposition conveyed by human leucocyte antigen is a strong risk factor for the disease and may be responsible in part for the wide variation in presentation in different geographic regions. Our understanding of the underlying pathogenic mechanisms is evolving and may lead to development of more targeted immunotherapies. Diagnosis is based on elevated levels of serum aminotransferases, gamma globulins, autoantibodies and characteristic findings on histology. Exclusion of other causes of chronic hepatitis is important. Although undiagnosed disease is associated with poor outcomes, it is readily treatable with timely immunosuppressive therapy in the majority of patients. International guidelines are available to guide management but there exists a disparity in the standard treatment regimens. This minireview aims to review the available guidelines and summarize the key recommendations involved in management of this complex autoimmune disease.

Also flagged:HDACHistone deacetylasecancerspancreatic cancerepithelial-mesenchymal transitiontumor
Journal Article 2018-12-01 No Snippets Ji M, Li Z, Lin Z, Chen L.
Show Full Abstract

Histone deacetylase (HDAC) is overexpressed in multiple cancers including pancreatic cancer (PC). However, the effects of histone deacetylase inhibitor (HDACi) on apoptosis and epithelial-mesenchymal transition (EMT) differ in various cancers. In this study, we aimed to investigate the anti-tumor effects of a novel multitargets HDACi, CUDC-101, combined with gemcitabine in PC cell lines. In vitro, we found that Co-treatment with CUDC-101 and gemcitabine results in greater levels of apoptosis and significantly inhibited cell proliferation on PC cells. In addition, CUDC-101 enhanced gemcitabine-induced apoptosis via inhibited PI3K/Akt/mTOR and Erk pathway activation, as indicated by the phosphorylation status of Akt, 4EBP1, S6 and Erk. We also found that co-treatment with gemcitabine and CUDC-101 not only synergistically suppressed ability of PC cell migration and invasion, but also synergistically inhibited EMT signaling pathway through modulation of cadherin, vimentin and transcription factors Snail, Slug and MMP-9. In vivo, the co-treatment group showed a significant anti-tumor function in the growth of xenograft tumors. Overall, combination of CUDC-101 and gemcitabine significantly increased anti-tumor activities compared with single drug alone, thus supporting a further evaluation of combination treatment for PC. Accordingly, it provides a rationale to investigate the combination of gemcitabine and CUDC-101 as a potential therapeutic strategy for PC.

Also flagged:colon carcinomaprimary tumorsGene Expressioncell migrationimmune responseC-X-C motif chemokine ligand 14
Journal Article 2018-12-01 No Snippets Liu J, Wang D, Zhang C, Zhang Z, Chen X, Lian J, Liu J, Wang G, Yuan W, Sun Z, Wang W, Song M, Wang Y, Wu Q, Cao L, Wang D, Zhang Y.
Show Full Abstract

<h4>Objective</h4>Liver metastasis, which contributes substantially to high mortality, is the most common recurrent mode of colon carcinoma. Thus, it is necessary to identify genes implicated in metastatic colonization of the liver in colon carcinoma.<h4>Methods</h4>We compared mRNA profiling in 18 normal colon mucosa (N), 20 primary tumors (T) and 19 liver metastases (M) samples from the dataset GSE49355 and GSE62321 of Gene Expression Omnibus (GEO) database. Gene ontology (GO) and pathways of the identified genes were analyzed. Co-expression network and protein-protein interaction (PPI) network were employed to identify the interaction relationship. Survival analyses based on The Cancer Genome Atlas (TCGA) database were used to further screening. Then, the candidate genes were validated by our data.<h4>Results</h4>We identified 22 specific genes related to liver metastasis and they were strongly associated with cell migration, adhesion, proliferation and immune response. Simultaneously, the results showed that C-X-C motif chemokine ligand 14 (CXCL14) might be a favorable prediction factor for survival of patients with colon carcinoma. Importantly, our validated data further suggested that lower CXCL14 represented poorer outcome and contributed to metastasis. Gene set enrichment analysis (GSEA) showed that CXCL14 was negatively related to the regulation of stem cell proliferation and epithelial to mesenchymal transition (EMT).<h4>Conclusions</h4>CXCL14 was identified as a crucial anti-metastasis regulator of colon carcinoma for the first time, and might provide novel therapeutic strategies for colon carcinoma patients to improve prognosis and prevent metastasis.

Also flagged:Candidiasisfluconazoleketoconazoleclotrimazolenystatinamphotericin B
Journal Article 2018-12-01 No Snippets Dalvand A, Katiraee F, Jafari Joozani R, Shokri H.
Show Full Abstract

<h4>Background and purpose</h4><i>Candida albicans</i> is the most prevalent <i>Candida</i> species isolated from animals. Candidiasis can be systemic in animals or may affect a single organ, such as the mouth, urinary tract, and skin. The aim of the present study was to determine the genetic diversity of <i>C. albicans</i> isolated from different animals and investigate the presence of a relationship between host specificity and genetic typing of <i>C. albicans</i>.<h4>Materials and methods</h4>For the purpose of the study, DNA extraction was performed on 27 clinical isolates of <i>C. albicans</i> obtained from animals. Subsequently, they were subjected to 25S ribosomal DNA amplification and ALT repeats in repetitive sequences (RPSs). The minimum inhibitory concentrations of fluconazole, ketoconazole, clotrimazole, nystatin, amphotericin B, and caspofungin were determined using the microdilution method based on the Clinical and Laboratory Standards Institute M27-S4 standard.<h4>Results</h4>Out of 27 <i>C. albicans</i> strains, 11, 6, 5, and 5 cases were recognized as genotypes A (40.8%), E (22.2%), B (18.5%), and C (18.5%), respectively, through amplification using AS-I, which revealed 17 different types of <i>C. albicans</i>. By combining the two typing methods, 27 <i>C. albicans</i> strains were finally divided into 22 genotypes.<h4>Conclusion</h4>Different genotypes showed genetic diversity among the <i>C. albicans</i> strains isolated from animal sources. The results revealed no special genotype relationship according to the host, anatomical source of isolation, and antifungal susceptibility.

Also flagged:venous thromboembolismthrombophiliaPROCCBSMTHFRGenoma
Journal Article 2018-12-01 ✓ 5 Snippets Yin L, Li G, Shen J, Liu Z.
In-Text Gene Mentions

The thousands of human genome database, ESP6500 database, Genoma database, HGMD mutation database were used to compare the mutation sites, and the pathogenic mutation sites were predicted according to SIFT, Polyphen, MutationTaster and CADD databases.<h4>Results</h4>Among 25 patients screened, eight patients with <i>PROC</i> mutations, two patients with <i>PROS1</i> mutations, three patients with <i>SERPINC1</i> mutations; one patient with <i>F5</i> mutation, one patient with <i>F2</i> mutation, one patient with <i>F8</i> mutation, two patient with <i>CBS</i> mutations, and one patient with <i>MTHFR</i> mutation.<h4>Conclusions</h4>The second generation gene sequencing helps to diagnose inherited thrombophilia and guide the decision of anticoagulation duration.

…)、蛋白S(基因名 PROS1 )和抗凝血酶Ⅲ(基因名SERPINC1),凝血因子相关基因凝血因子Ⅴ(基因名 F5 )、凝血因子Ⅱ…

…突变患者8例, PROS1 突变患者2例,SERPINC1突变患者3例;凝血相关基因 F5 突变1例,…

…, PROS1 ,SERPINC1and coagulation-related genes…

…three patients withSERPINC1mutations; one patient…

Show Full Abstract

<h4>Objective</h4>To screening coagulation and anticoagulation genes and mutations in Chinese patients with venous thromboembolism suspected of inhered thrombophilia.<h4>Methods</h4>Patients with venous thromboembolism caused by inherited thrombophilia were collected from the second Affiliated Hospital, Zhejiang University School of Medicine during June 2015 and December 2017. Gene sequencing was conducted to screen the anticoagulant-related genes <i>PROC, PROS1, SERPINC1</i> and coagulation-related genes <i>F5, F2, F8, CBS, MTHFR</i>. The thousands of human genome database, ESP6500 database, Genoma database, HGMD mutation database were used to compare the mutation sites, and the pathogenic mutation sites were predicted according to SIFT, Polyphen, MutationTaster and CADD databases.<h4>Results</h4>Among 25 patients screened, eight patients with <i>PROC</i> mutations, two patients with <i>PROS1</i> mutations, three patients with <i>SERPINC1</i> mutations; one patient with <i>F5</i> mutation, one patient with <i>F2</i> mutation, one patient with <i>F8</i> mutation, two patient with <i>CBS</i> mutations, and one patient with <i>MTHFR</i> mutation.<h4>Conclusions</h4>The second generation gene sequencing helps to diagnose inherited thrombophilia and guide the decision of anticoagulation duration.

Also flagged:metabolismInborn errors ofdiseases of the nervous systemneurodevelopmental disorderneurodegenerative disordererrors of
Journal Article 2018-12-01 ✓ 1 Snippet Saudubray JM, Garcia-Cazorla A.
In-Text Gene Mentions

Main neurological presentations, pathophysiological categories, and neurodevelopmental to neurodegenerative features. Main clinical presentations are presented depending on the severity degree, from antenatal malformations to isolated symptoms. It is not rare that the same disease could have different types of presentation. Severe global encephalopathies include genetic defects that lead to early disruption of fundamental biological processes that are required for a proper brain development and affect motor, cognitive and behavioural aspects. Synaptopathies correspond to diseases impairing synaptic communication and often have epilepsy, intellectual disability, behavioural abnormalities (including autism) and movement disorders in any combination. Synaptic diseases produce connectivity impairments (abnormal brain circuitries' organization). Complex motor presentations correspond to diseases leading to abnormal motor symptoms; these are related to brain structures and circuits that regulate voluntary and passive movements, strength, and muscle tone. In pediatrics' IEMs it is not rare to detect combinations of different motor signs (dyskinetic movements, pyramidal signs, hypotonia, ataxia...). Some additional explanations: COG6 plays a major role in Golgi trafficking and positioning of glycosylation enzymes. HCFC1: gene responsible for X-linked cobalamin deficiency. PHARC: Acronym for a neuropathy syndrome due to a phospholipid remodeling defect that mimics Refsum disease. PIGA is one of the 7 proteins required for the 1st step of the GPI synthesis. SERAC1: protein with a lipase domain involved in the remodeling of phosphatidylglycerol, bis monoacyl glycerol phosphate and cardiolipin. SNAP29: encodes for a SNARE protein involved in vesicle fusion. SNX14: gene mutations responsible for childhood ARCA syndrome (Autosomic Recessive Cerebellar Ataxia). VPS15: is implicated in endosomal-lysosomal trafficking and autophagy. WDR45: interacts with autophagy proteins Atg2 and Atg9 to regulate autophagosome formation and elongation. Ast: aspartate transporter; Asp: asparagine synthetase; ADSL: adenylosuccinate lyase deficiency: BCAA: branched chain amino acid; BetaM: β mannosidosis; CAD: enzymatic complex responsible for the first 3 steps of the de novo pyrimidine synthesis; Cbl: cobalamin; Cholest: cholesterol; CholK: choline kinase; COG6: conserved oligomeric Golgi complex; CDG: Congenital disorder of glycosylation; CERS: ceramide synthetase; DARS2: mt aspartyl-tRNA synthetases; EARS2: mt glutamyl-tRNA synthetases; ELOVL4: fatty acid elongase 4; FAt: fatty acid transporter; FAs: fatty acid synthetase; FADH: fatty alcohol deshydrogenase; FAHN: fatty acid hydroxylase associated neurodegeneration; FARS 2: mt phenylalanine-tRNA synthetases; GABA:y aminobutyric acid; Glu: glutamine synthetase; GLUT1: glucose transporter; GluR: glutamate receptor; GlyR: glycine receptor; GM: ganglioside; HCFC1: host cell factor C1; HHH: hyperammonemia, hyperornithinemia, homocitrullinemia syndrome; MARS2: mt methionyl-tRNA synthetases. MTHFR: methyltetrahydrofolate reductase; MD: movement disorders; ML: mucolipidosis; MLD: metachromatic leucodystrophy; MPS III: mucopolysaccharidosis type III (sanfilippo disease); NBIA: neurodegeneration with brain iron accumulation; NCL: neuronal ceroid lipofuschinosis; NPSY: neuropsychiatric symptoms; OA: organic aciduriasO-gly: O-glycosylation; PC: pyruvate carboxylase; PDH: pyruvate deshydrogenase; perox: peroxysome biogenesis defects; PHARC: polyneuropathy, hearing loss, ataxia, retinitis pigmentosa and cataracts; PIGA: phosphatidylinositol glucosaminyltransferase; P13K/AKT: phosphatidyl inositides kinase; PLA2G6: phospholipase A2; PNPLA6: phospholipase B; PNPO: pyridox(am)ine 5'-phosphate oxidase; Ser: serine synthesis defects; SERAC1: serine active site containing protein 1; SNAP29: synaptosomal associated protein 29 KD; SNX14: sorting nexin 14 SV: synaptic vesicle; tRNAs: tRNA synthetases; TPP: thiamine pyrophosphate; VARS2 mt valyl-tRNA synthetases; VPS15 is also known as PHOSPHATIDYLINOSITOL 3-KINASE, REGULATORY SUBUNIT 4: PIK3R4; WDR45: WD repeat containing protein 45.

Show Full Abstract

Inborn errors of metabolism (IEMs) are particularly frequent as diseases of the nervous system. In the pediatric neurologic presentations of IEMs neurodevelopment is constantly disturbed and in fact, as far as biochemistry is involved, any kind of monogenic disease can become an IEM. Clinical features are very diverse and may present as a neurodevelopmental disorder (antenatal or late-onset), as well as an intermittent, a fixed chronic, or a progressive and late-onset neurodegenerative disorder. This also occurs within the same disorder in which a continuum spectrum of severity is frequently observed. In general, the small molecule defects have screening metabolic markers and many are treatable. By contrast only a few complex molecules defects have metabolic markers and most of them are not treatable so far. Recent molecular techniques have considerably contributed in the description of many new diseases and unexpected phenotypes. This paper provides a comprehensive list of IEMs that affect neurodevelopment and may also present with neurodegeneration.

Also flagged:transmembraneneuronal ceroid lipofuscinoseslysosomal storage disordersvisiondeathmembrane
Journal Article 2018-12-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.