Gene Literature Dashboard

Viewing February 2019 — 416 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← January 2019 March 2019 →
Also flagged:lipoxygenaseslipidlipoxygenasebindingeicosanoidsleukotrienes
Journal Article 2019-02-28 ✓ 5 Snippets Mikulska-Ruminska K, Shrivastava I, Krieger J, Zhang S, Li H, Bayır H, Wenzel SE, VanDemark AP, Kagan VE, Bahar I.
In-Text Gene Mentions

…(PE)-binding protein 1 (PEBP1), a small promiscuous…

…revealed that thePEBP1-binding site on 15LO1…

…analysis of the 15LOX-PEBP1complex revealed the…

…the role ofPEBP1in altering the…

…of LOX withPEBP1.…

Show Full Abstract

Accurate modeling of structural dynamics of proteins and their differentiation across different species can help us understand generic mechanisms of function shared by family members and the molecular basis of the specificity of individual members. We focused here on the family of lipoxygenases, enzymes that catalyze lipid oxidation, the mammalian and bacterial structures of which have been elucidated. We present a systematic method of approach for characterizing the sequence, structure, dynamics, and allosteric signaling properties of these enzymes using a combination of structure-based models and methods and bioinformatics tools applied to a data set of 88 structures. The analysis elucidates the signature dynamics of the lipoxygenase family and its differentiation among members, as well as key sites that enable its adaptation to specific substrate binding and allosteric activity.

Also flagged:PPM1FhookL41carnitine O-acetyltransferaseyippeeKANK2
Journal Article 2019-02-28 ✓ 2 Snippets Das S, Frisk C, Eriksson MJ, Walentinsson A, Corbascio M, Hage C, Kumar C, Asp M, Lundeberg J, Maret E, Persson H, Linde C, Persson B.
In-Text Gene Mentions

HTT

…factor STAT4 ,HTTand tumour suppressor…

Show Full Abstract

Heart failure affects 2-3% of adult Western population. Prevalence of heart failure with preserved left ventricular (LV) ejection fraction (HFpEF) increases. Studies suggest HFpEF patients to have altered myocardial structure and functional changes such as incomplete relaxation and increased cardiac stiffness. We hypothesised that patients undergoing elective coronary bypass surgery (CABG) with HFpEF characteristics would show distinctive gene expression compared to patients with normal LV physiology. Myocardial biopsies for mRNA expression analysis were obtained from sixteen patients with LV ejection fraction ≥45%. Five out of 16 patients (31%) had echocardiographic characteristics and increased NTproBNP levels indicative of HFpEF and this group was used as HFpEF proxy, while 11 patients had Normal LV physiology. Utilising principal component analysis, the gene expression data clustered into two groups, corresponding to HFpEF proxy and Normal physiology, and 743 differentially expressed genes were identified. The associated top biological functions were cardiac muscle contraction, oxidative phosphorylation, cellular remodelling and matrix organisation. Our results also indicate that upstream regulatory events, including inhibition of transcription factors STAT4, SRF and TP53, and activation of transcription repressors HEY2 and KDM5A, could provide explanatory mechanisms to observed gene expression differences and ultimately cardiac dysfunction in the HFpEF proxy group.

Also flagged:osteosarcomaactivating transcription factor 6GRP78chaperone78 kDa glucose-related proteinendoplasmin
Journal Article 2019-02-28 No Snippets Chaiyawat P, Sungngam P, Teeyakasem P, Sirikaew N, Klangjorhor J, Settakorn J, Diskul-Na-Ayudthaya P, Chokchaichamnankit D, Srisomsap C, Svasti J, Pruksakorn D.
Show Full Abstract

Oncogenic drivers of osteosarcoma remain controversial due to the complexity of the genomic background of the disease. There are limited novel therapeutic options, and the survival rate of patients with osteosarcoma has not improved in decades. Genomic instability leads to complexity in various pathways, which is potentially revealed at the protein level. Therefore, the present study aimed to identify the mechanisms involved in the oncogenesis of osteosarcoma using proteomics and bioinformatics tools. As clinical specimens from patients are the most relevant disease‑related source, expression patterns of proteins in osteosarcoma tissues were compared with soft tissue callus from donors containing high numbers of osteoblastic cells. Two‑dimensional electrophoresis and liquid chromatography‑tandem mass spectrometry (LC‑MS/MS) successfully identified 33 differentially expressed proteins in the osteosarcoma tissues compared with the soft tissue callus. Among these proteins, 29 proteins were significantly upregulated in osteosarcoma. A functionally grouped network of the overexpressed proteins, that was created using the ClueGo and CluePedia applications, demonstrated that the unfolded protein response (UPR) pathway was activated mainly through the activating transcription factor 6 arm in osteosarcoma. The results of proteomics analysis were confirmed by elevated expression of UPR‑related chaperone proteins, including 78 kDa glucose‑related protein (GRP78), endoplasmin, calreticulin and prelamin‑A/C, in the patient‑derived primary cells and osteosarcoma cell lines. Furthermore, the expression of GRP78, a master regulator of the UPR, was enhanced in the osteosarcoma tissues of patients that were resistant to double regimen of doxorubicin and a platinum‑based drug. The findings of the present study suggest that targeting the UPR pathway may be promising for the treatment of osteosarcoma.

Also flagged:thymomasthymomamethylationgene expressiontumorFraser extracellular matrix complex subunit 1
Journal Article 2019-02-28 No Snippets Bi Y, Meng Y, Niu Y, Li S, Liu H, He J, Zhang Y, Liang N, Liu L, Mao X, Yan J, Long B, Liang Z, Wu Z.
Show Full Abstract

The aim of the present study was to examine the whole‑genome DNA methylation status of thymomas and identify differences in thymoma DNA methylation profiles. DNA methylation profiles of tissues (n=12) were studied using the Infinium MethylationEPIC BeadChip microarray (850K) and analyzed in relation to gene expression data. Functional annotation analysis of DNA methylation between the different groups was performed using the online tool GeneCodis3. In order to assess the diagnostic value of candidate DNA methylation markers, receiver operation characteristic (ROC) analysis was performed using the pROC package. A total of 10,014 CpGs were found to be differentially methylated (Δβ>0.2) between two thymoma types (type A and B). Combination analysis showed that 36 genes had differentially methylated CpG sites in their promoter region. 'Pathways in cancer', 'focal adhesion' and 'regulation of actin cytoskeleton' were the most enriched KEGG pathways of differentially methylated genes between tumor and controls. Among the 29 genes that were hypomethylated with a high expression, zinc finger protein 396 and Fraser extracellular matrix complex subunit 1 had the largest area under the curve. The present results may provide useful insights into the tumorigenesis of thymomas and a strong basis for future research on the molecular subtyping of epigenetic regulation in thymomas.

Also flagged:methylationchronic obstructive pulmonary diseaserespiratory diseasesnitrogenOTUB2immune responses
Journal Article 2019-02-28 No Snippets Lee MK, Xu CJ, Carnes MU, Nichols CE, Ward JM, BIOS consortium, Kwon SO, Kim SY, Kim WJ, London SJ.
Show Full Abstract

<h4>Background</h4>Ambient air pollution is associated with numerous adverse health outcomes, but the underlying mechanisms are not well understood; epigenetic effects including altered DNA methylation could play a role. To evaluate associations of long-term air pollution exposure with DNA methylation in blood, we conducted an epigenome-wide association study in a Korean chronic obstructive pulmonary disease cohort (N = 100 including 60 cases) using Illumina's Infinium HumanMethylation450K Beadchip. Annual average concentrations of particulate matter ≤ 10 μm in diameter (PM<sub>10</sub>) and nitrogen dioxide (NO<sub>2</sub>) were estimated at participants' residential addresses using exposure prediction models. We used robust linear regression to identify differentially methylated probes (DMPs) and two different approaches, DMRcate and comb-p, to identify differentially methylated regions (DMRs).<h4>Results</h4>After multiple testing correction (false discovery rate < 0.05), there were 12 DMPs and 27 DMRs associated with PM<sub>10</sub> and 45 DMPs and 57 DMRs related to NO<sub>2</sub>. DMP cg06992688 (OTUB2) and several DMRs were associated with both exposures. Eleven DMPs in relation to NO<sub>2</sub> confirmed previous findings in Europeans; the remainder were novel. Methylation levels of 39 DMPs were associated with expression levels of nearby genes in a separate dataset of 3075 individuals. Enriched networks were related to outcomes associated with air pollution including cardiovascular and respiratory diseases as well as inflammatory and immune responses.<h4>Conclusions</h4>This study provides evidence that long-term ambient air pollution exposure impacts DNA methylation. The differential methylation signals can serve as potential air pollution biomarkers. These results may help better understand the influences of ambient air pollution on human health.

Also flagged:acute lymphoblastic leukemiaALLasparagineprotein synthesisdeathhuntingtin associated protein 1
Journal Article 2019-02-28 ✓ 1 Snippet Lee JK, Kang S, Wang X, Rosales JL, Gao X, Byun HG, Jin Y, Fu S, Wang J, Lee KY.
In-Text Gene Mentions

Htt

Show Full Abstract

l-Asparaginase (l-ASNase) is a strategic component of treatment protocols for acute lymphoblastic leukemia (ALL). It causes asparagine deficit, resulting in protein synthesis inhibition and subsequent leukemic cell death and ALL remission. However, patients often relapse because of the development of resistance, but the underlying mechanism of ALL cell resistance to l-asparaginase remains unknown. Through unbiased genome-wide RNA interference screening, we identified huntingtin associated protein 1 (<i>HAP1</i>) as an ALL biomarker for l-asparaginase resistance. Knocking down HAP1 induces l-asparaginase resistance. HAP1 interacts with huntingtin and the intracellular Ca<sup>2+</sup> channel, inositol 1,4,5-triphosphate receptor to form a ternary complex that mediates endoplasmic reticulum (ER) Ca<sup>2+</sup> release upon stimulation with inositol 1,4,5-triphosphate<sub>3</sub> Loss of HAP1 prevents the formation of the ternary complex and thus l-asparaginase-mediated ER Ca<sup>2+</sup> release. HAP1 loss also inhibits external Ca<sup>2+</sup> entry, blocking an excessive rise in [Ca<sup>2+</sup>]<sub>i</sub>, and reduces activation of the Ca<sup>2+</sup>-dependent calpain-1, Bid, and caspase-3 and caspase-12, leading to reduced number of apoptotic cells. These findings indicate that HAP1 loss prevents l-asparaginase-induced apoptosis through downregulation of the Ca<sup>2+</sup>-mediated calpain-1-Bid-caspase-3/12 apoptotic pathway. Treatment with BAPTA-AM [1,2-bis(2-aminophenoxy)ethane-<i>N,N,N</i>',<i>N</i>'-tetraacetic acid tetrakis(acetoxymethyl ester)] reverses the l-asparaginase apoptotic effect in control cells, supporting a link between l-asparaginase-induced [Ca<sup>2+</sup>]<sub>i</sub> increase and apoptotic cell death. Consistent with these findings, ALL patient leukemic cells with lower HAP1 levels showed resistance to l-asparaginase, indicating the clinical relevance of HAP1 loss in the development of l-asparaginase resistance, and pointing to <i>HAP1</i> as a functional l-asparaginase resistance biomarker that may be used for the design of effective treatment of l-asparaginase-resistant ALL.

Also flagged:alpha-1 antitrypsinmetabolic disordersAATcytokinewaterformation
Journal Article 2019-02-28 No Snippets Lee C, Dhawan A, Iansante V, Filippi C, Mitry R, Tang J, Walker S, Fernandez DaCosta R, Sinha S, Hughes RD, Koulmanda M, Fitzpatrick E.
Show Full Abstract

For patients with non-cirrhotic liver-based metabolic disorders, hepatocyte transplantation can be an effective treatment. However, long-term function of transplanted hepatocytes following infusion has not been achieved due to insufficient numbers of hepatocytes reaching the liver cell plates caused by activation of the instant blood-mediated inflammatory reaction (IBMIR). Our aim was to determine if the natural immune modulator, alpha-1 antitrypsin (AAT), could improve engraftment of transplanted hepatocytes and investigate its mechanism of action. A tubing loop model was used to analyse activation of the IBMIR when human hepatocytes were in contact with ABO-matched blood and 4 mg/ml AAT. Platelet and white cell counts, complement and cytokine expression were analysed. To determine if AAT could improve short-term engraftment, female rats underwent tail vein injection of AAT (120 mg/kg) or water (control) prior to the intrasplenic transplantation of 2 × 10<sup>7</sup> male hepatocytes. At 48 h and 1 week, livers were collected for analysis. In our loop model, human hepatocytes elicited a significant drop in platelet count with thrombus formation compared to controls. Loops containing AAT and hepatocytes showed no platelet consumption and no thrombus formation. Further, AAT treatment resulted in reduced IL-1β, IL-6 and IFN-γ and increased IL-1RA compared to untreated loops. In vivo, AAT significantly improved engraftment of rat hepatocytes compared to untreated at 48 h. AAT infusion may inhibit the IBMIR, thus improving short-term engraftment of donor hepatocytes and potentially improve the outcomes for patients with liver-based metabolic disease. KEY MESSAGES: • Alpha-1 antitrypsin (AAT) acts as an immune modulator to improve the efficacy of hepatocyte transplantation. • Treatment with AAT decreased thrombus formation and pro-inflammatory cytokine expression in a tubing loop model. • AAT significantly improved engraftment of donor hepatocytes within the first 48 h post transplantation.

Also flagged:gene expressioncolorectal cancerTRIM4PYGLtumorscell growth
Journal Article 2019-02-28 No Snippets Bien SA, Su YR, Conti DV, Harrison TA, Qu C, Guo X, Lu Y, Albanes D, Auer PL, Banbury BL, Berndt SI, Bézieau S, Brenner H, Buchanan DD, Caan BJ, Campbell PT, Carlson CS, Chan AT, Chang-Claude J, Chen S, Connolly CM, Easton DF, Feskens EJM, Gallinger S, Giles GG, Gunter MJ, Hampe J, Huyghe JR, Hoffmeister M, Hudson TJ, Jacobs EJ, Jenkins MA, Kampman E, Kang HM, Kühn T, Küry S, Lejbkowicz F, Le Marchand L, Milne RL, Li L, Li CI, Lindblom A, Lindor NM, Martín V, McNeil CE, Melas M, Moreno V, Newcomb PA, Offit K, Pharaoh PDP, Potter JD, Qu C, Riboli E, Rennert G, Sala N, Schafmayer C, Scacheri PC, Schmit SL, Severi G, Slattery ML, Smith JD, Trichopoulou A, Tumino R, Ulrich CM, van Duijnhoven FJB, Van Guelpen B, Weinstein SJ, White E, Wolk A, Woods MO, Wu AH, Abecasis GR, Casey G, Nickerson DA, Gruber SB, Hsu L, Zheng W, Peters U.
Show Full Abstract

Genome-wide association studies have reported 56 independently associated colorectal cancer (CRC) risk variants, most of which are non-coding and believed to exert their effects by modulating gene expression. The computational method PrediXcan uses cis-regulatory variant predictors to impute expression and perform gene-level association tests in GWAS without directly measured transcriptomes. In this study, we used reference datasets from colon (n = 169) and whole blood (n = 922) transcriptomes to test CRC association with genetically determined expression levels in a genome-wide analysis of 12,186 cases and 14,718 controls. Three novel associations were discovered from colon transverse models at FDR ≤ 0.2 and further evaluated in an independent replication including 32,825 cases and 39,933 controls. After adjusting for multiple comparisons, we found statistically significant associations using colon transcriptome models with TRIM4 (discovery P = 2.2 × 10<sup>- 4</sup>, replication P = 0.01), and PYGL (discovery P = 2.3 × 10<sup>- 4</sup>, replication P = 6.7 × 10<sup>- 4</sup>). Interestingly, both genes encode proteins that influence redox homeostasis and are related to cellular metabolic reprogramming in tumors, implicating a novel CRC pathway linked to cell growth and proliferation. Defining CRC risk regions as one megabase up- and downstream of one of the 56 independent risk variants, we defined 44 non-overlapping CRC-risk regions. Among these risk regions, we identified genes associated with CRC (P < 0.05) in 34/44 CRC-risk regions. Importantly, CRC association was found for two genes in the previously reported 2q25 locus, CXCR1 and CXCR2, which are potential cancer therapeutic targets. These findings provide strong candidate genes to prioritize for subsequent laboratory follow-up of GWAS loci. This study is the first to implement PrediXcan in a large colorectal cancer study and findings highlight the utility of integrating transcriptome data in GWAS for discovery of, and biological insight into, risk loci.

Also flagged:reproductiondeathbehavioralwaterheat shock proteins 70HSP70
Journal Article 2019-02-28 No Snippets Berihulay H, Abied A, He X, Jiang L, Ma Y.
Show Full Abstract

Small ruminants are the critical source of livelihood for rural people to the development of sustainable and environmentally sound production systems. They provided a source of meat, milk, skin, and fiber. The several contributions of small ruminants to the economy of millions of rural people are however being challenged by extreme heat stress difficulties. Heat stress is one of the most detrimental factors contributing to reduced growth, production, reproduction performance, milk quantity and quality, as well as natural immunity, making animals more vulnerable to diseases and even death. However, small ruminants have successfully adapted to this extreme environment and possess some unique adaptive traits due to behavioral, morphological, physiological, and largely genetic bases. This review paper, therefore, aims to provide an integrative explanation of small ruminant adaptation to heat stress and address some responsible candidate genes in adapting to thermal-stressed environments.

Also flagged:glycoprotein Evaricellaherpes zosterprimary infectionpostherpetic neuralgiaToll-like receptor 4
Journal Article 2019-02-28 No Snippets Wui SR, Kim KS, Ryu JI, Ko A, Do HTT, Lee YJ, Kim HJ, Lim SJ, Park SA, Cho YJ, Kim CG, Lee NG.
Show Full Abstract

Varicella zoster virus (VZV) is a neurotropic and lymphotropic alpha herpesvirus that causes varicella and herpes zoster (HZ). At a primary infection, VZV causes varicella in young children. Reactivation of latent VZV in sensory ganglia causes painful HZ in elderly people, occasionally leading to a serious complication, postherpetic neuralgia (PHN). A live attenuated VZV vaccine, the first vaccine licensed for the prevention of HZ and PHN is not very effective, while a recombinant subunit vaccine provides higher and longer protection against HZ. In the present study, we developed a new adjuvant system CIA09A, which is composed of cationic liposomes, the Toll-like receptor 4 (TLR4) agonist de-O-acylated lipooligosaccharide, and Quillaja saponin fraction QS-21. We then determined its adjuvant activity for recombinant VZV glycoprotein E (gE) in mice. Co-lyophilization of the liposomal adjuvant formulation with gE did not abolish the immune-stimulating activity. In fact, the CIA09A-adjuvanted gE vaccine was highly effective in eliciting both humoral and cellular immune responses to the recombinant gE protein and VZV in a VZV-primed mouse model. Furthermore, the frequency of gE-specific polyfunctional CD4<sup>+</sup> T cells expressing interferon (IFN)-γ, tumor necrosis factor (TNF)-α, and interleukin (IL)-2 was significantly increased in mice immunized with the adjuvanted vaccine. These data indicate that co-lyophilization of protein antigens with CIA09A enables development of a liposome-adjuvanted vaccine in a single vial to induce strong cell-mediated immunity required for vaccine efficacy. Thus, the CIA09A-adjuvanted gE vaccine warrants further development as a new prophylactic vaccine against HZ.

Also flagged:gene expressionErythropoiesisoligonucleotideorganizationcell differentiationmetabolism
Journal Article 2019-02-28 No Snippets Mello FV, Land MGP, Costa ES, Teodósio C, Sanchez ML, Bárcena P, Peres RT, Pedreira CE, Alves LR, Orfao A.
Show Full Abstract

Erythropoiesis has been extensively studied using in vitro and in vivo animal models. Despite this, there is still limited data about the gene expression profiles (GEP) of primary (ex vivo) normal human bone marrow (BM) erythroid maturation. We investigated the GEP of nucleated red blood cell (NRBC) precursors during normal human BM erythropoiesis. Three maturation-associated populations of NRBC were identified and purified from (fresh) normal human BM by flow cytometry and the GEP of each purified cell population directly analyzed using DNA-oligonucleotide microarrays. Overall, 6569 genes (19% of the genes investigated) were expressed in ≥1 stage of BM erythropoiesis at stable (e.g., genes involved in DNA process, cell signaling, protein organization and hemoglobin production) or variable amounts (e.g., genes related to cell differentiation, apoptosis, metabolism), the latter showing a tendency to either decrease from stage 1 to 3 (genes associated with regulation of erythroid differentiation and survival, e.g., <i>SPI1</i>, <i>STAT5A</i>) or increase from stage 2 to stage 3 (genes associated with autophagy, erythroid functions such as heme production, e.g., <i>ALAS1</i>, ALAS2), iron metabolism (e.g., <i>ISCA1, SLC11A2</i>), protection from oxidative stress (e.g., <i>UCP2</i>, <i>PARK7</i>), and NRBC enucleation (e.g., <i>ID2</i>, <i>RB1</i>). Interestingly, genes involved in apoptosis (e.g., <i>CASP8, P2RX1</i>) and immune response (e.g., <i>FOXO3, TRAF6</i>) were also upregulated in the last stage (stage 3) of maturation of NRBC precursors. Our results confirm and extend on previous observations and providing a frame of reference for better understanding the critical steps of human erythroid maturation and its potential alteration in patients with different clonal and non-clonal erythropoietic disorders.

Also flagged:glutathioneObesitychildhood obesityironmetabolismHp
Journal Article 2019-02-28 ✓ 4 Snippets Aguiar L, Marinho C, Martins R, Alho I, Ferreira J, Levy P, Faustino P, Bicho M, Inacio A.
In-Text Gene Mentions

Interaction between HFE and haptoglobin polymorphisms and its relation with plasma glutathione levels in obese children.

The growing prevalence of childhood obesity has led to the appearance of serious complications, including a chronic systemic inflammation associated with oxidative stress. In the present study, we analysed the interaction between two genes related with iron metabolism - HFE and haptoglobin - and the plasmatic concentration of glutathione, as a way to evaluate the antioxidant response capacity in obesity.

…iron metabolism -HFEand haptoglobin -…

…of haptoglobin andHFEwith oxidative stress…

Show Full Abstract

Obesity among children has emerged as a serious public health problem. The growing prevalence of childhood obesity has led to the appearance of serious complications, including a chronic systemic inflammation associated with oxidative stress.  In the present study, we analysed the interaction between two genes related with iron metabolism - HFE and haptoglobin - and the plasmatic concentration of glutathione, as a way to evaluate the antioxidant response capacity in obesity. To achieve this, 118 obese children and 89 eutrophic children were recruited for the study. Results showed that although obese children present a significantly decreased tGSH levels, once we analysed separately children based on their haptoglobin phenotype, the decreased tGSH levels is significant only for the Hp 2 allele. Additionally, Hp 2.2 obese children carrying H63D polymorphism show significantly lower tGSH/GSSG values. Our results found an association of haptoglobin and HFE with oxidative stress in childhood obesity.

Also flagged:Lipidobesitycell-surfacereceptor for advanced glycation end products
Journal Article 2019-02-28 ✓ 2 Snippets Dozio E, Vianello E, Bandera F, Longhi E, Brizzola S, Nebuloni M, Corsi Romanelli MM.
In-Text Gene Mentions

…Decr 1 andEci2) are also…

…Decr 1 andEci2(accessory enzymes which…

Show Full Abstract

Most of the obesity-related complications are due to ectopic fat accumulation. Recently, the activation of the cell-surface receptor for advanced glycation end products (RAGE) has been associated with lipid accumulation in different organs. Nevertheless, the role of RAGE and sRAGE, the soluble form that prevents ligands to activate RAGE, in intramyocardial lipid accumulation is presently unknown. To this aim, we analyzed whether, in obesity, intramyocardial lipid accumulation and lipid metabolism-related transcriptome are related to RAGE and sRAGE. Heart and serum samples were collected from 10 lean (L) and 10 obese (OB) Zucker rats. Oil red staining was used to detect lipids on frozen heart sections. The lipid metabolism-related transcriptome (84 genes) was analyzed by a specific PCR array. Heart RAGE expression was explored by real-time RT-PCR and Western blot analyses. Serum levels of sRAGE (total and endogenous secretory form (esRAGE)) were quantified by ELISA. Genes promoting fatty acid transport, activation, and oxidation in mitochondria/peroxisomes were upregulated in OB hearts. Intramyocardial lipid content did not differ between OB and L rats, as well as RAGE expression. A slight increase in epicardial adipose tissue was observed in OB hearts. Total sRAGE and esRAGE concentrations were significantly higher in OB rats. sRAGE may protect against obesity-induced intramyocardial lipid accumulation by preventing RAGE hyperexpression, therefore allowing lipids to be metabolized. EAT also played a protective role by working as a buffering system that protects the myocardium against exposure to excessively high levels of fatty acids. These observations reinforce the potential role of RAGE pathway as an interesting therapeutic target for obesity-related complications, at least at the cardiovascular level.

Also flagged:lung cancercancertumorgene expressionT-cell receptorosteoclast differentiation
Journal Article 2019-02-28 No Snippets Chang WA, Tsai YM, Tsai YC, Wu CY, Chang KF, Lien CT, Hung JY, Hsu YL, Kuo PL.
Show Full Abstract

A pre-metastatic niche (PMN) facilitates cancer metastasis through mobilization and recruitment of bone marrow-derived cells (BMDCs) and associated factors. In bone marrow, hematogenous cells, including osteoclasts, macrophages and lymphocytes, and mesenchymal cells, including mesenchymal stem cells, osteoblasts and adipocytes, are involved in PMN formation. Patients with lung cancer and metastasis have a poor prognosis and shortened median survival time. Bone marrow has been considered fertile ground for dormant and proliferating tumor cells, and mobilizing and recruiting BMDCs and immune cells can establish a PMN. However, the role of BMDCs in PMN formation is not yet fully understood. The present study aimed to investigate the association between BMDCs and PMN in bone marrow tissue samples. The results demonstrated that bone marrow served an important role in lung cancer progression and that eight pathways were potentially involved, including 'T-cell receptor signaling pathway', 'osteoclast differentiation', 'MAPK signaling pathway', 'VEGF signaling pathway', 'leukocyte transendothelial migration', 'signaling pathways regulating the pluripotency of stem cells', 'oxytocin signaling pathway' and 'cell adhesion molecules (CAMs)'. In addition, the present study investigated the role of BMDCs in facilitating lung cancer metastasis. In conclusion, the results from the present study suggested that molecular alterations in gene expression may provide a novel signature in lung cancer, which may aid in the development of novel diagnostic and therapeutic strategies for patients with lung cancer and bone metastasis.

Also flagged:trophic factors receptorsrecurrent laryngeal nerve injuryaxonalNetrin-1glial cell-derived neurotrophic factorGDNF
Journal Article 2019-02-27 ✓ 3 Snippets Hernandez-Morato I, Tian L, Montalbano M, Pitman MJ.
In-Text Gene Mentions

Immunostaining was performed for Netrin-1 (deleted in colorectal carcinoma [DCC], UNC5A) and GDNF receptors (rearranged during transfection [Ret], glycosylphosphatidylinositol-linked cell surface receptors [GFRα1, GFRα2, GFRα3]).

…in colorectal carcinoma [DCC], UNC5A) and GDNF…

DCC, the receptor that…

Show Full Abstract

<h4>Objective</h4>An injury of the recurrent laryngeal nerve (RLN) triggers axonal regeneration but results in a poor functional recovery. Netrin-1 and glial cell-derived neurotrophic factor (GDNF) expression are up-regulated in laryngeal muscles during RLN regeneration, but the role of their receptors produced in the nucleus ambiguus is unknown. The aim of this work was to determine the timing of the production of Netrin-1 and GDNF receptors during RLN regeneration and correlate this with the previously identified timing of up-regulation of their trophic factors in the laryngeal muscles.<h4>Study design</h4>Laboratory experiment with rat model.<h4>Methods</h4>The right RLN was transected and dextran amine tracer applied. At 7, 14, and 21 days postinjury (DPI), brainstems were removed and harvested. Immunostaining was performed for Netrin-1 (deleted in colorectal carcinoma [DCC], UNC5A) and GDNF receptors (rearranged during transfection [Ret], glycosylphosphatidylinositol-linked cell surface receptors [GFRα1, GFRα2, GFRα3]). The timing and type of receptor production relative to injury as well as their position in the nucleus ambiguus was analyzed.<h4>Results</h4>Netrin-1 UNC5A receptors were minimal in the nucleus ambiguus during RLN regeneration. DCC, the receptor that plays an attract role, was immunopositive from 7 to 21 DPI. All GDNF receptors, except GFRα2, were clearly positive from 7 to 14 DPI. No differences of production were observed according to the position of the motor neurons in the nucleus ambiguus.<h4>Conclusion</h4>An injury of the RLN leads to a higher production of Netrin-1 DCC and GDNF receptors in the nucleus ambiguus. The timing of receptor production is similar to up-regulation of their trophic factors in the laryngeal muscles.<h4>Level of evidence</h4>NA. Laryngoscope, 129:2537-2542, 2019.

Also flagged:thrombophiliathrombophiliasintrauterine growth restrictiongestationplacental abruptionpreeclampsia
Journal Article 2019-02-27 ✓ 1 Snippet Fernández Arias M, Mazarico E, Gonzalez A, Muniesa M, Molinet C, Almeida L, Gómez Roig MD.
In-Text Gene Mentions

…Serpina A10 (Arg67Stop),Serpina C1C1 (Cambridge Ala384Ser…

Show Full Abstract

<h4>Objectives</h4>To investigate the incidence of inherited thrombophilias in patients with adverse obstetric outcomes and to compare detection rates of thrombophilias between standard blood tests and a novel genetic test.<h4>Methods</h4>This is a case-control prospective study performed in Hospital Sant Joan de Déu in Barcelona, Spain. Cases had a history of intrauterine growth restriction requiring delivery before 34 weeks gestation, placental abruption before 34 weeks gestation, or severe preeclampsia. Controls had at least two normal, spontaneously conceived pregnancies at term, without complications or no underlying medical disease. At least 3 months after delivery, all case and control women underwent blood collection for standard blood tests for thrombophilias and saliva collection for the genetic test, which enables the diagnosis of 12 hereditary thrombophilias by analyzing genetic variants affecting different points of the blood coagulation cascade.<h4>Results</h4>The study included 33 cases and 41 controls. There were no statistically significant differences between cases and controls in the standard blood tests for thrombophilias in plasma or the TiC test for genetic variables. One clinical-genetic model was generated using variables with the lowest P values: ABO, body mass index, C_rs5985, C_rs6025, and protein S. This model exhibited good prediction capacity, with an area under the curve of almost 0.7 (P <0.05), sensitivity of almost 67%, and specificity of 70%.<h4>Conclusion</h4>Although some association may exist between hypercoagulability and pregnancy outcomes, no significant direct correlation was observed between adverse obstetric outcomes and inherited thrombophilias when analyzed using either standard blood tests or the genetic test. Future studies with a larger sample size are required to create a clinical-genetic model that better discriminates women with a history of adverse pregnancy outcomes and an increased risk of poor outcomes in subsequent pregnancies.

Also flagged:generalized pustular psoriasisinflammatory skin diseasepathogenesisGPPIL-1βIL-36G
Journal Article 2019-02-27 No Snippets Shao S, Fang H, Zhang J, Jiang M, Xue K, Ma J, Zhang J, Lei J, Zhang Y, Li B, Yuan X, Dang E, Wang G.
Show Full Abstract

Generalized pustular psoriasis (GPP) is a rare and severe inflammatory skin disease that can be life-threatening. Gene mutations are found in some cases, but its immune pathogenesis is largely unknown. Here, we observed that the neutrophil:lymphocyte ratio in patients with GPP was higher than that in healthy controls and decreased after effective treatment. Neutrophils isolated from patients with GPP induced higher expressions of inflammatory genes including <i>IL-1β</i>, <i>IL-36G</i>, <i>IL-18</i>, <i>TNF-α</i>, and C-X-C motif chemokine ligands in keratinocytes than normal neutrophils did. Moreover, neutrophils from patients with GPP secreted more exosomes than controls, which were then rapidly internalized by keratinocytes, increasing the expression of these inflammatory molecules <i>via</i> activating NF-κB and MAPK signaling pathways. The proteomic profiles in neutrophil exosomes further characterized functional proteins and identified olfactomedin 4 as the critical differentially expressed protein that mediates the autoimmune inflammatory responses of GPP. These results demonstrate that neutrophil exosomes have an immune-regulatory effect on keratinocytes, which modulates immune cell migration and autoinflammation in GPP.-Shao, S., Fang, H., Zhang, J., Jiang, M., Xue, K., Ma, J., Zhang, J., Lei, J., Zhang, Y., Li, B., Yuan, X., Dang, E., Wang, G. Neutrophil exosomes enhance the skin autoinflammation in generalized pustular psoriasis <i>via</i> activating keratinocytes.

Also flagged:ironfibroblast growth factor 6FGF-6metabolismFGF6systemic sclerosis
Journal Article 2019-02-27 ✓ 5 Snippets Guo S, Jiang S, Epperla N, Ma Y, Maadooliat M, Ye Z, Olson B, Wang M, Kitchner T, Joyce J, An P, Wang F, Strenn R, Mazza JJ, Meece JK, Wu W, Jin L, Smith JA, Wang J, Schrodi SJ.
In-Text Gene Mentions

…a novel susceptibilityhemochromatosisgene and has…

…FGF6 as ahemochromatosis-susceptibility gene.…

…FGF6 , andhemochromatosisin the central…

hemochromatosis

HFE

Show Full Abstract

Standard analyses applied to genome-wide association data are well designed to detect additive effects of moderate strength. However, the power for standard genome-wide association study (GWAS) analyses to identify effects from recessive diplotypes is not typically high. We proposed and conducted a gene-based compound heterozygosity test to reveal additional genes underlying complex diseases. With this approach applied to iron overload, a strong association signal was identified between the fibroblast growth factor-encoding gene, <i>FGF6</i>, and hemochromatosis in the central Wisconsin population. Functional validation showed that fibroblast growth factor 6 protein (FGF-6) regulates iron homeostasis and induces transcriptional regulation of hepcidin. Moreover, specific identified <i>FGF6</i> variants differentially impact iron metabolism. In addition, FGF6 downregulation correlated with iron-metabolism dysfunction in systemic sclerosis and cancer cells. Using the recessive diplotype approach revealed a novel susceptibility hemochromatosis gene and has extended our understanding of the mechanisms involved in iron metabolism.

Also flagged:hydroxymethylationstem cell differentiationcytosineneurogenesistranscription factors
Journal Article 2019-02-27 ✓ 1 Snippet Noack F, Pataskar A, Schneider M, Buchholz F, Tiwari VK, Calegari F.
In-Text Gene Mentions

…, Numb ,Pou3f2, and others…

Show Full Abstract

Dynamic changes in DNA (hydroxy-)methylation are fundamental for stem cell differentiation. However, the signature of these epigenetic marks in specific cell types during corticogenesis is unknown. Moreover, site-specific manipulation of cytosine modifications is needed to reveal the significance and function of these changes. Here, we report the first assessment of (hydroxy-)methylation in neural stem cells, neurogenic progenitors, and newborn neurons during mammalian corticogenesis. We found that gain in hydroxymethylation and loss in methylation occur sequentially at specific cellular transitions during neurogenic commitment. We also found that these changes predominantly occur within enhancers of neurogenic genes up-regulated during neurogenesis and target of pioneer transcription factors. We further optimized the use of dCas9-Tet1 manipulation of (hydroxy-)methylation, locus-specifically, in vivo, showing the biological relevance of our observations for <i>Dchs1</i>, a regulator of corticogenesis involved in developmental malformations and cognitive impairment. Together, our data reveal the dynamics of cytosine modifications in lineage-related cell types, whereby methylation is reduced and hydroxymethylation gained during the neurogenic lineage concurrently with up-regulation of pioneer transcription factors and activation of enhancers for neurogenic genes.

Also flagged:CYP21A2congenital adrenal hyperplasianucleotidecortisolsynthesisadrenal
Journal Article 2019-02-27 No Snippets Chi DV, Tran TH, Nguyen DH, Luong LH, Le PT, Ta MH, Ngo HTT, Nguyen MP, Le-Anh TP, Nguyen DP, Bui TH, Ta VT, Tran VK.
Show Full Abstract

<h4>Background</h4>Congenital adrenal hyperplasia (CAH) (OMIM #201910) is a complex disease most often caused by pathogenic variant of the CYP21A2 gene. We have designed an efficient multistep approach to diagnose and classify CAH cases due to CYP21A2 variant and to study the genotype-phenotype relationship.<h4>Methods</h4>A large cohort of 212 Vietnamese patients from 204 families was recruited. We utilized Multiplex Ligation-dependent Probe Amplification to identify large deletion or rearrangement followed by complete gene sequencing of CYP21A2 to map single-nucleotide changes and possible novel variants.<h4>Results</h4>Pathogenic variants were identified in 398 out of 408 alleles (97.5%). The variants indexed span across most of the CYP21A2 gene regions. The most common genotypes were: I2g/I2g (15.35%); Del/Del (14.4%); Del/I2g (10.89%); p.R356W/p.R356W (6.44%); and exon 1-3 del/exon 1-3 del (5.44%). In addition to the previously characterized and documented variants, we also discovered six novel variants which were not previously reported, in silico tools were used to support the pathogenicity of these variants.<h4>Conclusion</h4>The result will contribute in further understanding the genotype-phenotype relationship of CAH patients and to guide better treatment and management of the affected.

Also flagged:GroEL1bentrehaloseTween-80Mycolic AcidsSynthesis
Journal Article 2019-02-27 ✓ 1 Snippet Holmes NJ, Kavunja HW, Yang Y, Vannest BD, Ramsey CN, Gepford DM, Banahene N, Poston AW, Piligian BF, Ronning DR, Ojha AK, Swarts BM.
In-Text Gene Mentions

DCC

Show Full Abstract

The mycobacterial outer membrane, or mycomembrane, is essential for the viability and virulence of <i>Mycobacterium tuberculosis</i> and related pathogens. The mycomembrane is a dynamic structure, whose chemical composition and biophysical properties can change during stress to give an advantage to the bacterium. However, the mechanisms that govern mycomembrane remodeling and their significance to mycobacterial pathogenesis are still not well characterized. Recent studies have shown that trehalose dimycolate (TDM), a major glycolipid of the mycomembrane, is broken down by the mycobacteria-specific enzyme TDM hydrolase (Tdmh) in response to nutrient deprivation, a process which appears to modulate the mycomembrane to increase nutrient acquisition, but at the expense of stress tolerance. Tdmh activity thus balances the growth of <i>M. tuberculosis</i> during infection in a manner that is contingent upon host immunity. Current methods to probe Tdmh activity are limited, impeding the development of inhibitors and the investigation of the role of Tdmh in bacterial growth and persistence. Here, we describe the synthesis and evaluation of FRET-TDM, which is a fluorescence-quenched analogue of TDM that is designed to fluoresce upon hydrolysis by Tdmh and potentially other trehalose ester-degrading hydrolases involved in mycomembrane remodeling. We found that FRET-TDM was efficiently activated in vitro by recombinant Tdmh, generating a 100-fold increase in fluorescence. FRET-TDM was also efficiently activated in the presence of whole cells of <i>Mycobacterium smegmatis</i> and <i>M. tuberculosis</i>, but the observed signal was predominantly Tdmh-independent, suggesting that physiological levels of Tdmh are low and that other mycobacterial enzymes also hydrolyze the probe. The latter notion was confirmed by employing a native protein gel-based fluorescence assay to profile FRET-TDM-activating enzymes from <i>M. smegmatis</i> lysates. On the other hand, FRET-TDM was capable of detecting the activity of Tdmh in cells when it was overexpressed. Together, our data demonstrate that FRET-TDM is a convenient and sensitive in vitro probe of Tdmh activity, which will be beneficial for Tdmh enzymatic characterization and inhibitor screening. In more complex samples, for example, live cells or cell lysates, FRET-TDM can serve as a tool to probe Tdmh activity at elevated enzyme levels, and it may facilitate the identification and characterization of related hydrolases that are involved in mycomembrane remodeling. Our study also provides insights as to how the structure of FRET-TDM or related fluorogenic probes can be optimized to achieve improved specificity and sensitivity for detecting mycobacteria.

Also flagged:HepcidinIronHomeostasisSubacute ThyroiditisSATacute-phase
Journal Article 2019-02-27 ✓ 1 Snippet Hernik A, Szczepanek-Parulska E, Filipowicz D, Czarnywojtek A, Wrotkowska E, Kramer L, Urbanovych A, Ruchała M.
In-Text Gene Mentions

…or liver diseases,hemochromatosis, and previous therapy…

Show Full Abstract

<h4>Purpose</h4>Hepcidin is an acute-phase protein involved also in regulation of iron homeostasis. The aim of the study was to prospectively assess for the first time the hepcidin<sub>EL</sub> concentration in patients with subacute thyroiditis (SAT), to identify biochemical determinants of hepcidin<sub>EL</sub> concentration and evaluate the potential role of hepcidin in SAT diagnosis and monitoring.<h4>Methods</h4>Out of 40 patients with SAT initially recruited, restrictive inclusion criteria fulfilled 21 subjects aged 45 ± 10 years and 21 healthy control subjects (CS). Hepcidin<sub>EL</sub> concentration, thyroid status, and iron homeostasis were evaluated at SAT diagnosis and following therapy and compared with CS.<h4>Results</h4>The median hepcidin<sub>EL</sub> concentration at SAT diagnosis is higher than that in CS (48.8 (15.9-74.5) ng/mL vs. 18.2 (10.2-23.3) ng/mL, <i>p</i> = 0.009) and is significantly lower after treatment (4.0 (1.2-10.0) ng/mL, <i>p</i> = 0.007) compared with CS. The ROC analysis for hepcidin<sub>EL</sub> at SAT diagnosis revealed that area under the curve (AUC) is 0.735 (<i>p</i> = 0.009), and the cut-off for hepcidin<sub>EL</sub> concentration is 48.8 ng/mL (sensitivity 0.52 and specificity 0.95). Hepcidin<sub>EL</sub> in SAT patients correlated with CRP (<i>r</i> = 0.614, <i>p</i> = 0.003), ferritin (<i>r</i> = 0.815, <i>p</i> < 0.001), and aTPO (<i>r</i> = -0.491, <i>p</i> = 0.024). On multiple regression, the correlation between hepcidin<sub>EL</sub> and ferritin was confirmed (<i>p</i> < 0.001).<h4>Conclusions</h4>SAT is accompanied by a significant increase in hepcidin, which reflects an acute-phase inflammatory process. Parameters of iron homeostasis improved significantly while inflammatory indices got lower following recovery. The potential role of hepcidin as a predictive factor of the risk of SAT relapse needs to be assessed in studies on larger groups of SAT patients.

Also flagged:Postpartum DepressionpreeclampsiaPEDepressionPPDobstetric
Journal Article 2019-02-27 ✓ 2 Snippets Chen L, Wang X, Ding Q, Shan N, Qi H.
In-Text Gene Mentions

…ydroxytryptamine transporter (5-HTT) and estrogen receptor…

…as MTHFR C677T,5-HTT, and ESR may…

Show Full Abstract

<h4>Background</h4>Postpartum depression (PPD) and preeclampsia (PE) are both common diseases in obstetrics that affect maternal health and infant development. However, the relationship between the two diseases still requires clarification.<h4>Objective</h4>The purpose of this study was to (1) determine the incidence rate of PPD in patients with PE and (2) identify the association between the prevalence of PPD and the severity of PE.<h4>Methods</h4>We conducted a retrospective analysis of women with and without PE who delivered between January 1, 2017, and August 30, 2018, in the First Affiliated Hospital of Chongqing Medical University. We used a questionnaire survey methodology that included the Edinburgh Postnatal Depression Scale (EPDS) to test the influence of PE on the development of new-onset PPD in the 6 weeks after delivery. We determined PPD based on a score ≥10 on the EPDS. Bivariate analysis was used to compare data between the two groups.<h4>Results</h4>A total of 180 women participated in this study. Thirty-five people screened positive for PPD, while the remaining 145 screened negative. The prevalence of PPD was 26.67% (24/90) in patients with PE, which was two times the prevalence in normal women (12.22%). Multiple logistic regression showed that women who had PE had nearly 3-fold increased odds of PPD compared to normal women and the risk of PPD increased with the aggravation of PE. Patients with severe PE had a more than 4-fold increased risk of screening positive for PPD.<h4>Conclusion</h4>PE was independently associated with PPD. Furthermore, the risk of PPD seemed to increase with the aggravation of PE. Thus, additional prevention efforts and support methods should be provided for women with PE to reduce the incidence of PPD.

Also flagged:ECR
Journal Article 2019-02-26 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:reproductionmetabolismphosphatidylinositolaminobenzoatedegradationT-cell receptor
Journal Article 2019-02-26 ✓ 1 Snippet Patnaik BB, Chung JM, Hwang HJ, Sang MK, Park JE, Min HR, Cho HC, Dewangan N, Baliarsingh S, Kang SW, Park SY, Jo YH, Park HS, Kim WJ, Han YS, Lee JS, Lee YS.
In-Text Gene Mentions

…members included Sox5,Sox6, Sox9, Sox11, Sox15,…

Show Full Abstract

<h4>Background</h4>Incilaria (= Meghimatium) fruhstorferi is an air-breathing land slug found in restricted habitats of Japan, Taiwan and selected provinces of South Korea (Jeju, Chuncheon, Busan, and Deokjeokdo). The species is on a decline due to depletion of forest cover, predation by natural enemies, and collection. To facilitate the conservation of the species, it is important to decide on a number of traits related to growth, immunity and reproduction addressing fitness advantage of the species.<h4>Results</h4>The visceral mass transcriptome of I. fruhstorferi was enabled using the Illumina HiSeq 4000 sequencing platform. According to BUSCO (Benchmarking Universal Single-Copy Orthologs) method, the transcriptome was considered complete with 91.8% of ortholog genes present (Single: 70.7%; Duplicated: 21.1%). A total of 96.79% of the raw read sequences were processed as clean reads. TransDecoder identified 197,271 contigs that contained candidate-coding regions. Of a total of 50,230 unigenes, 34,470 (68.62% of the total unigenes) annotated to homologous proteins in the Protostome database (PANM-DB). The GO term and KEGG pathway analysis indicated genes involved in metabolism, phosphatidylinositol signalling system, aminobenzoate degradation, and T-cell receptor signalling pathway. Many genes associated with molluscan innate immunity were categorized under pathogen recognition receptor, TLR signalling pathway, MyD88 dependent pathway, endogenous ligands, immune effectors, antimicrobial peptides, apoptosis, and adaptation-related. The reproduction-associated unigenes showed homology to protein fem-1, spermatogenesis-associated protein, sperm associated antigen, and testis expressed sequences, among others. In addition, we identified key growth-related genes categorized under somatotrophic axis, muscle growth, chitinases and collagens. A total of 4822 Simple Sequence Repeats (SSRs) were also identified from the unigene sequences of I. fruhstorferi.<h4>Conclusions</h4>This is the first available genomic information for non-model land slug, I. fruhstorferi focusing on genes related to growth, immunity, and reproduction, with additional focus on microsatellites and repeating elements. The transcriptome provides access to greater number of traits of unknown relevance in the species that could be exploited for in-depth analyses of evolutionary plasticity and making informed choices during conservation planning. This would be appropriate for understanding the dynamics of the species on a priority basis considering the ecological, health, and social benefits.

Also flagged:Lung CancerCancergenetic diseasetumoursscatter factor receptorsMET
Journal Article 2019-02-26 ✓ 1 Snippet Stella GM, Corino A, Berzero G, Kolling S, Filippi AR, Benvenuti S.
In-Text Gene Mentions

Altiratinib (DCC-2701) was instead designed based on the rationale of engineering a single therapeutic agent able to address multiple hallmarks of cancer, among which was MET.

Show Full Abstract

The process of metastatic dissemination begins when malignant cells start to migrate and leave the primary mass. It is now known that neoplastic progression is associated with a combination of genetic and epigenetic events. Cancer is a genetic disease and this pathogenic concept is the basis for a new classification of tumours, based precisely on the presence of definite genetic lesions to which the clones are addicted. Regarding the scatter factor receptors MET and Recepteur d'Origin Nantais (RON), it is recognised that MET is an oncogene necessary for a narrow subset of tumours (MET-addicted) while it works as an adjuvant <i>metastogene</i> for many others. This notion highlights that the anti-MET therapy can be effective as the first line of intervention in only a few MET-addicted cases, while it is certainly more relevant to block MET in cases of advanced neoplasia that exploit the activation of the invasive growth program to promote dissemination in other body parts. Few data are instead related to the role played by RON, a receptor homologous to MET. We have already demonstrated an implication of MET and RON genes in brain metastases from lung cancer. On this basis, the aim of this work is to recapitulate and dissect the molecular basis of metastatic brain dissemination from lung cancer. The latter is among the big killers and frequently gives rise to brain metastases, most often discovered at diagnosis. Molecular mechanisms leading to tumour spread to the brain are mostly unknown and in turn these tragic cases are still lacking effective therapies. Based on previously published data from our group, we aim to summarise and analyse the pathogenic mechanisms leading to activation of the scatter factor receptor in brain metastatic lesions of lung primaries, from the point of view of replacing the currently used empirical treatment with a more targeted approach.

Also flagged:ALKCancerreceptor tyrosine kinasetumoranaplastic large cell lymphomasinflammatory myofibroblastic tumors
Journal Article 2019-02-26 No Snippets Aubry A, Galiacy S, Allouche M.
Show Full Abstract

ALK is a receptor tyrosine kinase, associated with many tumor types as diverse as anaplastic large cell lymphomas, inflammatory myofibroblastic tumors, breast and renal cell carcinomas, non-small cell lung cancer, neuroblastomas, and more. This makes ALK an attractive target for cancer therapy. Since ALK⁻driven tumors are dependent for their proliferation on the constitutively activated ALK kinase, a number of tyrosine kinase inhibitors have been developed to block tumor growth. While some inhibitors are under investigation in clinical trials, others are now approved for treatment, notably in ALK-positive lung cancer. Their efficacy is remarkable, however limited in time, as the tumors escape and become resistant to the treatment through different mechanisms. Hence, there is a pressing need to target ALK-dependent tumors by other therapeutic strategies, and possibly use them in combination with kinase inhibitors. In this review we will focus on the therapeutic potential of proapoptotic ALK-derived peptides based on the dependence receptor properties of ALK. We will also try to make a non-exhaustive list of several alternative treatments targeting ALK-dependent and independent signaling pathways.

Also flagged:TLR2chemotaxiscytoskeletonPerinatal infectionLeukocyteToll-like receptor
Journal Article 2019-02-26 No Snippets Mottahedin A, Joakim Ek C, Truvé K, Hagberg H, Mallard C.
Show Full Abstract

Perinatal infection and inflammation are major risk factors for injury in the developing brain, however, underlying mechanisms are not fully understood. Leukocyte migration to the cerebrospinal fluid (CSF) and brain is a hallmark of many pathologies of the central nervous system including those in neonates. We previously reported that systemic activation of Toll-like receptor (TLR) 2, a major receptor for gram-positive bacteria, by agonist Pam3CSK4 (P3C) resulted in dramatic neutrophil and monocyte infiltration to the CSF and periventricular brain of neonatal mice, an effect that was absent by the TLR4 agonist, LPS. Here we first report that choroid plexus is a route of TLR2-mediated leukocyte infiltration to the CSF by performing flow cytometry and transmission electron microscopy (TEM) of the choroid plexus. Next, we exploited the striking discrepancy between P3C and LPS effects on cell migration to determine the pathways regulating leukocyte trafficking through the choroid plexus. We performed RNA sequencing on the choroid plexus after administration of P3C and LPS to postnatal day 8 mice. A cluster gene analysis revealed a TLR2-specific signature of chemotaxis represented by 80-fold increased expression of the gene Ccl3 and 1000-fold increased expression of the gene Cxcl2. Ingenuity pathway analysis (IPA) revealed TLR2-specific molecular signaling related to cytoskeleton organization (e.g. actin signaling) as well as inositol phospholipids biosynthesis and degradation. This included upregulation of genes such as Rac2 and Micall2. In support of IPA results, ultrastructural analysis by TEM revealed clefting and perforations in the basement membrane of the choroid plexus epithelial cells in P3C-treated mice. In summary, we show that the choroid plexus is a route of TLR2-mediated transmigration of neutrophils and monocytes to the developing brain, and reveal previously unrecognized mechanisms that includes a specific chemotaxis profile as well as pathways regulating cytoskeleton and basement membrane remodeling.

Also flagged:Cysteinyl-tRNA SynthetaseRecessive DiseaseMicrocephalyAminoacyl-tRNA synthetasesamino acidsARS
Journal Article 2019-02-26 No Snippets Kuo ME, Theil AF, Kievit A, Malicdan MC, Introne WJ, Christian T, Verheijen FW, Smith DEC, Mendes MI, Hussaarts-Odijk L, van der Meijden E, van Slegtenhorst M, Wilke M, Vermeulen W, Raams A, Groden C, Shimada S, Meyer-Schuman R, Hou YM, Gahl WA, Antonellis A, Salomons GS, Mancini GMS.
Show Full Abstract

Aminoacyl-tRNA synthetases (ARSs) are essential enzymes responsible for charging tRNA molecules with cognate amino acids. Consistent with the essential function and ubiquitous expression of ARSs, mutations in 32 of the 37 ARS-encoding loci cause severe, early-onset recessive phenotypes. Previous genetic and functional data suggest a loss-of-function mechanism; however, our understanding of the allelic and locus heterogeneity of ARS-related disease is incomplete. Cysteinyl-tRNA synthetase (CARS) encodes the enzyme that charges tRNA<sup>Cys</sup> with cysteine in the cytoplasm. To date, CARS variants have not been implicated in any human disease phenotype. Here, we report on four subjects from three families with complex syndromes that include microcephaly, developmental delay, and brittle hair and nails. Each affected person carries bi-allelic CARS variants: one individual is compound heterozygous for c.1138C>T (p.Gln380<sup>∗</sup>) and c.1022G>A (p.Arg341His), two related individuals are compound heterozygous for c.1076C>T (p.Ser359Leu) and c.1199T>A (p.Leu400Gln), and one individual is homozygous for c.2061dup (p.Ser688Glnfs<sup>∗</sup>2). Measurement of protein abundance, yeast complementation assays, and assessments of tRNA charging indicate that each CARS variant causes a loss-of-function effect. Compared to subjects with previously reported ARS-related diseases, individuals with bi-allelic CARS variants are unique in presenting with a brittle-hair-and-nail phenotype, which most likely reflects the high cysteine content in human keratins. In sum, our efforts implicate CARS variants in human inherited disease, expand the locus and clinical heterogeneity of ARS-related clinical phenotypes, and further support impaired tRNA charging as the primary mechanism of recessive ARS-related disease.

Also flagged:systemic infectionspathogenesistranscription factorcell differentiationEFG1gene conversion
Journal Article 2019-02-26 ✓ 1 Snippet Liang SH, Anderson MZ, Hirakawa MP, Wang JM, Frazer C, Alaalm LM, Thomson GJ, Ene IV, Bennett RJ.
In-Text Gene Mentions

HTT

Show Full Abstract

Candida albicans is a commensal fungus of human gastrointestinal and reproductive tracts, but also causes life-threatening systemic infections. The balance between colonization and pathogenesis is associated with phenotypic plasticity, with alternative cell states producing different outcomes in a mammalian host. Here, we reveal that gene dosage of a master transcription factor regulates cell differentiation in diploid C. albicans cells, as EFG1 hemizygous cells undergo a phenotypic transition inaccessible to "wild-type" cells with two functional EFG1 alleles. Notably, clinical isolates are often EFG1 hemizygous and thus licensed to undergo this transition. Phenotypic change corresponds to high-frequency loss of the functional EFG1 allele via de novo mutation or gene conversion events. This phenomenon also occurs during passaging in the gastrointestinal tract with the resulting cell type being hypercompetitive for commensal and systemic infections. A "two-hit" genetic model therefore underlies a key phenotypic transition in C. albicans that enables adaptation to host niches.

Also flagged:cancerbacterial infectionadenocarcinoma of the stomachtumorsaltgastric cancer
Journal Article 2019-02-26 ✓ 1 Snippet Rahman MM, Sarker MAK, Hossain MM, Alam MS, Islam MM, Shirin L, Sultana R, Sultana GNN.
In-Text Gene Mentions

…genes, specifically APC,DCC, and p53 in…

Show Full Abstract

<h4>Background</h4>Gastric cancer is also a leading cancer in Bangladesh like that of the global incidences. It is speculated that environmental, bacterial infection and molecular factors might have been carrying the key role of rising trend of the disease. This study was aimed to investigate the association of mutated <i>p53</i> gene with of <i>Helicobacter pylori</i> (<i>H. pylori</i>) infection, clinicopathological and some environmental factors of the gastric cancer patients.<h4>Methods</h4>This cross-sectional study was carried out from January 2015 to December 2016 in a specialized cancer hospital of Bangladesh. Patients were selected randomly who were admitted for surgical intervention after diagnosis as adenocarcinoma of the stomach and physically fit for surgery. After admission proper evaluation of the patients was done. Tissue sample from the gastrectomy specimen along with the blood sample was sent to the related laboratories. After DNA extraction for <i>p53</i>, exons 5 and 6, they were adjusted for proper primer designing. Appropriate sequencing analysis of the result was done. Status of <i>p53</i> was investigated to see their association with the result of the <i>H. pylori</i>, age and sex, tumor status, smoking and extra salt intake of the patients. Result of the study was calculated and analyzed by Chi-square and binomial logistic regression to find the association amongst them.<h4>Results</h4>Among the 71 patients, mean age was 52.96 years old, male: female ratio were 48:23, age group above 41 years were 53 (74.6%), proliferative and ulceroproliferative group of the tumor dominated (87.3%). There were 52 cases with (73.2%) <i>p53</i> mutation. Among the 51 <i>H. pylori</i> positive cases, 41 (80%) had <i>p53</i> mutation (P = 0.033). Tumor size and lymph node status were found to be associated with the gene mutation (P = 0.05). Age also had strong correlation with the mutation (P = 0.015). Gene mutation was found mostly among the younger (≤ 40 years) group of patients (94.4%). Patient with extra salt intake was also found related with the mutation (P = 0.03).<h4>Conclusions</h4>Environmental and genetic factors seem to be risk factors for gastric cancer in Bangladesh. Nationwide anti <i>H. pylori</i> drive and further molecular research could elicit the other risk factors which might help to reduce the gastric cancer incidences in the country after taking appropriate measures.

Also flagged:toluenedegradationchromosomesintegraseexcisionasesecretion
Journal Article 2019-02-26 No Snippets Zeng L, Zhan Z, Hu L, Jiang X, Zhang Y, Feng J, Gao B, Zhao Y, Yang W, Yang H, Yin Z, Zhou D.
Show Full Abstract

This study presents three novel integrons In1394, In1395, and In1443, three novel unit transposons Tn<i>6392</i>, Tn<i>6393</i>, and Tn<i>6403</i>, one novel conjugative element (ICE) Tn<i>6413</i>, and the first sequenced IncP-7 resistance plasmid p1160-VIM from clinical <i>Pseudomonas aeruginosa</i>. Detailed sequence comparison of p1160-VIM (carrying Tn<i>6392</i> and Tn<i>6393</i>) and Tn<i>6413</i> (carrying Tn<i>6403</i>) with related elements were performed. Tn<i>6392</i>, Tn<i>6393</i>, and Tn<i>6403</i> were generated from integration of In1394 (carrying <i>bla</i> <sub>VIM-24</sub>), In1395 and In1443 (carrying <i>bla</i> <sub>VIM-4</sub>) into prototype Tn<i>3</i>-family unit transposons Tn<i>5563</i>, Tn<i>1403</i>, and Tn<i>6346</i>, respectively. To the best of our knowledge, this is the first report of a <i>bla</i> <sub>VIM-24</sub>-carrying <i>P. aeruginosa</i> isolate.

Also flagged:Systemic Lupus ErythematosusSLEcomplexsystemic autoimmunitymetabolismMelanoma
Journal Article 2019-02-26 ✓ 2 Snippets Martínez-Bueno M, Alarcón-Riquelme ME.
In-Text Gene Mentions

The same rationale could be applied to the other SLE associated genes by common variation also detected as targets by rare variation with SKAT but not by burden test in our study (Supplemental Tables 1, 4): GTF2IRD1 (39, 42), DAB2 (41), NOTCH4 (37), CLEC16A (32, 42, 44), TNFSF4 (32, 40–46), and C2 (36).

…, 44 ),TNFSF4( 32 ,…

Show Full Abstract

The importance of low frequency and rare variation in complex disease genetics is difficult to estimate in patient populations. Genome-wide association studies are therefore, underpowered to detect rare variation. We have used a combined approach of genome-wide-based imputation with a highly stringent sequence kernel association (SKAT) test and a case-control burden test. We identified 98 candidate genes containing rare variation that in aggregate show association with SLE many of which have recognized immunological function, but also function and expression related to relevant tissues such as the joints, skin, blood or central nervous system. In addition we also find that there is a significant enrichment of genes annotated for disease-causing mutations in the OMIM database, suggesting that in complex diseases such as SLE, such mutations may be involved in subtle or combined phenotypes or could accelerate specific organ abnormalities found in the disease. We here provide an important resource of candidate genes for SLE.

Also flagged:ReelinVLDL Receptorbindingapolipoprotein E receptor 2very low density lipoprotein receptorVLDLR
Journal Article 2019-02-26 ✓ 2 Snippets Dlugosz P, Tresky R, Nimpf J.
In-Text Gene Mentions

…in colorectal cancer (DCC) binds netrin1 and…

…Knock-down ofDCCimpairs multipolar-to-bipolar …

Show Full Abstract

The canonical Reelin signaling cascade regulates correct neuronal layering during embryonic brain development. Details of this pathway are still not fully understood since the participating components are highly variable and create a complex mixture of interacting molecules. Reelin is proteolytically processed resulting in five different fragments some of which carrying the binding site for two different but highly homologous receptors, apolipoprotein E receptor 2 (ApoER2) and very low density lipoprotein receptor (VLDLR). The receptors are expressed in different variants in different areas of the developing brain. Binding of Reelin and its central fragment to the receptors results in phosphorylation of the intracellular adapter disabled-1 (Dab1) in neurons. Here, we studied the changes of the arrangement of the receptors upon Reelin binding and its central fragment at the molecular level in human embryonic kidney 293 (HEK293) cells by time-resolved anisotropy and fluorescence lifetime imaging microscopy (FLIM). In the off-state of the pathway ApoER2 and VLDLR form homo or hetero-di/oligomers. Upon binding of full length Reelin ApoER2 and VLDLR homo-oligomers are rearranged to higher order receptor clusters which leads to Dab1 phosphorylation. When the central fragment of Reelin binds to the receptors the cluster size of homo-oligomers is not affected and Dab1 is not phosphorylated. Hetero-oligomerization, however, can be induced, but does not lead to Dab1 phosphorylation. Cells expressing only ApoER2 or VLDLR change their shape when stimulated with the central fragment. Cells expressing ApoER2 produce filopodia/lamellipodia and cell size increases, whereas VLDLR-expressing cells decrease in size. These findings demonstrate that the primary event in the canonical Reelin pathway is the rearrangement of preformed receptor homo-oligomers to higher order clusters. In addition the possibility of yet another signaling mechanism which is mediated by the central Reelin fragment independent of Dab1 phosphorylation became apparent.

Also flagged:IronFerritinMHC Class Ihost cellsimmune responsesferritin heavy chain
Journal Article 2019-02-26 ✓ 5 Snippets Sottile R, Federico G, Garofalo C, Tallerico R, Faniello MC, Quaresima B, Cristiani CM, Di Sanzo M, Cuda G, Ventura V, Wagner AK, Contrò G, Perrotti N, Gulletta E, Ferrone S, Kärre K, Costanzo FS, Carlomagno F, Carbone E.
In-Text Gene Mentions

…tissue damage, isHfe( 21 ,…

Hfeencodes a non-classical,…

…In the liver,Hfeprotein promotes signal…

…TheHfegene is in…

…knockout” mice forHfeand the β2m…

Show Full Abstract

The ability of pathogens to sequester iron from their host cells and proteins affects their virulence. Moreover, iron is required for various innate host defense mechanisms as well as for acquired immune responses. Therefore, intracellular iron concentration may influence the interplay between pathogens and immune system. Here, we investigated whether changes in iron concentrations and intracellular ferritin heavy chain (FTH) abundance may modulate the expression of Major Histocompatibility Complex molecules (MHC), and susceptibility to Natural Killer (NK) cell cytotoxicity. FTH downregulation, either by shRNA transfection or iron chelation, led to MHC surface reduction in primary cancer cells and macrophages. On the contrary, mouse embryonic fibroblasts (MEFs) from NCOA4 null mice accumulated FTH for ferritinophagy impairment and displayed MHC class I cell surface overexpression. Low iron concentration, but not FTH, interfered with IFN-γ receptor signaling, preventing the increase of MHC-class I molecules on the membrane by obstructing STAT1 phosphorylation and nuclear translocation. Finally, iron depletion and FTH downregulation increased the target susceptibility of both primary cancer cells and macrophages to NK cell recognition. In conclusion, the reduction of iron and FTH may influence the expression of MHC class I molecules leading to NK cells activation.

Also flagged:chromatin-associated proteinscell proliferationdegradationchromosometumorschromatin
Journal Article 2019-02-26 ✓ 1 Snippet Sarthy JF, Henikoff S, Ahmad K.
In-Text Gene Mentions

…remodeler or DAXXhistone chaperone complexchaperone complex that…

Show Full Abstract

Cancer accounts for ∼9 million deaths per year worldwide, predominantly affecting adults. Adult malignancies are usually examined after extensive clonal evolution and carry many mutations, obscuring the individual contributions of these alterations to oncogenesis. By contrast, pediatric cancers often contain few mutations, many of which cause defects in chromatin-associated proteins. We explore here the roles that chromatin plays in oncogenesis. We highlight how the developmental regulation of cell proliferation genes and the degradation of chromosome ends are two major bottlenecks in the evolution of malignant cells, and point to a third bottleneck where epigenomic dysfunction triggers expression of tumor-suppressor genes, limiting the development of aggressive and metastatic features in tumors. We also identify opportunities for chromatin-based therapies.

Also flagged:ps21241100110421041RP24
Journal Article 2019-02-26 No Snippets Ng B, Cash-Mason T, Wang Y, Seitzer J, Burchard J, Brown D, Dudkin V, Davide J, Jadhav V, Sepp-Lorenzino L, Cejas PJ.
Show Full Abstract

Clinical application of siRNA-based therapeutics outside of the liver has been hindered by the inefficient delivery of siRNA effector molecules into extra-hepatic organs and cells of interest. To understand the parameters that enable RNAi activity in vivo, it is necessary to develop a systematic approach to identify which cells within a tissue are permissive to oligonucleotide internalization and activity. In the present study, we evaluate the distribution and activity within the lung of chemically stabilized siRNA to characterize cell-type tropism and structure-activity relationship. We demonstrate intratracheal delivery of fully modified siRNA for RNAi-mediated target knockdown in lung CD11c<sup>+</sup> cells (dendritic cells, alveolar macrophages) and alveolar epithelial cells. Finally, we use an allergen-induced model of lung inflammation to demonstrate the capacity of inhaled siRNA to induce target knockdown in dendritic cells and ameliorate lung pathology.

Also flagged:SOX transcription factorsSOXtranscription factorsSOX11SOX4SOX8
Journal Article 2019-02-26 ✓ 2 Snippets Lefebvre V.
In-Text Gene Mentions

…with SOX5 andSOX6(SOXD group) and…

SOX6

Show Full Abstract

SOX transcription factors participate in the specification, differentiation and activities of many cell types in development and beyond. The 20 mammalian family members are distributed into eight groups based on sequence identity, and while co-expressed same-group proteins often have redundant functions, different-group proteins typically have distinct functions. More than a handful of SOX proteins have pivotal roles in skeletogenesis. Heterozygous mutations in their genes cause human diseases, in which skeletal dysmorphism is a major feature, such as campomelic dysplasia (SOX9), or a minor feature, such as LAMSHF syndrome (SOX5) and Coffin-Siris-like syndromes (SOX4 and SOX11). Loss- and gain-of-function experiments in animal models have revealed that SOX4 and SOX11 (SOXC group) promote skeletal progenitor survival and control skeleton patterning and growth; SOX8 (SOXE group) delays the differentiation of osteoblast progenitors; SOX9 (SOXE group) is essential for chondrocyte fate maintenance and differentiation, and works in cooperation with SOX5 and SOX6 (SOXD group) and other types of transcription factors. These and other SOX proteins have also been proposed, mainly through in vitro experiments, to have key roles in other aspects of skeletogenesis, such as SOX2 in osteoblast stem cell self-renewal. We here review current knowledge of well-established and proposed skeletogenic roles of SOX proteins, their transcriptional and non-transcriptional actions, and their modes of regulation at the gene, RNA and protein levels. We also discuss gaps in knowledge and directions for future research to further decipher mechanisms underlying skeletogenesis in health and diseases and identify treatment options for skeletal malformation and degeneration diseases.

Also flagged:postmenopausal osteoporosismineralacidtretinoincolecalciferoltriphosadenine
Journal Article 2019-02-26 No Snippets Zhang C, Wang Y, Zhang CL, Wu HR.
Show Full Abstract

Risk metabolites of postmenopausal osteoporosis (PO) were explored to offer a theoretical basis for future therapy. The data E-GEOD-7429 were downloaded from ArrayExpress database. In total 20 samples deprived from postmenopausal women having low or high bone mineral density (BMD) were covered in this expression profile. After screening of differentially expressed genes (DEGs), gene-gene network was constructed taking the intersection between the DEGs and genes in the seed protein-protein interaction network. Then, the other five networks were established, including metabolite, phenotype, gene-metabolite, phenotype-gene, and phenotype-metabolite networks. Next, these 6 networks were integrated into one weighted multi-omics network to further identify the candidate metabolites using random walk with restart based on the PO-related seed genes, seed metabolites and phenotype. Using the score among nodes of the weighted composite network, the top 50 metabolites, and the top 100 co-expressed genes interacting with the top 50 metabolites were detected. A set of 601 DEGs between low BMD and high BMD samples were selected. Significantly, the top 5 metabolites were respectively glucosylgalactosyl hydroxylysine, all-trans-5,6-epoxyretinoic acid, tretinoin, colecalciferol, and rocaltrol. Moreover, 3 metabolites (estraderm, triphosadenine, and tretinoin) had a degree >50 in the co-expression network. Tretinoin was the member of the top 5 metabolites, and estraderm was a metabolite with the seventh interaction score. A series of metabolites, tretinoin and estraderm might be closely associated with the onset and progression of PO.

Thin Patient, Fatty Liver.

Also flagged:albumintransaminasesaldolaseaspiration pneumonitismyositissteatohepatitis
Journal Article 2019-02-26 ✓ 1 Snippet Mukthinuthalapati VVPK, Attar BM, Abu Omar Y, Nath V, Czapar C, Gandhi SR.
In-Text Gene Mentions

…-mitochondrial antibody assay,HFEgene mutation analysis,…

Show Full Abstract

A 49-year-old lady with no past medical history presented with dysphagia and 40-pound weight loss, which occurred over eight months. On physical examination, she had proximal muscle weakness and crackles in basilar regions of the lungs. Labs were significant for low albumin, elevated transaminases, and high aldolase. Imaging suggested aspiration pneumonitis in both lungs and hepatic steatosis. A swallow evaluation revealed oropharyngeal dysphagia and muscle biopsy confirmed a rare form of myositis. A liver biopsy showed steatohepatitis and a diagnosis of starvation-induced steatohepatitis was made. The patient succumbed to hypoxic respiratory failure from aspiration pneumonitis before the treatment for myositis could be initiated. We report the first case of starvation-induced steatohepatitis in a patient with dysphagia from myositis affecting the oropharyngeal musculature.

Also flagged:Synthesisbindingantibodymetronidazolezidovudinelamivudine
Journal Article 2019-02-26 No Snippets Wubulikasimu M, Muhammad T, Imerhasan M, Hudaberdi N, Yang W, Zhao J, Peng X.
Show Full Abstract

Fluorescent immunosorbent assay (FIA) is very promising for sensitive and selective analysis in bio-medical applications. Here, we proposed an assay, using fluorescent engineering of analytes and the corresponding molecularly imprinted polymers (MIPs) as a plastic antibody. Three drug molecules (metronidazole, zidovudine and lamivudine) were condensed with 9-aminoacridine, using succinic anhydride as a spacer. The target products were characterized with <sup>1</sup>H-NMR, IR and mass spectrometry. UV-vis absorption and fluorescent properties of the fluorophore-labeled drug molecules were investigated. Feasibility of the fluorescent biomimetic immunosorbent assay based on MIPs was demonstrated in the solution. This work will provide sound foundation for the future application in real sample.

Also flagged:ThrombosisPortal vein thrombosisliver cirrhosishereditary thrombophiliaacuteantithrombin deficiency
Journal Article 2019-02-25 ✓ 1 Snippet Setaka T, Hirano K, Moriya K, Kaneko T, Morita S, Shinkai T, Morishita E, Ichida T.
In-Text Gene Mentions

…analysis of theSERPINC1gene, which encodes…

Show Full Abstract

Portal vein thrombosis (PVT) has been reported in many patients with and without liver cirrhosis. The portal vein is a rare site of thrombosis, and various conditions can predispose an individual to PVT. Among those conditions, hereditary thrombophilia has been increasingly reported recently. We herein report the case of a non-cirrhotic 30-year-old man who developed acute PVT with hereditary antithrombin deficiency. Antithrombin (AT) replacement therapy was required along with heparin. Given our experience with this case, we believe that a screening test for prothrombotic disorders, such as AT deficiency, should be considered in cases of PVT.

Also flagged:-LeucylaminopeptidasesmitochondrialspermatogenesisorganizationSperm-LeucylaminopeptidaseS-Lap
Journal Article 2019-02-25 ✓ 5 Snippets Laurinyecz B, Vedelek V, Kovács AL, Szilasi K, Lipinszki Z, Slezák C, Darula Z, Juhász G, Sinka R.
In-Text Gene Mentions

…The S-Lap1Δ7 allele contains…

…The S-Lap1Δ7 , S-Lap2…

…(1332 bp before S-Lap1and 2141 bp…

…version of the S-Lap1rescue construct, an…

…agenesis, the whole pJET1.2-S-Lap1genomic rescue construct…

Show Full Abstract

Drosophila melanogaster sperm reach an extraordinary long size, 1.8 mm, by the end of spermatogenesis. The mitochondrial derivatives run along the entire flagellum and provide structural rigidity for flagellar movement, but its precise function and organization is incompletely understood. The two mitochondrial derivatives differentiate and by the end of spermatogenesis the minor one reduces its size and the major one accumulates paracrystalline material inside it. The molecular constituents and precise function of the paracrystalline material have not yet been revealed. Here we purified the paracrystalline material from mature sperm and identified by mass spectrometry Sperm-Leucylaminopeptidase (S-Lap) family members as important constituents of it. To study the function of S-Lap proteins we show the characterization of classical mutants and RNAi lines affecting of the S-Lap genes and the analysis of their mutant phenotypes. We show that the male sterile phenotype of the S-Lap mutants is caused by defects in paracrystalline material accumulation and abnormal structure of the elongated major mitochondrial derivatives. Our work shows that S-Lap proteins localize and accumulate in the paracrystalline material of the major mitochondrial derivative. Therefore, we propose that S-Lap proteins are important constituents of the paracrystalline material of Drosophila melanogaster sperm.

Also flagged:type 2 diabetes mellitusdiabetes mellitusdeathhepatitis C virus infectionhepatitis C infectioninfection
Journal Article 2019-02-25 ✓ 1 Snippet Ambachew S, Eshetie S, Geremew D, Endalamaw A, Melku M.
In-Text Gene Mentions

…DM, such ashemochromatosis, will be excluded.…

Show Full Abstract

<h4>Introduction</h4>The ever-increasing global hepatitis C infection is fueling the burden of diabetes mellitus, which exaggerates various complications and may be a cause of death for millions. Several studies have reported that hepatitis C virus infection is an important risk factor for the development of diabetes mellitus. However, the results of fragmented studies reported variable and inconsistent findings on the prevalence of type 2 diabetes mellitus among hepatitis C virus-infected patients. Therefore, this protocol for meta-analysis will determine the overall pooled prevalence of type 2 diabetes mellitus in patients infected with hepatitis C virus.<h4>Methods and analysis</h4>This systematic review and meta-analysis will include original articles of cohort and cross-sectional studies published in English. A systematic search will be performed in PubMed, Science Direct, Scopus, and Google Scholar. A fixed/random-effects meta-analysis model will be used to estimate the global pooled prevalence of type 2 diabetes mellitus among hepatitis C virus-infected patients. Sensitivity analysis will be conducted to check the stability of the summary estimate. Heterogeneity will be assessed using the I<sup>2</sup> statistic. Subgroup analysis will also be conducted based on geographical region. Funnel plots and Egger's test and Begg's test will be used to assess for publication bias.<h4>Ethics and dissemination</h4>The review is based on published data; therefore, ethical approval is not required. The systematic review and meta-analysis will summarize the existing data on the prevalence of type 2 diabetes mellitus among hepatitis C virus-infected patients at the global level. This provides the empirical evidence necessary for researchers, policymakers, and public health stakeholders to derive health-promoting policies, allocate resources, and set priorities for monitoring future trends. The final result will be presented at annual scientific meetings, conferences, and seminars. Moreover, it will also be published in a peer-reviewed reputable journal. We also plan to review every 5 years to provide updated information.<h4>Systematic review registration</h4>PROSPERO CRD42018083409.

Also flagged:BRN2melanomaPOU domain transcription factorcancerstranscription cofactorsDNA damage response proteins
Journal Article 2019-02-25 ✓ 1 Snippet Herbert K, Binet R, Lambert JP, Louphrasitthiphol P, Kalkavan H, Sesma-Sanz L, Robles-Espinoza CD, Sarkar S, Suer E, Andrews S, Chauhan J, Roberts ND, Middleton MR, Gingras AC, Masson JY, Larue L, Falletta P, Goding CR.
In-Text Gene Mentions

…values for genesPOU3F2(BRN2, ENSG00000184486), POU4F…

Show Full Abstract

Whether cell types exposed to a high level of environmental insults possess cell type-specific prosurvival mechanisms or enhanced DNA damage repair capacity is not well understood. BRN2 is a tissue-restricted POU domain transcription factor implicated in neural development and several cancers. In melanoma, BRN2 plays a key role in promoting invasion and regulating proliferation. Here we found, surprisingly, that rather than interacting with transcription cofactors, BRN2 is instead associated with DNA damage response proteins and directly binds PARP1 and Ku70/Ku80. Rapid PARP1-dependent BRN2 association with sites of DNA damage facilitates recruitment of Ku80 and reprograms DNA damage repair by promoting Ku-dependent nonhomologous end-joining (NHEJ) at the expense of homologous recombination. BRN2 also suppresses an apoptosis-associated gene expression program to protect against UVB-, chemotherapy- and vemurafenib-induced apoptosis. Remarkably, BRN2 expression also correlates with a high single-nucleotide variation prevalence in human melanomas. By promoting error-prone DNA damage repair via NHEJ and suppressing apoptosis of damaged cells, our results suggest that BRN2 contributes to the generation of melanomas with a high mutation burden. Our findings highlight a novel role for a key transcription factor in reprogramming DNA damage repair and suggest that BRN2 may impact the response to DNA-damaging agents in BRN2-expressing cancers.

Also flagged:anaphasetankyrase 1P-40Etoposidechromosomesphosphorylation
Journal Article 2019-02-25 ✓ 1 Snippet Daniloski Z, Bisht KK, McStay B, Smith S.
In-Text Gene Mentions

Condensinaction is a…

Show Full Abstract

Formation of individualized sister chromatids is essential for their accurate segregation. In budding yeast, while most of the genome segregates at the metaphase to anaphase transition, resolution of the ribosomal DNA (rDNA) repeats is delayed. The timing and mechanism in human cells is unknown. Here we show that resolution of human rDNA occurs in anaphase after the bulk of the genome, dependent on tankyrase 1, condensin II, and topoisomerase IIα. Defective resolution leads to rDNA bridges, rDNA damage, and aneuploidy of an rDNA-containing acrocentric chromosome. Thus, temporal regulation of rDNA segregation is conserved between yeast and man and is essential for genome integrity.

Also flagged:glyceraldehyde-3-phosphate dehydrogenaseGAPDHDenguemosquito-borne diseasepolyproteinnon-structural 3
Journal Article 2019-02-25 ✓ 1 Snippet Silva EM, Conde JN, Allonso D, Ventura GT, Coelho DR, Carneiro PH, Silva ML, Paes MV, Rabelo K, Weissmuller G, Bisch PM, Mohana-Borges R.
In-Text Gene Mentions

…the serpin superfamily,SERPINC1and SERPINA3.…

Show Full Abstract

Dengue is an important mosquito-borne disease and a global public health problem. The disease is caused by dengue virus (DENV), which is a member of the Flaviviridae family and contains a positive single-stranded RNA genome that encodes a single precursor polyprotein that is further cleaved into structural and non-structural proteins. Among these proteins, the non-structural 3 (NS3) protein is very important because it forms a non-covalent complex with the NS2B cofactor, thereby forming the functional viral protease. NS3 also contains a C-terminal ATPase/helicase domain that is essential for RNA replication. Here, we identified 47 NS3-interacting partners using the yeast two-hybrid system. Among those partners, we highlight several proteins involved in host energy metabolism, such as apolipoprotein H, aldolase B, cytochrome C oxidase and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). GAPDH directly binds full-length NS3 and its isolated helicase and protease domains. Moreover, we observed an intense colocalization between the GAPDH and NS3 proteins in DENV2-infected Huh7.5.1 cells, in NS3-transfected BHK-21 cells and in hepatic tissue from a fatal dengue case. Taken together, these results suggest that the human GAPDH-DENV NS3 interaction is involved in hepatic metabolic alterations, which may contribute to the appearance of steatosis in dengue-infected patients. The interaction between GAPDH and full-length NS3 or its helicase domain in vitro as well as in NS3-transfected cells resulted in decreased GAPDH glycolytic activity. Reduced GAPDH glycolytic activity may lead to the accumulation of metabolic intermediates, shifting metabolism to alternative, non-glycolytic pathways. This report is the first to identify the interaction of the DENV2 NS3 protein with the GAPDH protein and to demonstrate that this interaction may play an important role in the molecular mechanism that triggers hepatic alterations.

Also flagged:HeparinHpheparansulfateglycosaminoglycanspolysaccharides
Journal Article 2019-02-25 ✓ 5 Snippets Taylor SL, Hogwood J, Guo W, Yates EA, Turnbull JE.
In-Text Gene Mentions

…activity of antithrombin (ATIII) for subsequent inhibition…

…between Hp andATIIIinvolves a pentasaccharide…

…the affinity ofATIIIfor Factor Xa…

…dual interaction betweenATIIIand Factor IIa…

…interact mainly withATIIIand culminated in…

Show Full Abstract

Global production of pharmaceutical heparin (Hp) is increasing, and the production process from raw mucosal material results in large amounts of waste by-products. These contain lower sulfated Hp-like and heparan sulfate (HS), as well as other glycosaminoglycans, which are bioactive entities with pharmaceutical potential. Here we describe the first purification, structural and functional characterisation of Hp-like and HS polysaccharides from the four major by-product fractions of standard heparin production. Analysis of the by-products by disaccharide composition analysis and NMR demonstrated a range of structural characteristics which differentiate them from Hp (particularly reduced sulfation and sulfated disaccharide content), and that they are each distinct. Functional properties of the purified by-products varied, each displaying distinct anticoagulant profiles in different assays, and all exhibiting significantly lower global and specific inhibition of the coagulation pathway than Hp. The by-products retained the ability to promote cell proliferation via fibroblast growth factor receptor signalling, with only minor differences between them. These collective analyses indicate that they represent an untapped and economical source of structurally-diverse Hp-like and HS polysaccharides with the potential for enhancing future structure-activity studies and uncovering new biomedical applications of these important natural products.

Also flagged:RAD51CCNA2TFDP1Cell Cycle ArrestBIRC5MCM2
Journal Article 2019-02-25 No Snippets Wang Y, Lim R, Nie G.
Show Full Abstract

Preeclampsia (PE) is a life-threatening complication of human pregnancy with no effective treatment other than premature delivery. It is hallmarked by systemic endothelial injury/dysfunction which is believed to be caused by abnormal levels/types of placenta-derived factors that are circulating in the maternal blood. Emerging evidence suggests that endothelial repair is also dysregulated in PE, as circulating endothelial progenitor cells (EPCs) critical for endothelial regeneration are reduced in number and functionality. However, the underlying mechanisms are poorly understood. HtrA4 is a placenta-specific protease that is secreted into the circulation and significantly elevated in early-onset PE. Here we investigated the impact of HtrA4 on endothelial proliferation and repair. We demonstrated that high levels of HtrA4 halted endothelial cell proliferation and significantly down-regulated a number of genes that are critical for cell cycle progression, including CDKN3, BIRC5, CDK1 and MKI67. Furthermore, HtrA4 significantly inhibited the proliferation of primary EPCs isolated from term human umbilical cord blood and impeded their differentiation into mature endothelial cells. Our data thus suggests that elevated levels of HtrA4 in the early-onset PE circulation may impair endothelial cell repair, not only by halting endothelial cell proliferation, but also by inhibiting the proliferation and differentiation of circulating EPCs.

Also flagged:BRCA1BARD1histonescore histonehistone H4inclusion bodies
Journal Article 2019-02-25 No Snippets Nakamura K, Saredi G, Becker JR, Foster BM, Nguyen NV, Beyer TE, Cesa LC, Faull PA, Lukauskas S, Frimurer T, Chapman JR, Bartke T, Groth A.
Show Full Abstract

Genotoxic DNA double-strand breaks (DSBs) can be repaired by error-free homologous recombination (HR) or mutagenic non-homologous end-joining<sup>1</sup>. HR supresses tumorigenesis<sup>1</sup>, but is restricted to the S and G2 phases of the cell cycle when a sister chromatid is present<sup>2</sup>. Breast cancer type 1 susceptibility protein (BRCA1) promotes HR by antagonizing the anti-resection factor TP53-binding protein 1(53BP1) (refs. <sup>2-5</sup>), but it remains unknown how BRCA1 function is limited to the S and G2 phases. We show that BRCA1 recruitment requires recognition of histone H4 unmethylated at lysine 20 (H4K20me0), linking DSB repair pathway choice directly to sister chromatid availability. We identify the ankyrin repeat domain of BRCA1-associated RING domain protein 1 (BARD1)-the obligate BRCA1 binding partner<sup>3</sup>-as a reader of H4K20me0 present on new histones in post-replicative chromatin<sup>6</sup>. BARD1 ankyrin repeat domain mutations disabling H4K20me0 recognition abrogate accumulation of BRCA1 at DSBs, causing aberrant build-up of 53BP1, and allowing anti-resection activity to prevail in S and G2. Consequently, BARD1 recognition of H4K20me0 is required for HR and resistance to poly (ADP-ribose) polymerase inhibitors. Collectively, this reveals that BRCA1-BARD1 monitors the replicative state of the genome to oppose 53BP1 function, routing only DSBs within sister chromatids to HR.

Also flagged:Autism spectrum disorderschizophreniamajor depressioncorticogenesischildhood autismatypical autism
Journal Article 2019-02-25 No Snippets Grove J, Ripke S, Als TD, Mattheisen M, Walters RK, Won H, Pallesen J, Agerbo E, Andreassen OA, Anney R, Awashti S, Belliveau R, Bettella F, Buxbaum JD, Bybjerg-Grauholm J, Bækvad-Hansen M, Cerrato F, Chambert K, Christensen JH, Churchhouse C, Dellenvall K, Demontis D, De Rubeis S, Devlin B, Djurovic S, Dumont AL, Goldstein JI, Hansen CS, Hauberg ME, Hollegaard MV, Hope S, Howrigan DP, Huang H, Hultman CM, Klei L, Maller J, Martin J, Martin AR, Moran JL, Nyegaard M, Nyegaard M, Nærland T, Palmer DS, Palotie A, Pedersen CB, Pedersen MG, dPoterba T, Poulsen JB, Pourcain BS, Qvist P, Rehnström K, Reichenberg A, Reichert J, Robinson EB, Roeder K, Roussos P, Saemundsen E, Sandin S, Satterstrom FK, Davey Smith G, Stefansson H, Steinberg S, Stevens CR, Sullivan PF, Turley P, Walters GB, Xu X, Autism Spectrum Disorder Working Group of the Psychiatric Genomics Consortium, BUPGEN, Major Depressive Disorder Working Group of the Psychiatric Genomics Consortium, 23andMe Research Team, Stefansson K, Geschwind DH, Nordentoft M, Hougaard DM, Werge T, Mors O, Mortensen PB, Neale BM, Daly MJ, Børglum AD.
Show Full Abstract

Autism spectrum disorder (ASD) is a highly heritable and heterogeneous group of neurodevelopmental phenotypes diagnosed in more than 1% of children. Common genetic variants contribute substantially to ASD susceptibility, but to date no individual variants have been robustly associated with ASD. With a marked sample-size increase from a unique Danish population resource, we report a genome-wide association meta-analysis of 18,381 individuals with ASD and 27,969 controls that identified five genome-wide-significant loci. Leveraging GWAS results from three phenotypes with significantly overlapping genetic architectures (schizophrenia, major depression, and educational attainment), we identified seven additional loci shared with other traits at equally strict significance levels. Dissecting the polygenic architecture, we found both quantitative and qualitative polygenic heterogeneity across ASD subtypes. These results highlight biological insights, particularly relating to neuronal function and corticogenesis, and establish that GWAS performed at scale will be much more productive in the near term in ASD.

Also flagged:Circularsignal transductionagingdiabetescardiovascular diseasescancer
Journal Article 2019-02-25 ✓ 1 Snippet Braicu C, Zimta AA, Gulei D, Olariu A, Berindan-Neagoe I.
In-Text Gene Mentions

DCC

Show Full Abstract

Circular RNAs (circRNAs) are members of the non-coding transcriptome; however, some of them are translated into proteins. These transcripts have important roles in both physiological and pathological mechanisms due to their ability to directly influence cellular signaling pathways. Specifically, circRNAs are regulators of transcription, translation, protein interaction, and signal transduction. An increased knowledge within their area is observed over the last few years, concomitant with the development of next-generation sequencing techniques. circRNAs are mostly tissue and disease specific with the ability of specifically changing the biological behavior of cells. The altered expression profile is currently investigated as novel minimally invasive diagnosis/prognosis tool and also therapeutic target in human disease. The diagnosis approach is based on their level modification within pathological states, especially cancer, where circRNAs' therapies are intensively explored in anti-aging strategies, diabetes, cardiovascular diseases, and malignant pathologies, and are relying on the restoration of homeostatic profiles.

Also flagged:Estrogen receptor betaenzalutamideandrogen receptorARAnnexin Vandrogens
Journal Article 2019-02-25 No Snippets Anestis A, Sarantis P, Theocharis S, Zoi I, Tryfonopoulos D, Korogiannos A, Koumarianou A, Xingi E, Thomaidou D, Kontos M, Papavassiliou AG, Karamouzis MV.
Show Full Abstract

<h4>Purpose</h4>Androgen receptor (AR) is playing an important role in the progression of a subset of TNBC. We evaluated the impact of ERβ expression along with anti-AR drugs in AR-positive TNBC.<h4>Methods</h4>ERβ expression was examined in AR-positive TNBC cell line using MTT assay, scratch and Annexin V-FITC assay in the presence or absence of anti-androgens. Protein levels of involved molecules were assessed using Western blot. Receptors' localization was detected by immunofluorescence and their physical association was examined using proximity ligation assay (PLA), which enables the visualization of interacting proteins in fixed cells and tissues.<h4>Results</h4>Transient transfection of ERβ in MDA-MB 453 AR-positive TNBC cell line significantly inhibited cell proliferation, metastatic potential and induced apoptosis. ERβ expression reversed the aggravating role of AR in both indirect and direct ways. Indirectly, ERβ decreased AR activation through the inhibition of PI3K/AKT signaling pathway. Directly, ERβ formed heterodimers with AR in MDA-MB 453 cells and in human tissue samples impeding AR from forming homodimers. Enzalutamide is a more potent anti-androgen in AR + TNBC compared to bicalutamide. ERβ expression increased the sensitivity of MDA-MB 453 cells to anti-androgens and especially to enzalutamide. The administration of enzalutamide enhanced AR:ERβ heterodimers formation increasing the anti-tumor capacity of ERβ.<h4>Conclusions</h4>Collectively, our results provide evidence for a novel mechanism by which ERβ exerts oncosuppressive effect in AR-positive TBNC through direct and indirect interactions with AR. Moreover, ERβ expression may identify a new subset of TNBC that would respond more favorable to anti-androgens.

Also flagged:osteosarcomaGene Expressionsmall nucleolar RNA host gene 1SNHG1ATF2MAPK
Journal Article 2019-02-25 No Snippets Zhang S, Ding L, Li X, Fan H.
Show Full Abstract

The aim of the present study was to identify the important mRNAs, micro (mi)RNAs and long non‑coding (lnc)RNAs that are associated with osteosarcoma recurrence. The GSE3905 dataset, which contains two sub‑datasets (GSE39040 and GSE39055), was downloaded from the Gene Expression Omnibus (GEO). Prognosis‑associated RNAs were identified by performing Cox regression univariate analysis and were subsequently used to construct a competing endogenous (ce)RNA regulatory network for Gene Set Enrichment Analysis (GSEA). Kaplan‑Meier survival analysis was used to determine the associations between expression levels and survival prognosis. In addition, another independent miRNA profile, GSE79181, was downloaded from GEO for validation. Among the differentially expressed RNAs, 417 RNAs (5 lncRNAs, 19 miRNAs, and 393 mRNAs) were observed to be associated with prognosis. The GSEA for the ceRNA regulatory network revealed that 'Mitogen‑activated protein kinase (MAPK) signaling pathway', 'Chemokine signaling pathway' and 'Spliceosome' were markedly associated with osteosarcoma. In addition, three lncRNAs [long intergenic non‑protein coding RNA 28 (LINC00028), LINC00323, and small nucleolar RNA host gene 1 (SNHG1)] and two miRNAs (hsa‑miR‑124 and hsa‑miR‑7) regulating three mRNAs [Ras‑related protein Rap‑1b (RAP1B), activating transcription factor 2 (ATF2) and protein phosphatase Mg2+/Mn2+ dependent 1B (PPM1B)] participated in the MAPK signaling pathway. The Kaplan‑Meier survival analysis also demonstrated that samples with lower expression levels of LINC00323 and SNHG1 had better prognosis, and samples with increased expression levels of LINC00028, hsa‑miR‑124 and hsa‑miR‑7 had better prognosis. Overexpression of RAP1B, ATF2 and PPM1B was positively associated with osteosarcoma recurrence. The roles of hsa‑miR‑124 and hsa‑miR‑7 in osteosarcoma recurrence were also validated using GSE79181. Thus, in conclusions, the three lncRNAs (LINC00028, LINC00323 and SNHG1), two miRNAs (hsa‑miR‑124 and hsa‑miR‑7) and three mRNAs (RAP1B, ATF2, and PPM1B) were associated with osteosarcoma recurrence.

Also flagged:cell growthNSCLCTCSFlung cancerluciferaselung adenocarcinoma
Journal Article 2019-02-25 No Snippets Huang WT, He RQ, Li XJ, Ma J, Peng ZG, Zhong JC, Hu XH, Chen G.
Show Full Abstract

Several studies have indicated that microRNAs (miRs) mediate multiple pathways associated with tumorigenesis and progression. Our preliminary study experimentally verified that miR‑146a‑5p has a role in the biological behavior of non‑small cell lung cancer (NSCLC) cells. To perform further investigation of miR‑146a‑5p, the present study evaluated miR‑146a‑5p by targeting its downstream gene tumor collagenase stimulatory factor (TCSF) to influence cell viability, proliferation and apoptosis in NSCLC. Online sequence prediction, a thorough search of the open source database The Cancer Genome Atlas (TCGA), immunohistochemistry (IHC) of TCSF in clinical lung cancer tissues, and a dual‑luciferase assay, as well as assays to test viability, proliferation and apoptosis in vitro, were conducted to explain the targeted regulation association between miR‑146a‑5p and TCSF in NSCLC. The miRanda and TargetScanHuman database revealed that TCSF and miR‑146a‑5p had target binding sites. A luciferase reporter assay demonstrated that miR‑146a‑5p and TCSF did have complementary sequences (P<0.05). From the TCGA database, TCSF was highly expressed in lung adenocarcinoma and lung squamous cell carcinoma tissues when compared with normal lung tissues (P<0.05). Furthermore, the protein level of TCSF in cancerous lung tissues was determined by IHC, and it was concluded that TCSF protein was also upregulated in NSCLC tissues (P<0.001). A significant difference was identified following in vitro experiments for the NSCLC cell line A549, which revealed that miR‑146a‑5p and TCSF regulated cell viability, proliferation and apoptosis. In conclusion, the present study verified the target action association between TCSF and miR‑146a‑5p with high throughput data analysis and experimental results in NSCLC.

Also flagged:BMPTgfbr2chondrogenesisTGFβSmad1Noggin
Journal Article 2019-02-25 ✓ 1 Snippet Ban GI, Williams S, Serra R.
In-Text Gene Mentions

Sox6

Show Full Abstract

Sclerotome is the embryonic progenitor of the axial skeleton. It was previously shown that Tgfbr2 is required in sclerotome for differentiation of fibrous skeletal tissues including the annulus fibrosus of the intervertebral disc. Alternatively, BMP signaling is required to form the vertebral body through chondrogenesis. In addition, TGFβ added to sclerotome cultures induces expression of markers for fibrous tissue differentiation but not cartilage or bone. The mechanism of how TGFβ signaling regulates this lineage decision in sclerotome is not known and could be due to the production of instructive or inhibitory signals or a combination of the two. Here we show that TGFβ antagonizes BMP/ Smad1/5 signaling in primary sclerotome likely through regulation of Noggin, an extracellular BMP antagonist, to prevent chondrogenesis. We then tested whether inhibition of BMP signaling, and inhibition of chondrogenesis, is sufficient to push cells toward the fibrous cell fate. While Noggin inhibited BMP/ Smad1/5 signaling and the formation of chondrogenic nodules in sclerotome cultures; Noggin and inhibition of BMP signaling through Gremlin or DMH2 were insufficient to induce fibrous tissue differentiation. The results suggest inhibition of BMP signaling is not sufficient to stimulate fibrous tissue differentiation and additional signals are likely required. We propose that TGFβ has a dual role in regulating sclerotome fate. First, it inhibits BMP signaling potentially through Noggin to prevent chondrogenesis and, second, it provides an unknown instructive signal to promote fibrous tissue differentiation in sclerotome. The results have implications for the design of stem cell-based therapies for skeletal diseases.

Also flagged:Aneurysmintracranial aneurysmIAIntracranialARHGAP32GBA
Journal Article 2019-02-25 No Snippets Hong EP, Kim BJ, Cho SS, Yang JS, Choi HJ, Kang SH, Jeon JP.
Show Full Abstract

Genome-wide association studies found genetic variations with modulatory effects for intracranial aneurysm (IA) formations in European and Japanese populations. We aimed to identify the susceptibility of single nucleotide polymorphisms (SNPs) to IA in a Korean population consisting of 250 patients, and 294 controls using the Asian-specific Axiom Precision Medicine Research Array. Twenty-nine SNPs reached a genome-wide significance threshold (5 × 10<sup>-8</sup>). The rs371331393 SNP, with a stop-gain function of <i>ARHGAP32</i> (11q24.3), showed the most significant association with the risk of IA (OR = 43.57, 95% CI: 21.84⁻86.95; <i>p</i> = 9.3 × 10<sup>-27</sup>). Eight out of 29 SNPs-<i>GBA</i> (rs75822236), <i>TCF24</i> (rs112859779), <i>OLFML2A</i> (rs79134766), <i>ARHGAP32</i> (rs371331393), <i>CD163L1</i> (rs138525217), <i>CUL4A</i> (rs74115822), <i>LOC102724084</i> (rs75861150), and <i>LRRC3</i> (rs116969723)-demonstrated sufficient statistical power greater than or equal to 0.8. Two previously reported SNPs, rs700651 (<i>BOLL</i>, 2q33.1) and rs6841581 (<i>EDNRA</i>, 4q31.22), were validated in our GWAS (Genome-wide association study). In a subsequent analysis, three SNPs showed a significant difference in expressions: the rs6741819 (<i>RNF144A</i>, 2p25.1) was down-regulated in the adrenal gland tissue (<i>p</i> = 1.5 × 10<sup>-6</sup>), the rs1052270 (<i>TMOD1</i>. 9q22.33) was up-regulated in the testis tissue (<i>p</i> = 8.6 × 10<sup>-10</sup>), and rs6841581 (<i>EDNRA</i>, 4q31.22) was up-regulated in both the esophagus (<i>p</i> = 5.2 × 10<sup>-12</sup>) and skin tissues (1.2 × 10<sup>-6</sup>). Our GWAS showed novel candidate genes with Korean-specific variations in IA formations. Large population based studies are thus warranted.

Also flagged:SynthesisPolyethylene Glycolsystemic infectionspolyurethanespolyurethanewater
Journal Article 2019-02-25 No Snippets Francolini I, Silvestro I, Di Lisio V, Martinelli A, Piozzi A.
Show Full Abstract

Despite advances in material sciences and clinical procedures for surgical hygiene, medical device implantation still exposes patients to the risk of developing local or systemic infections. The development of efficacious antimicrobial/antifouling materials may help with addressing such an issue. In this framework, polyethylene glycol (PEG)-grafted segmented polyurethanes were synthesized, physico-chemically characterized, and evaluated with respect to their bacterial fouling-resistance properties. PEG grafting significantly altered the polymer bulk and surface properties. Specifically, the PEG-grafted polyurethanes possessed a more pronounced <i>hard/soft</i> phase segregated microstructure, which contributed to improving the mechanical resistance of the polymers. The better flexibility of the <i>soft</i> phase in the PEG-functionalized polyurethanes compared to the pristine polyurethane (PU) was presumably also responsible for the higher ability of the polymer to uptake water. Additionally, dynamic contact angle measurements evidenced phenomena of surface reorganization of the PEG-functionalized polyurethanes, presumably involving the exposition of the polar PEG chains towards water. As a consequence, <i>Staphylococcus epidermidis</i> initial adhesion onto the surface of the PEG-functionalized PU was essentially inhibited. That was not true for the pristine PU. Biofilm formation was also strongly reduced.

Also flagged:Inflammatory Responsecancervascular diseasewound healingpentraxin-3dipeptidyl-peptidase 4
Journal Article 2019-02-25 ✓ 1 Snippet Eken SM, Christersdottir T, Winski G, Sangsuwan T, Jin H, Chernogubova E, Pirault J, Sun C, Simon N, Winter H, Backlund A, Haghdoost S, Hansson GK, Halle M, Maegdefessel L.
In-Text Gene Mentions

…the miR-29b targetsB4GALT5, DPP4, and COL1A1…

Show Full Abstract

As a consequence of the success of present-day cancer treatment, radiotherapy-induced vascular disease is emerging. This disease is caused by chronic inflammatory activation and is likely orchestrated in part by microRNAs. In irradiated versus nonirradiated conduit arteries from patients receiving microvascular free tissue transfer reconstructions, irradiation resulted in down-regulation of miR-29b and up-regulation of miR-146b. miR-29b affected inflammation and adverse wound healing through its targets pentraxin-3 and dipeptidyl-peptidase 4. In vitro and in vivo, we showed that miR-29b overexpression therapy, through inhibition of pentraxin-3 and dipeptidyl-peptidase 4, could dampen the vascular inflammatory response.

Also flagged:NitrogenHyperpigmentationmelanindepigmentationpigmentationdiamond
Journal Article 2019-02-25 ✓ 1 Snippet Jokar L, Bayani M, Hamidi H, Keivan M, Azari-Marhabi S.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<b>Introduction:</b> Gingival hyperpigmentation is excessive deposition of melanin pigments in the epithelium of gingiva which affects facial esthetics. Various surgical methods for gingival depigmentation have been used to treat the darkened color of pigmented gingiva. This study compared the use of 940 nm diode laser and liquid nitrogen cryosurgery in the treatment of gingival physiologic hyperpigmentation in terms of gingival depigmentation, postoperative pain, healing duration, pigmentation recurrence, and patients' satisfaction. <b>Methods:</b> Fifteen systemically healthy patients (11 females and 4 males; 17-35 years of age) with bilateral gingival physiologic hyperpigmentation were enrolled in this split-mouth randomized study. Maxillary anterior labial gingiva of each patient was divided into left and right halves, and each half was randomly depigmented by either laser or cryosurgery. Patients were given questionnaires to evaluate the procedures and were followed up in 3, 7, 10, 17 and 21 days postoperatively for the assessment of gingival healing and 1, 3, 6 and 12 months after the treatments to detect any sign of pigmentation recurrence. <b>Results:</b> The severity of post-op pain measured by visual analogue scale (VAS) was mild to average and showed no significant difference between the 2 modalities (<i>P</i>>0.05). There was no considerable swelling or hemorrhage after the treatment procedures and the healing duration was significantly shorter in laser (<i>P</i><0.05). The degree of pigmentation in all gingival sites treated by laser reached and remained at zero until the last follow up (1 year) and reached zero in 9 out of 15 cryosurgerytreated sites. All patients were completely satisfied with the laser, and 9 out of 15 were completely satisfied with cryosurgery. No pigmentation recurrence was observed during any follow-up periods. <b>Conclusion:</b> Removal of gingival physiologic hyperpigmentation by laser therapy and cryotherapy was effective and safe. The efficiency of the laser was better than cryotherapy.

Also flagged:Netrinmembrane-associated proteinsaxonalangiogenesiscell migrationtumor
Journal Article 2019-02-24 ✓ 1 Snippet Bruikman CS, Zhang H, Kemper AM, van Gils JM.
In-Text Gene Mentions

Netrin-1 receptors DCC (Deleted in Colorectal Carcinoma) and UNC5 act as ‘dependence receptors' and when surrounded by a NTN1 gradient, cell survival is prevailed.

Show Full Abstract

Netrins form a family of secreted and membrane-associated proteins. Netrins are involved in processes for axonal guidance, morphogenesis, and angiogenesis by regulating cell migration and survival. These processes are of special interest in tumor biology. From the netrin genes various isoforms are translated and regulated by alternative splicing. We review here the diversity of isoforms of the netrin family members and their known and potential roles in cancer.

Also flagged:cerebral arterial thrombosislargeatherosclerosiscarotid plaqueischemic stroketumor necrosis factor super family member 4
Journal Article 2019-02-23 ✓ 5 Snippets Jiang Y, Liu X, Du Y, Zhou S.
In-Text Gene Mentions

TNFSF4 SNPs, rs1234313 and rs45454293, are associated with the risk of specific subtypes of cerebral arterial thrombosis in the Han Chinese population.

Moreover, reports have shown that TNFSF4 polymorphisms are associated with multiple autoimmune diseases, such as Sjogren’s syndrome and systemic lupus erythematosus [12, 13].

TNFSF4 functions as a T cell co-stimulatory molecule [8], and is involved in the formation of atherosclerosis [9, 10].

Studies have shown that TNFSF4 rs2205960 and rs844648 SNPs are associated with the susceptibility to systemic sclerosis [24].

Moreover, rs45454293 SNP, a TNFSF4 promoter gene, is considered a risk factor in myocardial infarction in Swedish women [18].

Show Full Abstract

<h4>Background</h4>Ischemic stroke is a leading cause of mortality and morbidity worldwide. Stenosis or blockage of an artery from atherosclerosis can cause insufficient cerebral blood supply, which leads to ischemic stroke. It has been reported that the polymorphisms of TNFSF4 (tumor necrosis factor super family member 4) are associated with multiple autoimmune diseases. However, it is still unclear whether TNFSF4 gene polymorphisms are associated with ischemic stroke in the Han Chinese population. Here we analyzed the association between TNFSF4 single nucleotide polymorphisms (SNPs) and cerebral arterial thrombosis in the Han Chinese population.<h4>Method</h4>We consecutively recruited 481 patients with cerebral arterial thrombosis and 538 healthy controls. Neck ultrasonography and magnetic resonance imaging (MRI) were used to evaluate large artery atherosclerosis (LAA) and small vessel disease (SVD), as well as the thickness and calcification of carotid artery. DNA was purified from the peripheral blood samples. TNFSF4 SNPs, rs1234313 and rs45454293, were genotyped using PCR.<h4>Results</h4>rs1234313 SNP had a significant correlation with the LAA and SVD subtypes in allelic (G vs A), dominate (GG/GA vs AA) and genotypic (GA vs AA; GG vs AA) models, as well as with the calcification of carotid plaque in dominant (GG/GA vs AA, p = 0.022) and genotypic (GA vs AA, p = 0.01) models. rs45454293 SNP had a significant correlation with the LAA and SVD subtypes in allelic (G vs A) and genotypic models, as well as with the thick carotid plaque in allelic (G vs A, p = 0.01) model.<h4>Conclusion</h4>TNFSF4 SNPs, rs1234313 and rs45454293, are associated with the risk of specific subtypes of cerebral arterial thrombosis in the Han Chinese population.

Also flagged:Colorectal cancerpathogenesiscancersPIWIcanceroncogenes
Journal Article 2019-02-23 ✓ 2 Snippets Chen H, Xu Z, Liu D.
In-Text Gene Mentions

Recently, some piRNAs have been found to be dysregulated in tumour tissues, and altered piRNAs play an important role in cancer cell proliferation, apoptosis and metastasis, and they may become potential prognostic and diagnostic biomarkers during cancer development.17, 91 Previous studies have shown that piR‐34377, piR‐34736, piR‐36249, piR‐35407 and piR‐36318 are significantly down‐regulated, while piR‐651, piR‐932, piR‐4987, piR‐20365, piR‐20485, piR‐20582, piR‐36743, piR‐36026, piR‐31106 and piR‐021285 are up‐regulated in breast cancer.92, 93 piR‐651, piR‐32105, piR‐58099 and piR‐59056 are increased in gastric cancer, whereas piR‐823 is decreased.94, 95 piR‐55490 is down‐regulated in lung cancer, while piR‐651 is up‐regulated96, 97; piR‐55490 inhibits lung cancer cell proliferation and the mechanism is associated with its binding to 3′ UTR of mTOR messenger RNA (mRNA).97 piR‐32051, piR‐39894 and piR‐43607 were found up‐regulated in kidney cancer tissues.98 PIWI‐interacting RNA DQ594040 is one down‐regulated piRNA in bladder cancer, and its overexpression can inhibit bladder cancer cell proliferation, colony formation and promote cell apoptosis through up‐regulating TNFSF4 protein.99 As for CRC, piR‐651 was found to be up‐regulated in tumour tissues, which is associated with metastasis state.

…poptosis through up‐regulatingTNFSF4protein.…

Show Full Abstract

Colorectal cancer (CRC) is the third most common malignance. Although great efforts have been made to understand the pathogenesis of CRC, the underlying mechanisms are still unclear. It is now clear that more than 90% of the total genome is actively transcribed, but lack of protein-coding potential. The massive amount of RNA can be classified as housekeeping RNAs (such as ribosomal RNAs, transfer RNAs) and regulatory RNAs (such as microRNAs [miRNAs], PIWI-interacting RNA [piRNAs], tRNA-derived stress-induced RNA, tRNA-derived small RNA [tRFs] and long non-coding RNAs [lncRNAs]). Small non-coding RNAs are a group of ncRNAs with the length no more than 200 nt and they have been found to exert important regulatory functions under many pathological conditions. In this review, we summarize the biogenesis and functions of regulatory sncRNAs, such as miRNAs, piRNA and tRFs, and highlight their involvements in cancers, particularly in CRC.

Also flagged:mitochondrialneurodegenerative diseasemitochondriaagingneurodegenerative diseasesABCB10
Journal Article 2019-02-23 ✓ 3 Snippets Fu Z, Liu F, Liu C, Jin B, Jiang Y, Tang M, Qi X, Guo X.
In-Text Gene Mentions

Numerous studies have shown that mitochondrial dysfunction contributes to consequential phenotypes of Huntington's disease (HD), a fatal and inherited neurodegenerative disease caused by the expanded CAG repeats in the N-terminus of the huntingtin (Htt) gene.

…of the huntingtin (Htt) gene.…

Htt

Show Full Abstract

Numerous studies have shown that mitochondrial dysfunction contributes to consequential phenotypes of Huntington's disease (HD), a fatal and inherited neurodegenerative disease caused by the expanded CAG repeats in the N-terminus of the huntingtin (Htt) gene. To maintain proper function, mitochondria develop a dedicated protein quality control mechanism by activating a stress response termed the mitochondrial unfolded protein response (UPR<sup>mt</sup>). Defects in the UPR<sup>mt</sup> have been linked to aging and are also associated with neurodegenerative diseases. However, little is known about the role of the UPR<sup>mt</sup> in HD. In this study, we find that ABCB10, a mitochondrial transporter involved in the UPR<sup>mt</sup> pathway, is downregulated in HD mouse striatal cells, HD patient fibroblasts, and HD R6/2 mice. Deletion of ABCB10 causes increased mitochondrial reactive oxygen species (ROS) production and cell death, whereas overexpression of ABCB10 reduces these aberrant events. Moreover, the mitochondrial chaperone HSP60 and mitochondrial protease Clpp, two well-established markers of the UPR<sup>mt</sup>, are reduced in the in vitro ABCB10-deficienct HD models. CHOP, a key transcription factor of HSP60 and Clpp, is regulated by ABCB10 in HD mouse striatal cells. Furthermore, we find that mutant huntingtin (mtHtt) inhibits the mtUPR by impairing ABCB10 mRNA stability. These findings demonstrate a suppression of the UPR<sup>mt</sup> by mtHtt, suggesting that disturbance of mitochondrial protein quality control may contribute to the pathogenesis of HD.

Also flagged:Dosage compensationautosomeschromosomechromosomesX-chromosomeorganization
Journal Article 2019-02-23 No Snippets Jordan W, Rieder LE, Larschan E.
Show Full Abstract

Dosage compensation is the process by which transcript levels of the X chromosome are equalized with those of autosomes. Although diverse mechanisms of dosage compensation have evolved across species, these mechanisms all involve distinguishing the X chromosome from autosomes. Because one chromosome is singled out from other chromosomes for precise regulation, dosage compensation serves as an important model for understanding how specific cis-elements are identified within the highly compacted 3D genome to co-regulate thousands of genes. Recently, multiple genomic approaches have provided key insights into the mechanisms of dosage compensation, extending what we have learned from classical genetic studies. In the future, newer genomic approaches that require little starting material show great promise to provide an understanding of the heterogeneity of dosage compensation between cells and how it functions in nonmodel organisms.

Also flagged:V-ATPasegliomasproton pump
Journal Article 2019-02-23 No Snippets Graner M.
Show Full Abstract

No abstract available.

Also flagged:nicotinic acidnicotinamidenicotinamide adenine dinucleotidenicotinamide adenine dinucleotide phosphategene expressioncell cycle
Journal Article 2019-02-23 ✓ 5 Snippets Gasperi V, Sibilano M, Savini I, Catani MV.
In-Text Gene Mentions

HD is caused by a CAG expansion in the gene encoding for huntingtin (htt), located on chromosome 4; normally, the htt gene contains up to 35 CAG repeats, while in HD it has more than 36 CAG repeats that produce a mutant protein, with an abnormally long polyglutamine repeat (polyQ), responsible for the selective striatal degeneration of medium-sized spiny neurons and cerebral cortex [170].

Nicotinamide effects do not depend on inhibition of mutant htt aggregation, but rather on replenishment of NAD levels required to restore energy balance dysregulation occurring in HD.

Accordingly, increased SIRT1 activity rescues neurons from mutant htt toxicity and ameliorates pathological mechanisms underlying HD onset [163,164].

By using the YAC128 transgenic model (expressing the full-length human mutant htt gene), Naia and co-workers [173] compared the effects of nicotinamide (a SIRT1 inhibitor) and resveratrol (a SIRT1 activator), both in vitro and in vivo.

…encoding for huntingtin (htt), located on chromosome…

Show Full Abstract

Niacin (also known as "vitamin B₃" or "vitamin PP") includes two vitamers (nicotinic acid and nicotinamide) giving rise to the coenzymatic forms nicotinamide adenine dinucleotide (NAD) and nicotinamide adenine dinucleotide phosphate (NADP). The two coenzymes are required for oxidative reactions crucial for energy production, but they are also substrates for enzymes involved in non-redox signaling pathways, thus regulating biological functions, including gene expression, cell cycle progression, DNA repair and cell death. In the central nervous system, vitamin B₃ has long been recognized as a key mediator of neuronal development and survival. Here, we will overview available literature data on the neuroprotective role of niacin and its derivatives, especially focusing especially on its involvement in neurodegenerative diseases (Alzheimer's, Parkinson's, and Huntington's diseases), as well as in other neuropathological conditions (ischemic and traumatic injuries, headache and psychiatric disorders).

Also flagged:BenzoxadiazoleAmino AcidHydrazidessynthesishydrazine
Journal Article 2019-02-23 No Snippets Brown AK, Aljohani AKB, Gill JH, Steel PG, Sellars JD.
Show Full Abstract

Discovery and development of new therapeutic options for the treatment of <i>Mycobacterium tuberculosis</i> (<i>Mtb</i>) infection are desperately needed to tackle the continuing global burden of this disease and the efficacy and cost limitations associated with current medicines. Herein, we report the synthesis of a series of novel benzoxa-[2,1,3]-diazole substituted amino acid hydrazides in a two-step synthesis and evaluate their inhibitory activity against <i>Mtb</i> and selected bacterial strains of clinical importance utilising an end point-determined REMA assay. Alongside this, their potential for undesired cytotoxicity against mammalian cells was assessed employing standard MTT assay methodologies. It has been demonstrated using modification at three sites (the hydrazine, amino acid, and the benzodiazole) it is possible to change both the antibacterial activity and cytotoxicity of these molecules whilst not affecting their microbial selectivity, making them attractive architectures for further exploitation as novel antibacterial agents.

Also flagged:pathogenesisSystemic sclerosissclerodermamultisystem diseasevasculopathyTGF-β
Journal Article 2019-02-23 ✓ 1 Snippet Korman B.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Systemic sclerosis (SSc, scleroderma) is a complex multisystem disease characterized by autoimmunity, vasculopathy, and most notably, fibrosis. Multiple lines of evidence demonstrate a variety of emerging cellular and molecular pathways which are relevant to fibrosis in SSc. The myofibroblast remains the key effector cell in SSc. Understanding the development, differentiation, and function of the myofibroblast is therefore crucial to understanding the fibrotic phenotype of SSc. Studies now show that (1) multiple cell types give rise to myofibroblasts, (2) fibroblasts and myofibroblasts are heterogeneous, and (3) that a large number of (primarily immune) cells have important influences on the transition of fibroblasts to an activated myofibroblasts. In SSc, this differentiation process involves multiple pathways, including well known signaling cascades such as TGF-β and Wnt/β-Catenin signaling, as well as epigenetic reprogramming and a number of more recently defined cellular pathways. After reviewing the major and emerging cellular and molecular mechanisms underlying SSc, this article looks to identify clinical applications where this new molecular knowledge may allow for targeted treatment and personalized medicine approaches.

Also flagged:SUZ12Liver Cancersuppressor of zest 12transcription polycomb repressive complex 2PRC2hepatocellular carcinoma
Journal Article 2019-02-23 ✓ 2 Snippets Xue C, Wang K, Jiang X, Gu C, Yu G, Zhong Y, Liu S, Nie Y, Zhou Y, Yang H.
In-Text Gene Mentions

…antitrypsin deficiency andhemochromatosis2 , chronic…

…activity of thepolycomb repressiverepressive complex PRC2…

Show Full Abstract

The suppressor of zest 12 (SUZ12), an essential subunit of the transcription polycomb repressive complex 2 (PRC2), has been found to be involved in HBV X-induced oncogenic transformation in hepatocellular carcinoma (HCC). However, the specific function of SUZ12 has not yet been determined in the pathogenesis of migration and invasion of HBV-associated HCC. Here, our results showed that SUZ12 was significantly down-regulated in HBV-related HCC tissues compared with adjacent non-tumor tissues by immunohistochemical and Western blot assays. The 5-years survival rate was worse in patients with low expression level of SUZ12. SUZ12 silencing increased the migration and invasion of HCC cells, and its overexpression impaired HCC cells migration and invasion. Knockdown of SUZ12 activated ERK1/2 pathway and increased MMP9 (matrix metallopeptidase 9) and MMP2 (matrix metallopeptidase 2) expression, whereas SUZ12 overexpression had opposite effects. Specific ERK1/2 inhibitor (SCH772984) significantly decreased HCC cells migration and invasion caused by SUZ12 shRNA. Thus, the liver cancer-down-regulated SUZ12 accelerated the invasion and metastasis of HCC cells. These effects might be associated with deregulation of SUZ12 activating ERK1/2, MMP2 and MMP9 in HCC cells.

Also flagged:KITgastrointestinal stromal tumoursTyrosine kinase
Journal Article 2019-02-22 No Snippets Napolitano A, Vincenzi B.
Show Full Abstract

Pharmacological targeting of KIT in gastrointestinal stromal tumours has dramatically changed the clinical outcome of this disease. Tyrosine kinase inhibitors are the cornerstone of this improvement, but resistance occurs through secondary KIT mutations. Studies aimed at improving our understanding of the molecular basis of sensitivity and resistance will soon allow us to further tailor our therapeutic strategies.

Also flagged:OX40OX40Lspontaneous abortionpolymerase
Journal Article 2019-02-22 No Snippets Rahmani F, Hadinedoushan H, Ghasemi N.
Show Full Abstract

This study determined the roles of OX40 and OX40L in women with recurrent spontaneous abortion (RSA). We compared the expression of OX40 and OX40L genes in peripheral blood mRNA levels and serum levels of OX40L in women with a history of RSA to the control group. In this case-control study, 40 women with a history of RSA (case group), and 40 others with no history of abortion (control group) were investigated. The expressions of OX40 mRNA and OX40L mRNA were determined in the two groups using the quantitative polymerase chain reaction. Also, the enzyme-linked immunosorbent assay was used to determine the levels of serum OX40L in the two groups. There were no significant differences in the maternal age of women in the two groups (30.1 ± 4.28 years in the case vs. 30.03 ± 4.23 years in the control group). There was no difference in terms of the levels of OX40 and OX40L mRNA between the groups (<i>p</i> = 0.08 and <i>p</i> = 0.56, respectively). In addition, there was no significant correlation between the expression of OX40 and OX40L mRNA levels with age or the number of abortions. The correlation between OX40 and OX40L mRNA levels was not significant. RSA history group turned to show a higher level of serum OX40L than the control group (<i>p</i> = 0.03). In conclusion, our findings demonstrated that the expression of OX40 mRNA and OX40L mRNA was similar between women with a history of RSA and the control group. The elevation of serum OX40L level may be considered as a risk factor for RSA.

Also flagged:LDAooUNKPIK3CAHer2BRCA2
Journal Article 2019-02-22 No Snippets Funnell T, Zhang AW, Grewal D, McKinney S, Bashashati A, Wang YK, Shah SP.
Show Full Abstract

Mutation signatures in cancer genomes reflect endogenous and exogenous mutational processes, offering insights into tumour etiology, features for prognostic and biologic stratification and vulnerabilities to be exploited therapeutically. We present a novel machine learning formalism for improved signature inference, based on multi-modal correlated topic models (MMCTM) which can at once infer signatures from both single nucleotide and structural variation counts derived from cancer genome sequencing data. We exemplify the utility of our approach on two hormone driven, DNA repair deficient cancers: breast and ovary (n = 755 samples total). We show how introducing correlated structure both within and between modes of mutation can increase accuracy of signature discovery, particularly in the context of sparse data. Our study emphasizes the importance of integrating multiple mutation modes for signature discovery and patient stratification, and provides a statistical modeling framework to incorporate additional features of interest for future studies.

Also flagged:cancerVEGFsecretiontumorcell adhesionvascular endothelial growth factor
Journal Article 2019-02-22 ✓ 5 Snippets Dabagh M, Randles A.
In-Text Gene Mentions

Fig 1A demonstrates the schematic of a cancer cell in the vicinity of glycocalyx layer. Fig 1B depicts the schematic of receptors on a substrate along with ligands on a cell membrane. The glycocalyx layer is anchored on the endothelial cell surface (Fig 1B). It has been reported that the DCC-secreted-VEGF not only can degrade glycocalyx, but also can increase the exposure of receptors on the endothelial surface as well as the transendothelial migration of DCC through endothelium in microvasculature [3–6]. The expression of VEGF by the endothelium are significantly distinctive between arteries and veins/capillaries due to differences in WSS magnitude [7,11]. Furthermore, a previous in vivo study reported that most deformable cancer cells are entrapped/arrested in capillaries, post-capillary venule intersections, or post-capillary venules [8, 12].

…interactions between theDCCand its local…

…affected by theDCC.…

…and extravasation ofDCC[ 1 –…

…interactions between theDCCand endothelium, which…

Show Full Abstract

Endothelial surface layer (glycocalyx) is the major physiological regulator of tumor cell adhesion to endothelium. Cancer cells express vascular endothelial growth factor (VEGF) which increases the permeability of a microvessel wall by degrading glycocalyx. Endothelial cells lining large arteries have also been reported, in vitro and in vivo, to mediate VEGF expression significantly under exposure to high wall shear stress (WSS) > 0.6 Pa. The objective of the present study is to explore whether local hemodynamic conditions in the vicinity of a migrating deformable cancer cell can influence the function of endothelial cells to express VEGF within the microvasculature. A three-dimensional model of deformable cancer cells (DCCs) migrating within a capillary is developed by applying a massively parallel hemodynamics application to simulate the fluid-structure interaction between the DCC and fluid surrounding the DCC. We study how dynamic interactions between the DCC and its local microenvironment affect WSS exposed on endothelium, under physiological conditions of capillaries with different diameters and flow conditions. Moreover, we quantify the area of endothelium affected by the DCC. Our results show that the DCC alters local hemodynamics in its vicinity up to an area as large as 40 times the cancer cell lateral surface. In this area, endothelium experiences high WSS values in the range of 0.6-12 Pa. Endothelial cells exposed to this range of WSS have been reported to express VEGF. Furthermore, we demonstrate that stiffer cancer cells expose higher WSS on the endothelium. A strong impact of cell stiffness on its local microenvironment is observed in capillaries with diameters <16 μm. WSS-induced-VEGF by endothelium represents an important potential mechanism for cancer cell adhesion and metastasis in the microvasculature. This work serves as an important first step in understanding the mechanisms driving VEGF-expression by endothelium and identifying the underlying mechanisms of glycocalyx degradation by endothelium in microvasculature. The identification of angiogenesis factors involved in early stages of cancer cell-endothelium interactions and understanding their regulation will help, first to develop anti-angiogenic strategies applied to diagnostic studies and therapeutic interventions, second to predict accurately where different cancer cell types most likely adhere in microvasculature, and third to establish accurate criteria predisposing the cancer metastasis.

Also flagged:SynthesisMed 6spinocerebellar ataxiasspinocerebellar ataxiaHuntington choreamyotonic dystrophy
Journal Article 2019-02-22 ✓ 2 Snippets Babačić H, Mehta A, Merkel O, Schoser B.
In-Text Gene Mentions

…the huntingtin (HTT) gene, located…

…] This mutatedHTTgene ( mHTT…

Show Full Abstract

<h4>Introduction</h4>The system of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (cas) is a new technology that allows easier manipulation of the genome. Its potential to edit genes opened a new door in treatment development for incurable neurological monogenic diseases (NMGDs). The aim of this systematic review was to summarise the findings on the current development of CRISPR-cas for therapeutic purposes in the most frequent NMGDs and provide critical assessment.<h4>Methods and data acquisition</h4>We searched the MEDLINE and EMBASE databases, looking for original studies on the use of CRISPR-cas to edit pathogenic variants in models of the most frequent NMGDs, until end of 2017. We included all the studies that met the following criteria: 1. Peer-reviewed study report with explicitly described experimental designs; 2. In vitro, ex vivo, or in vivo study using human or other animal biological systems (including cells, tissues, organs, organisms); 3. focusing on CRISPR as the gene-editing method of choice; and 5. featured at least one NMGD.<h4>Results</h4>We obtained 404 papers from MEDLINE and 513 from EMBASE. After removing the duplicates, we screened 490 papers by title and abstract and assessed them for eligibility. After reading 50 full-text papers, we finally selected 42 for the review.<h4>Discussion</h4>Here we give a systematic summary on the preclinical development of CRISPR-cas for therapeutic purposes in NMGDs. Furthermore, we address the clinical interpretability of the findings, giving a comprehensive overview of the current state of the art. Duchenne's muscular dystrophy (DMD) paves the way forward, with 26 out of 42 studies reporting different strategies on DMD gene editing in different models of the disease. Most of the strategies aimed for permanent exon skipping by deletion with CRISPR-cas. Successful silencing of the mHTT gene with CRISPR-cas led to successful reversal of the neurotoxic effects in the striatum of mouse models of Huntington's disease. Many other strategies have been explored, including epigenetic regulation of gene expression, in cellular and animal models of: myotonic dystrophy, Fraxile X syndrome, ataxias, and other less frequent dystrophies. Still, before even considering the clinical application of CRISPR-cas, three major bottlenecks need to be addressed: efficacy, safety, and delivery of the systems. This requires a collaborative approach in the research community, while having ethical considerations in mind.

Also flagged:Cancerfetaltumorcarotenoidscurcuminresveratrol
Journal Article 2019-02-22 ✓ 1 Snippet Pan P, Huang YW, Oshima K, Yearsley M, Zhang J, Arnold M, Yu J, Wang LS.
In-Text Gene Mentions

DCC

Show Full Abstract

Cancer is considered a fetal disease caused by uncontrolled proliferation and progression of abnormal cells. The most efficient cancer therapies suppress tumor growth, prevent progression and metastasis, and are minimally toxic to normal cells. Natural compounds have shown a variety of chemo-protective effects alone or in combination with standard cancer therapies. Along with better understanding of the dynamic interactions between our immune system and cancer development, nutritional immunology-the use of natural compounds as immunomodulators in cancer patients-has begun to emerge. Cancer cells evolve strategies that target many aspects of the immune system to escape or even edit immune surveillance. Therefore, the immunesuppressive tumor microenvironment is a major obstacle in the development of cancer therapies. Because interaction between the tumor microenvironment and the immune system is a complex topic, this review focuses mainly on human clinical trials and animal studies, and it highlights specific immune cells and their cytokines that have been modulated by natural compounds, including carotenoids, curcumin, resveratrol, EGCG, and β-glucans. These natural compounds have shown promising immune-modulating effects, such as inhibiting myeloid-derived suppressor cells and enhancing natural killer and cytolytic T cells, in tumor-bearing animal models, but their efficacy in cancer patients remains to be determined.

Also flagged:osteoarthritisknee osteoarthritismetabolismapolipoprotein A-ITFcarboxypeptidase B2
Journal Article 2019-02-22 ✓ 1 Snippet Luo Q, Ji S, Li Z, Huang T, Fan S, Xi Q.
In-Text Gene Mentions

…distinctive manifestation ofhemochromatosis, resembling degenerative join…

Show Full Abstract

<h4>Background</h4>Ultrasound (US) therapy may improve osteoarthritis symptoms. We investigated the effects of US on the synovial fluid (SF) proteome in a rabbit knee osteoarthritis (KOA) model to explore its therapeutic mechanisms.<h4>Methods</h4>Sixteen healthy 6-month-old New Zealand white rabbits (eight male, eight female), weighing 2.5-3.0 kg, were randomly divided into groups A and B with eight rabbits per group. Both groups were subjected to right anterior cruciate ligament transaction. Six weeks after surgery, we treated the operated knee joint of group A rabbits with US and of group B rabbits with sham US for 2 weeks. The proteomes of knee joint SF from groups A and B rabbits were then analyzed using a label-free mass spectrometry (MS) quantification method.<h4>Results</h4>We identified 19 protein sequences annotated by 361 Gene Ontology (GO) items. According to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database of rabbit protein sequences, we then annotated the KO numbers of homologous/similar proteins to 32 relevant KEGG pathways. We extracted 10 significantly differentially expressed proteins among the 32 relevant KEGG messages/metabolism pathways. The proteins whose levels were decreased were apolipoprotein A-I (AopA-1), transferrin (TF), carboxypeptidase B2 (CBP2), arylesterase/paraoxonase (PON), fibrinogen alpha chain, and alpha-2-macroglobulin (A2M). The proteins whose levels were increased were molecular chaperone HtpG/heat shock proteins (htpG, HSP90A), decorin (DCN), pyruvate kinase (PK, pyk), and fatty acid-binding protein 4/adipocyte (FABP4, aP2).<h4>Conclusions</h4>US therapy can alter protein levels in SF, which can decrease AopA-1, TF, CBP2, PON, fibrinogen alpha chain and A2M protein levels, and increase HtpG/HSP90A, DCN, PK/PKY, and FABP4/aP2 protein levels in SF of KOA, suggesting that the therapeutic mechanisms of US therapy on KOA may occur through changes in the SF proteome.

Also flagged:tumorbreast cancerepithelial-mesenchymal transitioncell migrationPBKZEB1
Journal Article 2019-02-22 ✓ 1 Snippet Li J, Hao Y, Mao W, Xue X, Xu P, Liu L, Yuan J, Zhang D, Li N, Chen H, Zhao L, Sun Z, Luo J, Chen R, Zhao RC.
In-Text Gene Mentions

…involved in Staufen1 (STAU1)-mediated mRNA decay (SMD)…

Show Full Abstract

<h4>Background</h4>Increasing evidence has demonstrated that mesenchymal stem cells (MSCs) play a role in the construction of tumor microenvironments. Co-culture between tumor cells and MSCs provides an easy and useful platform for mimicking tumor microenvironments and identifying the important members involved in tumor progress. The long non-coding RNAs (lncRNAs) have been shown to regulate different tumorigenic processes. In this study, we aimed to examine functional lncRNA deregulations associated with breast cancer malignancy instigated by MSC-MCF-7 co-culture.<h4>Methods</h4>The microarrays were used to profile the expression changes of lncRNAs in MCF-7 cells during epithelial-mesenchymal transition (EMT) induced by co-culture with MSCs. We found that an intergenic lncRNA KB-1732A1.1 (termed LincK, partly overlapped with GASL1) was significantly elevated. To investigate the biological function of LincK, the expression of EMT markers, cell migration, invasion, proliferation, and colony formation were evaluated in vitro and xenograft assay in nude mice were performed in vivo. Furthermore, we detected LincK expression in clinical samples using RNAscope® technology and verified aberrant expression of LincK in breast cancer data sets from The Cancer Genome Atlas (TCGA) by bioinformatic analysis. The underlying mechanisms of LincK were investigated using mRNA microarray analyses, Western blot, RNA pull down, and RNA immunoprecipitation.<h4>Results</h4>LincK induced an EMT progress in breast cancer cells (BCC) MCF-7, MDA-MB-453, and MDA-MB-231. The depletion of LincK decreased the growth, migration, and invasion in BCC, whereas the overexpression of LincK exerted the opposite effects. Moreover, knockdown of LincK repressed tumorigenesis, and ectopic expression of LincK promoted tumor growth in MCF-7 xenograft model. LincK ablation in MDA-MB-231 cells dramatically impaired lung metastasis when incubated intravenously into nude mice. Further, LincK was frequently elevated in breast cancer compared with normal breast tissue in clinical samples. Mechanistically, LincK may share common miRNA response elements with PBK and ZEB1 and regulate the effects of miR-200 s.<h4>Conclusion</h4>LincK plays a significant role in regulating EMT and tumor growth and could be a potential therapeutic target in breast cancer.

Also flagged:Gene Expressionbrainchromatinchromosomebrain developmentchromosomes
Journal Article 2019-02-22 ✓ 1 Snippet Bagadia M, Chandradoss KR, Jain Y, Singh H, Lal M, Lal M, Sandhu KS.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Conserved noncoding elements (CNEs) have a significant regulatory influence on their neighboring genes. Loss of proximity to CNEs through genomic rearrangements can, therefore, impact the transcriptional states of the cognate genes. Yet, the evolutionary implications of such chromosomal alterations have not been studied. Through genome-wide analysis of CNEs and the cognate genes of representative species from five different mammalian orders, we observed a significant loss of genes' linear proximity to CNEs in the rat lineage. The CNEs and the genes losing proximity had a significant association with fetal, but not postnatal, brain development as assessed through ontology terms, developmental gene expression, chromatin marks, and genetic mutations. The loss of proximity to CNEs correlated with the independent evolutionary loss of fetus-specific upregulation of nearby genes in the rat brain. DNA breakpoints implicated in brain abnormalities of germline origin had significant representation between a CNE and the gene that exhibited loss of proximity, signifying the underlying developmental tolerance of genomic rearrangements that allowed the evolutionary splits of CNEs and the cognate genes in the rodent lineage. Our observations highlighted a nontrivial impact of chromosomal rearrangements in shaping the evolutionary dynamics of mammalian brain development and might explain the loss of brain traits, like cerebral folding of the cortex, in the rodent lineage.

Also flagged:minocyclinehyperalgesiaEmr1Irf8gene expressionneurogenesis
Journal Article 2019-02-22 ✓ 1 Snippet Moriarty O, Tu Y, Sengar AS, Salter MW, Beggs S, Walker SM.
In-Text Gene Mentions

…housekeeping genes (Abt1, Eef2 ,…

Show Full Abstract

Neonatal hindpaw incision primes developing spinal nociceptive circuitry, resulting in enhanced hyperalgesia following reinjury in adulthood. Spinal microglia contribute to this persistent effect, and microglial inhibition at the time of adult reincision blocks the enhanced hyperalgesia. Here, we pharmacologically inhibited microglial function with systemic minocycline or intrathecal SB203580 at the time of neonatal incision and evaluated sex-dependent differences following adult reincision. Incision in adult male and female rats induced equivalent hyperalgesia and spinal dorsal horn expression of genes associated with microglial proliferation (<i>Emr1</i>) and transformation to a reactive phenotype (<i>Irf8</i>). In control adults with prior neonatal incision, the enhanced degree and duration of incision-induced hyperalgesia and spinal microglial responses to reincision were equivalent in males and females. However, microglial inhibition at the time of the neonatal incision revealed sex-dependent effects: the persistent mechanical and thermal hyperalgesia following reincision in adulthood was prevented in males but unaffected in females. Similarly, reincision induced <i>Emr1</i> and <i>Irf8</i> gene expression was downregulated in males, but not in females, following neonatal incision with minocycline. To evaluate the distribution of reincision hyperalgesia, prior neonatal incision was performed at different body sites. Hyperalgesia was maximal when the same paw was reincised, and was increased following prior incision at ipsilateral, but not contralateral, sites, supporting a segmentally restricted spinal mechanism. These data highlight the contribution of spinal microglial mechanisms to persistent effects of early-life injury in males, and sex-dependent differences in the ability of microglial inhibition to prevent the transition to a persistent pain state span developmental stages.<b>SIGNIFICANCE STATEMENT</b> Following the same surgery, some patients develop persistent pain. Contributory mechanisms are not fully understood, but early-life experience and sex/gender may influence the transition to chronic pain. Surgery and painful procedural interventions in vulnerable preterm neonates are associated with long-term alterations in somatosensory function and pain that differ in males and females. Surgical injury in neonatal rodents primes the developing nociceptive system and enhances reinjury response in adulthood. Neuroimmune interactions are critical mediators of persistent pain, but sex-dependent differences in spinal neuroglial signaling influence the efficacy of microglial inhibitors following adult injury. Neonatal microglial inhibition has beneficial long-term effects on reinjury response in adult males only, emphasizing the importance of evaluating sex-dependent differences at all ages in preclinical studies.

Also flagged:cDNASCORsGTAcapitataNod1Nod2
Journal Article 2019-02-22 ✓ 1 Snippet Shumaker A, Putnam HM, Qiu H, Price DC, Zelzion E, Harel A, Wagner NE, Gates RD, Yoon HS, Bhattacharya D.
In-Text Gene Mentions

…, Kif3a ,Klhl20), autophagy, apoptosis…

Show Full Abstract

Corals comprise a biomineralizing cnidarian, dinoflagellate algal symbionts, and associated microbiome of prokaryotes and viruses. Ongoing efforts to conserve coral reefs by identifying the major stress response pathways and thereby laying the foundation to select resistant genotypes rely on a robust genomic foundation. Here we generated and analyzed a high quality long-read based ~886 Mbp nuclear genome assembly and transcriptome data from the dominant rice coral, Montipora capitata from Hawai'i. Our work provides insights into the architecture of coral genomes and shows how they differ in size and gene inventory, putatively due to population size variation. We describe a recent example of foreign gene acquisition via a bacterial gene transfer agent and illustrate the major pathways of stress response that can be used to predict regulatory components of the transcriptional networks in M. capitata. These genomic resources provide insights into the adaptive potential of these sessile, long-lived species in both natural and human influenced environments and facilitate functional and population genomic studies aimed at Hawaiian reef restoration and conservation.

Also flagged:telomeremeningiomabrain tumorsgliomabrain tumorchromosomes
Journal Article 2019-02-22 ✓ 1 Snippet Muskens IS, Hansen HM, Smirnov IV, Molinaro AM, Bondy ML, Schildkraut JM, Wrensch M, Wiemels JL, Claus EB.
In-Text Gene Mentions

MLLT10

Show Full Abstract

<h4>Purpose</h4>Telomere length-associated SNPs have been associated with incidence and survival rates for malignant brain tumors such as glioma. Here, we study the influence of genetically determined lymphocyte telomere length (LTL) by comparing telomerase associated SNPs between the most common non-malignant brain tumor, i.e. meningioma, and healthy controls.<h4>Methods/patients</h4>One thousand fifty-three (1053) surgically treated meningioma patients and 4437 controls of Western European ancestry were included. Germline DNA was genotyped for 8 SNPs previously significantly associated with LTL. Genotypically-estimated LTL was then calculated by summing each SNP's genotypically-specified telomere length increase in base pairs (bp) for each person. Odds ratios for genotypically-estimated LTL in meningioma cases and controls were evaluated using logistic regression with the first two ancestral principal components and sex as covariates.<h4>Results</h4>Three out of the eight evaluated LTL SNPs were significantly associated with increased meningioma risk (rs10936599: OR 1.14, 95% CI 1.01-1.28, rs2736100: OR 1.13, 95% CI 1.03-1.25, rs9420907: OR 1.22, 95% CI 1.07-1.39). Only rs9420907 remained significant after correction for multiple testing. Average genotypically-estimated LTL was significantly longer for those with meningioma compared to controls [mean cases: 560.2 bp (standard error (SE): 4.05 bp), mean controls: 541.5 bp (SE: 2.02 bp), logistic regression p value = 2.13 × 10<sup>-5</sup>].<h4>Conclusion</h4>Increased genotypically-estimated LTL was significantly associated with increased meningioma risk. A role for telomere length in the pathophysiology of meningioma is novel, and could lead to new insights on the etiology of meningioma.

Also flagged:VHLE3 ligasesvon Hippel-LindauCRBNCullin RINGE3 ubiquitin ligase
Journal Article 2019-02-22 No Snippets Girardini M, Maniaci C, Hughes SJ, Testa A, Ciulli A.
Show Full Abstract

The von Hippel-Lindau (VHL) and cereblon (CRBN) proteins are substrate recognition subunits of two ubiquitously expressed and biologically important Cullin RING E3 ubiquitin ligase complexes. VHL and CRBN are also the two most popular E3 ligases being recruited by bifunctional Proteolysis-targeting chimeras (PROTACs) to induce ubiquitination and subsequent proteasomal degradation of a target protein. Using homo-PROTACs, VHL and CRBN have been independently dimerized to induce their own degradation. Here we report the design, synthesis and cellular activity of VHL-CRBN hetero-dimerizing PROTACs featuring diverse conjugation patterns. We found that the most active compound 14a induced potent, rapid and profound preferential degradation of CRBN over VHL in cancer cell lines. At lower concentrations, weaker degradation of VHL was instead observed. This work demonstrates proof of concept of designing PROTACs to hijack different E3 ligases against each other, and highlights a powerful and generalizable proximity-induced strategy to achieve E3 ligase knockdown.

Also flagged:portal vein thrombosiscirrhosisalbuminglucosefactor V Leidenprothrombin
Journal Article 2019-02-22 ✓ 1 Snippet Cagin YF, Bilgic Y, Berber İ, Yildirim O, Erdogan MA, Firat F, Arslan AK, Colak C, Seckin Y, Harputluoglu M.
In-Text Gene Mentions

ATIII

Show Full Abstract

This study was designed to identify and assess risk factors for portal vein thrombosis (PVT) in patients with cirrhosis. A total of 98 cirrhosis patients with PVT were identified and 101 cirrhosis patients without PVT were chosen as the control group in this retrospective study. Several variables were measured and the two groups PVT and non-PVT were compared statistically. PVT was identified in 98 patients (10%). Significant differences in hematocrit, international normalized ratio, albumin, bilirubin and glucose were determined between the groups (P<0.05). Out of the thrombophilic risk factors in the patients with PVT factor V Leiden was identified in 8.8%, prothrombin gene 6.6% and methylenetetrahydrofolate reductase 2.2%. There was no difference in survival time between groups (P>0.05).

Also flagged:sinusoidal obstruction syndromeprotein-losing enteropathyintestinal lymphangiectasiacirrhosisliver diseasesLiver Cirrhosis
Journal Article 2019-02-22 ✓ 1 Snippet Philips CA, Augustine P, Paramaguru R, Ahamed R, Padsalgi G.
In-Text Gene Mentions

…mutational studies forhemochromatosis, alpha-1 anti-trypsin deficie…

Show Full Abstract

We present the rare case of a young male with sinusoidal obstruction syndrome due to Ayurvedic herbal medicine which he took for management of bilateral leg swelling associated with protein-losing enteropathy due to intestinal lymphangiectasia. The patient developed progressive sinusoidal fibrosis leading to cirrhosis on long term follow-up. In a diagnosis that took three years to conclude, we showcase serial liver biopsies that reveal the rare disease progression. Complementary and alternative medicine use among apparently healthy population is a potentially modifiable risk factor for liver diseases, in the presence of adequate public health education from concerned authorities.

bioRxiv 2019-02-22 Preprint (No Snippets API) Li M, Fine RD, Dinda M, Bekiranov S, Smith JS.
Show Full Abstract

The NAD + -dependent histone deacetylase Sir2 was originally identified in Saccharomyces cerevisiae as a silencing factor for HML and HMR , the heterochromatic cassettes utilized as donor templates during mating-type switching. MAT a cells preferentially switch to MAT α using HML as the donor, which is driven by an adjacent cis -acting element called the recombination enhancer (RE). In this study we demonstrate that Sir2 and the condensin complex are recruited to the RE exclusively in MAT a cells, specifically to the promoter of a small gene within the right half of the RE known as RDT1 . We go on to demonstrate that the RDT1 promoter functions as a locus control region (LCR) that regulates both transcription and long-range chromatin interactions. Sir2 represses the transcription of RDT1 until it is redistributed to a dsDNA break at the MAT locus induced by the HO endonuclease during mating-type switching. Condensin is also recruited to the RDT1 promoter and is displaced upon HO induction, but does not significantly repress RDT1 transcription. Instead condensin appears to promote mating-type switching efficiency and donor preference by maintaining proper chromosome III architecture, which is defined by the interaction of HML with the right arm of chromosome III, including MAT a and HMR . Remarkably, eliminating Sir2 and condensin recruitment to the RDT1 promoter disrupts this structure and reveals an aberrant interaction between MAT a and HMR , consistent with the partially defective donor preference for this mutant. Global condensin subunit depletion also impairs mating type switching efficiency and donor preference, suggesting that modulation of chromosome architecture plays a significant role in controlling mating type switching, thus providing a novel model for dissecting condensin function in vivo . <h4>Author summary</h4> Sir2 is a highly conserved NAD + -dependent protein deacetylase and defining member of the sirtuin protein family. It was identified about 40 years ago in the budding yeast, Saccharomyces cerevisiae , as a gene required for silencing of the cryptic mating-type loci, HML and HMR . These heterochromatic cassettes are utilized as templates for mating-type switching, whereby a programmed DNA double-strand break at the MAT a or MAT α locus is repaired by gene conversion to the opposite mating type. The preference for switching to the opposite mating type is called donor preference, and in MAT a cells, is driven by a cis-acting DNA element called the recombination enhancer (RE). It was believed that the only role for Sir2 in mating-type switching was silencing HML and HMR. However, in this study we show that Sir2 also regulates expression of a small gene (RDT1) in the RE that is activated during mating-type switching. The promoter of this gene is also bound by the condensin complex, and deleting this region of the RE drastically changes chromosome III structure and alters donor preference. The RE therefore appears to function as a complex locus control region (LCR) that links transcriptional control to chromatin architecture, and thus provides a new model for investigating the underlying mechanistic principles of programmed chromosome architectural dynamics.

Also flagged:infectiongene responsesimmune responseschronic respiratory diseaseTightGapA
Journal Article 2019-02-21 No Snippets Beaudet J, Tulman ER, Pflaum K, Canter JA, Silbart LK, Geary SJ.
Show Full Abstract

Mycoplasmas are small bacterial commensals or pathogens that commonly colonize host mucosal tissues and avoid rapid clearance, in part by stimulating inflammatory, immunopathogenic responses. We previously characterized a wide array of transcriptomic perturbations in avian host tracheal mucosae infected with virulent, immunopathologic <i>Mycoplasma gallisepticum</i>; however, mechanisms delineating these from protective responses, such as those induced upon vaccination, have not been thoroughly explored. In this study, host transcriptomic responses to two experimental <i>M. gallisepticum</i> vaccines were assessed during the first 2 days of infection. Relative to virulent infection, host metabolic and immune gene responses to both vaccines were greatly decreased, including early innate immune responses critical to disease development and subsequent adaptive immunity. These data specify host genes and potential mechanisms contributing to maladaptive versus beneficial host responses-information critical for design of vaccines efficacious in both limiting inflammation and enabling pathogen clearance.

Also flagged:coagulationprothrombinpartial thromboplastinantithrombin IIIfibrinogenClot formation
Journal Article 2019-02-21 ✓ 2 Snippets Yoon JU, Cheon JH, Choi YJ, Byeon GJ, Ahn JH, Choi EJ, Park JY.
In-Text Gene Mentions

…(aPTT), antithrombin III (ATIII), platelet count (PLT),…

…with levels ofATIIIand fibrinogen.<h4>Conclusions…

Show Full Abstract

<h4>Introduction</h4>Thromboelastography (TEG) is gaining increasing acceptance in liver transplantation (LT) with conventional coagulation tests (CCTs) such as prothrombin time (PT), activated partial thromboplastin time (aPTT), antithrombin III (ATIII), platelet count (PLT), and fibrinogen concentration. The purpose of this study was to evaluate the clinical utility of TEG in LT and investigate the correlation between TEG and CCT values during each phase of LT.<h4>Materials and methods</h4>Medical records of patients who underwent deceased donor LT at a single, university hospital between October 2010 and July 2015 were retrospectively reviewed. Blood samples were obtained at each phase of LT (pre-anhepatic, anhepatic, and neo-hepatic phase) according to our institutional LT protocol and utilized for analysis of TEG and CCTs. The Spearman correlation coefficient between TEG and CCT values were obtained.<h4>Results</h4>During the pre-anhepatic phase, the reaction time (R), PT, and aPTT did not correlate with each other, but demonstrated a negative correlation with PLT. Clot formation time (K) demonstrated a similar correlation with R and a negative correlation with fibrinogen. The maximal amplitude (MA) and α-angle (α) were positively correlated with PLT and fibrinogen and inversely correlated with aPTT. During the anhepatic phase, MA was significantly correlated with PLT and inversely correlated with aPTT; other parameters had weak or indistinct correlation. During the neo-hepatic phase, R and K were significantly correlated with aPTT and inversely correlated with PLT and fibrinogen. A correlation of MA and α with PLT, aPTT, and fibrinogen was also observed. Clot lysis at 30 minutes and estimated percent lysis were inversely correlated with levels of ATIII and fibrinogen.<h4>Conclusions</h4>Conventional coagulation tests and TEG show particularly poor comparability during the anhepatic period of liver transplantation. TEG can be most reliable in the anhepatic phase, during which dynamic hemostatic changes occur.

Also flagged:mitochondrialneddylationmetabolismcancerbreast cancerdegradation
Journal Article 2019-02-21 ✓ 1 Snippet Zhou Q, Li H, Li Y, Tan M, Fan S, Cao C, Meng F, Zhu L, Zhao L, Guan MX, Jin H, Sun Y.
In-Text Gene Mentions

Fbxl4

Show Full Abstract

Abnormal activation of neddylation modification and dysregulated energy metabolism are frequently seen in many types of cancer cells. Whether and how neddylation modification affects cellular metabolism remains largely unknown. Here, we showed that MLN4924, a small-molecule inhibitor of neddylation modification, induces mitochondrial fission-to-fusion conversion in breast cancer cells via inhibiting ubiquitylation and degradation of fusion-promoting protein mitofusin 1 (MFN1) by SCFβ-TrCP E3 ligase and blocking the mitochondrial translocation of fusion-inhibiting protein DRP1. Importantly, MLN4924-induced mitochondrial fusion is independent of cell cycle progression, but confers cellular survival. Mass-spectrometry-based metabolic profiling and mitochondrial functional assays reveal that MLN4924 inhibits the TCA cycle but promotes mitochondrial OXPHOS. MLN4924 also increases glycolysis by activating PKM2 via promoting its tetramerization. Biologically, MLN4924 coupled with the OXPHOS inhibitor metformin, or the glycolysis inhibitor shikonin, significantly inhibits cancer cell growth both in vitro and in vivo. Together, our study links neddylation modification and energy metabolism, and provides sound strategies for effective combined cancer therapies.

Also flagged:Ironmanganesemetalsneurological diseasesneurological disordersmitochondrial
Journal Article 2019-02-21 No Snippets Chen P, Totten M, Zhang Z, Bucinca H, Erikson K, Santamaría A, Bowman AB, Aschner M.
Show Full Abstract

<h4>Introduction</h4>Iron (Fe) and manganese (Mn) are essential nutrients for humans. They act as cofactors for a variety of enzymes. In the central nervous system (CNS), these two metals are involved in diverse neurological activities. Dyshomeostasis may interfere with the critical enzymatic activities, hence altering the neurophysiological status and resulting in neurological diseases. Areas covered: In this review, the authors cover the molecular mechanisms of Fe/Mn-induced toxicity and neurological diseases, as well as the diagnosis and potential treatment. Given that both Fe and Mn are abundant in the earth crust, nutritional deficiency is rare. In this review the authors focus on the neurological disorders associated with Mn and Fe overload. Expert commentary: Oxidative stress and mitochondrial dysfunction are the primary molecular mechanism that mediates Fe/Mn-induced neurotoxicity. Although increased Fe or Mn concentrations have been found in brain of patients, it remains controversial whether the elevated metal amounts are the primary cause or secondary consequence of neurological diseases. Currently, treatments are far from satisfactory, although chelation therapy can significantly decrease brain Fe and Mn levels. Studies to determine the primary cause and establish the molecular mechanism of toxicity may help to adapt more comprehensive and satisfactory treatments in the future.

Also flagged:Netrin-1myocardial fibrosisacute myocardial infarctiontumor necrosis factor alpha αTNF-αinterleukin 6
Journal Article 2019-02-21 ✓ 5 Snippets Daliang Z, Lifang Y, Hong F, Lingling Z, Lin W, Dapeng L, Tianshu Z, Weimin L.
In-Text Gene Mentions

Compared with the AMI group, the ET group showed reduced expression of myocardial MMP2 and MMP9 proteins, whereas expression of myocardial netrin-1, TIMP2 and the DCC receptor, was significantly increased.

The expression of myocardial MMP2 and MMP9 was significantly increased in the AMI group compared with the sham group, whereas that of myocardial netrin-1, TIMP2 and the DCC receptor, was significantly reduced.

Aerobic exercise increased levels of serum netrin-1, myocardial netrin-1, and the DCC receptor and reduced the expression of myocardial MMP2 and MMP9 proteins, to improve the degree of fibrosis following myocardial infarction in rats.

*P<0.05 versus sham;#P<0.05 versus the AMI group;Sham,the sham group(n = 3);AMI,the acute myocardial infarction model group(n = 3);ET,the aerobic exercise treatment after acute myocardial infarction group(n = 3);MMP2, 9,myocardial matrix metalloproteinases 2 and 9proteins; TIMP2,tissue inhibitor of metalloproteinases 2;DCC,the deleted in colorectal cancer.

In conclusion, Aerobic exercise can improve myocardial fibrosis after myocardial infarction and promote the expression of netrin-1 and DCC receptors.

Show Full Abstract

<h4>Introduction</h4>This study aimed to investigate the effect of aerobic exercise on the expression of neitrin-1,DCC receptor and myocardial fibrosis in rats with acute myocardial infarction.<h4>Methods</h4>Twenty-four rats were randomly divided into three groups: the sham group (n = 8), the acute myocardial infarction (AMI) model group (n = 8), and the aerobic exercise treatment after acute myocardial infarction group (ET) (n = 8). After 10 weeks, the serum levels of netrin-1, tumor necrosis factor alpha α (TNF-α), and interleukin 6 (IL-6) were measured. The expression of matrix metalloproteinase 2 and 9 (MMP2, 9), and their inhibitor, tissue inhibitor of metalloproteinase 2 (TIMP2), myocardial netrin-1, and the deleted in colorectal cancer (DCC) receptor were evaluated. Histopathological results were also evaluated. The collagen volume fraction of the myocardial tissues was also calculated.<h4>Results</h4>Compared with the sham group, in the AMI and ET groups, left ventricular end diastolic pressure (LVEDP) were increased, while left ventricular systolic pressure (LVSP), and left ventricular pressure maximal rate of rise and fall (± dp/dtmax) were significantly decreased (P<0.05,). Compared with the AMI group, in the ET group, LVSP, and ±dp/dtmax were significantly increased while LVEDP was decreased (P<0.05). Compared with the sham group, the AMI group and ET groups showed increased levels of serum TNF-α, IL-6 and significantly reduced levels of netrin-1. Levels of TNF-α and IL-6 were significantly reduced in the ET group compared with the AMI group, whereas the level of netrin-1 was increased. The expression of myocardial MMP2 and MMP9 was significantly increased in the AMI group compared with the sham group, whereas that of myocardial netrin-1, TIMP2 and the DCC receptor, was significantly reduced. Compared with the AMI group, the ET group showed reduced expression of myocardial MMP2 and MMP9 proteins, whereas expression of myocardial netrin-1, TIMP2 and the DCC receptor, was significantly increased. The collagen volume fraction of the myocardial tissues was significantly increased in the AMI group and the ET group compared with the sham group, with a greater increase in the AMI group.<h4>Conclusions</h4>Aerobic exercise increased levels of serum netrin-1, myocardial netrin-1, and the DCC receptor and reduced the expression of myocardial MMP2 and MMP9 proteins, to improve the degree of fibrosis following myocardial infarction in rats.

Also flagged:major histocompatibility complexMHCclass IoligopeptidesCD1MR-1
Journal Article 2019-02-21 ✓ 2 Snippets D'Souza MP, Adams E, Altman JD, Birnbaum ME, Boggiano C, Casorati G, Chien YH, Conley A, Eckle SBG, Früh K, Gondré-Lewis T, Hassan N, Huang H, Jayashankar L, Kasmar AG, Kunwar N, Lavelle J, Lewinsohn DM, Moody B, Picker L, Ramachandra L, Shastri N, Parham P, McMichael AJ, Yewdell JW.
In-Text Gene Mentions

…molecules, MR1, CD1a-e,HFE, is a protein…

…All butHFE, FcRn, and ZAG…

Show Full Abstract

Most studies of T lymphocytes focus on recognition of classical major histocompatibility complex (MHC) class I or II molecules presenting oligopeptides, yet there are numerous variations and exceptions of biological significance based on recognition of a wide variety of nonclassical MHC molecules. These include αβ and γδ T cells that recognize different class Ib molecules (CD1, MR-1, HLA-E, G, F, et al.) that are nearly monomorphic within a given species. Collectively, these T cells can be considered "unconventional," in part because they recognize lipids, metabolites, and modified peptides. Unlike classical MHC-specific cells, unconventional T cells generally exhibit limited T-cell antigen receptor (TCR) repertoires and often produce innate immune cell-like rapid effector responses. Exploiting this system in new generation vaccines for human immunodeficiency virus (HIV), tuberculosis (TB), other infectious agents, and cancer was the focus of a recent workshop, "Immune Surveillance by Non-classical MHC Molecules: Improving Diversity for Antigens," sponsored by the National Institute of Allergy and Infectious Diseases. Here, we summarize salient points presented regarding the basic immunobiology of unconventional T cells, recent advances in methodologies to measure unconventional T-cell activity in diseases, and approaches to harness their considerable clinical potential.

Also flagged:liver cirrhosishepatocellular carcinomahepatocelluler carcinomaliver diseasesprimary hemochromatosisalcoholic liver diseases
Journal Article 2019-02-21 ✓ 2 Snippets Tarao K, Nozaki A, Ikeda T, Sato A, Komatsu H, Komatsu T, Taguri M, Tanaka K.
In-Text Gene Mentions

…HCC in genetichemochromatosis

…251 patients withhemochromatosisfor up to…

Show Full Abstract

<h4>Background</h4>It is well known that the incidence of developing hepatocelluler carcinoma (HCC) is increased in liver cirrhosis of different etiologies. However, comparison of HCC incidence in various liver diseases has not yet been estimated. We surveyed this comparison.<h4>Methods</h4>The PubMed database was examined (1989-2017) for studies published in English language regarding the prospective follow-up results for the development of HCC in various liver diseases. A meta-analysis was performed for each liver disease.<h4>Results</h4>The annual incidence (%) of HCC in the non-cirrhotic stage and cirrhotic stage, and the ratio of HCC incidence in the cirrhotic stage/non-cirrhotic stage were as follows. (a) hepatitis B virus liver disease: 0.37%→3.23% (8.73-fold), (b) hepatitis C virus liver diseases: 0.68%→4.81% (7.07-fold), (c) primary biliary cholangitis (0.26%→1.79%, 6.88-fold), (d) autoimmune hepatitis (0.19%→0.53%, 2.79-fold), and (e) NASH (0.03%→1.35%, 45.00-fold). Regarding primary hemochromatosis and alcoholic liver diseases, only follow-up studies in the cirrhotic stage were presented, 1.20% and 2.06%, respectively.<h4>Conclusions</h4>When the liver diseases advance to cirrhosis, the incidence of HCC is markedly increased. The development of HCC must be closely monitored by ultrasonography, magnetic resonance imaging, and computed tomography, irrespective of the different kinds of liver diseases.

Also flagged:thiazolidinonesironhereditary hemochromatosisβ-thalassemiairon-overload disordersHepcidin
Journal Article 2019-02-21 ✓ 5 Snippets Liu J, Liu W, Liu Y, Miao Y, Guo Y, Song H, Wang F, Zhou H, Ganz T, Yan B, Liu S.
In-Text Gene Mentions

Although Hfe−/− and β-thalassemic mice both exhibit a similar iron overload phenotype, the underlying molecular pathologies are different.41,42 The common mechanism is lower level of hepcidin compared to that in Wt mice, giving rise to enhanced dietary iron uptake and iron egress out of macrophages and consequently iron deposition in various organs, especially the liver.36,43 However in β-thalassemias, unlike in HH, ineffective erythropoiesis and hemolysis accompany the iron overload, leading to enhanced erythrophagocytosis by macrophages in the spleen and consequently excess iron deposition in splenic macrophages.41 Upon treatment to relieve ineffective erythropoiesis, iron utilization for hemoglobin formation and erythropoiesis would be enhanced, resulting in reduced splenic iron overload.5,44 Our data showed significant reduction of splenic iron and spleen size/weight as well as improvement of hemoglobin and red blood cell indices in Hbbth3/+ mice after treatment with the compounds, demon strating that anemia was markedly ameliorated in β-thalassemia intermedia mice by our compounds through improving ineffective erythropoiesis.

Type 1 HH, caused by mutations of the hemochromatosis (HFE) gene, is the most common form of HH in populations of northern European origin.7 β-thalassemia, common worldwide in regions where malaria was historically endemic, is a genetic erythrocyte disorder characterized by ineffective erythropoiesis, anemia, and progressive iron overload.8 For both HH and β-thalassemia patients, long-term iron overload causes liver cirrhosis, cardiomyopathy, and endocrinopathies.7 Iron excess is currently managed by phlebotomy in HH and chelation in iron-loading anemias,9 but both treatments have serious limitations, including suboptimal compliance and secondary suppression of hepcidin, which results in a further increase of dietary iron uptake.7,10 Iron-chelating drugs can adversely affect ocular, auditory and renal functions11–13 and their administration can be burdensome, e.g., because of the short half-life of desferrioxamine.14,15 Other approaches, such as mini-hepcidin peptides, are still at the experimental stage.16,17 We therefore searched for hepcidin agonists with favorable characteristics for clinical applications.

Moreover, the development of hepcidin mimics is still in the experimental stage.16,17Tmprss6 siRNA and Tmprss6 antisense oligonucleotides also diminished iron overload in Hfe−/− mice and improved ineffective erythropoiesis in β-thalassemic mice,46,47 but face challenges of cost of synthesis and lack of experience with the long-term administration of these classes of compounds.

…In ahemochromatosismouse model with…

…mutations of thehemochromatosis( HFE )…

Show Full Abstract

Genetic iron-overload disorders, mainly hereditary hemochromatosis and untransfused β-thalassemia, affect a large population worldwide. The primary etiology of iron overload in these diseases is insufficient production of hepcidin by the liver, leading to excessive intestinal iron absorption and iron efflux from macrophages. Hepcidin agonists would therefore be expected to ameliorate iron overload in hereditary hemochromatosis and β-thalassemia. In the current study, we screened our synthetic library of 210 thiazolidinone compounds and identified three thiazolidinone compounds, 93, 156 and 165, which stimulated hepatic hepcidin production. In a hemochromatosis mouse model with hemochromatosis deficiency, the three compounds prevented the development of iron overload and elicited iron redistribution from the liver to the spleen. Moreover, these compounds also greatly ameliorated iron overload and mitigated ineffective erythropoiesis in β-thalassemic mice. Compounds 93, 156 and 165 acted by promoting SMAD1/5/8 signaling through differentially repressing ERK1/2 phosphorylation and decreasing transmembrane protease serine 6 activity. Additionally, compounds 93, 156 and 165 targeted erythroid regulators to strengthen hepcidin expression. Therefore, our hepcidin agonists induced hepcidin expression synergistically through a direct action on hepatocytes via SMAD1/5/8 signaling and an indirect action via eythroid cells. By increasing hepcidin production, thiazolidinone compounds may provide a useful alternative for the treatment of iron-overload disorders.

Also flagged:axonsaxonVasodilator-stimulated phosphoproteinsaxon guidancecol-99transmembrane collagen
Journal Article 2019-02-21 ✓ 1 Snippet Taylor J, Hutter H.
In-Text Gene Mentions

DCC receptors

Show Full Abstract

The central nervous system of most animals is bilaterally symmetrical. Closer observation often reveals some functional or anatomical left-right asymmetries. In the nematode <i>Caenorhabditis elegans</i>, the most obvious asymmetry in the nervous system is found in the ventral nerve cord (VNC), where most axons are in the right axon tract. The asymmetry is established when axons entering the VNC from the brain switch from the left to the right side at the anterior end of the VNC. In genetic screens we identified several mutations compromising VNC asymmetry. This includes alleles of <i>col-99</i> (encoding a transmembrane collagen), <i>unc-52</i>/perlecan and <i>unc-34</i> (encoding the actin modulator Enabled/Vasodilator-stimulated phosphoproteins). In addition, we evaluated mutants in known axon guidance pathways for asymmetry defects and used genetic interaction studies to place the genes into genetic pathways. In total we identified four different pathways contributing to the establishment of VNC asymmetry, represented by UNC-6/netrin, SAX-3/Robo, COL-99, and EPI-1/laminin. The combined inactivation of these pathways in triple and quadruple mutants leads to highly penetrant VNC asymmetry defects, suggesting these pathways are important contributors to the establishment of VNC asymmetry in <i>C. elegans</i>.

Also flagged:status epilepticusSEearly growth response 1Egr1regulatorpilocarpine
Journal Article 2019-02-21 ✓ 1 Snippet van Loo KMJ, Rummel CK, Pitsch J, Müller JA, Bikbaev AF, Martinez-Chavez E, Blaess S, Dietrich D, Heine M, Becker AJ, Schoch S.
In-Text Gene Mentions

Cacna1e

Show Full Abstract

Transient brain insults, including status epilepticus (SE), can trigger a period of epileptogenesis during which functional and structural reorganization of neuronal networks occurs resulting in the onset of focal epileptic seizures. In recent years, mechanisms that regulate the dynamic transcription of individual genes during epileptogenesis and thereby contribute to the development of a hyperexcitable neuronal network have been elucidated. Our own results have shown early growth response 1 (Egr1) to transiently increase expression of the T-type voltage-dependent Ca<sup>2+</sup> channel (VDCC) subunit Ca<sub>V</sub>3.2, a key proepileptogenic protein. However, epileptogenesis involves complex and dynamic transcriptomic alterations; and so far, our understanding of the transcriptional control mechanism of gene regulatory networks that act in the same processes is limited. Here, we have analyzed whether Egr1 acts as a key transcriptional regulator for genes contributing to the development of hyperexcitability during epileptogenesis. We found Egr1 to drive the expression of the VDCC subunit α2δ4, which was augmented early and persistently after pilocarpine-induced SE. Furthermore, we show that increasing levels of α2δ4 in the CA1 region of the hippocampus elevate seizure susceptibility of mice by slightly decreasing local network activity. Interestingly, we also detected increased expression levels of Egr1 and α2δ4 in human hippocampal biopsies obtained from epilepsy surgery. In conclusion, Egr1 controls the abundance of the VDCC subunits Ca<sub>V</sub>3.2 and α2δ4, which act synergistically in epileptogenesis, and thereby contributes to a seizure-induced "transcriptional Ca<sup>2+</sup> channelopathy."<b>SIGNIFICANCE STATEMENT</b> The onset of focal recurrent seizures often occurs after an epileptogenic process induced by transient insults to the brain. Recently, transcriptional control mechanisms for individual genes involved in converting neurons hyperexcitable have been identified, including early growth response 1 (Egr1), which activates transcription of the T-type Ca<sup>2+</sup> channel subunit Ca<sub>V</sub>3.2. Here, we find Egr1 to regulate also the expression of the voltage-dependent Ca<sup>2+</sup> channel subunit α2δ4, which was augmented after pilocarpine- and kainic acid-induced status epilepticus. In addition, we observed that α2δ4 affected spontaneous network activity and the susceptibility for seizure induction. Furthermore, we detected corresponding dynamics in human biopsies from epilepsy patients. In conclusion, Egr1 orchestrates a seizure-induced "transcriptional Ca<sup>2+</sup> channelopathy" consisting of Ca<sub>V</sub>3.2 and α2δ4, which act synergistically in epileptogenesis.

Also flagged:OAlocalizationimmune responsetoll-like receptorextracellular matrixorganization
Journal Article 2019-02-21 No Snippets Rai MF, Tycksen ED, Cai L, Yu J, Wright RW, Brophy RH.
Show Full Abstract

<h4>Objective</h4>To compare the transcriptome of articular cartilage from knees with meniscus tears to knees with end-stage osteoarthritis (OA).<h4>Design</h4>Articular cartilage was collected from the non-weight bearing medial intercondylar notch of knees undergoing arthroscopic partial meniscectomy (APM; N = 10, 49.7 ± 10.8 years, 50% females) for isolated medial meniscus tears and knees undergoing total knee arthroplasty (TKA; N = 10, 66.0 ± 7.6 years, 70% females) due to end-stage OA. Ribonucleic acid (RNA) preparation was subjected to SurePrint G3 human 8 × 60K RNA microarrays to probe differentially expressed transcripts followed by computational exploration of underlying biological processes. Real-time polymerase chain reaction amplification was performed on selected transcripts to validate microarray data.<h4>Results</h4>We observed that 81 transcripts were significantly differentially expressed (45 elevated, 36 repressed) between APM and TKA samples (≥ 2 fold) at a false discovery rate of ≤ 0.05. Among these, CFD, CSN1S1, TSPAN11, CSF1R and CD14 were elevated in the TKA group, while CHI3L2, HILPDA, COL3A1, COL27A1 and FGF2 were highly expressed in APM group. A few long intergenic non-coding RNAs (lincRNAs), small nuclear RNAs (snoRNAs) and antisense RNAs were also differentially expressed between the two groups. Transcripts up-regulated in TKA cartilage were enriched for protein localization and activation, chemical stimulus, immune response, and toll-like receptor signaling pathway. Transcripts up-regulated in APM cartilage were enriched for mesenchymal cell apoptosis, epithelial morphogenesis, canonical glycolysis, extracellular matrix organization, cartilage development, and glucose catabolic process.<h4>Conclusions</h4>This study suggests that APM and TKA cartilage express distinct sets of OA transcripts. The gene profile in cartilage from TKA knees represents an end-stage OA whereas in APM knees it is clearly earlier in the degenerative process.

Also flagged:deathcell-cell adhesion moleculesE-cadherinα-cateninL1CAMcancer
Journal Article 2019-02-21 ✓ 1 Snippet Gordon KL, Payne SG, Linden-High LM, Pani AM, Goldstein B, Hubbard EJA, Sherwood DR.
In-Text Gene Mentions

DCC

Show Full Abstract

Niche cell enwrapment of stem cells and their differentiating progeny is common and provides a specialized signaling and protective environment. Elucidating the mechanisms underlying enwrapment behavior has important basic and clinical significance in not only understanding how niches are formed and maintained but also how they can be engineered and how they are misregulated in human pathologies, such as cancer. Previous work in C. elegans found that, when germ cells, which are enwrapped by somatic gonadal niche cells, are freed into the body cavity, they embed into other tissues. We investigated this phenomenon using live-cell imaging and discovered that ectopic germ cells preferentially induce body-wall muscle to extend cellular processes that enwrap the germ cells, the extent of which was strikingly similar to the distal tip cell (DTC)-germ stem cell niche. Enwrapment was specific for escaped germ cells, and genetic analysis revealed it did not depend on pathways that control cell death and engulfment or muscle arm extension. Instead, using a large-scale RNAi screen and GFP knockin strains, we discovered that the enwrapping behavior of muscle relied upon the same suite of cell-cell adhesion molecules that functioned in the endogenous niche: the C. elegans E-cadherin HMR-1, its intracellular associates α-catenin (HMP-1) and β-catenin (HMP-2), and the L1CAM protein SAX-7. This ectopic niche-like behavior resembles the seed-and-soil model of cancer metastasis and offers a new model to understand factors regulating ectopic niche formation.

Also flagged:Aminoacyl transfer RNA (tRNA) synthetase complexinteracting multifunctional protein ItRNA multi-synthetaseamino acidsAIMP1axonal growth
Journal Article 2019-02-21 ✓ 1 Snippet Khan A, Bennett J, Scantlebury MH, Wei XC, Kerr M.
In-Text Gene Mentions

…in the geneDARS2(OMIM 610956( http://omim.org/…

Show Full Abstract

Aminoacyl transfer RNA (tRNA) synthetase complex-interacting multifunctional protein I is a noncatalytic component of tRNA multi-synthetase complexes. Although important in joining tRNAs to their cognate amino acids, AIMP1 has several other functions including axonal growth, cytokine activity, and interactions with <i>N</i>-acetylaspartic acid in ribosomal tRNA synthetase complexes. Further, <i>N</i>-acetylaspartic acid donates an aspartate during myelination and is therefore important to axonal integrity. Mutations in <i>AIMP1</i> can disrupt these functions, as demonstrated in this clinical case study of 2 monozygotic twins, who display congenital opisthotonus, microcephaly, severe developmental delay, and seizures. Whole exome sequencing was used to identify a premature stop codon in the <i>AIMP1</i> gene (g. 107248613_c.115C>T; p.(Gln39). In the absence of whole exome sequencing, we propose that decreased <i>N</i>-acetylaspartic acid peaks on magnetic resonance spectroscopy could act as a biomarker for <i>AIMP1</i> mutations.

Also flagged:Myopia diseaseZinc finger 644transcription factormyopiaG9aGLP
Journal Article 2019-02-21 ✓ 5 Snippets Szczerkowska KI, Petrezselyova S, Lindovsky J, Palkova M, Dvorak J, Makovicky P, Fang M, Jiang C, Chen L, Shi M, Liu X, Zhang J, Kubik-Zahorodna A, Schuster B, Beck IM, Novosadova V, Prochazka J, Sedlacek R.
In-Text Gene Mentions

Our findings prove that ZNF644/Zfp644 is involved in the development of high-myopia, indicating that mutations such as, Zfp644S673G and Zfp644Δ8 are causative for changes connected with the disease.

Taking in account that myopia is not a retina related disease, the mouse model provides better opportunities to study the molecular role of ZNF644 in human patients with inherited high myopia, then lower vertebrate model.

Among them, ZNF644 was identified as a potential factor causing inherited myopia in different populations [13, 15–18].

All these results point to the important regulatory role of ZNF644 in myopia development.

…(Zfp644 in mouse,ZNF644in human) gene…

Show Full Abstract

Zinc finger 644 (Zfp644 in mouse, ZNF644 in human) gene is a transcription factor whose mutation S672G is considered a potential genetic factor of inherited high myopia. ZNF644 interacts with G9a/GLP complex, which functions as a H3K9 methyltransferase to silence transcription. In this study, we generated mouse models to unravel the mechanisms leading to symptoms associated with high myopia. Employing TALEN technology, two mice mutants were generated, either with the disease-carrying mutation (<i>Zfp644</i> <sup><i>S673G</i></sup> ) or with a truncated form of <i>Zfp644</i> (<i>Zfp644</i> <sup><i>Δ8</i></sup> ). Eye morphology and visual functions were analysed in both mutants, revealing a significant difference in a vitreous chamber depth and lens diameter, however the physiological function of retina was preserved as found under the high-myopia conditions. Our findings prove that ZNF644/Zfp644 is involved in the development of high-myopia, indicating that mutations such as, <i>Zfp644</i> <sup><i>S673G</i></sup> and <i>Zfp644</i> <sup><i>Δ8</i></sup> are causative for changes connected with the disease. The developed models represent a valuable tool to investigate the molecular basis of myopia pathogenesis and its potential treatment.

Also flagged:NMDARGluN2B-type NMDARHuntington diseaseHDdeathGluN2B
Journal Article 2019-02-21 ✓ 5 Snippets Kang R, Wang L, Sanders SS, Zuo K, Hayden MR, Raymond LA.
In-Text Gene Mentions

Moreover, GluN2B is a hub protein for the postsynaptic Htt interactome (Shirasaki et al., 2012), and several lines of evidence support the idea of altered NMDAR signaling in human HD striatum.

Progressive striatal atrophy and behavioral manifestations of HD are reproduced in the YAC128 transgenic mouse model, expressing the full-length human genomic DNA for mutant Htt (mHtt) (Slow et al., 2003).

Together, these results strongly suggest a link between mutant Htt and early enhanced excitotoxic vulnerability of striatal neurons in HD through altered GluN2B palmitoylation by HIP14L, one of two unique Huntingtin-interacting PATs, that differentially interact with and modulate the palmitoylation of GluN2B on the two Cys clusters (Figure 8).

HD is caused by a CAG repeat expansion >35 in the gene for huntingtin (Htt) (Lin et al., 1993), which results in prominent degeneration of striatal medium-sized spiny neurons (MSNs) (Vonsattel and Difiglia, 1998).

In this study, we investigated whether palmitoylation of GluN2B contributes to increased 2B-NMDAR extrasynaptic localization in striatal neurons from YAC128 HD mice and explored a role for Htt-associated PATs (HIP14 and HIP14L) in regulating GluN2B palmitoylation.

Show Full Abstract

<i>N</i>-methyl-D-aspartate receptors (NMDARs) play a critical role in synaptic signaling, and alterations in the synaptic/extrasynaptic NMDAR balance affect neuronal survival. Studies have shown enhanced extrasynaptic GluN2B-type NMDAR (2B-NMDAR) activity in striatal neurons in the YAC128 mouse model of Huntington disease (HD), resulting in increased cell death pathway activation contributing to striatal vulnerability to degeneration. However, the mechanism(s) of altered GluN2B trafficking remains unclear. Previous work shows that GluN2B palmitoylation on two C-terminal cysteine clusters regulates 2B-NMDAR trafficking to the surface membrane and synapses in cortical neurons. Notably, two palmitoyl acyltransferases (PATs), zDHHC17 and zDHHC13, also called huntingtin-interacting protein 14 (HIP14) and HIP14-like (HIP14L), directly interact with the huntingtin protein (Htt), and mutant Htt disrupts this interaction. Here, we investigated whether GluN2B palmitoylation is involved in enhanced extrasynaptic surface expression of 2B-NMDARs in YAC128 striatal neurons and whether this process is regulated by HIP14 or HIP14L. We found reduced GluN2B palmitoylation in YAC128 striatum, specifically on cysteine cluster II. Consistent with that finding, the palmitoylation-deficient GluN2B Cysteine cluster II mutant exhibited enhanced, extrasynaptic surface expression in striatal neurons from wild-type mice, mimicking increased extrasynaptic 2B-NMDAR observed in YAC128 cultures. We also found that HIP14L palmitoylated GluN2B cysteine cluster II. Moreover, GluN2B palmitoylation levels were reduced in striatal tissue from HIP14L-deficient mice, and siRNA-mediated HIP14L knockdown in cultured neurons enhanced striatal neuronal GluN2B surface expression and susceptibility to NMDA toxicity. Thus, altered regulation of GluN2B palmitoylation levels by the huntingtin-associated PAT HIP14L may contribute to the cell death-signaling pathways underlying HD.

Also flagged:GADgene expressionCASesophagitiscolon cancerCCR2
Journal Article 2019-02-21 No Snippets Zhang R, Zhu X, Bai H, Ning K.
Show Full Abstract

The research field of systems biology has greatly advanced and, as a result, the concept of network pharmacology has been developed. This advancement, in turn, has shifted the paradigm from a "one-target, one-drug" mode to a "network-target, multiple-component-therapeutics" mode. Network pharmacology is more effective for establishing a "compound-protein/gene-disease" network and revealing the regulation principles of small molecules in a high-throughput manner. This approach makes it very powerful for the analysis of drug combinations, especially Traditional Chinese Medicine (TCM) preparations. In this work, we first summarized the databases and tools currently used for TCM research. Second, we focused on several representative applications of network pharmacology for TCM research, including studies on TCM compatibility, TCM target prediction, and TCM network toxicology research. Third, we compared the general statistics of several current TCM databases and evaluated and compared the search results of these databases based on 10 famous herbs. In summary, network pharmacology is a rational approach for TCM studies, and with the development of TCM research, powerful and comprehensive TCM databases have emerged but need further improvements. Additionally, given that several diseases could be treated by TCMs, with the mediation of gut microbiota, future studies should focus on both the microbiome and TCMs to better understand and treat microbiome-related diseases.

Also flagged:coagulationfibrinolysiscardiac arrestNeuron-specific enolaseNSES100-B protein
Journal Article 2019-02-20 ✓ 1 Snippet Park JH, Wee JH, Choi SP, Oh JH, Cheol S.
In-Text Gene Mentions

…fibrin degradation product,antithrombin-III, fibrinogen, and lactate…

Show Full Abstract

<h4>Objective</h4>Despite increased survival in patients with cardiac arrest, it remains difficult to determine patient prognosis at the early stage. This study evaluated the prognosis of cardiac arrest patients using brain injury, inflammation, cardiovascular ischemic events, and coagulation/fibrinolysis markers collected 24, 48, and 72 hours after return of spontaneous circulation (ROSC).<h4>Methods</h4>From January 2011 to December 2016, we retrospectively observed patients who underwent therapeutic hypothermia. Blood samples were collected immediately and 24, 48, and 72 hours after ROSC. Neuron-specific enolase (NSE), S100-B protein, procalcitonin, troponin I, creatine kinase-MB, pro-brain natriuretic protein, D-dimer, fibrin degradation product, antithrombin-III, fibrinogen, and lactate levels were measured. Prognosis was evaluated using GlasgowPittsburgh cerebral performance categories and the predictive accuracy of each marker was evaluated. The secondary outcome was whether the presence of multiple markers improved prediction accuracy.<h4>Results</h4>A total of 102 patients were included in the study: 39 with good neurologic outcomes and 63 with poor neurologic outcomes. The mean NSE level of good outcomes measured 72 hours after ROSC was 18.50 ng/mL. The area under the curve calculated on receiver operating characteristic analysis was 0.92, which showed the best predictive power among all markers included in the study analysis. The relative integrated discrimination improvement and categoryfree net reclassification improvement models showed no improvement in prognostic value when combined with all other markers and NSE (72 hours).<h4>Conclusion</h4>Although biomarker combinations did not improve prognostic accuracy, NSE (72 hours) showed the best predictive power for neurological prognosis in patients who received therapeutic hypothermia.

Also flagged:Tnnc1Cxcl14Ccl8NppadiclofenacCACT
Journal Article 2019-02-20 ✓ 1 Snippet Muraoka N, Nara K, Tamura F, Kojima H, Yamakawa H, Sadahiro T, Miyamoto K, Isomi M, Haginiwa S, Tani H, Kurotsu S, Osakabe R, Torii S, Shimizu S, Okano H, Sugimoto Y, Fukuda K, Ieda M.
In-Text Gene Mentions

…Il1r1 , andTnfsf4, were downregulated…

Show Full Abstract

Direct cardiac reprogramming from fibroblasts can be a promising approach for disease modeling, drug screening, and cardiac regeneration in pediatric and adult patients. However, postnatal and adult fibroblasts are less efficient for reprogramming compared with embryonic fibroblasts, and barriers to cardiac reprogramming associated with aging remain undetermined. In this study, we screened 8400 chemical compounds and found that diclofenac sodium (diclofenac), a non-steroidal anti-inflammatory drug, greatly enhanced cardiac reprogramming in combination with Gata4, Mef2c, and Tbx5 (GMT) or GMT plus Hand2. Intriguingly, diclofenac promoted cardiac reprogramming in mouse postnatal and adult tail-tip fibroblasts (TTFs), but not in mouse embryonic fibroblasts (MEFs). Mechanistically, diclofenac enhanced cardiac reprogramming by inhibiting cyclooxygenase-2, prostaglandin E2/prostaglandin E receptor 4, cyclic AMP/protein kinase A, and interleukin 1β signaling and by silencing inflammatory and fibroblast programs, which were activated in postnatal and adult TTFs. Thus, anti-inflammation represents a new target for cardiac reprogramming associated with aging.

Also flagged:StradasilvercoilfitTMImanganite
Journal Article 2019-02-20 No Snippets Merten S, Shapoval O, Damaschke B, Samwer K, Moshnyaga V.
Show Full Abstract

A long-standing issue in the physics of the colossal magnetoresistance is the role of electron-phonon coupling, which manifests itself as Jahn-Teller polarons. The origin and architecture of polarons makes it possible to study their behavior by Raman spectroscopy, which allows to analyze the polaronic behavior in an applied magnetic field. We performed magnetic-field-dependent Raman spectroscopy on thin films of (La<sub>0.6</sub>Pr<sub>0.4</sub>)<sub>0.7</sub>Ca<sub>0.3</sub>MnO<sub>3</sub> in a range of H = 0-50 kOe and compared the obtained Raman spectra with the magnetic field behavior of the electrical resistivity. In the vicinity of the Curie temperature, T<sub>C</sub> = 197 K, the intensity of the Jahn-Teller stretching mode at 614 cm<sup>-1</sup> and of the bending mode at 443 cm<sup>-1</sup> was found to be suppressed and enhanced, respectively. This observed behavior has a remarkable similarity with the field and temperature dependence of the colossal magnetoresistance in (La<sub>0.6</sub>Pr<sub>0.4</sub>)<sub>0.7</sub>Ca<sub>0.3</sub>MnO<sub>3</sub>. Our work provides direct evidence that the reduction of the amount of Jahn-Teller polarons at the phase transition is the main mechanism underlying the colossal magnetoresistance.

Also flagged:deathmyeloid neoplasmsBMTLeukemiamyelodysplasiaSer
Journal Article 2019-02-20 ✓ 2 Snippets Follo MY, Pellagatti A, Armstrong RN, Ratti S, Mongiorgi S, De Fanti S, Bochicchio MT, Russo D, Gobbi M, Miglino M, Parisi S, Martinelli G, Cavo M, Luiselli D, McCubrey JA, Suh PG, Manzoli L, Boultwood J, Finelli C, Cocco L.
In-Text Gene Mentions

…whereas SOD2 andHFEgenes showed no…

…AKT3, MAP3K1, PIK3R1,HFE, CDKN1A, SOD2, AKT1,…

Show Full Abstract

Specific myeloid-related and inositide-specific gene mutations can be linked to myelodysplastic syndromes (MDS) pathogenesis and therapy. Here, 44 higher-risk MDS patients were treated with azacitidine and lenalidomide and mutations analyses were performed at baseline and during the therapy. Results were then correlated to clinical outcome, overall survival (OS), leukemia-free-survival (LFS) and response to therapy. Collectively, 34/44 patients were considered evaluable for response, with an overall response rate of 76.25% (26/34 cases): 17 patients showed a durable response, 9 patients early lost response and 8 patients never responded. The most frequently mutated genes were ASXL1, TET2, RUNX1, and SRSF2. All patients early losing response, as well as cases never responding, acquired the same 3 point mutations during therapy, affecting respectively PIK3CD (D133E), AKT3 (D280G), and PLCG2 (Q548R) genes, that regulate cell proliferation and differentiation. Moreover, Kaplan-Meier analyses revealed that this mutated cluster was significantly associated with a shorter OS, LFS, and duration of response. All in all, a common mutated cluster affecting 3 inositide-specific genes is significantly associated with loss of response to azacitidine and lenalidomide therapy in higher risk MDS. Further studies are warranted to confirm these data and to further analyze the functional role of this 3-gene cluster.

Also flagged:gestationgene expressionorganogenesismatingsnitrogendigoxigenin
Journal Article 2019-02-20 No Snippets Cao J, Spielmann M, Qiu X, Huang X, Ibrahim DM, Hill AJ, Zhang F, Mundlos S, Christiansen L, Steemers FJ, Trapnell C, Shendure J.
Show Full Abstract

Mammalian organogenesis is a remarkable process. Within a short timeframe, the cells of the three germ layers transform into an embryo that includes most of the major internal and external organs. Here we investigate the transcriptional dynamics of mouse organogenesis at single-cell resolution. Using single-cell combinatorial indexing, we profiled the transcriptomes of around 2 million cells derived from 61 embryos staged between 9.5 and 13.5 days of gestation, in a single experiment. The resulting 'mouse organogenesis cell atlas' (MOCA) provides a global view of developmental processes during this critical window. We use Monocle 3 to identify hundreds of cell types and 56 trajectories, many of which are detected only because of the depth of cellular coverage, and collectively define thousands of corresponding marker genes. We explore the dynamics of gene expression within cell types and trajectories over time, including focused analyses of the apical ectodermal ridge, limb mesenchyme and skeletal muscle.

Also flagged:hepatic cirrhosismineralcirrhosisLiver cirrhosisosteoporosisChronic liver disease
Journal Article 2019-02-20 ✓ 2 Snippets Wakolbinger R, Muschitz C, Scheriau G, Bodlaj G, Kocijan R, Feichtinger X, Schanda JE, Haschka J, Resch H, Pietschmann P.
In-Text Gene Mentions

…, such ashemochromatosisbased on histology…

…disease, 2 withhemochromatosis, and one with…

Show Full Abstract

Liver cirrhosis leads to bone loss. To date, information on bone quality (three-dimensional microarchitecture) and, thus, bone strength is scarce. We observed decreased bone quality at both assessed sites, independent of disease severity. Therefore, all patients should undergo early-stage screening for osteoporosis.<h4>Introduction</h4>Recent studies found low bone mineral density in cirrhosis, but data on bone microstructure are scarce. This study assessed weight-bearing and non-weight-bearing bones in patients with cirrhosis and healthy controls. The primary objective was to evaluate trabecular and cortical microarchitecture.<h4>Methods</h4>This was a single-center study in patients with recently diagnosed hepatic cirrhosis. Thirty-two patients and 32 controls participated in this study. After determining the type of cirrhosis, the parameters of bone microarchitecture were assessed by high-resolution peripheral quantitative computed tomography.<h4>Results</h4>Both cortical and trabecular microarchitectures showed significant alterations. At the radius, trabecular bone volume fraction was 17% lower (corrected p = 0.028), and, at the tibia, differences were slightly more pronounced. Trabecular bone volume fraction was 19% lower (p = 0.024), cortical bone mineral density 7% (p = 0.007), and cortical thickness 28% (p = 0.001), while cortical porosity was 32% higher (p = 0.023), compared to controls. Areal bone mineral density was lower (lumbar spine - 13%, total hip - 11%, total body - 9%, radius - 17%, and calcaneus - 26%). There was no correlation between disease severity and microarchitecture. Areal bone mineral density (aBMD) measured by dual-energy X-ray absorptiometry (DXA) correlated well with parameters of cortical and trabecular microarchitecture.<h4>Conclusions</h4>Hepatic cirrhosis deteriorates both trabecular and cortical microarchitecture, regardless of disease severity. Areal bone mineral density is diminished at all sites as a sign of generalized affection. In patients with hepatic cirrhosis, regardless of its origin or disease severity, aBMD measurements are an appropriate tool for osteologic screening.

Also flagged:prionfibrilsdeathcognitivebehavioralimmune response
Journal Article 2019-02-20 ✓ 5 Snippets Masnata M, Sciacca G, Maxan A, Bousset L, Denis HL, Lauruol F, David L, Saint-Pierre M, Kordower JH, Melki R, Alpaugh M, Cicchetti F.
In-Text Gene Mentions

Importantly, HD is caused by a CAG repeat expansion beyond 35 in exon1 of the huntingtin gene which encodes for huntingtin (HTT), a cytoplasmic protein ubiquitously expressed and present both in humans and rodents, with a particularly high expression in the brain [47].

…pattern of endogenousHTTwas detected.…

…encodes for huntingtin (HTT), a cytoplasmic protein…

…of recombinant N-terminalHTTfibrillar fragments, termed…

…EndogenousHTTis visible as…

Show Full Abstract

In recent years, evidence has accumulated to suggest that mutant huntingtin protein (mHTT) can spread into healthy tissue in a prion-like fashion. This theory, however, remains controversial. To fully address this concept and to understand the possible consequences of mHTT spreading to Huntington's disease pathology, we investigated the effects of exogenous human fibrillar mHTT (Q48) and huntingtin (HTT) (Q25) N-terminal fragments in three cellular models and three distinct animal paradigms. For in vitro experiments, human neuronal cells [induced pluripotent stem cell-derived GABA neurons (iGABA) and (SH-SY5Y)] as well as human THP1-derived macrophages, were incubated with recombinant mHTT fibrils. Recombinant mHTT and HTT fibrils were taken up by all cell types, inducing cell morphology changes and death. Variations in HTT aggregation were further observed following incubation with fibrils in both THP1 and SH-SY5Y cells. For in vivo experiments, adult wild-type (WT) mice received a unilateral intracerebral cortical injection and R6/2 and WT pups were administered fibrils via bilateral intraventricular injections. In both protocols, the injection of Q48 fibrils resulted in cognitive deficits and increased anxiety-like behavior. Post-mortem analysis of adult WT mice indicated that most fibrils had been degraded/cleared from the brain by 14 months post-surgery. Despite the absence of fibrils at these later time points, a change in the staining pattern of endogenous HTT was detected. A similar change was revealed in post-mortem analysis of the R6/2 mice. These effects were specific to central administration of fibrils, as mice receiving intravenous injections were not characterized by behavioral changes. In fact, peripheral administration resulted in an immune response mounting against the fibrils. Together, the in vitro and in vivo data indicate that exogenously administered mHTT is capable of both causing and exacerbating disease pathology.

Also flagged:hepatocellular carcinomaAngiogenesispathogenesissorafenibBevacizumabVEGF
Journal Article 2019-02-20 ✓ 1 Snippet Wattenberg MM, Damjanov N, Kaplan DE.
In-Text Gene Mentions

…liver disease includedhemochromatosisand chronic liver…

Show Full Abstract

Hepatocellular carcinoma (HCC) is a challenging to treat malignancy with few available systemic therapies. Angiogenesis has been implicated in the pathogenesis of HCC and prior studies have suggested a role for anti-VEGF therapy. Prior to FDA approval of second-line therapy for advanced HCC, from 2008 until 2017, we initiated bevacizumab monotherapy (5-10 mg/kg every 2-3 weeks) in 12 patients with intolerance of or progression during sorafenib therapy. Bevacizumab therapy was well tolerated with only 1/12 patients experiencing a grade 3-4 treatment-related adverse event (transient ischemic attack) and only 2/12 patients discontinued the therapy due to adverse events. Median overall survival was 20.2 months (IQR, 7.0-43.5), with a median time to radiologic progression of 10.4 months (IQR, 2.8-16.1) and a disease control rate of 54%. Taken together, our experience provides rationale for further prospective investigation of bevacizumab for the treatment of advanced HCC.

Also flagged:PhosphorusmetabolismmineralGene expressionresponse to stimuliCalcium
Journal Article 2019-02-20 No Snippets Gerlinger C, Oster M, Borgelt L, Reyer H, Muráni E, Ponsuksili S, Polley C, Vollmar B, Reichel M, Wolf P, Wimmers K.
Show Full Abstract

Phosphorus (P) is an important element of various metabolic and signalling processes, including bone metabolism and immune function. To elucidate the routes of P homeostasis and utilization, a five-week feeding study was conducted with weaned piglets receiving a diet with recommended amounts of P and Ca (M), or a diet with lower (L) or higher (H) P values and a constant Ca:P ratio. Routes of P utilization were deduced via bone characteristics (MicroCT), genome-wide transcriptomic profiles of peripheral blood mononuclear cells (PBMCs), and serum mineral levels. MicroCT revealed significantly lower bone mineral density, trabecular number, and mechanical fracture load in (L). Gene expression analyses showed transcripts of 276 and 115 annotated genes with higher or lower abundance in (H) than (L) that were related to basic cellular and metabolic processes as well as response to stimuli, developmental processes and immune system processes. This study shows the many molecular routes involved in P homeostasis that should be considered to improve endogenous mechanisms of P utilization.

Also flagged:methoxyphenylacetic acidcarbonspolyketideslactonegene expressionFusarisolins A
Journal Article 2019-02-20 No Snippets Niu S, Tang XX, Fan Z, Xia JM, Xie CL, Yang XW.
Show Full Abstract

Five new (fusarisolins A⁻E, <b>1</b> to <b>5</b>) and three known (<b>6</b> to <b>8</b>) polyketides were isolated from the marine-derived fungus <i>Fusarium</i> <i>solani</i> H918, along with six known phenolics (<b>9</b> to <b>14</b>). Their structures were established by comprehensive spectroscopic data analyses, methoxyphenylacetic acid (MPA) method, chemical conversion, and by comparison with data reported in the literature. Compounds <b>1</b> and <b>2</b> are the first two naturally occurring 21 carbons polyketides featuring a rare β- and γ-lactone unit, respectively. All isolates (<b>1</b> to <b>14</b>) were evaluated for their inhibitory effects against tea pathogenic fungus <i>Pestalotiopsis theae</i> and 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase gene expression. Compound <b>8</b> showed potent antifungal activity with an ED<sub>50</sub> value of 55 μM, while <b>1</b>, <b>8</b>, <b>13</b>, and <b>14</b> significantly inhibited HMG-CoA synthase gene expression.

Also flagged:Multiple SclerosisMSmicroglial cell activationoxygennitrogenmitochondrial
Journal Article 2019-02-20 No Snippets Correale J, Marrodan M, Ysrraelit MC.
Show Full Abstract

Multiple Sclerosis (MS) is a major cause of neurological disability, which increases predominantly during disease progression as a result of cortical and grey matter structures involvement. The gradual accumulation of disability characteristic of the disease seems to also result from a different set of mechanisms, including in particular immune reactions confined to the Central Nervous System such as: (a) B-cell dysregulation, (b) CD8⁺ T cells causing demyelination or axonal/neuronal damage, and (c) microglial cell activation associated with neuritic transection found in cortical demyelinating lesions. Other potential drivers of neurodegeneration are generation of oxygen and nitrogen reactive species, and mitochondrial damage, inducing impaired energy production, and intra-axonal accumulation of Ca<sup>2+</sup>, which in turn activates a variety of catabolic enzymes ultimately leading to progressive proteolytic degradation of cytoskeleton proteins. Loss of axon energy provided by oligodendrocytes determines further axonal degeneration and neuronal loss. Clearly, these different mechanisms are not mutually exclusive and could act in combination. Given the multifactorial pathophysiology of progressive MS, many potential therapeutic targets could be investigated in the future. This remains however, an objective that has yet to be undertaken.

Also flagged:GBMV-ATPasesacidification
Journal Article 2019-02-20 No Snippets Garnier D.
Show Full Abstract

No abstract available.

Also flagged:cancergene expressionRNA Pol-IIofcell cycleE2F1
Journal Article 2019-02-20 ✓ 1 Snippet Saleembhasha A, Mishra S.
In-Text Gene Mentions

…through Staufen 1 (STAU1)-mediated messenger RNA decay…

Show Full Abstract

Despite years of research, we are still unraveling crucial stages of gene expression regulation in cancer. On the basis of major biological hallmarks, we hypothesized that there must be a uniform gene expression pattern and regulation across cancer types. Among non-coding genes, long non-coding RNAs (lncRNAs) are emerging as key gene regulators playing powerful roles in cancer. Using TCGA RNAseq data, we analyzed coding (mRNA) and non-coding (lncRNA) gene expression across 15 and 9 common cancer types, respectively. 70 significantly differentially expressed genes common to all 15 cancer types were enlisted. Correlating with protein expression levels from Human Protein Atlas, we observed 34 positively correlated gene sets which are enriched in gene expression, transcription from RNA Pol-II, regulation of transcription and mitotic cell cycle biological processes. Further, 24 lncRNAs were among common significantly differentially expressed non-coding genes. Using guilt-by-association method, we predicted lncRNAs to be involved in same biological processes. Combining RNA-RNA interaction prediction and transcription regulatory networks, we identified E2F1, FOXM1 and <i>PVT1</i> regulatory path as recurring pan-cancer regulatory entity. <i>PVT1</i> is predicted to interact with <i>SYNE1</i> at 3'-UTR; <i>DNAJC9, RNPS1</i> at 5'-UTR and <i>ATXN2L, ALAD, FOXM1</i> and <i>IRAK1</i> at CDS sites. The key findings are that through E2F1, FOXM1 and <i>PVT1</i> regulatory axis and possible interactions with different coding genes, <i>PVT1</i> may be playing a prominent role in pan-cancer development and progression.

Also flagged:ironhereditary hemochromatosistransferrin receptorzincprotoporphyriniron deficiency
Journal Article 2019-02-20 ✓ 1 Snippet Allen A, Premawardhena A, Allen S, Rodrigo R, Manamperi A, Perera L, Wray K, Armitage A, Fisher C, Drakesmith A, Robson K, Weatherall D.
In-Text Gene Mentions

…allele of theHFEgene protects against…

Show Full Abstract

In hereditary hemochromatosis, iron overload is associated with homozygosity for the p.C282Y mutation. A second mutation, p.H63D, occurs at significant frequencies in Europe, North Africa, the Middle East and Asia. Early studies in Sri Lanka indicated that the variant had arisen independently, suggesting that it had been the subject of selective pressure. However, its role in iron absorption is unclear. In a survey of 7526 Sri Lankan secondary school students, we determined hemoglobin genotype and measured red cell indices, serum ferritin, transferrin receptor, iron zinc protoporphyrin and hepcidin. These variables were compared according to the presence or absence of the p.H63D variant in a subset of 1313 students for whom DNA samples were available. Students were classified as having low red cell indices if they had an MCV <80 fl and/or MCH <27 pg. Hetero and/or homozygosity for the p.H63D variant was more common in students with normal than low red cell indices (16.4% and 11.9% respectively; p = 0.019). Iron biomarkers and red cell indices were greater in children with the p.H63D variant than in normal and this was statistically significant for MCV (p = 0.046). Our findings suggest that selective pressure by mild iron deficiency contributes to the high frequencies of the p.H63D variant.

Also flagged:Hematopoietic Transcription FactorPU.1ETS-familytranscription factorhematopoiesiserythroid cell differentiation
Journal Article 2019-02-20 No Snippets Rothenberg EV, Hosokawa H, Ungerbäck J.
Show Full Abstract

PU.1 is an ETS-family transcription factor that plays a broad range of roles in hematopoiesis. A direct regulator of myeloid, dendritic-cell, and B cell functional programs, and a well-known antagonist of terminal erythroid cell differentiation, it is also expressed in the earliest stages of T-cell development of each cohort of intrathymic pro-T cells. Its expression in this context appears to give T-cell precursors initial, transient access to myeloid and dendritic cell developmental competence and therefore to represent a source of antagonism or delay of T-cell lineage commitment. However, it has remained uncertain until recently why T-cell development is also intensely dependent upon PU.1. Here, we review recent work that sheds light on the molecular biology of PU.1 action across the genome in pro-T cells and identifies the genes that depend on PU.1 for their correct regulation. This work indicates modes of chromatin engagement, pioneering, and cofactor recruitment ("coregulator theft") by PU.1 as well as gene network interactions that not only affect specific target genes but also have system-wide regulatory consequences, amplifying the impact of PU.1 beyond its own direct binding targets. The genes directly regulated by PU.1 also suggest a far-reaching transformation of cell biology and signaling potential between the early stages of T-cell development when PU.1 is expressed and when it is silenced. These cell-biological functions can be important to distinguish fetal from adult T-cell development and have the potential to illuminate aspects of thymic function that have so far remained the most mysterious.

Also flagged:gene expressionADagingmitochondrialaxonalmyelin
Journal Article 2019-02-20 ✓ 1 Snippet Berchtold NC, Prieto GA, Phelan M, Gillen DL, Baldi P, Bennett DA, Buchman AS, Cotman CW.
In-Text Gene Mentions

LRRC7

Show Full Abstract

Exercise has emerged as a powerful variable that can improve cognitive function and delay age-associated cognitive decline and Alzheimer's disease (AD); however, the underlying mechanisms are poorly understood. To determine if protective mechanisms may occur at the transcriptional level, we used microarrays to investigate the relationship between physical activity levels and gene expression patterns in the cognitively intact aged human hippocampus. In parallel, hippocampal gene expression patterns associated with aging and AD were assessed using publicly available microarray data profiling hippocampus from young (20-59 years), cognitively intact aging (73-95 years) and age-matched AD cases. To identify "anti-aging/AD" transcription patterns associated with physical activity, probesets significantly associated with both physical activity and aging/AD were identified and their directions of expression change in each condition were compared. Remarkably, of the 2210 probesets significant in both data sets, nearly 95% showed opposite transcription patterns with physical activity compared with aging/AD. The majority (>70%) of these anti-aging/AD genes showed increased expression with physical activity and decreased expression in aging/AD. Enrichment analysis of the anti-aging/AD genes showing increased expression in association with physical activity revealed strong overrepresentation of mitochondrial energy production and synaptic function, along with axonal function and myelin integrity. Synaptic genes were notably enriched for synaptic vesicle priming, release and recycling, glutamate and GABA signaling, and spine plasticity. Anti-aging/AD genes showing decreased expression in association with physical activity were enriched for transcription-related function (notably negative regulation of transcription). These data reveal that physical activity is associated with a more youthful profile in the hippocampus across multiple biological processes, providing a potential molecular foundation for how physical activity can delay age- and AD-related decline of hippocampal function.

bioRxiv 2019-02-20 Preprint (No Snippets API) Miladi M, Sokhoyan E, Houwaart T, Heyne S, Costa F, Grüning B, Backofen R.
Show Full Abstract

<h4>ABSTRACT</h4> RNA plays essential regulatory roles in all known forms of life. Clustering RNA sequences with common sequence and structure is an essential step towards studying RNA function. With the advent of high-throughput sequencing techniques, experimental and genomic data are expanding to complement the predictive methods. However, the existing methods do not effectively utilize and cope with the immense amount of data becoming available. Here we present GraphClust2, a comprehensive approach for scalable clustering of RNAs based on sequence and structural similarities. GraphClust2 provides an integrative solution by incorporating diverse types of experimental and genomic data in an accessible fashion via the Galaxy framework. We demonstrate that the tasks of clustering and annotation of structured RNAs can be considerably improved, through a scalable methodology that also supports structure probing data. Based on this, we further introduce an off-the-shelf procedure to identify locally conserved structure candidates in long RNAs. In this way, we suggest the presence and the sparsity of phylogenetically conserved local structures in some long non-coding RNAs. Furthermore, we demonstrate the advantage of a scalable clustering for discovering structured motifs under inherent and experimental biases and uncover prominent targets of the double-stranded RNA binding protein Roquin-1 that are evolutionary conserved.

bioRxiv 2019-02-20 Preprint (No Snippets API) Saleem M, Hodgkinson CP, Contreras EW, Xiao L, Gimenez-Bastida JA, Foss J, Payne AJ, Mirotsou M, Gama V, Dzau VJ, Gomez JA.
Show Full Abstract

<h4>ABSTRACT</h4> Juxtaglomerular (JG) cells, major sources of renin, differentiate from metanephric mesenchymal cells which give rise to JG cells or a subset of smooth muscle cells of the renal afferent arteriole. During periods of dehydration and salt deprivation JG cells undergo expansion. Gene expression profiling comparing resident renal Mesenchymal Stromal Cells (MSCs) with JG cells indicate that the transcription factor Sox6 is highly expressed in JG cells in the adult kidney. In vitro , loss of Sox6 expression reduces differentiation of renal MSCs to renin producing cells. In vivo , Sox6 expression is up-regulated during JG cell expansion. Importantly, knockout of Sox6 in Ren1d+ cells halts the increase in renin expressing cells normally seen during JG cell expansion as well as the typical increase in renin. These results support a previously undefined role for Sox6 in renin expression during normal and pathophysiological conditions.

bioRxiv 2019-02-20 Preprint (No Snippets API) Piszczek L, Memoli S, Raggioli A, Viosca J, Rientjes J, Hublitz P, Czaban W, Wyrzykowska A, Gross C.
Show Full Abstract

Genetic factors play a significant role in risk for mood and anxiety disorders. Polymorphisms in genes that regulate the brain monoamine systems, such as catabolic enzymes and transporters, are attractive candidates for being risk factors for emotional disorders given the weight of evidence implicating monoamines involvement in these conditions. Several common genetic variants have been identified in the human serotonin transporter (5-HTT) gene, including a repetitive sequence located in the promoter region of the locus called the serotonin transporter-linked polymorphic region (5-HTT-LPR). This polymorphism has been associated with a number of mental traits in both humans and primates, including depression, neuroticism, and harm avoidance. Some, but not all studies found a link between the polymorphism and 5-HTT levels, leaving open the question of whether the polymorphism affects risk for mental traits via changes in 5-HTT expression. To investigate the impact of the polymorphism on gene expression, serotonin homeostasis, and behavioural traits we set out to develop a mouse model of the human 5-HTT- LPR. Here we describe the creation and characterization of a set of mouse lines with single copy human transgenes carrying the short and long 5-HTT-LPR variants.

Also flagged:Myosin Xbone formationpodosomeMyo10OCUnc5b
Journal Article 2019-02-19 ✓ 1 Snippet Wang B, Pan JX, Yu H, Xiong L, Zhao K, Xiong S, Guo JP, Lin S, Sun D, Zhao L, Guo H, Mei L, Xiong WC.
In-Text Gene Mentions

DCC

Show Full Abstract

Normal bone mass is maintained by balanced bone formation and resorption. Myosin X (Myo10), an unconventional "myosin tail homology 4-band 4.1, ezrin, radixin, moesin" (MyTH4-FERM) domain containing myosin, is implicated in regulating osteoclast (OC) adhesion, podosome positioning, and differentiation in vitro. However, evidence is lacking for Myo10 in vivo function. Here we show that mice with Myo10 loss of function, Myo10<sup>m/m</sup> , exhibit osteoporotic deficits, which are likely due to the increased OC genesis and bone resorption because bone formation is unchanged. Similar deficits are detected in OC-selective Myo10 conditional knockout (cko) mice, indicating a cell autonomous function of Myo10. Further mechanistic studies suggest that Unc-5 Netrin receptor B (Unc5b) protein levels, in particular its cell surface level, are higher in the mutant OCs, but lower in RAW264.7 cells or HEK293 cells expressing Myo10. Suppressing Unc5b expression in bone marrow macrophages (BMMs) from Myo10<sup>m/m</sup> mice by infection with lentivirus of Unc5b shRNA markedly impaired RANKL-induced OC genesis. Netrin-1, a ligand of Unc5b, increased RANKL-induced OC formation in BMMs from both wild-type and Myo10<sup>m/m</sup> mice. Taken together, these results suggest that Myo10 plays a negative role in OC formation, likely by inhibiting Unc5b cell-surface targeting, and suppressing Netrin-1 promoted OC genesis. © 2019 American Society for Bone and Mineral Research.

Also flagged:Huntington's diseaseneurodegenerative disordercytosineadenineguaninepsychiatric
Journal Article 2019-02-19 ✓ 1 Snippet Rodrigues FB, Byrne LM, De Vita E, Johnson EB, Hobbs NZ, Thornton JS, Scahill RI, Wild EJ.
In-Text Gene Mentions

…expansion in theHTTgene, symptoms usually…

Show Full Abstract

Multiple targeted therapeutics for Huntington's disease are now in clinical trials, including intrathecally delivered compounds. Previous research suggests that CSF dynamics may be altered in Huntington's disease, which could be of paramount relevance to intrathecal drug delivery to the brain. To test this hypothesis, we conducted a prospective cross-sectional study comparing people with early stage Huntington's disease with age- and gender-matched healthy controls. CSF peak velocity, mean velocity and mean flow at the level of the cerebral aqueduct, and sub-arachnoid space in the upper and lower spine, were quantified using phase contrast MRI. We calculated Spearman's rank correlations, and tested inter-group differences with Wilcoxon rank-sum test. Ten people with early Huntington's disease, and 10 controls were included. None of the quantified measures was associated with potential modifiers of CSF dynamics (demographics, osmolality, and brain volumes), or by known modifiers of Huntington's disease (age and HTTCAG repeat length); and no significant differences were found between the two studied groups. While external validation is required, the attained results are sufficient to conclude tentatively that a clinically relevant alteration of CSF dynamics - that is, one that would justify dose-adjustments of intrathecal drugs - is unlikely to exist in Huntington's disease.

Also flagged:Ddb1ubiquitin ligasessister chromatidCohesin acetyltransferasesESCO1ESCO2
Journal Article 2019-02-19 ✓ 5 Snippets Sun H, Zhang J, Xin S, Jiang M, Zhang J, Li Z, Cao Q, Lou H.
In-Text Gene Mentions

FLAG-MMS22L was incubated with glutathione sepharose bound GST-ESCO2 or LG.

…also show thatMMS22L, a vertebrate ortholog…

…ubiquitin ligases (CRL4MMS22L), in collaboration…

…Both CRL4MMS22Land PCNA are…

…We show thatMMS22L(Mms22-like), the human…

Show Full Abstract

Cohesin acetyltransferases ESCO1 and ESCO2 play a vital role in establishing sister chromatid cohesion. How ESCO1 and ESCO2 are controlled in a DNA replication-coupled manner remains unclear in higher eukaryotes. Here we show a critical role of CUL4-RING ligases (CRL4s) in cohesion establishment via regulating ESCO2 in human cells. Depletion of CUL4A, CUL4B or DDB1 subunits substantially reduces the normal cohesion efficiency. We also show that MMS22L, a vertebrate ortholog of yeast Mms22, is one of DDB1 and CUL4-associated factors (DCAFs) involved in cohesion. Several lines of evidence show selective interaction of CRL4s with ESCO2 through LxG motif, which is lost in ESCO1. Depletion of either CRL4s or ESCO2 causes a defect in SMC3 acetylation, which can be rescued by HDAC8 inhibition. More importantly, both CRL4s and PCNA act as mediators for efficiently stabilizing ESCO2 on chromatin and catalyzing SMC3 acetylation. Taken together, we propose an evolutionarily conserved mechanism in which CRL4s and PCNA promote ESCO2-dependent establishment of sister chromatid cohesion.

Also flagged:synaptic transmissiontranslationalinjurynerve injurygene expressionsleep
Journal Article 2019-02-19 ✓ 1 Snippet Stephens KE, Zhou W, Ji Z, Chen Z, He S, Ji H, Guan Y, Taverna SD.
In-Text Gene Mentions

…(e.g., Cacna1a, Cacna1b,Cacna1e, Scn9a), ligand-gated ion…

Show Full Abstract

<h4>Background</h4>Pain is a subjective experience derived from complex interactions among biological, environmental, and psychosocial pathways. Sex differences in pain sensitivity and chronic pain prevalence are well established. However, the molecular basis underlying these sex dimorphisms are poorly understood particularly with regard to the role of the peripheral nervous system. Here we sought to identify shared and distinct gene networks functioning in the peripheral nervous systems that may contribute to sex differences of pain in rats after nerve injury.<h4>Results</h4>We performed RNA-seq on dorsal root ganglia following chronic constriction injury of the sciatic nerve in male and female rats. Analysis from paired naive and injured tissues showed that 1513 genes were differentially expressed between sexes. Genes which facilitated synaptic transmission in naïve and injured females did not show increased expression in males.<h4>Conclusions</h4>Appreciating sex-related gene expression differences and similarities in neuropathic pain models may help to improve the translational relevance to clinical populations and efficacy of clinical trials of this major health issue.

Also flagged:FBXW7ZEB2tumourcolorectal cancercancerE3-ubiquitin ligase
Journal Article 2019-02-19 ✓ 1 Snippet Li N, Babaei-Jadidi R, Lorenzi F, Spencer-Dene B, Clarke P, Domingo E, Tulchinsky E, Vries RGJ, Kerr D, Pan Y, He Y, Bates DO, Tomlinson I, Clevers H, Nateri AS.
In-Text Gene Mentions

…the expression ofOlfm4and Lgr5 repressed…

Show Full Abstract

Colorectal cancer (CRC) patients develop recurrence after chemotherapy owing to the survival of stem cell-like cells referred to as cancer stem-like cells (CSCs). The origin of CSCs is linked to the epithelial-mesenchymal transition (EMT) process. Currently, it remains poorly understood how EMT programmes enable CSCs residing in the tumour microenvironment to escape the effects of chemotherapy. This study identifies a key molecular pathway that is responsible for the formation of drug-resistant CSC populations. Using a modified yeast-2-hybrid system and 2D gel-based proteomics methods, we show that the E3-ubiquitin ligase FBXW7 directly binds and degrades the EMT-inducing transcription factor ZEB2 in a phosphorylation-dependent manner. Loss of FBXW7 induces an EMT that can be effectively reversed by knockdown of ZEB2. The FBXW7-ZEB2 axis regulates such important cancer cell features, as stemness/dedifferentiation, chemoresistance and cell migration in vitro, ex vivo and in animal models of metastasis. High expression of ZEB2 in cancer tissues defines the reduced ZEB2 expression in the cancer-associated stroma in patients and in murine intestinal organoids, demonstrating a tumour-stromal crosstalk that modulates a niche and EMT activation. Our study thus uncovers a new molecular mechanism, by which the CRC cells display differences in resistance to chemotherapy and metastatic potential.

Also flagged:insulinglucosehydroxyoleosidephenolic acidtrifluoroacetatedimolybdenum
Journal Article 2019-02-19 No Snippets Lee BW, Ha TKQ, Pham HTT, Hoang QH, Tran VO, Oh WK.
Show Full Abstract

As part of an ongoing study of new insulin mimetic agents from medicinal plants, the 70% EtOH extract of Symplocos cochinchinensis was found to have a stimulatory effect on glucose uptake in 3T3-L1 adipocyte cells. The intensive targeted isolation of this active extract resulted in ten new hydroxyoleoside-type compounds conjugated with a phenolic acid and monoterpene (1-6 and 8-11), as well as four known compounds (7 and 12-14). The chemical structures of the new compounds were determined based on spectroscopic data analysis (<sup>1</sup>H and <sup>13</sup>C NMR, HSQC, HMBC, NOESY and MS). The absolute configurations of the isolated compounds were determined by electronic circular dichroism (ECD) analysis of derivatives obtained after a series of reactions, such as those with dirhodium (ІІ) tetrakis (trifluoroacetate) and dimolybdenum (ІІ) tetraacetate. In vitro, compounds 3, 7 and 8 moderately increased the 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]-D-glucose (2-NBDG) uptake level in differentiated 3T3-L1 adipocytes. For further studies, we evaluated their effects on the expression of glucose transporter-4 (GLUT4), its translocation, protein tyrosine phosphatase 1B (PTP1B) inhibition and expression of phosphorylated Akt. Our results strongly suggest that the traditional uses of this plant can be described as active constituents by hydroxyoleoside-type compounds.

Also flagged:alpha-synucleinα-synprotein synthesisagingwatersugar
Journal Article 2019-02-19 ✓ 5 Snippets Fragniere AMC, Stott SRW, Fazal SV, Andreasen M, Scott K, Barker RA.
In-Text Gene Mentions

…1 huntingtin constructs (WT-htt, mut-htt) were a…

…ngtin constructs (WT-htt, mut-htt) were a kind…

…Tau and Huntingtin (htt), when overexpressed in…

…either Tau orhtt. (…

…proteins (Tau orhtt) did not exhibit…

Show Full Abstract

The aggregation of alpha-synuclein (α-syn) is a pathological feature of a number of neurodegenerative conditions, including Parkinson's disease. Genetic mutations, abnormal protein synthesis, environmental stress, and aging have all been implicated as causative factors in this process. The importance of water in the polymerisation of monomers, however, has largely been overlooked. In the present study, we highlight the role of hyperosmotic stress in inducing human α-syn to aggregate in cells in vitro, through rapid treatment of the cells with three different osmolytes: sugar, salt and alcohol. This effect is cell-dependent and not due to direct protein-osmolyte interaction, and is specific for α-syn when compared to other neurodegeneration-related proteins, such as Tau or Huntingtin. This new property of α-syn not only highlights a unique aspect of its behaviour which may have some relevance for disease states, but may also be useful as a screening test for compounds to inhibit the aggregation of α-syn in vitro.

Also flagged:XVIWolframXIIImineralArchaeolXII
Journal Article 2019-02-19 No Snippets Pfeifer SJ, Hartramph WL, Kahlke RD, Müller FA.
Show Full Abstract

Late Pleistocene societies throughout the northern hemisphere used mammoth and mastodon ivory not only for art and adornment, but also for tools, in particular projectile points. A comparative analysis of the mechanical properties of tusk dentine from woolly mammoth (Mammuthus primigenius) and African elephant (Loxodonta africana) reveals similar longitudinal stiffness values that are comparable to those of cervid antler compacta. The longitudinal bending strength and work of fracture of proboscidean ivory are very high owing to its substantial collagen content and specific microstructure. In permafrost, these properties can be fully retained for thousands of years. Owing to the unique combination of stiffness, toughness and size, ivory was obviously the most suitable osseous raw material for massive projectile points used in big game hunting.

Also flagged:neuronopathic storage diseasesLysosomesorganellesdegradationmetabolic diseaseslysosomal storage disorders
Journal Article 2019-02-19 No Snippets Zunke F, Mazzulli JR.
Show Full Abstract

Lysosomes are organelles involved in the degradation and recycling of macromolecules, and play a critical role in sensing metabolic information in the cell. A class of rare metabolic diseases called lysosomal storage disorders (LSD) are characterized by lysosomal dysfunction and the accumulation of macromolecular substrates. The central nervous system appears to be particularly vulnerable to lysosomal dysfunction, since many LSDs are characterized by severe, widespread neurodegeneration with pediatric onset. Furthermore, variants in lysosomal genes are strongly associated with some common neurodegenerative disorders such as Parkinson's disease (PD). To better understand disease pathology and develop novel treatment strategies, it is critical to study the fundamental molecular disease mechanisms in the affected cell types that harbor endogenously expressed mutations. The discovery of methods for reprogramming of patient-derived somatic cells into induced pluripotent stem cells (iPSCs), and their differentiation into distinct neuronal and glial cell types, have provided novel opportunities to study mechanisms of lysosomal dysfunction within the relevant, vulnerable cell types. These models also expand our ability to develop and test novel therapeutic targets. We discuss recently developed methods for iPSC differentiation into distinct neuronal and glial cell types, while addressing the need for meticulous experimental techniques and parameters that are essential to accurately identify inherent cellular pathologies. iPSC models for neuronopathic LSDs and their relationship to sporadic age-related neurodegeneration are also discussed. These models should facilitate the discovery and development of personalized therapies in the future.

Also flagged:SynthesisThiazolyl-CoumarinHistone Deacetylasehistone deacetylasesHDACfibrotic diseases
Journal Article 2019-02-19 No Snippets Pardo-Jiménez V, Navarrete-Encina P, Díaz-Araya G.
Show Full Abstract

New histone deacetylases (HDAC) inhibitors with low toxicity to non-cancerous cells, are a prevalent issue at present because these enzymes are actively involved in fibrotic diseases. We designed and synthesized a novel series of thiazolyl-coumarins, substituted at position 6 (R = H, Br, OCH₃), linked to classic zinc binding groups, such as hydroxamic and carboxylic acid moieties and alternative zinc binding groups such as disulfide and catechol. Their in vitro inhibitory activities against HDACs were evaluated. Disulfide and hydroxamic acid derivatives were the most potent ones. Assays with neonatal rat cardiac fibroblasts demonstrated low cytotoxic effects for all compounds. Regarding the parameters associated to cardiac fibrosis development, the compounds showed antiproliferative effects, and triggered a strong decrease on the expression levels of both α-SMA and procollagen I. In conclusion, the new thiazolyl-coumarin derivatives inhibit HDAC activity and decrease profibrotic effects on cardiac fibroblasts.

Also flagged:IronStrokeNeurodegenerationmetabolismbrain pathologiesorganelles
Journal Article 2019-02-19 ✓ 2 Snippets DeGregorio-Rocasolano N, Martí-Sistac O, Gasull T.
In-Text Gene Mentions

TfR1 binds HTf with a Kd of 1 nM; it is expressed in response to changes in iron levels through modulation by iron regulatory elements (IREs) present in its mRNA and binds hereditary hemochromatosis HFE protein, a molecule that competes with HTf for binding to TfR1.

Abbreviations: APP, amyloid precursor protein; ATf, apotransferrin; CD163, hemoglobin/haptoglobin receptor; CD91, heme/hemopexin receptor; CO, carbon monoxide; CP, ceruloplasmin; DMT1, divalent metal transporter 1; EAAT, excitatory amino acid transporter; Fe2+, ferrous iron; Fe3+, ferric iron; Fe–S, iron–sulfur cluster; FPN, ferroportin; FT, ferritin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GLS, glutaminase; GPX4, glutathione peroxidase 4; GSH, glutathione; GSSG, glutathione disulfide; Hb, hemoglobin; HFE, hereditary hemochromatosis protein; HIF, hypoxia-inducible factor; HO1, heme oxygenase 1; Hp, haptoglobin; Hpx, hemopexin; HTf, holotransferrin; IRE, iron-responsive element; IRPs, iron regulatory proteins; LIP, labile iron pool; MCOLN1, mucolipin 1; MtFT, mitochondrial ferritin; NCOA, nuclear receptor coactivator; NMDAR, NMDA receptor; NTBI, non-transferrin-bound iron; OH, hydroxyl radical; PCBP, poly(rC)-binding protein; PUFA, poly-unsaturated fatty acid; PUFA-OOH, PUFA peroxide; ROS, reactive oxygen species; Se, selenium; Steap, six-transmembrane epithelial antigen of prostate; system Xc−, cystine–glutamate antiporter; TfR1, transferrin receptor 1; TfR2, transferrin receptor 2; ZIP8/14, zinc transporters 8/14.

Show Full Abstract

In general, iron represents a double-edged sword in metabolism in most tissues, especially in the brain. Although the high metabolic demands of brain cells require iron as a redox-active metal for ATP-producing enzymes, the brain is highly vulnerable to the devastating consequences of excessive iron-induced oxidative stress and, as recently found, to ferroptosis as well. The blood-brain barrier (BBB) protects the brain from fluctuations in systemic iron. Under pathological conditions, especially in acute brain pathologies such as stroke, the BBB is disrupted, and iron pools from the blood gain sudden access to the brain parenchyma, which is crucial in mediating stroke-induced neurodegeneration. Each brain cell type reacts with changes in their expression of proteins involved in iron uptake, efflux, storage, and mobilization to preserve its internal iron homeostasis, with specific organelles such as mitochondria showing specialized responses. However, during ischemia, neurons are challenged with excess extracellular glutamate in the presence of high levels of extracellular iron; this causes glutamate receptor overactivation that boosts neuronal iron uptake and a subsequent overproduction of membrane peroxides. This glutamate-driven neuronal death can be attenuated by iron-chelating compounds or free radical scavenger molecules. Moreover, vascular wall rupture in hemorrhagic stroke results in the accumulation and lysis of iron-rich red blood cells at the brain parenchyma and the subsequent presence of hemoglobin and heme iron at the extracellular milieu, thereby contributing to iron-induced lipid peroxidation and cell death. This review summarizes recent progresses made in understanding the ferroptosis component underlying both ischemic and hemorrhagic stroke subtypes.

Also flagged:Cytochrome P450 2C19DepressionPKPDbipolar disorderBP
Journal Article 2019-02-19 No Snippets Veldic M, Ahmed AT, Blacker CJ, Geske JR, Biernacka JM, Borreggine KL, Moore KM, Prieto ML, Vande Voort JL, Croarkin PE, Hoberg AA, Kung S, Alarcon RD, Keeth N, Singh B, Bobo WV, Frye MA.
Show Full Abstract

<b>Background:</b> Pharmacogenomic testing, specifically for pharmacokinetic (PK) and pharmacodynamic (PD) genetic variation, may contribute to a better understanding of baseline genetic differences in patients seeking treatment for depression, which may further impact clinical antidepressant treatment recommendations. This study evaluated PK and PD genetic variation and the clinical use of such testing in treatment seeking patients with bipolar disorder (BP) and major depressive disorder (MDD) and history of multiple drug failures/treatment resistance. <b>Methods:</b> Consecutive depressed patients evaluated at the Mayo Clinic Depression Center over a 10-year study time frame (2003-2013) were included in this retrospective analysis. Diagnoses of BP or MDD were confirmed using a semi-structured diagnostic interview. Clinical rating scales included the Hamilton Rating Scale for Depression (HRSD<sub>24</sub>), Generalized Anxiety Disorder 7-item scale (GAD-7), Patient Health Questionnaire-9 (PHQ-9), and Adverse Childhood Experiences (ACE) Questionnaire. Clinically selected patients underwent genotyping of cytochrome P450 <i>CYP2D6</i>/<i>CYP2C19</i> and the serotonin transporter <i>SLC6A4</i>. PK and PD differences and whether clinicians incorporated test results in providing recommendations were compared between the two patient groups. <b>Results:</b> Of the 1795 patients, 167/523 (31.9%) with BP and 446/1272 (35.1%) with MDD were genotyped. Genotyped patients had significantly higher self-report measures of depression and anxiety compared to non-genotyped patients. There were significantly more <i>CYP2C19</i> poor metabolizer (PM) phenotypes in BP (9.3%) vs. MDD patients (1.7%, <i>p</i> = 0.003); among participants with an S-allele, the rate of <i>CYP2C19</i> PM phenotype was even higher in the BP (9.8%) vs. MDD (0.6%, <i>p</i> = 0.003). There was a significant difference in the distribution of <i>SLC6A4</i> genotypes between BP (<i>l/l</i> = 28.1%, <i>s/l</i> = 59.3%, <i>s/s</i> = 12.6%) and MDD (<i>l/l</i> = 31.4%, <i>s/l</i> = 46.1%, <i>s/s</i> = 22.7%) patients (<i>p</i> < 0.01). <b>Conclusion:</b> There may be underlying pharmacogenomic differences in treatment seeking depressed patients that potentially have impact on serum levels of <i>CYP2C19</i> metabolized antidepressants (i.e., citalopram / escitalopram) contributing to rates of efficacy vs. side effect burden with additional potential risk of antidepressant response vs. induced mania. The evidence for utilizing pharmacogenomics-guided therapy in MDD and BP is still developing with a much needed focus on drug safety, side effect burden, and treatment adherence.

Also flagged:Supranuclear PalsyParkinson's DiseaseDepressionProgressive Supranuclear Palsyatypical parkinsonismPD
Journal Article 2019-02-19 ✓ 1 Snippet Wittwer JE, Winbolt M, Morris ME.
In-Text Gene Mentions

…results using theACE-IIIindicated that only…

Show Full Abstract

<b>Objectives:</b> To understand the benefits and feasibility of using supervised, home-based, music-cued training to improve gait speed and stability in community-dwelling people with Progressive Supranuclear Palsy. <b>Design:</b> Feasibility trial incorporating a single group repeated-measures design. <b>Setting:</b> Human movement laboratory and participants' homes. <b>Interventions:</b>Two training sessions per week, conducted by experienced physiotherapists over 4 weeks. Each home training session consisted of a range of activities in standing or walking, with, and without auditory cues. Rhythmic auditory cues were played via a portable digital music player and consisted of metronome beats and individually chosen, commercially available rhythmic music tracks. <b>Main Outcome Measures:</b> Spatiotemporal gait measures were recorded using an 8 m long GAITRite® mat. Participants walked without cues at self-selected comfortable pace. The Progressive Supranuclear Palsy and Unified Parkinson's Disease Rating Scales were administered at baseline. Addenbrooke's Cognitive Examination-III, Geriatric Depression Scale, Assessment of Personal Music Preference Scale, and Physiological Profile Assessment were administered at baseline and retest. <b>Results:</b> At baseline, two of the five community-dwelling participants with Progressive Supranuclear Palsy walked with normal speed and low gait variability. Of the remainder who walked with slower, more variable patterns, two walked faster at retest, one by a clinically meaningful amount. Four participants reduced their timing variability at retest and three reduced step length variability. All participants reported high satisfaction levels with the program. <b>Conclusions:</b> When delivered at home with the support of caregivers, music-cued gait training can provide a feasible approach to improving disorders of gait stability in people with this rare, degenerative condition. Movement to music is engaging and enjoyable which can facilitate adherence to therapy. <b>Clinical Trial Registration :</b> ANZCTR 12616000851460. http://www.anzctr.org.au/.

Also flagged:β-lactoglobulinautosomeschromosomesPCDHB6PCDHB7PCDHB16
Journal Article 2019-02-19 No Snippets Zhou C, Li C, Cai W, Liu S, Yin H, Shi S, Zhang Q, Zhang S.
Show Full Abstract

Genome-wide association studies (GWASs) have been widely used to determine the genetic architecture of quantitative traits in dairy cattle. In this study, with the aim of identifying candidate genes that affect milk protein composition traits, we conducted a GWAS for nine such traits (α<sub>s1</sub>-casein, α<sub>s2</sub>-casein, β-casein, κ-casein, α-lactalbumin, β-lactoglobulin, casein index, protein percentage, and protein yield) in 614 Chinese Holstein cows using a single-step strategy. We used the Illumina BovineSNP50 Bead chip and imputed genotypes from high-density single-nucleotide polymorphisms (SNPs) ranging from 50 to 777 K, and subsequent to genotype imputation and quality control, we screened a total of 586,304 informative high-quality SNPs. Phenotypic observations for six major milk proteins (α<sub>s1</sub>-casein, α<sub>s2</sub>-casein, β-casein, κ-casein, α-lactalbumin, and β-lactoglobulin) were evaluated as weight proportions of the total protein fraction (wt/wt%) using a commercial enzyme-linked immunosorbent assay kit. Informative windows comprising five adjacent SNPs explaining no < 0.5% of the genomic variance per window were selected for gene annotation and gene network and pathway analyses. Gene network analysis performed using the STRING Genomics 10.0 database revealed a co-expression network comprising 46 interactions among 62 of the most plausible candidate genes. A total of 178 genomic windows and 194 SNPs on 24 bovine autosomes were significantly associated with milk protein composition or protein percentage. Regions affecting milk protein composition traits were mainly observed on chromosomes BTA 1, 6, 11, 13, 14, and 18. Of these, several windows were close to or within the <i>CSN1S1, CSN1S2, CSN2, CSN3, LAP3, DGAT1, RPL8</i>, and <i>HSF1</i> genes, which have well-known effects on milk protein composition traits of dairy cattle. Taken together with previously reported quantitative trait loci and the biological functions of the identified genes, we propose 19 novel candidate genes affecting milk protein composition traits: <i>ARL6, SST, EHHADH, PCDHB4, PCDHB6, PCDHB7, PCDHB16, SLC36A2, GALNT14, FPGS, LARP4B, IDI1, COG4, FUK, WDR62, CLIP3, SLC25A21, IL5RA</i>, and <i>ACADSB</i>. Our findings provide important insights into milk protein synthesis and indicate potential targets for improving milk quality.

Also flagged:metabolic diseasesobesitydiabeteschronic inflammatory diseasescognitive dysfunctionneurogenesis
Journal Article 2019-02-19 No Snippets Yoon G, Cho KA, Song J, Kim YK.
Show Full Abstract

High fat diet can lead to metabolic diseases such as obesity and diabetes known to be chronic inflammatory diseases with high prevalence worldwide. Recent studies have reported cognitive dysfunction in obese patients is caused by a high fat diet. Accordingly, such dysfunction is called "type 3 diabetes" or "diabetic dementia." Although dysregulation of protein-coding genes has been extensively studied, profiling of non-coding RNAs including long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs) has not been reported yet. Therefore, the objective of this study was to obtain profiles of diverse RNAs and determine their patterns of alteration in high fat fed brain cortex compared to normal brain cortex. To investigate regulatory roles of both coding and non-coding RNAs in high fat diet brain, we performed RNA sequencing of ribosomal RNA-depleted RNAs and identified genome-wide lncRNAs and circRNAs expression and co-expression patterns of mRNAs in high fat diet mouse brain cortex. Our results showed expression levels of mRNAs related to neurogenesis, synapse, and calcium signaling were highly changed in high fat diet fed cortex. In addition, numerous differentially expressed lncRNAs and circRNAs were identified. Our study provides valuable expression profiles and potential function of both coding and non-coding RNAs in high fat diet fed brain cortex.

Also flagged:P311inflammatory responsescell proliferationcoagulationneuronal regeneration related proteinamino acid
Journal Article 2019-02-19 ✓ 1 Snippet Wang S, Zhang X, Hao F, Li Y, Sun C, Zhan R, Wang Y, He W, Li H, Luo G.
In-Text Gene Mentions

…proteins are HRG,SERPINC, MT2A, SRPR, HYI,…

Show Full Abstract

P311 is a highly conserved multifunctional protein. However, it does not belong to any established family of proteins, and its biological function has not been entirely determined. This study aims to reveal the unknown molecular and cellular function of P311. OCG (Overlapping Cluster Generator) is a clustering method used to partition a protein-protein network into overlapping clusters. Multifunctional proteins are at the intersection of relevant clusters. DAVID is an analytic tool used to extract biological meaning from a large protein list. Here we presented OD2 (OCG + DAVID + 2 human PPI datasets), a novel strategy to increase the likelihood to identify biological functions most pertinent to the multifunctional proteins. The principle of OD2 is that OCG prepares the protein lists from multifunctional protein relevant overlapping clusters, for a functional enrichment analysis by DAVID, and the similar functional enrichments, which occurs simultaneously when analyzing two human PPI datasets, are supposed to be the predicted functions. By applying OD2 to two reconstructed human PPI datasets, we supposed the function of the P311 in inflammatory responses, cell proliferation and coagulation, which were confirmed by the following biological experiments. Collectively, our study preliminarily found that P311 could play a role in inflammatory responses, cell proliferation and coagulation. Further studies are required to validate and elucidate the underlying mechanism.

Also flagged:BRCA1steroid receptorsmenopauseestrogen receptor alphaER-αProgesterone receptor
Journal Article 2019-02-19 No Snippets Crone M, Hallman K, Lloyd V, Szmyd M, Badamo B, Morse M, Dinda S.
Show Full Abstract

<h4>Background</h4>Black cohosh (BC) is an herbal remedy often used by women to treat symptoms associated with menopause. Research has shown that the molecular activity of BC is associated with estrogen receptor alpha (ER-α) regulation. Progesterone receptor (PR) expression is found to be consistent with ER expression and mutations in the <i>BRCA1</i> gene, a tumor-suppressor gene, are known to be responsible for about 40%-45% of hereditary breast cancers.<h4>Purpose</h4>The objective of this study was to determine the effects of BC alone, as well as in combination with hormones and antihormones, on cell viability and expression of ER-α, PR, and BRCA1 in both T-47D and MCF-7 cell lines.<h4>Methods</h4>Cells were cultured in charcoal-stripped serum prior to their treatment and subsequent protein extraction. Western blot analyses were performed following a Bio-Rad Bradford protein assay and SDS-PAGE gel electrophoresis, with ECL luminescence and Image Studio Lite software. Cellular viability assays were performed using propidium iodine (PI) staining, and the distribution of fluorescent structures was evaluated through confocal microscopy. RT-qPCR analysis was performed on extracted cellular RNA. All statistical analyses were performed using SPSS software, and data was subjected to Kruskal-Wallis testing, followed by post-hoc analysis using the Mann-Whitney U-test to determine the statistical significance of all findings.<h4>Results</h4>Western blot analysis displayed significant alterations of ER-α, PR, and BRCA1 protein levels after 24-hour treatment with 80-500 μM BC. BC displayed a concentration-dependent decrease on ER-α and BRCA1 expression, with an 87% reduction of ER-α expression and a 43% of BRCA1 expression in T-47D cells compared to control. After six days of treatment with 400 μM BC, a 50% decrease in cell proliferation was observed. Following 24 hours of co-treatment with 400 μM BC and 10 nM E<sub>2</sub>, ER-α was downregulated by 90% and BRCA1 expression was reduced by 70% compared to control. The expression of PR, following the same treatment, exhibited similar effects. The proliferative effect of E<sub>2</sub> was reduced in the presence of BC.<h4>Conclusion</h4>Black Cohosh demonstrates substantial anti-cancer properties, and this study may significantly aid in the understanding of the molecular effects of BC on ER-α, PR, and BRCA1 in breast cancer cells.

Also flagged:MetforminCdk5neuroblastomacell differentiationcell proliferationoxygen
Journal Article 2019-02-19 ✓ 5 Snippets Binlateh T, Tanasawet S, Rattanaporn O, Sukketsiri W, Hutamekalin P.
In-Text Gene Mentions

Metformin Promotes Neuronal Differentiation via Crosstalk between Cdk5 and Sox6 in Neuroblastoma Cells

3.5. Metformin Promotes Neuronal Differentiation through Cdk5/Sox6 Crosstalk

Further examination revealed that metformin significantly reduced Cdk5 expression while increased Sox6 expression levels.

To answer the question whether Sox6 is related to metformin-induced neuronal differentiation via Cdk5 or not, the experiment with Cdk5 inhibitor, roscovitine, was performed.

These demonstrated that Cdk5 has a relation, crosstalk, with Sox6 in metformin promoted cell differentiation.

Show Full Abstract

Metformin has recently emerged as a key player in promotion of neuroblastoma differentiation and neurite outgrowth. However, molecular mechanisms of how metformin promotes cellular differentiation have not yet been fully elucidated. In this study, we investigated how metformin promotes cell differentiation, via an inhibition of cell proliferation, by culturing SH-SY5Y neuroblastoma cells with or without metformin. Pretreatment with reactive oxygen species (ROS) scavenger, NAC, revealed that ROS plays a crucial role in induction of cell differentiation. Cell differentiation was observed under various morphological criteria: extension of neuritic processes and neuronal differentiation markers. Treatment with metformin significantly increased neurite length, number of cells with neurite, and expression of neuronal differentiation markers, <i>β</i>-tubulin III and tyrosine hydroxylase (TH) compared with untreated control. Further investigation found that metformin significantly decreased Cdk5 but increased Sox6 during cell differentiation. Analysis of the mechanism underlying these changes using Cdk5 inhibitor, roscovitine, indicated that expressions of Cdk5 and Sox6 corresponded to metformin treatment. These results suggested that metformin produces neuronal differentiation via Cdk5 and Sox6. In addition, phosphorylated Erk1/2 was decreased while phosphorylated Akt was increased in metformin treatment. Taken together, these findings suggest that metformin promotes neuronal differentiation via ROS activation through Cdk5/Sox6 crosstalk, relating to Erk1/2 and Akt signaling.

Also flagged:glucocorticoidsgastric metaplasiagastric cancersteroid hormonesgastric inflammationoxyntic atrophy
Journal Article 2019-02-18 ✓ 1 Snippet Busada JT, Ramamoorthy S, Cain DW, Xu X, Cook DN, Cidlowski JA.
In-Text Gene Mentions

Olfm4

Show Full Abstract

In the stomach, chronic inflammation causes metaplasia and creates a favorable environment for the evolution of gastric cancer. Glucocorticoids are steroid hormones that repress proinflammatory stimuli, but their role in the stomach is unknown. In this study, we show that endogenous glucocorticoids are required to maintain gastric homeostasis. Removal of circulating glucocorticoids in mice by adrenalectomy resulted in the rapid onset of spontaneous gastric inflammation, oxyntic atrophy, and spasmolytic polypeptide-expressing metaplasia (SPEM), a putative precursor of gastric cancer. SPEM and oxyntic atrophy occurred independently of lymphocytes. However, depletion of monocytes and macrophages by clodronate treatment or inhibition of gastric monocyte infiltration using the Cx3cr1 knockout mouse model prevented SPEM development. Our results highlight the requirement for endogenous glucocorticoid signaling within the stomach to prevent spontaneous gastric inflammation and metaplasia, and suggest that glucocorticoid deficiency may lead to gastric cancer development.

Also flagged:serotoninaggressionOxytocincognitionOTOT receptors
Journal Article 2019-02-18 No Snippets Weinberg-Wolf H, Chang SWC.
Show Full Abstract

Primates must balance the need to monitor other conspecifics to gain social information while not losing other resource opportunities. We consolidate evidence across the fields of primatology, psychology, and neuroscience to examine individual, population, and species differences in how primates, particularly macaques, monitor conspecifics. We particularly consider the role of serotonin in mediating social competency via social attention, aggression, and dominance behaviors. Finally, we consider how the evolution of variation in social tolerance, aggression, and social monitoring might be explained by differences in serotonergic function in macaques. This article is categorized under: Economics > Interactive Decision-Making Psychology > Comparative Psychology Neuroscience > Behavior Cognitive Biology > Evolutionary Roots of Cognition.

Also flagged:volume-regulated anion channelanion channelsLRRC8Alipidbindingextracellular
Journal Article 2019-02-18 ✓ 1 Snippet Kern DM, Oh S, Hite RK, Brohawn SG.
In-Text Gene Mentions

…are formed byleucine-rich repeat-containing protein 8repeat-containing protein 8…

Show Full Abstract

Hypoosmotic conditions activate volume-regulated anion channels in vertebrate cells. These channels are formed by leucine-rich repeat-containing protein 8 (LRRC8) family members and contain LRRC8A in homo- or hetero-hexameric assemblies. Here, we present single-particle cryo-electron microscopy structures of <i>Mus musculus</i> LRRC8A in complex with the inhibitor DCPIB reconstituted in lipid nanodiscs. DCPIB plugs the channel like a cork in a bottle - binding in the extracellular selectivity filter and sterically occluding ion conduction. Constricted and expanded structures reveal coupled dilation of cytoplasmic LRRs and the channel pore, suggesting a mechanism for channel gating by internal stimuli. Conformational and symmetry differences between LRRC8A structures determined in detergent micelles and lipid bilayers related to reorganization of intersubunit lipid binding sites demonstrate a critical role for the membrane in determining channel structure. These results provide insight into LRRC8 gating and inhibition and the role of lipids in the structure of an ionic-strength sensing ion channel.

Also flagged:prostate adenocarcinomaipilimumabnivolumabinfliximabsteroidinflammatory bowel disease
Journal Article 2019-02-18 ✓ 1 Snippet Zhang HC, Luo W, Wang Y.
In-Text Gene Mentions

HFEgene testing revealed…

Show Full Abstract

<h4>Background</h4>Immune checkpoint inhibitors (ICPIs), used to treat different advanced malignancies, are associated with a wide range of immune-related adverse reactions (irAEs) that deserve close monitoring of patients. Gastrointestinal reactions and hepatotoxicity may occur, which warrant careful evaluation to confirm the etiology and attribution to ICPIs as these events could affect future management.<h4>Case presentation</h4>We describe a case of a patient with prostate adenocarcinoma, treated with dual ICPIs comprised of ipilimumab and nivolumab, who developed elevated liver enzymes in the context of infliximab therapy prescribed to treat gastrointestinal irAE from his ICPIs. The patient's grade 3 colitis became steroid-refractory, requiring a one-time infusion of infliximab, a biologic agent used commonly in inflammatory bowel disease, as a rescue therapy, to which he responded. The patient subsequently developed liver injury. This presented a diagnostic dilemma involving differential diagnoses of hepatotoxicity due to ICPI or infliximab exposure. A careful review of the clinical history, evaluation of the chronology of events, and exclusion of other causes of acute hepatitis were employed to make the final diagnosis of this event as infliximab-associated hepatotoxicity.<h4>Conclusion</h4>ICPIs such as CTLA-4 and PD-1 inhibitors have the potential to cause both gastrointestinal reactions and hepatotoxicity. An additional confounding factor in our patient's case was the exposure to infliximab used to manage an established irAE that developed after the last exposure to ICPIs. The clinical history and data supported infliximab-associated hepatotoxicity, rather than an irAE. With the increasing application of ICPIs for different cancers, in conjunction with potential risks for irAE, the liver profile should be closely monitored during treatment with ICPI as well as with anti-TNF-α agents in this patient population.

Also flagged:PDGFRαGISTPlatelet-Derived Growth Factor Receptor AlphaPDGFRAaspartic acidvaline
Journal Article 2019-02-18 ✓ 1 Snippet Nannini M, Tarantino G, Indio V, Ravegnini G, Astolfi A, Urbini M, De Leo A, Santini D, Ceccarelli C, Gruppioni E, Altimari A, Castellucci P, Fanti S, Di Scioscio V, Saponara M, Gatto L, Pession A, Martelli PL, Casadio R, Pantaleo MA.
In-Text Gene Mentions

In particular, it could be interesting to evaluate the affinity to novel compounds currently under development, such as BLU-285 and DCC-2618, which until now have been shown to be particularly promising in PDGFRA D842V mutants; however, nothing is yet known for other PDGFRA mutants in GIST16,17.

Show Full Abstract

Platelet-Derived Growth Factor Receptor Alpha (PDGFRA) mutations occur in approximately 5-7% of gastrointestinal stromal tumours (GIST). Over half of all PDGFRA mutations are represented by the substitution at position 842 in the A-loop of an aspartic acid (D) with a valine (V), recognized as D842V, conferring primary resistance to imatinib in vitro and in clinical observations due to the conformation of the kinase domain, which negatively affects imatinib binding. The lack of interaction between imatinib and the D842V PDGFRA mutated model has been established and widely confirmed in vivo. However, for the other PDGFRA mutations, the correlation between pre-clinical and clinical data is still unclear. An in silico evaluation of the p.His845_Asn848delinsPro mutation involving exon 18 of PDGFRA in a metastatic GIST patient responding to first-line imatinib has been provided. Docking analyses were performed, and the ligand-receptor interactions were evaluated with the jCE algorithm for structural alignment. The docking simulation and structural superimposition analysis show that PDGFRA p.His845_Asn848delinsPro stabilizes the imatinib binding site with the residues that are conserved in KIT. The in vivo evidence that PDGFRA p.His845_Asn848delinsPro is sensitive to imatinib was confirmed by the molecular modelling, which may represent a reliable tool for the prediction of clinical outcomes and treatment selection in GIST, especially for rare mutations.

Also flagged:HSFA2REF6HSFA3demethylationBRMoligonucleotide
Journal Article 2019-02-18 ✓ 1 Snippet Liu J, Feng L, Gu X, Deng X, Qiu Q, Li Q, Zhang Y, Wang M, Deng Y, Wang E, He Y, Bäurle I, Li J, Cao X, He Z.
In-Text Gene Mentions

…TAS1 TARGET (HTT) genes, which…

Show Full Abstract

Global warming has profound effects on plant growth and fitness. Plants have evolved sophisticated epigenetic machinery to respond quickly to heat, and exhibit transgenerational memory of the heat-induced release of post-transcriptional gene silencing (PTGS). However, how thermomemory is transmitted to progeny and the physiological relevance are elusive. Here we show that heat-induced HEAT SHOCK TRANSCRIPTION FACTOR A2 (HSFA2) directly activates the H3K27me3 demethylase RELATIVE OF EARLY FLOWERING 6 (REF6), which in turn derepresses HSFA2. REF6 and HSFA2 establish a heritable feedback loop, and activate an E3 ubiquitin ligase, SUPPRESSOR OF GENE SILENCING 3 (SGS3)-INTERACTING PROTEIN 1 (SGIP1). SGIP1-mediated SGS3 degradation leads to inhibited biosynthesis of trans-acting siRNA (tasiRNA). The REF6-HSFA2 loop and reduced tasiRNA converge to release HEAT-INDUCED TAS1 TARGET 5 (HTT5), which drives early flowering but attenuates immunity. Thus, heat induces transmitted phenotypes via a coordinated epigenetic network involving histone demethylases, transcription factors, and tasiRNAs, ensuring reproductive success and transgenerational stress adaptation.

Also flagged:lipidadiponectintriglyceridePLXND1AgingY-chromosome
Journal Article 2019-02-18 ✓ 5 Snippets Justice AE, Karaderi T, Highland HM, Young KL, Graff M, Lu Y, Turcot V, Auer PL, Fine RS, Guo X, Schurmann C, Lempradl A, Marouli E, Mahajan A, Winkler TW, Winkler TW, Locke AE, Medina-Gomez C, Esko T, Vedantam S, Giri A, Lo KS, Alfred T, Mudgal P, Ng MCY, Heard-Costa NL, Feitosa MF, Manning AK, Willems SM, Sivapalaratnam S, Abecasis G, Alam DS, Allison M, Amouyel P, Arzumanyan Z, Balkau B, Bastarache L, Bergmann S, Bielak LF, Blüher M, Boehnke M, Boeing H, Boerwinkle E, Böger CA, Bork-Jensen J, Bottinger EP, Bowden DW, Brandslund I, Broer L, Burt AA, Butterworth AS, Caulfield MJ, Cesana G, Chambers JC, Chasman DI, Chen YI, Chowdhury R, Christensen C, Chu AY, Collins FS, Cook JP, Cox AJ, Crosslin DS, Danesh J, de Bakker PIW, Denus S, Mutsert R, Dedoussis G, Demerath EW, Dennis JG, Denny JC, Di Angelantonio E, Dörr M, Drenos F, Dubé MP, Dunning AM, Easton DF, Elliott P, Evangelou E, Farmaki AE, Feng S, Ferrannini E, Ferrieres J, Florez JC, Fornage M, Fox CS, Franks PW, Friedrich N, Gan W, Gandin I, Gasparini P, Giedraitis V, Girotto G, Gorski M, Grallert H, Grarup N, Grove ML, Gustafsson S, Haessler J, Hansen T, Hattersley AT, Hayward C, Heid IM, Holmen OL, Hovingh GK, Howson JMM, Hu Y, Hung YJ, Hveem K, Ikram MA, Ingelsson E, Jackson AU, Jarvik GP, Jia Y, Jørgensen T, Jousilahti P, Justesen JM, Kahali B, Karaleftheri M, Kardia SLR, Karpe F, Kee F, Kitajima H, Komulainen P, Kooner JS, Kovacs P, Krämer BK, Kuulasmaa K, Kuusisto J, Laakso M, Lakka TA, Lamparter D, Lange LA, Langenberg C, Larson EB, Lee NR, Lee WJ, Lehtimäki T, Lewis CE, Li H, Li J, Li-Gao R, Lin LA, Lin X, Lind L, Lindström J, Linneberg A, Liu CT, Liu DJ, Luan J, Lyytikäinen LP, MacGregor S, Mägi R, Männistö S, Marenne G, Marten J, Masca NGD, McCarthy MI, Meidtner K, Mihailov E, Moilanen L, Moitry M, Mook-Kanamori DO, Morgan A, Morris AP, Müller-Nurasyid M, Munroe PB, Narisu N, Nelson CP, Neville M, Ntalla I, O'Connell JR, Owen KR, Pedersen O, Peloso GM, Pennell CE, Perola M, Perry JA, Perry JRB, Pers TH, Ewing A, Polasek O, Raitakari OT, Rasheed A, Raulerson CK, Rauramaa R, Reilly DF, Reiner AP, Ridker PM, Rivas MA, Robertson NR, Robino A, Rudan I, Ruth KS, Saleheen D, Salomaa V, Samani NJ, Schreiner PJ, Schulze MB, Scott RA, Segura-Lepe M, Sim X, Slater AJ, Small KS, Smith BH, Smith JA, Southam L, Spector TD, Speliotes EK, Stefansson K, Steinthorsdottir V, Stirrups KE, Strauch K, Stringham HM, Stumvoll M, Sun L, Surendran P, Swart KMA, Tardif JC, Taylor KD, Teumer A, Thompson DJ, Thorleifsson G, Thorsteinsdottir U, Thuesen BH, Tönjes A, Torres M, Tsafantakis E, Tuomilehto J, Uitterlinden AG, Uusitupa M, van Duijn CM, Vanhala M, Varma R, Vermeulen SH, Vestergaard H, Vitart V, Vogt TF, Vuckovic D, Wagenknecht LE, Walker M, Wallentin L, Wang F, Wang CA, Wang S, Wareham NJ, Warren HR, Waterworth DM, Wessel J, White HD, Willer CJ, Wilson JG, Wood AR, Wu Y, Yaghootkar H, Yao J, Yerges-Armstrong LM, Young R, Zeggini E, Zhan X, Zhang W, Zhao JH, Zhao W, Zheng H, Zhou W, Zillikens MC, Rivadeneira F, Borecki IB, Pospisilik JA, Deloukas P, Frayling TM, Lettre G, Mohlke KL, Rotter JI, Kutalik Z, Hirschhorn JN, Cupples LA, Loos RJF, North KE, Lindgren CM, CHD Exome+ Consortium, Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) Consortium, EPIC-CVD Consortium, ExomeBP Consortium, Global Lipids Genetic Consortium, GoT2D Genes Consortium, InterAct, ReproGen Consortium, T2D-Genes Consortium, MAGIC Investigators.
In-Text Gene Mentions

…two genes (DNAH10and PLXND1 ).…

…forward for follow-up,DNAH10and PLXND1 .…

…PCNXL3, ACVR1C, andDARS2.…

…with RSPO3 ,DNAH10, MNS1 ,…

…, COBLL1 ,CCDC92, and ITIH3…

Show Full Abstract

Body-fat distribution is a risk factor for adverse cardiovascular health consequences. We analyzed the association of body-fat distribution, assessed by waist-to-hip ratio adjusted for body mass index, with 228,985 predicted coding and splice site variants available on exome arrays in up to 344,369 individuals from five major ancestries (discovery) and 132,177 European-ancestry individuals (validation). We identified 15 common (minor allele frequency, MAF ≥5%) and nine low-frequency or rare (MAF <5%) coding novel variants. Pathway/gene set enrichment analyses identified lipid particle, adiponectin, abnormal white adipose tissue physiology and bone development and morphology as important contributors to fat distribution, while cross-trait associations highlight cardiometabolic traits. In functional follow-up analyses, specifically in Drosophila RNAi-knockdowns, we observed a significant increase in the total body triglyceride levels for two genes (DNAH10 and PLXND1). We implicate novel genes in fat distribution, stressing the importance of interrogating low-frequency and protein-coding variants.

Also flagged:ironmetabolic diseasemetabolismGlucosenucleotideglucose intolerance
Journal Article 2019-02-18 ✓ 1 Snippet Miranda MA, St Pierre CL, Macias-Velasco JF, Nguyen HA, Schmidt H, Agnello LT, Wayhart JP, Lawson HA.
In-Text Gene Mentions

…iron overload in non-hemochromatosisindividuals promises to…

Show Full Abstract

<h4>Background</h4>Iron is a critical component of metabolic homeostasis, but consumption of dietary iron has increased dramatically in the last 30 years, corresponding with the rise of metabolic disease. While the link between iron metabolism and metabolic health is well established, the extent to which dietary iron contributes to metabolic disease risk is unexplored. Further, it is unknown how dietary iron interacts with genetic background to modify metabolic disease risk.<h4>Methods</h4>LG/J and SM/J inbred mouse strains were used to investigate the relationship between genetic background and metabolic function during an 8-week high iron diet. Glucose tolerance and adiposity were assessed, colorimetric assays determined levels of circulating metabolic markers, and hepatic iron content was measured. RNA sequencing was performed on white adipose tissue to identify genes differentially expressed across strain, diet, and strain X diet cohorts. Hepatic <i>Hamp</i> expression and circulating hepcidin was measured, and small nucleotide variants were identified in the <i>Hamp</i> genic region.<h4>Results</h4>LG/J mice experienced elevated fasting glucose and glucose intolerance during the high iron diet, corresponding with increased hepatic iron load, increased circulating ferritin, and signs of liver injury. Adipose function was also altered in high iron-fed LG/J mice, including decreased adiposity and leptin production and differential expression of genes involved in iron and glucose homeostasis. LG/J mice failed to upregulate hepatic <i>Hamp</i> expression during the high iron diet, resulting in low circulating hepcidin levels compared to SM/J mice.<h4>Conclusions</h4>This study highlights the importance of accounting for genetic variation when assessing the effects of diet on metabolic health, and suggests dietary iron's impact on liver and adipose tissue is an underappreciated component of metabolic disease risk.

Also flagged:cancermetastatic diseasetumorstumorNanomaterialsgold
Journal Article 2019-02-18 ✓ 1 Snippet Turdo A, Veschi V, Gaggianesi M, Chinnici A, Bianca P, Todaro M, Stassi G.
In-Text Gene Mentions

CSC, cancer stem cell; CTC, tumor circulating cells; DCC, differentiated cancer cell; CAF, cancer associated fibroblast; TAM, tumor associated macrophage; EC, endothelial cell; PC, pericyte cell.

Show Full Abstract

Notwithstanding cancer patients benefit from a plethora of therapeutic alternatives, drug resistance remains a critical hurdle. Indeed, the high mortality rate is associated with metastatic disease, which is mostly incurable due to the refractoriness of metastatic cells to current treatments. Increasing data demonstrate that tumors contain a small subpopulation of cancer stem cells (CSCs) able to establish primary tumor and metastasis. CSCs are endowed with multiple treatment resistance capabilities comprising a highly efficient DNA damage repair machinery, the activation of survival pathways, enhanced cellular plasticity, immune evasion and the adaptation to a hostile microenvironment. Due to the presence of distinct cell populations within a tumor, cancer research has to face the major challenge of targeting the intra-tumoral as well as inter-tumoral heterogeneity. Thus, targeting molecular drivers operating in CSCs, in combination with standard treatments, may improve cancer patients' outcomes, yielding long-lasting responses. Here, we report a comprehensive overview on the most significant therapeutic advances that have changed the known paradigms of cancer treatment with a particular emphasis on newly developed compounds that selectively affect the CSC population. Specifically, we are focusing on innovative therapeutic approaches including differentiation therapy, anti-angiogenic compounds, immunotherapy and inhibition of epigenetic enzymes and microenvironmental cues.

Also flagged:BVESPOPDC1Popeye domain-containing protein 1colitisheart diseasescancers
Journal Article 2019-02-18 No Snippets Han P, Lei Y, Li D, Liu J, Yan W, Tian D.
Show Full Abstract

Since the blood vessel epicardial substance or Popeye domain-containing protein 1 (BVES/POPDC1) was first identified in the developing heart by two independent laboratories in 1999, an increasing number of studies have investigated the structure, function, and related diseases of BVES/POPDC1. During the first 10 years following the discovery of BVES/POPDC1, studies focused mainly on its structure, expression patterns, and functions. Based on these studies, further investigations conducted over the previous decade examined the role of BVES/POPDC1 in human diseases, such as colitis, heart diseases, and human cancers. This review provides an overview of the structure and expression of BVES/POPDC1, mainly focusing on its potential role and mechanism through which it is involved in human cancers.

Also flagged:dapsoneLyme diseaseLyme disease syndromediaminodiphenylsulfonePTLDS
Journal Article 2019-02-18 ✓ 1 Snippet Horowitz RI, Freeman PR.
In-Text Gene Mentions

…was positive forhemochromatosis).…

Show Full Abstract

<h4>Purpose</h4>We collected data from an online survey of 200 of our patients, which evaluated the efficacy of dapsone (diaminodiphenyl sulfone, ie, DDS) combined with other antibiotics and agents that disrupt biofilms for the treatment of chronic Lyme disease/post-treatment Lyme disease syndrome (PTLDS). We also collected aggregate data from direct retrospective chart review, including laboratory testing for Lyme, other infections, and associated tick-borne coinfections. This helped us to determine the frequency of exposure to other infections/coinfections among a cohort of chronically ill Lyme patients, evaluate the efficacy of newer "persister" drug regimens like DDS, and determine how other infections and tick-borne coinfections may be contributing to the burden of chronic illness leading to resistant symptomatology.<h4>Patients and methods</h4>A total of 200 adult patients recruited from a specialized Lyme disease medical practice had been ill for at least 1 year. We regularly monitored laboratory values and participants' symptom severity, and the patients completed the online symptom questionnaire both before beginning treatment and after 6 months on DDS combination therapy (DDS CT). Paired-samples <i>t</i>-tests and Wilcoxon signed-rank nonparametric test were performed on each of eight major Lyme symptoms, both before DDS CT and after 6 months of therapy.<h4>Results</h4>DDS CT statistically improved the eight major Lyme symptoms. We found multiple species of intracellular bacteria including rickettsia, Bartonella, Mycoplasma, Chlamydia, Tularemia, and Brucella contributing to the burden of illness and a high prevalence of Babesia complicating management with probable geographic spread of <i>Babesia WA1/duncani</i> to the Northeast. Borrelia, Bartonella, and Mycoplasma species, as well as <i>Babesia microti</i> had variable manifestations and diverse seroreactivity, with evidence of persistence despite commonly prescribed courses of anti-infective therapies. Occasional reactivation of viral infections including human herpes virus 6 was also seen in immunocompromised individuals.<h4>Conclusion</h4>DDS CT decreased eight major Lyme symptoms severity and improved treatment outcomes among patients with chronic Lyme disease/PTLDS and associated coinfections.

Also flagged:Protocadherin 17tumorcarcinomasreverse transcriptionmethylation-specificcell proliferation
Journal Article 2019-02-18 ✓ 5 Snippets He Y, Wang Z, Liu C, Gong Z, Li Y, Lu T, Hu G.
In-Text Gene Mentions

No significant correlation was found in NPC patients between the methylation/unmethylation of the PCDH17 promoter and age, gender, tumor TNM stage, or lymph node metastasis (Table 2).

PCDH17 plays a tumor suppressor role in NPC.

Studies on the promoter methylation of CpG islands and the discovery of new TSGs have revealed the epigenetic mechanisms of tumorigenesis, thereby identifying early detection biomarkers for NPC.2 Several PCDH genes are downregulated or silenced in carcinomas and act as candidate TSGs: PCDH20 in non-small-cell lung cancers;7PCDH10 in hematologic, gastric, testicular, cervical, breast, esophageal, colorectal, nasopharyngeal, lung, and hepatocellular cancers;8–15PCDH17 in colorectal and gastric cancers, esophageal squamous cell carcinoma (ESCC),16,17 and laryngeal squamous cell carcinoma;18PCDH9 in glioblastoma;19 and PCDH8 in breast cancer and hematologic cancers.20,21 Abnormal expression of PCDH8, 10, and 17 represses tumor cell proliferation and migration but induces apoptosis and autophagy.11,16,17,21 Recent studies have shown involvement of PCDH17 methylation in ESCC, gastric and colorectal cancers,22 and urological cancer.16,23PCDH17 is silenced in ESCC, which is associated with a poor differentiation state, suggesting that PCDH17 is a TSG.

Our results show that apoptotic cells were positive for TUNEL and that active caspase-3 staining was significantly increased in CNE1-PCDH17 tumor tissue sections compared with CNE1-vector tumor tissue sections (Figure 7B).

DNA methylation leads to PCDH17 transcriptional silencing in NPC, indicating that PCDH17 may play a tumor suppressor role in NPC.

Show Full Abstract

<h4>Purpose</h4>Several <i>PCDH</i> genes were shown to be downregulated or silenced in carcinomas and act as candidate tumor suppressor genes. However, the functions of <i>PCDH17</i> in nasopharyngeal carcinoma (NPC) remain unclear. Here, we investigated the <i>PCDH17</i> promoter methylation status and its impact on the expression and functions of <i>PCDH17</i> in NPC.<h4>Patients and methods</h4>To determine the mRNA levels and promoter methylation status of <i>PCDH17</i> in NPC cell lines as well as 42 NPC patient specimens, we performed reverse transcription PCR, methylation-specific PCR, and bisulfite genome sequencing. The effects of ectopic <i>PCDH17</i> expression in NPC cell lines were determined by colony formation, cell proliferation, wound healing, in vitro human umbilical vein endothelial cells tube formation, migration, invasion, cell cycle, and apoptosis assays and an in vivo subcutaneous tumor model.<h4>Results</h4><i>PCDH17</i> expression was almost absent or significantly reduced in 100% of the NPC cell lines (5/5). However, 5-aza-2'-deoxycytidine and trichostatin A treatment restored <i>PCDH17</i> expression. Promoter methylation was involved in <i>PCDH17</i> silencing. Ectopic expression of <i>PCDH17</i> in silenced NPC cells reduced colony formation, cell migration, angiogenesis, VEGF secretion, and tumorigenicity.<h4>Conclusion</h4><i>PCDH17</i> plays a tumor suppressor role in NPC. <i>PCDH17</i> methylation may be a tumor-specific event and can be used as an epigenetic biomarker for NPC.

Also flagged:synthesislipaselauric acidceramideCeramidessphingolipids
Journal Article 2019-02-18 No Snippets Kanojia SV, Chatterjee S, Chattopadhyay S, Goswami D.
Show Full Abstract

A chemoenzymatic synthesis of the title compound has been developed using an efficient and highly enantioselective lipase-catalyzed acylation in a hydrophobic ionic liquid, [bmim][PF<sub>6</sub>], followed by a diastereoselective asymmetric dihydroxylation as the key steps for incorporating the stereogenic centers. The further conversion to the appropriate intermediates and subsequent acylation with lauric acid furnished the target compound.

Also flagged:coagulopathyclot formationclottingtraumaTICtranexamic acid
Journal Article 2019-02-17 No Snippets Juffermans NP, Wirtz MR, Balvers K, Baksaas-Aasen K, van Dieren S, Gaarder C, Naess PA, Stanworth S, Johansson PI, Stensballe J, Maegele M, Goslings JC, Brohi K, TACTIC partners.
Show Full Abstract

Essentials The response of thromboelastometry (ROTEM) parameters to therapy is unknown. We prospectively recruited hemorrhaging trauma patients in six level-1 trauma centres in Europe. Blood products and pro-coagulants prevent further derangement of ROTEM results. ROTEM algorithms can be used to treat and monitor trauma induced coagulopathy. SUMMARY: Background Rotational thromboelastometry (ROTEM) can detect trauma-induced coagulopathy (TIC) and is used in transfusion algorithms. The response of ROTEM to transfusion therapy is unknown. Objectives To determine the response of ROTEM profiles to therapy in bleeding trauma patients. Patients/Methods A prospective multicenter study in bleeding trauma patients (receiving ≥ 4 red blood cell [RBC] units) was performed. Blood was drawn in the emergency department, after administration of 4, 8 and 12 RBC units and 24 h post-injury. The response of ROTEM to plasma, platelets (PLTs), tranexamic acid (TXA) and fibrinogen products was evaluated in the whole cohort as well as in the subgroup of patients with ROTEM values indicative of TIC. Results Three hundred and nine bleeding and shocked patients were included. A mean dose of 3.8 g of fibrinogen increased FIBTEM CA5 by 5.2 mm (IQR: 4.1-6.3 mm). TXA administration decreased lysis by 5.4% (4.3-6.5%). PLT transfusion prevented further derangement of parameters of clot formation. The effect of PLTs on EXTEM ca5 values was more pronounced in patients with a ROTEM value indicative of TIC than in the whole cohort. Plasma transfusion decreased EXTEM clotting time by 3.1 s (- 10 s to 3.9 s) in the whole cohort and by 10.6 s (- 45 s to 24 s) in the subgroup of patients with a ROTEM value indicative of TIC. Conclusion The effects of therapy on ROTEM values were small, but prevented further derangement of test results. In patients with ROTEM values indicative of TIC, the efficacy of PLTs and plasma in correcting deranged ROTEM parameters is possibly more robust.

Also flagged:cell developmentgene expressionpairingnucleotidetranslationaldegradation
Journal Article 2019-02-17 No Snippets Bian H, Zhou Y, Zhou D, Zhang Y, Shang D, Qi J.
Show Full Abstract

Non-coding RNAs (ncRNAs) have been emerging players in cell development, differentiation, proliferation and apoptosis. Based on their differences in length and structure, they are subdivided into several categories including long non-coding RNAs (lncRNAs >200nt), stable non-coding RNAs (60-300nt), microRNAs (miRs or miRNAs, 18-24nt), circular RNAs, piwi-interacting RNAs (26-31nt) and small interfering RNAs (about 21nt). Therein, miRNAs not only directly regulate gene expression through pairing of nucleotide bases between the miRNA sequence and a specific mRNA that leads to the translational repression or degradation of the target mRNA, but also indirectly affect the function of downstream genes through interactions with lncRNAs and circRNAs. The latest studies have highlighted their importance in physiological and pathological processes. MiR-374 family member are located at the X-chromosome inactivation center. In recent years, numerous researches have uncovered that miR-374 family members play an indispensable regulatory role, such as in reproductive disorders, cell growth and differentiation, calcium handling in the kidney, various cancers and epilepsy. In this review, we mainly focus on the role of miR-374 family members in multiple physiological and pathological processes. More specifically, we also summarize their promising potential as novel prognostic biomarkers and therapeutic targets from bench to bedside.

Also flagged:ofGene Expressionregulation of gene expressioncancerinfectious diseaseschromosome
Journal Article 2019-02-17 No Snippets Fernandes JCR, Acuña SM, Aoki JI, Floeter-Winter LM, Muxel SM.
Show Full Abstract

The identification of RNAs that are not translated into proteins was an important breakthrough, defining the diversity of molecules involved in eukaryotic regulation of gene expression. These non-coding RNAs can be divided into two main classes according to their length: short non-coding RNAs, such as microRNAs (miRNAs), and long non-coding RNAs (lncRNAs). The lncRNAs in association with other molecules can coordinate several physiological processes and their dysfunction may impact in several pathologies, including cancer and infectious diseases. They can control the flux of genetic information, such as chromosome structure modulation, transcription, splicing, messenger RNA (mRNA) stability, mRNA availability, and post-translational modifications. Long non-coding RNAs present interaction domains for DNA, mRNAs, miRNAs, and proteins, depending on both sequence and secondary structure. The advent of new generation sequencing has provided evidences of putative lncRNAs existence; however, the analysis of transcriptomes for their functional characterization remains a challenge. Here, we review some important aspects of lncRNA biology, focusing on their role as regulatory elements in gene expression modulation during physiological and disease processes, with implications in host and pathogens physiology, and their role in immune response modulation.

Also flagged:anthraquinonecancerDPTRap1breast cancerAnthraquinones
Journal Article 2019-02-17 No Snippets Long S, Yuan C, Wang Y, Zhang J, Li G.
Show Full Abstract

<i>Damnacanthus indicus C.F.Gaertn</i> is known as Huci in traditional Chinese medicine. It contains a component having anthraquinone-like structure which is a part of the many used anticancer drugs. This study was to collect the evidence of disease-modulatory activities of Huci by analyzing the published literature on the chemicals and drugs. A list of its compounds and direct protein targets is predicted by using Bioinformatics Analysis Tool for Molecular Mechanism of TCM. A protein-protein interaction network using links between its directed targets and the other known targets was constructed. The DPT-associated genes in net were scrutinized by WebGestalt. Exploring the cancer genomics data related to Huci through cBio Portal. Survival analysis for the overlap genes is done by using UALCAN. We got 16 compounds and it predicts 62 direct protein targets and 100 DPTs and they were identified for these compounds. DPT-associated genes were analyzed by WebGestalt. Through the enrichment analysis, we got top 10 identified KEGG pathways. Refined analysis of KEGG pathways showed that one of these ten pathways is linked to Rap1 signaling pathway and another one is related to breast cancer. The survival analysis for the overlap genes shows the significant negative effect of these genes on the breast cancer patients. Through the research results of <i>Damnacanthus indicus C.F.Gaertn</i>, it is shown that medicine network pharmacology may be regarded as a new paradigm for guiding the future studies of the traditional Chinese medicine in different fields.

Also flagged:FLOT1Major depressive disordermental disordergene expressionpathogenesissleep
Journal Article 2019-02-16 ✓ 1 Snippet Zhong J, Li S, Zeng W, Li X, Gu C, Liu J, Luo XJ.
In-Text Gene Mentions

BTN3A3

Show Full Abstract

Major depressive disorder (MDD) is the most prevalent mental disorder that affects more than 200 million people worldwide. Recent large-scale genome-wide association studies (GWAS) have identified multiple risk variants that show robust association with MDD. Nevertheless, how the identified risk variants confer risk of MDD remains largely unknown. To identify risk variants that are associated with gene expression in human brain and to identify genes whose expression change may contribute to the susceptibility of MDD, we systematically integrated the genetic associations from a large-scale MDD GWAS (N = 480,359) and brain expression quantitative trait loci (eQTL) data (N = 494) using a Bayesian statistical framework (Sherlock). Sherlock integrative analysis showed that FLOT1 was significantly associated with MDD (P = 6.02 × 10<sup>-6</sup>), suggesting that risk variants may contribute to MDD susceptibility through affecting FLOT1 expression. We further examined the expression level of FLOT1 in MDD cases and controls and found that FLOT1 was significantly upregulated in brains and peripheral blood of MDD cases compared with controls (European sample). Interestingly, we found that FLOT1 expression was also significantly upregulated in peripheral blood of first-episode drug-naive MDD cases compared with controls (P = 1.01 × 10<sup>-7</sup>, Chinese sample). Our study identified FLOT1 as a novel MDD risk gene whose expression level may play a role in MDD. In addition, our findings also suggest that risk variants may confer risk of MDD through affecting expression of FLOT1. Further functional investigation of FLOT1 may provide new insights for MDD pathogenesis.

Also flagged:tumorcancersepithelial-mesenchymal transitioncancerbindingnucleotides
Journal Article 2019-02-16 No Snippets Nie D, Fu J, Chen H, Cheng J, Fu J.
Show Full Abstract

MicroRNA-34a (miR-34a), a tumor suppressor, has been reported to be dysregulated in various human cancers. MiR-34a is involves in certain epithelial-mesenchymal transition (EMT)-associated signal pathways to repress tumorigenesis, cancer progression, and metastasis. Due to the particularity of miR-34 family in tumor-associated EMT, the significance of miR-34a is being increasingly recognized. Competing endogenous RNA (ceRNA) is a novel concept involving mRNA, circular RNA, pseudogene transcript, and long noncoding RNA regulating each other's expressions using microRNA response elements to compete for the binding of microRNAs. Studies showed that miR-34a is efficient for cancer therapy. Here, we provide an overview of the function of miR-34a in tumor-associated EMT. ceRNA hypothesis plays an important role in miR-34a regulation in EMT, cancer progression, and metastasis. Its potential roles and challenges as a microRNA therapeutic candidate are discussed. As the negative effect on cancer progression, miR-34a should play crucial roles in clinical diagnosis and cancer therapy.

Also flagged:cancerMdh1cholangiocarcinomaannexin Vp53propidium iodide
Journal Article 2019-02-15 ✓ 2 Snippets Giovannini C, Salzano AM, Baglioni M, Vitale M, Scaloni A, Zambrano N, Giannone FA, Vasuri F, D'Errico A, Svegliati Baroni G, Bolondi L, Gramantieri L.
In-Text Gene Mentions

PRDX6

…(Prdx4), peroxiredoxin 6 (Prdx6) and protein disulphide…

Show Full Abstract

<h4>Background</h4>Sorafenib is the first targeted agent proven to improve survival of patients with advanced hepatocellular carcinoma (HCC) and it has been used in first line treatments with heterogeneous response across patients. Most of the promising agents evaluated in first-line or second-line phase III trials for HCC failed to improve patient survival. The absence of molecular characterisation, including the identification of pathways driving resistance might be responsible for these disappointing results.<h4>Methods</h4>2D DIGE and MS analyses were used to reveal proteomic signatures resulting from Notch3 inhibition in HepG2 cells, combined with brivanib treatment. The therapeutic potential of Notch3 inhibition combined with brivanib treatment was also demonstrated in a rat model of HCC and in cell lines derived from different human cancers.<h4>Results</h4>Using a proteomic approach, we have shown that Notch3 is strongly involved in brivanib resistance through a p53-dependent regulation of enzymes of the tricarboxylic acid (TCA), both in vitro and in vivo.<h4>Conclusion</h4>We have demonstrated that regulation of the TCA cycle is a common mechanism in different human cancers, suggesting that Notch3 inhibitors combined with brivanib treatment may represent a strong formulation for the treatment of HCC as well as Notch3-driven cancers.

Also flagged:Synthesiswatercarbonmetaloxidephotosynthesis
Journal Article 2019-02-15 No Snippets Dalle KE, Warnan J, Leung JJ, Reuillard B, Karmel IS, Reisner E.
Show Full Abstract

The synthesis of renewable fuels from abundant water or the greenhouse gas CO<sub>2</sub> is a major step toward creating sustainable and scalable energy storage technologies. In the last few decades, much attention has focused on the development of nonprecious metal-based catalysts and, in more recent years, their integration in solid-state support materials and devices that operate in water. This review surveys the literature on 3d metal-based molecular catalysts and focuses on their immobilization on heterogeneous solid-state supports for electro-, photo-, and photoelectrocatalytic synthesis of fuels in aqueous media. The first sections highlight benchmark homogeneous systems using proton and CO<sub>2</sub> reducing 3d transition metal catalysts as well as commonly employed methods for catalyst immobilization, including a discussion of supporting materials and anchoring groups. The subsequent sections elaborate on productive associations between molecular catalysts and a wide range of substrates based on carbon, quantum dots, metal oxide surfaces, and semiconductors. The molecule-material hybrid systems are organized as "dark" cathodes, colloidal photocatalysts, and photocathodes, and their figures of merit are discussed alongside system stability and catalyst integrity. The final section extends the scope of this review to prospects and challenges in targeting catalysis beyond "classical" H<sub>2</sub> evolution and CO<sub>2</sub> reduction to C<sub>1</sub> products, by summarizing cases for higher-value products from N<sub>2</sub> reduction, C <sub>x>1</sub> products from CO<sub>2</sub> utilization, and other reductive organic transformations.

Also flagged:tauopathiestauADprotein kinasesprotein-3acetyl
Journal Article 2019-02-15 No Snippets Jadhav S, Avila J, Schöll M, Kovacs GG, Kövari E, Skrabana R, Evans LD, Kontsekova E, Malawska B, de Silva R, Buee L, Zilka N.
Show Full Abstract

Tau neuronal and glial pathologies drive the clinical presentation of Alzheimer's disease and related human tauopathies. There is a growing body of evidence indicating that pathological tau species can travel from cell to cell and spread the pathology through the brain. Throughout the last decade, physiological and pathological tau have become attractive targets for AD therapies. Several therapeutic approaches have been proposed, including the inhibition of protein kinases or protein-3-O-(N-acetyl-beta-D-glucosaminyl)-L-serine/threonine Nacetylglucosaminyl hydrolase, the inhibition of tau aggregation, active and passive immunotherapies, and tau silencing by antisense oligonucleotides. New tau therapeutics, across the board, have demonstrated the ability to prevent or reduce tau lesions and improve either cognitive or motor impairment in a variety of animal models developing neurofibrillary pathology. The most advanced strategy for the treatment of human tauopathies remains immunotherapy, which has already reached the clinical stage of drug development. Tau vaccines or humanised antibodies target a variety of tau species either in the intracellular or extracellular spaces. Some of them recognise the amino-terminus or carboxy-terminus, while others display binding abilities to the proline-rich area or microtubule binding domains. The main therapeutic foci in existing clinical trials are on Alzheimer's disease, progressive supranuclear palsy and non-fluent primary progressive aphasia. Tau therapy offers a new hope for the treatment of many fatal brain disorders. First efficacy data from clinical trials will be available by the end of this decade.

Also flagged:Huntingtincytoskeletonα-actininactin associated proteinscell adhesionlocalization
Journal Article 2019-02-15 ✓ 5 Snippets Tousley A, Iuliano M, Weisman E, Sapp E, Richardson H, Vodicka P, Alexander J, Aronin N, DiFiglia M, Kegel-Gleason KB.
In-Text Gene Mentions

Huntingtin is the protein product of HTT, a gene which is mutated in Huntington’s disease (HD) when a normal CAG repeat is expanded to >37 [5] and has been implicated in diverse cellular functions including vesicle trafficking and signaling functions at membranes (reviews [6, 7]).

…protein product ofHTT, a gene which…

…lasmids containing FLAG-taggedHTTdeletion cDNA constructs…

…gel (Full lengthHtt, arrow, predicted molecular…

…lysates (Full lengthHtt, arrow).…

Show Full Abstract

One response of cells to growth factor stimulus involves changes in morphology driven by the actin cytoskeleton and actin associated proteins which regulate functions such as cell adhesion, motility and in neurons, synaptic plasticity. Previous studies suggest that Huntingtin may be involved in regulating morphology however, there has been limited evidence linking endogenous Huntingtin localization or function with cytoplasmic actin in cells. We found that depletion of Huntingtin in human fibroblasts reduced adhesion and altered morphology and these phenotypes were made worse with growth factor stimulation, whereas the presence of the Huntington's Disease mutation inhibited growth factor induced changes in morphology and increased numbers of vinculin-positive focal adhesions. Huntingtin immunoreactivity localized to actin stress fibers, vinculin-positive adhesion contacts and membrane ruffles in fibroblasts. Interactome data from others has shown that Huntingtin can associate with α-actinin isoforms which bind actin filaments. Mapping studies using a cDNA encoding α-actinin-2 showed that it interacts within Huntingtin aa 399-969. Double-label immunofluorescence showed Huntingtin and α-actinin-1 co-localized to stress fibers, membrane ruffles and lamellar protrusions in fibroblasts. Proximity ligation assays confirmed a close molecular interaction between Huntingtin and α-actinin-1 in human fibroblasts and neurons. Huntingtin silencing with siRNA in fibroblasts blocked the recruitment of α-actinin-1 to membrane foci. These studies support the idea that Huntingtin is involved in regulating adhesion and actin dependent functions including those involving α-actinin.

Also flagged:Fragile X syndromecognitive impairmentfragile X mental retardation proteinFMRPgene silencingpathogenesis
Journal Article 2019-02-15 No Snippets Abu Diab M, Eiges R.
Show Full Abstract

Fragile X syndrome (FXS) is the most common heritable form of cognitive impairment. It results from a deficiency in the fragile X mental retardation protein (FMRP) due to a CGG repeat expansion in the 5'-UTR of the X-linked <i>FMR1</i> gene. When CGGs expand beyond 200 copies, they lead to epigenetic gene silencing of the gene. In addition, the greater the allele size, the more likely it will become unstable and exhibit mosaicism for expansion size between and within tissues in affected individuals. The timing and mechanisms of <i>FMR1</i> epigenetic gene silencing and repeat instability are far from being understood given the lack of appropriate cellular and animal models that can fully recapitulate the molecular features characteristic of the disease pathogenesis in humans. This review summarizes the data collected to date from mutant human embryonic stem cells, induced pluripotent stem cells, and hybrid fusions, and discusses their contribution to the investigation of FXS, their key limitations, and future prospects.

Also flagged:netrin-1axonnetrin receptorsynapsessecretionsynapse
Journal Article 2019-02-15 ✓ 5 Snippets Wong EW, Glasgow SD, Trigiani LJ, Chitsaz D, Rymar V, Sadikot A, Ruthazer ES, Hamel E, Kennedy TE.
In-Text Gene Mentions

…the netrin receptorDCCare both enriched…

…and its receptorDCCare enriched at…

…However, netrin-1 andDCCare widely expressed…

DCChaploinsufficient mice display…

…that netrin-1 andDCCmay influence the…

Show Full Abstract

Netrin-1 was initially characterized as an axon guidance molecule that is essential for normal embryonic neural development; however, many types of neurons continue to express netrin-1 in the postnatal and adult mammalian brain. Netrin-1 and the netrin receptor DCC are both enriched at synapses. In the adult hippocampus, activity-dependent secretion of netrin-1 by neurons potentiates glutamatergic synapse function, and is critical for long-term potentiation, an experimental cellular model of learning and memory. Here, we assessed the impact of neuronal expression of netrin-1 in the adult brain on behavior using tests of learning and memory. We show that adult mice exhibit impaired spatial memory following conditional deletion of netrin-1 from glutamatergic neurons in the hippocampus and neocortex. Further, we provide evidence that mice with conditional deletion of netrin-1 do not display aberrant anxiety-like phenotypes and show a reduction in self-grooming behavior. These findings reveal a critical role for netrin-1 expressed by neurons in the regulation of spatial memory formation.

Also flagged:atrial fibrillationAFIGF1insulin like growth factor 1polymerasePI3K
Journal Article 2019-02-15 No Snippets Wang J, Li Z, Du J, Li J, Zhang Y, Liu J, Hou Y.
Show Full Abstract

<h4>Background</h4>Structural remodeling is critical to the initiation and maintenance of atrial fibrillation (AF). IGF1, insulin like growth factor 1, has been recognized as contributor to fibrosis. However, the roles and mechanisms of IGF1 in structural remodeling during AF is still unclear.<h4>Methods</h4>We investigated the transcriptional expression profiles of left atria in AF and non-AF rat models by using microarray analysis. And quantitative real-time polymerase chain reaction (qRT-PCR) was performed to validate the accuracy. After bioinformatics analysis, IGF1 was selected to explore its effects and mechanisms on atrial fibrosis. The fibroblasts were extracted from atria of rats, and randomly divided into negative control group, mIGF1 overexpression group and mIGF1 silencing group. Then 30 healthy male Wistar rats were randomly divided into negative control group (n = 10), pacing group (n = 10), pacing + mIGF1 silencing viruses group (n = 10). Then the intracardiac electrophysiological examination, qRT-PCR, Western Blotting, masson staining were conducted after IGF1 interfering experiments.<h4>Results</h4>A total of 956 differentially expressed transcripts were identified, in which 395 transcripts were down-regulated and 561 transcripts were up-regulated. Bioinformatics analysis was conducted to predict the functions and interactions of the aberrantly expressed genes. The inhibition of IGF1 function in AF model could ameliorate the inducibility of AF. The IGF1 plays a fibrotic role by activating the PI3K-Akt pathway to increase the expression of CTGF and AT1R.<h4>Conclusions</h4>IGF1 develops vital function in regulating structural remodeling during AF, which could illustrate the mechanism of AF pathogenesis and supply potential targets for its precise treatment.

Also flagged:tumorcolorectal cancertumorscell proliferationPolycomb group protein enhancer of zeste homolog 2EZH2
Journal Article 2019-02-15 ✓ 5 Snippets Shi L, Hong X, Ba L, He X, Xiong Y, Ding Q, Yang S, Peng G.
In-Text Gene Mentions

We then examined the clinicopathological characteristics of lncRNA ZNFXA-AS1 in CRC patients, the results indicated that lncRNA ZNFX1-AS1 was significantly associated with tumor size, invasion depth, lymph node invasion, and advanced TNM stage.

The real-time PCR analysis confirmed that the expression of lncRNA ZNFX1-AS1 was significantly decreased in tumors formed by sh-ZNFX1-AS1 cells (Fig. 2g).

Previously, Wang et al reported that lncRNA ZNFX1-AS1 acted as a tumor suppressor and inhibited the growth of hepatocellular carcinoma cells27, this implies that lncRNA ZNFX1-AS1 expression pattern may be tissue and cell-specific, and lncRNA ZNFX1-AS1 can be oncogenic or tumor-suppressive depending on the tumor type and cellular microenvironment.

The results showed that the tumor weight and tumor volume was significantly reduced in the sh-ZNFX1-AS1 group as compared with the sh-NC group (Fig. 2d and f).

lncRNA ZNFX1-AS1 promotes CRC cell proliferation and tumor growth

Show Full Abstract

Mounting evidences indicated that long non-coding RNA is dysregulated and involved in the pathology of tumors. However, the role of lncRNAs in colorectal cancer (CRC) progression is not fully determined. Differentially expressed lncRNA profile in CRC was conducted by lncRNA microarray in 15 pairs of CRC tissues and adjacent normal tissues, and validated by real-time PCR analysis in another 106 pairs of tissues. The biological effect of lncRNA ZNFX1-AS1 was evaluated by in vitro and in vivo assays. The regulation between lncRNA ZNFX1-AS1 and miR-144 was evaluated by a series of experiments. We found that lncRNA ZNFX1-AS1 expression was significantly upregulated in CRC tissues and cell lines, and the expression of lncRNA ZNFX1-AS1 was associated with aggressive tumor phenotype and poor prognosis in CRC. Functionally, knockdown of lncRNA ZNFX1-AS1 inhibited cell proliferation, invasion, in vitro and tumorigenesis and metastasis in vivo. Further investigation demonstrated that lncRNA ZNFX1-AS1 functioned as a competing endogenous RNA (ceRNA) for miR-144, thereby leading to the depression of its endogenous target gene Polycomb group protein enhancer of zeste homolog 2 (EZH2). We found that lncRNA ZNFX1-AS1 is significantly upregulated in CRC, and the newly identified lncRNA ZNFX1-AS1-miR-144-EZH2 axis is involved in the regulation of CRC progression, which might be used as potential therapeutic targets for CRC patients.

Also flagged:Tween-20Hox-C9actinAKT2tumorsMYCN
Journal Article 2019-02-15 ✓ 1 Snippet Soriano A, Masanas M, Boloix A, Masiá N, París-Coderch L, Piskareva O, Jiménez C, Henrich KO, Roma J, Westermann F, Stallings RL, Sábado C, de Toledo JS, Santamaria A, Gallego S, Segura MF.
In-Text Gene Mentions

…is CHAF1A, achromatin modifiermodifier protein recently…

Show Full Abstract

Current therapies for most non-infectious diseases are directed at or affect functionality of the human translated genome, barely 2% of all genetic information. By contrast, the therapeutic potential of targeting the transcriptome, ~ 70% of the genome, remains largely unexplored. RNA therapeutics is an emerging field that widens the range of druggable targets and includes elements such as microRNA. Here, we sought to screen for microRNA with tumor-suppressive functions in neuroblastoma, an aggressive pediatric tumor of the sympathetic nervous system that requires the development of new therapies. We found miR-323a-5p and miR-342-5p to be capable of reducing cell proliferation in multiple neuroblastoma cell lines in vitro and in vivo, thereby providing a proof of concept for miRNA-based therapies for neuroblastoma. Furthermore, the combined inhibition of the direct identified targets such as CCND1, CHAF1A, INCENP and BCL-XL could reveal new vulnerabilities of high-risk neuroblastoma.

Also flagged:axonalorganizationmyelinaxonsHDneurodegenerative disorder
Journal Article 2019-02-15 ✓ 1 Snippet Gatto RG, Gatto RG, Ye AQ, Colon-Perez L, Mareci TH, Lysakowski A, Price SD, Brady ST, Karaman M, Morfini G, Magin RL.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Objective</h4>The goal of this work is to study the changes in white matter integrity in R6/2, a well-established animal model of Huntington's disease (HD) that are captured by ex vivo diffusion imaging (DTI) using a high field MRI (17.6 T).<h4>Materials and methods</h4>DTI and continuous time random walk (CTRW) models were used to fit changes in the diffusion-weighted signal intensity in the corpus callosum of controls and in R6/2 mice.<h4>Results</h4>A significant 13% decrease in fractional anisotropy, a 7% increase in axial diffusion, and a 33% increase in radial diffusion were observed between R6/2 and control mice. No change was observed in the CTRW beta parameter, but a significant decrease in the alpha parameter (- 21%) was measured. Histological analysis of the corpus callosum showed a decrease in axonal organization, myelin alterations, and astrogliosis. Electron microscopy studies demonstrated ultrastructural changes in degenerating axons, such as an increase in tortuosity in the R6/2 mice.<h4>Conclusions</h4>DTI and CTRW diffusion models display quantitative changes associated with the microstructural alterations observed in the corpus callosum of the R6/2 mice. The observed increase in the diffusivity and decrease in the alpha CTRW parameter providing support for the use of these diffusion models for non-invasive detection of white matter alterations in HD.

Also flagged:methylationpathogenesismelanomaneurological diseaseshomeoboxpolycomb protein
Journal Article 2019-02-15 ✓ 2 Snippets Georgiadis P, Gavriil M, Rantakokko P, Ladoukakis E, Botsivali M, Kelly RS, Bergdahl IA, Kiviranta H, Vermeulen RCH, Spaeth F, Hebbels DGAJ, Kleinjans JCS, de Kok TMCM, Palli D, Vineis P, Kyrtopoulos SA, EnviroGenomarkers consortium.
In-Text Gene Mentions

The involvement of these sites in the pathogenesis of CLL isbiologically plausible since they are associated with PCDH17 [protocadherin 17,a tumor suppressor gene (Yin et al.,2016)], miR196B [hypermethylated in leukemia, thus allowing theupregulation of a number of oncogenes (Liu etal., 2013)] and BARHL2 [BarH like homeobox 2, hypermethylated inmultiple cancer types (Rauch et al.,2012) and a regulator of proliferation and survival (Juraver-Geslin et al., 2011)].

…are associated withPCDH17[protocadherin 17, a…

Show Full Abstract

<h4>Objectives</h4>To characterize the impact of PCB exposure on DNA methylation in peripheral blood leucocytes and to evaluate the corresponding changes in relation to possible health effects, with a focus on B-cell lymphoma.<h4>Methods</h4>We conducted an epigenome-wide association study on 611 adults free of diagnosed disease, living in Italy and Sweden, in whom we also measured plasma concentrations of 6 PCB congeners, DDE and hexachlorobenzene.<h4>Results</h4>We identified 650 CpG sites whose methylation correlates strongly (FDR < 0.01) with plasma concentrations of at least one PCB congener. Stronger effects were observed in males and in Sweden. This epigenetic exposure profile shows extensive and highly statistically significant overlaps with published profiles associated with the risk of future B-cell chronic lymphocytic leukemia (CLL) as well as with clinical CLL (38 and 28 CpG sites, respectively). For all these sites, the methylation changes were in the same direction for increasing exposure and for higher disease risk or clinical disease status, suggesting an etiological link between exposure and CLL. Mediation analysis reinforced the suggestion of a causal link between exposure, changes in DNA methylation and disease. Disease connectivity analysis identified multiple additional diseases associated with differentially methylated genes, including melanoma for which an etiological link with PCB exposure is established, as well as developmental and neurological diseases for which there is corresponding epidemiological evidence. Differentially methylated genes include many homeobox genes, suggesting that PCBs target stem cells. Furthermore, numerous polycomb protein target genes were hypermethylated with increasing exposure, an effect known to constitute an early marker of carcinogenesis.<h4>Conclusions</h4>This study provides mechanistic evidence in support of a link between exposure to PCBs and the etiology of CLL and underlines the utility of omic profiling in the evaluation of the potential toxicity of environmental chemicals.

Also flagged:TumorCancertumorsextracellularangiogenesisEpithelial tumors
Journal Article 2019-02-15 No Snippets Roma-Rodrigues C, Mendes R, Baptista PV, Fernandes AR.
Show Full Abstract

Cancer development is highly associated to the physiological state of the tumor microenvironment (TME). Despite the existing heterogeneity of tumors from the same or from different anatomical locations, common features can be found in the TME maturation of epithelial-derived tumors. Genetic alterations in tumor cells result in hyperplasia, uncontrolled growth, resistance to apoptosis, and metabolic shift towards anaerobic glycolysis (Warburg effect). These events create hypoxia, oxidative stress and acidosis within the TME triggering an adjustment of the extracellular matrix (ECM), a response from neighbor stromal cells (e.g., fibroblasts) and immune cells (lymphocytes and macrophages), inducing angiogenesis and, ultimately, resulting in metastasis. Exosomes secreted by TME cells are central players in all these events. The TME profile is preponderant on prognosis and impacts efficacy of anti-cancer therapies. Hence, a big effort has been made to develop new therapeutic strategies towards a more efficient targeting of TME. These efforts focus on: (i) therapeutic strategies targeting TME components, extending from conventional therapeutics, to combined therapies and nanomedicines; and (ii) the development of models that accurately resemble the TME for bench investigations, including tumor-tissue explants, "tumor on a chip" or multicellular tumor-spheroids.

Also flagged:cognitive impairmentdementiafronto-temporal dementiaAlzheimer dementiaACEdementia syndromes
Journal Article 2019-02-15 ✓ 5 Snippets Bruno D, Schurmann Vignaga S.
In-Text Gene Mentions

…Comparison of theACE-IIIwith other screening…

…Utility of theACE-IIIin the detection…

…studies, with theACE-IIIin several studies,…

…studies evaluated theACE-III, but in these…

…these studies theACE-IIIshowed very similar…

Show Full Abstract

Addenbrooke's cognitive examination III is a screening test that is composed of tests of attention, orientation, memory, language, visual perceptual and visuospatial skills. It is useful in the detection of cognitive impairment, especially in the detection of Alzheimer's disease and fronto-temporal dementia. The aim of this study is to do a critical review of the Addenbrooke's cognitive examination III. The different language versions available and research about the different variables that have relationship with the performance of the subject in the ACE-III are listed. The ACE-III is a detection technique that can differentiate patients with and without cognitive impairment, is sensitive to the early stages of dementia, and is available in different languages. However, further research is needed to obtain optimal cutoffs for the different versions and to evaluate the impact of different age, gender, IQ, and education variables on the performance of the test.

Also flagged:gene expressioncancerstumorBCNSpostnatal neoplasmsmTOR
Journal Article 2019-02-15 No Snippets Phatak A, Athar M, Crowell JA, Leffel D, Herbert BS, Bale AE, Kopelovich L.
Show Full Abstract

Studies of dominantly heritable cancers enabled insights about tumor progression. BCNS is a dominantly inherited disorder that is characterized by developmental abnormalities and postnatal neoplasms, principally BCCs. We performed an exploratory gene expression profiling of primary cell cultures derived from clinically unaffected skin biopsies of BCNS gene-carriers (<i>PTCH1</i> <sup>+/-</sup>) and normal individuals. PCA and HC of untreated keratinocytes or fibroblasts failed to clearly distinguish BCNS samples from controls. These results are presumably due to the common suppression of canonical HH signaling <i>in vitro</i>. We then used a relaxed threshold (p-value <0.05, no FDR cut-off; FC 1.3) that identified a total of 585 and 857 genes differentially expressed in BCNS keratinocytes and fibroblasts samples, respectively. A GSEA identified pancreatic β cell hallmark and mTOR signaling genes in BCNS keratinocytes, whereas analyses of BCNS fibroblasts identified gene signatures regulating pluripotency of stem cells, including WNT pathway. Significantly, rapamycin treatment (FDR<0.05), affected a total of 1411 and 4959 genes in BCNS keratinocytes and BCNS fibroblasts, respectively. In contrast, rapamycin treatment affected a total of 3214 and 4797 genes in normal keratinocytes and normal fibroblasts, respectively. The differential response of BCNS cells to rapamycin involved 599 and 1463 unique probe sets in keratinocytes and fibroblasts, respectively. An IPA of these genes in the presence of rapamycin pointed to hepatic fibrosis/stellate cell activation, and HIPPO signaling in BCNS keratinocytes, whereas mitochondrial dysfunction and <i>AGRN</i> expression were uniquely enriched in BCNS fibroblasts. The gene expression changes seen here are likely involved in the etiology of BCCs and they may represent biomarkers/targets for early intervention.

Also flagged:norepinephrine transporterNETneuroendocrine tumorssalt1Synthesis
Journal Article 2019-02-15 No Snippets Gourand F, Patin D, Henry A, Ibazizène M, Dhilly M, Fillesoye F, Tirel O, Tintas ML, Papamicaël C, Levacher V, Barré L.
Show Full Abstract

The norepinephrine transporter (NET) plays an important role in neurotransmission and is involved in a multitude of psychiatric and neurodegenerative diseases. [<sup>123</sup>I/<sup>131</sup>I]<i>meta</i>-iodobenzylguanidine (MIBG) is a widely used radiotracer in the diagnosis and follow-up of peripheral neuroendocrine tumors overexpressing the norepinephrine transporter. MIBG does not cross the blood-brain barrier (BBB), and we have demonstrated the "proof-of-concept" that 1,4-dihydroquinoline/quinolinium salt as chemical delivery system (CDS) is a promising tool to deliver MIBG to the brain. To improve BBB passage, various substituents on the 1,4-dihydroquinoline moiety and a linker between CDS and MIBG were added. A series of CDS-MIBG <b>1a</b>-<b>d</b> was synthesized, labeled with carbon-11, and evaluated <i>in vivo</i> into rats. The <i>in vivo</i> results demonstrated that, although adding substituents on CDS in <b>1a</b>-<b>c</b> is of no benefit for brain delivery of MIBG, the presence of a linker in CDS-MIBG <b>1d</b> greatly improved both brain penetration and the release rate of MIBG in the central nervous system.

Also flagged:Venous Thromboembolismcoagulation factor VIIIVon Willebrand factorVWFfactor VIIIcoagulation
Journal Article 2019-02-15 ✓ 1 Snippet Rajpal S, Ahluwalia J, Kumar N, Malhotra P, Uppal V.
In-Text Gene Mentions

ATIII

Show Full Abstract

Elevated levels of coagulation factor VIII have been associated with increased risk for venous thromboembolism (VTE). The role of Von Willebrand factor (VWF) in VTE is unclear. In this study, we investigated the association of raised levels of VWF and factor VIII in patients with VTE. 100 patients of VTE and 100 age and gender matched controls were tested for levels of VWF antigen, coagulation factor VIII:C, Protein C, Protein S, antithrombin, antiphospholipid antibodies and for the presence of Factor V Leiden mutation. The mean level of VWF was significantly higher amongst patients of VTE (177.3 IU/dl) when compared to controls (129.7 IU/dl) (<i>P</i> < 0.001). Similarly, the mean level of FVIII:C was significantly higher amongst patients of VTE (199.1 IU/dl) when compared to controls (145.2 IU/dl) (<i>P</i> < 0.001). On logistic regression analysis, after adjusting for FVIII:C, Protein S, factor V Leiden and trauma, the association of raised VWF with VTE remained significant (<i>P </i>= 0.001). Similarly higher levels of FVIII:C persisted to have an independent association with VTE (<i>P </i>= 0.004). Both, higher levels of VWF and FVIII:C levels, are independently associated with VTE.

Also flagged:polyphosphoesterscholesterolethylenesodiummethoxydemethylation
Journal Article 2019-02-15 No Snippets Noree S, Iwasaki Y.
Show Full Abstract

Protein therapeutics has recently attracted interest in various medical treatments. However, the structure and function preservation in proteins under physiological conditions is still an important issue and reliable immobilization techniques are required. In this study, the thermally assisted complexation of proteins with amphiphilic polyphosphoesters is proposed as a new methodology for their durability improvement. Amphiphilic cholesterol-terminated poly(ethylene sodium phosphate) (CH-PEP·Na) was synthesized via the organocatalytic ring-opening polymerization of 2-methoxy-2-oxo-1,3,2-dioxaphospholane initiated by cholesterol as the hydrophobic molecule and followed by demethylation and neutralization. For the protein nanocarrier preparation, a complex of the amphiphilic CH-PEP·Na with bovine serum albumin (BSA) was formed through the hydrophobic interactions between the lipophilic moieties of the protein and the cholesteryl groups of the CH-PEP·Na chains, which were induced by thermal treatment at 90 °C. The resulting complex size ranged between 27 and 51 nm, as confirmed by dynamic light scattering. The complexes dispersed in an aqueous medium exhibited a high stability in size for up to 1 month of storage. CH-PEP·Na efficiently inhibited the thermal aggregation and sedimentation of BSA, unlike poly(ethylene sodium phosphate) (PEP·Na) and cholesterol-terminated poly(ethylene glycol) (CH-PEG). In addition, CH-PEP·Na was able to protect the complexed BSA against proteolytic digestion and the BSA-CH-PEP·Na complexes well adsorbed onto hydroxyapatite even in the presence of BSA (5.5 g/dL). Hence, thermally induced protein-CH-PEP·Na complexes can be a potential tool for the development of bone and dental applications.

bioRxiv 2019-02-15 Preprint (No Snippets API) Donley DW, Jenkins T, Deiter C, Campbell R, Realing M, Chopra V, Hersch S, Gigley JP, Fox JH.
Show Full Abstract

Toxoplasma gondii causes a prevalent neuroinvasive protozoal pathogen that in immune competent individuals results in latent infection characterized by intra-cellular parasite cysts in brain. Despite life-long infection, the role of latent toxoplasmosis on chronic neurodegenerative processes is poorly understood. Huntington’s disease (HD) is a progressive neurodegenerative disorder caused by a dominant CAG repeat expansion in the huntingtin gene (HTT) that results in the expression and accumulation of mutant huntingtin protein (mHTT). The mutant HD gene is fully penetrant. However, there is significant variability in disease progression that is in part explained by as yet unidentified environmental factors. The kynurenine pathway of tryptophan metabolism (KP) is an inflammatory pathway and its activation is implicated in HD pathogenesis. KP upregulation also occurs in response to infection with Toxoplasma gondii suggesting that the latent infection may promote HD. We discovered that mice on the FVB/NJ background develop latent toxoplasmosis following infection with the ME49 strain of T. gondii . This finding enabled us to address the hypothesis that latent toxoplasmosis potentiates disease in the YAC128 mouse model of HD, as these mice are maintained on the FVB/NJ background. Wild-type and HD mice were infected at 2-months of age. During the 10-month follow-up, infection had adverse effects on mice of both genotypes. However, YAC128 HD mice demonstrated specific vulnerability to latent toxoplasmosis, as demonstrated by the presence of increased striatal degeneration, high levels of the blood neurodegeneration marker neurofilament light protein, and elevated brain soluble mHTT. Our studies have uncovered a novel HD-infection interaction in mice that provides insights into the large variability of the human HD phenotype.

bioRxiv 2019-02-15 Preprint (No Snippets API) Donley DW, Nelson R, Gigley JP, Fox JH.
Show Full Abstract

Huntington’s disease (HD) is a progressive neurodegenerative disease that affects the striatum and cerebral cortex. It is caused by a dominant CAG trinucleotide expansion in exon 1 of the HTT gene. Mutant huntingtin protein (mHtt) is expressed in neurons and immune cells. HD patients demonstrate altered blood cytokine profiles and altered responses of peripheral immune cells to inflammatory stimuli. However, the effects of mHtt on microglial immune responses are not fully understood. Herein we discuss the current understanding of how mHtt alters microglial inflammatory responses. Using lentivirus, we expressed the N171 N-terminal fragment of wild-type or mhtt containing 18 and 82 glutamine repeats in cultured EOC-20 microglial cells. We then measured responses to lipopolysaccharide or interleukin-6. Mutant huntingtin-expressing microglial cells produced less interleukin-6 and nitric oxide in response to lipopolysaccharide stimulation than wild-type huntingtin-expressing cells. However, mHtt-expressing microglia stimulated with interleukin-6 produced more nitric oxide than wild-type cells. Mutant huntingtin-expressing cells had higher basal NF-κB and further elevations of NF-κB after interleukin-6 but not lipopolysaccharide stimulation. Thus we demonstrate the potential of mHtt to dampen responses to lipopolysaccharide but potentiate responses to interleukin-6. This work adds to the emerging understanding that mHtt alters not only baseline status of cells but may also result in altered immune responses dependent on the nature of the inflammatory stimuli. We also present our perspective that in human HD the extent of inflammation may depend, in part, on altered responses to varied inflammatory stimuli including environmental factors such as infection.

Also flagged:Hepatocellular CarcinomahematoxylintumorstumordeathTdt
Journal Article 2019-02-14 ✓ 1 Snippet Bale R, Schullian P, Eberle G, Putzer D, Zoller H, Schneeberger S, Manzl C, Moser P, Oberhuber G.
In-Text Gene Mentions

…(n = 56),hemochromatosis(n = 1),…

Show Full Abstract

This retrospective study was performed to evaluate the efficacy of three-dimensional (3D)-navigated multiprobe radiofrequency ablation (RFA) with intraprocedural image fusion for treatment of hepatocellular carcinoma (HCC) by histopathological examination. From 2009 to 2018, 97 patients (84 men, 13 women; median age, 60 years; range, 1-71) were transplanted after bridging therapy of 195 HCCs by stereotactic RFA (SRFA). The median interval between the first SRFA and transplantation was 6.8 months (range, 0-71). The rate of residual vital tissue (RVT) could be assessed in 188 of 195 lesions in 96 of 97 patients by histological examination of the explanted livers using hematoxylin and eosin (H&E) and Tdt-mediated UTP nick-end labeling (TUNEL) stains. Histopathological results were compared with the findings of the last computed tomography (CT) imaging before liver transplantation (LT). Median number and size of treated tumors were 1 (range, 1-8) and 2.5 cm (range, 1-8). Complete radiological response was achieved in 186 of 188 nodules (98.9%) and 94 of 96 patients (97.9%) and complete pathological response in the explanted liver specimen in 183 of 188 nodules (97.3%) and 91 of 96 patients (94.8%), respectively. In lesions ≥3 cm, complete tumor cell death was achieved in 50 of 52 nodules (96.2%). Residual tumor did not correlate with tumor size (P = 0.5). Conclusion: Multiprobe SRFA with intraprocedural image fusion represents an efficient, minimally invasive therapy for HCC, even with tumor sizes larger than 3 cm, and without the need of a combination with additional treatments. The results seem to justify the additional efforts related to the stereotactic approach.

Also flagged:membraneoxytocinOTvasopressinVPlactation
Journal Article 2019-02-14 No Snippets Armstrong WE, Foehring RC, Kirchner MK, Sladek CD.
Show Full Abstract

To understand the contribution of intrinsic membrane properties to the different in vivo firing patterns of oxytocin (OT) and vasopressin (VP) neurones, in vitro studies are needed, where stable intracellular recordings can be made. Combining immunochemistry for OT and VP and intracellular dye injections allows characterisation of identified OT and VP neurones, and several differences between the two cell types have emerged. These include a greater transient K<sup>+</sup> current that delays spiking to stimulus onset, and a higher Na<sup>+</sup> current density leading to greater spike amplitude and a more stable spike threshold, in VP neurones. VP neurones also show a greater incidence of both fast and slow Ca<sup>2+</sup> -dependent depolarising afterpotentials, the latter of which summate to plateau potentials and contribute to phasic bursting. By contrast, OT neurones exhibit a sustained outwardly rectifying potential (SOR), as well as a consequent depolarising rebound potential, not found in VP neurones. The SOR makes OT neurones more susceptible to spontaneous inhibitory synaptic inputs and correlates with a longer period of spike frequency adaptation in these neurones. Although both types exhibit prominent Ca<sup>2+</sup> -dependent afterhyperpolarising potentials (AHPs) that limit firing rate and contribute to bursting patterns, Ca<sup>2+</sup> -dependent AHPs in OT neurones selectively show significant increases during pregnancy and lactation. In OT neurones, but not VP neurones, AHPs are highly dependent on the constitutive presence of the second messenger, phosphatidylinositol 4,5-bisphosphate, which permissively gates N-type channels that contribute the Ca<sup>2+</sup> during spike trains that activates the AHP. By contrast to the intrinsic properties supporting phasic bursting in VP neurones, the synchronous bursting of OT neurones has only been demonstrated in vitro in cultured hypothalamic explants and is completely dependent on synaptic transmission. Additional differences in Ca<sup>2+</sup> channel expression between the two neurosecretory terminal types suggests these channels are also critical players in the differential release of OT and VP during repetitive spiking, in addition to their importance to the potentials controlling firing patterns.

Also flagged:axonalβ3-tubulinnestinGFAP
Journal Article 2019-02-14 ✓ 1 Snippet Mikhailova MM, Bolshakov AP, Chaban EA, Paltsev MA, Panteleyev AA.
In-Text Gene Mentions

…nestin, crmp1, SMI-32,DCCor GFAP.…

Show Full Abstract

<b>Objective:</b> Primary culture is an effective experimental model to study molecular mechanisms that drive axonal regeneration after central nervous system injury. However, the culture of spinal cord (SC) cells remains poorly characterized. Here, we have analyzed the cell composition of a primary SC culture during its maturation. <b>Methods:</b> Primary cell culture was prepared from mouse embryo spinal cords. After 2, 7, and 14 days of cultivation, the cells were fixed and stained with antibodies against β3-tubulin, nestin, crmp1, SMI-32, DCC or GFAP. We counted percentage of cells positive for the mentioned markers and measured the length of cell processes. <b>Results:</b> We found that β3-tubulin and nestin were both expressed at day 2 of culture in vitro. Surprisingly (given the use of differentiation-supporting culture medium), the number of nestin+ cells has significantly increased during the first week of cultivation. The GFAP+ cells appeared only at the seventh day in vitro, and their fraction increased during the following cultivation. At 14 day in vitro, SC culture contained cells that expressed the markers typical of commissural and motor neurons. At this age, the neurons had the ability to repair injured neurites after mechanical damage. <b>Conclusion:</b> Primary culture of SC cells is a dynamically developing cell population that contains all main types of SC cells and is capable of self-repair. Therefore, the culture of mouse embryonic SC cells represents an adequate experimental model for studying cellular and molecular processes taking place in SC neurons after axonal damage in the absence of external inhibitors.

Also flagged:morphineKCNJ6ABCB1COMTARRB2DRD2
Journal Article 2019-02-14 ✓ 5 Snippets Li J, Wei Z, Zhang J, Hakonarson H, Cook-Sather SD.
In-Text Gene Mentions

Twenty-seven single nucleotide polymorphisms (SNPs) from 9 genes (ABCB1, ARRB2, COMT, DRD2, KCNJ6, MC1R, OPRD1, OPRM1, UGT2B7) met selection criteria and were analyzed along with TAOK3. Few associations replicated: morphine dose (mcg/kg) in African American children and ABCB1 rs1045642 (A allele, ß=−9.30, 95% CI −17.25–−1.35, p=0.02) and OPRM1 rs1799971 (G allele, ß=23.19, 95% CI 3.27–43.11, p=0.02); KCNJ6 rs2211843 and high pain in African American subjects (T allele, OR 2.08, 95% CI 1.17–3.71, p=0.01) and in congruent European Caucasian pain phenotypes; and COMT rs740603 for high pain in European Caucasian subjects (A allele, OR 0.69, 95% CI 0.48–0.99, p=0.046).

In the European Caucasian cohort, for total morphine dose phenotype, no candidate SNP (with the exception of those in TAOK3) reached significance; for high maximum pain phenotype, only SNPs rs740603 in COMT and rs563649 in OPRM1 were significant; for low maximum pain phenotype, the KCNJ6 SNP rs2835925 and OPRD1 SNP rs569356 reached significance.

In the European Caucasian group, we also reconfirmed significant associations between TAOK3 and total morphine sulfate dose (P=6 ×10−5), as well as with high maximum pain phenotype (P=0.0015).

We previously investigated acute pain and morphine requirement following day surgery tonsillectomy and adenoidectomy in opioid-naïve children of African American or European Caucasian ancestry and, using genome wide association study (GWAS) methodology, identified a novel locus (TAOK3) that accounted for 8% of morphine dose variance in European Caucasian subjects.14 In our retrospective African American and European Caucasian GWAS discovery cohorts, we sought to replicate associations of select candidate genes for morphine dose, high (≥7/10) pain, and low (≤3/10) pain, and, using top SNP candidate gene array modelling, estimate the upper limits of predicted race-specific morphine dose variance.

Finally, we expect that rare variants and additional GWAS-identified loci, such as TAOK3, now showing increased importance across other clinical pain and analgesia phenotypes,63 will become essential components of larger and more precise genetic testing arrays for morphine analgesia and acute postoperative pain.

Show Full Abstract

Acute pain and opioid analgesia demonstrate inter-individual variability and polygenic influence. In 241 children of African American and 277 of European Caucasian ancestry, we sought to replicate select candidate gene associations with morphine dose and postoperative pain and then to estimate dose prediction limits. Twenty-seven single-nucleotide polymorphisms (SNPs) from nine genes (ABCB1, ARRB2, COMT, DRD2, KCNJ6, MC1R, OPRD1, OPRM1, and UGT2B7) met selection criteria and were analyzed along with TAOK3. Few associations replicated: morphine dose (mcg/kg) in African American children and ABCB1 rs1045642 (A allele, β = -9.30, 95% CI: -17.25 to -1.35, p = 0.02) and OPRM1 rs1799971 (G allele, β = 23.19, 95% CI: 3.27-43.11, p = 0.02); KCNJ6 rs2211843 and high pain in African American subjects (T allele, OR 2.08, 95% CI: 1.17-3.71, p = 0.01) and in congruent European Caucasian pain phenotypes; and COMT rs740603 for high pain in European Caucasian subjects (A allele, OR: 0.69, 95% CI: 0.48-0.99, p = 0.046). With age, body mass index, and physical status as covariates, simple top SNP candidate gene models could explain theoretical maximums of 24.2% (European Caucasian) and 14.6% (African American) of morphine dose variances.

Also flagged:Schizophreniamethylationmental disorderchromosomeGRIK3EFNA5
Journal Article 2019-02-14 ✓ 1 Snippet Wang M, Huang TZ, Fang J, Calhoun VD, Wang YP.
In-Text Gene Mentions

DCC

Show Full Abstract

Schizophrenia (SZ) is a complex disease. Single nucleotide polymorphism (SNP), brain activity measured by functional magnetic resonance imaging (fMRI) and DNA methylation are all important biomarkers that can be used for the study of SZ. To our knowledge, there has been little effort to combine these three datasets together. In this study, we propose a group sparse joint nonnegative matrix factorization (GSJNMF) model to integrate SNP, fMRI, and DNA methylation for the identification of multi-dimensional modules associated with SZ, which can be used to study regulatory mechanisms underlying SZ at multiple levels. The proposed GSJNMF model projects multiple types of data onto a common feature space, in which heterogeneous variables with large coefficients on the same projected bases are used to identify multi-dimensional modules. We also incorporate group structure information available from each dataset. The genomic factors in such modules have significant correlations or functional associations with several brain activities. At the end, we have applied the method to the analysis of real data collected from the Mind Clinical Imaging Consortium (MCIC) for the study of SZ and identified significant biomarkers. These biomarkers were further used to discover genes and corresponding brain regions, which were confirmed to be significantly associated with SZ.

Also flagged:lymphangiectasialymphangitislymphatic diseaseintestinal lymphangiectasiainflammatory bowel diseaseimmunosuppression
Journal Article 2019-02-14 ✓ 4 Snippets Craven MD, Washabau RJ.
In-Text Gene Mentions

…of antithrombin III (ATIII), hyperaggregation of platele…

…anticoagulant by bindingATIIIand is a…

…dogs, evidenced byATIIIinhibition and anti‐Xa…

…‐induced hemorrhage, excessiveATIIIconsumption, or thrombocytopen…

Show Full Abstract

Protein-losing enteropathy, or PLE, is not a disease but a syndrome that develops in numerous disease states of differing etiologies and often involving the lymphatic system, such as lymphangiectasia and lymphangitis in dogs. The pathophysiology of lymphatic disease is incompletely understood, and the disease is challenging to manage. Understanding of PLE mechanisms requires knowledge of lymphatic system structure and function, which are reviewed here. The mechanisms of enteric protein loss in PLE are identical in dogs and people, irrespective of the underlying cause. In people, PLE is usually associated with primary intestinal lymphangiectasia, suspected to arise from genetic susceptibility, or "idiopathic" lymphatic vascular obstruction. In dogs, PLE is most often a feature of inflammatory bowel disease (IBD), and less frequently intestinal lymphangiectasia, although it is not proven which process is the true driving defect. In cats, PLE is relatively rare. Review of the veterinary literature (1977-2018) reveals that PLE was life-ending in 54.2% of dogs compared to published disease-associated deaths in IBD of <20%, implying that PLE is not merely a continuum of IBD spectrum pathophysiology. In people, diet is the cornerstone of management, whereas dogs are often treated with immunosuppression for causes of PLE including lymphangiectasia, lymphangitis, and crypt disease. Currently, however, there is no scientific, extrapolated, or evidence-based support for an autoimmune or immune-mediated mechanism. Moreover, people with PLE have disease-associated loss of immune function, including lymphopenia, severe CD4+ T-cell depletion, and negative vaccinal titers. Comparison of PLE in people and dogs is undertaken here, and theories in treatment of PLE are presented.

Also flagged:cancergenetic diseasesgene expressionbreast cancerhepatocellular carcinomacolorectal cancer
Journal Article 2019-02-14 No Snippets Wang S, Shen HW, Chai H, Liang Y.
Show Full Abstract

For studying cancer and genetic diseases, the issue of identifying high correlation genes from high-dimensional data is an important problem. It is a great challenge to select relevant biomarkers from gene expression data that contains some important correlation structures, and some of the genes can be divided into different groups with a common biological function, chromosomal location or regulation. In this paper, we propose a penalized accelerated failure time model CHR-DE using a non-convex regularization (local search) with differential evolution (global search) in a wrapper-embedded memetic framework. The complex harmonic regularization (CHR) can approximate to the combination [Formula: see text] and ℓq (1 ≤ q < 2) for selecting biomarkers in group. And differential evolution (DE) is utilized to globally optimize the CHR's hyperparameters, which make CHR-DE achieve strong capability of selecting groups of genes in high-dimensional biological data. We also developed an efficient path seeking algorithm to optimize this penalized model. The proposed method is evaluated on synthetic and three gene expression datasets: breast cancer, hepatocellular carcinoma and colorectal cancer. The experimental results demonstrate that CHR-DE is a more effective tool for feature selection and learning prediction.

Also flagged:ESRDADPKDdiabeteshypertensionAutosomal dominant polycystic kidney diseaselarge vessel disease
Journal Article 2019-02-14 No Snippets Murphy EL, Dai F, Blount KL, Droher ML, Liberti L, Crews DC, Dahl NK.
Show Full Abstract

<h4>Introduction</h4>Autosomal dominant polycystic kidney disease (ADPKD) affects all races. Whether the progression of ADPKD varies by race remains unclear.<h4>Methods</h4>In this retrospective cohort study from 2004 to 2013 non-Hispanic blacks and non-Hispanic whites of all ages classified in the US Renal Data System (USRDS) with incident ESRD from ADPKD (n = 23,647), hypertension/large vessel disease (n = 296,352), or diabetes mellitus (n = 451,760) were stratified into five-year age categories ranging from < 40 to > 75 (e.g., < 40, 40-44, 45-49, …, 75+). The Cochran-Mantel-Haenszel test was used to determine the association of race and incidence of ESRD from ADPKD, diabetes, or hypertension. The difference in the proportions of ESRD in non-Hispanic black and non-Hispanic white patients at each age categorical bin was compared by two-sample proportion test. The age of ESRD onset between non-Hispanic black and non-Hispanic white patients at each year was compared using two-sample t-test with unequal variance.<h4>Results</h4>1.068% of non-Hispanic blacks and 2.778% of non-Hispanic whites had ESRD attributed to ADPKD. Non-Hispanic blacks were less likely than non-Hispanic whites to have ESRD attributed to ADPKD (odds ratio (OR) (95% CI) = 0.38 (0.36-0.39), p <  0.0001). Using US Census data as the denominator to adjust for population differences non-Hispanic blacks were still slightly under-represented (OR (95% CI) 0.94 (0.91-0.96), p = 0.004). However, non-Hispanic blacks with ADPKD had a younger age of ESRD (54.4 years ±13) than non-Hispanic whites (55.9 years ±12.8) (p <  0.0001). For those < 40 years old, more non-Hispanic blacks had incident ESRD from ADPKD than non-Hispanic whites (9.49% vs. 7.68%, difference (95% CI) = 1.81% (0.87-2.84%), p <  0.001) for the combined years examined.<h4>Conclusions</h4>As previously shown, we find the incidence of ESRD from ADPKD in non-Hispanic blacks is lower than in non-Hispanic whites. Among the younger ADPKD population (age < 40), however, more non-Hispanic blacks initiated dialysis than non-Hispanic whites. Non-Hispanic blacks with ADPKD initiated dialysis younger than non-Hispanic whites. A potential implication of these findings may be that black race should be considered an additional risk factor for progression in ADPKD.

Also flagged:Gaucher diseaselysosomal storage disorderglucocerebrosidaseglycolipidGBA1chitotriosidase
Journal Article 2019-02-14 No Snippets Sheth J, Bhavsar R, Mistri M, Pancholi D, Bavdekar A, Dalal A, Ranganath P, Girisha KM, Shukla A, Phadke S, Puri R, Panigrahi I, Kaur A, Muranjan M, Goyal M, Ramadevi R, Shah R, Nampoothiri S, Danda S, Datar C, Kapoor S, Bhatwadekar S, Sheth F.
Show Full Abstract

<h4>Background</h4>Gaucher disease is a rare pan-ethnic, lysosomal storage disorder resulting due to beta-Glucosidase (GBA1) gene defect. This leads to the glucocerebrosidase enzyme deficiency and an increased accumulation of undegraded glycolipid glucocerebroside inside the cells' lysosomes. To date, nearly 460 mutations have been described in the GBA1 gene. With the aim to determine mutations spectrum and molecular pathology of Gaucher disease in India, the present study investigated one hundred unrelated patients (age range: 1 day to 31 years) having splenomegaly, with or without hepatomegaly, cytopenia and bone abnormality in some of the patients.<h4>Methods</h4>The biochemical investigation for the plasma chitotriosidase enzyme activity and β-Glucosidase enzyme activity confirmed the Gaucher disease. The mutations were identified by screening the patients' whole GBA gene coding region using bidirectional Sanger sequencing.<h4>Results</h4>The biochemical analysis revealed a significant reduction in the β-Glucosidase activity in all patients. Sanger sequencing established 71 patients with homozygous mutation and 22 patients with compound heterozygous mutation in GBA1 gene. Lack of identification of mutations in three patients suggests the possibility of either large deletion/duplication or deep intronic variations in the GBA1 gene. In four cases, where the proband died due to confirmed Gaucher disease, the parents were found to be a carrier. Overall, the study identified 33 mutations in 100 patients that also covers four missense mutations (p.Ser136Leu, p.Leu279Val, p.Gly383Asp, p.Gly399Arg) not previously reported in Gaucher disease patients. The mutation p.Leu483Pro was identified as the most commonly occurring Gaucher disease mutation in the study (62% patients). The second common mutations identified were p.Arg535Cys (7% patients) and RecNcil (7% patients). Another complex mutation Complex C was identified in a compound heterozygous status (3% patients). The homology modeling of the novel mutations suggested the destabilization of the GBA protein structure due to conformational changes.<h4>Conclusions</h4>The study reports four novel and 29 known mutations identified in the GBA1 gene in one-hundred Gaucher patients. The given study establishes p.Leu483Pro as the most prevalent mutation in the Indian patients with type 1 Gaucher disease that provide new insight into the molecular basis of Gaucher Disease in India.

Also flagged:methylationnucleusgene expressionbindingtranscription factorsEGR1
Journal Article 2019-02-14 ✓ 3 Snippets He J, Xu X, Monavarfeshani A, Banerjee S, Fox MA, Xie H.
In-Text Gene Mentions

…Lhx2, Sox5 andSox6genes.…

…CACNA1A, CACNA1C andCACNA1E.…

…the connection betweenCACNA1Egene and visual…

Show Full Abstract

DNA methylation plays important roles in the regulation of nervous system development and in cellular responses to environmental stimuli such as light-derived signals. Despite great efforts in understanding the maturation and refinement of visual circuits, we lack a clear understanding of how changes in DNA methylation correlate with visual activity in the developing subcortical visual system, such as in the dorsal lateral geniculate nucleus (dLGN), the main retino-recipient region in the dorsal thalamus. Here, we explored epigenetic dynamics underlying dLGN development at ages before and after eye opening in wild-type mice and mutant mice in which retinal ganglion cells fail to form. We observed that development-related epigenetic changes tend to co-localize together on functional genomic regions critical for regulating gene expression, while retinal-input-induced epigenetic changes are enriched on repetitive elements. Enhancers identified in neurons are prone to methylation dynamics during development, and activity-induced enhancers are associated with retinal-input-induced epigenetic changes. Intriguingly, the binding motifs of activity-dependent transcription factors, including EGR1 and members of MEF2 family, are enriched in the genomic regions with epigenetic aberrations in dLGN tissues of mutant mice lacking retinal inputs. Overall, our study sheds new light on the epigenetic regulatory mechanisms underlying the role of retinal inputs on the development of mouse dLGN.

Also flagged:tumormetastaticcervical cancermTORcell migrationphosphatidic acid
Journal Article 2019-02-14 ✓ 5 Snippets Li J, Liu C, Li D, Wan M, Zhang H, Zheng X, Jie X, Zhang P, Li J, Hou H, Sun Q.
In-Text Gene Mentions

OLFM4 has been shown to play an important role in tumor initiation and progression.

In conclusion, our results confirm OLFM4 as a tumor suppressor that inhibits cervical cancer metastasis by regulating mTOR signal pathway.

As the mTOR activity has been reported to participate in the regulation of cancer cell mobility and metastasis10–12, the influence of OLFM4 on mTOR signaling was subsequently investigated.

It is well known that OLFM4 is a secreted glycoprotein, and plasma levels of OLFM4 are tightly associated with tumor progression, lymph node invasion, and metastases.

The expression pattern of OLFM4 has been widely investigated in many types of human tumors, especially in gastrointestinal tumors13–15.

Show Full Abstract

OLFM4 has been shown to play an important role in tumor initiation and progression. This study aims to investigate the role of OLFM4 in metastatic cervical cancer and its underlying mechanism. Here we discover that OLFM4 expression is significantly reduced in metastatic cervical cancer. Accordingly, overexpression of OLFM4 inhibits epithelial-mesenchymal transition (EMT), migration, and invasion in human cervical cancer cells. To further explore its molecular mechanisms, we reveal that OLFM4 augmentation interferes with mTOR signaling pathway, and the suppressive effects of OLFM4 on cell migration and invasion are largely weakened by phosphatidic acid (PA)-induced mTOR signal activation, which implicates the potential role of the mTOR pathway in OLFM4-related cervical metastasis. In conclusion, our results confirm OLFM4 as a tumor suppressor that inhibits cervical cancer metastasis by regulating mTOR signal pathway.

Also flagged:depressionattachmentneuroticismmental disordercognitionsoxytocin
Journal Article 2019-02-14 No Snippets Laird KT, Krause B, Funes C, Lavretsky H.
Show Full Abstract

In contrast to traditional perspectives of resilience as a stable, trait-like characteristic, resilience is now recognized as a multidimentional, dynamic capacity influenced by life-long interactions between internal and environmental resources. We review psychosocial and neurobiological factors associated with resilience to late-life depression (LLD). Recent research has identified both psychosocial characteristics associated with elevated LLD risk (e.g., insecure attachment, neuroticism) and psychosocial processes that may be useful intervention targets (e.g., self-efficacy, sense of purpose, coping behaviors, social support). Psychobiological factors include a variety of endocrine, genetic, inflammatory, metabolic, neural, and cardiovascular processes that bidirectionally interact to affect risk for LLD onset and course of illness. Several resilience-enhancing intervention modalities show promise for the prevention and treatment of LLD, including cognitive/psychological or mind-body (positive psychology; psychotherapy; heart rate variability biofeedback; meditation), movement-based (aerobic exercise; yoga; tai chi), and biological approaches (pharmacotherapy, electroconvulsive therapy). Additional research is needed to further elucidate psychosocial and biological factors that affect risk and course of LLD. In addition, research to identify psychobiological factors predicting differential treatment response to various interventions will be essential to the development of more individualized and effective approaches to the prevention and treatment of LLD.

Also flagged:antibodyFlubendiamidephthalic acidryanodine receptorRyRschlorantraniliprole
Journal Article 2019-02-14 No Snippets Li Q, Cui Y, Liao M, Feng T, Tan G, Wang B, Liu S.
Show Full Abstract

Flubendiamide (FD), the first commercial phthalic acid diamide that targets insect ryanodine receptor (RyRs), has played an important role in pest management. With its extensive worldwide application, a rapid and convenient method to detect its existence in the environment is necessary. In this study, an indirect competitive enzyme-linked immunosorbent assay (icELISA) was developed to analyse FD residue on environmental and food samples. The established icELISA showed a half maximal inhibition concentration (IC<sub>50</sub>) of 17.25 µg L<sup>-1</sup>, with a working range of 4.06-103.59 µg L<sup>-1</sup> for FD, and showed no cross-reactivity with chlorantraniliprole, cyantraniliprole, and several FD analogues. Average FD recoveries from spinach, tap water, and soil samples were 89.3-112.3%, 93.0-102.1%, and 86.9-97.6%, respectively. Meanwhile, FD detection results of icELISA were compared with those of ultra-high-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS). The comparable results verified that icELISA was suitable for rapid detection of FD residue in environmental and agricultural samples.

Also flagged:furunculosisphosphorylationbacterial infectionkinasesVRK3GAK
Journal Article 2019-02-14 ✓ 1 Snippet Liu PF, Du Y, Meng L, Li X, Yang D, Liu Y.
In-Text Gene Mentions

…paralogs (VRK1 andVRK2), one or two…

Show Full Abstract

Aeromonas salmonicida (A. salmonicida) is a pathogenic bacterium that causes furunculosis and poses a significant global risk, particularly in economic activities such as Atlantic salmon (Salmo salar) farming. In a previous study, we identified proteins that are significantly upregulated in kidneys of Atlantic salmon challenged with A. salmonicida. Phosphoproteomic analyses were conducted to further clarify the dynamic changes in protein phosphorylation patterns triggered by bacterial infection. To our knowledge, this is the first study to characterize phosphorylation events in proteins from A. salmonicida-infected Atlantic salmon. Overall, we identified over 5635 phosphorylation sites in 3112 proteins, and 1502 up-regulated and 77 down-regulated proteins quantified as a 1.5-fold or greater change relative to control levels. Based on the combined data from proteomic and motif analyses, we hypothesize that five prospective novel kinases (VRK3, GAK, HCK, PKCδ and RSK6) with common functions in inflammatory processes and cellular pathways to regulate apoptosis and the cytoskeleton could serve as potential biomarkers against bacterial propagation in fish. Data from STRING-based functional network analyses indicate that fga is the most central protein. Our collective findings provide new insights into protein phosphorylation patterns, which may serve as effective indicators of A. salmonicida infection in Atlantic salmon.

Also flagged:Associated DiseasesnucleusIntracellularAgingcytoskeleton3,6
Journal Article 2019-02-14 No Snippets Gessner I, Yu X, Jüngst C, Klimpel A, Wang L, Fischer T, Neundorf I, Schauss AC, Odenthal M, Mathur S.
Show Full Abstract

MicroRNAs (miRNAs) are small non-coding nucleotides playing a crucial role in posttranscriptional expression and regulation of target genes in nearly all kinds of cells. In this study, we demonstrate a reliable and efficient capture and purification of miRNAs and intracellular proteins using magnetic nanoparticles functionalized with antisense oligonucleotides. For this purpose, a tumor suppressor miRNA (miR-198), deregulated in several human cancer types, was chosen as the model oligonucleotide. Magnetite nanoparticles carrying the complementary sequence of miR-198 (miR-198 antisense) on their surface were delivered into cells and subsequently used for the extracellular transport of miRNA and proteins. The successful capture of miR-198 was demonstrated by isolating RNA from magnetic nanoparticles followed by real-time PCR quantification. Our experimental data showed that antisense-coated particles captured 5-fold higher amounts of miR-198 when compared to the control nanoparticles. Moreover, several proteins that could play a significant role in miR-198 biogenesis were found attached to miR-198 conjugated nanoparticles and analyzed by mass spectrometry. Our findings demonstrate that a purpose-driven vectorization of magnetic nanobeads with target-specific recognition ligands is highly efficient in selectively transporting miRNA and disease-relevant proteins out of cells and could become a reliable and useful tool for future diagnostic, therapeutic and analytical applications.

Also flagged:cryptococcal meningitisarachidonic acidbindingactivin receptorreplication forkasthma
Journal Article 2019-02-14 ✓ 4 Snippets Zhang L, Fang WJ, Zhang KM, Jiang WW, Chen M, Liao WQ, Pan WH.
In-Text Gene Mentions

In addition to protein‐noncoding RNAs, most of the protein‐coding genes identified by PCR, including CAMP, LT, CTSG, OLR1, BPI, PGLYRP1, CEACAM8, and OLFM4, which were highly expressed in this study, were found for the first time to be involved in cryptococcal meningitis, although these genes were already known to be involved in antimicrobial and inflammatory responses.27, 28 Notably, most of the overexpressed genes in our study were related to the NF‐kappaB pathway, consistent with a previous report that the NF‐kappaB signaling pathway can be manipulated by C. neoformans within macrophages.39

The mRNAs (Figure 5A,C) for cathelicidin antimicrobial peptide (CAMP), lactoferrin (LTF), OLR1, bactericidal/permeability‐increasing protein (BPI), cathepsin G (CTSG), peptidoglycan recognition protein 1 (PGLYRP1), arginase 1 (ARG1), olfactomedin 4 (OLFM4), and carcinoembryonic antigen‐related cell adhesion molecule 8 (CEACAM8,also known as CD66b) were found to be more highly expressed in cryptococcal meningitis patients than in healthy controls.

…(ARG1), olfactomedin 4 (OLFM4), and carcinoembryonic antige…

…PGLYRP1, CEACAM8, andOLFM4, which were highly…

Show Full Abstract

<h4>Aims</h4>LncRNAs play a vital role in the pathological and physiological process. This study aimed to explore the involvement of lncRNAs in cryptococcal meningitis.<h4>Methods</h4>Microarray was performed in cryptococcal meningitis patients, and then, GO and KEGG pathways were analyzed. Coexpression relationship between lncRNA and mRNA was explored. The expressions of the lncRNAs and mRNAs, and their changes after treatment were detected by PCR.<h4>Results</h4>A total of 325 mRNAs (201 upregulated and 124 downregulated) and 497 lncRNAs (263 upregulated and 234 downregulated) were identified. The top three enriched GO terms for the mRNAs were arachidonic acid binding, activin receptor binding, and replication fork protection complex. The top three pathways in KEGG were asthma, one carbon pool by folate, and allograft rejection. A total of 305 coexpression relationships were found between 108 lncRNAs and 87 mRNAs. LncRNA-DPY19L1p1 was significantly increased in patients and decreased after treatment. ROC analysis revealed DPY19L1p1 was a potential diagnostic marker (AUC<sub>ROC</sub>  = 0.9389). Furthermore, the target genes of DPY19L1p1 in cis or trans regulation were mainly involved in immune-related pathways like the interleukin signaling pathway.<h4>Conclusions</h4>This study analyzed the differential lncRNA profile in cryptococcal meningitis patients and revealed DPY19L1p1 could be used for treatment evaluation and disease diagnosis.

Also flagged:membranemineralscalcium ionslocomotioninfectionosteogenesis
Journal Article 2019-02-14 No Snippets Chocholata P, Kulda V, Babuska V.
Show Full Abstract

The present article describes the state of the art in the rapidly developing field of bone tissue engineering, where many disciplines, such as material science, mechanical engineering, clinical medicine and genetics, are interconnected. The main objective is to restore and improve the function of bone tissue by scaffolds, providing a suitable environment for tissue regeneration and repair. Strategies and materials used in oral regenerative therapies correspond to techniques generally used in bone tissue engineering. Researchers are focusing on developing and improving new materials to imitate the native biological neighborhood as authentically as possible. The most promising is a combination of cells and matrices (scaffolds) that can be fabricated from different kinds of materials. This review summarizes currently available materials and manufacturing technologies of scaffolds for bone-tissue regeneration.

Also flagged:UNC80ADKintellectual disabilitiesIDlactic acidosisencephalomyopathic mitochondrial DNA depletion syndrome-13
Journal Article 2019-02-14 ✓ 4 Snippets Kuptanon C, Srichomthong C, Ittiwut C, Wechapinan T, Sri-Udomkajorn S, Iamopas O, Phokaew C, Suphapeetiporn K, Shotelersuk V.
In-Text Gene Mentions

Whole exome sequencing revealed mutations in FBXL4, UNC80, and ADK in Thai patients with severe intellectual disabilities.

Whole exome sequencing found that Patient 1 was homozygous for a nonsense, c.1303C>T (p.Arg435Ter), mutation in FBXL4, a gene responsible for encephalomyopathic mitochondrial DNA depletion syndrome-13 (MTDPS13).

…revealed mutations inFBXL4, UNC80, and ADK…

…(p.Arg435Ter), mutation inFBXL4, a gene responsible…

Show Full Abstract

Intellectual disabilities (ID) are etiologically heterogeneous. Advanced molecular techniques could be helpful in identification of the underlying genetic defects. We aimed to characterize clinical and molecular features of three Thai patients with ID. Patient 1 had ID, hypotonia and lactic acidosis. Patient 2 had ID and growth failure. Patient 3 had ID, seizure, diarrhea and hypoglycemia. Whole exome sequencing found that Patient 1 was homozygous for a nonsense, c.1303C>T (p.Arg435Ter), mutation in FBXL4, a gene responsible for encephalomyopathic mitochondrial DNA depletion syndrome-13 (MTDPS13). Patient 2 was compound heterozygous for two novel mutations, c.3226C>T (p.Arg1076Ter) and c.3205C>T (p.Arg1069Ter), in UNC80, a known gene of infantile hypotonia with psychomotor retardation and characteristic facies-2 (IHPRF2). Patient 3 was homozygous for a novel missense, c.427T>C (p.Cys143Arg), mutation in ADK, a known gene of adenosine kinase deficiency leading to hypermethioninemia. This study expands the mutational spectra of ID genes.

Also flagged:SPONASTRIME Dysplasiaspondyloepimetaphyseal dysplasiaScoliosiscoxa varachildhood cataractshypogammaglobulinemia
Journal Article 2019-02-14 ✓ 1 Snippet Burrage LC, Reynolds JJ, Baratang NV, Phillips JB, Wegner J, McFarquhar A, Higgs MR, Christiansen AE, Lanza DG, Seavitt JR, Jain M, Li X, Parry DA, Raman V, Chitayat D, Chinn IK, Bertuch AA, Karaviti L, Schlesinger AE, Earl D, Bamshad M, Savarirayan R, Doddapaneni H, Muzny D, Jhangiani SN, Eng CM, Gibbs RA, Bi W, Emrick L, Rosenfeld JA, Postlethwait J, Westerfield M, Dickinson ME, Beaudet AL, Ranza E, Huber C, Cormier-Daire V, Shen W, Mao R, Heaney JD, Orange JS, University of Washington Center for Mendelian Genomics, Undiagnosed Diseases Network, Bertola D, Yamamoto GL, Baratela WAR, Butler MG, Ali A, Adeli M, Cohn DH, Krakow D, Jackson AP, Lees M, Offiah AC, Carlston CM, Carey JC, Stewart GS, Bacino CA, Campeau PM, Lee B.
In-Text Gene Mentions

MMS22L

Show Full Abstract

SPONASTRIME dysplasia is an autosomal-recessive spondyloepimetaphyseal dysplasia characterized by spine (spondylar) abnormalities, midface hypoplasia with a depressed nasal bridge, metaphyseal striations, and disproportionate short stature. Scoliosis, coxa vara, childhood cataracts, short dental roots, and hypogammaglobulinemia have also been reported in this disorder. Although an autosomal-recessive inheritance pattern has been hypothesized, pathogenic variants in a specific gene have not been discovered in individuals with SPONASTRIME dysplasia. Here, we identified bi-allelic variants in TONSL, which encodes the Tonsoku-like DNA repair protein, in nine subjects (from eight families) with SPONASTRIME dysplasia, and four subjects (from three families) with short stature of varied severity and spondylometaphyseal dysplasia with or without immunologic and hematologic abnormalities, but no definitive metaphyseal striations at diagnosis. The finding of early embryonic lethality in a Tonsl<sup>-/-</sup> murine model and the discovery of reduced length, spinal abnormalities, reduced numbers of neutrophils, and early lethality in a tonsl<sup>-/-</sup> zebrafish model both support the hypomorphic nature of the identified TONSL variants. Moreover, functional studies revealed increased amounts of spontaneous replication fork stalling and chromosomal aberrations, as well as fewer camptothecin (CPT)-induced RAD51 foci in subject-derived cell lines. Importantly, these cellular defects were rescued upon re-expression of wild-type (WT) TONSL; this rescue is consistent with the hypothesis that hypomorphic TONSL variants are pathogenic. Overall, our studies in humans, mice, zebrafish, and subject-derived cell lines confirm that pathogenic variants in TONSL impair DNA replication and homologous recombination-dependent repair processes, and they lead to a spectrum of skeletal dysplasia phenotypes with numerous extra-skeletal manifestations.

Also flagged:SPONASTRIME dysplasiaskeletal dysplasiaTONSLscaffold proteinspondyloepimetaphyseal dysplasiashort-limb type dwarfism
Journal Article 2019-02-14 ✓ 1 Snippet Chang HR, Cho SY, Lee JH, Lee E, Seo J, Lee HR, Cavalcanti DP, Mäkitie O, Valta H, Girisha KM, Lee C, Neethukrishna K, Bhavani GS, Shukla A, Nampoothiri S, Phadke SR, Park MJ, Ikegawa S, Wang Z, Higgs MR, Stewart GS, Jung E, Lee MS, Park JH, Lee EA, Kim H, Myung K, Jeon W, Lee K, Kim D, Kim OH, Choi M, Lee HW, Kim Y, Cho TJ.
In-Text Gene Mentions

MMS22L

Show Full Abstract

SPONASTRIME dysplasia is a rare, recessive skeletal dysplasia characterized by short stature, facial dysmorphism, and aberrant radiographic findings of the spine and long bone metaphysis. No causative genetic alterations for SPONASTRIME dysplasia have yet been determined. Using whole-exome sequencing (WES), we identified bi-allelic TONSL mutations in 10 of 13 individuals with SPONASTRIME dysplasia. TONSL is a multi-domain scaffold protein that interacts with DNA replication and repair factors and which plays critical roles in resistance to replication stress and the maintenance of genome integrity. We show here that cellular defects in dermal fibroblasts from affected individuals are complemented by the expression of wild-type TONSL. In addition, in vitro cell-based assays and in silico analyses of TONSL structure support the pathogenicity of those TONSL variants. Intriguingly, a knock-in (KI) Tonsl mouse model leads to embryonic lethality, implying the physiological importance of TONSL. Overall, these findings indicate that genetic variants resulting in reduced function of TONSL cause SPONASTRIME dysplasia and highlight the importance of TONSL in embryonic development and postnatal growth.

Also flagged:ATL3ER-Phagy ReceptorGABARAPAutophagyendoplasmic reticulumnuclear
Journal Article 2019-02-14 ✓ 1 Snippet Chen Q, Xiao Y, Chai P, Zheng P, Teng J, Chen J.
In-Text Gene Mentions

…SEC62 [9], andCCPG1[10].…

Show Full Abstract

The endoplasmic reticulum (ER) consists of the nuclear envelope and both peripheral ER sheets and a peripheral tubular network [1, 2]. In response to physiological or pathological conditions, receptor-mediated selective ER-phagy, engulfing specific ER subdomains or components, is essential for ER turnover and homeostasis [3-6]. Four mammalian receptors for ER-phagy have been reported: FAM134B [7], reticulon 3 (RTN3) [8], SEC62 [9], and CCPG1 [10]. However, these ER-phagy receptors function in subcellular- and tissue- or physiological- and pathological-condition-specific manners, so the diversity of ER-phagy receptors and underlying mechanisms remain largely unknown [3, 4]. Atlastins (ATL1, ATL2, and ATL3), in mammals, are a class of membrane-bound, dynamin-like GTPases that function in ER fusion [11, 12]. ATL1 is expressed mainly in the central nervous system, while ATL2 and ATL3 are more ubiquitously distributed [13]. Recent studies showed that ATL2 mainly affects ER morphology by promoting ER fusion, whereas alterations in ER morphology are hardly detectable after ATL3 depletion [14, 15]. Here, we show that ATL3 functions as a receptor for ER-phagy, promoting tubular ER degradation upon starvation. ATL3 specifically binds to GABARAP, but not LC3, subfamily proteins via 2 GABARAP interaction motifs (GIMs). ATL3-GABARAP interaction is essential for ATL3 to function in ER-phagy. Moreover, hereditary sensory and autonomic neuropathy type I (HSAN I)-associated ATL3 mutations (Y192C and P338R) disrupt ATL3's association with GABARAP and impair ATL3's function in ER-phagy, suggesting that defective ER-phagy is involved in HSAN I. Therefore, we reveal a new ATL3 function for GABARAP-mediated ER-phagy in the degradation of tubular ER.

Also flagged:tumorp53cancergliomagliomascytokine
Journal Article 2019-02-14 ✓ 5 Snippets Meng X, Duan C, Pang H, Chen Q, Han B, Zha C, Dinislam M, Wu P, Li Z, Zhao S, Wang R, Lin L, Jiang C, Cai J.
In-Text Gene Mentions

TNFSF4 is an important cytokine of the tumor necrosis factor (TNF) ligand family and is associated with susceptibility to systemic sclerosis as well as its clinical and autoantibody subsets [[75], [76], [77]].

…ABclonal, A0286), rabbit anti-TNFSF4(1:500, Abcam, ab156285),…

…IL6 (Abcam, ab46027),TNFSF4(Abcam, ab213842), MDK…

…Il6 (Abcam, ab100712),Tnfsf4(Abcam, ab193729), Mdk…

…ABclonal, A0286), mouse anti-TNFSF4(1:200, Abcam, ab89896),…

Show Full Abstract

<h4>Background</h4>DNA damage repair (DDR) alterations are important events in cancer initiation, progression, and therapeutic resistance. However, the involvement of DDR alterations in glioma malignancy needs further investigation. This study aims to characterize the clinical and molecular features of gliomas with DDR alterations and elucidate the biological process of DDR alterations that regulate the cross talk between gliomas and the tumor microenvironment.<h4>Methods</h4>Integrated transcriptomic and genomic analyses were undertaken to conduct a comprehensive investigation of the role of DDR alterations in glioma. The prognostic DDR-related cytokines were identified from multiple datasets. In vivo and in vitro experiments validated the role of p53, the key molecule of DDR, regulating M2 polarization of microglia in glioma.<h4>Findings</h4>DDR alterations are associated with clinical and molecular characteristics of glioma. Gliomas with DDR alterations exhibit distinct immune phenotypes, and immune cell types and cytokine processes. DDR-related cytokines have an unfavorable prognostic implication for GBM patients and are synergistic with DDR alterations. Overexpression of MDK mediated by p53, the key transcriptional factor in DDR pathways, remodels the GBM immunosuppressive microenvironment by promoting M2 polarization of microglia, suggesting a potential role of DDR in regulating the glioma microenvironment.<h4>Interpretation</h4>Our work suggests that DDR alterations significantly contribute to remodeling the glioma microenvironment via regulating the immune response and cytokine pathways. FUND: This study was supported by: 1. The National Key Research and Development Plan (No. 2016YFC0902500); 2. National Natural Science Foundation of China (No. 81702972, No. 81874204, No. 81572701, No. 81772666); 3. China Postdoctoral Science Foundation (2018M640305); 4. Special Fund Project of Translational Medicine in the Chinese-Russian Medical Research Center (No. CR201812); 5. The Research Project of the Chinese Society of Neuro-oncology, CACA (CSNO-2016-MSD12); 6. The Research Project of the Health and Family Planning Commission of Heilongjiang Province (2017-201); and 7. Harbin Medical University Innovation Fund (2017LCZX37, 2017RWZX03).

Also flagged:TDP-43TAR DNA binding protein 43DNA binding proteinmetabolisminclusion bodiesmotor neuron diseases
Journal Article 2019-02-14 No Snippets Prasad A, Bharathi V, Sivalingam V, Girdhar A, Patel BK.
Show Full Abstract

TAR DNA binding protein 43 (TDP-43) is a versatile RNA/DNA binding protein involved in RNA-related metabolism. Hyper-phosphorylated and ubiquitinated TDP-43 deposits act as inclusion bodies in the brain and spinal cord of patients with the motor neuron diseases: amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). While the majority of ALS cases (90-95%) are sporadic (sALS), among familial ALS cases 5-10% involve the inheritance of mutations in the <i>TARDBP</i> gene and the remaining (90-95%) are due to mutations in other genes such as: <i>C9ORF72, SOD1, FUS</i>, and <i>NEK1</i> etc. Strikingly however, the majority of sporadic ALS patients (up to 97%) also contain the TDP-43 protein deposited in the neuronal inclusions, which suggests of its pivotal role in the ALS pathology. Thus, unraveling the molecular mechanisms of the TDP-43 pathology seems central to the ALS therapeutics, hence, we comprehensively review the current understanding of the TDP-43's pathology in ALS. We discuss the roles of TDP-43's mutations, its cytoplasmic mis-localization and aberrant post-translational modifications in ALS. Also, we evaluate TDP-43's amyloid-like <i>in vitro</i> aggregation, its physiological vs. pathological oligomerization <i>in vivo</i>, liquid-liquid phase separation (LLPS), and potential prion-like propagation propensity of the TDP-43 inclusions. Finally, we describe the various evolving TDP-43-induced toxicity mechanisms, such as the impairment of endocytosis and mitotoxicity etc. and also discuss the emerging strategies toward TDP-43 disaggregation and ALS therapeutics.

Also flagged:lipoproteinhypobetalipoproteinemiaNAFLDhepatic steatosisnonalcoholic fatty liver diseaseliver disease
Journal Article 2019-02-14 ✓ 1 Snippet Mouzaki M, Shah A, Arce-Clachar AC, Hardy J, Bramlage K, Xanthakos SA.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Low-density lipoprotein cholesterol (LDL-C) levels below 50 mg/dL may suggest familial hypobetalipoproteinemia, particularly in patients with hepatic steatosis. The prevalence of hypobetalipoproteinemia in cohorts with nonalcoholic fatty liver disease (NAFLD) is not known, and it is not clear whether the severity of liver disease of these patients is different. The objective of this study was to address these questions in a large pediatric NAFLD cohort.<h4>Methods</h4>Retrospective study of children followed at the Steatohepatitis Center of a tertiary care center from August 2010 to October 2017. Patients with secondary causes of hepatic steatosis and those on statins were excluded.<h4>Results</h4>Of the 740 patients included, 58 (8%) had hypobetalipoproteinemia. These patients were younger (P = .04), had a lower body mass index (P < .01) and waist circumference (P = .01), and were less likely to be on metformin (P = .01). In spite of that, serum aminotransferase levels were not different between those with low, normal, and high LDL-C levels. Of the 222 patients who had both lipid and histology data available, the steatosis score was higher in those with low LDL-C compared to those with normal or elevated LDL-C, a result that trended toward significance (P = .06). The severity of inflammation and fibrosis did not differ between the groups. When all patients with hypertriglyceridemia were excluded, steatosis severity was higher in those with low LDL-C (P = .04).<h4>Conclusion</h4>Hypobetalipoproteinemia is common among patients with NAFLD and is associated with similar liver disease severity in spite of a leaner phenotype and a more favorable metabolic profile.

Also flagged:Type 2 Diabetes MellitusDiabetes mellituschronic metabolic diseasesinsulin-secretiondeficiency
Journal Article 2019-02-14 No Snippets Cheng L, Zhuang H, Ju H, Yang S, Han J, Tan R, Hu Y.
Show Full Abstract

<b>Introduction:</b> High body mass index (BMI) is a positive associated phenotype of type 2 diabetes mellitus (T2DM). Abundant studies have observed this from a clinical perspective. Since the rapid increase in a large number of genetic variants from the genome-wide association studies (GWAS), common SNPs of BMI and T2DM were identified as the genetic basis for understanding their associations. Currently, their causality is beginning to blur. <b>Materials and Methods:</b> To classify it, a Mendelian randomisation (MR), using genetic instrumental variables (IVs) to explore the causality of intermediate phenotype and disease, was utilized here to test the effect of BMI on the risk of T2DM. In this article, MR was carried out on GWAS data using 52 independent BMI SNPs as IVs. The pooled odds ratio (OR) of these SNPs was calculated using inverse-variance weighted method for the assessment of <i>5 kg/m<sup>2</sup></i> higher BMI on the risk of T2DM. The leave-one-out validation was conducted to identify the effect of individual SNPs. MR-Egger regression was utilized to detect potential pleiotropic bias of variants. <b>Results:</b> We obtained the high OR (1.470; 95% CI 1.170 to 1.847; <i>P</i> = 0.001), low intercept (0.004, <i>P</i> = 0.661), and small fluctuation of ORs {from -0.039 [(1.412 - 1.470) / 1.470)] to 0.075 [(1.568- 1.470) / 1.470)] in leave-one-out validation. <b>Conclusion:</b> We validate the causal effect of high BMI on the risk of T2DM. The low intercept shows no pleiotropic bias of IVs. The small alterations of ORs activated by removing individual SNPs showed no single SNP drives our estimate.

Also flagged:Flashsilicasodiumamino2,2-dimethylpropanoic acidsodium sulphate
Journal Article 2019-02-14 ✓ 1 Snippet Bell M, Foley D, Naylor C, Wood G, Robinson C, Riley J, Epemolu O, Ellis L, Scullion P, Shishikura Y, Osuna-Cabello M, Ferguson L, Pinto E, Fletcher D, Katz E, McLean WHI, Wyatt P, Read KD, Woodland A.
In-Text Gene Mentions

DCC

Show Full Abstract

In order to study the role of S1PRs in inflammatory skin disease, S1PR modulators are dosed orally and topically in animal models of disease. The topical application of S1PR modulators in these models may, however, lead to systemic drug concentrations, which can complicate interpretation of the observed effects. We set out to design soft drug S1PR modulators as topical tool compounds to overcome this limitation. A fast follower approach starting from the drug ponesimod allowed the rapid development of an active phenolic series of soft drugs. The phenols were, however, chemically unstable. Protecting the phenol as an ester removed the instability and provided a compound that is converted by enzymatic hydrolysis in the skin to the phenolic soft drug species. In simple formulations, topical dosing of these S1PR modulators to mice led to micromolar skin concentrations but no detectable blood concentrations. These topical tools will allow researchers to investigate the role of S1PR in skin, without involvement of systemic S1PR biology.

Also flagged:Phosphoinositide-3-kinase Adapter Protein 1cirrhosisliver diseaseproteinnonalcoholic fatty liver diseasesteatohepatitis
Journal Article 2019-02-14 ✓ 1 Snippet Abby Philips C, Agarwal M, Phadke N, Rajesh S, Padsalgi G, Ahamed R, Augustine P.
In-Text Gene Mentions

HFE

Show Full Abstract

Familial cirrhosis is a condition that is associated with the presence of liver disease with genetic linkage among multiple family members in a generation or in multiple generations. With cirrhosis, most of these disease pathogeneses are related to a defect of an enzyme/transport protein leading to a deranged metabolic pathway with variable prevalence. Many studies and high-quality metanalyses have shed light on genetic linkage associated with nonalcoholic fatty liver disease and steatohepatitis such as the PNPLA3, MBOAT7, and TM6SF2 variants. In this report, we shed light on a novel missense mutation associated with cirrhosis in a family of brothers associated with phosphoinositide-3-kinase adapter protein 1 gene through high-output whole exosome gene sequencing methodology.

Also flagged:canceroncoproteinsinfectiongenetic diseasesE6E7
Journal Article 2019-02-13 No Snippets Chen YF, Xia Y.
Show Full Abstract

An important goal of systems medicine is to study disease in the context of genetic and environmental perturbations to the human interactome network. For diseases with both genetic and infectious contributors, a key postulate is that similar perturbations of the human interactome by either disease mutations or pathogens can have similar disease consequences. This postulate has so far only been tested for a few viral species at the level of whole proteins. Here, we expand the scope of viral species examined, and test this postulate more rigorously at the higher resolution of protein domains. Focusing on diseases with both genetic and viral contributors, we found significant convergent perturbation of the human domain-resolved interactome by endogenous genetic mutations and exogenous viral proteins inducing similar disease phenotypes. Pan-cancer, pan-oncovirus analysis further revealed that domains of human oncoproteins either physically targeted or structurally mimicked by oncoviruses are enriched for cancer driver rather than passenger mutations, suggesting convergent targeting of cancer driver pathways by diverse oncoviruses. Our study provides a framework for high-resolution, network-based comparison of various disease factors, both genetic and environmental, in terms of their impacts on the human interactome.

Also flagged:autoantibodiesEXD2PHAXchronic thromboembolic pulmonary hypertensioncardiovascular diseasesCTEPH
Journal Article 2019-02-13 No Snippets Naito A, Hiwasa T, Tanabe N, Sanada TJ, Sugiura T, Shigeta A, Terada J, Takizawa H, Kashiwado K, Sakao S, Tatsumi K.
Show Full Abstract

While circulating autoantibodies have been detected in patients with several cardiovascular diseases, such studies have not been performed for chronic thromboembolic pulmonary hypertension (CTEPH) and pulmonary arterial hypertension (PAH). Here we investigated the production of certain auto-antibodies in CTEPH patients. Initial screening was performed in 5 CTEPH patients and 5 healthy donors (HDs) using a ProtoArray Human Protein Microarray v5.1 containing 9,375 human proteins, and we selected 34 antigens recognized by IgG antibodies more strongly in the sera of CTEPH patients than in the sera of HDs. In subsequent second/third analyses, we validated the auto-antibody level using amplified luminescent proximity homogeneous assay-linked immunosorbent assay (AlphaLISA) in 96 CTEPH patients and 96 HDs as follows: At the second screening, we used 63 crude peptides derived from those selected 34 antigens and found that the serum levels of autoantibodies for 4 peptides seemed higher in CTEPH patients than in HDs. In third analysis, we used the purified peptides of those selected in second screening and found that serum antibodies against peptides derived from exonuclease 3'-5' domain-containing 2 (EXD2) and phosphorylated adaptor for RNA export (PHAX) were significantly higher in CTEPH patients than in HDs. The serum antibody levels to these antigens were also elevated in PAH patients. The titers against EXD2 peptide decreased after surgical treatment in CTEPH patients. These autoantibodies may be useful as biomarkers of CTEPH and PAH, and further investigations may provide novel insight into the etiology.

Also flagged:segmentationamyloid precursor proteinAPPADCASP3cysteine-aspartic acid protease
Journal Article 2019-02-13 ✓ 3 Snippets Bang S, Son S, Kim S, Shin H.
In-Text Gene Mentions

Source genes tend to be specified with each disease pathway, such as APP for AD and Htt for Huntington’s disease.

…for AD andHttfor Huntington’s disease.…

…And theHTTgene provides instructions…

Show Full Abstract

<h4>Background</h4>Biomarker discovery studies have been moving the focus from a single target gene to a set of target genes. However, the number of target genes in a drug should be minimum to avoid drug side-effect or toxicity. But still, the set of target genes should effectively block all possible paths of disease progression.<h4>Methods</h4>In this article, we propose a network based computational analysis for target gene identification for multi-target drugs. The min-cut algorithm is employed to cut all the paths from onset genes to apoptotic genes on a disease pathway. If the pathway network is completely disconnected, development of disease will not further go on. The genes corresponding to the end points of the cutting edges are identified as candidate target genes for a multi-target drug.<h4>Results and conclusions</h4>The proposed method was applied to 10 disease pathways. In total, thirty candidate genes were suggested. The result was validated with gene set enrichment analysis software, PubMed literature review and de facto drug targets.

Also flagged:ironcanceralopeciacyclophosphamidegene expressionLama5
Journal Article 2019-02-13 No Snippets Lim YC, Kim H, Lim SM, Kim JS.
Show Full Abstract

<h4>Background</h4>Chemotherapy-induced alopecia has been well documented as a cause of distress to patients undergoing cancer treatment. Almost all traditional chemotherapeutic agents cause severe alopecia. Despite advances in the treatment of chemotherapy-induced alopecia, there is no effective treatment for preventing chemotherapy-induced alopecia.<h4>Methods</h4>In the present study, we investigated the potential role of a multi-target iron chelator, M30 in protecting against cyclophosphamide-induced alopecia in C57BL/6 mice implanted with an osmotic pump. M30 enhanced hair growth and prevented cyclophosphamide-induced abnormal hair in the mice. Furthermore, we examined the gene expression profiles derived from skin biopsy specimens of normal mice, cyclophosphamide-treated mice, and cyclophosphamide treated mice with M30 supplement.<h4>Results</h4>The top genes namely Tnfrsf19, Ercc2, Lama5, Ctsl, and Per1 were identified by microarray analysis. These genes were found to be involved in the biological processes of hair cycle, hair cycle phase, hair cycle process, hair follicle development, hair follicle maturation, hair follicle morphogenesis, regulation of hair cycle.<h4>Conclusion</h4>Our study demonstrates that M30 treatment is a promising therapy for cyclophosphamide-induced alopecia and suggests that the top five genes have unique preventive effects in cyclophosphamide-induced transformation.

Also flagged:venous thromboembolismThrombophiliatransforming growth factor β1TGFβ1cardiovascular diseasepulmonary embolism
Journal Article 2019-02-13 No Snippets Wang X, Sundquist K, Svensson PJ, Rastkhani H, Palmér K, Memon AA, Sundquist J, Zöller B.
Show Full Abstract

<h4>Background</h4>Patients with unprovoked first venous thromboembolism (VTE) are at a high risk of recurrence. Although circulating microRNAs (miRNAs) have been found to be associated with VTE and are markers of hypercoagulability, this study is the first to examine whether circulating miRNAs are associated with the risk of VTE recurrence.<h4>Results</h4>A nested case-control study design was used where plasma samples were obtained from 78 patients with unprovoked VTE from the Malmö Thrombophilia Study (MATS). A total of 39 VTE patients with recurrent VTE (cases) were matched with 39 VTE patients without recurrent VTE (controls) defined by age and sex (MATS population). Plasma levels of 179 different miRNAs were evaluated in the 78 samples (after anticoagulant treatment was stopped) using qPCR. A total of 110 miRNAs were detected in all samples. Among those, 12 miRNAs (miR-15b-5p, miR-106a-5p, miR-197-3p, miR-652-3p, miR-361-5p, miR-222-3p, miR-26b-5p, miR-532-5p, miR-27b-3p, miR-21-5p, miR-103a-3p, and miR-30c-5p) were found to be associated with recurrent VTE after multiple correction test and conditional logistic regression analysis. A further analysis showed that miR-15b-5p, miR-197-3p, miR-27b-3p, and miR-30c-5p exhibited a trend over time, with a larger difference in miRNA levels between cases and controls for earlier recurrence. Of these 12 miRNAs, 8 miRNAs significantly correlated with circulating transforming growth factor β1/2 (TGFβ1/2). Three of them correlated with platelet count.<h4>Conclusion</h4>We have identified 12 plasma miRNAs that may have the potential to serve as novel, non-invasive predictive biomarkers for VTE recurrence.

Also flagged:BCL9WntcancertumourAPCLgr5
Journal Article 2019-02-13 ✓ 2 Snippets Gay DM, Ridgway RA, Müller M, Hodder MC, Hedley A, Clark W, Leach JD, Jackstadt R, Nixon C, Huels DJ, Campbell AD, Bird TG, Sansom OJ.
In-Text Gene Mentions

…for Lgr5 (312178),Olfm4(311838), Axin2 (400338),…

…stem cell markers,Olfm4, were not…

Show Full Abstract

Different thresholds of Wnt signalling are thought to drive stem cell maintenance, regeneration, differentiation and cancer. However, the principle that oncogenic Wnt signalling could be specifically targeted remains controversial. Here we examine the requirement of BCL9/9l, constituents of the Wnt-enhanceosome, for intestinal transformation following loss of the tumour suppressor APC. Although required for Lgr5+ intestinal stem cells and regeneration, Bcl9/9l deletion has no impact upon normal intestinal homeostasis. Loss of BCL9/9l suppressed many features of acute APC loss and subsequent Wnt pathway deregulation in vivo. This resulted in a level of Wnt pathway activation that favoured tumour initiation in the proximal small intestine (SI) and blocked tumour growth in the colon. Furthermore, Bcl9/9l deletion completely abrogated β-catenin driven intestinal and hepatocellular transformation. We speculate these results support the just-right hypothesis of Wnt-driven tumour formation. Importantly, loss of BCL9/9l is particularly effective at blocking colonic tumourigenesis and mutations that most resemble those that occur in human cancer.

Also flagged:Cervical cancercancercervical tumorscytokeratinsp16kinases
Journal Article 2019-02-13 No Snippets Rosa MN, Evangelista AF, Leal LF, De Oliveira CM, Silva VAO, Munari CC, Munari FF, Matsushita GM, Dos Reis R, Andrade CE, Souza CP, Reis RM.
Show Full Abstract

Cervical cancer is the fourth most common cancer in women. Although cure rates are high for early stage disease, clinical outcomes for advanced, metastatic, or recurrent disease remain poor. To change this panorama, a deeper understanding of cervical cancer biology and novel study models are needed. Immortalized human cancer cell lines such as HeLa constitute crucial scientific tools, but there are few other cervical cancer cell lines available, limiting our understanding of a disease known for its molecular heterogeneity. This study aimed to establish novel cervical cancer cell lines derived from Brazilian patients. We successfully established one (HCB-514) out of 35 cervical tumors biopsied. We confirmed the phenotype of HCB-514 by verifying its' epithelial and tumor origin through cytokeratins, EpCAM and p16 staining. It was also HPV-16 positive. Whole-exome sequencing (WES) showed relevant somatic mutations in several genes including BRCA2, TGFBR1 and IRX2. A copy number variation (CNV) analysis by nanostring and WES revealed amplification of genes mainly related to kinases proteins involved in proliferation, migration and cell differentiation, such as EGFR, PIK3CA, and MAPK7. Overexpression of EGFR was confirmed by phospho RTK-array and validated by western blot analysis. Furthermore, the HCB-514 cell line was sensitive to cisplatin. In summary, this novel Brazilian cervical cancer cell line exhibits relevant key molecular features and constitutes a new biological model for pre-clinical studies.

Also flagged:Acute myeloid leukemiasAMLtumor suppressoroncogenesNUP98WT1
Journal Article 2019-02-13 ✓ 5 Snippets McNeer NA, Philip J, Geiger H, Ries RE, Lavallée VP, Walsh M, Shah M, Arora K, Emde AK, Robine N, Alonzo TA, Kolb EA, Gamis AS, Smith M, Gerhard DS, Guidry Auvil JM, Meshinchi S, Kentsis A.
In-Text Gene Mentions

Insofar as MLLT10 is a cofactor of the DOT1L methyltransferase, this may be associated with the susceptibility to emerging DOT1L methyltransferase inhibitors such as pinometostat (EPZ-5686), which will need to be tested in future studies.

Similarly, MLLT10 is frequently rearranged as part of KMT2A/MLL1 and other chromosomal translocations in acute leukemias, including refractory forms of T-ALL in particular (24) (25).

We also observed deletions of MLLT10, which is recurrently rearranged as gene fusions in subsets of T-ALL.

…in KMT2C andMLLT10.…

…, RUNX1 ,MLLT10, SPECC1 ,…

Show Full Abstract

Acute myeloid leukemias (AML) are characterized by mutations of tumor suppressor and oncogenes, involving distinct genes in adults and children. While certain mutations have been associated with the increased risk of AML relapse, the genomic landscape of primary chemotherapy-resistant AML is not well defined. As part of the TARGET initiative, we performed whole-genome DNA and transcriptome RNA and miRNA sequencing analysis of pediatric AML with failure of induction chemotherapy. We identified at least three genetic groups of patients with induction failure, including those with NUP98 rearrangements, somatic mutations of WT1 in the absence of apparent NUP98 mutations, and additional recurrent variants including those in KMT2C and MLLT10. Comparison of specimens before and after chemotherapy revealed distinct and invariant gene expression programs. While exhibiting overt therapy resistance, these leukemias nonetheless showed diverse forms of clonal evolution upon chemotherapy exposure. This included selection for mutant alleles of FRMD8, DHX32, PIK3R1, SHANK3, MKLN1, as well as persistence of WT1 and TP53 mutant clones, and elimination of FLT3, PTPN11, and NRAS mutant clones. These findings delineate genetic mechanisms of primary chemotherapy resistance in pediatric AML, which should inform improved approaches for its diagnosis and therapy.

Also flagged:OX40Ltumor necrosis factorTNF)-like cytokine 1AIL-7STAT5OX40
Journal Article 2019-02-13 ✓ 1 Snippet Deng T, Suo C, Chang J, Yang R, Li J, Cai T, Qiu J.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

OX40L is one of the co-stimulatory molecules that can be expressed by splenic lymphoid tissue inducer (Lti) cells, a subset of group 3 innate lymphoid cells (ILC3s). OX40L expression in subsets of intestinal ILC3s and the molecular regulation of OX40L expression in ILC3s are unknown. Here, we showed intestinal ILC3s marked as an OX40L<sup>high</sup> population among all the intestinal leukocytes and were the dominant source of OX40L in Rag1<sup>-/-</sup> mice. All ILC3 subsets expressed OX40L, and NCR<sup>-</sup>ILC3s were the most abundant source of OX40L. The expression of OX40L in ILC3s could be upregulated during inflammation. In addition to tumor necrosis factor (TNF)-like cytokine 1A (TL1A), which has been known as a trigger for OX40L, we found that Poly (I:C) representing viral stimulus promoted OX40L expression in ILC3s via a cell-autonomous manner. Furthermore, we demonstrated that IL-7-STAT5 signaling sustained OX40L expression by ILC3s. Intestinal regulatory T cells (Tregs), most of which expressed OX40, had defective expansion in chimeric mice, in which ILC3s were specifically deficient for OX40L expression. Consistently, co-localization of Tregs and ILC3s was found in the cryptopatches of the intestine, which suggests the close interaction between ILC3s and Tregs. Our study has unveiled the crosstalk between Tregs and ILC3s in mucosal tissues through OX40-OX40L signaling, which is crucial for the homeostasis of intestinal Tregs.

Also flagged:Neurodegenerative Disordersbrain diseasestranscription factorsDNaseTFneurodegenerative diseases
Journal Article 2019-02-13 ✓ 2 Snippets Pearl JR, Colantuoni C, Bergey DE, Funk CC, Shannon P, Basu B, Casella AM, Oshone RT, Hood L, Price ND, Ament SA.
In-Text Gene Mentions

Using primary human neural stem cells, we validated network predictions that link the TF POU3F2 to schizophrenia and bipolar disorder via both cis- and trans-acting mechanisms.

…link the TFPOU3F2to schizophrenia and…

Show Full Abstract

Transcriptional regulatory changes in the developing and adult brain are prominent features of brain diseases, but the involvement of specific transcription factors (TFs) remains poorly understood. We integrated brain-specific DNase footprinting and TF-gene co-expression to reconstruct a transcriptional regulatory network (TRN) model for the human brain. We identified key regulator TFs whose predicted target genes were enriched for differentially expressed genes in the prefrontal cortex of individuals with psychiatric and neurodegenerative diseases. Many of these TFs were further implicated in the same diseases through disruption of their binding sites by disease-associated SNPs and associations of TF loci with disease risk. Using primary human neural stem cells, we validated network predictions that link the TF POU3F2 to schizophrenia and bipolar disorder via both cis- and trans-acting mechanisms. Our models of brain-specific TF binding sites and target genes provide a resource for network analysis of brain diseases.

Also flagged:StresscancermitochondrialChronic inflammatory diseasechronic atrophic gastritisgastric cancer
Journal Article 2019-02-13 ✓ 1 Snippet Takaki A, Kawano S, Uchida D, Takahara M, Hiraoka S, Okada H.
In-Text Gene Mentions

Tumor suppressor gene PTENsuppressor gene PTEN…

Show Full Abstract

Oxidative stress is recognized as a cancer-initiating stress response in the digestive system. It is produced through mitochondrial respiration and induces DNA damage, resulting in cancer cell transformation. However, recent findings indicate that oxidative stress is also a necessary anticancer response for destroying cancer cells. The oxidative stress response has also been reported to be an important step in increasing the anticancer response of newly developed molecular targeted agents. Oxidative stress might therefore be a cancer-initiating response that should be downregulated in the precancerous stage in patients at risk of cancer but an anticancer cell response that should not be downregulated in the postcancerous stage when cancer cells are still present. Many commercial antioxidant agents are marketed as "cancer-eliminating agents" or as products to improve one's health, so cancer patients often take these antioxidant agents. However, care should be taken to avoid harming the anticancerous oxidative stress response. In this review, we will highlight the paradoxical effects of oxidative stress and antioxidant agents in the digestive system before and after carcinogenesis.

Also flagged:Serpina3gMatrix Metalloproteinase-9Tissue Inhibitor of Metalloproteinase-1Chronic Obstructive Pulmonary DiseaseCOPDprotease
Journal Article 2019-02-13 ✓ 1 Snippet Uysal P, Uzun H.
In-Text Gene Mentions

…(AAT deficiency), thrombosisserpin C1C1 (antithrombin) deficiency,…

Show Full Abstract

Chronic obstructive pulmonary disease (COPD) is influenced by genetic and environmental factors. A protease-antiprotease imbalance has been suggested as a possible pathogenic mechanism for COPD. Here, we examined the relationship between circulating serpina3g, matrix metalloproteinase-9 (MMP-9), and tissue inhibitor of metalloproteinase-1 and -2 (TIMP-1 and -2, respectively) and severity of COPD. We included 150 stable COPD patients and 35 control subjects in the study. The COPD patients were classified into four groups (I, II, III, and IV), according to the Global Initiative for Chronic Obstructive Lung Disease (GOLD) guidelines based on the severity of symptoms and the exacerbation risk. Plasma serpina3g, MMP-9, and TIMP-1 and -2 concentrations were significantly higher in the all patients than in control subjects. Plasma serpina3g, MMP-9, and TIMP-1 and -2 concentrations were significantly higher in groups III and IV than in groups I and II. A negative correlation between serpina3g, MMP-9, and TIMP-1 and -2 levels and the forced expiratory volume in 1 s (FEV1) was observed. MMP-9 concentration and the MMP-9/TIMP-1 ratio were higher in patients with emphysema than in other phenotypes (both with <i>p</i> < 0.01). The findings of this study suggest that circulating serpina3g, MMP-9, and TIMP-1 and -2 levels may play an important role in airway remodeling in COPD pathogenesis. Disrupted protease-antiprotease imbalance in patients with COPD is related to the presence of airway injury. MMP-9 concentration and the MMP-9/TIMP-1 ratio are the best predictors of emphysema in COPD patients.

Also flagged:PTSDPost-traumatic stress disorderacquired psychiatric disorderpsychiatric disordersbehavioraldepressive disorders
Journal Article 2019-02-13 No Snippets Blacker CJ, Frye MA, Morava E, Kozicz T, Veldic M.
Show Full Abstract

Post-traumatic stress disorder (PTSD) is an acquired psychiatric disorder with functionally impairing physiological and psychological symptoms following a traumatic exposure. Genetic, epigenetic, and environmental factors act together to determine both an individual's susceptibility to PTSD and its clinical phenotype. In this literature review, we briefly review the candidate genes that have been implicated in the development and severity of the PTSD phenotype. We discuss the importance of the epigenetic regulation of these candidate genes. We review the general epigenetic mechanisms that are currently understood, with examples of each in the PTSD phenotype. Our focus then turns to studies that have examined PTSD in the context of comorbid psychiatric disorders or associated social and behavioral stressors. We examine the epigenetic variation in cases or models of PTSD with comorbid depressive disorders, anxiety disorders, psychotic disorders, and substance use disorders. We reviewed the literature that has explored epigenetic regulation in PTSD in adverse childhood experiences and suicide phenotypes. Finally, we review some of the information available from studies of the transgenerational transmission of epigenetic variation in maternal cases of PTSD. We discuss areas pertinent for future study to further elucidate the complex interactions between epigenetic modifications and this complex psychiatric disorder.

Also flagged:METTL3RNA methyltransferase-like 3gliomaRNA editing enzymesADARAPOBEC3A
Journal Article 2019-02-13 ✓ 1 Snippet Visvanathan A, Patil V, Abdulla S, Hoheisel JD, Somasundaram K.
In-Text Gene Mentions

…SALL2, OLIG2 andPOU3F2) and selected transcripts…

Show Full Abstract

Despite recent advances in <i>N</i>⁶-methyladenosine (m⁶A) biology, the regulation of crucial RNA processing steps by the RNA methyltransferase-like 3 (METTL3) in glioma stem-like cells (GSCs) remains obscure. An integrated analysis of m⁶A-RIP (RNA immunoprecipitation) and total RNA-Seq of METTL3-silenced GSCs identified that m⁶A modification in GSCs is principally carried out by METTL3. The m⁶A-modified transcripts showed higher abundance compared to non-modified transcripts. Further, we showed that the METTL3 is essential for the expression of GSC-specific actively transcribed genes. Silencing METTL3 resulted in the elevation of several aberrant alternative splicing events. We also found that putative m⁶A reader proteins play a key role in the RNA stabilization function of METTL3. METTL3 altered A-to-I and C-to-U RNA editing events by differentially regulating RNA editing enzymes ADAR and APOBEC3A. Similar to protein-coding genes, lincRNAs (long intergenic non-coding RNAs) with m⁶A marks showed METTL3-dependent high expression. m⁶A modification of 3'UTRs appeared to result in a conformation-dependent hindrance to miRNA binding to their targets. The integrated analysis of the m⁶A regulome in METTL3-silenced GSCs showed global disruption in tumorigenic pathways that are indispensable for GSC maintenance and glioma progression. We conclude that METTL3 plays a vital role in many steps of RNA processing and orchestrates successful execution of oncogenic pathways in GSCs.

Also flagged:Type III Adenylyl Cyclaseautistic spectrum disorderAC3phosphorylationautismphosphopeptides
Journal Article 2019-02-13 No Snippets Zhou Y, Qiu L, Sterpka A, Wang H, Chu F, Chen X.
Show Full Abstract

Type III adenylyl cyclase (AC3, <i>ADCY3</i>) is predominantly enriched in neuronal primary cilia throughout the central nervous system (CNS). Genome-wide association studies in humans have associated <i>ADCY3</i> with major depressive disorder and autistic spectrum disorder, both of which exhibit sexual dimorphism. To date, it is unclear how AC3 affects protein phosphorylation and signal networks in central neurons, and what causes the sexual dimorphism of autism. We employed a mass spectrometry (MS)-based phosphoproteomic approach to quantitatively profile differences in phosphorylation between inducible AC3 knockout (KO) and wild type (WT), male and female mice. In total, we identified 4,655 phosphopeptides from 1,756 proteins, among which 565 phosphopeptides from 322 proteins were repetitively detected in all samples. Over 46% phosphopeptides were identified in at least three out of eight biological replicas. Comparison of AC3 KO and WT datasets revealed that phosphopeptides with motifs matching proline-directed kinases' recognition sites had a lower abundance in the KO dataset than in WTs. We detected 14 phosphopeptides restricted to WT dataset (i.e., <i>Rabl6, Spast and Ppp1r14a</i>) and 35 exclusively in KOs (i.e., <i>Sptan1, Arhgap20, Arhgap44, and Pde1b</i>). Moreover, 95 phosphopeptides (out of 90 proteins) were identified only in female dataset and 26 only in males. Label-free MS spectrum quantification using Skyline further identified phosphopeptides that had higher abundance in each sample group. In total, 204 proteins had sex-biased phosphorylation and 167 of them had increased expression in females relative to males. Interestingly, among the 204 gender-biased phosphoproteins, 31% were found to be associated with autism, including <i>Dlg1, Dlgap2, Syn1, Syngap1, Ctnna1, Ctnnd1, Ctnnd2, Pkp4, and Arvcf</i>. Therefore, this study also provides the first phosphoproteomics evidence suggesting that gender-biased post-translational phosphorylation may be implicated in the sexual dimorphism of autism.

Also flagged:AutismAutism spectrum disorderneurodevelopmental disordersneuropsychiatric disorderspsychiatric disordersmajor depressive disorder
Journal Article 2019-02-13 ✓ 5 Snippets Wang H, Yin F, Gao J, Fan X.
In-Text Gene Mentions

The combination of terms “SERT,” “5-HTT,” “SLC6A4” or “serotonin transporter gene”; “autism”, “autistic” or “ASD”; and “polymorphism,” “variation,” “mutation,” or “genotype” was used in order to obtain all the genetic studies on the association of 5-HTTLPR genetic polymorphism and autism.

It is well known that 5-HTT (an integral membrane protein of 630 amino acids, containing 12 transmembrane domains) could regulate the concentration of 5-HT in synapses and further change the excitatory of synapses.

As the gene encoding 5-HTT, the SLC6A4 plays an important role in regulating serotonin across the serotoninergic system.

…Serotonin transporter (5-HTT) is one of…

…role in altering5-HTTmessenger RNA (mRNA)…

Show Full Abstract

<b>Background:</b> Recently, many case-control studies have reported the association between 5-HTTLPR polymorphism and autism risk. However, the results are inconclusive and conflicting. To investigate the genetic association of 5-HTTLPR polymorphism and autism risk, we conducted a comprehensive meta-analysis based on previous case-control studies. <b>Methods:</b> Literature search was performed through PubMed, Embase, Web of Knowledge and CNKI databases until June 27, 2018. The strength of the association was assessed by relative risk (RR) and its corresponding 95% confidence interval (CI). Fixed or random effect model was selected based on the results of heterogeneity test. Further, subgroup analyses were conducted to explore the association of 5-HTTLPR polymorphism and autism risk in different population. <b>Results:</b> Eleven studies with 930 cases and 1234 controls were identified. Although there was a significant association between 5-HTTLPR polymorphism and autism risk under the dominant model after removing the studies causing heterogeneity, the significance did not exist after Bonferroni's correction. Subgroup analyses also showed similar results after Bonferroni's correction. In addition, there was no obvious publication bias in our meta-analysis. <b>Conclusions:</b> Our present meta-analysis does not support a direct effect of 5-HTTLPR polymorphism on autism risk according to present results. Further analyses of the effect of genetic networks and more well designed studies with larger sample size are required.

Also flagged:cancerMLLpeptidesleukemiasacute leukemiaKMT2A
Journal Article 2019-02-13 No Snippets Dal Molin A, Bresolin S, Gaffo E, Tretti C, Boldrin E, Meyer LH, Guglielmelli P, Vannucchi AM, Te Kronnie G, Bortoluzzi S.
Show Full Abstract

Chromosomal translocations harbored by cancer genomes are important oncogenic drivers. In <i>MLL</i> rearranged acute leukemia (MLLre) <i>MLL/KMT2A</i> fuses with over 90 partner genes. Mechanistic studies provided clues of MLL fusion protein leukemogenic potential, but models failed to fully recapitulate the disease. Recently, expression of oncogenic fusion circular RNAs (f-circ) by <i>MLL-AF9</i> fusion was proven. This discovery, together with emerging data on the importance and diversity of circRNAs formed the incentive to study the circRNAs of the <i>MLL</i> recombinome. Through interactions with other RNAs, such as microRNAs, and with proteins, circRNAs regulate cellular processes also related to cancer development. CircRNAs can translate into functional peptides too. <i>MLL</i> and most of the 90 <i>MLL</i> translocation partners do express circRNAs and exploration of our RNA-seq dataset of sorted blood cell populations provided new data on alternative circular isoform generation and expression variability of circRNAs of the <i>MLL</i> recombinome. Further, we provided evidence that rearrangements of <i>MLL</i> and three of the main translocation partner genes can impact circRNA expression, supported also by preliminary observations in leukemic cells. The emerging picture underpins the view that circRNAs are worthwhile to be considered when studying MLLre leukemias and provides a new perspective on the impact of chromosomal translocations in cancer cells at large.

Also flagged:NF-κBPeptideInterleukin-1βIL-1βIL-1 receptorIL-1R
Journal Article 2019-02-13 No Snippets Geranurimi A, Cheng CWH, Quiniou C, Zhu T, Hou X, Rivera JC, St-Cyr DJ, Beauregard K, Bernard-Gauthier V, Chemtob S, Lubell WD.
Show Full Abstract

Interleukin-1β (IL-1β) binds to the IL-1 receptor (IL-1R) and is a key cytokine mediator of inflammasome activation. IL-1β signaling leads to parturition in preterm birth (PTB) and contributes to the retinal vaso-obliteration characteristic of oxygen-induced retinopathy (OIR) of premature infants. Therapeutics targeting IL-1β and IL-1R are approved to treat rheumatoid arthritis; however, all are large proteins with clinical limitations including immunosuppression, due in part to inhibition of NF-κB signaling, which is required for immuno-vigilance and cytoprotection. The all-D-amino acid peptide <b>1</b> (101.10, H-d-Arg-d-Tyr-d-Thr-d-Val-d-Glu-d-Leu-d-Ala-NH<sub>2</sub>) is an allosteric IL-1R modulator, which exhibits functional selectivity and conserves NF-κB signaling while inhibiting other IL-1-activated pathways. Peptide <b>1</b> has proven effective in experimental models of PTB and OIR. Seeking understanding of the structural requirements for the activity and biased signaling of <b>1</b>, a panel of twelve derivatives was synthesized employing the various stereochemical isomers of α-amino-γ-lactam (Agl) and α-amino-β-hydroxy-γ-lactam (Hgl) residues to constrain the D-Thr-D-Val dipeptide residue. Using circular dichroism spectroscopy, the peptide conformation in solution was observed to be contingent on Agl, Hgl, and Val stereochemistry. Moreover, the lactam mimic structure and configuration influenced biased IL-1 signaling in an <i>in vitro</i> panel of cellular assays as well as <i>in vivo</i> activity in murine models of PTB and OIR. Remarkably, all Agl and Hgl analogs of peptide 1 did not inhibit NF-κB signaling but blocked other pathways, such as JNK and ROCK2 phosphorylation contingent on structure and configuration. Efficacy in preventing preterm labor correlated with a capacity to block IL-1β-induced IL-1β synthesis. Furthermore, the importance of inhibition of JNK and ROCK2 phosphorylation for enhanced activity was highlighted for prevention of vaso-obliteration in the OIR model. Taken together, lactam mimic structure and stereochemistry strongly influenced conformation and biased signaling. Selective modulation of IL-1 signaling was proven to be particularly beneficial for curbing inflammation in models of preterm labor and retinopathy of prematurity (ROP). A class of biased ligands has been created with potential to serve as selective probes for studying IL-1 signaling in disease. Moreover, the small peptide mimic prototypes are promising leads for developing immunomodulatory therapies with easier administration and maintenance of beneficial effects of NF-κB signaling.

Also flagged:Synthesesβ-nicotinamide ribosidemetabolismribosidenicotinamide ribosidenicotinamide adenine dinucleotide
Journal Article 2019-02-13 No Snippets Makarov MV, Migaud ME.
Show Full Abstract

The β-anomeric form of nicotinamide riboside (NR<sup>+</sup>) is a precursor for nicotinamide adenine dinucleotide (NAD<sup>+</sup>), a redox cofactor playing a critical role in cell metabolism. Recently, it has been demonstrated that its chloride salt (NR<sup>+</sup>Cl<sup>-</sup>) has beneficial effects, and now NR<sup>+</sup>Cl<sup>-</sup> is available as a dietary supplement. Syntheses and studies of analogues and derivatives of NR<sup>+</sup> are of high importance to unravel the role of NR<sup>+</sup> in biochemical processes in living cells and to elaborate the next generation of NR<sup>+</sup> derivatives and conjugates with the view of developing novel drug and food supplement candidates. This review provides an overview of the synthetic approaches, the chemical properties, and the structural and functional modifications which have been undertaken on the nicotinoyl riboside scaffold.

Also flagged:cytokineoxygennitrogenChronic liver diseasescancersdeath
Journal Article 2019-02-13 ✓ 1 Snippet Senoner T, Schindler S, Stättner S, Öfner D, Troppmair J, Primavesi F.
In-Text Gene Mentions

PRDX6:…

Show Full Abstract

Several types of surgical procedures have shown to elicit an inflammatory stress response, leading to substantial cytokine production and formation of oxygen-based or nitrogen-based free radicals. Chronic liver diseases including cancers are almost always characterized by increased oxidative stress, in which hepatic surgery is likely to potentiate at least in the short term and hereby furthermore impair the hepatic redox state. During liver resection, intermittent inflow occlusion is commonly applied to prevent excessive blood loss but resulting ischemia and reperfusion of the liver have been linked to increased oxidative stress, leading to impairment of cell functions and subsequent cell death. In the field of liver transplantation, ischemia/reperfusion injury has extensively been investigated in the last decades and has recently been in the scientific focus again due to increased use of marginal donor organs and new machine perfusion concepts. Therefore, given the intriguing role of oxidative stress in the pathogenesis of numerous diseases and in the perioperative setting, the interest for a therapeutic antioxidative agent has been present for several years. This review is aimed at giving an introduction to oxidative stress in surgical procedures in general and then examines the role of oxidative stress in liver surgery in particular, discussing both transplantation and resection. Results from studies in the animal and human settings are included. Finally, potential therapeutic agents that might be beneficial in reducing the burden of oxidative stress in hepatic diseases and during surgery are presented. While there is compelling evidence from animal models and a limited number of clinical studies showing that oxidative stress plays a major role in both liver resection and transplantation and several recent studies have suggested a potential for antioxidative treatment in chronic liver disease (e.g., steatosis), the search for effective antioxidants in the field of liver surgery is still ongoing.

Also flagged:colorectal cancermetastatic colorectal cancerepidermal growth factor receptorEGFRantibodiesangiogenesis
Journal Article 2019-02-13 No Snippets Gbolahan O, O'Neil B.
Show Full Abstract

Over the last decade, progress in the management of metastatic colorectal cancer (CRC) has focused on the development of biologic therapy in addition to the back bone of combination chemotherapy. Anti-epidermal growth factor receptor (EGFR) antibodies and agents targeting angiogenesis are widely used in the clinic, and more recently, in a subset of patients with mismatch repair (MMR) deficient cancer, immunotherapy with immune check point inhibitors have been integrated into clinical practice. The major challenge with the use of these biologic therapies is determining predictive biomarkers to optimize patient selection. In this review, we discuss the most recent updates in the use of biologic therapy in CRC. We review data on the role of primary tumor location (PTL) (sidedness) as predictive biomarker and recent advances in treatment of CRC with BRAF mutation.

Also flagged:Capsaicinlipidmembranesmembranecholesterolorganization
Journal Article 2019-02-13 No Snippets Sharma N, Phan HTT, Yoda T, Shimokawa N, Vestergaard MC, Takagi M.
Show Full Abstract

Capsaicin is a natural compound that produces a warm sensation and is known for its remarkable medicinal properties. Understanding the interaction between capsaicin with lipid membranes is essential to clarify the molecular mechanisms behind its pharmacological and biological effects. In this study, we investigated the effect of capsaicin on thermoresponsiveness, fluidity, and phase separation of liposomal membranes. Liposomal membranes are a bioinspired technology that can be exploited to understand biological mechanisms. We have shown that by increasing thermo-induced membrane excess area, capsaicin promoted membrane fluctuation. The effect of capsaicin on membrane fluidity was dependent on lipid composition. Capsaicin increased fluidity of (1,2-dioleoyl-<i>sn</i>-glycero-3-phosphocholine (DOPC) membranes, while it rigidified DOPC and cholesterol-based liposomes. In addition, capsaicin tended to decrease phase separation of heterogeneous liposomes, inducing homogeneity. We imagine this lipid re-organization to be associated with the physiological warming sensation upon consumption of capsaicin. Since capsaicin has been reported to have biological properties such as antimicrobial and as antiplatelet, the results will help unravel these biological properties.

Also flagged:glucoseinsulininsulin resistanceobesityvildagliptinmetformin
Journal Article 2019-02-12 No Snippets Matthews DR, Paldánius PM, Proot P, Foley JE, Stumvoll M, Del Prato S.
Show Full Abstract

<h4>Aim</h4>To assess the long-term clinical benefits of early combination treatment with vildagliptin-metformin vs. standard-of-care, metformin monotherapy in the ongoing VERIFY study.<h4>Methods</h4>We randomized 2001 participants with multi-ethnic background, aged 18-70 years, having HbA<sub>1c</sub> levels 48-58 mmol/mol (6.5-7.5%) and BMI 22-40 kg/m<sup>2</sup> . Baseline data included HbA<sub>1c</sub> , fasting plasma glucose and homeostasis model β-cell and insulin sensitivity. Standardized meal-tests, insulin secretion rate relative to glucose, and oral glucose insulin sensitivity were assessed in a subpopulation.<h4>Results</h4>Out of 4524 screened, data were collected from the 2001 eligible participants (53% women) across Europe (52.4%), Latin America (26.8%), Asia (17.2%), South Africa (3.1%) and Australia (0.5%). The median (interquartile range) disease duration was 3.4 (0.9, 10.2) months; mean (±SD) age 54.3±9.4 years; weight 85.5±17.5 kg and BMI 31.1±4.7 kg/m<sup>2</sup> . Baseline HbA<sub>1c</sub> was 52±3 mmol/mol (6.9±0.3%), fasting plasma glucose 7.5±1.5 mmol/l and the median (interquartile range) of fasting insulin was 109 (75-160) mU/l. Homeostasis model β-cell and insulin sensitivity values were 84% (60, 116) and 46% (31, 68), respectively. In those undertaking meal-tests, insulin secretion rate relative to glucose was 28±12 pmol/min/m<sup>2</sup> /mmol/l and oral glucose insulin sensitivity was 353±57 ml/min/m<sup>2</sup> .<h4>Conclusions</h4>Our current, multi-ethnic, newly diagnosed VERIFY population reflects a characteristic presence of early insulin resistance in participants with increased demand for insulin associated with obesity. The VERIFY study will provide unique evidence in characterizing therapeutic intervention in a diverse population with hyperglycaemia, focusing on durability of early glycaemic control.

Also flagged:Thyroid CancerOPCMLcancerthyroid glandMedullary thyroid cancerMTC
Journal Article 2019-02-12 No Snippets Xu Y, Chen J, Yang Z, Xu L.
Show Full Abstract

BACKGROUND The aims of this study were to use RNA expression profile bioinformatics data from cases of thyroid cancer from the Cancer Genome Atlas (TCGA), the Kyoto Encyclopedia of Genes and Genomes (KEGG), and the Gene Ontology (GO) databases to construct a competing endogenous RNA (ceRNA) network of mRNAs, long noncoding RNAs (lncRNAs), and microRNAs (miRNAs). MATERIAL AND METHODS TCGA provided RNA profiles from 515 thyroid cancer tissues and 56 normal thyroid tissues. The DESeq R package analyzed high-throughput sequencing data on differentially expressed RNAs. GO and KEGG pathway analysis used the DAVID 6.8 and the ClusterProfile R package. Kaplan-Meier survival statistics and Cox regression analysis were performed. The thyroid cancer ceRNA network was constructed based on the miRDB, miRTarBase, and TargetScan databases. RESULTS There were 1,098 mRNAs associated with thyroid cancer; 101 mRNAs were associated with overall survival (OS). Multivariate analysis developed a risk scoring system that identified seven signature mRNAs, with a discriminative value of 0.88, determined by receiver operating characteristic (ROC) curve analysis. A ceRNA network included 13 mRNAs, 31 lncRNAs, and seven miRNAs. Four out of the 31 lncRNAs and all miRNAs were down-regulated, and the remaining RNAs were upregulated. Two lncRNAs (MIR1281A2HG and OPCML-IT1) and one miRNA (miR-184) were significantly associated with OS in patients with thyroid cancer. CONCLUSIONS Differential RNA expression profiling in thyroid cancer was used to construct a ceRNA network of mRNAs, lncRNAs, and miRNAs that showed potential in evaluating prognosis.

Also flagged:steroidhormonewaterchloroformoxygenphenol red
Journal Article 2019-02-12 No Snippets Lee UN, Berthier J, Yu J, Berthier E, Theberge AB.
Show Full Abstract

We present an open microfluidic platform that enables stable flow of an organic solvent over an aqueous solution. The device features apertures connecting a lower aqueous channel to an upper solvent compartment that is open to air, enabling easy removal of the solvent for analysis. We have previously shown that related open biphasic systems enable steroid hormone extraction from human cells in microscale culture and secondary metabolite extraction from microbial culture; here we build on our prior work by determining conditions under which the system can be used with extraction solvents of ranging polarities, a critical feature for applying this extraction platform to diverse classes of metabolites. We developed an analytical model that predicts the limits of stable aqueous-organic interfaces based on analysis of Laplace pressure. With this analytical model and experimental testing, we developed generalized design rules for creating stable open microfluidic biphasic systems with solvents of varying densities, aqueous-organic interfacial tensions, and polarities. The stable biphasic interfaces afforded by this device will enable on-chip extraction of diverse metabolite structures and novel applications in microscale biphasic chemical reactions.

Also flagged:serotonin transportercocainecocaine addictionnucleussucrose5
Journal Article 2019-02-12 ✓ 5 Snippets Karel P, Van der Toorn A, Vanderschuren L, Guo C, Sadighi Alvandi M, Reneman L, Dijkhuizen R, Verheij MMM, Homberg JR.
In-Text Gene Mentions

It has been well established that heavy cocaine use can lead to changes in brain gray2, 3 and white matter (WM).4, 5 There are, however, substantial individual differences in these structural changes, to which various factors contribute, including predisposition.6 One factor shaping predisposition involves the short (s)‐allele of the serotonin transporter (5‐HTT)–linked polymorphic region (5‐HTTLPR).7 This polymorphism is particularly known for its association with affective disorders like depression8 but has also been linked to psychostimulant addiction.9, 10, 11 The 5‐HTTLPR s‐allele goes along with lower levels of 5‐HTT messenger RNA (mRNA) transcription,12 implying that reduced 5‐HTT expression and possibly increased synaptic levels of serotonin (5‐HT) have downstream effects on the brain that contribute to the predisposition.

In conclusion, we show that increased long‐access cocaine self‐administration in 5‐HTT−/− rats is associated with decreased AMY and DRN volume, providing a neural substrate for increased vulnerability seen in individuals characterized by inherited 5‐HTT downregulation.

Overview of images for serotonin transporter (5‐HTT)+/+ and 5‐HTT−/− rats with a history of sucrose or cocaine self‐administration.

Of particular interest for this study, 5‐HTT−/− rats show higher extracellular levels of 5‐HT in the Hip and nucleus accumbens (NAc),26 increased anxiety‐ and depression‐like behavior,27, 28 enhanced cocaine‐induced conditioned place preference (CPP), and most importantly, increased intravenous cocaine self‐administration under both short‐29 and long‐access conditions.30, 31 5‐HTT−/− rats also display an increased motivation for cocaine,28, 29 an impairment in the extinction of cocaine‐seeking behavior,29, 30 and insensitivity to punishment.30 These latter three behavioral manifestations correspond to the three criteria that have been proposed to assess addiction‐like behavior in rats.32 These findings together suggest that 5‐HTT−/− rats show higher levels of cocaine self‐administration to “self‐medicate” their negative emotional state.

In support, we found that increased long‐access cocaine self‐administration in 5‐HTT−/− rats is associated with increased anxiety and with changes in corticotropin‐releasing factor (CRF) levels in the AMY.

Show Full Abstract

Excessive use of cocaine is known to induce changes in brain white and gray matter. It is unknown whether the extent of these changes is related to individual differences in vulnerability to cocaine addiction. One factor increasing vulnerability involves reduced expression of the serotonin transporter (5-HTT). Human studies have shown that inherited 5-HTT downregulation is associated with structural changes in the brain. These genotype-related structural changes may contribute to risk for cocaine addiction. Here, we tested this idea by using ultrahigh-resolution structural magnetic resonance imaging (MRI) on postmortem tissue of 5-HTT<sup>-/-</sup> and wild-type (5-HTT<sup>+/+</sup> ) rats with a history of long access to cocaine or sucrose (control) self-administration. We found that 5-HTT<sup>-/-</sup> rats, compared with wild-type control animals, self-administered more cocaine, but not sucrose, under long-access conditions. Ultrahigh-resolution structural MRI subsequently revealed that, independent of sucrose or cocaine self-administration, 5-HTT<sup>-/-</sup> rats had a smaller amygdala. Moreover, we found an interaction between genotype and type of reward for dorsal raphe nucleus volume. The data point to an important but differential role of the amygdala and dorsal raphe nucleus in 5-HTT genotype-dependent vulnerability to cocaine addiction.

Also flagged:eicosanoidbiosynthesissynthesiscyclooxygenaselipoxygenaseeicosanoids
Journal Article 2019-02-12 ✓ 5 Snippets Scarpati M, Qi Y, Govind S, Govind S, Singh S.
In-Text Gene Mentions

PTGIS catalyzes the isomerization of PGH2 to prostacyclin, the only prostaglandin with a bicyclic ring structure [106].

PTGIS encodes a 500 amino acid enzyme characterized by a cytochrome p450 family domain ranging from position 30 to 494.

…Prostacyclin synthase (PTGIS) is another enzyme…

PTGIScatalyzes the isomerization…

PTGISencodes a 500…

Show Full Abstract

This study reports on a putative eicosanoid biosynthesis pathway in Drosophila melanogaster and challenges the currently held view that mechanistic routes to synthesize eicosanoid or eicosanoid-like biolipids do not exist in insects, since to date, putative fly homologs of most mammalian enzymes have not been identified. Here we use systematic and comprehensive bioinformatics approaches to identify most of the mammalian eicosanoid synthesis enzymes. Sensitive sequence analysis techniques identified candidate Drosophila enzymes that share low global sequence identities with their human counterparts. Twenty Drosophila candidates were selected based upon (a) sequence identity with human enzymes of the cyclooxygenase and lipoxygenase branches, (b) similar domain architecture and structural conservation of the catalytic domain, and (c) presence of potentially equivalent functional residues. Evaluation of full-length structural models for these 20 top-scoring Drosophila candidates revealed a surprising degree of conservation in their overall folds and potential analogs for functional residues in all 20 enzymes. Although we were unable to identify any suitable candidate for lipoxygenase enzymes, we report structural homology models of three fly cyclooxygenases. Our findings predict that the D. melanogaster genome likely codes for one or more pathways for eicosanoid or eicosanoid-like biolipid synthesis. Our study suggests that classical and/or novel eicosanoids mediators must regulate biological functions in insects-predictions that can be tested with the power of Drosophila genetics. Such experimental analysis of eicosanoid biology in a simple model organism will have high relevance to human development and health.

Also flagged:chimeric antigen receptorhematological cancersbindingtransmembranephosphorylationCARs
Journal Article 2019-02-12 No Snippets Ramello MC, Benzaïd I, Kuenzi BM, Lienlaf-Moreno M, Kandell WM, Santiago DN, Pabón-Saldaña M, Darville L, Fang B, Rix U, Yoder S, Berglund A, Koomen JM, Haura EB, Abate-Daga D.
Show Full Abstract

Adoptive transfer of T cells that express a chimeric antigen receptor (CAR) is an approved immunotherapy that may be curative for some hematological cancers. To better understand the therapeutic mechanism of action, we systematically analyzed CAR signaling in human primary T cells by mass spectrometry. When we compared the interactomes and the signaling pathways activated by distinct CAR-T cells that shared the same antigen-binding domain but differed in their intracellular domains and their in vivo antitumor efficacy, we found that only second-generation CARs induced the expression of a constitutively phosphorylated form of CD3ζ that resembled the endogenous species. This phenomenon was independent of the choice of costimulatory domains, or the hinge/transmembrane region. Rather, it was dependent on the size of the intracellular domains. Moreover, the second-generation design was also associated with stronger phosphorylation of downstream secondary messengers, as evidenced by global phosphoproteome analysis. These results suggest that second-generation CARs can activate additional sources of CD3ζ signaling, and this may contribute to more intense signaling and superior antitumor efficacy that they display compared to third-generation CARs. Moreover, our results provide a deeper understanding of how CARs interact physically and/or functionally with endogenous T cell molecules, which will inform the development of novel optimized immune receptors.

Also flagged:histonemodificationsHistoneschromatinbindingcancer
Journal Article 2019-02-12 No Snippets Ngo V, Chen Z, Zhang K, Whitaker JW, Wang M, Wang W.
Show Full Abstract

Histones are modified by enzymes that act in a locus, cell-type, and developmental stage-specific manner. The recruitment of enzymes to chromatin is regulated at multiple levels, including interaction with sequence-specific DNA-binding factors. However, the DNA-binding specificity of the regulatory factors that orchestrate specific histone modifications has not been broadly mapped. We have analyzed 6 histone marks (H3K4me1, H3K4me3, H3K27ac, H3K27me3, K3H9me3, H3K36me3) across 121 human cell types and tissues from the NIH Roadmap Epigenomics Project as well as 8 histone marks (with addition of H3K4me2 and H3K9ac) from the mouse ENCODE Consortium. We have identified 361 and 369 DNA motifs in human and mouse, respectively, that are the most predictive of each histone mark. Interestingly, 107 human motifs are conserved between the two species. In human embryonic cell line H1, we mutated only the found DNA motifs at particular loci and the significant reduction of H3K27ac levels validated the regulatory roles of the perturbed motifs. The functionality of these motifs was also supported by the evidence that histone-associated motifs, especially H3K4me3 motifs, significantly overlap with the expression of quantitative trait loci SNPs in cancer patients more than the known and random motifs. Furthermore, we observed possible feedbacks to control chromatin dynamics as the found motifs appear in the promoters or enhancers associated with various histone modification enzymes. These results pave the way toward revealing the molecular mechanisms of epigenetic events, such as histone modification dynamics and epigenetic priming.

Also flagged:Chronic Thromboembolic Pulmonary HypertensionCTEPHpulmonary embolismPEfibrinogenfibrinolysis
Journal Article 2019-02-12 No Snippets Opitz I, Kirschner MB.
Show Full Abstract

Chronic Thromboembolic Pulmonary Hypertension (CTEPH) is a debilitating disease, for which the underlying pathophysiological mechanisms have yet to be fully elucidated. Occurrence of a pulmonary embolism (PE) is a major risk factor for the development of CTEPH, with non-resolution of the thrombus being considered the main cause of CTEPH. Polymorphisms in the α-chain of fibrinogen have been linked to resistance to fibrinolysis in CTEPH patients, and could be responsible for development and disease progression. However, it is likely that additional genetic predisposition, as well as genetic and molecular alterations occurring as a consequence of tissue remodeling in the pulmonary arteries following a persistent PE, also play an important role in CTEPH. This review summarises the current knowledge regarding genetic differences between CTEPH patients and controls (with or without pulmonary hypertension). Mutations in BMPR2, differential gene and microRNA expression, and the transcription factor FoxO1 have been suggested to be involved in the processes underlying the development of CTEPH. While these studies provide the first indications regarding important dysregulated pathways in CTEPH (e.g., TGF-β and PI3K signaling), additional in-depth investigations are required to fully understand the complex processes leading to CTEPH.

Also flagged:MineralChronic Diseasesmineralscalciummagnesiumiron
Journal Article 2019-02-12 ✓ 2 Snippets Cheng WW, Zhu Q, Zhang HY.
In-Text Gene Mentions

Moreover, the results of the “single-SNP” and “leave-one-out” analyses showed that rs7965584 in the RP11-654D12.2 gene and rs1800562 in the HFE gene corresponded to Mg and Fe, respectively, and had a significant impact on gout (Supplementary Figures S1 and S2).

…rs1800562 in theHFEgene corresponded to…

Show Full Abstract

We applied Mendelian randomization analyses to investigate the potential causality between blood minerals (calcium, magnesium, iron, copper, and zinc) and osteoporosis (OP), gout, rheumatoid arthritis (RA), type 2 diabetes (T2D), Alzheimer's disease (AD), bipolar disorder (BD), schizophrenia , Parkinson's disease and major depressive disorder. Single nucleotide polymorphisms (SNPs) that are independent (<i>r</i>² < 0.01) and are strongly related to minerals (<i>p</i> < 5 × 10<sup>-8</sup>) are selected as instrumental variables. Each standard deviation increase in magnesium (0.16 mmol/L) is associated with an 8.94-fold increase in the risk of RA (<i>p</i> = 0.044) and an 8.78-fold increase in BD (<i>p</i> = 0.040) but a 0.10 g/cm² increase in bone density related to OP (<i>p</i> = 0.014). Each per-unit increase in copper is associated with a 0.87-fold increase in the risk of AD (<i>p</i> = 0.050) and BD (<i>p</i> = 0.010). In addition, there is suggestive evidence that calcium is positively correlated (OR = 1.36, <i>p</i> = 0.030) and iron is negatively correlated with T2D risk (OR = 0.89, <i>p</i> = 0.010); both magnesium (OR = 0.26, <i>p</i> = 0.013) and iron (OR = 0.71, <i>p</i> = 0.047) are negatively correlated with gout risk. In the sensitivity analysis, causal estimation is not affected by pleiotropy. This study supports the long-standing hypothesis that magnesium supplementation can increase RA and BD risks and decrease OP risk and that copper intake can reduce AD and BD risks. This study will be helpful to address some controversial debates on the relationships between minerals and chronic diseases.

Also flagged:KDM4BcancerhistonesJumonj domain histone demethylaseslysinehistone
Journal Article 2019-02-12 ✓ 1 Snippet Wilson C, Krieg AJ.
In-Text Gene Mentions

…act as lysinespecific histone demethylaseshistone demethylases (KDMs)…

Show Full Abstract

Epigenetic changes are well-established contributors to cancer progression and normal developmental processes. The reversible modification of histones plays a central role in regulating the nuclear processes of gene transcription, DNA replication, and DNA repair. The KDM4 family of Jumonj domain histone demethylases specifically target di- and tri-methylated lysine 9 on histone H3 (H3K9me3), removing a modification central to defining heterochromatin and gene repression. KDM4 enzymes are generally over-expressed in cancers, making them compelling targets for study and therapeutic inhibition. One of these family members, KDM4B, is especially interesting due to its regulation by multiple cellular stimuli, including DNA damage, steroid hormones, and hypoxia. In this review, we discuss what is known about the regulation of KDM4B in response to the cellular environment, and how this context-dependent expression may be translated into specific biological consequences in cancer and reproductive biology.

Also flagged:lipidmembraneaxonsaction potentialsmyelinOligodendrocyte
Journal Article 2019-02-12 No Snippets Elbaz B, Popko B.
Show Full Abstract

Myelin is a multilayer lipid membrane structure that wraps and insulates axons, allowing for the efficient propagation of action potentials. During developmental myelination of the central nervous system (CNS), oligodendrocyte progenitor cells (OPCs) proliferate and migrate to their final destination, where they terminally differentiate into mature oligodendrocytes and myelinate axons. Lineage progression and terminal differentiation of oligodendrocyte lineage cells are under tight transcriptional and post-transcriptional control. The characterization of several recently identified regulatory factors that govern these processes, which are the focus of this review, has greatly increased our understanding of oligodendrocyte development and function. These insights are critical to facilitate efforts to enhance OPC differentiation in neurological disorders that disrupt CNS myelin.

Also flagged:Serotonin TransportertransmembraneserotoninNa/K ATPasedisorders of thedepression
Journal Article 2019-02-12 ✓ 1 Snippet Baudry A, Pietri M, Launay JM, Kellermann O, Schneider B.
In-Text Gene Mentions

…transporter (SERT or5-HTT), and to a…

Show Full Abstract

Serotonin transporter, SERT (<i>SLC64A</i> for solute carrier family 6, member A4), is a twelve transmembrane domain (TMDs) protein that assumes the uptake of serotonin (5-HT) through dissipation of the Na<sup>+</sup> gradient established by the electrogenic pump Na/K ATPase. Abnormalities in 5-HT level and signaling have been associated with various disorders of the central nervous system (CNS) such as depression, obsessive-compulsive disorder, anxiety disorders, and autism spectrum disorder. Since the 50s, SERT has raised a lot of interest as being the target of a class of antidepressants, the Serotonin Selective Reuptake Inhibitors (SSRIs), used in clinics to combat depressive states. Because of the refractoriness of two-third of patients to SSRI treatment, a better understanding of the mechanisms regulating SERT functions is of priority. Here, we review how genetic and epigenetic regulations, post-translational modifications of SERT, and specific interactions between SERT and a set of diverse partners influence SERT expression, trafficking to and away from the plasma membrane and activity, in connection with the neuronal adaptive cell response to SSRI antidepressants.

Also flagged:Satb2-associated syndromegenetic disorderbehavioraldevelopmental delayintellectual disability
Journal Article 2019-02-12 ✓ 2 Snippets Zhang Q, Huang Y, Zhang L, Ding YQ, Song NN.
In-Text Gene Mentions

…the serotonin transporter (5-HTT) expressed by thalamocortical…

…7F,G ), but5-HTT-positive axons were sparsely…

Show Full Abstract

Satb2-associated syndrome (SAS) is a genetic disorder that results from the deletion or mutation of one allele within the Satb2 locus. Patients with SAS show behavioral abnormalities, including developmental delay/intellectual disability, hyperactivity, and symptoms of autism. To address the role of Satb2 in SAS-related behaviors and generate an SAS mouse model, Satb2 was deleted in the cortex and hippocampus of Emx1-Cre; Satb2<sup>flox/flox</sup> [Satb2 conditional knockout (CKO)] mice. Satb2 CKO mice showed hyperactivity, increased impulsivity, abnormal social novelty, and impaired spatial learning and memory. Furthermore, we also found that the development of neurons in cortical layer IV was defective in Satb2 CKO mice, as shown by the loss of layer-specific gene expression and abnormal thalamocortical projections. In summary, the abnormal behaviors revealed in Satb2 CKO mice may reflect the SAS symptoms associated with Satb2 mutation in human patients, possibly due to defective development of cortical neurons in multiple layers including alterations of their inputs/outputs.

Also flagged:cognitive disordersneurodegenerative diseasesfrontotemporal dementianeurogenesisextracellularneurodegenerative disorders
Journal Article 2019-02-12 No Snippets Peteri UK, Niukkanen M, Castrén ML.
Show Full Abstract

To an increasing extent, astrocytes are connected with various neuropathologies. Astrocytes comprise of a heterogeneous population of cells with region- and species-specific properties. The frontal cortex exhibits high levels of plasticity that is required for high cognitive functions and memory making this region especially susceptible to damage. Aberrations in the frontal cortex are involved with several cognitive disorders, including Alzheimer's disease, Huntington's disease and frontotemporal dementia. Human induced pluripotent stem cells (iPSCs) provide an alternative for disease modeling and offer possibilities for studies to investigate pathological mechanisms in a cell type-specific manner. Patient-specific iPSC-derived astrocytes have been shown to recapitulate several disease phenotypes. Addressing astrocyte heterogeneity may provide an improved understanding of the mechanisms underlying neurodegenerative diseases.

Also flagged:Hypertensive Nephropathyblood pressurekidney damagedamageHNcapsule
Journal Article 2019-02-12 ✓ 2 Snippets Guo F, Zhang W, Su J, Xu H, Yang H.
In-Text Gene Mentions

PAH interacts with DCC to regulate dopamine synthesis from tyrosine.

…PAH interacts withDCCto regulate dopamine…

Show Full Abstract

Hypertensive nephropathy (HN) is a medical condition in which chronic high blood pressure causes different kidney damage, including vascular, glomerular and tubulointerstitial lesions. For HN patients, glomerular and tubulointerstitial lesions occur in different renal structure with distinct mechanisms in the progression of renal damage. As an extraction of <i>Eucommia ulmoides</i>, Quan-du-zhong capsule (QDZJN) has the potential to treat HN due to antihypertensive and renal protective activities. Complicated mechanism of HN underlying various renal lesions and the "multi-component and multi-target" characteristics of QDZJN make identifying drug positioning for various renal lesions of HN complex. Here, we proposed an approach based on drug perturbation of disease network robustness, that is used to assess QDZJN positioning for various HN lesions. Topological characteristics of drug-attacked nodes in disease network were used to evaluated nodes importance to network. To evaluate drug attack on the whole disease network of various HN lesions, the robustness of disease networks before/after drug attack were assessed and compared with null models generated from random networks. We found that potential targets of QDZJN were specifically expressed in the kidneys and tended to participate in the "inflammatory response," "regulation of blood pressure," and "response to LPS and hypoxia," and they were also key factors of HN. Based on network robustness assessment, QDZJN may specifically target glomeruli account to the stronger influence on glomerular network after removal of its potential targets. This prediction strategy of drug positioning is suitable for multi-component drugs based on drug perturbation of disease network robustness for two renal compartments, glomeruli and tubules. A stronger influence on the disease network of glomeruli than of tubules indicated that QDZJN may specifically target glomerular lesion of HN patients and will provide more evidence for precise clinical application of QDZJN against HN. Drug positioning approach we proposed also provides a new strategy for predicting precise clinical use of multi-target drugs.

Also flagged:enzyme activityhereditary angioedemaserine proteasescoagulationkininrine p rotease
Journal Article 2019-02-12 No Snippets Sanrattana W, Maas C, de Maat S.
Show Full Abstract

Excessive enzyme activity often has pathological consequences. This for example is the case in thrombosis and hereditary angioedema, where serine proteases of the coagulation system and kallikrein-kinin system are excessively active. Serine proteases are controlled by SERPINs (serine protease inhibitors). We here describe the basic biochemical mechanisms behind SERPIN activity and identify key determinants that influence their function. We explore the clinical phenotypes of several SERPIN deficiencies and review studies where SERPINs are being used beyond replacement therapy. Excitingly, rare human SERPIN mutations have led us and others to believe that it is possible to refine SERPINs toward desired behavior for the treatment of enzyme-driven pathology.

Also flagged:diaminodiacidpeptidesynthesisdisulfidepeptidespinacol ester
Journal Article 2019-02-12 No Snippets Liu C, Zou Y, Zou Y, Hu H, Jiang Y, Qin L.
Show Full Abstract

The diaminodiacid strategy has been widely studied in the chemical synthesis of peptide disulfide bond mimics. Diaminodiacid building blocks, which are key intermediates, are currently under the spotlight. However, one technical bottleneck inherent in existing building blocks is the contamination problem caused by the heavy metal reagents during the deprotection process, which makes the peptides less suitable for pharmaceutical use. Herein, we describe the successful development of a <i>p</i>-dihydroxyborylbenzyloxycarbonyl pinacol ester (pDobz)- and <i>p</i>-dihydroxyborylbenzyl pinacol ester (pDobb)-based novel diaminodiacid building block that can be easily deprotected <i>via</i> mild treatment with amine oxide. Its efficiency and practicability were also confirmed by the total synthesis of contryphan-Vn disulfide bond mimic. The results suggested that this novel diaminodiacid building block has satisfactory Fmoc SPPS compatibility, yet only required a facile, rapid, and metal-free deprotection process. We believe this novel diaminodiacid building block could promote further development of the diaminodiacid strategy.

bioRxiv 2019-02-12 Preprint (No Snippets API) Glazer AM, Bastarache L, Hall L, Short L, Shields T, Kroncke BM, Denny JC, Roden DM.
Show Full Abstract

Hereditary hemochromatosis (HH) is an autosomal recessive disorder of excess iron absorption. The most common form, HH1, is caused by loss of function variants in HFE. HFE encodes a cell surface protein that binds to the Transferrin Receptor (TfR1), reducing TfR1’s affinity for the transferrin/iron complex and thereby limiting cellular iron uptake. Two common missense alleles for HH1 have been identified, HFE C282Y and HFE H63D; H63D is considered to be a less penetrant allele. When we deployed Phenotype Risk Scores (PheRS), a method that aggregates multiple symptoms together in Electronic Health Records (EHRs), we identified HFE E168Q as a novel variant associated with HH. E168Q is on the same haplotype as H63D, and in a crystal structure HFE E168 lies at the interface of the HFE-TfR1 interaction and makes multiple salt bridge connections with TfR1. In in vitro cell surface abundance experiments, the HFE E168Q+H63D double mutation surprisingly increased cell surface abundance of HFE by 10-fold compared to wildtype. In coimmunoprecipitation experiments, however, HFE C282Y, E168Q, and E168Q+H63D completely abolished the interaction between HFE and TfR1, while H63D alone only partially reduced binding. These findings provide mechanistic insight to validate the PheRS result that HFE E168Q is an HH1-associated allele and lead to the reclassification of E168Q from a variant of uncertain significance to a pathogenic variant, according to ACMG guidelines. HFE E168Q results in loss of HFE function by disrupting the HFE-TfR1 interaction. In addition, some disease manifestations attributed to H63D may reflect the functional effects of E168Q.

Also flagged:primary tumortumorsbamTesticular Germ Cell CancerMediS1B
Journal Article 2019-02-11 ✓ 2 Snippets Dorssers LCJ, Gillis AJM, Stoop H, van Marion R, Nieboer MM, van Riet J, van de Werken HJG, Oosterhuis JW, de Ridder J, Looijenga LHJ.
In-Text Gene Mentions

CSE1L

…BRCA1, CCKBR, CROCC,CSE1L, KAT6A, KEAP1, MTOR,…

Show Full Abstract

<h4>Background</h4>Testicular germ cell cancer (TGCC), being the most frequent malignancy in young Caucasian males, is initiated from an embryonic germ cell. This study determines intratumour heterogeneity to unravel tumour progression from initiation until metastasis.<h4>Methods</h4>In total, 42 purified samples of four treatment-resistant nonseminomatous (NS) TGCC were investigated, including the precursor germ cell neoplasia in situ (GCNIS) and metastatic specimens, using whole-genome and targeted sequencing. Their evolution was reconstructed.<h4>Results</h4>Intratumour molecular heterogeneity did not correspond to the supposed primary tumour histological evolution. Metastases after systemic treatment could be derived from cancer stem cells not identified in the primary cancer. GCNIS mostly lacked the molecular marks of the primary NS and comprised dominant clones that failed to progress. A BRCA-like mutational signature was observed without evidence for direct involvement of BRCA1 and BRCA2 genes.<h4>Conclusions</h4>Our data strongly support the hypothesis that NS is initiated by whole-genome duplication, followed by chromosome copy number alterations in the cancer stem cell population, and accumulation of low numbers of somatic mutations, even in therapy-resistant cases. These observations of heterogeneity at all stages of tumourigenesis should be considered when treating patients with GCNIS-only disease, or with clinically overt NS.

Also flagged:Developmental dyslexiaDDlearning disordersattention-deficit hyperactivity disorderADHDdepression
Journal Article 2019-02-11 ✓ 1 Snippet Gialluisi A, Andlauer TFM, Mirza-Schreiber N, Moll K, Becker J, Hoffmann P, Ludwig KU, Czamara D, St Pourcain B, Brandler W, Honbolygó F, Tóth D, Csépe V, Huguet G, Morris AP, Hulslander J, Willcutt EG, DeFries JC, Olson RK, Smith SD, Pennington BF, Vaessen A, Maurer U, Lyytinen H, Peyrard-Janvid M, Leppänen PHT, Brandeis D, Bonte M, Stein JF, Talcott JB, Fauchereau F, Wilcke A, Francks C, Bourgeron T, Monaco AP, Ramus F, Landerl K, Kere J, Scerri TS, Paracchini S, Fisher SE, Schumacher J, Nöthen MM, Müller-Myhsok B, Schulte-Körne G.
In-Text Gene Mentions

…located within theCSE1Lgene (20q13.13), with…

Show Full Abstract

Developmental dyslexia (DD) is one of the most prevalent learning disorders, with high impact on school and psychosocial development and high comorbidity with conditions like attention-deficit hyperactivity disorder (ADHD), depression, and anxiety. DD is characterized by deficits in different cognitive skills, including word reading, spelling, rapid naming, and phonology. To investigate the genetic basis of DD, we conducted a genome-wide association study (GWAS) of these skills within one of the largest studies available, including nine cohorts of reading-impaired and typically developing children of European ancestry (N = 2562-3468). We observed a genome-wide significant effect (p < 1 × 10<sup>-8</sup>) on rapid automatized naming of letters (RANlet) for variants on 18q12.2, within MIR924HG (micro-RNA 924 host gene; rs17663182 p = 4.73 × 10<sup>-9</sup>), and a suggestive association on 8q12.3 within NKAIN3 (encoding a cation transporter; rs16928927, p = 2.25 × 10<sup>-8</sup>). rs17663182 (18q12.2) also showed genome-wide significant multivariate associations with RAN measures (p = 1.15 × 10<sup>-8</sup>) and with all the cognitive traits tested (p = 3.07 × 10<sup>-8</sup>), suggesting (relational) pleiotropic effects of this variant. A polygenic risk score (PRS) analysis revealed significant genetic overlaps of some of the DD-related traits with educational attainment (EDUyears) and ADHD. Reading and spelling abilities were positively associated with EDUyears (p ~ [10<sup>-5</sup>-10<sup>-7</sup>]) and negatively associated with ADHD PRS (p ~ [10<sup>-8</sup>-10<sup>-17</sup>]). This corroborates a long-standing hypothesis on the partly shared genetic etiology of DD and ADHD, at the genome-wide level. Our findings suggest new candidate DD susceptibility genes and provide new insights into the genetics of dyslexia and its comorbities.

Also flagged:NESHbindingproteincarboxypeptidase Zlaminin alpha 2ARHGAP6
Journal Article 2019-02-11 ✓ 1 Snippet Kuçi S, Kuçi Z, Schäfer R, Spohn G, Winter S, Schwab M, Salzmann-Manrique E, Klingebiel T, Bader P.
In-Text Gene Mentions

…9, 12, 14,NEGR1, EPHA4 and especially…

Show Full Abstract

In the current study we compared the molecular signature of expanded mesenchymal stromal cells (MSCs) derived from selected CD271+ bone marrow mononuclear cells (CD271-MSCs) and MSCs derived from non-selected bone marrow mononuclear cells by plastic adherence (PA-MSCs). Transcriptome analysis demonstrated for the first time the upregulation of 115 and downregulation of 131 genes in CD271-MSCs. Functional enrichment analysis showed that the upregulated genes in CD271-MSCs are significantly enriched for extracellular matrix (tenascin XB, elastin, ABI family, member 3 (NESH) binding protein, carboxypeptidase Z, laminin alpha 2 and nephroblastoma overexpressed) and cell adhesion (CXCR7, GPNMB, MYBPH, SVEP1, ARHGAP6, TSPEAR, PIK3CG, ABL2 and NCAM1). CD271-MSCs expressed higher gene transcript levels that are involved in early osteogenesis/chondrogenesis/adipogenesis (ZNF145, FKBP5). In addition, increased transcript levels for early and late osteogenesis (DPT, OMD, ID4, CRYAB, SORT1), adipogenesis (CTNNB1, ZEB, LPL, FABP4, PDK4, ACDC), and chondrogenesis (CCN3/NOV, CCN4/WISP1, CCN5/WISP2 and ADAMTS-5) were detected. Interestingly, CD271-MSCs expressed increased levels of hematopoiesis associated genes (CXCL12, FLT3L, IL-3, TPO, KITL). Down-regulated genes in CD271-MSCs were associated with WNT and TGF-beta signaling, and cytokine/chemokine signaling pathways. In addition to their capacity to support hematopoiesis, these results suggest that CD271-MSCs may contain more osteo/chondro progenitors and/or feature a greater differentiation potential.

Also flagged:mitochondrialHuntingtinFragile X syndromeRNA-binding proteinfragile X mental retardation proteinFMRP
Journal Article 2019-02-11 ✓ 5 Snippets Shen M, Wang F, Li M, Sah N, Stockton ME, Tidei JJ, Gao Y, Korabelnikov T, Kannan S, Vevea JD, Chapman ER, Bhattacharyya A, van Praag H, Zhao X.
In-Text Gene Mentions

To determine how FMRP deficiency affects Htt mRNA levels, we determined the stability of Htt mRNA in KO and WT hippocampal neurons treated with transcriptional inhibitor actinomycin D. We found that Htt mRNA had a reduced half-life (T1/2) in Fmr1 KO neurons (3.86 hours) compared to WT neurons (4.18 hours; Supplementary Fig. 17b).

Our data unveil mitochondrial dysfunction as a contributor to the impaired dendritic maturation of FMRP-deficient neurons and suggest a role for interactions between FMRP and HTT in the pathogenesis of Fragile X syndrome.

…leads to reducedHttmRNA and protein…

…levels and thatHTTmediates FMRP regulation…

…between FMRP andHTTin the pathogenesis…

Show Full Abstract

Fragile X syndrome results from a loss of the RNA-binding protein fragile X mental retardation protein (FMRP). How FMRP regulates neuronal development and function remains unclear. Here we show that FMRP-deficient immature neurons exhibit impaired dendritic maturation, altered expression of mitochondrial genes, fragmented mitochondria, impaired mitochondrial function, and increased oxidative stress. Enhancing mitochondrial fusion partially rescued dendritic abnormalities in FMRP-deficient immature neurons. We show that FMRP deficiency leads to reduced Htt mRNA and protein levels and that HTT mediates FMRP regulation of mitochondrial fusion and dendritic maturation. Mice with hippocampal Htt knockdown and Fmr1-knockout mice showed similar behavioral deficits that could be rescued by treatment with a mitochondrial fusion compound. Our data unveil mitochondrial dysfunction as a contributor to the impaired dendritic maturation of FMRP-deficient neurons and suggest a role for interactions between FMRP and HTT in the pathogenesis of fragile X syndrome.

Also flagged:CACNB2voltage-gated calcium channelsbipolar disorderHippocampusCalcium voltage-gated channel auxiliary subunit β2Mental illnesses
Journal Article 2019-02-11 ✓ 1 Snippet Liu F, Gong X, Yao X, Cui L, Yin Z, Li C, Tang Y, Wang F.
In-Text Gene Mentions

…( CACNA1C rs10848635,CACNA1Ers10848635, CACNB2 rs11013860,…

Show Full Abstract

<h4>Background</h4>Calcium voltage-gated channel auxiliary subunit β2 is a protein that, in humans, is encoded by the CACNB2 gene. The β2 subunit is an auxiliary protein of voltage-gated calcium channels, which is predominantly expressed in hippocampal pyramidal neurons. A single-nucleotide polymorphism at the CACNB2 gene (rs11013860) has been reported in genome-wide association studies to be associated with bipolar disorder (BD). However, the neural effects of rs11013860 expression are unknown. Thus, the current study investigated the mechanisms of how the CACNB2 gene influences hippocampal-cortical limbic circuits in patients with bipolar disorder (BD).<h4>Methods</h4>A total of 202 subjects were studied [69 BD patients and 133 healthy controls (HC)]. Participants agreed to undergo resting-state functional magnetic resonance imaging (rs-fMRI) and have blood drawn for genetic testing. Participants were found to belong to either a CC group homozygous for the C-allele (17 BD, 41 HC), or an A-carrier group carrying the high risk A-allele (AA/CA genotypes; 52 BD, 92 HC). Brain activity was assessed using resting-state functional connectivity (rs-FC) analyses.<h4>Results</h4>A main effect of genotype showed that the rs-FC of the AA/CA group was elevated more than that of the CC-group between the hippocampus and the regions of right-inferior temporal, fusiform, and left-inferior occipital gyri. Additionally, a significant diagnosis × genotype interaction was noted between the hippocampus and right pars triangularis. Furthermore, in BD patients, the AA/CA group showed lower rs-FC when compared to that of the CC group. Additionally, individuals from HC within the AA/CA group showed higher rs-FC than that of the CC group. Finally, within C-allele-carrying groups, individuals with BD showed significantly increased rs-FC compared to that of HC.<h4>Conclusions</h4>Our study demonstrates that BD patients with the CACNB2 rs11013860 AA/CA genotype may exhibit altered hippocampal-cortical connectivity.

Also flagged:ZRANB2intracranial neoplasmRNA-binding proteinsgliomadegradationbinding
Journal Article 2019-02-11 ✓ 5 Snippets Li X, Xue Y, Liu X, Zheng J, Shen S, Yang C, Chen J, Li Z, Liu L, Ma J, Ma T, Liu Y.
In-Text Gene Mentions

…The Staufen1 (STAU1)-mediated mRNA decay (SMD)…

…forming the complexSTAU1-UPF1 which allows the…

…short-hairpin RNA againstSTAU1(STAU1(−)), short-hairpin RNA…

…(FOXK1 mRNA) andSTAU1in the Ago2…

…To determine whetherSTAU1and UPF1 involved…

Show Full Abstract

<h4>Background</h4>Glioma is the most common intracranial neoplasm with vasculogenic mimicry formation as one form of blood supply. Many RNA-binding proteins and long non-coding RNAs are involved in tumorigenesis of glioma.<h4>Methods</h4>The expression of ZRANB2, SNHG20 and FOXK1 in glioma were detected by real-time PCR or western blot. The function of ZRANB2/SNHG20/FOXK1 axis in glioma associated with vasculogenic mimicry formation was analyzed.<h4>Results</h4>ZRANB2 is up-regulated in glioma tissues and glioma cells. ZRANB2 knockdown inhibits the proliferation, migration, invasion and vasculogenic mimicry formation of glioma cells. ZRANB2 binds to SNHG20 and increases its stability. Knockdown of SNHG20 reduces the degradation of FOXK1 mRNA by SMD pathway. FOXK1 inhibits transcription by binding to the promoters of MMP1, MMP9 and VE-Cadherin and inhibits vasculogenic mimicry formation of glioma cells.<h4>Conclusions</h4>ZRANB2/SNHG20/FOXK1 axis plays an important role in regulating vasculogenic mimicry formation of glioma, which might provide new targets of glioma therapy.

Also flagged:axon growthdeathsignal transductionDSCAM receptorscytoplasmicDown syndrome kinase
Journal Article 2019-02-11 ✓ 2 Snippets Sachse SM, Lievens S, Ribeiro LF, Dascenco D, Masschaele D, Horré K, Misbaer A, Vanderroost N, De Smet AS, Salta E, Erfurth ML, Kise Y, Nebel S, Van Delm W, Plaisance S, Tavernier J, De Strooper B, De Wit J, Schmucker D.
In-Text Gene Mentions

PCDH17

DCC

Show Full Abstract

DSCAM and DSCAML1 are immunoglobulin and cell adhesion-type receptors serving important neurodevelopmental functions including control of axon growth, branching, neurite self-avoidance, and neuronal cell death. The signal transduction mechanisms or effectors of DSCAM receptors, however, remain poorly characterized. We used a human ORFeome library to perform a high-throughput screen in mammalian cells and identified novel cytoplasmic signaling effector candidates including the Down syndrome kinase Dyrk1a, STAT3, USP21, and SH2D2A. Unexpectedly, we also found that the intracellular domains (ICDs) of DSCAM and DSCAML1 specifically and directly interact with IPO5, a nuclear import protein of the importin beta family, via a conserved nuclear localization signal. The DSCAM ICD is released by γ-secretase-dependent cleavage, and both the DSCAM and DSCAML1 ICDs efficiently translocate to the nucleus. Furthermore, RNA sequencing confirms that expression of the DSCAM as well as the DSCAML1 ICDs alone can profoundly alter the expression of genes associated with neuronal differentiation and apoptosis, as well as synapse formation and function. Gain-of-function experiments using primary cortical neurons show that increasing the levels of either the DSCAM or the DSCAML1 ICD leads to an impairment of neurite growth. Strikingly, increased expression of either full-length DSCAM or the DSCAM ICD, but not the DSCAML1 ICD, significantly decreases synapse numbers in primary hippocampal neurons. Taken together, we identified a novel membrane-to-nucleus signaling mechanism by which DSCAM receptors can alter the expression of regulators of neuronal differentiation and synapse formation and function. Considering that chromosomal duplications lead to increased DSCAM expression in trisomy 21, our findings may help uncover novel mechanisms contributing to intellectual disability in Down syndrome.

Also flagged:PNDGFAPNeuNRighting reflexArntder
Journal Article 2019-02-11 ✓ 4 Snippets van de Wijer L, Garcia LP, Hanswijk SI, Rando J, Middelman A, Ter Heine R, Mast Q, Martens GJM, van der Ven AJAM, Kolk SM, Schellekens AFA, Homberg JR.
In-Text Gene Mentions

…the 5-HT transporter (5-HTT) 13 .…

…induced by genetic5-HTTinactivation, have been…

…observed after pharmacological5-HTTinhibition by prenatal…

…inactivation of the5-HTT: reflex development 22…

Show Full Abstract

Efavirenz is recommended as a preferred first-line drug for women of childbearing potential living with human immunodeficiency virus. Efavirenz is known for its central nervous system side effects, which are partly mediated by serotonergic actions. The neurotransmitter serotonin exerts neurotrophic effects during neurodevelopment and antenatal exposure to serotonergic agents has been linked to developmental delay. Although the teratogenic risks of efavirenz appear to be minimal, data on long-term developmental effects remain scarce. Here, we aimed to investigate the short- and long-term behavioral and neurodevelopmental effects of perinatal efavirenz exposure. We treated pregnant rats from gestation day 1 until postnatal day 7 with efavirenz (100 mg/kg) or vehicle. We measured behavioral outcomes in male offspring during the first 3 postnatal weeks, adolescence and adulthood, and conducted brain immunohistochemistry analyses after sacrifice. Perinatal efavirenz exposure resulted in reduced body weight and delayed reflex and motor development. During adulthood, we observed a decrease in the total number of cells and mature neurons in the motor cortex, as well as an increase in the number of Caspase-3-positive cells and serotonergic fibers. Together, our data show a developmental delay and persistent changes in the brain motor cortex of rats exposed to efavirenz perinatally. Because over 1 million children born annually are exposed to antiretroviral therapy, our findings underline the need for clinical studies on long-term neurodevelopmental outcomes of perinatal exposure to efavirenz.

Also flagged:organelleneurodegenerative diseasesMitochondriamitochondrialParkinsonAlzheimer's disease
Journal Article 2019-02-11 ✓ 1 Snippet Cowan K, Anichtchik O, Luo S.
In-Text Gene Mentions

When the aggregate involved accumulates in neurons (alpha‐synuclein in PD or Htt in HD), this can disrupt the function of the ETC Studies into HD patients have found reduced activity in complex II and complex III, as well as complex IV.

Show Full Abstract

The mitochondrion is a unique organelle with a diverse range of functions. Mitochondrial dysfunction is a key pathological process in several neurodegenerative diseases. Mitochondria are mostly important for energy production; however, they also have roles in Ca<sup>2+</sup> homeostasis, ROS production, and apoptosis. There are two major systems in place, which regulate mitochondrial integrity, mitochondrial dynamics, and mitophagy. These two processes remove damaged mitochondria from cells and protect the functional mitochondrial population. These quality control systems often become dysfunctional during neurodegenerative diseases, such as Parkinson's and Alzheimer's disease, causing mitochondrial dysfunction and severe neurological symptoms.

Also flagged:reproductiondmrt1cyp19a1aSex determinationdmychromosome
Journal Article 2019-02-11 ✓ 2 Snippets Tian C, Li Z, Dong Z, Huang Y, Du T, Chen H, Jiang D, Deng S, Zhang Y, Wanida S, Shi H, Wu T, Zhu C, Li G.
In-Text Gene Mentions

Sox6, a SOX…

…In this study,Sox6and two SOX…

Show Full Abstract

Silver sillago (<i>Sillago sihama</i>) is an emerging commercial marine aquaculture species in China. To date, fundamental information on <i>S. sihama</i>, such as genomic information, is lacking, and no data are available on the gonad transcriptome of <i>S. sihama</i>. Here, the first gonadal transcriptomes of <i>S. sihama</i> have been constructed and genes potentially involved in gonadal development and reproduction identified. Illumina sequencing generated 60.18 million clean reads for the testis and 59.10 million for the ovary. All reads were assembled into 74,038 unigenes with a mean length of 1,004 bp and N50 value of 2,190 bp. Among all the predictable unigenes, a total of 34,104 unigenes (46%) were searched against multiple databases, including 33,244 unigenes annotated in the RefSeq Non- Redundant database at NCBI, and 28,924 in Swiss-Prot. By comparing the ovary and testis, 35,367 unigenes were identified as being differentially expressed between males and females, of which 29,127 were upregulated in the testis and 6,240 were upregulated in the ovary. Numerous differentially expressed genes (DEGs) known to be involved in gonadal development and gametogenesis were identified, including <i>amh</i>, <i>dmrt1</i>, <i>gsdf</i>, <i>cyp19a1a</i>, <i>gnrhr</i>, and <i>zps</i>. Using gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, the top 20 KEGG pathways with highest number of DEGs were found to be involved in regulating gonadal development and gametogenesis in <i>S. sihama</i>. Moreover, 22,666 simple sequence repeats (SSRs) were identified in 14,577 SSR-containing sequences. The findings provide a valuable dataset for future functional analyses of sex-associated genes and molecular marker assisted selection in <i>S. sihama.</i>

Also flagged:HydroxyapatiteNanocrystalsbiomineralizationkeratinapatitemineralization
Journal Article 2019-02-11 No Snippets Gao C, Zhao K, Lin L, Wang J, Liu Y, Zhu P.
Show Full Abstract

Hydroxyapatite (HA), a typical inorganic component of bone, is a widely utilized biomaterial for bone tissue repair and regeneration due to its excellent properties. Inspired by the recent findings on the important roles of protein in biomineralization and natural structure of fish scales, keratin was chosen as a template for modulating the assembly of HA nanocrystals. A series of HA nanocrystals with different sizes were synthesized by adjusting the concentration of partially hydrolyzed keratin. The structure and compositions of the prepared HA were characterized by Fourier transform infrared (FTIR) spectroscopy, X-ray diffraction (XRD), Raman spectrum, and Transmission electron microscopy (TEM). Results revealed that the size of the synthesized HA nanocrystals can be controlled by adjusting the concentration of partially hydrolyzed keratin. Specifically, the size of synthesized HA decreased from 63 ± 1.5 nm to 27 ± 0.9 nm with the increasing concentration of partially hydrolyzed keratin from 0 to 0.6g. In addition, <i>in vitro</i> cytocompatibility of synthesized HA nanocrystals were evaluated using the MG-63 cells.

Also flagged:PDlipidcollagencalciumstrokeplaques
Journal Article 2019-02-11 No Snippets Torres G, Czernuszewicz TJ, Homeister JW, Caughey MC, Huang BY, Lee ER, Zamora CA, Farber MA, Marston WA, Huang DY, Nichols TC, Gallippi CM.
Show Full Abstract

While in vivo acoustic radiation force impulse (ARFI)-induced peak displacement (PD) has been demonstrated to have high sensitivity and specificity for differentiating soft from stiff plaque components in patients with carotid plaque, the parameter exhibits poorer performance for distinguishing between plaque features with similar stiffness. To improve discrimination of carotid plaque features relative to PD, we hypothesize that signal correlation and signal-to-noise ratio (SNR) can be combined, outright or via displacement variance. Plaque feature detection by displacement variance, evaluated as the decadic logarithm of the variance of acceleration and termed "log(VoA)," was compared to that achieved by exploiting SNR, cross correlation coefficient, and ARFI-induced PD outcome metrics. Parametric images were rendered for 25 patients undergoing carotid endarterectomy, with spatially matched histology confirming plaque composition and structure. On average, across all plaques, log(VoA) was the only outcome metric with values that statistically differed between regions of lipid-rich necrotic core (LRNC), intraplaque hemorrhage (IPH), collagen (COL), and calcium (CAL). Further, log(VoA) achieved the highest contrast-to-noise ratio (CNR) for discriminating between LRNC and IPH, COL and CAL, and grouped soft (LRNC and IPH) and stiff (COL and CAL) plaque components. More specifically, relative to the previously demonstrated ARFI PD parameter, log(VoA) achieved 73% higher CNR between LRNC and IPH and 59% higher CNR between COL and CAL. These results suggest that log(VoA) enhances the differentiation of LRNC, IPH, COL, and CAL in human carotid plaques, in vivo, which is clinically relevant to improving stroke risk prediction and medical management.

Also flagged:breast cancertumorcancermammary adenocarcinomatumorsPrimary tumor
Journal Article 2019-02-11 ✓ 5 Snippets Kurpińska A, Suraj J, Bonar E, Zakrzewska A, Stojak M, Sternak M, Jasztal A, Walczak M.
In-Text Gene Mentions

tumor after the 2nd week following cancer cell inoculation, secretion of prolific tumor-derived factors as well as the presence of the increasing number of circulating cancer cells and extravasation processes further impose reorganization of the lung tissue [Actb, vimentin (Vim), clathrin light chain A (Clta)], altering additional metabolic pathways [annexin A5 (Anxa5), Rho GDP-dissociation inhibitor 2 (Arhgdib), complement 1 Q subcomponent-binding protein, mitochondrial (C1qbp), 14-3-3 protein zeta/delta (Ywhaz), peroxiredoxin-6 (Prdx6), chitinase-like protein 4 (Chi3l4), reticulocalbin-1 (Rcn1), EF-hand domain-containing protein D2 (Efhd2), calumenin

tumor after the 2nd week following cancer cell inoculation, secretion of prolific tumor-derived factors as well as the presence of the increasing number of circulating cancer cells and extravasation processes further impose reorganization of the lung tissue [Actb, vimentin (Vim), clathrin light chain A (Clta)], altering additional metabolic pathways [annexin A5 (Anxa5), Rho GDP-dissociation inhibitor 2 (Arhgdib), complement 1 Q subcomponent-binding protein, mitochondrial (C1qbp), 14-3-3 protein zeta/delta (Ywhaz), peroxiredoxin-6 (Prdx6), chitinase-like protein 4 (Chi3l4

cancer cell inoculation, secretion of prolific tumor-derived factors as well as the presence of the increasing number of circulating cancer cells and extravasation processes further impose reorganization of the lung tissue [Actb, vimentin (Vim), clathrin light chain A (Clta)], altering additional metabolic pathways [annexin A5 (Anxa5), Rho GDP-dissociation inhibitor 2 (Arhgdib), complement 1 Q subcomponent-binding protein, mitochondrial (C1qbp), 14-3-3 protein zeta/delta (Ywhaz), peroxiredoxin-6 (Prdx6), chitinase-like protein 4 (Chi3l4), reticulocalbin-1 (Rcn1), EF-hand domain-containing protein D2 (Efhd2

tumor after the 2nd week following cancer cell inoculation, secretion of prolific tumor-derived factors as well as the presence of the increasing number of circulating cancer cells and extravasation processes further impose reorganization of the lung tissue [Actb, vimentin (Vim), clathrin light chain A (Clta)], altering additional metabolic pathways [annexin A5 (Anxa5), Rho GDP-dissociation inhibitor 2 (Arhgdib), complement 1 Q subcomponent-binding protein, mitochondrial (C1qbp), 14-3-3 protein zeta/delta (Ywhaz), peroxiredoxin-6 (Prdx6), chitinase-like protein 4 (Chi3l4), reticulocalbin-1 (Rcn1), EF-hand domain-containing protein D2 (Efhd2), calumenin (Calu

cancer cell inoculation, secretion of prolific tumor-derived factors as well as the presence of the increasing number of circulating cancer cells and extravasation processes further impose reorganization of the lung tissue [Actb, vimentin (Vim), clathrin light chain A (Clta)], altering additional metabolic pathways [annexin A5 (Anxa5), Rho GDP-dissociation inhibitor 2 (Arhgdib), complement 1 Q subcomponent-binding protein, mitochondrial (C1qbp), 14-3-3 protein zeta/delta (Ywhaz), peroxiredoxin-6 (Prdx6), chitinase-like protein 4 (Chi3l4), reticulocalbin-1 (Rcn1), EF-hand domain-containing protein D2

Show Full Abstract

<h4>Introduction</h4>The tumor-promoting rearrangement of the lungs facilitates the process of cancer cell survival in a foreign microenvironment and enables their protection against immune defense. The study aimed to define the fingerprint of the early rearrangement of the lungs via the proteomic profiling of the lung tissue in the experimental model of tumor metastasis in a murine 4T1 mammary adenocarcinoma.<h4>Materials and methods</h4>The studies were performed on 7-8-week-old BALB/c female mice. Viable 4T1 cancer cells were orthotopically inoculated into the right mammary fat pad. The experiment was performed in the early phase of the tumor metastasis one and two weeks after cancer cell inoculation. The comparative analysis of protein profiles was carried out with the aid of the two-dimensional difference in gel electrophoresis (2D-DIGE). Proteins, of which expression differed significantly, were identified using nano-liquid chromatography coupled to a high-resolution mass spectrometry (nanoLC/hybrid ion trap- Orbitrap XL Discovery).<h4>Results</h4>Palpable primary tumors were noted in the 2<sup>nd</sup> week after cancer cell inoculation. The investigated period preceded the formation of numerous macrometastases in the lungs, however the metastasis-promoting changes were visible very early. Primary tumor-induced inflammation developed in the lungs as early as after the 1<sup>st</sup> week and progressed during the 2<sup>nd</sup> week, accompanied by increased concentration of 2-OH-E<sup>+</sup>, an oxidative stress marker, and imbalance in nitric oxide metabolites, pointing to endothelium dysfunction. The early proteomic changes in the lungs in the 1<sup>st</sup> week after 4T1 cell inoculation resulted in the reorganization of lung tissue structure [actin, cytoplasmic 1 (Actb), tubulin beta chain (Tubb5), lamin-B1 (Lmnb1), serine protease inhibitor A3K (Serpina3k)] and activation of defense mechanisms [selenium-binding protein 1 (Selenbp1), endoplasmin (Hsp90b1), stress 70 protein, mitochondrial (Hspa9), heat shock protein HSP 90-beta (Hsp90ab1)], but also modifications in metabolic pathways [glucose-6-phosphate 1-dehydrogenase X (G6pdx), ATP synthase subunit beta, mitochondrial (Atp5b), L-lactate dehydrogenase B chain (Ldhb)]. Further development of the solid tumor after the 2<sup>nd</sup> week following cancer cell inoculation, secretion of prolific tumor-derived factors as well as the presence of the increasing number of circulating cancer cells and extravasation processes further impose reorganization of the lung tissue [Actb, vimentin (Vim), clathrin light chain A (Clta)], altering additional metabolic pathways [annexin A5 (Anxa5), Rho GDP-dissociation inhibitor 2 (Arhgdib), complement 1 Q subcomponent-binding protein, mitochondrial (C1qbp), 14-3-3 protein zeta/delta (Ywhaz), peroxiredoxin-6 (Prdx6), chitinase-like protein 4 (Chi3l4), reticulocalbin-1 (Rcn1), EF-hand domain-containing protein D2 (Efhd2), calumenin (Calu)]. Interestingly, many of differentially expressed proteins were involved in calcium homeostasis (Rcn1, Efhd2, Calu, Actb, Vim, Lmnb1, Clta, Tubb5, Serpina3k, Hsp90b1, Hsp90ab1, Hspa9. G6pdx, Atp5b, Anxa5, Arhgdib, Ywhaz).<h4>Conclusion</h4>The analysis enabled revealing the importance of calcium signaling during the early phase of metastasis development, early cytoskeleton and extracellular matrix reorganization, activation of defense mechanisms and metabolic adaptations. It seems that the tissue response is an interplay between pro- and anti-metastatic mechanisms accompanied by inflammation, oxidative stress and dysfunction of the barrier endothelial cells.

Also flagged:γ-Secretaseamyloid precursor proteinAPPPSβ-secretase
Journal Article 2019-02-11 No Snippets Xia W.
Show Full Abstract

Twenty years ago, Wolfe, Xia, and Selkoe identified two aspartate residues in Alzheimer's presenilin protein that constitute the active site of the γ-secretase complex. Mutations in the genes encoding amyloid precursor protein (APP) or presenilin (PS) cause early onset familial Alzheimer's disease (AD), and sequential cleavages of the APP by β-secretase and γ-secretase/presenilin generate amyloid β protein (Aβ), the major component of pathological hallmark, neuritic plaques, in brains of AD patients. Therapeutic strategies centered on targeting γ-secretase/presenilin to reduce amyloid were implemented and led to several high profile clinical trials. This review article focuses on the studies of γ-secretase and its inhibitors/modulators since the discovery of presenilin as the γ-secretase. While a lack of complete understanding of presenilin biology renders failure of clinical trials, the lessons learned from some γ-secretase modulators, while premature for human testing, provide new directions to develop potential therapeutics. Imbalanced Aβ homeostasis is an upstream event of neurodegenerative processes. Exploration of γ-secretase modulators for their roles in these processes is highly significant, e.g., decreasing neuroinflammation and levels of phosphorylated tau, the component of the other AD pathological hallmark, neurofibrillary tangles. Agents with excellent human pharmacology hold great promise in suppressing neurodegeneration in pre-symptomatic or early stage AD patients.

Also flagged:cell proliferationMYCAP-1prostate cancerPCacell cycle
Journal Article 2019-02-11 ✓ 1 Snippet Elliott B, Millena AC, Matyunina L, Zhang M, Zou J, Wang G, Zhang Q, Bowen N, Eaton V, Webb G, Thompson S, McDonald J, Khan S.
In-Text Gene Mentions

HTT

Show Full Abstract

JunD, a member of the AP-1 family, is essential for cell proliferation in prostate cancer (PCa) cells. We recently demonstrated that JunD knock-down (KD) in PCa cells results in cell cycle arrest in G<sub>1</sub>-phase concomitant with a decrease in cyclin D1, Ki67, and c-MYC, but an increase in p21 levels. Furthermore, the over-expression of JunD significantly increased proliferation suggesting JunD regulation of genes required for cell cycle progression. Here, employing gene expression profiling, quantitative proteomics, and validation approaches, we demonstrate that JunD KD is associated with distinct gene and protein expression patterns. Comparative integrative analysis by Ingenuity Pathway Analysis (IPA) identified 1) cell cycle control/regulation as the top canonical pathway whose members exhibited a significant decrease in their expression following JunD KD including PRDX3, PEA15, KIF2C, and CDK2, and 2) JunD dependent genes are associated with cell proliferation, with MYC as the critical downstream regulator. Conversely, JunD over-expression induced the expression of the above genes including c-MYC. We conclude that JunD is a crucial regulator of cell cycle progression and inhibiting its target genes may be an effective approach to block prostate carcinogenesis.

Also flagged:IronMetabolismMultiple SclerosisMShydroperoxidesTf
Journal Article 2019-02-11 ✓ 1 Snippet Siotto M, Filippi MM, Simonelli I, Landi D, Ghazaryan A, Vollaro S, Ventriglia M, Pasqualetti P, Rongioletti MCA, Squitti R, Vernieri F.
In-Text Gene Mentions

…secondary hepatic diseases,hemochromatosis, aceruloplasminemia and any…

Show Full Abstract

Oxidative status may play a role in chronic inflammation and neurodegeneration which are considered critical etiopathogenetic factors in Multiple Sclerosis (MS), both in the early phase of the disease and in the progressive one. The aim of this study is to explore oxidative status related to iron metabolism in peripheral blood of stable Relapsing-Remitting MS with low disability. We studied 60 Relapsing-Remitting MS patients (age 37.2 ± 9.06, EDSS median 1.0), and 40 healthy controls (age 40.3 ± 10.86). We measured total hydroperoxides (dROMs test) and Total Antioxidant Status (TAS), along with the iron metabolism biomarkers: Iron (Fe), ferritin (Ferr), transferrin (Tf), transferrin saturation (Tfsat), and ceruloplasmin (Cp) panel biomarkers [concentration (iCp) and enzymatic activity (eCp), copper (Cu), ceruloplasmin specific activity (eCp:iCp), copper to ceruloplasmin ratio (Cu:Cp), non-ceruloplasmin copper (nCp-Cu)]. We computed also the Cp:Tf ratio as an index of oxidative stress related to iron metabolism. We found lower TAS levels in MS patients than in healthy controls (CTRL) and normal reference level and higher dROMs and Cp:Tf ratio in MS than in healthy controls. Cp and Cu were higher in MS while biomarkers of iron metabolism were not different between patients and controls. Both in controls and MS, dROMs correlated with iCp (CTRL <i>r</i> = 0.821, <i>p</i> < 0.001; MS <i>r</i> = 0.775 <i>p</i> < 0.001) and eCp (CTRL <i>r</i> = 0.734, <i>p</i> < 0.001; MS <i>r</i> = 0.820 <i>p</i> < 0.001). Moreover, only in MS group iCp correlated negatively with Tfsat (<i>r</i> = -0.257, <i>p</i> = 0.047). Dividing MS patients in "untreated" group and "treated" group, we found a significant difference in Fe values [<i>F</i>(2, 97) = 10.136, <i>p</i> < 0.001]; in particular "MS untreated" showed higher mean values (mean = 114.5, <i>SD</i> = 39.37 μg/dL) than CTRL (mean 78.6, <i>SD</i> = 27.55 μg/dL <i>p</i> = 0.001) and "MS treated" (mean = 72.4, <i>SD</i> = 38.08 μg/dL; <i>p</i> < 0.001). Moreover, "MS untreated" showed significantly higher values of Cp:Tf (mean = 10.19, <i>SD</i> = 1.77<sup>∗</sup>10<sup>-2</sup>; <i>p</i> = 0.015), than CTRL (mean = 9.03, <i>SD</i> = 1.46 <sup>∗</sup>10<sup>-2</sup>). These results suggest that chronic oxidative stress is relevant also in the remitting phase of the disease in patients with low disability and short disease duration. Therefore, treatment with antioxidants may be beneficial also in the early stage of the disease to preserve neuronal reserve.

Also flagged:HuntingtinfibrilprolinePolyglutaminefibrilsfibril formation
Journal Article 2019-02-11 ✓ 5 Snippets Kotler SA, Tugarinov V, Schmidt T, Ceccon A, Libich DS, Ghirlando R, Schwieters CD, Clore GM.
In-Text Gene Mentions

The structural model, validated by EPR distance measurements, illuminates the role of the htt<sup>NT</sup> domain in the earliest stages of prenucleation and oligomerization, before fibril formation.

The N-terminal region of the huntingtin protein, encoded by exon-1, comprises an amphiphilic domain (htt<sup>NT</sup>), a polyglutamine (Q <sub><i>n</i></sub> ) tract, and a proline-rich sequence.

…an amphiphilic domain (httNT ), a…

…a minimalistic construct,httNT Q 7…

…role of thehttNT domain in…

Show Full Abstract

The N-terminal region of the huntingtin protein, encoded by exon-1, comprises an amphiphilic domain (htt<sup>NT</sup>), a polyglutamine (Q <sub><i>n</i></sub> ) tract, and a proline-rich sequence. Polyglutamine expansion results in an aggregation-prone protein responsible for Huntington's disease. Here, we study the earliest events involved in oligomerization of a minimalistic construct, htt<sup>NT</sup>Q<sub>7</sub>, which remains largely monomeric over a sufficiently long period of time to permit detailed quantitative NMR analysis of the kinetics and structure of sparsely populated [Formula: see text] oligomeric states, yet still eventually forms fibrils. Global fitting of concentration-dependent relaxation dispersion, transverse relaxation in the rotating frame, and exchange-induced chemical shift data reveals a bifurcated assembly mechanism in which the NMR observable monomeric species either self-associates to form a productive dimer (τ<sub>ex</sub> ∼ 30 μs, <i>K</i><sub>diss</sub> ∼ 0.1 M) that goes on to form a tetramer ([Formula: see text] μs; <i>K</i><sub>diss</sub> ∼ 22 μM), or exchanges with a "nonproductive" dimer that does not oligomerize further (τ<sub>ex</sub> ∼ 400 μs; <i>K</i><sub>diss</sub> ∼ 0.3 M). The excited state backbone chemical shifts are indicative of a contiguous helix (residues 3-17) in the productive dimer/tetramer, with only partial helical character in the nonproductive dimer. A structural model of the productive dimer/tetramer was obtained by simulated annealing driven by intermolecular paramagnetic relaxation enhancement data. The tetramer comprises a <i>D</i><sub>2</sub> symmetric dimer of dimers with largely hydrophobic packing between the helical subunits. The structural model, validated by EPR distance measurements, illuminates the role of the htt<sup>NT</sup> domain in the earliest stages of prenucleation and oligomerization, before fibril formation.

Also flagged:Fc receptoraseptic meningitishepatitisneurological diseasemeningitisencephalitis
Journal Article 2019-02-11 ✓ 2 Snippets Morosky S, Wells AI, Lemon K, Evans AS, Schamus S, Bakkenist CJ, Coyne CB.
In-Text Gene Mentions

HFE

hemochromatosis

Show Full Abstract

Echoviruses are amongst the most common causative agents of aseptic meningitis worldwide and are particularly devastating in the neonatal population, where they are associated with severe hepatitis, neurological disease, including meningitis and encephalitis, and even death. Here, we identify the neonatal Fc receptor (FcRn) as a pan-echovirus receptor. We show that loss of expression of FcRn or its binding partner beta 2 microglobulin (β2M) renders cells resistant to infection by a panel of echoviruses at the stage of virus attachment, and that a blocking antibody to β2M inhibits echovirus infection in cell lines and in primary human intestinal epithelial cells. We also show that expression of human, but not mouse, FcRn renders nonpermissive human and mouse cells sensitive to echovirus infection and that the extracellular domain of human FcRn directly binds echovirus particles and neutralizes infection. Lastly, we show that neonatal mice expressing human FcRn are more susceptible to echovirus infection by the enteral route. Our findings thus identify FcRn as a pan-echovirus receptor, which may explain the enhanced susceptibility of neonates to echovirus infections.

Also flagged:Alzheimer diseaseADLRRC2SSBP2neuronal growthneuronal growth regulator precursor
Journal Article 2019-02-11 ✓ 3 Snippets Raghavan NS, Vardarajan B, Mayeux R.
In-Text Gene Mentions

…, SSBP2, andNEGR1; the latter…

…regulator precursor (NEGR1) gene, leucine-rich…

…region of theNEGR1gene is also…

Show Full Abstract

<h4>Objective</h4>To determine the putative protective relationship of educational attainment on Alzheimer disease (AD) risk using Mendelian randomization and to test the hypothesis that by using genetic regions surrounding individually associated single nucleotide polymorphisms (SNPs) as the instrumental variable, we can identify genes that contribute to the relationship.<h4>Methods</h4>We performed Mendelian randomization using genome-wide association study summary statistics from studies of educational attainment and AD in two stages. Our instrumental variable comprised (1) 1,271 SNPs significantly associated with educational attainment and (2) individual 2-Mb regions surrounding the genome-wide significant SNPs.<h4>Results</h4>A causal inverse relationship between educational attainment and AD was identified by the 1,271 SNPs (odds ratio = 0.63; 95% confidence interval, 0.54-0.74; <i>p</i> = 4.08 x 10<sup>-8</sup>). Analysis of individual loci identified 2 regions that significantly replicated the causal relationship. Genes within these regions included <i>LRRC2</i>, <i>SSBP2,</i> and <i>NEGR1</i>; the latter a regulator of neuronal growth.<h4>Conclusions</h4>Educational attainment is an important protective factor for AD. Genomic regions that significantly paralleled the overall causal relationship contain genes expressed in neurons or involved in the regulation of neuronal development.

Also flagged:Postpartumironanaemiaintraventricular haemorrhagedeathpolycythaemia
Journal Article 2019-02-11 No Snippets Basile S, Pinelli S, Micelli E, Caretto M, Benedetti Panici P.
Show Full Abstract

<h4>Introduction</h4>Umbilical cord milking is a procedure in which clamped or unclamped umbilical cord is grasped, and blood is pushed ("stripped") two to four times towards the newborn, in a rapid time frame, usually within 20 seconds. The target of umbilical cord milking is to provide infants with their whole potential blood volume-of which they are deprived when early cord clamping is carried out-completing placental transfusion in a shorter time than delayed cord clamping. The aim of this narrative review is to analyse the literature regarding umbilical cord milking in term and late-preterm infants and to assess all possible benefits and limits of this procedure in clinical practice, especially in comparison to immediate and delayed cord clamping.<h4>Methods</h4>We analysed literature data concerning maternal, as well as neonatal, outcomes for term and late-preterm (gestational age ≥ 34 weeks) newborns who received umbilical cord milking.<h4>Results</h4>Most studies show comparable benefits for both umbilical cord milking and delayed cord clamping, especially in terms of haematological parameters when compared to immediate cord clamping. Umbilical cord milking may be a feasible procedure also for newborns requiring resuscitation.<h4>Conclusions</h4>Literature data concerning positive effects of umbilical cord milking are encouraging and suggest that umbilical cord milking may be a quick and effective method to provide placental transfusions to depressed infants. However, the lack of standardised procedures and the variation in evaluated outcomes as well as the limited number of patients enrolled in trials, along with the retrospective nature of some of them, prevent recommending umbilical cord milking as a routine procedure.

Also flagged:hemorrhagedrug abuseCancerpulmonary diseasealcoholic fatty liverpsychotic
Journal Article 2019-02-10 ✓ 5 Snippets Park H, Wang W, Henry L, Nelson DR.
In-Text Gene Mentions

We also performed a subgroup analysis in which we assessed DCC incidence in patients who received DAA therapy of at least 8 weeks of sofosbuvir/ledipasvir or 12 weeks of the other DAA regimens and found no significant change in the results (HR, 0.38; 95% CI, 0.25‐0.57 in patients with cirrhosis; HR, 0.39; 95% CI, 0.27‐0.56 in patients without cirrhosis) (Supporting Table S4).

…developing HCC andDCC, stratified by cirrhosis…

…[CI], 0.15‐0.52) andDCC(HR, 0.38; 95%…

…a history ofDCCor HCC before…

…of HCC andDCCevents and person‐time…

Show Full Abstract

Approved treatment for hepatitis C virus (HCV) with all-oral direct-acting antivirals (DAA) therapy is now entering into its fourth year; however, little has been reported on the real-world clinical (decompensated cirrhosis [DCC] and hepatocellular carcinoma [HCC]) and economic outcomes. A retrospective cohort analysis of the Truven Health MarketScan Database (2012-2016) was conducted. In a cohort of 26,105 patients with newly diagnosed HCV, 30% received all-oral DAA therapy (DAA group) and 70% were not treated (untreated group). Multivariate Cox proportional hazards models were used to compare the risk of developing HCC and DCC, stratified by cirrhosis status. Among patients with cirrhosis (n = 2157), DAA therapy was associated with a 72% and a 62% lower incidence of HCC (hazard ratio [HR], 0.28; 95% confidence interval [CI], 0.15-0.52) and DCC (HR, 0.38; 95% CI, 0.26-0.56). Similarly, DAA therapy was associated with a 57% and a 58% lower incidence of HCC (HR, 0.43; 95% CI, 0.26-0.71) and DCC (HR, 0.42; 95% CI, 0.30-0.58) in patients with noncirrhotic HCV (n = 23,948). A propensity score-matched cohort of 8064 HCV-infected patients who had at least a 12-month follow-up after HCV treatment was included for economic analysis. For patients with cirrhosis in the DAA group, the mean adjusted liver-related costs ($1749 vs. $4575; P < 0.001) and all-cause medical costs ($19,300 vs. $33,039; P < 0.001) were significantly lower compared with those in the untreated group. The mean adjusted costs were not statistically different between the two groups among patients without cirrhosis. Conclusion: In the short term, all-oral DAA treatment for HCV infection was associated with a decreased risk of developing HCC and DCC, resulting in decreased health care costs, especially in patients with cirrhosis. A longitudinal study is necessary to confirm our findings.

Also flagged:30S ribosomalPeptideMAPmembranesdextranefflux pump
Journal Article 2019-02-10 No Snippets Bocsik A, Gróf I, Kiss L, Ötvös F, Zsíros O, Daruka L, Fülöp L, Vastag M, Kittel Á, Imre N, Martinek TA, Pál C, Szabó-Révész P, Deli MA.
Show Full Abstract

The absorption of drugs is limited by the epithelial barriers of the gastrointestinal tract. One of the strategies to improve drug delivery is the modulation of barrier function by the targeted opening of epithelial tight junctions. In our previous study the 18-mer amphiphilic PN159 peptide was found to be an effective tight junction modulator on intestinal epithelial and blood⁻brain barrier models. PN159, also known as KLAL or MAP, was described to interact with biological membranes as a cell-penetrating peptide. In the present work we demonstrated that the PN159 peptide as a penetration enhancer has a dual action on intestinal epithelial cells. The peptide safely and reversibly enhanced the permeability of Caco-2 monolayers by opening the intercellular junctions. The penetration of dextran molecules with different size and four efflux pump substrate drugs was increased several folds. We identified claudin-4 and -7 junctional proteins by docking studies as potential binding partners and targets of PN159 in the opening of the paracellular pathway. In addition to the tight junction modulator action, the peptide showed cell membrane permeabilizing and antimicrobial effects. This dual action is not general for cell-penetrating peptides (CPPs), since the other three CPPs tested did not show barrier opening effects.

Also flagged:HepcidinBMPSMADironmetabolismiron disorders
Journal Article 2019-02-10 No Snippets Silvestri L, Nai A, Dulja A, Pagani A.
Show Full Abstract

Hepcidin, the main regulator of iron metabolism, is synthesized and released by hepatocytes in response to increased body iron concentration and inflammation. Deregulation of hepcidin expression is a common feature of genetic and acquired iron disorders: in Hereditary Hemochromatosis (HH) and iron-loading anemias low hepcidin causes iron overload, while in Iron Refractory Iron Deficiency Anemia (IRIDA) and anemia of inflammation (AI), high hepcidin levels induce iron-restricted erythropoiesis. Hepcidin expression in the liver is mainly controlled by the BMP-SMAD pathway, activated in a paracrine manner by BMP2 and BMP6 produced by liver sinusoidal endothelial cells. The BMP type I receptors ALK2 and ALK3 are responsible for iron-dependent hepcidin upregulation and basal hepcidin expression, respectively. Characterization of animal models with genetic inactivation of the key components of the pathway has suggested the existence of two BMP/SMAD pathway branches: the first ALK3 and HH proteins dependent, responsive to BMP2 for basal hepcidin activation, and the second ALK2 dependent, activated by BMP6 in response to increased tissue iron. The erythroid inhibitor of hepcidin Erythroferrone also impacts on the liver BMP-SMAD pathway although its effect is blunted by pathway hyper-activation. The liver BMP-SMAD pathway is required also in inflammation to cooperate with JAK2/STAT3 signaling for full hepcidin activation. Pharmacologic targeting of BMP-SMAD pathway components or regulators may improve the outcome of both genetic and acquired disorders of iron overload and deficiency by increasing or inhibiting hepcidin expression.

Also flagged:heat illnessesasexertional heat strokeheat strokeheat illnessheat intolerance
Journal Article 2019-02-09 No Snippets Mitchell KM, Cheuvront SN, King MA, Mayer TA, Leon LR, Kenefick RW.
Show Full Abstract

Exercise or work in hot environments increases susceptibility to exertional heat illnesses such as exertional heat stroke (EHS). EHS occurs when body heat gain exceeds body heat dissipation, resulting in rapid body heat storage and potentially life-threatening consequences. EHS poses a dangerous threat for athletes, agriculture workers, and military personnel, as they are often exposed to hot environmental conditions that restrict body heat loss or contribute to body heat gain. Currently, there is limited guidance on return to activity (RTA) after an episode of EHS. While examining biomarkers in the blood is thought to be beneficial for determining RTA, they are not sensitive or specific enough to be a final determining factor as organ damage may persist despite blood biomarkers returning to baseline levels. As such, additional assessment tests to more accurately determine RTA are desired. One method used for determining RTA is the heat tolerance test (HTT, 120 minutes treadmill walking; 40°C, 40% relative humidity). Unfortunately, the HTT provides even less information about EHS recovery since it offers no test sensitivity or specificity even after years of implementation. We provide an overview of the HTT and the controversy of this test with respect to assessment criteria, applicability to tasks involving high metabolic workloads, and the lack of follow-up analyses to determine its accuracy for determining recovery in order to diminish the likelihood of a second EHS occurrence.

Also flagged:esophagus squamous cell carcinomaesophageal squamous cell carcinomaDNA polymerase ζtumoroxygenESCC
Journal Article 2019-02-08 ✓ 1 Snippet Gu C, Luo J, Lu X, Tang Y, Ma Y, Yun Y, Cao J, Cao J, Huang Z, Zhou X, Zhang S.
In-Text Gene Mentions

…expression of REV3,PRDX613 , 14…

Show Full Abstract

Radiotherapy has been widely used for the clinical management of esophageal squamous cell carcinoma. However, radioresistance remains a serious concern that prevents the efficacy of esophageal squamous cell carcinoma (ESCC) radiotherapy. REV7, the structural subunit of eukaryotic DNA polymerase ζ, has multiple functions in bypassing DNA damage and modulating mitotic arrest in human cell lines. However, the expression and molecular function of REV7 in ESCC progression remains unclear. In this study, we first examined the expression of REV7 in clinical ESCC samples, and we found higher expression of REV7 in ESCC tissues compared to matched adjacent or normal tissues. Knockdown of REV7 resulted in decreased colony formation and increased apoptosis in irradiated Eca-109 and TE-1 cells coupled with decreased tumor weight in a xenograft nude mouse model postirradiation. Conversely, overexpression of REV7 resulted in radioresistance in vitro and in vivo. Moreover, silencing of REV7 induced increased reactive oxygen species levels postirradiation. Proteomic analysis of REV7-interacting proteins revealed that REV7 interacted with peroxiredoxin 2 (PRDX2), a well-known antioxidant protein. Existence of REV7-PRDX2 complex and its augmentation postirradiation were further validated by immunoprecipitation and immunofluorescence assays. REV7 knockdown significantly disrupted the presence of nuclear PRDX2 postirradiation, which resulted in oxidative stress. REV7-PRDX2 complex also assembled onto DNA double-strand breaks, whereas REV7 knockdown evidently increased double-strand breaks that were unmerged by PRDX2. Taken together, the present study sheds light on REV7-modulated radiosensitivity through interacting with PRDX2, which provides a novel target for ESCC radiotherapy.

Also flagged:cobalt ferriteoleylaminedimercaptosuccinic acidbile acidoxygengadolinium
Journal Article 2019-02-08 No Snippets Piché D, Tavernaro I, Fleddermann J, Lozano JG, Varambhia A, Maguire ML, Koch M, Ukai T, Hernández Rodríguez AJ, Jones L, Dillon F, Reyes Molina I, Mitzutani M, González Dalmau ER, Maekawa T, Nellist PD, Kraegeloh A, Grobert N.
Show Full Abstract

Extraordinarily small (2.4 nm) cobalt ferrite nanoparticles (ESCIoNs) were synthesized by a one-pot thermal decomposition approach to study their potential as magnetic resonance imaging (MRI) contrast agents. Fine size control was achieved using oleylamine alone, and annular dark-field scanning transmission electron microscopy revealed highly crystalline cubic spinel particles with atomic resolution. Ligand exchange with dimercaptosuccinic acid rendered the particles stable in physiological conditions with a hydrodynamic diameter of 12 nm. The particles displayed superparamagnetic properties and a low r<sub>2</sub>/ r<sub>1</sub> ratio suitable for a T<sub>1</sub> contrast agent. The particles were functionalized with bile acid, which improved biocompatibility by significant reduction of reactive oxygen species generation and is a first step toward liver-targeted T<sub>1</sub> MRI. Our study demonstrates the potential of ESCIoNs as T<sub>1</sub> MRI contrast agents.

Also flagged:Cas9Fuchs endothelial corneal dystrophypolymeraseTCF4nucleotideautosomal dominant disorders
Journal Article 2019-02-08 No Snippets Hafford-Tear NJ, Tsai YC, Sadan AN, Sanchez-Pintado B, Zarouchlioti C, Maher GJ, Liskova P, Tuft SJ, Hardcastle AJ, Clark TA, Davidson AE.
Show Full Abstract

<h4>Purpose</h4>To demonstrate the utility of an amplification-free long-read sequencing method to characterize the Fuchs endothelial corneal dystrophy (FECD)-associated intronic TCF4 triplet repeat (CTG18.1).<h4>Methods</h4>We applied an amplification-free method, utilizing the CRISPR/Cas9 system, in combination with PacBio single-molecule real-time (SMRT) long-read sequencing, to study CTG18.1. FECD patient samples displaying a diverse range of CTG18.1 allele lengths and zygosity status (n = 11) were analyzed. A robust data analysis pipeline was developed to effectively filter, align, and interrogate CTG18.1-specific reads. All results were compared with conventional polymerase chain reaction (PCR)-based fragment analysis.<h4>Results</h4>CRISPR-guided SMRT sequencing of CTG18.1 provided accurate genotyping information for all samples and phasing was possible for 18/22 alleles sequenced. Repeat length instability was observed for all expanded (≥50 repeats) phased CTG18.1 alleles analyzed. Furthermore, higher levels of repeat instability were associated with increased CTG18.1 allele length (mode length ≥91 repeats) indicating that expanded alleles behave dynamically.<h4>Conclusion</h4>CRISPR-guided SMRT sequencing of CTG18.1 has revealed novel insights into CTG18.1 length instability. Furthermore, this study provides a framework to improve the molecular diagnostic accuracy for CTG18.1-mediated FECD, which we anticipate will become increasingly important as gene-directed therapies are developed for this common age-related and sight threatening disease.

Also flagged:extracellularvesiclesgastric cancertumormitochondrialcancer
Journal Article 2019-02-08 No Snippets Kahroba H, Hejazi MS, Samadi N.
Show Full Abstract

Exosomes represent an important group of extracellular vesicles with a defined size between 40 and 150 nm and cup-shaped construction which have a pivotal role in elimination of intracellular debris and intercellular signaling networks. A line of evidence revealed the impact of different types of exosomes in initiation, progression, and metastasis of gastric cancer (GC). These bioactive vesicles mediate tumor and stromal communication network through modulation of cell signaling for carcinogenesis and pre-metastatic niche formation in distant organs. Exosomes contain various cargos including DNAs (mitochondrial and genomic), proteins, transposable elements, and RNAs (coding and noncoding) with different compositions related to functional status of origin cells. In this review, we summarize the main roles of key exosomal cargos in induction of exosome-mediated signaling in cancer cells. Body fluids are employed frequently as the source of exosomes released by tumor cells with a potential role in early diagnosis of GC and chemoresistance. These vesicles as non-toxic and non-immunogenic carriers are also found to be applied for novel drug delivery systems.

Also flagged:amyloid precursor proteinADamyloid beta peptidecancertranscriptional factorprotease
Journal Article 2019-02-08 No Snippets Yao J, Hurle MR, Nelson MR, Agarwal P.
Show Full Abstract

<h4>Background</h4>Determining which target to pursue is a challenging and error-prone first step in developing a therapeutic treatment for a disease, where missteps are potentially very costly given the long-time frames and high expenses of drug development. With current informatics technology and machine learning algorithms, it is now possible to computationally discover therapeutic hypotheses by predicting clinically promising drug targets based on the evidence associating drug targets with disease indications. We have collected this evidence from Open Targets and additional databases that covers 17 sources of evidence for target-indication association and represented the data as a tensor of 21,437 × 2211 × 17.<h4>Results</h4>As a proof-of-concept, we identified examples of successes and failures of target-indication pairs in clinical trials across 875 targets and 574 disease indications to build a gold-standard data set of 6140 known clinical outcomes. We designed and executed three benchmarking strategies to examine the performance of multiple machine learning models: Logistic Regression, LASSO, Random Forest, Tensor Factorization and Gradient Boosting Machine. With 10-fold cross-validation, tensor factorization achieved AUROC = 0.82 ± 0.02 and AUPRC = 0.71 ± 0.03. Across multiple validation schemes, this was comparable or better than other methods.<h4>Conclusion</h4>In this work, we benchmarked a machine learning technique called tensor factorization for the problem of predicting clinical outcomes of therapeutic hypotheses. Results have shown that this method can achieve equal or better prediction performance compared with a variety of baseline models. We demonstrate one application of the method to predict outcomes of trials on novel indications of approved drug targets. This work can be expanded to targets and indications that have never been clinically tested and proposing novel target-indication hypotheses. Our proposed biologically-motivated cross-validation schemes provide insight into the robustness of the prediction performance. This has significant implications for all future methods that try to address this seminal problem in drug discovery.

Also flagged:dopamineopiatemorphinenucleusaddictiondrug dependence
Journal Article 2019-02-08 ✓ 5 Snippets Simmons SC, Wheeler K, Mazei-Robison MS.
In-Text Gene Mentions

Together, while these data suggest that the proportions of Sncg, Otx2, and Sox6 expression can distinguish NAc-projecting VTA DA neurons from striatum-projecting SNc DA neurons, these markers do not help to molecularly define the subsets of VTA DA neurons that are differentially affected by morphine exposure.

…region Y-box 6 (Sox6, Abcam, Cat# 30455,…

…Sncg, Otx2, orSox6colocalization within the…

…Sncg, Otx2, andSox6were obtained by…

…regulators (Otx2 andSox6) which may differentiate…

Show Full Abstract

Chronic opiate exposure induces neuroadaptations in the mesocorticolimbic system including ventral tegmental area (VTA) dopamine (DA) neurons, whose soma size is decreased following opiate exposure. Yet it is now well documented that VTA DA neurons are heterogeneous, with notable differences between VTA DA neurons based on their projection target. Therefore, we sought to determine whether chronic morphine induced similar changes in the morphology of VTA DA neurons that project to the nucleus accumbens (NAc) and prefrontal cortex (PFC). We utilized Cre-dependent retrograde viral vectors in DA Cre driver lines to label VTA DA neurons that projected to NAc and PFC and assessed neuronal soma size. Consistent with previous data, the soma size of VTA DA neurons that projected to the NAc medial shell was decreased following morphine exposure. However, soma size of VTA DA neurons that projected to the NAc core was unaltered by morphine. Interestingly, morphology of PFC-projecting VTA DA neurons was also altered by morphine, but in this case soma size was increased compared to sham controls. Differences in basal soma size were also noted, suggesting stable differences in projection-specific morphology in addition to drug-induced changes. Together, these data suggest morphine-induced changes in VTA DA morphology occur within distinct VTA DA populations and that study of opiate-induced structural plasticity of individual VTA DA subcircuits may be critical for understanding addiction-related behavior.

Also flagged:mitochondrialcytoplasmicleukodystrophyaminoacylationleucyl tRNA synthasedeafness
Journal Article 2019-02-08 ✓ 1 Snippet van der Knaap MS, Bugiani M, Mendes MI, Riley LG, Smith DEC, Rudinger-Thirion J, Frugier M, Breur M, Crawford J, van Gaalen J, Schouten M, Willems M, Waisfisz Q, Mau-Them FT, Rodenburg RJ, Taft RJ, Keren B, Christodoulou J, Depienne C, Simons C, Salomons GS, Mochel F.
In-Text Gene Mentions

DARS2

Show Full Abstract

<h4>Objective</h4>To describe the leukodystrophy caused by pathogenic variants in <i>LARS2</i> and <i>KARS</i>, encoding mitochondrial leucyl transfer RNA (tRNA) synthase and mitochondrial and cytoplasmic lysyl tRNA synthase, respectively.<h4>Methods</h4>We composed a group of 5 patients with leukodystrophy, in whom whole-genome or whole-exome sequencing revealed pathogenic variants in <i>LARS2</i> or <i>KARS</i>. Clinical information, brain MRIs, and postmortem brain autopsy data were collected. We assessed aminoacylation activities of purified mutant recombinant mitochondrial leucyl tRNA synthase and performed aminoacylation assays on patients' lymphoblasts and fibroblasts.<h4>Results</h4>Patients had a combination of early-onset deafness and later-onset neurologic deterioration caused by progressive brain white matter abnormalities on MRI. Female patients with <i>LARS2</i> pathogenic variants had premature ovarian failure. In 2 patients, MRI showed additional signs of early-onset vascular abnormalities. In 2 other patients with <i>LARS2</i> and <i>KARS</i> pathogenic variants, magnetic resonance spectroscopy revealed elevated white matter lactate, suggesting mitochondrial disease. Pathology in one patient with <i>LARS2</i> pathogenic variants displayed evidence of primary disease of oligodendrocytes and astrocytes with lack of myelin and deficient astrogliosis. Aminoacylation activities of purified recombinant mutant leucyl tRNA synthase showed a 3-fold loss of catalytic efficiency. Aminoacylation assays on patients' lymphoblasts and fibroblasts showed about 50% reduction of enzyme activity.<h4>Conclusion</h4>This study adds <i>LARS2</i> and <i>KARS</i> pathogenic variants as gene defects that may underlie deafness, ovarian failure, and leukodystrophy with mitochondrial signature. We discuss the specific MRI characteristics shared by leukodystrophies caused by mitochondrial tRNA synthase defects. We propose to add aminoacylation assays as biochemical diagnostic tools for leukodystrophies.

Also flagged:MicrotubuleMicrotubule affinity regulating kinase 4MARK4cancercancersacridone
Journal Article 2019-02-08 No Snippets Voura M, Khan P, Thysiadis S, Katsamakas S, Queen A, Hasan GM, Ali S, Sarli V, Hassan MI.
Show Full Abstract

Microtubule affinity regulating kinase 4 (MARK4) becomes a unique anti-cancer drug target as its overexpression is responsible for different types of cancers. In quest of novel, effective MARK4 inhibitors, some acridone derivatives were synthesized, characterized and evaluated for inhibitory activity against human MARK4. Among all the synthesized compounds, three (7b, 7d and 7f) were found to have better binding affinity and enzyme inhibition activity in µM range as shown by fluorescence binding, ITC and kinase assays. Here we used functional assays of selected potential lead molecules with commercially available panel of 26 kinases of same family. A distinctive kinase selectivity profile was observed for each compound. The selective compounds were identified with submicromolar cellular activity against MARK4. Furthermore, in vitro antitumor evaluation against cancerous cells (MCF-7 and HepG2) revealed that compounds 7b, 7d and 7f inhibit cell proliferation and predominantly induce apoptosis in MCF-7 cells, with IC<sub>50</sub> values of 5.2 ± 1.2 μM, 6.3 ± 1.2 μM, and 5.8 ± 1.4 μM respectively. In addition, these compounds significantly upsurge the oxidative stress in cancerous cells. Our observations support our approach for the synthesis of effective inhibitors against MARK4 that can be taken forward for the development of novel anticancer molecules targeting MARK4.

Also flagged:ACSL4ferroptosisdeathironlipidoxygen
Journal Article 2019-02-08 ✓ 1 Snippet Li Y, Feng D, Wang Z, Zhao Y, Sun R, Tian D, Liu D, Zhang F, Ning S, Yao J, Tian X.
In-Text Gene Mentions

…proteins such asPEBP1[ 63 ],…

Show Full Abstract

Ferroptosis is a recently identified form of regulated cell death defined by the iron-dependent accumulation of lipid reactive oxygen species. Ferroptosis has been studied in various diseases such as cancer, Parkinson's disease, and stroke. However, the exact function and mechanism of ferroptosis in ischemia/reperfusion (I/R) injury, especially in the intestine, remains unknown. Considering the unique conditions required for ferroptosis, we hypothesize that ischemia promotes ferroptosis immediately after intestinal reperfusion. In contrast to conventional strategies employed in I/R studies, we focused on the ischemic phase. Here we verified ferroptosis by assessing proferroptotic changes after ischemia along with protein and lipid peroxidation levels during reperfusion. The inhibition of ferroptosis by liproxstatin-1 ameliorated I/R-induced intestinal injury. Acyl-CoA synthetase long-chain family member 4 (ACSL4), which is a key enzyme that regulates lipid composition, has been shown to contribute to the execution of ferroptosis, but its role in I/R needs clarification. In the present study, we used rosiglitazone (ROSI) and siRNA to inhibit ischemia/hypoxia-induced ACSL4 in vivo and in vitro. The results demonstrated that ACSL4 inhibition before reperfusion protected against ferroptosis and cell death. Further investigation revealed that special protein 1 (Sp1) was a crucial transcription factor that increased ACSL4 transcription by binding to the ACSL4 promoter region. Collectively, this study demonstrates that ferroptosis is closely associated with intestinal I/R injury, and that ACSL4 has a critical role in this lethal process. Sp1 is an important factor in promoting ACSL4 expression. These results suggest a unique and effective mechanistic approach for intestinal I/R injury prevention and treatment.

Also flagged:nucleosidesnucleobase4-cyanoindoleguanineoligonucleotidesbinding
Journal Article 2019-02-08 No Snippets Ahmed IA, Acharyya A, Eng CM, Rodgers JM, DeGrado WF, Jo H, Gai F.
Show Full Abstract

Unnatural nucleosides possessing unique spectroscopic properties that mimic natural nucleobases in both size and chemical structure are ideally suited for spectroscopic measurements of DNA/RNA structure and dynamics in a site-specific manner. However, such unnatural nucleosides are scarce, which prompts us to explore the utility of a recently found unnatural nucleoside, 4-cyanoindole-2'-deoxyribonucleoside (4CNI-NS), as a site-specific spectroscopic probe of DNA. A recent study revealed that 4CNI-NS is a universal nucleobase that maintains the high fluorescence quantum yield of 4-cyanoindole and that among the four natural nucleobases, only guanine can significantly quench its fluorescence. Herein, we further show that the C≡N stretching frequency of 4CNI-NS is sensitive to the local environment, making it a useful site-specific infrared probe of oligonucleotides. In addition, we demonstrate that the fluorescence-quencher pair formed by 4CNI-NS and guanine can be used to quantitatively assess the binding affinity of a single-stranded DNA to the protein system of interest via fluorescence spectroscopy, among other applications. We believe that this fluorescence binding assay is especially useful as its potentiality allows high-throughput screening of DNA⁻protein interactions.

Also flagged:Autophagyorganellesmembranevesiclesautophagosomeslysosomes
Journal Article 2019-02-08 ✓ 1 Snippet Condello M, Pellegrini E, Caraglia M, Meschini S.
In-Text Gene Mentions

Huntington’s disease is a neurodegenerative disease caused by GAG trinucleotide repeat in the gene encoding the huntingtin protein (HTT).

Show Full Abstract

Autophagy is an evolutionarily conserved cellular process, through which damaged organelles and superfluous proteins are degraded, for maintaining the correct cellular balance during stress insult. It involves formation of double-membrane vesicles, named autophagosomes, that capture cytosolic cargo and deliver it to lysosomes, where the breakdown products are recycled back to cytoplasm. On the basis of degraded cell components, some selective types of autophagy can be identified (mitophagy, ribophagy, reticulophagy, lysophagy, pexophagy, lipophagy, and glycophagy). Dysregulation of autophagy can induce various disease manifestations, such as inflammation, aging, metabolic diseases, neurodegenerative disorders and cancer. The understanding of the molecular mechanism that regulates the different phases of the autophagic process and the role in the development of diseases are only in an early stage. There are still questions that must be answered concerning the functions of the autophagy-related proteins. In this review, we describe the principal cellular and molecular autophagic functions, selective types of autophagy and the main in vitro methods to detect the role of autophagy in the cellular physiology. We also summarize the importance of the autophagic behavior in some diseases to provide a novel insight for target therapies.

Also flagged:double-stranded RNA-binding proteinRNA virus infectioninfectionbindingCas9ribosome
Journal Article 2019-02-08 ✓ 5 Snippets Chen YM, Ou BT, Chen CY, Chan HH, Chen CJ, Wang RY.
In-Text Gene Mentions

In mammalian cells, two homologues of Staufen, namely Stau1 and Stau2, have been identified as exhibiting a 51% homology with amino acid residues [21].

Through analyzing Stau1-knockout cells and viral RNA-Stau1 colocalization studies, we provide evidence that Stau1 is involved in the translation of viral RNA during the EV-A71 infection cycle.

EV-A71 infection was then challenged in the Stau1 knockout and normal RD cells.

The normal and Stau1-knockout RD cells were infected with EV-A71 at a multiplicity of infection (MOI) of 1.

The lower level of 5′-UTR of viral RNA was measured at 2 h after EV-A71 5′-UTR RNA transfection infection in the Stau1-knockout cells compared with the normal cells (Figure 7A).

Show Full Abstract

The double-stranded RNA-binding protein Staufen1 (Stau1) has multiple functions during RNA virus infection. In this study, we investigated the role of Stau1 in viral translation by using a combination of enterovirus 71 (EV-A71) infection, RNA reporter transfection, and in vitro functional and biochemical assays. We demonstrated that Stau1 specifically binds to the 5'-untranslated region of EV-A71 viral RNA. The RNA-binding domain 2-3 of Stau1 is responsible for this binding ability. Subsequently, we created a Stau1 knockout cell line using the CRISPR/Cas9 approach to further characterize the functional role of Stau1's interaction with viral RNA in the EV-A71-infected cells. Both the viral RNA accumulation and viral protein expression were downregulated in the Stau1 knockout cells compared with the wild-type naïve cells. Moreover, dysregulation of viral RNA translation was observed in the Stau1 knockout cells using ribosome fractionation assay, and a reduced RNA stability of 5'-UTR of the EV-A71 was also identified using an RNA stability assay, which indicated that Stau1 has a role in facilitating viral translation during EV-A71 infection. In conclusion, we determined the functional relevance of Stau1 in the EV-A71 infection cycle and herein describe the mechanism of Stau1 participation in viral RNA translation through its interaction with viral RNA. Our results suggest that Stau1 is an important host factor involved in viral translation and influential early in the EV-A71 replication cycle.

Also flagged:psychiatric disorderschromosomesdepressiondeliberate self-harmsubstance abuse-related disordersmood disorders
Journal Article 2019-02-08 ✓ 5 Snippets Strawbridge RJ, Ward J, Ferguson A, Graham N, Shaw RJ, Cullen B, Pearsall R, Lyall LM, Johnston KJA, Niedzwiedz CL, Pell JP, Mackay D, Martin JL, Lyall DM, Bailey MES, Smith DJ.
In-Text Gene Mentions

The netrin 1 receptor (encoded by DCC) has been robustly associated with depression [40], schizophrenia [41] and related traits [42].

This study highlights a component of suicidal predisposition that is distinct from MDD predisposition and the potential relevance of CNTN5, CEP57 and DCC to suicidality, further study of which may provide valuable insight into the underlying biology of suicide.

…and FAM76B andDCCfor suicidality (primary…

…and SENP3 andDCCfor DSH (…

…chromosome 18 (DCC).…

Show Full Abstract

<h4>Background</h4>Suicide is a major issue for global public health. Suicidality describes a broad spectrum of thoughts and behaviours, some of which are common in the general population. Although suicide results from a complex interaction of multiple social and psychological factors, predisposition to suicidality is at least partly genetic.<h4>Methods</h4>Ordinal genome-wide association study of suicidality in the UK Biobank cohort comparing: 'no suicidality' controls (N = 83,557); 'thoughts that life was not worth living' (N = 21,063); 'ever contemplated self-harm' (N = 13,038); 'act of deliberate self-harm in the past' (N = 2498); and 'previous suicide attempt' (N = 2666).<h4>Outcomes</h4>We identified three novel genome-wide significant loci for suicidality (on chromosomes nine, 11 and 13) and moderate-to-strong genetic correlations between suicidality and a range of psychiatric disorders, most notably depression (r<sub>g</sub> 0·81).<h4>Interpretation</h4>These findings provide new information about genetic variants relating to increased risk of suicidal thoughts and behaviours. Future work should assess the extent to which polygenic risk scores for suicidality, in combination with non-genetic risk factors, may be useful for stratified approaches to suicide prevention at a population level. FUND: UKRI Innovation-HDR-UK Fellowship (MR/S003061/1). MRC Mental Health Data Pathfinder Award (MC_PC_17217). MRC Doctoral Training Programme Studentship at the University of Glasgow (MR/K501335/1). MRC Doctoral Training Programme Studentship at the Universities of Glasgow and Edinburgh. UKRI Innovation Fellowship (MR/R024774/1).

Also flagged:Ferritinironiron deficiencyliver disordersanemiabinding
Journal Article 2019-02-08 ✓ 1 Snippet Bahr TM, Christensen RD, Ward DM, Meng F, Jackson LK, Doyle K, Christensen DR, Harvey AG, Yaish HM.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Serum ferritin reflects total body iron stores, thus a low serum ferritin is used as a parameter of iron deficiency. In healthy adults in Japan, urine ferritin levels were about 5% of serum ferritin levels, with a correlation coefficient of 0.79. It is not known whether a low urine ferritin could serve as a non-invasive screen for iron deficiency. If so, this might be useful for neonates and young children, avoiding phlebotomy to screen for iron deficiency. However, for urinary ferritin screening to be feasible, ferritin must be measurable in the urine and correlate with serum ferritin. Testing should also clarify whether the iron content of ferritin in serum and urine are similar. In this pilot feasibility study we measured ferritin in paired serum and urine samples of healthy adult males, healthy term neonates, growing preterm neonates, and children who had very high serum ferritin levels from liver disorders or iron overload. We detected ferritin in every urine sample, and found a correlation with paired serum ferritin (Spearman correlation coefficient 0.78 of log<sub>10</sub>-transformed values). These findings suggest merit in further studying urinary ferritin in select populations, as a potential non-invasive screen to assess iron stores.

Also flagged:cancerP2RX7vWFTFACell migrationcathelicidin
Journal Article 2019-02-08 ✓ 1 Snippet Hou L, Sun F, Huang R, Sun W, Zhang D, Wang Q.
In-Text Gene Mentions

…Cambridge, MA,USA) andactivators of transcription 1of transcription 1…

Show Full Abstract

The activation of NADPH oxidase contributes to dopaminergic neurodegeneration and motor deficits in Parkinson's disease (PD). However, whether NADPH oxidase is involved in non-motor symptoms, especially cognitive dysfunction in PD remains unknown. This study is undertaken to characterize the effects of inhibition of NADPH oxidase by a widely used NADPH oxidase inhibitor apocynin on learning and memory deficits in paraquat and maneb-induced mouse PD model. Results showed that mice injected with paraquat and maneb displayed impairments of spatial learning and memory, which was associated with reduced tyrosine hydroxylase expression as well as increased neurodegeneration, synaptic loss, α-synuclein expression and Ser129-phosphorylation in the hippocampus. Interestingly, apocynin treatment significantly ameliorated learning and memory deficits as well as hippocampal neurodegeneration and α-synuclein pathology in mice treated with these two pesticides. Mechanistically, we found that apocynin mitigated paraquat and maneb-induced NADPH oxidase activation and related oxidative stress. Furthermore, reduced microglial activation and M1 polarization were observed in apocynin and paraquat and maneb co-treated mice compared with paraquat and maneb alone group. Finally, apocynin inhibited the activation of signal transducers and activators of transcription 1 (STAT1) and nuclear factor kappa B (NF-κB) pathways, two key regulatory factors for microglial M1 inflammatory responses, in paraquat and maneb-treated mice. Altogether, our findings implied that NADPH oxidase mediates learning and memory deficits in PD, and inhibition of NADPH oxidase by apocynin blocks impairments of learning and memory via the suppression of oxidative stress and neuroinflammation.

Also flagged:Hepcidinironmetabolismbindingiron export proteindegradation
Journal Article 2019-02-08 No Snippets Ginzburg YZ.
Show Full Abstract

Hepcidin is central to regulation of iron metabolism. Its effect on a cellular level involves binding ferroportin, the main iron export protein, resulting in its internalization and degradation and leading to iron sequestration within ferroportin-expressing cells. Aberrantly increased hepcidin leads to systemic iron deficiency and/or iron restricted erythropoiesis. Furthermore, insufficiently elevated hepcidin occurs in multiple diseases associated with iron overload. Abnormal iron metabolism as a consequence of hepcidin dysregulation is an underlying factor resulting in pathophysiology of multiple diseases and several agents aimed at manipulating this pathway have been designed, with some already in clinical trials. In this chapter, we present an overview of and rationale for exploring the development of hepcidin agonists and antagonists in various clinical scenarios.

Also flagged:Hereditary hemochromatosisHHgenetic diseaseirongenetic disordersdeath
Journal Article 2019-02-08 ✓ 5 Snippets Katsarou MS, Papasavva M, Latsi R, Drakoulis N.
In-Text Gene Mentions

Hereditary hemochromatosis and HFE

Hemochromatosis: Hereditary hemochromatosis and HFE

Hemochromatosis: Hereditary hemochromatosis a…

…Hereditary hemochromatosis andHFEgene.…

…polymorphisms of theHFEgene (rs1800562, rs1799945…

Show Full Abstract

Hereditary Hemochromatosis (HH) is an autosomal recessive genetic disease, characterized by an excessively increased absorption of dietary iron. Excess iron can be accumulated because of the lack of an effective excretory mechanism leading to toxic effects. HH is one of the most common genetic disorders in individuals of European descent. Genetic polymorphisms of the HFE gene (rs1800562, rs1799945 and rs1800730) also affect the normal activity of another protein, hepcidin, a negative regulator of iron homeostasis. If left untreated, hereditary hemochromatosis can lead to morbidity and eventually death. Clinical onset hereditary hemochromatosis symptoms occur more frequently in adult men than women, as the monthly loss of iron due to menstruation in women slows down accumulation and the symptoms usually start appearing after menopause. Therapeutic phlebotomy is the primary form of treatment for this disease so far, combined with the use of chelating agents. Orthotopic liver transplantation (OTL) is performed in patients with advanced cirrhosis. In order to prevent the progression of iron accumulation, an early detection may be achieved by genotypic check of the frequent mutations of the HFE. Consequently, initiation of treatment may take place before the development of clinical symptoms, particularly cirrhosis, contributing significantly in achieving normal life expectancy. Therefore, genotypic check is vital in order to prevent the development of this type of hemochromatosis.

Also flagged:Metabotropic Glutamate ReceptorsGlutamatedeathmGluRsG protein-coupledGPC
Journal Article 2019-02-08 No Snippets Crupi R, Impellizzeri D, Cuzzocrea S.
Show Full Abstract

Glutamate is a fundamental excitatory neurotransmitter in the mammalian central nervous system (CNS), playing key roles in memory, neuronal development, and synaptic plasticity. Moreover, excessive glutamate release has been implicated in neuronal cell death. There are both ionotropic and metabotropic glutamate receptors (mGluRs), the latter of which can be divided into eight subtypes and three subgroups based on homology sequence and their effects on cell signaling. Indeed, mGluRs exert fine control over glutamate activity by stimulating several cell-signaling pathways <i>via</i> the activation of G protein-coupled (GPC) or G protein-independent cell signaling. The involvement of specific mGluRs in different forms of synaptic plasticity suggests that modulation of mGluRs may aid in the treatment of cognitive impairments related to several neurodevelopmental/psychiatric disorders and neurodegenerative diseases, which are associated with a high economic and social burden. Preclinical and clinical data have shown that, in the CNS, mGluRs are able to modulate presynaptic neurotransmission by fine-tuning neuronal firing and neurotransmitter release in a dynamic, activity-dependent manner. Current studies on drugs that target mGluRs have identified promising, innovative pharmacological tools for the treatment of neurodegenerative and neuropsychiatric conditions, including chronic pain.

Also flagged:NaproxenCutaneous Melanomacancersmetastatic melanomamelanomacaspase 3
Journal Article 2019-02-08 No Snippets Ercolano G, De Cicco P, Frecentese F, Saccone I, Corvino A, Giordano F, Magli E, Fiorino F, Severino B, Calderone V, Citi V, Cirino G, Ianaro A.
Show Full Abstract

The beneficial effects of H<sub>2</sub>S-release and of COXs-inhibition have been exploited in the design of novel anti-inflammatory drugs, the H<sub>2</sub>S-releasing non-steroidal anti-inflammatory drugs (H<sub>2</sub>S-NSAIDs), showing promising potential for chemoprevention in cancers. Here, we evaluated the efficacy of a new H<sub>2</sub>S-releasing derivative of naproxen, named naproxen-4-hydroxybenzodithioate (naproxen-HBTA), in reducing metastatic melanoma features, both <i>in vitro</i> and <i>in vivo</i>. The novel H<sub>2</sub>S donor has been prepared following a synthetic scheme that provided high yields and purity. In particular, we investigated the effect of naproxen-HBTA <i>in vitro</i> on several metastatic features of human melanoma cells such as proliferation, migration, invasion, and colonies formation and <i>in vivo</i> in a model of cutaneous melanoma. Cell culture studies demonstrated that naproxen-HBTA induced caspase 3-mediated apoptosis and inhibited motility, invasiveness, and focus formation. Finally, daily oral treatment with naproxen-HBTA significantly suppressed melanoma growth and progression in mice. In conclusion, by using this dual approach we propose that the COX-2 and H<sub>2</sub>S pathways could be regarded as novel therapeutic targets/tools to generate new treatment options based on "combination therapy" for melanoma.

Also flagged:Coagulation failureinflammatory responsesepsisacute-on-chronic liver failuresystemic inflammatory syndromeSIRS
Journal Article 2019-02-07 ✓ 3 Snippets Premkumar M, Saxena P, Rangegowda D, Baweja S, Mirza R, Jain P, Bhatia P, Kumar G, Bihari C, Kalal C, Vyas T, Choudhury A, Sarin SK.
In-Text Gene Mentions

…and antithrombin III [ATIII]) and followed for…

…protein C andATIII.…

…P = 0.017),ATIII(HR 1.4; CI…

Show Full Abstract

<h4>Background</h4>Patients with acute-on-chronic liver failure (ACLF) have coagulation failure in the setting of systemic inflammatory syndrome (SIRS), sepsis and extra-hepatic organ failures.<h4>Methods</h4>Consecutive ACLF patients without sepsis at baseline were assessed at days 0, 3 and 7 with thromboelastography (TEG) and specific assays (Factor VIII, von Willebrand factor [vWF], protein C and antithrombin III [ATIII]) and followed for development of sepsis, bleeding and outcome.<h4>Results</h4>Of 243 patients, 114 (63% ethanol related; mean age 44.3 ± 11.7 years; 90% male) were recruited. SIRS was noted in 39 (34.2%), 45 (39.5%) and 46 (40%) patients at days 0, 3 and 7 and sepsis in 28 (24%) and 52 (56.1%) patients at days 3 and 7 respectively. The 28- and 90-day survivals were 62% and 51% respectively. A hypocoagulable TEG at baseline was a predictor of bleeding (hazard ratio [HR] 2.1; CI 1.6-4.9; P = 0.050) and mortality (HR 1.9; CI 1.3-7.9; P = 0.043). ACLF patients had increased Factor VIII, vWF, tissue factor levels and tissue plasminogen activator (tPA) activity with reduced protein C and ATIII. Coagulation parameters like Coagulation Index (HR 2.1; CI 1.1-4.5; P = 0.044),clot lysis (HR 3.2; CI 1.9-3.4; P = 0.033), low protein C < 30% (HR 2.1; CI 1.5-2.8; P = 0.017), ATIII (HR 1.4; CI 1.7-3.1; P = 0.052) and tPA (HR 1.5; CI 1.1-2.4; P = 0.052) were predictors of mortality at day 28. Protein C activity <30% (HR 1.3; CI 1.0-2.9; P = 0.042) and tPA >20 ng/mL (HR 1.2; CI 1.1-2.1; P = 0.040) predicted mortality when adjusted for age, gender and baseline MELD.<h4>Conclusions</h4>Dynamic coagulation derangements, measured by TEG, determine the likelihood of bleeding and mortality in ACLF.

Also flagged:papillary thyroid cancerPTCThyroid cancercanceriodinethyroid hormone
Journal Article 2019-02-07 ✓ 2 Snippets Pak K, Kim YH, Suh S, Goh TS, Jeong DC, Kim SJ, Kim IJ, Han ME, Oh SO.
In-Text Gene Mentions

Genetic mutations such as BRAF, RAS, and RET are known to be prognostic markers in thyroid cancer.5 PTCs with BRAF mutations show a higher risk of recurrence and a higher risk of death.5 TERT mutation is also associated with aggressive clinicopathological characteristics and poorer prognosis in PTC.20 TCGA launched in 2013 with 33 different tumor types from 11 000 patients.21 Data from 507 patients with PTC were included in TCGA generated by raw sequencing, transcriptome profiling, simple nucleotide variation, and copy number variation.21 Using the data from TCGA, upregulation of SLC2A1, SLC2A3 and SLC2A14 were associated with increased risk of death in PTC patients,22 and downregulation of long non‐coding RNA271 was associated with increased recurrence.23 Previous studies have shown the prognostic value of specific genes for other cancers via traditional statistical methods such as Cox regression analysis, Lasso and Elastic net regression.7, 9, 10 These methods have several limitations; Cox regression analysis does not consider gene‐gene expression networks and biological pathways.

…SLC2A1, SLC2A3 andSLC2A14were associated with…

Show Full Abstract

As the importance of personalized therapeutics in aggressive papillary thyroid cancer (PTC) increases, accurate risk stratification is required. To develop a novel prognostic scoring system for patients with PTC (n = 455), we used mRNA expression and clinical data from The Cancer Genome Atlas. We performed variable selection using Network-Regularized high-dimensional Cox-regression with gene network from pathway databases. The risk score was calculated using a linear combination of regression coefficients and mRNA expressions. The risk score and clinical variables were assessed by several survival analyses. The risk score showed high discriminatory power for the prediction of event-free survival as well as the presence of metastasis. In multivariate analysis, the risk score and presence of metastasis were significant risk factors among the clinical variables that were examined together. In the current study, we developed a risk scoring system that will help to identify suitable therapeutic options for PTC.

Also flagged:oligodendrocyteaxonaltranscription factorsOlig2Sox10Tcf7l2
Journal Article 2019-02-07 ✓ 1 Snippet Cantone M, Küspert M, Reiprich S, Lai X, Eberhardt M, Göttle P, Beyer F, Azim K, Küry P, Wegner M, Vera J.
In-Text Gene Mentions

…of others (Sox2,Sox6, Sox11, Nkx2-2, Nkx6-2,…

Show Full Abstract

Oligodendrocytes (OLs) facilitate information processing in the vertebrate central nervous system via axonal ensheathment. The structure and dynamics of the regulatory network that mediates oligodendrogenesis are poorly understood. We employed bioinformatics and meta-analysis of high-throughput datasets to reconstruct a regulatory network underpinning OL differentiation. From this network, we identified families of feedforward loops comprising the transcription factors (TFs) Olig2, Sox10, and Tcf7l2 and their targets. Among the targets, we found eight other TFs related to OL differentiation, suggesting a hierarchical architecture in which some TFs (Olig2, Sox10, and Tcf7l2) regulate via feedforward loops the expression of others (Sox2, Sox6, Sox11, Nkx2-2, Nkx6-2, Hes5, Myt1, and Myrf). Model simulations with a kinetic model reproduced the mechanisms of OL differentiation only when in the model, Sox10-mediated repression of Tcf7l2 by miR-338/miR-155 was introduced, a prediction confirmed in genetic functional experiments. Additional model simulations suggested that OLs from dorsal regions emerge through BMP/Sox9 signaling.

Also flagged:cohesinchromosomesmitosiscondensin Icondensinschromatin
Journal Article 2019-02-07 ✓ 5 Snippets Skibbens RV.
In-Text Gene Mentions

Condensinand cohesin structures,…

Condensinsand cohesins –…

…ABSTRACTCondensinsand cohesins are…

…Summary:Condensinsand cohesins generate…

Condensin

Show Full Abstract

Condensins and cohesins are highly conserved complexes that tether together DNA loci within a single DNA molecule to produce DNA loops. Condensin and cohesin structures, however, are different, and the DNA loops produced by each underlie distinct cell processes. Condensin rods compact chromosomes during mitosis, with condensin I and II complexes producing spatially defined and nested looping in metazoan cells. Structurally adaptive cohesin rings produce loops, which organize the genome during interphase. Cohesin-mediated loops, termed topologically associating domains or TADs, antagonize the formation of epigenetically defined but untethered DNA volumes, termed compartments. While condensin complexes formed through <i>cis</i>-interactions must maintain chromatin compaction throughout mitosis, cohesins remain highly dynamic during interphase to allow for transcription-mediated responses to external cues and the execution of developmental programs. Here, I review differences in condensin and cohesin structures, and highlight recent advances regarding the intramolecular or <i>cis</i>-based tetherings through which condensins compact DNA during mitosis and cohesins organize the genome during interphase.

Also flagged:waterlipidAmide Iglucoseoligosaccharidesreproduction
Journal Article 2019-02-07 No Snippets Vujanovic V, Kim SH, Lahlali R, Karunakaran C.
Show Full Abstract

In the present study, FTIR spectroscopy and hyperspectral imaging was introduced as a non-destructive, sensitive-reliable tool for assessing the tripartite kernel-fungal endophyte environment interaction. Composition of coleorhizae of Triticum durum was studied under ambient and drought stress conditions. The OH-stretch IR absorption spectrum suggests that the water-deficit was possibly improved or moderated by kernel's endophytic partner. The OH-stretch frequency pattern coincides with other (growth and stress) related molecular changes. Analysis of lipid (3100-2800 cm<sup>-1</sup>) and protein (1700-1550 cm<sup>-1</sup>) regions seems to demonstrate that drought has a positive impact on lipids. The fungal endosymbiont direct contact with kernel during germination had highest effect on both lipid and protein (Amide I and II) groups, indicating an increased stress resistance in inoculated kernel. Compared to the indirect kernel-fungus interaction and to non-treated kernels (control), direct interaction produced highest effect on lipids. Among treatments, the fingerprint region (1800-800 cm<sup>-1</sup>) and SEM images indicated an important shift in glucose oligosaccharides, possibly linked to coleorhiza-polymer layer disappearance. Acquired differentiation in coleorhiza composition of T. durum, between ambient and drought conditions, suggests that FTIR spectroscopy could be a promising tool for studying endosymbiont-plant interactions within a changing environment.

Also flagged:albumintype 2 diabetesObesitygene expressionglucoseinsulin
Journal Article 2019-02-07 No Snippets Chang DC, Xu X, Ferrante AW, Krakoff J.
Show Full Abstract

<h4>Background</h4>Plasma albumin is reduced during inflammation. Obesity, a strong risk factor for type 2 diabetes (T2D), is associated with adipose tissue inflammation. However, whether albumin is associated with adipose tissue inflammation and whether it predicts T2D are unclear.<h4>Methods</h4>Adults (predominantly American Indian) from a longitudinal study were included. Macrophage content and gene expression related to recruitment/activation were measured from subcutaneous adipose tissue (n = 51). The relationship between plasma albumin and adiposity (dual-energy X-ray absorptiometry or hydrodensitometry), glucose (oral glucose tolerance test), insulin action (hyperinsulinemic-euglycemic clamp), and insulin secretion (intravenous glucose tolerance test) were evaluated (n = 422). Progression to T2D was evaluated by Cox regression (median follow-up 8.8 years; 102 progressors).<h4>Results</h4>Albumin was associated with macrophage markers including C1QB (r = - 0.30, p = 0.04), CSF1R (r = - 0.30, p = 0.03), and CD11b (r = - 0.36, p = 0.01). Albumin was inversely associated with body fat percentage (r = - 0.14, p = 0.003), fasting plasma glucose (r = - 0.17, p = 0.0003), and 2 h plasma glucose (r = - 0.11, p = 0.03), and was reduced in impaired glucose regulation compared with normal glucose regulation (mean ± SD: 39.4 ± 3.6 g/l and 40.1 ± 3.9 g/l, respectively; p = 0.049). Albumin predicted T2D, even after adjustment for confounders (HR, 0.75; 95% CI 0.58-0.96; p = 0.02; per one SD difference in albumin).<h4>Conclusions</h4>Reduced albumin is associated with an unfavorable metabolic profile, characterized by increased adipose tissue inflammation, adiposity, and glucose, and with an increased risk for T2D.

Also flagged:Tumorparasitic diseaseLUNG cancerBREAST cancercancerinfection
Journal Article 2019-02-07 ✓ 5 Snippets Lu G, Zhou J, Zhao YH, Li QL, Gao YY, Wang L.
In-Text Gene Mentions

Among these genes, CaM, RTK, PLA genes were involved in the RAS signaling pathway; Gadd45 and Fas genes belong to the P53 signaling pathway; APC, DCC, Smad2, Smad4, Bax, hMLH1, hMSH2, hMSH3 and hMSH6 genes were involved in the COLORECTAL cancer pathway; K-Ras, EGFR, FHIT, RASSF1 and RARβ genes belong to NON-SMALL CELL LUNG cancer signaling pathway; PTEN, BRCA1, BRCA2, PI3K, and CCND1were involved in the BREAST cancer signaling pathway.

The expression of DCC protein was up-regulated after T. gondii infection, which suggested that T. gondii infection might improve the resistance of host against colorectal cancer through increasing the expression of DCC protein.

…signaling pathway; APC,DCC, Smad2, Smad4, Bax,…

…genes PLA, Gadd45,DCC, Smad2, Smad4,hMSH3, RASSF1…

…of PLA, Gadd45,DCC, Smad2, Smad4, hMSH3,…

Show Full Abstract

<i>Toxoplasma gondii</i> is an intracellular parasite and causes a global epidemic parasitic disease. <i>T. gondii-</i>infection could inhibit the growth of tumor. In this study, the transcriptomes of samples were detected by deep sequencing analysis. The transcriptome data was compared with reference genome to perform sequence alignment and the further analysis. The analyses of differential expression and the differentially expressed genes were performed in the present study. Genes involved in <i>P53</i> signaling pathway, COLORECTAL cancer pathway, NON-SMALL CELL LUNG cancer signaling pathway, and BREAST cancer signaling pathway were up-regulated or down-regulated among the samples. The KEGG analysis indicated that the cancer pathways changed after infection of <i>T. gondii.</i> Furthermore, tumor-related mRNAs from different samples had a large difference, which suggested that the difference might provide important information in resisting cancer. The protein results indicated that tumor-related protein changes occurred after infection of <i>T. gondii.</i> In conclusion, the infection changed the cancer pathways, which could possibly inhibit the growth of tumor.

Also flagged:transcriptionscell differentiationdeathStat3phosphorylationWnt
Journal Article 2019-02-07 ✓ 3 Snippets Zhang X, Liu S, Wang Y, Hu H, Li L, Wu Y, Cao D, Cai Y, Zhang J, Zhang X.
In-Text Gene Mentions

…olfactomedin 4 (Olfm4) sense, TCTTGGGCAGAAGGTGGGACT…

…markers, including Ascl2,Olfm4and Lgr5 was…

…ISC markers (Lgr5,Olfm4and Znrf3) were…

Show Full Abstract

Interleukin‑22 (IL‑22) has both pro‑inflammatory and anti‑inflammatory properties in a number tissues depending on the environment. Epithelial cells usually have a rapid turnover and are fueled by tissue stem cells. However, the question of whether IL‑22 regulates tissue homeostasis through the modulation of stem cells remains unanswered. In this study, we investigated the role of IL‑22 in the homeostasis of intestinal epithelial cells (IECs) during inflammation through a 3D organoid culture system. qPCR was performed to detect the changes in important gene transcriptions, and immunohistochemistry and western blot analysis were carried out to determine protein expression. As a result, we found that the expression of IL‑22 was synchronously altered with the damage of the intestine. IL‑22 treatment promoted cell proliferation and suppressed the cell differentiation of intestinal organoids. Surprisingly, IL‑22 also led to self‑renewal defects of intestinal stem cells (ISCs), thereby eventually resulting in the death of organoids. In examining the underlying mechanisms, we found that IL‑22 activated signal transducer and activator of transcription 3 (Stat3) phosphorylation and suppressed the Wnt and Notch signaling pathways. Importantly, Wnt3a treatment attenuated the organoid defects caused by IL‑22, which consolidated the importance of Wnt pathway at the downstream of IL‑22. Collectively, the findings of this study indicate that IL‑22 regulates the homeostasis of the intestinal epithelium and is critical for the regeneration of the intestine during inflammation. Thus, the data of this study may provide a potential strategy and a basis for the treatment of diseases of intestinal inflammation in clinical practice.

Also flagged:Colon Cancercell communicationRNA polymerase IIaxonMAPKendocytosis
Journal Article 2019-02-07 ✓ 2 Snippets Dong Z, Lin W, Kujawa SA, Wu S, Wang C.
In-Text Gene Mentions

For example, Ruan et al. [7] reported that miR-1181 and miR-4314 were associated with ovarian cancer through downregulated FOXP1 and GRWD1/IP6K1/NEGR1 whereas Zhang et al. [8] indicated that the tumor suppressive role of miR-149 targeted the AKT-mTOR pathway in human hepatocellular carcinoma.

…gulated FOXP1 and GRWD1/IP6K1/NEGR1whereas Zhang et…

Show Full Abstract

<h4>Background</h4>Colon cancer is a heterogeneous disease, differing in clinical symptoms, epigenetics, and prognosis for each individual patient. Identifying the core genes is important for early diagnoses and it provides a more precise method for treating colon cancer.<h4>Materials and methods</h4>In this study, we wanted to pinpoint these core genes so we obtained GSE101502 microRNA profiles from the GEO database, which resulted in 17 differential expressed microRNAs that were identified by GEO2R analysis. Then, 875 upregulated and 2920 downregulated target genes were predicted by FunRich. GO and KEGG pathway were used to do enrich analysis.<h4>Results</h4>GO analysis indicated that upregulated genes were significantly enriched in the regulation of cell communication and signaling and in nervous system development, while the downregulated genes were significantly enriched in nervous system development and regulation of transcription from the RNA polymerase II promoter. KEGG pathway analysis suggested that the upregulated genes were enriched in axon guidance, MAPK signaling pathway, and endocytosis, while the downregulated genes existed in pathways in cancer, focal adhesion, and PI3K-Akt signaling pathway. The top four molecules including 82 hub genes were identified from the PPI network and involved in endocytosis, spliceosome, TGF-beta signaling pathway, and lysosome. Finally, NUDT21, GNB1, CLINT1, and COL1A2 core gene were selected due to their correlation with the prognosis of IIA stage colon cancer.<h4>Conclusion</h4>this study suggested that NUDT21, GNB1, CLINT1, and COL1A2 might be the core genes for colon cancer that play an important role in the development and prognosis of IIA stage colon cancer.

Also flagged:lactic acidosteoblast proliferationcell adhesioncollagenfibrilsapatite
Journal Article 2019-02-06 No Snippets Lee S, Matsugaki A, Kasuga T, Nakano T.
Show Full Abstract

During the bone regeneration process, the anisotropic microstructure of bone tissue (bone quality) recovers much later than bone mass (bone quantity), resulting in severe mechanical dysfunction in the bone. Hence, restoration of bone microstructure in parallel with bone mass is necessary for ideal bone tissue regeneration; for this, development of advanced bifunctional biomaterials, which control both the quality and quantity in regenerated bone, is required. We developed novel oriented bioactive glass/poly(lactic acid) composite scaffolds by introducing an effective methodology for controlling cell alignment and proliferation, which play important roles for achieving bone anisotropy and bone mass, respectively. Our strategy is to manipulate the cell alignment and proliferation by the morphological control of the scaffolds in combination with controlled ion release from bioactive glasses. We quantitatively controlled the morphology of fibermats containing bioactive glasses by electrospinning, which successfully induced cell alignment along the fibermats. Also, the substitution of CaO in Bioglass®(45S5) with MgO and SrO improved osteoblast proliferation, indicating that dissolved Mg<sup>2+</sup> and Sr<sup>2+</sup> ions promoted cell adhesion and proliferation. Our results indicate that the fibermats developed in this work are candidates for the scaffolds to bone tissue regeneration that enable recovery of both bone quality and bone quantity. © 2019 The Authors. journal Of Biomedical Materials Research Part A Published By Wiley Periodicals, Inc. J Biomed Mater Res Part A: 107A: 1031-1041, 2019.

Also flagged:oxygenHypertensioncardiovascular diseasekidney failuresuperoxideanion
Journal Article 2019-02-06 No Snippets Cuevas S, Villar VAM, Jose PA.
Show Full Abstract

Hypertension is the most prevalent cause of cardiovascular disease and kidney failure, but only about 50% of patients achieve adequate blood pressure control, in part, due to inter-individual genetic variations in the response to antihypertensive medication. Significant strides have been made toward the understanding of the role of reactive oxygen species (ROS) in the regulation of the cardiovascular system. However, the role of ROS in human hypertension is still unclear. Polymorphisms of some genes involved in the regulation of ROS production are associated with hypertension, suggesting their potential influence on blood pressure control and response to antihypertensive medication. This review provides an update on the genes associated with the regulation of ROS production in hypertension and discusses the controversies on the use of antioxidants in the treatment of hypertension, including the antioxidant effects of antihypertensive drugs.

Also flagged:chronic central serous chorioretinopathychorioretinal diseasePTPRBCentral serous chorioretinopathyneuroretinal detachmentcorticoids
Journal Article 2019-02-06 ✓ 1 Snippet Schellevis RL, van Dijk EHC, Breukink MB, Keunen JEE, Santen GWE, Hoyng CB, de Jong EK, Boon CJF, den Hollander AI.
In-Text Gene Mentions

…[OMIM:NA], ZAN [OMIM:602372],SHISA6[OMIM:617327], DCP1A [OMIM:607…

Show Full Abstract

<h4>Background</h4>Central serous chorioretinopathy (CSC) is a chorioretinal disease characterized by fluid accumulation between the neuroretina and retinal pigment epithelium with unknown etiology. Family studies have suggested a heritable component for CSC with an autosomal dominant inheritance pattern. Therefore, exome sequencing was performed on familial cCSC to indentify the genetic components contributing to familial cCSC.<h4>Methods</h4>Exome sequencing was performed on 72 individuals of 18 families with CSC. In these families, we determined whether rare genetic variants (minor allele frequency < 1%) were segregated with CSC and also performed familial gene-burden analysis.<h4>Results</h4>In total, 11 variants segregated in two out of 18 families. One of these variants, c.4145C>T; p.T1382I (rs61758735) in the PTPRB gene, was also associated with CSC in a large case-control cohort sequenced previously (p = 0.009). Additionally, in 28 genes two or more different heterozygous variants segregated in two or more families, but no gene showed consistent associations in both the family gene-burden results and gene-burden analysis in the case-control cohort.<h4>Conclusion</h4>We identified potential candidate genes for familial CSC and managed to exclude Mendelian inheritance of variants in one or a limited number of genes. Instead, familial CSC may be a heterogeneous Mendelian disease caused by variants in many different genes, or alternatively CSC may represent a complex disease to which both environmental factors and genetics contribute.

Also flagged:synthesishydridesethanedithiolatesulfurthiolsthiol-ene
Journal Article 2019-02-06 No Snippets Kagalwala HN, Lalaoui N, Li QL, Liu L, Woods T, Rauchfuss TB.
Show Full Abstract

The chemistry of Fe<sub>2</sub>(μ-SH)<sub>2</sub>(CO)<sub>4</sub>(PPh<sub>3</sub>)<sub>2</sub> (2<sup>HH</sup>) is described with attention to S-S coupling reactions. Produced by the reduction of Fe<sub>2</sub>(μ-S<sub>2</sub>)(CO)<sub>4</sub>(PPh<sub>3</sub>)<sub>2</sub> (2), 2<sup>HH</sup> is an analogue of Fe<sub>2</sub>(μ-SH)<sub>2</sub>(CO)<sub>6</sub> (1<sup>HH</sup>), which exhibits well-behaved S-centered redox. Both 2<sup>HH</sup> and the related 2<sup>MeH</sup> exist as isomers that differ with respect to the stereochemistry of the μ-SR ligands (R = H, Me). Compounds 2<sup>HH</sup>, 2<sup>MeH</sup>, and 2 protonate to give rare examples of Fe-SH and Fe-S<sub>2</sub> hydrides. Salts of [H2]<sup>+</sup>, [H2<sup>HH</sup>]<sup>+</sup>, and [H2<sup>MeH</sup>]<sup>+</sup> were characterized crystallographically. Complex 2<sup>HH</sup> reduces O<sub>2</sub>, H<sub>2</sub>O<sub>2</sub>, (PhCO<sub>2</sub>)<sub>2</sub>, and Ph<sub>2</sub>N<sub>2</sub>, giving 2. Related reactions involving 1<sup>HH</sup> gave uncharacterizable polymers. The differing behaviors of 2<sup>HH</sup> and 1<sup>HH</sup> reflect stabilization of the ferrous intermediates by the PPh<sub>3</sub> ligands. When independently generated by the reaction of 2<sup>HH</sup> with 2,2,6,6-tetramethyl-1-piperidinyloxy, 2* quantitatively converts to 2 or, in the presence of C<sub>2</sub>H<sub>4</sub>, is trapped as the ethanedithiolate Fe<sub>2</sub>(μ-S<sub>2</sub>C<sub>2</sub>H<sub>4</sub>)(CO)<sub>4</sub>(PPh<sub>3</sub>)<sub>2</sub>. Evidence is presented that the Hieber-Gruber synthesis of 1 involves polysulfido intermediates [Fe<sub>2</sub>(μ-S <sub>n</sub>)<sub>2</sub>(CO)<sub>6</sub>]<sup>2-</sup> ( n > 1). Two relevant experiments are as follows: (i) protonation of [Fe<sub>4</sub>(μ-S)<sub>2</sub>(μ-S<sub>2</sub>)CO)<sub>12</sub>]<sup>2-</sup> gives 1 and 1<sup>HH</sup>, and (ii) oxidation of 1<sup>HH</sup> by sulfur gives 1.

Also flagged:metabolismextracellularkinasesflagellummicrotubule related proteinstransport-associated proteins
Journal Article 2019-02-06 No Snippets Mattos EC, Canuto G, Manchola NC, Magalhães RDM, Crozier TWM, Lamont DJ, Tavares MFM, Colli W, Ferguson MAJ, Alves MJM.
Show Full Abstract

Trypanosoma cruzi, the etiological agent of Chagas' disease, affects 8 million people predominantly living in socioeconomic underdeveloped areas. T. cruzi trypomastigotes (Ty), the classical infective stage, interact with the extracellular matrix (ECM), an obligatory step before invasion of almost all mammalian cells in different tissues. Here we have characterized the proteome and phosphoproteome of T. cruzi trypomastigotes upon interaction with ECM (MTy) and the data are available via ProteomeXchange with identifier PXD010970. Proteins involved with metabolic processes (such as the glycolytic pathway), kinases, flagellum and microtubule related proteins, transport-associated proteins and RNA/DNA binding elements are highly represented in the pool of proteins modified by phosphorylation. Further, important metabolic switches triggered by this interaction with ECM were indicated by decreases in the phosphorylation of hexokinase, phosphofructokinase, fructose-2,6-bisphosphatase, phosphoglucomutase, phosphoglycerate kinase in MTy. Concomitantly, a decrease in the pyruvate and lactate and an increase of glucose and succinate contents were detected by GC-MS. These observations led us to focus on the changes in the glycolytic pathway upon binding of the parasite to the ECM. Inhibition of hexokinase, pyruvate kinase and lactate dehydrogenase activities in MTy were observed and this correlated with the phosphorylation levels of the respective enzymes. Putative kinases involved in protein phosphorylation altered upon parasite incubation with ECM were suggested by in silico analysis. Taken together, our results show that in addition to cytoskeletal changes and protease activation, a reprogramming of the trypomastigote metabolism is triggered by the interaction of the parasite with the ECM prior to cell invasion and differentiation into amastigotes, the multiplicative intracellular stage of T. cruzi in the vertebrate host.

Also flagged:AP3EGFRMDM2GAPDHVPS28UBE2N
Journal Article 2019-02-06 No Snippets Minaidou A, Nicolaou P, Christodoulou K.
Show Full Abstract

CMT is the most common hereditary neuromuscular disorder of the peripheral nervous system with a prevalence of 1/2500 individuals and it is caused by mutations in more than 80 genes. LRSAM1, a RING finger ubiquitin ligase also known as TSG101-associated ligase (TAL), has been associated with Charcot-Marie-Tooth disease type 2P (CMT2P) and to date eight causative mutations have been identified. Little is currently known on the pathogenetic mechanisms that lead to the disease. We investigated the effect of LRSAM1 deregulation on possible LRSAM1 interacting molecules in cell based models. Possible LRSAM1 interacting molecules were identified using protein-protein interaction databases and literature data. Expression analysis of these molecules was performed in both CMT2P patient and control lymphoblastoid cell lines as well as in LRSAM1 and TSG101 downregulated SH-SY5Y cells.TSG101, UBE2N, VPS28, EGFR and MDM2 levels were significantly decreased in the CMT2P patient lymphoblastoid cell line as well as in LRSAM1 downregulated cells. TSG101 downregulation had a significant effect only on the expression of VPS28 and MDM2 and it did not affect the levels of LRSAM1. This study confirms that LRSAM1 is a regulator of TSG101 expression. Furthermore, deregulation of LRSAM1 significantly affects the levels of UBE2N, VPS28, EGFR and MDM2.

Also flagged:macroelementmetalsmetabolismsecretionsynthesisglycogen
Journal Article 2019-02-06 ✓ 2 Snippets Kicińska A, Glichowska P, Mamak M.
In-Text Gene Mentions

…of iron, i.e.,hemochromatosis.…

…mutation of theHFEgene.…

Show Full Abstract

The paper presents the macroelement (Al, Ca, Cu, Fe, K, Mg, Mn, Na, P, and Zn) and microelement (As, Cd, Co, Cr, Hg, Mo, Ni, Pb, and Sn) contents found in the liver of wild animals (boar and deer) and farm animals (rabbit, chicken, duck, cow, goat, and turkey). Statistically, the differences in element contents between the two groups were not significant (at p = 0.05), with the exception of Fe, K, Mg, Cd, Hg, Mo, and Pb. The liver of farm animals contained more Al, Cu, K, Mg, Na, Cr, and Sn, while the content of the remaining elements was higher in wild animals. An analysis of correlations between element content and age in wild animals (boar) showed that Pb and Al content increases with age, while Na and Cr contents decrease significantly. Comparisons between the test results and the maximum limits allowed by law showed that, in the case of wild animals, the regulatory limits were exceeded in 18% (for Cd and Cu) and 9% (for Hg) of the liver samples analyzed. In the case of farm animals, the limits for micro- and macroelement contents were not exceeded. The hazard index (HI) values for farm animals were lower than for wild animals, with regard to consumption by both children and adults. Based on the HI values calculated, it seems recommendable that consumption of the liver (preferably from farm animals) by children be limited to once weekly. For adults, the liver can be a valuable source of elements such as Zn, Fe, and Cr, which may be an indication for more frequent consumption.

Also flagged:magnetitemaghemiteiron carbidesironcarbongraphite
Journal Article 2019-02-06 No Snippets Garanina A, Kireev I, Zhironkina O, Strelkova O, Shakhov A, Alieva I, Davydov V, Murugesan S, Khabashesku V, Majouga A, Agafonov V, Uzbekov R.
Show Full Abstract

<h4>Background</h4>Theranostics application of superparamagnetic nanoparticles based on magnetite and maghemite is impeded by their toxicity. The use of additional protective shells significantly reduced the magnetic properties of the nanoparticles. Therefore, iron carbides and pure iron nanoparticles coated with multiple layers of onion-like carbon sheath seem to be optimal for biomedicine. Fluorescent markers associated with magnetic nanoparticles provide reliable means for their multimodal visualization. Here, biocompatibility of iron nanoparticles coated with graphite-like shell and labeled with Alexa 647 fluorescent marker has been investigated.<h4>Methods</h4>Iron core nanoparticles with intact carbon shells were purified by magnetoseparation after hydrochloric acid treatment. The structure of the NPs (nanoparticles) was examined with a high resolution electron microscopy. The surface of the NPs was alkylcarboxylated and further aminated for covalent linking with Alexa Fluor 647 fluorochrome to produce modified fluorescent magnetic nanoparticles (MFMNPs). Live fluorescent imaging and correlative light-electron microscopy were used to study the NPs intracellular distribution and the effects of constant magnetic field on internalized NPs in the cell culture were analyzed. Cell viability was assayed by measuring a proliferative pool with Click-IT labeling.<h4>Results</h4>The microstructure and magnetic properties of superparamagnetic Fe@C core-shell NPs as well as their endocytosis by living tumor cells, and behavior inside the cells in constant magnetic field (150 mT) were studied. Correlative light-electron microscopy demonstrated that NPs retained their microstructure after internalization by the living cells. Application of constant magnetic field caused orientation of internalized NPs along power lines thus demonstrating their magnetocontrollability. Carbon onion-like shells make these NPs biocompatible and enable long-term observation with confocal microscope. It was found that iron core of NPs shows no toxic effect on the cell physiology, does not inhibit the cell proliferation and also does not induce apoptosis.<h4>Conclusions</h4>Non-toxic, biologically compatible superparamagnetic fluorescent MFMNPs can be further used for biological application such as delivery of biologically active compounds both inside the cell and inside the whole organism, magnetic separation, and magnetic resonance imaging (MRI) diagnostics.

Also flagged:IronFerroptosisdeathlipidoxygenerastin
Journal Article 2019-02-06 ✓ 1 Snippet Kose T, Vera-Aviles M, Sharp PA, Latunde-Dada GO.
In-Text Gene Mentions

…disorders such ashemochromatosisand thalassemia, which…

Show Full Abstract

Ferroptosis is a form of programmed cell death that is characterized by lipid peroxidation and is inducible by iron and the accumulation of reactive oxygen species (ROS). It is triggered by erastin but inhibited by antioxidants such as -tocopherol, -carotene, polyphenols, and iron chelators such as deferoxamine (DFO), nitrilotriacetic acid (NTA), and ethylenediaminetetraacetic acid (EDTA). This study investigated the protective effects of two polyphenols, curcumin and (-)- epigallocatechin-3-gallate (EGCG), against iron loading and erastin-mediated ferroptosis in MIN6 cells. Cells were treated with polyphenols before exposure to iron-induced oxidative stress comprising of 20 μmol/L of 8-hydroxyquinoline (8HQ) and 50 μmol/L of ferric ammonium citrate, (FAC) (8HQ+FAC) or Fenton reaction substrate (FS) (30 μmol/L of FeSO₄ and 0.5 of mmol/L H₂O₂) and 20 μmol/L erastin. Cell viability was determined by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) assay, iron levels were measured by inductively-coupled plasma mass spectrometry (ICP-MS), glutathione and lipid peroxidation were assayed with commercially-available kits. Curcumin and EGCG both significantly protected pancreatic cells against iron-induced oxidative damage. Moreover, both compounds also protected against erastin-induced ferroptosis in pancreatic cells. The polyphenols enhanced cell viability in erastin-treated MIN6 cells in a dose- and time-dependent manner. Furthermore, MIN6 cells exposed to erastin alone showed elevated levels of iron, glutathione (GSH) depletion, glutathione peroxidase 4 (GPX4) degradation and lipid peroxidation (p < 0.05) compared to cells that were protected by pre-treatment with curcumin or EGCG. Taken together, the data identify curcumin and EGCG as novel ferroptosis inhibitors, which might exert their protective effects by acting as iron chelators and preventing GSH depletion, GPX4 inactivation, and lipid peroxidation in MIN6 cells. The implications of the findings on the effects of iron overload and ferroptosis represent a potential therapeutic strategy against iron-related diseases.

Also flagged:Tumorglucose2-deoxyglucosecancerwaterfolic acid
Journal Article 2019-02-06 No Snippets Jin S, Du Z, Guo H, Zhang H, Ren F, Wang P.
Show Full Abstract

The glucose analog, 2-deoxyglucose (2-DG), specifically inhibits glycolysis of cancer cells and interferes with the growth of cancer cells. However, the excellent water solubility of 2-DG makes it difficult to be concentrated in tumor cells. In this study, a targeted nano-pharmacosome was developed with folic acid-modified 2-DG (FA-2-DG) by using amino ethanol as a cleavable linker. FA-2-DG was able to self-assemble, forming nano-particles with diameters of 10⁻30 nm. The biological effects were evaluated with cell viability assays and flow cytometry analysis. Compared with a physical mixture of folic acid and 2-DG, FA-2-DG clearly reduced cell viability and resulted in cell cycle arrest. A computational study involving docking simulation suggested that FA-2-DG can dock into the same receptor as folic acid, thus confirming that the structural modification did not affect the targeting performance. The results indicated that the nano-pharmacosome consisting of FA-2-DG can be used for targeting in a nano-drug delivery system.

Also flagged:InfectionsSepsisSeptic ShockshockpolymeraseCEACAM4
Journal Article 2019-02-06 ✓ 1 Snippet Artigas A, Carlet J, Garnacho J, Niederman M, Torres A.
In-Text Gene Mentions

…S.E. et al.PEBP1Wardens Ferroptosis by…

Show Full Abstract

This 24th International Symposium on Infections in the Critically Ill Patient aims to review current concepts, technology and present advances in infections in critically ill patient [...].

Also flagged:GBMV-ATPasetumoracidificationgliomaV-ATPase pump
Journal Article 2019-02-06 ✓ 5 Snippets Bertolini I, Terrasi A, Martelli C, Gaudioso G, Di Cristofori A, Storaci AM, Formica M, Braidotti P, Todoerti K, Ferrero S, Caroli M, Ottobrini L, Vaccari T, Vaira V.
In-Text Gene Mentions

Expression of POU3F2 mRNA was higher in LGG/IDHwt than in LGG/IDHmut, as well as being upregulated in GBM.

Here we extend this information showing that V-ATPase G1, HOXA10 and POU3F2 are found in vivo in the tumor surrounding milieu of GBM.

Remarkably, LOs loaded with V1G1 and POU3F2 were present in the circulation of glioma patients, and their levels increased with tumor grade or in patients with a poorer outcome.

Interestingly, the value of POU3F2 expression that best discriminated LGG/IDHmut from GBM cases (corresponding to 11.1 copies/μl) (Fig. 4f) classified LGG/IDHwt cases alongside GBM (Fig. 4g) and it was also predictive of shorter disease-free survival time in LGG patients (p = 0.01; Fig. 4h).

POU3F2 was also high among GBM patients who died of disease (Fig. 4e).

Show Full Abstract

<h4>Background</h4>The V-ATPase proton pump controls acidification of intra and extra-cellular milieu in both physiological and pathological conditions. We previously showed that some V-ATPase subunits are enriched in glioma stem cells and in patients with poor survival. In this study, we investigated how expression of a GBM-like V-ATPase pump influences the non-neoplastic brain microenvironment.<h4>Methods</h4>Large oncosome (LO) vesicles were isolated from primary glioblastoma (GBM) neurospheres, or from patient sera, and co-cultured with primary neoplastic or non-neoplastic brain cells. LO transcript and protein contents were analyzed by qPCR, immunoblotting and immunogold staining. Activation of pathways in recipient cells was determined at gene and protein expression levels. V-ATPase activity was impaired by Bafilomycin A1 or gene silencing.<h4>Findings</h4>GBM neurospheres influence their non-neoplastic microenvironment by delivering the V-ATPase subunit V1G1 and the homeobox genes HOXA7, HOXA10, and POU3F2 to recipient cells via LO. LOs reprogram recipient cells to proliferate, grow as spheres and to migrate. Moreover, LOs are particularly abundant in the circulation of GBM patients with short survival time. Finally, impairment of V-ATPase reduces LOs activity.<h4>Interpretation</h4>We identified a novel mechanism adopted by glioma stem cells to promote disease progression via LO-mediated reprogramming of their microenvironment. Our data provide preliminary evidence for future development of LO-based liquid biopsies and suggest a novel potential strategy to contrast glioma progression. FUND: This work was supported by Fondazione Cariplo (2014-1148 to VV) and by the Italian Minister of Health-Ricerca Corrente program 2017 (to SF).

Also flagged:caspaseHuntington diseaseneurological disordersHDdepressiondeath
Journal Article 2019-02-06 No Snippets Lessard-Beaudoin M, Yu-Taeger L, Laroche M, Singer E, Riess O, Nguyen HHP, Graham RK.
Show Full Abstract

Olfactory dysfunction is observed in several neurological disorders, including Huntington disease (HD), and correlates with global cognitive performance, depression and degeneration of olfactory regions in the brain. Despite clear evidence demonstrating olfactory dysfunction in HD patients, only limited details are available in murine models and the underlying mechanisms are unknown. In order to determine if alterations in the olfactory bulb (OB) are observed in HD we assessed OB weight or area from 3 to 12 months of age in the BACHD transgenic lines (TG5 and TG9). A significant decrease in the OB was observed at 6 and 12 months of age compared to WT. We also detected increased mRNA and protein expression of mutant huntingtin (mHTT) in the OB of TG5 compared to TG9 at specific ages. Despite the higher expression of mHTT in the TG5 OBs, there was increased nuclear accumulation of mHTT in the OB of TG9 compared to WT and TG5 rats. As we observed atrophy of the OB in the BACHD rats we assessed for caspase activation, a known mechanism underlying the cell death observed in HD. We characterized caspase-3, -6, -8 and - 9 mRNA and protein expression levels in the OB of the BACHD transgenic lines at 3, 6 and 12 months of age. Alterations in caspase mRNA and protein expression were detected in the TG5 and TG9 lines. However, the changes observed in the mRNA and protein levels are in some cases discordant, suggesting that the caspase protein modifications detected may be more attributable to post-translational modifications. The caspase activation studies support that cell death may be increased in the rodent HD OB and further our understanding of the olfactory dysfunction and the role of caspases in the pathogenesis of HD.

Also flagged:type 2 diabetesGene ExpressionType 1 diabetestranscription factorsEGR1NAMPT
Journal Article 2019-02-06 ✓ 1 Snippet Jia K, Wu Y, Ju J, Wang L, Shi L, Wu H, Jiang K, Dong J.
In-Text Gene Mentions

…(logFC = −1.846),MRPL39(logFC = −1.788),…

Show Full Abstract

In general, type 2 diabetes (T2D) usually occurs in middle-aged and elderly people. However, the incidence of childhood-onset T2D has increased all across the globe. Therefore, it is very important to determine the molecular and genetic mechanisms of childhood-onset T2D. In this study, the dataset GSE9006 was downloaded from the GEO (Gene Expression Omnibus database); it includes 24 healthy children, 43 children with newly diagnosed Type 1 diabetes (T1D), and 12 children with newly diagnosed T2D. These data were used for differentially expressed genes (DGEs) analysis and weighted co-expression network analysis (WGCNA). We identified 192 up-regulated genes and 329 down-regulated genes by performing DEGs analysis. By performing WGGNA, we found that blue module (539 genes) was highly correlated to cyan module (97 genes). Gene ontology (GO) and pathway enrichment analyses were performed to figure out the functions and related pathways of genes, which were identified in the results of DEGs and WGCNA. Genes with conspicuous logFC and in the high correlated modules were input into GeneMANIA, which is a plugin of Cytoscape application. Thus, we constructed the protein-protein interaction (PPI) network (92 nodes and 254 pairs). Eventually, we analyzed the transcription factors and references related to genes with conspicuous logFC or high-degree genes, which were present in both the modules of WGCNA and PPI network. Current research shows that EGR1 and NAMPT can be used as marker genes for childhood-onset T2D. Gestational diabetes and chronic inflammation are risk factors that lead to the development of childhood-onset T2D.

Also flagged:positronpeptideADpathogenesisaging
Journal Article 2019-02-06 ✓ 2 Snippets Ashton NJ, Nevado-Holgado AJ, Barber IS, Lynham S, Gupta V, Chatterjee P, Goozee K, Hone E, Pedrini S, Blennow K, Schöll M, Zetterberg H, Ellis KA, Bush AI, Rowe CC, Villemagne VL, Ames D, Masters CL, Aarsland D, Powell J, Lovestone S, Martins R, Hye A.
In-Text Gene Mentions

…heavy chain 10 (DNAH10), G protein–signaling modulat…

…NGN2, FHAD1, andDNAH10, although further work…

Show Full Abstract

A blood-based assessment of preclinical disease would have huge potential in the enrichment of participants for Alzheimer's disease (AD) therapeutic trials. In this study, cognitively unimpaired individuals from the AIBL and KARVIAH cohorts were defined as Aβ negative or Aβ positive by positron emission tomography. Nontargeted proteomic analysis that incorporated peptide fractionation and high-resolution mass spectrometry quantified relative protein abundances in plasma samples from all participants. A protein classifier model was trained to predict Aβ-positive participants using feature selection and machine learning in AIBL and independently assessed in KARVIAH. A 12-feature model for predicting Aβ-positive participants was established and demonstrated high accuracy (testing area under the receiver operator characteristic curve = 0.891, sensitivity = 0.78, and specificity = 0.77). This extensive plasma proteomic study has unbiasedly highlighted putative and novel candidates for AD pathology that should be further validated with automated methodologies.

Also flagged:Epilepsyneurological disorderspediatric epilepsygenetic epilepsy syndromesARXSCN1A
Journal Article 2019-02-06 ✓ 2 Snippets Sharma P, Hussain A, Greenwood R.
In-Text Gene Mentions

A prime example is the substantiation ofGABRB2,SNAP25,CACNA1E, andKCNQ3 as epileptic NDD-related genes (KCNQ3 has prior association with benign familial neonatal seizures44).

…, SNAP25 ,CACNA1E, and KCNQ3…

Show Full Abstract

Epilepsy in infants and children is one of the most common and devastating neurological disorders. In the past, we had a limited understanding of the causes of epilepsy in pediatric patients, so we treated pediatric epilepsy according to seizure type. Now with new tools and tests, we are entering the age of precision medicine in pediatric epilepsy. In this review, we use the new etiological classification system proposed by the International League Against Epilepsy to review the advances in the diagnosis of pediatric epilepsy, describe new tools to identify seizure foci for epilepsy surgery, and define treatable epilepsy syndromes.

Also flagged:liver cancernonalcoholic fatty liver diseaseaflatoxinperfluorooctanoic acidironNAFLD
Journal Article 2019-02-06 ✓ 1 Snippet VoPham T.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Purpose of review</h4>The objective of this review was to summarize recent epidemiologic research examining the associations between environmental exposures and liver cancer and nonalcoholic fatty liver disease (NAFLD).<h4>Recent findings</h4>There were 28 liver cancer studies showing positive associations for exposures to aflatoxin, air pollution, polycyclic aromatic hydrocarbons, asbestos, chimney sweeping occupation, and paints; an inverse association for ultraviolet radiation; and null/inconsistent results for organic solvents, pesticides, perfluorooctanoic acid, nuclear radiation, iron foundry occupation, and brick kiln pollution. There were n=5 NAFLD studies showing positive associations for heavy metals, methyl tertiary-butyl ether, and selenium; and no association with trihalomethanes.<h4>Summary</h4>Evidence suggests that particular environmental exposures may be associated with liver cancer and NAFLD. Future liver cancer studies should examine specific histological subtypes and assess historical environmental exposures. Future NAFLD research should examine incident, biopsy-confirmed cases and the potential role of obesity and/or diabetes in studies of environmental factors and NAFLD.

Also flagged:V-ATPasegliomasgliomaGBMIDHtumor
Journal Article 2019-02-05 ✓ 5 Snippets Terrasi A, Bertolini I, Martelli C, Gaudioso G, Di Cristofori A, Storaci AM, Formica M, Bosari S, Caroli M, Ottobrini L, Vaccari T, Vaira V.
In-Text Gene Mentions

Therefore, we examined expression of homeobox genes HOXA7, HOXA10, SHOX2, and POU3F2 in our patient-derived GBM primary cultures.

In mammalian systems, we observed that the neurodevelopmental homeobox transcription factor POU3F2 is regulated by the V-ATPase inhibitor Bafilomycin A1 [8].

Further, POU3F2 has been previously demonstrated to be a fundamental reprogramming transcription factor for GBM stem cells [18], and elevated expression of the homeobox signature genes in subgroups of GBM [32] or in GBM-derived NS [33] has been documented.

…MP2 (10373–2-AP, Proteintech),POU3F2(12,137, Cell Signaling),…

…homeobox transcription factorPOU3F2is regulated by…

Show Full Abstract

<h4>Background</h4>Cancer cells use specific V-ATPase subunits to activate oncogenic pathways. Therefore, we investigated V-ATPase deregulation in aggressive gliomas and associated signaling.<h4>Methods</h4>V-ATPase genes expression and associated pathways were analyzed in different series of glioma available from public databases, as well as in patients' cohort. Activation of pathways was analyzed at gene and protein expression levels. A genetic model of glioma in Drosophila melanogaster and mice with GBM patients-derived orthotopic xenografts were used as in vivo models of disease.<h4>Findings</h4>GBM and recurrent gliomas display a specific V-ATPase signature. Such signature resolves the heterogeneous class of IDH-wild type lower-grade gliomas, identifying the patients with worse prognosis independently from clinical and molecular features (p = 0·03, by Cox proportional-hazards model). In vivo, V-ATPase subunits deregulation significantly impacts tumor growth and proliferation. At the molecular level, GBM-like V-ATPase expression correlates with upregulation of Homeobox genes.<h4>Interpretation</h4>Our data identify a V-ATPase signature that accompanies glioma aggressiveness and suggest new entry points for glioma stratification and follow-up. FUND: This work was supported by Fondazione Cariplo (2014-1148 to VV), Fondazione IRCCS Ca' Granda, and Fondazione INGM Grant in Molecular Medicine 2014 (to VV).

Also flagged:Testicular CancercancerinfertilemitochondrialNDUFS1CD63
Journal Article 2019-02-05 No Snippets Panner Selvam MK, Agarwal A, Pushparaj PN.
Show Full Abstract

Testicular cancer (TC) represents the most common cancer affecting men within the reproductive age and is often accompanied by major disturbances in semen parameters. Cryopreservation is recommended in these patients before initiating cancer treatment. Currently, there are no studies reporting the molecular mechanisms associated with altered semen quality in these men. The main objective of this study was to compare the sperm proteome of normozoospermic (motility >40%) and asthenozoospermic (motility <40%) TC patients with normozoospermic infertile men without cancer (control group). Pooled sperm samples from normozoospermic (<i>n</i> = 20), asthenozoospermic (<i>n</i> = 11) TC, and a control group (<i>n</i> = 9) were used for quantitative global proteomic profiling using liquid chromatography-tandem mass spectrometry. A total of 1085, 846, and 982 proteins were identified in normozoospermic TC, asthenozoospermic TC, and control groups, respectively. Functional analysis revealed mitochondrial dysfunction and altered cellular pathways in both normozoospermic and asthenozoospermic TC patients. Comparison of pathway analysis showed no significant difference in fertility-associated proteins/mechanism between the normozoospermic TC patients and infertile men. Western blot analysis revealed under-expression of NDUFS1 associated with mitochondrial dysfunction and overexpression of CD63 involved in sperm maturation in both normozoospermic and asthenozoospermic TC patients. Our proteomic results confirm that defective cellular pathways are associated with reproductive functions in both normozoospermic and asthenozoospermic TC patients before the start of cancer treatment.

Also flagged:Machado-Joseph diseaseMJDSCA3ataxianeurological diseasesoligonucleotide
Journal Article 2019-02-05 ✓ 1 Snippet Costa IPD, Almeida BC, Sequeiros J, Amorim A, Martins S.
In-Text Gene Mentions

In other expansion diseases, risk SNP haplotypes seem to predispose to large jumps, namely large expansions into the pathogenic range in HTT (responsible for HD) (Warby et al., 2009) and in C9orf72 (the most common known genetic cause of amyotrophic lateral sclerosis and frontotemporal lobar degeneration) (Xi et al., 2015) or large contractions into the normal range in fragile X (Maia et al., 2017).

Show Full Abstract

At least 40 human diseases are associated with repeat expansions; yet, the mutational origin and instability mechanisms remain unknown for most of them. Previously, genetic epidemiology and predisposing backgrounds for the instability of some expanding <i>loci</i> have been studied in different populations through the analysis of diversity flanking the respective pathogenic repeats. Here, we aimed at developing a pipeline to assess disease-associated haplotypes at oligonucleotide repeat <i>loci</i>, combining analysis of single nucleotide polymorphisms (SNPs) and short tandem repeats (STRs). Machado-Joseph disease (MJD/SCA3), the most frequent dominant ataxia worldwide, was used as an example of a detailed procedure. Thus, to identify genetic backgrounds that segregate with expanded/mutated alleles in MJD, we selected a set of 26 SNPs and 7 STRs flanking the causative CAG repeat. Key criteria and steps for this selection are described, and included (1) haplotype blocks minimizing the occurrence of recombination (for SNPs); and (2) match scores to increase potential for polymorphic information content of repetitive sequences found in Tandem Repeats Finder (for STRs). To directly assess SNP haplotypes in phase with MJD expansions, we optimized a strategy with preferential amplification of normal over expanded alleles, in addition to SNP allele-specific amplifications; this allowed the identification of disease-associated SNP haplotypes, even when only the proband is available in a given family. To infer STR haplotypes, we optimized a multiplex PCR, including 7 STRs plus the MJD_CAG repeat, followed by analysis of segregation or the use of the PHASE software. This protocol is a ready-to-use tool to assess MJD haplotypes in different populations. The pipeline designed can be used to assess disease-associated haplotypes in other repeat-expansion diseases. This should be of great utility to study (1) genetic epidemiology (population-of-origin, age and spreading routes of mutations) and (2) mechanisms responsible for <i>de novo</i> expansions, in these neurological diseases; (3) to detect predisposing haplotypes and (4) phenotype modifiers; (5) to help solving cases of apparent homoallelism (two same-size normal alleles) in diagnosis; and (6) to identify the best targets for the development of allele-specific therapies in ethnically diverse patient populations.

Also flagged:Mitochondrial DNA depletion syndromesgenetic disordersmitochondrialencephalomyopathic mtDNA depletion syndrome 13MTDPS13failure to thrive
Journal Article 2019-02-05 ✓ 5 Snippets Ballout RA, Al Alam C, Bonnen PE, Huemer M, El-Hattab AW, Shbarou R.
In-Text Gene Mentions

Among those, <i>FBXL4</i> mutations result in the encephalomyopathic mtDNA depletion syndrome 13 (MTDPS13; OMIM #615471), which commonly presents as a combination of failure to thrive, neurodevelopmental delays, encephalopathy, hypotonia, and persistent lactic acidosis.

FBXL4-Related Mitochondrial DNA…

…Among those,FBXL4mutations result in…

…with an underlyingFBXL4missense mutation that…

…all the pathologicalFBXL4mutations reported in…

Show Full Abstract

Mitochondrial DNA depletion syndromes (MTDPS) are a group of rare genetic disorders caused by defects in multiple genes involved in mitochondrial DNA (mtDNA) maintenance. Among those, <i>FBXL4</i> mutations result in the encephalomyopathic mtDNA depletion syndrome 13 (MTDPS13; OMIM #615471), which commonly presents as a combination of failure to thrive, neurodevelopmental delays, encephalopathy, hypotonia, and persistent lactic acidosis. We report here the case of a Lebanese infant presenting to us with profound neurodevelopmental delays, generalized hypotonia, facial dysmorphic features, and extreme emaciation. Whole-exome sequencing (WES) showed the girl as having MTDPS13 with an underlying <i>FBXL4</i> missense mutation that has been previously reported only twice in unrelated individuals (c.1303C > T). Comprehensive literature search marked our patient as being the 94th case of MTDPS13 reported to date worldwide, and the first from Lebanon. We include at the end of this report a comprehensive mutation review table of all the pathological <i>FBXL4</i> mutations reported in the literature, using it to highlight, for the first time, a possible founder effect of Arab origins to the disorder, being most prevalent in patients of Arab descent as shown in our mutation table. Finally, we provide a direct comparison of the disorder's clinical manifestations across two unrelated patients harboring the same disease-causing mutation as our patient, emphasizing the remarkable variability in genotype-to-phenotype correlation characteristic of the disease.

Also flagged:Asthmarespiratory diseaseallergypathogenesisofpulmonary diseases
Journal Article 2019-02-05 No Snippets Hernandez-Pacheco N, Pino-Yanes M, Flores C.
Show Full Abstract

Asthma is a complex respiratory disease considered as the most common chronic condition in children. A large genetic contribution to asthma susceptibility is predicted by the clustering of asthma and allergy symptoms among relatives and the large disease heritability estimated from twin studies, ranging from 55 to 90%. Genetic basis of asthma has been extensively investigated in the past 40 years using linkage analysis and candidate-gene association studies. However, the development of dense arrays for polymorphism genotyping has enabled the transition toward genome-wide association studies (GWAS), which have led the discovery of several unanticipated asthma genes in the last 11 years. Despite this, currently known risk variants identified using many thousand samples from distinct ethnicities only explain a small proportion of asthma heritability. This review examines the main findings of the last 2 years in genomic studies of asthma using GWAS and admixture mapping studies, as well as the direction of studies fostering integrative perspectives involving omics data. Additionally, we discuss the need for assessing the whole spectrum of genetic variation in association studies of asthma susceptibility, severity, and treatment response in order to further improve our knowledge of asthma genes and predictive biomarkers. Leveraging the individual's genetic information will allow a better understanding of asthma pathogenesis and will facilitate the transition toward a more precise diagnosis and treatment.

Also flagged:Hypertensioncardiovascular diseasescardiovascular disorderscoronary artery diseaseheart diseasesBP
Journal Article 2019-02-05 No Snippets Wang Y, Wang JG.
Show Full Abstract

Genome-wide association studies (GWAS) have greatly expanded our understanding of the genetic architecture of cardiovascular diseases in the past decade. They have revealed hundreds of suggestive genetic loci that replicate known biological candidate genes and indicate the existence of a previously unsuspected new biology relevant to cardiovascular disorders. These data have been used successfully to create genetic risk scores that may improve risk prediction and the identification of susceptive individuals. Furthermore, these GWAS-identified novel pathways may herald a new era of novel drug development and stratification of patients. In this review, we will briefly summarize the literature on the candidate genes and signals discovered by GWAS on hypertension and coronary artery disease and discuss their implications on clinical medicine.

Also flagged:SMPD3Sphingomyelin phosphodiesterase 3lipid-metabolizing enzymeextracellularmineralizationchondrogenesis
Journal Article 2019-02-04 ✓ 1 Snippet Manickam G, Moffatt P, Murshed M.
In-Text Gene Mentions

Sox6

Show Full Abstract

Sphingomyelin phosphodiesterase 3 (SMPD3), a lipid-metabolizing enzyme present in bone and cartilage, has important roles in the developing skeleton. We previously showed that SMPD3 deficiency results in delayed extracellular matrix (ECM) mineralization and severe skeletal deformities in an inducible knockout mouse model, <i>Smpd3<sup>flox/flox</sup></i> ; <i>Osx-Cre</i> mice, in which <i>Smpd3</i> was ablated in <i>Osx</i>-expressing chondrocytes and osteoblasts during early skeletogenesis. However, as shown in the current study, ablation of <i>Smpd3</i> postnatally in 3-month-old <i>Smpd3<sup>flox/flox</sup></i> ; <i>Osx-Cre</i> mice resulted in only a mild bone mineralization defect. Interestingly, though, there was a marked increase of unmineralized osteoid in the fractured tibiae of 3-month-old <i>Smpd3<sup>flox/flox</sup></i> ; <i>Osx-Cre</i> mice. As was the case in the embryonic bones, we also observed impaired chondrocyte apoptosis at the fracture sites of <i>Smpd3<sup>flox/flox</sup></i> ; <i>Osx-Cre</i> mice. We further examined how <i>Smpd3</i> expression is regulated in ATDC5 chondrogenic cells by two major regulators of chondrogenesis, bone morphogenetic protein 2 (BMP-2) and PTHrP. Our data show that BMP-2 positively regulates <i>Smpd3</i> expression via p38 mitogen-activated protein kinase. Taken together, our findings show that SMPD3 plays a significant role in ECM mineralization and chondrocyte apoptosis during fracture healing. Furthermore, our gene expression analyses suggest that BMP-2 and PTHrP exert opposing effects on the regulation of <i>Smpd3</i> expression in chondrocytes.

Also flagged:osteoarthritisOAinnervationnetrin-1axonal growthreceptor activator of nuclear factor kappa-B ligand
Journal Article 2019-02-04 ✓ 3 Snippets Zhu S, Zhu J, Zhen G, Hu Y, An S, Li Y, Zheng Q, Chen Z, Yang Y, Wan M, Skolasky RL, Cao Y, Wu T, Gao B, Yang M, Gao M, Kuliwaba J, Ni S, Wang L, Wu C, Findlay D, Eltzschig HK, Ouyang HW, Crane J, Zhou FQ, Guan Y, Dong X, Cao X.
In-Text Gene Mentions

…through its receptorDCC(deleted in colorectal…

…or knockdown ofDccreduces OA pain…

DCC

Show Full Abstract

Joint pain is the defining symptom of osteoarthritis (OA) but its origin and mechanisms remain unclear. Here, we investigated an unprecedented role of osteoclast-initiated subchondral bone remodeling in sensory innervation for OA pain. We show that osteoclasts secrete netrin-1 to induce sensory nerve axonal growth in subchondral bone. Reduction of osteoclast formation by knockout of receptor activator of nuclear factor kappa-B ligand (Rankl) in osteocytes inhibited the growth of sensory nerves into subchondral bone, dorsal root ganglion neuron hyperexcitability, and behavioral measures of pain hypersensitivity in OA mice. Moreover, we demonstrated a possible role for netrin-1 secreted by osteoclasts during aberrant subchondral bone remodeling in inducing sensory innervation and OA pain through its receptor DCC (deleted in colorectal cancer). Importantly, knockout of Netrin1 in tartrate-resistant acid phosphatase-positive (TRAP-positive) osteoclasts or knockdown of Dcc reduces OA pain behavior. In particular, inhibition of osteoclast activity by alendronate modifies aberrant subchondral bone remodeling and reduces innervation and pain behavior at the early stage of OA. These results suggest that intervention of the axonal guidance molecules (e.g., netrin-1) derived from aberrant subchondral bone remodeling may have therapeutic potential for OA pain.

Also flagged:axon guidance molecule receptorpolymerasemotorCCaxonsegmentations
Journal Article 2019-02-04 ✓ 5 Snippets Vosberg DE, Beaulé V, Torres-Berrío A, Cooke D, Chalupa A, Jaworska N, Cox SML, Larcher K, Zhang Y, Allard D, Durand F, Dagher A, Benkelfat C, Srour M, Tampieri D, La Piana R, Joober R, Lepore F, Rouleau G, Pascual-Leone A, Fox MD, Flores C, Leyton M, Théoret H.
In-Text Gene Mentions

Together, by identifying distinct phenotypes among DCC mutation carriers with and without MM, these findings affirm the critical role that DCC plays in the organization and function of commissural and CST fibers in humans.

These differential effects of the DCC mutation might reflect individual differences in the regionally specific expression of DCC; for example, suppression of DCC within CST neurons is not sufficient to disrupt CST crossing but selective inhibition of DCC within commissural neurons is sufficient to disrupt callosal decussation.10 More generally, phenotypic differences between the 2 DCC+/− groups may be explained by more extensive and pervasive brain regional decreases in DCC expression, as suggested by the observation here that DCC mRNA reduction was associated with MM but not the DCC+/− mutation.

To map in detail the neurocircuitry of DCC mutation–related MM, we have completed multimodal neuroimaging in 33 members of a large, 4‐generational Quebec family with a DCC frameshift mutation (NM_005215.3, c.1140 + 1G > A).

A previous report indicated that some DCC and RAD51 mutation carriers without visually apparent MM nonetheless exhibited subtle MM.40 In comparison, we did not detect any evidence of increased pMM in DCC+/−/MM− individuals.

We also provide a possible mechanism underlying the partial penetrance of MM, as a reduction in peripheral DCC mRNA expression was only associated with the presence of MM and not the DCC mutation.

Show Full Abstract

<h4>Objective</h4>Recently identified mutations of the axon guidance molecule receptor gene, DCC, present an opportunity to investigate, in living human brain, mechanisms affecting neural connectivity and the basis of mirror movements, involuntary contralateral responses that mirror voluntary unilateral actions. We hypothesized that haploinsufficient DCC<sup>+/-</sup> mutation carriers with mirror movements would exhibit decreased DCC mRNA expression, a functional ipsilateral corticospinal tract, greater "mirroring" motor representations, and reduced interhemispheric inhibition. DCC<sup>+/-</sup> mutation carriers without mirror movements might exhibit some of these features.<h4>Methods</h4>The participants (n = 52) included 13 DCC<sup>+/-</sup> mutation carriers with mirror movements, 7 DCC<sup>+/-</sup> mutation carriers without mirror movements, 13 relatives without the mutation or mirror movements, and 19 unrelated healthy volunteers. The multimodal approach comprised quantitative real time polymerase chain reaction, transcranial magnetic stimulation (TMS), functional magnetic resonance imaging (fMRI) under resting and task conditions, and measures of white matter integrity.<h4>Results</h4>Mirror movements were associated with reduced DCC mRNA expression, increased ipsilateral TMS-induced motor evoked potentials, increased fMRI responses in the mirroring M1 and cerebellum, and markedly reduced interhemispheric inhibition. The DCC<sup>+/-</sup> mutation, irrespective of mirror movements, was associated with reduced functional connectivity and white matter integrity.<h4>Interpretation</h4>Diverse connectivity abnormalities were identified in mutation carriers with and without mirror movements, but corticospinal effects and decreased peripheral DCC mRNA appeared driven by the mirror movement phenotype. ANN NEUROL 2019;85:433-442.

Also flagged:Arf6axonsendocytosisRobo1cell surfaceaxonal
Journal Article 2019-02-04 ✓ 1 Snippet Kinoshita-Kawada M, Hasegawa H, Hongu T, Yanagi S, Kanaho Y, Masai I, Mishima T, Chen X, Tsuboi Y, Rao Y, Yuasa-Kawada J, Wu JY.
In-Text Gene Mentions

DCC

Show Full Abstract

A switch in the response of commissural axons to the repellent Slit is crucial for ensuring that they cross the ventral midline only once. However, the underlying mechanisms remain to be elucidated. We have found that both endocytosis and recycling of Robo1 receptor are crucial for modulating Slit sensitivity in vertebrate commissural axons. Robo1 endocytosis and its recycling back to the cell surface maintained the stability of axonal Robo1 during Slit stimulation. We identified Arf6 guanosine triphosphatase and its activators, cytohesins, as previously unknown components in Slit-Robo1 signalling in vertebrate commissural neurons. Slit-Robo1 signalling activated Arf6. The <i>Arf6</i>-deficient mice exhibited marked defects in commissural axon midline crossing. Our data showed that a Robo1 endocytosis-triggered and Arf6-mediated positive-feedback strengthens the Slit response in commissural axons upon their midline crossing. Furthermore, the cytohesin-Arf6 pathways modulated this self-enhancement of the Slit response before and after midline crossing, resulting in a switch that reinforced robust regulation of axon midline crossing. Our study provides insights into endocytic trafficking-mediated mechanisms for spatiotemporally controlled axonal responses and uncovers new players in the midline switch in Slit responsiveness of commissural axons.

Also flagged:Intestinal ischemiasepsisleucine-rich-repeat-containing G protein-coupled receptor 5homeodomain only protein Xischemiaischemic disease
Journal Article 2019-02-04 ✓ 1 Snippet Gonzalez LM, Stewart AS, Freund J, Kucera CR, Dekaney CM, Magness ST, Blikslager AT.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Intestinal ischemia is an abdominal emergency with a mortality rate >50%, leading to epithelial barrier loss and subsequent sepsis. Epithelial renewal and repair after injury depend on intestinal epithelial stem cells (ISC) that reside within the crypts of Lieberkühn. Two ISC populations critical to epithelial repair have been described: 1) active ISC (aISC; highly proliferative; leucine-rich-repeat-containing G protein-coupled receptor 5 positive, sex determining region Y-box 9 positive) and 2) reserve ISC [rISC; less proliferative; homeodomain only protein X (Hopx)<sup>+</sup>]. Yorkshire crossbred pigs (8-10 wk old) were subjected to 1-4 h of ischemia and 1 h of reperfusion or recovery by reversible mesenteric vascular occlusion. This study was designed to evaluate whether ISC-expressing biomarkers of aISCs or rISCs show differential resistance to ischemic injury and different contributions to the subsequent repair and regenerative responses. Our data demonstrate that, following 3-4 h ischemic injury, aISC undergo apoptosis, whereas rISC are preserved. Furthermore, these rISC are retained ex vivo in spheroids in which cell populations are enriched in the rISC biomarker Hopx. These cells appear to go on to provide a proliferative pool of cells during the recovery period. Taken together, these data indicate that Hopx<sup>+</sup> cells are resistant to injury and are the likely source of epithelial renewal following prolonged ischemic injury. It is therefore possible that targeting reserve stem cells will lead to new therapies for patients with severe intestinal injury. NEW & NOTEWORTHY The population of reserve less-proliferative intestinal epithelial stem cells appears resistant to injury despite severe epithelial cell loss, including that of the active stem cell population, which results from prolonged mesenteric ischemia. These cells can change to an activated state and are likely indispensable to regenerative processes. Reserve stem cell targeted therapies may improve treatment and outcome of patients with ischemic disease.

Also flagged:PPARαretinopathyDiabetic retinopathytype 1 diabetesfenofibratedeath
Journal Article 2019-02-04 ✓ 1 Snippet Pearsall EA, Cheng R, Matsuzaki S, Zhou K, Ding L, Ahn B, Kinter M, Humphries KM, Quiambao AB, Farjo RA, Ma JX.
In-Text Gene Mentions

…antioxidant enzymes Gsm1,Prdx6and Txnrd1 were…

Show Full Abstract

Diabetic retinopathy (DR) is a common neurovascular complication of type 1 diabetes. Current therapeutics target neovascularization characteristic of end-stage disease, but are associated with significant adverse effects. Targeting early events of DR such as neurodegeneration may lead to safer and more effective approaches to treatment. Two independent prospective clinical trials unexpectedly identified that the PPARα agonist fenofibrate had unprecedented therapeutic effects in DR, but gave little insight into the physiological and molecular mechanisms of action. The objective of the present study was to evaluate potential neuroprotective effects of PPARα in DR, and subsequently to identify the responsible mechanism of action. Here we reveal that activation of PPARα had a robust protective effect on retinal function as shown by Optokinetic tracking in a rat model of type 1 diabetes, and also decreased retinal cell death, as demonstrated by a DNA fragmentation ELISA. Further, PPARα ablation exacerbated diabetes-induced decline of visual function as demonstrated by ERG analysis. We further found that PPARα improved mitochondrial efficiency in DR, and decreased ROS production and cell death in cultured retinal neurons. Oxidative stress biomarkers were elevated in diabetic Pparα-/- mice, suggesting increased oxidative stress. Mitochondrially mediated apoptosis and oxidative stress secondary to mitochondrial dysfunction contribute to neurodegeneration in DR. Taken together, these findings identify a robust neuroprotective effect for PPARα in DR, which may be due to improved mitochondrial function and subsequent alleviation of energetic deficits, oxidative stress and mitochondrially mediated apoptosis.

Also flagged:pathogenesisEhlers-Danlos syndromeClassical Ehlers-Danlos syndromecEDSconnective tissue disorderCOL5A1
Journal Article 2019-02-04 ✓ 5 Snippets Chiarelli N, Carini G, Zoppi N, Ritelli M, Colombi M.
In-Text Gene Mentions

…, VIPAS39 ,CCPG1, ATG10 ,…

…, VPS29 ,CCPG1, ATG10 ,…

…ATG10 ,CCPG1, VIPAS39 ,…

…as DNAJB7 ,CCPG1, ATG10 ,…

…gene 1 (CCPG1) encodes an…

Show Full Abstract

Classical Ehlers-Danlos syndrome (cEDS) is a dominant inherited connective tissue disorder mainly caused by mutations in the COL5A1 and COL5A2 genes encoding type V collagen (COLLV), which is a fibrillar COLL widely distributed in a variety of connective tissues. cEDS patients suffer from skin hyperextensibility, abnormal wound healing/atrophic scars, and joint hypermobility. Most of the causative variants result in a non-functional COL5A1 allele and COLLV haploinsufficiency, whilst COL5A2 mutations affect its structural integrity. To shed light into disease mechanisms involved in cEDS, we performed gene expression profiling in skin fibroblasts from four patients harboring haploinsufficient and structural mutations in both disease genes. Transcriptome profiling revealed significant changes in the expression levels of different extracellular matrix (ECM)-related genes, such as SPP1, POSTN, EDIL3, IGFBP2, and C3, which encode both matricellular and soluble proteins that are mainly involved in cell proliferation and migration, and cutaneous wound healing. These gene expression changes are consistent with our previous protein findings on in vitro fibroblasts from other cEDS patients, which exhibited reduced migration and poor wound repair owing to COLLV disorganization, altered deposition of fibronectin into ECM, and an abnormal integrin pattern. Microarray analysis also indicated the decreased expression of DNAJB7, VIPAS39, CCPG1, ATG10, SVIP, which encode molecular chaperones facilitating protein folding, enzymes regulating post-Golgi COLLs processing, and proteins acting as cargo receptors required for endoplasmic reticulum (ER) proteostasis and implicated in the autophagy process. Patients' cells also showed altered mRNA levels of many cell cycle regulating genes including CCNE2, KIF4A, MKI67, DTL, and DDIAS. Protein studies showed that aberrant COLLV expression causes the disassembly of itself and many structural ECM constituents including COLLI, COLLIII, fibronectin, and fibrillins. Our findings provide the first molecular evidence of significant gene expression changes in cEDS skin fibroblasts highlighting that defective ECM remodeling, ER homeostasis and autophagy might play a role in the pathogenesis of this connective tissue disorder.

Also flagged:gene expressioncancersmelanomaadenocarcinomaliver carcinomaprostate cancers
Journal Article 2019-02-04 No Snippets Taguchi YH.
Show Full Abstract

<h4>Background</h4>Although in silico drug discovery is necessary for drug development, two major strategies, a structure-based and ligand-based approach, have not been completely successful. Currently, the third approach, inference of drug candidates from gene expression profiles obtained from the cells treated with the compounds under study requires the use of a training dataset. Here, the purpose was to develop a new approach that does not require any pre-existing knowledge about the drug-protein interactions, but these interactions can be inferred by means of an integrated approach using gene expression profiles obtained from the cells treated with the analysed compounds and the existing data describing gene-gene interactions.<h4>Results</h4>In the present study, using tensor decomposition-based unsupervised feature extraction, which represents an extension of the recently proposed principal-component analysis-based feature extraction, gene sets and compounds with a significant dose-dependent activity were screened without any training datasets. Next, after these results were combined with the data showing perturbations in single-gene expression profiles, genes targeted by the analysed compounds were inferred. The set of target genes thus identified was shown to significantly overlap with known target genes of the compounds under study.<h4>Conclusions</h4>The method is specifically designed for large-scale datasets (including hundreds of treatments with compounds), not for conventional small-scale datasets. The obtained results indicate that two compounds that have not been extensively studied, WZ-3105 and CGP-60474, represent promising drug candidates targeting multiple cancers, including melanoma, adenocarcinoma, liver carcinoma, and breast, colon, and prostate cancers, which were analysed in this in silico study.

Also flagged:antenatal depressionmaternal depressionbehavioralemotional problemsmethylationanxiety
Journal Article 2019-02-04 No Snippets Bleker LS, Milgrom J, Sexton-Oates A, Roseboom TJ, Gemmill AW, Holt CJ, Saffery R, Burger H, de Rooij SR.
Show Full Abstract

<h4>Background</h4>Children prenatally exposed to maternal depression more often show behavioral and emotional problems compared to unexposed children, possibly through epigenetic alterations. Current evidence is largely based on animal and observational human studies. Therefore, evidence from experimental human studies is needed. In this follow-up of a small randomized controlled trial (RCT), DNA-methylation was compared between children of women who had received cognitive behavioral therapy (CBT) for antenatal depression and children of women who had received treatment as usual (TAU). Originally, 54 women were allocated to CBT or TAU. A beneficial treatment effect was found on women's mood symptoms.<h4>Findings</h4>We describe DNA methylation findings in buccal swab DNA of the 3-7-year-old children (CBT(N) = 12, TAU(N) = 11), at a genome-wide level at 770,668 CpG sites and at 729 CpG sites spanning 16 a priori selected candidate genes, including the glucocorticoid receptor (NR3C1). We additionally explored associations with women's baseline depression and anxiety symptoms and offspring DNA methylation, regardless of treatment. Children from the CBT group had overall lower DNA methylation compared to children from the TAU group (mean ∆β = - 0.028, 95% CI - 0.035 to - 0.022). Although 68% of the promoter-associated NR3C1 probes were less methylated in the CBT group, with cg26464411 as top most differentially methylated CpG site (p = 0.038), mean DNA methylation of all NR3C1 promoter-associated probes did not differ significantly between the CBT and TAU groups (mean ∆β = 0.002, 95%CI - 0.010 to 0.011). None of the effects survived correction for multiple testing. There were no differences in mean DNA methylation between the children born to women with more severe depression or anxiety compared to children born to women with mild symptoms of depression or anxiety at baseline (mean ∆β (depression) = 0.0008, 95% CI - 0.007 to 0.008; mean ∆β (anxiety) = 0.0002, 95% CI - 0.004 to 0.005).<h4>Conclusion</h4>We found preliminary evidence of a possible effect of CBT during pregnancy on widespread methylation in children's genomes and a trend toward lower methylation of a CpG site previously shown by others to be linked to depression and child maltreatment. However, none of the effects survived correction for multiple testing and larger studies are warranted.<h4>Trial registration</h4>Trial registration of the original RCT: ACTRN12607000397415 . Registered on 2 August 2007.

Also flagged:TumorSuppressorHepatocellular Carcinomacancerhistone methyltransferaseEZH2
Journal Article 2019-02-04 ✓ 3 Snippets Xu F, Li CH, Wong CH, Chen GG, Lai PBS, Shao S, Chan SL, Chen Y.
In-Text Gene Mentions

Aberrant suppression of TCAM1P-004 and RP11-598D14.1 led to loss of their tumor-suppressive effects by disrupting the interaction with IGF2BP1, HIST1H1C, and STAU1, which in turn promoted HCC development and progression.

…bound IGF2BP1 andSTAU1.…

…IGF2BP1, HIST1H1C, andSTAU1, which in turn…

Show Full Abstract

Long noncoding RNAs (lncRNA) play critical roles in the development of cancer, including hepatocellular carcinoma (HCC). However, the mechanisms underlying their deregulation remain largely unexplored. In this study, we report that two lncRNAs frequently downregulated in HCC function as tumor suppressors and are epigenetically silenced by histone methyltransferase EZH2. lncRNAs TCAM1P-004 and RP11-598D14.1 were inhibited by EZH-mediated trimethylation of H3K27me3 at their promoters. Downregulation of TCAM1P-004 and RP11-598D14.1 was frequently observed in HCC tumors compared with adjacent normal tissues. Both lncRNAs inhibited cell growth, cell survival, and transformation in HCC cells <i>in vitro</i> as well as tumor formation <i>in vivo</i>. Using RNA pull-down and mass spectrometry, we demonstrated that TCAM1P-004 bound IGF2BP1 and HIST1H1C, whereas RP11-598D14.1 bound IGF2BP1 and STAU1. These lncRNA-protein interactions were critical in regulating p53, MAPK, and HIF1α pathways that promoted cell proliferation in HCC. Overexpression of EZH2 was critical in repressing TCAM1P-004 and RP11-598D14.1, and EZH2-TCAM1P-004/RP11-598D14.1-regulated pathways were prevalent in human HCC. Aberrant suppression of TCAM1P-004 and RP11-598D14.1 led to loss of their tumor-suppressive effects by disrupting the interaction with IGF2BP1, HIST1H1C, and STAU1, which in turn promoted HCC development and progression. Collectively, these findings demonstrate the role of TCAMP1P-004 and RP11-598D14.1 in suppressing tumor growth and suggest that EZH2 may serve as a therapeutic target in HCC. SIGNIFICANCE: EZH2-mediated loss of lncRNAs TCAM1P-004 and RP11-598D14.1 hinders the formation of tumor suppressor lncRNA-protein complexes and subsequently promotes HCC growth.

Also flagged:methylationdepressionBDNFSLC6A4hypermethylationssynthesis
Journal Article 2019-02-04 No Snippets Li M, D'Arcy C, Li X, Zhang T, Joober R, Meng X.
Show Full Abstract

There has been a limited number of systematic reviews conducted to summarize the overview of the relationship between DNA methylation and depression, and to critically appraise the roles of major study characteristics in the accuracy of study findings. This systematic review aims to critically appraise the impact of study characteristics on the association between DNA methylation and depression, and summarize the overview of this association. Electronic databases and gray literatures until December 2017 were searched for English-language studies with standard diagnostic criteria of depression. A total of 67 studies were included in this review along with a summary of their study characteristics. We grouped the findings into etiological and treatment studies. Majority of these selected studies were recently published and from developed countries. Whole blood samples were the most studied common tissues. Bisulfite conversion, along with pyrosequencing, was widely used to test the DNA methylation level across all the studies. High heterogeneity existed among the studies in terms of experimental and statistical methodologies and study designs. As recommended by the Cochrane guideline, a systematic review without meta-analysis should be undertaken. This review has, in general, found that DNA methylation modifications were associated with depression. Subgroup analyses showed that most studies found BDNF and SLC6A4 hypermethylations to be associated with MDD or depression in general. In contrast, studies on NR3C1, OXTR, and other genes, which were tested by only few studies, reported mixed findings. More longitudinal studies using standardized experimental and laboratory methodologies are needed in future studies to enable more systematical comparisons and quantitative synthesis.

Also flagged:SLEFOXP2CYLC2MTNR1BPHF2heart disease
Journal Article 2019-02-04 ✓ 4 Snippets Arnau-Soler A, Macdonald-Dunlop E, Adams MJ, Clarke TK, MacIntyre DJ, Milburn K, Navrady L, Generation Scotland, Major Depressive Disorder Working Group of the Psychiatric Genomics Consortium, Hayward C, McIntosh AM, Thomson PA.
In-Text Gene Mentions

…UK Biobank (DCC, ACSS3, DRD2, STAG1,…

…10 −6 ;DCC, p =…

…with PHQ (DCC, ACSS3 ,…

…includes UKB (DCC, p =…

Show Full Abstract

Stress is associated with poorer physical and mental health. To improve our understanding of this link, we performed genome-wide association studies (GWAS) of depressive symptoms and genome-wide by environment interaction studies (GWEIS) of depressive symptoms and stressful life events (SLE) in two UK population-based cohorts (Generation Scotland and UK Biobank). No SNP was individually significant in either GWAS, but gene-based tests identified six genes associated with depressive symptoms in UK Biobank (DCC, ACSS3, DRD2, STAG1, FOXP2 and KYNU; p < 2.77 × 10<sup>-6</sup>). Two SNPs with genome-wide significant GxE effects were identified by GWEIS in Generation Scotland: rs12789145 (53-kb downstream PIWIL4; p = 4.95 × 10<sup>-9</sup>; total SLE) and rs17070072 (intronic to ZCCHC2; p = 1.46 × 10<sup>-8</sup>; dependent SLE). A third locus upstream CYLC2 (rs12000047 and rs12005200, p < 2.00 × 10<sup>-8</sup>; dependent SLE) when the joint effect of the SNP main and GxE effects was considered. GWEIS gene-based tests identified: MTNR1B with GxE effect with dependent SLE in Generation Scotland; and PHF2 with the joint effect in UK Biobank (p < 2.77 × 10<sup>-6</sup>). Polygenic risk scores (PRSs) analyses incorporating GxE effects improved the prediction of depressive symptom scores, when using weights derived from either the UK Biobank GWAS of depressive symptoms (p = 0.01) or the PGC GWAS of major depressive disorder (p = 5.91 × 10<sup>-3</sup>). Using an independent sample, PRS derived using GWEIS GxE effects provided evidence of shared aetiologies between depressive symptoms and schizotypal personality, heart disease and COPD. Further such studies are required and may result in improved treatments for depression and other stress-related conditions.

Also flagged:alcoholalcohol use disordersPDE4CNAF1FSTL5PRKG2
Journal Article 2019-02-04 ✓ 1 Snippet Peng Q, Bizon C, Gizer IR, Wilhelmsen KC, Ehlers CL.
In-Text Gene Mentions

…nonsynonymous variants inZNF644.…

Show Full Abstract

A limited number of genetic variants have been identified in traditional GWAS as risk or protective factors for alcohol use disorders (AUD) and related phenotypes. We herein report whole-genome association and rare-variant analyses on AUD traits in American Indians (AI) and European Americans (EA). We evaluated 742 AIs and 1711 EAs using low-coverage whole-genome sequencing. Phenotypes included: (1) a metric based on the occurrence of 36 alcohol-related life events that reflect AUD severity; (2) two alcohol-induced affective symptoms that accompany severe AUDs. We identified two new loci for alcohol-related life events with converging evidence from both cohorts: rare variants of K<sub>2P</sub> channel gene KCNK2, and rare missense and splice-site variants in pro-inflammatory mediator gene PDE4C. A NAF1-FSTL5 intergenic variant and an FSTL5 variant were respectively associated with alcohol-related life events in AI and EA. PRKG2 of serine/threonine protein kinase family, and rare variants in interleukin subunit gene EBI3 (IL-27B) were uniquely associated with alcohol-induced affective symptoms in AI. LncRNA LINC02347 on 12q24.32 was uniquely associated with alcohol-induced depression in EA. The top GWAS findings were primarily rare/low-frequency variants in AI, and common variants in EA. Adrenal gland was the most enriched in tissue-specific gene expression analysis for alcohol-related life events, and nucleus accumbens was the most enriched for alcohol-induced affective states in AI. Prefrontal cortex was the most enriched in EA for both traits. These studies suggest that whole-genome sequencing can identify novel, especially uncommon, variants associated with severe AUD phenotypes although the findings may be population specific.

Also flagged:Dental carieshypersensitivityphosphopeptidecalcium phosphateACPcalcium
Journal Article 2019-02-04 No Snippets Fernando JR, Shen P, Sim CPC, Chen YY, Walker GD, Yuan Y, Reynolds C, Stanton DP, MacRae CM, Reynolds EC.
Show Full Abstract

Dental caries, erosion and hypersensitivity are major public health problems. SnF<sub>2</sub> is used widely in oral care products to help prevent/treat these conditions. Casein phosphopeptide-stabilised amorphous calcium phosphate nanocomplexes (CPP-ACP) are a biomimetic nanotechnology of salivary phosphopeptide-ACP complexes that deliver bioavailable calcium and phosphate ions to promote dental remineralisation (repair). We show here using in vitro studies and a double-blind, randomised controlled, cross-over design in situ clinical trial that SnF<sub>2</sub> and CPP-ACP interact to form a nanofilament coating on the tooth surface and that together they are superior in their ability to promote dental remineralisation. Sn(II) by cross-linking the CPP-ACP helps to stabilise the complexes which improves delivery to the tooth surface and enhances binding and ion incorporation into tooth mineral. The combination of SnF<sub>2</sub> and CPP-ACP in oral care products may significantly improve their efficacy in prevention/treatment of dental caries/erosion and hypersensitivity.

Also flagged:opaopaAaopaBopaCopaDopaAaAb
Journal Article 2019-02-04 No Snippets Kasai D, Iwasaki T, Nagai K, Araki N, Nishi T, Fukuda M.
Show Full Abstract

Pseudomonas sp. strain PTH10 can utilize o-phthalate which is a key intermediate in the bacterial degradation of some polycyclic aromatic hydrocarbons. In this strain, o-phthalate is degraded to 2,3-dihydroxybenzoate and further metabolized via the 2,3-dihydroxybenzoate meta-cleavage pathway. Here, the opa genes which are involved in the o-phthalate catabolism were identified. Based on the enzymatic activity of the opa gene products, opaAaAbAcAd, opaB, opaC, and opaD were found to code for o-phthalate 2,3-dioxygenase, dihydrodiol dehydrogenase, 2,3-dihydroxybenzoate 3,4-dioxygenase, and 3-carboxy-2-hydroxymuconate-6-semialdehyde decarboxylase, respectively. Collectively, these enzymes are thought to catalyze the conversion of o-phthalate to 2-hydroxymuconate-6-semialdehyde. Deletion mutants of the above opa genes indicated that their products were required for the utilization of o-phthalate. Transcriptional analysis showed that the opa genes were organized in the same transcriptional unit. Quantitative analysis of opaAa, opaB, opaC, opaD, opaE, and opaN revealed that, except for opaB and opaC, all other genes were transcriptionally induced during growth on o-phthalate. The constitutive expression of opaB and opaC, and the transcriptional induction of opaD located downstream of opaB, suggest several possible internal promoters are existence in the opa cluster. Together, these results strongly suggest that the opa genes are involved in a novel o-phthalate catabolic pathway in strain PTH10.

Also flagged:dammarane triterpenescell proliferationagingsarcopeniaAMP-activated protein kinaseAMPK
Journal Article 2019-02-04 No Snippets Ha TKQ, Pham HTT, Cho HM, Tran VO, Yang JL, Jung DW, Williams DR, Oh WK.
Show Full Abstract

The aging population is growing rapidly around the world and there is also an increase in sarcopenia, which is characterized by decreased muscle mass, strength and function in the elderly population. AMP-activated protein kinase (AMPK) is an essential sensor and regulator of glucose, lipid and energy metabolism throughout the body. Previous studies have shown that AMPK pathway activation by regular exercise and appropriate dietary control have beneficial effects on skeletal muscle. In the process of searching for new AMPK activators from medicinal plants, we isolated and characterized eight new 12,23-dione dammarane triterpenoids (1-3 and 5-9), as well as one known gypentonoside A from Gynostemma longipes. When all isolates were tested for their AMPK activation activities, seven compounds (1 and 3-8) were significantly activated AMPK phosphorylation in mouse C2C12 skeletal muscle cell lines. Since G. longipes contained a significant amount of active compound 1 (over 2.08% per dried raw plant), it suggested the potential of this plant to be developed as a functional food or botanical drug that enhances muscle proliferation by activating AMPK signaling pathways.

Also flagged:depressionMajor depressionpsychiatric illnessMajor Depressive Disorderanxietybipolar disorder
Journal Article 2019-02-04 ✓ 4 Snippets Howard DM, Adams MJ, Clarke TK, Hafferty JD, Gibson J, Shirali M, Coleman JRI, Hagenaars SP, Ward J, Wigmore EM, Alloza C, Shen X, Barbu MC, Xu EY, Whalley HC, Marioni RE, Porteous DJ, Davies G, Deary IJ, Hemani G, Berger K, Teismann H, Rawal R, Arolt V, Baune BT, Dannlowski U, Domschke K, Tian C, Hinds DA, 23andMe Research Team, Major Depressive Disorder Working Group of the Psychiatric Genomics Consortium, Trzaskowski M, Byrne EM, Ripke S, Smith DJ, Sullivan PF, Wray NR, Breen G, Lewis CM, McIntosh AM.
In-Text Gene Mentions

NEGR1

vaccinia-related kinase 2

VRK2

CACNA1E

Show Full Abstract

Major depression is a debilitating psychiatric illness that is typically associated with low mood and anhedonia. Depression has a heritable component that has remained difficult to elucidate with current sample sizes due to the polygenic nature of the disorder. To maximize sample size, we meta-analyzed data on 807,553 individuals (246,363 cases and 561,190 controls) from the three largest genome-wide association studies of depression. We identified 102 independent variants, 269 genes, and 15 genesets associated with depression, including both genes and gene pathways associated with synaptic structure and neurotransmission. An enrichment analysis provided further evidence of the importance of prefrontal brain regions. In an independent replication sample of 1,306,354 individuals (414,055 cases and 892,299 controls), 87 of the 102 associated variants were significant after multiple testing correction. These findings advance our understanding of the complex genetic architecture of depression and provide several future avenues for understanding etiology and developing new treatment approaches.

Also flagged:transforming growth factor-beta 1alkaline phosphataseMidazolambone morphogenetic protein 2differentiationdentin phosphoprotein
Journal Article 2019-02-04 No Snippets Karakida T, Onuma K, Saito MM, Yamamoto R, Chiba T, Chiba R, Hidaka Y, Fujii-Abe K, Kawahara H, Yamakoshi Y.
Show Full Abstract

Drug repositioning promises the advantages of reducing costs and expediting approvalschedules. An induction of the anesthetic and sedative drug; midazolam (MDZ), regulatesinhibitory neurotransmitters in the vertebrate nervous system. In this study we show the potentialfor drug repositioning of MDZ for dentin regeneration. A porcine dental pulp-derived cell line(PPU-7) that we established was cultured in MDZ-only, the combination of MDZ with bonemorphogenetic protein 2, and the combination of MDZ with transforming growth factor-beta 1. Thedifferentiation of PPU-7 into odontoblasts was investigated at the cell biological and genetic level.Mineralized nodules formed in PPU-7 were characterized at the protein and crystal engineeringlevels. The MDZ-only treatment enhanced the alkaline phosphatase activity and mRNA levels ofodontoblast differentiation marker genes, and precipitated nodule formation containing a dentinspecificprotein (dentin phosphoprotein). The nodules consisted of randomly orientedhydroxyapatite nanorods and nanoparticles. The morphology, orientation, and chemicalcomposition of the hydroxyapatite crystals were similar to those of hydroxyapatite that hadtransformed from amorphous calcium phosphate nanoparticles, as well as the hydroxyapatite inhuman molar dentin. Our investigation showed that a combination of MDZ and PPU-7 cellspossesses high potential of drug repositioning for dentin regeneration.

Also flagged:radiocarboncollagenpeptidequartzCarbonoxygen
Journal Article 2019-02-04 No Snippets Garrison EG, Morgan GS, McGrath K, Speller C, Cherkinsky A.
Show Full Abstract

The Atlantic gray whale (<i>Eschrichtius robustus</i>) presents an interesting case study of climate related dispersal and extinction. While (limited) fossil records confirm its presence in the Atlantic up until the 18th Century, its abundance and distribution within the Eastern and Western basins are still not well understood. The discovery of presumed gray whale fossil remains from the Georgia Bight and the Atlantic coast of Florida, from the mid-1980s to late-2000s, provides a new opportunity to recover additional data regarding their chronology within the Western basin. Here, we apply accelerator mass spectrometry radiocarbon techniques to six fossil whale finds, identifying dates within marine isotope stage 3 (59-24 ka) and the late Holocene, ∼2,000 yr BP. We additionally confirm the taxonomic identification of two fossil bone samples as <i>E. robustus</i> using collagen peptide mass fingerprinting (ZooMS). The obtained dates, when combined with a larger corpus of previously published Atlantic gray whale fossil dates, support the hypothesis for the decline of the Atlantic gray whale in the late Pleistocene and the late Holocene. These new data augment the findings of the Eastern Atlantic Basin and better incorporate the Western Atlantic Basin into a pan-ocean understanding for the species.

Preprints.org 2019-02-04 Preprint (No Snippets API) Adenomon MO, Mbuk JJ, Yahaya HU.
Show Full Abstract

The aim of this research work was to provide model for predicting stock volatility in Nigeria Stock market. To achieve this, monthly data for Nigerian stock exchange, Exchange rate, Share index and inflation rate was collected for a period of January 1990 to December 2016.The descriptive statistics revealed these variables to exhibit volatility as a characteristics of financial time &ndash;varying series. DCC Model was fitted, were the coefficients for all the parameters and that of the correlation-Targeting (rho_21) are both negative and positive and tend very close to 1 and -1, indicating that high persistence in the conditional variances. The Model DCC, satisfied the properties of a good model of conditional mean and variance of the confidential Interval (C.I) of 1 and -1, that is, the conditional variances are finites and their series are strictly stationary. This therefore implies that the Nigerian Stock Exchange, Exchange rate, share index and Inflation rate will experience a non-steady shock in the Stock market. However Each of these variables have different length of recovery (volatility half- life)&nbsp; ranging from 1.5month, 6.5months, 6months to 2,4months&nbsp;&nbsp; for stock exchange, exchange rate, share index and inflation rate respectively. By implication, the volatility of these variables had a long memory, persistence and mean-reverting.

Also flagged:LOXACSL5pancreatic cancerSLC44A4TOX3tumor
Journal Article 2019-02-03 No Snippets Ma W, Li T, Wu S, Li J, Wang X, Li H.
Show Full Abstract

Pancreatic cancer is one of the most malignant diseases and has a poor prognosis. The screening and validation of biomarkers with predictive value for prognosis and treatment efficacy are important. To identify potential prognostic markers of pancreatic cancer patients, we conducted a study that included 99 pancreatic cancer patients. Three patients with PFS>18 months were enrolled in the treat group, and three patients with PFS<12 months were enrolled in the control group. Differentially expressed genes (DEGs) between these two groups were analyzed by whole-genome expression microarray. A total of 178 DEGs were identified, including 110 up-regulated and 68 down-regulated genes. Next, 24 candidate genes were selected for validation by qPCR based on fold change and previous studies. The results showed that the mRNA levels of four candidate genes, including ACSL5, SLC44A4, LOX, and TOX3, were correlated with PFS. Immunohistochemical staining was performed to validate the protein expression levels of these four markers. The results showed that patients with LOX <sup>high</sup>, ACSL5 <sup>low</sup> and TOX3 <sup>low</sup> expression had a significantly shorter PFS than those with LOX <sup>low</sup>, ACSL5 <sup>high</sup> and TOX3 <sup>high</sup> expression. Multivariable analysis revealed differentiation, tumor stage, LOX expression, and ACSL5 expression were independent prognostic factors for PFS. Then, we use the TCGA database to explore the underlying mechanism of LOX influence pancreatic cancer progression. Protein-protein interaction network of ACSL5 was established by STRING to uncover the potential regulation mechanism. Our findings reveal that LOX and ACSL5 are potential prognostic markers for the prognosis of pancreatic cancer patients.

Also flagged:pyrazolMethylEthylmalonamidesynthesisphenyl
Journal Article 2019-02-03 No Snippets Li QB, Liao M, Liu Q, Feng T, Xu ZY, Rui CH, Liu SZ.
Show Full Abstract

New 1,3,5-trimethylpyrazole-containing malonamide derivatives based on pyflubumide were designed, synthesized, and characterized using ¹H-NMR, <sup>13</sup>C-NMR, and high-resolution mass spectra (HRMS). The results of preliminary bioassays showed that the target compounds possessed good activities against <i>Tetranychus cinnabarinus</i>, <i>Plutella xylostella</i>, and <i>Aphis craccivora</i>. Most of the target compounds exhibited moderate to good acaricidal activity against <i>Tetranychus cinnabarinus</i> at a concentration of 400 µg/mL, and some showed moderate activity at a concentration of 200 µg/mL; in particular, compounds <b>8m</b> and <b>8p</b> exhibited 70.0% mortality. In addition, some of the target compounds exhibited good insecticidal activities against <i>Plutella xylostella</i> at a concentration of 200 µg/mL, especially compounds <b>8i</b> and <b>8o,</b> which achieved 100.0% mortality at a concentration of 100 µg/mL. Interestingly, some of the target compounds exhibited potent anti-aphid activity against <i>Aphis craccivora</i> at a concentration of 200 µg/mL; furthermore, compounds <b>8p</b> and <b>8q</b> demonstrated 100.0% anti-aphid activity at a concentration of 50 µg/mL. The preliminary analyses of the structure⁻activity relationships (SAR) indicated that the acaricidal and insecticidal activities varied significantly depending on the type of substituent and substitution pattern, which provides guidance for the further investigation of such structural modifications.

Also flagged:Peroxiredoxin 6Peroxiredoxinsglutathione peroxidasesoxygenthiolperoxidases
Journal Article 2019-02-02 ✓ 5 Snippets Shahnaj S, Chowhan RK, Meetei PA, Kakchingtabam P, Herojit Singh K, Rajendrakumar Singh L, Nongdam P, Fisher AB, Rahaman H.
In-Text Gene Mentions

Prdx6 has three tryptophan (Trp) residues, Trp33, Trp82 and Trp181.

However, it seems that the hyperoxidation of Prdx6 did not affect the overall dynamics or stability of the protein, indeed, it somehow disrupted the packing of the hydrophobic core, leading to solvent exposition of hydrophobic amino acids as evidenced by the higher gyration radii, SASA profile, and ANS fluorescence of hyperoxidized Prdx6 as compared to reduced Prdx6.

The solvent exposure of these Trp residues under different redox conditions is assessed by measuring tryptophan fluorescence of reduced and hyperoxidized Prdx6.

Such exposure of hydrophobic amino acids in oxidized Prdx6, suggests conformational alterations with opening of the hydrophobic core.

The complete sequence of rat Prdx6 (consisting of 224 amino acids) was retrieved from UniProtKB database (accession number O35244).

Show Full Abstract

Peroxiredoxins(Prdx), the family of non-selenium glutathione peroxidases, are important antioxidant enzymes that defend our system from the toxic reactive oxygen species (ROS). They are thiol-based peroxidases that utilize self-oxidation of their peroxidatic cysteine (C<sub>p</sub>) group to reduce peroxides and peroxidized biomolecules. However, because of its high affinity for hydrogen peroxide this peroxidatic cysteine moiety is extremely susceptible to hyperoxidation, forming peroxidase inactive sulfinic acid (Cys-SO₂H) and sulfonic acid (Cys-SO₃H) derivatives. With the exception of peroxiredoxin 6 (Prdx6), hyperoxidized sulfinic forms of Prdx can be reversed to restore peroxidase activity by the ATP-dependent enzyme sulfiredoxin. Interestingly, hyperoxidized Prdx6 protein seems to have physiological significance as hyperoxidation has been reported to dramatically upregulate its calcium independent phospholipase A₂ activity. Using biochemical studies and molecular dynamic (MD) simulation, we investigated the roles of thermodynamic, structural and internal flexibility of Prdx6 to comprehend the structural alteration of the protein in the oxidized state. We observed the loosening of the hydrophobic core of the enzyme in its secondary and tertiary structures. These changes do not affect the internal dynamics of the protein (as indicated by root-mean-square deviation, RMSD and root mean square fluctuation, RMSF plots). Native-PAGE and dynamic light scattering experiments revealed the formation of higher oligomers of Prdx6 under hyperoxidation. Our study demonstrates that post translational modification (like hyperoxidation) in Prdx6 can result in major alterations of its multimeric status.

Also flagged:behavioraldefensetransient receptor potential (TRP) channelscamphorTRP channelsRuthenium red
Journal Article 2019-02-02 No Snippets Ishikawa DT, Vizin RCL, Souza CO, Carrettiero DC, Romanovsky AA, Almeida MC.
Show Full Abstract

Thermoregulatory grooming, a behavioral defense against heat, is known to be driven by skin-temperature signals. Because at least some thermal cutaneous signals that drive heat defenses are likely to be generated by transient receptor potential (TRP) channels, we hypothesized that warmth-sensitive TRPs drive thermoregulatory grooming. Adult male Wistar rats were used. We showed that camphor, a nonselective agonist of several TRP channels, including vanilloid (V) 3, when applied epidermally to the back (500 mg/kg), caused a pronounced self-grooming response, including paw-licking and snout- and chest-"washing". By the percentage of time spent grooming, the response was similar to the thermoregulatory grooming observed during exposure to ambient warmth (32 °C). Ruthenium red (a non-selective antagonist of TRP channels, including TRPV3), when administered intravenously at a dose of 0.1 mg/kg, attenuated the self-grooming behavior induced by either ambient warmth or epidermal camphor. Furthermore, the intravenous administration of AMG8432 (40 mg/kg), a relatively selective TRPV3 antagonist, also attenuated the self-grooming response to epidermal camphor. We conclude that camphor causes the self-grooming behavior by acting on TRP channels in the skin. We propose that cutaneous warmth signals mediated by TRP channels, possibly including TRPV3, drive thermoregulatory self-grooming in rats.

Also flagged:immunoglobulinRIGrabiesdeath
Journal Article 2019-02-02 No Snippets Tran CH, Afriyie DO, Pham TN, Otsu S, Urabe M, Dang AD, Tran HGT, Nguyen HV, Le HT, Nguyen HTT.
Show Full Abstract

<h4>Background</h4>Adhering to post-exposure prophylaxis (PEP): wound treatment, vaccine, and rabies immunoglobulin (RIG) is a crucial step in preventing rabies mortality. When PEP is widely available, a lack of adherence to the recommended treatment guidelines can also lead to death. Our objective was to understand characteristics associated with adherence to the vaccine regimen and RIG in Vietnam.<h4>Methods</h4>We obtained individual-level data on PEP adherence from registries at 10 sites located in five provinces. From these registries, we extracted epidemiologic characteristics of patients including the timing of PEP initiation and completion. We used descriptive analyses and logistic regression to examine patient characteristics associated with initiation and completion of RIG and vaccine. Based on reported rabies mortality, the government defined provincial rabies burden as medium-burden (<5 and >2 deaths) and high-burden (≥5 deaths).<h4>Results</h4>During 2014-2016, 15,646 patients received PEP in our study. Among 14,296 vaccinated patients, only 41.4% (5847) completed their five-dose intramuscular (IM) injections and 81.6% (133) of patients completed their eight-dose intradermal (ID) injections. Approximately 26% of patients received RIG. Patient characteristics associated with vaccine completion were females (44%), <15 years of age (44%), category 1 exposure (68%, bite location on leg (46%), bite from bat (56%), bite from a healthy animal (45%), high-burden province (86%), and district preventive center (49%). Disparities were revealed among provinces, with high-burden provinces having highest (86%) and lowest (7%) vaccine completion rates.<h4>Conclusions and relevance</h4>Vietnam has made tremendous progress towards reducing the burden of rabies. However, despite the wide availability of PEP, we found relatively low rates of vaccine completion. Our findings suggest provider training and patient education is needed to ensure appropriate treatment is completed. Moreover, our data suggest changes to information reported through the national surveillance system for monitoring good clinical practice for rabies prevention and control.

Also flagged:BEdysplasiaBarrettgastro-oesophageal reflux diseaseoesophageal adenocarcinomaneoplasia
Journal Article 2019-02-02 ✓ 1 Snippet Trindade AJ, McKinley MJ, Alshelleh M, Levi G, Stewart M, Quinn KJ, Thomas RM.
In-Text Gene Mentions

…NME1), 18q (SMAD4,DCC), 21q (TFF1, PSEN2)…

Show Full Abstract

<h4>Background and aims</h4>Mutational load (ML) has been shown to help risk-stratify those that may progress from non-dysplastic Barrett's oesophagus (BE) to dysplastic disease. Management of patients with BE and indefinite for dysplasia (BE-IND) is challenging and risk stratification tools are lacking. The aim of this pilot study is to evaluate the utility of ML for risk stratification in patients with BE-IND.<h4>Methods</h4>This is a single-centre, retrospective pilot study evaluating ML quantification in patients with BE-IND. Histology at follow-up endoscopy at least 1 year after the baseline endoscopy was used to determine if a patient progressed to low or high dysplasia. The ML levels were then compared among patients who progressed to dysplasia versus those who did not.<h4>Results</h4>Thirty-five patients who met the inclusion criteria were identified, and seven met the exclusion criteria. Twenty-eight patients were analysed, of whom eight progressed to low-grade dysplasia (6) and high-grade dysplasia (2). Seven of these eight patients had some level of genomic instability detected in their IND biopsy (ML ≥0.5). Ten of the 20 (50%) who did not progress had no ML level. At an ML cut-off above 1.5, the risk of progression to high-grade dysplasia was 33% vs 0% (p=0.005), with a sensitivity of 100% and a specificity of 85%.<h4>Conclusion</h4>These results indicate that ML may be able to risk-stratify progression to high-grade dysplasia in BE-IND. Larger studies are needed to confirm these findings.

Also flagged:senile dementiaADADApathogenesissignal transductionAGTR1
Journal Article 2019-02-02 ✓ 3 Snippets Pang C, Yang H, Hu B, Wang S, Chen M, Cohen DS, Chen HS, Jarrell JT, Carpenter KA, Rosin ER, Huang X.
In-Text Gene Mentions

…alcium dyshomeostasis (CACNB2,CACNA1E).…

…the CACNB2 andCACNA1Eproteins, which are…

…of genes (CACNB2,CACNA1E) correlate with the…

Show Full Abstract

<h4>Background</h4>Alzheimer's disease (AD) is the most common form of senile dementia. However, its pathological mechanisms are not fully understood. In order to comprehend AD pathological mechanisms, researchers employed AD-related DNA microarray data and diverse computational algorithms. More efficient computational algorithms are needed to process DNA microarray data for identifying AD-related candidate genes.<h4>Methods</h4>In this paper, we propose a specific algorithm that is based on the following observation: When an acrobat walks along a steel-wire, his/her body must have some swing; if the swing can be controlled, then the acrobat can maintain the body balance. Otherwise, the acrobat will fall. Based on this simple idea, we have designed a simple, yet practical, algorithm termed as the Amplitude Deviation Algorithm (ADA). Deviation, overall deviation, deviation amplitude, and 3δ are introduced to characterize ADA.<h4>Results</h4>52 candidate genes for AD have been identified via ADA. The implications for some of the AD candidate genes in AD pathogenesis have been discussed.<h4>Conclusions</h4>Through the analysis of these AD candidate genes, we believe that AD pathogenesis may be related to the abnormality of signal transduction (AGTR1 and PTAFR), the decrease in protein transport capacity (COL5A2 (221729_at), COL5A2 (221730_at), COL4A1), the impairment of axon repair (CNR1), and the intracellular calcium dyshomeostasis (CACNB2, CACNA1E). However, their potential implication for AD pathology should be further validated by wet lab experiments as they were only identified by computation using ADA.

Also flagged:Chromosomecohesingene expressionchromosomescell cycleCSF
Journal Article 2019-02-01 ✓ 5 Snippets da Silva EML, Rankin S.
In-Text Gene Mentions

…the Cohesin andCondensinprotein complexes.…

…In contrast,Condensinis active largely…

…both Cohesin andCondensin.…

…nuclear proteins, includingCondensinand Cohesin, sufficient…

…for Cohesin andCondensinfunction using Xenopus…

Show Full Abstract

Chromosome structure in both interphase and M-phase cells is strongly influenced by the action of the cohesin and condensin protein complexes. The cohesin complex tethers the identical copies of each chromosome, called sister chromatids, together following DNA replication and promotes normal interphase chromosome structure and gene expression. In contrast, condensin is active largely in M phase and promotes the compaction of individual chromosomes. The <i>Xenopus</i> egg extract system is uniquely suited to analyze the functions of both complexes. Egg extracts, in which the cell cycle state can be manipulated, contain stockpiles of nuclear proteins (including condensin and cohesin) sufficient for the assembly of thousands of nuclei per microliter. Extract prepared from unfertilized eggs is arrested by the presence of cytostatic factor (CSF) in a state with high levels of M-phase kinase activity, but can be stimulated to enter interphase, in which DNA replication occurs spontaneously. For cohesion assays, demembranated sperm nuclei are incubated in interphase extract, where they undergo rapid and synchronous DNA replication and cohesion establishment through the recruitment of proteins and other factors (e.g., nucleotides) from the extract. Sister chromatid cohesion is assessed by then driving the extract into M phase by the addition of fresh CSF-arrested extract. In contrast, because chromosome condensation occurs spontaneously in M-phase extracts, sperm nuclei are added directly to CSF extracts to assay condensation.

Also flagged:Synthesisinsulinpeptidepeptidesisoacyl dipeptidespentalysine
Journal Article 2019-02-01 No Snippets Disotuar MM, Petersen ME, Nogueira JM, Kay MS, Chou DH.
Show Full Abstract

The introduction of solid-phase peptide synthesis in the 1960s improved the chemical synthesis of both the A- and B-chains of insulin and insulin analogs. However, the subsequent elaboration of the synthetic peptides to generate active hormones continues to be difficult and complex due in part to the hydrophobicity of the A-chain. Over the past decade, several groups have developed different methods to enhance A-chain solubility. Two of the most popular methods are use of isoacyl dipeptides, and the attachment of an A-chain C-terminal pentalysine tag with a base-labile 4-hydroxymethylbenzoic acid linker. These methods have proven effective but can be limited in scope depending on the peptide sequence of a specific insulin. Herein we describe an auxiliary approach to enhance the solubility of insulin-based peptides by incorporating a tri-lysine tag attached to a cleavable Fmoc-Ddae-OH linker. Incorporation of this linker, or "helping hand", on the N-terminus greatly improved the solubility of chicken insulin A-chain, which is analogous to human insulin, and allowed for coupling of the insulin A- and B-chain via directed disulfide bond formation. After formation of the insulin heterodimer, the linker and tag could be easily removed using a hydrazine buffer (pH 7.5) to obtain an overall 12.6% yield based on A-chain. This strategy offers an efficient method to enhance the solubility of hydrophobic insulin-based peptides as well as other traditionally difficult peptides.

Also flagged:Cancercytotoxic T-lymphocyte-associated protein 4CTLA-4programmed death 1PD-1antibodies
Journal Article 2019-02-01 ✓ 1 Snippet Chang LS, Barroso-Sousa R, Tolaney SM, Hodi FS, Kaiser UB, Min L.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Immune checkpoints are small molecules expressed by immune cells that play critical roles in maintaining immune homeostasis. Targeting the immune checkpoints cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) and programmed death 1 (PD-1) with inhibitory antibodies has demonstrated effective and durable antitumor activity in subgroups of patients with cancer. The US Food and Drug Administration has approved several immune checkpoint inhibitors (ICPis) for the treatment of a broad spectrum of malignancies. Endocrinopathies have emerged as one of the most common immune-related adverse events (irAEs) of ICPi therapy. Hypophysitis, thyroid dysfunction, insulin-deficient diabetes mellitus, and primary adrenal insufficiency have been reported as irAEs due to ICPi therapy. Hypophysitis is particularly associated with anti-CTLA-4 therapy, whereas thyroid dysfunction is particularly associated with anti-PD-1 therapy. Diabetes mellitus and primary adrenal insufficiency are rare endocrine toxicities associated with ICPi therapy but can be life-threatening if not promptly recognized and treated. Notably, combination anti-CTLA-4 and anti-PD-1 therapy is associated with the highest incidence of ICPi-related endocrinopathies. The precise mechanisms underlying these endocrine irAEs remain to be elucidated. Most ICPi-related endocrinopathies occur within 12 weeks after the initiation of ICPi therapy, but several have been reported to develop several months to years after ICPi initiation. Some ICPi-related endocrinopathies may resolve spontaneously, but others, such as central adrenal insufficiency and primary hypothyroidism, appear to be persistent in most cases. The mainstay of management of ICPi-related endocrinopathies is hormone replacement and symptom control. Further studies are needed to determine (i) whether high-dose corticosteroids in the treatment of ICPi-related endocrinopathies preserves endocrine function (especially in hypophysitis), and (ii) whether the development of ICPi-related endocrinopathies correlates with tumor response to ICPi therapy.

Also flagged:depressionpsychiatric disordersanhedoniamajor depressive disorderserotoninketamine
Journal Article 2019-02-01 ✓ 1 Snippet Höflich A, Michenthaler P, Kasper S, Lanzenberger R.
In-Text Gene Mentions

…interregional relation of5-HTTavailability, for example,…

Show Full Abstract

Pleasure and motivation are important factors for goal-directed behavior and well-being in both animals and humans. Intact hedonic capacity requires an undisturbed interplay between a number of different brain regions and transmitter systems. Concordantly, dysfunction of networks encoding for reward have been shown in depression and other psychiatric disorders. The development of technological possibilities to investigate connectivity on a functional level in humans and to directly influence networks in animals using optogenetics among other techniques has provided new important insights in this field of research.In this review, we aim to provide an overview on the neurobiological substrates of anhedonia on a network level. For this purpose, definition of anhedonia and the involved reward components are described first, then current data on reward networks in healthy individuals and in depressed patients are summarized, and the roles of different neurotransmitter systems involved in reward processing are specified. Based on this information, the impact of different therapeutic approaches on reward processing is described with a particular focus on deep brain stimulation (DBS) as a possibility for a direct modulation of human brain structures in vivo.Overall, results of current studies emphasize the importance of anhedonia in psychiatric disorders and the relevance of targeting this phenotype for a successful psychiatric treatment. However, more data incorporating these results for the refinement of methodological approaches are needed to be able to develop individually tailored therapeutic concepts based on both clinical and neurobiological profiles of patients.

Also flagged:transcriptional regulatorsKrüppel-like factorsmetabolismnuclear receptorsynthesismitochondrial
Journal Article 2019-02-01 No Snippets Hsieh PN, Fan L, Sweet DR, Jain MK.
Show Full Abstract

Nutrient handling by higher organisms is a complex process that is regulated at the transcriptional level. Studies over the past 15 years have highlighted the critical importance of a family of transcriptional regulators termed the Krüppel-like factors (KLFs) in metabolism. Within an organ, distinct KLFs direct networks of metabolic gene targets to achieve specialized functions. This regulation is often orchestrated in concert with recruitment of tissue-specific transcriptional regulators, particularly members of the nuclear receptor family. Upon nutrient entry into the intestine, gut, and liver, KLFs control a range of functions from bile synthesis to intestinal stem cell maintenance to effect nutrient acquisition. Subsequently, coordinated KLF activity across multiple organs distributes nutrients to sites of storage or liberates them for use in response to changes in nutrient status. Finally, in energy-consuming organs like cardiac and skeletal muscle, KLFs tune local metabolic programs to precisely match substrate uptake, flux, and use, particularly via mitochondrial function, with energetic demand; this is achieved in part via circulating mediators, including glucocorticoids and insulin. Here, we summarize current understanding of KLFs in regulation of nutrient absorption, interorgan circulation, and tissue-specific use.

Also flagged:HDpathogenesisbehavioralαB-crystallinGFAPautosomal dominant neurodegenerative disorder
Journal Article 2019-02-01 ✓ 4 Snippets Wood TE, Barry J, Yang Z, Cepeda C, Levine MS, Gray M.
In-Text Gene Mentions

Neuronal and non-neuronal cells express the huntingtin (HTT) protein, yet neurodegeneration in Huntington's disease (HD) is largely selective, affecting most prominently striatal medium spiny neurons and cortical pyramidal neurons.

…express the huntingtin (HTT) protein, yet neurodegenerati…

…full-length human mutantHTT(fl-mHTT) may be…

HTT

Show Full Abstract

Neuronal and non-neuronal cells express the huntingtin (HTT) protein, yet neurodegeneration in Huntington's disease (HD) is largely selective, affecting most prominently striatal medium spiny neurons and cortical pyramidal neurons. Selective toxicity of full-length human mutant HTT (fl-mHTT) may be due in part to its expression in non-neuronal cells. While studies suggest neuronal-glial interactions are important in HD and fl-mHTT is expressed in astrocytes, it has not been determined whether the expression of fl-mHTT in astrocytes is necessary for HD pathogenesis. To directly assess the necessity of fl-mHTT in astrocytes for HD pathogenesis, we used a mouse genetic approach and bred the conditional mHTT-expressing BACHD mouse model with GFAP-CreERT2 mice. We show that GFAP-CreERT2 expression in these mice is highly selective for astrocytes, and we are able to significantly reduce the expression of fl-mHTT protein in the striatum and cortex of BACHD/GFAP-CreERT2-tam mice. We performed behavioral, electrophysiological and neuropathological analyses of BACHD and BACHD/GFAP-CreERT2-tam mice. Behavioral analyses of BACHD/GFAP-CreERT2-tam mice demonstrate significant improvements in motor and psychiatric-like phenotypes. We observe improvements in neuropathological and electrophysiological phenotypes in BACHD/GFAP-CreERT2-tam mice compared to BACHD mice. We observed a restoration of the normal level αB-crystallin in the striatum of the BACHD/GFAP-CreERT2 mice, indicating a cell autonomous effect of mHTT on its expression. Taken together, this work indicates that astrocytes are important contributors to the progression of the behavioral and neuropathological phenotypes observed in HD.

Also flagged:IgGAntibodyinfectioninterferon-gammaPrimary infectionalanine aminotransferase
Journal Article 2019-02-01 ✓ 1 Snippet Choi Y, Zhang X, Skinner B.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

<h4>Background</h4>Secondary spread of hepatitis E virus (HEV) infection occurs often in endemic settings in developing countries. The host immune signatures contributing to protection against subsequent HEV reinfection are unknown.<h4>Methods</h4>Twelve seroconverted rhesus macaques were reinoculated with homologous HEV genotype 1 (gt1, Sar-55) and followed for 115 days. HEV RNA, HEV-specific T-cell responses, IgG anti-HEV antibody, and the IgG anti-HEV avidity index were tested.<h4>Results</h4>Four animals with baseline IgG anti-HEV levels from 1.5 to 13.4 World Health Organization (WHO) U/mL evidenced reinfection as determined by HEV RNA in stool, and increase in IgG anti-HEV levels between 63- and 285-fold (P = .003). Eight animals with baseline IgG anti-HEV levels from 2.8 to 90.7 WHO U/mL did not develop infection or shed virus in feces, and IgG anti-HEV antibody levels were unchanged (P = .017). The 4 reinfected animals showed a lower HEV-IgG avidity index (average 35.5%) than the 8 protected animals (average 62.1%). HEV-specific interferon-gamma-producing T cells were 2-fold higher in reinfected animals (P = .018).<h4>Conclusions</h4>Preexisting antibody and high IgG avidity index (>50%) are important factors for protection against HEV reinfection. HEV-specific T-cell responses were elevated in reinfected animals after subsequent exposure to HEV.

Also flagged:All-Trans Retinoic Acidretinoic acidRAretinoidmetabolismWnt4
Journal Article 2019-02-01 No Snippets Spade DJ, Dere E, Hall SJ, Schorl C, Freiman RN, Boekelheide K.
Show Full Abstract

Exposure to excess retinoic acid (RA) disrupts the development of the mammalian testicular seminiferous cord. However, the molecular events surrounding RA-driven loss of cord structure have not previously been examined. To investigate the mechanisms associated with this adverse developmental effect, fetal rat testes were isolated on gestational day 15, after testis determination and the initiation of cord development, and cultured in media containing all-trans RA (ATRA; 10-8 to 10-6 M) or vehicle for 3 days. ATRA exposure resulted in a concentration-dependent decrease in the number of seminiferous cords per testis section and number of germ cells, assessed by histopathology and immunohistochemistry. Following 1 day of culture, genome-wide expression profiling by microarray demonstrated that ATRA exposure altered biological processes related to retinoid metabolism and gonadal sex determination. Real-time RT-PCR analysis confirmed that ATRA enhanced the expression of the key ovarian development gene Wnt4 and the antitestis gene Nr0b1 in a concentration-dependent manner. After 3 days of culture, ATRA-treated testes contained both immunohistochemically DMRT1-positive and FOXL2-positive somatic cells, providing evidence of disrupted testicular cell fate maintenance following ATRA exposure. We conclude that exogenous RA disrupts seminiferous cord development in ex vivo cultured fetal rat testes, resulting in a reduction in seminiferous cord number, and interferes with maintenance of somatic cell fate by enhancing expression of factors that promote ovarian development.

Also flagged:neurodegenerative diseasechromosomeFANCD2FAN1HDnuclease
Journal Article 2019-02-01 ✓ 5 Snippets Goold R, Flower M, Moss DH, Medway C, Wood-Kaczmar A, Andre R, Farshim P, Bates GP, Holmans P, Jones L, Tabrizi SJ.
In-Text Gene Mentions

To assess the stability of the CAG repeat in the endogenous HTT gene, we used iPSCs derived from an HD patient with 109 CAG repeats (32).

Huntington’s disease (HD) is a dominantly inherited neurodegenerative condition caused by expansion of a CAG trinucleotide repeat in the huntingtin (HTT) gene (1).

Huntington’s disease (HD) is an inherited neurodegenerative disease caused by an expanded CAG repeat in the huntingtin (HTT) gene.

…the huntingtin (HTT) gene.…

…the huntingtin (HTT) gene (…

Show Full Abstract

Huntington's disease (HD) is an inherited neurodegenerative disease caused by an expanded CAG repeat in the huntingtin (HTT) gene. CAG repeat length explains around half of the variation in age at onset (AAO) but genetic variation elsewhere in the genome accounts for a significant proportion of the remainder. Genome-wide association studies have identified a bidirectional signal on chromosome 15, likely underlain by FANCD2- and FANCI-associated nuclease 1 (FAN1), a nuclease involved in DNA interstrand cross link repair. Here we show that increased FAN1 expression is significantly associated with delayed AAO and slower progression of HD, suggesting FAN1 is protective in the context of an expanded HTT CAG repeat. FAN1 overexpression in human cells reduces CAG repeat expansion in exogenously expressed mutant HTT exon 1, and in patient-derived stem cells and differentiated medium spiny neurons, FAN1 knockdown increases CAG repeat expansion. The stabilizing effects are FAN1 concentration and CAG repeat length-dependent. We show that FAN1 binds to the expanded HTT CAG repeat DNA and its nuclease activity is not required for protection against CAG repeat expansion. These data shed new mechanistic insights into how the genetic modifiers of HD act to alter disease progression and show that FAN1 affects somatic expansion of the CAG repeat through a nuclease-independent mechanism. This provides new avenues for therapeutic interventions in HD and potentially other triplet repeat disorders.

Also flagged:Diabeteshemoglobinopathiesglucosesickle cell traitsickleerythrocyte
Journal Article 2019-02-01 No Snippets Hivert MF, Christophi CA, Jablonski KA, Edelstein SL, Kahn SE, Golden SH, Dagogo-Jack S, Mather KJ, Luchsinger JA, Caballero AE, Barrett-Connor E, Knowler WC, Florez JC, Herman WH.
Show Full Abstract

<h4>Purpose</h4>HbA1c levels are higher in blacks than non-Hispanic whites (NHWs). We investigated whether genetics could explain this difference in Diabetes Prevention Program (DPP) participants.<h4>Methods</h4>We tested (i) genetic variants causing hemoglobinopathies, (ii) a genetic risk score (GRS) based on 60 variants associated with HbA1c from genome-wide association meta-analysis, and (iii) principal component (PC) factors that capture continental ancestry derived from genetic markers distributed across the genome.<h4>Results</h4>Of 2658 eligible DPP participants, 537 (20%) self-identified as black and 1476 (56%) as NHW. Despite comparable fasting and 2-hour glucose levels, blacks had higher HbA1c (mean ± SD = 6.2 ± 0.6%) compared with NHWs (5.8 ± 0.4%; P < 0.001). In blacks, the genetic variant causing sickle cell trait was associated with higher HbA1c [β (SE) = +0.44 (0.08)%; P = 2.1 × 10-4]. The GRS was associated with HbA1c in both blacks and NHWs. Self-identified blacks were distributed along the first PC axis, as expected in mixed ancestry populations. The first PC explained 60% of the 0.4% difference in HbA1c between blacks and NHWs, whereas the sickle cell variant explained 16% and GRS explained 14%.<h4>Conclusions</h4>A large proportion of HbA1c difference between blacks and NHWs was associated with the first PC factor, suggesting that unidentified genetic markers influence HbA1c in blacks in addition to nongenetic factors.

Also flagged:asthmaadaptive immunitygene expressionsteroidobesityobstruction
Journal Article 2019-02-01 ✓ 1 Snippet Peters MC, Ringel L, Dyjack N, Herrin R, Woodruff PG, Rios C, O'Connor B, Fahy JV, Seibold MA.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

<h4>Background</h4>Type 2 (T2) inflammation drives airway dysfunction in many patients with asthma; yet, we lack a comprehensive understanding of the airway immune cell types and networks that sustain this inflammation. Moreover, defects in the airway immune system in patients with asthma without T2 inflammation are not established.<h4>Objectives</h4>To determine the gene networks that sustain T2 airway inflammation in T2-high asthma and to explore the gene networks that characterize T2-low asthma.<h4>Methods</h4>Network analysis of sputum cell transcriptome expression data from 84 subjects with asthma and 27 healthy control subjects was used to identify immune cell type-enriched networks that underlie asthma subgroups.<h4>Results</h4>Sputum T2 gene expression was characterized by an immune cell network derived from multiple innate immune cells, including eosinophils, mast cells/basophils, and inflammatory dendritic cells. Clustering of subjects within this network stratified subjects into T2-high and T2-low groups, but it also revealed a subgroup of T2-high subjects with uniformly higher expression of the T2 network. These "T2-ultrahigh subjects" were characterized clinically by older age and more severe airflow obstruction and pathologically by a second T2 network derived from T2-skewed, CD11b<sup>+</sup>/CD103<sup>-</sup>/IRF4<sup>+</sup> classical dendritic cells. Subjects with T2-low asthma were differentiated from healthy control subjects by lower expression of a cytotoxic CD8<sup>+</sup> T-cell network, which was negatively correlated with body mass index and plasma IL-6 concentrations.<h4>Conclusions</h4>Persistent airway T2 inflammation is a complex construct of innate and adaptive immunity gene expression networks that are variable across individuals with asthma and persist despite steroid treatment. Individuals with T2-low asthma exhibit an airway deficiency in cytotoxic T cells associated with obesity-driven inflammation.

Also flagged:gene expressionbindingtranscription factorshistone deacetylasesHDACsHDAC3
Journal Article 2019-02-01 ✓ 1 Snippet Emmett MJ, Lazar MA.
In-Text Gene Mentions

…sequences, to whichchromatin modifiersmodifiers such as…

Show Full Abstract

Cell-type-specific gene expression is physiologically modulated by the binding of transcription factors to genomic enhancer sequences, to which chromatin modifiers such as histone deacetylases (HDACs) are recruited. Drugs that inhibit HDACs are in clinical use but lack specificity. HDAC3 is a stoichiometric component of nuclear receptor co-repressor complexes whose enzymatic activity depends on this interaction. HDAC3 is required for many aspects of mammalian development and physiology, for example, for controlling metabolism and circadian rhythms. In this Review, we discuss the mechanisms by which HDAC3 regulates cell type-specific enhancers, the structure of HDAC3 and its function as part of nuclear receptor co-repressors, its enzymatic activity and its post-translational modifications. We then discuss the plethora of tissue-specific physiological functions of HDAC3.

Also flagged:gene expressionchronic kidney diseasemetabolismhibernationresponse to hibernationRTN4RL2
Journal Article 2019-02-01 ✓ 5 Snippets Srivastava A, Kumar Sarsani V, Fiddes I, Sheehan SM, Seger RL, Barter ME, Neptune-Bear S, Lindqvist C, Korstanje R.
In-Text Gene Mentions

SOCS2, CISH, and SERPINC1) and the lack of increased expression of cytokines and genes involved in inflammation

CISH, and SERPINC1) and the lack of increased expression of cytokines and genes involved in inflammation

SERPINC1) and the lack of increased expression of cytokines and genes involved in inflammation

…CISH , andSERPINC1) and the…

…CISH , andSERPINC1) in the…

Show Full Abstract

The prevalence of chronic kidney disease (CKD) is rising worldwide and 10-15% of the global population currently suffers from CKD and its complications. Given the increasing prevalence of CKD there is an urgent need to find novel treatment options. The American black bear (Ursus americanus) copes with months of lowered kidney function and metabolism during hibernation without the devastating effects on metabolism and other consequences observed in humans. In a biomimetic approach to better understand kidney adaptations and physiology in hibernating black bears, we established a high-quality genome assembly. Subsequent RNA-Seq analysis of kidneys comparing gene expression profiles in black bears entering (late fall) and emerging (early spring) from hibernation identified 169 protein-coding genes that were differentially expressed. Of these, 101 genes were downregulated and 68 genes were upregulated after hibernation. Fold changes ranged from 1.8-fold downregulation (RTN4RL2) to 2.4-fold upregulation (CISH). Most notable was the upregulation of cytokine suppression genes (SOCS2, CISH, and SERPINC1) and the lack of increased expression of cytokines and genes involved in inflammation. The identification of these differences in gene expression in the black bear kidney may provide new insights in the prevention and treatment of CKD.

Also flagged:BlackCarbonglaucomablindnessblack carbonAging
Journal Article 2019-02-01 No Snippets Nwanaji-Enwerem JC, Wang W, Nwanaji-Enwerem O, Vokonas P, Baccarelli A, Weisskopf M, Herndon LW, Wiggs JL, Park SK, Schwartz J.
Show Full Abstract

<h4>Importance</h4>Elevated intraocular pressure is a major risk factor for glaucoma, a leading cause of irreversible blindness worldwide. Environmental air pollution has been suggested as a potential contributor to elevated intraocular pressure; however, no studies have demonstrated such an association to date.<h4>Objective</h4>To investigate the association of long-term ambient black carbon exposure with intraocular pressure in community-dwelling older adults.<h4>Design, setting, and participants</h4>This population-based analysis, conducted from October 18, 2017, through March 22, 2018, used data from the all-male, New England-based Normative Aging Study of the US Department of Veterans Affairs. The analysis included 419 older men with a total of 911 follow-up study visits between January 1, 2000, and December 30, 2011. Intraocular pressure was measured by Goldmann applanation tonometry during the study visits. Validated spatiotemporal models were used to generate 1-year black carbon exposure levels at the addresses of the participants.<h4>Main outcomes and measures</h4>An independently developed genetic score approach was used to calculate allelic risk scores for 3 pathways associated with black carbon toxicity: endothelial function, oxidative stress, and metal processing. The associations among black carbon exposure, allelic risk scores, and intraocular pressure were explored using linear mixed-effects models.<h4>Results</h4>All 419 participants were men with a mean (SD) age of 75.3 (6.9) years. The mean (SD) 1-year black carbon exposure was 0.51 (0.18) μg/m3, and the mean (SD) intraocular pressure for the left eye was 14.1 (2.8) mm Hg and for the right eye was 14.1 (3.0) mm Hg. Of the 911 visits, 520 (57.1%) had a high endothelial function allelic risk score, 644 (70.7%) had a high metal-processing allelic risk score, and 623 (68.4%) had a high oxidative stress allelic risk score. In fully adjusted linear mixed-effects models, the association of black carbon with intraocular pressure was greater in individuals with a high oxidative stress allelic score (β = 0.36; 95% CI, 0.003-0.73) compared with individuals with a low score (β = -0.35; 95% CI, -0.86 to 0.15).<h4>Conclusions and relevance</h4>Ambient black carbon exposure may be a risk factor for increased intraocular pressure in individuals susceptible to other biological oxidative stressors. If additional studies confirm these results, monitoring ambient black carbon exposure and physiological oxidative stress may prevent the development and progression of intraocular pressure-related disease.

Also flagged:Redoxmicrobial infectionoxygenwound healingmucosal diseaseNOX1
Journal Article 2019-02-01 No Snippets Campbell EL, Colgan SP.
Show Full Abstract

Redox signalling in the gastrointestinal mucosa is held in an intricate balance. Potent microbicidal mechanisms can be used by infiltrating immune cells, such as neutrophils, to protect compromised mucosae from microbial infection through the generation of reactive oxygen species. Unchecked, collateral damage to the surrounding tissue from neutrophil-derived reactive oxygen species can be detrimental; thus, maintenance and restitution of a breached intestinal mucosal barrier are paramount to host survival. Redox reactions and redox signalling have been studied for decades with a primary focus on contributions to disease processes. Within the past decade, an upsurge of exciting findings have implicated subtoxic levels of oxidative stress in processes such as maintenance of mucosal homeostasis, the control of protective inflammation and even regulation of tissue wound healing. Resident gut microbial communities have been shown to trigger redox signalling within the mucosa, which expresses similar but distinct enzymes to phagocytes. At the fulcrum of this delicate balance is the colonic mucosal epithelium, and emerging evidence suggests that precise control of redox signalling by these barrier-forming cells may dictate the outcome of an inflammatory event. This Review will address both the spectrum and intensity of redox activity pertaining to host-immune and host-microbiota crosstalk during homeostasis and disease processes in the gastrointestinal tract.

Also flagged:sickle cell diseasebeta globinanemiahydroxyureaL-glutamineheme
Journal Article 2019-02-01 No Snippets Telen MJ, Malik P, Vercellotti GM.
Show Full Abstract

For over 100 years, clinicians and scientists have been unravelling the consequences of the A to T substitution in the β-globin gene that produces haemoglobin S, which leads to the systemic manifestations of sickle cell disease (SCD), including vaso-occlusion, anaemia, haemolysis, organ injury and pain. However, despite growing understanding of the mechanisms of haemoglobin S polymerization and its effects on red blood cells, only two therapies for SCD - hydroxyurea and L-glutamine - are approved by the US Food and Drug Administration. Moreover, these treatment options do not fully address the manifestations of SCD, which arise from a complex network of interdependent pathophysiological processes. In this article, we review efforts to develop new drugs targeting these processes, including agents that reactivate fetal haemoglobin, anti-sickling agents, anti-adhesion agents, modulators of ischaemia-reperfusion and oxidative stress, agents that counteract free haemoglobin and haem, anti-inflammatory agents, anti-thrombotic agents and anti-platelet agents. We also discuss gene therapy, which holds promise of a cure, although its widespread application is currently limited by technical challenges and the expense of treatment. We thus propose that developing systems-oriented multi-agent strategies on the basis of SCD pathophysiology is needed to improve the quality of life and survival of people with SCD.

Also flagged:DMT1Phosphorylationhepatocellular carcinomairondivalent metal-ion transporter-1tumors
Journal Article 2019-02-01 ✓ 1 Snippet Hoki T, Katsuta E, Yan L, Takabe K, Ito F.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Despite a high rate of recurrences, long-term survival can be achieved after the resection of hepatocellular carcinoma (HCC) with effective local treatment. Discovery of adverse prognostic variables to identify patients with high risk of recurrence could improve the management of HCC. Accumulating evidence showing a link between carcinogenesis and increased expression of iron import proteins and intracellular iron prompted us to investigate a role of divalent metal-ion transporter-1 (DMT1) that binds and regulates a variety of divalent metals in HCC.<h4>Materials and methods</h4>Clinical and gene expression data from RNA seq in 369 HCC patients were obtained from The Cancer Genome Atlas. Disease-free survival was compared between DMT1 high- and low-expressing tumors, and gene set enrichment analysis was conducted.<h4>Results</h4>Patients with lower expression of DMT1 exhibited significantly worse disease-free survival compared with the DMT1 high group (P = 0.044), notably in advanced-stage patients (P = 0.008). DMT1 expression did not differ in etiologies, stages, and differentiation status of HCC. Interestingly, DMT1 expression levels inversely associated with cellular respiratory function in HCC. Furthermore, gene set enrichment analysis revealed that metabolism-related gene sets such as glycolysis, oxidative phosphorylation, and reactive oxygen species pathway were significantly enriched in the DMT1 low-expressing HCC.<h4>Conclusions</h4>Low DMT1 expression associates with increased oxidative phosphorylation as well as glycolysis and identifies early recurrence in HCC patients after surgical treatment.

Also flagged:transcription factorsreproductionsex chromosomeszinc-fingerKrüppel -type zinc fingersvision
Journal Article 2019-02-01 ✓ 1 Snippet Kolora SRR, Weigert A, Saffari A, Kehr S, Walter Costa MB, Spröer C, Indrischek H, Chintalapati M, Lohse K, Doose G, Overmann J, Bunk B, Bleidorn C, Grimm-Seyfarth A, Henle K, Nowick K, Faria R, Stadler PF, Schlegel M.
In-Text Gene Mentions

…The prostacyclin synthase (PTGIS) involved in regeneration…

Show Full Abstract

<h4>Background</h4>Lacerta viridis and Lacerta bilineata are sister species of European green lizards (eastern and western clades, respectively) that, until recently, were grouped together as the L. viridis complex. Genetic incompatibilities were observed between lacertid populations through crossing experiments, which led to the delineation of two separate species within the L. viridis complex. The population history of these sister species and processes driving divergence are unknown. We constructed the first high-quality de novo genome assemblies for both L. viridis and L. bilineata through Illumina and PacBio sequencing, with annotation support provided from transcriptome sequencing of several tissues. To estimate gene flow between the two species and identify factors involved in reproductive isolation, we studied their evolutionary history, identified genomic rearrangements, detected signatures of selection on non-coding RNA, and on protein-coding genes.<h4>Findings</h4>Here we show that gene flow was primarily unidirectional from L. bilineata to L. viridis after their split at least 1.15 million years ago. We detected positive selection of the non-coding repertoire; mutations in transcription factors; accumulation of divergence through inversions; selection on genes involved in neural development, reproduction, and behavior, as well as in ultraviolet-response, possibly driven by sexual selection, whose contribution to reproductive isolation between these lacertid species needs to be further evaluated.<h4>Conclusion</h4>The combination of short and long sequence reads resulted in one of the most complete lizard genome assemblies. The characterization of a diverse array of genomic features provided valuable insights into the demographic history of divergence among European green lizards, as well as key species differences, some of which are candidates that could have played a role in speciation. In addition, our study generated valuable genomic resources that can be used to address conservation-related issues in lacertids.

Also flagged:bindingdosage compensationMSL2HASnucleosome-repeat binding protein
Journal Article 2019-02-01 ✓ 5 Snippets Albig C, Tikhonova E, Krause S, Maksimenko O, Regnard C, Becker PB.
In-Text Gene Mentions

…genome-wide and promotesDCCbinding to HAS.…

…age compensation complex (MSL-DCC, or just DCC).…

…(MSL-DCC, or justDCC).…

…(HAS) for theDCC, which are also…

…poses that theDCCfirst interacts with…

Show Full Abstract

Transcription regulators select their genomic binding sites from a large pool of similar, non-functional sequences. Although general principles that allow such discrimination are known, the complexity of DNA elements often precludes a prediction of functional sites. The process of dosage compensation in Drosophila allows exploring the rules underlying binding site selectivity. The male-specific-lethal (MSL) Dosage Compensation Complex (DCC) selectively binds to some 300 X chromosomal 'High Affinity Sites' (HAS) containing GA-rich 'MSL recognition elements' (MREs), but disregards thousands of other MRE sequences in the genome. The DNA-binding subunit MSL2 alone identifies a subset of MREs, but fails to recognize most MREs within HAS. The 'Chromatin-linked adaptor for MSL proteins' (CLAMP) also interacts with many MREs genome-wide and promotes DCC binding to HAS. Using genome-wide DNA-immunoprecipitation we describe extensive cooperativity between both factors, depending on the nature of the binding sites. These are explained by physical interaction between MSL2 and CLAMP. In vivo, both factors cooperate to compete with nucleosome formation at HAS. The male-specific MSL2 thus synergises with a ubiquitous GA-repeat binding protein for refined X/autosome discrimination.

Also flagged:non-alcoholic fatty liver diseaseNAFLDmetabolic syndromefattyaspartate aminotransferasealanine aminotransferase
Journal Article 2019-02-01 ✓ 1 Snippet Salmanroghani H, Salmanroghani R, Nourian M, Khayarn K, Lahmi F, Iravani S.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background/aims</h4>The aim of the present study was to investigate the relationship between non-alcoholic fatty liver disease (NAFLD) and neck circumference (NC) and to compare the NC predictive value with other anthropometric indices in the prediction of NAFLD and metabolic syndrome (MetS) as well as to find the NC cut-off point for the prediction of NAFLD and MetS in an Iranian population.<h4>Materials and methods</h4>A total of 590 individuals who fulfilled our criteria were enrolled in the study. Anthropometric measurements, physical examinations, and abdominal ultrasonography were performed by trained staff. Blood samples for biochemical tests were also obtained after fasting for 12 h.<h4>Results</h4>Neck circumference was associated with NAFLD and MetS in both genders (p<0.0001) and remained significant even after adjustment for possible confounding factors. It was also significantly associated with other anthropometric indices, such as fatty liver severity, aspartate aminotransferase, alanine aminotransferase, fasting blood sugar, triglycerides, low-density lipoprotein, systolic and diastolic blood pressure, and family history of diabetes in both sexes (p<0.05). There was a significant negative correlation between high-density lipoprotein levels and NC in both sexes (p<0.001).<h4>Conclusion</h4>Neck circumference was significantly correlated with NAFLD and MetS. In addition, it had the highest predictive value for NAFLD and MetS among other common anthropometric indices. Therefore, it can be used as a simple and feasible tool for screening NAFLD in a large population.

Also flagged:CreatinineHuntingtinHypoxanthineALPPhosphocholineALT
Journal Article 2019-02-01 ✓ 5 Snippets Biscans A, Coles A, Haraszti R, Echeverria D, Hassler M, Osborn M, Khvorova A.
In-Text Gene Mentions

Htt

…probe sets (mouseHtt, mouse Ppib…

…genes: Huntingtin (Htt) ( 31…

…different levels (Httlow, and Ppib…

…injected with siRNAHttand eight were…

Show Full Abstract

Small interfering RNA (siRNA)-based therapies are proving to be efficient for treating liver-associated disorders. However, extra-hepatic delivery remains challenging, limiting therapeutic siRNA utility. We synthesized a panel of fifteen lipid-conjugated siRNAs and systematically evaluated the impact of conjugate on siRNA tissue distribution and efficacy. Generally, conjugate hydrophobicity defines the degree of clearance and the liver-to-kidney distribution profile. In addition to primary clearance tissues, several conjugates achieve significant siRNA accumulation in muscle, lung, heart, adrenal glands and fat. Oligonucleotide distribution to extra-hepatic tissues with some conjugates was significantly higher than with cholesterol, a well studied conjugate, suggesting that altering conjugate structure can enhance extra-hepatic delivery. These conjugated siRNAs enable functional gene silencing in lung, muscle, fat, heart and adrenal gland. Required levels for productive silencing vary (5-200 μg/g) per tissue, suggesting that the chemical nature of conjugates impacts tissue-dependent cellular/intracellular trafficking mechanisms. The collection of conjugated siRNA described here enables functional gene modulation in vivo in several extra-hepatic tissues opening these tissues for gene expression modulation. A systemic evaluation of a panel of conjugated siRNA, as reported here, has not previously been investigated and shows that chemical engineering of lipid siRNAs is essential to advance the RNA therapeutic field.

Also flagged:Hepcidinatherosclerotic diseaseironatherosclerosisdextranLDL receptor
Journal Article 2019-02-01 ✓ 2 Snippets Malhotra R, Wunderer F, Barnes HJ, Bagchi A, Buswell MD, O'Rourke CD, Slocum CL, Ledsky CD, Peneyra KM, Sigurslid H, Corman B, Johansson KB, Rhee DK, Bloch KD, Bloch DB.
In-Text Gene Mentions

hemochromatosis

HFE

Show Full Abstract

Objective- Inflammatory stimuli enhance the progression of atherosclerotic disease. Inflammation also increases the expression of hepcidin, a hormonal regulator of iron homeostasis, which decreases intestinal iron absorption, reduces serum iron levels and traps iron within macrophages. The role of macrophage iron in the development of atherosclerosis remains incompletely understood. The objective of this study was to investigate the effects of hepcidin deficiency and decreased macrophage iron on the development of atherosclerosis. Approach and Results- Hepcidin- and LDL (low-density lipoprotein) receptor-deficient ( Hamp<sup>-/-</sup>/ Ldlr<sup>-/-</sup>) mice and Hamp<sup>+/+</sup>/ Ldlr<sup>-/-</sup> control mice were fed a high-fat diet for 21 weeks. Compared with control mice, Hamp<sup>-/-</sup>/ Ldlr<sup>-/-</sup> mice had decreased aortic macrophage activity and atherosclerosis. Because hepcidin deficiency is associated with both increased serum iron and decreased macrophage iron, the possibility that increased serum iron was responsible for decreased atherosclerosis in Hamp<sup>-/-</sup>/ Ldlr<sup>-/-</sup> mice was considered. Hamp<sup>+/+</sup>/ Ldlr<sup>-/-</sup> mice were treated with iron dextran so as to produce a 2-fold increase in serum iron. Increased serum iron did not decrease atherosclerosis in Hamp<sup>+/+</sup>/ Ldlr<sup>-/-</sup> mice. Aortic macrophages from Hamp<sup>-/-</sup>/ Ldlr<sup>-/-</sup> mice had less labile free iron and exhibited a reduced proinflammatory (M1) phenotype compared with macrophages from Hamp<sup>+/+</sup>/ Ldlr<sup>-/-</sup> mice. THP1 human macrophages treated with an iron chelator were used to model hepcidin deficiency in vitro. Treatment with an iron chelator reduced LPS (lipopolysaccharide)-induced M1 phenotypic expression and decreased uptake of oxidized LDL. Conclusions- In summary, in a hyperlipidemic mouse model, hepcidin deficiency was associated with decreased macrophage iron, a reduced aortic macrophage inflammatory phenotype and protection from atherosclerosis. The results indicate that decreasing hepcidin activity, with the resulting decrease in macrophage iron, may prove to be a novel strategy for the treatment of atherosclerosis.

Also flagged:ATXN2transthyretinfamilial amyloid polyneuropathyTTRFAPneurological disease
Journal Article 2019-02-01 ✓ 1 Snippet Santos D, Coelho T, Alves-Ferreira M, Sequeiros J, Mendonça D, Alonso I, Sousa A, Lemos C.
In-Text Gene Mentions

…ATXN7, TBP, ATN1,HTT, JPH3, AR, and…

Show Full Abstract

<h4>Objective</h4>Transthyretin (TTR)-related familial amyloid polyneuropathy (FAP) is an autosomal dominant neurological disease, caused most frequently by a Val30Met (now classified as Val50Met) substitution in TTR. Age at onset (AO) ranges from 19 to 82 years, and variability exists mostly between generations. Unstable oligonucleotide repeats in various genes are the mechanism behind several neurological diseases, found also to act as modifiers for other disorders. Our aim was to investigate whether large normal repeat alleles of 10 genes had a possible modifier effect in AO in Portuguese TTR-FAP Val30Met families.<h4>Methods</h4>We analyzed 329 Portuguese patients from 123 families. Repeat length (at ATXN1, ATXN2, ATXN3, ATXN7, TBP, ATN1, HTT, JPH3, AR, and DMPK) was assessed by single and multiplex polymerase chain reaction, using fluorescently labeled primers, followed by capillary electrophoresis. We used a family-centered approach, and generalized estimating equations were used to account for AO correlation between family members.<h4>Results</h4>For ATXN2, the presence of at least 1 allele longer than 22 CAGs was significantly associated with an earlier onset in TTR-FAP Val30Met, decreasing mean AO by 6 years (95% confidence interval = -8.81 to -2.19, p = 0.001). No association was found for the remaining repeat loci.<h4>Interpretation</h4>Length of normal repeats at ATXN2 may modify AO in TTR-FAP Val30Met and may function as a risk factor. This can be due to the role of ATXN2 in RNA metabolism and as a modulator of various cellular processes, including mitochondrial stress. This may have relevant implications for prognosis and the follow-up of presymptomatic carriers. ANN NEUROL 2019;85:251-258.

Also flagged:TetrafluoropyridylphenolPhenolsoxygenwaterflavonoids
Journal Article 2019-02-01 No Snippets Brittain WDG, Cobb SL.
Show Full Abstract

Phenols are extremely valuable building blocks in the areas of pharmaceuticals, natural products, materials and catalysts. In order to carry out modifications on phenols, the phenolic oxygen is routinely protected to prevent unwanted side reactions. Presently many of the protecting groups available can require harsh conditions, specialist equipment, expensive or air/moisture-sensitive reagents to install and remove. Here we introduce the use of the tetrafluoropyridyl (TFP) group as a general protecting group for phenols. TFP can be installed in one step with no sensitivity to water or air, and it is stable under a range of commonly employed reaction conditions including acid and base. The TFP protecting group is readily cleaved under mild conditions with quantitative conversion to the parent phenol, observed in many cases in less than 1 hour.

Also flagged:capsidsgene transfergene expressioncapsidtransductiongene
Journal Article 2019-02-01 No Snippets Challis RC, Ravindra Kumar S, Chan KY, Challis C, Beadle K, Jang MJ, Kim HM, Rajendran PS, Tompkins JD, Shivkumar K, Deverman BE, Gradinaru V.
Show Full Abstract

We recently developed adeno-associated virus (AAV) capsids to facilitate efficient and noninvasive gene transfer to the central and peripheral nervous systems. However, a detailed protocol for generating and systemically delivering novel AAV variants was not previously available. In this protocol, we describe how to produce and intravenously administer AAVs to adult mice to specifically label and/or genetically manipulate cells in the nervous system and organs, including the heart. The procedure comprises three separate stages: AAV production, intravenous delivery, and evaluation of transgene expression. The protocol spans 8 d, excluding the time required to assess gene expression, and can be readily adopted by researchers with basic molecular biology, cell culture, and animal work experience. We provide guidelines for experimental design and choice of the capsid, cargo, and viral dose appropriate for the experimental aims. The procedures outlined here are adaptable to diverse biomedical applications, from anatomical and functional mapping to gene expression, silencing, and editing.

Also flagged:Hyalinizing Trabecular Tumorthyroid neoplasmpapillary thyroid carcinomaPTCGLIS3tumors
Journal Article 2019-02-01 ✓ 3 Snippets Nikiforova MN, Nikitski AV, Panebianco F, Kaya C, Yip L, Williams M, Chiosea SI, Seethala RR, Roy S, Condello V, Santana-Santos L, Wald AI, Carty SE, Ferris RL, El-Naggar AK, Nikiforov YE.
In-Text Gene Mentions

PAX8-GLIS3 was prospectively identified in 8/10,165 (0.1%) indeterminate cytology fine-needle aspiration samples; 5/5 resected fusion-positive nodules were HTT on surgical pathology.<h4>Conclusions</h4>This study demonstrates that GLIS rearrangements, particularly PAX8-GLIS3, are highly prevalent in HTT but not in PTC.

The prevalence of GLIS fusions was studied in 17 tumors initially diagnosed as HTT, 220 PTC, and 10,165 thyroid fine-needle aspiration samples.<h4>Results</h4>Using whole-exome and RNA-Seq analyses of the initial three HTT, no known thyroid tumor mutations were identified, while in-frame gene fusion between PAX8 exon 2 and GLIS3 exon 3 was detected in all tumors.

HTT

Show Full Abstract

<h4>Background</h4>Hyalinizing trabecular tumor (HTT) is a rare thyroid neoplasm with a characteristic trabecular growth pattern and hyalinization. This lesion has been the subject of long-term controversy surrounding its genetic mechanisms, relationship to papillary thyroid carcinoma (PTC), and malignant potential. Due to the presence of nuclear features shared with PTC, HTT frequently contributes to a false-positive cytology, which hampers patient management. The goal of this study was to apply genome-wide sequencing analyses to elucidate the genetic mechanisms of HTT and its relationship to PTC.<h4>Methods</h4>Whole-exome, RNA-Seq, and targeted next-generation sequencing analyses were performed to discover and characterize driver mutations in HTT. RNA-Seq results were used for pathway analysis. Tissue expression of GLIS3 and other proteins was detected by immunohistochemistry. The prevalence of GLIS fusions was studied in 17 tumors initially diagnosed as HTT, 220 PTC, and 10,165 thyroid fine-needle aspiration samples.<h4>Results</h4>Using whole-exome and RNA-Seq analyses of the initial three HTT, no known thyroid tumor mutations were identified, while in-frame gene fusion between PAX8 exon 2 and GLIS3 exon 3 was detected in all tumors. Further analysis identified PAX8-GLIS3 in 13/14 (93%) and PAX8-GLIS1 in 1/14 (7%) of HTT confirmed after blind pathology review. The fusions were validated by Sanger sequencing and FISH. The fusions resulted in overexpression of the 3'-portion of GLIS3 and GLIS1 mRNA containing intact DNA-binding domains of these transcription factors and upregulation of extracellular matrix genes including collagen IV. Immunohistochemistry confirmed upregulation and deposition of collagen IV and pan-collagen in HTT. The analysis of 220 PTC revealed no PAX8-GLIS3 and one PAX8-GLIS1 fusion. PAX8-GLIS3 was prospectively identified in 8/10,165 (0.1%) indeterminate cytology fine-needle aspiration samples; 5/5 resected fusion-positive nodules were HTT on surgical pathology.<h4>Conclusions</h4>This study demonstrates that GLIS rearrangements, particularly PAX8-GLIS3, are highly prevalent in HTT but not in PTC. The fusions lead to overexpression of GLIS, upregulation of extracellular matrix genes, and deposition of collagens, which is a characteristic histopathologic feature of HTT. Due to unique genetic mechanisms and an indolent behavior, it is proposed to rename this tumor as "GLIS-rearranged hyalinizing trabecular adenoma."

Also flagged:neurodegenerative disordersPDautophagymitochondrialvesiclecytoskeleton
Journal Article 2019-02-01 ✓ 1 Snippet Weykopf B, Haupt S, Jungverdorben J, Flitsch LJ, Hebisch M, Liu GH, Suzuki K, Belmonte JCI, Peitz M, Blaess S, Till A, Brüstle O.
In-Text Gene Mentions

…3 homeobox 2 (POU3F2, aka BRN2) and…

Show Full Abstract

Recent advances in cell reprogramming have enabled assessment of disease-related cellular traits in patient-derived somatic cells, thus providing a versatile platform for disease modeling and drug development. Given the limited access to vital human brain cells, this technology is especially relevant for neurodegenerative disorders such as Parkinson's disease (PD) as a tool to decipher underlying pathomechanisms. Importantly, recent progress in genome-editing technologies has provided an ability to analyze isogenic induced pluripotent stem cell (iPSC) pairs that differ only in a single genetic change, thus allowing a thorough assessment of the molecular and cellular phenotypes that result from monogenetic risk factors. In this review, we summarize the current state of iPSC-based modeling of PD with a focus on leucine-rich repeat kinase 2 (LRRK2), one of the most prominent monogenetic risk factors for PD linked to both familial and idiopathic forms. The LRRK2 protein is a primarily cytosolic multi-domain protein contributing to regulation of several pathways including autophagy, mitochondrial function, vesicle transport, nuclear architecture and cell morphology. We summarize iPSC-based studies that contributed to improving our understanding of the function of LRRK2 and its variants in the context of PD etiopathology. These data, along with results obtained in our own studies, underscore the multifaceted role of LRRK2 in regulating cellular homeostasis on several levels, including proteostasis, mitochondrial dynamics and regulation of the cytoskeleton. Finally, we expound advantages and limitations of reprogramming technologies for disease modeling and drug development and provide an outlook on future challenges and expectations offered by this exciting technology.

Also flagged:Hereditary HemochromatosisSarcopeniairondiabetesarthritisliver disease
Journal Article 2019-02-01 ✓ 5 Snippets Tamosauskaite J, Atkins JL, Pilling LC, Kuo CL, Kuchel GA, Ferrucci L, Melzer D.
In-Text Gene Mentions

HFE C282Y homozygosity is associated with substantial excess sarcopenia, frailty, and chronic pain at older ages.

In Northern-European ancestry populations, HFE gene C282Y mutations are relatively common (0.3%–0.6% rare homozygote prevalence) and associated with excessive iron absorption, fatigue, diabetes, arthritis, and liver disease, especially in men.

It is interesting to note that models suggest that targeted population screening for the HFE C282Y homozygous status would be cost effective (31), even before our new findings reported substantial later life sarcopenia, frailty, and chronic pain.

…European ancestry populations,HFEgene C282Y mutations…

…ConclusionsHFEC282Y homozygosity is…

Show Full Abstract

<h4>Background</h4>Iron is essential for life but contributes to oxidative damage. In Northern-European ancestry populations, HFE gene C282Y mutations are relatively common (0.3%-0.6% rare homozygote prevalence) and associated with excessive iron absorption, fatigue, diabetes, arthritis, and liver disease, especially in men. Iron excess can be prevented or treated but diagnosis is often delayed or missed. Data on sarcopenia, pain, and frailty are scarce.<h4>Methods</h4>Using 200,975 UK Biobank volunteers aged 60-70 years, we tested associations between C282Y homozygosity with Fried frailty, sarcopenia, and chronic pain using logistic regression adjusted for age and technical genetic covariates. As iron overload is progressive (with menstruation protective), we included specific analyses of older (65-70 years) females and males.<h4>Results</h4>One thousand three hundred and twelve (0.65%) participants were C282Y homozygotes; 593 were men (0.62%) and 719 were women (0.68%). C282Y homozygote men had increased likelihoods of reporting chronic pain (odds ratio [OR] 1.23: 95% confidence interval [CI] 1.05-1.45, p = .01) and diagnoses of polymyalgia rheumatica, compared to common "wild-type" genotype. They were also more likely to have sarcopenia (OR 2.38: 1.80-3.13, p = 9.70 × 10-10) and frailty (OR 2.01: 1.45-2.80, p = 3.41 × 10-05). C282Y homozygote women (n = 312, 0.7%) aged 65-70 were more likely to be frail (OR 1.73: 1.05-2.84, p = .032) and have chronic knee, hip, and back pain. Overall, 1.50% of frail men and 1.51% of frail women in the 65-70 age group were C282Y homozygous.<h4>Conclusions</h4>HFE C282Y homozygosity is associated with substantial excess sarcopenia, frailty, and chronic pain at older ages. Given the availability of treatment, hereditary hemochromatosis is a strong candidate for precision medicine approaches to improve outcomes in late life.

Corrigendum.

Also flagged:ADAR2cell proliferationnucleotidesnucleotide residuesCell migration
Journal Article 2019-02-01 ✓ 3 Snippets Unknown Authors
In-Text Gene Mentions

…rotein level (D) of STAU1 were evaluated by q…

…to detect the relative mRNA levels of STAU1. …

…ve protein level of STAU1 in 293T cells when …

Show Full Abstract

No abstract available.

Also flagged:TFEBneurodegenerative diseasestranscription factor EBautophagykanamycinfurosemide
Journal Article 2019-02-01 ✓ 2 Snippets Ye B, Wang Q, Hu H, Shen Y, Fan C, Chen P, Ma Y, Wu H, Xiang M.
In-Text Gene Mentions

In addition, in HD cell and mouse models, the accumulation of the pathogenic protein HTT (huntingtin) causes neurodegeneration and eventually HD by binding with BECN1 to decrease autophagy levels [13].

…the pathogenic proteinHTT(huntingtin) causes neurodegen…

Show Full Abstract

Macroautophagy/autophagy dysfunction is associated with many neurodegenerative diseases. TFEB (transcription factor EB), an important molecule that regulates lysosomal and autophagy function, is regarded as a potential target for treating some neurodegenerative diseases. However, the relationship between autophagy dysfunction and spiral ganglion neuron (SGN) degeneration and the role of TFEB in SGN degeneration has not yet been established. Here, we showed that in degenerated SGNs, induced by sensory epithelial cell loss in the cochlea of mice following kanamycin and furosemide administration, the lipofuscin area and oxidative stress level were increased, the nuclear-to-cytoplasmic TFEB ratio was decreased, and the late stage of autophagic flux was impaired. After autophagy dysfunction was partially ameliorated with an MTOR inhibitor, which promoted TFEB translocation into the nucleus from the cytoplasm, we found that the lysosomal deficits were significantly relieved, the oxidative stress level was reduced, and the density of surviving SGNs and auditory nerve fibers was increased. The results in the present study reveal that autophagy dysfunction is an important component of SGN degeneration, and TFEB may be a potential target for attenuating SGN degeneration following sensory epithelial cell loss in the cochlea of mice. Abbreviations: 3-NT: 3-nitrotyrosine; 4-HNE: 4-hydroxynonenal; 8-OHdG: 8-hydroxy-2'-deoxyguanosine; ABR: auditory brainstem response; APP: amyloid beta (A4) precursor protein; CLEAR: coordinated lysosomal expression and regulation; CTSB: cathespin B; CTSD: cathespin D; SAMR1: senescence-accelerated mouse/resistance 1; SAMP8: senescence-accelerated mouse/prone 8; MAPK1/ERK2: mitogen-activated protein kinase 1; MTOR: mechanistic target of rapamycin kinase; SGN: spiral ganglion neuron; SQSTM1/p62: sequestosome 1; TEM: transmission electron microscope; TFEB: transcription factor EB.

Also flagged:ExtracellularTyrosine HydroxylaseParkinson's diseasePDneurodegenerative disorderapomorphine
Journal Article 2019-02-01 ✓ 2 Snippets Narbute K, Piļipenko V, Pupure J, Dzirkale Z, Jonavičė U, Tunaitis V, Kriaučiūnaitė K, Jarmalavičiūtė A, Jansone B, Kluša V, Pivoriūnas A.
In-Text Gene Mentions

…(TXN) and peroxiredoxin‐6 (PRDX6) which are important…

…SOD1, TXN andPRDX6proteins by EVs…

Show Full Abstract

Parkinson's disease (PD) is the second most common neurodegenerative disorder affecting millions of people worldwide. At present, there is no effective cure for PD; treatments are symptomatic and do not halt progression of neurodegeneration. Extracellular vesicles (EVs) can cross the blood-brain barrier and represent promising alternative to the classical treatment strategies. In the present study, we examined therapeutic effects of intranasal administration of EVs derived from human exfoliated deciduous teeth stem cells (SHEDs) on unilateral 6-hydroxydopamine (6-OHDA) medial forebrain bundle (MFB) rat model of PD. CatWalk gait tests revealed that EVs effectively suppressed 6-OHDA-induced gait impairments. All tested gait parameters (stand, stride length, step cycle, and duty cycle) were significantly improved in EV-treated animals when compared with 6-OHDA-lesion group rats. Furthermore, EVs slowed down numbers of 6-OHDA-induced contralateral rotations in apomorphine test. Improvements in motor function correlated with normalization of tyrosine hydroxylase expression in the striatum and substantia nigra. In conclusion, we demonstrated, for the first time, the therapeutic efficacy of intranasal administration of EVs derived from SHEDs in a rat model of PD induced by 6-OHDA intra-MFB lesion. Our findings could be potentially exploited for the development of new treatment strategies against PD.

Also flagged:hydrogenasesnickelirondiphosphinesThiolateshydride
Journal Article 2019-02-01 No Snippets Basu D, Bailey TS, Lalaoui N, Richers CP, Woods TJ, Rauchfuss TB, Arrigoni F, Zampella G.
Show Full Abstract

Described are the syntheses of several Ni(μ-SR)<sub>2</sub>Fe complexes, including hydride derivatives, in a search for improved models for the active site of [NiFe]-hydrogenases. The nickel(II) precursors include (i) nickel with tripodal ligands: Ni(PS<sub>3</sub>)<sup>-</sup> and Ni(NS<sub>3</sub>)<sup>-</sup> (PS<sub>3</sub><sup>3-</sup> = tris(phenyl-2-thiolato)phosphine, NS<sub>3</sub><sup>3-</sup> = tris(benzyl-2-thiolato)amine), (ii) traditional diphosphine-dithiolates, including chiral diphosphine R,R-DIPAMP, (iii) cationic Ni(phosphine-imine/amine) complexes, and (iv) organonickel precursors Ni( o-tolyl)Cl(tmeda) and Ni(C<sub>6</sub>F<sub>5</sub>)<sub>2</sub>. The following new nickel precursor complexes were characterized: PPh<sub>4</sub>[Ni(NS<sub>3</sub>)] and the dimeric imino/amino-phosphine complexes [NiCl<sub>2</sub>(PCH═N<sup>An</sup>)]<sub>2</sub> and [NiCl<sub>2</sub>(PCH<sub>2</sub>NH<sup>An</sup>)]<sub>2</sub> (P = Ph<sub>2</sub>PC<sub>6</sub>H<sub>4</sub>-2-). The iron(II) reagents include [CpFe(CO)<sub>2</sub>(thf)]BF<sub>4</sub>, [Cp*Fe(CO)(MeCN)<sub>2</sub>]BF<sub>4</sub>, FeI<sub>2</sub>(CO)<sub>4</sub>, FeCl<sub>2</sub>(diphos)(CO)<sub>2</sub>, and Fe(pdt)(CO)<sub>2</sub>(diphos) (diphos = chelating diphosphines). Reactions of the nickel and iron complexes gave the following new Ni-Fe compounds: Cp*Fe(CO)Ni(NS<sub>3</sub>), [Cp(CO)Fe(μ-pdt)Ni(dppbz)]BF<sub>4</sub>, [( R,R-DIPAMP)Ni(μ-pdt)(H)Fe(CO)<sub>3</sub>]BAr<sup>F</sup><sub>4</sub>, [(PCH═N<sup>An</sup>)Ni(μ-pdt)(Cl)Fe(dppbz)(CO)]BF<sub>4</sub>, [(PCH<sub>2</sub>NH<sup>An</sup>)Ni(μ-pdt)(Cl)Fe(dppbz)(CO)]BF<sub>4</sub>, [(PCH═N<sup>An</sup>)Ni(μ-pdt)(H)Fe(dppbz)(CO)]BF<sub>4</sub>, [(dppv)(CO)Fe(μ-pdt)]<sub>2</sub>Ni, {H[(dppv)(CO)Fe(μ-pdt)]<sub>2</sub>Ni]}BF<sub>4</sub>, and (C<sub>6</sub>F<sub>5</sub>)<sub>2</sub>Ni(μ-pdt)Fe(CO)<sub>2</sub>(dppv) (DIPAMP = (CH<sub>2</sub>P(C<sub>6</sub>H<sub>4</sub>-2-OMe)<sub>2</sub>)<sub>2</sub>; BAr<sup>F</sup><sub>4</sub><sup>-</sup> = [B(C<sub>6</sub>H<sub>3</sub>-3,5-(CF<sub>3</sub>)<sub>2</sub>]<sub>4</sub><sup>-</sup>)) Within the context of Ni-(SR)<sub>2</sub>-Fe complexes, these new complexes feature new microenvironments for the nickel center: tetrahedral Ni, chirality, imine, and amine coligands, and Ni-C bonds. In the case of {H[(dppv)(CO)Fe(μ-pdt)]<sub>2</sub>Ni}<sup>+</sup>, four low-energy isomers are separated by ≤3 kcal/mol, one of which features a biomimetic HNi(SR)<sub>4</sub> site, as supported by density functional theory calculations.

Also flagged:Neurodegenerative Diseasesandrogen receptorARatrophin-1ATN1ataxin 1
Journal Article 2019-02-01 ✓ 1 Snippet Vázquez N, Rocha S, López-Fernández H, Torres A, Camacho R, Fdez-Riverola F, Vieira J, Vieira CP, Reboiro-Jato M.
In-Text Gene Mentions

…A (CACNA1A), Huntingtin (HTT), and TATA-binding protein…

Show Full Abstract

Protein-protein interaction (PPI) data is essential to elucidate the complex molecular relationships in living systems, and thus understand the biological functions at cellular and systems levels. The complete map of PPIs that can occur in a living organism is called the interactome. For animals, PPI data is stored in multiple databases (e.g., BioGRID, CCSB, DroID, FlyBase, HIPPIE, HitPredict, HomoMINT, INstruct, Interactome3D, mentha, MINT, and PINA2) with different formats. This makes PPI comparisons difficult to perform, especially between species, since orthologous proteins may have different names. Moreover, there is only a partial overlap between databases, even when considering a single species. The EvoPPI ( http://evoppi.i3s.up.pt ) web application presented in this paper allows comparison of data from the different databases at the species level, or between species using a BLAST approach. We show its usefulness by performing a comparative study of the interactome of the nine polyglutamine (polyQ) disease proteins, namely androgen receptor (AR), atrophin-1 (ATN1), ataxin 1 (ATXN1), ataxin 2 (ATXN2), ataxin 3 (ATXN3), ataxin 7 (ATXN7), calcium voltage-gated channel subunit alpha1 A (CACNA1A), Huntingtin (HTT), and TATA-binding protein (TBP). Here we show that none of the human interactors of these proteins is common to all nine interactomes. Only 15 proteins are common to at least 4 of these polyQ disease proteins, and 40% of these are involved in ubiquitin protein ligase-binding function. The results obtained in this study suggest that polyQ disease proteins are involved in different functional networks. Comparisons with Mus musculus PPIs are also made for AR and TBP, using EvoPPI BLAST search approach (a unique feature of EvoPPI), with the goal of understanding why there is a significant excess of common interactors for these proteins in humans.

Also flagged:Tetrazoleheterocyclesamidebindingtetrazolescarboxylic acid
Journal Article 2019-02-01 No Snippets Neochoritis CG, Zhao T, Dömling A.
Show Full Abstract

Tetrazole derivatives are a prime class of heterocycles, very important to medicinal chemistry and drug design due to not only their bioisosterism to carboxylic acid and amide moieties but also to their metabolic stability and other beneficial physicochemical properties. Although more than 20 FDA-approved drugs contain 1 H- or 2 H-tetrazole substituents, their exact binding mode, structural biology, 3D conformations, and in general their chemical behavior is not fully understood. Importantly, multicomponent reaction (MCR) chemistry offers convergent access to multiple tetrazole scaffolds providing the three important elements of novelty, diversity, and complexity, yet MCR pathways to tetrazoles are far from completely explored. Here, we review the use of multicomponent reactions for the preparation of substituted tetrazole derivatives. We highlight specific applications and general trends holding therein and discuss synthetic approaches and their value by analyzing scope and limitations, and also enlighten their receptor binding mode. Finally, we estimated the prospects of further research in this field.

Also flagged:TECO1dStransposonsreproductionTransfers
Journal Article 2019-02-01 ✓ 2 Snippets Reiss D, Mialdea G, Miele V, de Vienne DM, Peccoud J, Gilbert C, Duret L, Charlat S.
In-Text Gene Mentions

…Observed and simulated HTT networks To produce null distributions for hypothesis testing, we simulated random HTT scenarios in R (scripts available in folder 07 of the data repository).…

…In other words, the pattern shown in Fig 2a (where a single HTT event explains more than one case of shared TEs through HT), occurs less often in the simulated than observed scenarios.…

Show Full Abstract

More than any other genome components, Transposable Elements (TEs) have the capacity to move across species barriers through Horizontal Transfer (HT), with substantial evolutionary consequences. Previous large-scale surveys, based on full-genomes comparisons, have revealed the transposition mode as an important predictor of HT rates variation across TE superfamilies. However, host biology could represent another major explanatory factor, one that needs to be investigated through extensive taxonomic sampling. Here we test this hypothesis using a field collection of 460 arthropod species from Tahiti and surrounding islands. Through targeted massive parallel sequencing, we uncover patterns of HT in three widely-distributed TE superfamilies with contrasted modes of transposition. In line with earlier findings, the DNA transposons under study (TC1-Mariner) were found to transfer horizontally at the highest frequency, closely followed by the LTR superfamily (Copia), in contrast with the non-LTR superfamily (Jockey), that mostly diversifies through vertical inheritance and persists longer within genomes. Strikingly, across all superfamilies, we observe a marked excess of HTs in Lepidoptera, an insect order that also commonly hosts baculoviruses, known for their ability to transport host TEs. These results turn the spotlight on baculoviruses as major potential vectors of TEs in arthropods, and further emphasize the importance of non-vertical TE inheritance in genome evolution.

Also flagged:PeptidesTGXProtein AK23ACT2MLO
Journal Article 2019-02-01 No Snippets Nielsen M, Ard R, Leng X, Ivanov M, Kindgren P, Pelechano V, Marquardt S.
Show Full Abstract

Progression of RNA polymerase II (RNAPII) transcription relies on the appropriately positioned activities of elongation factors. The resulting profile of factors and chromatin signatures along transcription units provides a "positional information system" for transcribing RNAPII. Here, we investigate a chromatin-based mechanism that suppresses intragenic initiation of RNAPII transcription. We demonstrate that RNAPII transcription across gene promoters represses their function in plants. This repression is characterized by reduced promoter-specific molecular signatures and increased molecular signatures associated with RNAPII elongation. The conserved FACT histone chaperone complex is required for this repression mechanism. Genome-wide Transcription Start Site (TSS) mapping reveals thousands of discrete intragenic TSS positions in fact mutants, including downstream promoters that initiate alternative transcript isoforms. We find that histone H3 lysine 4 mono-methylation (H3K4me1), an Arabidopsis RNAPII elongation signature, is enriched at FACT-repressed intragenic TSSs. Our analyses suggest that FACT is required to repress intragenic TSSs at positions that are in part characterized by elevated H3K4me1 levels. In sum, conserved and plant-specific chromatin features correlate with the co-transcriptional repression of intragenic TSSs. Our insights into TSS repression by RNAPII transcription promise to inform the regulation of alternative transcript isoforms and the characterization of gene regulation through the act of pervasive transcription across eukaryotic genomes.

Also flagged:Wilson diseaseATP7Bcopper transportercopperWDmethylation
Journal Article 2019-02-01 ✓ 1 Snippet Mordaunt CE, Kieffer DA, Shibata NM, Członkowska A, Litwin T, Weiss KH, Zhu Y, Bowlus CL, Sarkar S, Cooper S, Wan YY, Ali MR, LaSalle JM, Medici V.
In-Text Gene Mentions

…primary biliary cholangitis,hemochromatosis) were excluded.…

Show Full Abstract

<h4>Background</h4>Wilson disease (WD) is an autosomal recessive disease caused by mutations in ATP7B encoding a copper transporter. Consequent copper accumulation results in a variable WD clinical phenotype involving hepatic, neurologic, and psychiatric symptoms, without clear genotype-phenotype correlations. The goal of this study was to analyze alterations in DNA methylation at the whole-genome level in liver and blood from patients with WD to investigate epigenomic alterations associated with WD diagnosis and phenotype. We used whole-genome bisulfite sequencing (WGBS) to examine distinct cohorts of WD subjects to determine whether DNA methylation could differentiate patients from healthy subjects and subjects with other liver diseases and distinguish between different WD phenotypes.<h4>Results</h4>WGBS analyses in liver identified 969 hypermethylated and 871 hypomethylated differentially methylated regions (DMRs) specifically identifying patients with WD, including 18 regions with genome-wide significance. WD-specific liver DMRs were associated with genes enriched for functions in folate and lipid metabolism and acute inflammatory response and could differentiate early from advanced fibrosis in WD patients. Functional annotation revealed that WD-hypermethylated liver DMRs were enriched in liver-specific enhancers, flanking active liver promoters, and binding sites of liver developmental transcription factors, including Hepatocyte Nuclear Factor 4 alpha (HNF4A), Retinoid X Receptor alpha (RXRA), Forkhead Box A1 (FOXA1), and FOXA2. DMRs associated with WD progression were also identified, including 15 with genome-wide significance. However, WD DMRs in liver were not related to large-scale changes in proportions of liver cell types. DMRs detected in blood differentiated WD patients from healthy and disease control subjects, and distinguished between patients with hepatic and neurologic WD manifestations. WD phenotype DMRs corresponded to genes enriched for functions in mental deterioration, abnormal B cell physiology, and as members of the polycomb repressive complex 1 (PRC1). 44 DMRs associated with WD phenotype tested in a small validation cohort had a predictive value of 0.9.<h4>Conclusions</h4>We identified a disease-mechanism relevant epigenomic signature of WD that reveals new insights into potential biomarkers and treatments for this complex monogenic disease.

Also flagged:Cell cycleBbc3Cpt1cCDKN1APolhKRAS
Journal Article 2019-02-01 No Snippets Fischer M.
Show Full Abstract

Understanding the p53 tumor suppressor pathway remains crucial for the design of anticancer strategies. Studies in human tumors and mouse models help to unravel the molecular mechanisms that underlie the p53 signaling pathway. Yet, the p53 gene regulatory network (GRN) is not the same in mice and humans. The comparison of the regulatory networks of p53 in mice and humans reveals that gene up- and down-regulation by p53 are distinctly affected during evolution. Importantly, gene up-regulation by p53 underwent more rapid evolution and gene down-regulation has been evolutionarily constrained. This difference stems from the two major mechanisms employed by p53 to regulate gene expression: up-regulation through direct p53 target gene binding and indirect down-regulation through the p53-p21-DREAM pathway. More than 1000 genes have been identified to differ in their p53-dependent expression between mice and humans. Analysis of p53 gene expression profiles and p53 binding data reveal that turnover of p53 binding sites is the major mechanism underlying extensive variation in p53-dependent gene up-regulation. Only a core set of high-confidence genes appears to be directly regulated by p53 in both species. In contrast to up-regulation, p53-induced down-regulation is well conserved between mice and humans and controls cell cycle genes. Here a curated data set is provided that extends the previously established web-atlas at www.targetgenereg.org to assess the p53 response of any human gene of interest and its mouse ortholog. Taken together, the analysis reveals a limited translation potential from mouse models to humans for the p53 GRN.

Also flagged:calcium phosphatecell adhesionangiogenic factorsbone formationHydroxyapatitepore
Journal Article 2019-02-01 No Snippets Gehrke SA, Mazón P, Pérez-Díaz L, Calvo-Guirado JL, Velásquez P, Aragoneses JM, Fernández-Domínguez M, De Aza PN.
Show Full Abstract

In this work, the physicochemical properties and in vitro bioactivity and cellular viability of two commercially available bovine bone blocks (allografts materials) with different fabrication processes (sintered and not) used for bone reconstruction were evaluated in order to study the effect of the microstructure in the in vitro behavior. Scanning electron microscopy, X-ray diffraction, Fourier transform infrared spectrometry, mechanical resistance of blocks, mercury porosimetry analysis, in vitro bioactivity, and cell viability and proliferation were performed to compare the characteristics of both allograft materials against a synthetic calcium phosphate block used as a negative control. The herein presented results revealed a very dense structure of the low-porosity bovine bone blocks, which conferred the materials' high resistance. Moreover, relatively low gas, fluid intrusion, and cell adhesion were observed in both the tested materials. The structural characteristics and physicochemical properties of both ceramic blocks (sintered and not) were similar. Finally, the bioactivity, biodegradability, and also the viability and proliferation of the cells was directly related to the physicochemical properties of the scaffolds.

Also flagged:Nonalcoholic Fatty Liver DiseaseNAFLDNonalcoholic steatohepatitisNASHliver diseasecirrhosis
Journal Article 2019-02-01 No Snippets Carulli L, Zanca G, Schepis F, Villa E.
Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD) is a common cause of hepatic abnormalities worldwide. Nonalcoholic steatohepatitis (NASH) is part of the spectrum of NAFLD and leads to progressive liver disease, such as cirrhosis and hepatocellular carcinoma. In NASH patient, fibrosis represents the major predictor of liver-related mortality; therefore, it is important to have an early and accurate diagnosis of NASH. The current gold standard for the diagnosis of NASH is still liver biopsy. The development of biomarkers able to predict disease severity, prognosis, as well as response to therapy without the need for a biopsy is the focus of most up-to-date genomic, transcriptomic, proteomic, and metabolomic research. In the future, patients might be diagnosed and treated according to their molecular signatures. In this short review, we discuss how information from genomics, proteomics, and metabolomics contribute to the understanding of NAFLD pathogenesis.

Also flagged:inflammationatopic dermatitisglucocorticoiddexamethasonecompoundsubstance P
Journal Article 2019-02-01 ✓ 3 Snippets Yamada K, Sato H, Sakamaki K, Kamada M, Okuno Y, Fukuishi N, Furuta K, Tanaka S.
In-Text Gene Mentions

They included genes involved in arachidonic acid metabolism, such as Ptges, Ptgs2, and Ptgis.

…Icam1, Mcpt4, Ptges,Ptgis, Ptgs2, Thbs1, and…

…Ptges, Ptgs2, andPtgis.…

Show Full Abstract

Steroidal anti-inflammatory drugs are widely used for the treatment of chronic cutaneous inflammation, such as atopic dermatitis, although it remains unknown how they modulate cutaneous mast cell functions. We investigated the effects of prolonged treatment with a synthetic glucocorticoid, dexamethasone, on murine connective tissue-type mast cells using in vitro and in vivo models. Our connective tissue-type bone marrow-derived cultured mast cell model was found to be sensitive to mast cell secretagogues, such as compound 48/80 and substance P, and higher expression levels of α subunit of a trimeric G protein, G<sub>i1</sub>, and several Mas-related G protein-coupled receptor (Mrgpr) subtypes were observed in comparison with immature cultured mast cells. Secretagogue-induced degranulation and up-regulation of these genes was suppressed when cultured in the presence of dexamethasone. The profiles of granule constituents were drastically altered by dexamethasone. Topical application of dexamethasone down-modulated secretagogue-induced degranulation and the expression levels of several Mrgpr subtypes in cutaneous tissue. These results suggest that mast cell-mediated IgE-independent cutaneous inflammation could be suppressed by steroidal anti-inflammatory drugs through the down-regulation of G <sub>αi1</sub> and several Mrgpr subtypes in mast cells.

Also flagged:lipidcognitionchronic diseaseFetal growth restrictiongestationmaternal undernutrition
Journal Article 2019-02-01 No Snippets Hambidge KM, Westcott JE, Garcés A, Figueroa L, Goudar SS, Dhaded SM, Pasha O, Ali SA, Tshefu A, Lokangaka A, Derman RJ, Goldenberg RL, Bose CL, Bauserman M, Koso-Thomas M, Thorsten VR, Sridhar A, Stolka K, Das A, McClure EM, Krebs NF, Women First Preconception Trial Study Group.
Show Full Abstract

<h4>Background</h4>Reported benefits of maternal nutrition supplements commenced during pregnancy in low-resource populations have typically been quite limited.<h4>Objectives</h4>This study tested the effects on newborn size, especially length, of commencing nutrition supplements for women in low-resource populations ≥3 mo before conception (Arm 1), compared with the same supplement commenced late in the first trimester of pregnancy (Arm 2) or not at all (control Arm 3).<h4>Methods</h4>Women First was a 3-arm individualized randomized controlled trial (RCT). The intervention was a lipid-based micronutrient supplement; a protein-energy supplement was also provided if maternal body mass index (kg/m2) was <20 or gestational weight gain was less than recommendations. Study sites were in rural locations of the Democratic Republic of the Congo (DRC), Guatemala, India, and Pakistan. The primary outcome was length-for-age z score (LAZ), with all anthropometry obtained <48 h post delivery. Because gestational ages were unavailable in DRC, outcomes were determined for all 4 sites from WHO newborn standards (non-gestational-age-adjusted, NGAA) as well as INTERGROWTH-21st fetal standards (3 sites, gestational age-adjusted, GAA).<h4>Results</h4>A total of 7387 nonpregnant women were randomly assigned, yielding 2451 births with NGAA primary outcomes and 1465 with GAA outcomes. Mean LAZ and other outcomes did not differ between Arm 1 and Arm 2 using either NGAA or GAA. Mean LAZ (NGAA) for Arm 1 was greater than for Arm 3 (effect size: +0.19; 95% CI: 0.08, 0.30, P = 0.0008). For GAA outcomes, rates of stunting and small-for-gestational-age were lower in Arm 1 than in Arm 3 (RR: 0.69; 95% CI: 0.49, 0.98, P = 0.0361 and RR: 0.78; 95% CI: 0.70, 0.88, P < 0.001, respectively). Rates of preterm birth did not differ among arms.<h4>Conclusions</h4>In low-resource populations, benefits on fetal growth-related birth outcomes were derived from nutrition supplements commenced before conception or late in the first trimester. This trial was registered at clinicaltrials.gov as NCT01883193.

Also flagged:Hydroxytryptamine transporter5-Hydroxytryptamine transporterserotonin transporterdelusionsADapolipoprotein E
Journal Article 2019-02-01 ✓ 5 Snippets D'Onofrio G, Panza F, Sancarlo D, Lauriola M, Dagostino MP, Paroni G, Lozupone M, Mangiacotti A, Bisceglia P, Gravina C, Urbano M, Addante F, Paris F, Cascavilla L, Greco A, Seripa D.
In-Text Gene Mentions

Thus, the S promoter allelic variant is linked to reduced 5-HTT mRNA expression, resulting in less serotonin reuptake than with the L-allelic variant and an increase of extraneuronal serotonin, contributing to the protective role in AD [48].

…5-HT, serotonin) transporter (5-HTT) gene-linked polymorphic regi…

…linked to reduced5-HTTmRNA expression, resulting…

…lead to decreased5-HTTfunction, which in…

…association between the5-HTTgenotype and physiological…

Show Full Abstract

<h4>Background</h4>Serotoninergic pathways underlying delusion symptoms in Alzheimer's disease (AD) have not been fully clarified. 5-Hydroxytryptamine transporter gene-linked polymorphic region (5-HTTLPR) is a variable number tandem repeats in the promoter region of serotonin transporter encoding-gene affecting transcription.<h4>Methods</h4>We investigated the association of 5-HTTLPR with delusions in a total of 257 consecutive patients clinically diagnosed as AD according to the National Institute on Aging-Alzheimer's Association criteria. All participants underwent a comprehensive evaluation with a standardized comprehensive geriatric assessment and Neuropsychiatric Inventory.<h4>Results</h4>Delusion symptoms were observed in 171 patients (66.54%). In respect to AD patients without delusions, AD patients with delusions showed a low prevalence of S-plus carriers (5-HTTLPR-L/S + 5-HTTLPR-S/S genotypes) [<i>p</i> < 0.001; odds ratio (OR) = 0.240, 95% confidence interval (CI) = 0.121-0.471]. Logistic regression analysis adjusted for the apolipoprotein E polymorphism showed that in AD patients with delusions the presence of an 5-HTTLPR-S allele may reduce disease duration (<i>p</i> = 0.005; OR = 0.680, 95% CI = 0.522-0.886) and increase aberrant motor activity (<i>p</i> = 0.013; OR = 2.257, 95% CI = 1.195-4.260). The present findings suggested that 5-HTTLPR might be associated with delusions in AD. S-plus carriers might be associated with protective effect against delusions in AD.<h4>Conclusions</h4>More studies on wider samples of high selected demented patients are needed to confirm our results. However, the present findings suggested that a genetic factor related to serotonin metabolism might exert a protective role on the clinical expression of neuropsychiatric clusters in AD with important implications regarding mechanisms underlying delusions and their possible treatment across the AD and dementia spectrum.

Also flagged:neurogenesisbrain developmentPI3KAKTmTORINSR
Journal Article 2019-02-01 ✓ 1 Snippet Pollen AA, Bhaduri A, Andrews MG, Nowakowski TJ, Meyerson OS, Mostajo-Radji MA, Di Lullo E, Alvarado B, Bedolli M, Dougherty ML, Fiddes IT, Kronenberg ZN, Shuga J, Leyrat AA, West JA, Bershteyn M, Lowe CB, Pavlovic BJ, Salama SR, Haussler D, Eichler EE, Kriegstein AR.
In-Text Gene Mentions

DCC

Show Full Abstract

Direct comparisons of human and non-human primate brains can reveal molecular pathways underlying remarkable specializations of the human brain. However, chimpanzee tissue is inaccessible during neocortical neurogenesis when differences in brain size first appear. To identify human-specific features of cortical development, we leveraged recent innovations that permit generating pluripotent stem cell-derived cerebral organoids from chimpanzee. Despite metabolic differences, organoid models preserve gene regulatory networks related to primary cell types and developmental processes. We further identified 261 differentially expressed genes in human compared to both chimpanzee organoids and macaque cortex, enriched for recent gene duplications, and including multiple regulators of PI3K-AKT-mTOR signaling. We observed increased activation of this pathway in human radial glia, dependent on two receptors upregulated specifically in human: INSR and ITGB8. Our findings establish a platform for systematic analysis of molecular changes contributing to human brain development and evolution.

Also flagged:amino acidRGMRGMCiron storage disorderjuvenile hemochromatosisgene expression
Journal Article 2019-02-01 ✓ 5 Snippets Rotwein P.
In-Text Gene Mentions

2002; Matsunaga et al. 2004; Niederkofler et al. 2004; Rajagopalan et al. 2004; Samad et al. 2004). In contrast, RGMC was initially characterized through its gene, which was found within a locus that was linked to a severe form of an iron storage disease that primarily affects children, termed juvenile hemochromatosis (Papanikolaou et al. 2004). The gene was termed HFE2 after HFE (high iron [chemical symbol Fe]), the initial gene whose mutations were found in hemochromatosis (Papanikolaou et al. 2004). The encoded protein, RGMC, is also called hemojuvelin (HJV), because of its relationship with juvenile hemochromatosis (Papanikolaou et al. 2004). Unlike RGMA and RGMB, RGMC/HFE2/HJV is produced in the liver and in cardiac and skeletal muscle, and not within the nervous system (Kuninger et al. 2004; Papanikolaou et al. 2004; Schmidtmer and Engelkamp 2004).

…termed HFE2 afterHFE(high iron [chemical…

…were found inhemochromatosis(Papanikolaou et al.…

…which also includesDCCand UNC5 (Keino‐Masu…

…individuals with juvenilehemochromatosisare amino acid…

Show Full Abstract

Repulsive guidance molecules, RGMA, RGMB, and RGMC, are related proteins discovered independently through different experimental paradigms. They are encoded by single copy genes in mammalian and other vertebrate genomes, and are ~50% identical in amino acid sequence. The importance of RGM actions in human physiology has not been realized, as most research has focused on non-human models, although mutations in RGMC are the cause of the severe iron storage disorder, juvenile hemochromatosis. Here I show that repositories of human genomic and population genetic data can be used as starting points for discovery and for developing new testable hypotheses about each of these paralogs in human biology and disease susceptibility. Information was extracted, aggregated, and analyzed from the Ensembl and UCSC Genome Browsers, the Exome Aggregation Consortium, the Genotype-Tissue Expression project portal, the cBio portal for Cancer Genomics, and the National Cancer Institute Genomic Data Commons data site. Results identify extensive variation in gene expression patterns, substantial alternative RNA splicing, and possible missense alterations and other modifications in the coding regions of each of the three genes, with many putative mutations being detected in individuals with different types of cancers. Moreover, selected amino acid substitutions are highly prevalent in the world population, with minor allele frequencies of up to 37% for RGMA and up to 8% for RGMB. These results indicate that protein sequence variation is common in the human RGM family, and raises the possibility that individual variants will have a significant population impact on human physiology and/or disease predisposition.

Also flagged:aldosteroneadenomasion homeostasisaldosterone-producing adenomascell proliferationtumor
Journal Article 2019-02-01 ✓ 1 Snippet Lerario AM, Nanba K, Blinder AR, Suematsu S, Omura M, Nishikawa T, Giordano TJ, Rainey WE, Else T.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

Somatic variants in genes that regulate intracellular ion homeostasis have been identified in aldosterone-producing adenomas (APA). Although the mechanisms leading to an increased aldosterone production in APA cells has been well studied, the molecular events that cause cell proliferation and tumor formation are poorly understood. In the present study, we have performed whole exome sequencing (WES) to characterize the landscape of somatic alterations in a homogeneous series of APA with pathogenic KCNJ5 variants. In the WES analysis on eleven APA, 84 exonic somatic events were called by 3 different somatic callers. Besides the KCNJ5 gene, only two genes (MED13 and ZNF669) harbored somatic variants in more than one APA. Unlike adrenocortical carcinomas, no chromosomal instability was observed by the somatic copy-number alteration and loss of heterozygosity analyses. The estimated tumor purity ranged from 0.35 to 0.67, suggesting a significant proportion of normal cell infiltration. Based on the results of PureCN analysis, the KCNJ5 variants appear to be clonal. In conclusion, in addition to KCNJ5 somatic pathogenic variant, no significant somatic event that would obviously explain proliferation or tumor growth was observed in our homogeneous cohort of KCNJ5-mutated APA. The molecular mechanisms causing APA growth and tumorigenesis remain to be elucidated.

Also flagged:Ironliver fibrosisextracellularchronic liver diseasesiron overload syndrome hereditary haemochromatosisviral hepatitis
Journal Article 2019-02-01 No Snippets Mehta KJ, Farnaud SJ, Sharp PA.
Show Full Abstract

Liver fibrosis is characterised by excessive deposition of extracellular matrix that interrupts normal liver functionality. It is a pathological stage in several untreated chronic liver diseases such as the iron overload syndrome hereditary haemochromatosis, viral hepatitis, alcoholic liver disease, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis and diabetes. Interestingly, regardless of the aetiology, iron-loading is frequently observed in chronic liver diseases. Excess iron can feed the Fenton reaction to generate unquenchable amounts of free radicals that cause grave cellular and tissue damage and thereby contribute to fibrosis. Moreover, excess iron can induce fibrosis-promoting signals in the parenchymal and non-parenchymal cells, which accelerate disease progression and exacerbate liver pathology. Fibrosis regression is achievable following treatment, but if untreated or unsuccessful, it can progress to the irreversible cirrhotic stage leading to organ failure and hepatocellular carcinoma, where resection or transplantation remain the only curative options. Therefore, understanding the role of iron in liver fibrosis is extremely essential as it can help in formulating iron-related diagnostic, prognostic and treatment strategies. These can be implemented in isolation or in combination with the current approaches to prepone detection, and halt or decelerate fibrosis progression before it reaches the irreparable stage. Thus, this review narrates the role of iron in liver fibrosis. It examines the underlying mechanisms by which excess iron can facilitate fibrotic responses. It describes the role of iron in various clinical pathologies and lastly, highlights the significance and potential of iron-related proteins in the diagnosis and therapeutics of liver fibrosis.

Also flagged:Wound Infectioninfectionvirulence genesironpolysaccharidelipopolysaccharide
Journal Article 2019-02-01 ✓ 1 Snippet Yamazaki K, Kashimoto T, Morita M, Kado T, Matsuda K, Yamasaki M, Ueno S.
In-Text Gene Mentions

…as liver cirrhosis,hemochromatosis, or alcoholism, which…

Show Full Abstract

<i>Vibrio vulnificus</i> can cause severe necrotic lesions within a short time. Recently, it has been reported that the numbers of wound infection cases in healthy hosts are increasing, for which surgical procedures are essential in many instances to eliminate the pathogen owing to its rapid proliferation. However, the mechanisms by which <i>V. vulnificus</i> can achieve wound infection in healthy hosts have not been elucidated. Here, we advance a systematic understanding of <i>V. vulnificus</i> wound infection through genome-wide identification of the relevant genes. Signature-tagged mutagenesis (STM) has been developed to identify functions required for the establishment of infection including colonization, rapid proliferation, and pathogenicity. Previously, STM had been regarded to be unsuitable for negative selection to detect the virulence genes of <i>V. vulnificus</i> owing to the low colonization and proliferation ability of this pathogen in the intestinal tract and systemic circulation. Alternatively, we successfully identified the virulence genes by applying STM to a murine model of wound infection. We examined a total of 5418 independent transposon insertion mutants by signature-tagged transposon mutagenesis and detected 71 clones as attenuated mutants consequent to disruption of genes by the insertion of a transposon. This is the first report demonstrating that the pathogenicity of <i>V. vulnificus</i> during wound infection is highly dependent on its characteristics: flagellar-based motility, siderophore-mediated iron acquisition system, capsular polysaccharide, lipopolysaccharide, and rapid chromosome partitioning. In particular, these functions during the wound infection process and are indispensable for proliferation in healthy hosts. Our results may thus allow the potential development of new strategies and reagents to control the proliferation of <i>V. vulnificus</i> and prevent human infections.

Also flagged:ciliumorganelleciliary motilitydyneinPrimary Ciliary Dyskinesiaciliopathies
Journal Article 2019-02-01 ✓ 1 Snippet Zur Lage P, Newton FG, Jarman AP.
In-Text Gene Mentions

…beta HC genes (DNAH10: Dhc98D and DNAH2:…

Show Full Abstract

The motile cilium/flagellum is an ancient eukaryotic organelle. The molecular machinery of ciliary motility comprises a variety of cilium-specific dynein motor complexes along with other complexes that regulate their activity. Assembling the motors requires the function of dedicated "assembly factors" and transport processes. In humans, mutation of any one of at least 40 different genes encoding components of the motility apparatus causes Primary Ciliary Dyskinesia (PCD), a disease of defective ciliary motility. Recently, <i>Drosophila</i> has emerged as a model for motile cilia biology and motile ciliopathies. This is somewhat surprising as most <i>Drosophila</i> cells lack cilia, and motile cilia are confined to just two specialized cell types: the sperm flagellum with a 9+2 axoneme and the ciliated dendrite of auditory/proprioceptive (chordotonal, Ch) neurons with a 9+0 axoneme. To determine the utility of <i>Drosophila</i> as a model for motile cilia, we survey the <i>Drosophila</i> genome for ciliary motility gene homologs, and assess their expression and function. We find that the molecules of cilium motility are well conserved in <i>Drosophila</i>. Most are readily characterized by their restricted cell-type specific expression patterns and phenotypes. There are also striking differences between the two motile ciliated cell types. Notably, sperm and Ch neuron cilia express and require entirely different outer dynein arm variants-the first time this has been clearly established in any organism. These differences might reflect the specialized functions for motility in the two cilium types. Moreover, the Ch neuron cilia lack the critical two-headed inner arm dynein (I1/f) but surprisingly retain key regulatory proteins previously associated with it. This may have implications for other motile 9+0 cilia, including vertebrate embryonic nodal cilia required for left-right axis asymmetry. We discuss the possibility that cell-type specificity in ciliary motility machinery might occur in humans, and therefore underlie some of the phenotypic variation observed in PCD caused by different gene mutations. Our work lays the foundation for the increasing use of <i>Drosophila</i> as an excellent model for new motile ciliary gene discovery and validation, for understanding motile cilium function and assembly, as well as understanding the nature of genetic defects underlying human motile ciliopathies.

Also flagged:calcium phosphateoral cancerIL-1βOAZ1SATIL-8
Journal Article 2019-02-01 No Snippets Dawes C, Wong DTW.
Show Full Abstract

The objective of this article was to provide an account of some of the developments related to saliva over the first 100 years of the Journal of Dental Research and to outline some of the many biomarkers identified in saliva in the last few years. The first section covers findings in salivary physiology, biochemistry, calcium phosphate chemistry related to saliva, microbiology, and the role of saliva in maintaining oral health. The second section highlights salivary diagnostics, salivaomics, and saliva exosomics in the context of the emerging theme of personalized and precision medicine.

Also flagged:gene expressionsignal transductionretinoic acidtransforming growth factor-βWntcorneal diseases
Journal Article 2019-02-01 ✓ 2 Snippets Ma J, Lwigale P.
In-Text Gene Mentions

…Nfat5 , andSox6are upregulated (…

…RA signaling (Sox6and Hic1 ),…

Show Full Abstract

<h4>Purpose</h4>Defects in neural crest development are a major contributing factor in corneal dysgenesis, but little is known about the genetic landscape during corneal development. The purpose of this study was to provide a detailed transcriptome profile and evaluate changes in gene expression during mouse corneal development.<h4>Methods</h4>RNA sequencing was used to uncover the transcriptomic profile of periocular mesenchyme (pNC) isolated at embryonic day (E) 10.5 and corneas isolated at E14.5 and E16.5. The spatiotemporal expression of several differentially expressed genes was validated by in situ hybridization.<h4>Results</h4>Analysis of the whole-transcriptome profile between pNC and embryonic corneas identified 3815 unique differentially expressed genes. Pathway analysis revealed an enrichment of differentially expressed genes involved in signal transduction (retinoic acid, transforming growth factor-β, and Wnt pathways) and transcriptional regulation.<h4>Conclusions</h4>Our analyses, for the first time, identify a large number of differentially expressed genes during progressive stages of mouse corneal development. Our data provide a comprehensive transcriptomic profile of the developing cornea. Combined, these data serve as a valuable resource for the identification of novel regulatory networks crucial for the advancement of studies in congenital defects, stem cell therapy, bioengineering, and adult corneal diseases.

Also flagged:bindingoncogenetumorcancerscancercytoplasmic
Journal Article 2019-02-01 ✓ 1 Snippet Legrand N, Dixon DA, Sobolewski C.
In-Text Gene Mentions

Olfm4 is frequently upregulated in human CRC tumors, and is mostly considered to be a stem cell marker involved in cancer cell proliferation and migration[74].

Show Full Abstract

Trans-acting factors controlling mRNA fate are critical for the post-transcriptional regulation of inflammation-related genes, as well as for oncogene and tumor suppressor expression in human cancers. Among them, a group of RNA-binding proteins called "Adenylate-Uridylate-rich elements binding proteins" (AUBPs) control mRNA stability or translation through their binding to AU-rich elements enriched in the 3'UTRs of inflammation- and cancer-associated mRNA transcripts. AUBPs play a central role in the recruitment of target mRNAs into small cytoplasmic foci called Processing-bodies and stress granules (also known as P-body/SG). Alterations in the expression and activities of AUBPs and P-body/SG assembly have been observed to occur with colorectal cancer (CRC) progression, indicating the significant role AUBP-dependent post-transcriptional regulation plays in controlling gene expression during CRC tumorigenesis. Accordingly, these alterations contribute to the pathological expression of many early-response genes involved in prostaglandin biosynthesis and inflammation, along with key oncogenic pathways. In this review, we summarize the current role of these proteins in CRC development. CRC remains a major cause of cancer mortality worldwide and, therefore, targeting these AUBPs to restore efficient post-transcriptional regulation of gene expression may represent an appealing therapeutic strategy.

Also flagged:FXRIntestinal Cancerbile acidscolorectal cancerWNTAPC
Journal Article 2019-02-01 ✓ 1 Snippet Fu T, Coulter S, Yoshihara E, Oh TG, Fang S, Cayabyab F, Zhu Q, Zhang T, Leblanc M, Liu S, He M, Waizenegger W, Gasser E, Schnabl B, Atkins AR, Yu RT, Knight R, Liddle C, Downes M, Evans RM.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Increased levels of intestinal bile acids (BAs) are a risk factor for colorectal cancer (CRC). Here, we show that the convergence of dietary factors (high-fat diet) and dysregulated WNT signaling (APC mutation) alters BA profiles to drive malignant transformations in Lgr5-expressing (Lgr5<sup>+</sup>) cancer stem cells and promote an adenoma-to-adenocarcinoma progression. Mechanistically, we show that BAs that antagonize intestinal farnesoid X receptor (FXR) function, including tauro-β-muricholic acid (T-βMCA) and deoxycholic acid (DCA), induce proliferation and DNA damage in Lgr5<sup>+</sup> cells. Conversely, selective activation of intestinal FXR can restrict abnormal Lgr5<sup>+</sup> cell growth and curtail CRC progression. This unexpected role for FXR in coordinating intestinal self-renewal with BA levels implicates FXR as a potential therapeutic target for CRC.

Also flagged:erythropoietic protoporphyriaPorphyriaFECHporphyrinmetabolismsynthesis
Journal Article 2019-02-01 ✓ 1 Snippet Liu HM, Deng GH, Mao Q, Wang XH.
In-Text Gene Mentions

…in liver imaging,hemochromatosiswas not considered.…

Show Full Abstract

<h4>Background</h4>Porphyria is a rare disease with complex classification. Erythropoietic protoporphyria (EPP) is an autosomal recessively inherited disease, and most are caused by mutations in the <i>FECH</i> gene. EPP combined with liver injury is even rarer.<h4>Case summary</h4>This paper reports a case of EPP which was admitted to the hospital with abnormal liver function and diagnosed by repeated questioning of medical history, screening of common causes of severe liver injury, and second generation sequencing of the whole exon genome. We also summarize the clinical characteristics of EPP with liver injury, and put forward some suggestions on EPP to provide a reference for the diagnosis of such rare disease.<h4>Conclusion</h4>A new mutation locus (c.32_35dupCCCT) which may be related to the disease was found by detecting the <i>FECH</i> gene in the pedigree of this case.

Also flagged:colorectal cancerchromogranin ACancerAxin2Oligonucleotidesadenoma
Journal Article 2019-02-01 ✓ 5 Snippets Antas P, Novellasdemunt L, Kucharska A, Massie I, Carvalho J, Oukrif D, Nye E, Novelli M, Li VSW.
In-Text Gene Mentions

Olfm4

…(ISH) for Lgr5,Olfm4, Axin2 and Sh3bp4…

…Lgr5 ref #312171,Olfm4ref #311831, Axin2…

…namely, Lgr5 andOlfm4( Figure S1…

…stem cell marker,Olfm4( Figures 2…

Show Full Abstract

Wnt signals at the base of mammalian crypts play a pivotal role in intestinal stem cell (ISC) homeostasis, whereas aberrant Wnt activation causes colon cancer. Precise control of Wnt signal strength is governed by a number of negative inhibitory mechanisms acting at distinct levels of the cascade. Here, we identify the Wnt negative regulatory role of Sh3bp4 in the intestinal crypt. We show that the loss of Sh3bp4 increases ISC and Paneth cell numbers in murine intestine and accelerates adenoma development in Apc<sup>min</sup> mice. Mechanistically, human SH3BP4 inhibits Wnt signaling downstream of β-catenin phosphorylation and ubiquitination. This Wnt inhibitory role is dependent on the ZU5 domain of SH3BP4. We further demonstrate that SH3BP4 is expressed at the perinuclear region to restrict nuclear localization of β-catenin. Our data uncover the tumor-suppressive role of SH3BP4 that functions as a negative feedback regulator of Wnt signaling through modulating β-catenin's subcellular localization.

Also flagged:SOX9osteoarthritisSRY-type HMG box 9OAdegenerative osteoarthropathypathogenesis
Journal Article 2019-02-01 ✓ 2 Snippets Wang Y, Zhang X, Niu X, Xu Y, Lu L, Li H.
In-Text Gene Mentions

In cartilage development, SOX9 can activate the transcription of Col2a which encodes the most abundant protein Col2 (type II collagen) in cartilage tissue.[28] In cartilage cells, SOX9 forms protein complex with L-SOX5 and SOX6 to affect the enhancer sequence Col2a and Col112a, and thus enhances their transcription.[29] What's more, β-catenin is a major molecule in Wnt pathway and regulates the formation and development of bone and joint, the key mechanism of OA.[30] Decreased expression of SOX9 combined with Col2 caused by β-catenin overexpression leads to phenotypic alternation of cartilage cells.

…with L-SOX5 andSOX6to affect the…

Show Full Abstract

This research aimed to reveal the relationship of SRY-type HMG box 9 (SOX9) gene polymorphisms with osteoarthritis (OA) risk in a Chinese population.Polymerase chain reaction and direct sequencing were used for genotyping polymorphism in 152 OA patients and 139 controls. Firstly, the conformity of genotype distribution to Hardy-Weinberg equilibrium in the control group was checked. The differences in genotype and allele frequencies of our studied polymorphism were compared between the two groups using chi-square test. Odds ratio (OR) with 95% confidence interval (95%CI) was used to appraise the strength of the relationship between the polymorphism and OA occurrence. Cross-over analysis was conducted to reveal the interaction between polymorphisms in SOX9.The AA genotype of the polymorphism rs1042667 was significantly correlated to the increased susceptibility to OA (OR = 2.075, 95%CI = 1.042-4.132). We also detected that the A allele of the polymorphism rs1042667 also obviously increased the occurrence of OA in our study (OR = 1.401, 95%CI = 1.009-1.945). Moreover, the G allele of the polymorphism rs12601701 and the A allele of the polymorphism rs1042667 could significantly elevate the risk of OA (OR = 2.075, 95%CI = 1.021-4.218).SOX9 polymorphism rs1042667 may be a risk factor for OA in Chinese Han population. The interaction between the polymorphisms rs1042667 and rs12601701 also contribute to OA risk.

Also flagged:Fasciculation and elongation zeta proteinsFasciculation and elongation zeta/zyginFEZFEZ1FEZ2neurological disorders
Journal Article 2019-02-01 ✓ 4 Snippets Teixeira MB, Alborghetti MR, Kobarg J.
In-Text Gene Mentions

…with TBC1D25, HAP1,HTT, TLK2, NBR1, PTPRS…

…[ 50 ]HTTHuntingtin [ 57…

…in neurons thatHTTand HAP1 are…

…HAP1 interacts withHTTand control dynein…

Show Full Abstract

Fasciculation and elongation zeta/zygin (FEZ) proteins are a family of hub proteins and share many characteristics like high connectivity in interaction networks, they are involved in several cellular processes, evolve slowly and in general have intrinsically disordered regions. In 1985, <i>unc-76</i> gene was firstly described and involved in axonal growth in <i>C. elegans</i>, and in 1997 Bloom and Horvitz enrolled also the human homologues genes, <i>FEZ1</i> and <i>FEZ2</i>, in this process. While nematodes possess one gene (<i>unc-76</i>), mammalians have one more copy (<i>FEZ1</i> and <i>FEZ2</i>). Several animal models have been used to study FEZ family functions like: <i>C. elegans, D. melanogaster</i>, <i>R. novergicus</i> and human cells. Complementation assays were performed and demonstrated the function conservation between paralogues. Human FEZ1 protein is more studied followed by UNC-76 and FEZ2 proteins, respectively. While FEZ1 and UNC-76 shared interaction partners, FEZ2 evolved and increased the number of protein-protein interactions (PPI) with cytoplasmatic partners. FEZ proteins are implicated in intracellular transport, acting as bivalent cargo transport adaptors in kinesin-mediated movement. Especially in light of this cellular function, this family of proteins has been involved in several processes like neuronal development, neurological disorders, viral infection and autophagy. However, nuclear functions of FEZ proteins have been explored as well, due to high content of PPI with nuclear proteins, correlating FEZ1 expression to <i>Sox2</i> and <i>Hoxb4</i> gene regulation and retinoic acid signaling. These recent findings open new avenue to study FEZ proteins functions and its involvement in already described processes. This review intends to reunite aspects of evolution, structure, interaction partners and function of FEZ proteins and correlate them to physiological and pathological processes.

IMI - Myopia Genetics Report.

Also flagged:refractive errormyopiahigh myopiahighmatrix metalloproteinasesMMP1
Journal Article 2019-02-01 No Snippets Tedja MS, Haarman AEG, Meester-Smoor MA, Kaprio J, Mackey DA, Guggenheim JA, Hammond CJ, Verhoeven VJM, Klaver CCW, CREAM Consortium.
Show Full Abstract

The knowledge on the genetic background of refractive error and myopia has expanded dramatically in the past few years. This white paper aims to provide a concise summary of current genetic findings and defines the direction where development is needed. We performed an extensive literature search and conducted informal discussions with key stakeholders. Specific topics reviewed included common refractive error, any and high myopia, and myopia related to syndromes. To date, almost 200 genetic loci have been identified for refractive error and myopia, and risk variants mostly carry low risk but are highly prevalent in the general population. Several genes for secondary syndromic myopia overlap with those for common myopia. Polygenic risk scores show overrepresentation of high myopia in the higher deciles of risk. Annotated genes have a wide variety of functions, and all retinal layers appear to be sites of expression. The current genetic findings offer a world of new molecules involved in myopiagenesis. As the missing heritability is still large, further genetic advances are needed. This Committee recommends expanding large-scale, in-depth genetic studies using complementary big data analytics, consideration of gene-environment effects by thorough measurement of environmental exposures, and focus on subgroups with extreme phenotypes and high familial occurrence. Functional characterization of associated variants is simultaneously needed to bridge the knowledge gap between sequence variance and consequence for eye growth.

Also flagged:hepatocellular carcinomaironhereditary hemochromatosismajor histocompatibility complexHHiron overload
Journal Article 2019-02-01 ✓ 5 Snippets de Campos WN, Massaro JD, Cançado ELR, Wiezel CEV, Simões AL, Teixeira AC, de Souza FF, Mendes-Junior CT, Martinelli ALC, Donadi EA.
In-Text Gene Mentions

Considering that HFE gene controls the iron uptake from gut, defects of the encoded molecule have been associated with iron overload (IO), particularly in hemochromatosis hereditary (HH).

Structure of the HFE gene (ID# ENSG00000010704 - http://www.ensembl.org) at chromosome region 6p21.3, showing the reference number (rs) of variation sites (NCBI Data base - http://www.ncbi.nlm.nih.gov/snp), previously associated with iron disorders.

We sequenced exons 2 to 5 and boundary introns of the HFE gene to evaluate all polymorphic sites in patients presenting HH or acquired IO (HCV and HCC), and in healthy controls, using Sanger sequencing.

We sequenced exons 2 to 5 and boundary introns of HFE gene, evaluating all polymorphic sites in patients presenting hereditary (hemochromatosis) or acquired iron overload HCV and HCC) and in healthy controls, using Sanger sequencing.

Increased frequency of the classical HFE mutations has also been reported for HCC patients[4].

Show Full Abstract

<h4>Background</h4>Patients with hepatitis C virus (HCV) and hepatocellular carcinoma (HCC) may or not develop iron overload (IO), which is associated with worst prognosis, because can cause serious damage to organs. <i>HFE</i> gene controls the iron uptake from gut, particularly in patients with hereditary hemochromatosis (HH).<h4>Aim</h4>To identify associations between <i>HFE</i> coding region in patients exhibiting hereditary hemochromatosis and in diseases associated with acquired IO.<h4>Methods</h4>We sequenced exons 2 to 5 and boundary introns of <i>HFE</i> gene, evaluating all polymorphic sites in patients presenting hereditary (hemochromatosis) or acquired iron overload HCV and HCC) and in healthy controls, using Sanger sequencing. We also determined the ensemble of extended haplotype in healthy control individuals, including several major histocompatibility complex loci, using sequence specific probes. Haplotype reconstruction was performed using the Arlequin and Phase softwares, and linkage disequilibrium (LD) between histocompatibility loci and <i>HFE</i> gene was performed using the Haploview software.<h4>Results</h4>The <i>HFE</i>*003 allele was overrepresented (<i>f</i> = 71%) and <i>HFE</i>*001 allele was underrepresented (<i>f</i> = 14%) in HH patients compared to all groups. A strong linkage disequilibrium was observed among the <i>H63D-G</i>, <i>IVS2(+4)-C</i> and <i>C282Y-G</i> gene variants, particularly in HH; however, the mutation <i>IVS2(+4)T>C</i> was not directly associated with HH susceptibility. The <i>HFE</i>*001/<i>HFE</i>*002 genotype conferred susceptibility to HCC in HCV patients exhibiting IO (<i>P</i> = 0.02, OR = 14.14). Although <i>HFE</i> is telomeric to other histocompatibility genes, the <i>H63D-G/IVS2(+4)-C</i> (<i>P</i> ≤ 0.00001/<i>P</i> ≤ 0.0057) combination was in LD with <i>HLA-B</i>*44 allele group in healthy controls. No LD was observed between <i>HFE</i> alleles and other major histocompatibility loci.<h4>Conclusion</h4>A differential <i>HFE</i> association was observed for HH and for diseases associated with acquired IO (HCV, HCC). Since <i>HFE</i> is very distant from other histocompatibility loci, only weak associations were observed with these alleles.

Also flagged:Neurexinssynaptic cleftextracellularneuropsychiatric diseasesautism spectrum disorderschizophrenia
Journal Article 2019-02-01 No Snippets Rudenko G.
Show Full Abstract

Neurexins constitute a large family of synaptic organizers. Their extracellular domains protrude into the synaptic cleft where they can form transsynaptic bridges with different partners. A unique constellation of structural elements within their ectodomains enables neurexins to create molecular platforms within the synaptic cleft that permit a large portfolio of partners to be recruited, assembled and their interactions to be dynamically regulated. Neurexins and their partners are implicated in neuropsychiatric diseases including autism spectrum disorder and schizophrenia. Detailed understanding of the mechanisms that underlie neurexin interactions may in future guide the design of tools to manipulate synaptic connections and their function, in particular those involved in the pathogenesis of neuropsychiatric disease.

Also flagged:hypophysitispituitary diseasespituitary diseaseadenomaAnterior pituitary hormone deficienciesdiabetes insipidus
Journal Article 2019-02-01 ✓ 1 Snippet Imga NN, Yildirim AE, Baser OO, Berker D.
In-Text Gene Mentions

…osis), infiltrative diseases (hemochromatosis, amyloidosis, Langerhans cell…

Show Full Abstract

<h4>Objective</h4>The inflammation of the pituitary gland is known as hypophysitis. It is a rare disease accounting for approximately 0.24%-0.88% of all pituitary diseases. The natural course of hypophysitis is variable. Main forms are histologically classified as lymphocytic, granulomatous, IgG4 related and xanthomatous. We aim to present our patients with hypophysitis and compare clinical, laboratory and radiological features.<h4>Subjects and methods</h4>We retrospectively reviewed our database of 1.293 patients diagnosed with pituitary diseases between 2010 and 2017. Twelve patients with hypophysitis were identified. Demographical data, clinical features, endocrinological dysfunction, imaging findings, treatment courses and follow-up periods were evaluated.<h4>Results</h4>The frequency of hypophysitis was found 0.93% in all cases of the pituitary disease. Twelve patients (nine females and three males), ages between 17-61 years, were evaluated. The characteristic features of our patients tended to be predominantly female and young. Diagnosis of hypophysitis was made after pituitary biopsy in four patients, and in eight patients after pituitary operation due to adenoma. Headache (67%) and visual problems (33%) were the most frequent nonendocrine symptoms. Anterior pituitary hormone deficiencies (63.7%) and/or diabetes insipidus (17%) were seen among patients. According to histopathological forms, four had lymphocytic, seven had granulomatous and one had xanthogranulomatous types. Contrast enhancement heterogeneous and thickened pituitary stalk were the most common radiological alterations.<h4>Conclusion</h4>Hypophysitis should be considered in the differential diagnosis of sellar masses. It can mimic pituitary adenomas in radiological and endocrinological aspects. The different patterns of pituitary hormone deficiencies may be seen in the course of the disease.

Also flagged:growth disorderIGF-1skeletal dysplasiagrowth hormoneGHinsulin-like growth factor 1
Journal Article 2019-02-01 No Snippets Vasques GA, Andrade NLM, Jorge AAL.
Show Full Abstract

Short stature is a common feature, and frequently remains without a specific diagnosis after conventional clinical and laboratorial evaluation. Longitudinal growth is mainly determined by genetic factors, and hundreds of common variants have been associated to height variability among healthy individuals. Although isolated short stature may be caused by the combination of variants, with a deleterious impact on the growth of individuals with polygenic inheritance, recent studies have pointed out some monogenic defects as the cause of the growth disorder observed in nonsyndromic children. The majority of these defects are in genes related to the growth plate cartilage and in the growth hormone (GH) - insulin-like growth factor 1 (IGF-1) axis. Affected patients usually present the mildest spectrum of some forms of skeletal dysplasia, or subtle abnormalities of laboratory tests, suggesting hormonal resistance or insensibility. The lack of specific characteristics, however, does not allow formulation of a definitive diagnosis without the use of broad genetic studies. Thus, molecular genetic studies including panels of genes or exome analysis will become essential in investigating and identifying the causes of isolated short stature in children, with a crucial impact on treatment and follow-up.

Also flagged:deathpneumothoraxorganizationcoagulopathytension pneumothoraxsilicone
Journal Article 2019-02-01 No Snippets Molnar TF.
Show Full Abstract

Thoracic damage control surgery (TDCS) is a decision making tool and derivate of the damage control concept (DCC), where physiological stabilization has a priority over anatomical reconstruction under the pressure of time. Intrathoracic haemorrhage control and pleural decompression are the two main immediate tasks of TDCS, while definitive procedures follow when the patient is stabilised in 24-48 hours. The focus of the thoracic surgeon is on the prevention of the haemorrhage induced coagulopathy, metabolic acidosis and hypothermy formed triad of death. Surgical haemorrhage control and pleural space decompression are to be performed. The individual patients benefit from TDCS procedures whose condition is too severe for a complex immediate reconstruction (polytrauma). Life threatening chest injuries in multiple/mass casualty scenarios in civilian and military environment alike are triaged and treated accordingly. Onset of acute mismatch between the resources (available hands, OP theaters, resources, hardware) and the needs (number and severity of chest trauma cases), a mindset shift should take place, where time and space the two main limiting factors. Airway obstruction, tension haemo/pneumothorax falls into the preventable death category. Chest drainage and emergency thoracotomy are the two main procedures offered by TDCS. An intervention structured organ/injury specific list of procedures is detailed. This is a mix of emergency surgery and cardiothoracic surgery, where less is more. TDSC is not the Holy Grail found to solve all complex thoracic trauma cases, but is a good tool to increase the chance for survival in challenging, and frequently quite hopeless situations.

Also flagged:viral hepatitis-bliver fibrosischronic viral hepatitis-bChronic liver diseasechronic viral hepatitisalcohol
Journal Article 2019-02-01 ✓ 1 Snippet Huang H, Che-Nordin N, Wang LF, Xiao BH, Chevallier O, Yun YX, Guo SW, Wáng YXJ.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Recently a small cohort study demonstrated that intravoxel incoherent motion (IVIM) diffusion MRI can detect early stage liver fibrosis. Using modified IVIM data acquisition parameters, the current study aims to confirm this finding.<h4>Methods</h4>Twenty-six healthy volunteers, three patients of chronic viral hepatitis-b but without fibrosis and one mild liver steatosis subject, and 12 viral hepatitis-b patients with fibrosis (stage 1-2=7, stage 3-4=5) were included in this study. With a 1.5-T MR scanner and respiration-gating, IVIM diffusion imaging was acquired using a single-shot echo-planar sequence with a <i>b</i>-value series of 2, 0, 1, 15, 20, 30, 45, 50, 60, 80, 100, 200, 300, 600, 800 s/mm<sup>2</sup>. Signal measurement was performed on right liver parenchyma. The first three very low <i>b</i>-values were excluded to improve the curve fitting stability, and bi-exponential segmented fitting was performed using the 12 <i>b</i>-values of 15~800 s/mm<sup>2</sup>. Both threshold <i>b</i>-values of 60 s/mm<sup>2</sup> and 200 s/mm<sup>2</sup> were tested. With a 3-dimensional tool, Dslow (<i>D</i>), PF (<i>f</i>) and Dfast (<i>D*</i>) values were placed along the x-axis, y-axis, and z-axis, and a plane was defined to separate healthy volunteers from liver fibrosis patients.<h4>Results</h4>Threshold <i>b</i>-value of 60 s/mm<sup>2</sup> was preferred over 200 s/mm<sup>2</sup> for separating healthy volunteers and liver fibrosis patients. The IVIM measures of the four patients without fibrosis resembled those of healthy volunteers. When threshold <i>b</i>-value =60 s/mm<sup>2</sup> was applied, PF (PF <6.49%) could differentiate healthy livers and all fibrotic livers with 100% sensitivity and specificity. For the patients' measurement, PF and Dfast were highly correlated with a Pearson correlation coefficient r of 0.865 (P<0.001); while the correlations between slow diffusion compartment (Dslow) and fast diffusion compartment (Dfast or PF) were not statistically significant.<h4>Conclusions</h4>This study confirms previous report that IVIM diffusion MRI has high diagnostic performance in detecting viral hepatitis-b induced liver fibrosis.

Also flagged:carbon nanotubesmethotrexatecarbon nanotubefolic acidethylenediaminecancer
Journal Article 2019-02-01 No Snippets Karimi A, Erfan M, Mortazavi SA, Ghorbani-Bidkorbeh F, Kobarfard F, Shirazi FH.
Show Full Abstract

Carboxylated functionalised multi-walled carbon nanotubes (f-MWCNT) were synthesised. Furthermore, folic acid (FA) and methotrexate (MTX) through ethylenediamine (ED) were attached to the surface of f-MWCNT to synthesise MWCNT-ED-FA and MWCNT-ED-MTX. Release studies of MTX as free drug and in MWCNT-ED-MTX were performed. These studies showed that MTX release rate from MWCNT-ED-MTX decreased in comparison with free MTX, which is due to the MTX attachment on the MWCNT. The anticancer effect of MWCNT-ED-FA and MWCNT-ED-MTX on the breast cancer cell line (MCF-7) was studied. Studies have shown that MWCNT-ED-MTX cytotoxicity is more than that of MWCNT-ED-FA, which is due to the presence of MTX. Furthermore, the anticancer effects of MWCNT-ED-FA and MWCNT-ED-MTX in the presence of infrared laser radiation on the MCF7 cell were studied. The experiments showed that in the presence of the laser, the cytotoxicities of MWCNT-ED-FA and MWCNT-ED-MTX were the same and increased in comparison with laser absence, which indicates that the photothermal effect is stronger than other factors and mask their effects. This effect can be related to laser radiation absorption by MWCNT and its conversion to heat which can induce cancer cell death. Targeting studies have shown that MWCNT-ED-FA is targeted to the cancer cells due to the presence of FA.

Also flagged:portal vein tumorhepatocellular carcinomagene expressionprimary tumorssorafenibtumor
Journal Article 2019-02-01 No Snippets Liu S, Zhou Z, Jia Y, Xue J, Liu Z, Cheng K, Cheng S, Liu S.
Show Full Abstract

<h4>Objective</h4>Multiple mechanisms underlying the development of portal vein tumor thrombus (PVTT) in hepatocellular carcinoma (HCC) have been reported recently. However, the origins of PVTT remain unknown. Increasing multi-omics data on PVTTs in HCCs have made it possible to investigate whether PVTTs originate from the corresponding primary tumors (Ts).<h4>Methods</h4>The clonal relationship between PVTTs and their corresponding primary Ts was investigated using datasets deposited in public databases. One DNA copy number variations dataset and three gene expression datasets were downloaded for the analyses. Clonality analysis was performed to investigate the clonal relationship between PVTTs and Ts from an individual patient. Differential gene expression analysis was applied to investigate the gene expression profiles of PVTTs and Ts.<h4>Results</h4>One out of 19 PVTTs had no clonal relationship with its corresponding T, whereas the others did. The PVTTs with independent clonal origin showed different gene expression and enrichment in biological processes from the primary Ts. Based on the unique gene expression profiles, a gene signature including 24 genes was used to identify pairs of PVTTs and primary Ts without any clonal relationship. Validation in three datasets showed that these types of pairs of PVTTs and Ts can be identified by the 24-gene signature.<h4>Conclusions</h4>Our findings show a direct evidence for PVTT origin and consolidate the heterogeneity of PVTTs observed in clinic. The results suggest that PVTT investigation at a molecular level is clinically necessary for diagnosis and treatment.

Also flagged:ErbiumYttriumAluminumcasein phosphopeptidefluorideCPP-ACP
Journal Article 2019-02-01 No Snippets Hajizadeh H, Nemati-Karimooy A, Babaee-Rishkhori P.
Show Full Abstract

<h4>Objective</h4>The aim of this study was to assess the combined effect of erbium:yttrium-aluminum-garnet (Er:YAG) laser and mineralizing agents including casein phosphopeptide-amorphous calcium phosphate (CPP-ACP) and fluoride in improving the resistance of demineralized dentin at new demineralization process.<h4>Materials and methods</h4>One hundred and twenty healthy dentin surfaces were prepared and demineralized using acidic solutions. Primary microhardness was measured (h1), and samples were randomly divided into six groups. Each group received a different protocol as follows: Group A (control group): no additional treatment, Group B: applying a fluoridated gel, Group C: applying a CPP-ACP-containing cream, Group D: irradiation of Er:YAG laser, Group E: irradiation of Er:YAG laser combined with the application of a fluoridated agent, and Group F: irradiation of Er:YAG laser combined with the application of CPP-ACP-containing cream. Microhardness values were measured afterward (h2). Then, all the groups were re-exposed to acidic solution, and microhardness was measured for the third time (h3). The microhardness data were analyzed using analysis of variance and Scheffe's post hoc test.<h4>Results</h4>Although application of mineralizing agents increased the microhardness of demineralized dentin in comparison with the control group, no significant difference was observed using two agents. Comparison of laser groups showed an increase in microhardness only after the irradiation of Er:YAG laser combined with the application of a fluoridated agent. Demineralizing process reduced the microhardness values in all the groups, but the application of a CPP-ACP agent caused the least reduction among the laser irradiated groups. Comparison of hardness changes at the beginning and end of the experiment did not show any significant differences between the groups.<h4>Conclusion</h4>Comparison of treatment modalities used in this study exhibited that fluoride had the greatest impact on dentin resistance. Laser irradiation on demineralized dentin did not increase the hardness or resistance to acidic attacks.

Also flagged:CD4HIVAIDSCD4Temotional disorderschronic diseases
Journal Article 2019-02-01 No Snippets de Brito-Neto JG, de Andrade MF, de Almeida VD, Paiva DCC, de Morais NM, Bezerra CM, Fernandes JV, do Nascimento EGC, Fonseca IAT, de Medeiros Fernandes TAA.
Show Full Abstract

The establishment of physical training programs for people living with HIV/AIDS (PLWHA) has several benefits. The study aimed to analyze the effect of resistance training using prediction of intensity by subjective perception of effort (SPE) on body composition, muscle strength, and TCD4<sup>+</sup> lymphocyte levels in PLWHA. This a randomized controlled trial study. Participants (11 men and 8 women), were divided in two groups: exercise group (EG) and control group (CG). The EG was submitted to 12 weeks of a resistance-training program based in the prediction of intensity by SPE. Body mass percentages were evaluated using tetrapolar bioelectrical impedance and skinfold methods. We used Flow Cytometry to quantify CD4+ T lymphocytes. Patients showed significant changes in Body Fat Percentage (Δ%=-6.23%), Lean Body Mass (Δ%=2.45%), and CD4T lymphocytes levels (Δ%=15.77%). They also showed significant increase in muscular strength presented in the test for one repetition maximum in all the evaluated exercises. Our data suggest that exercising program prescribed by SPE is capable of improving immune function, body composition, and muscular strength in PLWHA.

Also flagged:S1BdefectsMetaphaseionsnucleic acidlocalization
Journal Article 2019-02-01 ✓ 1 Snippet Poser E, Caous R, Gruneberg U, Barr FA.
In-Text Gene Mentions

Condensincomplexes localize to…

Show Full Abstract

Aurora kinases create phosphorylation gradients within the spindle during prometaphase and anaphase, thereby locally regulating factors that promote spindle organization, chromosome condensation and movement, and cytokinesis. We show that one such factor is the kinesin KIF4A, which is present along the chromosome axes throughout mitosis and the central spindle in anaphase. These two pools of KIF4A depend on condensin I and PRC1, respectively. Previous work has shown KIF4A is activated by Aurora B at the anaphase central spindle. However, whether or not chromosome-associated KIF4A bound to condensin I is regulated by Aurora kinases remain unclear. To determine the roles of the two different pools of KIF4A, we generated specific point mutants that are unable to interact with either condensin I or PRC1 or are deficient for Aurora kinase regulation. By analyzing these mutants, we show that Aurora A phosphorylates the condensin I-dependent pool of KIF4A and thus actively promotes chromosome congression from the spindle poles to the metaphase plate.

Also flagged:Neuroticism5HTTanxietyserotonin transporterdepressionCognitive Anxiety
Journal Article 2019-02-01 ✓ 1 Snippet Altamura M, Iuso S, D'Andrea G, D'Urso F, Piccininni C, Angelini E, Sessa F, Margaglione M, Padulo C, Fairfield B, Petito A, Bellomo A.
In-Text Gene Mentions

5-HTT

Show Full Abstract

<h4>Objective</h4>Previous studies have suggested that genetic factors, personality traits and coping strategies might play both independent and interacting roles when influencing stress-related anxiety symptoms. The aim of this study was to examine whether Neuroticism and maladaptive coping strategies mediate the association between the serotonin transporter gene-linked polymorphic region (5HTT-LPR) and symptoms of anxiety and depression in elite athletes who experience high levels of competitive stress.<h4>Method</h4>One hundred and thirty-three participants were genotyped for the 5-HTTLPR polymorphism and then asked to complete the Cope Orientation to Problems Experienced Inventory and the NEO Five-Factor Inventory. A path analysis was used to test this hypothesis.<h4>Results</h4>The 5HTT-LPR was significantly associated with Neuroticism, the coping strategy of Focus on and Venting of Emotions' (FVE) and symptoms of anxiety. FVE and Neuroticism mediated the association between the 5HTT-LPR and symptoms of anxiety (i.e., Cognitive Anxiety and Emotional Arousal Control). Also, Neuroticism was a mediator of the association between the 5HTT-LPR and FVE. Finally, FVE also mediated effects on the relationship between Neuroticism and symptoms of anxiety.<h4>Conclusions</h4>The 5HTT-LPR may affect the susceptibility to develop symptoms of anxiety in elite athletes indirectly through mediation by maladaptive coping strategies and Neuroticism.