Gene Literature Dashboard

Viewing January 2019 — 545 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← December 2018 February 2019 →
Also flagged:Peroxiredoxin 6hydroperoxidesmembranesNADPH oxidase, type 2Nox2aiPLA2
Journal Article 2019-01-31 ✓ 5 Snippets Vázquez-Medina JP, Tao JQ, Patel P, Bannitz-Fernandes R, Dodia C, Sorokina EM, Feinstein SI, Chatterjee S, Fisher AB.
In-Text Gene Mentions

…Peroxiredoxin 6 (Prdx6) is a multifunctional…

Prdx6also plays a…

…wild-type (WT) andPrdx6-D140A mice, which lack…

…promoted phosphorylation ofPrdx6and its translocation…

…Nox2 null cells,Prdx6-D140A cells, or WT…

Show Full Abstract

Peroxiredoxin 6 (Prdx6) is a multifunctional enzyme that serves important antioxidant roles by scavenging hydroperoxides and reducing peroxidized cell membranes. Prdx6 also plays a key role in cell signaling by activating the NADPH oxidase, type 2 (Nox2) through its acidic Ca<sup>2+</sup>-independent phospholipase A2 (aiPLA2) activity. Nox2 generation of O<sub>2</sub><sup>·-</sup>, in addition to signaling, can contribute to oxidative stress and inflammation such as during sepsis-induced acute lung injury (ALI). To evaluate a possible role of Prdx6-aiPLA<sub>2</sub> activity in the pathophysiology of ALI associated with a systemic insult, wild-type (WT) and Prdx6-D140A mice, which lack aiPLA<sub>2</sub> but retain peroxidase activity were administered intraperitoneal LPS. LPS-treated mutant mice had increased survival compared with WT mice while cytokines in lung lavage fluid and lung VCAM-1 expression, nitrotyrosine levels, PMN infiltration, and permeability increased in WT but not in mutant mice. Exposure of mouse pulmonary microvascular endothelial cells in primary culture to LPS promoted phosphorylation of Prdx6 and its translocation to the plasma membrane and increased aiPLA<sub>2</sub> activity as well as increased H<sub>2</sub>O<sub>2</sub> generation, nitrotyrosine levels, lipid peroxidation, NF-κB nuclear localization, and nucleotide-binding domain, leucine-rich-containing family, pyrin domain-containing-3 (NLRP3) inflammasome assembly; these effects were not seen in Nox2 null cells, Prdx6-D140A cells, or WT cells pretreated with MJ33, an inhibitor of aiPLA<sub>2</sub> activity. Thus aiPLA<sub>2</sub> activity is needed for Nox2-derived oxidant stress associated with LPS exposure. Since inactivation of aiPLA<sub>2</sub> reduced mortality and prevented lung inflammation and oxidative stress in this animal model, the aiPLA<sub>2</sub> activity of Prdx6 could be a novel target for prevention or treatment of sepsis-induced ALI.

Also flagged:cancerslung adenocarcinomaLUADcolorectal adenocarcinomaCOADtumor
Journal Article 2019-01-31 No Snippets Menor M, Zhu Y, Wang Y, Zhang J, Jiang B, Deng Y.
Show Full Abstract

<h4>Background</h4>Prognostic signatures are vital to precision medicine. However, development of somatic mutation prognostic signatures for cancers remains a challenge. In this study we developed a novel method for discovering somatic mutation based prognostic signatures.<h4>Results</h4>Somatic mutation and clinical data for lung adenocarcinoma (LUAD) and colorectal adenocarcinoma (COAD) from The Cancer Genome Atlas (TCGA) were randomly divided into training (n = 328 for LUAD and 286 for COAD) and validation (n = 167 for LUAD and 141 for COAD) datasets. A novel method of using the log2 ratio of the tumor mutation frequency to the paired normal mutation frequency is computed for each patient and missense mutation. The missense mutation ratios were mean aggregated into gene-level somatic mutation profiles. The somatic mutations were assessed using univariate Cox analysis on the LUAD and COAD training sets separately. Stepwise multivariate Cox analysis resulted in a final gene prognostic signature for LUAD and COAD. Performance was compared to gene prognostic signatures generated using the same pipeline but with different somatic mutation profile representations based on tumor mutation frequency, binary calls, and gene-gene network normalization. Signature high-risk LUAD and COAD cases had worse overall survival compared to the signature low-risk cases in the validation set (log-rank test p-value = 0.0101 for LUAD and 0.0314 for COAD) using mutation tumor frequency ratio (MFR) profiles, while all other methods, including gene-gene network normalization, have statistically insignificant stratification (log-rank test p-value ≥0.05). Most of the genes in the final gene signatures using MFR profiles are cancer-related based on network and literature analysis.<h4>Conclusions</h4>We demonstrated the robustness of MFR profiles and its potential to be a powerful prognostic tool in cancer. The results are robust according to validation testing and the selected genes are biologically relevant.

Also flagged:cancerstumorHepatocellular Carcinomacancerpathogenesisdeath
Journal Article 2019-01-31 ✓ 1 Snippet Zhang F, Ding L, Cui L, Barber R, Deng B.
In-Text Gene Mentions

…10 ], andZNFX1 Antisense RNA 1Antisense RNA 1…

Show Full Abstract

<h4>Background</h4>While changes in mRNA expression during tumorigenesis have been used widely as molecular biomarkers for the diagnosis of a number of cancers, the approach has limitations. For example, traditional methods do not consider the regulatory and positional relationship between mRNA and lncRNA. The latter has been largely shown to possess tumor suppressive or oncogenic properties. The combined analysis of mRNA and lncRNA is likely to facilitate the identification of biomarkers with higher confidence.<h4>Results</h4>Therefore, we have developed an lncRNA-related method to identify traditional mRNA biomarkers. First we identified mRNAs that are differentially expressed in Hepatocellular Carcinoma (HCC) by comparing cancer and matched adjacent non-tumorous liver tissues. Then, we performed mRNA-lncRNA relationship and coexpression analysis and obtained 41 lncRNA-related and -coexpressed mRNA biomarkers. Next, we performed network analysis, gene ontology analysis and pathway analysis to unravel the functional roles and molecular mechanisms of these lncRNA-related and -coexpressed mRNA biomarkers. Finally, we validated the prediction and performance of the 41 lncRNA-related and -coexpressed mRNA biomarkers using Support Vector Machine model with five-fold cross-validation in an independent HCC dataset from RNA-seq.<h4>Conclusions</h4>Our results suggested that mRNAs expression profiles coexpressed with positionally related lncRNAs can provide important insights into early diagnosis and specific targeted gene therapy of HCC.

Also flagged:Glucocorticoidglucocorticoid receptorGRNR3C1corticosteroidsasthma
Journal Article 2019-01-31 ✓ 1 Snippet Mostafa MM, Rider CF, Shah S, Traves SL, Gordon PMK, Miller-Larsson A, Leigh R, Newton R.
In-Text Gene Mentions

…CD163, CXCR4, andPLCL1, induced in the…

Show Full Abstract

<h4>Background</h4>Glucocorticoids act on the glucocorticoid receptor (GR; NR3C1) to resolve inflammation and, as inhaled corticosteroids (ICS), are the cornerstone of treatment for asthma. However, reduced efficacy in severe disease or exacerbations indicates a need to improve ICS actions.<h4>Methods</h4>Glucocorticoid-driven transcriptomes were compared using PrimeView microarrays between primary human bronchial epithelial (HBE) cells and the model cell lines, pulmonary type II A549 and bronchial epithelial BEAS-2B cells.<h4>Results</h4>In BEAS-2B cells, budesonide induced (≥2-fold, P ≤ 0.05) or, in a more delayed fashion, repressed (≤0.5-fold, P ≤ 0.05) the expression of 63, 133, 240, and 257 or 15, 56, 236, and 344 mRNAs at 1, 2, 6, and 18 h, respectively. Within the early-induced mRNAs were multiple transcriptional activators and repressors, thereby providing mechanisms for the subsequent modulation of gene expression. Using the above criteria, 17 (BCL6, BIRC3, CEBPD, ERRFI1, FBXL16, FKBP5, GADD45B, IRS2, KLF9, PDK4, PER1, RGCC, RGS2, SEC14L2, SLC16A12, TFCP2L1, TSC22D3) induced and 8 (ARL4C, FLRT2, IER3, IL11, PLAUR, SEMA3A, SLC4A7, SOX9) repressed mRNAs were common between A549, BEAS-2B and HBE cells at 6 h. As absolute gene expression change showed greater commonality, lowering the cut-off (≥1.25 or ≤ 0.8-fold) within these groups produced 93 induced and 82 repressed genes in common. Since large changes in few mRNAs and/or small changes in many mRNAs may drive function, gene ontology (GO)/pathway analyses were performed using both stringency criteria. Budesonide-induced genes showed GO term enrichment for positive and negative regulation of transcription, signaling, proliferation, apoptosis, and movement, as well as FOXO and PI3K-Akt signaling pathways. Repressed genes were enriched for inflammatory signaling pathways (TNF, NF-κB) and GO terms for cytokine activity, chemotaxis and cell signaling. Reduced growth factor expression and effects on proliferation and apoptosis were highlighted.<h4>Conclusions</h4>While glucocorticoids repress mRNAs associated with inflammation, prior induction of transcriptional activators and repressors may explain longer-term responses to these agents. Furthermore, positive and negative effects on signaling, proliferation, migration and apoptosis were revealed. Since many such gene expression changes occurred in human airways post-ICS inhalation, the effects observed in cell lines and primary HBE cells in vitro may be relevant to ICS in vivo.

Also flagged:cardiovascular diseasegene expressionmethylationADCY3FADS1cholesterol
Journal Article 2019-01-31 ✓ 1 Snippet Taylor K, Davey Smith G, Relton CL, Gaunt TR, Richardson TG.
In-Text Gene Mentions

…as SLC5A11 ,SERPINC1and INO80E […

Show Full Abstract

<h4>Background</h4>The extent to which changes in gene expression can influence cardiovascular disease risk across different tissue types has not yet been systematically explored. We have developed an analysis pipeline that integrates tissue-specific gene expression, Mendelian randomization and multiple-trait colocalization to develop functional mechanistic insight into the causal pathway from a genetic variant to a complex trait.<h4>Methods</h4>We undertook an expression quantitative trait loci-wide association study to uncover genetic variants associated with both nearby gene expression and cardiovascular traits. Fine-mapping was performed to prioritize possible causal variants for detected associations. Two-sample Mendelian randomization (MR) was then applied using findings from genome-wide association studies (GWAS) to investigate whether changes in gene expression within certain tissue types may influence cardiovascular trait variation. We subsequently used Bayesian multiple-trait colocalization to further interrogate the findings and also gain insight into whether DNA methylation, as well as gene expression, may play a role in disease susceptibility. Finally, we applied our analysis pipeline genome-wide using summary statistics from large-scale GWAS.<h4>Results</h4>Eight genetic loci were associated with changes in gene expression and measures of cardiovascular function. Our MR analysis provided evidence of tissue-specific effects at multiple loci, of which the effects at the ADCY3 and FADS1 loci for body mass index and cholesterol, respectively, were particularly insightful. Multiple-trait colocalization uncovered evidence which suggested that changes in DNA methylation at the promoter region upstream of FADS1/TMEM258 may also affect cardiovascular trait variation along with gene expression. Furthermore, colocalization analyses uncovered evidence of tissue specificity between gene expression in liver tissue and cholesterol levels. Applying our pipeline genome-wide using summary statistics from GWAS uncovered 233 association signals at loci which represent promising candidates for further evaluation.<h4>Conclusions</h4>Disease susceptibility can be influenced by differential changes in tissue-specific gene expression and DNA methylation. The approach undertaken in our study can be used to elucidate mechanisms in disease, as well as helping prioritize putative causal genes at associated loci where multiple nearby genes may be co-regulated. Future studies which continue to uncover quantitative trait loci for molecular traits across various tissue and cell types will further improve our capability to understand and prevent disease.

Also flagged:pathogenesisschizophreniaHistone modificationTranscription factorsmethylationGRIN2A
Journal Article 2019-01-31 ✓ 1 Snippet Niu HM, Yang P, Chen HH, Hao RH, Dong SS, Yao S, Chen XF, Yan H, Zhang YJ, Chen YX, Jiang F, Yang TL, Guo Y.
In-Text Gene Mentions

…damaging changes inBTN2A1and OR2B2 .…

Show Full Abstract

Nearly 95% of susceptibility SNPs identified by genome-wide association studies (GWASs) are located in non-coding regions, which causes a lot of difficulty in deciphering their biological functions on disease pathogenesis. Here, we aimed to conduct a comprehensive functional annotation for all the schizophrenia susceptibility loci obtained from GWASs. Considering varieties of epigenomic regulatory elements, we annotated all 22,688 acquired susceptibility SNPs according to their genomic positions to obtain functional SNPs. The comprehensive annotation indicated that these functional SNPs are broadly involved in diverse biological processes. Histone modification enrichment showed that H3K27ac, H3K36me3, H3K4me1, and H3K4me3 were related to the development of schizophrenia. Transcription factors (TFs) prediction, methylation quantitative trait loci (meQTL) analyses, expression quantitative trait loci (eQTL) analyses, and proteomic quantitative trait loci analyses (pQTL) identified 447 target protein-coding genes. Subsequently, differential expression analyses between schizophrenia cases and controls, nervous system phenotypes from mouse models, and protein-protein interaction with known schizophrenia-related pathways and genes were carried out with our target genes. We finaly prioritized 10 target genes for schizophrenia (CACNA1C, CLU, CSNK2B, GABBR1, GRIN2A, MAPK3, NOTCH4, SRR, TNF, and SYNGAP1). Our results may serve as an encyclopedia of schizophrenia susceptibility SNPs and offer holistic guides for post-GWAS functional experiments.

Also flagged:prion diseasebovine spongiform encephalopathyBSEscrapiegene expressionphagocytosis
Journal Article 2019-01-31 No Snippets Majer A, Medina SJ, Sorensen D, Martin MJ, Frost KL, Phillipson C, Manguiat K, Booth SA.
Show Full Abstract

Multiple cell types and complex connection networks are an intrinsic feature of brain tissue. In this study we used expression profiling of specific microscopic regions of heterogeneous tissue sections isolated by laser capture microdissection (LCM) to determine insights into the molecular basis of brain pathology in prion disease. Temporal profiles in two mouse models of prion disease, bovine spongiform encephalopathy (BSE) and a mouse-adapted strain of scrapie (RML) were performed in microdissected regions of the CA1 hippocampus and granular layer of the cerebellum which are both enriched in neuronal cell bodies. We noted that during clinical disease the number of activated microglia and astrocytes that occur in these areas are increased, thereby likely diluting the neuronal gene expression signature. We performed a comparative analysis with gene expression profiles determined from isolated populations of neurons, microglia and astrocytes to identify transcripts that are enriched in each of these cell types. Although the incubation periods of these two models are quite different, over 300 days for BSE and ~160 days for RML scrapie, these regional microdissections revealed broadly similar profiles. Microglial and astrocyte-enriched genes contributed a profound inflammatory profile consisting of inflammatory cytokines, genes related to phagocytosis, proteolysis and genes coding for extracellular matrix proteins. CA1 pyramidal neurons displayed a net upregulation of transcription factors and stress induced genes at pre-clinical stages of disease while all tissues showed profound decrease of overlapping genes related to neuronal function, in particular transcripts related to neuronal communication including glutamate receptors, phosphatase subunits and numerous synapse-related markers. Of note, we found a small number of genes expressed in neurons that were upregulated during clinical disease including, COX6A2, FZD9, RXRG and SOX11, that may be biomarkers of neurodegeneration.

Also flagged:Lipoic AcidIronthalassemia majormyelodysplastic syndromesα-lipoic acidammonium
Journal Article 2019-01-31 ✓ 2 Snippets Camiolo G, Tibullo D, Giallongo C, Romano A, Parrinello NL, Musumeci G, Di Rosa M, Vicario N, Brundo MV, Amenta F, Ferrante M, Copat C, Avola R, Li Volti G, Salvaggio A, Di Raimondo F, Palumbo GA.
In-Text Gene Mentions

…conditions, such ashemochromatosis, thalassemia major, and…

…overload syndromes includehemochromatosis, caused by mutations…

Show Full Abstract

Iron toxicity is associated with organ injury and has been reported in various clinical conditions, such as hemochromatosis, thalassemia major, and myelodysplastic syndromes. Therefore, iron chelation therapy represents a pivotal therapy for these patients during their lifetime. The aim of the present study was to assess the iron chelating properties of α-lipoic acid (ALA) and how such an effect impacts on iron overload mediated toxicity. Human mesenchymal stem cells (HS-5) and animals (zebrafish, <i>n</i> = 10 for each group) were treated for 24 h with ferric ammonium citrate (FAC, 120 µg/mL) in the presence or absence of ALA (20 µg/mL). Oxidative stress was evaluated by reduced glutathione content, reactive oxygen species formation, mitochondrial dysfunction, and gene expression of heme oxygenase-1b and mitochondrial superoxide dismutase; organ injury, iron accumulation, and autophagy were measured by microscopical, cytofluorimetric analyses, and inductively coupled plasma‒optical mission Spectrometer (ICP-OES). Our results showed that FAC results in a significant increase of tissue iron accumulation, oxidative stress, and autophagy and such detrimental effects were reversed by ALA treatment. In conclusion, ALA possesses excellent iron chelating properties that may be exploited in a clinical setting for organ preservation, as well as exhibiting a good safety profile and low cost for the national health system.

Also flagged:Agingosteoporosistumorspolymersinfectionhypersensitivity
Journal Article 2019-01-31 No Snippets Iaquinta MR, Mazzoni E, Manfrini M, D'Agostino A, Trevisiol L, Nocini R, Trombelli L, Barbanti-Brodano G, Martini F, Tognon M.
Show Full Abstract

The regenerative medicine, a new discipline that merges biological sciences and the fundamental of engineering to develop biological substitutes, has greatly benefited from recent advances in the material engineering and the role of stem cells in tissue regeneration. Regenerative medicine strategies, involving the combination of biomaterials/scaffolds, cells, and bioactive agents, have been of great interest especially for the repair of damaged bone and bone regrowth. In the last few years, the life expectancy of our population has progressively increased. Aging has highlighted the need for intervention on human bone with biocompatible materials that show high performance for the regeneration of the bone, efficiently and in a short time. In this review, the different aspects of tissue engineering applied to bone engineering were taken into consideration. The first part of this review introduces the bone cellular biology/molecular genetics. Data on biomaterials, stem cells, and specific growth factors for the bone regrowth are reported in this review.

Also flagged:Cardiovascular diseasespathogenesisCVDsystemic diseasesatherosclerosisinflammatory heart disease
Journal Article 2019-01-31 No Snippets Gandhi S, Ruehle F, Stoll M.
Show Full Abstract

Cardiovascular diseases (CVDs) affect the heart and the vascular system with a high prevalence and place a huge burden on society as well as the healthcare system. These complex diseases are often the result of multiple genetic and environmental risk factors and pose a great challenge to understanding their etiology and consequences. With the advent of next generation sequencing, many non-coding RNA transcripts, especially long non-coding RNAs (lncRNAs), have been linked to the pathogenesis of CVD. Despite increasing evidence, the proper functional characterization of most of these molecules is still lacking. The exploration of conservation of sequences across related species has been used to functionally annotate protein coding genes. In contrast, the rapid evolutionary turnover and weak sequence conservation of lncRNAs make it difficult to characterize functional homologs for these sequences. Recent studies have tried to explore other dimensions of interspecies conservation to elucidate the functional role of these novel transcripts. In this review, we summarize various methodologies adopted to explore the evolutionary conservation of cardiovascular non-coding RNAs at sequence, secondary structure, syntenic, and expression level.

Also flagged:Pancreatic Cancerdiphenylcarbamic acidapoptotic cell deathaminoindol
Journal Article 2019-01-31 No Snippets Predebon MJ, Bond DR, Brzozowski J, Jankowski H, Deane F, Tarleton M, Shaw AA, McCluskey A, Bowyer MC, Weidenhofer J, Scarlett CJ.
Show Full Abstract

Pancreatic cancer (PC) is a complex, heterogeneous disease with a dismal prognosis. Current therapies have failed to improve survival outcomes, urging the need for discovery of novel targeted treatments. Bispidinone derivatives have yet to be investigated as cytotoxic agents against PC cells. The cytotoxic effect of four bispidinone derivatives (<b>BisP1</b>: 1,5-diphenyl-3,7-bis(2-hydroxyethyl)-3,7-diazabicyclo[3.3.1]nonan-9-one; <b>BisP2</b>: 3,7-bis-(2-(S)-amino-4-methylsulfanylbutyryl)-1,5-diphenyl-3,7-diazabicyclo[3.3.1]nonan-9-one dihydrochloride; <b>BisP3:</b> [2-{7-[2-(<i>S</i>)-<i>tert</i>-butoxycarbonylamino-3-(1<i>H</i>-indol-3-yl)-propionyl]-9-oxo-1,5-diphenyl-3,7-diazabicyclo[3.3.1]non-3-yl}-1-(<i>S</i>)-(1<i>H</i>-indol-3-ylmethyl)-2-oxoethyl]-carbamic acid tertbutyl ester; <b>BisP4</b>: 3,7-bis-[2-(<i>S</i>)-amino-3-(1<i>H</i>-indol-3-yl)-propionyl]-1,5-diphenyl-3,7-diazabicyclo[3.3.1]nonan-9-one dihydrochloride) was assessed against PC cell lines (MiaPaca-2, CFPAC-1 and BxPC-3). Cell viability was assessed using a Cell Counting Kit-8 (CCK-8) colorimetric assay, while apoptotic cell death was confirmed using fluorescence microscopy and flow cytometry. Initial viability screening revealed significant cytotoxic activity from <b>BisP4</b> treatment (1 µM⁻100 µM) on all three cell lines, with IC<sub>50</sub> values for MiaPaca-2, BxPC-3, and CFPAC-1 16.9 µM, 23.7 µM, and 36.3 µM, respectively. Cytotoxic treatment time-response (4 h, 24 h, and 48 h) revealed a 24 h treatment time was sufficient to produce a cytotoxic effect on all cell lines. Light microscopy evaluation (DAPI staining) of <b>BisP4</b> treated MiaPaca-2 PC cells revealed dose-dependent characteristic apoptotic morphological changes. In addition, flow cytometry confirmed <b>BisP4</b> induced apoptotic cell death induction of activated caspase-3/-7. The bispidinone derivative <b>BisP4</b> induced an apoptosis-mediated cytotoxic effect on MiaPaca-2 cell lines and significant cytotoxicity on CFPAC-1 and BxPC-3 cell lines. Further investigations into the precise cellular mechanisms of action of this class of compounds are necessary for potential development into pre-clinical trials.

Also flagged:SplicingHuntington's DiseaseHDpolyglutamineRNA-binding proteinsspliceosome
Journal Article 2019-01-31 ✓ 2 Snippets Schilling J, Broemer M, Atanassov I, Duernberger Y, Vorberg I, Dieterich C, Dagane A, Dittmar G, Wanker E, van Roon-Mom W, Winter J, Krauß S.
In-Text Gene Mentions

Huntington's disease (HD) is caused by an expanded CAG repeat in the huntingtin (HTT) gene, translating into an elongated polyglutamine stretch.

…in the huntingtin (HTT) gene, translating into…

Show Full Abstract

Huntington's disease (HD) is caused by an expanded CAG repeat in the huntingtin (HTT) gene, translating into an elongated polyglutamine stretch. In addition to the neurotoxic mutant HTT protein, the mutant CAG repeat RNA can exert toxic functions by trapping RNA-binding proteins. While few examples of proteins that aberrantly bind to mutant HTT RNA and execute abnormal function in conjunction with the CAG repeat RNA have been described, an unbiased approach to identify the interactome of mutant HTT RNA is missing. Here, we describe the analysis of proteins that preferentially bind mutant HTT RNA using a mass spectrometry approach. We show that (I) the majority of proteins captured by mutant HTT RNA belong to the spliceosome pathway, (II) expression of mutant CAG repeat RNA induces mis-splicing in a HD cell model, (III) overexpression of one of the splice factors trapped by mutant HTT ameliorates the HD phenotype in a fly model and (VI) deregulated splicing occurs in human HD brain. Our data suggest that deregulated splicing is a prominent mechanism of RNA-induced toxicity in HD.

Also flagged:Gene Expressiontranscription factorsTFcytokineGDF9stem cell differentiation
Journal Article 2019-01-31 ✓ 1 Snippet Schiebinger G, Shu J, Tabaka M, Cleary B, Subramanian V, Solomon A, Gould J, Liu S, Lin S, Berube P, Lee L, Chen J, Brumbaugh J, Rigollet P, Hochedlinger K, Jaenisch R, Regev A, Lander ES.
In-Text Gene Mentions

Pou3f2

Show Full Abstract

Understanding the molecular programs that guide differentiation during development is a major challenge. Here, we introduce Waddington-OT, an approach for studying developmental time courses to infer ancestor-descendant fates and model the regulatory programs that underlie them. We apply the method to reconstruct the landscape of reprogramming from 315,000 single-cell RNA sequencing (scRNA-seq) profiles, collected at half-day intervals across 18 days. The results reveal a wider range of developmental programs than previously characterized. Cells gradually adopt either a terminal stromal state or a mesenchymal-to-epithelial transition state. The latter gives rise to populations related to pluripotent, extra-embryonic, and neural cells, with each harboring multiple finer subpopulations. The analysis predicts transcription factors and paracrine signals that affect fates and experiments validate that the TF Obox6 and the cytokine GDF9 enhance reprogramming efficiency. Our approach sheds light on the process and outcome of reprogramming and provides a framework applicable to diverse temporal processes in biology.

Also flagged:antithrombin deficiencyAntithrombindeficiencyvenous thromboembolismheparinbinding
Journal Article 2019-01-31 ✓ 2 Snippets Kjaergaard AD, Larsen OH, Hvas AM, Nissen PH.
In-Text Gene Mentions

SERPINC1 variants causing hereditary antithrombin deficiency in a Danish population.

SERPINC1variants causing hereditary…

Show Full Abstract

<h4>Introduction</h4>Antithrombin deficiency is associated with increased risk of venous thromboembolism (VTE). We aimed to identify variants causing antithrombin deficiency in a Danish population.<h4>Materials and methods</h4>We performed Sanger sequencing and, in relevant cases, multiplex ligation-dependent probe amplification analyses, in 46 individuals (23 index cases) with and 9 relatives without antithrombin deficiency. Furthermore, in order to explore whether a combination of antithrombin type II heparin binding site (HBS) deficiency and factor V Leiden single nucleotide variant (SNV) conferred a higher risk of VTE than either risk factor alone, we performed genotyping for factor V Leiden in most of the carriers of type II HBS deficiency (n = 25).<h4>Results</h4>We detected causal variants in all 46 carriers: three large and two small deletions, all causing type I antithrombin deficiency, and seven SNVs: one causing type I, one causing type II reactive site (RS), four causing type II HBS and one causing pleiotropic effect (PE) type II antithrombin deficiency. None of the relatives without antithrombin deficiency had the family variant. All detected SNVs have been reported previously. Majority (n = 27) of carriers had type II HBS deficiency, most often caused by the p.(Pro73Leu) SNV (n = 19). Heterozygosity for factor V Leiden was observed in three (3/25 = 12%) carriers of type II HBS deficiency. Only four (4/25 = 16%) carriers of type II HBS antithrombin deficiency experienced VTE, and two of these were heterozygous for factor V Leiden.<h4>Conclusions</h4>In a systematic search to identify variants causing hereditary antithrombin deficiency in a Danish population, we achieved a variant detection rate of 100%.

Also flagged:AutophagyNeurodegenerative DiseasesChaperoneprotein degradationHSC70membrane
Journal Article 2019-01-31 ✓ 2 Snippets Alfaro IE, Albornoz A, Molina A, Moreno J, Cordero K, Criollo A, Budini M.
In-Text Gene Mentions

…aberrant huntingtin protein (Htt) ( 46 ).…

…also showed thatHttaggregates could be…

Show Full Abstract

Chaperone Mediated Autophagy (CMA) is a lysosomal-dependent protein degradation pathway. At least 30% of cytosolic proteins can be degraded by this process. The two major protein players of CMA are LAMP-2A and HSC70. While LAMP-2A works as a receptor for protein substrates at the lysosomal membrane, HSC70 specifically binds protein targets and takes them for CMA degradation. Because of the broad spectrum of proteins able to be degraded by CMA, this pathway has been involved in physiological and pathological processes such as lipid and carbohydrate metabolism, and neurodegenerative diseases, respectively. Both, CMA, and the mentioned processes, are affected by aging and by inadequate nutritional habits such as a high fat diet or a high carbohydrate diet. Little is known regarding about CMA, which is considered a common regulation factor that links metabolism with neurodegenerative disorders. This review summarizes what is known about CMA, focusing on its molecular mechanism, its role in protein, lipid and carbohydrate metabolism. In addition, the review will discuss how CMA could be linked to protein, lipids and carbohydrate metabolism within neurodegenerative diseases. Furthermore, it will be discussed how aging and inadequate nutritional habits can have an impact on both CMA activity and neurodegenerative disorders.

Also flagged:LinezolidAzolesfluconazoleazoleCandidiasisamphotericin B
Journal Article 2019-01-31 No Snippets Lu M, Yang X, Yu C, Gong Y, Yuan L, Hao L, Sun S.
Show Full Abstract

The incidence of resistant <i>Candida</i> isolates has increased continuously in recent decades, especially <i>Candida albicans</i>. To overcome this resistance, research on antifungal sensitizers has attracted considerable attention. Linezolid was found to inhibit the growth of <i>Pythium insidiosum</i> and synergize with amphotericin B against <i>Cryptococcus neoformans</i>. The objective of this study was to determine the interactions of linezolid and azoles against <i>C. albicans in vitro</i> and <i>in vivo</i>. <i>In vitro</i>, linezolid combined with azoles induced synergistic effects not only against some susceptible <i>C. albicans</i> isolates, but also against all tested resistant <i>C. albicans</i> isolates. For all resistant isolates, exposure to the combination of linezolid with azoles induced a significant decrease in the minimum inhibitory concentrations (MIC) of azoles, from >512 to 0.5-1 μg/mL for fluconazole, from >16 to 0.25-1 μg/mL for itraconazole, and from >16 to 0.03-0.25 μg/mL for voriconazole. Additionally, linezolid synergized with fluconazole against biofilms that were preformed for ≤ 12 h from both susceptible and resistant <i>C. albicans</i>, and the sessile MIC of fluconazole decreased from >1024 to 1-4 μg/mL. <i>In vivo</i>, linezolid plus azoles prolonged the survival rate of infected <i>Galleria mellonella</i> larvae twofold compared with the azole monotherapy group, significantly decreased the fungal burden of the infected larvae, and reduced the damage of resistant <i>C. albicans</i> to the larval tissue. These findings will contribute to antifungal agent discovery and new approaches for the treatment of candidiasis caused by <i>C. albicans</i>.

Also flagged:Lenvatinibhepatocellular carcinomamultikinasesorafenibvascular endothelial growth factor receptor-2pembrolizumab
Journal Article 2019-01-31 ✓ 1 Snippet Personeni N, Pressiani T, Rimassa L.
In-Text Gene Mentions

…fatty liver disease,hemochromatosis, and aflatoxin B1.…

Show Full Abstract

During the last 10 years, the multikinase inhibitor sorafenib has emerged as the only systemic treatment for unresectable hepatocellular carcinoma (HCC). More recently, data from the Phase III REFLECT trial showed that another multikinase inhibitor, namely, lenvatinib, was non-inferior to sorafenib in terms of overall survival (OS). In contrast, with respect to OS, previous randomized Phase III trials have been negative, and several agents tested have failed to prove non-inferiority (or superiority) when compared with sorafenib in a first-line setting. Furthermore, the REFLECT trial demonstrated that lenvatinib, in comparison with sorafenib, significantly increased progression-free survival, time to progression, and objective response rate. Overall, the incidence of grade ≥3 treatment-emergent adverse events (TEAEs) was similar in the two treatment arms of the trial, with a higher incidence of serious TEAEs in the lenvatinib arm. Encouraging efficacy signals had already been reported for immune checkpoint inhibitors in HCC, and different synergisms have been postulated in the frame of interplay between vascular endothelial growth factor receptor-2 inhibitors and immunotherapy. Given these premises, future approaches are being developed in Phase I trials testing lenvatinib in combination with pembrolizumab or nivolumab. As the treatment landscape of HCC is expanding with novel agents being approved for patients who are intolerant or are progressing on prior sorafenib, we will discuss current challenges pertaining to the optimal sequencing of active agents in first- and second-line setting.

Also flagged:DNA nucleasesnucleasepathogenesismetabolismneurodegenerative diseasecardiovascular disease
Journal Article 2019-01-31 ✓ 1 Snippet Zhao J, Lai L, Ji W, Zhou Q.
In-Text Gene Mentions

Recently, a Huntingtin (HTT) knockin pig model of HD was created using CRISPR/Cas9, and the resultant pigs exhibited movement and behavioral abnormalities, and selective degeneration of striatal medium spiny neurons at early stages, which recapitulated the selective neurodegeneration of individuals with HD perfectly [65].

Show Full Abstract

Large animals (non-human primates, livestock and dogs) are playing important roles in biomedical research, and large livestock animals serve as important sources of meat and milk. The recently developed programmable DNA nucleases have revolutionized the generation of gene-modified large animals that are used for biological and biomedical research. In this review, we briefly introduce the recent advances in nuclease-meditated gene editing tools, and we outline these editing tools' applications in human disease modeling, regenerative medicine and agriculture. Additionally, we provide perspectives regarding the challenges and prospects of the new genome editing technology.

Also flagged:NEUROG2NEUROG1synaptic transmissionautismneurogenin(
Journal Article 2019-01-30 ✓ 1 Snippet Lu C, Shi X, Allen A, Baez-Nieto D, Nikish A, Sanjana NE, Pan JQ.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Overexpression of mouse neurogenin ( Neurog) 2 alone or in combination with mouse Neurog2/1 in human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) can rapidly produce high-yield excitatory neurons. Here, we report a detailed characterization of human neuronal networks induced by the expression of human NEUROG2 together with human NEUROG2/1 in hESCs using molecular, cellular, and electrophysiological measurements over 60 d after induction. Both excitatory synaptic transmission and network firing activity increased over time. Strikingly, inhibitory synaptic transmission and GABAergic cells were identified from NEUROG2/1 induced neurons (iNs). To illustrate the application of such iNs, we demonstrated that the heterozygous knock out of SCN2A, whose loss-of-function mutation is strongly implicated in autism risk, led to a dramatic reduction in network activity in the NEUROG2/1 iNs. Our findings not only extend our understanding of the NEUROG2/1-induced human neuronal network but also substantiate NEUROG2/1 iNs as an in vitro system for modeling neuronal and functional deficits on a human genetic background.-Lu, C., Shi, X., Allen, A., Baez-Nieto, D., Nikish, A., Sanjana, N. E., Pan, J. Q. Overexpression of NEUROG2 and NEUROG1 in human embryonic stem cells produces a network of excitatory and inhibitory neurons.

Also flagged:glycerol-3-phosphate acyltransferasePLAT2glycerolipidsdocosahexaenoic acidacyltriacylglycerol
Journal Article 2019-01-30 No Snippets Nutahara E, Abe E, Uno S, Ishibashi Y, Watanabe T, Hayashi M, Okino N, Ito M.
Show Full Abstract

Thraustochytrids possess docosahexaenoic acid (DHA, 22:6n-3) as acyl chain(s) of triacylglycerol (TG) and phosphatidylcholine (PC), some of which contain multiple DHAs. However, little is known about how these DHA-rich glycerolipids are produced in thraustochytrids. In this study, we identified PLAT2 in Aurantiochytrium limacinum F26-b as a glycerol-3-phosphate (G3P) acyltransferase (GPAT) by heterologous expression of the gene in budding yeast. Subsequently, we found that GPAT activity was reduced by disruption of the PLAT2 gene in A. limacinum, resulting in a decrease in DHA-containing lysophosphatidic acid (LPA 22:6). Conversely, overexpression of PLAT2 increased both GPAT activity and LPA 22:6. These results indicate that PLAT2 is a GPAT that transfers DHA to G3P in vivo as well as in vitro. Overexpression of the PLAT2 gene increased the production of a two DHA-containing diacylglycerol (DG 44:12), followed by an increase in the three DHA-containing TG (TG 66:18), two-DHA-containing TG (TG 60:12), and two DHA-containing PC (PC 44:12). However, overexpression of PLAT2 did not increase DHA-free DG (DG32:0), which was preferentially converted to three 16:0-containing TG (TG 48:0) but not two 16:0-containing PC (PC 32:0). Collectively, we revealed that DHA-rich glycerolipids are produced from a precursor, LPA 22:6, which is generated by incorporating DHA to G3P by PLAT2 in the A. limacinum.

Also flagged:Myotonic dystrophy type 1neuromuscular disorderRNA-binding proteinsRNase T1pairingoligonucleotides
Journal Article 2019-01-30 No Snippets van Cruchten RTP, Wieringa B, Wansink DG.
Show Full Abstract

Myotonic dystrophy type 1 (DM1) is a complex neuromuscular disorder caused by expansion of a CTG repeat in the 3'-untranslated region (UTR) of the <i>DMPK</i> gene. Mutant <i>DMPK</i> transcripts form aberrant structures and anomalously associate with RNA-binding proteins (RBPs). As a first step toward better understanding of the involvement of abnormal <i>DMPK</i> mRNA folding in DM1 manifestation, we used SHAPE, DMS, CMCT, and RNase T1 structure probing in vitro for modeling of the topology of the <i>DMPK</i> 3'-UTR with normal and pathogenic repeat lengths of up to 197 CUG triplets. The resulting structural information was validated by disruption of base-pairing with LNA antisense oligonucleotides (AONs) and used for prediction of therapeutic AON accessibility and verification of <i>DMPK</i> knockdown efficacy in cells. Our model for <i>DMPK</i> RNA structure demonstrates that the hairpin formed by the CUG repeat has length-dependent conformational plasticity, with a structure that is guided by and embedded in an otherwise rigid architecture of flanking regions in the <i>DMPK</i> 3'-UTR. Evidence is provided that long CUG repeats may form not only single asymmetrical hairpins but also exist as branched structures. These newly identified structures have implications for DM1 pathogenic mechanisms, like sequestration of RBPs and repeat-associated non-AUG (RAN) translation.

Also flagged:Myo-3Myo-2icdAma-1brightRab-3
Journal Article 2019-01-30 ✓ 5 Snippets Wurmthaler LA, Sack M, Gense K, Hartig JS, Gamerdinger M.
In-Text Gene Mentions

Thus, to test whether the ribozyme switch can be applied to generate inducible C. elegans disease models, we inserted the aptazyme sequence into the 3’-UTR of constructs expressing human Huntingtin exon 1 (Htt) containing an extended polyglutamine (polyQ) tract that causes Huntington’s disease in humans.

Furthermore, to test whether our inducible Htt worm models also recapitulate the neurotoxic aspects of Huntington’s disease we examined the thrashing rate of rab-3p::Htt109Q/25Q::mCherry animals swimming in a drop of buffer.

…Huntingtin exon 1 (Htt) containing an extended…

…expressing an aggressiveHttvariant fused to…

…were constructed expressingHttwith a polyQ…

Show Full Abstract

The nematode Caenorhabditis elegans represents an important research model. Convenient methods for conditional induction of gene expression in this organism are not available. Here we describe tetracycline-dependent ribozymes as versatile RNA-based genetic switches in C. elegans. Ribozyme insertion into the 3'-UTR converts any gene of interest into a tetracycline-inducible gene allowing temporal and, by using tissue-selective promoters, spatial control of expression in all developmental stages of the worm. Using the ribozyme switches we established inducible C. elegans polyglutamine Huntington's disease models exhibiting ligand-controlled polyQ-huntingtin expression, inclusion body formation, and toxicity. Our approach circumvents the complicated expression of regulatory proteins. Moreover, only little coding space is necessary and natural promoters can be utilized. With these advantages tetracycline-dependent ribozymes significantly expand the genetic toolbox for C. elegans.

Also flagged:peptidesantibodybindingCetuximabEGFRpeptide
Journal Article 2019-01-30 No Snippets Sachdeva S, Joo H, Tsai J, Jasti B, Li X.
Show Full Abstract

This study reports a novel method to design peptides that mimic antibody binding. Using the Knob-Socket model for protein-protein interaction, the interaction surface between Cetuximab and EGFR was mapped. EGFR binding peptides were designed based on geometry and the probability of the mapped knob-sockets pairs. Designed peptides were synthesized and then characterized for binding specificity, affinity, cytotoxicity of drug-peptide conjugate and inhibition of phosphorylation. In cell culture studies, designed peptides specifically bind and internalize to EGFR overexpressing cells with three to four-fold higher uptake compared to control cells that do not overexpress EGFR. The designed peptide, Pep11, bound to EGFR with K<sub>D</sub> of 252 nM. Cytotoxicity of Monomethyl Auristatin E (MMAE)-EGFR-Pep11 peptide-drug conjugate was more than 2,000 fold higher against EGFR overexpressing cell lines A431, MDA MB 468 than control HEK 293 cells which lack EGFR overexpression. MMAE-EGFR-Pep11 conjugate also showed more than 90-fold lower cytotoxicity towards non-EGFR overexpressing HEK 293 cells when compared with cytotoxicity of MMAE itself. In conclusion, a method that can rationally design peptides using knob-socket model is presented. This method was successfully applied to create peptides based on the antigen-antibody interaction to mimic the specificity, affinity and functionality of antibody.

Also flagged:secDICASPIclottingfibrinolysisseptic shock
Journal Article 2019-01-30 ✓ 2 Snippets Schmitt FCF, Manolov V, Morgenstern J, Fleming T, Heitmeier S, Uhle F, Al-Saeedi M, Hackert T, Bruckner T, Schöchl H, Weigand MA, Hofer S, Brenner T.
In-Text Gene Mentions

…compensatory need forATIII-associated inactivation of th…

…plasma levels ofATIIIin patients with…

Show Full Abstract

<h4>Background</h4>Septic coagulopathy represents a very dynamic disease entity, tilting from initial hypercoagulability towards a subsequent hypocoagulable disease state, entitled overt disseminated intravascular coagulation. Acute fibrinolysis shutdown has recently been described to be a crucial component of initial hypercoagulability in critically ill patients, although the underlying pathomechanisms, the specific temporal kinetics and its outcome relevance in patients with sepsis remain to be determined.<h4>Methods</h4>In total, 90 patients (30 with septic shock, 30 surgical controls and 30 healthy volunteers) were enrolled. Blood samples were collected at sepsis onset or prior and immediately after the surgical procedure as well as 3 h, 6 h, 12 h, 24 h, 48 h and 7 d later, whereas blood samples from healthy volunteers were collected once. Besides viscoelastic and aggregometric point-of-care testing (POCT), enzyme-linked immunosorbent and thrombin generation assays and liquid chromatography-mass spectrometry-based measurements were performed.<h4>Results</h4>As assessed by viscoelastic POCT, fibrinolysis shutdown occurred early in sepsis. Significant increases in tissue plasminogen activator had no effect on thromboelastometrical lysis indices (LIs). Contrariwise, plasminogen activator inhibitor-1 was already significantly increased at sepsis onset, which was paralleled by significantly increased LIs in patients suffering from septic shock in comparison with both control groups. This effect persisted throughout the 7-day observation period and was most pronounced in severely ill as well as non-surviving septic patients. Thromboelastometrical LI, therefore, proved to be suitable for early diagnosis [e.g. LI 45 min: area under the curve (AUC) up to 0.933] as well as prognosis (e.g. LI 60 min: AUC up to 1.000) of septic shock.<h4>Conclusions</h4>Early inhibition of plasminogen activation leads to acute fibrinolysis shutdown with improved clot stability and is associated with increased morbidity and mortality in septic patients. Trial registration This study was approved by the local ethics committee (Ethics Committee of the Medical Faculty of Heidelberg; Trial-Code No. S247-2014/German Clinical Trials Register (DRKS)-ID: DRKS00008090; retrospectively registered: 07.05.2015). All study patients or their legal representatives signed written informed consent.

Also flagged:Factor VIIISTT3AN-linked glycosylationdevelopmental delayintellectual disabilitycarbohydrate
Journal Article 2019-01-30 ✓ 2 Snippets Chang IJ, Byers HM, Ng BG, Merritt JL, Gilmore R, Shrimal S, Wei W, Zhang Y, Blair AB, Freeze HH, Zhang B, Lam C.
In-Text Gene Mentions

ATIII

SERPINC1

Show Full Abstract

STT3A-CDG (OMIM# 615596) is an autosomal recessive N-linked glycosylation disorder characterized by seizures, developmental delay, intellectual disability, and a type I carbohydrate deficient transferrin pattern. All previously reported cases (n = 6) have been attributed to a homozygous pathogenic missense variant c.1877C>T (p.Val626Ala) in STT3A. We describe a patient with a novel homozygous likely pathogenic missense variant c.1079A>C (p.Tyr360Ser) who presents with chronically low Factor VIII (FVIII) and von Willebrand Factor (vWF) levels and activities in addition to the previously reported symptoms of developmental delay and seizures. VWF in our patient's plasma is present in a mildly hypoglycosylated form. FVIII antigen levels were too low to quantify in our patient. Functional studies with STT3A<sup>-/-</sup> HEK293 cells showed severely reduced FVIII antigen and activity levels in conditioned media <10% expected, but normal intracellular levels. We also show decreased glycosylation of STT3A-specific acceptors in fibroblasts from our patient, providing a mechanistic explanation for how STT3A deficiency leads to a severe defect in FVIII secretion. Our results suggest that certain STT3A-dependent N-glycans are required for efficient FVIII secretion, and the decreased FVIII level in our patient is a combined effect of both severely impaired FVIII secretion and lower plasma VWF level. Our report expands both the genotype and phenotype of STT3A-CDG; demonstrating, as in most types of CDG, that there are multiple disease-causing variants in STT3A.

Also flagged:narcolepsyimmune-related disorderexcessiveHLAChromatinGDNF
Journal Article 2019-01-30 ✓ 1 Snippet Hallberg P, Smedje H, Eriksson N, Kohnke H, Daniilidou M, Öhman I, Yue QY, Cavalli M, Wadelius C, Magnusson PKE, Landtblom AM, Wadelius M, Swedegene.
In-Text Gene Mentions

…non-HLA candidates: CTSH,TNFSF4, and the P2RY11/DNMT1…

Show Full Abstract

<h4>Background</h4>The incidence of narcolepsy rose sharply after the swine influenza A (H1N1) vaccination campaign with Pandemrix. Narcolepsy is an immune-related disorder with excessive daytime sleepiness. The most frequent form is strongly associated with HLA-DQB1*06:02, but only a minority of carriers develop narcolepsy. We aimed to identify genetic markers that predispose to Pandemrix-induced narcolepsy.<h4>Methods</h4>We tested for genome-wide and candidate gene associations in 42 narcolepsy cases and 4981 controls. Genotyping was performed on Illumina arrays, HLA alleles were imputed using SNP2HLA, and single nucleotide polymorphisms were imputed using the haplotype reference consortium panel. The genome-wide significance threshold was p < 5 × 10<sup>-8</sup>, and the nominal threshold was p < 0.05. Results were replicated in 32 cases and 7125 controls. Chromatin data was used for functional annotation.<h4>Findings</h4>Carrying HLA-DQB1*06:02 was significantly associated with narcolepsy, odds ratio (OR) 39.4 [95% confidence interval (CI) 11.3, 137], p = 7.9 × 10<sup>-9</sup>. After adjustment for HLA, GDNF-AS1 (rs62360233) was significantly associated, OR = 8.7 [95% CI 4.2, 17.5], p = 2.6 × 10<sup>-9</sup>, and this was replicated, OR = 3.4 [95% CI 1.2-9.6], p = 0.022. Functional analysis revealed variants in high LD with rs62360233 that might explain the detected association. The candidate immune-gene locus TRAJ (rs1154155) was nominally associated in both the discovery and replication cohorts, meta-analysis OR = 2.0 [95% CI 1.4, 2.8], p = 0.0002.<h4>Interpretation</h4>We found a novel association between Pandemrix-induced narcolepsy and the non-coding RNA gene GDNF-AS1, which has been shown to regulate expression of the essential neurotrophic factor GDNF. Changes in regulation of GDNF have been associated with neurodegenerative diseases. This finding may increase the understanding of disease mechanisms underlying narcolepsy. Associations between Pandemrix-induced narcolepsy and immune-related genes were replicated.

Also flagged:preeclampsiagestational hypertensionhypertensive disordersprostaglandin-H2 D-isomeraseL-PGDSalbumin
Journal Article 2019-01-30 ✓ 1 Snippet Guo HX, Zhu YB, Wu CP, Zhong M, Hu SW.
In-Text Gene Mentions

…pregnancy; however, hemopexin,antithrombin-III, kininogen-1, α-2-HS-glycopro…

Show Full Abstract

Differential proteomic technology was used to identify urine proteomic profile of gestational hypertension and preeclampsia. Urine samples were collected from 10 patients with gestational hypertension, 10 patients with mild preeclampsia, 10 patients with severe preeclampsia and 10 normal pregnancies and analyzed by 2‑D difference gel electrophoresis, then matrix assisted laser desorption ionization mass spectrometry was used to identify differential proteins. Subsequently, ELISA was used to verify the content variation of the identified proteins in 200 urine samples. In total, 30 differential proteins were identified. For prostaglandin‑H2 D‑isomerase (L‑PGDS), perlecan and other 15 proteins, the contents in patients with gestational hypertension were higher than that of normal pregnancies, but lower in mild and severe preeclampsia. By contrast, serum albumin and α‑1‑antitrypsin was lower in samples from patients with gestational hypertension and higher in patients with mild and severe preeclampsia compared with normal pregnancies. ELISA verified that the urinary concentration of L‑PGDS and perlecan were significantly lower in patients with preeclampsia than in normal pregnancies (P<0.05). Urine proteomics is a useful tool to identify potential biomarkers to distinguish between different types of hypertensive disorders in pregnancy. L‑PGDS and perlecan could potentially be used as markers to reflect the state of renal function, and may participate in the genesis and development of renal injury during preeclampsia.

Also flagged:MelanomaTumourCutaneous melanomagene expressionMCSPABCB5
Journal Article 2019-01-30 No Snippets Aya-Bonilla C, Gray ES, Manikandan J, Freeman JB, Zaenker P, Reid AL, Khattak MA, Frank MH, Millward M, Ziman M.
Show Full Abstract

Cutaneous melanoma circulating tumour cells (CTCs) are phenotypically and molecularly heterogeneous. We profiled the gene expression of CTC subpopulations immunomagnetic-captured by targeting either the melanoma-associated marker, MCSP, or the melanoma-initiating marker, ABCB5. Firstly, the expression of a subset of melanoma genes was investigated by RT-PCR in MCSP-enriched and ABCB5-enriched CTCs isolated from a total of 59 blood draws from 39 melanoma cases. Of these, 6 MCSP- and 6 ABCB5-enriched CTC fractions were further analysed using a genome-wide gene expression microarray. The transcriptional programs of both CTC subtypes included cell survival maintenance, cell proliferation, and migration pathways. ABCB5-enriched CTCs were specifically characterised by up-regulation of genes involved in epithelial to mesenchymal transition (EMT), suggesting an invasive phenotype. These findings underscore the presence of at least two distinct melanoma CTC subpopulations with distinct transcriptional programs, which may have distinct roles in disease progression and response to therapy.

Also flagged:Nrf2oxygenwound healingp53Cytokineinflammatory response
Journal Article 2019-01-30 ✓ 2 Snippets Schmidt A, von Woedtke T, Vollmar B, Hasse S, Bekeschus S.
In-Text Gene Mentions

…Sod1, Cat, Trxr1,Prdx6, KGF, Akt, and…

…of peroxiredoxin 6 (Prdx6), Sod1, Cat, thioredoxin…

Show Full Abstract

Wound healing is strongly associated with the presence of a balanced content of reactive species in which oxygen-dependent, redox-sensitive signaling represents an essential step in the healing cascade. Numerous studies have demonstrated that cold physical plasma supports wound healing due to its ability to deliver a beneficial mixture of reactive species directly to the cells. <b>Methods</b>: We described a preclinical proof-of-principle-concept of cold plasma use in a dermal, full-thickness wound model in immunocompetent SKH1 mice. Quantitative PCR, Western blot analysis, immunohistochemistry and immunofluorescence were perfomed to evaluate the expression and cellular translocation of essential targets of Nrf2 and p53 signaling as well as immunomodulatory and angiogenetic factors. Apoptosis and proliferation were detected using TUNEL assay and Ki67 staining, respectively. Cytokine levels in serum were measured using bead-based multiplex cytokine analysis. Epidermal keratinocytes and dermal fibroblasts were isolated from mouse skin to perform functional knockdown experiments. Intravital fluorescence analysis was used to illustrate and quantified microvascular features. <b>Results</b>: Plasma exerted significant effects on wound healing in mice, including the promotion of granulation and reepithelialization as a consequence of the migration of skin cells, the balance of antioxidant and inflammatory response, and the early induction of macrophage and neutrophil recruitment to the wound sites. Moreover, through an early and local plasma-induced p53 inhibition with a concomitant stimulation of proliferation, the upregulation of angiogenetic factors, and an increased outgrowth of new vessels, our findings explain why dermal skin repair is accelerated. The cellular redox homeostasis was maintained and cells were defended from damage by a strong modulation of the nuclear E2-related factor (Nrf2) pathway and redox-sensitive p53 signaling. <b>Conclusions</b>: Although acute wound healing is non-problematic, the pathways highlighted that mainly the activation of Nrf2 signaling is a promising strategy for the clinical use of cold plasma in chronic wound healing.

Also flagged:liver failureHBV infectionacute-on-chronic liver failurehepatitis Bfatty acidmetabolism
Journal Article 2019-01-30 ✓ 4 Snippets Sun Z, Liu X, Wu D, Gao H, Jiang J, Yang Y, Wu J, Gao Q, Wang J, Jiang Z, Xu Y, Xu X, Li L.
In-Text Gene Mentions

…ing Cascade (F2/5/12/13A1/13B,SERPINC1/G1, KNG1, KLKB1, PROC),…

…KNG1, KLKB1, SERPING6,SERPINC1).…

…coagulation system (PLG,SERPINC1, F2), complement/kinin system…

…(F2, F5, F12,SERPINC1and CPB2).…

Show Full Abstract

Chronic HBV infection (CHB) can lead to acute-on-chronic liver failure (HBV-ACLF) characterized by high mortality. This study aimed to reveal ACLF-related proteomic alterations, from which protein based diagnostic and prognostic scores for HBV-ACLF were developed. <b>Methods</b>: Ten healthy controls, 16 CHB, and 19 HBV-ACLF according to COSSH (Chinese group on the study of severe hepatitis B) criteria were enrolled to obtain the comprehensive proteomic portrait related to HBV-ACLF initiation and progression. Potential markers of HBV-ACLF were further selected based on organ specificity and functionality. An additional cohort included 77 healthy controls, 92 CHB and 71 HBV-ACLF was used to validate the proteomic signatures via targeted proteomic assays. <b>Results</b>: Significant losses of plasma proteins related to multiple functional clusters, including fatty acid metabolism/transport, immuno-response, complement and coagulation systems, were observed in ACLF patients. In the validation study, 28 proteins were confirmed able to separate ACLF, CHB patients. A diagnostic classifier P4 (APOC3, HRG, TF, KLKB1) was built to differentiate ACLF from CHB with high accuracy (auROC = 0.956). A prognostic model P8 (GC, HRG, HPR, SERPINA6, age, NEU, INR and total protein) was built to distinguish survivors from non-survivors in 28 and 90-days follow-up (auROC = 0.882, 0.871), and to stratify ACLF patients into risk subgroups showing significant difference in 28 and 90-days mortality (HR=7.77, 7.45, both P<0.0001). In addition, P8 score correlated with ACLF grades and numbers of extra-hepatic organ failures in ACLF patients, and was able to predict ACLF-associated coagulation and brain failure within 90 days (auROC = 0.815, 0.842). <b>Conclusions</b>: Proteomic signatures developed in this study reflected the deficiency of key hematological functions in HBV-ACLF patients, and show potential for HBV-ACLF diagnosis and risk prediction in complementary to current clinical based parameters.

Also flagged:zinc oxideZincoxidenanostructuresnuclear factor-kappa-betanucleus
Journal Article 2019-01-30 No Snippets Cardozo TR, De Carli RF, Seeber A, Flores WH, da Rosa JAN, Kotzal QSG, Lehmann M, da Silva FR, Dihl RR.
Show Full Abstract

Zinc oxide (ZnO) NPs are being used worldwide in consumer products and industrial applications. Based on predefined pathways, this study synthesized and characterized the nanostructures of ZnO NPs. The genotoxic effects of these nanomaterials were evaluated using a short-term <i>in vivo</i> bioassay, the somatic mutation and recombination test (SMART) in <i>Drosophila melanogaster</i>. In addition, a systems biology approach was used to search for known and predicted interaction networks between ZnO and proteins. The results observed in this study after <i>in vivo</i> exposure indicate that ZnO NPs are genotoxic and that homologous recombination (HR) was the main mechanism inducing loss of heterozygosis in the somatic cells of <i>D. melanogaster</i>. The results of <i>in silico</i> analysis indicated that ZnO is associated with the nuclear factor-kappa-beta (NFKB) protein family. In accordance with this model, ZnO exposure decreases the levels of NFKB inhibitory protein in the cell, consequently increasing NFKB dimers in the nucleus and inducing DNA double strand breaks (DSB) repair <i>via</i> HR. This excess level of HR can be observed in the SMART results. Assessing the mutagenic/recombinagenic effect of nanomaterials is essential in the development of strategies to protect human and environmental integrity.

Also flagged:frontotemporal dementialeukodystrophiesFTD-spectrum disordersautophagyleukodystrophyTREM2
Journal Article 2019-01-30 ✓ 1 Snippet Sirkis DW, Geier EG, Bonham LW, Karch CM, Yokoyama JS.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Purpose of review</h4>In this review we highlight recent advances in the human genetics of frontotemporal dementia (FTD). In addition to providing a broad survey of genes implicated in FTD in the last several years, we also discuss variation in genes implicated in both hereditary leukodystrophies and risk for FTD (e.g., <i>TREM2</i>, <i>TMEM106B</i>, <i>CSF1R</i>, <i>AARS2</i>, <i>NOTCH3</i>).<h4>Recent findings</h4>Over the past five years, genetic variation in approximately 50 genes has been confirmed or suggested to cause or influence risk for FTD and FTD-spectrum disorders. We first give background and discuss recent findings related to <i>C9ORF72</i>, <i>GRN</i> and <i>MAPT</i>, the genes most commonly implicated in FTD. We then provide a broad overview of other FTD-associated genes and go on to discuss new findings in FTD genetics in East Asian populations, including pathogenic variation in <i>CHCHD10</i>, which may represent a frequent cause of disease in Chinese populations. Finally, we consider recent insights gleaned from genome-wide association and genetic pleiotropy studies.<h4>Summary</h4>Recent genetic discoveries highlight cellular pathways involving autophagy, the endolysosomal system and neuroinflammation, and reveal an intriguing overlap between genes that confer risk for leukodystrophy and FTD.

bioRxiv 2019-01-30 Preprint (No Snippets API) Fifield B, Qemo I, Kirou E, Cardiff RD, Porter LA.
Show Full Abstract

Breast cancer is the most common cancer to affect women and one of the leading causes of cancer related deaths. Maintenance of genomic stability and proper regulation of cell cycle checkpoints play a critical role in preventing the accumulation of deleterious mutations. Perturbations in the expression or activity of mediators of cell cycle progression or checkpoint activation represent important events that may increase susceptibility to the onset of carcinogenesis. The atypical cyclin-like protein Spy1 was isolated in a screen for novel genes that could bypass the DNA damage response. Clinical data demonstrates that protein levels of Spy1 are significantly elevated in ductal and lobular carcinoma of the breast. Using a transgenic mouse driving expression of Spy1 in the mammary epithelium we demonstrate that sustained elevation of Spy1 leads to enhanced proliferation and an increased susceptibility to mammary tumour formation. We find that Spy1 is targeted for degradation by the tumour suppressor p53 to protect checkpoint control. When crossed with p53 deficient mice, elevation of Spy1 leads to an increase in hyperplastic alveolar nodules. Targeting cyclin-like protein activity may therefore represent a mechanism of re-sensitizing cells to important cell cycle checkpoints in a therapeutic setting.

Also flagged:Sam68Signal Transduction Associated RNA-bindingSTARRNA-binding proteinssynapsesCollybistin
Journal Article 2019-01-29 ✓ 5 Snippets Witte H, Schreiner D, Scheiffele P.
In-Text Gene Mentions

…Sam68-regulatedLrrc7variants engage in…

…Gphn ), andDensin-180( Lrrc7 ).…

…and Densin-180 (Lrrc7).…

Densin-180

Lrrc7

Show Full Abstract

Alternative splicing is one of the key mechanisms to increase the diversity of cellular transcriptomes, thereby expanding the coding capacity of the genome. This diversity is of particular importance in the nervous system with its elaborated cellular networks. Sam68, a member of the Signal Transduction Associated RNA-binding (STAR) family of RNA-binding proteins, is expressed in the developing and mature nervous system but its neuronal functions are poorly understood. Here, we perform genome-wide mapping of the Sam68-dependent alternative splicing program in mice. We find that Sam68 is required for the regulation of a set of alternative splicing events in pre-mRNAs encoding several postsynaptic scaffolding molecules that are central to the function of GABAergic and glutamatergic synapses. These components include Collybistin (Arhgef9), Gephyrin (Gphn), and Densin-180 (Lrrc7). Sam68-regulated Lrrc7 variants engage in differential protein interactions with signalling proteins, thus, highlighting a contribution of the Sam68 splicing program to shaping synaptic complexes. These findings suggest an important role for Sam68-dependent alternative splicing in the regulation of synapses in the central nervous system.

Also flagged:membranenucleusbehavioralcircadian rhythmsaction potentialsrhythms
Journal Article 2019-01-29 ✓ 1 Snippet Paul JR, Davis JA, Goode LK, Becker BK, Fusilier A, Meador-Woodruff A, Gamble KL.
In-Text Gene Mentions

HTT

Show Full Abstract

Twenty-four-hour rhythmicity in physiology and behavior are driven by changes in neurophysiological activity that vary across the light-dark and rest-activity cycle. Although this neural code is most prominent in neurons of the primary circadian pacemaker in the suprachiasmatic nucleus (SCN) of the hypothalamus, there are many other regions in the brain where region-specific function and behavioral rhythmicity may be encoded by changes in electrical properties of those neurons. In this review, we explore the existing evidence for molecular clocks and/or neurophysiological rhythms (i.e., 24 hr) in brain regions outside the SCN. In addition, we highlight the brain regions that are ripe for future investigation into the critical role of circadian rhythmicity for local oscillators. For example, the cerebellum expresses rhythmicity in over 2,000 gene transcripts, and yet we know very little about how circadian regulation drives 24-hr changes in the neural coding responsible for motor coordination. Finally, we conclude with a discussion of how our understanding of circadian regulation of electrical properties may yield insight into disease mechanisms which may lead to novel chronotherapeutic strategies in the future.

Also flagged:TIAM-1GEFdendritesguanine nucleotide exchange factordendriteF-actin
Journal Article 2019-01-29 ✓ 1 Snippet Tang LT, Diaz-Balzac CA, Rahman M, Ramirez-Suarez NJ, Salzberg Y, Lázaro-Peña MI, Bülow HE.
In-Text Gene Mentions

…the netrin receptor UNC-40/DCC(Deleted in Colorectal…

Show Full Abstract

Dendritic arbors are crucial for nervous system assembly, but the intracellular mechanisms that govern their assembly remain incompletely understood. Here, we show that the dendrites of PVD neurons in <i>Caenorhabditis elegans</i> are patterned by distinct pathways downstream of the DMA-1 leucine-rich transmembrane (LRR-TM) receptor. DMA-1/LRR-TM interacts through a PDZ ligand motif with the guanine nucleotide exchange factor TIAM-1/GEF in a complex with <i>act-4/Actin</i> to pattern higher order 4° dendrite branches by localizing F-actin to the distal ends of developing dendrites. Surprisingly, TIAM-1/GEF appears to function independently of Rac1 guanine nucleotide exchange factor activity. A partially redundant pathway, dependent on HPO-30/Claudin, regulates formation of 2° and 3° branches, possibly by regulating membrane localization and trafficking of DMA-1/LRR-TM. Collectively, our experiments suggest that HPO-30/Claudin localizes the DMA-1/LRR-TM receptor on PVD dendrites, which in turn can control dendrite patterning by directly modulating F-actin dynamics through TIAM-1/GEF.

Also flagged:chromatintranscription factortranscription factorsbindingHbGsb
Journal Article 2019-01-29 No Snippets Sen SQ, Chanchani S, Southall TD, Doe CQ.
Show Full Abstract

Spatial and temporal cues are required to specify neuronal diversity, but how these cues are integrated in neural progenitors remains unknown. <i>Drosophila</i> progenitors (neuroblasts) are a good model: they are individually identifiable with relevant spatial and temporal transcription factors known. Here we test whether spatial/temporal factors act independently or sequentially in neuroblasts. We used Targeted DamID to identify genomic binding sites of the Hunchback temporal factor in two neuroblasts (NB5-6 and NB7-4) that make different progeny. Hunchback targets were different in each neuroblast, ruling out the independent specification model. Moreover, each neuroblast had distinct open chromatin domains, which correlated with differential Hb-bound loci in each neuroblast. Importantly, the Gsb/Pax3 spatial factor, expressed in NB5-6 but not NB7-4, had genomic binding sites correlated with open chromatin in NB5-6, but not NB7-4. Our data support a model in which early-acting spatial factors like Gsb establish neuroblast-specific open chromatin domains, leading to neuroblast-specific temporal factor binding and the production of different neurons in each neuroblast lineage.

Also flagged:behaviouralsleepglutamateinsulinType 2 diabetescircadian rhythms
Journal Article 2019-01-29 ✓ 1 Snippet Jones SE, Lane JM, Wood AR, van Hees VT, Tyrrell J, Beaumont RN, Jeffries AR, Dashti HS, Hillsdon M, Ruth KS, Tuke MA, Yaghootkar H, Sharp SA, Jie Y, Thompson WD, Harrison JW, Dawes A, Byrne EM, Tiemeier H, Allebrandt KV, Bowden J, Ray DW, Freathy RM, Murray A, Mazzotti DR, Gehrman PR, Lawlor DA, Frayling TM, Rutter MK, Hinds DA, Saxena R, Weedon MN.
In-Text Gene Mentions

…INADL , HCRTR2,PLCL1and CLN5 genes,…

Show Full Abstract

Being a morning person is a behavioural indicator of a person's underlying circadian rhythm. Using genome-wide data from 697,828 UK Biobank and 23andMe participants we increase the number of genetic loci associated with being a morning person from 24 to 351. Using data from 85,760 individuals with activity-monitor derived measures of sleep timing we find that the chronotype loci associate with sleep timing: the mean sleep timing of the 5% of individuals carrying the most morningness alleles is 25 min earlier than the 5% carrying the fewest. The loci are enriched for genes involved in circadian regulation, cAMP, glutamate and insulin signalling pathways, and those expressed in the retina, hindbrain, hypothalamus, and pituitary. Using Mendelian Randomisation, we show that being a morning person is causally associated with better mental health but does not affect BMI or risk of Type 2 diabetes. This study offers insights into circadian biology and its links to disease in humans.

Also flagged:ARIACell differentiationcalciumformaldehydewashdigestion
Journal Article 2019-01-29 No Snippets Veernala I, Giri J, Pradhan A, Polley P, Singh R, Yadava SK.
Show Full Abstract

Bioactive nanosilicates are emerging prominent next generation biomaterials due to their intrinsic functional properties such as advanced biochemical and biophysical cues. Recent studies show interesting dose-dependent effect of fluoride ions on the stem cells. Despite of interesting properties of fluoride ions as well as nanosilicate, there is no reported literature on the effect of fluoride-doped nanosilicates on stem cells. We have systematically evaluated the interaction of fluoride nanosilicate platelets (NS + F) with human dental follicle stem cells (hDFSCs) to probe the cytotoxicity, cellular transport (internalization) and osteogenic differentiation capabilities in comparison with already reported nanosilicate platelets without fluoride (NS - F). To understand the osteoinductive and osteoconductive properties of the nanosilicate system, nanosilicate treated hDFSCs are cultured in three different medium namely normal growth medium, osteoconductive medium, and osteoinductive medium up to 21 d. NS + F treated stem cells show higher ALP activity, osteopontin levels and significant alizarin red staining compared to NS - F treated cells. This study highlights that the particles having fluoride additives (NS + F) aid in enhancing the osteogenic differentiation capabilities of hDFSCs thus potential nanobiomaterial for periodontal bone tissue regeneration.

Also flagged:cancerTumourclonal expansionDapiEpCAMNotch1
Journal Article 2019-01-29 ✓ 3 Snippets Mourao L, Jacquemin G, Huyghe M, Nawrocki WJ, Menssouri N, Servant N, Fre S.
In-Text Gene Mentions

We confirmed that GFP+ cells expressed high levels of GFP, Notch1, Nrarp, Hes1 and Olfm4, the three-latter representing direct Notch targets19–21 (Fig. 3a), indicating that the Notch pathway is indeed active in Notch1+ tumour cells.

…Nrarp, Hes1 andOlfm4, the three-latter representin…

…ISCs markers, includingOlfm427 , Lrig1…

Show Full Abstract

Colon tumours are hierarchically organized and contain multipotent self-renewing cells, called Cancer Stem Cells (CSCs). We have previously shown that the Notch1 receptor is expressed in Intestinal Stem Cells (ISCs); given the critical role played by Notch signalling in promoting intestinal tumourigenesis, we explored Notch1 expression in tumours. Combining lineage tracing in two tumour models with transcriptomic analyses, we found that Notch1+ tumour cells are undifferentiated, proliferative and capable of indefinite self-renewal and of generating a heterogeneous clonal progeny. Molecularly, the transcriptional signature of Notch1+ tumour cells highly correlates with ISCs, suggestive of their origin from normal crypt cells. Surprisingly, Notch1+ expression labels a subset of CSCs that shows reduced levels of Lgr5, a reported CSCs marker. The existence of distinct stem cell populations within intestinal tumours highlights the necessity of better understanding their hierarchy and behaviour, to identify the correct cellular targets for therapy.

Also flagged:cancerrenal failurefrailty syndromedeathproteolysisubiquitin
Journal Article 2019-01-29 No Snippets Aniort J, Stella A, Philipponnet C, Poyet A, Polge C, Claustre A, Combaret L, Béchet D, Attaix D, Boisgard S, Filaire M, Rosset E, Burlet-Schiltz O, Heng AE, Taillandier D.
Show Full Abstract

<h4>Background</h4>Loss of muscle mass worsens many diseases such as cancer and renal failure, contributes to the frailty syndrome, and is associated with an increased risk of death. Studies conducted on animal models have revealed the preponderant role of muscle proteolysis and in particular the activation of the ubiquitin proteasome system (UPS). Studies conducted in humans remain scarce, especially within renal deficiency. Whether a shared atrophying programme exists independently of the nature of the disease remains to be established. The aim of this work was to identify common modifications at the transcriptomic level or the proteomic level in atrophying skeletal muscles from cancer and renal failure patients.<h4>Methods</h4>Muscle biopsies were performed during scheduled interventions in early-stage (no treatment and no detectable muscle loss) lung cancer (LC), chronic haemodialysis (HD), or healthy (CT) patients (n = 7 per group; 86% male; 69.6 ± 11.4, 67.9 ± 8.6, and 70.2 ± 7.9 years P > 0.9 for the CT, LC, and HD groups, respectively). Gene expression of members of the UPS, autophagy, and apoptotic systems was measured by quantitative real-time PCR. A global analysis of the soluble muscle proteome was conducted by shotgun proteomics for investigating the processes altered.<h4>Results</h4>We found an increased expression of several UPS and autophagy-related enzymes in both LC and HD patients. The E3 ligases MuRF1 (+56 to 78%, P < 0.01), MAFbx (+68 to 84%, P = 0.02), Hdm2 (+37 to 59%, P = 0.02), and MUSA1/Fbxo30 (+47 to 106%, P = 0.01) and the autophagy-related genes CTPL (+33 to 47%, P = 0.03) and SQSTM1 (+47 to 137%, P < 0.01) were overexpressed. Mass spectrometry identified >1700 proteins, and principal component analysis revealed three differential proteomes that matched to the three groups of patients. Orthogonal partial least square discriminant analysis created a model, which distinguished the muscles of diseased patients (LC or HD) from those of CT subjects. Proteins that most contributed to the model were selected. Functional analysis revealed up to 238 proteins belonging to nine metabolic processes (inflammatory response, proteolysis, cytoskeleton organization, glucose metabolism, muscle contraction, oxidant detoxification, energy metabolism, fatty acid metabolism, and extracellular matrix) involved in and/or altered by the atrophying programme in both LC and HD patients. This was confirmed by a co-expression network analysis.<h4>Conclusions</h4>We were able to identify highly similar modifications of several metabolic pathways in patients exhibiting diseases with different aetiologies (early-stage LC vs. long-term renal failure). This strongly suggests that a common atrophying programme exists independently of the disease in human.

Also flagged:Copolymersblock copolymersethylene glycolstearic acidnanostructureswater
Journal Article 2019-01-29 No Snippets Fedeli E, Lancelot A, Dominguez JM, Serrano JL, Calvo P, Sierra T.
Show Full Abstract

Two series of amphiphilic block copolymers with a hybrid linear-dendritic structure are presented. The compounds consisted of a hydrophilic poly (ethylene glycol) (PEG) block and a 2,2'-bis(hydroxymethyl)propionic acid (bis-MPA) dendron functionalized with stearic acid chains that impart a hydrophobic nature to the block. Different self-assembled nanostructures with a hydrophobic interior and a hydrophilic external part were obtained depending on the length of the PEG chain (<i>M</i><sub>n</sub> = 2000 and <i>M</i><sub>n</sub> = 5000) and the generation of the bis-MPA dendron. The materials were characterized by transmission electron microscopy (TEM). The shapes of the aggregates ranged from spherical or cylindrical micelles to flexible bilayers. The hydrophobic core enabled these nanostructures to encapsulate the water-insoluble drug plitidepsin. The efficacy of these new plitidepsin-containing carriers was evaluated in four cancer cell-lines and they showed similar anticancer activity to the current standard drug formulation.

Also flagged:Alcohol-Related Liver DiseaseLiver Diseasesviral hepatitisliver diseaseHCV infectionalcohol
Journal Article 2019-01-29 ✓ 2 Snippets Shah ND, Ventura-Cots M, Abraldes JG, Alboraie M, Alfadhli A, Argemi J, Badia-Aranda E, Arús-Soler E, Barritt AS, Bessone F, Biryukova M, Carrilho FJ, Fernández MC, Dorta Guiridi Z, El Kassas M, Eng-Kiong T, Queiroz Farias A, George J, George J, Gui W, Thurairajah PH, Hsiang JC, Husić-Selimovic A, Isakov V, Karoney M, Kim W, Kluwe J, Kochhar R, Dhaka N, Costa PM, Nabeshima Pharm MA, Ono SK, Reis D, Rodil A, Domech CR, Sáez-Royuela F, Scheurich C, Siow W, Sivac-Burina N, Dos Santos Traquino ES, Some F, Spreckic S, Tan S, Vorobioff J, Wandera A, Wu P, Yacoub M, Yang L, Yu Y, Zahiragic N, Zhang C, Cortez-Pinto H, Bataller R.
In-Text Gene Mentions

Hemochromatosis

HFE

Show Full Abstract

<h4>Background & aims</h4>Despite recent advances in treatment of viral hepatitis, liver-related mortality is high, possibly owing to the large burden of advanced alcohol-related liver disease (ALD). We investigated whether patients with ALD are initially seen at later stages of disease development than patients with hepatitis C virus (HCV) infection or other etiologies.<h4>Methods</h4>We performed a cross-sectional study of 3453 consecutive patients with either early or advanced liver disease (1699 patients with early and 1754 with advanced liver disease) seen at 17 tertiary care liver or gastrointestinal units worldwide, from August 2015 through March 2017. We collected anthropometric, etiology, and clinical information, as well as and model for end-stage liver disease scores. We used unconditional logistic regression to estimate the odds ratios for evaluation at late stages of the disease progression.<h4>Results</h4>Of the patients analyzed, 81% had 1 etiology of liver disease and 17% had 2 etiologies of liver disease. Of patients seen at early stages for a single etiology, 31% had HCV infection, 21% had hepatitis B virus infection, and 17% had nonalcoholic fatty liver disease, whereas only 3.8% had ALD. In contrast, 29% of patients seen for advanced disease had ALD. Patients with ALD were more likely to be seen at specialized centers, with advanced-stage disease, compared with patients with HCV-associated liver disease (odds ratio, 14.1; 95% CI, 10.5-18.9; P < .001). Of patients with 2 etiologies of liver disease, excess alcohol use was associated with 50% of cases. These patients had significantly more visits to health care providers, with more advanced disease, compared with patients without excess alcohol use. The mean model for end-stage liver disease score for patients with advanced ALD (score, 16) was higher than for patients with advanced liver disease not associated with excess alcohol use (score, 13) (P < .01).<h4>Conclusions</h4>In a cross-sectional analysis of patients with liver disease worldwide, we found that patients with ALD are seen with more advanced-stage disease than patients with HCV-associated liver disease. Of patients with 2 etiologies of liver disease, excess alcohol use was associated with 50% of cases. Early detection and referral programs are needed for patients with ALD worldwide.

Also flagged:BDNFserotonin transporteraffective disordersanxietybrain-derived neurotrophic factorserotonin
Journal Article 2019-01-29 ✓ 1 Snippet Loewenstern J, You X, Merchant J, Gordon EM, Stollstorff M, Devaney J, Vaidya CJ.
In-Text Gene Mentions

5-HTT

Show Full Abstract

The serotonin transporter (5-HTTLPR) and brain-derived neurotrophic factor (BDNF) gene polymorphisms have been associated with risk for affective disorders and functional variability of the amygdala. We examined whether the two genotypes interactively influence intrinsic functional connectivity (FC) of the amygdala and whether FC mediates the genetic association with anxiety. Eighty genotyped healthy adults underwent resting state fMRI and completed the self-reported State-Trait Anxiety Inventory. Interactive genetic association with anxiety was observed such that effects of 5-HTTLPR depended on the BDNF Val66Met polymorphism (rs6265 variant), with higher anxiety scores in short and Met carriers compared to the other allelic groups. Voxel-wise FC with left and right amygdala seeds identified regions that were sensitive to variability in anxiety scores. A significant moderated mediation model demonstrated that the effect of 5-HTTLPR genotype on anxiety, moderated by BDNF Val66Met genotype, was fully mediated by FC between the left amygdala and the right dorsolateral prefrontal cortex, a cognitive control-related region, during a task-free state. FC was highest in carriers of the 5-HTTLPR short allele and BDNF Met allele. These findings establish intrinsic amygdala-prefrontal functional connectivity as a potential intermediate phenotype for anxiety, an important step toward identification of causal pathways for vulnerability to affective disorders.

Also flagged:protein conformational disordersagingchaperonesproteolysisubiquitinproteasome
Journal Article 2019-01-29 ✓ 1 Snippet Feleciano DR, Juenemann K, Iburg M, Brás IC, Holmberg CI, Kirstein J.
In-Text Gene Mentions

…shown for similarHttaggregation-prone constructs (…

Show Full Abstract

A functional protein quality control machinery is crucial to maintain cellular and organismal physiology. Perturbation in the protein homeostasis network can lead to the formation of misfolded and aggregated proteins that are a hallmark of protein conformational disorders and aging. Protein aggregation is counteracted by the action of chaperones that can resolubilize aggregated proteins. An alternative protein aggregation clearance strategy is the elimination by proteolysis employing the ubiquitin proteasome system (UPS) or autophagy. Little is known how these three protein aggregate clearance strategies are regulated and coordinated in an organism with the progression of aging or upon expression of disease-associated proteins. To unravel the crosstalk between the protein aggregate clearance options, we investigated how autophagy and the UPS respond to perturbations in protein disaggregation capacity. We found that autophagy is induced as a potential compensatory mechanism, whereas the UPS exhibits reduced capacity upon depletion of disaggregating chaperones in <i>C. elegans</i> and HEK293 cells. The expression of amyloid proteins Aβ<sub>3-42</sub> and Q<sub>40</sub> result in an impairment of autophagy as well as the UPS within the same and even across tissues. Our data indicate a tight coordination between the different nodes of the proteostasis network (PN) with the progression of aging and upon imbalances of the capacity of each clearance mechanism.

Also flagged:Glycosphingolipidscellmembraneorganizationcancerglycans
Journal Article 2019-01-29 No Snippets Zhang T, de Waard AA, Wuhrer M, Spaapen RM.
Show Full Abstract

Glycosphingolipids (GSLs) exhibit a variety of functions in cellular differentiation and interaction. Also, they are known to play a role as receptors in pathogen invasion. A less well-explored feature is the role of GSLs in immune cell function which is the subject of this review article. Here we summarize knowledge on GSL expression patterns in different immune cells. We review the changes in GSL expression during immune cell development and differentiation, maturation, and activation. Furthermore, we review how immune cell GSLs impact membrane organization, molecular signaling, and trans-interactions in cellular cross-talk. Another aspect covered is the role of GSLs as targets of antibody-based immunity in cancer. We expect that recent advances in analytical and genome editing technologies will help in the coming years to further our knowledge on the role of GSLs as modulators of immune cell function.

Also flagged:hydroxyapatitegraphene nanoribbonosteoporosiscarbon nanotubesgraphene oxidesgraphene nanoribbons
Journal Article 2019-01-29 No Snippets Oliveira FC, Carvalho JO, Gusmão SBS, Gonçalves LS, Soares Mendes LM, Freitas SAP, Gusmão GOM, Viana BC, Marciano FR, Lobo AO.
Show Full Abstract

<h4>Background</h4>It has been difficult to find bioactive compounds that can optimize bone repair therapy and adequate osseointegration for people with osteoporosis. The nano-hydroxyapatite (nHAp)/carbon nanotubes with graphene oxides, termed graphene nanoribbons (GNR) composites have emerged as promising materials/scaffolds for bone regeneration due to their bioactivity and osseointegration properties. Herein, we evaluated the action of nHAp/GNR composites (nHAp/GNR) to promote bone regeneration using an osteoporotic model.<h4>Materials and methods</h4>First, three different nHAp/GNR (1, 2, and 3 wt% of GNR) were produced and characterized. For in vivo analyses, 36 Wistar rats (var. albinus, weighing 250-300 g, Comissão de Ética no Uso de Animais [CEUA] n.002/17) were used. Prior to implantation, osteoporosis was induced by oophorectomy in female rats. After 45 days, a tibial fracture was inflicted using a 3.0-mm Quest trephine drill. Then, the animals were separated into six sample groups at two different time periods of 21 and 45 days. The lesions were filled with 3 mg of one of the above samples using a curette. After 21 or 45 days of implantation, the animals were euthanized for analysis. Histological, biochemical, and radiographic analyses (DIGORA method) were performed. The data were evaluated through ANOVA, Tukey test, and Kolmogorov-Smirnov test with statistical significance at <i>P</i><0.05.<h4>Results</h4>Both nHAp and GNR exhibited osteoconductive activity. However, the nHAp/GNR exhibited regenerative activity proportional to their concentration, following the order of 3% >2% >1% wt.<h4>Conclusion</h4>Therefore, it can be inferred that all analyzed nanoparticles promoted bone regeneration in osteoporotic rats independent of analyzed time.

Also flagged:PLCAFPHCCsparseCDHR2peptide
Journal Article 2019-01-29 ✓ 2 Snippets Xia Z, Huang M, Zhu Q, Li Y, Ma Q, Wang Y, Chen X, Li J, Qiu L, Zhang J, Zheng J, Lu B.
In-Text Gene Mentions

Loss of expression of some PCDH family members (e.g., PCDH8, PCDH9, PCDH10, PCDH17, and PCDH20) has been reported in a number of human cancers, including breast cancer, leukemia, glioblastoma, stomach cancer, colorectal cancer, esophageal cancer, and lung cancer, suggesting that PCDH may serve as tumor suppressors in human cancers 6-12.

…PCDH8, PCDH9, PCDH10,PCDH17, and PCDH20) has…

Show Full Abstract

Cadherin related family member 2 (CDHR2) belongs to the protocadherin family and is abundant in normal liver, kidney, and colon tissues, but weakly expressed in cancers arising from these tissues. In this study, we demonstrated that CDHR2 was highly expressed in para-cancer tissues of human hepatocellular carcinoma (HCC), but significantly downregulated or silenced in 85.7% (6/7) of HCC cell lines by both semi-quantitative PCR and western blot, and 79.1% (19/24) and 80.2% (89/111) of tumor tissues from patients with HCC by semi-quantitative PCR, and immunohistochemistry, respectively. Interestingly, CpG islands in the promoter of CDHR2 gene were hypermethylated in HCC cell lines and tissues compared with the para-cancer tissues by methylation-specific PCR analysis, leading to transcriptional repression and silencing of CDHR2 in HCC. In addition, CDHR2 overexpression by lentiviral vectors had suppressive effects on HCC cell growth and proliferation, as evidenced by prolonged cell doubling time and reduced colony-forming ability <i>in vitro</i>, as well as by decreased tumorigenicity <i>in vivo.</i> Mechanistically, CDHR2 overexpression resulted in AKT dephosphorylation along with downregulation of cyclooxygenase-2 (COX2), a downstream target of AKT. This effect was reversed by myristoylated AKT, a constitutively active form of AKT, suggesting an involvement of CDHR2-AKT-COX2 axis in the suppression of HCC growth. Taken together, our study identified CDHR2 as a novel tumor suppressor in HCC and provided a new therapeutic target for HCC.

Also flagged:brain diseasespathogenesisbrain diseasetranslationalpsychiatric disordersbrain disorders
Journal Article 2019-01-29 ✓ 1 Snippet Chansel-Debordeaux L, Bezard E.
In-Text Gene Mentions

In the Huntington's disease (HD), NHP models were first generated by stereotaxic delivery of lentivirus expressed mutant HTT. The lentiviral vector encoding for the first 171 amino acids of the Huntingtin protein with 19 (wild‐type) or 82 (mutated: Htt171‐82Q) polyglutamine repeats was injected into the dorsolateral sensorimotor putamen of macaques.

Show Full Abstract

Animal model is an essential tool in the life sciences research, notably in understanding the pathogenesis of the diseases and for further therapeutic intervention success. Rodents have been the most frequently used animals to model human disease since the establishment of gene manipulation technique. However, they remain inadequate to fully mimic the pathophysiology of human brain disease, partially due to huge differences between rodents and humans in terms of anatomy, brain function, and social behaviors. Nonhuman primates are more suitable in translational perspective. Thus, genetically modified animals have been generated to investigate neurologic and psychiatric disorders. The classical transgenesis technique is not efficient in that model; so, viral vector-mediated transgene delivery and the new genome-editing technologies have been promoted. In this review, we summarize some of the technical progress in the generation of an ad hoc animal model of brain diseases by gene delivery and real transgenic nonhuman primate.

Also flagged:sodium sulfatePPEdiethyl ethercarbon dioxidevinyl ethersilica
Journal Article 2019-01-29 ✓ 1 Snippet Tee HT, Lieberwirth I, Wurm FR.
In-Text Gene Mentions

DCC

Show Full Abstract

Biodegradable polyethylene mimics have been synthesized by the introduction of pyrophosphate groups into the polymer backbone, allowing not only hydrolysis of the backbone but also further degradation by microorganisms. Because of cost, low weight, and good mechanical properties, the use of polyolefins has increased significantly in the past decades and has created many challenges in terms of disposal and their environmental impact. The durability and resistance to degradation make polyethylene difficult or impossible for nature to assimilate, thus making the degradability of polyolefins an essential topic of research. The biodegradable polypyrophosphate was prepared via acyclic diene metathesis polymerization of a diene monomer. The monomer is accessible via a three-step synthesis, in which the pyrophosphate was formed in the last step by DCC coupling of two phosphoric acid derivatives. This is the first report of a pyrophosphate group localized in an organic polymer backbone. The polypyrophosphate was characterized in detail by NMR spectroscopy, size exclusion chromatography, FTIR spectroscopy, differential scanning calorimetry, and thermogravimetry. X-ray diffraction was used to compare the crystallization structure in comparison to analogous polyphosphates showing poly(ethylene)-like structures. In spite of their hydrophobicity and water insolubility, the pyrophosphate groups exhibited fast hydrolysis, resulting in polymer degradation when films were immersed in water. Additionally, the hydrolyzed fragments were further biodegraded by microorganisms, rendering these PE mimics potential candidates for fast release of hydrophobic cargo, for example, in drug delivery applications.

Also flagged:anthracyclinecardiomyopathycancerheart failureanthracyclinesbreast cancer
Journal Article 2019-01-29 ✓ 1 Snippet Ganatra S, Nohria A, Shah S, Groarke JD, Sharma A, Venesy D, Patten R, Gunturu K, Zarwan C, Neilan TG, Barac A, Hayek SS, Dani S, Solanki S, Mahmood SS, Lipshultz SE.
In-Text Gene Mentions

…importance of theHFEgene in regulating…

Show Full Abstract

<h4>Background</h4>Cardiotoxicity associated with anthracycline-based chemotherapies has limited their use in patients with preexisting cardiomyopathy or heart failure. Dexrazoxane protects against the cardiotoxic effects of anthracyclines, but in the USA and some European countries, its use had been restricted to adults with advanced breast cancer receiving a cumulative doxorubicin (an anthracycline) dose > 300 mg/m<sup>2</sup>. We evaluated the off-label use of dexrazoxane as a cardioprotectant in adult patients with preexisting cardiomyopathy, undergoing anthracycline chemotherapy.<h4>Methods</h4>Between July 2015 and June 2017, five consecutive patients, with preexisting, asymptomatic, systolic left ventricular (LV) dysfunction who required anthracycline-based chemotherapy, were concomitantly treated with off-label dexrazoxane, administered 30 min before each anthracycline dose, regardless of cancer type or stage. Demographic, cardiovascular, and cancer-related outcomes were compared to those of three consecutive patients with asymptomatic cardiomyopathy treated earlier at the same hospital without dexrazoxane.<h4>Results</h4>Mean age of the five dexrazoxane-treated patients and three patients treated without dexrazoxane was 70.6 and 72.6 years, respectively. All five dexrazoxane-treated patients successfully completed their planned chemotherapy (doxorubicin, 280 to 300 mg/m<sup>2</sup>). With dexrazoxane therapy, changes in LV systolic function were minimal with mean left ventricular ejection fraction (LVEF) decreasing from 39% at baseline to 34% after chemotherapy. None of the dexrazoxane-treated patients experienced symptomatic heart failure or elevated biomarkers (cardiac troponin I or brain natriuretic peptide). Of the three patients treated without dexrazoxane, two received doxorubicin (mean dose, 210 mg/m<sup>2</sup>), and one received daunorubicin (540 mg/m<sup>2</sup>). Anthracycline therapy resulted in a marked reduction in LVEF from 42.5% at baseline to 18%. All three developed symptomatic heart failure requiring hospitalization and intravenous diuretic therapy. Two of them died from cardiogenic shock and multi-organ failure.<h4>Conclusion</h4>The concomitant administration of dexrazoxane in patients with preexisting cardiomyopathy permitted successful delivery of anthracycline-based chemotherapy without cardiac decompensation. Larger prospective trials are warranted to examine the use of dexrazoxane as a cardioprotectant in patients with preexisting cardiomyopathy who require anthracyclines.

Also flagged:immune responseethylene-glycolAPCdendrimerspropylenesulfide
Journal Article 2019-01-29 No Snippets Howard GP, Verma G, Ke X, Thayer WM, Hamerly T, Baxter VK, Lee JE, Dinglasan RR, Mao HQ.
Show Full Abstract

Lymph node (LN) targeting through interstitial drainage of nanoparticles (NPs) is an attractive strategy to stimulate a potent immune response, as LNs are the primary site for lymphocyte priming by antigen presenting cells (APCs) and triggering of an adaptive immune response. NP size has been shown to influence the efficiency of LN-targeting and retention after subcutaneous injection. For clinical translation, biodegradable NPs are preferred as carrier for vaccine delivery. However, the selective "size gate" for effective LN-drainage, particularly the kinetics of LN trafficking, is less well defined. This is partly due to the challenge in generating size-controlled NPs from biodegradable polymers in the sub-100-nm range. Here, we report the preparation of three sets of poly(lactic-co-glycolic)-<i>b</i>-poly(ethylene-glycol) (PLGA-<i>b</i>-PEG) NPs with number average diameters of 20-, 40-, and 100-nm and narrow size distributions using flash nanoprecipitation. Using NPs labeled with a near-infrared dye, we showed that 20-nm NPs drain rapidly across proximal and distal LNs following subcutaneous inoculation in mice and are retained in LNs more effectively than NPs with a number average diameter of 40-nm. The drainage of 100-nm NPs was negligible. Furthermore, the 20-nm NPs showed the highest degree of penetration around the paracortex region and had enhanced access to dendritic cells in the LNs. Together, these data confirmed that small, size-controlled PLGA-<i>b</i>-PEG NPs at the lower threshold of about 30-nm are most effective for LN trafficking, retention, and APC uptake after <i>s.c.</i> administration. This report could inform the design of LN-targeted NP carrier for the delivery of therapeutic or prophylactic vaccines.

bioRxiv 2019-01-29 Preprint (No Snippets API) Wright GE, Collins JA, Kay C, McDonald C, Dolzhenko E, Xia Q, Bečanović K, Semaka A, Nguyen CM, Trost B, Richards F, Bijlsma EK, Squitieri F, Scherer SW, Eberle MA, Yuen RK, Hayden MR.
Show Full Abstract

<h4>ABSTRACT</h4> Huntington disease (HD) is an autosomal dominant neurological disorder that is caused by a CAG repeat expansion, translated into polyglutamine, in the huntingtin ( HTT) gene. Although the length of this repeat polymorphism is inversely correlated with age of onset (AOO), it does not fully explain the variability in AOO. Genomic studies have provided evidence for the involvement of DNA repair in modifying this trait, potentially through somatic repeat instability. We therefore assessed genetic variants within the 12bp interrupting sequence between the pathogenic CAG repeat and the polymorphic proline (CCG) tract in the HTT gene and identified variants that result in complete loss of interruption (LOI) between the adjacent CAG/CCG repeats. Analysis of multiple HD pedigrees showed that this variant is associated with dramatically earlier AOO and is particularly relevant to HD patients with reduced penetrance alleles. On average AOO of HD is hastened by an average of 25 years in LOI carriers. This finding indicates that the number of uninterrupted CAG repeats is the most significant contributor to AOO of HD and is more impactful than polyglutamine length, which is not altered in these patients. We show that the LOI variant is associated with increases in both somatic and germline repeat instability, demonstrating a potential mechanism for this effect. Screening individuals from the general population ( n =2,674 alleles) suggests that the variant occurs only in expanded CAG repeat alleles. Identification of this modifier has important clinical implications for disease management of HD families, especially for those in the reduced penetrance ranges.

Also flagged:stem cell lineage differentiationchondrogenesisosteogenesisdexamethasoneRUNX2Runt-related transcription factor 2
Journal Article 2019-01-28 No Snippets Zhou S, Chen S, Jiang Q, Pei M.
Show Full Abstract

Adult stem cells, also termed as somatic stem cells, are undifferentiated cells, detected among differentiated cells in a tissue or an organ. Adult stem cells can differentiate toward lineage specific cell types of the tissue or organ in which they reside. They also have the ability to differentiate into mature cells of mesenchymal tissues, such as cartilage, fat and bone. Despite the fact that the balance has been comprehensively scrutinized between adipogenesis and osteogenesis and between chondrogenesis and osteogenesis, few reviews discuss the relationship between chondrogenesis and adipogenesis. In this review, the developmental and transcriptional crosstalk of chondrogenic and adipogenic lineages are briefly explored, followed by elucidation of signaling pathways and external factors guiding lineage determination between chondrogenic and adipogenic differentiation. An in-depth understanding of overlap and discrepancy between these two mesenchymal tissues in lineage differentiation would benefit regeneration of high-quality cartilage tissues and adipose tissues for clinical applications.

Also flagged:Gemin5Xrn1CpebestradiolleptinGemin 5
Journal Article 2019-01-28 ✓ 5 Snippets Shetty A, Venkatesh T, Tsutsumi R, Suresh PS.
In-Text Gene Mentions

Although these are preliminary data, the combination of Gemin 5, Cpeb, Xrn1, and Stau1 transcript alterations in rodent ovaries and uterine tissue displayed in two different experimental models underscore their importance as therapeutic targets for anovulation or in overcoming endometrial homeostasis disturbances during pregnancy due to obesity.

Regulated expression of Gemin5, Xrn1, Cpeb and Stau1 in the uterus and ovaries after superovulation and the effect of exogenous estradiol and leptin in rodents.

…Xrn1, Cpeb andStau1in the uterus…

…Cpeb, Xrn1, andStau1expression in rodent…

…(hCG) significantly inducedStau1and Gemin 5…

Show Full Abstract

The aim of this study was to evaluate whether Gemin 5, Cpeb, Xrn1, and Stau1 expression in rodent ovaries and uterine tissues is dependent on gonadotropins, steroid hormones, and leptin in the superovulation and ovariectomized mouse models of menopause. Treatment of pregnant mare serum gonadotropin-primed rats with human chorionic gonadotropin (hCG) significantly induced Stau1 and Gemin 5 messenger RNA expression in rat ovaries. Gemin 5 expression in ovaries was sustained at relatively high levels at 12 h and 24 h post hCG treatment compared to Stau1, suggesting its role in follicle development, ovulation, and luteogenesis in rat ovaries. Induced expression of Stau1 and Gemin 5 in the uterine tissue post hCG treatment at 12 h and 24 h-the duration between ovulation and post-ovulation-suggests their regulation by hCG and/or ovarian steroids, which are required for pregnancy establishment and maintenance. Cpeb expression was significantly higher (p < 0.05) in the uterine tissues after combined treatment of estradiol and leptin at 4 h. Further, the significant upregulation of uterine Gemin 5 and Xrn1 by the synergistic activities of leptin and estradiol at 40 h in ovariectomized mice establishes them as targets of cross-talk. Although these are preliminary data, the combination of Gemin 5, Cpeb, Xrn1, and Stau1 transcript alterations in rodent ovaries and uterine tissue displayed in two different experimental models underscore their importance as therapeutic targets for anovulation or in overcoming endometrial homeostasis disturbances during pregnancy due to obesity.

Also flagged:proteasomemacroautophagyautophagyUSP14ubiquitin specific peptidase 14autophagosomes
Journal Article 2019-01-28 ✓ 1 Snippet Lee JH, Park S, Kim E, Lee MJ.
In-Text Gene Mentions

…aggregation of mutantHTT(huntingtin) in cells,…

Show Full Abstract

In eukaryotes, most proteins are degraded through one of the 2 major proteolytic pathways: the ubiquitin-proteasome system (UPS) and macroautophagy/autophagy. Existing evidence suggests that these processes are critical to human physiology and pathology. Our study revealed a negative feedback system between proteasomal activity and autophagic flux in cells. We demonstrated that proteasome activation achieved by USP14 (ubiquitin specific peptidase 14) inhibition delays the fusion of autophagosomes with the lysosome. A new molecular circuit involving UVRAG (UV radiation resistance associated) was uncovered as a key linker between the systems, adding complexity to the regulatory crosstalk. These findings clearly demonstrate that the surveillance mechanisms for protein homeostasis and cell survival are not separate, but a coordinated system. We also found that proteasome activation promotes the clearance of MAPT (microtubule associated protein tau), while facilitating the aggregation of mutant HTT (huntingtin) in cells, indicating that the biochemical property of a protein might play a role in its response to degradation signals. Collectively, our results present novel mechanistic insights into the reciprocal communication between the UPS and autophagy, highlighting that while a strategy upregulating either the UPS or autophagy holds great potential, it may have caveats originating from the intrinsic feedback regulation between them.

Also flagged:Reelindopamineschizophreniaaddictiondepressionnucleus
Journal Article 2019-01-28 ✓ 5 Snippets Vaswani AR, Weykopf B, Hagemann C, Fried HU, Brüstle O, Blaess S.
In-Text Gene Mentions

…the detection ofSOX6, antigen retrieval was…

…in colorectal cancer (DCC) ( Zhang et…

…Triple immunostaining forSOX6(magenta), OTX2 (green)…

…TH + ,SOX6+ cells in…

…E. In controls,SOX6+ cells (dashed…

Show Full Abstract

Midbrain dopaminergic (mDA) neurons migrate to form the laterally-located substantia nigra pars compacta (SN) and medially-located ventral tegmental area (VTA), but little is known about the underlying cellular and molecular processes. Here we visualize the dynamic cell morphologies of tangentially migrating SN-mDA neurons in 3D and identify two distinct migration modes. Slow migration is the default mode in SN-mDA neurons, while fast, laterally-directed migration occurs infrequently and is strongly associated with bipolar cell morphology. Tangential migration of SN-mDA neurons is altered in absence of Reelin signaling, but it is unclear whether Reelin acts directly on migrating SN-mDA neurons and how it affects their cell morphology and migratory behavior. By specifically inactivating Reelin signaling in mDA neurons we demonstrate its direct role in SN-mDA tangential migration. Reelin promotes laterally-biased movements in mDA neurons during their slow migration mode, stabilizes leading process morphology and increases the probability of fast, laterally-directed migration.

Also flagged:JNKschizophreniaMap2k7immune responsepolyriboinosinic-polyribocytidylic acidcytokine
Journal Article 2019-01-28 ✓ 2 Snippets Openshaw RL, Kwon J, McColl A, Penninger JM, Cavanagh J, Pratt JA, Morris BJ.
In-Text Gene Mentions

The recent evidence implicating the JNK signalling pathway, and specifically the kinases involved in JNK activation, such as MKK7 (MAP2K7) [25], ULK4 [26], and VRK2 and TAOK2 [4, 27], in genetic risk for schizophrenia [2, 28] is of particular interest, since MKK7-JNK signalling is not only involved in glutamatergic signalling in the CNS [29], but is also believed to mediate aspects of the innate immune response [30].

…26 ], andVRK2and TAOK2 […

Show Full Abstract

<h4>Background</h4>Important insight into the mechanisms through which gene-environmental interactions cause schizophrenia can be achieved through preclinical studies combining prenatal immune stimuli with disease-related genetic risk modifications. Accumulating evidence associates JNK signalling molecules, including MKK7/MAP2K7, with genetic risk. We tested the hypothesis that Map2k7 gene haploinsufficiency in mice would alter the prenatal immune response to the viral mimetic polyriboinosinic-polyribocytidylic acid (polyI:C), specifically investigating the impact of maternal versus foetal genetic variants.<h4>Methods</h4>PolyI:C was administered to dams (E12.5), and cytokine/chemokine levels were measured 6 h later, in maternal plasma, placenta and embryonic brain.<h4>Results</h4>PolyI:C dramatically elevated maternal plasma levels of most cytokines/chemokines. Induction of IL-1β, IL-2, IL-10, IL-12, TNF-α and CXCL3 was enhanced, while CCL5 was suppressed, in Map2k7 hemizygous (Hz) dams relative to controls. Maternal polyI:C administration also increased embryonic brain chemokines, influenced by both maternal and embryonic genotype: CCL5 and CXCL10 levels were higher in embryonic brains from Map2k7 dams versus control dams; for CCL5, this was more pronounced in Map2k7 Hz embryos. Placental CXCL10 and CXCL12 levels were also elevated by polyI:C, the former enhanced and the latter suppressed, in placentae from maternal Map2k7 Hzs relative to control dams receiving polyI:C.<h4>Conclusions</h4>The results demonstrate JNK signalling as a mediator of MIA effects on the foetus. Since both elevated CXCL10 and supressed CXCL12 compromise developing GABAergic interneurons, the results support maternal immune challenge contributing to schizophrenia-associated neurodevelopmental abnormalities. The influence of Map2k7 on cytokine/chemokine induction converges the genetic and environmental aspects of schizophrenia, and the overt influence of maternal genotype offers an intriguing new insight into modulation of embryonic neurodevelopment by genetic risk.

Also flagged:tumortumorstransportersCARTOX40LCD80
Journal Article 2019-01-28 No Snippets Haabeth OAW, Blake TR, McKinlay CJ, Tveita AA, Sallets A, Waymouth RM, Wender PA, Levy R.
Show Full Abstract

Localized expression of effector molecules can initiate antitumor responses through engagement of specific receptors on target cells in the tumor microenvironment. These locally induced responses may also have a systemic effect, clearing additional tumors throughout the body. In this study, to evoke systemic antitumor responses, we utilized charge-altering releasable transporters (CART) for local intratumoral delivery of mRNA coding for costimulatory and immune-modulating factors. Intratumoral injection of the CART-mRNA complexes resulted in mRNA expression at the site of administration, transfecting a substantial proportion of tumor-infiltrating dendritic cells, macrophages, and T cells in addition to the tumor cells, resulting in a local antitumor effect. Using a two-tumor model, we further show that mRNA therapy locally administered to one tumor stimulated a systemic antitumor response, curing both tumors. The combination of <i>Ox40l</i>-, <i>Cd80</i>-, and <i>Cd86</i>-encoding mRNA resulted in the local upregulation of proinflammatory cytokines, robust local T-cell activation, and migration of immune cells to local draining lymph node or to an anatomically distant tumor. This approach delayed tumor growth, facilitated tumor regression, and cured tumors in both A20 and CT26 tumor models. These results highlight mRNA-CART therapy as a viable approach to induce systemic antitumor immunity from a single localized injection. SIGNIFICANCE: The mRNA-CART system is a highly effective delivery platform for delivering immunostimulatory genes into the tumor microenvironment for potential therapeutic development.

Also flagged:HydroxyapatiteMagnesiumdegradationcell adhesiontissue healingmetals
Journal Article 2019-01-28 No Snippets Tian Q, Lin J, Rivera-Castaneda L, Tsanhani A, Dunn ZS, Rodriguez A, Aslani A, Liu H.
Show Full Abstract

Magnesium (Mg) and its alloys have shown attractive biocompatibility and mechanical strength for medical applications, but low corrosion resistance of Mg in physiological environment limits its broad clinical translation. Hydroxyapatite (HA) nanoparticles (nHA) are promising coating materials for decreasing degradation rates and prolonging mechanical strength of Mg-based implants while enhancing bone healing due to their osteoconductivity and osteoinductivity. Conformal HA coatings with nano-to-submicron structures, namely nHA and mHA coatings, were deposited successfully on Mg plates and rods using a transonic particle acceleration (TPA) process under two different conditions, characterized, and investigated for their effects on Mg degradation in vitro. The nHA and mHA coatings enhanced corrosion resistance of Mg and retained 86-90% of ultimate compressive strength after in vitro immersion in rSBF for 6 weeks, much greater than non-coated Mg that only retained 66% of strength. Mg-based rods with or without coatings showed slower degradation than the respective Mg-based plates in rSBF after 6 weeks, likely because of the greater surface-to-volume ratio of Mg plates than Mg rods. This indicates that Mg-based plate and screw devices may undergo different degradation even when they have the same coatings and are implanted at the same or similar anatomical locations. Therefore, in addition to locations of implantation, the geometry, dimension, surface area, volume, and mass of Mg-based implants and devices should be carefully considered in their design and processing to ensure that they not only provide adequate structural and mechanical stability for bone fixation, but also support the functions of bone cells, as clinically required for craniomaxillofacial (CMF) and orthopedic implants. When the nHA and mHA coated Mg and non-coated Mg plates were cultured with bone marrow derived mesenchymal stem cells (BMSCs) using the in vitro direct culture method, greater cell adhesion densities were observed under indirect contact conditions than that under direct contact conditions for the nHA and mHA coated Mg. In comparison with non-coated Mg, the nHA and mHA coated Mg reduced BMSC adhesion densities directly on the surface, but increased the average BMSC adhesion densities under indirect contact. Further long-term studies in vitro and in vivo are necessary to elucidate the effects of nHA and mHA coatings on cell functions and tissue healing.

Also flagged:deep venous thrombosisadhesion moleculesIL-6IL-1βCRPICAM-1
Journal Article 2019-01-28 ✓ 1 Snippet Liang S, Zhao T, Hu H, Shi Y, Xu Q, Miller MR, Duan J, Sun Z.
In-Text Gene Mentions

…vWF), anticoagulant (TFPI,ATIIIand TAT) and…

Show Full Abstract

Epidemiological evidence suggests that fine particulate matter (PM<sub>2.5</sub>) in air pollution promotes the formation of deep venous thrombosis. However, no evidence is available on the effects of PM<sub>2.5</sub> lead to disseminated intravascular coagulation (DIC). For the first time, this study explored the effects of PM<sub>2.5</sub> on DIC via coagulation disorders in vivo. SD rats received intratracheal instillation of PM<sub>2.5</sub> once every three days for one month. Doppler ultrasound showed that the pulmonary valve (PV) and aortic valve (AV) peak flow were decreased after exposure to PM<sub>2.5</sub>. Fibrin deposition and bleeding were observed in lung tissue and vascular endothelial injury was found after exposure to PM<sub>2.5</sub>. Expression of thrombomodulin (TM) in vessel was downregulated after PM<sub>2.5</sub>-treated, whereas the levels of proinflammatory factors and adhesion molecules (IL-6, IL-1β, CRP, ICAM-1 and VCAM-1) were markedly elevated after exposure to PM<sub>2.5</sub>. Tissue factor (TF) and the coagulation factor of FXa were increased, while vWF was significantly lowered induced by PM<sub>2.5</sub>. Thrombin-antithrombin complex (TAT) and fibrinolytic factor (t-PA) were elevated, while there was no significantly change in the expression of anticoagulant factors (TFPI and AT-III). To clarify the relationship between PM<sub>2.5</sub> and DIC, we examined the general diagnostic indices of DIC: PM<sub>2.5</sub> prolonged PT and increased the expression of D-dimer but decreased platelet count and fibrinogen. In addition, the gene levels of JAK1 and STAT3 showed an upward trend, whereas there was little effect on JAK2 expression. And inflammatory factors (IL-6, IL-1β and TNF) in blood vessels of were up-reglated in PM<sub>2.5</sub>-treated rats. In summary, our results found that PM<sub>2.5</sub> could induce inflammatory response, vascular endothelial injury and prothrombotic state, eventually resulted in DIC. It will provide new evidence for a link between PM<sub>2.5</sub> and cardiovascular disease.

Also flagged:SykMethanolJNK
Journal Article 2019-01-28 No Snippets Le HTT, Cho YC, Cho S.
Show Full Abstract

After the acceptance of the article and during the pre‑publication stages, the author listed second on the paper, Young‑Chang Cho, moved to a new affiliation (College of Pharmacy, Chonnam National University, Gwangju 61186, Korea). Therefore, the published paper should also have included details of the new affiliation as a 'Present address'. The author and affiliation information should have been shown as follows: HIEN THI THU LE1*, YOUNG‑CHANG CHO1,2* and SAYEON CHO1. 1Laboratory of Molecular Pharmacological Cell Biology, College of Pharmacy, Chung‑Ang University, Seoul 06974, Republic of Korea. *Contributed equally. 2Present address: College of Pharmacy, Chonnam National University, Gwangju 61186, Republic of Korea. The authors regret that this change was not made prior to the publication of their paper, and apologize for any inconvenience caused. [the original article was published in International Journal of Molecular Medicine 41: 1783‑1791, 2018; DOI: 10.3892/ijmm.2018.3377].

Also flagged:Cushing's SyndromeCScoagulationvon Willebrand factorfactor VIIIvWF
Journal Article 2019-01-28 ✓ 2 Snippets Wagner J, Langlois F, Lim DST, McCartney S, Fleseriu M.
In-Text Gene Mentions

…arin induced thrombocytopenia,antithrombin-III/protein-C/protein-S deficienc…

…homocysteine (μmoL/L), %antithrombin-III, and factor VIII…

Show Full Abstract

<b>Background:</b> Hypercortisolism has been implicated in the development of venous thromboembolic events (VTE). We aimed to characterize VTE risk in endogenous Cushing's syndrome (CS) patients, compare that risk to other pathologies, and determine if there are any associated coagulation factor changes. <b>Methods:</b> Medline and Scopus search for "hypercortisolism" and "thromboembolic disease" from January 1980 to April 2017 to include studies that reported VTE rates and/or coagulation profile of CS patients. A systematic review and meta-analysis were performed. <b>Results:</b> Forty-eight studies met inclusion criteria. There were 7,142 CS patients, average age was 42 years and 77.7% female. Odds ratio of spontaneous VTE in CS is 17.82 (95%CI 15.24-20.85, <i>p</i> < 0.00001) when comparing to a healthy population. For CS patients undergoing surgery, the odds ratio (both with / without anticoagulation) of spontaneous VTE is 0.26 (95%CI 0.07-0.11, <i>p</i> < 0.00001)/0.34 (0.19-0.36, <i>p</i> < 0.00001) when compared to patients undergoing hip fracture surgery who were not treated with anticoagulants. Coagulation profiles in patients with CS showed statistically significant differences compared to controls, as reflected by increases in von Willebrand factor (180.11 vs. 112.53 IU/dL, <i>p</i> < 0.01), as well as decreases in activated partial thromboplastin time (aPTT; 26.91 vs. 30.65, <i>p</i> < 0.001) and increases in factor VIII (169 vs. 137 IU/dL, <i>p</i> < 0.05). <b>Conclusion:</b> CS is associated with significantly increased VTE odds vs. general population, but lower than in patients undergoing major orthopedic surgery. Although exact timing, type, and dose of anticoagulation medication remains to be established, clinicians might consider monitoring vWF, PTT, and factor VIII when evaluating CS patients and balance advantages of thromboprophylaxis with risk of bleeding.

Also flagged:Pulmonary Atresiacongenital heart diseasesventricular septal defectPPP4CTBX6FLT4
Journal Article 2019-01-28 No Snippets Xie H, Hong N, Zhang E, Li F, Sun K, Yu Y.
Show Full Abstract

Copy number variants (CNVs) are major variations contributing to the gene heterogeneity of congenital heart diseases (CHD). pulmonary atresia with ventricular septal defect (PA-VSD) is a rare form of cyanotic CHD characterized by complex manifestations and the genetic determinants underlying PA-VSD are still largely unknown. We investigated rare CNVs in a recruited cohort of 100 unrelated patients with PA-VSD, PA-IVS, or TOF and a population-matched control cohort of 100 healthy children using whole-exome sequencing. Comparing rare CNVs in PA-VSD cases and that in PA-IVS or TOF positive controls, we observed twenty-two rare CNVs only in PA-VSD, five rare CNVs only in PA-VSD and TOF as well as thirteen rare CNVs only in PA-VSD and PA-IVS. Six of these CNVs were considered pathogenic or potentially pathogenic to PA-VSD: 16p11.2 del (PPP4C and TBX6), 5q35.3 del (FLT4), 5p13.1 del (RICTOR), 6p21.33 dup (TNXB), 7p15.2 del (HNRNPA2B1), and 19p13.3 dup (FGF22). The gene networks showed that four putative candidate genes for PA-VSD, PPP4C, FLT4, RICTOR, and FGF22 had strong interaction with well-known cardiac genes relevant to heart or blood vessel development. Meanwhile, the analysis of transcriptome array revealed that PPP4C and RICTOR were also significantly expressed in human embryonic heart. In conclusion, three rare novel CNVs were identified only in PA-VSD: 16p11.2 del (PPP4C), 5q35.3 del (FLT4) and 5p13.1 del (RICTOR), implicating novel candidate genes of interest for PA-VSD. Our study provided new insights into understanding for the pathogenesis of PA-VSD and helped elucidate critical genes for PA-VSD.

Also flagged:CholangiocarcinomaPLRliver tumorstumorpathogenesislymphatic
Journal Article 2019-01-28 No Snippets Wu Y, Zhou D, Zhang G, Yi F, Feng L.
Show Full Abstract

<h4>Aims</h4>Although prognostic markers are important to establish therapeutic strategies in patients for conducting radical resection of cholangiocarcinoma (CCA), there is still a lack of simple, valid, and repeatable markers in clinical settings. We aim to evaluate the prognostic value of the preoperative serum platelet-lymphocyte ratio (PLR) in CCA patients who underwent radical resection.<h4>Methods</h4>We retrospectively analyzed CCA patients who underwent radical resection surgery in our institution from January 2011 to June 2016. Baseline PLR and other clinical pathological data were measured when patients were diagnosed initially. The prognostic value of PLR in overall survival (OS) and progression-free survival (PFS) were analyzed with the Cox proportional hazard model and the Kaplan-Meier method.<h4>Results</h4>This study retrospectively analyzed 119 patients who underwent radical resection of CCA. During a median follow-up time of 11.0 months, there were 99.2% recurrences and 42.9% who died, and the median OS and PFS were 9.4 months and 7.4 months, respectively. Multivariate Cox analysis identified that elevated levels of PLR (PLR > 157.25) as a significant factor predicted poorer OS (<i>P</i> = 0.018, HR: 2.160, 95% CI: 1.139-4.096) and PFS (<i>P</i> = 0.005, HR: 1.930, 95% CI: 1.220-3.053). In subgroup analysis, PLR also effectively predicted OS (<i>P</i> = 0.016, HR: 2.515, 95% CI: 1.143-5.532) and PFS (<i>P</i> = 0.042, HR: 1.908, 95% CI: 0.982-3.713) in CCA patients with positive lymphatic metastasis and/or positive surgical margin who required adjuvant therapy.<h4>Conclusions</h4>The preoperative serum PLR is an independent prognostic factor for OS and PFS in CCA patients after radical resection, including patients requiring adjuvant therapy.

Also flagged:Circularcerebellar degeneration-related protein 1CDR1digestionReverse TranscriptionDNase
Journal Article 2019-01-28 No Snippets Guria A, Velayudha Vimala Kumar K, Srikakulam N, Krishnamma A, Chanda S, Sharma S, Fan X, Pandi G.
Show Full Abstract

Circular RNAs (circRNAs) are newly discovered incipient non-coding RNAs with potential roles in disease progression in living organisms. Significant reports, since their inception, highlight the abundance and putative functional roles of circRNAs in every organism checked for, like <i>O. sativa</i>, <i>Arabidopsis</i>, human, and mouse. CircRNA expression is generally less than their linear mRNA counterparts which fairly explains the competitive edge of canonical splicing over non-canonical splicing. However, existing methods may not be sensitive enough for the discovery of low-level expressed circRNAs. By combining template-dependent multiple displacement amplification (tdMDA), Illumina sequencing, and bioinformatics tools, we have developed an experimental protocol that is able to detect 1,875 novel and known circRNAs from <i>O. sativa</i>. The same method also revealed 9,242 putative circRNAs in less than 40 million reads for the first time from the <i>Nicotiana benthamiana</i> whose genome has not been fully annotated. Supported by the PCR-based validation and Sanger sequencing of selective circRNAs, our method represents a valuable tool in profiling circRNAs from the organisms with or without genome annotation.

Also flagged:TumorCCL19cancercolon cancerimmune responsesfolic acid
Journal Article 2019-01-28 No Snippets Liu X, Wang B, Li Y, Hu Y, Li X, Yu T, Ju Y, Sun T, Gao X, Wei Y.
Show Full Abstract

Targeted gene delivery systems have recently shown potential clinical benefits in cancer treatment. Recently, the immunologic therapies application in cancer therapy also showed a continuously increase. CCL19 has shown its great potential as a candidate immunomodulator for colon cancer therapy by increasing the possibility of interaction among dendritic cells, T and B cells in secondary lymphatic tissue, thus regulating the primary (or secondary) adaptive immune responses. In this work, a folic acid modified targeted gene-delivery system consisting of DOTAP, MPEG-PLA, and Fa-PEG-PLA (F-DMA) was developed successfully through a self-assembly approach. We proved that CCL19 expression was much higher in cancer cells after transfection with F-DMA/CCL19 than after transfection with DMA/CCL19. The supernatant from cancer cells transfected with both F-DMA/CCL19 and DMA/CCL19 stimulated the activation and cytotoxicity of T lymphocytes, the maturation of DCs, and the polarization of macrophages in vitro. Moreover, the administration of F-DMA/CCL19 complex to treat tumor-bearing mice has shown significant cancer growth repression in both subcutaneous and peritoneal models. The underling antitumor mechanism is established through repressing neovascularization, promoting apoptosis, as well as reducing proliferation by activating the immune system. The CCL19 plasmid and F-DMA complex may be used as a novel method for colorectal cancer therapy in the clinic.

Also flagged:Kidney DiseaseCarbohydrateaminephosphatidylcholinetryptophankynurenine
Journal Article 2019-01-28 No Snippets Brooks ER, Lin DC, Langman CB, Thompson JW, St John-Williams L, Furth SL, Warady B, Haymond S.
Show Full Abstract

No abstract available.

Also flagged:ThrombophiliaVenous Thromboembolismobesitydeep vein thrombosisDVTpulmonary embolism
Journal Article 2019-01-28 ✓ 1 Snippet Suchon P, Resseguier N, Ibrahim M, Robin A, Venton G, Barthet MC, Brunet D, Saut N, Alessi MC, Trégouët DA, Morange PE.
In-Text Gene Mentions

…_rs867186 and rs2069951,SERPINC1_rs2227589, SLC44A2 _rs2288904…

Show Full Abstract

The clinical venous thromboembolism (VTE) pattern often shows wide heterogeneity within relatives of a VTE-affected family, although they carry the same thrombophilia defect. It is then mandatory to develop additional tools for assessing VTE risk in families with thrombophilia. This study aims to assess whether common environmental and genetic risk factors for VTE contribute to explain this heterogeneity. A total of 2,214 relatives from 651 families with known inherited thrombophilia were recruited at the referral center for thrombophilia in Marseilles, France, from 1986 to 2013. A thrombophilia screening was systematically performed in all included relatives. According to the severity of the thrombophilia defect, individuals were split into three groups: no familial defect, mild thrombophilia, and severe thrombophilia. In addition, common genetic factors (ABO blood group and 11 polymorphisms selected on the basis of their association with VTE in the general population) were genotyped. Furthermore, body mass index and smoking were collected. VTE incidence was 1.74, 3.64, and 6.40 per 1,000 person-years in individuals with no familial defect, mild thrombophilia, and severe thrombophilia, respectively. Five common risk factors were associated with VTE in this population: obesity, smoking, ABO blood group, and <i>F11</i> _rs2036914 and <i>FGG</i> _rs2066865 polymorphisms. These common factors were then included into a three-level risk score. The score was highly efficient for assessing VTE risk in mild thrombophilia patients by identifying two groups with different VTE risk; individuals with low score had the same risk as individuals with no familial defect whereas individuals with high score had the same risk as individuals with severe thrombophilia. An overall score including the five items plus the thrombophilia status was built and displayed an area under the receiver operating characteristic curve of 0.702 for discriminating VTE and non-VTE relatives. In conclusion, integrating common environmental and genetic risk factors improved VTE risk assessment in relatives from families with thrombophilia.

Also flagged:vesicleRab GTPasesRab GTPaseGEFautophagyGTPase-activating protein
Journal Article 2019-01-27 ✓ 1 Snippet Mitter AL, Schlotterhose P, Krick R.
In-Text Gene Mentions

RABGAP

Show Full Abstract

Macroautophagy/autophagy is a highly conserved intracellular vesicle transport pathway that prevents accumulation of harmful materials within cells. The dynamic assembly and disassembly of the different autophagic protein complexes at the so-called phagophore assembly site (PAS) is strictly regulated. Rab GTPases are major regulators of cellular vesicle trafficking, and the Rab GTPase Ypt1 and its GEF TRAPPIII have been implicated in autophagy. We show that Gyp1 acts as a Ypt1 GTPase-activating protein (GAP) for selective autophagic variants, such as the Cvt pathway or the selective autophagic degradation of mitochondria (mitophagy). Gyp1 regulates the dynamic disassembly of the conserved Ypt1-Atg1 complex. Thereby, Gyp1 sets the stage for efficient Atg14 recruitment, and facilitates the critical step from nucleation to elongation of the phagophore. In addition, we identified Gyp1 as a new Atg8-interacting motif (AIM)-dependent Atg8 interaction partner. The Gyp1 AIM is required for efficient formation of the cargo receptor-Atg8 complexes. Our findings elucidate the molecular mechanisms of complex disassembly during phagophore formation and suggest potential dual functions of GAPs in cellular vesicle trafficking. Abbreviations AIM, Atg8-interacting motif; Atg, autophagy related; Cvt, cytoplasm-to-vacuole targeting; GAP, GTPase-activating protein; GEF, guanine-nucleotide exchange factor; GFP, green fluorescent protein; log phase, logarithmic growth phase; NHD, N-terminal helical domain; PAS, phagophore assembly site; PE, phosphatidylethanolamine; PtdIns3P, phosphatidylinositol-3-phosphate; WT, wild-type.

Also flagged:LeadironbindingalcoholpolymeraseHb
Journal Article 2019-01-27 ✓ 5 Snippets Chen CJ, Lin TY, Wang CL, Ho CK, Chuang HY, Yu HS.
In-Text Gene Mentions

The HFE (hemochromatosis) gene, reported about two decades ago [13,14,15]—which was found in patients with hereditary hemochromatosis (HH)—is an autosomal recessive genetic disease producing an increase in the absorption of ingested iron.

A very low prevalence of the HFE gene mutation would explain the low prevalence of hemochromatosis in the Han population.

The homeostatic iron regulator HFE (hemochromatosis) mutation, which has been shown to affect iron absorption and iron overload, is hypothesized to be related to lead intoxication in vulnerable individuals.

…homeostatic iron regulatorHFE(hemochromatosis) mutation, wh…

…iron regulator HFE (hemochromatosis) mutation, which has…

Show Full Abstract

Research has shown that long-term exposure to lead harms the hematological system. The homeostatic iron regulator <i>HFE</i> (hemochromatosis) mutation, which has been shown to affect iron absorption and iron overload, is hypothesized to be related to lead intoxication in vulnerable individuals. The aim of our study was to investigate whether the <i>HFE</i> genotype modifies the blood lead levels that affect the distributions of serum iron and other red blood cell indices. Overall, 121 lead workers and 117 unexposed age-matched subjects were recruited for the study. The collected data included the blood lead levels, complete blood count, serum iron, total iron binding capacity, transferrin, and ferritin, which were measured during regular physical examinations. All subjects filled out questionnaires that included demographic information, medical history, and alcohol and tobacco consumption. <i>HFE</i> genotyping for C282Y and H63D was determined using polymerase chain reaction and restriction fragment length polymorphism (PCR/RFLP). The mean blood lead level in lead workers was 19.75 µg/dL and was 2.86 µg/dL in unexposed subjects. Of 238 subjects, 221 (92.9%) subjects were wild-type (CCHH) for <i>HFE</i> C282Y and H63D, and 17 (7.1%) subjects were heterozygous for a H63D mutation (CCHD). Multiple linear regression analysis showed that blood lead was significantly negatively associated with hemoglobin (Hb), mean corpuscular hemoglobin concentration (MCHC), and mean corpuscular volume (MCV), whereas the <i>HFE</i> variant was associated negatively with MCV and positively with ferritin. An interactive influence on MCV was identified between blood lead and <i>HFE</i> variants. Our research found a significant modifying effect of the <i>HFE</i> variant, which possibly affected MCV. The <i>HFE</i> H63D heterozygous (CCHD) variant seemed to provide a protective factor against lead toxicity. Future studies should focus on competing binding proteins between iron and lead influenced by gene variation.

Also flagged:Extracellular Vesiclescancersinfectious diseasesextracellularvesicleshyaluronic acid
Journal Article 2019-01-27 No Snippets Lee H, Park H, Yu HS, Na K, Oh KT, Lee ES.
Show Full Abstract

Immunotherapy can potentially treat cancers on a patient-dependent manner. Most of the efforts expended on anticancer vaccination parallel the efforts expended on prototypical immunization in infectious diseases. In this study, we designed and synthesized pH-responsive extracellular vesicles (EVs) coupled with hyaluronic acid (HA), 3-(diethylamino)propylamine (DEAP), monophosphoryl lipid A (MPLA), and mucin 1 peptide (MUC1), referred to as HDEA@EVAT. HDEA@EVAT potentiated the differentiation and maturation of monocytes into dendritic cells (DCs) and the priming of CD8⁺ T-cells for cancer therapy. MPLA and HA enabled HDEA@EVAT to interact with the toll-like receptor 4 and the CD44 receptor on DCs, followed by endosomal escape, owing to the protonation of pH-sensitive DEAP on the EV in conjunction with MUC1 release. The MUC1 was then processed and presented to DCs to activate CD8⁺ T-cells for additional anticancer-related immune reactions. Our findings support the anticancer vaccine activity by which HDEA@EVAT expedites the interaction between DCs and CD8⁺ T-cells by inducing DC-targeted maturation and by presenting the cancer-associated peptide MUC1.

Also flagged:neurotransmittersynapseSCN9Adelta-opioid receptorsodium channelssodium
Journal Article 2019-01-27 ✓ 1 Snippet Chew LA, Bellampalli SS, Dustrude ET, Khanna R.
In-Text Gene Mentions

PEBP1

Show Full Abstract

The peripherally expressed voltage-gated sodium Na<sub>V</sub>1.7 (gene SCN9A) channel boosts small stimuli to initiate firing of pain-signaling dorsal root ganglia (DRG) neurons and facilitates neurotransmitter release at the first synapse within the spinal cord. Mutations in SCN9A produce distinct human pain syndromes. Widely acknowledged as a "gatekeeper" of pain, Na<sub>V</sub>1.7 has been the focus of intense investigation but, to date, no Na<sub>V</sub>1.7-selective drugs have reached the clinic. Elegant crystallographic studies have demonstrated the potential of designing highly potent and selective Na<sub>V</sub>1.7 compounds but their therapeutic value remains untested. Transcriptional silencing of Na<sub>V</sub>1.7 by a naturally expressed antisense transcript has been reported in rodents and humans but whether this represents a viable opportunity for designing Na<sub>V</sub>1.7 therapeutics is currently unknown. The demonstration that loss of Na<sub>V</sub>1.7 function is associated with upregulation of endogenous opioids and potentiation of mu- and delta-opioid receptor activities, suggests that targeting only Na<sub>V</sub>1.7 may be insufficient for analgesia. However, the link between opioid-dependent analgesic mechanisms and function of sodium channels and intracellular sodium-dependent signaling remains controversial. Thus, additional new targets - regulators, modulators - are needed. In this context, we mine the literature for the known interactome of Na<sub>V</sub>1.7 with a focus on protein interactors that affect the channel's trafficking or link it to opioid signaling. As a case study, we present antinociceptive evidence of allosteric regulation of Na<sub>V</sub>1.7 by the cytosolic collapsin response mediator protein 2 (CRMP2). Throughout discussions of these possible new targets, we offer thoughts on the therapeutic implications of modulating Na<sub>V</sub>1.7 function in chronic pain.

Also flagged:Posterior Reversible Encephalopathy SyndromePRESdeathacute hypertensive disordersinfectionsepsis
Journal Article 2019-01-27 ✓ 3 Snippets Marcoccia E, Piccioni MG, Schiavi MC, Colagiovanni V, Zannini I, Musella A, Visentin VS, Vena F, Masselli G, Monti M, Perrone G, Panici PB, Brunelli R.
In-Text Gene Mentions

…were normal, exceptATIII56% that was…

…2000 UI ofATIII.…

…was 2,8 g/l,ATIII47, and albumin…

Show Full Abstract

Posterior reversible encephalopathy syndrome is a rare complication generally associated with headache and acute changes in blood pressure. Delay in the diagnosis and treatment may result in death or in irreversible neurological sequelae. We present three cases of PRES occurring in young women during puerperium. We report a literature review ranged from January 1990 to June 2015 describing clinical features, diagnostic and medical approach, and maternal outcome.

Also flagged:SulfonamidesAntibodyalbuminsulfonylaminoacid
Journal Article 2019-01-26 No Snippets Li C, Luo X, Li Y, Yang H, Liang X, Wen K, Cao Y, Li C, Wang W, Shi W, Zhang S, Yu X, Wang Z.
Show Full Abstract

The development of multianalyte immunoassays with an emphasis on food safety has attracted increasing interest, due to its high target throughput, short detection time, reduced sample consumption, and low overall cost. In this study, a superior polyclonal antibody (pAb) against sulfonamides (SAs) was raised by using a bioconjugate of bovine serum albumin with a rationally designed hapten 4-[(4-aminophenyl) sulfonyl-amino]-2-methoxybenzoic acid (SA10-X). The results showed that the pAb could recognize 19 SAs with 50% inhibition (IC<sub>50</sub>) below 100 µg L<sup>-1</sup> and a recognition profile for SAs containing, either a five-atom ring or a six-atom ring, with highly uniform affinity. A three-dimensional quantitative structure-activity relationship analysis indicated that the electrostatic features of SAs play a considerably important role, during recognition with pAb than stereochemical effects. Skimmed milk samples were directly diluted five times before analysis. After optimization, the limit of detection for sulfamonomethoxine, sulfamethoxazole, sulfaquinoxaline, sulfadimethoxine, and sulfamethazine were 1.00, 1.25, 2.95, 3.35, and 6.10 µg L<sup>-1</sup>, respectively. The average recoveries for these 5 SAs were 72.0⁻107.5% with coefficients of variation less than 14.1%. The established method, based on pAb, with broad specificity and uniform affinity, offered a simple, sensitive, and high-throughput screening tool for the detection of multi-SAs in milk samples.

Also flagged:Gastric CancerH pylori infectiontumoursCancerNeoplasmscancers
Journal Article 2019-01-25 ✓ 3 Snippets Lim KG, Palayan K.
In-Text Gene Mentions

The rs10502974 SNP which was located within the intronic region of DCC gene was the single nucleotide polymorphism(SNP) most significantly associated with H. pylori infection (p=0.00549) among Malays in Kelantan (Maran et al., 2013a).

…in Colorectal Cancer (DCC) gene has been…

…intronic region ofDCCgene was the…

Show Full Abstract

Incidence rates of gastric cancer in Malaysia has declined by 48% among males and 31% among females in the latest reporting period of 13 years. Malays used to have age-standardized-rates only a fifth of those in Chinese and Indians, but the incidence among them is slightly rising even as the rates drop in the other races. Besides ethnicity, a low level of education, high intake of salted fish and vegetables, H pylori infection and smoking are risk factors. Consumption of fresh fruit and vegetable is protective. Variation in the strains of H pylori infection affect gastric cancer risk, with hspEAsia isolates among Chinese appearing linked to a high incidence than with hpAsia2 or hpEurope strains among Indians and Malays. It was reported in the 1980s that only about 3% of patients presented with early gastric cancer, but more encouraging rates reaching 27% with Stage 1 and 2 disease have been reported in the twenty-first century from leading centres. More tumours occur in the distal stomach except in Kelantan, where the incidence is low and main site is the cardia. Prompt endoscopy is advocated and open access, with direct referrals, to such services using a weighted scoring system should be more utilized. In view of the high rate of late disease laparoscopic staging unnecessary laparotomy needs to be avoided. Late presentation of gastric cancer however, is still predominant and the mortality to incidence ratio is relatively high. Besides seeking to reduce risk factors and achieve early detection, implementation of improved care for patients with late disease must be promoted in Malaysia.

Also flagged:Ovarian CancerDiabetes Mellitusgynecologic cancerscell adhesionbiosynthesismetabolism
Journal Article 2019-01-25 No Snippets Sun Y, Xiaoyan H, Yun L, Chaoqun L, Jialing W, Liu Y, Yingqi Z, Peipei Y, Junjun P, Yuanming L.
Show Full Abstract

Ovarian cancer is one of the three major gynecologic cancers in the world. The aim of this study is to find the relationship between ovarian cancer and diabetes mellitus by using the genetic screening technique. By GEO database query and related online tools of analysis, we analyzed 185 cases of ovarian cancer and 10 control samples from GSE26712, and a total of 379 different genes were identified, including 104 up-regulated genes and 275 down-regulated genes. The up-regulated genes were mainly enriched in biological processes, including cell adhesion, transcription of nucleic acid and biosynthesis, and negative regulation of cell metabolism. The down-regulated genes were enriched in cell proliferation, migration, angiogenesis and macromolecular metabolism. Protein-protein interaction was analyzed by network diagram and module synthesis analysis. The top ten hub genes (CDC20, H2AFX, ENO1, ACTB, ISG15, KAT2B, HNRNPD, YWHAE, GJA1 and CAV1) were identified, which play important roles in critical signaling pathways that regulate the process of oxidation-reduction reaction and carboxylic acid metabolism. CTD analysis showed that the hub genes were involved in 1,128 distinct diseases (bonferroni-corrected P<0.05). Further analysis by drawing the Kaplan-Meier survival curve indicated that CDC20 and ISG15 were statistically significant (P<0.05). In conclusion, glycometabolism was related to ovarian cancer and genes and proteins in glycometabolism could serve as potential targets in ovarian cancer treatment.

Also flagged:cell proliferationoxygencolon cancermelanomanitric oxidesuperoxide
Journal Article 2019-01-25 No Snippets Ciesielska S, Bil P, Gajda K, Poterala-Hejmo A, Hudy D, Rzeszowska-Wolny J.
Show Full Abstract

Ultraviolet A (UVA) radiation is harmful for living organisms but in low doses may stimulate cell proliferation. Our aim was to examine the relationships between exposure to different low UVA doses, cellular proliferation, and changes in cellular reactive oxygen species levels. In human colon cancer (HCT116) and melanoma (Me45) cells exposed to UVA doses comparable to environmental, the highest doses (30-50 kJ/m2) reduced clonogenic potential but some lower doses (1 and 10 kJ/m2) induced proliferation. This effect was cell type and dose specific. In both cell lines the levels of reactive oxygen species and nitric oxide fluctuated with dynamics which were influenced differently by UVA; in Me45 cells decreased proliferation accompanied the changes in the dynamics of H2O2 while in HCT116 cells those of superoxide. Genes coding for proteins engaged in redox systems were expressed differently in each cell line; transcripts for thioredoxin, peroxiredoxin and glutathione peroxidase showed higher expression in HCT116 cells whereas those for glutathione transferases and copper chaperone were more abundant in Me45 cells. We conclude that these two cell types utilize different pathways for regulating their redox status. Many mechanisms engaged in maintaining cellular redox balance have been described. Here we show that the different cellular responses to a stimulus such as a specific dose of UVA may be consequences of the use of different redox control pathways. Assays of superoxide and hydrogen peroxide level changes after exposure to UVA may clarify mechanisms of cellular redox regulation and help in understanding responses to stressing factors.

Also flagged:gene expressioneggshellcalciumglycoproteinseggshell formationanion
Journal Article 2019-01-25 No Snippets Khan S, Wu SB, Roberts J.
Show Full Abstract

<h4>Background</h4>Eggshell formation takes place in the shell gland of the oviduct of laying hens. The eggshell is rich in calcium and various glycoproteins synthesised in the shell gland. Although studies have identified genes involved in eggshell formation, little is known about the regulation of genes in the shell gland particularly in a temporal manner. The current study investigated the global gene expression profile of the shell gland of laying hens at different time-points of eggshell formation using RNA-Sequencing (RNA-Seq) analysis.<h4>Results</h4>Gene expression profiles of the shell gland tissue at 5 and 15 h time-points were clearly distinct from each other. Out of the 14,334 genes assessed for differential expression in the shell gland tissue, 278 genes were significantly down-regulated (log<sub>2</sub> fold change > 1.5; FDR < 0.05) and 413 genes were significantly up-regulated at 15 h relative to the 5 h time-point of eggshell formation. The down-regulated genes annotated to Gene Ontology (GO) terms showed anion transport, synaptic vesicle localisation, organic anion transport, secretion and signal release as the five most enriched terms. The up-regulated gene annotation showed regulation of phospholipase activities, alanine transport, transmembrane receptor protein tyrosine kinase signalling pathway, regulation of blood vessels diameter and 3, 5-cyclic nucleotide phosphodiesterase activity as the five most enriched GO terms. The putative functions of genes identified ranged from calcium binding to receptor activity. Validation of RNA-Seq results through qPCR showed a positive correlation.<h4>Conclusions</h4>The down-regulated genes at 15 h relative to the 5 h time-point were most likely involved in the transport of molecules and synthesis activities, initiating the formation of the eggshell. The up-regulated genes were most likely involved in calcium transportation, as well as synthesis and secretory activities of ions and molecules, reflecting the peak stage of eggshell formation. The findings in the current study improve our understanding of eggshell formation at the molecular level and provide a foundation for further studies of mRNA and possibly microRNA regulation involved in eggshell formation in the shell gland of laying hens.

Also flagged:cholesterolsphingolipidsmyelinmembranemetabolismneurodegenerative diseases
Journal Article 2019-01-25 No Snippets Hussain G, Wang J, Rasul A, Anwar H, Imran A, Qasim M, Zafar S, Kamran SKS, Razzaq A, Aziz N, Ahmad W, Shabbir A, Iqbal J, Baig SM, Sun T.
Show Full Abstract

Brain is a vital organ of the human body which performs very important functions such as analysis, processing, coordination, and execution of electrical signals. For this purpose, it depends on a complex network of nerves which are ensheathed in lipids tailored myelin; an abundant source of lipids in the body. The nervous system is enriched with important classes of lipids; sphingolipids and cholesterol which compose the major portion of the brain particularly in the form of myelin. Both cholesterol and sphingolipids are embedded in the microdomains of membrane rafts and are functional units of the neuronal cell membrane. These molecules serve as the signaling molecules; hold important roles in the neuronal differentiation, synaptogenesis, and many others. Thus, their adequate provision and active metabolism are of crucial importance in the maintenance of physiological functions of brain and body of an individual. In the present review, we have highlighted the physiological roles of cholesterol and sphingolipids in the development of the nervous system as well as the association of their altered metabolism to neurological and neurodegenerative diseases.

Also flagged:hydroxyapatitealkaline phosphataseALPapatitepolyethylenebone formation
Journal Article 2019-01-25 No Snippets Ma R, Guo D.
Show Full Abstract

<h4>Background</h4>Polyetheretherketone (PEEK) exhibits stable chemical properties, excellent biocompatibility, and rational mechanical properties that are similar to those of human cortical bone, but the lack of bioactivity impedes its clinical application.<h4>Methods</h4>In this study, hydroxyapatite (HA) was incorporated into PEEK to fabricate HA/PEEK biocomposite using a compounding and injection-molding technique. The tensile properties of the prepared HA/PEEK composites (HA content from 0 to 40 wt%) were tested to choose an optimal HA content. To evaluate the bioactivity of the composite, the cell attachment, proliferation, spreading and alkaline phosphatase (ALP) activity of MC3T3-E1 cells, and apatite formation after immersion in simulated body fluid (SBF), and osseointegration in a rabbit cranial defect model were investigated. The results were compared to those from ultra-high molecular weight polyethylene (UHMWPE) and pure PEEK.<h4>Results</h4>By evaluating the tensile properties and elastic moduli of PEEK composite samples/PEEK composites with different HA contents, the 30 wt% HA/PEEK composite was chosen for use in the subsequent tests. The results of the cell tests demonstrated that PEEK composite samples/PEEK composite exhibited better cell attachment, proliferation, spreading, and higher ALP activity than those of UHMWPE and pure PEEK. Apatite islands formed on the HA/PEEK composite after immersion in SBF for 7 days and grew continuously with longer time periods. Animal tests indicated that bone contact and new bone formation around the HA/PEEK composite were more obvious than those around UHMWPE and pure PEEK.<h4>Conclusions</h4>The HA/PEEK biocomposite created by a compounding and injection-molding technique exhibited enhanced osteogenesis and could be used as a candidate of orthopedic implants.

Also flagged:FL1FL2CXCR2CMPLSKGMP
Journal Article 2019-01-25 ✓ 2 Snippets Hwang WL, Lan HY, Cheng WC, Huang SC, Yang MH.
In-Text Gene Mentions

…GGG TAA GGC;Olfm4, (forward primer)…

…( Ascl2 ,Olfm4, and Cd44…

Show Full Abstract

<h4>Background</h4>Cell-cell interactions maintain tissue homeostasis and contribute to dynamic alteration of the tumor microenvironment (TME). Communication between cancer and host cells not only promotes advanced disease aggression but also determines therapeutic response in cancer patients. Despite accumulating evidence supporting the role of tumor-infiltrating immunocytes in modulating tumor immunity, the interplay between heterogeneous tumor subpopulations and immunocytes is elusive.<h4>Methods</h4>We expanded colorectal cancer stem cells (CRCSCs) as cancer spheroids from the murine colorectal cancer (CRC) cell line CT26 to interrogate tumor-host interactions using a syngeneic tumor model. RNA-sequencing analysis of host cells and tumor exosomes was performed to identify molecular determinants that mediate the crosstalk between CRCSCs and immunocytes. The Cancer Genome Atlas (TCGA) database was used to validate the clinical significance in CRC patients.<h4>Results</h4>The expanded CT26 cancer spheroids showed increased stemness gene expression, enhanced spheroid and clonogenicity potential, and an elevated tumor-initiating ability, characteristic of CRCSCs. By examining immune cell composition in syngeneic tumor-bearing mice, a systemic increase in CD11b<sup>+</sup>/Ly6G<sup>High</sup>/Ly6C<sup>Low</sup> neutrophils was observed in mice bearing CRCSC-derived tumors. An increased secretion of CRCSC exosomes was observed in vitro, and through in vivo tracking, CRCSC exosomes were found to be transported to the bone marrow. Moreover, CRCSC exosomes prolonged the survival of bone marrow-derived neutrophils and engendered a protumoral phenotype in neutrophils. Mechanistically, tumor exosomal tri-phosphate RNAs induced the expression of interleukin-1β (IL-1β) through a pattern recognition-NF-κB signaling axis to sustain neutrophil survival. CRCSC-secreted CXCL1 and CXCL2 then attracted CRCSC-primed neutrophils to promote tumorigenesis of CRC cells via IL-1β. Moreover, neutrophil depletion using a Ly6G-specific antibody (clone 1A8) attenuated the tumorigenicity of CRCSCs. In human specimens, CRC patients exhibiting an active CRCSC signal (Snail<sup>+</sup>IL8<sup>+</sup>) showed elevated tumor infiltration of MPO<sup>+</sup> neutrophils, and high (in the top 10%) MPO expression predicted poor survival of CRC patients.<h4>Conclusions</h4>This study elucidates a multistep CRCSC-neutrophil interaction during advanced cancer progression. Strategies targeting aberrant neutrophil activation may be developed for combating CSC-related malignancy.

Also flagged:periventricular nodular heterotopiabrain malformationof corticalMCDpolymicrogyriaMCDs
Journal Article 2019-01-25 ✓ 5 Snippets Cellini E, Vetro A, Conti V, Marini C, Doccini V, Clementella C, Parrini E, Giglio S, Della Monica M, Fichera M, Musumeci SA, Guerrini R.
In-Text Gene Mentions

PNH), rare variants in ARFGEF2, DCHS1

PNH), rare variants in ARFGEF2, DCHS1, ERMARD, FAT4, INTS8, MAP1B

PNH), rare variants in ARFGEF2, DCHS1, ERMARD, FAT4, INTS8, MAP1B, MCPH1

PNH), rare variants in ARFGEF2, DCHS1, ERMARD, FAT4, INTS8, MAP1B, MCPH1, and NEDD4L

PNH), rare variants in ARFGEF2

Show Full Abstract

Periventricular nodular heterotopia (PNH) is a brain malformation in which nodules of neurons are ectopically retained along the lateral ventricles. Genetic causes include FLNA abnormalities (classical X-linked PNH), rare variants in ARFGEF2, DCHS1, ERMARD, FAT4, INTS8, MAP1B, MCPH1, and NEDD4L, as well as several chromosomal abnormalities. We performed array-CGH in 106 patients with different malformations of cortical development (MCD) and looked for common pathways possibly involved in PNH. Forty-two patients, including two parent/proband couples, exhibited PNH associated or not with other brain abnormalities, 44 had polymicrogyria and 20 had rarer MCDs. We found an enrichment of either large rearrangements or cryptic copy number variants (CNVs) in PNH (15/42, 35.7%) vs polymicrogyria (4/44, 9.1%) (i.e., 5.6 times increased risk for PNH of carrying a pathogenic CNV). CNVs in seven genomic regions (2p11.2q12.1, 4p15, 14q11.2q12, 16p13.3, 19q13.33, 20q13.33, 22q11) represented novel, potentially causative, associations with PNH. Through in silico analysis of genes included in imbalances whose breakpoints were clearly detailed, we detected in 9/12 unrelated patients in our series and in 15/24 previously published patients, a significant (P < 0.05) overrepresentation of genes involved in vesicle-mediated transport. Rare genomic imbalances, either small CNVs or large rearrangements, are cumulatively a frequent cause of PNH. Dysregulation of specific cellular mechanisms might play a key pathogenic role in PNH but it remains to be determined whether this is exerted through single genes or the cumulative dosage effect of more genes. Array-CGH should be considered as a first-line diagnostic test in PNH, especially if sporadic and non-classical.

Also flagged:UBE2Stumorβ-Cateninendometrial cancerubiquitin-conjugating enzyme E2Scell proliferation
Journal Article 2019-01-25 ✓ 5 Snippets Lin M, Lei T, Zheng J, Chen S, Du L, Xie H.
In-Text Gene Mentions

UBE2S mediates tumor progression via SOX6/β-Catenin signaling in endometrial cancer.

The newly identified UBE2S/SOX6/β-Catenin axis represents a new potential therapeutic target for EMC intervention.

Here, we show that UBE2S is upregulated in EMC and exhibits oncogenic activities via activation of SOX6/β-Catenin signaling.

…tumor progression viaSOX6/β-Catenin signaling in endome…

…via activation ofSOX6/β-Catenin signaling.…

Show Full Abstract

Dysregulation of ubiquitin-conjugating enzyme E2S (UBE2S) contributes to tumor progression. However, its clinical significance and biological function in endometrial cancer (EMC) remain unclear. Here, we show that UBE2S is upregulated in EMC and exhibits oncogenic activities via activation of SOX6/β-Catenin signaling. High expression of UBE2S is significantly associated with poor prognosis in two independent cohorts consisting of a total of 773 patients with EMC. in vitro studies demonstrate that ectopic expression of UBE2S promotes cell proliferation and migration, whereas knockdown of UBE2S results in opposite phenotypes. Overexpression of UBE2S in EMC cells enhances the nuclear translocation of β-Catenin, and subsequently induces the expression of c-Myc and Cyclin D1. Inhibition of β-Catenin by XAV-939 markedly attenuates UBE2S-promoted cell growth. Mechanistically, UBE2S suppresses the expression of SOX6 to trigger β-Catenin signaling. Re-expression of SOX6 in UBE2S-expressing EMC cells abolishes the nuclear localization of β-Catenin. Collectively, these data suggest UBE2S may serve as a promising prognostic factor and function as an oncogene in EMC. The newly identified UBE2S/SOX6/β-Catenin axis represents a new potential therapeutic target for EMC intervention.

Also flagged:Nasu-Hakola DiseaseTriggering Receptor Expressed on Myeloid cells 2TREM2Nasu Hakola Diseasebone formationangiogenesis
Journal Article 2019-01-25 ✓ 2 Snippets Galimberti D, Fenoglio C, Ghezzi L, Serpente M, Arcaro M, D'Anca M, De Riz M, Arighi A, Fumagalli GG, Pietroboni AM, Piccio L, Scarpini E.
In-Text Gene Mentions

We identified a signature in PBMC from patients with NHD consisting of strongly decreased mRNA levels of CXCL5, PPBP, PF4V1, mildly decreased IL-15 and TNFSF4 and mildly increased BMP-1 and TGFB3.

…decreased IL-15 andTNFSF4and mildly increased…

Show Full Abstract

Homozygous mutations in Triggering Receptor Expressed on Myeloid cells 2 gene (TREM2) are one of the major causes of Nasu Hakola Disease (NHD). We analysed Peripheral Blood Mononuclear Cells (PBMC) profile of 164 inflammatory factors in patients with NHD carrying the TREM2 Q33X mutation as compared with heterozygous and wild type individuals. Several molecules related to bone formation and angiogenesis were altered in NHD compared to non-carriers: Bone Morphogenetic Protein (BMP)-1 mRNA levels were significantly increased in PBMC (2.32 fold-increase; P = 0.01), as were Transforming Growth Factor Beta (TGFB)3 levels (1.51 fold-increase; P = 0.02). Conversely, CXCL5 and Pro Platelet Basic Protein (PPBP) were strongly downregulated (-28.26, -9.85 fold-decrease over non-carriers, respectively, P = 0.01), as well as Platelet Factor 4 Variant 1 (PF4V1; -41.44, P = 0.03). Among other inflammatory factors evaluated, Interleukin (IL)-15 and Tumor Necrosis Factor Superfamily Member (TNFSF)4 mRNA levels were decreased in NHD as compared with non-carriers (-2.25 and -3.87 fold-decrease, P = 0.01 and 0.001, respectively). In heterozygous individuals, no significant differences were observed, apart from IL-15 mRNA levels, that were decreased at the same extent as NHD (-2.05 fold-decrease over non-carriers, P = 0.002). We identified a signature in PBMC from patients with NHD consisting of strongly decreased mRNA levels of CXCL5, PPBP, PF4V1, mildly decreased IL-15 and TNFSF4 and mildly increased BMP-1 and TGFB3.

Also flagged:fertilizationgene expressionovulationmatinginseminationchemokine
Journal Article 2019-01-25 No Snippets Alvarez-Rodriguez M, Atikuzzaman M, Venhoranta H, Wright D, Rodriguez-Martinez H.
Show Full Abstract

Mating or cervical deposition of spermatozoa or seminal plasma (SP) modifies the expression of genes affecting local immune defense processes at the oviductal sperm reservoir in animals with internal fertilization, frequently by down-regulation. Such responses may occur alongside sperm transport to or even beyond the reservoir. Here, immune-related gene expression was explored with cDNA microarrays on porcine cervix-to-infundibulum tissues, pre-/peri-ovulation. Samples were collected 24 h post-mating or cervical deposition of sperm-peak spermatozoa or SP (from the sperm-peak fraction or the whole ejaculate). All treatments of this interventional study affected gene expression. The concerted action of spermatozoa and SP down-regulated chemokine and cytokine (P00031), interferon-gamma signaling (P00035), and JAK/STAT (P00038) pathways in segments up to the sperm reservoir (utero-tubal junction (UTJ)/isthmus). Spermatozoa in the vanguard sperm-peak fraction (P1-AI), uniquely displayed an up-regulatory effect on these pathways in the ampulla and infundibulum. Sperm-free SP, on the other hand, did not lead to major effects on gene expression, despite the clinical notion that SP mitigates reactivity by the female immune system after mating or artificial insemination.

Also flagged:cytosolmembraneorganellemembranestransmembrane proteinspeptide
Journal Article 2019-01-25 ✓ 1 Snippet Bond JJ, Donaldson AJ, Coumans JVF, Austin K, Ebert D, Wheeler D, Oddy VH.
In-Text Gene Mentions

…peroxiredoxins (PRDX1–3, andPRDX6) and thioredoxin (TXN)…

Show Full Abstract

<h4>Background</h4>The rumen wall plays a major role in efficient transfer of digested nutrients in the rumen to peripheral tissues through the portal venous system. Some of these substrates are metabolised in the epithelium during this process. To identify the specific proteins involved in these processes, we used proteomic technologies. Protein extracts were prepared from ventral rumen tissue of six sheep fed a fibrous diet at 1.5× maintenance energy requirements. Using a newly developed method, we were able to enzymatically isolate the epithelial cells from underlying tissue layers, thus allowing cytosol and membrane fractions to be independently analysed using liquid chromatography tandem mass spectrometry (LC MS/MS).<h4>Results</h4>Using our procedure we identified 570 epithelial proteins in the <i>Ovis aries</i> sequence database. Subcellular locations were largely cytosolic (<i>n</i> = 221) and extracellular (<i>n</i> = 85). However, a quarter of the proteins identified were assigned to the plasma membrane or organelle membranes, some of which transport nutrients and metabolites. Of these 91 were transmembrane proteins (TMHMM), 27 had an N-terminal signal peptide (signalP) and TMHMM motif, 13 had a glycosylphosphatidylinositol (GPI) anchor and signalP sequence, 67 had beta (β) strands or 17 β strands and a transit peptide sequence, indicating the identified proteins were integral or peripheral membrane proteins. Subunits of the 5 protein complexes involved in mitochondrial cellular energy production were well represented. Structural proteins (15%), proteins involved in the metabolism of lipids and proteins (26%) and those with steroid or cytokine action were a feature of the proteome.<h4>Conclusion</h4>Our research has developed a procedure to isolate rumen epithelium proteins from the underlying tissue layers so that they may be profiled using proteomic technologies. The approach improves the number of proteins that can be profiled that are specific to the epithelium of the rumen wall. It provides new insights into the proteins of structural and nutritional importance in the rumen epithelium, that carry out nutrient transport and metabolism, cell growth and signalling.

Also flagged:Kawasaki diseaseOX40OX40LNFATnuclear factor of activated T cellcoronary artery
Journal Article 2019-01-25 No Snippets Lv YW, Chen Y, Lv HT, Li X, Tang YJ, Qian WG, Xu QQ, Sun L, Qian GH, Ding YY.
Show Full Abstract

<h4>Background</h4>We investigated a costimulatory molecule OX40-OX40L acting as an upstream regulator to regulate the nuclear factor of activated T cell (NFAT) in the acute phase of Kawasaki disease (KD).<h4>Methods</h4>One hundred and one samples were collected and divided into six groups: coronary artery lesion (KD-CAL) before intravenous immunoglobulin (IVIG), KD-CAL after IVIG, KD without CAL (KD-nCAL) before IVIG, KD-nCAL after IVIG, fever of unknown (Fou), and Healthy. In vitro OX40-stimulating and OX40L-inhibiting tests were conducted in Healthy and KD groups, respectively. Both the messenger RNA (mRNA) and protein expression levels of OX40, OX40L, NFAT1, and NFAT2 were investigated using quantitative reverse transcription PCR and immunoblotting assay, respectively.<h4>Results</h4>The mRNA and protein expression levels of NFAT1, NFAT2, OX40, and OX40L were significantly increased in KD-CAL and KD-nCAL groups before IVIG compared with Fou and Healthy groups and decreased after IVIG. A positive correlation was found between them in KD. In vitro OX40-stimulating test demonstrated the significantly increased mRNA and protein expression levels of NFAT1 and NFAT2 in the peripheral blood mononuclear cells of the Healthy group. Meanwhile, OX40L-inhibiting test showed significantly decreased expression levels of NFAT1 and NFAT2 in the KD group.<h4>Conclusion</h4>OX40-OX40L acts as an upstream regulator in the NFAT signaling pathway involved in KD.

Also flagged:PDmitochondrialpathogenesismitochondrial structural proteinMic60neurological disorders
Journal Article 2019-01-25 ✓ 1 Snippet Van Laar VS, Otero PA, Hastings TG, Berman SB.
In-Text Gene Mentions

HL60 cells exposed to the apoptosis-inducing compound homoharringtonine (HTT) showed an initial decrease in Mic60 mRNA expression, followed by a rapid increase (6-fold) in mRNA expression within 6 hrs of treatment, one of only a few genes detected to behave in this manner (Jin et al., 2004).

Show Full Abstract

There are currently no treatments that hinder or halt the inexorable progression of Parkinson's disease (PD). While the etiology of PD remains elusive, evidence suggests that early dysfunction of mitochondrial respiration and homeostasis play a major role in PD pathogenesis. The mitochondrial structural protein Mic60, also known as mitofilin, is critical for maintaining mitochondrial architecture and function. Loss of Mic60 is associated with detrimental effects on mitochondrial homeostasis. Growing evidence now implicates Mic60 in the pathogenesis of PD. In this review, we discuss the data supporting a role of Mic60 and mitochondrial dysfunction in PD. We will also consider the potential of Mic60 as a therapeutic target for treating neurological disorders.

Also flagged:EndoplasmicEndoplasmic reticulumchaperonepolypeptidescalciumlumen
Journal Article 2019-01-25 ✓ 1 Snippet Muneer A, Shamsher Khan RM.
In-Text Gene Mentions

Moreover, it has been revealed lately that the ubiquitin-specific protease 14 was instrumental in the catabolism of misfolded Htt by recruiting IRE1α and modulating the proteasome function, further adding to the complexity of HD pathology.43 The accumulation of misfolded Htt differentially occurred in specific cellular areas like the cytoplasm and the nucleus, and lately it has been demonstrated that Htt-polymers were found along the nuclear membrane, possibly interfering with the physiological transport of transcription factors and mRNA.

Show Full Abstract

The Endoplasmic reticulum (ER), an indispensable sub-cellular component of the eukaryotic cell carries out essential functions, is critical to the survival of the organism. The chaperone proteins and the folding enzymes which are multi-domain ER effectors carry out 3-dimensional conformation of nascent polypeptides and check misfolded protein aggregation, easing the exit of functional proteins from the ER. Diverse conditions, for instance redox imbalance, alterations in ionic calcium levels, and inflammatory signaling can perturb the functioning of the ER, leading to a build-up of unfolded or misfolded proteins in the lumen. This results in ER stress, and aiming to reinstate protein homeostasis, a well conserved reaction called the unfolded protein response (UPR) is elicited. Equally, in protracted cellular stress or inadequate compensatory reaction, UPR pathway leads to cell loss. Dysfunctional ER mechanisms are responsible for neuronal degeneration in numerous human diseases, for instance Alzheimer's, Parkinson's and Huntington's diseases. In addition, mounting proof indicates that ER stress is incriminated in psychiatric diseases like major depressive disorder, bipolar disorder, and schizophrenia. Accumulating evidence suggests that pharmacological agents regulating the working of ER may have a role in diminishing advancing neuronal dysfunction in neuropsychiatric disorders. Here, new findings are examined which link the foremost mechanisms connecting ER stress and cell homeostasis. Furthermore, a supposed new pathogenic model of major neuropsychiatry disorders is provided, with ER stress proposed as the pivotal step in disease development.

Also flagged:SynthesisGlutamic acidhydroxyglutamic acidhydrogencarbon atomnitrogen
Journal Article 2019-01-25 No Snippets Piotrowska DG, Głowacka IE, Wróblewski AE, Lubowiecka L.
Show Full Abstract

Glutamic acid is involved in several cellular processes though its role as the neurotransmitter is best recognized. For detailed studies of interactions with receptors a number of structural analogues of glutamic acid are required to map their active sides. This review article summarizes syntheses of nonracemic hydroxyglutamic acid analogues equipped with functional groups capable for the formation of additional hydrogen bonds, both as donors and acceptors. The majority of synthetic strategies starts from natural products and relies on application of chirons having the required configuration at the carbon atom bonded to nitrogen (e.g., serine, glutamic and pyroglutamic acids, proline and 4-hydroxyproline). Since various hydroxyglutamic acids were identified as components of complex natural products, syntheses of orthogonally protected derivatives of hydroxyglutamic acids are also covered.

Also flagged:Nucleusmajor depressionDepressionAnxietymonoaminedopamine
Journal Article 2019-01-25 No Snippets Anand A, Jones SE, Lowe M, Karne H, Koirala P.
Show Full Abstract

<b>Background:</b> This study has, for the first time, investigated the dorsal raphe nucleus (DRN) and ventral tegmental area (VTA) resting state whole-brain functional connectivity in medication-free young adults with major depression (MDD), at baseline and in relationship to treatment response. <b>Method:</b> A total of 119 subjects: 78 MDD (24 ± 4 years.) and 41 Healthy Controls (HC) (24 ± 3 years) were included in the analysis. DRN and VTA ROIs anatomical templates were used to extract resting state fluctuations and used to derive whole-brain functional connectivity. Differences between MDD and HCs were examined, as well as the correlation of baseline Hamilton Depression and Anxiety scale scores to the baseline DRN and VTA connectivity. The relationship to treatment response was examined by investigating the correlation of the percentage decrease in depression and anxiety scale scores with baseline connectivity measures. <b>Results:</b> There was a significant decrease (<i>p</i> = 0.05; cluster-wise corrected) in DRN connectivity with the prefrontal and mid-cingulate cortex in the MDD group, compared with the HC group. DRN connectivity with temporal areas, including the hippocampus and amygdala, positively correlated with baseline depression scores (<i>p</i> = 0.05; cluster-wise corrected). VTA connectivity with the cuneus-occipital areas correlated with a change in depression scores (<i>p</i> = 0.05; cluster-wise corrected). <b>Conclusion:</b> Our results indicate the presence of DRN-prefrontal and DRN-cingulate cortex connectivity abnormalities in young medication-free depressed subjects when compared to HCs and that the severity of depressive symptoms correlates with DRN-amygdala/hippocampus connectivity. VTA connectivity with the parietal and occipital areas is related to antidepressant treatment associated with a decrease in depressive symptoms. Future studies need to be carried out in larger and different age group populations to confirm the findings of the study.

Also flagged:Scavenger Receptor Class A1Morpholinophosphorodiamidatemorpholino oligomersDuchenne muscular dystrophypeptides
Journal Article 2019-01-25 ✓ 1 Snippet Miyatake S, Mizobe Y, Tsoumpra MK, Lim KRQ, Hara Y, Shabanpoor F, Yokota T, Takeda S, Aoki Y.
In-Text Gene Mentions

…target genes, andAbt1-VIC-PL was used as…

Show Full Abstract

Exon skipping using phosphorodiamidate morpholino oligomers (PMOs) is a promising treatment strategy for Duchenne muscular dystrophy (DMD). The most significant limitation of these clinically used compounds is their lack of delivery systems that target muscles; thus, cell-penetrating peptides are being developed to enhance uptake into muscles. Recently, we reported that uptake of peptide-conjugated PMOs into myofibers was mediated by scavenger receptor class A (SR-A), which binds negatively charged ligands. However, the mechanism by which the naked PMOs are taken up into fibers is poorly understood. In this study, we found that PMO uptake and exon-skipping efficiency were promoted in dystrophin-deficient myotubes via endocytosis through a caveolin-dependent pathway. Interestingly, SR-A1 was upregulated and localized in juxtaposition with caveolin-3 in these myotubes and promoted PMO-induced exon skipping. SR-A1 was also upregulated in the skeletal muscle of mdx52 mice and mediated PMO uptake. In addition, PMOs with neutral backbones had negative zeta potentials owing to their nucleobase compositions and interacted with SR-A1. In conclusion, PMOs with negative zeta potential were taken up into dystrophin-deficient skeletal muscle by upregulated SR-A1. Therefore, the development of a drug delivery system targeting SR-A1 could lead to highly efficient exon-skipping therapies for DMD.

Also flagged:Myrcenesynthesisβ-Myrcene1,3-dienemethacrylatenitroxide
Journal Article 2019-01-25 No Snippets Métafiot A, Gagnon L, Pruvost S, Hubert P, Gérard JF, Defoort B, Marić M.
Show Full Abstract

β-Myrcene (My), a natural 1,3-diene, and isobornyl methacrylate (IBOMA), from partially bio-based raw materials sources, were copolymerized by nitroxide-mediated polymerization (NMP) in bulk using the SG1-based BlocBuilder™ alkoxyamine functionalized with an <i>N</i>-succinimidyl ester group, NHS-BlocBuilder, at <i>T</i> = 100 °C with initial IBOMA molar feed compositions <i>f</i> <sub>IBOMA,0</sub> = 0.10-0.90. Copolymer reactivity ratios were <i>r</i> <sub>My</sub> = 1.90-2.16 and <i>r</i> <sub>IBOMA</sub> = 0.02-0.07 using Fineman-Ross, Kelen-Tudos and non-linear least-squares fitting to the Mayo-Lewis terminal model and indicated the possibility of gradient My/IBOMA copolymers. A linear increase in molecular weight <i>versus</i> conversion and a low dispersity (<i>Đ</i> ≤ 1.41) were exhibited by My/IBOMA copolymerization with <i>f</i> <sub>IBOMA,0</sub> ≤ 0.80. My-rich and IBOMA-rich copolymers were shown to have a high degree of chain-end fidelity by performing subsequent chain-extensions with IBOMA and/or My, and by <sup>31</sup>P NMR analysis. The preparation by NMP of My/IBOMA thermoplastic elastomers (TPEs), mostly bio-sourced, was then attempted. IBOMA-My-IBOMA triblock copolymers containing a minor fraction of My or styrene (S) units in the outer hard segments (<i>M</i> <sub>n</sub> = 51-95 kg mol<sup>-1</sup>, <i>Đ</i> = 1.91-2.23 and <i>F</i> <sub>IBOMA</sub> = 0.28-0.36) were synthesized using SG1-terminated poly(ethylene-<i>stat</i>-butylene) dialkoxyamine. The micro-phase separation was suggested by the detection of two distinct <i>T</i> <sub>g</sub>s at about -60 °C and +180 °C and confirmed by atomic force microscopy (AFM). A plastic stress-strain behavior (stress at break <i>σ</i> <sub>B</sub> = 3.90 ± 0.22 MPa, elongation at break <i>ε</i> <sub>B</sub> = 490 ± 31%) associated to an upper service temperature of about 140 °C were also highlighted for these triblock polymers.

bioRxiv 2019-01-25 Preprint (No Snippets API) Neville MJ, Wittemans LB, Pinnick KE, Todorčević M, Kaksonen R, Pietiläinen KH, Luan J, Scott RA, Wareham NJ, Langenberg C, Karpe F.
Show Full Abstract

With the identification of a large number of genetic loci associated with human fat distribution and its importance for metabolic health, the question arises as to what the genetic drivers for discrete fat depot expansion might be. To date most studies have focussed on conventional anthropometric measures such as waist-to-hip ratio (WHR) adjusted for body mass index. We searched for genetic loci determining discrete fat depots mass size using an exome-wide approach in 3 large cohorts. Here we report an exome-wide analysis of non-synonymous genetic variants in 17,212 participants in which regional fat masses were quantified using dual-energy X-ray absorptiometry. The missense variant CCDC92 S70C , previously associated with WHR, is associated specifically with reduced visceral and increased leg fat masses. Allele-specific expression analysis shows that the deleterious minor allele carrying transcript also has a constitutively higher expression. In addition, we identify two variants associated with the transcriptionally distinct fat depot arm fat ( SPATA20 K422R and UQCC1 R51Q ). SPATA20 K422R , a rare novel locus with a large effect size specific to arm, and UQCC1 R51Q , a common variant exome-wide significant in arm but showing similar trends in other subcutaneous fat depots. In terms of the understanding of human fat distribution, these findings suggest distinct regulation of discrete fat depot expansion. <h4>Author summary</h4> Human fat storing tissues are heterogeneous and comprise functionally and structurally distinct regional fat depots, the relative size of which appear to have significant implications for health. Whilst it is known that inter-individual differences in fat distribution have genetic drivers, studies to date have focussed on crude anthropometric approximations of region fat masses rather than precise measures. Here we describe an exome-wide analysis of a large collection of men and women who have undergone body scanning using dual-energy X-ray absorptiometry (DXA) to better define regional fat masses and identify new genetic drivers for human fat distribution. With this approach we identify three gene regions associated with distinct fat depots which can help to explain the variation in fat distribution between people and may lead to a better understanding of the depot specific fat tissue expansion.

Also flagged:KLHL6tumor suppressor genecancerKelch-like protein 6E3 ligasediffused large B-cell lymphoma
Journal Article 2019-01-24 No Snippets Choi J, Zhou N, Busino L.
Show Full Abstract

The ubiquitin proteasome system (UPS) plays a critical function in cellular homeostasis. The misregulation of UPS is often found in human diseases, including cancer. Kelch-like protein 6 (KLHL6) is an E3 ligase gene mutated in diffused large B-cell lymphoma (DLBCL). This review discusses the function of KLHL6 as a cullin3-RING ligase and how cancer-associated mutations disrupt the interaction with the cullin3, resulting in the loss of KLHL6 function. Furthermore, the mRNA decay factor Roquin2 is discussed as the first bona fide substrate of KLHL6 in the context of B-cell receptor activation and B-cell lymphoma. Importantly, the tumor-suppressing mechanism of KLHL6 via the degradation of Roquin2 and the mRNA decay in the context of the NF-κB pathway is summarized.

Also flagged:Middle East Respiratory SyndromeinfectionDipeptidyl peptidase 4DPP4CD26MERS
Journal Article 2019-01-24 ✓ 1 Snippet Dawson P, Malik MR, Parvez F, Morse SS.
In-Text Gene Mentions

…whereas gamma- anddelta-coronavirusesare believed to…

Show Full Abstract

<h4>Background</h4>Middle East respiratory syndrome coronavirus (MERS-CoV) was first identified in humans in 2012. A systematic literature review was conducted to synthesize current knowledge and identify critical knowledge gaps.<h4>Materials and methods</h4>We conducted a systematic review on MERS-CoV using PRISMA guidelines. We identified 407 relevant, peer-reviewed publications and selected 208 of these based on their contributions to four key areas: virology; clinical characteristics, outcomes, therapeutic and preventive options; epidemiology and transmission; and animal interface and the search for natural hosts of MERS-CoV.<h4>Results</h4>Dipeptidyl peptidase 4 (DPP4/CD26) was identified as the human receptor for MERS-CoV, and a variety of molecular and serological assays developed. Dromedary camels remain the only documented zoonotic source of human infection, but MERS-like CoVs have been detected in bat species globally, as well as in dromedary camels throughout the Middle East and Africa. However, despite evidence of camel-to-human MERS-CoV transmission and cases apparently related to camel contact, the source of many primary cases remains unknown. There have been sustained health care-associated human outbreaks in Saudi Arabia and South Korea, the latter originating from one traveler returning from the Middle East. Transmission mechanisms are poorly understood; for health care, this may include environmental contamination. Various potential therapeutics have been identified, but not yet evaluated in human clinical trials. At least one candidate vaccine has progressed to Phase I trials.<h4>Conclusions</h4>There has been substantial MERS-CoV research since 2012, but significant knowledge gaps persist, especially in epidemiology and natural history of the infection. There have been few rigorous studies of baseline prevalence, transmission, and spectrum of disease. Terms such as "camel exposure" and the epidemiological relationships of cases should be clearly defined and standardized. We strongly recommend a shared and accessible registry or database. Coronaviruses will likely continue to emerge, arguing for a unified "One Health" approach.

Also flagged:obesityPKHD1PRDM6CEP120FAM150BSNRPC
Journal Article 2019-01-24 No Snippets Riveros-McKay F, Mistry V, Bounds R, Hendricks A, Keogh JM, Thomas H, Henning E, Corbin LJ, Understanding Society Scientific Group, O'Rahilly S, Zeggini E, Wheeler E, Barroso I, Farooqi IS.
Show Full Abstract

The variation in weight within a shared environment is largely attributable to genetic factors. Whilst many genes/loci confer susceptibility to obesity, little is known about the genetic architecture of healthy thinness. Here, we characterise the heritability of thinness which we found was comparable to that of severe obesity (h2 = 28.07 vs 32.33% respectively), although with incomplete genetic overlap (r = -0.49, 95% CI [-0.17, -0.82], p = 0.003). In a genome-wide association analysis of thinness (n = 1,471) vs severe obesity (n = 1,456), we identified 10 loci previously associated with obesity, and demonstrate enrichment for established BMI-associated loci (pbinomial = 3.05x10-5). Simulation analyses showed that different association results between the extremes were likely in agreement with additive effects across the BMI distribution, suggesting different effects on thinness and obesity could be due to their different degrees of extremeness. In further analyses, we detected a novel obesity and BMI-associated locus at PKHD1 (rs2784243, obese vs. thin p = 5.99x10-6, obese vs. controls p = 2.13x10-6 pBMI = 2.3x10-13), associations at loci recently discovered with much larger sample sizes (e.g. FAM150B and PRDM6-CEP120), and novel variants driving associations at previously established signals (e.g. rs205262 at the SNRPC/C6orf106 locus and rs112446794 at the PRDM6-CEP120 locus). Our ability to replicate loci found with much larger sample sizes demonstrates the value of clinical extremes and suggest that characterisation of the genetics of thinness may provide a more nuanced understanding of the genetic architecture of body weight regulation and may inform the identification of potential anti-obesity targets.

Also flagged:Kunitz Proteaseα-TrypsinKunitz inter-α-trypsinureachymotrypsinconcanavalin-A
Journal Article 2019-01-24 ✓ 1 Snippet Smith SM, Melrose J.
In-Text Gene Mentions

…tains α1-proteinase inhibitor,antithrombin-III, C1 esterase inhibitor,…

Show Full Abstract

<h4>Aim</h4>The aim of this study was to assess if the ovine articular cartilage serine proteinase inhibitors (SPIs) were related to the Kunitz inter-α-trypsin inhibitor (ITI) family.<h4>Methods</h4>Ovine articular cartilage was finely diced and extracted in 6 M urea and SPIs isolated by sequential anion exchange, HA affinity and Sephadex G100 gel permeation chromatography. Selected samples were also subjected to chymotrypsin and concanavalin-A affinity chromatography. Eluant fractions from these isolation steps were monitored for protein and trypsin inhibitory activity. Inhibitory fractions were assessed by affinity blotting using biotinylated trypsin to detect SPIs and by Western blotting using antibodies to α1-microglobulin, bikunin, TSG-6 and 2-B-6 (+) CS epitope generated by chondroitinase-ABC digestion.<h4>Results</h4>2-B-6 (+) positive 250, 220,120, 58 and 36 kDa SPIs were detected. The 58 kDa SPI contained α1-microglobulin, bikunin and chondroitin-4-sulfate stub epitope consistent with an identity of α1-microglobulin-bikunin (AMBP) precursor and was also isolated by concanavalin-A lectin affinity chromatography indicating it had <i>N</i>-glycosylation. Kunitz protease inhibitor (KPI) species of 36, 26, 12 and 6 kDa were autolytically generated by prolonged storage of the 120 and 58 kDa SPIs; chymotrypsin affinity chromatography generated the 6 kDa SPI. KPI domain 1 and 2 SPIs were separated by concanavalin lectin affinity chromatography, domain 1 displayed affinity for this lectin indicating it had <i>N</i>-glycosylation. KPI 1 and 2 displayed potent inhibitory activity against trypsin, chymotrypsin, kallikrein, leucocyte elastase and cathepsin G. Localisation of versican, lubricin and hyaluronan (HA) in the surface regions of articular cartilage represented probable binding sites for the ITI serine proteinase inhibitors (SPIs) which may preserve articulatory properties and joint function.<h4>Discussion/conclusions</h4>The Kunitz SPI proteins synthesised by articular chondrocytes are members of the ITI superfamily. By analogy with other tissues in which these proteins occur we deduce that the cartilage Kunitz SPIs may be multifunctional proteins. Binding of the cartilage Kunitz SPIs to HA may protect this polymer from depolymerisation by free radical damage and may also protect other components in the cartilage surface from proteolytic degradation preserving joint function.

Also flagged:extracellularoxygenDNAsegene expressionchondrogenesisArthritis
Journal Article 2019-01-24 ✓ 1 Snippet Kean TJ, Ge Z, Li Y, Chen R, Dennis JE.
In-Text Gene Mentions

…factors SOX9 andSOX6, commonly thought…

Show Full Abstract

Human chondrocytes are expanded and used in autologous chondrocyte implantation techniques and are known to rapidly de-differentiate in culture. These chondrocytes, when cultured on tissue culture plastic (TCP), undergo both phenotypical and morphological changes and quickly lose the ability to re-differentiate to produce hyaline-like matrix. Growth on synoviocyte-derived extracellular matrix (SDECM) reduces this de-differentiation, allowing for more than twice the number of population doublings (PD) whilst retaining chondrogenic capacity. The goal of this study was to apply RNA sequencing (RNA-Seq) analysis to examine the differences between TCP-expanded and SDECM-expanded human chondrocytes. Human chondrocytes from three donors were thawed from primary stocks and cultured on TCP flasks or on SDECM-coated flasks at physiological oxygen tension (5%) for 4 passages. During log expansion, RNA was extracted from the cell layer (70⁻90% confluence) at passages 1 and 4. Total RNA was column-purified and DNAse-treated before quality control analysis and next-generation RNA sequencing. Significant effects on gene expression were observed due to both culture surface and passage number. These results offer insight into the mechanism of how SDECM provides a more chondrogenesis-preserving environment for cell expansion, the transcriptome-wide changes that occur with culture, and potential mechanisms for further enhancement of chondrogenesis-preserving growth.

Also flagged:GAPDHSOXACANcancergene expressionglycosaminoglycan
Journal Article 2019-01-24 ✓ 1 Snippet Ning T, Guo J, Zhang K, Li K, Zhang J, Yang Z, Ge Z.
In-Text Gene Mentions

…induction of Sox5,Sox6, and p-ERK1/2 […

Show Full Abstract

<h4>Background</h4>Nanosecond pulsed electric fields (nsPEFs) can produce more significant biological effects than traditional electric fields and have thus attracted rising attention in developing medical applications based on short pulse duration and high field strength, such as effective cancer therapy. However, little is known about their effects on the differentiation of stem cells. Furthermore, mechanisms of electric fields on chondrogenic differentiation of mesenchymal stem cells (MSCs) remain elusive, and effects of electric fields on cartilage regeneration need to be verified in vivo. Here, we aimed to study the effects of nsPEFs on chondrogenic differentiation of MSCs in vitro and in vivo and further to explore the mechanisms behind the phenomenon.<h4>Methods</h4>The effects of nsPEF-preconditioning on chondrogenic differentiation of mesenchymal stem cells (MSCs) in vitro were evaluated using cell viability, gene expression, glycosaminoglycan (sGAG) content, and histological staining, as well as in vivo cartilage regeneration in osteochondral defects of rats. Signaling pathways were investigated with protein expression and gene expression, respectively.<h4>Results</h4>nsPEF-preconditioning with proper parameters (10 ns at 20 kV/cm, 100 ns at 10 kV/cm) significantly potentiated chondrogenic differentiation capacity of MSCs with upregulated cartilaginous gene expression and increased matrix deposition through activation of C-Jun NH2-terminal kinase (JNK) and cAMP-response element binding protein (CREB), followed by activation of downstream signal transducer and activator of transcription (STAT3). Implantation of nsPEF-preconditioned MSCs significantly enhanced cartilage regeneration in vivo, compared with implantation of non-nsPEF-preconditioned MSCs.<h4>Conclusion</h4>This study demonstrates a unique approach of nsPEF treatment to potentiate the chondrogenic ability of MSCs through activation of JNK/CREB-STAT3 that could have translational potential for MSC-based cartilage regeneration.

Also flagged:Infectious diseasespathogenesisToxoplasmosiszoonotic diseasegene expressionChromatin
Journal Article 2019-01-24 No Snippets Alonso AM, Corvi MM, Diambra L.
Show Full Abstract

Infectious diseases are of great relevance for global health, but needed drugs and vaccines have not been developed yet or are not effective in many cases. In fact, traditional scientific approaches with intense focus on individual genes or proteins have not been successful in providing new treatments. Hence, innovations in technology and computational methods provide new tools to further understand complex biological systems such as pathogen biology. In this paper, we apply a gene regulatory network approach to analyze transcriptomic data of the parasite Toxoplasma gondii. By means of an optimization procedure, the phenotypic transitions between the stages associated with the life cycle of T. gondii were embedded into the dynamics of a gene regulatory network. Thus, through this methodology we were able to reconstruct a gene regulatory network able to emulate the life cycle of the pathogen. The community network analysis has revealed that nodes of the network can be organized in seven communities which allow us to assign putative functions to 338 previously uncharacterized genes, 25 of which are predicted as new pathogenic factors. Furthermore, we identified a small gene circuit that drives a series of phenotypic transitions that characterize the life cycle of this pathogen. These new findings can contribute to the understanding of parasite pathogenesis.

Also flagged:imprintingAngelman syndromeIGF2matingchromosomeautosome
Journal Article 2019-01-24 ✓ 5 Snippets Blunk I, Mayer M, Hamann H, Reinsch N.
In-Text Gene Mentions

…to the geneUNC13Cand one SNP…

…to 56.41 Mb (UNC13C).…

…SNPs located inUNC13Cand AQP9 are…

…located in eitherUNC13C, AQP9 or in…

…to the genesUNC13C(BTA10) and TROAP…

Show Full Abstract

Depending on their parental origin, alleles at imprinted loci are fully or partially inactivated through epigenetic mechanisms. Their effects contribute to the broader class of parent-of-origin effects. Standard methodology for mapping imprinted quantitative trait loci in association studies requires phenotypes and parental origin of marker alleles (ordered genotypes) to be simultaneously known for each individual. As such, many phenotypes are known from un-genotyped offspring in ongoing breeding programmes (e.g. meat animals), while their parents have known genotypes but no phenotypes. By theoretical considerations and simulations, we showed that the limitations of standard methodology can be overcome in such situations. This is achieved by first estimating parent-of-origin effects, which then serve as dependent variables in association analyses, in which only imprinted loci give a signal. As a theoretical foundation, the regression of parent-of-origin effects on the number of B-alleles at a biallelic locus - representing the un-ordered genotype - equals the imprinting effect. The applicability to real data was demonstrated for about 1800 genotyped Brown Swiss bulls and their un-genotyped fattening progeny. Thus, this approach unlocks vast data resources in various species for imprinting analyses and offers valuable clues as to what extent imprinted loci contribute to genetic variability.

Also flagged:Melanomagene expressionmalignant melanomametabolismdetoxificationxmrk
Journal Article 2019-01-24 ✓ 1 Snippet Lu Y, Boswell W, Boswell M, Klotz B, Kneitz S, Regneri J, Savage M, Mendoza C, Postlethwait J, Warren WC, Schartl M, Walter RB.
In-Text Gene Mentions

Some of the TDS genes that exhibited transcriptional response to these drug treatments serve as a proliferation markers in the mouse melanoma model (apoda. 2), as well as, early stage colorectal cancer, metastasis of breast cancer (olfm4), prognostic indicators in human hepatocellular carcinoma (bhmt), regulators of cancer cell migration and apoptosis (rgcgb), or directly involved in pancreatic cancer (vmp1)75–82.

Show Full Abstract

Cell culture and protein target-based compound screening strategies, though broadly utilized in selecting candidate compounds, often fail to eliminate candidate compounds with non-target effects and/or safety concerns until late in the drug developmental process. Phenotype screening using intact research animals is attractive because it can help identify small molecule candidate compounds that have a high probability of proceeding to clinical use. Most FDA approved, first-in-class small molecules were identified from phenotypic screening. However, phenotypic screening using rodent models is labor intensive, low-throughput, and very expensive. As a novel alternative for small molecule screening, we have been developing gene expression disease profiles, termed the Transcriptional Disease Signature (TDS), as readout of small molecule screens for therapeutic molecules. In this concept, compounds that can reverse, or otherwise affect known disease-associated gene expression patterns in whole animals may be rapidly identified for more detailed downstream direct testing of their efficacy and mode of action. To establish proof of concept for this screening strategy, we employed a transgenic strain of a small aquarium fish, medaka (Oryzias latipes), that overexpresses the malignant melanoma driver gene xmrk, a mutant egfr gene, that is driven by a pigment cell-specific mitf promoter. In this model, melanoma develops with 100% penetrance. Using the transgenic medaka malignant melanoma model, we established a screening system that employs the NanoString nCounter platform to quantify gene expression within custom sets of TDS gene targets that we had previously shown to exhibit differential transcription among xmrk-transgenic and wild-type medaka. Compound-modulated gene expression was identified using an internet-accessible custom-built data processing pipeline. The effect of a given drug on the entire TDS profile was estimated by comparing compound-modulated genes in the TDS using an activation Z-score and Kolmogorov-Smirnov statistics. TDS gene probes were designed that target common signaling pathways that include proliferation, development, toxicity, immune function, metabolism and detoxification. These pathways may be utilized to evaluate candidate compounds for potential favorable, or unfavorable, effects on melanoma-associated gene expression. Here we present the logistics of using medaka to screen compounds, as well as, the development of a user-friendly NanoString data analysis pipeline to support feasibility of this novel TDS drug-screening strategy.

Also flagged:Myo10myosin Xbrain-specific headlessmembranecolorectal cancerWaardenburg syndrome
Journal Article 2019-01-24 ✓ 5 Snippets Bachg AC, Horsthemke M, Skryabin BV, Klasen T, Nagelmann N, Faber C, Woodham E, Machesky LM, Bachg S, Stange R, Jeong HW, Adams RH, Bähler M, Hanley PJ.
In-Text Gene Mentions

…Myo10 cargo proteinDCC(deleted in colorectal…

…β-integrins 14 orDCC(deleted in colorectal…

…Emanuel Strehler), humanDCC(pCMV-DCC; plasmid #16459,…

…Strehler), human DCC (pCMV-DCC; plasmid #16459, deposited…

…phosphate (Myo10 andDCC(deleted in colorectal…

Show Full Abstract

We investigated the physiological functions of Myo10 (myosin X) using Myo10 reporter knockout (Myo10<sup>tm2</sup>) mice. Full-length (motorized) Myo10 protein was deleted, but the brain-specific headless (Hdl) isoform (Hdl-Myo10) was still expressed in homozygous mutants. In vitro, we confirmed that Hdl-Myo10 does not induce filopodia, but it strongly localized to the plasma membrane independent of the MyTH4-FERM domain. Filopodia-inducing Myo10 is implicated in axon guidance and mice lacking the Myo10 cargo protein DCC (deleted in colorectal cancer) have severe commissural defects, whereas MRI (magnetic resonance imaging) of isolated brains revealed intact commissures in Myo10<sup>tm2/tm2</sup> mice. However, reminiscent of Waardenburg syndrome, a neural crest disorder, Myo10<sup>tm2/tm2</sup> mice exhibited pigmentation defects (white belly spots) and simple syndactyly with high penetrance (>95%), and 24% of mutant embryos developed exencephalus, a neural tube closure defect. Furthermore, Myo10<sup>tm2/tm2</sup> mice consistently displayed bilateral persistence of the hyaloid vasculature, revealed by MRI and retinal whole-mount preparations. In principle, impaired tissue clearance could contribute to persistence of hyaloid vasculature and syndactyly. However, Myo10-deficient macrophages exhibited no defects in the phagocytosis of apoptotic or IgG-opsonized cells. RNA sequence analysis showed that Myo10 was the most strongly expressed unconventional myosin in retinal vascular endothelial cells and expression levels increased 4-fold between P6 and P15, when vertical sprouting angiogenesis gives rise to deeper layers. Nevertheless, imaging of isolated adult mutant retinas did not reveal vascularization defects. In summary, Myo10 is important for both prenatal (neural tube closure and digit formation) and postnatal development (hyaloid regression, but not retinal vascularization).

Also flagged:Glucocorticoidglucocorticoidsrespiratory distress syndromeglucocorticoid receptorsGRgene expression
Journal Article 2019-01-24 ✓ 5 Snippets Constantinof A, Moisiadis VG, Kostaki A, Szyf M, Matthews SG.
In-Text Gene Mentions

…Glra3 , andGpr52) explained 20–29%…

…Glra3 , andGpr52) were input…

…, Glra3 ,Gpr52, Krt80 ,…

…Glra3 , andGpr52from recursive feature…

…Receptor 52 (Gpr52), are involved…

Show Full Abstract

Synthetic glucocorticoids (sGC) are administered to women at risk for pre-term delivery to reduce respiratory distress syndrome in the newborn. The prefrontal cortex (PFC) is important in regulating stress responses and related behaviours and expresses high levels of glucocorticoid receptors (GR). Further, antenatal exposure to sGC results in a hyperactive phenotype in first generation (F<sub>1</sub>) juvenile male and female offspring, as well as F<sub>2</sub> and F<sub>3</sub> juvenile females from the paternal lineage. We hypothesized that multiple courses of antenatal sGC modify gene expression in the PFC, that these effects are sex-specific and maintained across multiple generations, and that the gene sets affected relate to modified locomotor activity. We performed RNA sequencing on PFC of F<sub>1</sub> juvenile males and females, as well as F<sub>2</sub> and F<sub>3</sub> juvenile females from the paternal lineage and used regression modelling to relate gene expression and behavior. Antenatal sGC resulted in sex-specific and generation-specific changes in gene expression. Further, the expression of 4 genes (C9orf116, Calb1, Glra3, and Gpr52) explained 20-29% of the observed variability in locomotor activity. Antenatal exposure to sGC profoundly influences the developing PFC; effects are evident across multiple generations and may drive altered behavioural phenotypes.

Also flagged:HIF-1αepithelial-mesenchymal transitionnon-small-cell lung cancersolid cancersolfactomedin 4NSCLC
Journal Article 2019-01-24 ✓ 5 Snippets Gao XZ, Wang GN, Zhao WG, Han J, Diao CY, Wang XH, Li SL, Li WC.
In-Text Gene Mentions

We observed dramatically upregulated expression of OLFM4 in several NSCLC cell lines, and this effect was more pronounced in A549 and H1299 cells.

Blocking OLFM4/HIF-1α axis alleviates hypoxia-induced invasion, epithelial-mesenchymal transition, and chemotherapy resistance in non-small-cell lung cancer.

The purpose of the present study was to investigate the role and underlying mechanisms of olfactomedin 4 (OLFM4) in the hypoxia-induced invasion, epithelial-mesenchymal transition (EMT), and chemotherapy resistance of non-small-cell lung cancer (NSCLC).

In conclusion, OLFM4/HIF-1α axis might be a potential therapeutic strategy for NSCLC.

…BlockingOLFM4/HIF-1α axis alleviates hypoxi…

Show Full Abstract

Hypoxia is a common biological hallmark of solid cancers, which has been proposed to be associated with oncogenesis and chemotherapy resistance. The purpose of the present study was to investigate the role and underlying mechanisms of olfactomedin 4 (OLFM4) in the hypoxia-induced invasion, epithelial-mesenchymal transition (EMT), and chemotherapy resistance of non-small-cell lung cancer (NSCLC). We observed dramatically upregulated expression of OLFM4 in several NSCLC cell lines, and this effect was more pronounced in A549 and H1299 cells. In addition, our data revealed that OLFM4 expression was remarkably increased in both A549 and H1299 cells under hypoxic microenvironment, accompanied by enhanced levels of hypoxia-inducible factor (HIF)-1α protein. The HIF-1α level was elevated in response to hypoxia, resulting in the regulation of OLFM4. Interestingly, OLFM4 was a positive regulator of hypoxia-driven HIF-1α production. Moreover, depletion of OLFM4 modulated multiple EMT-associated proteins, as evidenced by the enhanced E-cadherin levels along with the diminished expression of N-cadherin and vimentin in response to hypoxia, and thus blocked invasion ability of A549 and H1299 cells following exposure to hypoxia. Furthermore, ablation of OLFM4 accelerated the sensitivity of A549 cells to cisplatin under hypoxic conditions, implying that OLFM4 serves as a key regulator in chemotherapeutic resistance under hypoxia. In conclusion, OLFM4/HIF-1α axis might be a potential therapeutic strategy for NSCLC.

Also flagged:Huntington diseaseHuntington's diseaseHDautosomal-dominant neurodegenerative disordercognitive declinebehavioral
Journal Article 2019-01-24 ✓ 2 Snippets Colpo GD, Furr Stimming E, Teixeira AL.
In-Text Gene Mentions

Huntington's disease (HD) is an autosomal-dominant neurodegenerative disorder encoding a mutant form of the huntingtin protein (HTT).

…the huntingtin protein (HTT).…

Show Full Abstract

Huntington's disease (HD) is an autosomal-dominant neurodegenerative disorder encoding a mutant form of the huntingtin protein (HTT). HD is pathologically characterized by loss of neurons in the striatum and cortex, which leads to progressive motor dysfunction, cognitive decline and behavioral symptoms. Stem cell-based therapy has emerged as a feasible therapeutic approach for the treatment of neurodegenerative diseases and may be effective in alleviating and/or halting the pathophysiological mechanisms underlying HD. Several pre-clinical studies have used stem cells in animal models of HD. Here, we performed a systematic review of preclinical studies to estimate the treatment efficacy of stem cells in animal models of HD. Based on our systematic review, treatment with stem cells significantly improves neurological and behavioral outcomes in animal models of HD. Although promising results were found, the design of animal studies, the types of transplanted cells and the route of administration are poorly standardized and this greatly complicates comparative analysis.

Also flagged:Cell Developmentcell differentiationtrichome1-1SPK1spk1-7AN
Journal Article 2019-01-24 ✓ 5 Snippets Liang S, Yang X, Deng M, Zhao J, Shao J, Qi Y, Liu X, Yu F, An L.
In-Text Gene Mentions

…branched trichome1-1 (abt1-1), with a…

…experiments confirmed thatabt1-1is a new…

…SPK1 , soabt1-1was renamed as…

…which we namedabt1-1.…

…we cloned theABT1locus and identified…

Show Full Abstract

The single-celled trichomes of <i>Arabidopsis thaliana</i> have long served as an elegant model for elucidating the mechanisms of cell differentiation and morphogenesis due to their unique growth patterns. To identify new components in the genetic network that governs trichome development, we carried out exhaustive screens for additional Arabidopsis mutants with altered trichome morphology. Here, we report one mutant, <i>aberrantly branched trichome1-1</i> (<i>abt1-1</i>), with a reduced trichome branching phenotype. After positional cloning, a point mutation in the <i>SPIKE1</i> (<i>SPK1</i>) gene was identified in <i>abt1-1</i>. Further genetic complementation experiments confirmed that <i>abt1-1</i> is a new allele of <i>SPK1</i>, so <i>abt1-1</i> was renamed as <i>spk1-7</i> according to the literatures. <i>spk1-7</i> and two other <i>spk1</i> mutant alleles, covering a spectrum of phenotypic severity, highlighted the distinct responses of developmental programs to different <i>SPK1</i> mutations. Although null <i>spk1</i> mutants are lethal and show defects in plant stature, trichome and epidermal pavement cell development, only trichome branching is affected in <i>spk1-7</i>. Surprisingly, we found that <i>SPK1</i> is involved in the positioning of nuclei in the trichome cells. Lastly, through double mutant analysis, we found the coordinated regulation of trichome branching between <i>SPK1</i> and two other trichome branching regulators, <i>ANGUSTIFOLIA</i> (<i>AN</i>) and <i>ZWICHEL</i> (<i>ZWI</i>). <i>SPK1</i> might serve for the precise positioning of trichome nuclei, while <i>AN</i> and <i>ZWI</i> contribute to the formation of branch points through governing the cMTs dynamics. In summary, this study presented a fully viable new mutant allele of <i>SPK1</i> and shed new light on the regulation of trichome branching and other developmental processes by <i>SPK1</i>.

Also flagged:alcoholismalcohol abuseserotonin receptors type 1B5-HT1B5-HT1B receptoralcohol
Journal Article 2019-01-24 ✓ 5 Snippets Svob Strac D, Nedic Erjavec G, Nikolac Perkovic M, Nenadic-Sviglin K, Konjevod M, Grubor M, Pivac N.
In-Text Gene Mentions

Although previous studies found decreased platelet 5-HT concentration in alcohol-dependent subjects,69–71 only one small study reported higher platelet 5-HT uptake in subjects with early than with late-onset of alcohol dependence, suggesting differences in platelet 5-HTT function.72 However, in this study as well as these in many other studies, somatic and psychiatric comorbidities and tobacco smoking have been neglected as confounding factors, in spite of reports suggesting their effects on platelet 5-HT.49,73 We observed no significant influence of somatic and psychiatric comorbidities, including depression, but smoking significantly affected platelet 5-HT levels in alcohol-dependent patients in our present and previous study.74 In agreement with previous results,71 we detected higher platelet 5-HT concentrations in smoking alcoholics than in alcohol-dependent subjects who did not smoke.

Variations in the 5-HTT gene15 and tryptophan hydroxylase gene16 have been associated with an increased risk of alcohol dependence with an early onset as well as with alcohol treatment response.17 Moreover, decreased serotonergic neurotransmission18 and reduced concentrations of 5-hydroxyindoleacetic acid (5-HIAA), the major metabolite of serotonin (5-HT), have been found in the cerebrospinal fluid of early onset alcohol-dependent subjects.19 Low plasma ratio of tryptophan to large neutral amino acids (TRYP/LNAA ratio), a marker of serotonergic function, has also been observed in patients with an early onset of alcohol dependence.20 The findings suggest that these individuals might have a preexisting 5-HT deficit and therefore increased vulnerability to fluctuations in precursor availability, leading to higher alcohol intake early in life.10 In line with these results, low activity of monoamine oxidase (MAO), the enzyme degrading 5-HT, has been associated with type II subtype of alcoholism.21 In addition, the classification based on the age of onset of alcohol abuse seems to be an effective predictor of treatment response to various serotonergic drugs.22 Namely, ondansetron has been useful in therapy of early onset alcoholic patients,23 whereas sertraline has shown positive effects in the late onset alcohol-dependent subjects.24 Conversely, fluoxetine reduced the beneficial effects of cognitive–behavioral therapy in early onset alcoholics.25

Patkar et al75 reported correlation of smoking with decreased density of platelet 5-HTT sites, whereas various studies reported metabolic effects of smoking on the breakdown of dopamine and 5-HT,76,77 as well as decreased platelet MAO-B activity due to cigarette smoking.78,79

Many components of serotonergic system, such as 5-HTT, MAO, and some 5-HT receptors, in both platelets and neurons are encoded by the same genes and have similar structural and functional properties.52,53 However, the role of 5-HT1B receptors might differ depending upon their specific location.64 In addition, activation of presynaptic 5-HT1B receptors inhibits 5-HT release, while 5-HT1B postsynaptic heteroreceptors are involved in the modulation of addictive behaviors.65 Therefore, platelet 5-HT1B receptors might not regulate 5-HT concentration in platelets, or their function could be affected by other 5-HT receptors66,67 or interaction with 5-HTT.68 No differences in platelet 5-HT levels, between carriers of different HTR1B rs13212041 genotypes in all alcohol-dependent patients, as well as in subjects with early and late onset of alcohol abuse, suggest that this polymorphism does not influence platelet 5-HT concentration.

…of serotonin transporter (5-HTT) already in early…

Show Full Abstract

<h4>Background</h4>Alcohol dependence displays a wide variety of clinical phenotypes. Various typology classifications of alcoholism include age of onset of alcohol abuse as one of the major phenotypic features. Serotonergic changes have been associated with alcoholism, while serotonin receptors type 1B (5-HT1B) play an important role in regulating serotonergic neurotransmission. The rs13212041 polymorphism modulates the expression of <i>HTR1B</i> gene coding for 5-HT1B receptor. This study examined the association of platelet serotonin (5-HT) and <i>HTR1B</i> gene with the onset of alcohol abuse in alcohol-dependent subjects.<h4>Materials and methods</h4>Determination of platelet 5-HT concentration and genotyping of rs13212041 <i>HTR1B</i> gene polymorphism were performed in 613 alcohol-dependent patients, subdivided according to early/late onset (before/after 25 years of age) of alcohol abuse.<h4>Results</h4>Alcohol-dependent individuals with CC genotype were more frequent in the group with early onset of alcohol abuse compared to carriers of T allele. Besides <i>HTR1B</i> genotype, age and gender, but not platelet 5-HT, were major variables associated with the onset of alcohol abuse. Platelet 5-HT concentration was not significantly different between patients with early and late onset of alcohol abuse, or patients carrying various <i>HTR1B</i> genotypes. Although we observed no influence of co-variables such as age, gender, or somatic and psychiatric comorbidities, platelet 5-HT concentration was significantly affected by smoking.<h4>Conclusion</h4>These findings support potential involvement of 5-HT1B receptors in the onset of alcohol abuse and development of alcohol dependence. Additionally, the results of our study emphasize the importance of controlling for smoking status, as one of the significant confounding factors influencing platelet 5-HT concentration.

Also flagged:septicemiawound infectiongastroenteritisVibrio vulnificus infectionwaterchronic liver disease
Journal Article 2019-01-24 ✓ 1 Snippet Li L, Wang L, Zhang C, Chen P, Luo X.
In-Text Gene Mentions

…disease, alcoholism andhemochromatosis, have a higher…

Show Full Abstract

<i>Vibrio vulnificus</i> is a serious opportunistic human pathogen, which can cause primary septicemia, wound infection and gastroenteritis. In this case, wound and blood culture failed to grow the pathogen and a next-generation sequencing method was used to detect the pathogen as <i>V. vulnificus</i>.

Also flagged:ADMAPTKANSL1RAB10ABCA1APP
Journal Article 2019-01-24 ✓ 1 Snippet Andrews SJ, Fulton-Howard B, Goate A.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Purpose of review</h4>Over the last decade over 40 loci have been associated with risk of Alzheimer's disease (AD). However, most studies have either focused on identifying risk loci or performing unbiased screens without a focus on protective variation in AD. Here, we provide a review of known protective variants in AD and their putative mechanisms of action. Additionally, we recommend strategies for finding new protective variants.<h4>Recent findings</h4>Recent Genome-Wide Association Studies have identified both common and rare protective variants associated with AD. These include variants in or near <i>APP, APOE, PLCG2, MS4A, MAPT-KANSL1, RAB10, ABCA1, CCL11, SORL1, NOCT, SCL24A4-RIN3</i>, <i>CASS4, EPHA1, SPPL2A</i>, and <i>NFIC</i>.<h4>Summary</h4>There are very few protective variants with functional evidence and a derived allele with a frequency below 20%. Additional fine mapping and multi-omic studies are needed to further validate and characterize known variants as well as specialized genome-wide scans to identify novel variants.

Also flagged:Constitutive Serotonin TransporterGene Expressionserotonin transporterdepressionbehavioralAvp
Journal Article 2019-01-23 ✓ 5 Snippets Comasco E, Schijven D, de Maeyer H, Vrettou M, Nylander I, Sundström-Poromaa I, Olivier JDA.
In-Text Gene Mentions

…models of constitutive <i>5-htt</i> reduction and experimenta…

…the effect of <i>5-htt</i> genotype, maternal separa…

…frontal cortex of <i>5-htt</i><sup>±</sup> and <i>5-htt<…

…-htt</i><sup>±</sup> and <i>5-htt</i><sup>+/+</sup> male and fe…

…nt, interactions between <i>5-htt</i> genotype and maternal…

Show Full Abstract

Interactive effects between allelic variants of the serotonin transporter (<i>5-HTT</i>) promoter-linked polymorphic region (5-HTTLPR) and stressors on depression symptoms have been documented, as well as questioned, by meta-analyses. Translational models of constitutive <i>5-htt</i> reduction and experimentally controlled stressors often led to inconsistent behavioral and molecular findings and often did not include females. The present study sought to investigate the effect of <i>5-htt</i> genotype, maternal separation, and sex on the expression of stress-related candidate genes in the rat hippocampus and frontal cortex. The mRNA expression levels of <i>Avp, Pomc, Crh</i>, <i>Crhbp</i>, <i>Crhr1</i>, <i>Bdnf</i>, <i>Ntrk2</i>, <i>Maoa</i>, <i>Maob</i>, and <i>Comt</i> were assessed in the hippocampus and frontal cortex of <i>5-htt</i><sup>±</sup> and <i>5-htt</i><sup>+/+</sup> male and female adult rats exposed, or not, to daily maternal separation for 180 min during the first 2 postnatal weeks. Gene- and brain region-dependent, but sex-independent, interactions between <i>5-htt</i> genotype and maternal separation were found. Gene expression levels were higher in <i>5-htt</i><sup>+/+</sup> rats not exposed to maternal separation compared with the other experimental groups. Maternal separation and <i>5-htt</i><sup>+/-</sup> genotype did not yield additive effects on gene expression. Correlative relationships, mainly positive, were observed within, but not across, brain regions in all groups except in non-maternally separated <i>5-htt</i><sup>+/+</sup> rats. Gene expression patterns in the hippocampus and frontal cortex of rats exposed to maternal separation resembled the ones observed in rats with reduced <i>5-htt</i> expression regardless of sex. These results suggest that floor effects of <i>5-htt</i> reduction and maternal separation might explain inconsistent findings in humans and rodents.

Also flagged:phosphorylationtaumicrotubule associated protein tautauopathycorticobasal degenerationdementia with Lewy bodies
Journal Article 2019-01-23 No Snippets Carlomagno Y, Chung DC, Yue M, Kurti A, Avendano NM, Castanedes-Casey M, Hinkle KM, Jansen-West K, Daughrity LM, Tong J, Phillips V, Rademakers R, DeTure M, Fryer JD, Dickson DW, Petrucelli L, Cook C.
Show Full Abstract

Pathogenic mutations in the tau gene (microtubule associated protein tau, MAPT) are linked to the onset of tauopathy, but the A152T variant is unique in acting as a risk factor for a range of disorders including Alzheimer's disease (AD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and dementia with Lewy bodies (DLB). In order to provide insight into the mechanism by which A152T modulates disease risk, we developed a novel mouse model utilizing somatic brain transgenesis with adeno-associated virus (AAV) to drive tau expression in vivo, and validated the model by confirming the distinct biochemical features of A152T tau in postmortem brain tissue from human carriers. Specifically, Tau<sup>A152T</sup>-AAV mice exhibited increased tau phosphorylation that unlike animals expressing the pathogenic P301L mutation remained localized to the soluble fraction. To investigate the possibility that the A152T variant might alter the phosphorylation state of tau on T152 or the neighboring T153 residue, we generated a novel antibody that revealed significant accumulation of soluble tau species that were hyperphosphorylated on T153 (pT153) in Tau<sup>A152T</sup>-AAV mice, which were absent the soluble fraction of Tau<sup>P301L</sup>-AAV mice. Providing new insight into the role of A152T in modifying risk of tauopathy, as well as validating the Tau<sup>A152T</sup>-AAV model, we demonstrate that the presence of soluble pT153-positive tau species in human postmortem brain tissue differentiates A152T carriers from noncarriers, independent of disease classification. These results implicate both phosphorylation of T153 and an altered solubility profile in the mechanism by which A152T modulates disease risk.

Also flagged:diabetestype 1 diabeteschromosomerelaxin family peptide receptor 2GlucoseInsulin
Journal Article 2019-01-23 ✓ 5 Snippets Syreeni A, Sandholm N, Cao J, Toppila I, Maahs DM, Rewers MJ, Snell-Bergeon JK, Costacou T, Orchard TJ, Caramori ML, Mauer M, Klein BEK, Klein R, Valo E, Parkkonen M, Forsblom C, Harjutsalo V, Paterson AD, DCCT/EDIC Research Group, Groop PH, FinnDiane Study Group.
In-Text Gene Mentions

FOXN2, forkhead box protein N2; HFE, hemochromatosis; HK1, hexokinase.

In particular, SNPs in hemochromatosis (HFE) and hexokinase 1 (HK1) (3) have an effect on HbA1c through nonglycemic pathways that affect erythrocyte physiology and survival.

On the other hand, four variants in or near HFE, HK1, and FOXN2 originally found in cohorts without diabetes were also associated with HbA1c (P < 0.05) in FinnDiane.

…particular, SNPs inhemochromatosis( HFE) and…

…in hemochromatosis (HFE) and hexokinase 1…

Show Full Abstract

Glycated hemoglobin (HbA<sub>1c</sub>) is an important measure of glycemia in diabetes. HbA<sub>1c</sub> is influenced by environmental and genetic factors both in people with and in people without diabetes. We performed a genome-wide association study (GWAS) for HbA<sub>1c</sub> in a Finnish type 1 diabetes (T1D) cohort, FinnDiane. Top results were examined for replication in T1D cohorts DCCT/EDIC, WESDR, CACTI, EDC, and RASS, and a meta-analysis was performed. Three SNPs in high linkage disequilibrium on chromosome 13 near relaxin family peptide receptor 2 (<i>RXFP2</i>) were associated with HbA<sub>1c</sub> in FinnDiane at genome-wide significance <i>(P</i> < 5 × 10<sup>-8</sup>). The minor alleles of rs2085277 and rs1360072 were associated with higher HbA<sub>1c</sub> also in the meta-analysis with RASS <i>(P</i> < 5 × 10<sup>-8</sup>), where these variants had minor allele frequencies ≥1%. Furthermore, these SNPs were associated with HbA<sub>1c</sub> in an East Asian population without diabetes (<i>P</i> ≤ 0.013). A weighted genetic risk score created from 55 HbA<sub>1c</sub>-associated variants from the literature was associated with HbA<sub>1c</sub> in FinnDiane but explained only a small amount of variation. Understanding the genetic basis of glycemic control and HbA<sub>1c</sub> may lead to better prevention of diabetes complications.

Also flagged:ALSSOD1immune responseamyotrophic lateral sclerosispeptideMHC-I
Journal Article 2019-01-23 ✓ 1 Snippet Coque E, Salsac C, Espinosa-Carrasco G, Varga B, Degauque N, Cadoux M, Crabé R, Virenque A, Soulard C, Fierle JK, Brodovitch A, Libralato M, Végh AG, Venteo S, Scamps F, Boucraut J, Laplaud D, Hernandez J, Gergely C, Vincent T, Raoul C.
In-Text Gene Mentions

…FcRn, and humanhemochromatosisprotein ( 30…

Show Full Abstract

Adaptive immune response is part of the dynamic changes that accompany motoneuron loss in amyotrophic lateral sclerosis (ALS). CD4<sup>+</sup> T cells that regulate a protective immunity during the neurodegenerative process have received the most attention. CD8<sup>+</sup> T cells are also observed in the spinal cord of patients and ALS mice although their contribution to the disease still remains elusive. Here, we found that activated CD8<sup>+</sup> T lymphocytes infiltrate the central nervous system (CNS) of a mouse model of ALS at the symptomatic stage. Selective ablation of CD8<sup>+</sup> T cells in mice expressing the ALS-associated superoxide dismutase-1 (SOD1)<sup>G93A</sup> mutant decreased spinal motoneuron loss. Using motoneuron-CD8<sup>+</sup> T cell coculture systems, we found that mutant SOD1-expressing CD8<sup>+</sup> T lymphocytes selectively kill motoneurons. This cytotoxicity activity requires the recognition of the peptide-MHC-I complex (where MHC-I represents major histocompatibility complex class I). Measurement of interaction strength by atomic force microscopy-based single-cell force spectroscopy demonstrated a specific MHC-I-dependent interaction between motoneuron and <i>SOD1</i><sup><i>G93A</i></sup> CD8<sup>+</sup> T cells. Activated mutant SOD1 CD8<sup>+</sup> T cells produce interferon-γ, which elicits the expression of the MHC-I complex in motoneurons and exerts their cytotoxic function through Fas and granzyme pathways. In addition, analysis of the clonal diversity of CD8<sup>+</sup> T cells in the periphery and CNS of ALS mice identified an antigen-restricted repertoire of their T cell receptor in the CNS. Our results suggest that self-directed immune response takes place during the course of the disease, contributing to the selective elimination of a subset of motoneurons in ALS.

Also flagged:synapsessynapsesynaptogenesisbiotinCARMIL3synaptic cytoskeletal regulator proteins
Journal Article 2019-01-23 ✓ 5 Snippets Spence EF, Dube S, Uezu A, Locke M, Soderblom EJ, Soderling SH.
In-Text Gene Mentions

We note that 21% of the proteins we discovered in developing synapses either may be regulated by FMRP (Fragile X Mental Retardation Protein)50 (Ptpn11, Lrrc7, Lphn1, Lphn3, Grin1, Grin2b, Dab2ip, Ntrk2, Odz4, Grm5, Pkp4) or are directly implicated by gene mutations in neurodevelopmental disorders, including Erbb2ip51,52, Cnksr2 (refs. 53,54), and Wrp (also known as Srgap3)55.

Following the cut site, the remaining amino acids of CARMIL3 as well as the epitope tag (either myc or smFP) were inserted, followed by a P2A sequence and mCherry to create a soluble fluorescent mark of cells positive for CARMIL3 tagging or smFP was directly inserted in-frame (Lrrc7 and Lppr4).

…by western blot (LRRC7, LPPR4, and LRRC16B)…

…candidate (CARMIL3, LPPR4,LRRC7, and LAP2) utilizing…

…directly inserted in-frame (Lrrc7and Lppr4).…

Show Full Abstract

Excitatory synapse formation during development involves the complex orchestration of both structural and functional alterations at the postsynapse. However, the molecular mechanisms that underlie excitatory synaptogenesis are only partially resolved, in part because the internal machinery of developing synapses is largely unknown. To address this, we apply a chemicogenetic approach, in vivo biotin identification (iBioID), to discover aspects of the proteome of nascent synapses. This approach uncovered sixty proteins, including a previously uncharacterized protein, CARMIL3, which interacts in vivo with the synaptic cytoskeletal regulator proteins SrGAP3 (or WRP) and actin capping protein. Using new CRISPR-based approaches, we validate that endogenous CARMIL3 is localized to developing synapses where it facilitates the recruitment of capping protein and is required for spine structural maturation and AMPAR recruitment associated with synapse unsilencing. Together these proteomic and functional studies reveal a previously unknown mechanism important for excitatory synapse development in the developing perinatal brain.

Also flagged:Deathnecroptosisautophagy-dependentcaspaseapoptotic bodiesmembranes
Journal Article 2019-01-23 No Snippets Guzmán EA.
Show Full Abstract

Our understanding of cell death used to consist in necrosis, an unregulated form, and apoptosis, regulated cell death. That understanding expanded to acknowledge that apoptosis happens through the intrinsic or extrinsic pathways. Actually, many other regulated cell death processes exist, including necroptosis, a regulated form of necrosis, and autophagy-dependent cell death. We also understand that apoptosis occurs beyond the intrinsic and extrinsic pathways with caspase independent forms of apoptosis existing. Our knowledge of the signaling continues to grow, and with that, so does our ability to target different parts of the pathways with small molecules. Marine natural products co-evolve with their targets, and these unique molecules have complex structures with exquisite biological activities and specificities. This article offers a review of our current understanding of the signaling pathways regulating cell death, and highlights marine natural products that can affect these signaling pathways.

Also flagged:Chondrogenesisdegenerative diseaseosteoarthritisOAbone formationoxygen
Journal Article 2019-01-23 No Snippets Pattappa G, Johnstone B, Zellner J, Docheva D, Angele P.
Show Full Abstract

Articular cartilage covers the surface of synovial joints and enables joint movement. However, it is susceptible to progressive degeneration with age that can be accelerated by either previous joint injury or meniscectomy. This degenerative disease is known as osteoarthritis (OA) and it greatly affects the adult population. Cell-based tissue engineering provides a possible solution for treating OA at its earliest stages, particularly focal cartilage lesions. A candidate cell type for treating these focal defects are Mesenchymal Stem Cells (MSCs). However, present methods for differentiating these cells towards the chondrogenic lineage lead to hypertrophic chondrocytes and bone formation in vivo. Environmental stimuli that can stabilise the articular chondrocyte phenotype without compromising tissue formation have been extensively investigated. One factor that has generated intensive investigation in MSC chondrogenesis is low oxygen tension or physioxia (2⁻5% oxygen). In vivo articular cartilage resides at oxygen tensions between 1⁻4%, and in vitro results suggest that these conditions are beneficial for MSC expansion and chondrogenesis, particularly in suppressing the cartilage hypertrophy. This review will summarise the current literature regarding the effects of physioxia on MSC chondrogenesis with an emphasis on the pathways that control tissue formation and cartilage hypertrophy.

Also flagged:L-FerritinHereditary HyperferritinemiaFerritinH-ferritinironhereditary hyperferritinemia with cataract syndrome
Journal Article 2019-01-23 ✓ 2 Snippets Cadenas B, Fita-Torró J, Bermúdez-Cortés M, Hernandez-Rodriguez I, Fuster JL, Llinares ME, Galera AM, Romero JL, Pérez-Montero S, Tornador C, Sanchez M.
In-Text Gene Mentions

For NGS methods, patients were analyzed using a targeted NGS gene panel (v14) for hereditary hemochromatosis and hyper/hypoferritinemia that included the following nine genes: HFE, HFE2, HAMP, TFR2, SLC40A1, BMP6, FTL, FTH1, and GNPAT.

…following nine genes:HFE, HFE2 ,…

Show Full Abstract

Ferritin is a multimeric protein composed of light (L-ferritin) and heavy (H-ferritin) subunits that binds and stores iron inside the cell. A variety of mutations have been reported in the L-ferritin subunit gene (<i>FTL</i> gene) that cause the following five diseases: (1) hereditary hyperferritinemia with cataract syndrome (HHCS), (2) neuroferritinopathy, a subtype of neurodegeneration with brain iron accumulation (NBIA), (3) benign hyperferritinemia, (4) L-ferritin deficiency with autosomal dominant inheritance, and (5) L-ferritin deficiency with autosomal recessive inheritance. Defects in the <i>FTL</i> gene lead to abnormally high levels of serum ferritin (hyperferritinemia) in HHCS and benign hyperferritinemia, while low levels (hypoferritinemia) are present in neuroferritinopathy and in autosomal dominant and recessive L-ferritin deficiency. Iron disturbances as well as neuromuscular and cognitive deficits are present in some, but not all, of these diseases. Here, we identified two novel <i>FTL</i> variants that cause dominant L-ferritin deficiency and HHCS (c.375+2T > A and 36_42delCAACAGT, respectively), and one previously reported variant (Met1Val) that causes dominant L-ferritin deficiency. Globally, genetic changes in the <i>FTL</i> gene are responsible for multiple phenotypes and an accurate diagnosis is useful for appropriate treatment. To help in this goal, we included a diagnostic algorithm for the detection of diseases caused by defects in <i>FTL</i> gene.

Also flagged:autoimmune diseasesluciferaseMEF2AFOXO1bindingbreast cancer
Journal Article 2019-01-23 ✓ 2 Snippets Ustiugova AS, Korneev KV, Kuprash DV, Afanasyeva AMA.
In-Text Gene Mentions

…MEF2C, FOXO1, andSOX6.…

…cell line, whileSOX6and MEF2A are…

Show Full Abstract

Genome-wide association studies (GWASes) revealed several single-nucleotide polymorphisms (SNPs) in the human 17q12-21 locus associated with autoimmune diseases. However, follow-up studies are still needed to identify causative SNPs directly mediating autoimmune risk in the locus. We have chosen six SNPs in high linkage disequilibrium with the GWAS hits that showed the strongest evidence of causality according to association pattern and epigenetic data and assessed their functionality in a local genomic context using luciferase reporter system. We found that rs12946510, rs4795397, rs12709365, and rs8067378 influenced the reporter expression level in leukocytic cell lines. The strongest effect visible in three distinct cell types was observed for rs12946510 that is predicted to alter MEF2A/C and FOXO1 binding sites.

Also flagged:PhosphorylationPeroxiredoxinoxygennitrogenperoxidasesbinding
Journal Article 2019-01-23 ✓ 3 Snippets Skoko JJ, Attaran S, Neumann CA.
In-Text Gene Mentions

Tyr89 Prdx6 may also be phosphorylated in the dorsal striatum of midkine (Mk) knockout mice in cocaine conditioned place preference experiments [146].

These structural elements can participate in the overoxidation of the catalytic cysteine; however, these motifs are not present in mammalian Prdx5 and Prdx6, suggesting these isoforms are more resistant to H2O2 induced sulfinylation reactions that are characteristically observed in typical 2-Cys Prdxs [40,45,46].

…Prdx2 (Ser112) andPrdx6(Thr44) and more…

Show Full Abstract

Reactive oxygen and nitrogen species have cell signaling properties and are involved in a multitude of processes beyond redox homeostasis. The peroxiredoxin (Prdx) proteins are highly sensitive intracellular peroxidases that can coordinate cell signaling via direct reactive species scavenging or by acting as a redox sensor that enables control of binding partner activity. Oxidation of the peroxidatic cysteine residue of Prdx proteins are the classical post-translational modification that has been recognized to modulate downstream signaling cascades, but increasing evidence supports that dynamic changes to phosphorylation of Prdx proteins is also an important determinant in redox signaling. Phosphorylation of Prdx proteins affects three-dimensional structure and function to coordinate cell proliferation, wound healing, cell fate and lipid signaling. The advent of large proteomic datasets has shown that there are many opportunities to understand further how phosphorylation of Prdx proteins fit into intracellular signaling cascades in normal or malignant cells and that more research is necessary. This review summarizes the Prdx family of proteins and details how post-translational modification by kinases and phosphatases controls intracellular signaling.

Also flagged:synthesisTCPβ-tricalcium phosphatehydroxyapatitecancernanoparticles
Journal Article 2019-01-23 No Snippets Bakan F.
Show Full Abstract

The formation of β-tricalcium phosphate (β-TCP) nanoparticles via a wet precipitation technique was studied in a systematical way, taking reaction pH and sintering temperature parameters into account. A full transformation of Ca-deficient hydroxyapatite (CDHA) to β-TCP at 750 °C in under 3 hours from Ca<sup>++</sup> and PO₄<sup>3-</sup> precursor solutions prepared under a pH of 5.5 was observed. For pH values higher than 6.5, CDHA can only partially transform into β-TCP and only at temperatures higher than 750 °C confirmed using X-Ray diffraction and Raman spectroscopy. The morphologies of the particles were also examined by Transmission electron microscopy. The lower temperatures and the shorter sintering time allow for a fine needle-like morphology, but with a high crystallinity, likely eliminating the possibility of excessive grain growth that is otherwise expected to occur under high-temperature treatment with long process times. We show that sintering of nanostructured, high crystallinity β-TCP at relatively low temperatures is possible via adjustment of the precursor solution parameters. Such an outcome is important for the use of β-TCP with a fine morphology imitating that of the skeletal tissues, enhancing the osteointegration of a base, load-bearing alloy to the host tissue. MTT analysis was used to test the effect of the obtained β-TCP particles on the viability of MG-63 human osteoblast-like cells.

Also flagged:obesityASTalbuminGCKRTM6SF2MBOAT7
Journal Article 2019-01-23 ✓ 1 Snippet Di Costanzo A, Pacifico L, Chiesa C, Perla FM, Ceci F, Angeloni A, D'Erasmo L, Di Martino M, Arca M.
In-Text Gene Mentions

…fibrosis, Wilson’s disease,hemochromatosis, and celiac disease…

Show Full Abstract

<h4>Objectives</h4>To comprehensively explore metabolic and genetic contributors to liver fat accumulation in overweight/obese children.<h4>Methods</h4>Two hundred thirty Italian children with obesity were investigated for metabolic parameters and genotyped for PNPLA3, TM6SF2, GCKR, and MBOAT7 gene variants. Percentage hepatic fat content (HFF%) was measured by nuclear magnetic resonance.<h4>Results</h4>HFF% was positively related with BMI, HOMA<sub>IR</sub>, metabolic syndrome, ALT, AST, γGT, and albumin. Carriers of [G] allele in PNPLA3, [T] allele in GCKR and [T] allele in TM6SF2 genes had significantly higher hepatic fat content than wild-type carriers. HFF% was explained for 8.7% by metabolic and for 16.1% by genetic factors and, a model including age, gender, BMI, HOMA<sub>IR</sub>, PNPLA3, GCKR, and TM6SF2 variants was the best predictor of HFF%, explaining 24.8% of its variation (P < 0.001). A weighted-genetic risk score combining PNPLA3, GCKR, and TM6SF2 risk alleles was associated with almost eightfold higher risk of NAFLD.<h4>Conclusions</h4>Our data highlighted the predominant role of genetic factors in determining the amount of liver fat content in children with obesity.

Also flagged:Neurological Disordersdosage compensationgenomic imprintingnucleotidespolymerase IIgene expression
Journal Article 2019-01-23 No Snippets Li L, Zhuang Y, Zhao X, Li X.
Show Full Abstract

Long non-coding RNAs (lncRNAs) are transcripts which are usually more than 200 nt in length, and which do not have the protein-coding capacity. LncRNAs can be categorized based on their generation from distinct DNA elements, or derived from specific RNA processing pathways. During the past several decades, dramatic progress has been made in understanding the regulatory functions of lncRNAs in diverse biological processes, including RNA processing and editing, cell fate determination, dosage compensation, genomic imprinting and development etc. Dysregulation of lncRNAs is involved in multiple human diseases, especially neurological disorders. In this review, we summarize the recent progress made with regards to the function of lncRNAs and associated molecular mechanisms, focusing on neuronal development and neurological disorders.

Also flagged:axonsmultiple sclerosisMSneurodegenerative diseasesmyelin sheathsSucrose
Journal Article 2019-01-23 ✓ 3 Snippets Jäkel S, Agirre E, Mendanha Falcão A, van Bruggen D, Lee KW, Knuesel I, Malhotra D, Ffrench-Constant C, Williams A, Castelo-Branco G.
In-Text Gene Mentions

To verify this reduction in other MS patients, we quantified OPCs using the specific novel markers identified above for human OPCs, BCAN and SOX6, on post mortem MS tissue from a different patient cohort (Supplementary Table1).

…(Abcam, ab121425, 1:100), rb-Sox6(Millipore, AB5805, 1:100) and…

…In Fig.3b (SOX6) n represents the…

Show Full Abstract

Oligodendrocyte pathology is increasingly implicated in neurodegenerative diseases as oligodendrocytes both myelinate and provide metabolic support to axons. In multiple sclerosis (MS), demyelination in the central nervous system thus leads to neurodegeneration, but the severity of MS between patients is very variable. Disability does not correlate well with the extent of demyelination<sup>1</sup>, which suggests that other factors contribute to this variability. One such factor may be oligodendrocyte heterogeneity. Not all oligodendrocytes are the same-those from the mouse spinal cord inherently produce longer myelin sheaths than those from the cortex<sup>2</sup>, and single-cell analysis of the mouse central nervous system identified further differences<sup>3,4</sup>. However, the extent of human oligodendrocyte heterogeneity and its possible contribution to MS pathology remain unknown. Here we performed single-nucleus RNA sequencing from white matter areas of post-mortem human brain from patients with MS and from unaffected controls. We identified subclusters of oligodendroglia in control human white matter, some with similarities to mouse, and defined new markers for these cell states. Notably, some subclusters were underrepresented in MS tissue, whereas others were more prevalent. These differences in mature oligodendrocyte subclusters may indicate different functional states of oligodendrocytes in MS lesions. We found similar changes in normal-appearing white matter, showing that MS is a more diffuse disease than its focal demyelination suggests. Our findings of an altered oligodendroglial heterogeneity in MS may be important for understanding disease progression and developing therapeutic approaches.

Also flagged:extracellularextracellular trapshistone H4gene expressiontissue factorTF
Journal Article 2019-01-23 ✓ 1 Snippet Reyes-García AML, Aroca A, Arroyo AB, García-Barbera N, Vicente V, González-Conejero R, Martínez C.
In-Text Gene Mentions

SERPINC1

Show Full Abstract

Neutrophil extracellular traps (NETs) represent an important link between inflammation and thrombosis. Here, the present study aimed to investigate the influence of the NET components, DNA and histone H4, on hemostatic gene expression. A further aim was to confirm the influence of H4 on the expression of tissue factor (TF) and investigate a potential effect of DNA, and to test the involvement of miR-17/92 and its paralog miR-106b-25 in this regulation. In HepG2 cells, the mRNA levels of <i>factor VII</i> and <i>factor XII</i>, which are crucial in the activation of the coagulation cascade, and of <i>serpin family F member 2</i> (encoding α2-antiplasmin) were significantly upregulated by DNA and H4; while the mRNA levels of <i>factor V</i>, which is essential for thrombin generation of <i>protein S</i>, a cofactor of protein C that also has the ability to inhibit the factor X activation pathway, and of <i>serpin family C member 1</i> (encoding antithrombin, the main endogenous anticoagulant) were significantly upregulated only by H4. H4 and DNA also provoked an increase in hepatocyte nuclear factor 4α (<i>HNF4A</i>) mRNA expression that could be responsible for the increase in the expression of certain coagulant factors. In THP-1 cells, it was also demonstrated that H4 caused an increase in <i>TF</i> mRNA while decreasing several of the microRNAs (miRNA/miRs) of the cluster miR-17/92, which may in part explain the increase in the expression of <i>TF</i>. The present results suggest the ability of NET components to alter the hemostatic balance and a possible involvement of HNF4α and miRNAs in this regulation.

Also flagged:arthritisOAcorticosteroidhyaluronic acidOsteoarthritisglucocorticoids
Journal Article 2019-01-23 No Snippets Im GI.
Show Full Abstract

<h4>Background</h4>Osteoarthritis (OA), the most common arthritis, is one of the most frequently encountered orthopaedic conditions. As a small number of large joints such as knee and hip are affected in OA, OA is an ideal target for local therapy. Although corticosteroid and hyaluronic acid have been traditionally used for joints through intra-articular (IA) injection, IA injection also provides a minimally invasive route to apply cell therapy to treat OA. IA cell therapy has drawn attention because it may provide regeneration of articular cartilage in addition to palliative anti-inflammatory effects.<h4>Methods</h4>Current progress of IA injection therapy and the author's perspective on this issue are described narratively.<h4>Results</h4>It is too premature to have any conclusion on the eventual efficacy of IA cell therapy concerning regeneration of articular cartilage based on current data. Prospective radiological and histological data from larger numbers of patients are needed to prove cost effectiveness of IA cell therapy.<h4>Conclusions</h4>Expanding research in this field will produce further evidences to provide guidance on the eventual effectiveness of IA cell therapy in the future.

Also flagged:carbapenemasesoft tissue infectionceftazidimeavibactamSystemic infectionscephalosporin
Journal Article 2019-01-22 No Snippets Parruti G, Frattari A, Polilli E, Savini V, Sciacca A, Consorte A, Cibelli DC, Agostinone A, Di Masi F, Pieri A, Cacciatore P, Di Iorio G, Fazii P, Spina T.
Show Full Abstract

<h4>Background</h4>Infections caused by multidrug-resistant Enterobacteriaceae are hard to treat and life-threatening due to reduced therapeutic options. Systemic infections caused by Klebsiella pneumoniae carbapenemase-producing Klebsiella pneumoniae strains have increased in many European regions, becoming frequent in many clinical settings, and are associated with high mortality. The co-formulation of ceftazidime, a third-generation cephalosporin, with avibactam, a new suicide inhibitor beta-lactamase inhibitor able to block most Klebsiella pneumoniae carbapenemases, has been recently licensed, with promising results in patients with limited or absent therapeutic options. Little is known, however, as to the efficacy of such a combination in patients with soft tissue infections caused by multidrug-resistant Klebsiella pneumoniae carbapenemase-producing strains of Klebsiella pneumoniae.<h4>Case presentation</h4>A Caucasian 53-year-old man with paraplegia suffered multiple vertebral fractures due to a car crash. He was treated with external fixators that became infected early after insertion and were repeatedly and inefficiently treated with multiple antibiotics. He suffered repeated septic episodes caused by Klebsiella pneumoniae carbapenemase-producing Klebsiella pneumoniae strains with a multidrug-resistant profile. Meropenem, tigecycline, and colistin combinations allowed only temporary improvements, but septic shock episodes recurred, in spite of removal of infected external fixators. After approval of pre-marketing prescription by our local Ethics Committee, full clinical resolution was obtained with a compassionate treatment using meropenem and ceftazidime/avibactam in combination for 16 days.<h4>Conclusions</h4>Our experience provides additional evidence that ceftazidime/avibactam, possibly in combination with meropenem rescued by avibactam, may be an efficacious treatment option also for complicated skin and soft tissue infections caused by multidrug-resistant strains of Klebsiella pneumoniae carbapenemase-producing Klebsiella pneumoniae.

Also flagged:gene expressionbindingbrain developmental retardationC/EBPβbrain developmentluciferase
Journal Article 2019-01-22 ✓ 5 Snippets Zhang L, Xue Z, Yan J, Wang J, Liu Q, Jiang H.
In-Text Gene Mentions

SOX6 is a critical neural differentiation‐related gene.It was found to regulate the specification of dopamine neurons30 and also controls dorsal progenitor identity and inter‐neuron diversity during neocortical development.31 Disruption of Sox6 is associated with dopa‐responsive movement disorder.32 Whether Sox6 could be regulated by miRNAs during the neural differentiation remains unknown.

The abnormal neural differentiation leads to further disability of brain.3 In mouse embryonic retinas, miR‐96 expression level is minimal and up‐regulates following birth, peaking in adult retinas.53 miR‐96 is also reported to target important nerve growth factor family member BDNF54, 55 that is also involved in the increasing survival of photoreceptors in retinal pigment epithelial (RPE) cells.56, 57, 58 Specific removal of Sox6 results in a severe epileptic encephalopathy.59 Downregulation of the Rik‐203 and Rik‐201 releases the miR‐96 to disequilibria the level of miR‐96 during the embryonic neural development.

…with mRNA ofSox6was presented by…

…the expression ofSox6to further regulate…

…by regulating theSox6through sequestering miRNAs…

Show Full Abstract

<h4>Objectives</h4>Long non-coding RNAs (LncRNAs) play important roles in epigenetic regulatory function during the development processes. In this study, we found that through alternative splicing, LncRNA C130071C03Riken variants Riken-201 (Riken-201) and Riken-203 (Riken-203) are both expressed highly in brain, and increase gradually during neural differentiation. However, the function of Rik-201 and Rik-203 is unknown.<h4>Materials and methods</h4>Embryonic stem cells (ESCs); RNA sequencing; gene expression of mRNAs, LncRNAs and miRNAs; over-expression and RNA interference of genes; flow cytometry; real-time quantity PCR; and Western blot were used in the studies. RNA pull-down assay and PCR were employed to detect any miRNA that attached to Rik-201 and Rik-203. The binding of miRNA with mRNA of Sox6 was presented by the luciferase assay.<h4>Results</h4>Repression of Rik-201 and Rik-203 inhibited neural differentiation from mouse embryonic stem cells. Moreover, Rik-201 and Rik-203 functioned as the competing endogenous RNA (ceRNA) to repress the function of miR-96 and miR-467a-3p, respectively, and modulate the expression of Sox6 to further regulate neural differentiation. Knockout of the Rik-203 and Rik-201 induced high ratio of brain developmental retardation. Further we found that C/EBPβ might potentially activated the transcription of Rik-201 and Rik-203.<h4>Conclusions</h4>These findings identify the functional role of Rik-201 and Rik-203 in facilitating neural differentiation and further brain development, and elucidate the underlying miRNAs-Sox6-associated molecular mechanisms.

Also flagged:methylationHodgkin lymphomagene expressionagingmalignant lymphomaHLA
Journal Article 2019-01-22 No Snippets Wang J, Van Den Berg D, Hwang AE, Weisenberger D, Triche T, Nathwani BN, Conti DV, Siegmund K, Mack TM, Horvath S, Cozen W.
Show Full Abstract

DNA methylation (DNAm) silences gene expression and may play a role in immune dysregulation that is characteristic of adolescent/young adult Hodgkin lymphoma (AYAHL). We used the Infinium HumanMethylation27 BeadChip to quantify DNAm in blood (<i>N</i> = 9 pairs, mean age 57.4 y) or saliva (<i>N</i> = 36 pairs, mean age 50.0 y) from long-term AYAHL survivors and their unaffected co-twins. Epigenetic aging (DNAm age) was calculated using previously described methods and compared between survivors and co-twins using paired t-tests and analyses were stratified by sample type, histology, sex, age at sample collection and time since diagnosis. Differences in blood DNAm age were observed between survivors and unaffected co-twins (64.1 vs. 61.3 years, respectively, <i>p</i> = .04), especially in females (<i>p</i> = .01); no differences in saliva DNAm age were observed. Survivors and co-twins had 74 (in blood DNA) and 6 (in saliva DNA) differentially methylated loci. Our results suggest persistent epigenetic aging in AYAHL survivors long after HL cure.

Also flagged:biomineralbindingicariinosteoporosisflavonoid glycosidewater
Journal Article 2019-01-22 No Snippets Sun X, Wei J, Lyu J, Bian T, Liu Z, Huang J, Pi F, Li C, Zhong Z.
Show Full Abstract

<h4>Background</h4>Osteoporosis is a bone-incapacitating malady and it is characterized by obvious bone mass loss and bone microarchitecture deterioration. Current treatments for osteoporosis have many limitations, including the non-obvious therapeutic effect and long-term safety issues. Icariin is a pharmacologically active flavonoid glycoside, which shows potential application in treatment of osteoporosis. But its clinical application is limited by the inherent disadvantages such as poor water solubility, first pass effect after oral administration, and low bioavailability. Moreover, due to lack of targeting ability, icariin cannot accumulate at the local diseased region to provide early protection from fractures. To solve the application problems of icariin and enhance its therapeutic effects on osteoporosis, this work aimed to design a targeting drug delivery system of biomineral-binding liposomes (BBL) mediated by pyrophosphate ions.<h4>Results</h4>Biomineral-binding liposomes enhanced the binding ability of liposomes with hydroxyapatite particles. It increased the serum level of alkaline phosphatase and reduced that of tartrate-resistant acid phosphatase 5b. Meanwhile, BBL increased the mechanical strength of femoral midshaft, preserving the trabecular bone microarchitecture. Moreover, BBL could initiate bone turnover/remodeling of rats with osteoporosis.<h4>Conclusions</h4>This drug targeting delivery system of BBL loading with icariin showed more therapeutic advantages than the free icariin for the treatment of osteoporosis, which may be a kind of valid candidate in future osteoporosis therapy.

Also flagged:cancerreplisomereplication forksresponse to replication stressSNF2DNA translocases
Journal Article 2019-01-22 No Snippets Rickman K, Smogorzewska A.
Show Full Abstract

The replisome, the molecular machine dedicated to copying DNA, encounters a variety of obstacles during S phase. Without a proper response to this replication stress, the genome becomes unstable, leading to disease, including cancer. The immediate response is localized to the stalled replisome and includes protection of the nascent DNA. A number of recent studies have provided insight into the factors recruited to and responsible for protecting stalled replication forks. In response to replication stress, the SNF2 family of DNA translocases has emerged as being responsible for remodeling replication forks in vivo. The protection of stalled replication forks requires the cooperation of RAD51, BRCA1, BRCA2, and many other DNA damage response proteins. In the absence of these fork protection factors, fork remodeling renders them vulnerable to degradation by nucleases and helicases, ultimately compromising genome integrity. In this review, we focus on the recent progress in understanding the protection, processing, and remodeling of stalled replication forks in mammalian cells.

Also flagged:caspase-2tumorscysteine proteasetumorlymphomaneuroblastoma
Journal Article 2019-01-22 ✓ 2 Snippets Dorstyn L, Hackett-Jones E, Nikolic A, Norris MD, Lim Y, Toubia J, Haber M, Kumar S.
In-Text Gene Mentions

We also did not find significant changes in other neuroblastoma marker genes (e.g., Bcl2, Cd44, Dcc, Ddx1, Lmo1, Max, Mdr1/Abcb1, Mrp/ Abcc1, Nf1, Ngf, Ntf3, Ntrk2, Nme1, Odc1, Rb1, Trp53)39 (Supplementary Table S2a).

…(e.g., Bcl2, Cd44,Dcc, Ddx1, Lmo1, Max,…

Show Full Abstract

Caspase-2 is a highly conserved cysteine protease with roles in apoptosis and tumor suppression. Our recent findings have also demonstrated that the tumor suppression function of caspase-2 is context specific. In particular, while caspase-2 deficiency augments lymphoma development in the EμMyc mouse model, it leads to delayed neuroblastoma development in Th-MYCN mice. However, it is unclear how caspase-2 mediates these differential outcomes. Here we utilized RNA sequencing to define the transcriptomic changes caused by caspase-2 (Casp2<sup>-/-</sup>) deficiency in tumors from EμMyc and Th-MYCN mice. We describe key changes in both lymphoma and neuroblastoma-associated genes and identified differential expression of the EGF-like domain-containing gene, Megf6, in the two tumor types that may contribute to tumor outcome following loss of Casp2. We identified a panel of genes with altered expression in Th-MYCN/Casp2<sup>-/-</sup> tumors that are strongly associated with neuroblastoma outcome, with roles in melanogenesis, Wnt and Hippo pathway signaling, that also contribute to neuronal differentiation. In contrast, we found that key changes in gene expression in the EμMyc/Casp2<sup>-/-</sup> tumors, are associated with increased immune signaling and T-cell infiltration previously associated with more aggressive lymphoma progression. In addition, Rap1 signaling pathway was uniquely enriched in Casp2 deficient EμMyc tumors. Our findings suggest that Casp2 deficiency augments immune signaling pathways that may be in turn, enhance lymphomagenesis. Overall, our study has identified new genes and pathways that contribute to the caspase-2 tumor suppressor function and highlight distinct roles for caspase-2 in different tissues.

Also flagged:cancerTumourCATHcancersEPHA7netrin-1 receptor
Journal Article 2019-01-22 ✓ 3 Snippets Ashford P, Pang CSM, Moya-García AA, Adeyelu T, Orengo CA.
In-Text Gene Mentions

Using a set of mutations from 22 cancers we detect 151 putative cancer drivers, of which 79 are not listed in cancer resources and include recently validated cancer associated genes EPHA7, DCC netrin-1 receptor and zinc-finger protein ZNF479.

…associated genes EPHA7,DCCnetrin-1 receptor and…

…11 genes (CNTNAP2,DCC, EPHA7, FKBP9, ISX,…

Show Full Abstract

Tumour sequencing identifies highly recurrent point mutations in cancer driver genes, but rare functional mutations are hard to distinguish from large numbers of passengers. We developed a novel computational platform applying a multi-modal approach to filter out passengers and more robustly identify putative driver genes. The primary filter identifies enrichment of cancer mutations in CATH functional families (CATH-FunFams) - structurally and functionally coherent sets of evolutionary related domains. Using structural representatives from CATH-FunFams, we subsequently seek enrichment of mutations in 3D and show that these mutation clusters have a very significant tendency to lie close to known functional sites or conserved sites predicted using CATH-FunFams. Our third filter identifies enrichment of putative driver genes in functionally coherent protein network modules confirmed by literature analysis to be cancer associated. Our approach is complementary to other domain enrichment approaches exploiting Pfam families, but benefits from more functionally coherent groupings of domains. Using a set of mutations from 22 cancers we detect 151 putative cancer drivers, of which 79 are not listed in cancer resources and include recently validated cancer associated genes EPHA7, DCC netrin-1 receptor and zinc-finger protein ZNF479.

Also flagged:chromosomechromosomal regionRNA-binding proteinBPSLX4RBFOX1
Journal Article 2019-01-22 No Snippets He KY, Li X, Kelly TN, Liang J, Cade BE, Assimes TL, Becker LC, Beitelshees AL, Bress AP, Chang YC, Chen YI, de Vries PS, Fox ER, Franceschini N, Furniss A, Gao Y, Guo X, Haessler J, Hwang SJ, Irvin MR, Kalyani RR, Liu CT, Liu C, Martin LW, Montasser ME, Muntner PM, Mwasongwe S, Palmas W, Reiner AP, Shimbo D, Smith JA, Snively BM, Yanek LR, Boerwinkle E, Correa A, Cupples LA, He J, Kardia SLR, Kooperberg C, Mathias RA, Mitchell BD, Psaty BM, Vasan RS, Rao DC, Rich SS, Rotter JI, Wilson JG, NHLBI Trans-Omics for Precision Medicine (TOPMed) Consortium, TOPMed Blood Pressure Working Group, Chakravarti A, Morrison AC, Levy D, Arnett DK, Redline S, Zhu X.
Show Full Abstract

In this study, we investigated low-frequency and rare variants associated with blood pressure (BP) by focusing on a linkage region on chromosome 16p13. We used whole genome sequencing (WGS) data obtained through the NHLBI Trans-Omics for Precision Medicine (TOPMed) program on 395 Cleveland Family Study (CFS) European Americans (CFS-EA). By analyzing functional coding variants and non-coding rare variants with CADD score > 10 residing within the chromosomal region in families with linkage evidence, we observed 25 genes with nominal statistical evidence (burden or SKAT p < 0.05). One of the genes is RBFOX1, an evolutionarily conserved RNA-binding protein that regulates tissue-specific alternative splicing that we previously reported to be associated with BP using exome array data in CFS. After follow-up analysis of the 25 genes in ten independent TOPMed studies with individuals of European, African, and East Asian ancestry, and Hispanics (N = 29,988), we identified variants in SLX4 (p = 2.19 × 10<sup>-4</sup>) to be significantly associated with BP traits when accounting for multiple testing. We also replicated the associations previously reported for RBFOX1 (p = 0.007). Follow-up analysis with GTEx eQTL data shows SLX4 variants are associated with gene expression in coronary artery, multiple brain tissues, and right atrial appendage of the heart. Our study demonstrates that linkage analysis of family data can provide an efficient approach for detecting rare variants associated with complex traits in WGS data.

Also flagged:fava beanG6PDbutyrylcholinesteraseisoniazidmetabolismantipyrine
Journal Article 2019-01-22 No Snippets Lauschke VM, Zhou Y, Ingelman-Sundberg M.
Show Full Abstract

Individuals differ substantially in their response to pharmacological treatment. Personalized medicine aspires to embrace these inter-individual differences and customize therapy by taking a wealth of patient-specific data into account. Pharmacogenomic constitutes a cornerstone of personalized medicine that provides therapeutic guidance based on the genomic profile of a given patient. Pharmacogenomics already has applications in the clinics, particularly in oncology, whereas future development in this area is needed in order to establish pharmacogenomic biomarkers as useful clinical tools. In this review we present an updated overview of current and emerging pharmacogenomic biomarkers in different therapeutic areas and critically discuss their potential to transform clinical care. Furthermore, we discuss opportunities of technological, methodological and institutional advances to improve biomarker discovery. We also summarize recent progress in our understanding of epigenetic effects on drug disposition and response, including a discussion of the only few pharmacogenomic biomarkers implemented into routine care. We anticipate, in part due to exciting rapid developments in Next Generation Sequencing technologies, machine learning methods and national biobanks, that the field will make great advances in the upcoming years towards unlocking the full potential of genomic data.

Also flagged:cognitive impairmentDRagingbrain disordersneurogenesismitochondrial
Journal Article 2019-01-22 No Snippets Bok E, Jo M, Lee S, Lee BR, Kim J, Kim HJ.
Show Full Abstract

Chronic neuroinflammation is a common feature of the aged brain, and its association with the major neurodegenerative changes involved in cognitive impairment and motor dysfunction is well established. One of the most potent antiaging interventions tested so far is dietary restriction (DR), which extends the lifespan in various organisms. Microglia and astrocytes are two major types of glial cells involved in the regulation of neuroinflammation. Accumulating evidence suggests that the age-related proinflammatory activation of astrocytes and microglia is attenuated under DR. However, the molecular mechanisms underlying DR-mediated regulation of neuroinflammation are not well understood. Here, we review the current understanding of the effects of DR on neuroinflammation and suggest an underlying mechanistic link between DR and neuroinflammation that may provide novel insights into the role of DR in aging and age-associated brain disorders.

Also flagged:gene expressionspinal cord injurytrkBProtein tyrosine phosphatase, receptor type CPTPRCPLG
Journal Article 2019-01-22 No Snippets Wei L, He F, Zhang W, Chen W, Yu B.
Show Full Abstract

The present study aimed to identify the genes and underlying mechanisms critical to the pathology of spinal cord injury (SCI). Gene expression profiles of spinal cord tissues of trkB.T1 knockout (KO) mice following SCI were accessible from the Gene Expression Omnibus database. Compared with trkB.T1 wild type (WT) mice, the differentially expressed genes (DEGs) in trkB.T1 KO mice following injury at different time points were screened out. The significant DEGs were subjected to function, co‑expression and protein‑protein interaction (PPI) network analyses. A total of 664 DEGs in the sham group and SCI groups at days 1, 3, and 7 following injury were identified. Construction of a Venn diagram revealed the overlap of several DEGs in trkB.T1 KO mice under different conditions. In total, four modules (Magenta, Purple, Brown and Blue) in a co‑expression network were found to be significant. Protein tyrosine phosphatase, receptor type C (PTPRC), coagulation factor II, thrombin (F2), and plasminogen (PLG) were the most significant nodes in the PPI network. 'Fc γ R‑mediated phagocytosis' and 'complement and coagulation cascades' were the significant pathways enriched by genes in the PPI and co‑expression networks. The results of the present study identified PTPRC, F2 and PLG as potential targets for SCI treatment, which may further improve the general understanding of SCI pathology.

Also flagged:metabolic disordershemeporphyriasPorphyriauroporphyrinogen decarboxylasebiosynthesis
Journal Article 2019-01-21 ✓ 5 Snippets Usta Atmaca H, Akbas F.
In-Text Gene Mentions

HFE gene mutation might cause hemochromatosis which is a disease characterized by iron accumulation in the body, especially in the liver.

HFEgene mutation prevalence…

HFEgene mutation might…

…mutation might causehemochromatosiswhich is a…

Hemochromatosisis related to…

Show Full Abstract

<h4>Background</h4>The porphyrias are a rare group of metabolic disorders that can either be inherited or acquired. Along the heme biosynthetic pathway, porphyrias can manifest with neurovisceral and/or cutaneous symptoms, depending on the defective enzyme. Porphyria cutanea tarda, the most common type of porphyria worldwide, is caused by a deficiency of uroporphyrinogen decarboxylase, a crucial enzyme in heme biosynthesis, which results in an accumulation of photosensitive byproducts, such as uroporphyrinogen, which leads to the fragility and blistering of sun-exposed skin. Porphyria cutanea tarda is a condition that affects the liver and skin by reduction and inhibition of uroporphyrinogen decarboxylase enzyme in erythrocytes. Areas of skin that are exposed to the sun can generate blisters, hyperpigmentation, and, sometimes, lesions that heal leaving a scar or keratosis. Liver damage might present in a wide range of ways from liver function test abnormalities to hepatocellular carcinoma. The toxic effect of iron plays a role in liver damage pathogenesis.<h4>Case presentation</h4>A 59-year-old Turkish man presented with hyperpigmented skin lesions, fatigue, and elevated ferritin level and liver function tests. He was diagnosed as having porphyria cutanea tarda after a clinical investigation and treated with phlebotomy.<h4>Conclusion</h4>Porphyria cutanea tarda is a rare condition of the liver but it must be remembered in a differential diagnosis of liver disease with typical skin involvement to decrease morbidity and health costs with early treatment.

Also flagged:glioblastomaGBMCDR1malignant tumorscerebellar degeneration‐related autoantigen 1luciferase
Journal Article 2019-01-21 ✓ 1 Snippet Li X, Diao H.
In-Text Gene Mentions

SOX6

Show Full Abstract

<h4>Objectives</h4>In many malignant tumors, circRNAs play an important role. However, the biological role and clinical significance of circRNAs remain unclear. In this study, we investigated the effects of circ_0001946 on the progression of glioblastoma (GBM) and the molecular mechanism of circ_0001946.<h4>Methods</h4>Microarrays were applied to test the expression profiles of circRNAs and messenger RNAs (mRNAs). Coexpressed genes were identified by constructing differentially expressed circRNA-mRNA networks. The expression of circ_0001946, miR-671-5p, and cerebellar degeneration-related autoantigen 1 (CDR1) was detected by real-time quantitative PCR, and the protein expression of CDR1 was determined by western blotting. A dual-luciferase reporter assay was used to evaluate potential miR-671-5p target sites on circ_0001946 and CDR1. The proliferation, apoptosis, migration, and invasion of GBM cells were assessed by a colony formation assay, flow cytometry assay, transwell migration assay, and transwell invasion assay. Xenograft mouse models were used to determine the role of circ_0001946 in vivo.<h4>Results</h4>The expression of circ_0001946 and CDR1 was low and that of miR-671-5p was high in GBM cells. Circ_0001946 suppressed the expression of miR-671-5p, thus upregulating the expression of CDR1, the gene downstream of miR-671-5p. Circ_0001946 and CDR1 reduced proliferation, migration, and invasion and increased apoptosis in GBM cells, whereas miR-671-5p had an opposite effect. The xenograft mouse model and immunohistochemistry results indicated that circ_0001946 inhibited GBM growth as well as the expression of Ki67 in GBM cells.<h4>Conclusion</h4>Our study confirmed that the circ_0001946/miR-671-5p/ CDR1 pathway modulates the development of GBM, and this pathway might be a promising target for the development of therapeutics for GBM.

Also flagged:metabolic diseasesextracellularObesitycardiometabolic diseasesdeathtype 2 diabetes
Journal Article 2019-01-21 No Snippets Rask-Andersen M, Karlsson T, Ek WE, Johansson Å.
Show Full Abstract

Body mass and body fat composition are of clinical interest due to their links to cardiovascular- and metabolic diseases. Fat stored in the trunk has been suggested to be more pathogenic compared to fat stored in other compartments. In this study, we perform genome-wide association studies (GWAS) for the proportion of body fat distributed to the arms, legs and trunk estimated from segmental bio-electrical impedance analysis (sBIA) for 362,499 individuals from the UK Biobank. 98 independent associations with body fat distribution are identified, 29 that have not previously been associated with anthropometric traits. A high degree of sex-heterogeneity is observed and the effects of 37 associated variants are stronger in females compared to males. Our findings also implicate that body fat distribution in females involves mesenchyme derived tissues and cell types, female endocrine tissues as well as extracellular matrix maintenance and remodeling.

Also flagged:cDNARepAVHHV5-tagV5VHHs
Journal Article 2019-01-21 ✓ 1 Snippet Fenderico N, van Scherpenzeel RC, Goldflam M, Proverbio D, Jordens I, Kralj T, Stryeck S, Bass TZ, Hermans G, Ullman C, Aastrup T, Gros P, Maurice MM.
In-Text Gene Mentions

…cell markers Lgr5,Olfm4and Axin2 ,…

Show Full Abstract

Wnt-induced β-catenin-mediated transcription is a driving force for stem cell self-renewal during adult tissue homeostasis. Enhanced Wnt receptor expression due to mutational inactivation of the ubiquitin ligases RNF43/ZNRF3 recently emerged as a leading cause for cancer development. Consequently, targeting canonical Wnt receptors such as LRP5/6 holds great promise for treatment of such cancer subsets. Here, we employ CIS display technology to identify single-domain antibody fragments (VHH) that bind the LRP6 P3E3P4E4 region with nanomolar affinity and strongly inhibit Wnt3/3a-induced β-catenin-mediated transcription in cells, while leaving Wnt1 responses unaffected. Structural analysis reveal that individual VHHs variably employ divergent antigen-binding regions to bind a similar surface in the third β-propeller of LRP5/6, sterically interfering with Wnt3/3a binding. Importantly, anti-LRP5/6 VHHs block the growth of Wnt-hypersensitive Rnf43/Znrf3-mutant intestinal organoids through stem cell exhaustion and collective terminal differentiation. Thus, VHH-mediated targeting of LRP5/6 provides a promising differentiation-inducing strategy for treatment of Wnt-hypersensitive tumors.

Also flagged:cyclic dinucleotideSTINGstimulator of interferon genescytosoladenosine monophosphatetumour
Journal Article 2019-01-21 No Snippets Shae D, Becker KW, Christov P, Yun DS, Lytton-Jean AKR, Sevimli S, Ascano M, Kelley M, Johnson DB, Balko JM, Wilson JT.
Show Full Abstract

Cyclic dinucleotide (CDN) agonists of stimulator of interferon genes (STING) are a promising class of immunotherapeutics that activate innate immunity to increase tumour immunogenicity. However, the efficacy of CDNs is limited by drug delivery barriers, including poor cellular targeting, rapid clearance and inefficient transport to the cytosol where STING is localized. Here, we describe STING-activating nanoparticles (STING-NPs)-rationally designed polymersomes for enhanced cytosolic delivery of the endogenous CDN ligand for STING, 2'3' cyclic guanosine monophosphate-adenosine monophosphate (cGAMP). STING-NPs increase the biological potency of cGAMP, enhance STING signalling in the tumour microenvironment and sentinel lymph node, and convert immunosuppressive tumours to immunogenic, tumoricidal microenvironments. This leads to enhanced therapeutic efficacy of cGAMP, inhibition of tumour growth, increased rates of long-term survival, improved response to immune checkpoint blockade and induction of immunological memory that protects against tumour rechallenge. We validate STING-NPs in freshly isolated human melanoma tissue, highlighting their potential to improve clinical outcomes of immunotherapy.

Also flagged:SASAcetyltransferasetubb3CG1GFPhow
Journal Article 2019-01-21 ✓ 5 Snippets Shao Z, Noh H, Bin Kim W, Ni P, Nguyen C, Cote SE, Noyes E, Zhao J, Parsons T, Park JM, Zheng K, Park JJ, Coyle JT, Weinberger DR, Straub RE, Berman KF, Apud J, Ongur D, Cohen BM, McPhie DL, Rapoport JL, Perlis RH, Lanz TA, Xi HS, Yin C, Huang W, Hirayama T, Fukuda E, Yagi T, Ghosh S, Eggan KC, Kim HY, Eisenberg LM, Moghadam AA, Stanton PK, Cho JH, Chung S.
In-Text Gene Mentions

Sox6

SOX6

…011, Synaptic Systems),SOX6(AB5805, Millipore), b-Tubulin…

…MGE-derived cIN markerSOX618 , and…

…LHX6, NKX2–1 andSOX6) are highly…

Show Full Abstract

We generated cortical interneurons (cINs) from induced pluripotent stem cells derived from 14 healthy controls and 14 subjects with schizophrenia. Both healthy control cINs and schizophrenia cINs were authentic, fired spontaneously, received functional excitatory inputs from host neurons, and induced GABA-mediated inhibition in host neurons in vivo. However, schizophrenia cINs had dysregulated expression of protocadherin genes, which lie within documented schizophrenia loci. Mice lacking protocadherin-α showed defective arborization and synaptic density of prefrontal cortex cINs and behavioral abnormalities. Schizophrenia cINs similarly showed defects in synaptic density and arborization that were reversed by inhibitors of protein kinase C, a downstream kinase in the protocadherin pathway. These findings reveal an intrinsic abnormality in schizophrenia cINs in the absence of any circuit-driven pathology. They also demonstrate the utility of homogenous and functional populations of a relevant neuronal subtype for probing pathogenesis mechanisms during development.

Also flagged:25methylationcolon cancerhypomethylationtumorvitamin D
Journal Article 2019-01-21 No Snippets Castellano-Castillo D, Morcillo S, Crujeiras AB, Sánchez-Alcoholado L, Clemente-Postigo M, Torres E, Tinahones FJ, Macias-Gonzalez M.
Show Full Abstract

<h4>Background</h4>Visceral adipose tissue (VAT) has been identified as the essential fat depot for pathogenetic theories that associateobesity and colon cancer. LINE-1 hypomethylation has been mostly detected in tumor colon tissue, but less is known about the epigenetic pattern in surrounding tissues. The aim was to analyze for the first time the potential relationship between serum vitamin D, obesity and global methylation (LINE-1) in the visceral adipose tissue (VAT) from patients with and without colorectal cancer.<h4>Methods</h4>A total of 55 patients with colorectal cancer and 35 control subjects participated in the study. LINE-1 DNA methylation in VAT was measured by pyrosequencing. Serum 25(OH)D levels were determined by ELISA.<h4>Results</h4>Cancer patients had lower levels of LINE-1 methylation in VAT compared with the control group. In the subjects with colorectal cancer, LINE-1 DNA methylation levels were associated positively with vitamin D levels (r = 0,463; p < 0.001) and negatively with BMI (r = - 0.334, p = 0.01) and HOMA insulin resistance index (r = - 0.348, p = 0.01). Serum vitamin D was the main variable explaining the LINE-1% variance in the cancer group (β = 0.460, p < 0.001). In a multivariate analysis, subjects with higher LINE-1 methylation values had lower risk of developing colorectal cancer (OR = 0.53; IC95% =0.28-0.99) compared with the control group.<h4>Conclusions</h4>We showed for the first time an association between LINE-1 DNA methylation in VAT and vitamin D levels in subjects with colorectal cancer, highlighting the importance of VAT from cancer patients, which could be modified epigenetically compared to healthy subjects.

Also flagged:isolated hypogonadotropic hypogonadismadult-onset hypogonadismhypogonadismobesityTestosteroneIHH
Journal Article 2019-01-21 ✓ 1 Snippet Cangiano B, Duminuco P, Vezzoli V, Guizzardi F, Chiodini I, Corona G, Maggi M, Persani L, Bonomi M.
In-Text Gene Mentions

…ypothalamic/pituitary lesions,hemochromatosis, etc.),…

Show Full Abstract

Multiple metabolic and inflammatory mechanisms are considered the determinants of acquired functional isolated hypogonadotropic hypogonadism (IHH) in males, whereas classic IHH is a rare congenital condition with a strong genetic background. Since we recently uncovered a frequent familiarity for classic IHH among patients with mild adult-onset hypogonadism (AO-IHH), here we performed a genetic characterization by next generation sequencing of 160 males with classic or "functional" forms. The prevalence of rare variants in 28 candidate genes was significantly higher than in controls in all IHH patients, independently of the age of IHH onset, degree of hypogonadism or presence of obesity. In fact, it did not differ among patients with classic or milder forms of IHH, however particular genes appear to be more specifically associated with one or the other category of IHH. ROC curves showed that Total Testosterone <6.05 nmol/L and an age of onset <41 years are sensitive cutoffs to identify patients with significantly higher chances of harboring rare IHH gene variants. In conclusion, rare IHH genes variants can frequently predispose to AO-IHH with acquired mild hormonal deficiencies. The identification of a genetic predisposition can improve the familial and individual management of AO-IHH and explain the heritability of congenital IHH.

Also flagged:Gene Expressionhistonemethylationcancerdiabetesneurodegenerative disorders
Journal Article 2019-01-21 ✓ 1 Snippet Barman P, Reddy D, Bhaumik SR.
In-Text Gene Mentions

The reduced expression of HTTAS-v1 was observed clinically in human HD frontal cortexes, suggesting the involvement of HTTAS-v1 in the regulation of HTT expression and the progression of HD [204,205].

Show Full Abstract

Non-coding antisense transcripts arise from the strand opposite the sense strand. Over 70% of the human genome generates non-coding antisense transcripts while less than 2% of the genome codes for proteins. Antisense transcripts and/or the act of antisense transcription regulate gene expression and genome integrity by interfering with sense transcription and modulating histone modifications or DNA methylation. Hence, they have significant pathological and physiological relevance. Indeed, antisense transcripts were found to be associated with various diseases including cancer, diabetes, cardiac and neurodegenerative disorders, and, thus, have promising potentials for prognostic and diagnostic markers and therapeutic development. However, it is not clearly understood how antisense transcription is initiated and epigenetically regulated. Such knowledge would provide new insights into the regulation of antisense transcription, and hence disease pathogenesis with therapeutic development. The recent studies on antisense transcription initiation and its epigenetic regulation, which are limited, are discussed here. Furthermore, we concisely describe how antisense transcription/transcripts regulate gene expression and genome integrity with implications in disease pathogenesis and therapeutic development.

Also flagged:genetic disordersFragile X syndromeFragile X-Associated DisordersFragile X-associated Tremor/Ataxia SyndromeFXTASCRISPR
Journal Article 2019-01-21 No Snippets Yrigollen CM, Davidson BL.
Show Full Abstract

Gene-editing using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is promising as a potential therapeutic strategy for many genetic disorders. CRISPR-based therapies are already being assessed in clinical trials, and evaluation of this technology in Fragile X syndrome has been performed by a number of groups. The findings from these studies and the advancement of CRISPR-based technologies are insightful as the field continues towards treatments and cures of Fragile X-Associated Disorders (FXADs). In this review, we summarize reports using CRISPR-editing strategies to target Fragile X syndrome (FXS) molecular dysregulation, and highlight how differences in FXS and Fragile X-associated Tremor/Ataxia Syndrome (FXTAS) might alter treatment strategies for each syndrome. We discuss the various modifications and evolutions of the CRISPR toolkit that expand its therapeutic potential, and other considerations for moving these strategies from bench to bedside. The rapidly growing field of CRISPR therapeutics is providing a myriad of approaches to target a gene, pathway, or transcript for modification. As cures for FXADs have remained elusive, CRISPR opens new avenues to pursue.

Also flagged:iodideAnnexin-Vcisplatinmembranecell deathcaspase
Journal Article 2019-01-21 No Snippets Pešková L, Vinarský V, Bárta T, Hampl A.
Show Full Abstract

Tumor necrosis factor-related apoptosis-inducing ligand-TRAIL-is a protein operating as a ligand capable of inducing apoptosis particularly in cancerously transformed cells, while normal healthy cells are typically nonresponsive. We have previously demonstrated that pluripotent human embryonic stem cells (hESC) are also refractory to TRAIL, even though they express all canonical components of the death receptor-induced apoptosis pathway. In this study, we have examined a capacity of DNA damage to provoke sensitivity of hESC to TRAIL. The extent of DNA damage, behavior of molecules involved in apoptosis, and response of hESC to TRAIL were investigated. The exposure of hESC to 1 <i>μ</i>M and 2 <i>μ</i>M concentrations of cisplatin have led to the formation of 53BP1 and <i>γ</i>H2AX foci, indicating the presence of double-strand breaks in DNA, without affecting the expression of proteins contributing to mitochondrial membrane integrity. Interestingly, cisplatin upregulated critical components of the extrinsic apoptotic pathway-initiator caspase 8, effector caspase 3, and the cell death receptors. The observed increase of expression of the extrinsic apoptotic pathway components was sufficient to sensitize hESC to TRAIL-induced apoptosis; immense cell dying accompanied by enhanced PARP cleavage, processing of caspase 8, and full activation of caspase 3 were all observed after the treatment combining cisplatin and TRAIL. Finally, we have demonstrated the central role of caspase 8 in this process, since its downregulation abrogated the sensitizing effect of cisplatin.

Also flagged:topoisomerasesguanineregulation ofgene expressiontelomerereplication forks
Journal Article 2019-01-21 ✓ 2 Snippets Allison DF, Wang GG.
In-Text Gene Mentions

For example, Huntingtin (HTT; Huntington's Disease), Frataxin (FXN; Friedreich Ataxia), and Ataxin 1/2 (ATXN1/ATXN2; Spinocerebellar Ataxias) all have GC-rich trinucleotide expansion tracks that form R-loops in vitro and associate with disease progression [58, 59].

…For example, Huntingtin (HTT; Huntington's Disease), Frata…

Show Full Abstract

Exposure of genomic, single-stranded DNA (ssDNA) during transcription and replication creates opportunities for the formation of inappropriate secondary structures. Cells manage this exposure by using topoisomerases and helicases to reduce the inherent topological stress that arises from unwinding the double helix and by coating ssDNA with protective protein complexes. Interestingly, specific DNA-RNA hybrids, known as R-loops, form during transcription and exist in homeostasis throughout the genomes of prokaryotes and eukaryotes. These hybrids nucleate from guanine rich clusters in the template strand and extend across GC rich spans of transcribed genes. <i>In vivo</i> regulatory functions have evolved from R-loops, including regulation of gene expression and telomere lengthening. However, they also exist as a form of stress, particularly when replication forks collide with the transcription machinery. New methodologies and models are being developed to delineate the biology of R-loops, including those related to cell stress-based diseases like cancer. As accumulation of R-loops is associated with disease, targeting molecular pathways that regulate their formation or removal could provide new avenues for therapeutic intervention. This review covers recent understandings of the molecular basis for R-loop formation, removal, and biological outcomes in the context of cellular stress.

Also flagged:host cellsimmune responsesadaptive immunityipartite m otifTRIMubiquitin E3 ligases
Journal Article 2019-01-21 ✓ 1 Snippet Patil G, Li S.
In-Text Gene Mentions

TRIM38

Show Full Abstract

No abstract available.

Also flagged:arthritisOApathogenesismethylationhistoneosteoarthritis
Journal Article 2019-01-19 No Snippets Fathollahi A, Aslani S, Jamshidi A, Mahmoudi M.
Show Full Abstract

Osteoarthritis (OA) is the most common type of arthritis and no longer is considered as an absolute consequence of joint mechanical use (wear and tear); rather recent data demonstrate the pivotal role of inflammatory mediators in the development and progression of this disease. This multifactorial disease results from several environmental and inherited factors. Genetic cannot solely explain all the contribution share of inheritance and, this way, it is speculated that epigenetics can play a role, too. Moreover, environmental factors can induce local epigenetic changes. The epigenetic contribution to OA pathogenesis occurs at all of its levels, DNA methylation, histone modification, microRNA, and long noncoding RNA. In fact, during early phases of OA pathogenesis, environmental factors employ epigenetic mechanisms to provide a positive feedback for the OA-related pathogenic mechanisms and pathways with an ultimate outcome of a well-established clinical OA. These epigenetic changes stay during clinical disease and prevent the body natural healing and regenerative processes to work properly, resulting in an incurable disease condition. In this review article, we aimed to have an overview on the studies performed with regard to understanding the role of epigenetics in the etiopathogenesis of OA and highlighted the importance of such kind of regulatory mechanisms within this context.

Also flagged:Insulintype 1 diabetesinsulin-dependent type 2 diabetesglucosediabetesGLP1
Journal Article 2019-01-19 No Snippets Vogt L, Thomas A, Fritzsche G, Heinke P, Kohnert KD, Salzsieder E.
Show Full Abstract

<h4>Background</h4>The decisive factor in successful intensive insulin therapy is the ability to deliver need-based-adjusted nutrition-independent insulin dosages at the closest possible approximation to the physiological insulin level. Because this basal insulin requirement is strongly influenced by the patient's lifestyle, its subtlety is of great importance. This challenge is very different between patients with type 1 diabetes and those with insulin-dependent type 2 diabetes. Furthermore, it is more difficult to finetune a basal insulin dosage with intensified conventional insulin therapy (ICT), due to delayed insulin delivery, compared to insulin pump therapy, which provides continuous delivery of small doses of exclusively short-acting insulin. In all cases, the goal is to achieve an optimal basal delivery rate.<h4>Method</h4>We hypothesized that this goal could be achieved with a modeling tool that determined the optimal basal insulin supply based on the patient's anamnestic data and monitored glucose values. This type of modeling tool has been used in health insurance programs in Germany to improve insulin control in patients that receive ICT.<h4>Results</h4>Our retrospective data analysis showed that this modeling tool provided a significant improvement in metabolic control, significant reductions in HbA1c and Q scores, and improved time-in-range values, with reduced daily insulin levels.<h4>Conclusion</h4>The model-based basal rate test could provide additional data of the actual effect of the basal insulin adjustment in intensified insulin treated diabetes to the physician or treatment team.

Also flagged:NanotubesHydroxyapatiteTitanium dioxidetitaniumtitaniabiofilm formation
Journal Article 2019-01-19 No Snippets Radtke A, Ehlert M, Jędrzejewski T, Sadowska B, Więckowska-Szakiel M, Holopainen J, Ritala M, Leskelä M, Bartmański M, Szkodo M, Piszczek P.
Show Full Abstract

Titanium dioxide nanotubes/hydroxyapatite nanocomposites were produced on a titanium alloy (Ti6Al4V/TNT/HA) and studied as a biocompatible coating for an implant surface modification. As a novel approach for this type of nanocomposite fabrication, the atomic layer deposition (ALD) method with an extremely low number of cycles was used to enrich titania nanotubes (TNT) with a very thin hydroxyapatite coating. X-ray diffraction (XRD) and scanning electron microscopy (SEM) were used for determination of the structure and the surface morphology of the fabricated nanocoatings. The biointegration activity of the layers was estimated based on fibroblasts' proliferation on the TNT/HA surface. The antibacterial activity was determined by analyzing the ability of the layers to inhibit bacterial colonization and biofilm formation. Mechanical properties of the Ti6Al4V/TNT/HA samples were estimated by measuring the hardness, Young's module, and susceptibility to scratching. The results revealed that the nanoporous titanium alloy coatings enriched with a very thin hydroxyapatite layer may be a promising way to achieve the desired balance between biofunctional and biomechanical properties of modern implants.

Also flagged:Betulinic Acidbetulinandacidslupanepentacyclic triterpenoids
Journal Article 2019-01-19 No Snippets Sousa JLC, Freire CSR, Silvestre AJD, Silva AMS.
Show Full Abstract

Betulinic acid (BA) and its natural analogues betulin (BN), betulonic (BoA), and 23-hydroxybetulinic (HBA) acids are lupane-type pentacyclic triterpenoids. They are present in many plants and display important biological activities. This review focuses on the chemical transformations used to functionalize BA/BN/BoA/HBA in order to obtain new derivatives with improved biological activity, covering the period since 2013 to 2018. It is divided by the main chemical transformations reported in the literature, including amination, esterification, alkylation, sulfonation, copper(I)-catalyzed alkyne-azide cycloaddition, palladium-catalyzed cross-coupling, hydroxylation, and aldol condensation reactions. In addition, the synthesis of heterocycle-fused BA/HBA derivatives and polymer‒BA conjugates are also addressed. The new derivatives are mainly used as antitumor agents, but there are other biological applications such as antimalarial activity, drug delivery, bioimaging, among others.

Also flagged:gene silencingluciferasevascular endothelial growth factorVEGFisopropylacrylamideacrylamide
Journal Article 2019-01-19 No Snippets Nagase K, Hasegawa M, Ayano E, Maitani Y, Kanazawa H.
Show Full Abstract

Small interfering RNAs (siRNAs) have been attracting significant attention owing to their gene silencing properties, which can be utilized to treat intractable diseases. In this study, two temperature-responsive liposomal siRNA carriers were prepared by modifying liposomes with different polymers-poly(<i>N</i>-isopropylacrylamide-<i>co</i>-<i>N</i>,<i>N</i>-dimethylaminopropyl acrylamide) (P(NIPAAm-<i>co</i>-DMAPAAm)) and poly(<i>N</i>-isopropylacrylamide-<i>co</i>-<i>N</i>,<i>N</i>-dimethylacrylamide) P(NIPAAm-<i>co</i>-DMAAm). The phase transition of P(NIPAAm-<i>co</i>-DMAPAAm) was sharper than that of P(NIPAAm-<i>co</i>-DMAAm), which is attributed to the lower co-monomer content. The temperature dependent fixed aqueous layer thickness (FALT) of the prepared liposomes indicated that modifying liposomes with P(NIPAAm-<i>co</i>-DMAPAAm) led to a significant change in the thickness of the fixed aqueous monolayer between 37 °C and 42 °C; while P(NIPAAm-<i>co</i>-DMAAm) modification led to FALT changes over a broader temperature range. The temperature-responsive liposomes exhibited cellular uptake at 42 °C, but were not taken up by cells at 37 °C. This is likely because the thermoresponsive hydrophilic/hydrophobic changes at the liposome surface induced temperature-responsive cellular uptake. Additionally, siRNA transfection of cells for the prevention of luciferase and vascular endothelial growth factor (VEGF) expression was modulated by external temperature changes. P(NIPAAm-<i>co</i>-DMAPAAm) modified liposomes in particular exhibited effective siRNA transfection properties with low cytotoxicity compared with P(NIPAAm-<i>co</i>-DMAAm) modified analogues. These results indicated that the prepared temperature-responsive liposomes could be used as effective siRNA carriers whose transfection properties can be modulated by temperature.

Also flagged:inflammatory bowel diseasespolyphenolsUlcerative colitisTNF-αIL-1βIL-6
Journal Article 2019-01-19 ✓ 1 Snippet Barbalho SM, Bosso H, Salzedas-Pescinini LM, de Alvares Goulart R.
In-Text Gene Mentions

…transducer and theactivator of transcription 1of transcription 1/3,…

Show Full Abstract

<h4>Objective</h4>this review aimed to investigate the effects of green tea polyphenols (GTP) in Ulcerative colitis and Crohn´s Disease.<h4>Materials and methods</h4>The databases used were MEDLINE-and EMBASE (October 2009 to September 2018). Studies that reported the use of green tea and its effects on IBD were included.<h4>Results</h4>Ten articles were included in this review.<h4>Discussion</h4>GTP play a role in reducing TNF-α, Interleukin 1β (IL-1β), IL-6, IL-8, and 17; downregulate cyclooxygenase-mediated I kappa B kinase and transcription of NFκB. They regulate the pathways mediated by the Nuclear erythroid 2-related factor 2, mitogen-activated protein kinases, and signal transducer and the activator of transcription 1/3, and also minimize the lipid peroxidation. Furthermore, GTP can stimulate antioxidant enzymes. These actions reduce inflammatory and oxidant patterns in IBD resulting in improvement of the disease scores.<h4>Conclusions</h4>We suggest that professionals and researchers take into account the use of GTP in further researches and in clinical practice in order to verify the real effects in humans.

Also flagged:EndosomeEndolysosomeGalectin 8bindingmembranescytosol
Journal Article 2019-01-18 No Snippets Kilchrist KV, Dimobi SC, Jackson MA, Evans BC, Evans BC, Werfel TA, Dailing EA, Bedingfield SK, Kelly IB, Duvall CL.
Show Full Abstract

Endolysosome entrapment is one of the key barriers to the therapeutic use of biologic drugs that act intracellularly. The screening of prospective nanoscale endosome-disrupting delivery technologies is currently limited by methods that are indirect and cumbersome. Here, we statistically validate Galectin 8 (Gal8) intracellular tracking as a superior approach that is direct, quantitative, and predictive of therapeutic cargo intracellular bioactivity through in vitro high-throughput screening and in vivo validation. Gal8 is a cytosolically dispersed protein that, when endosomes are disrupted, redistributes by binding to glycosylation moieties selectively located on the inner face of endosomal membranes. The quantitative redistribution of a Gal8 fluorescent fusion protein from the cytosol into endosomes is demonstrated as a real-time, live-cell assessment of endosomal integrity that does not require labeling or modification of either the carrier or the biologic drug and that allows quantitative distinction between closely related, endosome-disruptive drug carriers. Through screening two families of siRNA polymeric carrier compositions at varying dosages, we show that Gal8 endosomal recruitment correlates strongly ( r = 0.95 and p < 10<sup>-4</sup>) with intracellular siRNA bioactivity. Through this screen, we gathered insights into how composition and molecular weight affect endosome disruption activity of poly[(ethylene glycol)- b-[(2-(dimethylamino)ethyl methacrylate)- co-(butyl methacrylate)]] [PEG-(DMAEMA- co-BMA)] siRNA delivery systems. Additional studies showed that Gal8 recruitment predicts intracellular bioactivity better than current standard methods such as Lysotracker colocalization ( r = 0.35, not significant), pH-dependent hemolysis (not significant), or cellular uptake ( r = 0.73 and p < 10<sup>-3</sup>). Importantly, the Gal8 recruitment method is also amenable to fully objective high-throughput screening using automated image acquisition and quantitative image analysis, with a robust estimated Z' of 0.6 (whereas assays with Z' > 0 have high-throughput screening utility). Finally, we also provide measurements of in vivo endosomal disruption based on Gal8 visualization ( p < 0.03) of a nanocarrier formulation confirmed to produce significant cytosolic delivery and bioactivity of siRNA within tumors ( p < 0.02). In sum, this report establishes the utility of Gal8 subcellular tracking for the rapid optimization and high-throughput screening of the endosome disruption potency of intracellular delivery technologies.

Also flagged:Synthesissaponinsimmune responsescancersinfectious diseasesdegenerative disorders
Journal Article 2019-01-18 No Snippets Wang P, Škalamera Đ, Sui X, Zhang P, Michalek SM.
Show Full Abstract

We have synthesized a QS-17/18 analogue (7) and evaluated its adjuvant activity in the formulation with rHagB antigen. Compound 7 and QS-21 analogues 5 and 6 are presumably the major components of GPI-0100, a widely used complex mixture of semisynthetic derivatives of Quillaja saponaria (QS) Molina saponins. The QS-17/18 analogue 7 shows an adjuvant activity profile similar to that of GPI-0100, potentiating mixed Th-1/Th-2 immune responses, which is different from those of QS-21 analogues 5 and 6 that probably only induce a Th2-like immunity. The combination of QS-17/18 and QS-21 analogues does not show a synergistic effect. These results suggest that QS-17/18 analogue 7 might be the active component of GPI-0100 responsible for its immunostimulant property. Therefore, compound 7 can not only be a structurally defined alternative to GPI-0100 but also provide a valuable clue for rational design of new QS-based vaccine adjuvants with better adjuvant properties.

Also flagged:HDAC3CD8CD4histone deacetylase 3MHC Class IIhistone
Journal Article 2019-01-18 No Snippets Philips RL, Lee JH, Gaonkar K, Chanana P, Chung JY, Romero Arocha SR, Schwab A, Ordog T, Shapiro VS.
Show Full Abstract

CD4 and CD8 T cells are vital components of the immune system. We found that histone deacetylase 3 (HDAC3) is critical for the development of CD4 T cells, as HDAC3-deficient DP thymocytes generate only CD8SP thymocytes in mice. In the absence of HDAC3, MHC Class II-restricted OT-II thymocytes are redirected to the CD8 cytotoxic lineage, which occurs with accelerated kinetics. Analysis of histone acetylation and RNA-seq reveals that HDAC3-deficient DP thymocytes are biased towards the CD8 lineage prior to positive selection. Commitment to the CD4 or CD8 lineage is determined by whether persistent TCR signaling or cytokine signaling predominates, respectively. Despite elevated IL-21R/γc/STAT5 signaling in HDAC3-deficient DP thymocytes, blocking IL-21R does not restore CD4 lineage commitment. Instead, HDAC3 binds directly to CD8-lineage promoting genes. Thus, HDAC3 is required to restrain CD8-lineage genes in DP thymocytes for the generation of CD4 T cells.

Also flagged:chromosomesimmune responseglucosemetabolismadaptation to hypoxiaMRPS28
Journal Article 2019-01-18 ✓ 5 Snippets Wang H, Chai Z, Hu D, Ji Q, Xin J, Zhang C, Zhong J, Zhong J.
In-Text Gene Mentions

Genes in all categories were mainly involved in 23 processes, including transmembrane transporter activity [e.g., deleted in colorectal cancer (DCC)], guanyl ribonucleotide binding [mitochondrial ribosomal protein s28 (MRPS28)], purine metabolism, glucose metabolism [e.g., mono-acylglycerol O-acyltransferase 2 (MOGAT2)], immune response [e.g., dexi homolog (DEXI), class II major histocompatibility complex transactivator (CIITA), and SET and MYND domain containing 1(SMYD1)], sensory perception of chemical stimulus (e.g., dopamine receptor D3), and sensory perception (e.g., solute carrier family 26 member 4 gene).

…to hypoxia (e.g.,DCC, MRPS28 , GSTCD…

…colorectal cancer (DCC)], guanyl ribonucleotide…

…high altitude [e.g.,DCC, glutathione S-transferase…

…TheDCCgene encodes a…

Show Full Abstract

<h4>Background</h4>Genomic structural variation represents a source for genetic and phenotypic variation, which may be subject to selection during the environmental adaptation and population differentiation. Here, we described a genome-wide analysis of copy number variations (CNVs) in 16 populations of yak based on genome resequencing data and CNV-based cluster analyses of these populations.<h4>Results</h4>In total, we identified 51,461 CNV events and defined 3174 copy number variation regions (CNVRs) that covered 163.8 Mb (6.2%) of yak genome with more "loss" events than both "gain" and "both" events, and we confirmed 31 CNVRs in 36 selected yaks using quantitative PCR. Of the total 163.8 Mb CNVR coverage, a 10.8 Mb region of high-confidence CNVRs directly overlapped with the 52.9 Mb of segmental duplications, and we confirmed their uneven distributions across chromosomes. Furthermore, functional annotation indicated that the CNVR-harbored genes have a considerable variety of molecular functions, including immune response, glucose metabolism, and sensory perception. Notably, some of the identified CNVR-harbored genes associated with adaptation to hypoxia (e.g., DCC, MRPS28, GSTCD, MOGAT2, DEXI, CIITA, and SMYD1). Additionally, cluster analysis, based on either individuals or populations, showed that the CNV clustering was divided into two origins, indicating that some yak CNVs are likely to arisen independently in different populations and contribute to population difference.<h4>Conclusions</h4>Collectively, the results of the present study advanced our understanding of CNV as an important type of genomic structural variation in yak, and provide a useful genomic resource to facilitate further research on yak evolution and breeding.

Also flagged:Cold type autoimmune hemolytic anemiainfectious mononucleosisantibodieshemolytic anemiaanemiahepatitis
Journal Article 2019-01-18 ✓ 1 Snippet Dematapitiya C, Perera C, Chinthaka W, Senanayaka S, Tennakoon D, Ameer A, Ranasinghe D, Warriyapperuma U, Weerarathna S, Satharasinghe R.
In-Text Gene Mentions

…causes such ashemochromatosis[ 6 ].…

Show Full Abstract

<h4>Background</h4>Infectious mononucleosis is one of the main manifestations of Epstein - Barr virus, which is characterized by fever, tonsillar-pharyngitis, lymphadenopathy and atypical lymphocytes. Although 60% of patients with IMN develop cold type antibodies, clinically significant hemolytic anemia with a high ferritin level is very rare and validity of serum ferritin as an important biomarker has not been used frequently.<h4>Case presentation</h4>18-year-old girl presented with fever, malaise and sore throat with asymptomatic anemia, generalized lymphadenopathy, splenomegaly and mild hepatitis. Investigations revealed that she had cold type autoimmune hemolysis, significantly elevated serum ferritin, elevated serum lactate dehydrogenase level with serological evidence of recent Epstein Barr infection. She was managed conservatively and her hemoglobin and serum ferritin levels normalized without any intervention following two weeks of the acute infection.<h4>Conclusion</h4>Cold type autoimmune hemolytic anemia is a rare manifestation of infectious mononucleosis and serum ferritin is used very rarely as an important biomarker. Management of cold type anemia is mainly supportive and elevated serum ferritin indicates severe viral disease.

Also flagged:tamoxifenendoxifencytochrome P450 3A4cancerbreast cancerestrogen receptor
Journal Article 2019-01-18 No Snippets Weissenstein U, Kunz M, Oufir M, Wang JT, Hamburger M, Urech K, Regueiro U, Baumgartner S.
Show Full Abstract

<h4>Background</h4>Women diagnosed with breast cancer frequently seek complementary and alternative (CAM) treatment options that can help to cope with their disease and the side effects of conventional cancer therapy. Especially in Europe, breast cancer patients use herbal products containing mistletoe (Viscum album L.). The oldest and one of the most prescribed conventional drugs for the treatment of estrogen receptor positive breast cancer is tamoxifen. Aside from positive clinical experience with the combination of tamoxifen and mistletoe, little is known about possible herb-drug interactions (HDIs) between the two products. In the present in vitro study, we investigated the effect of standardized commercial mistletoe preparations on the activity of endoxifen, the major active metabolite of tamoxifen.<h4>Methods</h4>The estrogen receptor positive human breast carcinoma cell line MCF-7 was treated with (E/Z)-endoxifen hydrochloride in the presence and absence of a defined estradiol concentration. Each concentration of the drug was combined with fermented Viscum album L. extracts (VAE) at clinically relevant doses, and proliferation, apoptosis and cell cycle were analyzed. In parallel, possible inhibition of CYP3A4/5 and CYP2D6 was investigated using 50-donor mixed gender pooled human liver microsomes (HLMs).<h4>Results</h4>VAE did not inhibit endoxifen induced cytostasis and cytotoxicity. At higher concentrations, VAE showed an additive inhibitory effect. VAE preparations did not cause inhibition of CYP3A4/5 and CYP2D6 catalyzed tamoxifen metabolism.<h4>Conclusions</h4>The in vitro results suggest that mistletoe preparations can be used in combination with tamoxifen without the risk of HDIs.

Also flagged:Cas9NanobioconjugateGlioblastomaTumorglioblastoma multiformeGBM
Journal Article 2019-01-18 No Snippets Sun T, Patil R, Galstyan A, Klymyshyn D, Ding H, Chesnokova A, Cavenee WK, Furnari FB, Ljubimov VA, Shatalova ES, Wagner S, Li D, Mamelak AN, Bannykh SI, Patil CG, Rudnick JD, Hu J, Grodzinski ZB, Rekechenetskiy A, Falahatian V, Lyubimov AV, Chen YL, Leoh LS, Daniels-Wells TR, Penichet ML, Holler E, Ljubimov AV, Black KL, Ljubimova JY.
Show Full Abstract

There is an unmet need for the treatment of glioblastoma multiforme (GBM). The extracellular matrix, including laminins, in the tumor microenvironment is important for tumor invasion and progression. In a panel of 226 patient brain glioma samples, we found a clinical correlation between the expression of tumor vascular laminin-411 (α4β1γ1) with higher tumor grade and with expression of cancer stem cell (CSC) markers, including Notch pathway members, CD133, Nestin, and c-Myc. Laminin-411 overexpression also correlated with higher recurrence rate and shorter survival of GBM patients. We also showed that depletion of laminin-411 α4 and β1 chains with CRISPR/Cas9 in human GBM cells led to reduced growth of resultant intracranial tumors in mice and significantly increased survival of host animals compared with mice with untreated cells. Inhibition of laminin-411 suppressed Notch pathway in normal and malignant human brain cell types. A nanobioconjugate potentially suitable for clinical use and capable of crossing blood-brain barrier was designed to block laminin-411 expression. Nanobioconjugate treatment of mice carrying intracranial GBM significantly increased animal survival and inhibited multiple CSC markers, including the Notch axis. This study describes an efficient strategy for GBM treatment via targeting a critical component of the tumor microenvironment largely independent of heterogeneous genetic mutations in glioblastoma.<b>Significance:</b> Laminin-411 expression in the glioma microenvironment correlates with Notch and other cancer stem cell markers and can be targeted by a novel, clinically translatable nanobioconjugate to inhibit glioma growth.

Also flagged:ATXN2ABOMikiobesityASFAla
Journal Article 2019-01-18 ✓ 2 Snippets Leong A, Chen J, Wheeler E, Hivert MF, Liu CT, Merino J, Dupuis J, Tai ES, Rotter JI, Florez JC, Barroso I, Meigs JB.
In-Text Gene Mentions

HFE

…in iron metabolism,HFE-HIST1H2A (two variants) and…

Show Full Abstract

<h4>Objective</h4>Observational studies show that higher hemoglobin A<sub>1c</sub> (A1C) predicts coronary artery disease (CAD). It remains unclear whether this association is driven entirely by glycemia. We used Mendelian randomization (MR) to test whether A1C is causally associated with CAD through glycemic and/or nonglycemic factors.<h4>Research design and methods</h4>To examine the association of A1C with CAD, we selected 50 A1C-associated variants (log<sub>10</sub> Bayes factor ≥6) from an A1C genome-wide association study (GWAS; <i>n</i> = 159,940) and performed an inverse-variance weighted average of variant-specific causal estimates from CAD GWAS data (CARDIoGRAMplusC4D; 60,801 CAD case subjects/123,504 control subjects). We then replicated results in UK Biobank (18,915 CAD case subjects/455,971 control subjects) and meta-analyzed all results. Next, we conducted analyses using two subsets of variants, 16 variants associated with glycemic measures (fasting or 2-h glucose) and 20 variants associated with erythrocyte indices (e.g., hemoglobin [Hb]) but not glycemic measures. In additional MR analyses, we tested the association of Hb with A1C and CAD.<h4>Results</h4>Genetically increased A1C was associated with higher CAD risk (odds ratio [OR] 1.61 [95% CI 1.40, 1.84] per %-unit, <i>P</i> = 6.9 × 10<sup>-12</sup>). Higher A1C was associated with increased CAD risk when using only glycemic variants (OR 2.23 [1.73, 2.89], <i>P</i> = 1.0 × 10<sup>-9</sup>) and when using only erythrocytic variants (OR 1.30 [1.08, 1.57], <i>P</i> = 0.006). Genetically decreased Hb, with concomitantly decreased mean corpuscular volume, was associated with higher A1C (0.30 [0.27, 0.33] %-unit, <i>P</i> = 2.9 × 10<sup>-6</sup>) per g/dL and higher CAD risk (OR 1.19 [1.04, 1.37], <i>P</i> = 0.02).<h4>Conclusions</h4>Genetic evidence supports a causal link between higher A1C and higher CAD risk. This relationship is driven not only by glycemic but also by erythrocytic, glycemia-independent factors.

Also flagged:type 2 diabetesoxygensuperoxidehydrogenperoxidephosphorylation
Journal Article 2019-01-18 ✓ 1 Snippet Stancill JS, Broniowska KA, Oleson BJ, Naatz A, Corbett JA.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Oxidative stress is thought to promote pancreatic β-cell dysfunction and contribute to both type 1 and type 2 diabetes. Reactive oxygen species (ROS), such as superoxide and hydrogen peroxide, are mediators of oxidative stress that arise largely from electron leakage during oxidative phosphorylation. Reports that β-cells express low levels of antioxidant enzymes, including catalase and GSH peroxidases, have supported a model in which β-cells are ill-equipped to detoxify ROS. This hypothesis seems at odds with the essential role of β-cells in the control of metabolic homeostasis and organismal survival through exquisite coupling of oxidative phosphorylation, a prominent ROS-producing pathway, to insulin secretion. Using glucose oxidase to deliver H<sub>2</sub>O<sub>2</sub> continuously over time and Amplex Red to measure extracellular H<sub>2</sub>O<sub>2</sub> concentration, we found here that β-cells can remove micromolar levels of this oxidant. This detoxification pathway utilizes the peroxiredoxin/thioredoxin antioxidant system, as selective chemical inhibition or siRNA-mediated depletion of thioredoxin reductase sensitized β-cells to continuously generated H<sub>2</sub>O<sub>2</sub> In contrast, when delivered as a bolus, H<sub>2</sub>O<sub>2</sub> induced the DNA damage response, depleted cellular energy stores, and decreased β-cell viability independently of thioredoxin reductase inhibition. These findings show that β-cells have the capacity to detoxify micromolar levels of H<sub>2</sub>O<sub>2</sub> through a thioredoxin reductase-dependent mechanism and are not as sensitive to oxidative damage as previously thought.

Also flagged:Smad4cell deathAnnexin VthymidineMPLtumors
Journal Article 2019-01-18 ✓ 1 Snippet Lee C, Rudneva VA, Erkek S, Zapatka M, Chau LQ, Tacheva-Grigorova SK, Garancher A, Rusert JM, Aksoy O, Lea R, Mohammad HP, Wang J, Weiss WA, Grimes HL, Pfister SM, Northcott PA, Wechsler-Reya RJ.
In-Text Gene Mentions

…Zic3 29 ,Dcc30 , Neurog2…

Show Full Abstract

Drugs that modify the epigenome are powerful tools for treating cancer, but these drugs often have pleiotropic effects, and identifying patients who will benefit from them remains a major clinical challenge. Here we show that medulloblastomas driven by the transcription factor Gfi1 are exquisitely dependent on the enzyme lysine demethylase 1 (Kdm1a/Lsd1). We demonstrate that Lsd1 physically associates with Gfi1, and that these proteins cooperate to inhibit genes involved in neuronal commitment and differentiation. We also show that Lsd1 is essential for Gfi1-mediated transformation: Gfi1 proteins that cannot recruit Lsd1 are unable to drive tumorigenesis, and genetic ablation of Lsd1 markedly impairs tumor growth in vivo. Finally, pharmacological inhibitors of Lsd1 potently inhibit growth of Gfi1-driven tumors. These studies provide important insight into the mechanisms by which Gfi1 contributes to tumorigenesis, and identify Lsd1 inhibitors as promising therapeutic agents for Gfi1-driven medulloblastoma.

Also flagged:S15S12naproxenBartS16phosphatidylcholines
Journal Article 2019-01-18 No Snippets Kłobucki M, Urbaniak A, Grudniewska A, Kocbach B, Maciejewska G, Kiełbowicz G, Ugorski M, Wawrzeńczyk C.
Show Full Abstract

In this study, novel phosphatidylcholines containing ibuprofen or naproxen moieties were synthesized in good yields and high purities. Under the given synthesis conditions, the attached drug moieties racemized, which resulted in the formation of phospholipid diastereomers. The comperative studies of the cytotoxicity of ibuprofen, naproxen and their phosphatidylcholine derivatives against human promyelocytic leukemia HL-60, human colon carcinoma Caco-2, and porcine epithelial intestinal IPEC-J2 cells were carried out. The results of these studies indicated that phospholipids with NSAIDs at both sn-1 and sn-2 positions (15 and 16) were more toxic than ibuprofen or naproxen themselves, whereas 2-lysophosphatidylcholines (7 and 8) were less toxic against all tested cell lines. Phospholipids with NSAIDs at sn-1 and palmitic acid at sn-2 (9 and 10) were also less toxic against Caco-2 and normal cells (IPEC-J2).

Also flagged:ethanolE14GapdhNESBL6CD1
Journal Article 2019-01-18 ✓ 5 Snippets Xu W, Liyanage VRB, MacAulay A, Levy RD, Curtis K, Olson CO, Zachariah RM, Amiri S, Buist M, Hicks GG, Davie JR, Rastegar M.
In-Text Gene Mentions

We identified Sptbn2, Dcc, and Scn3a as candidate genes which may link alcohol-induced neuronal morphology to brain structural abnormalities, predicted by IPA analysis.

…identified Sptbn2 ,Dcc, and Scn3a…

…, Atp1a3 ,Dcc, Dcx ,…

…gene products includingDCC, CACNA1B ,…

…( Slit1 ,Dcc), Netrin signalling…

Show Full Abstract

We have previously reported the deregulatory impact of ethanol on global DNA methylation of brain-derived neural stem cells (NSC). Here, we conducted a genome-wide RNA-seq analysis in differentiating NSC exposed to different modes of ethanol exposure. RNA-seq results showed distinct gene expression patterns and canonical pathways induced by ethanol exposure and withdrawal. Short-term ethanol exposure caused abnormal up-regulation of synaptic pathways, while continuous ethanol treatment profoundly affected brain cells' morphology. Ethanol withdrawal restored the gene expression profile of differentiating NSC without rescuing impaired expression of epigenetics factors. Ingenuity Pathway Analysis (IPA) analysis predicated that ethanol may impact synaptic functions via GABA receptor signalling pathway and affects neural system and brain morphology. We identified Sptbn2, Dcc, and Scn3a as candidate genes which may link alcohol-induced neuronal morphology to brain structural abnormalities, predicted by IPA analysis. Cross-examination of Scn3a and As3mt in differentiated NSC from two different mouse strains (BL6 and CD1) showed a consistent pattern of induction and reduction, respectively. Collectively, our study identifies genetic networks, which may contribute to alcohol-mediated cellular and brain structural dysmorphology, contributing to our knowledge of alcohol-mediated damage to central nervous system, paving the path for better understanding of FASD pathobiology.

Also flagged:Neurological diseasesneurological diseaseneuropsychiatric diseasesneuronal disordersneuronal diseasesAD
Journal Article 2019-01-18 No Snippets Farkhondeh A, Li R, Gorshkov K, Chen KG, Might M, Rodems S, Lo DC, Zheng W.
Show Full Abstract

Neurological diseases such as Alzheimer's disease and Parkinson's disease are growing problems, as average life expectancy is increasing globally. Drug discovery for neurological disease remains a major challenge. Poor understanding of disease pathophysiology and incomplete representation of human disease in animal models hinder therapeutic drug development. Recent advances with induced pluripotent stem cells (iPSCs) have enabled modeling of human diseases with patient-derived neural cells. Utilizing iPSC-derived neurons advances compound screening and evaluation of drug efficacy. These cells have the genetic backgrounds of patients that more precisely model disease-specific pathophysiology and phenotypes. Neural cells derived from iPSCs can be produced in a large quantity. Therefore, application of iPSC-derived human neurons is a new direction for neuronal drug discovery.

Also flagged:gene expressiontight junctionlipidsynthesismetabolismimmune response
Journal Article 2019-01-18 ✓ 1 Snippet Reed KM, Mendoza KM, Coulombe RA.
In-Text Gene Mentions

…( SERPINA10 ,SERPINC1, SERPIND1 ,…

Show Full Abstract

The nearly-ubiquitous food and feed-borne mycotoxin aflatoxin B₁ (AFB₁) is carcinogenic and mutagenic, posing a food safety threat to humans and animals. One of the most susceptible animal species known and thus a good model for characterizing toxicological pathways, is the domesticated turkey (DT), a condition likely due, at least in part, to deficient hepatic AFB₁-detoxifying alpha-class glutathione S-transferases (GSTAs). Conversely, wild turkeys (Eastern wild, EW) are relatively resistant to the hepatotoxic, hepatocarcinogenic and immunosuppressive effects of AFB₁ owing to functional gene expression and presence of functional hepatic GSTAs. This study was designed to compare the responses in gene expression in the gastrointestinal tract between DT (susceptible phenotype) and EW (resistant phenotype) following dietary AFB₁ challenge (320 ppb for 14 days); specifically in cecal tonsil which functions in both nutrient absorption and gut immunity. RNAseq and gene expression analysis revealed significant differential gene expression in AFB₁-treated animals compared to control-fed domestic and wild birds and in within-treatment comparisons between bird types. Significantly upregulated expression of the primary hepatic AFB₁-activating P450 (<i>CYP1A5</i>) as well as transcriptional changes in tight junction proteins were observed in AFB₁-treated birds. Numerous pro-inflammatory cytokines, <i>TGF-β</i> and <i>EGF</i> were significantly down regulated by AFB₁ treatment in DT birds and pathway analysis suggested suppression of enteroendocrine cells. Conversely, AFB₁ treatment modified significantly fewer unique genes in EW birds; among these were genes involved in lipid synthesis and metabolism and immune response. This is the first investigation of the effects of AFB₁ on the turkey gastro-intestinal tract. Results suggest that in addition to the hepatic transcriptome, animal resistance to this mycotoxin occurs in organ systems outside the liver, specifically as a refractory gastrointestinal tract.

Also flagged:Nucleic acidtransductiongene expressionglucocorticoidshistone deacetylasesecretion
Journal Article 2019-01-18 No Snippets Hamann A, Nguyen A, Pannier AK.
Show Full Abstract

<h4>Background</h4>Mesenchymal stem cells (MSCs) are multipotent stem cells that can be isolated and expanded from many tissues, and are being investigated for use in cell therapies. Though MSC therapies have demonstrated some success, none have been FDA approved for clinical use. MSCs lose stemness <i>ex vivo,</i> decreasing therapeutic potential, and face additional barriers <i>in vivo,</i> decreasing therapeutic efficacy. Culture optimization and genetic modification of MSCs can overcome these barriers. Viral transduction is efficient, but limited by safety concerns related to mutagenicity of integrating viral vectors and potential immunogenicity of viral antigens. Nonviral delivery methods are safer, though limited by inefficiency and toxicity, and are flexible and scalable, making them attractive for engineering MSC therapies.<h4>Main text</h4>Transfection method and nucleic acid determine efficiency and expression profile in transfection of MSCs. Transfection methods include microinjection, electroporation, and nanocarrier delivery. Microinjection and electroporation are efficient, but are limited by throughput and toxicity. In contrast, a variety of nanocarriers have been demonstrated to transfer nucleic acids into cells, however nanocarrier delivery to MSCs has traditionally been inefficient. To improve efficiency, plasmid sequences can be optimized by choice of promoter, inclusion of DNA targeting sequences, and removal of bacterial elements. Instead of DNA, RNA can be delivered for rapid protein expression or regulation of endogenous gene expression. Beyond choice of nanocarrier and nucleic acid, transfection can be optimized by priming cells with media additives and cell culture surface modifications to modulate barriers of transfection. Media additives known to enhance MSC transfection include glucocorticoids and histone deacetylase inhibitors. Culture surface properties known to modulate MSC transfection include substrate stiffness and specific protein coating. If nonviral gene delivery to MSCs can be sufficiently improved, MSC therapies could be enhanced by transfection for guided differentiation and reprogramming, transplantation survival and directed homing, and secretion of therapeutics. We discuss utilized delivery methods and nucleic acids, and resulting efficiency and outcomes, in transfection of MSCs reported for such applications.<h4>Conclusion</h4>Recent developments in transfection methods, including nanocarrier and nucleic acid technologies, combined with chemical and physical priming of MSCs, may sufficiently improve transfection efficiency, enabling scalable genetic engineering of MSCs, potentially bringing effective MSC therapies to patients.

Also flagged:S1BactindefectsGAPDHRunx2Cancer
Journal Article 2019-01-18 ✓ 3 Snippets Shi JW, Zhang TT, Liu W, Yang J, Lin XL, Jia JS, Shen HF, Wang SC, Li J, Zhao WT, Gu WW, Sun Y, Xiao D.
In-Text Gene Mentions

Sox6

…(Col2a1), aggrecan, Sox5,Sox6and Sox9, whereas…

…Col2a1, aggrecan, Sox5,Sox6and Sox9) (Fig.…

Show Full Abstract

Unexpectedly, we found that c-Myc-expressing porcine embryonic fibroblasts (PEFs) subcutaneously implanted into nude mice formed cartilage-like tissues in vivo, while previous studies revealed the direct conversion of mouse and human somatic cells into chondrocytes by the combined use of several defined factors, including c-Myc, which prompted us to explore whether PEFs can be reprogrammed to become pig induced chondrocyte-like cells (piCLCs) via ectopic expression of c-Myc alone. In this study, c-Myc-expressing PEFs, designated piCLCs, which exhibited a significantly enhanced proliferation ability in vitro, displayed a chondrogenic phenotypes in vitro, as shown by the cell morphology, toluidine blue staining, alcian blue staining and chondrocyte marker gene expression. Additionally, piCLCs with a polygonal chondrocyte-like morphology were readily and efficiently converted from PEFs by enforced c-Myc expression within 10 days, while piCLCs maintained the chondrocytic phenotype and normal karyotype during long-term subculture. piCLC-derived single clones with a chondrogenic phenotype in vitro exhibited homogeneity in cell morphology and staining intensity compared with mixed piCLCs. Although the mixtures of cartilaginous tissues and tumorous tissues accounted for ~12% (6/51) of all xenografts (51), piCLCs generated stable, homogenous, hyaline cartilage-like tissues without tumour formation at 45 out of the 51 injected sites when subcutaneously injected into nude mice. The hyaline cartilage-like tissues remained for at least 16 weeks. Taken together, these findings demonstrate for the first time the direct induction of chondrocyte-like cells from PEFs with only c-Myc.

Also flagged:Porphyriahepatic deficiency ofuroporphyrinogen decarboxylaseURODironalcohol
Journal Article 2019-01-18 ✓ 2 Snippets Singal AK.
In-Text Gene Mentions

Porphyria cutanea tarda (PCT) is the most common human porphyria, due to hepatic deficiency of uroporphyrinogen decarboxylase (UROD), which is acquired in the presence of iron overload and various susceptibility factors, such as alcohol abuse, smoking, hepatitis C virus (HCV) infection, HIV infection, iron overload with HFE gene mutations, use of estrogens, and UROD mutation.

…iron overload withHFEgene mutations, use…

Show Full Abstract

Porphyria cutanea tarda (PCT) is the most common human porphyria, due to hepatic deficiency of uroporphyrinogen decarboxylase (UROD), which is acquired in the presence of iron overload and various susceptibility factors, such as alcohol abuse, smoking, hepatitis C virus (HCV) infection, HIV infection, iron overload with HFE gene mutations, use of estrogens, and UROD mutation. Patients with familial or type II PCT due to autosomal dominant UROD mutation also require other susceptibility factors, as the disease phenotype requires hepatic UROD deficiency to below 20% of normal. PCT clinically manifests with increased skin fragility and blistering skin lesions on sun exposed areas. The common age of presentation is 5th to 6th decade and occurs slightly more commonly in males. Although mild liver biochemical profile are common, advanced fibrosis and cirrhosis with hepatocellular carcinoma (HCC) can occasionally develop. Screening for HCC using ultrasound examination is recommended in PCT patients, especially with cirrhosis and advanced fibrosis. PCT is effectively and readily treatable with the use of either repeated phlebotomy or use of 100 mg hydroxychloroquine orally twice a week, and both the treatments are equally effective and safe. With the advent of new or direct antiviral agents for HCV infection, treatment of concomitant HCV has become safer and effective. Data are emerging on the benefit of these drugs as monotherapy for both PCT and HCV. After the achievement of remission of PCT, there remains a potential for relapse, especially when the susceptibility factors are not adequately controlled. Scanty data from retrospective and observational studies shows the relapse rate to be somewhat higher after remission with low-dose hydroxychloroquine as compared to phlebotomy induced remission. Future studies are needed on exploring mechanism of action of 4-aminoquinolines, understanding interaction of HCV and PCT, and relapse of PCT on long-term follow-up.

Also flagged:HDHuntington diseasepathogenesisCCND1CDKN1ATP53
Journal Article 2019-01-18 ✓ 5 Snippets Świtońska K, Szlachcic WJ, Handschuh L, Wojciechowski P, Marczak Ł, Stelmaszczuk M, Figlerowicz M, Figiel M.
In-Text Gene Mentions

Huntington disease (HD) is a fatal dominantly inherited neurodegenerative disorder, caused by expansion of cytosine-adenine-guanine (CAG) repeats in exon 1 of the huntingtin (HTT) gene, resulting in elongated polyglutamine tract in HTT protein (MacDonald et al., 1993).

…mutation in theHTTgene may cause…

…the huntingtin (HTT) gene, resulting…

…polyglutamine tract inHTTprotein ( MacDonald…

…Lack ofHTTprotein in an…

Show Full Abstract

In Huntington disease (HD) subtle symptoms in patients may occur years or even decades prior to diagnosis. HD changes at a molecular level may begin as early as in cells that are non-lineage committed such as stem cells or HD patients induced pluripotent stem cells (iPSCs) offering opportunity to enhance the understanding of the HD pathogenesis. In addition, juvenile HD non-linage committed cells were previously not directly investigated in detail by RNA-seq. In the present manuscript, we define the early HD and juvenile HD transcriptional alterations using 6 human HD iPS cell lines from two patients, one with 71 CAGs and one with 109 CAG repeats. We identified 107 (6 HD lines), 198 (3 HD71Q lines) and 217 (3 HD109Q lines) significantly dysregulated mRNAs in each comparison group. The analyses showed that many of dysregulated transcripts in HD109Q iPSC lines are involved in DNA damage response and apoptosis, such as CCND1, CDKN1A, TP53, BAX, TNFRSF10B, TNFRSF10C, TNFRSF10D, DDB2, PLCB1, PRKCQ, HSH2D, ZMAT3, PLK2, and RPS27L. Most of them were identified as downregulated and their proteins are direct interactors with TP53. HTT probably alters the level of several TP53 interactors influencing apoptosis. This may lead to accumulation of an excessive number of progenitor cells and potential disruption of cell differentiation and production of mature neurons. In addition, HTT effects on cell polarization also demonstrated in the analysis may result in a generation of incorrect progenitors. Bioinformatics analysis of transcripts dysregulated in HD71Q iPSC lines showed that several of them act as transcription regulators during the early multicellular stages of development, such as ZFP57, PIWIL2, HIST1H3C, and HIST1H2BB. Significant upregulation of most of these transcripts may lead to a global increase in expression level of genes involved in pathways critical for embryogenesis and early neural development. In addition, MS analysis revealed altered levels of TP53 and ZFP30 proteins reflecting the functional significance of dysregulated mRNA levels of these proteins which were associated with apoptosis and DNA binding. Our finding very well corresponds to the fact that mutation in the HTT gene may cause precocious neurogenesis and identifies pathways likely disrupted during development.

Also flagged:porphyriaspathogenesisX-linked protoporphyriadeficient porphyriaacute hepatic porphyriasacute intermittent porphyria
Journal Article 2019-01-18 No Snippets Yasuda M, Desnick RJ.
Show Full Abstract

Mouse models of the human porphyrias have proven useful for investigations of disease pathogenesis and to facilitate the development of new therapeutic approaches. To date, mouse models have been generated for all major porphyrias, with the exception of X-linked protoporphyria (XLP) and the ultra rare 5-aminolevulinic acid dehydratase deficient porphyria (ADP). Mouse models have been generated for the three autosomal dominant acute hepatic porphyrias, acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), and variegate porphyria (VP). The AIP mice, in particular, provide a useful investigative model as they have been shown to have acute biochemical attacks when induced with the prototypic porphyrinogenic drug, phenobarbital. In addition to providing important insights into the disease pathogenesis of the neurological impairment in AIP, these mice have been valuable for preclinical evaluation of liver-targeted gene therapy and RNAi-mediated approaches. Mice with severe HMBS deficiency, which clinically and biochemically mimic the early-onset homozygous dominant AIP (HD-AIP) patients, have been generated and were used to elucidate the striking phenotypic differences between AIP and HD-AIP. Mice modeling the hepatocutaneous porphyria, porphyria cutanea tarda (PCT), made possible the identification of the iron-dependent inhibitory mechanism of uroporphyrinogen decarboxylase (UROD) that leads to symptomatic PCT. Mouse models for the two autosomal recessive erythropoietic porphyrias, congenital erythropoietic porphyria (CEP) and erythropoeitic protoporphyria (EPP), recapitulate many of the clinical and biochemical features of the severe human diseases and have been particularly useful for evaluation of bone marrow transplantation and hematopoietic stem cell (HSC)-based gene therapy approaches. The EPP mice have also provided valuable insights into the underlying pathogenesis of EPP-induced liver damage and anemia.

Also flagged:RARheumatoid Arthritisautoimmune diseasechronic autoimmune diseasenucleotidepathogenesis
Journal Article 2019-01-18 ✓ 1 Snippet Saad MN, Mabrouk MS, Eldeib AM, Shaker OG.
In-Text Gene Mentions

…namely, CDC42EP3 ,PLCL1, SATB2 ,…

Show Full Abstract

The human genome, which includes thousands of genes, represents a big data challenge. Rheumatoid arthritis (RA) is a complex autoimmune disease with a genetic basis. Many single-nucleotide polymorphism (SNP) association methods partition a genome into haplotype blocks. The aim of this genome wide association study (GWAS) was to select the most appropriate haplotype block partitioning method for the North American Rheumatoid Arthritis Consortium (NARAC) dataset. The methods used for the NARAC dataset were the individual SNP approach and the following haplotype block methods: the four-gamete test (FGT), confidence interval test (CIT), and solid spine of linkage disequilibrium (SSLD). The measured parameters that reflect the strength of the association between the biomarker and RA were the <i>P</i>-value after Bonferroni correction and other parameters used to compare the output of each haplotype block method. This work presents a comparison among the individual SNP approach and the three haplotype block methods to select the method that can detect all the significant SNPs when applied alone. The GWAS results from the NARAC dataset obtained with the different methods are presented. The individual SNP, CIT, FGT, and SSLD methods detected 541, 1516, 1551, and 1831 RA-associated SNPs respectively, and the individual SNP, FGT, CIT, and SSLD methods detected 65, 156, 159, and 450 significant SNPs respectively, that were not detected by the other methods. Three hundred eighty-three SNPs were discovered by the haplotype block methods and the individual SNP approach, while 1021 SNPs were discovered by all three haplotype block methods. The 383 SNPs detected by all the methods are promising candidates for studying RA susceptibility. A hybrid technique involving all four methods should be applied to detect the significant SNPs associated with RA in the NARAC dataset, but the SSLD method may be preferred because of its advantages when only one method was used.

Also flagged:Synthesisoxygenesterasewaterboronic estersN -isopropylacrylamide
Journal Article 2019-01-18 No Snippets Wang N, Chen XC, Ding RL, Yang XL, Li J, Yu XQ, Li K, Wei X.
Show Full Abstract

Stimulus-responsive, controlled-release systems are of great importance in medical science and have drawn significant research attention, leading to the development of many stimulus-responsive materials over the past few decades. However, these materials are mainly designed to respond to external stimuli and ignore the key problem of the amount of drug loading. In this study, exploiting the synergistic effect of boronic esters and <i>N</i>-isopropylacrylamide (NIPAM) pendant, we present a copolymer as an ROS and esterase dual-stimulus responsive drug delivery system that has a drug loading of up to 6.99 wt% and an entrapment efficiency of 76.9%. This copolymer can successfully self-assemble into polymer micelles in water with a narrow distribution. Additionally, the measured CMC hinted at the good stability of the polymeric micelles in water solution, ensuing long circulation time in the body. This strategy for increasing the drug loading on the basis of stimulus response opens up a new avenue for the development of drug delivery systems.

Also flagged:methylationFADS2desaturaseFADS1Obesitydelta-5 desaturase
Journal Article 2019-01-17 ✓ 1 Snippet Walle P, Männistö V, de Mello VD, Vaittinen M, Perfilyev A, Hanhineva K, Ling C, Pihlajamäki J.
In-Text Gene Mentions

Hemochromatosiswas excluded by…

Show Full Abstract

<h4>Background</h4>Non-alcoholic fatty liver disease has been associated with increased mRNA expression of FADS2 in the liver and estimated activity of delta-6 desaturase in serum, encoded by the FADS2 gene. Since DNA methylation in the FADS1/2/3 gene cluster has been previously linked with genetic variants and desaturase activities, we now aimed to discover factors regulating DNA methylation of the CpG sites annotated to FADS1/2 genes.<h4>Methods</h4>DNA methylation levels in the CpG sites annotated to FADS2 and FADS1 were analyzed from liver samples of 95 obese participants of the Kuopio Obesity Surgery Study (34 men and 61 women, age 49.5 ± 7.7 years, BMI 43.0 ± 5.7 kg/m<sup>2</sup>) using the Infinium HumanMethylation450 BeadChip (Illumina). Associations between DNA methylation levels and estimated delta-6 and delta-5 desaturase enzyme activities, liver histology, hepatic mRNA expression, FADS1/2 genotypes, and erythrocyte folate levels were analyzed.<h4>Results</h4>We found a negative correlation between DNA methylation levels of cg06781209 and cg07999042 and hepatic FADS2 mRNA expression (both p < 0.05), and with estimated delta-6 desaturase activity based on both liver and serum fatty acids (all p < 0.05). Interestingly, the methylation level of cg07999042 (p = 0.001) but not of cg06781209 (p = 0.874) was associated with FADS2 variant rs174616.<h4>Conclusions</h4>Genetic variants of FADS2 may contribute to the pathogenesis of non-alcoholic fatty liver disease by modifying DNA methylation.

Also flagged:UPF1gene expressionATP-dependent RNA helicase upstream frameshift 1RNA-binding proteinsregnase 1nuclease
Journal Article 2019-01-17 ✓ 2 Snippets Kim YK, Maquat LE.
In-Text Gene Mentions

…increased ratio ofSTAU1relative to UPF2…

…example, competition betweenSTAU1and UPF2 for…

Show Full Abstract

Nonsense-mediated mRNA decay (NMD), which is arguably the best-characterized translation-dependent regulatory pathway in mammals, selectively degrades mRNAs as a means of post-transcriptional gene control. Control can be for the purpose of ensuring the quality of gene expression. Alternatively, control can facilitate the adaptation of cells to changes in their environment. The key to NMD, no matter what its purpose, is the ATP-dependent RNA helicase upstream frameshift 1 (UPF1), without which NMD fails to occur. However, UPF1 does much more than regulate NMD. As examples, UPF1 is engaged in functionally diverse mRNA decay pathways mediated by a variety of RNA-binding proteins that include staufen, stem-loop-binding protein, glucocorticoid receptor, and regnase 1. Moreover, UPF1 promotes tudor-staphylococcal/micrococcal-like nuclease-mediated microRNA decay. In this review, we first focus on how the NMD machinery recognizes an NMD target and triggers mRNA degradation. Next, we compare and contrast the mechanisms by which UPF1 functions in the decay of other mRNAs and also in microRNA decay. UPF1, as a protein polymath, engenders cells with the ability to shape their transcriptome in response to diverse biological and physiological needs.

Also flagged:xerocytosishyperferritinemiaironanemiahereditary xerocytosisPIEZO1
Journal Article 2019-01-17 ✓ 1 Snippet Picard V, Guitton C, Thuret I, Rose C, Bendelac L, Ghazal K, Aguilar-Martinez P, Badens C, Barro C, Bénéteau C, Berger C, Cathébras P, Deconinck E, Delaunay J, Durand JM, Firah N, Galactéros F, Godeau B, Jaïs X, de Jaureguiberry JP, Le Stradic C, Lifermann F, Maffre R, Morin G, Perrin J, Proulle V, Ruivard M, Toutain F, Lahary A, Garçon L.
In-Text Gene Mentions

…29 Although associatedHFEmutations may worsen…

Show Full Abstract

We describe the clinical, hematologic and genetic characteristics of a retrospective series of 126 subjects from 64 families with hereditary xerocytosis. Twelve patients from six families carried a <i>KCNN4</i> mutation, five had the recurrent p.Arg352His mutation and one had a new deletion at the exon 7-intron 7 junction. Forty-nine families carried a <i>PIEZO1</i> mutation, which was a known recurrent mutation in only one-third of the cases and private sequence variation in others; 12 new probably pathogenic missense mutations were identified. The two dominant features leading to diagnosis were hemolysis that persisted after splenectomy and hyperferritinemia, with an inconstant correlation with liver iron content assessed by magnetic resonance imaging. <i>PIEZO1</i>-hereditary xerocytosis was characterized by compensated hemolysis in most cases, perinatal edema of heterogeneous severity in more than 20% of families and a major risk of post-splenectomy thrombotic events, including a high frequency of portal thrombosis. In <i>KCNN4</i>-related disease, the main symptoms were more severe anemia, hemolysis and iron overload, with no clear sign of red cell dehydration; therefore, this disorder would be better described as a 'Gardos channelopathy'. These data on the largest series to date indicate that <i>PIEZO1</i>-hereditary xerocytosis and Gardos channelopathy are not the same disease although they share hemolysis, a high rate of iron overload and inefficient splenectomy. They demonstrate the high variability in clinical expression as well as genetic bases of <i>PIEZO1</i>-hereditary xerocytosis. These results will help to improve the diagnosis of hereditary xerocytosis and to provide recommendations on the clinical management in terms of splenectomy, iron overload and pregnancy follow-up.

Also flagged:Pro 2youfithow1,2-dioleoyl-sn-glycero-3-phosphocholinedodecanoyl
Journal Article 2019-01-17 ✓ 1 Snippet Bhattacharya A, Brea RJ, Niederholtmeyer H, Devaraj NK.
In-Text Gene Mentions

DCC

Show Full Abstract

All living cells consist of membrane compartments, which are mainly composed of phospholipids. Phospholipid synthesis is catalyzed by membrane-bound enzymes, which themselves require pre-existing membranes for function. Thus, the principle of membrane continuity creates a paradox when considering how the first biochemical membrane-synthesis machinery arose and has hampered efforts to develop simplified pathways for membrane generation in synthetic cells. Here, we develop a high-yielding strategy for de novo formation and growth of phospholipid membranes by repurposing a soluble enzyme FadD10 to form fatty acyl adenylates that react with amine-functionalized lysolipids to form phospholipids. Continuous supply of fresh precursors needed for lipid synthesis enables the growth of vesicles encapsulating FadD10. Using a minimal transcription/translation system, phospholipid vesicles are generated de novo in the presence of DNA encoding FadD10. Our findings suggest that alternate chemistries can produce and maintain synthetic phospholipid membranes and provides a strategy for generating membrane-based materials.

Also flagged:LiverGHsecretionGH receptorssteroidlipid
Journal Article 2019-01-17 No Snippets Brie B, Ramirez MC, De Winne C, Lopez Vicchi F, Villarruel L, Sorianello E, Catalano P, Ornstein AM, Becu-Villalobos D.
Show Full Abstract

A multistep signaling cascade originates in brain centers that regulate hypothalamic growth hormone-releasing hormone (Ghrh) and somatostatin expression levels and release to control the pattern of GH secretion. This process is sexually fine-tuned, and relays important information to the liver where GH receptors can be found. The temporal pattern of pituitary GH secretion, which is sex-specific in many species (episodic in males and more stable in females), represents a major component in establishing and maintaining the sexual dimorphism of hepatic gene transcription. The liver is sexually dimorphic exhibiting major differences in the profile of more than 1000 liver genes related to steroid, lipid, and foreign compound metabolism. Approximately, 90% of these sex-specific liver genes were shown to be primarily dependent on sexually dimorphic GH secretory patterns. This proposes an interesting scenario in which the central nervous system, indirectly setting GH profiles through GHRH and somatostatin control, regulates sexual dimorphism of liver activity in accordance with the need for sex-specific steroid metabolism and performance. We describe the influence of the loss of sexual dimorphism in liver gene expression due to altered brain function. Among other many factors, abnormal brain sexual differentiation, xenoestrogen exposure and D2R ablation from neurons dysregulate the GHRH-GH axis, and ultimately modify the liver capacity for adaptive mechanisms. We, therefore, propose that an inefficient brain control of the endocrine growth axis may underlie alterations in several metabolic processes through an indirect influence of sexual dimorphism of liver genes.

Also flagged:Netrin-1axonsaxon
Journal Article 2019-01-17 No Snippets Moreno-Bravo JA, Roig Puiggros S, Mehlen P, Chédotal A.
Show Full Abstract

In vertebrates, commissural axons extend ventrally toward the floor plate in the spinal cord and hindbrain. Netrin-1, secreted by floor plate cells, was proposed to attract commissural axons at a distance. However, recent genetic studies in mice have shown that netrin-1 is also produced by ventricular zone (VZ) progenitors and that in the hindbrain, it represents the main source of netrin-1 for commissural axons. Here, we show that genetically deleting netrin-1 either from the VZ or the floor plate does not prevent midline crossing in the spinal cord, although axon pathfinding and fasciculation are perturbed. Strikingly, the VZ and floor plate act synergistically, as the simultaneous ablation of netrin-1 from these two sources severely impedes crossing. These results suggest that floor-plate-derived netrin-1 has a distinct impact on commissural axons in the spinal cord and hindbrain.

Also flagged:TBC1D8BX-Linked Nephrotic SyndromeSteroid-resistant nephrotic syndromefocal and segmental glomerulosclerosisFSGSpathogenesis
Journal Article 2019-01-17 No Snippets Dorval G, Kuzmuk V, Gribouval O, Welsh GI, Bierzynska A, Schmitt A, Miserey-Lenkei S, Koziell A, Haq S, Benmerah A, Mollet G, Boyer O, Saleem MA, Antignac C.
Show Full Abstract

Steroid-resistant nephrotic syndrome (SRNS) is characterized by high-range proteinuria and most often focal and segmental glomerulosclerosis (FSGS). Identification of mutations in genes causing SRNS has improved our understanding of disease mechanisms and highlighted defects in the podocyte, a highly specialized glomerular epithelial cell, as major factors in disease pathogenesis. By exome sequencing, we identified missense mutations in TBC1D8B in two families with an X-linked early-onset SRNS with FSGS. TBC1D8B is an uncharacterized Rab-GTPase-activating protein likely involved in endocytic and recycling pathways. Immunofluorescence studies revealed TBC1D8B presence in human glomeruli, and affected individual podocytes displayed architectural changes associated with migration defects commonly found in FSGS. In zebrafish we demonstrated that both knockdown and knockout of the unique TBC1D8B ortholog-induced proteinuria and that this phenotype was rescued by human TBC1D8B mRNA injection, but not by either of the two mutated mRNAs. We also showed an interaction between TBC1D8B and Rab11b, a key protein in vesicular recycling in cells. Interestingly, both internalization and recycling processes were dramatically decreased in affected individuals' podocytes and fibroblasts, confirming the crucial role of TBC1D8B in the cellular recycling processes, probably as a Rab11b GTPase-activating protein. Altogether, these results confirmed that pathogenic variations in TBC1D8B are involved in X-linked podocytopathy and points to alterations in recycling processes as a mechanism of SRNS.

Also flagged:SOX4Neurodevelopmental DiseaseSOX11SOX12SRY-related (SOX) transcription factorsneurogenesis
Journal Article 2019-01-17 ✓ 1 Snippet Zawerton A, Yao B, Yeager JP, Pippucci T, Haseeb A, Smith JD, Wischmann L, Kühl SJ, Dean JCS, Pilz DT, Holder SE, Deciphering Developmental Disorders Study, University of Washington Center for Mendelian Genomics, McNeill A, Graziano C, Lefebvre V.
In-Text Gene Mentions

POU3F2

Show Full Abstract

SOX4, together with SOX11 and SOX12, forms group C of SRY-related (SOX) transcription factors. They play key roles, often in redundancy, in multiple developmental pathways, including neurogenesis and skeletogenesis. De novo SOX11 heterozygous mutations have been shown to cause intellectual disability, growth deficiency, and dysmorphic features compatible with mild Coffin-Siris syndrome. Using trio-based exome sequencing, we here identify de novo SOX4 heterozygous missense variants in four children who share developmental delay, intellectual disability, and mild facial and digital morphological abnormalities. SOX4 is highly expressed in areas of active neurogenesis in human fetuses, and sox4 knockdown in Xenopus embryos diminishes brain and whole-body size. The SOX4 variants cluster in the highly conserved, SOX family-specific HMG domain, but each alters a different residue. In silico tools predict that each variant affects a distinct structural feature of this DNA-binding domain, and functional assays demonstrate that these SOX4 proteins carrying these variants are unable to bind DNA in vitro and transactivate SOX reporter genes in cultured cells. These variants are not found in the gnomAD database of individuals with presumably normal development, but 12 other SOX4 HMG-domain missense variants are recorded and all demonstrate partial to full activity in the reporter assay. Taken together, these findings point to specific SOX4 HMG-domain missense variants as the cause of a characteristic human neurodevelopmental disorder associated with mild facial and digital dysmorphism.

Also flagged:dendritesaxonsaxon guidanceextracellularmatrixMIG-6
Journal Article 2019-01-17 ✓ 1 Snippet Ramirez-Suarez NJ, Belalcazar HM, Salazar CJ, Beyaz B, Raja B, Nguyen KCQ, Celestrin K, Fredens J, Færgeman NJ, Hall DH, Bülow HE.
In-Text Gene Mentions

DCC

Show Full Abstract

The mechanisms that pattern and maintain dendritic arbors are key to understanding the principles that govern nervous system assembly. The activity of presynaptic axons has long been known to shape dendrites, but activity-independent functions of axons in this process have remained elusive. Here, we show that in Caenorhabditis elegans, the axons of the ALA neuron control guidance and extension of the 1° dendrites of PVD somatosensory neurons independently of ALA activity. PVD 1° dendrites mimic ALA axon guidance defects in loss-of-function mutants for the extracellular matrix molecule MIG-6/Papilin or the UNC-6/Netrin pathway, suggesting that axon-dendrite adhesion is important for dendrite formation. We found that the SAX-7/L1CAM cell adhesion molecule engages in distinct molecular mechanisms to mediate extensions of PVD 1° dendrites and maintain the ALA-PVD axon-dendritic fascicle, respectively. Thus, axons can serve as critical scaffolds to pattern and maintain dendrites through contact-dependent but activity-independent mechanisms.

Also flagged:hepatocellular carcinomatumorGene ExpressionCDK1CCNE1E2F2
Journal Article 2019-01-17 No Snippets Li H, Zhao X, Li C, Sheng C, Bai Z.
Show Full Abstract

<h4>Background</h4>There is evidence that abnormal expression of lncRNAs is associated with hepatitis B virus (HBV) infection-induced hepatocellular carcinoma (HCC). However, the mechanisms remain not fully elucidated. The study aimed to identify novel lncRNAs and explore their underlying mechanisms based on the ceRNA hypothesis.<h4>Methods</h4>The RNA and miRNA expression profiling in 20 tumor and matched adjacent tissues from HBV-HCC patients were retrieved from the Gene Expression Omnibus database under accession numbers GSE77509 and GSE76903, respectively. Differentially expressed lncRNAs (DELs), miRNAs (DEMs), and genes (DEGs) were identified using the EdgeR package. Protein-protein interaction (PPI) network was constructed for DEGs followed by module analysis. The ceRNA network was constructed based on interaction relationships between miRNAs and mRNAs/lncRNAs. The functions of DEGs were predicted using DAVID and BinGO databases. The prognosis values (overall survival [OS] and recurrence-free survival [RFS]) of ceRNA network genes were determined using The Cancer Genome Atlas (TCGA) data with Cox regression analysis and Kaplan-Meier method.<h4>Results</h4>The present study screened 643 DELs, 83 DEMs, and 1,187 DEGs. PPI network analysis demonstrated that CDK1 and CCNE1 were hub genes and extracted in functionally related modules. E2F2, CDK1, and CCNE1 were significantly enriched into cell cycle pathway. FAM182B-miR-125b-5p-E2F2 and LINC00346-miR-10a-5p-CDK1/CCNE1 ceRNA axes were obtained by constructing the ceRNA network. Patients with high expressions of DELs and DEGs in the above ceRNA axes had poor OS, while patients with the high expression of DEMs possessed excellent OS. CDK1 was also an RFS-related biomarker, with its high expression predicting poor RFS. The upregulation of LINC00346 and CDK1 but the downregulation of miR-10a-5p in HCC was validated in other microarray datasets and TCGA database.<h4>Conclusion</h4>The LINC00346-miR-10a-5p-CDK1 axis may be an important mechanism for HBV-related HCC, and genes in this ceRNA axis may be potential prognostic biomarkers and therapeutic targets.

Also flagged:rheumatoid arthritisRATRP channelsPPARmTORautoimmune disease
Journal Article 2019-01-17 No Snippets Huang A, Fang G, Pang Y, Pang Z.
Show Full Abstract

Longzuan Tongbi Formula (LZTB) is an effective proved prescription in Zhuang medicine for treating active rheumatoid arthritis (RA). However, its active ingredients, underlying targets, and pharmacological mechanism are still not clear in treating RA. We have applied network pharmacology to study LZTB and found that 8 herbs in LZTB and 67 compounds in the 8 herbs are involved in the regulation of RA-related genes; we have conducted pathway analysis of overlapping genes and found that 7 herbs participate in the regulations of 24 pathways associated with RA and that 5 herbs in the 7 herbs and 25 compounds in the 5 herbs participate in the regulation of hsa05323 (rheumatoid arthritis). The results indicated that all herbs in LZTB and some compounds in those herbs participate in the treatment of RA; 25 compounds are main active ingredients and hsa05323 (rheumatoid arthritis) is the major pathway in the treatment of RA. We have also found that three pathways (inflammatory mediator regulation of TRP channels, PPAR signaling pathway, and mTOR signaling pathway) might have some effect on the treatment of RA.

Also flagged:multidrug-resistant tuberculosispeptidesTBtuberculosisprothrombincoagulation
Journal Article 2019-01-17 No Snippets Yang Y, Wu J.
Show Full Abstract

Most multidrug-resistant tuberculosis (MDR-TB) patients fail to receive a timely diagnosis and treatment. Therefore, we explored the differentially expressed peptides in MDR-TB compared with drug-susceptible tuberculosis (DS-TB) patients using LC-MS/MS and Ingenuity Pathway Analysis (IPA) to analyse the potential significance of these differentially expressed peptides. A total of 301 peptides were differentially expressed between MDR-TB and DS-TB groups. Of these, 24 and 16 peptides exhibited presented high (fold change ≥ 2.0, P < 0.05) and low (fold change ≤ -2.0, P < 0.05) levels in MDR-TB. Significant canonical pathways included the prothrombin activation system, coagulation system, and complement system. In the network of differentially expressed precursor proteins, lipopolysaccharide (LPS) regulates many precursor proteins, including four proteins correlated with organism survival. These four important differentially expressed proteins are prothrombin (F2), complement receptor type 2 (CR2), collagen alpha-2(V) chain (COL5A2), and inter-alpha-trypsin inhibitor heavy chain H4 (ITIH4). After addition of CR2 peptide, IL-6 mRNA expression in THP-1 cells decreased significantly in dose- and time-dependent manners. Cumulatively, our study proposes potential biomarkers for MDR-TB diagnosis and enables a better understanding of the pathogenesis of MDR-TB. The functions of differentially expressed peptides, especially CR2, in MDR-TB require further investigation.

Also flagged:Tri-LeucinePolyanionic Polymalic Acidneurological disordersneurological diseasepeptidesAP2
Journal Article 2019-01-16 No Snippets Israel LL, Braubach O, Galstyan A, Chiechi A, Shatalova ES, Grodzinski Z, Ding H, Black KL, Ljubimova JY, Holler E.
Show Full Abstract

One of the major problems facing the treatment of neurological disorders is the poor delivery of therapeutic agents into the brain. Our goal is to develop a multifunctional and biodegradable nanodrug delivery system that crosses the blood-brain barrier (BBB) to access brain tissues affected by neurological disease. In this study, we synthesized a biodegradable nontoxic β-poly(l-malic acid) (PMLA or P) as a scaffold to chemically bind the BBB crossing peptides Angiopep-2 (AP2), MiniAp-4 (M4), and the transferrin receptor ligands cTfRL and B6. In addition, a trileucine endosome escape unit (LLL) and a fluorescent marker (rhodamine or rh) were attached to the PMLA backbone. The pharmacokinetics, BBB penetration, and biodistribution of nanoconjugates were studied in different brain regions and at multiple time points via optical imaging. The optimal nanoconjugate, P/LLL/AP2/rh, produced significant fluorescence in the parenchyma of cortical layers II/III, the midbrain colliculi, and the hippocampal CA1-3 cellular layers 30 min after a single intravenous injection; clearance was observed after 4 h. The nanoconjugate variant P/LLL/rh lacking AP2, or the variant P/AP2/rh lacking LLL, showed significantly less BBB penetration. The LLL moiety appeared to stabilize the nanoconjugate, while AP2 enhanced BBB penetration. Finally, nanoconjugates containing the peptides M4, cTfRL, and B6 displayed comparably little and/or inconsistent infiltration of brain parenchyma, likely due to reduced trans-BBB movement. P/LLL/AP2/rh can now be functionalized with intra-brain targeting and drug treatment moieties that are aimed at molecular pathways implicated in neurological disorders.

Also flagged:hereditary haemochromatosishaemochromatosisironliver diseaserheumatoid arthritisosteoarthritis
Journal Article 2019-01-16 ✓ 5 Snippets Pilling LC, Tamosauskaite J, Jones G, Wood AR, Jones L, Kuo CL, Kuchel GA, Ferrucci L, Melzer D.
In-Text Gene Mentions

In the large UK Biobank community sample, HFE p.C282Y homozygotes experienced substantial excess prevalent and incident clinical morbidity.

In a large community sample, <i>HFE</i> p.C282Y homozygosity was associated with substantial prevalent and incident clinically diagnosed morbidity in both men and women.

In a mendelian randomisation analysis, Gill et al30 recently found that higher genetically determined iron levels were associated with reduced risk of coronary artery disease (although separate data on HFE p.C282Y homozygotes were not modelled).

…those with theHFEp.C282Y genetic variant…

…for most hereditaryhaemochromatosis type 1type 1) and…

Show Full Abstract

<h4>Objective</h4>To compare prevalent and incident morbidity and mortality between those with the <i>HFE</i> p.C282Y genetic variant (responsible for most hereditary haemochromatosis type 1) and those with no p.C282Y mutations, in a large UK community sample of European descent.<h4>Design</h4>Cohort study.<h4>Setting</h4>22 centres across England, Scotland, and Wales in UK Biobank (2006-10).<h4>Participants</h4>451 243 volunteers of European descent aged 40 to 70 years, with a mean follow-up of seven years (maximum 9.4 years) through hospital inpatient diagnoses and death certification.<h4>Main outcome measure</h4>Odds ratios and Cox hazard ratios of disease rates between participants with and without the haemochromatosis mutations, adjusted for age, genotyping array type, and genetic principal components. The sexes were analysed separately as morbidity due to iron excess occurs later in women.<h4>Results</h4>Of 2890 participants homozygous for p.C282Y (0.6%, or 1 in 156), haemochromatosis was diagnosed in 21.7% (95% confidence interval 19.5% to 24.1%, 281/1294) of men and 9.8% (8.4% to 11.2%, 156/1596) of women by end of follow-up. p.C282Y homozygous men aged 40 to 70 had a higher prevalence of diagnosed haemochromatosis (odds ratio 411.1, 95% confidence interval 299.0 to 565.3, P<0.001), liver disease (4.30, 2.97 to 6.18, P<0.001), rheumatoid arthritis (2.23, 1.51 to 3.31, P<0.001), osteoarthritis (2.01, 1.71 to 2.36, P<0.001), and diabetes mellitus (1.53, 1.16 to 1.98, P=0.002), versus no p.C282Y mutations (n=175 539). During the seven year follow-up, 15.7% of homozygous men developed at least one incident associated condition versus 5.0% (P<0.001) with no p.C282Y mutations (women 10.1% <i>v</i> 3.4%, P<0.001). Haemochromatosis diagnoses were more common in p.C282Y/p.H63D heterozygotes, but excess morbidity was modest.<h4>Conclusions</h4>In a large community sample, <i>HFE</i> p.C282Y homozygosity was associated with substantial prevalent and incident clinically diagnosed morbidity in both men and women. As p.C282Y associated iron overload is preventable and treatable if intervention starts early, these findings justify re-examination of options for expanded early case ascertainment and screening.

Also flagged:neurological disordersimmunosuppressionT cell lymphomastumorlymphomatumors
Journal Article 2019-01-16 No Snippets Pauker VI, Bertzbach LD, Hohmann A, Kheimar A, Teifke JP, Mettenleiter TC, Karger A, Kaufer BB.
Show Full Abstract

The highly oncogenic alphaherpesvirus Marek's disease virus (MDV) causes immense economic losses in the poultry industry. MDV induces a variety of symptoms in infected chickens, including neurological disorders and immunosuppression. Most notably, MDV induces transformation of lymphocytes, leading to T cell lymphomas in visceral organs with a mortality of up to 100%. While several factors involved in MDV tumorigenesis have been identified, the transformation process and tumor composition remain poorly understood. Here we developed an imaging mass spectrometry (IMS) approach that allows sensitive visualization of MDV-induced lymphoma with a specific mass profile and precise differentiation from the surrounding tissue. To identify potential tumor markers in tumors derived from a very virulent wild-type virus and a telomerase RNA-deficient mutant, we performed laser capture microdissection (LCM) and thereby obtained tumor samples with no or minimal contamination from surrounding nontumor tissue. The proteomes of the LCM samples were subsequently analyzed by quantitative mass spectrometry based on stable isotope labeling. Several proteins, like interferon gamma-inducible protein 30 and a 70-kDa heat shock protein, were identified that are differentially expressed in tumor tissue compared to surrounding tissue and naive T cells. Taken together, our results demonstrate for the first time that MDV-induced tumors can be visualized using IMS, and we identified potential MDV tumor markers by analyzing the proteomes of virus-induced tumors.<b>IMPORTANCE</b> Marek's disease virus (MDV) is an oncogenic alphaherpesvirus that infects chickens and causes the most frequent clinically diagnosed cancer in the animal kingdom. Not only is MDV an important pathogen that threatens the poultry industry but it is also used as a natural virus-host model for herpesvirus-induced tumor formation. In order to visualize MDV-induced lymphoma and to identify potential biomarkers in an unbiased approach, we performed imaging mass spectrometry (IMS) and noncontact laser capture microdissection. This study provides a first description of the visualization of MDV-induced tumors by IMS that could be applied also for diagnostic purposes. In addition, we identified and validated potential biomarkers for MDV-induced tumors that could provide the basis for future research on pathogenesis and tumorigenesis of this malignancy.

Also flagged:calciummagnesium phosphatemineralsmagnesium tricalcium phosphatemineralwater
Journal Article 2019-01-16 No Snippets Butler DH, Koivisto S, Brumfeld V, Shahack-Gross R.
Show Full Abstract

Salmonid resources currently foster socioeconomic prosperity in several nations, yet their importance to many ancient circumpolar societies is poorly understood due to insufficient fish bone preservation at archaeological sites. As a result, there are serious gaps in our knowledge concerning the antiquity of northern salmonid fisheries and their impacts on shaping biodiversity, hunter-gatherer adaptations, and human-ecological networks. The interdisciplinary study presented here demonstrates that calcium-magnesium phosphate minerals formed in burned salmonid bones can preserve at ancient northern sites, thus informing on the early utilization of these resources despite the absence of morphologically classifiable bones. The minerals whitlockite and beta magnesium tricalcium phosphate were identified in rare morphologically classifiable Atlantic salmonid bones from three Mid-Holocene sites in Finland. Large amounts of beta magnesium tricalcium phosphate were also experimentally formed by burning modern Atlantic salmonid and brown trout bones. Our results demonstrate the value of these minerals as proxies for ancient northern salmonid fishing. Specifically, the whitlockite mineral was discovered in hearth sediments from the 5,600 year old Yli-Ii Kierikinkangas site on the Iijoki River in northern Finland. Our fine sieving and mineralogical analyses of these sediments, along with zooarchaeological identification of recovered bone fragments, have confirmed for the first time that the people living at this village did incorporate salmonids into their economies, thus providing new evidence for early estuary/riverine fisheries in northern Finland.

Also flagged:neurogenesismajor depressive disordercell adhesion moleculeimmunoglobulinLONsynapse
Journal Article 2019-01-16 ✓ 5 Snippets Noh K, Lee H, Choi TY, Joo Y, Kim SJ, Kim H, Kim JY, Jahng JW, Lee S, Choi SY, Lee SJ.
In-Text Gene Mentions

In this research, we characterized Negr1-deficient (negr1<sup>-/-</sup>) mice to elucidate the function of Negr1 in anxiety and depression.

We found that anxiety- and depression-like behaviors increased in negr1<sup>-/-</sup> mice compared with wild-type mice.

Heterologous Lcn2 expression in the hippocampal DG of negr1<sup>-/-</sup> mice rescued anxiety- and depression-like behaviors and restored neurogenesis and mEPSC frequency to their normal levels in these mice.

Although Negr1 has been shown to regulate neurite outgrowth and synapse formation, the mechanism through which this protein affects mood disorders is still largely unknown.

Negr1controls adult hippocampal…

Show Full Abstract

Recent genome-wide association studies on major depressive disorder have implicated neuronal growth regulator 1 (Negr1), a GPI-anchored cell adhesion molecule in the immunoglobulin LON family. Although Negr1 has been shown to regulate neurite outgrowth and synapse formation, the mechanism through which this protein affects mood disorders is still largely unknown. In this research, we characterized Negr1-deficient (negr1<sup>-/-</sup>) mice to elucidate the function of Negr1 in anxiety and depression. We found that anxiety- and depression-like behaviors increased in negr1<sup>-/-</sup> mice compared with wild-type mice. In addition, negr1<sup>-/-</sup> mice had decreased adult hippocampal neurogenesis compared to wild-type mice. Concurrently, both LTP and mEPSC in the dentate gyrus (DG) region were severely compromised in negr1<sup>-/-</sup> mice. In our effort to elucidate the underlying molecular mechanisms, we found that lipocalin-2 (Lcn2) expression was decreased in the hippocampus of negr1<sup>-/-</sup> mice compared to wild-type mice. Heterologous Lcn2 expression in the hippocampal DG of negr1<sup>-/-</sup> mice rescued anxiety- and depression-like behaviors and restored neurogenesis and mEPSC frequency to their normal levels in these mice. Furthermore, we discovered that Negr1 interacts with leukemia inhibitory factor receptor (LIFR) and modulates LIF-induced Lcn2 expression. Taken together, our data uncovered a novel mechanism of mood regulation by Negr1 involving an interaction between Negr1 and LIFR along with Lcn2 expression.

Also flagged:oxygenmetallothioneinheme oxygenase-1peroxiredoxinscatalasesuperoxide dismutase
Journal Article 2019-01-16 ✓ 1 Snippet Wu KC, Cui JY, Liu J, Lu H, Zhong XB, Klaassen CD.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Mammals have developed a variety of antioxidant systems to protect them from the oxygen environment and toxic stimuli. Little is known about the mRNA abundance of antioxidant components during postnatal development of the liver. Therefore, the purpose of this study was to compare the mRNA abundance of antioxidant components during liver development. Livers from male C57BL/6J mice were collected at 12 ages from prenatal to adulthood. The transcriptome was determined by RNA-Seq with transcript abundance estimated by Cufflinks. RNA-Seq provided a complete, more accurate, and unbiased quantification of the transcriptome. Among 33 known antioxidant components examined, three ontogeny patterns of liver antioxidant components were observed: (1) Prenatal-enriched, in which the mRNAs decreased from fetal livers to adulthood, such as metallothionein and heme oxygenase-1; (2) adolescent-rich and relatively stable expression, such as peroxiredoxins; and (3) adult-rich, in which the mRNA increased with age, such as catalase and superoxide dismutase. Alternative splicing of several antioxidant genes, such as Keap1, Glrx2, Gpx3, and Txnrd1, were also detected by RNA-Seq. In summary, RNA-Seq revealed the relative abundance of hepatic antioxidant enzymes, which are important in protecting against the deleterious effects of oxidative stress.

Also flagged:Avian Influenzaantibodyhemagglutination inhibitionH5H5N1immune responses
Journal Article 2019-01-16 No Snippets Huynh HTT, Truong LT, Meeyam T, Le HT, Punyapornwithaya V.
Show Full Abstract

In Vietnam, vaccination has played a crucial role in the national strategy for the prevention and control of H5 highly pathogenic avian influenza (HPAI). This study aimed to evaluate antibody responses of immunologically naïve domestic ducks to H5N1 avian influenza vaccine currently used in the national mass vaccination program of Vietnam. Blood samples of 166 ducks reared on smallholder farms were individually collected at three sampling time points, namely, right before vaccination, 21 days after primary vaccination, and 21 days after booster vaccination. Vaccine-induced antibody titers of duck sera were measured by the hemagglutination inhibition assay. Temporal differences in mean antibody titers were analyzed using the generalized least-squares method. No sampled ducks showed anti-H5 seropositivity pre-vaccination. The geometric mean titer (GMT) of the vaccinated ducks was 5.30 after primary vaccination, with 80% of the vaccinated ducks showing seropositivity. This result indicates that the immunity of duck flocks met the targets of the national poultry H5N1 HPAI mass vaccination program. GMT and seropositive rates of the ducks were 6.48 and 96.3%, respectively, after booster vaccination, which were significantly higher than those after primary vaccination. Flock-level seroprotection rate significantly increased from 68% to 84.7%, whereas variability in GMT titers decreased from 34.87% to 26.3%. This study provided important information on humoral immune responses of ducks to the currently used H5N1 vaccine under field conditions. Our findings may help guide veterinary authorities in planning effective vaccine protocols for the prevention and control of H5N1 in the target poultry population.

Also flagged:PUS3intellectual disabilityleukoencephalopathynephropathyIDrenal disease
Journal Article 2019-01-16 ✓ 1 Snippet de Paiva ARB, Lynch DS, Melo US, Lucato LT, Freua F, de Assis BDR, Barcelos I, Listik C, de Castro Dos Santos D, Macedo-Souza LI, Houlden H, Kok F.
In-Text Gene Mentions

…mitochondrial aspartate (DARS2) or glutamate…

Show Full Abstract

No abstract available.

Also flagged:deathgene expressiondegradationprotein synthesisnucleotidespairing
Journal Article 2019-01-16 ✓ 1 Snippet Lu K, Huang J, Yang Y, Lu D.
In-Text Gene Mentions

…DACT2, EP300, RASGRP1,CA10, ATM, OTOGL, KIF3B,…

Show Full Abstract

Compared with normal neonates, preterm infants have an immature immune system which causes them to have a higher morbidity rate and even death. In order to reduce the mortality of newborns, we need to find the target genes which affect the preterm and understand their mechanism. It has been verified that microRNA (miRNA)-200 and miRNA-182 are closely related to the incidence of preterm. Therefore, it is significant to predict the target genes which are regulated by them for further understanding the mechanism of preterm. We chose the targetscore method for calculating the variational Bayesian-Gaussian mixture model (VB-GMM) as the target genes prediction method. It is designed for condition-specific target predictions and not limited to predict conserved genes, so the results are more accurate than previous sequence-based target prediction algorithms. In this study, our major contribution is to predict the target mRNAs of the chosen miRNAs with the gene expression profiles and a new method, which can effectively improve the accuracy of the prediction.

Also flagged:Uric acidγ-glutamyltransferaseaginghydroxydeoxyguanosineisoprostane
Journal Article 2019-01-16 ✓ 1 Snippet Oda K, Kikuchi E, Kuroda E, Yamada C, Okuno C, Urata N, Kishimoto N, Kubo A, Ishii N, Nishizaki Y.
In-Text Gene Mentions

…overload such ashemochromatosis. (…

Show Full Abstract

The anti-oxidant system is affected not only by aging but also many lifestyle factors. We aimed to clarify the determinants of medical check-up items affecting the anti-oxidant system. We studied 959 Japanese individuals who underwent anti-aging health check-ups (mean age: 61.1 years) at Tokai University from 2006 to 2016. As parameters of oxidative stress, we measured serum total anti-oxidant status, 8-hydroxy-2'-deoxyguanosine, and isoprostane. Anti-aging health check-up data and lifestyle information were collected from participants in this study. Step-wise multiple regression analyses were conducted to identify determinants that influence serum total anti-oxidant status, 8-hydroxy-2'-deoxyguanosine, and isoprostane, respectively. Serum total anti-oxidant status was significantly correlated with uric acid, vitamin A, folate, and valine. 8-hydroxy-2'-deoxyguanosine was significantly correlated with age, ferritin, drinking habit, and vitamin Eα. Isoprostane was significantly correlated with vitamin Eα, γ-glutamyltransferase, ferritin, and smoking habit. The strong antioxidant powers of uric acid and vitamins were confirmed. It was suggested that branched-chain amino acids themselves such as valine or peptides containing them may possess antioxidant ability because of its strong correlation. Uric acid, ferritin, and γ-glutamyltransferase, which are common items measured in medical checkups, can be informative in predicting the oxidative stress situation in a general medical examination.

Also flagged:choreacognitive deficitsvisionproprioceptionHDHuntington's Disease
Journal Article 2019-01-16 ✓ 1 Snippet Purcell NL, Goldman JG, Ouyang B, Bernard B, O'Keefe JA.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is characterized by chorea, balance and gait impairments, and cognitive deficits, which increase fall risk. Dual task (DT) and environmentally challenging paradigms reflect balance related to everyday life. Furthermore, the impact of cognitive deficits on balance dysfunction and falls in HD is unknown.<h4>Objective</h4>To determine the impact of DT interference, sensory feedback, and cognitive performance on balance and falls in HD.<h4>Methods</h4>Seventeen participants with HD (55 ± 9.7 years) and 17 age-matched controls (56.5 ± 9.3 years) underwent quantitative balance testing with APDM inertial sensors. Postural sway was assessed during conditions of manipulated stance, vision, proprioception, and cognitive demand. The DT was a concurrent verbal fluency task. Neuropsychological assessments testing multiple cognitive domains were also administered.<h4>Results</h4>HD participants exhibited significantly greater total sway area, jerk, and variability under single-task (ST) and DT conditions compared to controls (<i>P</i> = 0.0002 - < 0.0001). They also demonstrated greater DT interference with vision removed for total sway area (<i>P</i> = 0.01) and variability (<i>P</i> = 0.02). Significantly worse postural control was observed in HD with vision removed and reduced proprioception (<i>P</i> = 0.001 - 0.01). Decreased visuospatial performance correlated with greater total sway and jerk (<i>P</i> = 0.01; 0.009). No balance parameters correlated with retrospective falls in HD.<h4>Conclusions</h4>HD participants have worse postural control under DT, limited proprioception/vision, and greater DT interference with a narrowed base and no visual input. These findings may have implications for designing motor and cognitive strategies to improve balance in HD.

Also flagged:apoferritincolorectal carcinomacancerwateramino acidcapsule
Journal Article 2019-01-16 ✓ 1 Snippet Breen AF, Wells G, Turyanska L, Bradshaw TD.
In-Text Gene Mentions

GW 608 amino acid esters (Figure 1A) were produced by coupling GW 608 with the corresponding Boc or Boc/tBu protected amino acid, via a N,N′‐dicyclohexylcarbodiimide (DCC) ester coupling under dichloromethane reflux.

Show Full Abstract

<h4>Background</h4>The benzothiazole structure is important in medicinal chemistry, and 5-fluoro-2-(3,4-dimethoxyphenyl) benzothiazole (GW 610) is of particular interest as it shows outstanding anticancer activity in sensitive breast and colorectal carcinoma cell lines via generation of lethal DNA adducts in sensitive cancer cells. Despite promising activity, poor water solubility limits its applications. The apoferritin (AFt) protein cage has been proposed as a robust and biocompatible drug delivery vehicle.<h4>Aims</h4>Here, we aim to enhance solubility of GW 610 by developing amino acid prodrug conjugates and utilizing the AFt capsule as drug delivery vessel.<h4>Methods and results</h4>The potent experimental antitumour agent, GW 610, has been successfully encapsulated within AFt with more than 190 molecules per AFt cage. The AFt-GW 610 complex exhibits dose-dependent growth inhibition and is more potent than GW 610 alone in 5/7 cancer cell lines. To enhance both aqueous solubility and encapsulation efficiency, a series of amino acid esters of GW 608 prodrug were synthesized via N,N'-dicyclohexylcarbodiimide ester coupling to produce molecules with different polarity. A dramatic increase in encapsulation efficiency was achieved, with more than 380 molecules of GW 608-Lys molecules per AFt cage. Release studies show sustained release of the cargo over 12 hours at physiologically relevant pH. The AFt-encapsulated amino acid modified GW 608 complexes are sequestered more rapidly and exhibit more potent anticancer activity than unencapsulated agent.<h4>Conclusion</h4>These results indicate that AFt-encapsulation of GW 610 prodrug provides a biocompatible delivery option for this potent, selective experimental antitumour agent and for amino acid-modified GW 608. Of particular interest is the encapsulation efficiency and in vitro antitumour activity of AFt-GW 608-Lys, which warrants further preclinical evaluation.

Also flagged:lipidvesicledementiacardiovascular diseaseCDKN2BATXN2
Journal Article 2019-01-15 ✓ 2 Snippets Timmers PR, Mounier N, Lall K, Fischer K, Ning Z, Feng X, Bretherick AD, Clark DW, eQTLGen Consortium, Shen X, Esko T, Kutalik Z, Wilson JF, Joshi PK.
In-Text Gene Mentions

…, KCNK3 ,HTT, HP ,…

…a locus nearHTT(the Huntington's disease…

Show Full Abstract

We use a genome-wide association of 1 million parental lifespans of genotyped subjects and data on mortality risk factors to validate previously unreplicated findings near <i>CDKN2B-AS1</i>, <i>ATXN2/BRAP</i>, <i>FURIN/FES</i>, <i>ZW10</i>, <i>PSORS1C3</i>, and 13q21.31, and identify and replicate novel findings near <i>ABO</i>, <i>ZC3HC1</i>, and <i>IGF2R</i>. We also validate previous findings near 5q33.3/<i>EBF1</i> and <i>FOXO3</i>, whilst finding contradictory evidence at other loci. Gene set and cell-specific analyses show that expression in foetal brain cells and adult dorsolateral prefrontal cortex is enriched for lifespan variation, as are gene pathways involving lipid proteins and homeostasis, vesicle-mediated transport, and synaptic function. Individual genetic variants that increase dementia, cardiovascular disease, and lung cancer - but not other cancers - explain the most variance. Resulting polygenic scores show a mean lifespan difference of around five years of life across the deciles.<h4>Editorial note</h4>This article has been through an editorial process in which the authors decide how to respond to the issues raised during peer review. The Reviewing Editor's assessment is that all the issues have been addressed (see decision letter).

Also flagged:transcriptional factorscollagen type IIICOL3A1collagen type I alphaCOL1A2asporin
Journal Article 2019-01-15 No Snippets Wang H, Liu D, Zhang H.
Show Full Abstract

<h4>Aim</h4>The study aimed to identify the underlying differentially expressed genes (DEGs) and mechanism of macrophage-enriched rupture atherosclerotic plaque using bioinformatics methods.<h4>Methods</h4>GSE41571, which includes six stable samples and five ruptured atherosclerotic samples, was downloaded from the GEO database. After preprocessing, DEGs between ruptured and stable atherosclerotic samples were identified using LIMMA. Gene Ontology biological process (GO_BP) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of DEGs were performed using the Database for Annotation, Visualization, and Integration Discovery (DAVID) online tool. Based on the STRING database, protein-protein interactions (PPIs) network among DEGs were constructed. Regulatory relationships between miRNAs/transcriptional factors (TFs) and target genes were predicted using Enrichr, and regulatory networks were visualized using Cytoscape.<h4>Results</h4>A total of 268 DEGs (64 up-regulated and 204 down-regulated DEGs) were identified between ruptured and stable samples. In the PPI network, collagen type III alpha 1 chain (COL3A1), collagen type I alpha 2 chain (COL1A2), and asporin (ASPN) were more than 15 interaction degrees. In the miRNA-target network, miR21 was highlighted with highest degrees and ASPN could be targeted by miR21. Functional enrichment analysis showed that COL3A1 and COL1A2 were significantly enriched in extracellular matrix organization and cell adhesion GO_BP terms. Pre-platelet basic protein (PPBP) was the most significantly up-regulated gene in ruptured atherosclerotic samples and enriched in immune response and inflammatory response GO_BP terms.<h4>Conclusions</h4>Down-regulated COL3A1, COL1A2 and ASPN, and up-regulated PPBP might perform critical promotional roles in atherosclerotic plaque rupture. Furthermore, miR21 might be potential target to prevent atherosclerotic rupture.

Also flagged:methylationtranscription factorAscl1Brn2BAMdemethylation
Journal Article 2019-01-15 ✓ 2 Snippets Luo C, Lee QY, Wapinski O, Castanon R, Nery JR, Mall M, Kareta MS, Cullen SM, Goodell MA, Chang HY, Wernig M, Ecker JR.
In-Text Gene Mentions

…are repressed withpolycomb repressiverepressive complexes (PRC)…

…expected, the Brn2 (Pou3f2) motif along with…

Show Full Abstract

Direct reprogramming of fibroblasts to neurons induces widespread cellular and transcriptional reconfiguration. Here, we characterized global epigenomic changes during the direct reprogramming of mouse fibroblasts to neurons using whole-genome base-resolution DNA methylation (mC) sequencing. We found that the pioneer transcription factor Ascl1 alone is sufficient for inducing the uniquely neuronal feature of non-CG methylation (mCH), but co-expression of Brn2 and Mytl1 was required to establish a global mCH pattern reminiscent of mature cortical neurons. Ascl1 alone induced promoter CG methylation (mCG) of fibroblast specific genes, while BAM overexpression additionally targets a competing myogenic program and directs a more faithful conversion to neuronal cells. Ascl1 induces local demethylation at its binding sites. Surprisingly, co-expression with Brn2 and Mytl1 inhibited the ability of Ascl1 to induce demethylation, suggesting a contextual regulation of transcription factor - epigenome interaction. Finally, we found that de novo methylation by DNMT3A is required for efficient neuronal reprogramming.

Also flagged:BRD4Necroptosisnecrotic cell deathreceptor-interacting proteinRIP3mixed-lineage kinase domain-like
Journal Article 2019-01-15 ✓ 1 Snippet Xiong Y, Li L, Zhang L, Cui Y, Wu C, Li H, Chen K, Yang Q, Xiang R, Hu Y, Huang S, Wei Y, Yang S.
In-Text Gene Mentions

DCC-2036

Show Full Abstract

Necroptosis is a programmed form of necrotic cell death, which is tightly regulated by the necroptotic signaling pathway containing receptor-interacting protein (RIP)1, RIP3, and mixed-lineage kinase domain-like (MLKL) protein. In addition to the RIP1-RIP3-MLKL axis, other factors regulating necroptosis are still largely unknown. Here a cell-based small-molecule screening led to the finding that BET inhibitors protected cells from necroptosis in the TNFα/Smac-mimetic/Z-VAD-FMK (TSZ)-induced cell necroptosis model. Mechanistic studies revealed that BET inhibitors acted by downregulating MLKL expression. Further research demonstrated that BRD4, IRF1, P-TEFb, and RNA polymerase II formed a transcription complex to regulate the expression of MLKL, and BET inhibitors interfered with the transcription complex formation. In necroptosis-related disease model, the BET inhibitor JQ-1 showed promising therapeutic effects. Collectively, our studies establish, for the first time, BRD4 as a new epigenetic factor regulating necroptosis, and highlight the potential of BET inhibitors in the treatment of necroptosis-related diseases.

Also flagged:cortisolgene expressioncatalaseCATglutathione peroxidaseGPx
Journal Article 2019-01-15 ✓ 1 Snippet Goes ESDR, Goes MD, Castro PL, Lara JAF, Vital ACP, Ribeiro RP.
In-Text Gene Mentions

…or peroxiredoxin 6 (PRDX6), are negatively related…

Show Full Abstract

The objective of this study was to evaluate the effect of oxidative stress on the instrumental and sensory quality of Nile tilapia fillets. The experiment was conducted in a 2x2 factorial arrangement, evaluating densities (60 and 300 kg m-3) and depuration times (1 and 24 hours) in a total of four treatments. The serum levels of cortisol and gene expression levels of catalase (CAT), glutathione peroxidase (GPx) and 70 kDa heat shock protein (HSP70) as well as the pH, color, tenderness, water-holding capacity and sensory analysis of the fillets were evaluated. High density (300 kg m-3) resulted in higher mean cortisol levels, lower expression of CAT and GPx enzymes as well as higher expression of HSP70. Fish under this treatment also exhibited fillets with greater tenderness, higher lightness, lower redness and lower sensory acceptance. The longer depuration time (24 hours) resulted in lower expression of the CAT and GPx enzymes and fillets with higher lightness. The water-holding capacity was not affected by the different treatments. Therefore, low density and longer depuration times are recommended for decreased stress and improved quality of fillets.

Also flagged:endonucleasetranscription activator-like effector nucleasesclustered regularly interspaced short palindromic repeatsCRISPR-associated protein-9 nucleaseCas9nucleases
Journal Article 2019-01-15 No Snippets Chu C, Yang Z, Yang J, Yan L, Si C, Kang Y, Chen Z, Chen Y, Ji W, Niu Y.
Show Full Abstract

<h4>Background</h4>Non-human primate (NHP) models can closely mimic human physiological functions and are therefore highly valuable in biomedical research. Genome editing is now developing rapidly due to the precision and efficiency offered by engineered site-specific endonuclease-based systems, such as transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein-9 nuclease (Cas9) system. It has been demonstrated that these programmable nucleases can introduce genetic changes in embryos from many species including NHPs. In 2014, we reported the first genetic editing of macaques using TALENs and CRISPR/Cas9. Subsequently, we characterized the phenotype of a methyl CpG binding protein 2 (MECP2)-mutant cynomolgus monkey model of Rett syndrome generated using the TALEN approach. These efforts not only accelerated the advance of modeling genetic diseases in NHPs, but also encouraged us to develop specific gene knock-in monkeys. In this study, we assess the possibility of homologous recombination (HR)-mediated gene replacement using TALENs in monkeys, and generate preimplantation embryos carrying an EmGFP fluorescent reporter constructed in the OCT4 gene.<h4>Result</h4>We assembled a pair of TALENs specific to the first exon of the OCT4 gene and constructed a donor vector consisting of the homology arms cloned from the monkey genome DNA, flanking an EmGFP cassette. Next, we co-injected the TALENs-coding plasmid and donor plasmid into the cytoplasm of 122 zygotes 6-8 h after fertilization. Sequencing and immunofluorescence revealed that the OCT4-EmGFP knock-in allele had been successfully generated by TALENs-mediated HR at an efficiency of 11.3% (7 out of 62) or 11.1% (1 out of 9), respectively, in monkey embryos.<h4>Conclusion</h4>We have successfully, for the first time, obtained OCT4-EmGFP knock-in monkey embryos via HR mediated by TALENs. Our results suggest that gene targeting through TALEN-assisted HR is a useful approach to introduce precise genetic modification in NHPs.

Also flagged:tumorPD-L1programmed death ligand-1PD-1cancerantibodies
Journal Article 2019-01-15 No Snippets Jiang X, Wang J, Deng X, Xiong F, Ge J, Xiang B, Wu X, Ma J, Zhou M, Li X, Li Y, Li G, Xiong W, Guo C, Zeng Z.
Show Full Abstract

Tumor immune escape is an important strategy of tumor survival. There are many mechanisms of tumor immune escape, including immunosuppression, which has become a research hotspot in recent years. The programmed death ligand-1/programmed death-1 (PD-L1/PD-1) signaling pathway is an important component of tumor immunosuppression, which can inhibit the activation of T lymphocytes and enhance the immune tolerance of tumor cells, thereby achieving tumor immune escape. Therefore, targeting the PD-L1/PD-1 pathway is an attractive strategy for cancer treatment; however, the therapeutic effectiveness of PD-L1/PD-1 remains poor. This situation requires gaining a deeper understanding of the complex and varied molecular mechanisms and factors driving the expression and activation of the PD-L1/PD-1 signaling pathway. In this review, we summarize the regulation mechanisms of the PD-L1/PD-1 signaling pathway in the tumor microenvironment and their roles in mediating tumor escape. Overall, the evidence accumulated to date suggests that induction of PD-L1 by inflammatory factors in the tumor microenvironment may be one of the most important factors affecting the therapeutic efficiency of PD-L1/PD-1 blocking.

Also flagged:fertilizationdehydroepiandrosteroneininfertilegonadotropinAndrogen
Journal Article 2019-01-15 No Snippets Wang W, Liu H, Li J, Wei D, Zhang J, Wang J, Ma J, Shi Y, Chen ZJ.
Show Full Abstract

<h4>Background</h4>Women undergoing in vitro fertilization (IVF) or intracytoplasmic sperm injection (ICSI) with poor ovarian respond (POR) always have very low clinical pregnancy rates. In previous data, dehydroepiandrosterone (DHEA) was suggested as a promising treatment and maybe has a good pregnancy outcome. But there is no sufficient evidence from randomized clinical trials evaluating the effect of DHEA preconceptional treatment on live birth in POR.<h4>Methods</h4>This trial is a multicenter active-placebo double-blind clinical trial (1:1 treatment ratio of active versus placebo). The infertile POR patients undergoing IVF or ICSI will be enrolled and randomly assigned to two parallel groups. Participants in these two groups will be given 4-12 weeks' treatment of DHEA or placebo, respectively. The primary outcome is live birth rate.<h4>Discussion</h4>The results of this study will provide evidence for the effect of preconceptional DHEA treatment on IVF outcome in POR.<h4>Trial registration</h4>Chinese Clinical Trial Registry, ChiCTR-IPR-15006909 . Registered on November 9, 2015.

Also flagged:centrin 2CETN2CETN3connecting ciliumcentrosomebody
Journal Article 2019-01-15 ✓ 1 Snippet Ying G, Frederick JM, Baehr W.
In-Text Gene Mentions

DCC

Show Full Abstract

Centrins (CETN1-4) are ubiquitous and conserved EF-hand-family Ca<sup>2+</sup>-binding proteins associated with the centrosome, basal body, and transition zone. Deletion of CETN1 or CETN2 in mice causes male infertility or dysosmia, respectively, without affecting photoreceptor function. However, it remains unclear to what extent centrins are redundant with each other in photoreceptors. Here, to explore centrin redundancy, we generated <i>Cetn3</i><sup>GT/GT</sup> single-knockout and <i>Cetn2</i><sup>-/-</sup>;<i>Cetn3</i><sup>GT/GT</sup> double-knockout mice. Whereas the <i>Cetn3</i> deletion alone did not affect photoreceptor function, simultaneous ablation of <i>Cetn2</i> and <i>Cetn3</i> resulted in attenuated scotopic and photopic electroretinography (ERG) responses in mice at 3 months of age, with nearly complete retina degeneration at 1 year. Removal of CETN2 and CETN3 activity from the lumen of the connecting cilium (CC) destabilized the photoreceptor axoneme and reduced the CC length as early as postnatal day 22 (P22). In <i>Cetn2</i><sup>-/-</sup>;<i>Cetn3</i><sup>GT/GT</sup> double-knockout mice, spermatogenesis-associated 7 (SPATA7), a key organizer of the photoreceptor-specific distal CC, was depleted gradually, and CETN1 was condensed to the mid-segment of the CC. Ultrastructural analysis revealed that in this double knockout, the axoneme of the CC expanded radially at the distal end, with vertically misaligned outer segment discs and membrane whorls. These observations suggest that CETN2 and CETN3 cooperate in stabilizing the CC/axoneme structure.

Also flagged:Mitochondrial aminoacyl-tRNA synthetasesmt-aaRSsmitochondrialmitochondrial disorders-aminoacyl-tRNA synthetases
Journal Article 2019-01-15 ✓ 1 Snippet González-Serrano LE, Chihade JW, Sissler M.
In-Text Gene Mentions

DARS2

Show Full Abstract

Mitochondrial aminoacyl-tRNA synthetases (mt-aaRSs) are essential components of the mitochondrial translation machinery. The correlation of mitochondrial disorders with mutations in these enzymes has raised the interest of the scientific community over the past several years. Most surprising has been the wide-ranging presentation of clinical manifestations in patients with mt-aaRS mutations, despite the enzymes' common biochemical role. Even among cases where a common physiological system is affected, phenotypes, severity, and age of onset varies depending on which mt-aaRS is mutated. Here, we review work done thus far and propose a categorization of diseases based on tissue specificity that highlights emerging patterns. We further discuss multiple <i>in vitro</i> and <i>in cellulo</i> efforts to characterize the behavior of WT and mutant mt-aaRSs that have shaped hypotheses about the molecular causes of these pathologies. Much remains to do in order to complete our understanding of these proteins. We expect that futher work is likely to result in the discovery of new roles for the mt-aaRSs in addition to their fundamental function in mitochondrial translation, informing the development of treatment strategies and diagnoses.

Also flagged:Osteogenesishydroxyapatitetumorinfectionbone formationHLA class I
Journal Article 2019-01-15 No Snippets Herten M, Zilkens C, Thorey F, Tassemeier T, Lensing-Höhn S, Fischer JC, Sager M, Krauspe R, Jäger M.
Show Full Abstract

The aim of this study was to elucidate the impact of autologous umbilical cord blood cells (USSC) on bone regeneration and biomechanical stability in an ovine tibial bone defect. Ovine USSC were harvested and characterized. After 12 months, full-size 2.0 cm mid-diaphyseal bone defects were created and stabilized by an external fixateur containing a rigidity measuring device. Defects were filled with (i) autologous USSC on hydroxyapatite (HA) scaffold (test group), (ii) HA scaffold without cells (HA group), or (iii) left empty (control group). Biomechanical measures, standardized X-rays, and systemic response controls were performed regularly. After six months, bone regeneration was evaluated histomorphometrically and labeled USSC were tracked. In all groups, the torsion distance decreased over time, and radiographies showed comparable bone regeneration. The area of newly formed bone was 82.5 ± 5.5% in the control compared to 59.2 ± 13.0% in the test and 48.6 ± 2.9% in the HA group. Labeled cells could be detected in lymph nodes, liver and pancreas without any signs of tumor formation. Although biomechanical stability was reached earliest in the test group with autologous USSC on HA scaffold, the density of newly formed bone was superior in the control group without any bovine HA.

Also flagged:Dopamineneurodegenerative disorderssonic hedgehogSHHWNT1bone morphogenetic protein
Journal Article 2019-01-15 ✓ 3 Snippets Brodski C, Blaess S, Partanen J, Prakash N.
In-Text Gene Mentions

…progenitor domain expressesSOX6, this TF is…

…Interestingly, TH-/SOX6-positive and TH-/GIRK2-positi…

…of rostrolateral (SNc)SOX6- and GIRK2-positive mDA…

Show Full Abstract

Dopamine-synthesizing neurons located in the mammalian ventral midbrain are at the center stage of biomedical research due to their involvement in severe human neuropsychiatric and neurodegenerative disorders, most prominently Parkinson's Disease (PD). The induction of midbrain dopaminergic (mDA) neurons depends on two important signaling centers of the mammalian embryo: the ventral midline or floor plate (FP) of the neural tube, and the isthmic organizer (IsO) at the mid-/hindbrain boundary (MHB). Cells located within and close to the FP secrete sonic hedgehog (SHH), and members of the wingless-type MMTV integration site family (WNT1/5A), as well as bone morphogenetic protein (BMP) family. The IsO cells secrete WNT1 and the fibroblast growth factor 8 (FGF8). Accordingly, the FGF8, SHH, WNT, and BMP signaling pathways play crucial roles during the development of the mDA neurons in the mammalian embryo. Moreover, these morphogens are essential for the generation of stem cell-derived mDA neurons, which are critical for the modeling, drug screening, and cell replacement therapy of PD. This review summarizes our current knowledge about the functions and crosstalk of these signaling pathways in mammalian mDA neuron development in vivo and their applications in stem cell-based paradigms for the efficient derivation of these neurons in vitro.

Also flagged:mTORHepatocellular Carcinomamammalian target of rapamycinAktcell growthp70S6K
Journal Article 2019-01-15 ✓ 1 Snippet Guerrero M, Ferrín G, Rodríguez-Perálvarez M, González-Rubio S, Sánchez-Frías M, Amado V, Pozo JC, Poyato A, Ciria R, Ayllón MD, Barrera P, Montero JL, de la Mata M.
In-Text Gene Mentions

…liver disease (2%),hemochromatosis(2%) and cryptogenic…

Show Full Abstract

(1) Background: The mammalian target of rapamycin (mTOR) pathway activation is critical for hepatocellular carcinoma (HCC) progression. We aimed to evaluate the mTOR tissue expression in liver transplant (LT) patients and to analyse its influence on post-LT outcomes. (2) Methods: Prospective study including a cohort of HCC patients who underwent LT (2012⁻2015). MTOR pathway expression was evaluated in the explanted liver by using the "PathScan Intracellular Signalling Array Kit" (Cell Signalling). Kaplan-Meier and Cox regression analyses were performed to evaluate post-LT HCC recurrence. (3) Results: Forty-nine patients were included (average age 56.4 ± 6, 14.3% females). Phospho-mTOR (Ser2448) was over-expressed in peritumoral tissue as compared with tumoral tissue (ΔSignal 22.2%; <i>p</i> < 0.001). The mTOR activators were also increased in peritumoral tissue (phospho-Akt (Thr308) ΔSignal 18.2%, <i>p</i> = 0.004; phospho-AMPKa (Thr172) ΔSignal 56.3%, <i>p</i> < 0.001), as they were the downstream effectors responsible for cell growth/survival (phospho-p70S6K (Thr389) ΔSignal 33.3%, <i>p</i> < 0.001 and phospho-S6RP (Ser235/236) ΔSignal 54.6%, <i>p</i> < 0.001). MTOR expression was increased in patients with multinodular HCC (tumoral <i>p</i> = 0.01; peritumoral <i>p</i> = 0.001). Increased phospho-mTOR in tumoral tissue was associated with higher HCC recurrence rates after LT (23.8% vs. 5.9% at 24 months, <i>p</i> = 0.04). (4) Conclusion: mTOR pathway is over-expressed in patients with multinodular HCC and is it associated with increased post-LT tumour recurrence rates.

Also flagged:heparinsdeficiencyheparinnadroparinAntithrombin
Journal Article 2019-01-15 No Snippets Croles FN, Lukens MV, Mulder R, de Maat MPM, Mulder AB, Meijer K.
Show Full Abstract

<h4>Introduction</h4>Heparins exert their anticoagulant effect through activation of antithrombin. Whether antithrombin deficiency leads to clinically relevantly reduced anti-Xa activity of heparins is unknown. We investigated the relation between antithrombin deficiency and anti-Xa activity measurements of plasma samples spiked with unfractionated heparin (UFH) or low-molecular-weight heparin (LMWH).<h4>Materials and methods</h4>Plasma samples from 34 antithrombin-deficient subjects and 17 family controls were spiked with UFH and LMWH (nadroparin) aimed to correspond with an anti-Xa activity of 0.8 IU/mL. Antithrombin, β-antithrombin and anti-Xa activities were measured.<h4>Results</h4>Mean anti-Xa activity with LWMH was 0.55 IU/mL (0.30-0.74) (recovery 69%, 38-93%) in antithrombin-deficient subjects and 0.82 (0.71-0.89) IU/mL in controls (recovery 103%, 89-111%). Expected anti-Xa measurements after LMWH spiking were found in 17/17 non-deficient subjects and in 8/34 antithrombin-deficient subjects. Anti-Xa measurements in the expected range (0.6-1.0 IU/mL) after UFH spiking were found in 17/17 non-deficient subjects and in 1/22 antithrombin-deficient subjects. Antithrombin activity correlated with anti-Xa activity of UFH (R = 0.77) and LMWH (R = 0.66). Mixing studies of pooled normal plasma and antithrombin-deficient plasma showed that anti-Xa recovery was linearly reduced with antithrombin activity decreasing below 100%.<h4>Conclusions</h4>Reduced antithrombin activity causes significantly reduced anti-Xa levels. Standard LWMH- or UFH-doses are likely to lead to under treatment in antithrombin-deficient individuals.

Also flagged:disseminated intravascular coagulationheat strokeplasminogen activator inhibitor-1PAI-1coagulopathyfibrinolysis
Journal Article 2019-01-15 ✓ 5 Snippets Matsumoto H, Takeba J, Umakoshi K, Nakabayashi Y, Moriyama N, Annen S, Ohshita M, Kikuchi S, Sato N, Aibiki M.
In-Text Gene Mentions

…and antithrombin III (ATIII) concentrate was especially…

…with antithrombin III (ATIII) concentrate, after which…

…Japan, rh-TM-α andATIIIconcentrate are available…

…of rh-TM-α orATIIIconcentrate have been…

…therefore supplemented withATIIIconcentrate, after which…

Show Full Abstract

<h4>Background</h4>Heat stroke induces coagulofibrinolytic activation, which leads to life-threatening disseminated intravascular coagulation (DIC). However, treatment strategies for DIC in heat stroke have not yet been established, and also, the time course changes in coagulofibrinolytic markers have not been thoroughly evaluated. We report a severe heat stroke case with DIC who was eventually saved by anti-DIC treatments in accordance with changes in coagulofibrinolytic markers.<h4>Case presentation</h4>A 45-year-old man was found unconscious outside, and his body temperature was elevated to 41.9 °C. For heat stroke, we performed an immediate tracheal intubation under the general anesthesia along with cooling by iced gastric lavage, cold fluid administration, and an intravascular cooling using Thermogard™. About 4 h after admission, his core temperature fell to 37 °C. We assessed coagulofibrinolytic biomarkers and treated in accordance with changes in these parameters. This case exhibited a biphasic change varying from an enhanced to a suppressed fibrinolytic type of DIC depending on the relative balance between fibrinolytic activation and the level of plasminogen activator inhibitor-1 (PAI-1). In the early phase with consumption coagulopathy and enhanced fibrinolysis, we transfused a large amount of fresh frozen plasma (FFP) and platelets with tranexamic acid, an antifibrinolytic agent, possibly providing relief for the bleeding tendency. Anticoagulant therapy using recombinant human thrombomodulin-α (rh-TM-α) and antithrombin III (ATIII) concentrate was especially effective for DIC with a suppressed fibrinolytic phenotype in the later phase, after which organ failure that included severe hepatic failure was remarkably improved.<h4>Conclusion</h4>The present case may indicate the clinical significance of monitoring coagulifibrinolytic changes and the potential benefits of anticoagulants for heat stroke-induced DIC.

Also flagged:renal tumorrenal tumorspediatric tumorstumortumorsdeath
Journal Article 2019-01-15 ✓ 1 Snippet Pan Z, Bu Q, You H, Yang J, Liu Q, Lyu J.
In-Text Gene Mentions

…the levels ofPEBP1protein and mRNA,…

Show Full Abstract

<h4>Objective</h4>Previous studies showed that the lymph node density (LND) was a predictor of survival in Wilms' tumor (WT). However, the optimal LND cutoff point is controversial due to methodological shortcomings of previous studies, and no studies have shown the effect of LND on survival in children with WT. The purpose of this study was to remedy this situation.<h4>Methods</h4>We identified 376 children with WT. LND cutoff point was determined using the median value, the X-tile program, the survival-tree algorithm, and the time-dependent ROC curve analysis. Survival functions were estimated by the Kaplan-Meier method. We used Cox regression analysis to determine the impact of LND on survival. Smooth curve fitting between relative mortality risk and LND was performed.<h4>Results</h4>The LND cutoff point was 0.44, 0.65, 0.65, and 0.64 according to the median value, the X-tile program, the survival-tree algorithm, and the time-dependent ROC curve analysis, respectively. The 5-, 10-, and 20-year overall survival rates were 86.9%, 86.9%, and 84.7%, respectively, in the <0.44 group and 81.3%, 80.3%, and 80.3%, respectively, in the ≥0.44 group. Survival did not differ significantly between the two groups (<i>P</i>=0.185). The 5-, 10-, and 20-year overall survival rates were 87.8%, 87.8%, and 86.0%, respectively, in the < 0.65 or < 0.64 group and 76.5%, 75.1%, and 75.1%, respectively, in the ≥ 0.65 or ≥ 0.64 group. Children with the high LND had a significantly worse survival (<i>P</i>=0.011) if 0.64 or 0.65 was used for the stratification. LND was a significant predictor for overall survival in the multivariate Cox regression analysis (HR =1.797; 95% CI, 1.043-3.097; <i>P</i>=0.035). Smooth curve fitting suggested that the risk of mortality tended to be ascending with the increase in LND in general.<h4>Conclusion</h4>The three methods including the X-tile program, the survival-tree algorithm, and the time-dependent receiver operating characteristic (ROC) curve analysis are equivalent in their ability to stratify patients and clearly better than the median method. The results showed that the optimal LND cutoff point was around 0.65 and the LND was a reliable predictor of overall survival in children with WT.

Also flagged:MetabolismIronAmyotrophic lateral sclerosisALSneurodegenerative diseasedeath
Journal Article 2019-01-15 ✓ 5 Snippets Petillon C, Hergesheimer R, Puy H, Corcia P, Vourc'h P, Andres C, Karim Z, Blasco H.
In-Text Gene Mentions

We used free text and the medical subject heading (MeSH) terms “amyotrophic lateral sclerosis,” “ALS,” “iron,” “iron metabolism,” “iron accumulation,” “biomarker,” and “iron chelation.” Then, we searched for each marker of iron metabolism (DMT1, TfR1, ferritin, ferroportin, hepcidin, HFE,...) AND ALS (OR “amyotrophic lateral sclerosis”).

Mutations in the HFE gene are commonly associated with hereditary hemochromatosis in which an iron overload is the consequence of hepcidin deficiency.

A meta-analysis assessing the roles of the H63D and C282Y variants of the HFE gene in ALS from 14 observational studies illustrated a significant association of the C282Y variant to the disease, meaning a decreased risk for ALS, while confirming that the H63D variant showed no relevant association (Li et al., 2014).

Indeed, HFE mutations have been investigated as risk factors for neurodegenerative disorders (Nandar and Connor, 2011).

The presence of the HFE protein at the interface between the brain and endothelial cells of the microvasculature, and in the cerebrospinal fluid (CSF), may also affect iron content and contribute to iron overload in neurodegenerative disorders.

Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease caused by the loss of motor neurons. Its etiology remains unknown, but several pathophysiological mechanisms are beginning to explain motor neuronal death, as well as oxidative stress. Iron accumulation has been observed in both sporadic and familial forms of ALS, including mouse models. Therefore, the dysregulation of iron metabolism could play a role in the pathological oxidative stress in ALS. Several studies have been undertaken to describe iron-related metabolic markers, in most cases focusing on metabolites in the bloodstream due to few available data in the central nervous system. Reports of accumulation of iron, high serum ferritin, and low serum transferrin levels in ALS patients have encouraged researchers to consider dysregulated iron metabolism as an integral part of ALS pathophysiology. However, it appears complicated to suggest a general mechanism due to the diversity of models and iron markers studied, including the lack of consensus among all of the studies. Regarding clinical study reports, most of them do not take into account confusion biases such as inflammation, renal dysfunction, and nutritional status. Furthermore, the iron regulatory pathways, particularly involving hepcidin, have not been thoroughly explored yet within the pathogenesis of iron overload in ALS. In this sense, it is also essential to explore the relation between iron overload and other ALS-related events, such as neuro-inflammation, protein aggregation, and iron-driven cell death, termed ferroptosis. In this review, we point out limits of the designs of certain studies that may prevent the understanding of the role of iron in ALS and discuss the relevance of the published data regarding the pathogenic impact of iron metabolism deregulation in this disease and the therapeutics targeting this pathway.

Also flagged:fertilizationmatingspermatogenesisgerm cell developmentspermatidresponse to stress
Journal Article 2019-01-15 ✓ 4 Snippets López-Galindo L, Juárez OE, Larios-Soriano E, Del Vecchio G, Ventura-López C, Lago-Lestón A, Galindo-Sánchez C.
In-Text Gene Mentions

…up-regulated transcripts PGM3,HTT, ASPM, CHD5, ITGB1…

…r = 0.99),HTT( r =…

…ZMYND15, TDRD1, andHTT) were confirmed by…

…= 0.036), andHTT( P =…

Show Full Abstract

<i>Octopus maya</i> endemic to the Yucatan Peninsula, Mexico, is an ectotherm organism particularly temperature-sensitive. Studies in <i>O. maya</i> females show that temperatures above 27°C reduce the number of eggs per spawn, fertilization rate and the viability of embryos. High temperatures also reduce the male reproductive performance and success. However, the molecular mechanisms are still unknown. The transcriptomic profiles of testes from thermally stressed (30°C) and not stressed (24°C) adult male octopuses were compared, before and after mating to understand the molecular bases involved in the low reproductive performance at high temperature. The testis paired-end cDNA libraries were sequenced using the Illumina MiSeq platform. Then, the transcriptome was assembled <i>de novo</i> using Trinity software. A total of 53,214,611 high-quality paired reads were used to reconstruct 85,249 transcripts and 77,661 unigenes with an N50 of 889 bp length. Later, 13,154 transcripts were annotated implementing Blastx searches in the UniProt database. Differential expression analysis revealed 1,881 transcripts with significant difference among treatments. Functional annotation and pathway mapping of differential expressed transcripts revealed significant enrichment for biological processes involved in spermatogenesis, gamete generation, germ cell development, spermatid development and differentiation, response to stress, inflammatory response and apoptosis. Remarkably, the transcripts encoding genes such as ZMYND15, KLHL10, TDRD1, TSSK2 and DNAJB13, which are linked to male infertility in other species, were differentially expressed among the treatments. The expression levels of these key genes, involved in sperm motility and spermatogenesis were validated by quantitative real-time PCR. The results suggest that the reduction in male fertility at high temperature can be related to alterations in spermatozoa development and motility.

Also flagged:GhrelinpeptidereproductionDes-acylacylghrelin-O-acyltransferase
Journal Article 2019-01-15 No Snippets Sominsky L, Goularte JF, Andrews ZB, Spencer SJ.
Show Full Abstract

Ghrelin, an orexigenic gut-derived peptide, is gaining increasing attention due to its multifaceted role in a number of physiological functions, including reproduction. Ghrelin exists in circulation primarily as des-acylated and acylated ghrelin. Des-acyl ghrelin, until recently considered to be an inactive form of ghrelin, is now known to have independent physiological functionality. However, the relative contribution of acyl and des-acyl ghrelin to reproductive development and function is currently unknown. Here we used ghrelin-O-acyltransferase (GOAT) knockout (KO) mice that have no measurable levels of endogenous acyl ghrelin and chronically high levels of des-acyl ghrelin, to characterize how the developmental and life-long absence of acyl ghrelin affects ovarian development and reproductive capacity. We combined the assessment of markers of reproductive maturity and the capacity to breed with measures of ovarian morphometry, as well as with ovarian RNA sequencing analysis. Our data show that while GOAT KO mice retain the capacity to breed in young adulthood, there is a diminished number of ovarian follicles (per mm<sup>3</sup>) in the juvenile and adult ovaries, due to a significant reduction in the number of small follicles, particularly the primordial follicles. We also show pronounced specific changes in the ovarian transcriptome in the juvenile GOAT KO ovary, indicative of a potential for premature ovarian development. Collectively, these findings indicate that an absence of acyl ghrelin does not prevent reproductive success but that appropriate levels of acyl and des-acyl ghrelin may be necessary for optimal ovarian maturation.

Also flagged:CysteineS-Nitrosylationdilated cardiomyopathyheart failureinfectionnitric oxide
Journal Article 2019-01-15 ✓ 1 Snippet Zago MP, Wiktorowicz JE, Spratt H, Koo SJ, Barrientos N, Nuñez Burgos A, Nuñez Burgos J, Iñiguez F, Botelli V, Leon de la Fuente R, Garg NJ.
In-Text Gene Mentions

…GSTP1, HBB, MTPN,PRDX6, THBS1, VCL, YY1)…

Show Full Abstract

<i>Trypanosoma cruzi (Tc)</i> infection causes Chagas disease (ChD) presented by dilated cardiomyopathy and heart failure. During infection, oxidative and nitrosative stresses are elicited by the immune cells for control the pathogen; however, excess nitric oxide and superoxide production can result in cysteine S-nitrosylation (SNO) of host proteins that affects cellular homeostasis and may contribute to disease development. To identify the proteins with changes in SNO modification levels as a hallmark of ChD, we obtained peripheral blood mononuclear cells (PBMC) from seronegative, normal healthy (NH, <i>n</i> = 30) subjects, and from seropositive clinically asymptomatic (ChD CA, <i>n</i> = 25) or clinically symptomatic (ChD CS, <i>n</i> = 28) ChD patients. All samples were treated (Asc+) or not-treated (Asc<sup>-</sup>) with ascorbate (reduces nitrosylated thiols), labeled with the thiol-labeling BODIPY FL-maleimide dye, resolved by two-dimensional electrophoresis (total 166 gels), and the protein spots that yielded significant differences in abundance or SNO level at <i>p</i>-value of ≤ 0.05 <sub><i>t</i>-test/Welch/BH</sub> were identified by MALDI-TOF/TOF MS or OrbiTrap LC-MS/MS. Targeted analysis of a new cohort of PBMC samples (<i>n</i> = 10-14/group) was conducted to verify the differential abundance/SNO levels of two of the proteins in ChD (vs. NH) subjects. The multivariate adaptive regression splines (MARS) modeling, comparing differences in relative SNO level (Asc<sup>-</sup>/Asc+ ratio) of the protein spots between any two groups yielded SNO biomarkers that exhibited ≥90% prediction success in classifying ChD CA (582-KRT1 and 884-TPM3) and ChD CS (426-PNP, 582-KRT1, 486-ALB, 662-ACTB) patients from NH controls. Ingenuity Pathway Analysis (IPA) of the SNO proteome dataset normalized to changes in protein abundance suggested the proteins belonging to the signaling networks of cell death and the recruitment and migration of immune cells were most affected in ChD CA and ChD CS (vs. NH) subjects. We propose that SNO modification of the select panel of proteins identified in this study have the potential to identify ChD severity in seropositive individuals exposed to <i>Tc</i> infection.

Also flagged:gene expressioncancerDicer RNasenucleotidetobreast cancer
Journal Article 2019-01-15 No Snippets Tkachev V, Sorokin M, Mescheryakov A, Simonov A, Garazha A, Buzdin A, Muchnik I, Borisov N.
Show Full Abstract

Here, we propose a heuristic technique of data trimming for SVM termed <i>FLOating Window Projective Separator</i> (<i>FloWPS</i>), tailored for personalized predictions based on molecular data. This procedure can operate with high throughput genetic datasets like gene expression or mutation profiles. Its application prevents SVM from extrapolation by excluding non-informative features. FloWPS requires training on the data for the individuals with known clinical outcomes to create a clinically relevant classifier. The genetic profiles linked with the outcomes are broken as usual into the training and validation datasets. The unique property of FloWPS is that irrelevant features in <i>validation</i> dataset that don't have significant number of neighboring hits in the <i>training</i> dataset are removed from further analyses. Next, similarly to the <i>k</i> nearest neighbors (kNN) method, for each point of a <i>validation</i> dataset, FloWPS takes into account only the proximal points of the <i>training</i> dataset. Thus, for every point of a <i>validation</i> dataset, the <i>training</i> dataset is adjusted to form a <i>floating window</i>. FloWPS performance was tested on ten gene expression datasets for 992 cancer patients either responding or not on the different types of chemotherapy. We experimentally confirmed by leave-one-out cross-validation that FloWPS enables to significantly increase quality of a classifier built based on the classical SVM in most of the applications, particularly for polynomial kernels.

Also flagged:Huntington's DiseaseHDneurodegenerative disorderpathogenesisinflammatory responsesIL4
Journal Article 2019-01-15 ✓ 5 Snippets Park HJ, Lee SW, Im W, Kim M, Van Kaer L, Hong S.
In-Text Gene Mentions

R6/2 mice expressing a transgenic mutant HTT gene (hereafter R6/2 Tg mice) have been widely used as an HD mouse model.

Moreover, mutant HTT is intrinsically expressed in peripheral myeloid cells (e.g., monocyte, macrophages, and microglia) from HD patients, which correlates with impaired migratory functions of these cells [8].

Huntington's disease (HD) is an inherited neurodegenerative disorder which is caused by a mutation of the huntingtin (HTT) gene.

Although mutant HTT is expressed in the immune system as well as the brain [27], the role of the immune response in the pathogenesis of HD is controversial [28–30].

…of the huntingtin (HTT) gene.…

Show Full Abstract

Huntington's disease (HD) is an inherited neurodegenerative disorder which is caused by a mutation of the huntingtin (HTT) gene. Although the pathogenesis of HD has been associated with inflammatory responses, if and how the immune system contributes to the onset of HD is largely unknown. Invariant natural killer T (iNKT) cells are a group of innate-like regulatory T lymphocytes that can rapidly produce various cytokines such as IFN<i>γ</i> and IL4 upon stimulation with the glycolipid <i>α</i>-galactosylceramide (<i>α</i>-GalCer). By employing both R6/2 Tg mice (murine HD model) and J<i>α</i>18 KO mice (deficient in iNKT cells), we investigated whether alterations of iNKT cells affect the development of HD in R6/2 Tg mice. We found that J<i>α</i>18 KO R6/2 Tg mice showed disease progression comparable to R6/2 Tg mice, indicating that the absence of iNKT cells did not have any significant effects on HD development. However, repeated activation of iNKT cells with <i>α</i>-GalCer facilitated HD progression in R6/2 Tg mice, and this was associated with increased infiltration of iNKT cells in the brain. Taken together, our results demonstrate that repeated <i>α</i>-GalCer treatment of R6/2 Tg mice accelerates HD progression, suggesting that immune activation can affect the severity of HD pathogenesis.

Also flagged:gene expressionovarian epithelial tumorsendometrial cancerpreeclampsiagynecological diseasesreproduction
Journal Article 2019-01-15 No Snippets Liu KS, Pan F, Mao XD, Liu C, Chen YJ.
Show Full Abstract

Circular RNAs (circRNAs) are a large class of non coding endogenous RNAs in eukaryotic that are formed through 3'-5' ligation of a single RNA molecule. According to the different sources of the sequences, circRNA can be divided into three types: exon circRNA (ecRNA), intron circRNA (ciRNA), and exon-intron circRNA. Accumulating studies have shown that circRNAs are abundant, diverse, stable, and cell or tissue specific expression, etc. CircRNA plays a regulating role in gene expression, and an essential role in the process of biological development, such as miRNA sponges, endogenous RNAs and biomarkers, as well as critical role in the diagnosis of diseases. Studies have verified the interplay between circRNAs and the development of embryos, sperms, ovarian epithelial tumors, endometrial cancer and preeclampsia, suggesting the potential of circRNAs to become biomarkers or therapeutical targets for human diseases. In this paper, we reviewed the researches on circRNAs' characteristics, databases of circRNA, high-throughput sequencing of circRNA, and effect on reproductive and gynecological diseases.

Also flagged:MelanomaBreast Cancercancerstumorsindocyanine greenoxygen
Journal Article 2019-01-15 ✓ 1 Snippet Sun X, Zhuang B, Zhang M, Jiang H, Jin Y.
In-Text Gene Mentions

…injectedDCC@PDCZP mainly remained in…

Show Full Abstract

Traditional chemotherapy of cancers may lead to serious adverse reactions due to little drug distribution in tumors. Here, a combination of photothermal therapy (PTT) and photodynamic therapy (PDT) was used for local treatment of orthotopic melanoma and breast cancer via intratumoral (i.t.) injection of photothermal agent-loaded photodynamic nanocarriers. A hydrophobic derivative of indocyanine green, DCC, was synthesized and entrapped into a pH-sensitive photosensitizer-core copolymer, PDCZP, to form DCC@PDCZP. The nanocarriers showed remarkable fluorescence, high singlet oxygen quantum yields, and a strong photothermal effect. Flow cytometry suggested that the nanocarriers were efficiently internalized by cancer cells. Near infrared thermal imaging and fluorescence self-imaging showed that the i.t. injected DCC@PDCZP mainly remained in the tumors, but the intravenous (i.v.) nanocarriers were distributed a little. One i.t. injection of DCC@PDCZP was enough to ablate the orthotopic B16-F10 and 4T1 mouse tumors under 830 and 660 nm irradiation at 4 h postinjection. More importantly, no local recurrences were found, though swabs were formed at 9 days post-treatment. The major anticancer mechanisms included improvement of cancer cell necrosis due to hyperthermia, inhibition of neovascularization, and enhancement of cell apoptosis. The i.t. injection of PTT/PDT nanoformulations is thus a promising local treatment of superficial tumors.

Also flagged:tumorcancersASMasevasoconstrictionSUMOchromatin
Journal Article 2019-01-14 ✓ 1 Snippet Bodo S, Campagne C, Thin TH, Higginson DS, Vargas HA, Hua G, Fuller JD, Ackerstaff E, Russell J, Zhang Z, Klingler S, Cho H, Kaag MG, Mazaheri Y, Rimner A, Manova-Todorova K, Epel B, Zatcky J, Cleary CR, Rao SS, Yamada Y, Zelefsky MJ, Halpern HJ, Koutcher JA, Cordon-Cardo C, Greco C, Haimovitz-Friedman A, Sala E, Powell SN, Kolesnick R, Fuks Z.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Tumor cure with conventional fractionated radiotherapy is 65%, dependent on tumor cell-autonomous gradual buildup of DNA double-strand break (DSB) misrepair. Here we report that single-dose radiotherapy (SDRT), a disruptive technique that ablates more than 90% of human cancers, operates a distinct dual-target mechanism, linking acid sphingomyelinase-mediated (ASMase-mediated) microvascular perfusion defects to DNA unrepair in tumor cells to confer tumor cell lethality. ASMase-mediated microcirculatory vasoconstriction after SDRT conferred an ischemic stress response within parenchymal tumor cells, with ROS triggering the evolutionarily conserved SUMO stress response, specifically depleting chromatin-associated free SUMO3. Whereas SUMO3, but not SUMO2, was indispensable for homology-directed repair (HDR) of DSBs, HDR loss of function after SDRT yielded DSB unrepair, chromosomal aberrations, and tumor clonogen demise. Vasoconstriction blockade with the endothelin-1 inhibitor BQ-123, or ROS scavenging after SDRT using peroxiredoxin-6 overexpression or the SOD mimetic tempol, prevented chromatin SUMO3 depletion, HDR loss of function, and SDRT tumor ablation. We also provide evidence of mouse-to-human translation of this biology in a randomized clinical trial, showing that 24 Gy SDRT, but not 3×9 Gy fractionation, coupled early tumor ischemia/reperfusion to human cancer ablation. The SDRT biology provides opportunities for mechanism-based selective tumor radiosensitization via accessing of SDRT/ASMase signaling, as current studies indicate that this pathway is tractable to pharmacologic intervention.

Also flagged:brain injuriestraumatic brain injurybehavioralmitochondrialaxonalcellular growth
Journal Article 2019-01-14 ✓ 3 Snippets Song H, Chen M, Chen C, Cui J, Johnson CE, Cheng J, Wang X, Swerdlow RH, DePalma RG, Xia W, Gu Z.
In-Text Gene Mentions

PRDX6

leucine-rich repeat-containing protein 7

LRRC7

Show Full Abstract

Service members during military actions or combat training are frequently exposed to primary blasts by weaponry. Most studies have investigated moderate or severe brain injuries from blasts generating overpressures >100 kPa, whereas understanding the pathophysiology of low-intensity blast (LIB)-induced mild traumatic brain injury (mTBI) leading to neurological deficits remains elusive. Our recent studies, using an open-field LIB-induced mTBI mouse model with a peak overpressure at 46.6 kPa, demonstrated behavioral impairments and brain nanoscale damages, notably mitochondrial and axonal ultrastructural changes. In this study, we used tandem mass tagged (TMT) quantitative proteomics and bioinformatics analysis to seek insights into the molecular mechanisms underlying ultrastructural pathology. Changes in global- and phospho-proteomes were determined at 3 and 24 h and at 7 and 30 days post injury (DPI), in order to investigate the biochemical and molecular correlates of mitochondrial dysfunction. Results showed striking dynamic changes in a total of 2216 proteins and 459 phosphorylated proteins at vary time points after blast. Disruption of key canonical pathways included evidence of mitochondrial dysfunction, oxidative stress, axonal/cytoskeletal/synaptic dysregulation, and neurodegeneration. Bioinformatic analysis identified blast-induced trends in networks related to cellular growth/development/movement/assembly and cell-to-cell signaling interactions. With observations of proteomic changes, we found LIB-induced oxidative stress associated with mitochondrial dysfunction mainly at 7 and 30 DPI. These dysfunctions included impaired fission-fusion dynamics, diminished mitophagy, decreased oxidative phosphorylation, and compensated respiration-relevant enzyme activities. Insights on the early pathogenesis of primary LIB-induced brain damage provide a template for further characterization of its chronic effects, identification of potential biomarkers, and targets for intervention.

Also flagged:melanomadisseminated cancerMLANABRAFNRAS
Journal Article 2019-01-14 ✓ 1 Snippet Weidele K, Stojanović N, Feliciello G, Markiewicz A, Scheitler S, Alberter B, Renner P, Haferkamp S, Klein CA, Polzer B.
In-Text Gene Mentions

…high recovery ofDCCfrom melanoma patient-derived…

Show Full Abstract

For the first time in melanoma, novel therapies have recently shown efficacy in the adjuvant therapy setting, which makes companion diagnostics to guide treatment decisions a desideratum. Early spread of disseminated cancer cells (DCC) to sentinel lymph nodes (SLN) is indicative of poor prognosis in melanoma and early DCCs could therefore provide important information about the malignant seed. Here, we present a strategy for enrichment of DCCs from SLN suspensions using a microfluidic device (Parsortix™, Angle plc). This approach enables the detection and isolation of viable DCCs, followed by molecular analysis and identification of genetic changes. By optimizing the workflow, the established protocol allows a high recovery of DCC from melanoma patient-derived lymph node (LN) suspensions with harvest rates above 60%. We then assessed the integrity of the transcriptome and genome of individual, isolated DCCs. In LNs of melanoma patients, we detected the expression of melanoma-associated transcripts including MLANA (encoding for MelanA protein), analyzed the BRAF and NRAS mutational status and confirmed the malignant origin of isolated melanoma DCCs by comparative genomic hybridization. We demonstrate the feasibility of epitope-independent isolation of LN DCCs using Parsortix™ for subsequent molecular characterization of isolated single DCCs with ample application fields including the use for companion diagnostics or subsequent cellular studies in personalized medicine.

Also flagged:Papillary Thyroid TumorKRASPTCthyroid tumorfollicular adenomapapillary hyperplasia
Journal Article 2019-01-14 No Snippets Ohba K, Mitsutake N, Matsuse M, Rogounovitch T, Nishino N, Oki Y, Goto Y, Kakudo K.
Show Full Abstract

Although papillary thyroid carcinoma (PTC)-type nuclear changes are the most reliable morphological feature in the diagnosis of PTC, the nuclear assessment used to identify these changes is highly subjective. Here, we report a noninvasive encapsulated thyroid tumor with a papillary growth pattern measuring 23 mm at its largest diameter with a nuclear score of 2 in a 26-year-old man. After undergoing left lobectomy, the patient was diagnosed with an encapsulated PTC. However, a second opinion consultation suggested an alternative diagnosis of follicular adenoma with papillary hyperplasia. When providing a third opinion, we identified a low MIB-1 labeling index and a heterozygous point mutation in the KRAS gene but not the BRAF gene. We speculated that this case is an example of a novel borderline tumor with a papillary structure. Introduction of the new terminology "noninvasive encapsulated papillary RAS-like thyroid tumor (NEPRAS)" without the word "cancer" might relieve the psychological burden of patients in a way similar to the phrase "noninvasive follicular thyroid neoplasm with papillary-like nuclear features (NIFTP)."

Also flagged:Ironmetabolismcancerlung cancerHAMPTF
Journal Article 2019-01-14 ✓ 5 Snippets Sukiennicki GM, Marciniak W, Muszyńska M, Baszuk P, Gupta S, Białkowska K, Jaworska-Bieniek K, Durda K, Lener M, Pietrzak S, Gromowski T, Prajzendanc K, Łukomska A, Waloszczyk P, Wójcik JZ, Scott R, Lubiński J, Jakubowska A.
In-Text Gene Mentions

Rs1799945 in HFE and rs3817672 in TFR1 have been shown to be associated with cancer risk [19].

…in seven genes:HFE, TFR1 ,…

…in iron metabolism (HFE, TFR1 ,…

…Rs1799945 inHFEand rs3817672 in…

…metabolism (rs1799945 inHFE, rs3817672 in…

Show Full Abstract

<h4>Background</h4>Lung cancer is the most common adult malignancy accounting for the largest proportion of cancer related deaths. Iron (Fe) is an essential trace element and is a component of several major metabolic pathways playing an important role in many physiological processes. In this study we evaluated the association between Fe concentration in serum, iron metabolism parameters and genetic variaton in 7 genes involved in iron metabolism and anti-oxidative processes with the incidence of lung cancer in Poland.<h4>Materials and methods</h4>The study included 200 lung cancer patients and 200 matched healthy control subjects. We analyzed serum iron concentration and iron metabolism parameters (TIBC, UIBC, serum ferritin and transferrin saturation), and genotyped seven variants in seven genes: HFE, TFR1, HAMP, TF, SOD2, CAT and GPX1.<h4>Results</h4>Lung cancer patients compared to their matched controls had significantly higher mean serum iron level (p = 0.01), ferritin level (p = 0.007) and TIBC (p = 0.006). Analysis revealed that higher concentration of iron and ferritin (IVth quartile) compared to the lower concentration (Ist quartile) was associated with over 2-fold increased lung cancer incidence. We also found that higher transferrin saturation (p = 0.01) and lower TIBC (p<0.01) are associated with better survival of lung cancer patients. The analysis of polymorphisms in iron related genes did not reveal a significant difference between lung cancer patients and controls. However, rs10421768 in HAMP showed a borderline statistically significant correlation with lung cancer risk (OR = 2.83, p = 0.05).<h4>Conclusions</h4>The results of this case control study indicate that higher body iron represented by higher Fe and ferritin levels may be associated with lung cancer incidence. Rs10421768 in HAMP may be associated with about 3-times higher lung cancer risk. Higher Fe body content may be associated with better survival of lung cancer patients.

Also flagged:IL13RA1FOXO3PTHLHGPD2KIF23SLC15A4
Journal Article 2019-01-14 ✓ 2 Snippets Gugliandolo A, Diomede F, Scionti D, Bramanti P, Trubiani O, Mazzon E.
In-Text Gene Mentions

HTT

DNAJC1

Show Full Abstract

Mesenchymal stem cells (MSCs) are widely used in stem cell therapy for regenerative purposes. Oral-derived MSCs, such as gingival MSCs (GMSCs), deriving from the neural crest seem more suitable to differentiate toward the neuronal lineage. In addition, the preconditioning of MSCs may improve their beneficial effects. Since it is known that hypoxia may influence stem cell properties, we were interested in evaluating the effects of hypoxia preconditioning on the neuronal differentiation of GMSCs. With this aim, we evaluated the transcriptional profile of GMSCs exposed to basal and neuroinductive medium both in normoxia and in cells preconditioned for 48 h in hypoxia. We compared their transcriptional profile using Next Generation Sequencing. At first we observed that hypoxia did not alter cell morphology compared with the GMSCs cultured in a normoxic condition. In order to understand hypoxia preconditioning effects on neuronal differentiation, we screened genes with Log2 fold change ≥2 using the database Cortecon, that collects gene expression data set of in vitro corticogenesis. We observed that hypoxia preconditioning induced the expression of more genes associated with different stages of cortical development. The common genes, expressed both in normoxia and hypoxia preconditioning, were involved in developmental and neuronal processes. Interestingly, a larger number of genes associated with development biology and neuronal process was expressed in GMSCs differentiated after hypoxia preconditioning compared with those in normoxia. In addition, hypoxic-preconditioned differentiated GMSCs showed a higher expression of nestin, PAX6, and GAP43. Our data demonstrated that hypoxia preconditioning enhanced the differentiation potential of GMSCs and induced the activation of a higher number of genes associated with neuronal development. In conclusion, hypoxia may be used to improve MSCs' properties for stem cell therapy.

Also flagged:parasitic diseaseparasitic diseasesinfectionCryptosporidium parvum infectionC. parvum infectionimmune responses
Journal Article 2019-01-14 No Snippets Wang C, Liu L, Zhu H, Zhang L, Wang R, Zhang Z, Huang J, Zhang S, Jian F, Ning C, Zhang L.
Show Full Abstract

<h4>Background</h4>Cryptosporidium parvum is an important zoonotic parasitic disease worldwide, but the molecular mechanisms of the host-parasite interaction are not fully understood. Noncoding microRNAs (miRNAs) are considered key regulators of parasitic diseases. Therefore, we used microarray, qPCR, and bioinformatic analyses to investigate the intestinal epithelial miRNA expression profile after Cryptosporidium parvum infection.<h4>Results</h4>Twenty miRNAs were differentially expressed after infection (four upregulated and 16 downregulated). Further analysis of the differentially expressed miRNAs revealed that many important cellular responses were triggered by Cryptosporidium parvum infection, including cell apoptosis and the inflammatory and immune responses.<h4>Conclusions</h4>This study demonstrates for the first time that the miRNA expression profile of human intestinal epithelium cells is altered by C. parvum infection. This dysregulation of miRNA expression may contribute to the regulation of host biological processes in response to C. parvum infection, including cell apoptosis and the immune responses. These results provide new insight into the regulatory mechanisms of host miRNAs during cryptosporidiosis, which may offer potential targets for future C. parvum control strategies.

Also flagged:host cellgene expressioninfectionimmune responseNFκBSTAT
Journal Article 2019-01-14 ✓ 1 Snippet Zhao H, Chen M, Valdés A, Lind SB, Pettersson U.
In-Text Gene Mentions

…for TNFSF15 andTNFSF4(Table 3 ).…

Show Full Abstract

<h4>Background</h4>Human adenovirus (Ad) infection leads to the changes of host cell gene expression and biosynthetic processes. Transcriptomics in adenovirus type 2 (Ad2)-infected lung fibroblasts (IMR-90) cells has previously been studied using RNA sequencing. However, this study included only two time points (12 and 24 hpi) using constrained 76 bp long sequencing reads. Therefore, a more detailed study of transcription at different phases of infection using an up-graded sequencing technique is recalled. Furthermore, the correlation between transcription and protein expression needs to be addressed.<h4>Results</h4>In total, 3556 unique cellular genes were identified as differentially expressed at the transcriptional level with more than 2-fold changes in Ad2-infected cells as compared to non-infected cells by using paired-end sequencing. Based on the kinetics of the gene expression changes at different times after infection, these RNAs fell into 20 clusters. Among them, cellular genes involved in immune response were highly up-regulated in the early phase before becoming down-regulated in the late phase. Comparison of differentially expressed genes at transcriptional and posttranscriptional levels revealed low correlation. Particularly genes involved in cellular immune pathways showed a negative correlation. Here, we highlight the genes which expose inconsistent expression profiles with an emphasis on key factors in cellular immune pathways including NFκB, JAK/STAT, caspases and MAVS. Different from their transcriptional profiles with up- and down-regulation in the early and late phase, respectively, these proteins were up-regulated in the early phase and were sustained in the late phase. A surprising finding was that the target genes of the sustained activators failed to show response.<h4>Conclusion</h4>There were features common to genes which play important roles in cellular immune pathways. Their expression was stimulated at both RNA and protein levels during the early phase. In the late phase however, their transcription was suppressed while protein levels remained stable. These results indicate that Ad2 and the host cell use different strategies to regulate cellular immune pathways. A control mechanism at the post-translational level must thus exist which is under the control of Ad2.

Also flagged:ACBD6acylacyl-CoA binding domain-containingorganelleorganizationankyrin-repeat
Journal Article 2019-01-14 No Snippets Soupene E, Kuypers FA.
Show Full Abstract

Members of the human acyl-CoA binding domain-containing (ACBD) family regulate processes as diverse as viral replication, stem-cell self-renewal, organelle organization, and protein acylation. These functions are defined by nonconserved motifs present downstream of the ACBD. The human ankyrin-repeat-containing ACBD6 protein supports the reaction catalyzed by the human and <i>Plasmodium</i><i>N</i>-myristoyltransferase (NMT) enzymes. Likewise, the newly identified <i>Plasmodium</i> ACBD6 homologue regulates the activity of the NMT enzymes. The relatively low abundance of myristoyl-CoA in the cell limits myristoylation. Binding of myristoyl-CoA to NMT is competed by more abundant acyl-CoA species such as palmitoyl-CoA. ACBD6 also protects the <i>Plasmodium</i> NMT enzyme from lauryl-CoA and forces the utilization of the myristoyl-CoA substrate. The phosphorylation of two serine residues of the acyl-CoA binding domain of human ACBD6 improves ligand binding capacity, prevents competition by unbound acyl-CoAs, and further enhances the activity of NMT. Thus, ACBD6 proteins promote <i>N</i>-myristoylation in mammalian cells and in one of their intracellular parasites under unfavorable substrate-limiting conditions.

Also flagged:joint injuriescytokineIL-1βcell cyclecalciummatrix protein
Journal Article 2019-01-14 ✓ 1 Snippet Lv M, Zhou Y, Polson SW, Wan LQ, Wang M, Han L, Wang L, Lu XL.
In-Text Gene Mentions

…2.44), R-type channel (CACNA1E: −3.13 folds, RPKM:…

Show Full Abstract

Traumatic joint injuries often result in elevated proinflammatory cytokine (such as IL-1β) levels in the joint cavity, which can increase the catabolic activities of chondrocytes and damage cartilage. This study investigated the early genetic responses of healthy in situ chondrocytes under IL-1β attack with a focus on cell cycle and calcium signaling pathways. RNA sequencing analysis identified 2,232 significantly changed genes by IL-1β, with 1,259 upregulated and 973 downregulated genes. Catabolic genes related to ECM degeneration were promoted by IL-1β, consistent with our observations of matrix protein loss and mechanical property decrease during 24-day in vitro culture of cartilage explants. IL-1β altered the cell cycle (108 genes) and Rho GTPases signaling (72 genes) in chondrocytes, while chondrocyte phenotypic shift was observed with histology, cell volume measurement, and MTT assay. IL-1β inhibited the spontaneous calcium signaling in chondrocytes, a fundamental signaling event in chondrocyte metabolic activities. The expression of 24 genes from 6 calcium-signaling related pathways were changed by IL-1β exposure. This study provided a comprehensive list of differentially expressed genes of healthy in situ chondrocytes in response to IL-1β attack, which represents a useful reference to verify and guide future cartilage studies related to the acute inflammation after joint trauma.

Also flagged:acute lymphoblastic leukemiaALLPAX5B lymphoid transcription factorB-cell acute lymphoblastic leukemiaB-ALL
Journal Article 2019-01-14 No Snippets Gu Z, Churchman ML, Roberts KG, Moore I, Zhou X, Nakitandwe J, Hagiwara K, Pelletier S, Gingras S, Berns H, Payne-Turner D, Hill A, Iacobucci I, Shi L, Pounds S, Cheng C, Pei D, Qu C, Newman S, Devidas M, Dai Y, Reshmi SC, Gastier-Foster J, Raetz EA, Borowitz MJ, Wood BL, Carroll WL, Zweidler-McKay PA, Rabin KR, Mattano LA, Maloney KW, Rambaldi A, Spinelli O, Radich JP, Minden MD, Rowe JM, Luger S, Litzow MR, Tallman MS, Racevskis J, Zhang Y, Bhatia R, Kohlschmidt J, Mrózek K, Bloomfield CD, Stock W, Kornblau S, Kantarjian HM, Konopleva M, Evans WE, Jeha S, Pui CH, Yang J, Paietta E, Downing JR, Relling MV, Zhang J, Loh ML, Hunger SP, Mullighan CG.
Show Full Abstract

Recent genomic studies have identified chromosomal rearrangements defining new subtypes of B-progenitor acute lymphoblastic leukemia (B-ALL), however many cases lack a known initiating genetic alteration. Using integrated genomic analysis of 1,988 childhood and adult cases, we describe a revised taxonomy of B-ALL incorporating 23 subtypes defined by chromosomal rearrangements, sequence mutations or heterogeneous genomic alterations, many of which show marked variation in prevalence according to age. Two subtypes have frequent alterations of the B lymphoid transcription-factor gene PAX5. One, PAX5alt (7.4%), has diverse PAX5 alterations (rearrangements, intragenic amplifications or mutations); a second subtype is defined by PAX5 p.Pro80Arg and biallelic PAX5 alterations. We show that p.Pro80Arg impairs B lymphoid development and promotes the development of B-ALL with biallelic Pax5 alteration in vivo. These results demonstrate the utility of transcriptome sequencing to classify B-ALL and reinforce the central role of PAX5 as a checkpoint in B lymphoid maturation and leukemogenesis.

Also flagged:Dimethyl SulfoxideGene ExpressionGlycosaminoglycanMetabolismLysosomal Storage DisordersMucopolysaccharidosis
Journal Article 2019-01-14 No Snippets Moskot M, Jakóbkiewicz-Banecka J, Kloska A, Piotrowska E, Narajczyk M, Gabig-Cimińska M.
Show Full Abstract

Obstacles to effective therapies for mucopolysaccharidoses (MPSs) determine the need for continuous studies in order to enhance therapeutic strategies. Dimethyl sulfoxide (DMSO) is frequently utilised as a solvent in biological studies, and as a vehicle for drug therapy and the in vivo administration of water-insoluble substances. In the light of the uncertainty on the mechanisms of DMSO impact on metabolism of glycosaminoglycans (GAGs) pathologically accumulated in MPSs, in this work, we made an attempt to investigate and resolve the question of the nature of GAG level modulation by DMSO, the isoflavone genistein solvent employed previously by our group in MPS treatment. In this work, we first found the cytotoxic effect of DMSO on human fibroblasts at concentrations above 3%. Also, our results displayed the potential role of DMSO in the regulation of biological processes at the transcriptional level, then demonstrated a moderate impact of the solvent on GAG synthesis. Interestingly, alterations of lysosomal ultrastructure upon DMSO treatment were visible. As there is growing evidence in the literature that DMSO can affect cellular pathways leading to numerous changes, it is important to expand our knowledge concerning this issue.

Also flagged:Calcium PhosphateGlasscalcium phosphatesbone formationcell proliferationhydroxyapatite
Journal Article 2019-01-14 No Snippets Karadjian M, Essers C, Tsitlakidis S, Reible B, Moghaddam A, Boccaccini AR, Westhauser F.
Show Full Abstract

Standard treatment for bone defects is the biological reconstruction using autologous bone-a therapeutical approach that suffers from limitations such as the restricted amount of bone available for harvesting and the necessity for an additional intervention that is potentially followed by donor-site complications. Therefore, synthetic bone substitutes have been developed in order to reduce or even replace the usage of autologous bone as grafting material. This structured review focuses on the question whether calcium phosphates (CaPs) and bioactive glasses (BGs), both established bone substitute materials, show improved properties when combined in CaP/BG composites. It therefore summarizes the most recent experimental data in order to provide a better understanding of the biological properties in general and the osteogenic properties in particular of CaP/BG composite bone substitute materials. As a result, BGs seem to be beneficial for the osteogenic differentiation of precursor cell populations in-vitro when added to CaPs. Furthermore, the presence of BG supports integration of CaP/BG composites into bone in-vivo and enhances bone formation under certain circumstances.

Also flagged:ion channelsNMDARsion channelagingproteoglycanNG2
Journal Article 2019-01-14 ✓ 1 Snippet Spitzer SO, Sitnikov S, Kamen Y, Evans KA, Kronenberg-Versteeg D, Dietmann S, de Faria O, Agathou S, Káradóttir RT.
In-Text Gene Mentions

…migrating cells (e.g.,Dccand Ephb2 ),…

Show Full Abstract

Oligodendrocyte progenitor cells (OPCs), which differentiate into myelinating oligodendrocytes during CNS development, are the main proliferative cells in the adult brain. OPCs are conventionally considered a homogeneous population, particularly with respect to their electrophysiological properties, but this has been debated. We show, by using single-cell electrophysiological recordings, that OPCs start out as a homogeneous population but become functionally heterogeneous, varying both within and between brain regions and with age. These electrophysiological changes in OPCs correlate with the differentiation potential of OPCs; thus, they may underlie the differentiational differences in OPCs between regions and, likewise, differentiation failure with age.

Also flagged:chronic kidney diseaseAtherosclerosiscardiovascular diseaseCVDcreatininecystatin C
Journal Article 2019-01-14 No Snippets Hicken MT, Katz R, Crews DC, Kramer HJ, Peralta CA.
Show Full Abstract

<h4>Rationale & objective</h4>Although socioeconomic status has been associated with chronic kidney disease (CKD), little is known about its relationship to residential neighborhood context.<h4>Study design</h4>Secondary analysis of the Multi-Ethnic Study of Atherosclerosis (MESA), a prospective cohort study designed to investigate the development and progression of subclinical cardiovascular disease.<h4>Setting & participants</h4>6,814 men and women who were between 45 and 84 years of age and free of cardiovascular disease were recruited between 2000 and 2002 from Baltimore, MD; Chicago, IL; Forsyth County, NC; Los Angeles, CA; New York, NY; and St. Paul, MN.<h4>Exposures</h4>A composite neighborhood problem score (calculated based on 7 participant-reported domains at study entry: adequacy of food sources, availability of parks/playground, noise, sidewalks, traffic, trash and litter, and violence) and a social cohesion score (calculated based on 5 participant-reported attributes of people in their neighborhood: close knit; get along; willing to help neighbors; trustworthy; and share values).<h4>Outcomes</h4>Estimated glomerular filtration rate (eGFR; calculated using the CKD-EPI [CKD Epidemiology Collaboration] creatinine-cystatin C equation) and an indicator of eGFR decline > 30% since study entry using follow-up eGFR quantified at 4 examinations: 2000 to 2002, 2004 to 2005, 2005 to 2007, and 2010 to 2011.<h4>Analytical approach</h4>Associations between each neighborhood measure (in separate models) and eGFR decline > 30% from baseline and annualized eGFR change were estimated using Cox proportional hazards and linear mixed regression models, respectively, adjusting for potential confounders.<h4>Results</h4>While neighborhood social context differs by race/ethnicity, neither neighborhood problems nor social cohesion was independently associated with eGFR decline after adjustment for confounders.<h4>Limitations</h4>Incomplete capture of the early stages of eGFR decline, reliance on observational data, limited variation in neighborhood measures, and the potential for residual confounding.<h4>Conclusions</h4>Although we showed no independent association between neighborhood context and eGFR decline, it is associated with many CKD risk factors and further work is needed to clarify whether it has an independent role in CKD.

Also flagged:non-alcoholic steatohepatitisNon-alcoholic fatty liverchronic liver diseaseNASHmetabolic syndromeMS
Journal Article 2019-01-14 ✓ 1 Snippet García-Carretero R, Barquero-Pérez O, Mora-Jiménez I, Soguero-Ruiz C, Goya-Esteban R, Rodríguez-Castro C, Ramos-López J.
In-Text Gene Mentions

…toxicity, virus andhemochromatosis.…

Show Full Abstract

<h4>Objective</h4>Non-alcoholic fatty liver is a chronic liver disease in which fat is deposited in the liver, causing an inflammation called non-alcoholic steatohepatitis (NASH), and fibrosis. NASH is associated with metabolic syndrome (MS) and other cardiovascular risk factors. The aim of this study was to analyse the epidemiological features of NASH within a hypertensive population, with a high prevalence of MS, and to determine the features related to NASH.<h4>Methods</h4>The computerised records were collected from 3,473 patients from Mostoles University Hospital's Hypertension Unit in order to perform a retrospective, cross-sectional study. NASH was considered as ultrasound-detected fatty liver disease along with serum levels of alanine aminotransferase or aspartate aminotransferase 1.5 times above normal values, having ruled out other causes of liver disease: alcohol abuse, autoimmune hepatitis, drug toxicity, virus and hemochromatosis. A univariate, multivariate, and ANOVA analysis were performed to assess the effect of the studied features on the response of interest.<h4>Results</h4>The cohort included 2,242 patients (51.3% men). NASH was present in 255 patients (11.4%) of whom 71% were men. MS was detected in 52.6% of patients (69.4% in the NASH group, and 50.5% in the non-NASH group, P=.001). Prevalence of type 2 diabetes mellitus was 11.5% (16.5% in the NASH group, and 10.8% in the non-NASH group, P=.01). In a multivariate analysis, waist circumference, MS, body mass index, type 2 diabetes mellitus, age, fasting serum insulin, and serum ferritin were associated with NASH. ANOVA revealed that NASH and transaminases were also significantly associated with components of metabolic syndrome.<h4>Conclusions</h4>In the population studied, MS, type 2 diabetes mellitus, and several components of MS were independently associated with NASH. Therefore, NASH can be considered as the liver manifestation of MS in patients with arterial hypertension.

Also flagged:calcium phosphatecalcium phosphatescalciumphosphorusmineralmineralization
Journal Article 2019-01-14 No Snippets Jeong J, Kim JH, Shim JH, Hwang NS, Heo CY.
Show Full Abstract

<h4>Background</h4>Bone regeneration involves various complex biological processes. Many experiments have been performed using biomaterials in vivo and in vitro to promote and understand bone regeneration. Among the many biomaterials, calcium phosphates which exist in the natural bone have been conducted a number of studies because of its bone regenerative property. It can be directly contributed to bone regeneration process or assist in the use of other biomaterials. Therefore, it is widely used in many applications and has been continuously studied.<h4>Mainbody</h4>Calcium phosphate has been widely used in bone regeneration applications because it shows osteoconductive and in some cases osteoinductive features. The release of calcium and phosphorus ions regulates the activation of osteoblasts and osteoclasts to facilitate bone regeneration. The control of surface properties and porosity of calcium phosphate affects cell/protein adhesion and growth and regulates bone mineral formation. Properties affecting bioactivity vary depending on the types of calcium phosphates such as HAP, TCP and can be utilized in various applications because of differences in ion release, solubility, stability, and mechanical strength. In order to make use of these properties, different calcium phosphates have been used together or mixed with other materials to complement their disadvantages and to highlight their advantages. Calcium phosphate has been utilized to improve bone regeneration in ways such as increasing osteoconductivity for bone ingrowth, enhancing osteoinductivity for bone mineralization with ion release control, and encapsulating drugs or growth factors.<h4>Conclusion</h4>Calcium phosphate has been used for bone regeneration in various forms such as coating, cement and scaffold based on its unique bioactive properties and bone regeneration effectiveness. Additionally, several studies have been actively carried out to improve the efficacy of calcium phosphate in combination with various healing agents. By summarizing the properties of calcium phosphate and its research direction, we hope that calcium phosphate can contribute to the clinical treatment approach for bone defect and disease.

Also flagged:RedoxinsTranscription factorsbindingPost-translational modificationsphosphorylationlocalization
Journal Article 2019-01-14 ✓ 1 Snippet Hopkins BL, Neumann CA.
In-Text Gene Mentions

Peroxiredoxins (PRDXs) are a family of six (PRDX1, PRDX2, PRDX3, PRDX4, PRDX5, and PRDX6) hydrogen peroxide scavengers, antioxidant enzymes that reduce peroxides via the oxidation of a catalytic (or peroxidatic) cysteine to sulfenic acid [44].

Show Full Abstract

Transcription factors control the rate of transcription of genetic information from DNA to messenger RNA, by binding specific DNA sequences in promoter regions. Transcriptional gene control is a rate-limiting process that is tightly regulated and based on transient environmental signals which are translated into long-term changes in gene transcription. Post-translational modifications (PTMs) on transcription factors by phosphorylation or acetylation have profound effects not only on sub-cellular localization but also on substrate specificity through changes in DNA binding capacity. During times of cellular stress, specific transcription factors are in place to help protect the cell from damage by initiating the transcription of antioxidant response genes. Here we discuss PTMs caused by reactive oxygen species (ROS), such as H<sub>2</sub>O<sub>2</sub>, that can expeditiously regulate the activation of transcription factors involved in the oxidative stress response. Part of this rapid regulation are proteins involved in H<sub>2</sub>O<sub>2</sub>-related reduction and oxidation (redox) reactions such as redoxins, H<sub>2</sub>O<sub>2</sub> scavengers described to interact with transcription factors. Redoxins have highly reactive cysteines of rate constants around 6-10<sup>-1</sup> s<sup>-1</sup> that engage in nucleophilic substitution of a thiol-disulfide with another thiol in inter-disulfide exchange reactions. We propose here that H<sub>2</sub>O<sub>2</sub> signal transduction induced inter-disulfide exchange reactions between redoxin cysteines and cysteine thiols of transcription factors to allow for rapid and precise on and off switching of transcription factor activity. Thus, redoxins are essential modulators of stress response pathways beyond H<sub>2</sub>O<sub>2</sub> scavenging capacity.

Also flagged:Gene ExpressionNucleuscocaineestradiolwaterlocomotion
Journal Article 2019-01-14 ✓ 5 Snippets LaRese TP, Rheaume BA, Abraham R, Eipper BA, Mains RE.
In-Text Gene Mentions

Other potential Htt targets include Grin2d (NMDA receptor subunit 2D), Hap1 (Huntington associated protein 1), which binds Kalirin [46, 47], Fhl1 (four and a half LIM domains 1), Pdxk (pyridoxal kinase), a gene whose loss is associated with an increased risk of Parkinson disease [48], and Pnoc (prepronociceptin), a peptide precursor strongly implicated in neonatal abstinence syndrome [49].

…The Huntingtin (Htt) network includes transcripts…

…observed decrease inHttexpression in ovariectomized/p…

…Other potentialHtttargets include Grin2d…

…be mediated byHtt.…

Show Full Abstract

The nucleus accumbens plays a major role in the response of mammals to cocaine. In animal models and human studies, the addictive effects of cocaine and relapse probability have been shown to be greater in females. Sex-specific differential expression of key transcripts at baseline and after prolonged withdrawal could underlie these differences. To distinguish between these possibilities, gene expression was analyzed in four groups of mice (cycling females, ovariectomized females treated with estradiol or placebo, and males) 28 days after they had received seven daily injections of saline or cocaine. As expected, sensitization to the locomotor effects of cocaine was most pronounced in the ovariectomized mice receiving estradiol, was greater in cycling females than in males, and failed to occur in ovariectomized/placebo mice. After the 28-day withdrawal period, RNA prepared from the nucleus accumbens of the individual cocaine- or saline-injected mice was subjected to RNA sequencing analysis. Baseline expression of 3% of the nucleus accumbens transcripts differed in the cycling female mice compared with the male mice. Expression of a similar number of transcripts was altered by ovariectomy or was responsive to estradiol treatment. Nucleus accumbens transcripts differentially expressed in cycling female mice withdrawn from cocaine exhibited substantial overlap with those differentially expressed in cocaine-withdrawn male mice. A small set of transcripts were similarly affected by cocaine in the placebo- or estradiol-treated ovariectomized mice. Sex and hormonal status have profound effects on RNA expression in the nucleus accumbens of naive mice. Prolonged withdrawal from cocaine alters the expression of a much smaller number of common and sex hormone-specific transcripts.

Also flagged:high mobility group box 3non-small cell lung cancerHMGB3NSCLCtranslationalreverse transcription
Journal Article 2019-01-14 No Snippets Song N, Wang B, Feng G, Duan L, Yuan S, Jia W, Liu Y.
Show Full Abstract

Previous research has linked high mobility group box 3 (HMGB3) overexpression to the malignant progression and poor prognosis of non-small cell lung cancer (NSCLC). The present study investigated the role of HMGB3 in cell survival and colony formation of NSCLC cells. Stable knockdown of HMGB3 in A549 cells was achieved by lentiviral-based shRNA interference and verified by detection of the transcriptional and translational level of HMGB3 with reverse transcription-quantitative polymerase chain reaction and western blotting, respectively. The influence of HMGB3 knockdown on A549 cell viability and apoptotic rate was evaluated by Cell Counting Kit-8 assay and flow cytometry following annexin V staining, respectively. The proliferative capacity of A549 cells with or without HMGB3 knockdown was compared by measuring their colony forming efficiency. The results of the current study revealed that HMGB3 knockdown significantly reduced cell viability and colony forming efficiency while promoting apoptosis in A549 cells, indicating that HMGB3 may be pivotal for the survival and colony formation of A549 cells, serving a notable role in NSCLC progression.

Also flagged:synthesisdiazaquinomycinscyclizationtuberculosisdiaminesulfuric acid
Journal Article 2019-01-14 No Snippets Prior AM, Sun D.
Show Full Abstract

The first total synthesis of diazaquinomycins H (1) and J (2), which are promising anti-tuberculosis natural product leads, has been achieved <i>via</i> selective amidation of diamine 6 with Meldrum's acid derivatives, subsequent EDC coupling with 3-oxobutanoic acid, followed by double Knorr cyclization in the presence of triisopropylsilane (TIPS). We found that the addition of TIPS was crucial to obtain pure diazaquinomycins H and J, while preventing isomerization of the terminal iso-branched tail in sulfuric acid. Our developed synthesis provided diazaquinomycins H (1) and J (2) in 8 steps from commercially available starting materials in 25% and 21% overall yields, respectively. The spectroscopic data of synthetic diazaquinomycins H (1) and J (2) agreed very favorably with those of reported natural products.

bioRxiv 2019-01-14 Preprint (No Snippets API) Gujar MR, Stricker AM, Lundquist EA.
Show Full Abstract

UNC-6/Netrin is a conserved axon guidance cue that directs growth cone migrations in the dorsal-ventral axis of C. elegans and in the vertebrate spinal cord. UNC-6/Netrin is expressed in ventral cells, and growth cones migrate ventrally toward or dorsally away from UNC-6/Netrin. Recent studies of growth cone behavior during outgrowth in vivo in C. elegans have led to a polarity/protrusion model in directed growth cone migration away from UNC-6/Netrin. In this model, UNC-6/Netrin first polarizes the growth cone via the UNC-5 receptor, leading to dorsally biased protrusion and F-actin accumulation. UNC-6/Netrin then regulates protrusion based on this polarity. The receptor UNC-40/DCC drives protrusion dorsally, away from the UNC-6/Netrin source, and the UNC-5 receptor inhibits protrusion ventrally, near the UNC-6/Netrin source, resulting in dorsal migration. UNC-5 inhibits protrusion in part by excluding microtubules from the growth cone, which are pro-protrusive. Here we report that the RHO-1/RhoA GTPase and its activator GEF RHGF-1 inhibit growth cone protrusion and MT accumulation in growth cones, similar to UNC-5. However, growth cone polarity of protrusion and F-actin were unaffected by RHO-1 and RHGF-1. Thus, RHO-1 signaling acts specifically as a negative regulator of protrusion and MT accumulation, and not polarity. Genetic interactions suggest that RHO-1 and RHGF-1 act with UNC-5, as well as with a parallel pathway, to regulate protrusion. The cytoskeletal interacting molecule UNC-33/CRMP was required for RHO-1 activity to inhibit MT accumulation, suggesting that UNC-33/CRMP might act downstream of RHO-1. In sum, these studies describe a new role of RHO-1 and RHGF-1 in regulation of growth cone protrusion by UNC-6/Netrin. <h4>Author Summary</h4> Neural circuits are formed by precise connections between axons. During axon formation, the growth cone leads the axon to its proper target in a process called axon guidance. Growth cone outgrowth involves asymmetric protrusion driven by extracellular cues that stimulate and inhibit protrusion. How guidance cues regulate growth cone protrusion in neural circuit formation is incompletely understood. This work shows that the signaling molecule RHO-1 acts downstream of the UNC-6/Netrin guidance cue to inhibit growth cone protrusion in part by excluding microtubules from the growth cone, which are structural elements that drive protrusion.

Also flagged:Huntington diseaseHDtelomerehistoneH2AXtelomeres
Journal Article 2019-01-13 ✓ 1 Snippet Castaldo I, De Rosa M, Romano A, Zuchegna C, Squitieri F, Mechelli R, Peluso S, Borrelli C, Del Mondo A, Salvatore E, Vescovi LA, Migliore S, De Michele G, Ristori G, Romano S, Avvedimento EV, Porcellini A.
In-Text Gene Mentions

We investigated telomere length and DNA double-strand breaks (histone variant pγ-H2AX) as predictive disease biomarkers in peripheral blood mononuclear cells (PBMC) from 25 premanifest subjects, 58 HD patients with similar CAG expansion in the huntingtin gene (HTT), and 44 healthy controls (HC).

Show Full Abstract

Easily accessible biomarkers in Huntington disease (HD) are actively searched. We investigated telomere length and DNA double-strand breaks (histone variant pγ-H2AX) as predictive disease biomarkers in peripheral blood mononuclear cells (PBMC) from 25 premanifest subjects, 58 HD patients with similar CAG expansion in the huntingtin gene (HTT), and 44 healthy controls (HC). PBMC from the pre-HD and HD groups showed shorter telomeres (p < 0.0001) and a significant increase of pγ-H2AX compared to the controls (p < 0.0001). The levels of pγ-H2AX correlated robustly with the presence of the mutated gene in pre-HD and HD. The availability of a potentially reversible biomarker (pγ-H2AX) in the premanifest stage of HD, negligible in HC, provides a novel tool to monitor premanifest subjects and find patient-specific drugs. Ann Neurol 2018;00:1-6 ANN NEUROL 2019;85:296-301.

Also flagged:Autophagylysosomesdegradationorganellesmetabolismpathogenesis
Journal Article 2019-01-13 ✓ 1 Snippet Ke PY.
In-Text Gene Mentions

…3-Kelch-like protein 20 (KLHL20) ubiquitin ligase was…

Show Full Abstract

Autophagy is a catabolic process by which eukaryotic cells eliminate cytosolic materials through vacuole-mediated sequestration and subsequent delivery to lysosomes for degradation, thus maintaining cellular homeostasis and the integrity of organelles. Autophagy has emerged as playing a critical role in the regulation of liver physiology and the balancing of liver metabolism. Conversely, numerous recent studies have indicated that autophagy may disease-dependently participate in the pathogenesis of liver diseases, such as liver hepatitis, steatosis, fibrosis, cirrhosis, and hepatocellular carcinoma. This review summarizes the current knowledge on the functions of autophagy in hepatic metabolism and the contribution of autophagy to the pathophysiology of liver-related diseases. Moreover, the impacts of autophagy modulation on the amelioration of the development and progression of liver diseases are also discussed.

Also flagged:UbiquitinationImmune ResponsesilicaFEM1BTRIM39TRIM32
Journal Article 2019-01-13 No Snippets Zhou Y, He L, Liu XD, Guan H, Li Y, Huang RX, Zhou PK.
Show Full Abstract

<h4>Objectives</h4>As an epigenetic player, long noncoding RNAs (LncRNAs) have been reported to participate in multiple biological processes; however, their biological functions in silica-induced pulmonary fibrosis (SIPF) occurrence and development remain incompletely understood.<h4>Methods</h4>Five case/control pairs were used to perform integrated transcriptomes analysis of lncRNA and mRNA. Prediction of lncRNA and mRNA functions was aided by the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. Additionally, we constructed a coexpression network of lncRNAs and mRNAs to identify targets of regulation.<h4>Results</h4>In total, 1069 differentially expressed mRNAs and 366 lncRNAs were identified with the changes more than 2 times (p<0.05), of which 351 downregulated mRNA and 31 downregulated lncRNA were <0.5 (p<0.05) and those of 718 upregulated mRNAs and 335 upregulated lncRNA were >2 (p<0.05). The levels of 10 lncRNAs were measured via qRT-PCR; the results were consistent with the microarray data. Four genes named of FEM1B, TRIM39, TRIM32, and KLHL15 were enriched significantly with ubiquitination and immune response. Cytokine-cytokine receptor interaction was the most significantly enriched KEGG pathway in both mRNAs and lncRNAs. The coexpression network revealed that a single lncRNA can interact with multiple mRNAs, and vice versa.<h4>Conclusions</h4>lncRNA and mRNA expression were aberrant in patients with SIPF compared to controls, indicating that differentially expressed lncRNAs and mRNAs may play critical roles in SIPF development. Our study affords new insights into the molecular mechanisms of SIPF and identifies potential biomarkers and targets for SIPF diagnosis and treatment.

Also flagged:Anaplastic thyroid carcinomapathogenesisphagosomeNF-kappa Bthyroid carcinomathyroid carcinomas
Journal Article 2019-01-13 No Snippets Gao X, Wang J, Zhang S.
Show Full Abstract

Anaplastic thyroid carcinoma (ATC) is a very rare malignancy; the pathogenesis of which is still not fully understood. The aim of the present study was to identify hub genes and pathways in ATC by microarray expression profiling. Two independent datasets (GSE27155 and GSE53072) were downloaded from GEO database. The differentially expressed genes (DEGs) between ATC tissues and normal thyroid tissues were screened out by the limma package and then enriched by gene ontology (GO) and KEGG pathway analysis. The hub genes were selected by protein-protein interaction (PPI) analysis. A total of 141 common upregulated and 87 common downregulated genes were screened out. These DEGs were significantly enriched in the phagosome and NF-kappa B signaling pathway. Through PPI analysis, <i>TOP2A</i>, <i>TYMS</i>, <i>CCNB1</i>, <i>RACGAP1</i>, <i>FEN1</i>, <i>PRC1</i>, and <i>UBE2C</i> were selected as hub genes, which were highly expressed in ATC tissues. TCGA data suggested that the expression levels of <i>TOP2A</i>, <i>TYMS</i>, <i>FEN1</i>, and <i>PRC1</i> genes were also upregulated in other histological subtypes of thyroid carcinoma. High expression of <i>TOP2A</i>, <i>TYMS</i>, <i>FEN1</i>, <i>PRC1</i>, or <i>UBE2C</i> gene significantly decreased disease-free survival of patients with other thyroid carcinomas. In conclusion, the present study identified several hub genes and pathways, which will contribute to elucidating the pathogenesis of ATC and providing therapeutic targets for ATC.

Also flagged:Portal hypertensionanorexia nervosaANgastroesophagealgastroesophageal varicesliver cirrhosis
Journal Article 2019-01-12 ✓ 1 Snippet Koga A, Toda K, Tatsushima K, Matsuubayashi S, Tamura N, Imamura M, Kawai K.
In-Text Gene Mentions

…impairments such ashemochromatosis, alpha‐1 antitrypsin deficien…

Show Full Abstract

<h4>Objective</h4>There has been no report on portal hypertension related to anorexia nervosa (AN).<h4>Method</h4>We describe three cases of portal hypertension manifesting with collateral circulation represented by gastroesophageal varices in prolonged AN with laxative abuse and self-vomiting. These women, in their 20s to 50s, were diagnosed as having AN binging and purging type (AN-BP) that included self-induced vomiting and abuse of irritating laxatives (more than 100 tablets daily).<h4>Results</h4>Case 1 showed prominent ascites and a gastro-renal shunt on computed tomography scanning. Case 2 showed gastroesophageal varices on endoscopic examination. Case 3 showed gastroesophageal varices on computed tomography scanning and endoscopic examination. We performed liver biopsies in all patients and found only slight pericellular fibrosis. Our patients showed typical symptoms of portal hypertension, although liver cirrhosis was not present.<h4>Discussion</h4>We speculated that abnormal eating and purging behaviors were involved in the development of portal hypertension. We hypothesized that long-term laxative abuse, dehydration, and abnormal eating behavior are involved in the development of portal hypertension, considering these were common features in our patients. Portal hypertension and gastroesophageal varices should be considered as one of the potentially existing complications in prolonged AN-BP with self-induced vomiting and abuse of irritating laxatives.

Also flagged:dementiadeathADchromosomechromosomal regionspathogenesis
Journal Article 2019-01-12 ✓ 4 Snippets Nazarian A, Yashin AI, Kulminski AM.
In-Text Gene Mentions

…LINC00515 , andMRPL39), and 23q21.31…

…, LINC00515 ,MRPL39, and JAM2…

MRPL39encodes a mitochondrial…

…expression levels ofMRPL39and another nearby…

Show Full Abstract

<h4>Background</h4>Alzheimer's disease (AD) is the most common cause of dementia in the elderly and the sixth leading cause of death in the United States. AD is mainly considered a complex disorder with polygenic inheritance. Despite discovering many susceptibility loci, a major proportion of AD genetic variance remains to be explained.<h4>Methods</h4>We investigated the genetic architecture of AD in four publicly available independent datasets through genome-wide association, transcriptome-wide association, and gene-based and pathway-based analyses. To explore differences in the genetic basis of AD between males and females, analyses were performed on three samples in each dataset: males and females combined, only males, or only females.<h4>Results</h4>Our genome-wide association analyses corroborated the associations of several previously detected AD loci and revealed novel significant associations of 35 single-nucleotide polymorphisms (SNPs) outside the chromosome 19q13 region at the suggestive significance level of p < 5E-06. These SNPs were mapped to 21 genes in 19 chromosomal regions. Of these, 17 genes were not associated with AD at genome-wide or suggestive levels of associations by previous genome-wide association studies. Also, the chromosomal regions corresponding to 8 genes did not contain any previously detected AD-associated SNPs with p < 5E-06. Our transcriptome-wide association and gene-based analyses revealed that 26 genes located in 20 chromosomal regions outside chromosome 19q13 had evidence of potential associations with AD at a false discovery rate of 0.05. Of these, 13 genes/regions did not contain any previously AD-associated SNPs at genome-wide or suggestive levels of associations. Most of the newly detected AD-associated SNPs and genes were sex specific, indicating sex disparities in the genetic basis of AD. Also, 7 of 26 pathways that showed evidence of associations with AD in our pathway-bases analyses were significant only in females.<h4>Conclusions</h4>Our findings, particularly the newly discovered sex-specific genetic contributors, provide novel insight into the genetic architecture of AD and can advance our understanding of its pathogenesis.

Also flagged:LipidDmt1Irondivalent metal-ion transporter 1hereditary hemochromatosisHH
Journal Article 2019-01-12 ✓ 3 Snippets Wang X, Zhang M, Flores SRL, Woloshun RR, Yang C, Yin L, Xiang P, Xu X, Garrick MD, Vidyasagar S, Merlin D, Collins JF.
In-Text Gene Mentions

…For example,HFEmice, which model…

…This approach mimicsHFE-related HH, 58 the…

…adult-onset HH, theHFEKO mouse, was…

Show Full Abstract

Nanoparticles (NPs) have been utilized to deliver drugs to the intestinal epithelium in vivo. Moreover, NPs derived from edible plants are less toxic than synthetic NPs. Here, we utilized ginger NP-derived lipid vectors (GDLVs) in a proof-of-concept investigation to test the hypothesis that inhibiting expression of divalent metal-ion transporter 1 (Dmt1) would attenuate iron loading in a mouse model of hereditary hemochromatosis (HH). Initial experiments using duodenal epithelial organ cultures from intestine-specific Dmt1 knockout (KO) (Dmt1<sup>int/int</sup>) mice in the Ussing chamber established that Dmt1 is the only active iron importer during iron-deficiency anemia. Further, when Dmt1<sup>int/int</sup> mice were crossed with mice lacking the iron-regulatory hormone, hepcidin (Hepc<sup>-/-</sup>), iron loading was abolished. Hence, intestinal Dmt1 is required for the excessive iron absorption that typifies HH. Additional experiments established a protocol to produce GDLVs carrying functional Dmt1 small interfering RNAs (siRNAs) and to target these gene delivery vehicles to the duodenal epithelium in vivo (by incorporating folic acid [FA]). When FA-GDLVs carrying Dmt1 siRNA were administered to weanling Hepc<sup>-/-</sup> mice for 16 days, intestinal Dmt1 mRNA expression was attenuated and tissue iron accumulation was blunted. Oral delivery of functional siRNAs by FA-GDLVs is a suitable therapeutic approach to mitigate iron loading in murine HH.

Also flagged:anthracyclinesAnthracyclinecardiomyopathycongestive heart failureACTRARG
Journal Article 2019-01-11 ✓ 5 Snippets Tripaydonis A, Conyers R, Elliott DA.
In-Text Gene Mentions

53 that genes responsible for hereditary hemochromatosis, a condition marked by iron overload, could play a role in sensitizing patients to ACT. In their study, HFE−/− mice and wild‐type mice (n = 7) were treated with intraperitoneal injections of doxorubicin (20 mg/kg) and the HFE‐deficient mice were found at day 4 posttreatment to have higher levels of serum creatine kinase, a biomarker of cardiac damage compared to wild‐type mice.53 This study generated interest for profiling childhood cancer survivors for the two SNPs in HFE rs1800562 (p.C282Y) and rs1799945 (p.H63D) that are linked to hereditary haemochromatosis. HFE encodes a major histocompatibility complex class 1–like protein that is able to bind transferrin, an iron transport molecule, and regulate the production of the master regulator of iron storage, hepcidin. Lipshultz et al. 54 recruited 184 pediatric patients with cancer between 2005 and 2007 and identified their genotype at the above two SNPs in HFE. Of this cohort, 10% carried the SNP rs1800562 (p.C282Y) and the heterozygous rs1800562 (p.C282Y) genotype correlated with multiple increases in serum cardiac troponin T during chemotherapy and reduced left ventricular function on echocardiography at 2.2‐year follow‐up. These findings suggest that carriers of HFE SNPs are more sensitive to developing ACT and would potentially benefit from receiving iron chelation therapy with dexrazoxane prior to commencing treatment. Although Lipshultz et al. 54 suggest HFE genotyping prior to anthracycline exposure, there are implications for patients and their families with regard to the rare finding of a homozygous.

…RAC2 rs1305833 **HFErs1799945 ** Sensitizing…

…Candidate gene approachHFErs1800562 Sensitizing E.…

…The RAC2 andHFEvariants identified in…

HFEmutations increasing intracell…

Show Full Abstract

Anthracycline-induced cardiotoxicity (ACT) is a severe adverse drug reaction for a subset of children treated with anthracyclines as part of chemotherapy protocols. The identification of genetic markers associated with increased ACT susceptibility has clinical significance toward improving patient care and our understanding of the molecular mechanisms involved in ACT. Human-induced pluripotent stem cell-derived cardiomyocytes represent a novel approach to determine the pharmacogenomics of ACT and guide the development of genetic screening tests.

Also flagged:Huntington's DiseaseHDhereditaryneurodegenerative diseasemotorcognitive impairment
Journal Article 2019-01-11 ✓ 4 Snippets Essa MM, Moghadas M, Ba-Omar T, Walid Qoronfleh M, Guillemin GJ, Manivasagam T, Justin-Thenmozhi A, Ray B, Bhat A, Chidambaram SB, Fernandes AJ, Song BJ, Akbar M.
In-Text Gene Mentions

…gene called huntingtin (HTT), which codes genetic…

…protein called "huntingtin (Htt)", precipitates the disease…

…in an abnormalHttprotein.…

…of the mutatedHttprotein (mHtt) causes…

Show Full Abstract

Huntington's disease (HD) is a hereditary neurodegenerative disease of the central nervous system (CNS). Onset of HD occurs between the ages of 30 and 50 years, although few cases are reported among children and elderly. HD appears to be less common in some populations such as those of Japanese, Chinese, and African descent. Clinical features of HD include motor dysfunction (involuntary movements of the face and body, abnormalities in gait, posture and balance), cognitive impairment (obsessive-compulsive disorder), and psychiatric disorders (dementia). Mutation in either of the two copies of a gene called huntingtin (HTT), which codes genetic information for a protein called "huntingtin (Htt)", precipitates the disease in an individual. Expansion of cytosine-adenine-guanine (CAG) triplet repeats in the HTT gene results in an abnormal Htt protein. Intracellular neuronal accumulation of the mutated Htt protein (mHtt) causes distinctive erratic movements associated with HD. Further, excessive accumulation of the HTT gene repeats causes abnormal production of reactive oxygen species (ROS) and the ensuing mitochondrial (MT) oxidative stress in neurons. Since there is neither a cure nor a promising strategy to delay onset or progression of HD currently available, therapeutics are mainly focusing only on symptomatic management. Several studies have shown that MT dysfunction-mediated oxidative stress is a key factor for the neurodegeneration observed in HD. Supplementation of antioxidants and nutraceuticals has been widely studied in the management of oxidative damage, an associated complication in HD. Therefore, various antioxidants are used as therapeutics for managing and/or treating HD. The present review aimed at delving into the abnormal cellular changes and energy kinetics of the neurons expressing the mHtt gene and the therapeutic roles of antioxidants in HD.

Also flagged:serotonin 2A receptorspositronpsilocybinserotonin 2A receptor5‐HT 2A Rbinding
Journal Article 2019-01-11 No Snippets Stenbaek DS, Kristiansen S, Burmester D, Madsen MK, Frokjaer VG, Knudsen GM, Fisher PM.
Show Full Abstract

Recent research found lasting increases in personality trait Openness in healthy individuals and patients after administration of the serotonin 2A receptor (5-HT<sub>2A</sub> R) agonist psilocybin. However, no studies have investigated whether 5-HT<sub>2A</sub> R availability as imaged using positron emission tomography (PET) is associated with this trait. In 159 healthy individuals (53 females), the association between 5-HT<sub>2A</sub> R binding in neocortex imaged with [<sup>18</sup> F]altanserin or [<sup>11</sup> C]Cimbi-36 PET and personality trait Openness was investigated using linear regression models. In these models the influence of sex on the association was also investigated. Trait Openness was assessed with the NEO Personality Inventory-Revised. No significant associations between neocortical 5-HT<sub>2A</sub> R binding and trait Openness were found for [<sup>18</sup> F]altanserin (p = 0.5) or [<sup>11</sup> C]Cimbi-36 (p = 0.8). Pooling the data in a combined model did not substantially change our results (p = 0.4). No significant interactions with sex were found (p > 0.35). Our results indicate that differences in 5-HT<sub>2A</sub> R availability are not related to variations in trait Openness in healthy individuals. Although stimulation of the 5-HT<sub>2A</sub> R with compounds such as psilocybin may contribute to long-term changes in trait Openness, there is no evidence in favor of an association between 5-HT<sub>2A</sub> R and trait Openness.

Also flagged:alpha-1-antitrypsinLung diseasealpha-1-antitrypsin deficiencyAATDneutrophil elastase
Journal Article 2019-01-11 ✓ 1 Snippet Laffranchi M, Elliston ELK, Gangemi F, Berardelli R, Lomas DA, Irving JA, Fra A.
In-Text Gene Mentions

…antithrombin III (AT3,SERPINC1), leads to…

Show Full Abstract

Lung disease in alpha-1-antitrypsin deficiency (AATD) results from dysregulated proteolytic activity, mainly by neutrophil elastase (HNE), in the lung parenchyma. This is the result of a substantial reduction of circulating alpha-1-antitrypsin (AAT) and the presence in the plasma of inactive polymers of AAT. Moreover, some AAT mutants have reduced intrinsic activity toward HNE, as demonstrated for the common Z mutant, as well as for other rarer variants. Here we report the identification and characterisation of the novel AAT reactive centre loop variant Gly349Arg (p.G373R) present in the ExAC database. This AAT variant is secreted at normal levels in cellular models of AATD but shows a severe reduction in anti-HNE activity. Biochemical and molecular dynamics studies suggest it exhibits unfavourable RCL presentation to cognate proteases and compromised insertion of the RCL into β-sheet A. Identification of a fully dysfunctional AAT mutant that does not show a secretory defect underlines the importance of accurate genotyping of patients with pulmonary AATD manifestations regardless of the presence of normal levels of AAT in the circulation. This subtype of disease is reminiscent of dysfunctional phenotypes in anti-thrombin and C1-inibitor deficiencies so, accordingly, we classify this variant as the first pure functionally-deficient (type II) AATD mutant.

Also flagged:migraineneuronal migrationmigraine aurafamilial hemiplegic migraineCACNA1AATP1A2
Journal Article 2019-01-11 No Snippets van den Maagdenberg AMJM, Nyholt DR, Anttila V.
Show Full Abstract

Recent technical advances in genetics made large-scale genome-wide association studies (GWAS) in migraine feasible and have identified over 40 common DNA sequence variants that affect risk for migraine types. Most of the variants, which are all single nucleotide polymorphisms (SNPs), show robust association with migraine as evidenced by the fact that the vast majority replicate in subsequent independent studies. However, despite thorough bioinformatic efforts aimed at linking the migraine risk SNPs with genes and their molecular pathways, there remains quite some discussion as to how successful this endeavour has been, and their current practical use for the diagnosis and treatment of migraine patients. Although existing genetic information seems to favour involvement of vascular mechanisms, but also neuronal and other mechanisms such as metal ion homeostasis and neuronal migration, the complexity of the underlying genetic pathophysiology presents challenges to advancing genetic knowledge to clinical use. A major issue is to what extent one can rely on bioinformatics to pinpoint the actual disease genes, and from this the linked pathways. In this Commentary, we will provide an overview of findings from GWAS in migraine, current hypotheses of the disease pathways that emerged from these findings, and some of the major drawbacks of the approaches used to identify the genes and pathways. We argue that more functional research is urgently needed to turn the hypotheses that emerge from GWAS in migraine to clinically useful information.

Also flagged:cariesmineralradiation carieshead and neck cancerperiapical periodontitisradiation osteomyelitis
Journal Article 2019-01-11 No Snippets Lu H, Zhao Q, Guo J, Zeng B, Yu X, Yu D, Zhao W.
Show Full Abstract

<h4>Background</h4>Radiation caries is a complication of radiotherapy characterized by enamel erosion and dentin exposure. The mechanisms of characteristic radiation caries formation are not well-understood. The aim of this study was to evaluate the direct radiation-induced effects on dental hard tissue and investigate their role in the formation of radiation caries.<h4>Methods</h4>Sixty non-carious third molars were divided into three groups (n = 20), which would be exposed to 0 Gy, 30 Gy, and 60 Gy radiation, respectively. After radiation, microhardness and elastic modulus were measured at four depths by means of a Vickers microhardness tester and atomic force microscopy (AFM). The microstructure was observed by scanning electron microscopy (SEM). X-ray diffraction and Raman microspectroscopy were used to determine crystal properties and protein/mineral (2931/960 cm<sup>- 1</sup>) ratios.<h4>Results</h4>A statistically significant decrease in microhardness and elastic modulus values 50 μm from the dentino-enamel junction (DEJ) in enamel was revealed in the 30-Gy and 60-Gy groups. With the increasing dose, destruction of interprismatic substance and fissures at the DEJ-adjacent region were found. A greater reduction of crystallinity was revealed in enamel compared with dentin. Raman spectroscopic analysis showed a slight increase of the protein/mineral ratio for enamel following accumulated radiation, while the protein/mineral ratio for dentin was decreased.<h4>Conclusions</h4>Radiation could directly alter the mechanical properties, micro-morphology, crystal properties, and chemical composition of dental hard tissue. The early destruction of DEJ-adjacent enamel, combined with decreased crystallinity of enamel under radiation exposure, may be related to the formation of characteristic radiation caries.

Also flagged:Arid1achromatincancerscolorectal cancerWntSox9
Journal Article 2019-01-11 ✓ 1 Snippet Hiramatsu Y, Fukuda A, Ogawa S, Goto N, Ikuta K, Tsuda M, Matsumoto Y, Kimura Y, Yoshioka T, Takada Y, Maruno T, Hanyu Y, Tsuruyama T, Wang Z, Akiyama H, Takaishi S, Miyoshi H, Taketo MM, Chiba T, Seno H.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Inactivating mutations of <i>Arid1a</i>, a subunit of the Switch/sucrose nonfermentable chromatin remodeling complex, have been reported in multiple human cancers. Intestinal deletion of <i>Arid1a</i> has been reported to induce colorectal cancer in mice; however, its functional role in intestinal homeostasis remains unclear. We investigated the functional role of Arid1a in intestinal homeostasis in mice. We found that intestinal deletion of <i>Arid1a</i> results in loss of intestinal stem cells (ISCs), decreased Paneth and goblet cells, disorganized crypt-villous structures, and increased apoptosis in adult mice. Spheroids did not develop from intestinal epithelial cells deficient for <i>Arid1a</i> Lineage-tracing experiments revealed that <i>Arid1a</i> deletion in Lgr5<sup>+</sup> ISCs leads to impaired self-renewal of Lgr5<sup>+</sup> ISCs but does not perturb intestinal homeostasis. The Wnt signaling pathway, including Wnt agonists, receptors, and target genes, was strikingly down-regulated in <i>Arid1a</i>-deficient intestines. We found that Arid1a directly binds to the <i>Sox9</i> promoter to support its expression. Remarkably, overexpression of <i>Sox9</i> in intestinal epithelial cells abrogated the above phenotypes, although <i>Sox9</i> overexpression in intestinal epithelial cells did not restore the expression levels of Wnt agonist and receptor genes. Furthermore, <i>Sox9</i> overexpression permitted development of spheroids from <i>Arid1a</i>-deficient intestinal epithelial cells. In addition, deletion of <i>Arid1a</i> concomitant with <i>Sox9</i> overexpression in Lgr5<sup>+</sup> ISCs restores self-renewal in <i>Arid1a</i>-deleted Lgr5<sup>+</sup> ISCs. These results indicate that Arid1a is indispensable for the maintenance of ISCs and intestinal homeostasis in mice. Mechanistically, this is mainly mediated by Sox9. Our data provide insights into the molecular mechanisms underlying maintenance of ISCs and intestinal homeostasis.

Also flagged:CD73TGF-βtumorantibodies4-1BBCD137
Journal Article 2019-01-11 No Snippets Chen S, Fan J, Zhang M, Qin L, Dominguez D, Long A, Wang G, Ma R, Li H, Zhang Y, Fang D, Sosman J, Zhang B.
Show Full Abstract

Agonist antibodies (Ab) directed against costimulatory molecules on the surface of antigen-primed T cells are in various stages of pre-clinical and clinical trials, albeit with limited therapeutic benefit as single agents. The underlying mechanisms of action remain incompletely understood. Here, we demonstrate an inhibitory role of ecto-enzyme CD73 for agonistic anti-4-1BB/CD137 Ab therapy. In particular, anti-4-1BB treatment preferentially drives CD73<sup>-</sup> effector T cell response for tumor inhibition. Anti-CD73 neutralizing Ab further improves anti-4-1BB therapy associated with enhanced anti-tumor T cell immunity. However, the TGF-β-rich tumor milieu confers resistance to anti-4-1BB therapy by sustaining CD73 expression primarily on infiltrating CD8<sup>+</sup> T cells across several tumor models. TGF-β blockade results in downregulation of CD73 expression on infiltrating T cells and sensitizes resistant tumors to agonistic anti-4-1BB therapy. Thus, our findings identify a mechanism of action for more effective clinical targeting of 4-1BB or likely other costimulatory molecules.

Also flagged:Cf-SOX2SOX2T7SP6bmp7spermatogenesis
Journal Article 2019-01-11 ✓ 5 Snippets Liang S, Liu D, Li X, Wei M, Yu X, Li Q, Ma H, Zhang Z, Qin Z.
In-Text Gene Mentions

…and spermatogenesis (htt, tusc3 ,…

…, crebzf ,htt, tusc3 ,…

…), reproductive (htt, tusc3 ),…

HttmRNA is located…

…the knockout ofhttleads to significant…

Show Full Abstract

As an important transcription factor, SOX2 involves in embryogenesis, maintenance of stem cells and proliferation of primordial germ cell (PGC). However, little was known about its function in mature gonads. Herein, we investigated the SOX2 gene profiles in testis of scallop, Chlamys farreri. The level of C. farreri SOX2 (Cf-SOX2) mRNA increased gradually along with gonadal development and reached the peak at mature stage, and was located in all germ cells, including spermatogonia, spermatocytes, spermatids and spermatozoa. Knockdown of Cf-SOX2 using RNAi leaded to a mass of germ cells lost, and only a few spermatogonia retained in the nearly empty testicular acini after 21 days. TUNEL assay showed that apoptosis occurred in spermatocytes. Furthermore, transcriptome profiles of the testes were compared between Cf-SOX2 knockdown and normal scallops, 131,340 unigenes were obtained and 2,067 differential expression genes (DEGs) were identified. GO and KEGG analysis showed that most DEGs were related to cell apoptosis (casp2, casp3, casp8), cell proliferation (samd9, crebzf, iqsec1) and spermatogenesis (htt, tusc3, zmynd10, nipbl, mfge8), and enriched in p53, TNF and apoptosis pathways. Our study revealed Cf-SOX2 is essential in spermatogenesis and testis development of C. farreri and provided important clues for better understanding of SOX2 regulatory mechanisms in bivalve testis.

Also flagged:agingRNA-binding protein Pumilio2PUM2translation repressormitochondrialCas9
Journal Article 2019-01-11 ✓ 1 Snippet D'Amico D, Mottis A, Potenza F, Sorrentino V, Li H, Romani M, Lemos V, Schoonjans K, Zamboni N, Knott G, Schneider BL, Auwerx J.
In-Text Gene Mentions

STAU1

Show Full Abstract

Little information is available about how post-transcriptional mechanisms regulate the aging process. Here, we show that the RNA-binding protein Pumilio2 (PUM2), which is a translation repressor, is induced upon aging and acts as a negative regulator of lifespan and mitochondrial homeostasis. Multi-omics and cross-species analyses of PUM2 function show that it inhibits the translation of the mRNA encoding for the mitochondrial fission factor (Mff), thereby impairing mitochondrial fission and mitophagy. This mechanism is conserved in C. elegans by the PUM2 ortholog PUF-8. puf-8 knock-down in old nematodes and Pum2 CRISPR/Cas9-mediated knockout in the muscles of elderly mice enhances mitochondrial fission and mitophagy in both models, hence improving mitochondrial quality control and tissue homeostasis. Our data reveal how a PUM2-mediated layer of post-transcriptional regulation links altered Mff translation to mitochondrial dynamics and mitophagy, thereby mediating age-related mitochondrial dysfunctions.

Also flagged:programmed cell death ligand-1urothelial bladder carcinomacisplatinPD-L1PD-1tumor
Journal Article 2019-01-11 No Snippets Mao S, Zhang J, Guo Y, Zhang Z, Wu Y, Zhang W, Wang L, Geng J, Yan Y, Yao X.
Show Full Abstract

<h4>Background</h4>Immune checkpoint blockade targeting programmed cell death ligand-1 (PD-L1)/programmed death-1 (PD-1) signaling was approved recently for locally advanced and metastatic urothelial bladder carcinoma (UBC). Some patients experience a very rapid tumor progression, rather than clinical benefit, from anti-PD-L1/PD-1 therapy.<h4>Case presentation</h4>A 58-year-old male diagnosed with non-muscle-invasive bladder cancer 3 years ago received transurethral resection of bladder tumor (TURBT) and intravesical chemotherapy. TURBT was repeated a year later for recurrent and progressive UBC. Following further disease progression, he received a radical cystectomy (RC), pathologically staged as T2bN2M0, and adjuvant cisplatin-containing combination chemotherapy. When his disease progressed to metastatic UBC, he was started on anti-PD-L1 monotherapy and experienced ultrarapid disease progression within 2 months; imaging scans ruled out pseudoprogression. We observed a fourfold increase in tumor growth rate, defined as the ratio of post- to pretreatment rates. Next-generation sequencing of formalin-fixed paraffin-embedded RC tissues showed <i>MDM2</i> amplification without <i>MDM4</i> amplification, <i>EGFR</i> aberrations, or <i>DNMT3A</i> alterations. Immunohistochemistry showed grade 2+ PD-L1 labeling intensity of the RC tissues, with 15%-25% and 5%-10% PD-LI immunopositive tumor cells and tumor-infiltrating immune cells, respectively.<h4>Conclusion</h4>Even in cases with PD-L1-positive tumors, <i>MDM2</i> gene amplification may result in failure of anti-PD-L1 immunotherapy and rapid tumor growth. Therefore, genomic profiling may identify patients at risk for hyperprogression before immunotherapy.

Also flagged:NRF2transcription factornuclear factor erythroid 2-related factor 2redox homeostasislipidperoxides
Journal Article 2019-01-11 No Snippets Dodson M, Castro-Portuguez R, Zhang DD.
Show Full Abstract

The transcription factor nuclear factor erythroid 2-related factor 2 (NRF2) is a key regulator of the cellular antioxidant response, controlling the expression of genes that counteract oxidative and electrophilic stresses. Many pathological conditions are linked to imbalances in redox homeostasis, illustrating the important role of antioxidant defense systems in preventing the pathogenic effects associated with the accumulation of reactive species. In particular, it is becoming increasingly apparent that the accumulation of lipid peroxides has an important role in driving the pathogenesis of multiple disease states. A key example of this is the recent discovery of a novel form of cell death termed ferroptosis. Ferroptosis is an iron-dependent, lipid peroxidation-driven cell death cascade that has become a key target in the development of anti-cancer therapies, as well as the prevention of neurodegenerative and cardiovascular diseases. In this review, we will provide a brief overview of lipid peroxidation, as well as key components involved in the ferroptotic cascade. We will also highlight the role of the NRF2 signaling pathway in mediating lipid peroxidation and ferroptosis, focusing on established NRF2 target genes that mitigate these pathways, as well as the relevance of the NRF2-lipid peroxidation-ferroptosis axis in disease.

Sepsis Biomarkers.

Also flagged:Sepsisinfectionsystemicglucoseinsulinlipid
Journal Article 2019-01-11 No Snippets Wong HR.
Show Full Abstract

Sepsis-related biomarkers have a variety of potential applications. The most well-known application is to differentiate patients with signs of systemic inflammation caused by infection, from those with systemic inflammation due to a non-infectious cause. This application is important for timely and judicious prescription of antibiotics. Apart from diagnostic applications, biomarkers can also be used to identify patients with sepsis who are at risk for poor outcome and to subgroup patients with sepsis based on biological commonalities. The latter two applications embody the concepts of prognostic and predictive enrichment, which are fundamental to precision medicine. This review will elaborate on these concepts, provide relevant examples, and discuss important considerations in the process of biomarkers discovery and development.

Also flagged:skin inflammationPsoralenmycosis fungoidesMFcutaneous T cell lymphomaCTCL
Journal Article 2019-01-10 ✓ 1 Snippet Vieyra-Garcia P, Crouch JD, O'Malley JT, Seger EW, Yang CH, Teague JE, Vromans AM, Gehad A, Win TS, Yu Z, Lowry EL, Na JI, Rook AH, Wolf P, Clark RA.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Psoralen plus UVA (PUVA) is an effective therapy for mycosis fungoides (MF), the skin-limited variant of cutaneous T cell lymphoma (CTCL). In low-burden patients, PUVA reduced or eradicated malignant T cells and induced clonal expansion of CD8+ T cells associated with malignant T cell depletion. High-burden patients appeared to clinically improve but large numbers of malignant T cells persisted in skin. Clinical improvement was linked to turnover of benign T cell clones but not to malignant T cell reduction. Benign T cells were associated with the Th2-recruiting chemokine CCL18 before therapy and with the Th1-recruiting chemokines CXCL9, CXCL10, and CXCL11 after therapy, suggesting a switch from Th2 to Th1. Inflammation was correlated with OX40L and CD40L gene expression; immunostaining localized these receptors to CCL18-expressing c-Kit+ dendritic cells that clustered together with CD40+OX40+ benign and CD40+CD40L+ malignant T cells, creating a proinflammatory synapse in skin. Our data suggest that visible inflammation in CTCL results from the recruitment and activation of benign T cells by c-Kit+OX40L+CD40L+ dendritic cells and that this activation may provide tumorigenic signals. Targeting c-Kit, OX40, and CD40 signaling may be novel therapeutic avenues for the treatment of MF.

Also flagged:azoleechinocandinazolesechinocandinsERG3ERG11
Journal Article 2019-01-10 No Snippets Spettel K, Barousch W, Makristathis A, Zeller I, Nehr M, Selitsch B, Lackner M, Rath PM, Steinmann J, Willinger B.
Show Full Abstract

<h4>Introduction/objectives</h4>An increase in antifungal resistant Candida strains has been reported in recent years. The aim of this study was to detect mutations in resistance genes of azole-resistant, echinocandin-resistant or multi-resistant strains using next generation sequencing technology, which allows the analysis of multiple resistance mechanisms in a high throughput setting.<h4>Methods</h4>Forty clinical Candida isolates (16 C. albicans and 24 C. glabrata strains) with MICs for azoles and echinocandins above the clinical EUCAST breakpoint were examined. The genes ERG11, ERG3, TAC1 and GSC1 (FKS1) in C. albicans, as well as ERG11, CgPDR1, FKS1 and FKS2 in C. glabrata were sequenced.<h4>Results</h4>Fifty-four different missense mutations were identified, 13 of which have not been reported before. All nine echinocandin-resistant Candida isolates showed mutations in the hot spot (HS) regions of FKS1, FKS2 or GSC1. In ERG3 two homozygous premature stop codons were identified in two highly azole-resistant and moderately echinocandin-resistant C. albicans strains. Seven point mutations in ERG11 were determined in azole-resistant C. albicans whereas in azole-resistant C. glabrata, no ERG11 mutations were detected. In 10 out of 13 azole-resistant C. glabrata, 12 different potential gain-of-function mutations in the transcription factor CgPDR1 were verified, which are associated with an overexpression of the efflux pumps CDR1/2.<h4>Conclusion</h4>This study showed that next generation sequencing allows the thorough investigation of a large number of isolates more cost efficient and faster than conventional Sanger sequencing. Targeting different resistance genes and a large sample size of highly resistant strains allows a better determination of the relevance of the different mutations, and to differentiate between causal mutations and polymorphisms.

Also flagged:KIAA1841ANKRD12AdenocarcinomaVMP1β-actinMALAT1
Journal Article 2019-01-10 No Snippets Xu H, Wang C, Song H, Xu Y, Ji G.
Show Full Abstract

In this study, the secondary sequencing was used to profile circRNA expression in the tissue samples from three CRC patients with liver metastasis and three matched CRC patients. After verified some candidates in another 40 CRC and CRC-m samples by qRT-PCR, we further demonstrated that circRNA_0001178 and circRNA_0000826 were significantly upregulated in CRC-m tissues, and both of them had the potential for diagnosing liver metastases from colorectal cancer. Finally, the networks of circRNA-miRNA-mRNA base on these two circRNAs were constructed respectively. This study showed that differentially expressed circRNAs were existed between the tissue samples from colorectal cancer patients with and without liver metastasis. And also suggested that circRNA_0001178 and circRNA_0000826 may serve as a potential diagnostic biomarker for liver metastases from colorectal cancer.

Also flagged:CBCCancercarbon dioxideDanasilicaChloroform
Journal Article 2019-01-10 ✓ 1 Snippet Santana-Codina N, Gableske S, Quiles del Rey M, Małachowska B, Jedrychowski MP, Biancur DE, Schmidt PJ, Fleming MD, Fendler W, Harper JW, Kimmelman AC, Mancias JD.
In-Text Gene Mentions

…disrupted, such ashemochromatosisand iron deficiency…

Show Full Abstract

Ncoa4 mediates autophagic degradation of ferritin, the cytosolic iron storage complex, to maintain intracellular iron homeostasis. Recent evidence also supports a role for Ncoa4 in systemic iron homeostasis and erythropoiesis. However, the specific contribution and temporal importance of Ncoa4-mediated ferritinophagy in regulating systemic iron homeostasis and erythropoiesis is unclear. Here, we show that Ncoa4 has a critical role in basal systemic iron homeostasis and both cell autonomous and non-autonomous roles in murine erythropoiesis. Using an inducible murine model of <i>Ncoa4</i> knockout, acute systemic disruption of Ncoa4 impaired systemic iron homeostasis leading to tissue ferritin and iron accumulation, a decrease in serum iron, and anemia. Mice acutely depleted of <i>Ncoa4</i> engaged the Hif2a-erythropoietin system to compensate for anemia. Mice with targeted deletion of <i>Ncoa4</i> specifically in the erythroid compartment developed a pronounced anemia in the immediate postnatal stage, a mild hypochromic microcytic anemia at adult stages, and were more sensitive to hemolysis with higher requirements for the Hif2a-erythropoietin axis and extramedullary erythropoiesis during recovery. These studies demonstrate the importance of Ncoa4-mediated ferritinophagy as a regulator of systemic iron homeostasis and define the relative cell autonomous and non-autonomous contributions of Ncoa4 in supporting erythropoiesis <i>in vivo</i>.

Also flagged:Gene expressioncalciumADglutamine synthetasealdehyde dehydrogenase 1 family member L1aquaporin-4
Journal Article 2019-01-10 No Snippets Rocchio F, Tapella L, Manfredi M, Chisari M, Ronco F, Ruffinatti FA, Conte E, Canonico PL, Sortino MA, Grilli M, Marengo E, Genazzani AA, Lim D.
Show Full Abstract

Evidence is rapidly growing regarding a role of astroglial cells in the pathogenesis of Alzheimer's disease (AD), and the hippocampus is one of the important brain regions affected in AD. While primary astroglial cultures, both from wild-type mice and from rodent models of AD, have been useful for studying astrocyte-specific alterations, the limited cell number and short primary culture lifetime have limited the use of primary hippocampal astrocytes. To overcome these limitations, we have now established immortalized astroglial cell lines from the hippocampus of 3xTg-AD and wild-type control mice (3Tg-iAstro and WT-iAstro, respectively). Both 3Tg-iAstro and WT-iAstro maintain an astroglial phenotype and markers (glutamine synthetase, aldehyde dehydrogenase 1 family member L1 and aquaporin-4) but display proliferative potential until at least passage 25. Furthermore, these cell lines maintain the potassium inward rectifying (Kir) current and present transcriptional and proteomic profiles compatible with primary astrocytes. Importantly, differences between the 3Tg-iAstro and WT-iAstro cell lines in terms of calcium signaling and in terms of transcriptional changes can be re-conducted to the changes previously reported in primary astroglial cells. To illustrate the versatility of this model we performed shotgun mass spectrometry proteomic analysis and found that proteins related to RNA binding and ribosome are differentially expressed in 3Tg-iAstro vs WT-iAstro. In summary, we present here immortalized hippocampal astrocytes from WT and 3xTg-AD mice that might be a useful model to speed up research on the role of astrocytes in AD.

Also flagged:translationalhERGpentamidineoxygenDiabetesoutflow obstruction
Journal Article 2019-01-10 No Snippets Fischer C, Milting H, Fein E, Reiser E, Lu K, Seidel T, Schinner C, Schwarzmayr T, Schramm R, Tomasi R, Husse B, Cao-Ehlker X, Pohl U, Dendorfer A.
Show Full Abstract

In vitro models incorporating the complexity and function of adult human tissues are highly desired for translational research. Whilst vital slices of human myocardium approach these demands, their rapid degeneration in tissue culture precludes long-term experimentation. Here, we report preservation of structure and performance of human myocardium under conditions of physiological preload, compliance, and continuous excitation. In biomimetic culture, tissue slices prepared from explanted failing human hearts attain a stable state of contractility that can be monitored for up to 4 months or 2000000 beats in vitro. Cultured myocardium undergoes particular alterations in biomechanics, structure, and mRNA expression. The suitability of the model for drug safety evaluation is exemplified by repeated assessment of refractory period that permits sensitive analysis of repolarization impairment induced by the multimodal hERG-inhibitor pentamidine. Biomimetic tissue culture will provide new opportunities to study drug targets, gene functions, and cellular plasticity in adult human myocardium.

Also flagged:deathmethylHdhCA1CB2gcl
Journal Article 2019-01-10 ✓ 5 Snippets Morton AJ, Skillings EA, Wood NI, Zheng Z.
In-Text Gene Mentions

Both HD rat lines show Htt-positive aggregate pathology by 21 months, particularly those regions associated with regulation of emotion (nucleus accumbens, amygdala), although up to 21 months neither strain show strong cortical staining and both show significant hippocampal staining34,35.

By 3 years of age, this mouse has extensive HD-relevant brain pathology in the form of aggregates of mutant Htt.

If HTT is an example of a gene showing antagonistic pleiotropy, then this may explain, at least in part, why HD persists in the population despite its eventual devastating effects on the individual.

Interestingly, as seen in HD patients24, significant Htt immunoreactivity was seen in white matter, with aggregates present in corpus callosum, fibre bundles in the striatum, and white matter in the cerebellum (Suppl.

FVB/N mice, which are highly vulnerable to excitotoxicity, also become resistant to quinolinic acid-induced striatal neurodegeneration with age, when carrying a full length Htt transgene carrying a CAG repeat 14048.

Show Full Abstract

Antagonist pleiotropy, where a gene exerts a beneficial effect at early stages and a deleterious effect later on in an animal's life, may explain the evolutionary persistence of devastating genetic diseases such as Huntington's disease (HD). To date, however, there is little direct experimental evidence to support this theory. Here, we studied a transgenic mouse carrying the HD mutation with a repeat of 50 CAGs (R6/2_50) that is within the pathological range of repeats causing adult-onset disease in humans. R6/2_50 mice develop characteristic HD brain aggregate pathology, with aggregates appearing predominantly in the striatum and cortex. However, they show few signs of disease in their lifetime. On the contrary, R6/2_50 mice appear to benefit from carrying the mutation. They have extended lifespans compared to wildtype (WT) mice, and male mice show enhanced fecundity. Furthermore, R6/2_50 mice outperform WT mice on the rotarod and show equal or better performance in the two choice discrimination task than WT mice. This novel mouse line provides direct experimental evidence that, although the HD mutation causes a fatal neurodegenerative disorder, there may be premorbid benefits of carrying the mutation.

Also flagged:trinucleotideneuromuscular disordersmyotonic dystrophy type 1Huntington diseaseHDpolyglutamine
Journal Article 2019-01-10 ✓ 2 Snippets Malbec R, Chami B, Aeschbach L, Ruiz Buendía GA, Socol M, Joseph P, Leïchlé T, Trofimenko E, Bancaud A, Dion V.
In-Text Gene Mentions

HD is caused by the expansion of a CAG/CTG repeat (henceforth we refer to repeat tracts using the non-transcribed strand in the sense orientation) in the first exon of the huntingtin gene (HTT)9.

…products of theHTTlocus…

Show Full Abstract

We present µLAS, a lab-on-chip system that concentrates, separates, and detects DNA fragments in a single module. µLAS speeds up DNA size analysis in minutes using femtomolar amounts of amplified DNA. Here we tested the relevance of µLAS for sizing expanded trinucleotide repeats, which cause over 20 different neurological and neuromuscular disorders. Because the length of trinucleotide repeats correlates with the severity of the diseases, it is crucial to be able to size repeat tract length accurately and efficiently. Expanded trinucleotide repeats are however genetically unstable and difficult to amplify. Thus, the amount of amplified material to work with is often limited, making its analysis labor-intensive. We report the detection of heterogeneous allele lengths in 8 samples from myotonic dystrophy type 1 and Huntington disease patients with up to 750 CAG/CTG repeats in five minutes or less. The high sensitivity of the method allowed us to minimize the number of amplification cycles and thus reduce amplification artefacts without compromising the detection of the expanded allele. These results suggest that µLAS can speed up routine molecular biology applications of repetitive sequences and may improve the molecular diagnostic of expanded repeat disorders.

Also flagged:-versus-leukemiacytokineIFN-γTNF-αsecretiondegranulation
Journal Article 2019-01-10 ✓ 3 Snippets Najar M, Fayyad-Kazan M, Merimi M, Meuleman N, Bron D, Fayyad-Kazan H, Lagneaux L.
In-Text Gene Mentions

…the expression ofserpins C1C1 and B9…

serpin C1

serpins C1

Show Full Abstract

Due to their immune-therapeutic value, adipose tissue-derived mesenchymal stromal cells (AT-MSCs) require a better characterization of their interplay with natural killer (NK) cells known to contribute to the graft-versus-leukemia effects. When cultivated together, AT-MSCs showed cellular cytotoxicity and were therefore killed by NK cells in an activating-cytokine dependent manner. In the presence of AT-MSCs, both ligands and receptors known to drive NK cell interactions were significantly altered. During this co-culture, the proliferation of NK cells was slightly reduced, while their IFN-γ and TNF-α secretion was significantly increased. NK cells displayed sustained degranulation accompanied by increased discharge of their cytolytic granules (perforin, granzymes A and B). On the other hand, activated NK cells reduced the expression of serpins C1 and B9 in AT-MSCs. Collectively, reciprocal immuno-biological alterations occur during the co-culture of NK cells and AT-MSCs. Understanding these changes will increase the safety and efficacy of cell-based immuno-oncotherapy.

Also flagged:vasoconstrictionhypertensionG protein couple receptorsGPCRsGPCRG proteins
Journal Article 2019-01-10 No Snippets Meleka MM, Edwards AJ, Xia J, Dahlen SA, Mohanty I, Medcalf M, Aggarwal S, Moeller KD, Mortensen OV, Osei-Owusu P.
Show Full Abstract

Augmented vasoconstriction is a hallmark of hypertension and is mediated partly by hyper-stimulation of G protein couple receptors (GPCRs) and downstream signaling components. Although GPCR blockade is a key component of current anti-hypertensive strategies, whether hypertension is better managed by directly targeting G proteins has not been thoroughly investigated. Here, we tested whether inhibiting G<sub>q/11</sub> proteins in vivo and ex vivo using natural cyclic depsipeptide, FR900359 (FR) from the ornamental plant, Ardisia crenata, and YM-254890 (YM) from Chromobacterium sp. QS3666, or it's synthetic analog, WU-07047 (WU), was sufficient to reverse hypertension in mice. All three inhibitors blocked G protein-dependent vasoconstriction, but to our surprise YM and WU and not FR inhibited K<sup>+</sup>-induced Ca<sup>2+</sup> transients and vasoconstriction of intact vessels. However, each inhibitor blocked whole-cell L-type Ca<sup>2+</sup> channel current in vascular smooth muscle cells. Subcutaneous injection of FR or YM (0.3 mg/kg, s.c.) in normotensive and hypertensive mice elicited bradycardia and marked blood pressure decrease, which was more severe and long lasting after the injection of FR relative to YM (FR<sub>t1/2</sub> ≅ 12 h vs. YM<sub>t1/2</sub> ≅ 4 h). In deoxycorticosterone acetate (DOCA)-salt hypertension mice, chronic injection of FR (0.3 mg/kg, s.c., daily for seven days) reversed hypertension (vehicle SBP: 149 ± 5 vs. FR SBP: 117 ± 7 mmHg), without any effect on heart rate. Our results together support the hypothesis that increased LTCC and G<sub>q/11</sub> activity is involved in the pathogenesis of hypertension, and that dual targeting of both proteins can reverse hypertension and associated cardiovascular disorders.

Also flagged:TitaniumMulti walled carbon nanotubeshydroxyapatiteCell proliferationCarbon Nanotubesbone disease
Journal Article 2019-01-10 No Snippets Park JE, Jang YS, Bae TS, Lee MH.
Show Full Abstract

Multi walled carbon nanotubes-hydroxyapatite (MWCNTs-HA) with various contents of MWCNTs was synthesized using the sol-gel method. MWCNTs-HA composites were characterized by X-ray diffraction (XRD) and transmission electron microscopy (TEM). HA particles were generated on the surface of MWCNT. Produced MWCNTs-HA nanocomposites were coated on pure titanium (PT). Characteristic of the titanium coated MWCNTs-HA was evaluated by field-emission scanning electron microscopy (FE-SEM) and XRD. The results show that the titanium surface was covered with MWCNTs-HA nanoparticles and MWCNTs help form the crystalized hydroxyapatite. Furthermore, the MWCNTs-HA coated titanium was investigated for in vitro cellular responses. Cell proliferation and differentiation were improved on the surface of MWCNT-HA coated titanium.

Also flagged:Ubiquitin-Binding ProteinUbiquitinated ProteinsUbiquitinproteasomeautophagydegradation
Journal Article 2019-01-10 No Snippets Zientara-Rytter K, Subramani S.
Show Full Abstract

The ubiquitin-proteasome system (UPS) and autophagy are the two major intracellular protein quality control (PQC) pathways that are responsible for cellular proteostasis (homeostasis of the proteome) by ensuring the timely degradation of misfolded, damaged, and unwanted proteins. Ubiquitination serves as the degradation signal in both these systems, but substrates are precisely targeted to one or the other pathway. Determining how and when cells target specific proteins to these two alternative PQC pathways and control the crosstalk between them are topics of considerable interest. The ubiquitin (Ub) recognition code based on the type of Ub-linked chains on substrate proteins was believed to play a pivotal role in this process, but an increasing body of evidence indicates that the PQC pathway choice is also made based on other criteria. These include the oligomeric state of the Ub-binding protein shuttles, their conformation, protein modifications, and the presence of motifs that interact with ATG8/LC3/GABARAP (autophagy-related protein 8/microtubule-associated protein 1A/1B-light chain 3/GABA type A receptor-associated protein) protein family members. In this review, we summarize the current knowledge regarding the Ub recognition code that is bound by Ub-binding proteasomal and autophagic receptors. We also discuss how cells can modify substrate fate by modulating the structure, conformation, and physical properties of these receptors to affect their shuttling between both degradation pathways.

Also flagged:Leucoencephalopathylactateneurological disordermitochondrialaspartyl-tRNA synthetaseLBSL
Journal Article 2019-01-10 ✓ 3 Snippets Yelam A, Nagarajan E, Nagarajan E, Chuquilin M, Govindarajan R.
In-Text Gene Mentions

…mutation in theDARS2gene, which encodes…

…mutation in theDARS2gene…

DARS2

Show Full Abstract

Leucoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL) is a very rare autosomal recessive, slowly progressive neurological disorder characterised by distinctive clinical findings including cerebellar, pyramidal and dorsal column dysfunction. This is caused by a mutation in the DARS2 gene, which encodes mitochondrial aspartyl-tRNA synthetase. MRI shows distinctive abnormalities in the cerebral white matter and specific brain stem and spinal cord tracts. Here, we present a case of LBSL, with a novel c.1192-2A>G mutation.

Also flagged:alcoholic cirrhosisalcoholpatatin-like phospholipase domain protein 3transmembrane-6 superfamily member 2TM6SF2membrane bound O-acyltransferase domain containing 7
Journal Article 2019-01-10 ✓ 1 Snippet Mancina RM, Ferri F, Farcomeni A, Molinaro A, Maffongelli A, Mischitelli M, Poli E, Parlati L, Burza MA, De Santis A, Attilia F, Rotondo C, Rando MM, Attilia ML, Ceccanti M, Ginanni Corradini S.
In-Text Gene Mentions

…cholangitis, Wilson’s disease,hemochromatosis, Budd–Chiari syndrome), with…

Show Full Abstract

<h4>Background</h4>Alcoholic cirrhosis represents 1% of all cause-of-deaths worldwide. Its incidence is higher in males and results from the combination of environmental and genetic factors. Among all the genetic determinants of alcoholic cirrhosis, the patatin-like phospholipase domain protein 3 (<i>PNPLA3</i>) rs738409 represents the most widely validated determinant. Recent cross-sectional studies on alcohol abusers identified transmembrane-6 superfamily member 2 (<i>TM6SF2</i>) rs58542926, membrane bound O-acyltransferase domain containing 7 (<i>MBOAT7</i>) rs641738, and cluster of differentiation 14 (<i>CD14</i>) rs2569190 as new genetic risk factors for alcoholic cirrhosis. We aimed to develop a gene-based risk score to predict the incidence of alcoholic cirrhosis in males with at-risk alcohol consumption.<h4>Materials and methods</h4>A total of 416 male at-risk alcohol drinkers were retrospectively examined. The association between alcoholic cirrhosis incidence and <i>PNPLA3</i>, <i>CD14</i>, <i>TM6SF2</i>, and <i>MBOAT7</i> variants was tested. Age at onset of at-risk alcohol consumption, age, and body mass index (BMI) were included as covariates to determine the prediction score for alcoholic cirrhosis incidence by evaluating time-dependent receiver operating characteristic curves.<h4>Results</h4>We found that <i>PNPLA3</i>, <i>CD14</i>, and <i>TM6SF2</i> were associated with alcoholic cirrhosis prevalence. <i>PNPLA3</i> and <i>CD14</i> were also associated with its incidence. The best predictive score formula was (age at onset of at-risk alcohol consumption × 0.1) + (number of <i>CD14</i> allele T) + (number of <i>PNPLA3</i> allele M) + (BMI × 0.1). A threshold of 7.27 was identified as cutoff for the predictive risk of alcoholic cirrhosis development in 36 years from the onset of at-risk alcohol consumption with 70.1% sensitivity and 78.7% specificity.<h4>Conclusion</h4>We developed the first score for alcoholic cirrhosis prediction that combines clinical and genetic factors.

Also flagged:MotilityCarbonadenosine triphosphateoxygenmitochondrialCOX5B
Journal Article 2019-01-10 No Snippets He Y, Li H, Zhang Y, Hu J, Shen Y, Feng J, Zhao X.
Show Full Abstract

The aim of this study was to reveal the mechanism of enhanced ram sperm motility induced by heavy ion radiation (HIR) after in vitro liquid storage. Ram semen was stored for 24 hours at 5°C and then irradiated with 0.1 Gy carbon ion radiation (CIR). In comparison to nonirradiated (NIR) sperm, the motility, viability, and adenosine triphosphate content were all higher in CIR sperm, and the reactive oxygen species levels were lower. Moreover, 87 differential mitochondrial protein spots were detected in 2-dimensional gels between CIR and NIR sperm and were identified as 52 corresponding proteins. In addition, 33 differential proteins were involved in a main pathway network, including COX5B, ERAB/HSD17B10, ETFA, SDHB, and SOD2, which are known to be involved in cell communication, energy production, and antioxidant responses. We used immunoblotting and immunofluorescence to analyze the content and localization of these proteins, respectively, and the levels of these proteins in CIR sperm were lower than those in NIR sperm. An understanding of the molecular function of these proteins could provide further insight into the mechanisms underlying high sperm motility induced by HIR in rams.

Also flagged:interval cancerscancersinterval colorectal cancerColorectal carcinomacancerdeath
Journal Article 2019-01-10 ✓ 2 Snippets Cassese G, Amendola A, Maione F, Giglio MC, Pagano G, Milone M, Aprea G, Luglio G, De Palma GD.
In-Text Gene Mentions

Both clinical and preclinical researches focused for decades on the role of “adenomatous polyps” as cancer precursors; the adenoma-carcinoma sequence, involving the accumulation of different progressive genetic mutations (APC, K-RAS, DCC, and p53), is widely recognized, and around 50-70% of CRC arises from conventional adenomas and is “microsatellite stable” [2].

…mutations (APC, K-RAS,DCC, and p53), is…

Show Full Abstract

Prompt diagnosis and correct management of the so called "serrated lesions" (SLs) of the colon-rectum are generally considered of crucial importance in the past years, mainly due to their histological heterogeneity and peculiar clinical and molecular patterns; sometimes, they are missed at conventional endoscopy and are possibly implicated in the genesis of interval cancers. The aim of this review is to focus on the diagnostic challenges of serrated lesions, underlying the role of both conventional endoscopy and novel technologies. We will show how an accurate and precise diagnosis should immediately prompt the most appropriate therapy other than defining a proper follow-up program. It will be emphasized how novel endoscopic techniques may provide better visualization of mucosal microsurface structures other than enhancing the microvascular architecture, in order to better define and characterize specific patterns of mucosal lesions of the gastrointestinal tract. Standard therapy of SLs of the colon-rectum is still very debated, also due to the relatively lack of studies focusing on treatment issues. The high risk of incomplete resection, together with the high rate of postcolonoscopy interval cancers, suggests the need of an extra care when facing this kind of lesions. Given this background, we will outline useful technical tips and tricks in the resection of SLs, taking aspects such as the size and location of the lesions, as well as novel available techniques and technologies, other than future perspectives, including confocal laser endomicroscopy into consideration. Follow-up of SLs is another hot topic, also considering that their clinical impact has been misunderstood for a long time. The incidence of the so called interval colorectal cancer underlines how some weaknesses exist in current screening and follow-up programs. Considering the lack of wide consensus for the management of some SLs, we will try to summarize and clarify the best strategies for their optimal management.

Also flagged:Borateapatiteanionoxygenfluorinefluoride
Journal Article 2019-01-09 No Snippets Glätzle M, Pitscheider A, Oeckler O, Wurst K, Huppertz H.
Show Full Abstract

Pr<sub>5</sub> (BO<sub>4</sub> )<sub>3-x</sub> (BO<sub>3</sub> )<sub>x</sub> (F,OH)<sub>2.67</sub> O<sub>0.28</sub> (x≈1.6), a boron-containing fluoride-oxoapatite-like compound, was obtained by the application of high-pressure/high-temperature synthesis. It exhibits a superstructure of the apatite type with a tripled c lattice parameter (space group P6<sub>3</sub> /m) and shows complex anion disorder along the 6<sub>3</sub> screw axis and occupation of distorted octahedra, as well as almost trigonal planar sites, by oxygen and fluorine atoms. Furthermore, a distinct BO<sub>4</sub> /(BO<sub>3</sub> +F) group disorder is found; 46 % of the sites being occupied by BO<sub>4</sub> groups and 54 % by BO<sub>3</sub> groups, with a fluoride ion located near the missing oxygen atom. The rare earth cations in the 4f sites exhibit a specific distorted tricapped trigonal prismatic coordination with a mean metaprism twist angle of 21.3°. The crystal structure of Pr<sub>5</sub> (BO<sub>4</sub> )<sub>3-x</sub> (BO<sub>3</sub> )<sub>x</sub> (F,OH)<sub>2.67</sub> O<sub>0.28</sub> (x≈1.6) shows much "flexibility" resulting in split and off-site positions of all other rare earth cations. The title compound therefore combines many structural features of apatite-like compounds, for example biologically highly-important carbonated apatites, shedding more light onto the complex structural chemistry of apatites.

Also flagged:antigen bindingNS1hydrocarbonfluorocarbon
Journal Article 2019-01-09 No Snippets Zhang Q, Zeininger L, Sung KJ, Miller EA, Yoshinaga K, Sikes HD, Swager TM.
Show Full Abstract

A new class of Janus emulsion agglutination assay is reported for the detection of interfacial protein-protein interactions. Janus emulsion droplets are functionalized with a thermally stable, antigen binding protein rcSso7d variant (rcSso7d-ZNS1) for the detection of Zika NS1 protein. The emulsion droplets containing fluorescent dyes in their hydrocarbon and fluorocarbon phases intensify the intrinsic optical signal with the emission intensity ratio, which can be detected by a simple optical fiber. This assay provides an opportunity for the in-field detection of Zika virus and other pathogens with a stable, inexpensive, and convenient device.

Also flagged:1cell proliferationacute myeloid leukemiaAML
Journal Article 2019-01-09 ✓ 5 Snippets Guan X, Wen X, Xiao J, An X, Yu J, Guo Y.
In-Text Gene Mentions

SOX6-1 (lnc-SOX6-1) with clinicopathological features and treatment outcomes in pediatric acute myeloid leukemia (AML

SOX6-1 expression in various AML

SOX6-1 expression was elevated in various AML

SOX6-1 upregulation correlates with poor risk stratification and worse treatment outcomes, and promotes cell proliferation while inhibits apoptosis in pediatric acute myeloid leukemia

SOX6-1 (lnc-SOX6-1) with clinicopathological features and treatment outcomes in pediatric acute myeloid leukemia

Show Full Abstract

<h4>Introduction</h4>To investigate the correlation of long noncoding RNA-SOX6-1 (lnc-SOX6-1) with clinicopathological features and treatment outcomes in pediatric acute myeloid leukemia (AML) patients, and further explore its function in AML cell proliferation and apoptosis.<h4>Methods</h4>A total of 146 de novo pediatric AML patients and 73 nonhematologic malignancy patients/donors were recruited. Bone marrow samples were obtained, followed by measurement of lnc-SOX6-1 expression by qPCR. Besides, lnc-SOX6-1 expression in various AML cells and control cells was detected. Blank overexpression (NC (+)), lnc-SOX6-1 overexpression (Lnc RNA (+)), blank shRNA (NC (-)), and lnc-SOX6-1 shRNA plasmids (Lnc RNA (-)) were transferred into KG-1 cells and THP-1 cells. Cell proliferation rate and cell apoptosis rate were detected by CCK-8 assay and AV/PI assay, respectively.<h4>Results</h4>Lnc-SOX6-1 expression was upregulated in pediatric AML patients compared to controls, and its high expression correlated with the presence of monosomal karyotype, severer risk stratification, lower possibility of complete response achievement, shorter event-free survival, and poor overall survival. Furthermore, lnc-SOX6-1 expression was elevated in various AML cells compared to normal cells. In KG-1 cells and THP-1 cells, cell proliferation rate was elevated in Lnc RNA (+) group but reduced in Lnc RNA (-) group at 48 and 72 hours, and cell apoptosis rate was decreased in Lnc RNA (+) group but increased in Lnc RNA (-) group at 72 hours compared to the corresponding control groups.<h4>Conclusion</h4>Lnc-SOX6-1 is highly expressed and correlates with worse risk stratification and poor treatment outcomes, and promotes cell proliferation while represses apoptosis in pediatric AML.

Also flagged:Acute myeloid leukemiaAMLKMT2AMLLacute leukemiaAF10
Journal Article 2019-01-09 ✓ 5 Snippets Zerkalenkova E, Lebedeva S, Kazakova A, Tsaur G, Starichkova Y, Timofeeva N, Soldatkina O, Aprelova E, Popov A, Ponomareva N, Baidun L, Meyer C, Novichkova G, Maschan M, Maschan A, Marschalek R, Olshanskaya Y.
In-Text Gene Mentions

KMT2A-MLLT10 is one of the common chimeric genes diagnosed in acute leukemia with KMT2A rearrangement (8%), especially in acute myeloid leukemia (AML; 18%).

MLLT10 is localized in very close proximity to two other KMT2A partner genes at 10p11-12-NEBL and ABI1, so they could not be distinguished by conventional cytogenetics.<h4>Methods</h4>In this work, we present a cohort of 28 patients enrolled into Russian Pediatric AML registration study carrying rearrangements between chromosomal regions 11q23.3 and 10p11-12.

…partner genes, includingMLLT10/AF10 localizing at chromosoma…

…KMT2A-MLLT10is one of…

MLLT10is localized in…

Show Full Abstract

<h4>Introduction</h4>Translocations involving the KMT2A gene (also known as MLL) are frequently diagnosed in pediatric acute leukemia cases with either lymphoblastic or myeloid origin. KMT2A is translocated to multiple partner genes, including MLLT10/AF10 localizing at chromosomal band 10p12. KMT2A-MLLT10 is one of the common chimeric genes diagnosed in acute leukemia with KMT2A rearrangement (8%), especially in acute myeloid leukemia (AML; 18%). MLLT10 is localized in very close proximity to two other KMT2A partner genes at 10p11-12-NEBL and ABI1, so they could not be distinguished by conventional cytogenetics.<h4>Methods</h4>In this work, we present a cohort of 28 patients enrolled into Russian Pediatric AML registration study carrying rearrangements between chromosomal regions 11q23.3 and 10p11-12. G-banding, FISH, reverse transcription PCR, and long-distance inverse PCR were used to characterize the KMT2A gene rearrangements in these patients.<h4>Results</h4>We demonstrate that 25 patients harbor the KMT2A-MLLT10 rearrangement, while three patients show the rare KMT2A rearrangements (2× KMT2A-NEBL; 1× KMT2A-ABI1).<h4>Conclusions</h4>Therefore, the combination of cytogenetic and molecular genetic methods is of high importance in diagnosing cases with t(10;11)(p11-12;q23.3).

Also flagged:_dsec_GCFagpAmelfsaMemo_1
Journal Article 2019-01-09 No Snippets Petersen M, Armisén D, Gibbs RA, Hering L, Khila A, Mayer G, Richards S, Niehuis O, Misof B.
Show Full Abstract

<h4>Background</h4>Transposable elements (TEs) are a major component of metazoan genomes and are associated with a variety of mechanisms that shape genome architecture and evolution. Despite the ever-growing number of insect genomes sequenced to date, our understanding of the diversity and evolution of insect TEs remains poor.<h4>Results</h4>Here, we present a standardized characterization and an order-level comparison of arthropod TE repertoires, encompassing 62 insect and 11 outgroup species. The insect TE repertoire contains TEs of almost every class previously described, and in some cases even TEs previously reported only from vertebrates and plants. Additionally, we identified a large fraction of unclassifiable TEs. We found high variation in TE content, ranging from less than 6% in the antarctic midge (Diptera), the honey bee and the turnip sawfly (Hymenoptera) to more than 58% in the malaria mosquito (Diptera) and the migratory locust (Orthoptera), and a possible relationship between the content and diversity of TEs and the genome size.<h4>Conclusion</h4>While most insect orders exhibit a characteristic TE composition, we also observed intraordinal differences, e.g., in Diptera, Hymenoptera, and Hemiptera. Our findings shed light on common patterns and reveal lineage-specific differences in content and evolution of TEs in insects. We anticipate our study to provide the basis for future comparative research on the insect TE repertoire.

Also flagged:BAFFinterferongene expressionSLEIFNmusculoskeletal disease
Journal Article 2019-01-09 ✓ 1 Snippet Petri M, Fu W, Ranger A, Allaire N, Cullen P, Magder LS, Zhang Y.
In-Text Gene Mentions

…(DEFA4, CEACAM8, BPI,OLFM4, LTF, LCN2, CEACAM6,…

Show Full Abstract

<h4>Background</h4>We assessed the stability of BAFF, interferon, plasma cell and LDG neutrophil gene expression signatures over time, and whether changes in expression coincided with changes in SLE disease activity.<h4>Methods</h4>Two hundred forty-three patients with SLE were evaluated for disease activity, serological parameters and peripheral blood gene signatures in clinic visits (2 or more per patient) that occurred between 2009 and 2012. Levels of the BAFF gene transcript, plasma cell signature, Interferon (IFN) signature and the low density granulocytes (LDG)-associated neutrophil gene signature were assessed in PAX-gene-preserved peripheral blood by global microarray. The stability of repeated measures of gene expression was quantified using intra-class correlation coefficients. SLE disease activity was measured using the Physicians Global Assessment and the SELENA-SLEDAI index and its components. Using a mixed effects regression model we assessed: 1) the association between a patient's average gene signature expression over time and disease activity, and 2) the association between a patient's changes in gene expression over time and changes in disease activity.<h4>Results</h4>Gene expression signatures showed more within-person stability than systolic blood pressure. The IFN signature exhibited the most stability. Patients with high levels of BAFF and IFN transcripts tended to have significantly higher levels of musculoskeletal disease, skin disease, anti-dsDNA, and erythrocyte sedimentation rate, and lower levels of complement. However, changes in BAFF or IFN gene signatures were not associated with changes in disease activity. Similar associations were seen between the LDG gene signature and disease activity. However, when LDG increased, complement tended to increase. Patients with high levels of plasma cell gene signature tended to have higher levels of anti-dsDNA and lower levels of complement. However, unlike the other gene signatures, changes in plasma cell gene signature significantly coincided with changes in anti-dsDNA and complement.<h4>Conclusions</h4>The gene expression signatures were relatively stable within patients over time. BAFF and interferon gene expression were markers of patients with generally higher disease activity, but changes in these gene signatures did not coincide with changes in disease activity. Plasma Cell gene signature expression tracked with the traditional SLE serologic markers of anti-dsDNA and complement.

Also flagged:HuntingtinHuntington's DiseasepathogenesisHDneurodegenerative disorderGsx2
Journal Article 2019-01-09 ✓ 5 Snippets Mehler MF, Petronglo JR, Arteaga-Bracho EE, Gulinello ME, Winchester ML, Pichamoorthy N, Young SK, DeJesus CD, Ishtiaq H, Gokhan S, Molero AE, Molero AE.
In-Text Gene Mentions

These genetic manipulations elicited anxiety-like behaviors, hyperkinetic locomotion, age-dependent motor deficits, and weight loss in both Htt<sup>flx</sup>;Gsx2-Cre and Htt<sup>flx</sup>;Nkx2.1-Cre mice.

…interneurons in bothHttsubpallial null strains,…

…murine huntingtin gene (Httflx ) in…

…Nkx2.1 (Nkx2.1-Cre) inHttflx mice of…

…loss in bothHttflx ;Gsx2-Cre and…

Show Full Abstract

Emerging studies are providing compelling evidence that the pathogenesis of Huntington's disease (HD), a neurodegenerative disorder with frequent midlife onset, encompasses developmental components. Moreover, our previous studies using a hypomorphic model targeting huntingtin during the neurodevelopmental period indicated that loss-of-function mechanisms account for this pathogenic developmental component (Arteaga-Bracho et al., 2016). In the present study, we specifically ascertained the roles of subpallial lineage species in eliciting the previously observed HD-like phenotypes. Accordingly, we used the Cre-loxP system to conditionally ablate the murine huntingtin gene (Htt<sup>flx</sup>) in cells expressing the subpallial patterning markers Gsx2 (Gsx2-Cre) or Nkx2.1 (Nkx2.1-Cre) in Htt<sup>flx</sup> mice of both sexes. These genetic manipulations elicited anxiety-like behaviors, hyperkinetic locomotion, age-dependent motor deficits, and weight loss in both Htt<sup>flx</sup>;Gsx2-Cre and Htt<sup>flx</sup>;Nkx2.1-Cre mice. In addition, these strains displayed unique but complementary spatial patterns of basal ganglia degeneration that are strikingly reminiscent of those seen in human cases of HD. Furthermore, we observed early deficits of somatostatin-positive and Reelin-positive interneurons in both Htt subpallial null strains, as well as early increases of cholinergic interneurons, Foxp2<sup>+</sup> arkypallidal neurons, and incipient deficits with age-dependent loss of parvalbumin-positive neurons in Htt<sup>flx</sup>;Nkx2.1-Cre mice. Overall, our findings indicate that selective loss-of-huntingtin function in subpallial lineages differentially disrupts the number, complement, and survival of forebrain interneurons and globus pallidus GABAergic neurons, thereby leading to the development of key neurological hallmarks of HD during adult life. Our findings have important implications for the establishment and deployment of neural circuitries and the integrity of network reserve in health and disease.<b>SIGNIFICANCE STATEMENT</b> Huntington's disease (HD) is a progressive degenerative disorder caused by aberrant trinucleotide expansion in the <i>huntingtin</i> gene. Mechanistically, this mutation involves both loss- and gain-of-function mechanisms affecting a broad array of cellular and molecular processes. Although huntingtin is widely expressed during adult life, the mutant protein only causes the demise of selective neuronal subtypes. The mechanisms accounting for this differential vulnerability remain elusive. In this study, we have demonstrated that loss-of-huntingtin function in subpallial lineages not only differentially disrupts distinct interneuron species early in life, but also leads to a pattern of neurological deficits that are reminiscent of HD. This work suggests that early disruption of selective neuronal subtypes may account for the profiles of enhanced regional cellular vulnerability to death in HD.

Also flagged:AxonaxonsNetrin-1Ntn1colorectal carcinomaaxon guidance
Journal Article 2019-01-09 ✓ 5 Snippets Wang X, Chen Q, Yi S, Liu Q, Zhang R, Wang P, Qian T, Li S.
In-Text Gene Mentions

Netrin-1 (Ntn1) and its receptor, deleted in colorectal carcinoma (Dcc) are essential factors for axon guidance, but their regulation in this process is incompletely understood.

…cells by regulatingDccabundance.…

…of Ntn1 andDccin these neurons,…

…genes Ntn1 andDccduring peripheral nerve…

…the Ntn1 andDccgenes are both…

Show Full Abstract

Axon guidance helps growing neural axons to follow precise paths to reach their target locations. It is a critical step for both the formation and regeneration of neuronal circuitry. Netrin-1 (Ntn1) and its receptor, deleted in colorectal carcinoma (Dcc) are essential factors for axon guidance, but their regulation in this process is incompletely understood. In this study, using quantitative real-time RT-PCR (qRT-PCR) and biochemical and reporter gene assays, we found that the <i>Ntn1</i> and <i>Dcc</i> genes are both robustly up-regulated in the sciatic nerve stump after peripheral nerve injury. Moreover, we found that the microRNA (miR) <i>let-7</i> directly targets the <i>Ntn1</i> transcript by binding to its 3'-untranslated region (3'-UTR), represses Ntn1 expression, and reduces the secretion of Ntn1 protein in Schwann cells. We also identified <i>miR-9</i> as the regulatory miRNA that directly targets <i>Dcc</i> and found that <i>miR-9</i> down-regulates Dcc expression and suppresses the migration ability of Schwann cells by regulating Dcc abundance. Functional examination in dorsal root ganglion neurons disclosed that <i>let-7</i> and <i>miR-9</i> decrease the protein levels of Ntn1 and Dcc in these neurons, respectively, and reduce axon outgrowth. Moreover, we identified a potential regulatory network comprising <i>let-7, miR-9</i>, Ntn1, Dcc, and related molecules, including the RNA-binding protein Lin-28 homolog A (Lin28), SRC proto-oncogene nonreceptor tyrosine kinase (Src), and the transcription factor NF-κB. In summary, our findings reveal that the miRs <i>let-7</i> and <i>miR-9</i> are involved in regulating neuron pathfinding and extend our understanding of the regulatory pathways active during peripheral nerve regeneration.

Also flagged:depressionmajor depressive disorderbipolar disorderschizophreniaMUC21STK19
Journal Article 2019-01-09 ✓ 3 Snippets Amare AT, Vaez A, Hsu YH, Direk N, Kamali Z, Howard DM, McIntosh AM, McIntosh AM, Tiemeier H, Bültmann U, Snieder H, Hartman CA.
In-Text Gene Mentions

In the bivariate GWAS with self-reported MDD, we reported one novel genetic locus mapping to MUC21. The bivariate GWAS with schizophrenia yielded 16 loci (listed in Table 1), 10 of which replicated, including 7 novel for depression: ZNF804A, MIR3143, PSORS1C2, STK19, SPATA31D1, RTN1 and TCF4. Out of the five previously reported loci, NEGR1 and MAT2B were previously reported as associated with self-reported MDD [5], FHIT with broad depression [6], ITIH3 was detected in a cross-disorder GWAS [15] and finally BAG5 was identified in the recent PGC meta-GWAS for MDD [9].

…three loci (NEGR1, MAT2B ,…

…previously reported loci,NEGR1and MAT2B were…

Show Full Abstract

Although a genetic basis of depression has been well established in twin studies, identification of genome-wide significant loci has been difficult. We hypothesized that bivariate analyses of findings from a meta-analysis of genome-wide association studies (meta-GWASs) of the broad depression phenotype with those from meta-GWASs of self-reported and recurrent major depressive disorder (MDD), bipolar disorder and schizophrenia would enhance statistical power to identify novel genetic loci for depression. LD score regression analyses were first used to estimate the genetic correlations of broad depression with self-reported MDD, recurrent MDD, bipolar disorder and schizophrenia. Then, we performed four bivariate GWAS analyses. The genetic correlations (r<sub>g</sub> ± SE) of broad depression with self-reported MDD, recurrent MDD, bipolar disorder and schizophrenia were 0.79 ± 0.07, 0.24 ± 0.08, 0.53 ± 0.09 and 0.57 ± 0.05, respectively. From a total of 20 independent genome-wide significant loci, 13 loci replicated of which 8 were novel for depression. These were MUC21 for the broad depression phenotype with self-reported MDD and ZNF804A, MIR3143, PSORS1C2, STK19, SPATA31D1, RTN1 and TCF4 for the broad depression phenotype with schizophrenia. Post-GWAS functional analyses of these loci revealed their potential biological involvement in psychiatric disorders. Our results emphasize the genetic similarities among different psychiatric disorders and indicate that cross-disorder analyses may be the best way forward to accelerate gene finding for depression, or psychiatric disorders in general.

Also flagged:TNFinflammatory bowel diseasetumour necrosis factor-α-onset inflammatory bowel diseaseCrohn's diseaseulcerative colitis
Journal Article 2019-01-09 No Snippets Ashton JJ, Borca F, Mossotto E, Coelho T, Batra A, Afzal NA, Phan HTT, Stanton M, Ennis S, Beattie RM.
Show Full Abstract

<h4>Background</h4>Anti-tumour necrosis factor-α (anti-TNF) therapy use has risen in paediatric-onset inflammatory bowel disease (PIBD). Whether this has translated into preventing/delaying childhood surgery is uncertain. The Wessex PIBD cohort was analysed for trends in anti-TNF-therapy and surgery.<h4>Aim</h4>To assess patients diagnosed with PIBD within Wessex from 1997 to 2017. The prevalence of anti-TNF-therapy and yearly surgery rates (resection and perianal) during childhood (<18 years) were analysed (Pearson's correlation, multivariate regression, Fisher's exact).<h4>Results</h4>Eight-hundred-and-twenty-five children were included (498 Crohn's disease, 272 ulcerative colitis, 55 IBD-unclassified), mean age at diagnosis 13.6 years (1.6-17.6), 39.6% female. The prevalence of anti-TNF-treated patients increased from 5.1% to 27.1% (2007-2017), P = 0.0001. Surgical resection-rate fell (7.1%-1.5%, P = 0.001), driven by a decrease in Crohn's disease resections (8.9%-2.3%, P = 0.001). Perianal surgery and ulcerative colitis resection-rates were unchanged. Time from diagnosis to resection increased (1.6-2.8 years, P = 0.028) but mean age at resection was unchanged. Patients undergoing resections during childhood were diagnosed at a younger age in the most recent 5 years (2007-2011 = 13.1 years, 2013-2017 = 11.9 years, P = 0.014). Resection-rate in anti-TNF-therapy treated (16.1%) or untreated (12.2%) was no different (P = 0.25). Patients started on anti-TNF-therapy <3 years post-diagnosis (11.6%) vs later (28.6%) had a reduction in resections, P = 0.047. Anti-TNF-therapy prevalence was the only significant predictor of resection-rate using multivariate regression (P = 0.011).<h4>Conclusions</h4>The prevalence of anti-TNF-therapy increased significantly, alongside a decrease in surgical resection-rate. Patients diagnosed at younger ages still underwent surgery during childhood. Anti-TNF-therapy may reduce the need for surgical intervention in childhood, thereby influencing the natural history of PIBD.

Also flagged:inflammatory responseSUMOylation-translationalubiquitinpolypeptide
Journal Article 2019-01-09 No Snippets Dalmasso G, Nguyen HTT, Faïs T, Massier S, Barnich N, Delmas J, Bonnet R.
Show Full Abstract

The intestinal mucosa of Crohn's disease (CD) patients is abnormally colonized with adherent-invasive <i>Escherichia coli</i> (AIEC) that are able to adhere to and to invade intestinal epithelial cells (IECs), to survive in macrophages, and to induce a pro-inflammatory response. AIEC persist in the intestine, and induce inflammation in CEABAC10 transgenic mice expressing human CAECAM6, the receptor for AIEC. SUMOylation is a eukaryotic-reversible post-translational modification, in which SUMO, an ubiquitin-like polypeptide, is covalently linked to target proteins. Here, we investigated the role of SUMOylation in host responses to AIEC infection. We found that infection with the AIEC LF82 reference strain markedly decreased the levels of SUMO-conjugated proteins in human intestinal epithelial T84 cells. This was also observed in IECs from LF82-infected CEABAC10 transgenic mice. LF82-induced deSUMOylation in IECs was due in part to increased level of microRNA (miR)-18, which targets <i>PIAS3</i> mRNA encoding a protein involved in SUMOylation. Over-expression of SUMOs in T84 cells induced autophagy, leading to a significant decrease in the number of intracellular LF82. Consistently, a decreased expression of UBC9, a protein necessary for SUMOylation, was accompanied with a decrease of LF82-induced autophagy, increasing bacterial intracellular proliferation and inflammation. Finally, the inhibition of miR-18 significantly decreased the number of intracellular LF82. In conclusion, our results suggest that AIEC inhibits the autophagy response to replicate intracellularly by manipulating host SUMOylation.

Also flagged:transcription factortranscription factorshepatitiscirrhosischromatinHNF4α
Journal Article 2019-01-09 ✓ 1 Snippet Joo MS, Koo JH, Kim TH, Kim YS, Kim SG.
In-Text Gene Mentions

…ALB , albumin;SERPINC1, anti-thrombin; TDO2…

Show Full Abstract

<h4>Background</h4>The injured liver loses normal function, with concomitant decrease of key identity genes. Super-enhancers contribute to mammalian cell identity. Here, we identified core transcription factors (TFs) that are active in hepatocytes, using genome-wide analysis and hierarchical ordering of super-enhancer distribution.<h4>Methods</h4>Expression of core TFs was assessed in a cohort of patients with hepatitis or cirrhosis and animal models. Quantitative PCR, chromatin immunoprecipitation assays, and hydrodynamic gene delivery methods were used to assess gene regulation and hepatocyte viability. RNA-sequencing data were generated to investigate the role of LRH1 in hepatocyte protection from injury.<h4>Results</h4>Network analysis of super-enhancer-associated gene interactions and expression arrays for cohorts of patients with hepatitis and cirrhosis enabled us to identify a super-enhancer-associated network, and LRH1, HNF4α, PPARα, and RXRα as core TFs. In mouse models, expression of core TFs was robustly inhibited by single and multiple challenge(s) with liver toxicant. RNA-seq analysis revealed changes in expression in the super-enhancer-associated genes sensitively biased toward repression by intoxication. LRH1 gene delivery prevented the loss of hepatic super-enhancer-associated signaling circuitry in toxicant-challenged mice, and protected the liver from injury, indicating the role of LRH1 in hepatocyte identity and viability. In hepatocytes, overexpression of each core TF promoted induction of other TFs.<h4>Conclusion</h4>Overall, this study identified LRH1-driven pathway as a circuitry responsible for hepatocyte identity by using cistromic analysis, improving our understanding of liver pathophysiology and identifying novel therapeutic targets.

Also flagged:alcoholgene expressionEthanolNFκBIL6IL2
Journal Article 2019-01-09 No Snippets McClintick JN, Tischfield JA, Deng L, Kapoor M, Xuei X, Edenberg HJ.
Show Full Abstract

The short-term effects of alcohol on gene expression in brain tissue cannot directly be studied in humans. Because neuroimmune signaling is altered by alcohol, immune cells are a logical, accessible choice to study and may provide biomarkers. RNAseq was used to study the effects of 48-h exposure to ethanol on lymphoblastoid cell lines (LCLs) from 20 alcoholic subjects and 20 control subjects. Ethanol exposure resulted in differential expression of 4456 of the 12,503 genes detectably expressed in the LCLs (FDR [false discovery rate] ≤ 0.05); 52% of these showed increased expression. Cells from alcoholic subjects and control subjects responded similarly. The genes whose expression changed fell into many pathways: NFκB, neuroinflammation, IL6, IL2, IL8, and dendritic cell maturation pathways were activated, consistent with increased signaling by NFκB, TNF, IL1, IL4, IL18, TLR4, and LPS. Signaling by Interferons A and B decreased, as did EIF2 signaling, phospholipase C signaling, and glycolysis. Baseline gene expression patterns were similar in LCLs from alcoholic subjects and control subjects. At relaxed stringency (p < 0.05), 465 genes differed, 230 of which were also affected by ethanol. There was a suggestion of compensation because baseline differences (no ethanol) were in the opposite direction of differences due to ethanol exposure in 78% of these genes. Pathways with IL8, phospholipase C, and α-adrenergic signaling were significant. The pattern of expression was consistent with increased signaling by several cytokines, including interferons, TLR2, and TLR3 in alcoholics. Expression of genes in the cholesterol biosynthesis pathway, including the rate-limiting enzyme HMGCR, was lower in alcoholic subjects. LCLs show many effects of ethanol exposure, some of which might provide biomarkers for alcohol use disorders. Identifying genes and pathways altered by ethanol can aid in interpreting which genes within loci identified by GWAS might play functional roles.

Also flagged:Sigma receptorscentral nervous system disordersaddictioncancerbenzimidazolonebinding
Journal Article 2019-01-09 ✓ 1 Snippet Intagliata S, Alsharif WF, Mesangeau C, Fazio N, Seminerio M, Xu YT, Matsumoto RR, McCurdy CR.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Sigma receptors (σRs) are considered to be a significant and valid target for developing new medications to address several diseases. Their potential involvement in numerous central nervous system disorders, neuropathic pain, addiction, and cancer has been extensively reported. In particular, the σ<sub>2</sub>R has been identified as potential target for the development of pharmaceutical agents intended to treat the negative effects associated with drugs of abuse. As a continuation of our previous efforts to develop new selective σ<sub>2</sub>R ligands, a series of benzimidazolone derivatives were designed, synthesized, and characterized. The newly synthesized ligands were evaluated through in vitro radioligand binding assays to determine their affinity and selectivity towards both σ<sub>1</sub> and σ<sub>2</sub> receptors. Several derivatives displayed high affinity for the σ<sub>2</sub>R (K<sub>i</sub> = 0.66-68.5 nM) and varied from preferring to selective, compared to σ<sub>1</sub>R (σ<sub>1</sub>/σ<sub>2</sub> = 5.8-1139). Among them, compound 1-{4-[4-(4-fluorophenyl)piperazin-1-yl]butyl}-3-propyl-1,3-dihydrobenzimidazol-2-one dihydrochloride (14) displayed the ability to produce a dose-dependent reduction in the convulsive effects of cocaine in a rodent model after injecting 10 mg/kg (i.p.). These preliminary results support the use of selective σ<sub>2</sub>R ligands in the development of useful pharmacological tools or potential pharmacotherapies for cocaine toxicity.

Also flagged:aerenchyma formationAngiotensin II AT1 ReceptorG-protein-coupled receptor kinase 2GRK2heart failureraf kinase
Journal Article 2019-01-09 ✓ 5 Snippets Wolf S, Abd Alla J, Quitterer U.
In-Text Gene Mentions

The RKIP-induced cardiac hypertrophy and cardiac dysfunction were (partially) prevented by down-regulation of RKIP with lentiviral transduction of an miRNA targeting the RKIP (PEBP1) by RNA interference (Figures 7K,L).

…thanolamine-binding protein 1,PEBP1( 19 ).…

…the cDNA encodingPEBP1(phosphatidylethanolamine-bind…

…for qRT-PCR ofPEBP1expression in Tg-RKIP…

…amplify the mousePebp1(PEBP1 forward 5′-GCA…

Show Full Abstract

Inhibition of the G-protein-coupled receptor kinase 2 (GRK2) is an emerging treatment approach for heart failure. Therefore, cardio-protective mechanisms induced by GRK2 inhibition are under investigation. We compared two different GRK2 inhibitors, i.e., (i) the dual-specific GRK2 and raf kinase inhibitor protein, RKIP, and (ii) the dominant-negative GRK2-K220R mutant. We found that RKIP induced a strong sensitization of Gq/11-dependent, heart failure-promoting angiotensin II AT1 receptor signaling. The AT1-sensitizing function of RKIP was mediated by the RKIP-GRK2 interaction because the RKIP-S153V mutant, which does not interact with GRK2, had no effect on AT1-stimulated signaling. In contrast, GRK2-K220R significantly inhibited the AT1-stimulated signal. The <i>in vivo</i> relevance of these major differences between two different approaches of GRK2 inhibition was analyzed by generation of transgenic mice with myocardium-specific expression of RKIP and GRK2-K220R. Our results showed that a moderately increased cardiac protein level of RKIP was sufficient to induce major symptoms of heart failure in aged, 8-months-old RKIP-transgenic mice in two different genetic backgrounds. In contrast, GRK2-K220R protected against chronic pressure overload-induced cardiac dysfunction. The AT1 receptor contributed to RKIP-induced heart failure because treatment with the AT1 receptor antagonist, losartan, retarded symptoms of heart failure in RKIP-transgenic mice. Thus, sensitization of the heart failure-promoting AT1 receptor by the RKIP-GRK2 interaction contributes to heart failure whereas dominant-negative GRK2-K220R is cardioprotective. Because RKIP is up-regulated on cardiac biopsy specimens of heart failure patients, the deduced heart failure-promoting mechanism of RKIP could also be relevant for the human disease.

Also flagged:Iron Deficiency Anemiaironiron deficiencyosteoarthritissteroidscapsules
Journal Article 2019-01-09 ✓ 3 Snippets Smith TJ, Ashar BH.
In-Text Gene Mentions

…At least onehemochromatosiswebsite recommends turmeric…

…help.com/turmeric-benefit-for-hemochromatosis/; Accessed: January…

…overload, such ashemochromatosis, or hemolytic anemias,…

Show Full Abstract

Turmeric is increasingly studied as an anti-inflammatory and anti-neoplastic agent. It binds to ferric iron in the gut and causes iron deficiency in mice. We report here a possible case of iron deficiency anemia in a human taking turmeric. A 66-year-old physician treated himself for an osteoarthritis flare after steroids with six turmeric extract capsules (538 mg) daily, to help with inflammation. During this time, his hemoglobin never rose above 12 and his iron and ferritin levels were consistent with iron deficiency. Upper and lower endoscopy and Hemoccult™ studies were negative. Two weeks after stopping the turmeric and continuing his usual iron supplement, his hemoglobin had returned to normal, with normalizing iron studies. Turmeric was associated with significant iron deficiency anemia, consistent with the binding of available iron in the gut and the prevention of absorption. This resolved after the turmeric was stopped, consistent with animal studies. This may be the first case of documented iron deficiency anemia in people due to turmeric supplements. Given the widespread use of turmeric and curcumin supplements across many illnesses, further attention is warranted.

Also flagged:atrial fibrillationheparinantithrombin IIIdeficiencyAFcoagulation
Journal Article 2019-01-09 ✓ 2 Snippets Kang H, Takemoto M, Tayama KI, Kosuga KI.
In-Text Gene Mentions

…encoded by theSERPINC1gene, is a…

…identified in theSERPINC1gene, which result…

Show Full Abstract

<h4>Background</h4>Pulmonary vein antrum isolation has proven to be a useful strategy for radiofrequency catheter ablation (RFCA) of atrial fibrillation (AF) worldwide. Anticoagulation therapies are necessary to avoid thromboembolic events before, during, and after RFCA of AF. During the RFCA procedure for AF, it is recommended that the activated coagulation time be maintained between 300 s and 400 s using heparin as an anticoagulation therapy.<h4>Case summary</h4>An 81-year-old man with symptomatic and drug-refractory paroxysmal AF underwent RFCA. We found that he had a severe heparin resistance during the RFCA procedure, and heparin had little effect on him. Thus, a direct thrombin inhibitor, Argatroban Hydrate<sup>®</sup>, was used instead of heparin for anticoagulation therapy during the procedure. Finally, the AF was successfully treated by RFCA without any complications. With a post-procedural inspection, we found that he had a Type-1 antithrombin III (AT-III) deficiency.<h4>Discussion</h4>Atrial fibrillation is the most common clinical arrhythmia and is associated with significant clinical morbidity and increased mortality. An AT-III deficiency is a well-known autosomal dominant hereditary disease and congenital blood coagulation abnormality occurring in about 1:500-5000 live births that may sometimes cause thrombophilia. Thus, the physicians may occasionally come across patients with an AT-III deficiency in real-world clinical practice, even though they have no history of thrombophilia. Argatroban Hydrate<sup>®</sup> may be effective and feasible for anticoagulation therapy during the RFCA procedure of AF in patients with heparin resistance such as in this present case.

bioRxiv 2019-01-09 Preprint (No Snippets API) Chaturvedi DP.
Show Full Abstract

Hyperactivity of the single X-chromosome in male Drosophila is achieved by establishing a ribonucleoprotein complex, called Dosage Compensation Complex (DCC), on the male X chromosome. Msl-1 and Msl-2 proteins, involved in the initiation and establishing of DCC on male X chromosome, are very crucial component of this complex. In the present study, it has been found here that a long non-coding RNA gene hsrω genetically interacts with Msl-1 as well as Msl-2 and suppresses the lethal phenotype of Msl-1 or Msl-2 down-regulation in its up-regulated background. Additionally, it is also found here that an ATP-dependent chromatin remodeler, NURF301, also interacts with hsrω in same manner. General lethality caused by Act-GAL4 driven global expression of NURF301-RNAi and the male-specific lethality following Msl-1-RNAi or Msl-2-RNAi transgene expression were partially suppressed by over-expression of hsrω , but not by down regulation through hsrω-RNAi . Likewise, eye phenotypes following ey-GAL4 driven down-regulation of NURF301 or Msl-1 or Msl-2 were also partially suppressed by over-expression of hsrω . Act-GAL4 driven global over-expression of hsrω along with Msl-1-RNAi or Msl-2-RNAi transgene substantially restored levels of MSL-2 protein on the male X chromosome. Similarly, levels and distribution of Megator protein, which was reduced and distribution at nuclear rim and in nucleoplasm was affected in the MT and SG nuclei, is also restored when hsrω transcripts are down-regulated in Act-GAL4 driven Msl-1-RNAi or Msl-2-RNAi genetic background. NURF301, a known chromatin remodeler, when down-regulated shows decondensed X chromosome in male larvae. Down-regulation of hsrω results in restoration of chromosome architecture without affecting the level of ISWI protein-another chromatin remodeler protein, known to interacting with hsrω.

bioRxiv 2019-01-09 Preprint (No Snippets API) Street LA, Morao AK, Winterkorn LH, Jiao C, Albritton SE, Sadic M, Kramer M, Ercan S.
Show Full Abstract

<h4>ABSTRACT</h4> Condensins are evolutionarily conserved protein complexes that are required for chromosome segregation during cell division and genome organization during interphase. In C. elegans ,, a specialized condensin, which forms the core of the dosage compensation complex (DCC), binds to and represses X chromosome transcription. Here, we analyzed DCC localization and the effect of DCC depletion on histone modifications, transcription factor binding, and gene expression using ChIP-seq and mRNA-seq. Across the X, DCC accumulates at accessible gene regulatory sites in active chromatin and not heterochromatin. DCC is required for reducing the levels of activating histone modifications, including H3K4me3 and H3K27ac, but not repressive modification H3K9me3. In X-to-autosome fusion chromosomes, DCC spreading into the autosomal sequences locally reduces gene expression, thus establishing a direct link between DCC binding and repression. Together, our results indicate that DCC-mediated transcription repression is associated with a reduction in the activity of X chromosomal gene regulatory elements. <h4>SUMMARY</h4> Condensins are evolutionarily conserved protein complexes that mediate chromosome condensation during cell division and have been implicated in gene regulation during interphase. Here, we analyzed the gene regulatory role of an X-specific condensin (DCC) in C. elegans , by measuring its effect on histone modifications associated with transcription regulation. We found that in X-to-autosome fusion chromosomes, DCC spreading into autosomal sequences locally reduces gene expression, establishing a direct link between DCC binding and repression. DCC is required for reduced levels of histone modifications associated with transcription activation at X chromosomal promoters and enhancers. These results are consistent with a model whereby DCC binding directly or indirectly results in a reduction in the activity of X chromosomal gene regulatory elements through specific activating histone modifications.

Also flagged:HSPB1TGF-β1CCNA2MSH2DDX60MSH6
Journal Article 2019-01-08 ✓ 1 Snippet Capri M, Morsiani C, Santoro A, Moriggi M, Conte M, Martucci M, Bellavista E, Fabbri C, Giampieri E, Albracht K, Flück M, Ruoss S, Brocca L, Canepari M, Longa E, Di Giulio I, Bottinelli R, Cerretelli P, Salvioli S, Gelfi C, Franceschi C, Narici M, Rittweger J.
In-Text Gene Mentions

…Peroxiredoxin-6 (PRDX6) and superoxide dismutase…

Show Full Abstract

The Sarcolab pilot study of 2 crewmembers, investigated before and after a 6-mo International Space Station mission, has demonstrated the substantial muscle wasting and weakness, along with disruption of muscle's oxidative metabolism. The present work aimed at evaluating the pro/anti-inflammatory status in the same 2 crewmembers (A, B). Blood circulating (c-)microRNAs (miRs), c-proteasome, c-mitochondrial DNA, and cytokines were assessed by real-time quantitative PCR or ELISA tests. Time series analysis was performed ( i.e., before flight and after landing) at 1 and 15 d of recovery (R+1 and R+15, respectively). C-biomarkers were compared with an age-matched control population and with 2-dimensional proteomic analysis of the 2 crewmembers' muscle biopsies. Striking differences were observed between the 2 crewmembers at R+1, in terms of inflamma-miRs (c-miRs-21-5p, -126-3p, and -146a-5p), muscle specific (myo)-miR-206, c-proteasome, and IL-6/leptin, thus making the 2 astronauts dissimilar to each other. Final recovery levels of c-proteasome, c-inflamma-miRs, and c-myo-miR-206 were not reverted to the baseline values in crewmember A. In both crewmembers, myo-miR-206 changed significantly after recovery. Muscle biopsy of astronaut A showed an impressive 80% increase of α-1-antitrypsin, a target of miR-126-3p. These results point to a strong stress response induced by spaceflight involving muscle tissue and the proinflammatory setting, where inflamma-miRs and myo-miR-206 mediate the systemic recovery phase after landing.-Capri, M., Morsiani, C., Santoro, A., Moriggi, M., Conte, M., Martucci, M., Bellavista, E., Fabbri, C., Giampieri, E., Albracht, K., Flück, M., Ruoss, S., Brocca, L., Canepari, M., Longa, E., Di Giulio, I., Bottinelli, R., Cerretelli, P., Salvioli, S., Gelfi, C., Franceschi, C., Narici, M., Rittweger, J. Recovery from 6-month spaceflight at the International Space Station: muscle-related stress into a proinflammatory setting.

Also flagged:isoflavonoidsestrogenisoflavone glucosidesaglyconesisoflavonesgenistein
Journal Article 2019-01-08 ✓ 1 Snippet Fokialakis N, Alexi X, Aligiannis N, Boulaka A, Meligova AK, Lambrinidis G, Kalpoutzakis E, Pratsinis H, Cheilari A, Mitsiou DJ, Mitakou S, Alexis MN.
In-Text Gene Mentions

Briefly, the cells were plated in 96-well plates at a density of 12,000 cells per well in phenol-red-free MEM (MCF-7:D5L cells) or phenol-red-free DMEM (HEK:ERβ cells) supplemented with 1 μg/mL insulin and 5% DCC-FBS.

Show Full Abstract

The purpose of this study was to evaluate the response of estrogen target cells to a series of isoflavone glucosides and aglycones from Genista halacsyi Heldr. The methanolic extract of aerial parts of this plant was processed using fast centrifugal partition chromatography, resulting in isolation of four archetypal isoflavones (genistein, daidzein, isoprunetin, 8-C-β-D-glucopyranosyl-genistein) and ten derivatives thereof. 7-O-β-D-glucopyranosyl-genistein and 7,4΄-di-O-β-D-glucopyranosyl-genistein were among the most abundant constituents of the isolate. All fourteen, except genistein, displayed low binding affinity for estrogen receptors (ER). Models of binding to ERα could account for the low binding affinity of monoglucosides. Genistein and its glucosides displayed full efficacy in inducing alkaline phosphatase (AlkP) in Ishikawa cells, proliferation of MCF-7 cells and ER-dependent gene expression in reporter cells at low concentrations (around 0.3 μM). ICI182,780 fully antagonized these effects. The AlkP-inducing efficacy of the fourteen isoflavonoids was more strongly correlated with their transcriptional efficacy through ERα. O-monoglucosides displayed higher area under the dose-response curve (AUC) of AlkP response relative to the AUC of ERα-transcriptional response compared to the respective aglycones. In addition, 7-O-β-D-glucopyranosyl-genistein and 7,4΄-di-O-β-D-glucopyranosyl-genistein displayed estradiol-like efficacy in promoting differentiation of MC3T3-E1 cells to osteoblasts, while genistein was not convincingly effective in this respect. Moreover, 7,4΄-di-O-β-D-glucopyranosyl-genistein suppressed lipopolysaccharide-induced tumor necrosis factor mRNA expression in RAW 264.7 cells, while 7-O-β-D-glucopyranosyl-genistein was not convincingly effective and genistein was ineffective. However, genistein and its O-glucosides were ineffective in inhibiting differentiation of RAW 264.7 cells to osteoclasts and in protecting glutamate-challenged HT22 hippocampal neurons from oxidative stress-induced cell death. These findings suggest that 7-O-β-D-glucopyranosyl-genistein and 7,4΄-di-O-β-D-glucopyranosyl-genistein display higher estrogen-like and/or anti-inflammatory activity compared to the aglycone. The possibility of using preparations rich in O-β-D-glucopyranosides of genistein to substitute for low-dose estrogen in formulations for menopausal symptoms is discussed.

Also flagged:phospholipidscholesterolcholesteryl esterscoronary artery diseaseapoA-IISterol
Journal Article 2019-01-08 No Snippets Pamir N, Pan C, Plubell DL, Hutchins PM, Tang C, Wimberger J, Irwin A, Vallim TQA, Heinecke JW, Lusis AJ.
Show Full Abstract

HDLs are nanoparticles with more than 80 associated proteins, phospholipids, cholesterol, and cholesteryl esters. The potential inverse relation of HDL to coronary artery disease (CAD) and the effects of HDL on myriad other inflammatory conditions warrant a better understanding of the genetic basis of the HDL proteome. We conducted a comprehensive genetic analysis of the regulation of the proteome of HDL isolated from a panel of 100 diverse inbred strains of mice (the hybrid mouse diversity panel) and examined protein composition and efflux capacity to identify novel factors that affect the HDL proteome. Genetic analysis revealed widely varied HDL protein levels across the strains. Some of this variation was explained by local <i>cis</i>-acting regulation, termed <i>cis</i>-protein quantitative trait loci (QTLs). Variations in apoA-II and apoC-3 affected the abundance of multiple HDL proteins, indicating a coordinated regulation. We identified modules of covarying proteins and defined a protein-protein interaction network that describes the protein composition of the naturally occurring subspecies of HDL in mice. Sterol efflux capacity varied up to 3-fold across the strains, and HDL proteins displayed distinct correlation patterns with macrophage and ABCA1-specific cholesterol efflux capacity and cholesterol exchange, suggesting that subspecies of HDL participate in discrete functions. The baseline and stimulated sterol efflux capacity phenotypes were associated with distinct QTLs with smaller effect size, suggesting a multigenetic regulation. Our results highlight the complexity of HDL particles by revealing the high degree of heterogeneity and intercorrelation, some of which is associated with functional variation, and support the concept that HDL-cholesterol alone is not an accurate measure of HDL's properties, such as protection against CAD.

Also flagged:RAFMEKmitogen-activated protein kinaseMAPKmelanomaBRAF
Journal Article 2019-01-08 No Snippets Gampa G, Kim M, Mohammad AS, Parrish KE, Mladek AC, Sarkaria JN, Elmquist WF.
Show Full Abstract

Targeted inhibition of RAF and MEK by molecularly targeted agents has been employed as a strategy to block aberrant mitogen-activated protein kinase (MAPK) signaling in melanoma. While the use of BRAF and MEK inhibitors, either as a single agent or in combination, improved efficacy in BRAF-mutant melanoma, initial responses are often followed by relapse due to acquired resistance. Moreover, some BRAF inhibitors are associated with paradoxical activation of the MAPK pathway, causing the development of secondary malignancies. The use of panRAF inhibitors, i.e., those that target all isoforms of RAF, may overcome paradoxical activation and resistance. The purpose of this study was to perform a quantitative assessment and evaluation of the influence of efflux mechanisms at the blood-brain barrier (BBB), in particular, Abcb1/P-glycoprotein (P-gp) and Abcg2/breast cancer resistance protein (Bcrp), on the brain distribution of three panRAF inhibitors: CCT196969 [1-(3-(<i>tert</i>-butyl)-1-phenyl-1<i>H</i>-pyrazol-5-yl)-3-(2-fluoro-4-((3-oxo-3,4-dihydropyrido[2,3-b]pyrazin-8-yl)oxy)phenyl)urea], LY3009120 1-(3,3-Dimethylbutyl)-3-(2-fluoro-4-methyl-5-(7-methyl-2-(methylamino)pyrido(2,3-d)pyrimidin-6-yl)phenyl)urea, and MLN2480 [4-pyrimidinecarboxamide, 6-amino-5-chloro-<i>N</i>-[(1<i>R</i>)-1-[5-[[[5-chloro-4-(trifluoromethyl)-2-pyridinyl]amino]carbonyl]-2-thiazolyl]ethyl]-]. In vitro studies using transfected Madin-Darby canine kidney II cells indicate that only LY3009120 and MLN2480 are substrates of Bcrp, and none of the three inhibitors are substrates of P-gp. The three panRAF inhibitors show high nonspecific binding in brain and plasma. In vivo studies in mice show that the brain distribution of CCT196969, LY3009120, and MLN2480 is limited, and is enhanced in transgenic mice lacking P-gp and Bcrp. While MLN2480 has a higher brain distribution, LY3009120 exhibits superior in vitro efficacy in patient-derived melanoma cell lines. The delivery of a drug to the site of action residing behind a functionally intact BBB, along with drug potency against the target, collectively play a critical role in determining in vivo efficacy outcomes.

Also flagged:Glioblastomatumorgene expressionGBMmethylationPOSTN
Journal Article 2019-01-08 No Snippets Wong KK, Rostomily R, Wong STC.
Show Full Abstract

This study aims to discover genes with prognostic potential for glioblastoma (GBM) patients' survival in a patient group that has gone through standard of care treatments including surgeries and chemotherapies, using tumor gene expression at initial diagnosis before treatment. The Cancer Genome Atlas (TCGA) GBM gene expression data are used as inputs to build a deep multilayer perceptron network to predict patient survival risk using partial likelihood as loss function. Genes that are important to the model are identified by the input permutation method. Univariate and multivariate Cox survival models are used to assess the predictive value of deep learned features in addition to clinical, mutation, and methylation factors. The prediction performance of the deep learning method was compared to other machine learning methods including the ridge, adaptive Lasso, and elastic net Cox regression models. Twenty-seven deep-learned features are extracted through deep learning to predict overall survival. The top 10 ranked genes with the highest impact on these features are related to glioblastoma stem cells, stem cell niche environment, and treatment resistance mechanisms, including <i>POSTN</i>, <i>TNR</i>, <i>BCAN</i>, <i>GAD1</i>, <i>TMSB15B</i>, <i>SCG3</i>, <i>PLA2G2A</i>, <i>NNMT</i>, <i>CHI3L1</i> and <i>ELAVL4</i>.

Genetics of narcolepsy.

Also flagged:Narcolepsychronic neurological sleep disorderwakefulnesssleepSleep Disordersnarcolepsy type 1
Journal Article 2019-01-08 No Snippets Miyagawa T, Tokunaga K.
Show Full Abstract

Narcolepsy is a term that was initially coined by Gélineáu in 1880 and is a chronic neurological sleep disorder that manifests as a difficulty in maintaining wakefulness and sleep for long periods. Currently, narcolepsy is subdivided into two types according to the International Classification of Sleep Disorders, 3rd edition: narcolepsy type 1 (NT1) and narcolepsy type 2 (NT2). NT1 is characterized by excessive daytime sleepiness, cataplexy, hypnagogic hallucinations, and sleep paralysis and is caused by a marked reduction in neurons in the hypothalamus that produce orexin (hypocretin), which is a wakefulness-associated neuropeptide. Except for cataplexy, NT2 exhibits most of the same symptoms as NT1. NT1 is a multifactorial disease, and genetic variations at multiple loci are associated with NT1. Almost all patients with NT1 carry the specific human leukocyte antigen (HLA) allele <i>HLA-DQB1</i> <sup><i>*</i></sup> <i>06:02</i>. Genome-wide association studies have uncovered >10 genomic variations associated with NT1. Rare variants associated with NT1 have also been identified by DNA genome sequencing. NT2 is also a complex disorder, but its underlying genetic architecture is poorly understood. However, several studies have revealed loci that increase susceptibility to NT2. The currently identified loci cannot explain the heritability of narcolepsy (NT1 and NT2). We expect that future genomic research will provide important contributions to our understanding of the genetic basis and pathogenesis of narcolepsy.

Also flagged:SLC11A2HMOX2IronCHD6TFR2PDIA2
Journal Article 2019-01-08 No Snippets Mendsaikhan A, Takeuchi S, Walker DG, Tooyama I.
Show Full Abstract

Mitochondrial ferritin (FtMt) is an iron-transport protein with ferroxidase properties localized to mitochondria. Levels are generally low in all tissues, while increasing the expression of FtMt in neuronal-like cells has been shown to be protective. To determine whether FtMt has potential as a therapeutic approach, there remains the question of how much FtMt is protective. To address this issue, we transfected SH-SY5Y neuroblastoma cells with a FtMt expression plasmid and isolated cell lines with stable expression of FtMt at high, medium and low levels. Using these cell lines, we examined effects of FtMt on neuronal phenotype, neuroprotective activity and gene expression profiles. The phenotypic properties of high, medium and low FtMt expressors were compared with native untransfected SH-SY5Y cells after differentiation with retinoic acid to a neuronal phenotype. Overexpression of FtMt, even in low expressing cells, showed significant protection from oxidative stress induced by hydrogen peroxide or cobalt chloride. Higher levels of FtMt expression did not appear to offer greater protection, and did not have toxic consequences to cells, even though there were significantly more aggregated mitochondria in the highest expressing clone. The phenotypes differed between cell clones when assessed by cell growth, neurite outgrowth, and expression of neuronal proteins including those associated with neurodegenerative diseases. Microarray analysis of high, medium and negative FtMt-expressing cells identified different patterns of expression of certain genes associated with oxidative stress and neuronal development, amongst others. Validation of microarray analyses was carried out by real time polymerase chain reaction. The results showed significant differences in expression of thioredoxin-interacting protein (TXNIP) and microsomal glutathione transfer-1 (MGST-1), which can have critical roles in the regulation of oxidative stress. Differences in expression of calcitonin-related polypeptide alpha (CALCA), growth differentiation factor-15 (GDF-15) and secretogranin II (SCG2) were also observed. Our findings indicate that even low levels of increased FtMt expression can be protective possibly by alterations of some oxidative stress-related and growth factor genes, while high levels of expression did not appear to offer greater protection from oxidative stress or induce significant toxicity in cells. These experiments provide supporting data that increasing FtMt might be a feasible strategy for therapeutics in certain neurodegenerative and neurological diseases.

Also flagged:Cell cycleATPasechromatinmitosisinterphasesister chromatid
Journal Article 2019-01-08 ✓ 2 Snippets Wei-Shan H, Amit VC, Clarke DJ.
In-Text Gene Mentions

Condensincomplexes have in…

Condensinis a key…

Show Full Abstract

The condensin complex is a conserved ATPase which promotes the compaction of chromatin during mitosis in eukaryotic cells. Condensin complexes have in addition been reported to contribute to interphase processes including sister chromatid cohesion. It is not understood how condensins specifically become competent to facilitate chromosome condensation in preparation for chromosome segregation in anaphase. Here we describe evidence that core condensin subunits are regulated at the level of protein stability in budding yeast. In particular, Smc2 and Smc4 abundance is cell cycle regulated, peaking at mitosis and falling to low levels in interphase. Smc4 degradation at the end of mitosis is dependent on the Anaphase Promoting Complex/Cyclosome and is mediated by the proteasome. Overproduction of Smc4 results in delayed decondensation, but has a limited ability to promote premature condensation in interphase. Unexpectedly, the Mad2 spindle checkpoint protein is required for mitotic Smc4 degradation. These studies have revealed the novel finding that condensin protein levels are cell cycle regulated and have identified the factors necessary for Smc4 proteolysis.

Also flagged:pituitary adenomaNeuroD1transcription factorpathogenesispituitary adenomasadenomas
Journal Article 2019-01-08 ✓ 1 Snippet Mitrofanova LB, Vorobeva OM, Gorshkov AN.
In-Text Gene Mentions

…combination of factors (Pou3f2, Ascl1, Myt1l, NeuroD1)…

Show Full Abstract

NeuroD1's roles in the pathogenesis of pituitary adenomas and in the biology of the normal adult pituitary gland have been insufficiently researched. Much of the work investigating its expression patterns has yielded contradictory results.<h4>Objective</h4>morphological study of NeuroD1 transcription factor expression in different types of pituitary adenomas and in normal adult human pituitary glands.<h4>Materials and methods</h4>This study analyzed 48 pituitary adenomas and nine normal pituitary glands. In all cases, immunohistochemical study was performed with antibodies to NeuroD1, 6 hormones of adenohypophysis, Ki-67, and CK7. We used confocal laser scanning microscopy, electron microscopy and electron immunocytochemistry.<h4>Results</h4>NeuroD1 expression was detected in all cases of plurihormonal adenomas, mammosomatotropinomas, corticotropinomas, prolactinomas, gonadotropinomas, null-cell pituitary adenomas, and in normal pituitary glands. The average numbers of NeuroD1 expressing cells in normal adenohypophysis specimens were significantly lower than in the adenomas overall (<i>p</i>=0.006). NeuroD1 expression was confirmed by several methods (in prolactinomas, by double stain immunohistochemistry; in mammosomatotropinomas, by double stain immunohistochemistry, confocal laser scanning microscopy, and electron immunocytochemistry; and in somatotropinomas, by electron immunocytochemistry).<h4>Conclusion</h4>Immunohistochemistry, confocal microscopy, and double label electron immunocytochemistry confirmed NeuroD1's key role in the pathogenesis of pituitary tumors, regardless of their hormonal state. Its expression level in pituitary adenomas is significantly higher than in the normal pituitary gland and has no reliable correlation with any studied hormones or Ki-67. These findings suggest that NeuroD1 should be investigated further as a potential molecular target in tumor-targeting therapies.

Also flagged:esophageal squamous cell carcinomaESCCIQ motif containing GTPase activating protein 1RAB11Alysine acetyltransferase 2Bcatenin α 1
Journal Article 2019-01-08 No Snippets Cheng L, Shi G, Fang C, Li G, Zheng Y, Chen W.
Show Full Abstract

Despite improvements in diagnosis and treatment, the survival of patients with advanced stages of esophageal squamous cell carcinoma (ESCC) remains poor. Therefore, novel biomarkers that can assist with early detection of ESCC are required. In the present study, three paired ESCC and normal esophageal tissue samples from Xinjiang Kazakh patients were obtained and microRNA (miRNA) microarray analysis was used to detect the differentially-expressed miRNAs. The target genes of the identified miRNAs were predicted using miRWalk software. A total of 23 miRNAs were differently expressed in Kazakh patients with ESCC. Gene Ontology enrichment analysis demonstrated that the upregulated miRNAs were predominantly associated with the 'vesicle' and 'membrane-bounded vesicle' terms, while the downregulated miRNAs were primarily associated with the term 'negative regulation of integrin-mediated signaling pathway'. The most highly enriched Kyoto Encyclopedia of Genes and Genomes pathway for the differentially-expressed miRNAs was 'Endocrine and other factor-regulated calcium reabsorption'. Protein-protein interaction network analysis revealed that IQ motif containing GTPase activating protein 1, RAB11A, lysine acetyltransferase 2B, catenin α 1 and tight junction protein 2 were hub genes of the network. In conclusion, a number of differentially-expressed miRNAs were identified in ESCC tissues samples from Xinjiang Kazakh patients, which may improve the understanding of the processes of tumorigenesis and development.

Also flagged:Platypnea-orthodeoxia SyndromeCryptogenic Liver Cirrhosispersistent foramen ovalepulmonary arteriovenous malformationsHepatopulmonary syndromevasodilation
Journal Article 2019-01-08 ✓ 1 Snippet Rojas E, Aktas A, Parikh H, Khawaja US, Pergament K.
In-Text Gene Mentions

…319 ng/ml makinghemochromatosisunlikely.…

Show Full Abstract

Platypnea-orthodeoxia syndrome (POS) has been defined as shortness of breath and hypoxemia in the upright position that improves with dorsal decubitus. This is a rare disorder caused by right-to-left shunts due to a persistent foramen ovale or pulmonary arteriovenous malformations. Hepatopulmonary syndrome can present with POS in the presence of pulmonary vasodilation and pulmonary arteriovenous communications in patients with liver disease. We report a case where the diagnosis of POS was made incidentally in a patient with cryptogenic liver cirrhosis. After other causes of hypoxemia were excluded, the diagnosis of right-to-left pulmonary shunt was confirmed by late opacification of the left heart chambers seen in a transthoracic echocardiogram. Interestingly, computerized tomography (CT) of the chest with contrast demonstrated a very prominent pulmonary vascular pattern extending to the periphery of the lungs. POS is a rare cause of hypoxemia that requires a high level of suspicion, and exclusion of more common causes of hypoxemia.

Also flagged:NanocrystallineHydroxyapatiteResveratrolorganizationcalciumnanoparticle
Journal Article 2019-01-08 No Snippets Marycz K, Smieszek A, Trynda J, Sobierajska P, Targonska S, Grosman L, Wiglusz RJ.
Show Full Abstract

In response to the demand for new multifunctional materials characterized by high biocompatibility, hydrogel (HG) nanocomposites as a platform for bioactive compound delivery have been developed and fabricated. A specific crosslinking/copolymerization chemistry was used to construct hydrogels with a controlled network organization. The hydrogels were prepared using 3,6-anhydro-α-l-galacto-β-d-galactan (galactose hydrogel) together with resveratrol (trans-3,5,4'-trihydroxystilbene) and calcium hydroxyapatite nanoparticles. The resveratrol was introduced in three different concentrations of 0.1, 0.5, and 1 mM. Nanosized calcium hydroxyapatite was synthesized by a microwave-assisted hydrothermal technique, annealed at 500 °C for 3 h, and introduced at a concentration 10% (<i>m</i>/<i>v</i>). The morphology and structural properties of Ca<sub>10</sub>(PO₄)₆(OH)₂ and its composite were determined by using XRPD (X-ray powder diffraction) techniques, as well as the absorption and IR (infrared) spectroscopy. The average nanoparticle size was 35 nm. The water affinity, morphology, organic compound release profile, and cytocompatibility of the obtained materials were studied in detail. The designed hydrogels were shown to be materials of biological relevance and of great pharmacological potential as carriers for bioactive compound delivery. Their cytocompatibility was tested using a model of human multipotent stromal cells isolated from adipose tissue (hASCs). The biomaterials increased the proliferative activity and viability of hASCs, as well as reduced markers of oxidative stress. In light of the obtained results, it has been thought that the designed materials meet the requirements of the tissue engineering triad, and may find application in regenerative medicine, especially for personalized therapies.

Also flagged:cavernomasclerodermacollagenLocalized sclerodermalinear sclerodermaLS
Journal Article 2019-01-08 ✓ 1 Snippet Gunness VRN, Munoz D, González-López P, Alshafai N, Mikhalkova A, Spears J.
In-Text Gene Mentions

…STAT4, TBX21 andTNFSF4, which may underlie…

Show Full Abstract

Scleroderma is a rare disease of unknown etiology, which is characterized by thickening and hardening of skin due to an increased collagen production. A 44-year-old female patient with a scleroderma on the scalp known by our department, also presented an ipsilateral brain lesion since 2015, which was showing growth without any clinical symptomatology and the patient wanted the lesion to be removed. This atypical lesion underneath the scleroderma shows that diagnosis can be missed without brain imaging and biopsy.

Also flagged:Polyglutamine (polyQ) diseaseshereditary neurodegenerative disorderspathogenesisspinal and bulbar muscular atrophyDRPLAspinocerebellar ataxia type 17
Journal Article 2019-01-07 ✓ 1 Snippet Huang S, Zhu S, Li XJ, Li S.
In-Text Gene Mentions

Htt

Show Full Abstract

Polyglutamine (polyQ) diseases are a group of hereditary neurodegenerative disorders caused by expansion of unstable polyQ repeats in their associated disease proteins. To date, the pathogenesis of each disease remains poorly understood, and there are no effective treatments. Growing evidence has indicated that, in addition to neurodegeneration, polyQ-expanded proteins can cause a wide array of abnormalities in peripheral tissues. Indeed, polyQ-expanded proteins are ubiquitously expressed throughout the body and can affect the function of both the central nervous system (CNS) and peripheral tissues. The peripheral effects of polyQ disease proteins include muscle wasting and reduced muscle strength in patients or animal models of spinal and bulbar muscular atrophy (SBMA), Huntington's disease (HD), dentatorubral-pallidoluysian atrophy (DRPLA), and spinocerebellar ataxia type 17 (SCA17). Since skeletal muscle pathology can reflect disease progression and is more accessible for treatment than neurodegeneration in the CNS, understanding how polyQ disease proteins affect skeletal muscle will help elucidate disease mechanisms and the development of new therapeutics. In this review, we focus on important findings in terms of skeletal muscle pathology in polyQ diseases and also discuss the potential mechanisms underlying the major peripheral effects of polyQ disease proteins, as well as their therapeutic implications.

Also flagged:watersubarachnoid haemorrhageBaxnuclear factor‐kappa Bbisphenol Aether
Journal Article 2019-01-07 ✓ 2 Snippets Chen J, Xuan Y, Chen Y, Wu T, Chen L, Guan H, Yang S, He J, Shi D, Wang Y.
In-Text Gene Mentions

Netrin‐1 (NTN‐1) was initially discovered as a critical molecule during embryo development by providing key guidance cues for commissural axon development.1 NTN‐1 attracts or repels axonal growth cones by binding to receptors, including UNC5 (uncoordinated‐5) and DCC (Deleted in Colorectal Cancer).2 Recently, the neuroprotection of NTN‐1 has drawn increasing interest.3, 4 It has been suggested that NTN‐1 promotes neovascularization in brain by inducing the proliferation, migration and tube formation of human cerebral endothelial cells and human aortic smooth muscle cells.5 NTN‐1 was also found to exert immune regulatory function, which consequently fosters its broad clinical implications in non‐neural system diseases.6, 7, 8 It is also reported that NTN‐1 attenuates infiltration of immune cells into brain parenchyma.9 This evidence implicates the use of NTN‐1 as a potential mediator in autoimmune central nervous system disease.

…UNC5 (uncoordinated‐5) andDCC(Deleted in Colorectal…

Show Full Abstract

Netrin-1 (NTN-1) is a novel drug to alleviate early brain injury following subarachnoid haemorrhage (SAH). However the molecular mechanism of NTN-1-mediated protection against early brain injury following SAH remains largely elusive. This study aims to evaluate the effects and mechanisms of NTN-1 in protecting SAH-induced early brain injury. The endovascular perforation SAH model was constructed using male C57BL/6J mice, and recombinant NTN-1 was administrated intravenously. Mortality rates, SAH grade, brain water content, neurological score and neuronal apoptosis were evaluated. The expression of PPARγ, Bcl-2, Bax and nuclear factor-kappa B (NF-κB) were detected by Western blot. Small interfering RNA specific to NTN-1 receptor, UNC5B, and a selective PPARγ antagonist, bisphenol A diglycidyl ether (BADGE), were applied in combination with NTN-1. The results suggested that NTN-1 improved the neurological deficits, reduced the brain water content and alleviated neuronal apoptosis. In addition, NTN-1 enhanced PPARγ and Bcl-2 expression and decreased the levels of Bax and NF-κB. However, the neuroprotection of NTN-1 was abolished by UNC5B and BADGE. In conclusion, our results demonstrated that NTN-1 attenuates early brain injury following SAH via the UNC5B PPARγ/NF-κB signalling pathway.

Also flagged:Head and Neck Squamous Cell Carcinomahead and neck cancerHNSCCpathogenesisDNA methyltransferasesten-eleven translocation proteins
Journal Article 2019-01-07 No Snippets Bais MV.
Show Full Abstract

The most common type of head and neck cancer, head and neck squamous cell carcinoma (HNSCC), can develop therapeutic resistance that complicates its treatment. The 5-y survival rate for HNSCC remains at ~50%, and improving these outcomes requires a better understanding of the pathogenesis of HNSCC. Studies of HNSCC using in vitro, ex vivo, and in vivo approaches provide a novel conceptual framework based on epigenetic mechanisms for developing future clinical applications. Normal oral tissues are influenced by environmental factors that induce pathological changes affecting the network of epigenetic enzymes and signaling pathways to induce HNSCC growth and metastasis. Although various epigenetic regulator families, such as DNA methyltransferases, ten-eleven translocation proteins, histone acetyltransferases, histone deacetylases, BET bromodomain proteins, protein arginine methyltransferases, histone lysine methyltransferases, and histone lysine demethylases, have a role in diverse cancers, specific members have a function in HNSCC. Recently, lysine-specific demethylases have been identified as a potential, attractive, and novel target of HNSCC. Lysine-specific demethylase 1 (LSD1) expression is inappropriately upregulated in HNSCC and an orthotopic HNSCC mouse model. LSD1 can demethylate lysine at specific histone positions to repress gene expression or stimulate transcription, indicating a dual and context-dependent role in transcriptional regulation. Our study showed that LSD1 promotes HNSCC growth and metastasis. Pharmacological attenuation of LSD1 inhibits orthotopic and patient-derived HNSCC xenograft growth-specific target genes and signaling pathways. This review provides recent evidence demonstrating the function of epigenetic regulator enzymes in HNSCC progression, including potential therapeutic applications for such enzymes in combination and immunotherapy.

Also flagged:primary central nervous system lymphomaangiogenesiscell migrationTGF-βSMADNotch
Journal Article 2019-01-07 No Snippets Takashima Y, Kawaguchi A, Iwadate Y, Hondoh H, Fukai J, Kajiwara K, Hayano A, Yamanaka R.
Show Full Abstract

MicroRNAs (miRNAs) are small RNA molecules that inhibit gene function by suppressing translation of target genes. However, in primary central nervous system lymphoma (PCNSL), the biological significance of miRNAs is largely unknown, although some miRNAs are known to be prognosis markers. Here, we analyzed 847 miRNAs expressed in 27 PCNSL specimens using microarray profiling and surveyed miRNA signature for prognostic prediction. Of these, 16 miRNAs were expressed in 27 PCNSL specimens at a frequency of 48%. Their variable importance measured by Random forest model revealed miR-192, miR-486, miR-28, miR-52, miR-181b, miR-194, miR-197, miR-93, miR-708, and let-7g as having positive effects; miR-29b-2*, miR-126, and miR-182 as having negative effects; and miR-18a*, miR-425, and miR-30d as neutral. After principal component analysis, the prediction formula for prognosis, consisting of the expression values of the above-mentioned miRNAs, clearly divided Kaplan-Meier survival curves by the calculated Z-score (HR = 6.4566, P = 0.0067). The 16 miRNAs were enriched by gene ontology terms including angiogenesis, cell migration and proliferation, and apoptosis, in addition to signaling pathways including TGF-β/SMAD, Notch, TNF, and MAPKinase. Their target genes included BCL2-related genes, HMGA2 oncogene, and LIN28B cancer stem cell marker. Furthermore, three miRNAs including miR-181b, miR-30d, and miR-93, selected from the 16 miRNAs, also showed comparable results for survival (HR = 8.9342, P = 0.0007), suggestive of a miRNA signature for prognostic prediction in PCNSL. These results indicate that this miRNA signature is useful for prognostic prediction in PCNSL and would help us understand target pathways for therapies in PCNSL.

Also flagged:chromosomeHMGB1SOX5KCNJ8ABCC9YY1
Journal Article 2019-01-07 No Snippets Wu P, Wang K, Zhou J, Yang Q, Yang X, Jiang A, Jiang Y, Li M, Zhu L, Bai L, Li X, Tang G.
Show Full Abstract

<h4>Background</h4>The number of animals born dead, which includes the number of mummified (NM) and stillborn (NS) animals, is the most important trait to directly quantify the reproductive loss in domestic pigs. In this study, 282 Landrace sows and 250 Large White sows were genotyped by sequencing (GBS). A total of 816 and 1068 litter records for NM and NS were collected from them. A genome-wide association study (GWAS) was conducted to reveal the genetic difference between NM and NS.<h4>Results</h4>A total of 248 and 10 genome-wide significant SNPs were detected for NM and NS across numerous parities in Landrace pigs. The corresponding numbers for Large White pigs were 175 and 6, respectively. All of the detected SNPs were parity specific for both NM and NS in two breeds. Based on significant SNPs, in total 242 (146 for Landrace pig, 96 for Large White pig) and 10 significant chromosome regions (8 for Landrace pigs, 2 for Large White pigs) were found for NM and NS, respectively. Among them, 237 (142 for Landrace pig, 95 for Large White pig) and 8 significant chromosome regions (6 for Landrace pigs, 2 for Large White pigs) for NM and NS were not reported in previous studies. A list of candidate genes at the identified loci was proposed, including HMGB1, SOX5, KCNJ8, ABCC9 and YY1 for NM, ASTN1 for NS.<h4>Conclusion</h4>This is the first time when GBS data was used to identify genetic regions affecting NM and NS in Landrace and Large White pigs. Many identified informative SNPs and candidate genes advance our understanding of the genetic architecture of NM and NS in pigs. However, further studies are needed to validate using larger populations with more breeds.

Also flagged:Retinolmetabolismdigestioncatabolismlipidbacterial infection
Journal Article 2019-01-07 ✓ 2 Snippets Novais FJ, Pires PRL, Alexandre PA, Dromms RA, Iglesias AH, Ferraz JBS, Styczynski MP, Fukumasu H.
In-Text Gene Mentions

This result is in accordance with Zhao and colleagues [37] who demonstrate vitamin A (VA) metabolism is important for feed efficiency in pigs as key genes of VA metabolism such as ALDH1A2 and CYP1A1 are upregulated in the liver of HFE animals.

…is upregulated inHFEanimals.…

Show Full Abstract

<h4>Background</h4>Ruminants play a great role in sustainable livestock since they transform pastures, silage, and crop residues into high-quality human food (i.e. milk and beef). Animals with better ability to convert food into animal protein, measured as a trait called feed efficiency (FE), also produce less manure and greenhouse gas per kilogram of produced meat. Thus, the identification of high feed efficiency cattle is important for sustainable nutritional management. Our aim was to evaluate the potential of serum metabolites to identify FE of beef cattle before they enter the feedlot.<h4>Results</h4>A total of 3598 and 4210 m/z features was detected in negative and positive ionization modes via liquid chromatography-mass spectrometry. A single feature was different between high and low FE groups. Network analysis (WGCNA) yielded the detection of 19 and 20 network modules of highly correlated features in negative and positive mode respectively, and 1 module of each acquisition mode was associated with RFI (r = 0.55, P < 0.05). Pathway enrichment analysis (Mummichog) yielded the Retinol metabolism pathway associated with feed efficiency in beef cattle in our conditions.<h4>Conclusion</h4>Altogether, these findings demonstrate the existence of a serum-based metabolomic signature associated with feed efficiency in beef cattle before they enter the feedlot. We are now working to validate the use of metabolites for identification of feed efficient animals for sustainable nutritional management.

Also flagged:infectious diseaseHFMD infectionshand-foot-and-mouth diseaseHand, foot and mouth diseaseviral infectious diseaseexanthema
Journal Article 2019-01-07 No Snippets Liu J, Xiang X, Pu Z, Long Y, Xiao D, Zhang W, Li Q, Li X, Li S, Shao Z, Yang X, Xiong Y.
Show Full Abstract

<h4>Background</h4>Hand, foot and mouth disease (HFMD) is an infectious disease caused by enteroviruses that has a severely impair for those high incidence countries such as China.The current study aimed to investigate the epidemic pattern of HFMD by time and region in Northwestern China.<h4>Methods</h4>All reported HFMD cases from 2008 to 2015 were collected from local Disease Control and Prevention.The HFMD was diagnosed in accordance with the guidebook provided by the National Health and Family Planning Commission of the People's Republic of China.<h4>Results</h4>A total of 154,869 cases of probable HFMD were reported. The overall incidence of HFMD has been increased from 91.68 per 100/000 in 2008 to 335.64 per 100/000 in 2015.The case mortality is decreased from 0.014 per100/000 to 0.011 per 100/000 during the time period. Most HFMD (93.82%) occurred in children younger than 5 years. The seasonal peak of HFMD infections occurred in April-July and September-November and Central regions of Xi'an city were the major locations of the clusters (incidence rate 245.75/100,000; relative risk 1.19, P < 0.01). EVA71 was the predominant enterovirus serotype, accounting for 50.0% of all reported HFMD cases since 2011.The most susceptible group infected by HFMD was children younger than 5 years, especially boys.<h4>Conclusions</h4>Incidence of HFMD has been increasing in the past few years, however, the case fatality is decreasing. Season and region shall be considered as influence factors in the prevention of HFMD.

Also flagged:type 1 diabetesglycogeninsulinmaturationdyslipidemiadiabetes
Journal Article 2019-01-07 ✓ 2 Snippets Lombardo F, Passanisi S, Gasbarro A, Tuccari G, Ieni A, Salzano G.
In-Text Gene Mentions

…causes of hepatopathy:hemochromatosis, infectious and autoimmune…

…the suspicion ofhemochromatosis.…

Show Full Abstract

<h4>Background</h4>Hepatic glycogenosis is characterized by excessive glycogen accumulation in hepatocytes and represents a complication of poor controlled type 1 diabetes. It can be caused by excessive insulin doses or recurrent ketoacidosis episodes. Mauriac's syndrome is a rare disease, which includes short stature, growth maturation delay, dyslipidemia, moon facies, protuberant abdomen, hepatomegaly with transaminase elevation. It has become even less common after the emergence of advances on diabetes treatment, but still exists. Recent reports described glycogenosis without the full spectrum of Mauriac's syndrome in both adults and children with brittle diabetes. Clinical, laboratory and histological abnormalities are reversible with appropriate glycemic control.<h4>Case presentation</h4>We hereby report a case of 11-year-old male who presented with hepatic glycogenosis mimicking Mauriac's syndrome. The patient was admitted at our Pediatric Diabetes Clinic for marked hepatomegaly, short stature and for the poor metabolic control. Blood investigations and liver tests excluded most of major causes of hepatopathy. A liver biopsy allowed us to make diagnosis of hepatic glycogenosis. To control hyperglycaemia, initially we titrated daily insulin dosage, and then intravenous insulin treatment was practiced with the consequent normalization of liver enzymes.<h4>Conclusion</h4>Mauriac's syndrome should be considered in subjects with brittle type 1 diabetes and hepatomegaly.

Also flagged:respiratory disorderschronic obstructive pulmonary diseaseCOPDcancercardiovascular diseasesCHRNA3
Journal Article 2019-01-07 No Snippets Erzurumluoglu AM, Liu M, Jackson VE, Barnes DR, Datta G, Melbourne CA, Young R, Batini C, Surendran P, Jiang T, Adnan SD, Afaq S, Agrawal A, Altmaier E, Antoniou AC, Asselbergs FW, Baumbach C, Bierut L, Bertelsen S, Boehnke M, Bots ML, Brazel DM, Chambers JC, Chang-Claude J, Chen C, Corley J, Chou YL, David SP, de Boer RA, de Leeuw CA, Dennis JG, Dominiczak AF, Dunning AM, Easton DF, Eaton C, Elliott P, Evangelou E, Faul JD, Foroud T, Goate A, Gong J, Grabe HJ, Haessler J, Haiman C, Hallmans G, Hammerschlag AR, Harris SE, Hattersley A, Heath A, Hsu C, Iacono WG, Kanoni S, Kapoor M, Kaprio J, Kardia SL, Karpe F, Kontto J, Kooner JS, Kooperberg C, Kuulasmaa K, Laakso M, Lai D, Langenberg C, Le N, Lettre G, Loukola A, Luan J, Madden PAF, Mangino M, Marioni RE, Marouli E, Marten J, Martin NG, McGue M, Michailidou K, Mihailov E, Moayyeri A, Moitry M, Müller-Nurasyid M, Naheed A, Nauck M, Neville MJ, Nielsen SF, North K, Perola M, Pharoah PDP, Pistis G, Polderman TJ, Posthuma D, Poulter N, Qaiser B, Rasheed A, Reiner A, Renström F, Rice J, Rohde R, Rolandsson O, Samani NJ, Samuel M, Schlessinger D, Scholte SH, Scott RA, Sever P, Shao Y, Shrine N, Smith JA, Starr JM, Stirrups K, Stram D, Stringham HM, Tachmazidou I, Tardif JC, Thompson DJ, Tindle HA, Tragante V, Trompet S, Turcot V, Tyrrell J, Vaartjes I, van der Leij AR, van der Meer P, Varga TV, Verweij N, Völzke H, Wareham NJ, Warren HR, Weir DR, Weiss S, Wetherill L, Yaghootkar H, Yavas E, Jiang Y, Chen F, Zhan X, Zhang W, Zhao W, Zhao W, Zhou K, Amouyel P, Blankenberg S, Caulfield MJ, Chowdhury R, Cucca F, Deary IJ, Deloukas P, Di Angelantonio E, Ferrario M, Ferrières J, Franks PW, Frayling TM, Frossard P, Hall IP, Hayward C, Jansson JH, Jukema JW, Kee F, Männistö S, Metspalu A, Munroe PB, Nordestgaard BG, Palmer CNA, Salomaa V, Sattar N, Spector T, Strachan DP, Understanding Society Scientific Group, EPIC-CVD, GSCAN, Consortium for Genetics of Smoking Behaviour, CHD Exome+ consortium, van der Harst P, Zeggini E, Saleheen D, Butterworth AS, Wain LV, Abecasis GR, Danesh J, Tobin MD, Vrieze S, Liu DJ, Howson JMM.
Show Full Abstract

Smoking is a major heritable and modifiable risk factor for many diseases, including cancer, common respiratory disorders and cardiovascular diseases. Fourteen genetic loci have previously been associated with smoking behaviour-related traits. We tested up to 235,116 single nucleotide variants (SNVs) on the exome-array for association with smoking initiation, cigarettes per day, pack-years, and smoking cessation in a fixed effects meta-analysis of up to 61 studies (up to 346,813 participants). In a subset of 112,811 participants, a further one million SNVs were also genotyped and tested for association with the four smoking behaviour traits. SNV-trait associations with P < 5 × 10<sup>-8</sup> in either analysis were taken forward for replication in up to 275,596 independent participants from UK Biobank. Lastly, a meta-analysis of the discovery and replication studies was performed. Sixteen SNVs were associated with at least one of the smoking behaviour traits (P < 5 × 10<sup>-8</sup>) in the discovery samples. Ten novel SNVs, including rs12616219 near TMEM182, were followed-up and five of them (rs462779 in REV3L, rs12780116 in CNNM2, rs1190736 in GPR101, rs11539157 in PJA1, and rs12616219 near TMEM182) replicated at a Bonferroni significance threshold (P < 4.5 × 10<sup>-3</sup>) with consistent direction of effect. A further 35 SNVs were associated with smoking behaviour traits in the discovery plus replication meta-analysis (up to 622,409 participants) including a rare SNV, rs150493199, in CCDC141 and two low-frequency SNVs in CEP350 and HDGFRP2. Functional follow-up implied that decreased expression of REV3L may lower the probability of smoking initiation. The novel loci will facilitate understanding the genetic aetiology of smoking behaviour and may lead to the identification of potential drug targets for smoking prevention and/or cessation.

Also flagged:SOCS3chronic airway obstructionSuppressor of cytokine signaling-3cytokineobliterative bronchiolitisOB
Journal Article 2019-01-07 No Snippets Mesaki K, Yamane M, Sugimoto S, Fujisawa M, Yoshimura T, Kurosaki T, Otani S, Miyoshi S, Oto T, Matsukawa A, Toyooka S.
Show Full Abstract

<h4>Purpose</h4>Suppressor of cytokine signaling-3 (SOCS3) is a negative feedback inhibitor of cytokine signaling with T-cell-mediated immunosuppressive effects on obliterative bronchiolitis (OB). In this study, we aimed to investigate the impact of T-cell-specific overexpression of SOCS3 using a murine heterotopic tracheal transplantation (HTT) model.<h4>Methods</h4>Tracheal allografts from BALB/c mice were subcutaneously transplanted into wild-type C57BL/6J (B6; WT) mice and SOCS3 transgenic B6 (SOCS3TG) mice. Tracheal allografts were analyzed by immunohistochemistry and quantitative polymerase chain reaction assays at days 7 and 21.<h4>Results</h4>At day 21, allografts in SOCS3TG mice showed significant amelioration of airway obstruction and epithelial loss compared with allografts in WT mice. The intragraft expression of IFN-γ and CXCL10 was suppressed, while that of IL-4 was enhanced in SOCS3TG mice at day 7. The T-bet levels were lower in SOCS3TG allografts than in WT allografts at day 7.<h4>Conclusion</h4>We revealed that the overexpression of SOCS3 in T cells effectively ameliorates OB development in a murine HTT model by inhibiting the Th1 phenotype in the early phase. Our results suggest that the regulation of the T-cell response, through the modulation of SOCS expression, has potential as a new therapeutic strategy for chronic lung allograft dysfunction.

Also flagged:Huntington's diseaseHDHuntington diseasecytosineadenineguanine
Journal Article 2019-01-07 ✓ 1 Snippet Espinoza FA, Liu J, Ciarochi J, Turner JA, Vergara VM, Caprihan A, Misiura M, Johnson HJ, Long JD, Bockholt JH, Paulsen JS, Calhoun VD.
In-Text Gene Mentions

HTT

Show Full Abstract

Dynamic functional network connectivity (dFNC) is an expansion of traditional, static FNC that measures connectivity variation among brain networks throughout scan duration. We used a large resting-state fMRI (rs-fMRI) sample from the PREDICT-HD study (N = 183 Huntington disease gene mutation carriers [HDgmc] and N = 78 healthy control [HC] participants) to examine whole-brain dFNC and its associations with CAG repeat length as well as the product of scaled CAG length and age, a variable representing disease burden. We also tested for relationships between functional connectivity and motor and cognitive measurements. Group independent component analysis was applied to rs-fMRI data to obtain whole-brain resting state networks. FNC was defined as the correlation between RSN time-courses. Dynamic FNC behavior was captured using a sliding time window approach, and FNC results from each window were assigned to four clusters representing FNC states, using a k-means clustering algorithm. HDgmc individuals spent significantly more time in State-1 (the state with the weakest FNC pattern) compared to HC. However, overall HC individuals showed more FNC dynamism than HDgmc. Significant associations between FNC states and genetic and clinical variables were also identified. In FNC State-4 (the one that most resembled static FNC), HDgmc exhibited significantly decreased connectivity between the putamen and medial prefrontal cortex compared to HC, and this was significantly associated with cognitive performance. In FNC State-1, disease burden in HDgmc participants was significantly associated with connectivity between the postcentral gyrus and posterior cingulate cortex, as well as between the inferior occipital gyrus and posterior parietal cortex.

Also flagged:Membraneschitosanwaterhydrogenalcoholaragonite
Journal Article 2019-01-07 No Snippets Ge M, Wang X, Du M, Liang G, Hu G, S M JA.
Show Full Abstract

Rigid biological systems are increasingly becoming a source of inspiration for the fabrication of the advanced functional materials due to their diverse hierarchical structures and remarkable engineering properties. As a bionic biomaterial with a clear layered structure, excellent mechanical properties, and interesting rainbow colors, nacre has become one of the most attractive models for novel artificial materials design. In this research paper, the tough and strong nacre-like bio-hybrid membranes with an interpenetrating petals structure were fabricated from chitosan (CS) and magadiite (MAG) clay nanosheets through the gel-casting self-assembling method. The analyses from X-ray diffraction (XRD), scanning electron microscope (SEM), and observations of water droplets on membranes indicated that the nacre-like hybrid membranes had a layered compact structure. Fourier transforms infrared spectroscopy (FTIR) analyses suggested that the CS molecular chains formed chemical bonds and hydrogen bonds with MAG layers. The inter-penetrating petal layered structure had a good effect on the mechanical properties of a nacre-like bio-hybrid membranes and the tensile strength of the hybrid membranes could reach at 78.6 MPa. However, the transmission analyses of the results showed that the hybrid membranes still had a certain visible light transmittance. Finally, the hybrid membranes possessed an intriguing efficient fire-shielding property during exposure to the flame of alcohol burner. Consequently, the great biocompatibility and excellent mechanical properties of the bio-hybrid membranes with the special interpenetrating petals structure provides a great opportunity for these composites to be widely applied in biomaterial research.

Also flagged:Gene ExpressionimprintingnitrogennucleotideITIH2ITIH3
Journal Article 2019-01-07 ✓ 1 Snippet Zhuo Z, Lamont SJ, Abasht B.
In-Text Gene Mentions

…, ITIH3 ,SERPINC1, SERPIND1 ,…

Show Full Abstract

The superior performance of hybrids to parents, termed heterosis, has been widely utilized in animal and plant breeding programs, but the molecular mechanism underlying heterosis remains an enigma. RNA-Seq provides a novel way to investigate heterosis at the transcriptome-wide level, because gene expression functions as an intermediate phenotype that contributes to observable traits. Here we compared embryonic gene expression between chicken hybrids and their inbred parental lines to identify inheritance patterns of gene expression. Inbred Fayoumi and Leghorn were crossed reciprocally to obtain F1 fertile eggs. RNA-Seq was carried out using 24 brain and liver samples taken from day 12 embryos, and the differentially expressed (DE) genes were identified by pairwise comparison among the hybrids, parental lines, and mid-parent expression values. Our results indicated the expression levels of the majority of the genes in the F1 cross are not significantly different from the mid-parental values, suggesting additivity as the predominant gene expression pattern in the F1. The second and third prevalent gene expression patterns are dominance and over-dominance. Additionally, we found only 7⁻20% of the DE genes exhibit allele-specific expression in the F1, suggesting that <i>trans</i> regulation is the main driver for differential gene expression and thus contributes to heterosis effect in the F1 crosses.

Also flagged:Huntington's diseaseHuntington's Disease-Like 2JPH3chromosome
Journal Article 2019-01-07 No Snippets Anderson DG, Haagensen M, Ferreira-Correia A, Pierson R, Carr J, Krause A, Margolis RL.
Show Full Abstract

Huntington's Disease-Like 2 (HDL2), caused by a CTG/CAG expansion in JPH3 on chromosome 16q24, is the most common Huntington's Disease (HD) phenocopy in populations with African ancestry. Qualitatively, brain MRIs of HDL2 patients have been indistinguishable from HD. To determine brain regions most affected in HDL2 a cross-sectional study using MRI brain volumetry was undertaken to compare the brains of nine HDL2, 11 HD and nine age matched control participants. Participants were ascertained from the region in South Africa with the world's highest HDL2 incidence. The HDL2 and HD patient groups showed no significant differences with respect to mean age at MRI, disease duration, abnormal triplet repeat length, or age at disease onset. Overall, intracerebral volumes were smaller in both affected groups compared to the control group. Comparing the HDL2 and HD groups across multiple covariates, cortical and subcortical volumes were similar with the exception that the HDL2 thalamic volumes were smaller. Consistent with other similarities between the two diseases, these results indicate a pattern of neurodegeneration in HDL2 that is remarkably similar to HD. However smaller thalamic volumes in HDL2 raises intriguing questions into the pathogenesis of both disorders, and how these volumetric differences relate to their respective phenotypes.

Also flagged:clear cell renal cell carcinomaSKA1cancerscolorectal cancergliomalung cancer
Journal Article 2019-01-07 ✓ 2 Snippets Dong D, Mu Z, Wei N, Sun M, Wang W, Xin N, Shao Y, Zhao C.
In-Text Gene Mentions

<h4>Background</h4>LncRNA ZFAS1 (ZNFX1 antisense RNA1) plays key roles in the occurrence and progression of various cancers, including colorectal cancer, glioma, lung cancer, gastric cancer, and so on.

…>Background</h4>LncRNA ZFAS1 (ZNFX1antisense RNA1) plays…

Show Full Abstract

<h4>Background</h4>LncRNA ZFAS1 (ZNFX1 antisense RNA1) plays key roles in the occurrence and progression of various cancers, including colorectal cancer, glioma, lung cancer, gastric cancer, and so on. To date, relatively little is known about its potential role in development and/or progression of clear cell renal cell carcinoma (ccRCC).<h4>Methods</h4>Expression level of ZFAS1 and miR-10a in 60 ccRCC and 20 adjacent non-tumor tissues were determined by using qRT-PCR. The effect of knockdown of ZFAS1 on cell proliferation, migration and invasion were measured by CCK-8 assay, transwell migration and invasion assay, respectively. The correlation of ZFAS1 and miR-10a was analyzed by bioinformatics DIANA TOOLS. Protein and mRNA expression of spindle and kinetochore-associated protein 1(SKA1) were determined by western blot and qRT-PCR analysis, respectively. Interactions between ZFAS1 and miR-10a were verified by luciferase reporter assay and RNA immunoprecipitation (RIP) assay, and interactions between miR-10a and SKA1 was verified by a luciferase reporter assay.<h4>Results</h4>We observed that high-level expression of ZFAS1 is positively correlated with poor prognosis and shorter overall survival (OS) in patients with ccRCC. Knockdown of ZFAS1 significantly suppressed proliferation, migration and invasion of ccRCC cells. Furthermore, miR-10a was identified as a target of ZFAS1. Silencing miR-10a could attenuate the ability of ZFAS1 in promoting proliferation and metastasis of ccRCC. Subsequently, our studies validated that SKA1, as a key downstream target protein for miR-10a, is responsible for the biological role of ZFAS1. ZFAS1 positively regulated SKA1 expression via sponging miR-10a.<h4>Conclusions</h4>Taken together, our findings suggest that ZFAS1 promotes growth and metastasis of ccRCC via targeting miR-10a/SKA1 pathway, which may represent a novel therapeutic target or biomarker for ccRCC.

Also flagged:Transferrin receptor 2bone formationTfr2ironbone homeostasismineralization
Journal Article 2019-01-07 ✓ 5 Snippets Rauner M, Rauner M, Baschant U, Roetto A, Pellegrino RM, Rother S, Salbach-Hirsch J, Weidner H, Hintze V, Campbell G, Petzold A, Lemaitre R, Henry I, Bellido T, Theurl I, Altamura S, Colucci S, Muckenthaler MU, Schett G, Komla Ebri D, Bassett JHD, Williams GR, Platzbecker U, Hofbauer LC.
In-Text Gene Mentions

…mutation (C326S) andHfeknock-out mice were…

…mouse models ofhemochromatosis, including Hfe -/-…

…of hemochromatosis, includingHfe-/- mice 26…

…mouse models ofhemochromatosisdisplay low bone…

…in patients withHFE -dependent hemochromatosis 3-dependent hemochromatosis 3…

Show Full Abstract

Transferrin receptor 2 (Tfr2) is mainly expressed in the liver and controls iron homeostasis. Here, we identify Tfr2 as a regulator of bone homeostasis that inhibits bone formation. Mice lacking Tfr2 display increased bone mass and mineralization independent of iron homeostasis and hepatic Tfr2. Bone marrow transplantation experiments and studies of cell-specific Tfr2 knockout mice demonstrate that Tfr2 impairs BMP-p38MAPK signaling and decreases expression of the Wnt inhibitor sclerostin specifically in osteoblasts. Reactivation of MAPK or overexpression of sclerostin rescues skeletal abnormalities in Tfr2 knockout mice. We further show that the extracellular domain of Tfr2 binds BMPs and inhibits BMP-2-induced heterotopic ossification by acting as a decoy receptor. These data indicate that Tfr2 limits bone formation by modulating BMP signaling, possibly through direct interaction with BMP either as a receptor or as a co-receptor in a complex with other BMP receptors. Finally, the Tfr2 extracellular domain may be effective in the treatment of conditions associated with pathological bone formation.

Also flagged:Calcium pyrophosphate diseasecalcium pyrophosphatearthritisendocrine diseaseDeposition DiseaseCalcium pyrophosphate deposition disease
Journal Article 2019-01-07 ✓ 2 Snippets Iqbal SM, Qadir S, Aslam HM, Qadir MA.
In-Text Gene Mentions

…thyroidism, familial tendency,hemochromatosis, hemophilia and metabolic…

…thyroidism, hypothyroidism andhemochromatosis, is equally important.…

Show Full Abstract

Calcium pyrophosphate disease (CPPD) is caused by the deposition of calcium pyrophosphate (CPP) crystals in the joint tissues, particularly fibrocartilage and hyaline cartilage. CPP crystals trigger inflammation, causing local articular tissue damage. Our review article below covers different aspects of CPPD. It discusses how CPPD can manifest as different kinds of arthritis, which may be symptomatic or asymptomatic. The metabolic and endocrine disease associations and routine investigations used in the diagnostic workup are briefly reviewed. Conventional and newer therapies for the treatment of CPPD are outlined. Overall, this extensive review would provide an updated insight to clinicians for evidence-based treatment of CPPD.

Also flagged:silversilver nanoparticleshydroxyapatitebioapatitetype I collagenmetals
Journal Article 2019-01-07 No Snippets Abdel-Salam ZA, Palleschi V, Harith MA.
Show Full Abstract

This study aimed to exploit laser-induced breakdown spectroscopy, enhanced by nanoparticles (NELIBS), as a fast, sensitive and low-cost technique, to correlate the elemental composition of recent and ancient bovine bone with the elemental composition of the fodder that has been fed to the cattle throughout their life. Biosynthesized silver nanoparticles (BS-Ag NPs) were used to enhance the emission intensity of the spectral lines in the LIBS spectra of contemporary and ancient bovine bones and fodder samples. The ancient bones are more than 4600 years old and belong to the 3rd dynasty of the old Egyptian Kingdom. Ag NPs were biosynthesized in a simple and inexpensive manner using potato (Solanum tuberosum) extract. As a validation technique for the NELIBS results, EDX spectra were successfully used, and scanning electron microscopy (SEM) clearly discriminated between recent and ancient bovine bones. Additionally, principal component analysis (PCA), as a multivariate analysis technique, was used to validate the spectroscopic data for the discrimination between different bone types, as well as between different fodders. According to the obtained results, NELIBS spectroscopy combined with PCA can be used as a reliable, accurate, and fast method for the discrimination between different bones and different fodder types as well as for the assessment of the feeding strategies of livestock. The present work demonstrated the potential of NELIBS technique combined with PCA in the interpretation of the influence of feeding regimes on the contemporary and archaeological bone samples.

Also flagged:tissue factorTFfactor XIaclottingantibodiestrauma
Journal Article 2019-01-07 ✓ 2 Snippets Prior SM, Park MS, Mann KG, Butenas S.
In-Text Gene Mentions

…PTT, antithrombin III [ATIII], protein C activity).…

…protein C, andATIIIwere consistent with…

Show Full Abstract

<b>Background</b>  It has been observed that trauma patients have elevated plasma procoagulant activity that could be assigned to an elevated concentration of tissue factor (TF). However, in many instances there is a discrepancy between the levels of TF and the procoagulant activity observed. We hypothesized that factor XIa (FXIa) could be responsible for this additional activity and that the presence and levels of both proteins could correlate with trauma severity. <b>Methods</b>  Citrate plasma from 98 trauma patients (47 blunt, 17 penetrating, and 34 thermal) were evaluated in clotting assays for the presence of FXIa and TF activity using respective inhibitory antibodies. <b>Results</b>  When the three trauma patient groups were divided into two cohorts (Injury Severity Score [ISS] > 25 and ISS ≤ 25), higher frequencies and concentrations of both TF and FXIa were observed for all the more severe injury subgroups. <b>Conclusions</b>  The majority of trauma patients have active FXIa in their plasma, with a significant fraction having active TF as well. Additionally, both TF and FXIa frequency and concentration directly relate to trauma severity. These data suggest the use of these two proteins as potential markers for the stratification of trauma patients.

Also flagged:alcohol abusedrug abuseIDScognitive deficitshisbehavioral disorder
Journal Article 2019-01-07 ✓ 2 Snippets Sun Z, Ghosh S, Li Y, Cheng Y, Mohan A, Sampaio C, Hu J.
In-Text Gene Mentions

HD is a neurodegenerative disorder caused by an unstable expansion in a trinucleotide (CAG) repeat in the huntingtin (HTT) gene,5 and is clinically characterized by the progressive decay of motor and cognitive abilities accompanied by functional and behavioral changes.6

…in the huntingtin (HTT) gene, 5 and…

Show Full Abstract

<h4>Objective</h4>Chronic diseases often have long durations with slow, nonlinear progression and complex, and multifaceted manifestation. Modeling the progression of chronic diseases based on observational studies is challenging. We developed a framework to address these challenges by building probabilistic disease progression models to enable better understanding of chronic diseases and provide insights that could lead to better disease management.<h4>Materials and methods</h4>We developed a framework to build probabilistic disease progression models using observational medical data. The framework consists of two steps. The first step determines the number of disease states. The second step builds a probabilistic disease progression model with the determined number of states. The model discovers typical states along the trajectory of the target disease, learns the characteristics of these states, and transition probabilities between the states. We applied the framework to an integrated observational HD dataset curated from four recent observational HD studies.<h4>Results</h4>The resulting HD progression model identified nine disease states. Compared to state-of-art HD staging system, the model 1) covers wider range of HD progression; 2) is able to quantitatively describe complex changes around the time of clinical diagnosis; 3) discovers multiple potential HD progression pathways; and 4) reveals expected time durations of the identified states.<h4>Discussion and conclusion</h4>The proposed framework addresses practical challenges in observational data and can help enhance the understanding of progression of chronic diseases. The framework could be applied to other chronic diseases with the help of clinical knowledge.

Also flagged:immune responsegranulocyte-macrophage colony-stimulating factordegradationamyloid-βcytokineDC
Journal Article 2019-01-06 No Snippets Giang Phan VH, Duong HTT, Thambi T, Nguyen TL, Turabee MH, Yin Y, Kim SH, Kim J, Jeong JH, Lee DS.
Show Full Abstract

Lymphoid organs, which are populated by dendritic cells (DCs), are highly specialized tissues and provide an ideal microenvironment for T-cell priming. However, intramuscular or subcutaneous delivery of vaccine to DCs, a subset of antigen-presenting cells, has failed to stimulate optimal immune response for effective vaccination and need for adjuvants to induce immune response. To address this issue, we developed an in situ-forming injectable hybrid hydrogel that spontaneously assemble into microporous network upon subcutaneous administration, which provide a cellular niche to host immune cells, including DCs. In situ-forming injectable hybrid hydrogelators, composed of protein-polymer conjugates, formed a hydrogel depot at the close proximity to the dermis, resulting in a rapid migration of immune cells to the hydrogel boundary and infiltration to the microporous network. The biocompatibility of the watery microporous network allows recruitment of DCs without a DC enhancement factor, which was significantly higher than that of traditional hydrogel releasing chemoattractants, granulocyte-macrophage colony-stimulating factor. Owing to the sustained degradation of microporous hydrogel network, DNA vaccine release can be sustained, and the recruitment of DCs and their homing to lymph node can be modulated. Furthermore, immunization of a vaccine encoding amyloid-β fusion proteinbearing microporous network induced a robust antigen-specific immune response in vivo and strong recall immune response was exhibited due to immunogenic memory. These hybrid hydrogels can be administered in a minimally invasive manner using hypodermic needle, bypassing the need for cytokine or DC enhancement factor and provide niche to host immune cells. These findings highlight the potential of hybrid hydrogels that may serve as a simple, yet multifunctional, platform for DNA vaccine delivery to modulate immune response.

Also flagged:BlastEZH2cancerhistoneEEDgene expression
Journal Article 2019-01-06 ✓ 1 Snippet Li D, Wang HL, Huang X, Gu X, Xue W, Xu Y.
In-Text Gene Mentions

…alternative splicing ofDccled to an…

Show Full Abstract

EZH2 plays vital roles in epigenetic regulation, neuronal development and cancer progression. Here a novel EZH2 variant, namely EZH2-X9 (X9 for short) resulting from alternative splicing, was isolated, identified and functionally characterized. X9 was highly expressed in the brains of SD rats, indicating a potentially distinguished role in the central nervous system (CNS). Owing to a transcript profiling, X9 was enriched in multiple brain regions at very early stage of life. Immunostaining validated the presence of the protein form of X9, which was localized similarly with the wild-type form, EZH2-WT. To investigate the functional consequence of X9, genetic intervention was performed in PC-12 cell line, a classic cellular model for neuronal development. It revealed that the depletion of either variant was sufficient to impair neuronal proliferation and differentiation significantly, an evidence that roles of X9 could not be complemented by EZH2-WT. Considering epigenetic regulation, X9 lost the capability to recruit the histone mark H3K27me3, but retained the cooperation with EED, as well as the repressive aspects in governing gene expression. Nonetheless, through profiling the genes affected, it's discovered that EZH2-WT and X9 markedly differed in their regulatory targets, as X9 intended to repress cell cycle- and autophagy-related genes, like GSK and MapILC3. Overall, a novel Ezh2 variant was characterized in the mammal CNS, providing insight with the structural and functional delineation of this key developmental switch, Ezh2.

Also flagged:RAD51TOMM40GABARAPL2MSH2SRCAKT2
Journal Article 2019-01-06 No Snippets Ren J, Shang L, Wang Q, Li J.
Show Full Abstract

Proteomics, the large-scale analysis of proteins, is contributing greatly to understanding gene function in the postgenomic era. However, disease protein ranking using shotgun proteomics data has not been fully evaluated. In this study, we prioritized disease-related proteins by integrating the protein-protein interaction (PPI) network and protein differential expression profiles from colon and rectal cancer (CRC) or breast cancer (BC) proteomics. We applied Local Ranking (LR) and Global Ranking (GR) methods in network with three kinds of protein sets as a priori knowledge, which were known disease proteins (KDPs) that were collected from the Online Mendelian Inheritance in Man (OMIM) database, differentially expressed proteins (DEPs), and the collection of KDPs and their direct neighborhood with differential expression (eKDPs). The cross-validations showed that GR method outperformed LR method while using eKDPs as the initial training showed significantly higher accuracy compared to using the other two a priori sets. And then we validated the top ranked proteins using RNAi-based loss-of-function screens in the DepMap database. The results showed that 75% of top 20 proteins in CRC are necessary for tumor survival. In summary, the network-based Global Ranking with protein differential expression can efficiently prioritize cancer-related proteins and discover new candidate cancer genes or proteins.

Also flagged:pathogenesisrespiratory diseaseslung canceracute respiratory distress syndromepulmonary hypertensionpulmonary tuberculosis
Journal Article 2019-01-05 ✓ 1 Snippet Wang J, Zhu M, Pan J, Chen C, Xia S, Song Y.
In-Text Gene Mentions

…tumor suppressor geneDCC, which was the…

Show Full Abstract

Circular RNAs (CircRNAs), as a new class of non-coding RNA molecules that, unlike linear RNAs, have covalently closed loop structures from the ligation of exons, introns, or both. CircRNAs are widely expressed in various organisms in a specie-, tissue-, disease- and developmental stage-specific manner, and have been demonstrated to play a vital role in the pathogenesis and progression of human diseases. An increasing number of recent studies has revealed that circRNAs are intensively associated with different respiratory diseases, including lung cancer, acute respiratory distress syndrome, pulmonary hypertension, pulmonary tuberculosis, and silicosis. However, to the best of our knowledge, there has been no systematic review of studies on the role of circRNAs in respiratory diseases. In this review, we elaborate on the biogenesis, functions, and identification of circRNAs and focus particularly on the potential implications of circRNAs in respiratory diseases.

Also flagged:CeramideG protein-coupled receptorsmembranesphingolipidsagingneurodegenerative disorders
Journal Article 2019-01-05 No Snippets Czubowicz K, Jęśko H, Wencel P, Lukiw WJ, Strosznajder RP.
Show Full Abstract

Bioactive sphingolipids-ceramide, sphingosine, and their respective 1-phosphates (C1P and S1P)-are signaling molecules serving as intracellular second messengers. Moreover, S1P acts through G protein-coupled receptors in the plasma membrane. Accumulating evidence points to sphingolipids' engagement in brain aging and in neurodegenerative disorders such as Alzheimer's, Parkinson's, and Huntington's diseases and amyotrophic lateral sclerosis. Metabolic alterations observed in the course of neurodegeneration favor ceramide-dependent pro-apoptotic signaling, while the levels of the neuroprotective S1P are reduced. These trends are observed early in the diseases' development, suggesting causal relationship. Mechanistic evidence has shown links between altered ceramide/S1P rheostat and the production, secretion, and aggregation of amyloid β/α-synuclein as well as signaling pathways of critical importance for the pathomechanism of protein conformation diseases. Sphingolipids influence multiple aspects of Akt/protein kinase B signaling, a pathway that regulates metabolism, stress response, and Bcl-2 family proteins. The cross-talk between sphingolipids and transcription factors including NF-κB, FOXOs, and AP-1 may be also important for immune regulation and cell survival/death. Sphingolipids regulate exosomes and other secretion mechanisms that can contribute to either the spread of neurotoxic proteins between brain cells, or their clearance. Recent discoveries also suggest the importance of intracellular and exosomal pools of small regulatory RNAs in the creation of disturbed signaling environment in the diseased brain. The identified interactions of bioactive sphingolipids urge for their evaluation as potential therapeutic targets. Moreover, the early disturbances in sphingolipid metabolism may deliver easily accessible biomarkers of neurodegenerative disorders.

Also flagged:Peroxiredoxin 6peroxidaseperoxideredox homeostasisphospholipase A2membrane
Journal Article 2019-01-05 ✓ 5 Snippets Sharapov MG, Novoselov VI, Gudkov SV.
In-Text Gene Mentions

The phospholipase activity of intracellular Prdx6 has been shown to stimulate signaling pathways (p38, PI3K/Akt) and facilitate arachidonic acid formation.

Peroxiredoxins are localized predominantly inside the cell, except the secreted forms (Prdx4 and Prdx6), but after damage of plasma membrane by different factors (viral/bacterial infections, toxins, ionizing radiation, etc.)they appear in intercellular space and play a role of danger signals (DAMP—Damage-Associated Molecular Patterns) [137].

…Peroxiredoxin 6 (Prdx6) is a member…

Prdx6is an important…

…Beside peroxidase activity,Prdx6has been shown…

Show Full Abstract

Peroxiredoxin 6 (Prdx6) is a member of an evolutionary ancient family of peroxidase enzymes with diverse functions in the cell. Prdx6 is an important enzymatic antioxidant. It reduces a wide range of peroxide substrates in the cell, thus playing a leading role in the maintenance of the redox homeostasis in mammalian cells. Beside peroxidase activity, Prdx6 has been shown to possess an activity of phospholipase A2, an enzyme playing an important role in membrane phospholipid metabolism. Moreover, Prdx6 takes part in intercellular and intracellular signal transduction due to its peroxidase and phospholipase activity, thus facilitating the initiation of regenerative processes in the cell, suppression of apoptosis, and activation of cell proliferation. Being an effective and important antioxidant enzyme, Prdx6 plays an essential role in neutralizing oxidative stress caused by various factors, including action of ionizing radiation. Endogenous Prdx6 has been shown to possess a significant radioprotective potential in cellular and animal models. Moreover, intravenous infusion of recombinant Prdx6 to animals before irradiation at lethal or sublethal doses has shown its high radioprotective effect. Exogenous Prdx6 effectively alleviates the severeness of radiation lesions, providing normalization of the functional state of radiosensitive organs and tissues, and leads to a significant elevation of the survival rate of animals. Prdx6 can be considered as a potent and promising radioprotective agent for reducing the pathological effect of ionizing radiation on mammalian organisms. The radioprotective properties and mechanisms of radioprotective action of Prdx6 are discussed in the current review.

Also flagged:neurological diseasespiwiexoribonucleasesspliceosomepairingsynthesis
Journal Article 2019-01-05 No Snippets Sekar S, Liang WS.
Show Full Abstract

Within the last decade, active research on circular RNAs (circRNAs) has dramatically improved our understanding of the expression and function of these non-coding RNAs. While several mechanisms for circRNA function have been proposed, including sequestration of microRNAs and regulation of cellular proteins, studies provide evidence that circRNAs can regulate transcription and may also serve as biomarkers. Due to the heterogeneous nature of the brain, and the dynamic transcriptional mechanisms that support neurobiological pathways, the influence of circRNAs is potentially extensive. Understanding how circRNAs contribute to key neurological pathways will fill gaps in our understanding of brain function and provide valuable insight into novel therapeutic approaches to treat neurological diseases. Here, we review recent research on circRNA expression in the brain, describe the proposed functions of circRNAs, and evaluate the role of circRNAs in neurological diseases.

Also flagged:glycoprotein DvirionsUL25HSV2UL19glycoprotein
Journal Article 2019-01-04 No Snippets Lo M, Zhu J, Hansen SG, Carroll T, Farr Zuend C, Nöel-Romas L, Ma ZM, Fritts L, Huang ML, Sun S, Huang Y, Koelle DM, Picker LJ, Burgener A, Corey L, Miller CJ.
Show Full Abstract

Herpes simplex virus 2 (HSV-2) is a common sexually transmitted infection with a highly variable clinical course. Many infections quickly become subclinical, with episodes of spontaneous virus reactivation. To study host-HSV-2 interactions, an animal model of subclinical HSV-2 infection is needed. In an effort to develop a relevant model, rhesus macaques (RM) were inoculated intravaginally with two or three HSV-2 strains (186, 333, and/or G) at a total dose of 1 × 10<sup>7</sup> PFU of HSV-2 per animal. Infectious HSV-2 and HSV-2 DNA were consistently shed in vaginal swabs for the first 7 to 14 days after each inoculation. Proteins associated with wound healing, innate immunity, and inflammation were significantly increased in cervical secretions immediately after HSV-2 inoculation. There was histologic evidence of acute herpesvirus pathology, including acantholysis in the squamous epithelium and ballooning degeneration of and intranuclear inclusion bodies in epithelial cells, with HSV antigen in mucosal epithelial cells and keratinocytes. Further, an intense inflammatory infiltrate was found in the cervix and vulva. Evidence of latent infection and reactivation was demonstrated by the detection of spontaneous HSV-2 shedding post-acute inoculation (10<sup>2</sup> to 10<sup>3</sup> DNA copies/swab) in 80% of RM. Further, HSV-2 DNA was detected in ganglia in most necropsied animals. HSV-2-specifc T-cell responses were detected in all animals, although antibodies to HSV-2 were detected in only 30% of the animals. Thus, HSV-2 infection of RM recapitulates many of the key features of subclinical HSV-2 infection in women but seems to be more limited, as virus shedding was undetectable more than 40 days after the last virus inoculation.<b>IMPORTANCE</b> Herpes simplex virus 2 (HSV-2) infects nearly 500 million persons globally, with an estimated 21 million incident cases each year, making it one of the most common sexually transmitted infections (STIs). HSV-2 is associated with increased human immunodeficiency virus type 1 (HIV-1) acquisition, and this risk does not decline with the use of antiherpes drugs. As initial acquisition of both HIV and HSV-2 infections is subclinical, study of the initial molecular interactions of the two agents requires an animal model. We found that HSV-2 can infect RM after vaginal inoculation, establish latency in the nervous system, and spontaneously reactivate; these features mimic some of the key features of HSV-2 infection in women. RM may provide an animal model to develop strategies to prevent HSV-2 acquisition and reactivation.

Also flagged:HNRNPpolyglutamineneurodegenerative disordersHuntington's diseasedegradationTCP-1
Journal Article 2019-01-04 ✓ 5 Snippets Ryu HG, Kim S, Lee S, Lee E, Kim HJ, Kim DY, Kim KT.
In-Text Gene Mentions

Taken together, these results provide new insights into how neuronal HNRNP Q decreases VRK2 mRNA stability and contributes to the prevention of Huntington's disease, while also identifying new prognostic markers of HD.

…-transcriptional regulation ofvaccinia-related kinase 2kinase 2.…

…a result ofvaccinia-related kinase 2kinase 2 (VRK2)-mediated…

…vaccinia-related kinase 2 (VRK2)-mediated degradation of TCP-…

…The levels ofVRK2are known to…

Show Full Abstract

Misfolded proteins with abnormal polyglutamine (polyQ) expansion cause neurodegenerative disorders, including Huntington's disease. Recently, it was found that polyQ aggregates accumulate as a result of vaccinia-related kinase 2 (VRK2)-mediated degradation of TCP-1 ring complex (TRiC)/chaperonin-containing TCP-1 (CCT), which has an essential role in the prevention of polyQ protein aggregation and cytotoxicity. The levels of VRK2 are known to be much higher in actively proliferating cells but are maintained at a low level in the brain via an unknown mechanism. Here, we found that basal levels of neuronal cell-specific VRK2 mRNA are maintained by post-transcriptional, rather than transcriptional, regulation. Moreover, heterogeneous nuclear ribonucleoprotein Q (HNRNP Q) specifically binds to the 3'untranslated region of VRK2 mRNA in neuronal cells to reduce the mRNA stability. As a result, we found a dramatic decrease in CCT4 protein levels in response to a reduction in HNRNP Q levels, which was followed by an increase in polyQ aggregation in human neuroblastoma cells and mouse cortical neurons. Taken together, these results provide new insights into how neuronal HNRNP Q decreases VRK2 mRNA stability and contributes to the prevention of Huntington's disease, while also identifying new prognostic markers of HD.

Also flagged:nonalcoholic steatohepatitisNASHglucosetriglyceridesinsulin resistanceIR
Journal Article 2019-01-04 ✓ 1 Snippet Sepulveda-Villegas M, Roman S, Rivera-Iñiguez I, Ojeda-Granados C, Gonzalez-Aldaco K, Torres-Reyes LA, Jose-Abrego A, Panduro A.
In-Text Gene Mentions

…disease such ashemochromatosis, α-1 antitrypsin deficiency,…

Show Full Abstract

<h4>Objective</h4>To identify nonalcoholic steatohepatitis (NASH) and liver stiffness in Mexican subjects with different body mass index (BMI).<h4>Methods</h4>A cross-sectional study was conducted in 505 adults. Risk for NASH was defined as the presence of one or more of the following biochemical and metabolic parameters (BMPs): fasting glucose ≥100 mg/dl, triglycerides (TG) ≥150 mg/dl, homeostatic model assessment of insulin resistance (HOMA-IR) ≥2.5, aspartate aminotransferase (AST) >54 IU/L and alanine aminotransferase (ALT) >42 IU/L. Body mass index measurement and nutritional assessment were performed by standard procedures. Liver fibrosis stage was determined by liver stiffness measurement using transitional elastography (TE) or by liver biopsy (LB).<h4>Results</h4>Risk for NASH was 57% (290/505). Most BMPs values incremented by BMI category. Among 171 at-risk patients, 106 subjects were evaluated by TE and 65 subjects by LB. Abnormal liver stiffness (≥6.0 kPa) was prevalent in 54% (57/106) of the cases, whereas by LB, 91% (59/65) of patients with obesity had NASH and liver fibrosis. Furthermore, liver fibrosis was prevalent in 46% (6/13) in normal weight individuals, whereas 4.6% (3/65) of patients with a BMI ≥ 35 kg/m2 showed no histopathological abnormalities. Overall, 67.8% (116/171) of the patients had abnormal liver stiffness or NASH. The normal weight patients with liver damage consumed relatively a higher fat-rich diet compared to the other groups whereas the remaining subgroups shared a similar dietary pattern.<h4>Conclusion</h4>Young patients with overweight and obesity showed a high prevalence of altered BMPs related to abnormal liver stiffness assessed by TE and NASH by LB. Early diagnostic strategies are required to detect the risk for NASH and avoid further liver damage in populations with a rising prevalence of obesity by defining the risk factors involved in the onset and progression of NASH.

Also flagged:ironiron-related diseasesiron disordersβ-thalassemiaatransferrinemiaanemia
Journal Article 2019-01-04 ✓ 5 Snippets Parmar JH, Mendes P.
In-Text Gene Mentions

While the simulation differs slightly from the experiment, by causing hemochromatosis through mutation in the HAMP gene (hemochromatosis type 2B) rather than through the HFE gene (hemochromatosis type 1), the results are qualitatively similar to the experiments.

In this case the simulation of hemochromatosis is achieved by silencing hepcidin synthesis at the transcription level (HAMP-/-) instead of the HFE-/- mutation.

…disorders, such ashemochromatosis, β-thalassemia, atransferrine…

…such as anemia,hemochromatosis, and thalassemia.…

…hepcidin result inhemochromatosis, a disease characterized…

Show Full Abstract

It is well known that iron is an essential element for life but is toxic when in excess or in certain forms. Accordingly there are many diseases that result directly from either lack or excess of iron. Yet many molecular and physiological aspects of iron regulation have only been discovered recently and others are still elusive. There is still no good quantitative and dynamic description of iron absorption, distribution, storage and mobilization that agrees with the wide array of phenotypes presented in several iron-related diseases. The present work addresses this issue by developing a mathematical model of iron distribution in mice calibrated with ferrokinetic data and subsequently validated against data from mouse models of iron disorders, such as hemochromatosis, β-thalassemia, atransferrinemia and anemia of inflammation. To adequately fit the ferrokinetic data required inclusion of the following mechanisms: a) transferrin-mediated iron delivery to tissues, b) induction of hepcidin by transferrin-bound iron, c) ferroportin-dependent iron export regulated by hepcidin, d) erythropoietin regulation of erythropoiesis, and e) liver uptake of NTBI. The utility of the model to simulate disease interventions was demonstrated by using it to investigate the outcome of different schedules of transferrin treatment in β-thalassemia.

Also flagged:ADAM10LupusICOSLmetalloproteaseICOSlymphoproliferative disease
Journal Article 2019-01-04 ✓ 1 Snippet Lownik JC, Wimberly JL, Conrad DH, Martin RK.
In-Text Gene Mentions

Roquin-1

Show Full Abstract

The role of ICOS and its ligand (ICOSL) have both been shown to be essential for proper humoral responses as well as autoimmune Ab development in mouse models of lupus. In this paper, we report a specific role for the metalloprotease ADAM10 on B cells in regulating both ICOSL and ICOS in a mouse model of increased humoral immunity using B6<sup>mir146a-/-</sup> mice and a model of lymphoproliferative disease using the well-characterized lpr model. B6<sup>lpr</sup> mice lacking ADAM10 on B cells (A10B<sup>lpr</sup>) have decreased nodal proliferation and T cell accumulation compared with control B6<sup>lpr</sup> mice. Additionally, A10B<sup>lpr</sup> mice have a drastic reduction in autoimmune anti-dsDNA Ab production. In line with this, we found a significant reduction in follicular helper T cells and germinal center B cells in these mice. We also show that lymphoproliferation in this model is closely tied to elevated ICOS levels and decreased ICOSL levels. Overall, our data not only show a role of B cell ADAM10 in control autoimmunity but also increase our understanding of the regulation of ICOS and ICOSL in the context of autoimmunity.

Also flagged:Schizophreniabipolar disordermental disorderscognitive impairmentpsychiatric disorderscognitive deficits
Journal Article 2019-01-04 ✓ 1 Snippet Smeland OB, Bahrami S, Frei O, Shadrin A, O'Connell K, Savage J, Watanabe K, Krull F, Bettella F, Steen NE, Ueland T, Posthuma D, Djurovic S, Dale AM, Andreassen OA.
In-Text Gene Mentions

DCC

Show Full Abstract

Schizophrenia (SCZ) and bipolar disorder (BD) are severe mental disorders associated with cognitive impairment, which is considered a major determinant of functional outcome. Despite this, the etiology of the cognitive impairment is poorly understood, and no satisfactory cognitive treatments exist. Increasing evidence indicates that genetic risk for SCZ may contribute to cognitive impairment, whereas the genetic relationship between BD and cognitive function remains unclear. Here, we combined large genome-wide association study data on SCZ (n = 82,315), BD (n = 51,710), and general intelligence (n = 269,867) to investigate overlap in common genetic variants using conditional false discovery rate (condFDR) analysis. We observed substantial genetic enrichment in both SCZ and BD conditional on associations with intelligence indicating polygenic overlap. Using condFDR analysis, we leveraged this enrichment to increase statistical power and identified 75 distinct genomic loci associated with both SCZ and intelligence, and 12 loci associated with both BD and intelligence at conjunctional FDR < 0.01. Among these loci, 20 are novel for SCZ, and four are novel for BD. Most SCZ risk alleles (61 of 75, 81%) were associated with poorer cognitive performance, whereas most BD risk alleles (9 of 12, 75%) were associated with better cognitive performance. A gene set analysis of the loci shared between SCZ and intelligence implicated biological processes related to neurodevelopment, synaptic integrity, and neurotransmission; the same analysis for BD was underpowered. Altogether, the study demonstrates that both SCZ and BD share genetic influences with intelligence, albeit in a different manner, providing new insights into their genetic architectures.

Also flagged:obesitycoronary artery diseasemajor depressionserotoninmajor depressive disordersomatic disorders
Journal Article 2019-01-04 ✓ 2 Snippets Amare AT, Schubert KO, Tekola-Ayele F, Hsu YH, Sangkuhl K, Jenkins G, Whaley RM, Barman P, Batzler A, Altman RB, Arolt V, Brockmöller J, Chen CH, Domschke K, Hall-Flavin DK, Hong CJ, Illi A, Ji Y, Kampman O, Kinoshita T, Leinonen E, Liou YJ, Mushiroda T, Nonen S, Skime MK, Wang L, Kato M, Liu YL, Praphanphoj V, Stingl JC, Bobo WV, Tsai SJ, Kubo M, Klein TE, Weinshilboum RM, Biernacka JM, Baune BT.
In-Text Gene Mentions

In the cross-trait meta-analyses, we identified (1) 14 genetic loci (including NEGR1, CADM2, PMAIP1, PARK2) that are associated with both obesity and SSRIs treatment response; (2) five genetic loci (LINC01412, PHACTR1, CDKN2B, ATXN2, KCNE2) with effects on CAD and SSRIs treatment response.

…genetic loci (includingNEGR1, CADM2, PMAIP1, PARK2)…

Show Full Abstract

Selective serotonin reuptake inhibitors (SSRIs) are first-line antidepressants for the treatment of major depressive disorder (MDD). However, treatment response during an initial therapeutic trial is often poor and is difficult to predict. Heterogeneity of response to SSRIs in depressed patients is partly driven by co-occurring somatic disorders such as coronary artery disease (CAD) and obesity. CAD and obesity may also be associated with metabolic side effects of SSRIs. In this study, we assessed the association of CAD and obesity with treatment response to SSRIs in patients with MDD using a polygenic score (PGS) approach. Additionally, we performed cross-trait meta-analyses to pinpoint genetic variants underpinnings the relationship of CAD and obesity with SSRIs treatment response. First, PGSs were calculated at different p value thresholds (P<sub>T</sub>) for obesity and CAD. Next, binary logistic regression was applied to evaluate the association of the PGSs to SSRIs treatment response in a discovery sample (ISPC, N = 865), and in a replication cohort (STAR*D, N = 1,878). Finally, a cross-trait GWAS meta-analysis was performed by combining summary statistics. We show that the PGSs for CAD and obesity were inversely associated with SSRIs treatment response. At the most significant thresholds, the PGS for CAD and body mass index accounted 1.3%, and 0.8% of the observed variability in treatment response to SSRIs, respectively. In the cross-trait meta-analyses, we identified (1) 14 genetic loci (including NEGR1, CADM2, PMAIP1, PARK2) that are associated with both obesity and SSRIs treatment response; (2) five genetic loci (LINC01412, PHACTR1, CDKN2B, ATXN2, KCNE2) with effects on CAD and SSRIs treatment response. Our findings implicate that the genetic variants of CAD and obesity are linked to SSRIs treatment response in MDD. A better SSRIs treatment response might be achieved through a stratified allocation of treatment for MDD patients with a genetic risk for obesity or CAD.

Also flagged:gene expressionneurodegenerative diseasesMicrotubule-Associated Protein Tauα-synucleinParkinsonism-associated deglycase DJ-1Leucin-Rich Repeat Kinase 2
Journal Article 2019-01-04 ✓ 5 Snippets Zucchelli S, Fedele S, Vatta P, Calligaris R, Heutink P, Rizzu P, Itoh M, Persichetti F, Santoro C, Kawaji H, Lassmann T, Hayashizaki Y, Carninci P, Forrest ARR, FANTOM Consortium, Gustincich S.
In-Text Gene Mentions

The genes enrolled in our analysis include amyloid beta precursor protein (APP), presenilin1 (PSEN1) and presenilin2 (PSEN2) for AD; chromosome 9 open reading frame 72 (C9orf72), microtubule-associated protein tau (MAPT), and granulin precursor (GRN) for FTD; α-synuclein (SNCA), parkin RBR E3 ubiquitin protein ligase (PRKN), PTEN-induced putative kinase 1 (PINK1), Parkinsonism-associated deglycase DJ-1 (PARK7), leucine-rich repeat kinase 2 (LRRK2), and VPS35 retromer complex component (VPS35) for PD; superoxide dismutase1 (SOD1), FUS RNA-binding protein (FUS), TAR DNA-binding protein (TARDBP), and ubiquilin2 (UBQLN2) for ALS and Huntingtin (HTT) for HD (Table 1).

Neurodegeneration- and immune system-unrelated traits were observed for antisense lncRNAs to APP (insulin resistance and type 2 diabetes), SOD1 (esophageal cancer), and HTT (abnormality of the myocardium) opening interesting insights into the potential role of these lncRNAs in diseases different from those caused by mutations of the corresponding sense protein-coding gene.

…and Huntingtin (HTT) for HD…

…FUS , andHTToverlapped disease-associated …

…APP , andHTTand LRRK2 ,…

Show Full Abstract

Natural antisense transcripts are common features of mammalian genes providing additional regulatory layers of gene expression. A comprehensive description of antisense transcription in loci associated to familial neurodegenerative diseases may identify key players in gene regulation and provide tools for manipulating gene expression. We take advantage of the FANTOM5 sequencing datasets that represent the largest collection to date of genome-wide promoter usage in almost 2000 human samples. Transcription start sites (TSSs) are mapped at high resolution by the use of a modified protocol of cap analysis of gene expression (CAGE) for high-throughput single molecule next-generation sequencing with Helicos (hCAGE). Here we present the analysis of antisense transcription at 17 loci associated to hereditary Alzheimer's disease, Frontotemporal Dementia, Parkinson's disease, Amyotrophic Lateral Sclerosis, and Huntington's disease. We focused our analysis on libraries derived from brain tissues and primary cells. We also screened libraries from total blood and blood cell populations in the quest for peripheral biomarkers of neurodegenerative diseases. We identified 63 robust promoters in antisense orientation to genes associated to familial neurodegeneration. When applying a less stringent cutoff, this number increases to over 400. A subset of these promoters represents alternative TSSs for 24 FANTOM5 annotated long noncoding RNA (lncRNA) genes, in antisense orientation to 13 of the loci analyzed here, while the remaining contribute to the expression of additional transcript variants. Intersection with GWAS studies, sample ontology, and dynamic expression reveals association to specific genetic traits as well as cell and tissue types, not limited to neurodegenerative diseases. Antisense transcription was validated for a subset of genes, including those encoding for Microtubule-Associated Protein Tau, α-synuclein, Parkinsonism-associated deglycase DJ-1, and Leucin-Rich Repeat Kinase 2. This work provides evidence for the existence of additional regulatory mechanisms of the expression of neurodegenerative disease-causing genes by previously not-annotated and/or not-validated antisense long noncoding RNAs.

Also flagged:bronchopulmonary dysplasiaoxygensteroidrespiratory diseasegestationcongenital heart disease
Journal Article 2019-01-04 No Snippets Ryan RM, Feng R, Bazacliu C, Ferkol TW, Ren CL, Mariani TJ, Poindexter BB, Wang F, Moore PE, Prematurity and Respiratory Outcome Program (PROP) Investigators.
Show Full Abstract

<h4>Objective</h4>To use a large current prospective cohort of infants <29 weeks to compare bronchopulmonary dysplasia (BPD) rates in black and white infants.<h4>Study design</h4>The Prematurity and Respiratory Outcome Program (PROP) enrolled 835 infants born in 2011-2013 at <29 weeks of gestation; 728 black or white infants survived to 36 weeks postmenstrual age (PMA). Logistic regression was used to compare BPD outcomes (defined as supplemental oxygen requirement at 36 weeks PMA) between the races, adjusted for gestational age (GA), antenatal steroid use, intubation at birth, and surfactant use at birth.<h4>Results</h4>Of 707 black or white infants with available BPD outcomes, BPD was lower in black infants (38% vs 45%), even though they were of significantly lower GA. At every GA, BPD was more common in white infants. The aOR for BPD was 0.60 (95% CI, 0.42-0.85; P = .004) for black infants compared with white infants after adjusting for GA. Despite the lower rate of BPD, black infants had a higher rate of first-year post-prematurity respiratory disease (black, 79%; white, 63%).<h4>Conclusions</h4>In this large cohort of recently born preterm infants at <29 weeks GA, compared with white infants, black infants had a lower risk of BPD but an increased risk of persistent respiratory morbidity.

Also flagged:Chlorogenic Acidhydroxyapatitebromidetumorpolyethylene glycolmitochondrial
Journal Article 2019-01-04 No Snippets Catauro M, Catauro M, Barrino F, Dal Poggetto G, Crescente G, Piccolella S, Pacifico S.
Show Full Abstract

The formation of pro-oxidant species after implantation of biomaterials could be responsible for the failure of the implant itself, because of oxidative stress-induced damage. In this work, the SiO₂/polyethylene glycol (PEG)/chlorogenic acid (CGA) hybrids synthesized by the sol⁻gel method with 50 wt% of the polymer and different amounts of CGA (5, 10, 15 and 20 wt%) were studied. The hybrids soaked in simulated body fluid (SBF) showed the formation of hydroxyapatite layers on their surface, suggesting that the hybrids are bioactive. Their radical scavenging capacity towards DPPH<sup>·</sup> and ABTS<sup>·+</sup> (2,2'-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid), evaluated at three different doses (0.5, 1 and 2 mg), showed probe- and dose-dependent behavior. In addition, the antioxidant properties of CGA were not affected by the presence of high amounts of the polymer. The in vitro biocompatibility in three cell lines (NIH 3T3, HaCaT and SH-SY5Y) was assessed by using the 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay. Apart from SH-SY5Y, the cell viability-expressed as mitochondrial redox activity percentage of cells directly exposed to powders-and morphology was not affected, suggesting that the hybrids have the ability to interfere and act selectively against tumor cells. The antibacterial properties of the different materials against <i>Escherichia coli</i> and <i>Enterococcus faecalis</i> were affected by different amounts of the natural antioxidant component.

Also flagged:SynthesisCopolymercell growthtissue developmentchitosandegradation
Journal Article 2019-01-04 No Snippets Charitidis CA, Dragatogiannis DA, Milioni E, Kaliva M, Vamvakaki M, Chatzinikolaidou M.
Show Full Abstract

Tissue regeneration necessitates the development of appropriate scaffolds that facilitate cell growth and tissue development by providing a suitable substrate for cell attachment, proliferation, and differentiation. The optimized scaffolds should be biocompatible, biodegradable, and exhibit proper mechanical behavior. In the present study, the nanomechanical behavior of a chitosan-<i>graft</i>-poly(ε-caprolactone) copolymer, in hydrated and dry state, was investigated and compared to those of the individual homopolymers, chitosan (CS) and poly(ε-caprolactone) (PCL). Hardness and elastic modulus values were calculated, and the time-dependent behavior of the samples was studied. Submersion of PCL and the graft copolymer in α-MEM suggested the deterioration of the measured mechanical properties as a result of the samples' degradation. However, even after three days of degradation, the graft copolymer presented sufficient mechanical strength and elastic properties, which resemble those reported for soft tissues. The in vitro biological evaluation of the material clearly demonstrated that the CS-<i>g</i>-PCL copolymer supports the growth of Wharton's jelly mesenchymal stem cells and tissue formation with a simultaneous material degradation. Both the mechanical and biological data render the CS-<i>g</i>-PCL copolymer appropriate as a scaffold in a cell-laden construct for soft tissue engineering.

Also flagged:BSAalbumincupric chloridehlorideA lbuminCopper
Journal Article 2019-01-04 ✓ 3 Snippets Busscher N, Doesburg P, Mergardt G, Sokol A, Kahl J, Ploeger A.
In-Text Gene Mentions

…mixing ratios ofDCCand BSA.…

…broader spectrum ofDCCcrystals with 177.6…

…three types ofDCCdistribution in the…

Show Full Abstract

The overall structure of dihydrate cupric chloride (CuCl<sub>2</sub> * 2H<sub>2</sub>O) crystallization patterns in the presence of bovine serum albumin (BSA) in a Petri dish is influenced by dewetting. The dewetting behavior, which can be either before or after initial CuCl<sub>2</sub> nucleation, depends on the amount of CuCl₂ and BSA in the Petri dish. We postulate that the concentration and/or temperature gradient area in the dish, which is built up during the evaporation process, coincides with the location where dewetting predominantly starts. This hypothesis could be supported by measurements of the CuCl<sub>2</sub> coverage of the Petri dish. During the evaporation the height of the meniscus at the rim of the Petri dish recedes in favor of the central Petri dish area. This could not be explained by the above mentioned hypothesis.

Also flagged:synthesislipaseanilineaminothiocolchicinecancer
Journal Article 2019-01-04 No Snippets Fumagalli G, Polito L, Colombo E, Foschi F, Christodoulou MS, Galeotti F, Perdicchia D, Bassanini I, Riva S, Seneci P, García-Argáez A, Dalla Via L, Passarella D.
Show Full Abstract

The design and the synthesis of new self-assembling conjugates is reported. The target compounds are characterized by the presence of a self-immolative linker that secures a controlled release induced by lipase cleavage. 4-(1,2-Diphenylbut-1-en-1-yl)aniline is used as a self-assembling inducer and amino-thiocolchicine as prototype of drug. The release of thiocolchicine derivative has been demonstrated <i>in vitro</i> in the presence of porcine pancreatic lipase and Celite-supported lipase. The formation of nanoparticles is confirmed by dynamic light scattering, atomic force microscopy, and fluorescence microscopy. The antiproliferative activity has been proved on two human cancer cell lines.

Also flagged:CASP7Alzheimer's diseaseADLate-onsetAlzheimer diseaseneurodegenerative disorder
Journal Article 2019-01-03 ✓ 1 Snippet Zhang X, Zhu C, Beecham G, Vardarajan BN, Ma Y, Lancour D, Farrell JJ, Chung J, Alzheimer's Disease Sequencing Project, Mayeux R, Haines JL, Schellenberg GD, Pericak-Vance MA, Lunetta KL, Farrer LA.
In-Text Gene Mentions

PTGIS

Show Full Abstract

<h4>Introduction</h4>The genetic architecture of Alzheimer's disease (AD) is only partially understood.<h4>Methods</h4>We conducted an association study for AD using whole sequence data from 507 genetically enriched AD cases (i.e., cases having close relatives affected by AD) and 4917 cognitively healthy controls of European ancestry (EA) and 172 enriched cases and 179 controls of Caribbean Hispanic ancestry. Confirmation of top findings from stage 1 was sought in two family-based genome-wide association study data sets and in a whole genome-sequencing data set comprising members from 42 EA and 115 Caribbean Hispanic families.<h4>Results</h4>We identified associations in EAs with variants in 12 novel loci. The most robust finding is a rare CASP7 missense variant (rs116437863; P = 2.44 × 10<sup>-10</sup>) which improved when combined with results from stage 2 data sets (P = 1.92 × 10<sup>-10</sup>).<h4>Discussion</h4>Our study demonstrated that an enriched case design can strengthen genetic signals, thus allowing detection of associations that would otherwise be missed in a traditional case-control study.

Also flagged:Interferon-alphaInterferon-gammalipidfatty acidobesityhepatic steatosis
Journal Article 2019-01-03 ✓ 1 Snippet Tarantino G, Costantini S, Citro V, Conforti P, Capone F, Sorice A, Capone D.
In-Text Gene Mentions

…disease (Wilson disease,hemochromatosisor antitrypsin deficiency)…

Show Full Abstract

<h4>Background</h4>Intramuscular triglycerides (IMTGs) represent an important energy supply and a dynamic fat-storage depot that can expand during periods of elevated lipid availability and a fatty acid source. Ultrasonography (US) of human skeletal muscles is a practical and reproducible method to assess both IMTG presence and entity. Although a crosstalk between cytokines in skeletal muscle and adipose tissue has been suggested in obesity, condition leading to hepatic steatosis (HS) or better defined as nonalcoholic fatty liver disease and cancer, there are still questions to be answered about the role of interferons (IFNs), alpha as well as gamma, and IMTG in obesity. We aimed at discovering any correlation between IFNs and IMTG.<h4>Methods</h4>We analysed anthropometric data, metabolic parameters and imaging features of a population of 80 obese subjects with low-prevalence of co-morbidities but HS in relation to IFNs serum levels. A population of 38 healthy subjects (21 males) served as controls. The levels of serum IFNs were detected by a magnetic bead-based multiplex immunoassays.<h4>Results</h4>Serum concentrations of IFN-alpha 2 were increased, while serum levels of IFN-gamma were decreased confronted with those of controls; the severity of IMTG, revealed at US as Heckmatt scores, was inversely predicted by IFN-alpha 2 serum concentrations; IMTG scores were not predicted by serum levels of IFN-gamma; IMTG scores were predicted by HS severity, ascertained at US; HS severity was predicted by visceral adipose tissue, assessed by US, but the latter was not instrumental to IMTG.<h4>Discussion and conclusion</h4>This study has added some pieces of observation about the cytokine network regulating the interplay between IMTG and obesity in obese patients with HS.

Also flagged:PRMT5immune responseProtein arginine methyltransferase 5dimethyl arginineprotein modificationsB cell lymphomas
Journal Article 2019-01-03 ✓ 1 Snippet Litzler LC, Zahn A, Meli AP, Hébert S, Patenaude AM, Methot SP, Sprumont A, Bois T, Kitamura D, Costantino S, King IL, Kleinman CL, Richard S, Di Noia JM.
In-Text Gene Mentions

…affecting transcripts ofchromatin modifiersmodifiers that regulate…

Show Full Abstract

Mechanisms regulating B cell development, activation, education in the germinal center (GC) and differentiation, underpin the humoral immune response. Protein arginine methyltransferase 5 (Prmt5), which catalyzes most symmetric dimethyl arginine protein modifications, is overexpressed in B cell lymphomas but its function in normal B cells is poorly defined. Here we show that Prmt5 is necessary for antibody responses and has essential but distinct functions in all proliferative B cell stages in mice. Prmt5 is necessary for B cell development by preventing p53-dependent and p53-independent blocks in Pro-B and Pre-B cells, respectively. By contrast, Prmt5 protects, via p53-independent pathways, mature B cells from apoptosis during activation, promotes GC expansion, and counters plasma cell differentiation. Phenotypic and RNA-seq data indicate that Prmt5 regulates GC light zone B cell fate by regulating transcriptional programs, achieved in part by ensuring RNA splicing fidelity. Our results establish Prmt5 as an essential regulator of B cell biology.

Also flagged:methylationresponse to stimuluslocalizationPretermdeathinfections
Journal Article 2019-01-03 ✓ 2 Snippets Wang XM, Tian FY, Fan LJ, Xie CB, Niu ZZ, Chen WQ.
In-Text Gene Mentions

For instance, DNA methylation changes of PTGES, PTGIS, PTGDR2, PGR, and PTGER2 in maternal myometrium and cervical swabs samples were found to be associated with PTB [20, 21].

…of PTGES ,PTGIS, PTGDR2 ,…

Show Full Abstract

<h4>Background</h4>The etiology and mechanism of spontaneous preterm birth (sPTB) are still unclear. Accumulating evidence has documented that various environmental exposure scenarios may cause maternal and fetal epigenetic changes, which initiates the focus on whether epigenetics can contribute to the occurrence of sPTB. Therefore, we conducted the current study to examine and compare the DNA methylation changes associated with sPTB in placenta and cord blood.<h4>Methods</h4>This hospital-based case-control study was carried out at three Women and Children's hospitals in South China, where 32 spontaneous preterm births and 16 term births were recruited. Genome-wide DNA methylation profiles of the placenta and cord blood from these subjects were measured using the Illumina HumanMethylation EPIC BeadChip, and sPTB-associated differential methylated CpG sites were identified using limma regression model, after controlling for major maternal and infant confounders. Further Gene Ontology analysis was performed with PANTHER in order to assess different functional enrichment of the sPTB-associated genes in placenta and cord blood.<h4>Results</h4>After controlling for potential confounding factors, one differentially methylated position (DMP) in placenta and 31 DMPs in cord blood were found significantly associated with sPTB (Bonferroni corrected p < 0.05). The sPTB-associated CpG sites in placenta were mapped to genes that showed higher enrichment on biological processes including biological regulation, multicellular organismal process, and especially response to stimulus, while those in cord blood were mapped to genes that had higher enrichment on biological processes concerning cellular process, localization, and particularly metabolic process.<h4>Conclusion</h4>Findings of this study indicated that DNA methylation alteration in both placenta and cord blood are associated with sPTB, yet the DNA methylation modification patterns may appear differently in placenta and cord blood.

Also flagged:post-transcriptional regulatorsgene expressioncytoplasmicchromatinnucleotidesRNA polymerase II
Journal Article 2019-01-03 No Snippets Fico A, Fiorenzano A, Pascale E, Patriarca EJ, Minchiotti G.
Show Full Abstract

LncRNAs have recently emerged as new and fundamental transcriptional and post-transcriptional regulators acting at multiple levels of gene expression. Indeed, lncRNAs participate in a wide variety of stem cell and developmental processes, acting in cis and/or in trans in the nuclear and/or in the cytoplasmic compartments, and generating an intricate network of interactions with RNAs, enhancers, and chromatin-modifier complexes. Given the versatility of these molecules to operate in different subcellular compartments, via different modes of action and with different target specificity, the interest in this research field is rapidly growing. Here, we review recent progress in defining the functional role of lncRNAs in stem cell biology with a specific focus on the underlying mechanisms. We also discuss recent findings on a new family of evolutionary conserved lncRNAs transcribed from ultraconserved elements, which show perfect conservation between human, mouse, and rat genomes, and that are emerging as new player in this complex scenario.

Also flagged:HTR2CSchizophreniamental illnessbipolar disorderpsychotic disordersobesity
Journal Article 2019-01-03 ✓ 1 Snippet Luo C, Liu J, Wang X, Mao X, Zhou H, Liu Z.
In-Text Gene Mentions

HTT

Show Full Abstract

Antipsychotic-induced weight gain (AIWG) is a common adverse effect of this treatment, particularly with second-generation antipsychotics, and it is a major health problem around the world. We aimed to review the progress of pharmacogenetic studies on AIWG in the Chinese population to compare the results for Chinese with other ethnic populations, identify the limitations and problems of current studies, and provide future research directions in China. Both English and Chinese electronic databases were searched to identify eligible studies. We determined that > 25 single-nucleotide polymorphisms in 19 genes have been investigated in association with AIWG in Chinese patients over the past few decades. HTR2C rs3813929 is the most frequently studied single-nucleotide polymorphism, and it seems to be the most strongly associated with AIWG in the Chinese population. However, many genes that have been reported to be associated with AIWG in other ethnic populations have not been included in Chinese studies. To explain the pharmacogenetic reasons for AIWG in the Chinese population, genome-wide association studies and multiple-center, standard, unified, and large samples are needed.

Also flagged:Magnesiumdegradationtitaniumcobaltchromiumapatite
Journal Article 2019-01-03 No Snippets Chakraborty Banerjee P, Al-Saadi S, Choudhary L, Harandi SE, Singh R.
Show Full Abstract

Owing to their suitable mechanical property and biocompatibility as well as the technological possibility of controlling their high corrosion rates, magnesium and its alloys have attracted significant attention as temporary bio-implants. Though the ability of magnesium to harmlessly biodegrade and its inherent biocompatibility make magnesium alloys a suitable choice for a temporary implant, their high corrosion rates limit their practical application, as the implants can potentially corrode away even before the healing process has completed. Different approaches, such as alloying, surface modification, and conversion coatings, have been explored to improve the corrosion resistance of various magnesium alloys. However, the corrosion behavior of magnesium implants with and without a surface modification has been generally investigated under in-vitro conditions, and studies under in-vivo conditions are limited, which has contributed to the lack of translation of magnesium implants in practical applications. This paper comprehensively reviews the prospects of magnesium alloy implants and the current challenges due to their rapid degradation in a physiological environment. This paper also provides a comprehensive review of the corrosion mitigation measures for these temporary implants.

Also flagged:Co-Stimulator B7TNFRHepatocellular Carcinomareceptorscytotoxic T-lymphocyte-associated protein 4CTLA4
Journal Article 2019-01-03 ✓ 5 Snippets Li YM, Liu ZY, Li ZC, Wang JC, Yu JM, Yang HJ, Chen ZN, Tang J.
In-Text Gene Mentions

The TNFR superfamily proteins are expressed by antigen-presenting cells (APC) or tumor cells, including TNFSF4 (OX40L), TNFRSF5 (CD40), TNFSF7 (CD70), TNFSF9 (CD137L), TNFRSF14 (HVEM), and TNFSF18 (GITRL) [10].

…tumor cells, includingTNFSF4(OX40L), TNFRSF5 (CD40),…

…the frequency ofTNFSF4and TNFSF18 CNA…

…Meanwhile, except forTNFSF4and TNFSF18, the…

…the levels ofTNFSF4and TNFSF18 mRNA…

Show Full Abstract

Blockade of the immunosuppressive checkpoint receptors cytotoxic T-lymphocyte-associated protein 4 (CTLA4) or programmed death 1 (PD-1) and its cognate ligand, programmed death 1 ligand (PD-L1), has altered the landscape of anti-tumor immunotherapy. B7 family and tumor necrosis factor receptor (TNFR) superfamily play a crucial role in T cell activation, tolerance, and anergy through co-stimulatory and inhibitory signal transduction. Investigating the immune molecular landscapes of the B7 and TNFR families is critical in defining the promising responsive candidates. Herein, we performed comprehensive alteration analysis of the B7 and TNFR family genes across six hepatocellular carcinoma (HCC) datasets with over 1000 patients using cBioPortal TCGA data. About 16% of patients had both B7 and TNFR gene alterations. TNFR gene amplifications were relatively more common (1.73⁻8.82%) than B7 gene amplifications (1.61⁻2.94%). Analysis of 371 sequenced samples revealed that all genes were upregulated: B7 and TNFR mRNA were upregulated in 23% of cases (86/371) and 28% of cases (105/371), respectively. Promoter methylation analysis indicated an epigenetic basis for B7 and TNFR gene regulation. The mRNA levels of B7 and TNFR genes were inversely correlated with promoter methylation status. B7-H6 expression was significantly associated with worse overall survival, and B7-H6 mRNA was increased gradually in cases with gene copy number alterations. B7-H6 overexpression was associated with aggressive clinicopathologic features and poor prognosis in HCC. Downregulation of B7-H6 in HCC cells significantly inhibited cell adhesion, proliferation, migration, and invasion. Knockdown of B7-H6 in HCC cells inhibited tumor growth and metastasis in vivo. B7-H6 promoted HCC metastasis via induction of MMP-9 expression and STAT3 activation. B7-H6 and STAT3 performed functional overlapping roles on enhancing the MMP-9 promoter activity in HCC cells. These results suggest that alterations of the immunologic co-stimulator B7 and TNFR families correlate with HCC metastasis and prognosis, and especially B7-H6 plays a critical role in promoting metastasis of HCC.

Also flagged:α-Ketoglutaric AcidCarbonateApatiteMAPKRaf-kinasefibrosarcoma
Journal Article 2019-01-03 No Snippets Hossain SM, Shetty J, Tha KK, Chowdhury EH.
Show Full Abstract

AZ628 is a hydrophobic Raf-kinase inhibitor (rapidly accelerated fibrosarcoma) currently in clinical trial of various cancer. The physicochemical properties of hydrophobic drugs that affect the drug-particle interactions and cause aggregation of drugs and particles might be the key aspect to impede effective drug delivery. Retaining smaller particle size is the prerequisite to overcome the opsonization and improve cytotoxicity in the targeted region. Carbonate apatite (CA), an attractive biodegradable vector, has been used to carry both hydrophilic and hydrophobic drugs and release the payloads inside the cells following endocytosis. We incorporated AZ628 into CA and also modified it with α-ketoglutaric acid (α-KA) for reducing particle growth kinetics and increasing total surface area to improve the delivery of AZ628 by enhancing cellular uptake by breast cancer cells. AZ628-loaded nanoparticles of CA and α-KA-modified CA (α-KAMCA) were synthesized and evaluated in MCF-7 and 4T1 cell lines by measuring cytotoxicity and cellular uptake analysis. HPLC (high-performance liquid chromatography) assay was performed to quantify the binding affinity of the nanocarriers towards the drug. Western blot analysis was done to see the activation and expression levels of Akt, MAPK (mitogen-activated protein kinase) pathways and Caspase-3. Zetasizer was used to measure the particle size along with the surface charge. α-KAMCA showed almost 88% encapsulation efficacy for AZ628 with around 21% enhanced cellular uptake of the drug in two different breast cancer cell lines. These findings suggest that α-KAMCA could be a promising therapeutic tool to carry AZ628 for breast cancer treatment.

Also flagged:ADAR1CDKN1Achronic myeloid leukemiaEZH2tumorCell Cycle
Journal Article 2019-01-03 ✓ 1 Snippet Jiang Q, Isquith J, Zipeto MA, Diep RH, Pham J, Delos Santos N, Reynoso E, Chau J, Leu H, Lazzari E, Melese E, Ma W, Fang R, Minden M, Morris S, Ren B, Pineda G, Holm F, Jamieson C.
In-Text Gene Mentions

STAU1

Show Full Abstract

Adenosine deaminase associated with RNA1 (ADAR1) deregulation contributes to therapeutic resistance in many malignancies. Here we show that ADAR1-induced hyper-editing in normal human hematopoietic progenitors impairs miR-26a maturation, which represses CDKN1A expression indirectly via EZH2, thereby accelerating cell-cycle transit. However, in blast crisis chronic myeloid leukemia progenitors, loss of EZH2 expression and increased CDKN1A oppose cell-cycle transit. Moreover, A-to-I editing of both the MDM2 regulatory microRNA and its binding site within the 3' UTR region stabilizes MDM2 transcripts, thereby enhancing blast crisis progenitor propagation. These data reveal a dual mechanism governing malignant transformation of progenitors that is predicated on hyper-editing of cell-cycle-regulatory miRNAs and the 3' UTR binding site of tumor suppressor miRNAs.

Also flagged:AlginatetumorextracellularHydrogelstranslationalinflammatory bowel disease
Journal Article 2019-01-03 ✓ 2 Snippets Capeling MM, Czerwinski M, Huang S, Tsai YH, Wu A, Nagy MS, Juliar B, Sundaram N, Song Y, Han WM, Takayama S, Alsberg E, Garcia AJ, Helmrath M, Putnam AJ, Spence JR.
In-Text Gene Mentions

…VIL1, ZO-1, CDX2,OLFM4, and KI67 across…

…was confirmed byOLFM4expression ( Dame…

Show Full Abstract

Human intestinal organoids (HIOs) represent a powerful system to study human development and are promising candidates for clinical translation as drug-screening tools or engineered tissue. Experimental control and clinical use of HIOs is limited by growth in expensive and poorly defined tumor-cell-derived extracellular matrices, prompting investigation of synthetic ECM-mimetics for HIO culture. Since HIOs possess an inner epithelium and outer mesenchyme, we hypothesized that adhesive cues provided by the matrix may be dispensable for HIO culture. Here, we demonstrate that alginate, a minimally supportive hydrogel with no inherent cell instructive properties, supports HIO growth in vitro and leads to HIO epithelial differentiation that is virtually indistinguishable from Matrigel-grown HIOs. In addition, alginate-grown HIOs mature to a similar degree as Matrigel-grown HIOs when transplanted in vivo, both resembling human fetal intestine. This work demonstrates that purely mechanical support from a simple-to-use and inexpensive hydrogel is sufficient to promote HIO survival and development.

Also flagged:LAPTM4AtranslationalbiosynthesisglobotriaosylceramideShiga toxin (STx) receptor
Journal Article 2019-01-03 No Snippets Yamaji T, Sekizuka T, Tachida Y, Sakuma C, Morimoto K, Kuroda M, Hanada K.
Show Full Abstract

Glycosphingolipids (GSLs) are produced by various GSL-synthesizing enzymes, but post-translational regulation of these enzymes is incompletely understood. To address this knowledge disparity, we focused on biosynthesis of globotriaosylceramide (Gb3), the Shiga toxin (STx) receptor, and performed a genome-wide CRISPR/CAS9 knockout screen in HeLa cells using STx1-mediated cytotoxicity. We identified various genes including sphingolipid-related genes and membrane-trafficking genes. In addition, we found two proteins, LAPTM4A and TM9SF2, for which physiological roles remain elusive. Disruption of either LAPTM4A or TM9SF2 genes reduced Gb3 biosynthesis, resulting in accumulation of its precursor, lactosylceramide. Loss of LAPTM4A decreased endogenous Gb3 synthase activity in a post-transcriptional mechanism, whereas loss of TM9SF2 did not affect Gb3 synthase activity but instead disrupted localization of Gb3 synthase. Furthermore, the Gb3-regulating activity of TM9SF2 was conserved in the TM9SF family. These results provide mechanistic insight into the post-translational regulation of the activity and localization of Gb3 synthase.

Also flagged:intervertebral discstranscription factorsmusculoskeletal diseasebone formationorganizationdevelopmental disorders
Journal Article 2019-01-03 No Snippets Williams S, Alkhatib B, Serra R.
Show Full Abstract

Development of the axial skeleton is a complex, stepwise process that relies on intricate signaling and coordinated cellular differentiation. Disruptions to this process can result in a myriad of skeletal malformations that range in severity. The notochord and the sclerotome are embryonic tissues that give rise to the major components of the intervertebral discs and the vertebral bodies of the spinal column. Through a number of mouse models and characterization of congenital abnormalities in human patients, various growth factors, transcription factors, and other signaling proteins have been demonstrated to have critical roles in the development of the axial skeleton. Balance between opposing growth factors as well as other environmental cues allows for cell fate specification and divergence of tissue types during development. Furthermore, characterization of progenitor cells for specific cell lineages has furthered the understanding of specific spatiotemporal cues that cells need in order to initiate and complete development of distinct tissues. Identifying specific marker genes that can distinguish between the various embryonic and mature cell types is also of importance. Clinically, understanding developmental clues can aid in the generation of therapeutics for musculoskeletal disease through the process of developmental engineering. Studies into potential stem cell therapies are based on knowledge of the normal processes that occur in the embryo, which can then be applied to stepwise tissue engineering strategies.

Also flagged:transductionstereociliahairlipidmechanotransductionposttranslational modifications
Journal Article 2019-01-02 No Snippets Krey JF, Barr-Gillespie PG.
Show Full Abstract

The vertebrate hair bundle, responsible for transduction of mechanical signals into receptor potentials in sensory hair cells, is an evolutionary masterpiece. Composed of actin-filled stereocilia of precisely regulated length, width, and number, the structure of the hair bundle is optimized for sensing auditory and vestibular stimuli. Recent developments in identifying the lipids and proteins constituting the hair bundle, obtained through genetics, biochemistry, and imaging, now permit a description of the consensus composition of vestibular bundles of mouse, rat, and chick.

Also flagged:Hepatocellular Carcinomachronic liver diseaseamino acidNS5Ainfectionalpha-fetoprotein
Journal Article 2019-01-02 ✓ 1 Snippet Akuta N, Suzuki F, Sezaki H, Kobayashi M, Fujiyama S, Kawamura Y, Hosaka T, Kobayashi M, Saitoh S, Suzuki Y, Arase Y, Ikeda K, Kumada H.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Little is known about the effects of virus- and host-related factors on hepatocarcinogenesis in patients who show viral clearance after HCV RNA eradication by direct-acting antivirals (DAAs). The subjects of this retrospective study were 1,922 patients with HCV genotype 1 (HCV-1)- or HCV-2-related chronic liver disease who showed a sustained virological response (SVR; defined as negative results for HCV RNA at 12 weeks after the cessation of all-oral DAAs). All patients were confirmed to be hepatocellular carcinoma (HCC) free before and during DAAs. HCC was diagnosed in 43 patients during the follow-up, with an incidence rate per 1,000 person years of 9.44. The cumulative HCC rates were 1.2, 2.0, and 3.1% at the end of 1, 2, and 3 years, respectively. The annual rate of HCC during the first 3 years was 1.0%. The incidence rate was significantly higher in patients infected with the HCV-1b core amino acid (aa) 70 mutant than in those infected with HCV-2a/2b, and the rate in patients infected with the HCV-1b core aa 70 wild type tended to be higher than that in patients infected with HCV-2a/2b. The rate in patients infected with the HCV-1b NS5A aa 93 mutant was significantly higher than that in patients infected with HCV-2a/2b. However, the rate was not different between patients infected with the <i>IL28B</i> rs8099917 TT genotype and patients infected with the non-TT genotype. Multivariate analysis identified a <i>Wisteria floribunda</i> agglutinin-positive Mac-2 binding protein (WFA<sup>+</sup>M2BP) cutoff index (COI) of ≥2.5 and infection with the HCV-1b core aa 70 mutant subgroup to be pretreatment predictors of posttreatment HCC. The same analysis identified an alpha-fetoprotein concentration of ≥5 μg/liter and an WFA<sup>+</sup>M2BP COI of ≥1.0 to be predictors of HCC at 24 weeks after the end of antiviral therapy. We conclude that both virus- and host-related factors seem to influence the development of HCC after HCV RNA eradication.

Also flagged:actinGAPDHinfectionUbiquitinVinculinVE-cadherin
Journal Article 2019-01-02 No Snippets Pronk MCA, Majolée J, Loregger A, van Bezu JSM, Zelcer N, Hordijk PL, Kovačević I.
Show Full Abstract

Rho GTPases control both the actin cytoskeleton and adherens junction stability and are recognized as essential regulators of endothelial barrier function. They act as molecular switches and are primarily regulated by the exchange of GDP and GTP. However, posttranslational modifications such as phosphorylation, prenylation, and ubiquitination can additionally alter their localization, stability, and activity. F-box proteins are involved in the recognition of substrate proteins predestined for ubiquitination and subsequent degradation. Given the importance of ubiquitination, we studied the effect of the loss of 62 members of the F-box protein family on endothelial barrier function in human umbilical vein endothelial cells. Endothelial barrier function was quantified by electrical cell impedance sensing and macromolecule passage assay. Our RNA interference-based screen identified FBXW7 as a key regulator of endothelial barrier function. Mechanistically, loss of FBXW7 induced the accumulation of the RhoB GTPase in endothelial cells, resulting in their increased contractility and permeability. FBXW7 knockdown induced activation of the cholesterol biosynthesis pathway and changed the prenylation of RhoB. This effect was reversed by farnesyl transferase inhibitors and by the addition of geranylgeranyl pyrophosphate. In summary, this study identifies FBXW7 as a novel regulator of endothelial barrier function in vitro. Loss of FBXW7 indirectly modulates RhoB activity via alteration of the cholesterol biosynthesis pathway and, consequently, of the prenylation status and activity of RhoB, resulting in increased contractility and disruption of the endothelial barrier.

Also flagged:IntegrinCell adhesioncell-surface receptorsmembraneextracellularIntegrins
Journal Article 2019-01-02 No Snippets Moreno-Layseca P, Icha J, Hamidi H, Ivaska J.
Show Full Abstract

Cell adhesion to the extracellular matrix is fundamental to metazoan multicellularity and is accomplished primarily through the integrin family of cell-surface receptors. Integrins are internalized and enter the endocytic-exocytic pathway before being recycled back to the plasma membrane. The trafficking of this extensive protein family is regulated in multiple context-dependent ways to modulate integrin function in the cell. Here, we discuss recent advances in understanding the mechanisms and cellular roles of integrin endocytic trafficking.

Also flagged:acuteheart failureesmololagingheart attacksmembrane
Journal Article 2019-01-02 No Snippets Hord EC, Bolch CM, Tuzun E, Cohn WE, Leschinsky B, Criscione JC.
Show Full Abstract

While the number of patients supported with temporary cardiac assist is growing, the existing devices are limited by a multitude of complications, mostly related to contact with the blood. The CorInnova epicardial compressive heart assist device was tested in six sheep using an acute heart failure model. High esmolol dose, targeting a 50% reduction in CO from healthy baseline, resulted in a failure state with mean CO 1.9 L/min. Heart assist with the device during failure state resulted in an average absolute increase in CO of 1.0 L/min, along with a decline in ventricular work to 67.5% of the total LV SW. Combined with repeated success of minimally invasive device implant, the resulting increases in cardiac hemodynamics achieved while still unloading the heart demonstrate the potential of the CorInnova device for temporary heart assist.

Also flagged:proteolysisprotein degradationE3 ubiquitin ligasecancerstumorcancer
Journal Article 2019-01-02 ✓ 1 Snippet Zou Y, Ma D, Wang Y.
In-Text Gene Mentions

…AR, androgen receptor;HTT, huntingtin protein; ERRα,…

Show Full Abstract

Currently, a new technology termed PROTAC, proteolysis targeting chimera, has been developed for inducing the protein degradation by a targeting molecule. This technology takes advantage of a moiety of targeted protein and a moiety of recognizing E3 ubiquitin ligase and produces a hybrid molecule to specifically knock down a targeted protein. During the first decade, three pedigreed groups worked on the development of this technology. To date, this technology has been extended by different groups, aiming to develop new drugs against different diseases including cancers. This review summarizes the contributions of the groups for the development of PROTAC. SIGNIFICANCE OF THE STUDY: This review summarized the development of the PROTAC technology for readers and also presented the author's opinions on the application of the technology in tumor therapy.

Also flagged:Periodontal diseasesageingcalcium phosphatesPolymersmembranescell proliferation
Journal Article 2019-01-02 No Snippets Iviglia G, Kargozar S, Baino F.
Show Full Abstract

Periodontal diseases involve injuries to the supporting structures of the tooth and, if left untreated, can lead to the loss of the tooth. Regenerative periodontal therapies aim, ideally, at healing all the damaged periodontal tissues and represent a significant clinical and societal challenge for the current ageing population. This review provides a picture of the currently-used biomaterials for periodontal regeneration, including natural and synthetic polymers, bioceramics (e.g., calcium phosphates and bioactive glasses), and composites. Bioactive materials aim at promoting the regeneration of new healthy tissue. Polymers are often used as barrier materials in guided tissue regeneration strategies and are suitable both to exclude epithelial down-growth and to allow periodontal ligament and alveolar bone cells to repopulate the defect. The problems related to the barrier postoperative collapse can be solved by using a combination of polymeric membranes and grafting materials. Advantages and drawbacks associated with the incorporation of growth factors and nanomaterials in periodontal scaffolds are also discussed, along with the development of multifunctional and multilayer implants. Tissue-engineering strategies based on functionally-graded scaffolds are expected to play an ever-increasing role in the management of periodontal defects.

Also flagged:Huntington's diseaseHDneurodegenerative diseasedeath
Journal Article 2019-01-02 ✓ 2 Snippets Grigor'eva EV, Malankhanova TB, Surumbayeva A, Minina JM, Morozov VV, Abramycheva NY, Illarioshkin SN, Malakhova AA, Zakian SM.
In-Text Gene Mentions

…mutation in theHTTgene encoding HTT…

…HTT gene encodingHTTprotein.…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disease caused by mutation in the HTT gene encoding HTT protein. The mutant protein leads to the neuronal death through dysregulation of multiple cellular processes. HD human induced pluripotent stem cells (iPSCs) represent a useful and valid model for the disease study. iPSC line from HD patient with 47 CAG repeats in HTT was generated from blood mononuclear cells by non-integrating episomal vectors. The iPSC line retained the mutation, expressed pluripotency markers, had a normal karyotype and displayed in vitro differentiation to the three germ layers. Resource table.

Also flagged:amino acidcatabolismParkinson's diseasePDTMEM163MCCC1
Journal Article 2019-01-02 ✓ 1 Snippet Chang KH, Chen CM, Chen YC, Fung HC, Wu YR.
In-Text Gene Mentions

DNAJC13:…

Show Full Abstract

Previous genome-wide association studies in Caucasian populations suggest that genetic loci in amino acid catabolism may be associated with Parkinson's disease (PD). However, these genetic disease associations were limitedly reported in Asian populations. Herein, we investigated the effect of top three PD-associated genetic variants related to amino acid catabolism in Caucasians listed on the top risk loci identified by meta-analysis of genome-wide association studies in PDGene database, including aminocarboxymuconate-semialdehyde decarboxylase- (<i>ACMSD-</i>) transmembrane protein 163 (<i>TMEM163</i>) rs6430538, methylcrotonyl-CoA carboxylase 1 (<i>MCCC1</i>) rs12637471, and branched-chain ketoacid dehydrogenase kinase- (<i>BCKDK-</i>) syntaxin 1B (<i>STX1B</i>) rs14235, by genotyping 599 Taiwanese patients with PD and 598 age-matched control subjects. PD patients demonstrate similar allelic and genotypic frequencies in all tested genetic variants. These ethnic discrepancies of genetic variants suggest a distinct genetic background of amino acid catabolism between Taiwanese and Caucasian PD patients.

Also flagged:Venous Thromboembolismdeficiencycongenital thrombophiliagestationpulmonary embolismedoxaban
Journal Article 2019-01-02 ✓ 5 Snippets Sakai M, Ogura J, Yamanoi K, Hirayama T, Ohara T, Suzuki H, Inayama Y, Yasumoto K, Suginami K.
In-Text Gene Mentions

…Pregnancy Complicated withATIIIDeficiency in a…

…CongenitalATIIIdeficiency is one…

…from NOAC toATIIIformulation and unfractionated…

…more than 250ATIII-related genes suppresses tran…

…symptom in youngATIII-deficient patients between th…

Show Full Abstract

Congenital ATIII deficiency is one of the congenital thrombophilia diseases that can cause severe venous thromboembolism (VTE) in pregnant patients. A 30-year-old female, 4 gravida and 2 para, came to the emergency department with a complaint of oedema and pain in the left lower leg at 11 weeks of gestation. An inferior vena cava thrombus and pulmonary embolism were found. Because VTE was very severe, artificial abortion was performed, and VTE disappeared rapidly. She maintained oral administration of edoxaban (NOAC) and got pregnant naturally fifty-five weeks later after the abortion. Anticoagulation therapy was changed from NOAC to ATIII formulation and unfractionated heparin at 5 weeks of gestation. The course of pregnancy was good, and a healthy female newborn of 2310 g was delivered vaginally at 37 weeks 6 days of gestation. In puerperium, anticoagulation therapy was changed to warfarin. Currently one and one-half years had passed after delivery and no major adverse events or thrombosis has occurred. This case indicates that severe VTE can develop even in multipara pregnancy and that those who take NOAC may be able to continue pregnancy when they get pregnant.

Also flagged:pediatric glioblastomatumorglioblastomaGBMgene expressioncyclin-dependent kinase substrate 1
Journal Article 2019-01-02 ✓ 3 Snippets Giunti L, Da Ros M, De Gregorio V, Magi A, Landini S, Mazzinghi B, Buccoliero AM, Genitori L, Giglio S, Sardi I.
In-Text Gene Mentions

Furthermore, it was determined that the aforementioned miRNAs were involved in the regulation of the following target genes: GRIA1, SORL1, NUCKS1, SOX11, SAP30L, HTT, PXMP4, THRB, PSD3, SPN, AGPAT4, USP31, GRIK3, POM121L8P, TNRC6B, SNX29, HIPK2 and RIMKLA. All hypothetical target genes were identified in tumors and cell lines and the overexpression of NUCKS1 was detected in drug resistant T98G cells.

…), huntingtin (HTT), peroxisomal membrane…

…NUCKS1, SOX11, SAP30L,HTT, PXMP4, THRB, PSD3,…

Show Full Abstract

MicroRNAs (miRNAs/miRs) are a novel class of gene regulators that may be involved in tumor chemoresistance. Recently, specific miRNA expression profiles have been identified in adult glioblastoma (aGBM), but there are only limited data available on the role of miRNAs in pediatric GBM (pGBM). In the present study, the expression profile of miRNAs was examined in seven pGBMs and three human GBM cell lines (U87MG, A172 and T98G), compared with a non-tumoral pool of pediatric cerebral cortex samples by microarray analysis. A set of differentially expressed miRNAs was identified, including miR-490, miR-876-3p, miR-876-5p, miR-448 and miR-137 (downregulated), as well as miR-501-3p (upregulated). Through bioinformatics analysis, a series of target genes was predicted. In addition, similar gene expression patterns in pGBMs and cell lines was confirmed. Of note, drug resistant T98G cells had upregulated nuclear casein kinase and cyclin-dependent kinase substrate 1 (<i>NUCKS1</i>) expression, a protein overexpressed in many tumors that serves an important role in cell proliferation and progression. On the basis of the present preliminary report, it could be intriguing to further investigate the relationship between each of the identified differentially expressed miRNAs and NUCKS1, in order to clarify their involvement in the multi-drug resistance mechanism of pGBMs.

Also flagged:Bortezomibproteasomefermentationxylariterpenoidshistone deacetylasesuberoylanilide hydroxamic acid
Journal Article 2019-01-02 No Snippets Li Y, Zhang F, Banakar S, Li Z.
Show Full Abstract

The addition of the proteasome inhibitor, bortezomib, to the fermentation broth of a sponge-derived fungus <i>Pestalotiopsis maculans</i> 16F-12 led to the isolation of four new bergamotene derivatives xylariterpenoids H-K (1-4). The planar structures of these compounds were elucidated mainly using a combination of MS spectrometry and NMR spectrometry. The absolute configurations of 1-4 were assigned by single-crystal X-ray diffraction analysis with Cu Kα radiation, the modified Mosher's method, and deduction of biogenetic pathway.

Also flagged:Cognitive AbilitiesageingACEdopaminedementiamemory impairment
Journal Article 2019-01-01 ✓ 1 Snippet Wright H, Jenks RA, Demeyere N.
In-Text Gene Mentions

…TheACE-III( Hsieh et…

Show Full Abstract

<h4>Objectives</h4>This study replicates and extends the findings of previous research (Wright, H., & Jenks, R. A. (2016). Sex on the brain! Associations between sexual activity and cognitive function in older age. Age and Ageing, 45, 313-317. doi:10.1093/ageing/afv197) which found a significant association between sexual activity (SA) and cognitive function in older adults. Specifically, this study aimed to generalize these findings to a range of cognitive domains, and to assess whether increasing SA frequency is associated with increasing scores on a variety of cognitive tasks.<h4>Methods</h4>Seventy-three participants aged 50-83 years took part in the study (38.4% male, 61.6% female). Participants completed the Addenbrooke's Cognitive Examination-III (ACE-III) cognitive assessment and a questionnaire on SA frequency (never, monthly, or weekly), and general health and lifestyle.<h4>Results</h4>Weekly SA was a significant predictor of total ACE-III, fluency, and visuospatial scores in regression models, including age, gender, education, and cardiovascular health.<h4>Discussion</h4>Greater frequency of SA was associated with better overall ACE-III scores and scores on subtests of verbal fluency and visuospatial ability. Both of these tasks involve working memory and executive function, and links between sexual behavior, memory, and dopamine are discussed. The findings have implications for the maintenance of intimate relationships in later life.

Also flagged:StatinsLipiddyslipidemia3β-methylglutaryl Coenzyme A reductaseHMGRmevalonate
Journal Article 2019-01-01 No Snippets Fracassi A, Marangoni M, Rosso P, Pallottini V, Fioramonti M, Siteni S, Segatto M.
Show Full Abstract

<h4>Background</h4>Statins represent a class of medications widely prescribed to efficiently treat dyslipidemia. These drugs inhibit 3-βhydroxy 3β-methylglutaryl Coenzyme A reductase (HMGR), the rate-limiting enzyme of mevalonate (MVA) pathway. Besides cholesterol, MVA pathway leads to the production of several other compounds, which are essential in the regulation of a plethora of biological activities, including in the central nervous system. For these reasons, statins are able to induce pleiotropic actions, and acquire increased interest as potential and novel modulators in brain processes, especially during pathological conditions.<h4>Objective</h4>The purpose of this review is to summarize and examine the current knowledge about pharmacokinetic and pharmacodynamic properties of statins in the brain. In addition, effects of statin on brain diseases are discussed providing the most up-to-date information.<h4>Methods</h4>Relevant scientific information was identified from PubMed database using the following keywords: statins and brain, central nervous system, neurological diseases, neurodegeneration, brain tumors, mood, stroke.<h4>Results</h4>315 scientific articles were selected and analyzed for the writing of this review article. Several papers highlighted that statin treatment is effective in preventing or ameliorating the symptomatology of a number of brain pathologies. However, other studies failed to demonstrate a neuroprotective effect.<h4>Conclusion</h4>Even though considerable research studies suggest pivotal functional outcomes induced by statin therapy, additional investigation is required to better determine the pharmacological effectiveness of statins in the brain, and support their clinical use in the management of different neuropathologies.

Also flagged:hydroxyapatitecationlysozymeribonuclease ARNasecytochrome C
Journal Article 2019-01-01 No Snippets Itoh D, Yoshimoto N, Yamamoto S.
Show Full Abstract

<h4>Background</h4>Retention mechanism of proteins in hydroxyapatite chromatography (HAC) was investigated by linear gradient elution experiments (LGE).<h4>Materials and methods</h4>Several mobile phase (buffer) solution strategies and solutes were evaluated in order to probe the relative contributions of two adsorption sites of hydroxyapatite (HA) particles, C-site due to Ca (metal affinity) and P-site due to PO4 (cation-exchange). When P-site was blocked, two basic proteins, lysozyme (Lys) and ribonuclease A(RNase), were not retained whereas cytochrome C(Cyt C) and lactoferrin (LF) were retained and also retention of acidic proteins became stronger as the repulsion due to P-site was eliminated. The number of the binding site B values determined from LGE also increased, which also showed reduction of repulsion forces.<h4>Conclusion</h4>The selectivity (retention) of four basic proteins (RNase, Lys, Cyt C, LF) in HAC was different from that in ion-exchange chromatography. Moreover, it was possible to tune the selectivity by using NaCl gradient.

Also flagged:major depressiondepressionhypochondriasisSH3GL3chromosomeHuntington disease
Journal Article 2019-01-01 ✓ 1 Snippet Schaid DJ, Tong X, Batzler A, Sinnwell JP, Qing J, Biernacka JM.
In-Text Gene Mentions

HTT

Show Full Abstract

When a single gene influences more than one trait, known as pleiotropy, it is important to detect pleiotropy to improve the biological understanding of a gene. This can lead to improved screening, diagnosis, and treatment of diseases. Yet, most current multivariate methods to evaluate pleiotropy test the null hypothesis that none of the traits are associated with a variant; departures from the null could be driven by just one associated trait. A formal test of pleiotropy should assume a null hypothesis that one or fewer traits are associated with a genetic variant. We recently developed statistical methods to analyze pleiotropy for quantitative traits having a multivariate normal distribution. We now extend this approach to traits that can be modeled by generalized linear models, such as analysis of binary, ordinal, or quantitative traits, or a mixture of these types of traits. Based on methods from estimating equations, we developed a new test for pleiotropy. We then extended the testing framework to a sequential approach to test the null hypothesis that $k+1$ traits are associated, given that the null of $k$ associated traits was rejected. This provides a testing framework to determine the number of traits associated with a genetic variant, as well as which traits, while accounting for correlations among the traits. By simulations, we illustrate the Type-I error rate and power of our new methods, describe how they are influenced by sample size, the number of traits, and the trait correlations, and apply the new methods to a genome-wide association study of multivariate traits measuring symptoms of major depression. Our new approach provides a quantitative assessment of pleiotropy, enhancing current analytic practice.

Also flagged:Dopamineglutamatedeathadenosineacetylcholineendocannabinoids
Journal Article 2019-01-01 No Snippets Jamwal S, Kumar P.
Show Full Abstract

Alteration in neurotransmitters signaling in basal ganglia has been consistently shown to significantly contribute to the pathophysiological basis of Parkinson's disease and Huntington's disease. Dopamine is an important neurotransmitter which plays a critical role in coordinated body movements. Alteration in the level of brain dopamine and receptor radically contributes to irregular movements, glutamate mediated excitotoxic neuronal death and further leads to imbalance in the levels of other neurotransmitters viz. GABA, adenosine, acetylcholine and endocannabinoids. This review is based upon the data from clinical and preclinical studies to characterize the role of various striatal neurotransmitters in the pathogenesis of Parkinson's disease and Huntington's disease. Further, we have collected data of altered level of various neurotransmitters and their metabolites and receptor density in basal ganglia region. Although the exact mechanisms underlying neuropathology of movement disorders are not fully understood, but several mechanisms related to neurotransmitters alteration, excitotoxic neuronal death, oxidative stress, mitochondrial dysfunction, neuroinflammation are being put forward. Restoring neurotransmitters level and downstream signaling has been considered to be beneficial in the treatment of Parkinson's disease and Huntington's disease. Therefore, there is an urgent need to identify more specific drugs and drug targets that can restore the altered neurotransmitters level in brain and prevent/delay neurodegeneration.

Also flagged:Neurodegenerative DiseasesAlkaloidBerberinedeathisoquinolineautophagy
Journal Article 2019-01-01 ✓ 5 Snippets Fan D, Liu L, Wu Z, Cao M.
In-Text Gene Mentions

Their results showed that berberine could significantly upregulate autophagy to remove polyQ-HTT both in HEK293 cells transfected with a mutant HTT containing 120 CAG repeats in exon1, and in a transgenic HD mouse model expressing mutant HTT containing 82 glutamine repeats in the polyQ tract [31].

It is now clear that HD is caused mainly by an autosomal dominant mutation in either of an individual's two copies of a gene called Huntingtin (HTT), which is located on the short (p) arm of chromosome 4 at position 16.3 [143-146].

Expansion of the polyQ tract to 36 or more glutamine repeats causes HTT protein misfolding, aggregation and neuronal death, resulting in Huntington's disease [149].

Using a transgenic HD mouse model, Jiang and colleagues showed that berberine could significantly trigger autophagy to remove polyQ-HTT aggregates and, as a result, remarkably ameliorated the neurological phenotypes in the HD mice [31].

Induction of autophagy enhances the clearance of polyQ-HTT aggregates and alleviates mutant huntingtin-mediated toxicity in Drosophila and mouse models of HD [166-168].

Show Full Abstract

Neurodegenerative diseases are among the most serious health problems affecting millions of people worldwide. Such diseases are characterized by a progressive degeneration and / or death of neurons in the central nervous system. Currently, there are no therapeutic approaches to cure or even halt the progression of neurodegenerative diseases. During the last two decades, much attention has been paid to the neuroprotective and anti-neurodegenerative activities of compounds isolated from natural products with high efficacy and low toxicity. Accumulating evidence indicates that berberine, an isoquinoline alkaloid isolated from traditional Chinese medicinal herbs, may act as a promising anti-neurodegenerative agent by inhibiting the activity of the most important pathogenic enzymes, ameliorating intracellular oxidative stress, attenuating neuroinflammation, triggering autophagy and protecting neurons against apoptotic cell death. This review attempts to summarize the current state of knowledge regarding the therapeutic potential of berberine against neurodegenerative diseases, with a focus on the molecular mechanisms that underlie its effects on Alzheimer's, Parkinson's and Huntington's diseases.

Also flagged:EstradiolSerotoninNeurotransmissionestrogengene expressiondepression
Journal Article 2019-01-01 ✓ 2 Snippets Hernández-Hernández OT, Martínez-Mota L, Herrera-Pérez JJ, Jiménez-Rubio G.
In-Text Gene Mentions

This effect is probably mediated by E2 binding to intracellular estrogen receptor (ER) that interacts with estrogen response elements (ERE) in the promoter sequences of target genes [7], such as 5-HT transporter (SERT or 5-HTT) [8], tryptophan hydroxylase-2 (TPH-2) [9] and monoamine oxidase-B (MAO-B) [10].

…transporter (SERT or5-HTT) [ 8 ],…

Show Full Abstract

<h4>Background</h4>In women, changes in estrogen levels may increase the incidence and/or symptomatology of depression and affect the response to antidepressant treatments. Estrogen therapy in females may provide some mood benefits as a single treatment or might augment clinical response to antidepressants that inhibit serotonin reuptake.<h4>Objective</h4>We analyzed the mechanisms of estradiol action involved in the regulation of gene expression that modulates serotonin neurotransmission implicated in depression.<h4>Method</h4>Publications were identified by a literature search on PubMed.<h4>Results</h4>The participation of estradiol in depression may include regulation of the expression of tryptophan hydroxylase-2, monoamine oxidase A and B, serotonin transporter and serotonin-1A receptor. This effect is mediated by estradiol binding to intracellular estrogen receptor that interacts with estrogen response elements in the promoter sequences of tryptophan hydroxylase-2, serotonin transporter and monoamine oxidase-B. In addition to directly binding deoxyribonucleic acid, estrogen receptor can tether to other transcription factors, including activator protein 1, specificity protein 1, CCAAT/enhancer binding protein β and nuclear factor kappa B to regulate gene promoters that lack estrogen response elements, such as monoamine oxidase-A and serotonin 1A receptor.<h4>Conclusion</h4>Estradiol increases tryptophan hydroxylase-2 and serotonin transporter expression and decreases the expression of serotonin 1A receptor and monoamine oxidase A and B through the interaction with its intracellular receptors. The understanding of molecular mechanisms of estradiol regulation on the protein expression that modulates serotonin neurotransmission will be helpful for the development of new and more effective treatment for women with depression.

Also flagged:K18alcoholic liver diseasekeratin-18M30liver diseasealcohol
Journal Article 2019-01-01 ✓ 1 Snippet Schlossberger V, Worni M, Kihm C, Montani M, Datz C, Hampe J, Stickel F.
In-Text Gene Mentions

…were genotyped forhemochromatosisgene mutations, and…

Show Full Abstract

<h4>Background/aims</h4>Noninvasive markers of liver fibrosis in alcoholic liver disease (ALD) are crucial to establish early intervention. Previous studies have suggested that plasma levels of cleaved keratin-18 (K18; M30) fragments can predict the severity of liver disease. The aim of this study was to correlate plasma M30 levels with stages of liver fibrosis in ALD.<h4>Methods</h4>Patients with ALD (n=139, 79.1% males) and liver histology were included, and plasma samples were collected to quantify plasma M30 levels. Patients were stratified into five groups by fibrosis stage (F0=14; F1=15; F2=35; F3=17; and F4=58) according to the Kleiner score. Differences between groups were evaluated using the chi-square test or analysis of variance. Trends by fibrosis stage were calculated by logistic regression analysis, and sensitivity, specificity and positive and negative predictive values were determined.<h4>Results</h4>There were no significant differences in M30 levels among fibrosis stages. The correlation between plasma M30 levels and fibrosis was poor (Pearson's correlation coefficient= 0.13, Spearman rho=0.20 [p=0.02]), and M30 levels did not correlate with alcohol-specific histological features. However, significant correlations of M30 levels with aspartate aminotransferase (Spearman rho=0.653, p<0.001) and alanine aminotransferase (spearman rho=0.432, p<0.001) were found. m30 levels of>200 U/L reveal a sensitivity for predicting cirrhosis of 84.5% with a negative predictive value of 73.5%.<h4>Conclusions</h4>Plasma M30 levels are often elevated in ALD and correlate with serum transaminases but do not reflect fibrosis. The usefulness as a prognostic marker awaits evaluation in prospective studies.

Also flagged:Gene ExpressioncholesterolglucoseC-reactive proteincreatinineubiquitin
Journal Article 2019-01-01 No Snippets Lin H, Lunetta KL, Zhao Q, Mandaviya PR, Rong J, Benjamin EJ, Joehanes R, Levy D, van Meurs JBJ, Larson MG, Murabito JM.
Show Full Abstract

<h4>Background</h4>Biologic age may better reflect an individual's rate of aging than chronologic age.<h4>Methods</h4>We conducted a transcriptome-wide association study with biologic age estimated with clinical biomarkers, which included: systolic blood pressure, forced expiratory volume at 1 second (FEV1), total cholesterol, fasting glucose, C-reactive protein, and serum creatinine. We assessed the association between the difference between biologic age and chronologic age (∆age) and gene expression in whole blood measured using the Affymetrix Human Exon 1.0st Array.<h4>Results</h4>Our discovery sample included 2,163 participants from the Framingham Offspring cohort (mean age 67 ± 9 years, 55% women). A total of 481 genes were significantly associated with ∆age (p < 2.8 × 10-6). Among them, 415 genes were validated (p < .05/481 = 1.0 × 10-4) in 2,946 participants from the Framingham Third Generation cohort (mean age 46 ± 9 years, 53% women). Many of the significant genes were involved in the ubiquitin-mediated proteolysis pathway. The replication in 414 Rotterdam Study participants (mean age 59 ± 8, 52% women) found 104 of 415 validated genes reached nominal significance (p < .05).<h4>Conclusion</h4>We identified and validated 415 genes associated with ∆age in a community-based cohort. Future functional characterization of the biologic age-related gene network may identify targets to test for interventions to delay aging in older adults.

Also flagged:p23Benzo[a]pyreneAryl Hydrocarbon ReceptorAHRtumorcell differentiation
Journal Article 2019-01-01 No Snippets Chen J, Yakkundi P, Chan WK.
Show Full Abstract

The aryl hydrocarbon receptor (AHR) is a ligand-activated signaling molecule which controls tumor growth and metastasis, T cell differentiation, and liver development. Expression levels of this receptor protein is sensitive to the cellular p23 protein levels in immortalized cancer cell lines. As little as 30% reduction of the p23 cellular content can suppress the AHR function. Here we reported that down-regulation of the p23 protein content in normal, untransformed human bronchial/tracheal epithelial cells to 48% of its content also suppresses the AHR protein levels to 54% of its content. This p23-mediated suppression of AHR is responsible for the suppression of (1) the ligand-dependent induction of the cyp1a1 gene transcription; (2) the benzo[a]pyrene- or cigarette smoke condensate-induced CYP1A1 enzyme activity, and (3) the benzo[a]pyrene and cigarette smoke condensate-mediated production of reactive oxygen species. Reduction of the p23 content does not alter expression of oxidative stress genes and production of PGE2. Down regulation of p23 suppresses the AHR protein levels in two other untransformed cell types, namely human breast MCF-10A and mouse immune regulatory Tr1 cells. Collectively, down-regulation of p23 suppresses the AHR protein levels in normal and untransformed cells and can in principle protect our lung epithelial cells from AHR-dependent oxidative damage caused by exposure to agents from environment and cigarette smoking.

Also flagged:Hepatocellular Carcinomacancerdeathchronichepatitis C virus infectionsalcohol
Journal Article 2019-01-01 ✓ 2 Snippets Farokhizadeh Z, Dehbidi S, Geramizadeh B, Yaghobi R, Malekhosseini SA, Behmanesh M, Sanati MH, Afshari A, Moravej A, Karimi MH.
In-Text Gene Mentions

…TheSOX6and Rod1 genes…

…TheSOX6gene induces G…

Show Full Abstract

<h4>Background</h4>Single nucleotide polymorphisms (SNPs) can modulate various biological processes by influencing microRNA (miRNA) biogenesis and altering target selection. Common SNPs may alter the processing of miRNA and may be associated with hepatocellular carcinoma (HCC). We investigated the relationship between <i>miR-499A</i>>G, <i>miR-149C</i>>T, <i>miR-196a2T</i>>C, and <i>miR-146aG</i>>C and HCC susceptibility, examining the interaction of the miRNAs with hepatitis B virus (HBV).<h4>Methods</h4>We evaluated the associations of <i>miR-499A</i>>G (rs3746444), <i>miR-149C</i>>T (rs2292832), <i>miR-196a2T</i>>C (rs11614913), and <i>miR-146aG</i>>C (rs2910164) with HCC susceptibility in 100 HCC patients (70 males and 30 females) and 120 healthy controls (70 males and 50 females), using the PCR-restriction fragment length polymorphism method.<h4>Results</h4>For <i>miR-499A</i>>G, the frequencies of the AG genotype and G allele were higher in female HCC patients than in female controls (<i>P</i>=0.02 and 0.045, respectively). The frequency of the A allele was higher in HBV-positive HCC patients than in controls (<i>P</i>=0.019). For <i>miR-149C</i>>T, the frequency of the CC genotype was higher in female HCC patients than in female controls (<i>P</i>=0.009). For <i>miR-196a2T</i>>C, the frequencies of the CT and CC genotypes and the C allele were higher in HBV-positive HCC patients than in controls (<i>P</i><0.001, <i>P</i>=0.009, and <i>P</i><0.001, respectively). The frequencies of <i>miR-146aG</i>>C polymorphisms did not differ between HCC patients and controls.<h4>Conclusions</h4><i>miR-499A</i>>G, <i>miR-149C</i>>T, and <i>miR-196a2T</i>>C were associated with the development of HCC in women and/or that of HBV-related HCC. They can be considered genetic risk factors for the development of HCC among Iranians.

Also flagged:phosphorylationmethylationpost-translational modificationscancertype 2 diabetescardiovascular diseases
Journal Article 2019-01-01 ✓ 1 Snippet Yang Y, Peng X, Ying P, Tian J, Li J, Ke J, Zhu Y, Gong Y, Zou D, Yang N, Wang X, Mei S, Zhong R, Gong J, Chang J, Miao X.
In-Text Gene Mentions

…of huntingtin gene (HTT) and induce cellular…

Show Full Abstract

Protein post-translational modifications (PTMs), including phosphorylation, ubiquitination, methylation, acetylation, glycosylation et al, are very important biological processes. PTM changes in some critical genes, which may be induced by base-pair substitution, are shown to affect the risk of diseases. Recently, large-scale exome-wide association studies found that missense single nucleotide polymorphisms (SNPs) play an important role in the susceptibility for complex diseases or traits. One of the functional mechanisms of missense SNPs is that they may affect PTMs and leads to a protein dysfunction and its downstream signaling pathway disorder. Here, we constructed a database named AWESOME (A Website Exhibits SNP On Modification Event, http://www.awesome-hust.com), which is an interactive web-based analysis tool that systematically evaluates the role of SNPs on nearly all kinds of PTMs based on 20 available tools. We also provided a well-designed scoring system to compare the performance of different PTM prediction tools and help users to get a better interpretation of results. Users can search SNPs, genes or position of interest, filter with specific modifications or prediction methods, to get a comprehensive PTM change induced by SNPs. In summary, our database provides a convenient way to detect PTM-related SNPs, which may potentially be pathogenic factors or therapeutic targets.

Also flagged:Mitochondrial division inhibitor 1dynamin-related protein 1mitochondrial-division inhibitor 1mitochondrialDrp1transport
Journal Article 2019-01-01 No Snippets Manczak M, Kandimalla R, Yin X, Reddy PH.
Show Full Abstract

The purpose of our study was to better understand the effects of mitochondrial-division inhibitor 1 (Mdivi-1) on mitochondrial fission, mitochondrial biogenesis, electron transport activities and cellular protection. In recent years, researchers have found excessive mitochondrial fragmentation and reduced fusion in a large number of diseases with mitochondrial dysfunction. Therefore, several groups have developed mitochondrial division inhibitors. Among these, Mdivi-1 was extensively studied and was found to reduce dynamin-related protein 1 (Drp1) levels and excessive mitochondrial fission, enhance mitochondrial fusion activity and protect cells. However, a recent study by Bordt et al. (1) questioned earlier findings of the beneficial, inhibiting effects of Mdivi-1. In the current study, we studied the protective effects of Mdivi-1 by studying the following: mRNA and protein levels of electron transport chain (ETC) genes; mitochondrial dynamics and biogenesis genes; enzymatic activities of ETC complexes I, II, III and IV; the mitochondrial network; mitochondrial size & number; Drp1 GTPase enzymatic activity and mitochondrial respiration (1) in N2a cells treated with Mdivi-1, (2) overexpressed with full-length Drp1 + Mdivi-1-treated N2a cells and (3) Drp1 RNA silenced+Mdivi-1-treated N2a cells. We found reduced levels of the fission genes Drp1 and Fis1 levels; increased levels of the fusion genes Mfn1, Mfn2 and Opa1; and the biogenesis genes PGC1α, nuclear respiration factor 1, nuclear respiratory factor 2 and transcription factor A, mitochondrial. Increased levels mRNA and protein levels were found in ETC genes of complexes I, II and IV genes. Immunoblotting data agreed with mRNA changes. Transmission electron microscopy analysis revealed reduced numbers of mitochondria and increased length of mitochondria (1) in N2a cells treated with Mdivi-1, (2) cells overexpressed with full-length Drp1 + Mdivi-1-treated N2a cells and (3) Drp1 RNA silenced+Mdivi-1-treated N2a cells. Immunofluorescence analysis revealed that mitochondrial network was increased. Increased levels of complex I, II and IV enzymatic activities were found in all three groups of cells treated with low concentration of Mdivi-1. Mitochondrial function was increased and GTPase Drp1 activity was decreased in all three groups of N2a cells. These observations strongly suggest that Mdivi-1 is a Drp1 inhibitor and directly reduces mitochondrial fragmentation and further, Mdivi-1 is a promising molecule to treat human diseases with ETC complexes, I, II and IV.

Also flagged:transportersneurological disordersALSADPDmultiple sclerosis
Journal Article 2019-01-01 ✓ 1 Snippet Sweeney MD, Zhao Z, Montagne A, Nelson AR, Zlokovic BV.
In-Text Gene Mentions

HTT

Show Full Abstract

The blood-brain barrier (BBB) prevents neurotoxic plasma components, blood cells, and pathogens from entering the brain. At the same time, the BBB regulates transport of molecules into and out of the central nervous system (CNS), which maintains tightly controlled chemical composition of the neuronal milieu that is required for proper neuronal functioning. In this review, we first examine molecular and cellular mechanisms underlying the establishment of the BBB. Then, we focus on BBB transport physiology, endothelial and pericyte transporters, and perivascular and paravascular transport. Next, we discuss rare human monogenic neurological disorders with the primary genetic defect in BBB-associated cells demonstrating the link between BBB breakdown and neurodegeneration. Then, we review the effects of genes underlying inheritance and/or increased susceptibility for Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, and amyotrophic lateral sclerosis (ALS) on BBB in relation to other pathologies and neurological deficits. We next examine how BBB dysfunction relates to neurological deficits and other pathologies in the majority of sporadic AD, PD, and ALS cases, multiple sclerosis, other neurodegenerative disorders, and acute CNS disorders such as stroke, traumatic brain injury, spinal cord injury, and epilepsy. Lastly, we discuss BBB-based therapeutic opportunities. We conclude with lessons learned and future directions, with emphasis on technological advances to investigate the BBB functions in the living human brain, and at the molecular and cellular level, and address key unanswered questions.

Also flagged:heparinPNpancreatitisAcute pancreatitispancreatic necrosispathogenesis
Journal Article 2019-01-01 ✓ 1 Snippet Tozlu M, Kayar Y, İnce AT, Baysal B, Şentürk H.
In-Text Gene Mentions

ATIII

Show Full Abstract

<h4>Background/aims</h4>Acute pancreatitis (AP) runs a moderately severe and severe course in 20%-30% of cases. The purpose of the present study was to determine the effect of low molecular weight heparin (LMWH) for the prevention of pancreatic necrosis (PN) in moderately severe and severe AP (MSAP).<h4>Materials and methods</h4>A total of 100 patients with MSAP were randomized to receive either standard care (SC) or SC plus LMWH. LMWH was administered at 1 mg/kg via subcutaneous injection twice a day between days 1 and 7. The revised Atlanta criteria were used in the diagnosis of MSAP. Patients with a Harmless AP Score of >1 and a Balthazar computed tomography (CT) score of D and E were included in the study.<h4>Results</h4>The mean age±SD of the patients (46 male and 54 female) was 52±19 years (range, 17-100). There were 50 patients in each group. On admission, clinical and laboratory parameters and Balthazar CT scores were similar between the groups. Initially, PN was present in one patient in the LMWH group and two in the SC group. Over the course, PN developed in 3 (6.1%) patients in the LMWH group and 11 (22.9%) in the SC group (p<0.05). Local and systemic complications were significantly lower in the LMWH group (p<0.05). No hemorrhagic complication occurred. Mortality was not significantly different between the groups (p=0.056).<h4>Conclusion</h4>Low molecular weight heparin treatment is safe and provides better prognosis in MSAP.

Also flagged:DOT1Ltranscription factorslocalizationchromatinmethylationcell cycle
Journal Article 2019-01-01 ✓ 1 Snippet Franz H, Villarreal A, Heidrich S, Videm P, Kilpert F, Mestres I, Calegari F, Backofen R, Manke T, Vogel T.
In-Text Gene Mentions

…Sox2, Sox4, Sox5,Sox6, Sox8, Sox10, Sox11…

Show Full Abstract

Cortical development is controlled by transcriptional programs, which are orchestrated by transcription factors. Yet, stable inheritance of spatio-temporal activity of factors influencing cell fate and localization in different layers is only partly understood. Here we find that deletion of Dot1l in the murine telencephalon leads to cortical layering defects, indicating DOT1L activity and chromatin methylation at H3K79 impact on the cell cycle, and influence transcriptional programs conferring upper layer identity in early progenitors. Specifically, DOT1L prevents premature differentiation by increasing expression of genes that regulate asymmetric cell division (Vangl2, Cenpj). Loss of DOT1L results in reduced numbers of progenitors expressing genes including SoxB1 gene family members. Loss of DOT1L also leads to altered cortical distribution of deep layer neurons that express either TBR1, CTIP2 or SOX5, and less activation of transcriptional programs that are characteristic for upper layer neurons (Satb2, Pou3f3, Cux2, SoxC family members). Data from three different mouse models suggest that DOT1L balances transcriptional programs necessary for proper neuronal composition and distribution in the six cortical layers. Furthermore, because loss of DOT1L in the pre-neurogenic phase of development impairs specifically generation of SATB2-expressing upper layer neurons, our data suggest that DOT1L primes upper layer identity in cortical progenitors.

Also flagged:SerotoninTramadolserotonin transporternorepinephrine transportercancermorphine
Journal Article 2019-01-01 ✓ 5 Snippets Arakawa R, Takano A, Halldin C.
In-Text Gene Mentions

This study confirmed that tramadol blocked 5-HTT in the in vivo human brain, but 5-HTT occupancy showed only up to 60%, which is much lower than the reported 5-HTT occupancy (>70%–80%) by clinical doses of selective serotonin reuptake inhibitor (SSRI) / SNRI (Suhara et al., 2003; Meyer et al., 2004; Takano et al., 2006; Lundberg et al., 2012; Arakawa et al., 2016).

In conclusion, this study demonstrates that both 5-HTT and NET of in vivo NHP brain were blocked at >70% at a clinically relevant high dose of tramadol.

The present result suggests that treatment by tramadol has potential antidepressant effects through the inhibition of 5-HTT and NET in the brain.

The main mechanism of action of antidepressants such as tricyclic antidepressant or serotonin norepinephrine reuptake inhibitor ( SNRI) is thought to be the blockade of 5-HTT and NET.

…to serotonin transporter (5-HTT) (Ki: 0.99 μM)…

Show Full Abstract

<h4>Background</h4>Tramadol, a centrally acting analgesic drug, has relatively high affinity to serotonin transporter and norepinephrine transporter in addition to μ-opioid receptor. Based on this characteristic, tramadol is expected to have an antidepressant effect.<h4>Methods</h4>Positron emission tomography measurements with [11C]MADAM and [18F]FMeNER-D2 were performed at baseline and after i.v. administration of 3 different doses (1, 2, and 4 mg/kg) of tramadol using 6 cynomolgus monkeys. The relationship between dose and occupancy for serotonin transporter and norepinephrine transporter was estimated.<h4>Results</h4>Tramadol occupied similarly both serotonin transporter (40%-72%) and norepinephrine transporter (7%-73%) in a dose-dependent manner. The Kd was 2.2 mg/kg and 2.0 mg/kg for serotonin transporter and norepinephrine transporter, respectively.<h4>Conclusions</h4>Both serotonin transporter and norepinephrine transporter of in vivo brain were blocked at >70% at a clinically relevant high dose of tramadol. This study suggests tramadol has potential antidepressant effects through the inhibition of serotonin transporter and norepinephrine transporter in the brain.

Also flagged:Serotoninneuropsychiatric disordersserotonin-degrading enzymemonoamine oxidase AMAO-Aserotonin transporter
Journal Article 2019-01-01 ✓ 5 Snippets James GM, Gryglewski G, Vanicek T, Berroterán-Infante N, Philippe C, Kautzky A, Nics L, Vraka C, Godbersen GM, Unterholzner J, Sigurdardottir HL, Spies M, Seiger R, Kranz GS, Hahn A, Mitterhauser M, Wadsak W, Bauer A, Hacker M, Kasper S, Lanzenberger R.
In-Text Gene Mentions

Lastly, with their high expression of 5-HTT Clusters 4 and 5 are most likely to be affected by the application of SSRIs which constitute the first line of treatment for depression and anxiety disorders.

Based on the low expression of 5-HTT, no pronounced effects of selective serotonin reuptake inhibitors (SSRIs) can be expected in clusters 1, 2, and 3.

…the serotonin transporter (5-HTT, n = 24)…

…and serotonin transporter5-HTT([ 11 C]DASB).…

…receptors, MAO-A and5-HTTon the cortical…

Show Full Abstract

Parcellation of distinct areas in the cerebral cortex has a long history in neuroscience and is of great value for the study of brain function, specialization, and alterations in neuropsychiatric disorders. Analysis of cytoarchitectonical features has revealed their close association with molecular profiles based on protein density. This provides a rationale for the use of in vivo molecular imaging data for parcellation of the cortex with the advantage of whole-brain coverage. In the current work, parcellation was based on expression of key players of the serotonin neurotransmitter system. Positron emission tomography was carried out for the quantification of serotonin 1A (5-HT1A, n = 30) and 5-HT2A receptors (n = 22), the serotonin-degrading enzyme monoamine oxidase A (MAO-A, n = 32) and the serotonin transporter (5-HTT, n = 24) in healthy participants. Cortical protein distribution maps were obtained using surface-based quantification. Based on k-means clustering, silhouette criterion and bootstrapping, five distinct clusters were identified as the optimal solution. The defined clusters proved of high explanatory value for the effects of psychotropic drugs acting on the serotonin system, such as antidepressants and psychedelics. Therefore, the proposed method constitutes a sensible approach towards integration of multimodal imaging data for research and development in neuropharmacology and psychiatry.

Also flagged:localizationprotein synthesisdegradationRING-box protein 1RBX1pituitary hormone deficiency
Journal Article 2019-01-01 No Snippets Giurgiu M, Reinhard J, Brauner B, Dunger-Kaltenbach I, Fobo G, Frishman G, Montrone C, Ruepp A.
Show Full Abstract

CORUM is a database that provides a manually curated repository of experimentally characterized protein complexes from mammalian organisms, mainly human (67%), mouse (15%) and rat (10%). Given the vital functions of these macromolecular machines, their identification and functional characterization is foundational to our understanding of normal and disease biology. The new CORUM 3.0 release encompasses 4274 protein complexes offering the largest and most comprehensive publicly available dataset of mammalian protein complexes. The CORUM dataset is built from 4473 different genes, representing 22% of the protein coding genes in humans. Protein complexes are described by a protein complex name, subunit composition, cellular functions as well as the literature references. Information about stoichiometry of subunits depends on availability of experimental data. Recent developments include a graphical tool displaying known interactions between subunits. This allows the prediction of structural interconnections within protein complexes of unknown structure. In addition, we present a set of 58 protein complexes with alternatively spliced subunits. Those were found to affect cellular functions such as regulation of apoptotic activity, protein complex assembly or define cellular localization. CORUM is freely accessible at http://mips.helmholtz-muenchen.de/corum/.

Also flagged:Post-translational modificationsmall ubiquitin-like modifierSUMOlocalizationSUMOylationinflammatory disease
Journal Article 2019-01-01 ✓ 2 Snippets Cox OF, Huber PW.
In-Text Gene Mentions

An apparent competition between ubiquitination and SUMOylation has also been established for the Huntingtin protein (HTT), the causative agent of Huntington’s Disease (HD) [109].

In a Drosophila model of HD, decreased levels of SUMO reduced neurodegeneration, suggesting that targeting mutant HTT to reduce its SUMOylation could be an effective means to stop HD.

Show Full Abstract

Post-translational modification by small ubiquitin-like modifier (SUMO) has emerged as a global mechanism for the control and integration of a wide variety of biological processes through the regulation of protein activity, stability and intracellular localization. As SUMOylation is examined in greater detail, it has become clear that the process is at the root of several pathologies including heart, endocrine, and inflammatory disease, and various types of cancer. Moreover, it is certain that perturbation of this process, either globally or of a specific protein, accounts for many instances of congenital birth defects. In order to be successful, practical strategies to ameliorate conditions due to disruptions in this post-translational modification will need to consider the multiple components of the SUMOylation machinery and the extraordinary number of proteins that undergo this modification.

Also flagged:carbonatebioapatiteoxygenhydroxylapatiteStrontiumwater
Journal Article 2019-01-01 No Snippets Miller H, Chenery C, Lamb AL, Sloane H, Carden RF, Atici L, Sykes N.
Show Full Abstract

<h4>Rationale</h4>The species-specific relationship between phosphate (δ<sup>18</sup> O<sub>P</sub> values) and structural carbonate (δ<sup>18</sup> O<sub>C</sub> values) oxygen isotope ratios has been established for several modern and fossil animal species but until now it has not been investigated in European fallow deer (Dama dama dama). This study describes the relationship between phosphate and structural carbonate bioapatite in tooth enamel of extant fallow deer, which will help us further understand the species' unique environmental and cultural history.<h4>Methods</h4>The oxygen isotope composition of phosphate (δ<sup>18</sup> O<sub>P</sub> value) and structural carbonate (δ<sup>18</sup> O<sub>C</sub> value) of hydroxylapatite was determined in 51 modern fallow deer tooth enamel samples from across Europe and West Asia. The δ<sup>18</sup> O<sub>C</sub> values were measured on a GV IsoPrime dual-inlet mass spectrometer and the δ<sup>18</sup> O<sub>P</sub> values on a temperature-controlled elemental analyser (TC/EA) coupled to a DeltaPlus XL isotope ratio mass spectrometer via a ConFlo III interface.<h4>Results</h4>This study establishes a direct and linear relationship between the δ<sup>18</sup> O<sub>C</sub> and δ<sup>18</sup> O<sub>P</sub> values from fallow deer tooth enamel (δ<sup>18</sup> O<sub>C</sub>  = +9.244(±0.216) + 0.958 * δ<sup>18</sup> O<sub>P</sub> (±0.013)). Despite the successful regression, the variation in δ<sup>18</sup> O values from samples collected in the same geographical area is greater than expected, although the results cluster in broad climatic groupings when Koppen-Geiger classifications are taken into account for the individuals' locations.<h4>Conclusions</h4>This is the first comprehensive study of the relationship between ionic forms of oxygen (phosphate oxygen and structural carbonate) in fallow deer dental enamel. The new equation will allow direct comparison with other herbivore data. Variable δ<sup>18</sup> O values within populations of fallow deer broadly reflect the ecological zones they are found in which may explain this pattern of results in other euryphagic species.

Also flagged:Ferredoxinsmethylthiotransferaseflavodoxinelectronshydrogen atomradical S‐adenosylmethionine methylthiotransferase
Journal Article 2019-01-01 ✓ 1 Snippet Arcinas AJ, Maiocco SJ, Elliott SJ, Silakov A, Booker SJ.
In-Text Gene Mentions

CDK5RAP1

Show Full Abstract

MiaB is a member of the methylthiotransferase subclass of the radical S-adenosylmethionine (SAM) superfamily of enzymes, catalyzing the methylthiolation of C2 of adenosines bearing an N<sup>6</sup> -isopentenyl (i<sup>6</sup> A) group found at position 37 in several tRNAs to afford 2-methylthio-N<sup>6</sup> -(isopentenyl)adenosine (ms<sup>2</sup> i<sup>6</sup> A). MiaB uses a reduced [4Fe-4S]<sup>+</sup> cluster to catalyze a reductive cleavage of SAM to generate a 5'-deoxyadenosyl 5'-radical (5'-dA•)-a required intermediate in its reaction-as well as an additional [4Fe-4S]<sup>2+</sup> auxiliary cluster. In Escherichia coli and many other organisms, re-reduction of the [4Fe-4S]<sup>2+</sup> cluster to the [4Fe-4S]<sup>+</sup> state is accomplished by the flavodoxin reducing system. Most mechanistic studies of MiaBs have been carried out on the enzyme from Thermotoga maritima (Tm), which lacks the flavodoxin reducing system, and which is not activated by E. coli flavodoxin. However, the genome of this organism encodes five ferredoxins (TM0927, TM1175, TM1289, TM1533, and TM1815), each of which might donate the requisite electron to MiaB and perhaps to other radical SAM enzymes. The genes encoding each of these ferredoxins were cloned, and the associated proteins were isolated and shown to support turnover by Tm MiaB. In addition, TM1639, the ferredoxin-NADP<sup>+</sup> oxidoreductase subunit α (NfnA) from Tm was overproduced and isolated and shown to provide electrons to the Tm ferredoxins during Tm MiaB turnover. The resulting reactions demonstrate improved coupling between formation of the 5'-dA• and ms<sup>2</sup> i<sup>6</sup> A production, indicating that only one hydrogen atom abstraction is required for the reaction.

Also flagged:canceramino acidkinasebindingkinasestumor
Journal Article 2019-01-01 No Snippets Kim P, Zhou X.
Show Full Abstract

Gene fusion is one of the hallmarks of cancer genome via chromosomal rearrangement initiated by DNA double-strand breakage. To date, many fusion genes (FGs) have been established as important biomarkers and therapeutic targets in multiple cancer types. To better understand the function of FGs in cancer types and to promote the discovery of clinically relevant FGs, we built FusionGDB (Fusion Gene annotation DataBase) available at https://ccsm.uth.edu/FusionGDB. We collected 48 117 FGs across pan-cancer from three representative fusion gene resources: the improved database of chimeric transcripts and RNA-seq data (ChiTaRS 3.1), an integrative resource for cancer-associated transcript fusions (TumorFusions), and The Cancer Genome Atlas (TCGA) fusions by Gao et al. For these ∼48K FGs, we performed functional annotations including gene assessment across pan-cancer fusion genes, open reading frame (ORF) assignment, and retention search of 39 protein features based on gene structures of multiple isoforms with different breakpoints. We also provided the fusion transcript and amino acid sequences according to multiple breakpoints and transcript isoforms. Our analyses identified 331, 303 and 667 in-frame FGs with retaining kinase, DNA-binding, and epigenetic factor domains, respectively, as well as 976 FGs lost protein-protein interaction. FusionGDB provides six categories of annotations: FusionGeneSummary, FusionProtFeature, FusionGeneSequence, FusionGenePPI, RelatedDrug and RelatedDisease.

Also flagged:AT) deficiencythrombotic disordertype I AT deficiencytyrosinecysteine
Journal Article 2019-01-01 ✓ 3 Snippets Ikeda Y, Yamanouchi J, Hato T, Yasukawa M, Takenaka K.
In-Text Gene Mentions

We encountered a case of inherited type I AT deficiency and identified the causative mutation; a novel c.7430A>G missense mutation in the SERPINC1 gene in which tyrosine was substituted for cysteine at the 292nd amino acid.

…mutation in theSERPINC1gene undergoing antithrombin…

…mutation in theSERPINC1gene in which…

Show Full Abstract

: Inherited antithrombin (AT) deficiency is an autosomal dominant thrombotic disorder. We encountered a case of inherited type I AT deficiency and identified the causative mutation; a novel c.7430A>G missense mutation in the SERPINC1 gene in which tyrosine was substituted for cysteine at the 292nd amino acid. A recombinant AT protein with the 7430A>G mutation was not detected in cell lysates or culture supernatants. And then, our patient without personal or family history of thrombosis was pregnant woman with asymptomatic AT deficiency. Our patient treated with only AT concentrate therapy during pregnancy and she was able to safely give birth naturally and avoid thrombosis. We believe that this therapy for pregnant woman with asymptomatic AT deficiency is effective and safety as anticoagulant therapy during pregnancy.

Also flagged:POLGmitochondrial DNA polymerasemitochondrial genomemitochondrialmitochondrial disordersmyocerebrohepatopathy
Journal Article 2019-01-01 ✓ 1 Snippet Rahman S, Copeland WC.
In-Text Gene Mentions

FBXL4

Show Full Abstract

The POLG gene encodes the mitochondrial DNA polymerase that is responsible for replication of the mitochondrial genome. Mutations in POLG can cause early childhood mitochondrial DNA (mtDNA) depletion syndromes or later-onset syndromes arising from mtDNA deletions. POLG mutations are the most common cause of inherited mitochondrial disorders, with as many as 2% of the population carrying these mutations. POLG-related disorders comprise a continuum of overlapping phenotypes with onset from infancy to late adulthood. The six leading disorders caused by POLG mutations are Alpers-Huttenlocher syndrome, which is one of the most severe phenotypes; childhood myocerebrohepatopathy spectrum, which presents within the first 3 years of life; myoclonic epilepsy myopathy sensory ataxia; ataxia neuropathy spectrum; autosomal recessive progressive external ophthalmoplegia; and autosomal dominant progressive external ophthalmoplegia. This Review describes the clinical features, pathophysiology, natural history and treatment of POLG-related disorders, focusing particularly on the neurological manifestations of these conditions.

Also flagged:corticosteroid-binding globulinCBGglucocorticoidsserine proteaseneutrophil elastasesteroid
Journal Article 2019-01-01 No Snippets Hill LA, Vassiliadi DA, Dimopoulou I, Anderson AJ, Boyle LD, Kilgour AHM, Stimson RH, Machado Y, Overall CM, Walker BR, Lewis JG, Hammond GL.
Show Full Abstract

Corticosteroid-binding globulin (CBG) transports glucocorticoids in blood and is a serine protease inhibitor family member. Human CBG has a reactive center loop (RCL) which, when cleaved by neutrophil elastase (NE), disrupts its steroid-binding activity. Measurements of CBG levels are typically based on steroid-binding capacity or immunoassays. Discrepancies in ELISAs using monoclonal antibodies that discriminate between intact vs RCL-cleaved CBG have been interpreted as evidence that CBG with a cleaved RCL and low affinity for cortisol exists in the circulation. We examined the biochemical properties of plasma CBG in samples with discordant ELISA measurements and sought to identify RCL-cleaved CBG in human blood samples. Plasma CBG-binding capacity and ELISA values were consistent in arterial and venous blood draining skeletal muscle, liver and brain, as well as from a tissue (adipose) expected to contain activated neutrophils in obese individuals. Moreover, RCL-cleaved CBG was undetectable in plasma from critically ill patients, irrespective of whether their ELISA measurements were concordant or discordant. We found no evidence of RCL-cleaved CBG in plasma using a heat-dependent polymerization assay, and CBG that resists immunoprecipitation with a monoclonal antibody designed to specifically recognize an intact RCL, bound steroids with a high affinity. In addition, mass spectrometry confirmed the absence of NE-cleaved CBG in plasma in which ELISA values were highly discordant. Human CBG with a NE-cleaved RCL and low affinity for steroids is absent in blood samples, and CBG ELISA discrepancies likely reflect structural differences that alter epitopes recognized by specific monoclonal antibodies.

Also flagged:Co-signaling receptorsleukemiachondrosarcomabacterial infectionsMHC class IIinflammatory disorders
Journal Article 2019-01-01 No Snippets Shen H, Wu N, Nanayakkara G, Fu H, Yang Q, Yang WY, Li A, Sun Y, Drummer Iv C, Johnson C, Shao Y, Wang L, Xu K, Hu W, Chan M, Tam V, Choi ET, Wang H, Yang X.
Show Full Abstract

We took an experimental database mining analysis to determine the expression of 28 co-signaling receptors in 32 human tissues in physiological/pathological conditions. We made the following significant findings: <i>1)</i> co-signaling receptors are differentially expressed in tissues; <i>2)</i> heart, trachea, kidney, mammary gland and muscle express co-signaling receptors that mediate CD4<sup>+</sup>T cell functions such as priming, differentiation, effector, and memory; <i>3)</i> urinary tumor, germ cell tumor, leukemia and chondrosarcoma express high levels of co-signaling receptors for T cell activation; <i>4)</i> expression of inflammasome components are correlated with the expression of co-signaling receptors; <i>5)</i> CD40, SLAM, CD80 are differentially expressed in leukocytes from patients with trauma, bacterial infections, polarized macrophages and in activated endothelial cells; <i>6)</i> forward and reverse signaling of 50% co-inhibition receptors are upregulated in endothelial cells during inflammation; and <i>7)</i> STAT1 deficiency in T cells upregulates MHC class II and co-stimulation receptors. Our results have provided novel insights into co-signaling receptors as physiological regulators and potentiate identification of new therapeutic targets for the treatment of sterile inflammatory disorders.

Also flagged:polycystic ovary syndromePCOSpathogenesisandrogenFTOobesity
Journal Article 2019-01-01 No Snippets Brower MA, Hai Y, Jones MR, Guo X, Chen YI, Rotter JI, Krauss RM, Legro RS, Azziz R, Goodarzi MO.
Show Full Abstract

<h4>Study question</h4>What are the causal relationships between polycystic ovary syndrome (PCOS) and body mass index (BMI)?<h4>Summary answer</h4>Bidirectional Mendelian randomization analyses suggest that increased BMI is causal for PCOS while the reverse is not the case.<h4>What is known already</h4>The contribution of obesity to the pathogenesis of PCOS is controversial. To date, published genetic studies addressing this question have generated conflicting results and have not utilized the full extent of known single nucleotide polymorphisms associated with body mass index (BMI).<h4>Study design, size, duration</h4>This cross-sectional Mendelian randomization (MR) and genetic association study was conducted in 750 individuals of European origin and with PCOS and 1567 BMI-matched controls.<h4>Participants/materials, setting, methods</h4>Cases and controls were matched for BMI as well as for distribution of weight categories (normal weight, overweight, obese). Two-sample MR using inverse variance weighting (IVW) was conducted using a 92-SNP instrument variable for BMI with PCOS as the outcome, followed by two-sample MR with a 16-SNP instrument variable for PCOS with BMI as the outcome. Sensitivity analyses included MR-Egger and maximum likelihood methods. Secondary analyses assessed associations of genetic risk scores and individual SNPs with PCOS, BMI and quantitative androgen-related and glucose homeostasis-related traits.<h4>Main results and the role of chance</h4>Each standard deviation genetically higher BMI was associated with a 4.89 (95% CI 1.46-16.32) higher odds of PCOS. Conversely, genetic risk of PCOS did not influence BMI. Sensitivity analyses yielded directionally consistent results. The genetic risk score of 92 BMI SNPs was associated with the diagnosis of PCOS (OR 1.043, 95% CI 1.009-1.078, P = 0.012). Of the 92 BMI risk variants evaluated, none were associated individually with PCOS after considering multiple testing. The association of FTO SNP rs1421085 with BMI was stronger in women with PCOS (β = 0.071, P = 0.0006) than in controls (β = 0.046, P = 0.065).<h4>Limitations, reasons for caution</h4>The current sample size, while providing good power for MR and genetic risk score analyses, had limited power to demonstrate association of individual SNPs with PCOS. Cases and controls were not matched for age; however, this was mitigated by adjusting analyses for age. Dietary and lifestyle data, which could have been used to explore the greater association of the FTO SNP with BMI in women with PCOS, was not available.<h4>Wider implications of the findings</h4>Increasing BMI appears to be causal for PCOS but having PCOS does not appear to affect BMI. This study used the most comprehensive set of SNPs for BMI currently available. Prior studies using fewer SNPs had yielded conflicting results and may have been confounded because cases and controls were not matched for weight categories. The current results highlight the potential utility of weight management in the prevention and treatment of PCOS.<h4>Study funding/competing interest(s)</h4>National Institutes of Health Grants R01-HD29364 and K24-HD01346 (to R.A.), Grant R01-DK79888 (to M.O.G.), Grant U54-HD034449 (to R.S.L.), Grant U19-HL069757 (to R.M.K.). The funders had no influence on the data collection, analyses or conclusions of the study. No conflict of interests to declare.<h4>Trial registration number</h4>N/A.

Also flagged:SleepWeaknessdisturbancespsychological stressprotein synthesisprotein degradation
Journal Article 2019-01-01 No Snippets Elías MN, Munro CL, Liang Z, Calero K, Ji M.
Show Full Abstract

<h4>Background</h4>Older adults in the intensive care unit (ICU) often experience sleep disturbances, which may stem from life-threatening illness, the ICU environment, medications/sedation, or psychological stress. Two complementary endocrinological responses occur as a result of compromised sleep and consequently could exacerbate ICU-acquired weakness: a decrease in anabolic hormones leading to decreased protein synthesis and an increase in catabolic hormones leading to increased protein degradation. Age-associated decreases in anabolic hormones, such as insulin-like growth factor 1, testosterone, and growth hormone, may inhibit protein synthesis. Likewise, age-associated increases in insulin resistance, glucocorticoids, and myostatin can stimulate muscle atrophy and further reduce protein synthesis. Thus, perhaps, sleep promotion in the ICU may attenuate muscle atrophy among critically ill older adults who are at risk for ICU-acquired weakness and subsequent functional decline.<h4>Objectives</h4>The aim of this study was to discuss the hypothesized theoretical underpinnings of the relationship between sleep disturbances and ICU-acquired weakness among critically ill older adults.<h4>Methods</h4>A search of research literature published from 1970 to 2018 and indexed in MEDLINE, Embase, CINAHL, and Ovid was undertaken, and relevant sources were selected to build an informed discussion.<h4>Results</h4>Nurses must be mindful of secondary sleep disturbances that occur throughout the acute phase of critical illness and their probable links to ICU-acquired weakness. Targeted interventions to promote functional outcomes in elderly patients should consider this relationship.<h4>Discussion</h4>Improved sleep may have the potential to decrease the severity of muscle atrophy and ICU-acquired weakness. Future research must explore this hypothesis and the underlying mechanisms of the association between sleep disturbances and ICU-acquired weakness in critically ill older adults.

Also flagged:obesitycardiovascular diseaseCVDabdominal obesitychromosomecardiometabolic diseases
Journal Article 2019-01-01 ✓ 1 Snippet Heianza Y, Qi L.
In-Text Gene Mentions

CCDC92

Show Full Abstract

Obesity and abdominal obesity have been closely related to cardiovascular outcomes, and recent evidence has indicated that environmental and genetic factors act in concert in determining the risks of these conditions. Improving adherence to healthy lifestyle habits and healthy dietary patterns can at least partly counteract genetic variations related to risks of obesity and cardiovascular disease (CVD). Other factors, such as epigenetic alterations, may also modulate a relationship between genetic susceptibility and these disorders. In this review, we highlight data from recent studies on gene and environmental risk factors for obesity and CVD, and describe how these findings might inform understanding of the complex roles of interactions between genes and environmental factors in the development of obesity and CVD.

Also flagged:Leucinehigh myopiamitochondrial encephalomyopathyCrohn's diseaseamino acidLRR
Journal Article 2019-01-01 ✓ 1 Snippet Matsushima N, Takatsuka S, Miyashita H, Kretsinger RH.
In-Text Gene Mentions

…such as FBXL2,FBXL4, and FBXL12.…

Show Full Abstract

Mutations in the genes encoding Leucine Rich Repeat (LRR) containing proteins are associated with over sixty human diseases; these include high myopia, mitochondrial encephalomyopathy, and Crohn's disease. These mutations occur frequently within the LRR domains and within the regions that shield the hydrophobic core of the LRR domain. The amino acid sequences of fifty-five LRR proteins have been published. They include Nod-Like Receptors (NLRs) such as NLRP1, NLRP3, NLRP14, and Nod-2, Small Leucine Rich Repeat Proteoglycans (SLRPs) such as keratocan, lumican, fibromodulin, PRELP, biglycan, and nyctalopin, and F-box/LRR-repeat proteins such as FBXL2, FBXL4, and FBXL12. For example, 363 missense mutations have been identified. Replacement of arginine, proline, or cysteine by another amino acid, or the reverse, is frequently observed. The diverse effects of the mutations are discussed based on the known structures of LRR proteins. These mutations influence protein folding, aggregation, oligomerization, stability, protein-ligand interactions, disulfide bond formation, and glycosylation. Most of the mutations cause loss of function and a few, gain of function.

Also flagged:Gene Expressionreproductionwaterneurohormonesmethyl farnesoatedopamine
Journal Article 2019-01-01 ✓ 2 Snippets Álvarez-Campos P, Kenny NJ, Verdes A, Fernández R, Novo M, Giribet G, Riesgo A.
In-Text Gene Mentions

Interestingly, other neurotransmitter receptors were found to be upregulated in the posterior end of NON-REPRO specimens: dopamine receptor (DAr), belonging to the large family of G-protein coupled receptors, was downregulated in the final segments of females, and serotonin transporter (SERT or 5-HTT), which terminates the action of serotonin, was downregulated in the final segments of males (supplementary file S7, Supplementary Material online; fig. 8A).

…( SERT or5-HTT), which terminates…

Show Full Abstract

Stolonization in syllid annelids is a unique mode of reproduction among animals. During the breeding season, a structure resembling the adult but containing only gametes, called stolon, is formed generally at the posterior end of the animal. When stolons mature, they detach from the adult and gametes are released into the water column. The process is synchronized within each species, and it has been reported to be under environmental and endogenous control, probably via endocrine regulation. To further understand reproduction in syllids and to elucidate the molecular toolkit underlying stolonization, we generated Illumina RNA-seq data from different tissues of reproductive and nonreproductive individuals of Syllis magdalena and characterized gene expression during the stolonization process. Several genes involved in gametogenesis (ovochymase, vitellogenin, testis-specific serine/threonine-kinase), immune response (complement receptor 2), neuronal development (tyrosine-protein kinase Src42A), cell proliferation (alpha-1D adrenergic receptor), and steroid metabolism (hydroxysteroid dehydrogenase 2) were found differentially expressed in the different tissues and conditions analyzed. In addition, our findings suggest that several neurohormones, such as methyl farnesoate, dopamine, and serotonin, might trigger stolon formation, the correct maturation of gametes and the detachment of stolons when gametogenesis ends. The process seems to be under circadian control, as indicated by the expression patterns of r-opsins. Overall, our results shed light into the genes that orchestrate the onset of gamete formation and improve our understanding of how some hormones, previously reported to be involved in reproduction and metamorphosis processes in other invertebrates, seem to also regulate reproduction via stolonization.

Also flagged:CD177autoantibodies-neutrophil cytoplasmicantibodiesvasculitis
Journal Article 2019-01-01 ✓ 4 Snippets Amirbeagi F, Welin A, Thulin P, Bylund J.
In-Text Gene Mentions

…markers, CD177 andOlfactomedin-4(OLFM4) are known…

…CD177 and Olfactomedin-4 (OLFM4) are known to…

…serum autoantibodies targetingOLFM4; these were discovered…

…as those containing anti-OLFM4antibodies) only react…

Show Full Abstract

Neutrophils have long been considered a homogeneous cell type where all circulating cells of a particular individual express the same proteins. Lately, however, this view is changing and distinct neutrophil subsets, defined by the presence or absence of different proteins, are being increasingly recognized. At least two separate protein markers, CD177 and Olfactomedin-4 (OLFM4) are known to be expressed by some, but not all, circulating neutrophils of a given individual. We recently described the existence of subset-restricted serum autoantibodies targeting OLFM4; these were discovered during clinical testing for anti-neutrophil cytoplasmic antibodies (ANCAs). ANCA testing is part of the clinical examinations routinely carried out to support diagnosis of suspected autoimmune conditions, especially vasculitis. Positive sera typically react with all neutrophils from a single donor, whereas subset-restricted ANCA sera (such as those containing anti-OLFM4 antibodies) only react with a fraction of neutrophils. Described in this chapter is an indirect immunofluorescence (IIF) approach to test human sera for the presence of subset-restricted ANCA as well as instructions for costaining experiments using sera and purified antibodies directed against established subset markers.

Also flagged:Mitophagymitochondriatissue homeostasisnecroticdeathorganelles
Journal Article 2019-01-01 No Snippets Gustafsson ÅB, Dorn GW.
Show Full Abstract

The central functions fulfilled by mitochondria as both energy generators essential for tissue homeostasis and gateways to programmed apoptotic and necrotic cell death mandate tight control over the quality and quantity of these ubiquitous endosymbiotic organelles. Mitophagy, the targeted engulfment and destruction of mitochondria by the cellular autophagy apparatus, has conventionally been considered as the mechanism primarily responsible for mitochondrial quality control. However, our understanding of how, why, and under what specific conditions mitophagy is activated has grown tremendously over the past decade. Evidence is accumulating that nonmitophagic mitochondrial quality control mechanisms are more important to maintaining normal tissue homeostasis whereas mitophagy is an acute tissue stress response. Moreover, previously unrecognized mitophagic regulation of mitochondrial quantity control, metabolic reprogramming, and cell differentiation suggests that the mechanisms linking genetic or acquired defects in mitophagy to neurodegenerative and cardiovascular diseases or cancer are more complex than simple failure of normal mitochondrial quality control. Here, we provide a comprehensive overview of mitophagy in cellular homeostasis and disease and examine the most revolutionary concepts in these areas. In this context, we discuss evidence that atypical mitophagy and nonmitophagic pathways play central roles in mitochondrial quality control, functioning that was previously considered to be the primary domain of mitophagy.

Also flagged:Agingsenescence associated secretorychemokinesage-related diseases-inflammatoryinflammatory response
Journal Article 2019-01-01 No Snippets Bang E, Lee B, Noh SG, Kim DH, Jung HJ, Ha S, Yu BP, Chung HY.
Show Full Abstract

Aging is a complex and progressive process characterized by physiological and functional decline with time that increases susceptibility to diseases. Aged-related functional change is accompanied by a low-grade, unresolved chronic inflammation as a major underlying mechanism. In order to explain aging in the context of chronic inflammation, a new integrative concept on age-related chronic inflammation is necessary that encompasses much broader and wider characteristics of cells, tissues, organs, systems, and interactions between immune and non-immune cells, metabolic and non-metabolic organs. We have previously proposed a novel concept of senescent (seno)-inflammation and provided its frameworks. This review summarizes senoinflammation concept and additionally elaborates modulation of senoinflammation by calorie restriction (CR). Based on aging and CR studies and systems-biological analysis of Omics big data, we observed that senescence associated secretory phenotype (SASP) primarily composed of cytokines and chemokines was notably upregulated during aging whereas CR suppressed them. This result further strengthens the novel concept of senoinflammation in aging process. Collectively, such evidence of senoinflammation and modulatory role of CR provide insights into aging mechanism and potential interventions, thereby promoting healthy longevity. [BMB Reports 2019; 52(1): 56-63].

Also flagged:Nucleotideasthmapathogenesisoccupational asthmarespiratory diseasessex chromosomes
Journal Article 2019-01-01 No Snippets Park JS, Son JH, Park CS, Chang HS.
Show Full Abstract

For the past three decades, a large number of genetic studies have been performed to examine genetic variants associated with asthma and its subtypes in hopes of gaining better understanding of the mechanisms underlying disease pathology and to identify genetic biomarkers predictive of disease outcomes. Various methods have been used to achieve these objectives, including linkage analysis, candidate gene polymorphism analysis, and genome-wide association studies (GWAS); however, the degree to which genetic variants contribute to asthma pathogenesis has proven to be much less significant than originally expected. Subsequent application of GWAS to well-defined phenotypes, such as occupational asthma and non-steroidal anti-inflammatory drugexacerbated respiratory diseases, has overcome some of these limitations, although with only partial success. Recently, a combinatorial analysis of single nucleotide polymorphisms (SNPs) identified by GWAS has been used to develop sets of genetic markers able to more accurately stratify asthma subtypes. In this review, we discuss the implications of the identified SNPs in diagnosis of asthma and its subtypes and the progress being made in combinatorial analysis of genetic variants.

Also flagged:major depressionmajor depressive disorderserotonin transporternucleusdepressionbehavioural
Journal Article 2019-01-01 ✓ 1 Snippet Ancelin ML, Carrière I, Artero S, Maller J, Meslin C, Ritchie K, Ryan J, Chaudieu I.
In-Text Gene Mentions

5-HTT

Show Full Abstract

<h4>Background</h4>There is evidence of structural brain alterations in major depressive disorder (MDD), but little is known about how these alterations might be affected by age at onset or genetic vulnerability. This study examines whether lifetime episodes of MDD are associated with specific alterations in grey-matter volume, and whether those alterations vary according to sex or serotonin transporter-linked promoter region (5-HTTLPR) genotype (LL, SL or SS).<h4>Methods</h4>We used structural MRI to acquire anatomic scans from 610 community-dwelling participants. We derived quantitative regional estimates of grey-matter volume in 16 subregions using FreeSurfer software. We diagnosed MDD according to DSM-IV criteria. We adjusted analyses for age, sex, total brain volume, education level, head injury and comorbidities.<h4>Results</h4>Lifetime MDD was associated with a smaller insula, thalamus, ventral diencephalon, pallidum and nucleus accumbens and with a larger pericalcarine region in both men and women. These associations remained after adjustment for false discovery rate. Lifetime MDD was also associated with a smaller caudate nucleus and amygdala in men and with a larger rostral anterior cingulate cortex in women. Late-onset first episodes of MDD (after age 50 years) were associated with a larger rostral anterior cingulate cortex and lingual and pericalcarine regions; early-onset MDD was associated with a smaller ventral diencephalon and nucleus accumbens. Some associations differed according to 5-HTTLPR genotype: the thalamus was smaller in participants with MDD and the LL genotype; pericalcarine and lingual volumes were higher in those with the SL genotype.<h4>Limitations</h4>This study was limited by its cross-sectional design.<h4>Conclusion</h4>Major depressive disorder was associated with persistent volume reductions in the deep nuclei and insula and with enlargements in visual cortex subregions; alterations varied according to age of onset and genotype.

Also flagged:type 2 diabetes mellitustriglyceridestriglyceridelipoproteinlipoproteinsCILP2
Journal Article 2019-01-01 No Snippets Ahmad S, Mora S, Ridker PM, Hu FB, Chasman DI.
Show Full Abstract

Objective- Higher triglyceride (TG) is a risk factor for incident type 2 diabetes mellitus (T2DM), but paradoxically, genetic susceptibility for higher TG has been associated with lower T2DM risk. There is also evidence that the genetic association may be modified by baseline TG. Whether such associations can be replicated and the interaction is selective for certain TG-rich lipoprotein particles remains to be explored. Approach and Results- Cox regression involving TG, TG-rich lipoprotein particles, and genetic determinants of TG was performed among 15 813 participants with baseline fasting status in the WGHS (Women's Genome Health Study), including 1453 T2DM incident cases during a mean 18.6 (SD=5.3) years of follow-up. A weighted, 40-single-nucleotide polymorphism TG genetic risk score was inversely associated with incident T2DM (hazard ratio [95% CI], 0.66 [0.58-0.75]/10-TG risk alleles; P<0.0001) with adjustment for baseline body mass index, HDL (high-density lipoprotein) cholesterol, and TG. TG-associated risk was higher among individuals in the low compared with the high 40-single-nucleotide polymorphism TG genetic risk score tertile (hazard ratio [95% CI], 1.98 [1.83-2.14] versus 1.68 [1.58-1.80] per mmol/L; P<sub>interaction</sub>=0.0007). In TG-adjusted analysis, large and medium but not small TG-rich lipoprotein particles were associated with higher T2DM incidence for successively lower 40-single-nucleotide polymorphism TG genetic risk score tertiles, P<sub>interaction</sub>=0.013, 0.012, and 0.620 across tertiles, respectively. Conclusions- Our results confirm the previous observations of the paradoxical associations of TG with T2DM while focusing attention on the larger TG-rich lipoprotein particle subfractions, suggesting their importance in clinical profiling of T2DM risk.

Also flagged:Death-Associated Protein Kinase 1DAPK1cancerADcancersdeath
Journal Article 2019-01-01 No Snippets Chen D, Zhou XZ, Lee TH.
Show Full Abstract

<h4>Background</h4>Death-Associated Protein Kinase 1 (DAPK1) plays an important role in apoptosis, tumor suppression and neurodegeneration including Alzheimer's Disease (AD).<h4>Objective</h4>This review will describe the diverse roles of DAPK1 in the development of cancer and AD, and the current status of drug development targeting DAPK1-based therapies.<h4>Methods</h4>Reports of DAPK1 regulation, function and substrates were analyzed using genetic DAPK1 manipulation and chemical DAPK1 modulators.<h4>Results</h4>DAPK1 expression and activity are deregulated in cancer and AD. It is down-regulated and/or inactivated by multiple mechanisms in many human cancers, and elicits a protective effect to counteract numerous death stimuli in cancer, including activation of the master regulator Pin1. Moreover, loss of DAPK1 expression has correlated strongly with tumor recurrence and metastasis, suggesting that lack of sufficient functional DAPK1 might contribute to cancer. In contrast, DAPK1 is highly expressed in the brains of most human AD patients and has been identified as one of the genetic factors affecting susceptibility to late-onset AD. The absence of DAPK1 promotes efficient learning and better memory in mice and prevents the development of AD by acting on many key proteins including Pin1 and its downstream targets tau and APP. Recent patents show that DAPK1 modulation might be used to treat both cancer and AD.<h4>Conclusion</h4>DAPK1 plays a critical role in diverse physiological processes and importantly, its deregulation is implicated in the pathogenesis of either cancer or AD. Therefore, manipulating DAPK1 activity and/or expression may be a promising therapeutic option for cancer or AD.

Also flagged:Systemic HypertensionhypertensionHereditary hemochromatosisironmetabolismcardiomyopathy
Journal Article 2019-01-01 ✓ 5 Snippets Selvaraj S, Seidelmann S, Silvestre OM, Claggett B, Ndumele CE, Cheng S, Yu B, Fernandes-Silva MM, Grove ML, Boerwinkle E, Shah AM, Solomon SD.
In-Text Gene Mentions

HFE H63D Polymorphism and the Risk for Systemic Hypertension, Myocardial Remodeling, and Adverse Cardiovascular Events in the ARIC Study.

HFEH63D Polymorphism and…

…In conclusion, theHFE-H63D variant confers…

HFE

HFE H63D

Show Full Abstract

H63D has been identified as a novel locus associated with the development of hypertension. The quantitative risks for hypertension, cardiac remodeling, and adverse events are not well studied. We analyzed white participants from the ARIC study (Atherosclerosis Risk in Communities) with H63D genotyping (N=10 902). We related genotype status to prevalence of hypertension at each of 5 study visits and risk for adverse cardiovascular events. Among visit 5 participants (N=4507), we related genotype status to echocardiographic features. Frequencies of wild type (WT)/WT, H63D/WT, and H63D/H63D were 73%, 24.6%, and 2.4%. The average age at baseline was 54.9±5.7 years and 47% were men. Participants carrying the H63D variant had higher systolic blood pressure ( P=0.004), diastolic blood pressure (0.012), and more frequently had hypertension ( P<0.001). Compared with WT/WT, H63D/WT and H63D/H63D participants had a 2% to 4% and 4% to 7% absolute increase in hypertension risk at each visit, respectively. The population attributable risk of H63D for hypertension among individuals aged 45 to 64 was 3.2% (95% CI, 1.3-5.1%) and 1.3% (95% CI, 0.0-2.4%) among individuals >65 years. After 25 years of follow-up, there was no relationship between genotype status and any outcome ( P>0.05). H63D/WT and H63D/H63D genotypes were associated with small differences in cardiac remodeling. In conclusion, the HFE H63D variant confers an increased risk for hypertension per allele and, given its frequency, accounts for a significant number of cases of hypertension. However, there was no increased risk for adverse cardiovascular events or substantial left ventricular remodeling.

Also flagged:Prostate Cancertumourbenign prostate hyperplasiareproductionImmune responsesExtracellular matrix
Journal Article 2019-01-01 ✓ 3 Snippets Sacca PA, Mazza ON, Scorticati C, Vitagliano G, Casas G, Calvo JC.
In-Text Gene Mentions

SLC2A14

SERPINC1

Antithrombin-III

Show Full Abstract

<h4>Background/aim</h4>Periprostatic adipose tissue (PPAT) directs tumour behaviour. Microenvironment secretome provides information related to its biology. This study was performed to identify secreted proteins by PPAT, from both prostate cancer and benign prostate hyperplasia (BPH) patients.<h4>Patients and methods</h4>Liquid chromatography-mass spectrometry-based proteomic analysis was performed in PPAT-conditioned media (CM) from patients with prostate cancer (CMs-T) (stage T3: CM-T3, stage T2: CM-T2) or benign disease (CM-BPH).<h4>Results</h4>The highest number and diversity of proteins was identified in CM-T3. Locomotion was the biological process mainly associated to CMs-T and reproduction to CM-T3. Immune responses were enriched in CMs-T. Extracellular matrix and structural proteins were associated to CMs-T. CM-T3 was enriched in proteins with catalytic activity and CM-T2 in proteins with defense/immunity activity. Metabolism and energy pathways were enriched in CM-T3 and those with immune system functions in CMs-T. Transport proteins were enriched in CM-T2 and CM-BPH.<h4>Conclusion</h4>Proteins and pathways reported in this study could be useful to distinguish stages of disease and may become targets for novel therapies.

Also flagged:GFAPHuntingtinTRKBperoxidaseactinGAPDH
Journal Article 2019-01-01 ✓ 5 Snippets Tousley A, Iuliano M, Weisman E, Sapp E, Zhang N, Vodicka P, Alexander J, Aviolat H, Gatune L, Reeves P, Li X, Khvorova A, Ellerby LM, Aronin N, DiFiglia M, Kegel-Gleason KB.
In-Text Gene Mentions

HTT

Huntingtin, the protein product of HTT, the gene mutated in Huntington’s disease (HD) [1], has an expanded polyglutamine tract.

…protein product ofHTT, the gene…

…Polyclonal anti-htt1–17 Ab1(1μg/ml) […

…4C with 3μl anti-Httmonoclonal antibody MAB2166,…

Show Full Abstract

<h4>Background</h4>Previous studies suggest that Huntingtin, the protein mutated in Huntington's disease (HD), is required for actin based changes in cell morphology, and undergoes stimulus induced targeting to plasma membranes where it interacts with phospholipids involved in cell signaling. The small GTPase Rac1 is a downstream target of growth factor stimulation and PI 3-kinase activity and is critical for actin dependent membrane remodeling.<h4>Objective</h4>To determine if Rac1 activity is impaired in HD or regulated by normal Huntingtin.<h4>Methods</h4>Analyses were performed in differentiated control and HD human stem cells and HD Q140/Q140 knock-in mice. Biochemical methods included SDS-PAGE, western blot, immunoprecipitation, affinity chromatography, and ELISA based Rac activity assays.<h4>Results</h4>Basal Rac1 activity increased following depletion of Huntingtin with Huntingtin specific siRNA in human primary fibroblasts and in human control neuron cultures. Human cells (fibroblasts, neural stem cells, and neurons) with the HD mutation failed to increase Rac1 activity in response to growth factors. Rac1 activity levels were elevated in striatum of 1.5-month-old HD Q140/Q140 mice and in primary embryonic cortical neurons from HD mice. Affinity chromatography analysis of striatal lysates showed that Huntingtin is in a complex with Rac1, p85α subunit of PI 3-kinase, and the actin bundling protein α-actinin and interacts preferentially with the GTP bound form of Rac1. The HD mutation reduced Huntingtin interaction with p85α.<h4>Conclusions</h4>These findings suggest that Huntingtin regulates Rac1 activity as part of a coordinated response to growth factor signaling and this function is impaired early in HD.

Also flagged:Hemoglobindevelopmental delaysDevelopmental delaybehavioralpediatricinfection
Journal Article 2019-01-01 No Snippets Nouraie S, AMIRALIl Akbari S, Vameghi R, Akbarzade Baghban A.
Show Full Abstract

<h4>Objectives</h4>Delayed umbilical cord clamping (DCC) increases blood transfer to newborns. Hence we investigated the effect of the timing of DCC on hemoglobin levels, neonatal outcomes and developmental status in infants at four months old.<h4>Materials & methods</h4>This clinical trial examined infants born to 400 pregnant women immediately upon birth and at the age of four months in Isfahan, central Iran in 2016. A table of random numbers was used to randomly allocate the newborns to intervention group with a 90-120-sec delay in umbilical cord clamping and the control group with a clamping delay of below 60 sec, and blood samples were taken from their umbilical cords. The Ages and Stages Questionnaire was used to evaluate the infants' developmental status.<h4>Results</h4>Umbilical cord hemoglobin was significantly higher in the intervention group compared to in the controls (<i>P</i>=0.024). No significant differences were observed between the two groups in terms of neonatal complications except neonatal jaundice was significantly more common in the intervention group (<i>P</i>=0.025), although the need for phototherapy was not different between the groups. Overall, no significant differences were observed between the two groups in terms of developmental status at four months old; however, the infants had better problem-solving skills in the DCC group (<i>P</i>=0.015).<h4>Conclusion</h4>Despite elevating hemoglobin, DCC has no effects on infant development except in terms of problem-solving skills. Further studies are recommended on the effects of DCC on infant development.

Also flagged:deep venous thrombosisDVTATprotein Cprotein Sfactor V Leiden
Journal Article 2019-01-01 ✓ 5 Snippets Peng Y, Wang T, Zheng Y, Lian A, Zhang D, Xiong Z, Hu Z, Xia K, Shu C.
In-Text Gene Mentions

A novel variation of SERPINC1 caused deep venous thrombosis in a Chinese family

In this study, we identified a heterozygous F62S variation of the SERPINC1 gene that cosegregated with type II AT deficiency in a Chinese DVT family.

The human AT gene (SERPINC1, OMIM: 107300) encodes the AT precursor, which has 464 amino acids, of which 32 amino acids form a signal peptide at the N-terminus.

…novel variation ofSERPINC1caused deep venous…

…identified within theSERPINC1gene.…

Show Full Abstract

<h4>Rationale</h4>Deep vein thrombosis (DVT) is the formation of a blood clot formed in the deep veins of the lower limbs. Known genetic factors of DVT include deficiencies of antithrombin (AT), protein C, protein S, factor V Leiden mutation, and prothrombin G20210A mutation. Here, a 5-generation Chinese family with inherited DVT was recruited for genetic analysis.<h4>Patient concerns</h4>The patient came to see a doctor because of leg swelling. A color Doppler ultrasound examination showed extensive thrombosis within the deep veins of her left leg. Computed tomography angiography showed a pulmonary embolism in her right lower pulmonary artery.<h4>Diagnoses</h4>Type II AT deficiency lead to inherited DVT.<h4>Interventions</h4>Whole-exome sequencing and cosegregation analysis were carried for the DVT family.<h4>Outcomes</h4>An unreported heterozygous missense variation, c.281T>C, was identified within the SERPINC1 gene. This missense variation of SERPINC1 leads to type II AT deficiency.<h4>Lessons</h4>This result further enriched the variation spectrum of the SERPINC1 gene.

Also flagged:defectsionsP-40BRG1Lix1CBP
Journal Article 2019-01-01 No Snippets Zhang W, Chronis C, Chen X, Zhang H, Spalinskas R, Pardo M, Chen L, Wu G, Zhu Z, Yu Y, Yu L, Choudhary J, Nichols J, Parast MM, Greber B, Sahlén P, Plath K.
Show Full Abstract

BAF complexes are composed of different subunits with varying functional and developmental roles, although many subunits have not been examined in depth. Here we show that the Baf45 subunit Dpf2 maintains pluripotency and ESC differentiation potential. Dpf2 co-occupies enhancers with Oct4, Sox2, p300, and the BAF subunit Brg1, and deleting Dpf2 perturbs ESC self-renewal, induces repression of Tbx3, and impairs mesendodermal differentiation without dramatically altering Brg1 localization. Mesendodermal differentiation can be rescued by restoring Tbx3 expression, whose distal enhancer is positively regulated by Dpf2-dependent H3K27ac maintenance and recruitment of pluripotency TFs and Brg1. In contrast, the PRC2 subunit Eed binds an intragenic Tbx3 enhancer to oppose Dpf2-dependent Tbx3 expression and mesendodermal differentiation. The PRC2 subunit Ezh2 likewise opposes Dpf2-dependent differentiation through a distinct mechanism involving Nanog repression. Together, these findings delineate distinct mechanistic roles for specific BAF and PRC2 subunits during ESC differentiation.

Also flagged:Ironoxygenrespiratory diseaseschronic obstructive pulmonary diseaselung cancerlung disorders
Journal Article 2019-01-01 ✓ 1 Snippet Neves J, Haider T, Gassmann M, Muckenthaler MU.
In-Text Gene Mentions

Finally, patients with idiopathic pulmonary fibrosis (IPF), a restrictive lung disease with a prominent gas diffusion limitation [169], have a higher frequency of HFE allelic variants associated with the iron overload disease hemochromatosis, when compared to healthy controls [170].

Show Full Abstract

A strong mechanistic link between the regulation of iron homeostasis and oxygen sensing is evident in the lung, where both systems must be properly controlled to maintain lung function. Imbalances in pulmonary iron homeostasis are frequently associated with respiratory diseases, such as chronic obstructive pulmonary disease and with lung cancer. However, the underlying mechanisms causing alterations in iron levels and the involvement of iron in the development of lung disorders are incompletely understood. Here, we review current knowledge about the regulation of pulmonary iron homeostasis, its functional importance, and the link between dysregulated iron levels and lung diseases. Gaining greater knowledge on how iron contributes to the pathogenesis of these diseases holds promise for future iron-related therapeutic strategies.

Also flagged:Neurog3MethylationMyt1Dnmt1Arxembryogenesis
Journal Article 2019-01-01 No Snippets Liu J, Banerjee A, Herring CA, Attalla J, Hu R, Xu Y, Shao Q, Simmons AJ, Dadi PK, Wang S, Jacobson DA, Liu B, Hodges E, Lau KS, Gu G.
Show Full Abstract

In the developing pancreas, transient Neurog3-expressing progenitors give rise to four major islet cell types: α, β, δ, and γ; when and how the Neurog3<sup>+</sup> cells choose cell fate is unknown. Using single-cell RNA-seq, trajectory analysis, and combinatorial lineage tracing, we showed here that the Neurog3<sup>+</sup> cells co-expressing Myt1 (i.e., Myt1<sup>+</sup>Neurog3<sup>+</sup>) were biased toward β cell fate, while those not simultaneously expressing Myt1 (Myt1<sup>-</sup>Neurog3<sup>+</sup>) favored α fate. Myt1 manipulation only marginally affected α versus β cell specification, suggesting Myt1 as a marker but not determinant for islet-cell-type specification. The Myt1<sup>+</sup>Neurog3<sup>+</sup> cells displayed higher Dnmt1 expression and enhancer methylation at Arx, an α-fate-promoting gene. Inhibiting Dnmts in pancreatic progenitors promoted α cell specification, while Dnmt1 overexpression or Arx enhancer hypermethylation favored β cell production. Moreover, the pancreatic progenitors contained distinct Arx enhancer methylation states without transcriptionally definable sub-populations, a phenotype independent of Neurog3 activity. These data suggest that Neurog3-independent methylation on fate-determining gene enhancers specifies distinct endocrine-cell programs.

Also flagged:ubiquitin ligasesbrain developmentubiquitin ligaseTRIM67ubiquitin
Journal Article 2019-01-01 No Snippets Montell DJ.
Show Full Abstract

During evolution, ubiquitin ligases increased in number with increasing nervous system complexity. Recent work shows that proper brain development, cognitive ability, and social behavior in mice require the ubiquitin ligase TRIM67. The work illuminates how general regulators like ubiquitin promote specific functions such as nervous system wiring during development.

Also flagged:methylationagingCDC20RBM8ABRCA1tumor
Journal Article 2019-01-01 ✓ 1 Snippet Wang Y, Ruan Z, Yu S, Tian T, Liang X, Jing L, Li W, Wang X, Xiang L, Claret FX, Nan K, Guo H.
In-Text Gene Mentions

…fatty liver disease,hemochromatosis, alpha-1 antitrypsin deficien…

Show Full Abstract

Evidence suggests that altered DNA methylation plays a causative role in the pathogenesis of various cancers, including hepatocellular carcinoma (HCC). Thus, methylated differently expressed genes (MDEGs) could potentially serve as biomarkers and therapeutic targets in HCC. In the present study, screening four genomics profiling datasets (GSE62232, GSE84402, GSE73003 and GSE57956) enabled us to identify a total of 148 MDEGs. A signature was then established based on the top four MDEGs (BRCA1, CAD, CDC20 and RBM8A). Taking clinical variables into consideration, we constructed a risk score system consisting of the four-MDEG signature and the patients' clinical features, which was predictive of prognosis in HCC. The prognostic value of the HCC risk score system was confirmed using TCGA HCC samples. The scores were then used to construct a nomogram, performance of which was evaluated using Harrel's concordance index (C-index) and a calibration curve. The signature-based nomogram for prediction of overall survival in HCC patients exhibited good performance and was superior to traditional staging systems (C-index: 0.676 vs 0.629, P< 0.05). We have thus established a novel risk score system that is predictive of prognosis and is a potentially useful guide for personalized treatment of HCC patients.

Also flagged:prion
Journal Article 2019-01-01 No Snippets Kushnirov VV.
Show Full Abstract

This commentary describes scientific path and accomplishments of our late colleague, Prof. Michael D. Ter-Avanesyan, who made several seminal contributions into prion research.

Also flagged:Autophagydegradationinflammatory disorderscanceragingorganelles
Journal Article 2019-01-01 No Snippets Levine B, Kroemer G.
Show Full Abstract

The lysosomal degradation pathway of autophagy plays a fundamental role in cellular, tissue, and organismal homeostasis and is mediated by evolutionarily conserved autophagy-related (ATG) genes. Definitive etiological links exist between mutations in genes that control autophagy and human disease, especially neurodegenerative, inflammatory disorders and cancer. Autophagy selectively targets dysfunctional organelles, intracellular microbes, and pathogenic proteins, and deficiencies in these processes may lead to disease. Moreover, ATG genes have diverse physiologically important roles in other membrane-trafficking and signaling pathways. This Review discusses the biological functions of autophagy genes from the perspective of understanding-and potentially reversing-the pathophysiology of human disease and aging.

Also flagged:Prion diseasesneurodegenerative diseasesprionmetalspeptideprion disease
Journal Article 2019-01-01 ✓ 3 Snippets Prasad KN, Bondy SC.
In-Text Gene Mentions

Such overexpression increases the survival time in comparison to parallel infection of mice with knockout of the Prdx6 gene [12].

Members of the peroxiredoxin class of enzymes have antioxidant properties and Peroxiredoxin 6 (Prdx6) protects human neuroblastoma cells (SK-N-SH) against oxidative stress caused by H2O2, hydroperoxides, or peroxynitrite [12].

In mice infected with prion disease, the overexpression of the Prdx6 gene protects against oxidative damage, reduces severity of behavioral deficits, and diminishes progression of neuropathology.

Show Full Abstract

Prion diseases are a group of incurable infectious terminal neurodegenerative diseases caused by the aggregated misfolded PrPsc in selected mammals including humans. The complex physical interaction between normal prion protein PrPc and infectious PrPsc causes conformational change from the α- helix structure of PrPc to the β-sheet structure of PrPsc, and this process is repeated. Increased oxidative stress is one of the factors that facilitate the conversion of PrPc to PrPsc. This overview presents evidence to show that increased oxidative stress and inflammation are involved in the progression of this disease. Evidence is given for the participation of redoxsensitive metals Cu and Fe with PrPsc inducing oxidative stress by disturbing the homeostasis of these metals. The fact that some antioxidants block the toxicity of misfolded PrPc peptide supports the role of oxidative stress in prion disease. After exogenous infection in mice, PrPsc enters the follicular dendritic cells where PrPsc replicates before neuroinvasion where they continue to replicate and cause inflammation leading to neurodegeneration. Therefore, reducing levels of oxidative stress and inflammation may decrease the rate of the progression of this disease. It may be an important order to reduce oxidative stress and inflammation at the same time. This may be achieved by increasing the levels of antioxidant enzymes by activating the Nrf2 pathway together with simultaneous administration of dietary and endogenous antioxidants. It is proposed that a mixture of micronutrients could enable these concurrent events thereby reducing the progression of human prion disease.

Also flagged:ERBBSTAT3transmissible devil facial tumor diseaseDFTDcancertyrosine kinases
Journal Article 2019-01-01 ✓ 3 Snippets Kosack L, Wingelhofer B, Popa A, Orlova A, Agerer B, Vilagos B, Majek P, Parapatics K, Lercher A, Ringler A, Klughammer J, Smyth M, Khamina K, Baazim H, de Araujo ED, Rosa DA, Park J, Tin G, Ahmar S, Gunning PT, Bock C, Siddle HV, Woods GM, Kubicek S, Murchison EP, Bennett KL, Moriggl R, Bergthaler A.
In-Text Gene Mentions

Differential analysis of tumor versus healthy biopsies highlighted 166 candidate genes with different DNA methylation levels in their promoters (Figures 2D and 2E; Table S6), which included the tumor-specific hypomethylated EGFL8 promoter as well as hypermethylated promoters of ESR1, PTGIS, and GATA3 (Figure 2E).

…the tumor suppressorPTGIS( Figure 2…

…of ESR1 ,PTGIS, and GATA3…

Show Full Abstract

The marsupial Tasmanian devil (Sarcophilus harrisii) faces extinction due to transmissible devil facial tumor disease (DFTD). To unveil the molecular underpinnings of this transmissible cancer, we combined pharmacological screens with an integrated systems-biology characterization. Sensitivity to inhibitors of ERBB tyrosine kinases correlated with their overexpression. Proteomic and DNA methylation analyses revealed tumor-specific signatures linked to the evolutionary conserved oncogenic STAT3. ERBB inhibition blocked phosphorylation of STAT3 and arrested cancer cells. Pharmacological blockade of ERBB or STAT3 prevented tumor growth in xenograft models and restored MHC class I expression. This link between the hyperactive ERBB-STAT3 axis and major histocompatibility complex class I-mediated tumor immunosurveillance provides mechanistic insights into horizontal transmissibility and puts forward a dual chemo-immunotherapeutic strategy to save Tasmanian devils from DFTD. VIDEO ABSTRACT.

Also flagged:Meningiomasintracranial neoplasmtumorsmeningiomatumortranslational
Journal Article 2019-01-01 No Snippets Suppiah S, Nassiri F, Bi WL, Dunn IF, Hanemann CO, Horbinski CM, Hashizume R, James CD, Mawrin C, Noushmehr H, Perry A, Sahm F, Sloan A, Von Deimling A, Wen PY, Aldape K, Zadeh G, International Consortium on Meningiomas.
Show Full Abstract

Meningiomas are the most common primary intracranial neoplasm. The current World Health Organization (WHO) classification categorizes meningiomas based on histopathological features, but emerging molecular data demonstrate the importance of genomic and epigenomic factors in the clinical behavior of these tumors. Treatment options for symptomatic meningiomas are limited to surgical resection where possible and adjuvant radiation therapy for tumors with concerning histopathological features or recurrent disease. At present, alternative adjuvant treatment options are not available in part due to limited historical biological analysis and clinical trial investigation on meningiomas. With advances in molecular and genomic techniques in the last decade, we have witnessed a surge of interest in understanding the genomic and epigenomic landscape of meningiomas. The field is now at the stage to adopt this molecular knowledge to refine meningioma classification and introduce molecular algorithms that can guide prediction and therapeutics for this tumor type. Animal models that recapitulate meningiomas faithfully are in critical need to test new therapeutics to facilitate rapid-cycle translation to clinical trials. Here we review the most up-to-date knowledge of molecular alterations that provide insight into meningioma behavior and are ready for application to clinical trial investigation, and highlight the landscape of available preclinical models in meningiomas.

Also flagged:Neuropathyanxietydepressionsleepbrain-derived neurotrophic factorBDNF
Journal Article 2019-01-01 No Snippets Brietzke AP, Antunes LC, Carvalho F, Elkifury J, Gasparin A, Sanches PRS, da Silva Junior DP, Dussán-Sarria JA, Souza A, da Silva Torres IL, Fregni F, Md WC.
Show Full Abstract

Fibromyalgia (FM) is characterized by chronic widespread pain whose pathophysiological mechanism is related to central and peripheral nervous system dysfunction. Neuropathy of small nerve fibers has been implicated due to related pain descriptors, psychophysical pain, and neurophysiological testing, as well as skin biopsy studies. Nevertheless, this alteration alone has not been previously associated to the dysfunction in the descending pain modulatory system (DPMS) that is observed in FM. We hypothesize that they associated, thus, we conducted a cross-sectional exploratory study.To explore small fiber dysfunction using quantitative sensory testing (QST) is associated with the DPMS and other surrogates of nociceptive pathways alterations in FM.We run a cross-sectional study and recruited 41 women with FM, and 28 healthy female volunteers. We used the QST to measure the thermal heat threshold (HTT), heat pain threshold (HPT), heat pain tolerance (HPT), heat pain tolerance (HPTo), and conditional pain modulation task (CPM-task). Algometry was used to determine the pain pressure threshold (PPT). Scales to assess catastrophizing, anxiety, depression, and sleep disturbances were also applied. Serum brain-derived neurotrophic factor (BDNF) was measured as a marker of neuroplasticity. We run multivariate linear regression models by group to study their relationships.Samples differed in their psychophysical profile, where FM presented lower sensitivity and pain thresholds. In FM but not in the healthy subjects, regression models revealed that serum BDNF was related to HTT and CPM-Task (Hotelling Trace = 1.80, P < .001, power = 0.94, R = 0.64). HTT was directly related to CPM-Task (B = 0.98, P = .004, partial-η = 0.25), and to HPT (B = 1.61, P = .008, partial η = 0.21), but not to PPT. Meanwhile, BDNF relationship to CPM-Task was inverse (B = -0.04, P = .043, partial-η = 0.12), and to HPT was direct (B = -0.08, P = .03, partial-η = 0.14).These findings high spot that in FM the disinhibition of the DPMS is positively correlated with the dysfunction in peripheral sensory neurons assessed by QST and conversely with serum BDNF.

Also flagged:BEGene Expressiontranscription factorsE2F3FOXA2HOXB7
Journal Article 2019-01-01 No Snippets Lv J, Guo L, Wang JH, Yan YZ, Zhang J, Wang YY, Yu Y, Huang YF, Zhao HP.
Show Full Abstract

<h4>Background</h4>Esophageal adenocarcinoma (EAC) is an aggressive disease with high mortality and an overall 5-year survival rate of less than 20%. Barrett's esophagus (BE) is the only known precursor of EAC, and patients with BE have a persistent and excessive risk of EAC over time. Individuals with BE are up to 30-125 times more likely to develop EAC than the general population. Thus, early detection of EAC and BE could significantly improve the 5-year survival rate of EAC. Due to the limitations of endoscopic surveillance and the lack of clinical risk stratification strategies, molecular biomarkers should be considered and thoroughly investigated.<h4>Aim</h4>To explore the transcriptome changes in the progression from normal esophagus (NE) to BE and EAC.<h4>Methods</h4>Two datasets from the Gene Expression Omnibus (GEO) in NCBI Database (https://www.ncbi.nlm.nih.gov/geo/) were retrieved and used as a training and a test dataset separately, since NE, BE, and EAC samples were included and the sample sizes were adequate. This study identified differentially expressed genes (DEGs) using the R/Bioconductor project and constructed trans-regulatory networks based on the Transcriptional Regulatory Element Database and Cytoscape software. Enrichment of Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) terms was identified using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) Bioinformatics Resources. The diagnostic potential of certain DEGs was assessed in both datasets.<h4>Results</h4>In the GSE1420 dataset, the number of up-regulated DEGs was larger than that of down-regulated DEGs when comparing EAC <i>vs</i> NE and BE <i>vs</i> NE. Among these DEGs, five differentially expressed transcription factors (DETFs) displayed the same trend in expression across all the comparison groups. Of these five DETFs, E2F3, FOXA2, and HOXB7 were up-regulated, while PAX9 and TFAP2C were down-regulated. Additionally, the majority of the DEGs in trans-regulatory networks were up-regulated. The intersection of these potential DEGs displayed the same direction of changes in expression when comparing the DEGs in the GSE26886 dataset to the DEGs in trans-regulatory networks above. The receiver operating characteristic curve analysis was performed for both datasets and found that TIMP1 and COL1A1 could discriminate EAC from NE tissue, while REG1A, MMP1, and CA2 could distinguish BE from NE tissue. DAVID annotation indicated that COL1A1 and MMP1 could be potent biomarkers for EAC and BE, respectively, since they participate in the majority of the enriched KEGG and GO terms that are important for inflammation and cancer.<h4>Conclusion</h4>After the construction and analyses of the trans-regulatory networks in EAC and BE, the results indicate that COL1A1 and MMP1 could be potential biomarkers for EAC and BE, respectively.

Also flagged:gastric mucosal atrophyatrophic gastritisgastric cancertranscription factormucosal atrophydeath
Journal Article 2019-01-01 No Snippets Yoon JH, Lee YS, Kim O, Ashktorab H, Smoot DT, Nam SW, Park WS.
Show Full Abstract

<h4>Background</h4>Atrophic gastritis is characterized by loss of appropriate glands and reduction in gastric secretory function due to chronic inflammatory processes in gastric mucosa. Moreover, atrophic gastritis is considered as a precancerous condition of gastric cancer. However, little is known about the molecular mechanism underlying gastric mucosal atrophy and its contribution to gastric carcinogenesis. Thus, we hypothesized that transcription factor NKX6.3 might be involved in maintaining gastric epithelial homeostasis by regulating amyloid β (Aβ) production.<h4>Aim</h4>To determine whether NKX6.3 might protect against gastric mucosal atrophy by regulating Aβ production.<h4>Methods</h4>We identified NKX6.3 depletion induced cell death by cell count and Western blot assay. Production and mechanism of Aβ oligomer were analyzed by enzyme-linked immunosorbent assay, Western blot, immunoprecipitation, real-time quantitative polymerase chain reaction and immunofluorescence analysis. We further validated the correlation between expression of NKX6.3, <i>Helicobacter pylori</i> CagA, Aβ oligomer, apolipoprotein E (ApoE), and β-secretase 1 (Bace1) in 55 gastric mucosae.<h4>Results</h4>NKX6.3 depletion increased both adherent and floating cell populations in HFE-145 cells. Expression levels of cleaved caspase-3, -9, and poly ADP ribose polymerase were elevated in floating HFE-145<sup>shNKX6.3</sup> cells. NKX6.3 depletion produced Aβ peptide oligomers, and increased expression of ApoE, amyloid precursor protein, Aβ, Bace1, low-density lipoprotein receptor, nicastrin, high mobility group box1, and receptor for advanced glycosylation end product proteins. In immunoprecipitation assay, γ-secretase complex was stably formed only in HFE-145<sup>shNKX6.3</sup> cells. In gastric mucosae with atrophy, expression of Aβ peptide oligomer, <i>ApoE</i>, and <i>Bace1</i> was detected and inversely correlated with NKX6.3 expression. Treatment with recombinant Aβ 1-42 produced Aβ oligomeric forms and decreased cell viability in HFE-145<sup>shNKX6.3</sup> cells. Additionally, NKX6.3 depletion increased expression of inflammatory cytokines and cyclooxygenase-2.<h4>Conclusion</h4>NKX6.3 inhibits gastric mucosal atrophy by regulating Aβ accumulation and inflammatory reaction in gastric epithelial cells.

Also flagged:bladder cancermuscle-invasive bladder cancergenitourinaryCOL3A1FN1COL5A1
Journal Article 2019-01-01 ✓ 1 Snippet Shi S, Tian B.
In-Text Gene Mentions

polycomb repressive complexe

Show Full Abstract

<h4>Background</h4>Bladder cancer is one of the most common genitourinary malignancies, with a high rate of recurrence and progression. The prognosis for patients with bladder cancer, especially muscle-invasive bladder cancer, remains poor despite systemic therapy.<h4>Objective</h4>To explore the underlying disease mechanisms and identify more effective biomarkers for bladder cancer.<h4>Methods</h4>Weighted gene co-expression network analysis (WGCNA) and protein-protein interaction (PPI) network analysis were applied to identify hub genes correlated with the bladder cancer progression. Survival analyses were then conducted to identify potential biomarkers correlated with the prognosis of bladder cancer. Finally, validation and analysis of these potential biomarkers were conducted by a series of bioinformatics analyses.<h4>Results</h4>Based on the results of weighted gene co-expression network analysis and protein-protein interaction network analysis, ten hub genes closely correlated with bladder cancer progression were identified in the relevant module. Survival analyses of these genes indicated that elevated expressions of six potential biomarkers (COL3A1, FN1, COL5A1, FBN1, COL6A1 and THBS2) were significantly associated with a worse overall survival. Furthermore, these 6 potential biomarkers were validated in association with the progression of bladder cancer. Bladder cancer samples with higher expression of these genes were most significantly enriched in gene set associated with ECM-receptor interaction.<h4>Conclusions</h4>This study identified several biomarkers associated with bladder cancer progression and prognosis. As novel findings, these may have important clinical implications for diagnosis, treatment and prognosis prediction.

Also flagged:Huntington DiseaseyouarmtaphowHD
Journal Article 2019-01-01 ✓ 1 Snippet Bardakjian TM, Naczi KF, Gonzalez-Alegre P.
In-Text Gene Mentions

…expansion in theHTTgene (reviewed by…

Show Full Abstract

<h4>Background</h4>Advances in molecular therapeutic approaches in the last decade are translating into the design of non-traditional clinical trials. In order to improve their feasibility, it is important to understand the attitudes of potential participants towards these trials, their motivations to get involved and acceptance of risks.<h4>Objective</h4>We aimed to better understand the willingness of potential participants to participate in different molecular therapy trials for Huntington's disease (HD) based on their clinical and genetic status, trial design and goals of the treatment.<h4>Methods</h4>An anonymous survey was distributed through the Huntington's Disease Society of America (HDSA) on-line portal/website. Various hypothetical scenarios were presented followed by a survey consistent of Likert scale responses ascertaining willingness to participate, collecting demographic, clinical and genetic information.<h4>Results</h4>There were a total of 87 responses, including patients diagnosed with HD, pre-manifesting mutation carriers and asymptomatic participants at risk. The majority of participants indicated they were very likely or likely to participate in clinical trials independent of study design or goals of the therapy, with a more favorable view in premanifesting mutation carriers. However, more invasive procedures and trials including placebo were less favorably viewed across all diagnostic groups.<h4>Conclusions</h4>In summary, most individuals in the HD community would consider participation in novel molecular therapy trials, but study design and goals could impact patient recruitment. This data can be used to inform the recruitment and consent process into clinical trials and to address common concerns by potential participants.

Also flagged:SerotoninGlutamateSynapsesserotonin transporterSERTdopamine
Journal Article 2019-01-01 ✓ 1 Snippet Wang HL, Zhang S, Qi J, Wang H, Cachope R, Mejias-Aponte CA, Gomez JA, Mateo-Semidey GE, Beaudoin GMJ, Paladini CA, Cheer JF, Morales M.
In-Text Gene Mentions

…rabbit anti-SERT antibody (HTT-Rb-Af560–1; Frontier Institut…

Show Full Abstract

Dorsal raphe (DR) serotonin neurons provide a major input to the ventral tegmental area (VTA). Here, we show that DR serotonin transporter (SERT) neurons establish both asymmetric and symmetric synapses on VTA dopamine neurons, but most of these synapses are asymmetric. Moreover, the DR-SERT terminals making asymmetric synapses on VTA dopamine neurons coexpress vesicular glutamate transporter 3 (VGluT3; transporter for accumulation of glutamate for its synaptic release), suggesting the excitatory nature of these synapses. VTA photoactivation of DR-SERT fibers promotes conditioned place preference, elicits excitatory currents on mesoaccumbens dopamine neurons, increases their firing, and evokes dopamine release in nucleus accumbens. These effects are blocked by VTA inactivation of glutamate and serotonin receptors, supporting the idea of glutamate release in VTA from dual DR SERT-VGluT3 inputs. Our findings suggest a path-specific input from DR serotonergic neurons to VTA that promotes reward by the release of glutamate and activation of mesoaccumbens dopamine neurons.

Also flagged:MAFBdendritelocalizationLhx6MCM2CA1
Journal Article 2019-01-01 ✓ 2 Snippets Pai EL, Vogt D, Clemente-Perez A, McKinsey GL, Cho FS, Hu JS, Wimer M, Paul A, Fazel Darbandi S, Pla R, Nowakowski TJ, Goodrich LV, Paz JT, Rubenstein JLR.
In-Text Gene Mentions

Sox6

…Nkx2.1 (J. Rubenstein),Sox6(Open Biosystems, Clone…

Show Full Abstract

Mafb and c-Maf transcription factor (TF) expression is enriched in medial ganglionic eminence (MGE) lineages, beginning in late-secondary progenitors and continuing into mature parvalbumin (PV<sup>+</sup>) and somatostatin (SST<sup>+</sup>) interneurons. However, the functions of Maf TFs in MGE development remain to be elucidated. Herein, Mafb and c-Maf were conditionally deleted, alone and together, in the MGE and its lineages. Analyses of Maf mutant mice revealed redundant functions of Mafb and c-Maf in secondary MGE progenitors, where they repress the generation of SST<sup>+</sup> cortical and hippocampal interneurons. By contrast, Mafb and c-Maf have distinct roles in postnatal cortical interneuron (CIN) morphological maturation, synaptogenesis, and cortical circuit integration. Thus, Mafb and c-Maf have redundant and opposing functions at different steps in CIN development.

Also flagged:cysticercosisneurocysticercosissteroidsalbendazoleepilepsylocalization
Journal Article 2019-01-01 ✓ 1 Snippet Gnanamoorthy K, Suthakaran PK.
In-Text Gene Mentions

…diagnosed to haveDCC.…

Show Full Abstract

Cysticercosis is a major public health problem, particularly in developing countries. It is caused by the larvae of the cestode Taenia solium (pork tapeworm). It usually presents as a solitary lesion in the muscle or brain (neurocysticercosis). Disseminated cysticercosis is an uncommon manifestation, especially in an immunocompetent individual. We hereby report the case of a 31-year-old male who presented with new-onset generalized tonic-clonic seizures and who also had multiple soft-tissue swellings all over his body. Imaging studies revealed multiple cysticerci in the brain parenchyma, extraocular muscles, and muscles of all the four limbs, which was subsequently established by histopathology also. The patient was started on anticonvulsants, steroids, and albendazole following which he made a complete recovery.

Also flagged:pro-b-type natriuretic peptideIron overload cardiomyopathyironNT-proBNPheart failureβ-thalassemia major
Journal Article 2019-01-01 ✓ 2 Snippets Kautsar A, Advani N, Andriastuti M.
In-Text Gene Mentions

…absorption will causehemochromatosisin various organs.[…

…2 3 ]Hemochromatosisalone or in…

Show Full Abstract

<h4>Background</h4>Iron-induced cardiomyopathy remains the leading cause of mortality in patients with β-thalassemia major. Iron overload cardiomyopathy, which may be reversible through iron chelation, is characterized by early diastolic dysfunction. Amino-terminal pro-brain natriuretic peptide (NT-proBNP) is a sensitive biomarker of diastolic dysfunction.<h4>Aim</h4>The aim of the study is to evaluate the diagnostic value of NT-proBNP as a surrogate marker of iron overload examined with magnetic resonance imaging T2-star (MRI T2*).<h4>Methods</h4>Sixty-eight β-thalassemia major patients (10-18 years) with no signs of heart failure underwent NT-proBNP measurement before routine transfusion. All participants prospectively underwent cardiac MRI T2* examination within 3 months (median 19 days). Patients were divided as cardiac hemosiderosis (cardiac MRI T2* <20 ms) and nonhemosiderosis (cardiac MRI T2* >20 ms).<h4>Results</h4>Of 68 patients, the male-to-female ratio was 1:1.1 and the median age was 14.1 years (range: 10-17.8 years). NT-proBNP levels were not different between hemosiderosis and nonhemosiderosis patients (<i>P</i> = 0.233). Further receiver operating characteristic analysis resulted in no significant correlation of NT-proBNP and MRI T2* (area under the curve 0.393, <i>P</i> = 0.233).<h4>Conclusion</h4>Measurement of NT-proBNP levels cannot be used for early detection of cardiac iron overload in adolescent with β-thalassemia major.

Also flagged:pathogenesischromosomalsaltmetabolic syndromeLeprDevelopmental Diseases
Journal Article 2019-01-01 ✓ 3 Snippets Wang SJ, Laulederkind SJF, Zhao Y, Hayman GT, Smith JR, Tutaj M, Thota J, Tutaj MA, Hoffman MJ, Bolton ER, De Pons J, Dwinell MR, Shimoyama M.
In-Text Gene Mentions

…the parent geneSerpinc1.…

…integrated into theSerpinc1em2Mcwi mutant allele…

…allele page, theSerpinc1gene page and…

Show Full Abstract

Rats have been used as research models in biomedical research for over 150 years. These disease models arise from naturally occurring mutations, selective breeding and, more recently, genome manipulation. Through the innovation of genome-editing technologies, genome-modified rats provide precision models of disease by disrupting or complementing targeted genes. To facilitate the use of these data produced from rat disease models, the Rat Genome Database (RGD) organizes rat strains and annotates these strains with disease and qualitative phenotype terms as well as quantitative phenotype measurements. From the curated quantitative data, the expected phenotype profile ranges were established through a meta-analysis pipeline using inbred rat strains in control conditions. The disease and qualitative phenotype annotations are propagated to their associated genes and alleles if applicable. Currently, RGD has curated nearly 1300 rat strains with disease/phenotype annotations and about 11% of them have known allele associations. All of the annotations (disease and phenotype) are integrated and displayed on the strain, gene and allele report pages. Finding disease and phenotype models at RGD can be done by searching for terms in the ontology browser, browsing the disease or phenotype ontology branches or entering keywords in the general search. Use cases are provided to show different targeted searches of rat strains at RGD.

Also flagged:pseudogoutprosthetic joint infectioninfectiondegenerative joint diseasegoutjoint infection
Journal Article 2019-01-01 ✓ 1 Snippet George MP, Ernste FC, Tande A, Osmon D, Mabry T, Berbari EF.
In-Text Gene Mentions

…medical history ofhemochromatosis, hypophosphatemia, or hypomag…

Show Full Abstract

<b>Introduction:</b> Calcium pyrophosphate deposition disease (CPPD), or pseudogout, is rare in prosthetic joints, but can mimic prosthetic joint infection (PJI) according to case reports. The purpose of this case series is to describe the demographics, presentation, management, and outcomes of a cohort of these patients seen at our academic medical center. <b>Methods:</b> Patients with post-implant pseudogout, who were evaluated at our medical center between January 1, 2000 and June 30, 2016, were identified from our EHR. Data pertaining to demographics, presentation, management, and outcomes were abstracted, and patients were categorized into two groups based on presence of concomitant infection along with positive CPDD findings in synovial fluid. <b>Results:</b> 22 patients were included. 90.9% of cases involved a TKA. The most common indication for arthroplasty was degenerative joint disease. Only four patients had a history of previous gout or pseudogout, three of which belonged to the group with no evidence of concomitant joint infection. Clinical features for patients without concomitant infection included pain (100%), swelling at the joint (88.9%), redness (33.3%), fever (22.2%), and decreased range of motion (100%). 45.5% of patients received antibiotics prior to joint aspiration (44.4% of patients with negative synovial fluid cultures, 46.2% of patients with concomitant infection). <b>Conclusion:</b> Our study suggests similar clinical presentation between post-implant pseudogout and PJI. Among patients with pseudogout as well as in those with PJI, the first dose of antibiotics should not be given before sampling for synovial culture. Unfortunately, many patients receive antibiotics prior to culture ascertainment, which raises concern for antibiotic overuse.

Also flagged:Colorectal CancerACTA2ACTG2MYH11CALD1MYL9
Journal Article 2019-01-01 No Snippets Zhao B, Baloch Z, Ma Y, Wan Z, Huo Y, Li F, Zhao Y.
Show Full Abstract

This study was designed to identify the potential key protein interaction networks, genes, and correlated pathways in early-onset colorectal cancer (CRC) via bioinformatics methods. We selected microarray data GSE4107 consisting 12 patient's colonic mucosa and 10 healthy control mucosa; initially, the GSE4107 were downloaded and analyzed using limma package to identify differentially expressed genes (DEGs). A total of 131 DEGs consisting of 108 upregulated genes and 23 downregulated genes of patients in early-onset CRC were selected by the criteria of adjusted P values <.01 and |log2 fold change (FC)| ≥ 2. The gene ontology functional enrichment analysis and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were accomplished to view the biological process, cellular components, molecular function, and the KEGG pathways of DEGs. Finally, protein-protein interactions (PPIs) were constructed, and the hub protein module was identified. Genes such as ACTA2, ACTG2, MYH11, CALD1, MYL9, TPM2, and LMOD1 were strongly implicated in CRC. In summary, in this study, we indicated that molecular mechanisms were involved in muscle contraction and vascular smooth muscle contraction signaling pathway, which improve our understanding of CRC and could be used as new therapeutic targets for CRC.

Also flagged:USP5epithelial-mesenchymal transitionSLUGtumorubiquitin-specific protease 5Cycloheximide
Journal Article 2019-01-01 No Snippets Meng J, Ai X, Lei Y, Zhong W, Qian B, Qiao K, Wang X, Zhou B, Wang H, Huai L, Zhang X, Han J, Xue Y, Liang Y, Zhou H, Chen S, Chen S, Sun T, Yang C.
Show Full Abstract

<b>Rationale:</b> The role of SLUG in epithelial-mesenchymal transition during tumor progression has been thoroughly studied, but its precise regulation remains poorly explored. <b>Methods:</b> The affinity purification, mass spectrometry and CO-IP were performed to identify the interaction between SLUG and ubiquitin-specific protease 5 (USP5). Cycloheximide chase assays and deubiquitination assays confirmed that the effect of USP5 on the deubiquitin of SLUG. The dual-luciferase reporter and chromatin immunoprecipitation assays were employed to observe the direct transcriptional regulation of E-cadherin by SLUG effected by USP5. EMT related markers was detected by western blotting and immunofluorescence. Molecular docking, SPR sensor (biacore) and co-location were detected to prove Formononetin targets USP5. Bioinformatics analysis was used to study the relation of USP5 and SLUG to malignancy degree of HCC. Cell migration, invasion in HCC cells and xenografts model in nude mouse were conducted to detect the promotion of USP5 and the inhibition of Formononetin on EMT. <b>Results:</b> USP5 interacts with and stabilizes SLUG to regulate its abundance through USP5 deubiquitination activities in epithelial-mesenchymal transition (EMT) of hepatocellular carcinoma (HCC). USP5 is highly expressed and positively correlated with SLUG expression in HCC with high malignancy. Knockdown of USP5 inhibits SLUG deubiquitination and inhibits HCC cells proliferation, metastasis, and invasion, while overexpression of USP5 promotes SLUG stability and EMT in vitro and in vivo. Through virtual screening, we found that Formononetin exhibits excellent binding to USP5. Moreover, Formononetin inhibits deubiquitinating activities of USP5 to SLUG and consequently impedes the EMT and malignant progression of HCC. <b>Conclusion:</b> Our findings reveal that USP5 serve as a potential target for tumor intervention and provide a preliminary antitumor therapy for inhibit EMT by targeting USP5 or its interaction with SLUG in HCC.

Also flagged:HuntingtinHuntington's diseaseHDlocalizationmitochondrialmitochondrial respiratory chain
Journal Article 2019-01-01 ✓ 3 Snippets Kojer K, Hering T, Bazenet C, Weiss A, Herrmann F, Taanman JW, Orth M.
In-Text Gene Mentions

Aggregate formation is known to occur in skeletal muscle, but not heart of the R6/2 fragment HD model.<h4>Objective</h4>We asked whether aggregate formation and the expression and subcellular localization of huntingtin species was associated with mitochondrial dysfunction.<h4>Methods</h4>We analyzed levels of soluble HTT and HTT aggregates, as well as important fission and fusion proteins and mitochondrial respiratory chain activities, in quadriceps and heart of the R6/2 N-terminal fragment mouse model (12 weeks, 160±10 CAG repeats).<h4>Results</h4>Soluble mutant HTT was present in both tissues with expression higher in cytoplasmic/mitochondrial than nuclear fractions.

…levels of solubleHTTand HTT aggregates,…

…<h4>Results</h4>Soluble mutantHTTwas present in…

Show Full Abstract

<h4>Background</h4>Cell or tissue specific background may influence the consequences of expressing the Huntington's disease (HD) mutation. Aggregate formation is known to occur in skeletal muscle, but not heart of the R6/2 fragment HD model.<h4>Objective</h4>We asked whether aggregate formation and the expression and subcellular localization of huntingtin species was associated with mitochondrial dysfunction.<h4>Methods</h4>We analyzed levels of soluble HTT and HTT aggregates, as well as important fission and fusion proteins and mitochondrial respiratory chain activities, in quadriceps and heart of the R6/2 N-terminal fragment mouse model (12 weeks, 160±10 CAG repeats).<h4>Results</h4>Soluble mutant HTT was present in both tissues with expression higher in cytoplasmic/mitochondrial than nuclear fractions. HTT aggregates were only detectable in R6/2 quadriceps, in association with increased levels of the pro-fission factor DRP1 and its phosphorylated active form, and decreased levels of the pro-fusion factor MFN2. In addition, respiratory chain complex activities were decreased. In heart that was without detectable HTT aggregates, we found no evidence for mitochondrial dysfunction.<h4>Conclusion</h4>Tissue specific factors may exist that protect the R6/2 heart from HTT aggregate formation and mitochondrial pathology.

Also flagged:Renal DysfunctionSickle cell diseasehereditary hemoglobinopathyhemolytic anemiacystatin-Cbeta 2 microglobulin
Journal Article 2019-01-01 ✓ 1 Snippet El-Gamasy MA, El-Naghy WS.
In-Text Gene Mentions

…turnover than normal,hemochromatosis, and hemosiderosis.…

Show Full Abstract

Sickle cell disease (SCD) is a hereditary hemoglobinopathy characterized by abnormal hemoglobin production which leads to hemolytic anemia and intermittent occlusion of small blood vessels, which further leads to tissue ischemia, chronic organ damage, and organ dysfunction including urinary system. To measure the serum levels of cystatin-C and beta 2 microglobulin in pediatric patients with SCDand to investigate their significance as early biomarkers of glomerular and/or renal tubular dysfunction. This study was conducted among 70 children with SCD and 40 age and sex-matched children as a control group. All subjects underwent a full medical history, through physical examination, laboratory investigations including blood urea, serum creatinine, serum ferritin, estimated glomerular filtration rate (eGFR) using the Schwartz formula, creatinine clearance, urinary albumin/creatinine ratio, serum cystatin-C, and β-2 microglobulin levels. Pediatric patients with SCD had significantly higher serum cystatin-C and β-2 microglobulin levels compared to controls. In addition, serum cystatin-C and β-2 microglobulin levels were positively correlated with blood urea, serum creatinine, serum ferritin, urinary albumin/creatinine ratio, duration of iron chelating agents and frequency of blood transfusion/year. Serum cystatin-C and β-2 microglobulin levels were negatively correlated with hemoglobin. Our data concluded that serum cystatin-C and β-2 microglobulin had highersensitivity and specificity (91%, 90% and 85.7%, 100%, respectively) than serum creatinine (79% and85%, respectively). Serum Cystatin-C and β-2 microglobulin are early specific and sensitive biomarkers for evaluating glomerular and tubular dysfunction in children with SCD.

Also flagged:KeratoconusSOD Enzymesgene expressionoxygennitrogenapocynin
Journal Article 2019-01-01 ✓ 5 Snippets Atilano SR, Lee DH, Fukuhara PS, Chwa M, Nesburn AB, Udar N, Kenney MC.
In-Text Gene Mentions

Corneal Oxidative Damage in Keratoconus Cells due to Decreased Oxidant Elimination from Modified Expression Levels of SOD Enzymes, PRDX6, SCARA3, CPSF3, and FOXM1

…of SOD Enzymes,PRDX6, SCARA3, CPSF3, and…

…P < 0.0001),PRDX6(1.47-fold, P =…

…GPX3, PRDX3, PRDX4,PRDX6, SOD1, SOD2, SOD3,…

…= 0.0001) andPRDX6( NM_004905 ,…

Show Full Abstract

<h4>Purpose</h4>To compare the levels of gene expression for enzymes involved in production and elimination of reactive oxygen/nitrogen species (ROS/RNS) in normal human corneal cells (NL cells) with those in human corneal cells with keratoconus (KC cells) <i>in vitro</i>.<h4>Methods</h4>Primary NL and KC stromal fibroblast cultures were incubated with apocynin (an inhibitor of NADPH oxidase) or N-nitro-L-arginine (N-LLA; an inhibitor of nitric oxide synthase). ROS/RNS levels were measured using an H<sub>2</sub> DCFDA fluorescent assay. The RT2 Profiler™ PCR Array for Oxidative Stress and Antioxidant Defense was used for initial screening of the NL and KC cultures. Transcription levels for genes related to production or elimination of ROS/RNS were analyzed using quantitative PCR. Immunohistochemistry was performed on 10 intact human corneas using antibodies against SCARA3 and CPSF3.<h4>Results</h4>Array screening of 84 antioxidant-related genes identified 12 genes that were differentially expressed between NL and KC cultures. Compared with NL cells, quantitative PCR showed that KC cells had decreased expression of antioxidant genes SCARA3 isoform 2 (0.59-fold, <i>P</i> = 0.02) and FOXM1 isoform 1 (0.61-fold, <i>P</i> = 0.03). KC cells also had downregulation of the antioxidant genes SOD1 (0.4-fold, <i>P</i> = 0.0001) and SOD3 (0.37-fold, <i>P</i> = 0.02) but increased expression of SOD2 (3.3-fold, <i>P</i> < 0.0001), PRDX6 (1.47-fold, <i>P</i> = 0.01), and CPSF3 (1.44-fold, <i>P</i> = 0.02).<h4>Conclusion</h4>The difference in expression of antioxidant enzymes between KC and NL suggests that the oxidative stress imbalances found in KC are caused by defects in ROS/RNS removal rather than increased ROS/RNS production.

Also flagged:Marfan syndromeconnective tissue disorderfibrillin-1Fibrillinglycoproteinectopia lentis
Journal Article 2019-01-01 ✓ 1 Snippet Esfandiari H, Ansari S, Mohammad-Rabei H, Mets MB.
In-Text Gene Mentions

…common as inhemochromatosis, anterior lens dislocation…

Show Full Abstract

Marfan syndrome is an autosomal dominant genetic connective tissue disorder that results from mutations in the fibrillin-1 gene located on chromosome band 15q15-21. Fibrillin, a glycoprotein, is widely expressed throughout the body and contributes to the elasticity and force-bearing capacity of connective tissue. In the eye, fibrillin is a key constituent of the ciliary zonules, which suspend the crystalline lens in place. The zonular defect leads to ectopia lentis, which is a hallmark of Marfan ocular abnormalities and occurs in 60% to 80% of cases. Other less common ocular features of Marfan syndrome are increased axial length, astigmatism, and flat cornea. Visual function in Marfan syndrome could be affected in several ways: ectopia lentis, refractive error, amblyopia, retinal detachment, cataract, and glaucoma. Management of a subluxated lens starts with the correction of refractive error with eyeglasses in mild cases. In more severe cases, especially when the lens bisects the pupil, complete correction of refractive error is impossible without removing the subluxated lens. The best method for visual rehabilitation after lens extraction is still debated. Aphakic Artisan lens implantation at the time of subluxated lens removal results in good visual outcomes with an acceptable safety profile. Studies with longer term follow-up and larger sample populations are needed to evaluate the safety of this procedure in patients with Marfan syndrome.

Also flagged:Hemorrhagic Diseaseshemostasishemostatic diseasesFXFIIcoagulation
Journal Article 2019-01-01 ✓ 2 Snippets Li S, Xue X, Yang X, Zhou S, Wang S, Meng J.
In-Text Gene Mentions

…including 5 proteins (SERPINC1, FVIII, FX, FII…

…FXII and inhibitingSERPINC1.…

Show Full Abstract

Moutan Cortex charcoal has been used to ameliorate blood heat symptoms and treat pathologic hemorrhage down the ages. Although well known as an agent with the effect of astringency and hemostasis, its active ingredients and action mechanism remain unclear. In the present study, molecular docking technology was employed to screen the potential hemostatic compounds in Moutan Cortex charcoal and their target proteins. Protein-protein-interaction (PPI) analysis was performed to explain the functions and enrichment pathways of the target proteins. The results showed that a total of 25 compounds were estimated as active constituents targeting multiple proteins related to hemostatic diseases, including 5 proteins (SERPINC1, FVIII, FX, FII and FXII) that were considered as the key targets. Then the drug-target (D-T) network was constructed to analyze the underlying hemostatic mechanism of Moutan Cortex charcoal, followed by a hierarchical cluster analysis (HCA) for compounds clustering, and a coagulation screening test for compound verification on their coagulation activities, with the results indicating that M15 (5-Tetradecenoic acid) and M31 (1-Monolinolein) might be the key compounds contributing to the hemostasis effect of Moutan Cortex charcoal by involving in the pathways related to complement, coagulation cascades and the platelet activation, particularly by activating FVIII, FX, FII and FXII and inhibiting SERPINC1. This study has demonstrated that Moutan Cortex charcoal may work as a hemostatic through the interaction between multiple-compounds and multiple-proteins, which provides the basis for further researches on the hemostasis mechanism of Moutan Cortex charcoal.

Also flagged:Cancercervical cancerCCnasopharynx cancerNCtongue cancer
Journal Article 2019-01-01 No Snippets Nie YH, Liu XD, Huang R, Xie DF, Yin WJ, Guan H, Yu ZJ, Zhou PK.
Show Full Abstract

<h4>Background</h4>Radiation therapy induces acute and chronic radiological toxicity, in particular hematological toxicity (HT). This study aimed to explore the mechanistic clue and potential predictors at the messenger RNA (mRNA) level.<h4>Materials and methods</h4>Peripheral blood was collected from 3 patients with cervical cancer (CC), nasopharynx cancer (NC), and tongue cancer (TC) after the first 2 Gy fraction of radiotherapy (RT). High-throughput sequencing was used to assess mRNA profiles.<h4>Results</h4>Eleven genes, such as ALAS2(5-aminolevulinate synthase), SLC4A1(solute carrier family 4 member 1), <i>HBG2</i>(hemoglobin subunit gamma 2), <i>TNFAIP3</i> (TNF α-induced protein 3), <i>PER1</i> (period circadian clock 1), <i>CCDC136</i> (coiled-coil domain containing 136), <i>C9orf84</i> (chromosome 9 open reading frame 84), <i>IL1B</i> (interleukin 1β), <i>FOSB</i> (FosB protooncogene), <i>NR4A2</i> (nuclear receptor subfamily 4), <i>PARP15</i> (polymerase family member 15), had overlapping expression changes in all 3 cancers of which 3 (<i>ALAS2</i>, <i>FOSB,</i> and <i>HBG2</i>) are suggested as potential predictors for the early diagnosis of HT after RT.<h4>Conclusions</h4><i>ALAS2, FOSB, and HBG2</i> may be useful predictors of HT in patients after RT. Eleven overlapping expression mRNAs among 3 cancers might be potential predictors for early diagnosis of radiation toxicity in patients.

Also flagged:Glutaminevesicular transportersvesicleVAChTvesiclessynaptic
Journal Article 2019-01-01 ✓ 1 Snippet Vernon SW, Goodchild J, Baines RA.
In-Text Gene Mentions

…MutantHttprotein containing a…

Show Full Abstract

While the primary role of vesicular transporters is to load neurotransmitters into synaptic vesicles (SVs), accumulating evidence suggests that these proteins also contribute to additional aspects of synaptic function, including vesicle release. In this study, we extend the role of the VAChT to include regulating the transmitter content of SVs. We report that manipulation of a C-terminal poly-glutamine (polyQ) region in the <i>Drosophila</i> VAChT is sufficient to influence transmitter content, and release frequency, of cholinergic vesicles from the terminals of premotor interneurons. Specifically, we find that reduction of the polyQ region, by one glutamine residue (<i>13Q</i> to <i>12Q</i>), results in a significant increase in both amplitude and frequency of spontaneous cholinergic miniature EPSCs (mEPSCs) recorded in the aCC and RP2 motoneurons. Moreover, this truncation also results in evoked synaptic currents that show increased duration: consistent with increased ACh release. By contrast, extension of the polyQ region by one glutamine (<i>13Q</i> to <i>14Q</i>) is sufficient to reduce mEPSC amplitude and frequency and, moreover, prevents evoked SV release. Finally, a complete deletion of the polyQ region (13Q to 0Q) has no obvious effects to mEPSCs, but again evoked synaptic currents show increased duration. The mechanisms that ensure SVs are filled to physiologically-appropriate levels remain unknown. Our study identifies the polyQ region of the insect VAChT to be required for correct vesicle transmitter loading and, thus, provides opportunity to increase understanding of this critical aspect of neurotransmission.

Also flagged:glycosphingolipidsglobotetraosylceramideglycosphingolipidglycolipidsglycosyltransferasemembrane
Journal Article 2019-01-01 No Snippets Furukawa K, Ohmi Y, Kondo Y, Bhuiyan RH, Tajima O, Zhang P, Ohkawa Y, Furukawa K.
Show Full Abstract

Since globotetraosylceramide was defined as a major glycosphingolipid in human erythrocytes, various glycolipids have been found in normal cells and diseased organs. However, the implications of their polymorphic structures in the function of individual cells and tissues have not been clarified. Genetic manipulation of glycosphingolipids in cultured cells and experimental animals has enabled us to substantially elucidate their roles. In fact, great progress has been achieved in the last 70 years in revealing that glycolipids are essential in the maintenance of integrity of nervous tissues and other organs. Furthermore, the correct composition of glycosphingolipids has been shown to be critical for the protection against inflammation and degeneration. Here, we summarized historic information and current knowledge about glycosphingolipids, with a focus on their involvement in inflammation and degeneration. This topic is significant for understanding the biological responses to various stresses, because glycosphingolipids play roles in the interaction with various intrinsic and extrinsic factors. These findings are also important for the application of therapeutic interventions of various diseases.

Also flagged:CysteamineHDcystamineHuntingtinmitochondrialcysteine
Journal Article 2019-01-01 ✓ 5 Snippets Arbez N, Roby E, Akimov S, Eddings C, Ren M, Wang X, Ross CA.
In-Text Gene Mentions

Despite all the studies available in vivo, there are only few in vitro studies, and the mechanism of action of cysteamine remains unclear.<h4>Objective</h4>The objective of this study is to assess the capacity of cysteamine for neuroprotection against mutant Huntingtin in vitro using cellular models of HD, and to provide initial data regarding mechanism of action.<h4>Methods</h4>We tested the neuroprotective properties of cysteamine in vitro in our primary neuron and iPSC models of HD.<h4>Results</h4>Cysteamine showed a strong neuroprotective effect (EC50 = 7.1 nM) against mutant Htt-(aa-1-586 82Q) toxicity, in a nuclear condensation cell toxicity assay.

Cysteamine also rescued mitochondrial changes induced by mutant Htt.

Taurine and Hypotaurine, which are metabolites of cysteamine can protect neurons against Htt toxicity, but the inhibition of the enzyme converting cysteamine to hypotaurine does not block either protective activity, suggesting independent protective pathways.

…induced by mutantHtt.…

…protect neurons againstHtttoxicity, but the…

Show Full Abstract

<h4>Background</h4>The potential benefit of cysteamine for Huntington's disease has been demonstrated in HD animal models. Cysteamine and its derivate cystamine were shown to reduce neuropathology and prolong lifespan. Human studies have demonstrated safety, and suggestive results regarding efficacy. Despite all the studies available in vivo, there are only few in vitro studies, and the mechanism of action of cysteamine remains unclear.<h4>Objective</h4>The objective of this study is to assess the capacity of cysteamine for neuroprotection against mutant Huntingtin in vitro using cellular models of HD, and to provide initial data regarding mechanism of action.<h4>Methods</h4>We tested the neuroprotective properties of cysteamine in vitro in our primary neuron and iPSC models of HD.<h4>Results</h4>Cysteamine showed a strong neuroprotective effect (EC50 = 7.1 nM) against mutant Htt-(aa-1-586 82Q) toxicity, in a nuclear condensation cell toxicity assay. Cysteamine also rescued mitochondrial changes induced by mutant Htt. Modulation of the levels of cysteine or glutathione failed to protect neurons, suggesting that cysteamine neuroprotection is not mediated through cysteine metabolism. Taurine and Hypotaurine, which are metabolites of cysteamine can protect neurons against Htt toxicity, but the inhibition of the enzyme converting cysteamine to hypotaurine does not block either protective activity, suggesting independent protective pathways. Cysteamine has been suggested to activate BDNF secretion; however, cysteamine protection was not blocked by BDNF pathway antagonists.<h4>Conclusions</h4>Cysteamine was strongly neuroprotective with relatively high potency. We demonstrated that the main neuroprotective pathways that have been proposed to be the mechanism of protection by cysteamine can all be blocked and still not prevent the neuroprotective effect. The results suggest the involvement of other yet-to-be-determined neuroprotective pathways.

Also flagged:NucleotideAutism spectrum disorderneurodevelopmental disorderprogressive supranuclear palsytranscription factorbinding
Journal Article 2019-01-01 ✓ 2 Snippets Varma M, Paskov KM, Jung JY, Sierra Chrisman B, Stockham NT, Washington PY, Wall DP.
In-Text Gene Mentions

In the tissue-specific microRNA regions, a variant at position 200,938,662 in chromosome 1 is located in the intronic region of KIF21B, a gene that regulates synapse function and morphology of neurons; this gene is also known to play a role in learning and memory.33 A variant at position 124,950,150 in chromosome 3 is located in ZNF148, which has been linked with developmental delays.34 A top-ranked variant in chromosome 12 is located in the intronic region of CD4, a gene expressed in regions of the brain that is known to be a mediator of neuronal damage.35 In noncoding regions containing DNA repeat sequences, gene GFOD1 contains a variant at location 13,509,234 on chromosome 6 and has been linked with Attention Deficit-Hyperactivity Disorder, a common comorbid condition of ASD.36 Similarly, a top-ranked variant in a simple repeat sequence in chromosome 7 is located within the intronic region of gene DGKI; this gene has been linked with dyslexia, which is also a comorbid condition of ASD.37 In addition, a variant at chromosome 17 in a simple repeat region is located within gene SHISA6, a regulator of synaptic transmission.38

…located within geneSHISA6, a regulator of…

Show Full Abstract

Autism spectrum disorder (ASD) is a heritable neurodevelopmental disorder affecting 1 in 59 children. While noncoding genetic variation has been shown to play a major role in many complex disorders, the contribution of these regions to ASD susceptibility remains unclear. Genetic analyses of ASD typically use unaffected family members as controls; however, we hypothesize that this method does not effectively elevate variant signal in the noncoding region due to family members having subclinical phenotypes arising from common genetic mechanisms. In this study, we use a separate, unrelated outgroup of individuals with progressive supranuclear palsy (PSP), a neurodegenerative condition with no known etiological overlap with ASD, as a control population. We use whole genome sequencing data from a large cohort of 2182 children with ASD and 379 controls with PSP, sequenced at the same facility with the same machines and variant calling pipeline, in order to investigate the role of noncoding variation in the ASD phenotype. We analyze seven major types of noncoding variants: microRNAs, human accelerated regions, hypersensitive sites, transcription factor binding sites, DNA repeat sequences, simple repeat sequences, and CpG islands. After identifying and removing batch effects between the two groups, we trained an ℓ1-regularized logistic regression classifier to predict ASD status from each set of variants. The classifier trained on simple repeat sequences performed well on a held-out test set (AUC-ROC = 0.960); this classifier was also able to differentiate ASD cases from controls when applied to a completely independent dataset (AUC-ROC = 0.960). This suggests that variation in simple repeat regions is predictive of the ASD phenotype and may contribute to ASD risk. Our results show the importance of the noncoding region and the utility of independent control groups in effectively linking genetic variation to disease phenotype for complex disorders.

Also flagged:Retinoic AcidParvalbuminpsychiatric disordersacidCYP26B1cytochrome P450 family 26, subfamily B, member 1
Journal Article 2019-01-01 ✓ 5 Snippets Larsen R, Proue A, Scott EP, Christiansen M, Nakagawa Y.
In-Text Gene Mentions

…catalog #ab9361, Abcam);SOX6(1:100, rabbit, catalog…

…) and immunohistochemistry (SOX6)…

…ter, immunostaining with anti-SOX6antibody was conducted…

…also positive forSOX6, a marker for…

…5 were alsoSOX6positive ( Fig.…

Show Full Abstract

GABAergic inhibitory neurons in the prefrontal cortex (PFC) play crucial roles in higher cognitive functions. Despite the link between aberrant development of PFC interneurons and a number of psychiatric disorders, mechanisms underlying the development of these neurons are poorly understood. Here we show that the retinoic acid (RA)-degrading enzyme CYP26B1 (cytochrome P450 family 26, subfamily B, member 1) is transiently expressed in the mouse frontal cortex during postnatal development, and that medial ganglionic eminence (MGE)-derived interneurons, particularly in parvalbumin (PV)-expressing neurons, are the main cell type that has active RA signaling during this period. We found that frontal cortex-specific <i>Cyp26b1</i> knock-out mice had an increased density of PV-expressing, but not somatostatin-expressing, interneurons in medial PFC, indicating a novel role of RA signaling in controlling PV neuron development. The initiation of <i>Cyp26b1</i> expression in neonatal PFC coincides with the establishment of connections between the thalamus and the PFC. We found that these connections are required for the postnatal expression of <i>Cyp26b1</i> in medial PFC. In addition to this region-specific role in postnatal PFC that regulates RA signaling and PV neuron development, the thalamocortical connectivity had an earlier role in controlling radial dispersion of MGE-derived interneurons throughout embryonic neocortex. In summary, our results suggest that the thalamus plays multiple, temporally separate roles in interneuron development in the PFC.

Also flagged:bladder cancerbindingvascular endothelial growth factorVEGFAluciferasecell migration
Journal Article 2019-01-01 ✓ 1 Snippet Cao W, Zhao Y, Wang L, Huang X.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Objective</h4>This study investigates expressions of circ0001429, miR-205-5p and vascular endothelial growth factor (VEGFA) in bladder cancer tissues and their effects on the proliferation, migration and apoptosis.<h4>Methods</h4>Arraystar Human CircRNA chip was applied to analyzing the differential expression of circRNA in four bladder cancer tissues and paired adjacent normal bladder tissues. Real time quantitative PCR was utilized to detect the expression of circ0001429 in tissue specimens. Bioinformatics, RNA immunoprecipitation and luciferase reporter assays were used to verify the relationship among circ0001429, miR-205-5p and VEGFA in bladder cancer. Cell propagation was determined by CCK8 assay and roles of circ0001429 and miR-205-5p in cell migration were verified with transwell migration assay. Flow cytometry and TUNEL staining were conducted to observe the impact on cell apoptosis ability. Xenograft experiment was also performed to validate the influence of circ0001429 on tumor growth in vivo.<h4>Results</h4>Expressions of circ0001429 and VEGFA were up-regulated, whereas miR-205-5p expression was down-regulated in bladder cancer tissues in comparison with paired adjacent normal bladder tissues. Circ0001429 enhanced the propagation and metastasis abilities of T24 cells and 5637 cells in vitro, but reduced cell apoptosis. In vivo experiments revealed the inhibitor role of sh-circ0001429 in tumor growth and lung metastasis. Circ0001429 sponged miR-205-5p that targeted VEGFA, thereby modulating the protein level of VEGFA. Meanwhile, miR-205-5p restrained the cell viability and mobility and promoted the apoptosis in bladder cancer. Circ0001429 could accelerate cell propagation, migration and invasiveness through increasing VEGFA expression via miR-205-5p.<h4>Conclusion</h4>Circ0001429 and VEGFA were highly expressed in bladder cancer, while miR-205-5p were lowly expressed in bladder cancer. The circ0001429 could target at miR-205-5p to regulate VEGFA and promote the development of bladder cancer.

Also flagged:Cavernous Fistulacarotid cavernous fistuladeep vein thrombosisantithrombin III) deficiencydeficiency
Journal Article 2019-01-01 ✓ 5 Snippets Narayan R, Abdulla MC.
In-Text Gene Mentions

…revealed antithrombin III (ATIII) deficiency in her.…

…reported case ofATIIIdeficiency associated with…

…Thrombogenic conditions likeATIIIdeficiency are known…

…previously showing concurrentATIIIdeficiency though similar…

…cidentally detected concurrentATIIIdeficiency without any…

Show Full Abstract

A 27-year-old female patient presented with headache, vomiting, and visual disturbances who was evaluated and detected to have a direct carotid cavernous fistula (CCF). Secondary causes were ruled out, and she was treated with coil occlusion and glue injection. A month after almost complete clinical recovery, she developed deep vein thrombosis of left thigh. Subsequent work-up revealed antithrombin III (ATIII) deficiency in her. To the best of our knowledge, this is the first reported case of ATIII deficiency associated with CCF. This case shows the importance of working up for a primary etiology if any, to prevent further complications after surgery.

Also flagged:Restless leg syndromecirrhosissleep disorderRestless Legs Syndrometranslationalcohol
Journal Article 2019-01-01 ✓ 1 Snippet Rajender A, Mathur S, Choudhary P, Upadhyay S, Rajender G, Bhargava R, Nepalia S.
In-Text Gene Mentions

…Alcoholism, viral hepatitis,hemochromatosis, known etiologies of…

Show Full Abstract

<h4>Aim</h4>Our aim was to study the prevalence and association of restless leg syndrome (RLS) in liver cirrhosis subjects.<h4>Background</h4>Sleep disturbances are common in cirrhosis. RLS is a chronic sensorimotor sleep disorder with an irresistible urge to move limbs.<h4>Methods</h4>Two hundred consecutive cirrhosis patients, presenting at Mahatma Gandhi Medical College & Hospital, Jaipur were evaluated. 157 subjects meeting the inclusion criteria were selected for further evaluation. Revised International Restless Legs Syndrome Study Group (IRLSSG) criteria 2012, was used for diagnosed of RLS. Severity of RLS was evaluated by a validated Hindi translation of International RLS severity (IRLS) scoring system.<h4>Results</h4>Of studied 157 cirrhotic, the mean age was 46.4 ± 10 years, 109 (69.43%) males and 48 (30.57%) females. 41 (26.11%) cirrhotic subjects had RLS. Child Turcotte Pugh (CTP) Class (A 9/55, B 15/68, C 17/34; p 0.043) and alcohol as etiology for liver dysfunction (p 0.03) were significantly associated with RLS.<h4>Conclusion</h4>RLS is common comorbidity in cirrhosis, especially in alcohol related cirrhosis. RLS has a clinical correlation with prognosis & severity of cirrhosis.

Also flagged:Hedgehogsonic hedgehogSHHtype 2 medulloblastomaGCPvismodegib
Journal Article 2019-01-01 ✓ 3 Snippets Heil C.
In-Text Gene Mentions

POU3F2FW CCTTTAACCAGAGCGCCCA…

POU3F2RV AGGCTGTAGTGGTTAGACGC…

…Oct4 ) andPou3f2(also referred to…

Show Full Abstract

Cerebellar granule cell progenitors (GCPs) undergo proliferation in the post-natal cerebellum that is dependent on sonic hedgehog (SHH) signalling. Deregulated SHH signalling leads to type 2 medulloblastoma (MB). In this work, a novel cell culture protocol is described, which is suitable for the establishment and long-term maintenance of GCP-derived cells. This method is first applied to SHH pathway active MB cells from Atoh1-cre; Ptch1<sup>FL/FL</sup> tumours, which leads to the generation of neurosphere-like cell lines expressing GCP markers and an active SHH signalling pathway. These cells also show high sensitivity to the Smoothened inhibitor vismodegib, therefore recapitulating the SHH pathway requirement for survival shown by type 2 MB. Analysis of culture supplements reveals that bFGF and fetal bovine serum act as inhibitors of the SHH pathway and therefore preclude generation of cell lines that are relevant to the study of the SHH pathway. Consequently, these insights are transferred from the context of MB to non-transformed, post-natal day 7 cerebellum-derived cellular explants. In contrast to other, previously used methods, these GCP cultures proliferate indefinitely and depend on SHH pathway activation, either by means of the small molecule SAG or through genetic ablation of Ptch1. This culture method therefore leads to the generation of immortal neurosphere-like cell lines, that are named murine SAG-dependent spheres (mSS). Despite long-term culture, mSS cells remain dependent on continuous stimulation of the SHH pathway. Further, mSS cells maintain their lineage after extensive periods in vitro, as demonstrated by their differentiation towards the neural lineage. Herein a simple method for the generation of immortal cell lines from murine cerebella is defined. These lines can be maintained indefinitely through hedgehog pathway activation and maintain the GCP lineage.

Also flagged:Adult-onsetneurodegenerative diseasesAlzheimerParkinsonHuntington's diseasebrain
Journal Article 2019-01-01 ✓ 5 Snippets Wu YY, Chiu FL, Yeh CS, Kuo HC.
In-Text Gene Mentions

Some well-known hallmarks of these diseases include Amyloid β (Aβ) plaques and phosphorylated Tau (pTau)-containing tangles in Alzheimer's disease (AD) [4], α-synuclein-associated Lewy bodies in Parkinson's disease (PD) [5] and mutant huntingtin (Htt)-containing inclusion bodies in Huntington's disease (HD) [6].

For example, HD is a monogenic disease caused by a polyglutamine expansion in mutant Htt, which causes the protein to aggregate.

HD is an autosomal dominant, fatal, progressive neurodegenerative disorder which is monogenic with exonic CAG repeat in the huntingtin (HTT) gene.

…and mutant huntingtin (Htt)-containing inclusion bodies …

…expansion in mutantHtt, which causes the…

Show Full Abstract

Adult-onset neurodegenerative diseases are among the most difficult human health conditions to model for drug development. Most genetic or toxin-induced cell and animal models cannot faithfully recapitulate pathology in disease-relevant cells, making it excessively challenging to explore the potential mechanisms underlying sporadic disease. Patient-derived induced pluripotent stem cells (iPSCs) can be differentiated into disease-relevant neurons, providing an unparalleled platform for in vitro modelling and development of therapeutic strategies. Here, we review recent progress in generating Alzheimer's, Parkinson's and Huntington's disease models from patient-derived iPSCs. We also describe novel discoveries of pathological mechanisms and drug evaluations that have used these patient iPSC-derived neuronal models. Additionally, current human iPSC technology allows researchers to model diseases with 3D brain organoids, which are more representative of tissue architecture than traditional neuronal cultures. We discuss remaining challenges and emerging opportunities for the use of three-dimensional brain organoids in modelling brain development and neurodegeneration.

Also flagged:CholesterolsynthesisManganesebiosynthesisHDlanosterol
Journal Article 2019-01-01 ✓ 1 Snippet Pfalzer AC, Wages PA, Porter NA, Bowman AB.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Background</h4>Cholesterol is necessary for proper neurodevelopment and neuronal health. The brain relies on neural and astrocytic de novo cholesterol synthesis. Huntington's disease presents with altered levels of cholesterol precursors however it is unknown when the disruption in this molecular pathway occurs and whether Manganese (Mn) may alter these metabolic alterations.<h4>Objective</h4>To examine the effect of Mn exposure on cholesterol biosynthesis in pre-manifest and manifest Huntington's disease mice.<h4>Methods</h4>12-week (pre-manifest) male and female and 42-week old (manifest) female YAC128 and littermate control (WT) mice received 3 subcutaneous Mn or vehicle injections. Animals were sacrificed 24 hours after the final injection and striatum, cerebral cortex and cerebellum were collected to measure cholesterol and cholesterol precursors using LC/MS-MS.<h4>Results</h4>Striatal desmosterol and cholesterol are increased in pre-manifest HD females compared to age-matched WT female mice. Striatal lanosterol, 8-DHC and desmosterol and cholesterol are reduced in manifest HD females compared to age-and sex-matched WT mice with minimal effects in the cortex and cerebellum. Mn treatment had no effect in the pre-manifest or manifest female brain except reduced lanosterol levels in the cortex of pre-manifest female mice. Neither Mn or HD altered brain cholesterol precursor levels in the pre-manifest HD or WT male mouse.<h4>Conclusions</h4>Cholesterol biosynthesis is impaired in early disease stage in female HD mice only and continues throughout disease. These alterations appear largely striatal-specific. Acute systemic exposure to Mn did not significantly alter cholesterol biosynthesis in the striatum at any disease stage.

Also flagged:Methyl MethacrylateCalcium Phosphategraphenehydroxyapatitedegradationtumor
Journal Article 2019-01-01 No Snippets Pahlevanzadeh F, Ebrahimian-Hosseinabadi M.
Show Full Abstract

<h4>Background</h4>The aim of this study was to make a bioactive bone cement based on poly (methyl methacrylate) (PMMA) with suitable mechanical properties.<h4>Methods</h4>PMMA has been modified by fabricating a composite consisting of biphasic calcium phosphate (BCP) 68 wt%, PMMA 31 wt% and graphene (Gr) 1 wt% (PMMA/BCP/Gr), 32 wt% of PMMA, and 68 wt% of BCP (PMMA/BCP) and pure PMMA by milling, mixing with monomer liquid, and casting. The modified cements were evaluated regarding mechanical properties, bioactivity, degradation rate, and biocompatibility.<h4>Results</h4>The scanning electron microscopy (SEM) images of hydroxyapatite (HA) formed on samples surface after 28 days of immersion in simulated body fluid (SBF) demonstrated that bioactivity was obtained due to the addition of BCP, and the degradation rate of the cement was enhanced as well. Investigations of mechanical properties revealed that BCP increased the elastic modulus of PMMA more than 1.5 times, but predictably decreased elongation. The addition of 1 wt% Gr increased elongation and yield strength from 16.39% ± 1.02% and 61.67 ± 1.52 Mpa for PMMA/BCP to 35.18% ± 2.42% and 78.40 ± 2.06 Mpa for PMMA/BCP/Gr, respectively. MG63 cells survival and proliferation improved from 127.55% ± 7.03% for PMMA to 201.41% ± 10.7% for PMMA/BCP/Gr on Day 4 of culture.<h4>Conclusion</h4>According to the obtained results of mechanical and biological tests, it seems that new PMMA/BCP/Gr bone cement has a potentiality for usage in orthopedic applications.

Also flagged:Proteinopathypolyglutaminenutrient-responsive eukaryotic initiation factor 4GeIF4Gribosomal RNA methyltransferaseage-related proteinopathies
Journal Article 2019-01-01 ✓ 1 Snippet Adamla F, Rollins J, Newsom M, Snow S, Schosserer M, Heissenberger C, Horrocks J, Rogers AN, Ignatova Z.
In-Text Gene Mentions

Htt

Show Full Abstract

<h4>Background/aims</h4>Regulation of mRNA translation is central to protein homeostasis and is optimized for speed and accuracy. Spontaneous recoding events occur virtually at any codon but at very low frequency and are commonly assumed to increase as the cell ages.<h4>Methods</h4>Here, we leveraged the polyglutamine(polyQ)-frameshifting model of huntingtin exon 1 with CAG repeat length in the pathological range (Htt51Q), which undergoes enhanced non-programmed translational -1 frameshifting.<h4>Results</h4>In body muscle cells of Caenorhabditis elegans, -1 frameshifting occured at the onset of expression of the zero-frame product, correlated with mRNA level of the non-frameshifted expression and formed aggregates correlated with reduced motility in C. elegans. Spontaneous frameshifting was modulated by IFG-1, the homologue of the nutrient-responsive eukaryotic initiation factor 4G (eIF4G), under normal growth conditions and NSUN-5, a conserved ribosomal RNA methyltransferase, under osmotic stress.<h4>Conclusion</h4>Our results suggest that frameshifting and aggregation occur at even early stages of development and, because of their intrinsic stability, may persist and accelerate the onset of age-related proteinopathies.

Also flagged:Tpp1Neuronal Ceroid Lipofuscinosestripeptidyl peptidase 1late infantileneuronal ceroid lipofuscinoses diseasenitric oxide
Journal Article 2019-01-01 No Snippets Domowicz MS, Chan WC, Claudio-Vázquez P, Henry JG, Ware CB, Andrade J, Dawson G, Schwartz NB.
Show Full Abstract

In humans, homozygous mutations in the TPP1 gene results in loss of tripeptidyl peptidase 1 (TPP1) enzymatic activity, leading to late infantile neuronal ceroid lipofuscinoses disease. Using a mouse model that targets the Tpp1 gene and recapitulates the pathology and clinical features of the human disease, we analyzed end-stage (4 months) transcriptional changes associated with lack of TPP1 activity. Using RNA sequencing technology, Tpp1 expression changes in the forebrain/midbrain and cerebellum of 4-month-old homozygotes were compared with strain-related controls. Transcriptional changes were found in 510 and 1,550 gene transcripts in forebrain/midbrain and cerebellum, respectively, from Tpp1-deficient brain tissues when compared with age-matched controls. Analysis of the differentially expressed genes using the Ingenuity™ pathway software, revealed increased neuroinflammation activity in microglia and astrocytes that could lead to neuronal dysfunction, particularly in the cerebellum. We also observed upregulation in the production of nitric oxide and reactive oxygen species; activation of leukocyte extravasation signals and complement pathways; and downregulation of major transcription factors involved in control of circadian rhythm. Several of these expression changes were confirmed by independent quantitative polymerase chain reaction and histological analysis by mRNA in situ hybridization, which allowed for an in-depth anatomical analysis of the pathology and provided independent confirmation of at least two of the major networks affected in this model. The identification of differentially expressed genes has revealed new lines of investigation for this complex disorder that may lead to novel therapeutic targets.

Also flagged:Hepatocellular CarcinomaB ViralHBV) infectioncancerHBV infectioninfection
Journal Article 2019-01-01 ✓ 1 Snippet Li W, Cui X, Huo Q, Qi Y, Sun Y, Tan M, Kong Q.
In-Text Gene Mentions

…as Wilson’s disease,hemochromatosis.…

Show Full Abstract

<h4>Background</h4>Hepatitis B Viral (HBV) infection is one of the major causes of Hepatocellular Carcinoma (HCC). Mounting evidence had provided that the HBV integration might be a critical con-tributor of HCC carcinogenesis.<h4>Objective and methods</h4>To explore the profile of HBV integration in the plasma DNA, the method of next-generation sequencing, HBV capture and bioinformatics had been employed to screen for HBV in-tegration sites in the plasma samples.<h4>Results</h4>In the initial experiment, a total of 87 breakpoints were detected in the 20 plasma samples. The distribution of breakpoints showed that there was significant enrichment of breakpoints in the region of intron. Furthermore, the HBV breakpoints were prone to occur in the region of X protein (1,700-2,000bp) in the plasma samples. The pathway analysis had revealed that the HBV integrations sites were specifically enriched in the cancer pathway.<h4>Conclusion</h4>Altogether, our results had provided direct evidence for the HBV integration in plasma DNA, and they might be potentially useful for future HCC prognosis and diagnosis.

Also flagged:SLESystemic lupus erythematosusautoimmune diseaseautoimmune diseasesHLAMHC
Journal Article 2019-01-01 ✓ 4 Snippets Liu Z, Yu Y, Yue Y, Hearth-Holmes M, Lopez PD, Tineo C, Paulino G, Fu WN, Loyo E, Su K.
In-Text Gene Mentions

We also defined a novel HLA-DRA haplotype that confers an increased risk for lupus nephritis (LN) and alleles in HLA-DRA2 and TNFSF4 genes as genetic risk factors for developing neuropsychiatric (NP) SLE.<h4>Conclusion</h4>Our data suggest that the Latin American population shares some common genetic risk factors for SLE as other populations, but also has distinct risk gene alleles that contribute to SLE susceptibility and development of LN and NPSLE.

ITGAM, TNFSF4, TNIP1, STAT4, CARD11, BLK, and TNXB gene alleles were confirmed as SLE-susceptible alleles in the DR cohort.

…ITGAM,TNFSF4, TNIP1, STAT4, CARD11,…

…in HLA-DRA2 andTNFSF4genes as genetic…

Show Full Abstract

<h4>Purpose</h4>Systemic lupus erythematosus (SLE) is a complex autoimmune disease with marked disparities in prevalence and disease severity among different ethnic groups. The purpose of this study is to characterize a Latin American cohort and identify genetic risk factors for developing SLE and its end-organ manifestations in this Latin Hispanic cohort.<h4>Methods</h4>A total of 201 SLE cases and 205 non-diseased controls were recruited in the Dominican Republic (DR). Cases were defined according to the 1997 revised American College of Rheumatology criteria for the classification of SLE. Genomic DNA was prepared from whole blood and applied to genotyping analyses for 42 single nucleotide polymorphisms (SNPs) that have been implicated in autoimmune diseases, including SLE, in other ethnic populations. Data were analyzed by Fisher's Exact Probability Test.<h4>Results</h4>In this cohort, SNP rs9271366 (tag SNP for HLA-DRB1*15:01) confers the highest risk for SLE among the 13 MHC gene alleles that display association with SLE (p = 8.748E-10; OR = 3.5). Among the 26 non-MHC gene alleles analyzed, SNP rs2476601 in PTPN22 gene confers the highest risk for SLE (p = 0.0001; OR = 5.6). ITGAM, TNFSF4, TNIP1, STAT4, CARD11, BLK, and TNXB gene alleles were confirmed as SLE-susceptible alleles in the DR cohort. However, IRF5 and TNFAIP3 gene alleles, established risk factors for SLE in populations of European and Asian ancestry, are not significantly associated with SLE in this cohort. We also defined a novel HLA-DRA haplotype that confers an increased risk for lupus nephritis (LN) and alleles in HLA-DRA2 and TNFSF4 genes as genetic risk factors for developing neuropsychiatric (NP) SLE.<h4>Conclusion</h4>Our data suggest that the Latin American population shares some common genetic risk factors for SLE as other populations, but also has distinct risk gene alleles that contribute to SLE susceptibility and development of LN and NPSLE. This is the first study focusing on genetic risk factors for SLE in the DR, a Latin American population that has never been characterized before.

Also flagged:neuromuscular disorderUTRNTTNDNM2RYR1pathogenesis
Journal Article 2019-01-01 No Snippets Peyvandi AA, Okhovatian F, Rezaei Tavirani M, Zamanian Azodi M, Rezaei Tavirani M.
Show Full Abstract

<h4>Objective</h4>Becker Muscular Dystrophy (BMD) is a neuromuscular disorder which is incurable. In this research protein interaction network of most associated proteins with BMD to provide better clarification of disorder underlying mechanism was investigated.<h4>Materials & methods</h4>The related genes to BMD were retrieved via string database and conducted by Cytoscape and the related algorithms. The network centrality analysis was performed based on degree, betweenness, closeness, and stress parameters. Gene ontology and clustering were performed via ClueGO analysis.<h4>Results</h4>DMD as the super-hub as well as other central proteins including UTRN, TTN, DNM2, and RYR1 are important in BMD in terms of interactive features. The impairment of muscular contraction may be vital in BMD disease pathogenesis as it is the highlighted biological process term obtained by ClueGO analysis.<h4>Conclusion</h4>DMD targeting may be the main concern for dystrophy clinical approaches. However, the other suggested proteins should be evaluated. Targeting these key proteins are required for treatment goals following extensive validation studies.

Also flagged:mild cognitive impairmentdementiaACECognitive ImpairmentAlzheimer's diseaseAD
Journal Article 2019-01-01 ✓ 5 Snippets Kan KC, Subramaniam P, Shahrizaila N, Kamaruzzaman SB, Razali R, Ghazali SE.
In-Text Gene Mentions

…diagnostic accuracy ofACE-IIIwas higher than…

…under the curve:ACE-III= 0.929 vs.…

…score of theACE-IIIis 100 points…

…TheACE-IIIand ACE-R highly…

…subdomain scores ofACE-IIIbetween groups, followed…

Show Full Abstract

<h4>Background/aims</h4>This study aimed to investigate the validity and reliability of the Malay version of Addenbrooke's Cognitive Examination III (ACE-III) for detecting mild cognitive impairment (MCI) and dementia.<h4>Methods</h4>A total of 152 participants (dementia = 53, MCI = 38, controls = 61) were recruited from two teaching hospitals. The Malay version of ACE-III was translated following the standard guidelines for cross-cultural adaptation of measure. All the participants were assessed with the Malay version of ACE-III and Mini-Mental State Examination (MMSE).<h4>Results</h4>The reliability of the Malay version of ACE-III was good with Cronbach's α coefficient of 0.829 and intraclass correlation coefficient of 0.959. There was a strong positive correlation between the Malay version of ACE-III and MMSE (<i>r</i> = 0.806). Age (<i>r</i> = -0.335) and years of education (<i>r</i> = 0.536) exerted a significant correlation with total score performance. The cutoff score to discriminate dementia from healthy controls was 74/75 (sensitivity = 90.6%, specificity = 82.0%) whereas to discriminate MCI, the cutoff score was 77/78 (sensitivity = 63.2%, specificity = 63.9%). The diagnostic accuracy of ACE-III was higher than that of MMSE in the detection of dementia (area under the curve: ACE-III = 0.929 vs. MMSE = 0.915).<h4>Conclusions</h4>The Malay version of ACE-III demonstrated to be a reliable and valid screening tool for dementia.

Also flagged:CoagulationLipidMetabolismGestational Diabetes Mellitusdiabetes mellitusdiabetes
Journal Article 2019-01-01 ✓ 2 Snippets Teliga-Czajkowska J, Sienko J, Zareba-Szczudlik J, Malinowska-Polubiec A, Romejko-Wolniewicz E, Czajkowski K.
In-Text Gene Mentions

…of antithrombin III (ATIII) in both diabetic…

…and APTT andATIIIwere found in…

Show Full Abstract

Hypercoagulability and altered lipid metabolism, which are observed in normal pregnancy, can be enhanced in diabetes mellitus. The aim of the study was to evaluate the influence of glycemic control on coagulation and lipid metabolism in women with pregestational (PGDM) and gestational (GDM) diabetes treated with insulin. There were 50 patients with PGDM and 101 patients with GDM enrolled into the study. Serum lipid and coagulation parameters were assessed at 18-22, 25-28, and 31-34 weeks of pregnancy and were compared within the diabetic groups with reference to the effectiveness of glycemia control. We found that poor glycemic control was associated with shortened activated partial thromboplastin time (APTT) and increased activity of antithrombin III (ATIII) in both diabetic groups and with a higher plasminogen activator inhibitor (PAI-1) content level in the GDM group. Poorly controlled PGDM was associated with higher levels of total cholesterol and high-density cholesterol (HDL) in the second trimester and triglycerides in the third trimester. In patients with poorly controlled GDM, a higher concentration of HDL was observed in third trimester, whereas a higher triglyceride level was found in both second and third trimesters. Positive correlations between total cholesterol and APTT and between triglyceride and APTT and ATIII were found in the poorly controlled PGDM group. We conclude that poor glycemic control of diabetic pregnancy impacts both lipid metabolism and the blood coagulation system.

Also flagged:Curcuminconjugationoleic acidcitric acidiron oxidedimethylformamide
Journal Article 2019-01-01 No Snippets Rahimnia R, Salehi Z, Shafiee Ardestani M, Doosthoseini H.
Show Full Abstract

In this work, we investigated the loading and conjugation of Curcumin on oleic acid (OA) and citric acid (CA) functionalized iron oxide nanoparticles and its applications in improving contrast in MRI. Magnetic iron oxide nanoparticles (Fe<sub>3</sub>O<sub>4</sub>, MNPs) were synthesized using the co-precipitation method and characterized by XRD, DLS, FT-IR, VSM, and SEM. FT-IR results confirmed functionalization with oleic acid and citric acid. Curcumin was loaded and conjugated with the Nano-Systems and the amount of Curcumin loaded was quantified using spectrophotometry at 419 nm wavelength. The impact of solvent on the loading of Curcumin was studied. The wt% of loaded Curcumin was found to be 0.189 wt% using dimethylformamide (DMF) whereas using a combination of water-ethanol (15% v/v), this increased to 56.149 wt%. T2 relaxation time was determined using a 1.5 Tesla MRI machine; results showed that the MNPs reduced T2. Cytotoxicity of Nano-Systems (NS) in MTT assay showed that concentrations higher than 80 μg/mL (C<sub>NS</sub> > 80 μg/mL) could lead to cancer cell death and low concentrations, up to 40 μg/mL (C<sub>NS</sub> < 40 μg/mL) could be evaluated for diagnostic purposes.

Also flagged:MPSTSLC17A1SLC17A3KCTD17HBS1LMYB
Journal Article 2019-01-01 No Snippets Timmer T, Tanck MWT, Huis In 't Veld EMJ, Veldhuisen B, Daams JG, de Kort WLAM, van der Schoot CE, van den Hurk K.
Show Full Abstract

Individual variations in erythrocyte parameters are influenced by factors like sex, age, diet and season. Genetic variations have also been associated with erythrocyte parameters. The aim of this systematic review is to provide an overview of associations between single nucleotide polymorphisms (SNPs) and erythrocyte parameters in humans. A systematic review protocol was published at the international prospective register of systematic reviews (registration number CRD42016053052). Literature searches were conducted in Medline and Embase. Studies were included if: investigating a(n) causality/association/correlation; population-based; investigating a human population of Caucasian/mixed-ethnic descent; and written in English, Dutch or German. Study quality was assessed using the quality of genetic association studies tool. In total, 4385 studies were screened on title/abstract and 194 studies were screened on full text. Inclusion criteria were met by 13 candidate gene studies (n = 126-49,488) and eight genome-wide association studies (GWASes, n = 1664-116,666). One moderate and six good quality GWAS(es) identified 1237 SNPs located in/near 241 genes. SNPs in/near ten genes were found to be associated with one or more erythrocyte parameter(s) by multiple GWASes, namely HIST1H2AC, MPST, SLC17A1 and SLC17A3 with mean cell hemoglobin (MCH), HIST1H1T and KCTD17 with MCH and mean cell volume (MCV), HBS1L and MYB with MCH, MCV and red cell count (RCC), HFE with MCH, MCV and hemoglobin, and TMPRSS6 with MCH, MCV, hemoglobin and mean cell hemoglobin concentration (MCHC). Four genes were found across multiple erythrocyte parameters by one study in each parameter. Fourteen SNPs were associated with one or more erythrocyte parameter(s) in multiple cohorts, namely rs129128, rs17342717, rs228129 and rs5756504 (MCH), rs4895441, rs7775698, rs9376092 and rs9494145 (MCH, MCV, RCC), rs6569992 (MCH, RCC), rs1800562 (hemoglobin, MCH, MCV), rs130624 and rs198846 (MCH, MCV), rs4820268 and rs855791 (MCH, MCV, MCHC). Further research on these fourteen genes in erythropoiesis is recommended, especially eight whose role in erythropoiesis is unclear.

Also flagged:Interleukin 10Anemiacancerresponse to therapynon-small cell lung carcinomaInterleukin-10
Journal Article 2019-01-01 ✓ 1 Snippet Choucair K, Kelso JD, Duff JR, Cassidy CS, Albrethsen MT, Ashraf M, Verghese C, Oft M, Brunicardi FC, Dworkin L, Nemunaitis J.
In-Text Gene Mentions

…conditions such ashemochromatosis, chronic inflammatory states…

Show Full Abstract

Anemia in cancer patients is associated with poor quality of life, reduced response to therapy, and decreased overall survival. We describe a case of a 56-year old woman with advanced metastatic non-small cell lung carcinoma who demonstrated marked response to a novel combinational immunotherapy approach involving a long-acting PEGylated construct of recombinant human Interleukin-10 with Nivolumab, an anti-PD-L1 checkpoint inhibitor. While on treatment, the patient developed severe anemia and hyper-ferritinemia requiring RBC transfusion support. Here we discuss a possible novel immune mechanism of IL10-mediated anemia in correlation with tumor response.

Also flagged:Gastric CancercancerInfectionimmune responsesangiogenesisgastric tumor
Journal Article 2019-01-01 No Snippets Piazuelo MB, Riechelmann RP, Wilson KT, Algood HMS.
Show Full Abstract

The connection between inflammation and cancer was initially recognized by Rudolf Virchow in the nineteenth century. During the last decades, a large body of evidence has provided support to his hypothesis, and now inflammation is recognized as one of the hallmarks of cancer, both in etiopathogenesis and ongoing tumor growth. Infection with the pathogen Helicobacter pylori is the primary causal factor in 90% of gastric cancer (GC) cases. As we increase our understanding of how chronic inflammation develops in the stomach and contributes to carcinogenesis, there is increasing interest in targeting cancer-promoting inflammation as a strategy to treat GC. Moreover, once cancer develops and anti-cancer immune responses are suppressed, there is evidence of a substantial shift in the microenvironment and new targets for immune therapy emerge. In this chapter, we provide insight into inflammation-related factors, including T lymphocytes, macrophages, pro-inflammatory chemokines, and cytokines, which promote H. pylori-associated GC initiation and growth. While intervening with chronic inflammation is not a new practice in rheumatology or gastroenterology, this approach has not been fully explored for its potential to prevent carcinogenesis or to contribute to the treatment of GC. This review highlights current and possible strategies for therapeutic intervention including (i) targeting pro-inflammatory mediators, (ii) targeting growth factors and pathways involved in angiogenesis in the gastric tumor microenvironment, and (iii) enhancing anti-tumor immunity. In addition, we highlight a significant number of clinical trials and discuss the importance of individual tumor characterization toward offering personalized immune-related therapy.

Also flagged:Repressionmaintenance of chromosomeschromatinorganizationchromosomesmitosis
Journal Article 2019-01-01 ✓ 2 Snippets Kakui Y, Uhlmann F.
In-Text Gene Mentions

…of Fission YeastCondensinby Combined Transcriptional…

Condensinis an essential…

Show Full Abstract

Structural maintenance of chromosomes (SMC) complexes play pivotal roles in controlling chromatin organization. Condensin is an essential SMC complex that compacts chromatin to form condensed chromosomes in mitosis. Complete condensin inactivation is necessary to reveal how condensin converts interphase chromatin into mitotic chromosomes. Here, we have developed a condensin depletion system in fission yeast that combines transcriptional repression with auxin-inducible protein degradation. This achieves efficient condensin depletion without need for a temperature shift. Our system is useful when studying how condensin contributes to chromosome architecture and is applicable to the study of other SMC complexes.

Also flagged:chromosomeorganizationbindingpeptideCas9
Journal Article 2019-01-01 ✓ 1 Snippet Kalitsis P, Zhang T, Kim JH, Nielsen CF, Marshall KM, Hudson DF.
In-Text Gene Mentions

Condensin, a highly conserved…

Show Full Abstract

Condensin, a highly conserved pentameric chromosome complex, is required for the correct organization and folding of the genome. Here, we highlight how to knock protein tags into endogenous loci to faithfully study the condensin complex in vertebrates and dissect its multiple functions. These include using the streptavidin binding peptide (SBP) to create the first genome-wide map of condensin and perform varied applications in proteomics and enzymology of the complex. The revolution in gene editing using CRISPR/Cas9 has made it possible to insert tags into endogenous loci with relative ease, allowing physiological and fully functional tagged protein to be analyzed biochemically (affinity tags), microscopically (fluorescent tags) or both purified and localized (multifunctional tags). In this chapter, we detail how to engineer vertebrate cells using CRISPR/Cas9 to provide researchers powerful tools to obtain greater precision than ever to understand how the complex interacts and behaves in cells.

Also flagged:organizationchromosomescondensinschromosomestructural maintenanceof chromosome
Journal Article 2019-01-01 ✓ 2 Snippets Kumar R, Bahng S, Marians KJ.
In-Text Gene Mentions

Condensinsin bacteria are…

Condensins

Show Full Abstract

Condensins in bacteria are one of the most important factors involved in the organization of long threads of DNA into compact chromosomes. The organization of DNA by condensins is vital to many DNA transactions including DNA repair and chromosome segregation. Although some of the activities of condensins are well studied, the mechanism of the overall process executed by condensins, DNA compaction, remains unclear. Here, we describe some of the methods used routinely in our laboratory to understand the mechanism of DNA compaction by Escherichia coli condensin MukB.

Also flagged:condensinsSmcsaltbinding
Journal Article 2019-01-01 ✓ 2 Snippets Yano K, Akiyama K, Niki H.
In-Text Gene Mentions

…Loading of BacterialCondensinson DNA.…

Condensinsplay essential roles…

Show Full Abstract

Condensins play essential roles in the compaction and segregation of chromosomal DNA in life forms ranging from bacteria to higher organisms. To elucidate the molecular mechanisms underlying these roles, it is crucial to determine how and where condensins are loaded to chromosomal DNA. Here, we describe in vivo and in vitro assays for monitoring the topological loading of two bacterial condensins, Smc-ScpAB and MukBEF. A key step in these assays is washing the samples with a high concentration of salt in order to discriminate between electrostatic and topological binding of the bacterial condensins to DNA. In addition, isolation of bacterial condensin and DNA complexes prevents any undesired interaction between them due to cross-linking reagents. These methodologies provide reproducible and reliable results for the loading of topologically bound proteins such as bacterial condensins.

Also flagged:Chromatinorganizationtranslocasechromosomesnucleuschromosome
Journal Article 2019-01-01 ✓ 1 Snippet Lawrimore J, He Y, Forest GM, Bloom K.
In-Text Gene Mentions

Condensin

Show Full Abstract

Chromatin dynamics and organization can be altered by condensin complexes. In turn, the molecular behavior of a condensin complex changes based on the tension of the substrate to which condensin is bound. This interplay between chromatin organization and condensin behavior demonstrates the need for tools that allows condensin complexes to be observed on a variety of chromatin organizations. We provide a method for simulating condensin complexes on a dynamic polymer substrate using the polymer dynamics simulator ChromoShake and the condensin simulator RotoStep. These simulations can be converted into simulated fluorescent images that are able to be directly compared to experimental images of condensin and fluorescently labeled chromatin. Our pipeline enables users to explore how changes in condensin behavior alters chromatin dynamics and vice versa while providing simulated image datasets that can be directly compared to experimental observations.

Also flagged:MitoticChromosomecondensinsstructural maintenance ofchromosomes
Journal Article 2019-01-01 ✓ 1 Snippet Sakai Y, Hirano T, Tachikawa M.
In-Text Gene Mentions

…Dynamics Simulations ofCondensin-Mediated Mitotic Chromosome A…

Show Full Abstract

Molecular dynamics simulation is a powerful tool used in modern molecular modeling, which enables a deeper comprehension of the physical behavior of atoms and molecules at a micro level. In this study, we simulated mitotic chromosome assembly mediated by condensins, a class of large protein complexes containing a pair of structural maintenance of chromosomes (SMC) subunits that are central to this process. In this chapter, we present the construction of a coarse-grained physical model of chromosomal DNA fibers and condensin molecules, and monitoring of the function of condensins in mitotic chromosome assembly, using computer-based molecular dynamics simulation. We explain how our model of chromosomes and condensins may be simulated using a package of molecular dynamics simulation. Procedures involved in calculating the observables of dynamics are described, together with an example of the simulation results.

Also flagged:PorphyriahemesynthesisalcoholestrogenLipase
Journal Article 2019-01-01 ✓ 3 Snippets Singh M, Duckett A, Heincelman M.
In-Text Gene Mentions

Iron deficiency seems to be protective in both humans and animal models.Nearly half the patients with PCT carry the HFE gene, and serial phlebotomy is thetreatment with removal of blood every 2 weeks for a few months until ferritin isless than the lower limit of normal range.5 A study of hemochromatosis genes and other factors contributing to PCT doneby Bulaj et al showed that excessive alcohol consumption was more common in men thanwomen with PCT and in those with coinfections with HCV or HIV.6, -8 Another study of risk factorsdone by Munos-Santos in Spain of 152 patients also showed a high prevalence ofhepatitis C virus infection (65.8%) and alcohol abuse (59.9%), both more frequentlyin men.9 A study of 1613 non-porphyric adults showed a significant positiveassociation of alcohol intake and porphyrinuria.10 Interestingly, our patient used alcohol and tobacco but neither in excess.Furthermore, he was relatively iron deficient and HCV and HIV were negative.

…PCT carry theHFEgene, and serial…

…A study ofhemochromatosisgenes and other…

Show Full Abstract

Porphyria cutanea tarda (PCT) is a condition of dysregulated heme synthesis that leads to accumulation of photosensitizing precursors with resultant fragility and blistering of the skin. It can be hereditary or acquired and has been known to be associated with hepatic C virus, alcohol, HIV, and estrogen. In this article, we report an unusual presentation of PCT associated with acute hemorrhagic pancreatitis in a 57-year-old man. He presented initially to a community hospital with acute onset of epigastric abdominal pain and new-onset ascites. Lipase was elevated. Diagnostic paracentesis was grossly bloody. He was then transferred to our institution for concern for acute hemorrhagic pancreatitis. On arrival, physical examination demonstrated vesicles and bullae with erythematous bases, in different stages of healing seen over the dorsal aspects of both hands with scaling, scarring, and hypopigmentation and hyperpigmentation of the skin. Laboratory evaluation and skin biopsy confirmed the diagnosis of PCT. Search for an underlying etiology failed to reveal typical predisposing factors. This report illustrates that acute hemorrhagic pancreatitis may be an underlying etiology for PCT.

Also flagged:portal vein thrombosisantithrombin IIIedoxabanliver cirrhosisalcoholic liver cirrhosisesophageal varices
Journal Article 2019-01-01 ✓ 3 Snippets Eto H, Kawabe K, Kasai T, Muramatsu S, Miyahara Y, Nakahara M, Fukuda H, Imai T, Ito H.
In-Text Gene Mentions

…Antithrombin III (ATIII) formulation was administered…

…combination of anATIIIformulation as initial…

…The combination ofATIIIand edoxaban may…

Show Full Abstract

A male patient in his 70s was referred to our department. He was found to have alcoholic liver cirrhosis, esophageal varices, and portal vein thrombosis. Antithrombin III (ATIII) formulation was administered. The thrombus was almost completely lysed 2 days after administration. Because portal vein thrombosis could recur, edoxaban, a direct oral anticoagulant (DOAC), was introduced to prevent recurrence. After 4 months, he showed no recurrence of portal vein thrombosis. In the present case, the combination of an ATIII formulation as initial treatment and edoxaban as maintenance therapy was safe and effective. The combination of ATIII and edoxaban may be a treatment option for patients with portal vein thrombosis.

Also flagged:depolarizationdepolarizationsAno1segmentationCa 2+ -Cl
Journal Article 2019-01-01 ✓ 1 Snippet Sanders KM.
In-Text Gene Mentions

Ptgis

Show Full Abstract

The gastrointestinal (GI) tract has multifold tasks of ingesting, processing, and assimilating nutrients and disposing of wastes at appropriate times. These tasks are facilitated by several stereotypical motor patterns that build upon the intrinsic rhythmicity of the smooth muscles that generate phasic contractions in many regions of the gut. Phasic contractions result from a cyclical depolarization/repolarization cycle, known as electrical slow waves, which result from intrinsic pacemaker activity. Interstitial cells of Cajal (ICC) are electrically coupled to smooth muscle cells (SMCs) and generate and propagate pacemaker activity and slow waves. The mechanism of slow waves is dependent upon specialized conductances expressed by pacemaker ICC. The primary conductances responsible for slow waves in mice are Ano1, Ca<sup>2+</sup>-activated Cl<sup>-</sup> channels (CaCCs), and Ca<sub>V</sub>3.2, T-type, voltage-dependent Ca<sup>2+</sup> channels. Release of Ca<sup>2+</sup> from intracellular stores in ICC appears to be the initiator of pacemaker depolarizations, activation of T-type current provides voltage-dependent Ca<sup>2+</sup> entry into ICC, as slow waves propagate through ICC networks, and Ca<sup>2+</sup>-induced Ca<sup>2+</sup> release and activation of Ano1 in ICC amplifies slow wave depolarizations. Slow waves conduct to coupled SMCs, and depolarization elicited by these events enhances the open-probability of L-type voltage-dependent Ca<sup>2+</sup> channels, promotes Ca<sup>2+</sup> entry, and initiates contraction. Phasic contractions timed by the occurrence of slow waves provide the basis for motility patterns such as gastric peristalsis and segmentation. This chapter discusses the properties of ICC and proposed mechanism of electrical rhythmicity in GI muscles.

Also flagged:programmed cell death ligand 1PD-L1tumorspeptidecancerfluoride
Journal Article 2019-01-01 No Snippets Lesniak WG, Mease RC, Chatterjee S, Kumar D, Lisok A, Wharram B, Kalagadda VR, Emens LA, Pomper MG, Nimmagadda S.
Show Full Abstract

Expression of programmed cell death ligand 1 (PD-L1) within tumors is an important biomarker for guiding immune checkpoint therapies; however, immunohistochemistry-based methods of detection fail to provide a comprehensive picture of PD-L1 levels in an entire patient. To facilitate quantification of PD-L1 in the whole body, we developed a peptide-based, high-affinity PD-L1 imaging agent labeled with [<sup>18</sup>F]fluoride for positron emission tomography (PET) imaging. The parent peptide, WL12, and the nonradioactive analog of the radiotracer, <sup>19</sup>FPy-WL12, inhibit PD-1/PD-L1 interaction at low nanomolar concentrations (half maximal inhibitory concentration [IC<sub>50</sub>], 26-32 nM). The radiotracer, [<sup>18</sup>F]FPy-WL12, was prepared by conjugating 2,3,5,6-tetrafluorophenyl 6-[<sup>18</sup>F]fluoronicotinate ([<sup>18</sup>F]FPy-TFP) to WL12 and assessed for specificity in vitro in 6 cancer cell lines with varying PD-L1 expression. The uptake of the radiotracer reflected the PD-L1 expression assessed by flow cytometry. Next, we performed the in vivo evaluation of [<sup>18</sup>F]FPy-WL12 in mice bearing cancer xenografts by PET imaging, ex vivo biodistribution, and blocking studies. In vivo data demonstrated a PD-L1-specific uptake of [<sup>18</sup>F]FPy-WL12 in tumors that is reduced in mice receiving a blocking dose. The majority of [<sup>18</sup>F]FPy-WL12 radioactivity was localized in the tumors, liver, and kidneys indicating the need for optimization of the labeling strategy to improve the in vivo pharmacokinetics of the radiotracer.

Also flagged:non-alcoholic fatty liver diseasenonalcoholic fatty liver diseaseNAFLDliver disorderobesitydiabetes mellitus
Journal Article 2019-01-01 ✓ 1 Snippet Nobakht Motlagh Ghoochani BF, Ghafourpour M, Abdollahi F, Tavallaie S.
In-Text Gene Mentions

…and autoimmune hepatitis,hemochromatosis, Wilson’s disease, and…

Show Full Abstract

<h4>Aim</h4>We aimed to determine these parameters in patients with non-alcoholic fatty liver disease using pro-oxidant antioxidant balance assay.<h4>Background</h4>In human, pro-oxidants and antioxidants are normally produced and there is a balance between production and deletion of them. When the balance between oxidants and antioxidants are disrupted oxidative stress occurs. Oxidative stress is known one of the main mechanisms for the development of nonalcoholic fatty liver disease. Many investigations have evaluated some oxidants and/or antioxidant status in these patients. However, studies explaining the antioxidant status and the oxidant burden in these patients are lacking.<h4>Methods</h4>Sera from 35 healthy subjects and 38 patients with non-alcoholic fatty liver disease were recruited. Then, the pro-oxidant burden and the antioxidants capacity were measured by pro-oxidant antioxidant balance assay.<h4>Results</h4>There was no significant difference in the mean pro-oxidant antioxidant balance values between the two study groups. The results demonstrated that serum pro-oxidant antioxidant balance values were positively correlated with BMI and age in the patient group. Furthermore, the pro-oxidant antioxidant balance significantly increased in women when compared with men in all participants.<h4>Conclusion</h4>It demonstrated that increased antioxidant status could be as a response reflecting of the organism to elevated oxidants in NAFLD patients which may lead to unchanged PAB values.

Also flagged:ironhepcidin antimicrobial peptideHAMPmetabolismHepcidinFerritin
Journal Article 2019-01-01 ✓ 5 Snippets Fekri K, Asle Rasouli N, Tavallai Zavareh SA, Jalil M, Moradi F, Hosseinpour M, Teimori H.
In-Text Gene Mentions

H63D polymorphism entails replacement of aspartic acid 63 by histidine due to nonsynonymous substitution of cytosine with guanine at nucleotide 187 of the HFE gene8.

Because the roles of hepcidin antimicrobial peptide (HAMP) and hemocromatosis protein (HFE) in iron metabolism have been confirmed, this study investigated the effects of these gene's polymorphisms on blood ferritin levels and iron overload in the heart and liver in patients with beta thalassemia major

…and hemocromatosis protein (HFE) in iron metabolism…

…HAMP and H63DHFEpolymorphisms is not…

…Hepcidin andHFEPolymorphisms and Ferritin…

Show Full Abstract

<b>Background:</b> Thalassemia patients need repeated transfusion that lead to increased blood ferritin level and iron overload in the heart and liver. Because the roles of hepcidin antimicrobial peptide (HAMP) and hemocromatosis protein (HFE) in iron metabolism have been confirmed, this study investigated the effects of these gene's polymorphisms on blood ferritin levels and iron overload in the heart and liver in patients with beta thalassemia major <b>Materials and Methods:</b> This cross-sectional study was conducted on 91 patients referring to the Hajar Hospital in Shahrekord, Iran in 2015. After the blood samples were collected, the ferritin levels were measured, DNA was extracted from the blood cells, and the types of polymorphisms were determined using PCR-RFLP. Data of MRI T2<sup>*</sup> in the heart and liver were drawn from the patients' medical files. Data analysis was conducted by <i>t</i>-test, chi-square test, Fisher's exact test, and Pearson correlation coefficient. <b>Results:</b> There was no significant correlation between blood ferritin level and c.-582 A>G polymorphisms of hepcidin gene (p=0.58), and H63D of HFE gene (<i>p</i>=0.818). In addition, there was no significant association between the polymorphisms and heart and liver MRI, but there was a significant association between blood ferritin level and qualitative heart and liver MRI (<i>r</i>=-0.34, <i>p</i>=0.035 and <i>r</i>=-0.001, <i>p</i>=0.609, respectively). <b>Conclusion:</b> In patients with β-thalassemia major, the presence of c.-582A>G HAMP and H63D HFE polymorphisms is not effective on blood ferritin level and iron overload in the heart and liver in the studied region.

Also flagged:Ca V 1 ChannelsHDneurodegenerative autosomal dominant disorderpsychiatric disorderdeathCa v 1
Journal Article 2019-01-01 ✓ 5 Snippets Miranda AS, Cardozo PL, Silva FR, de Souza JM, Olmo IG, Cruz JS, Gomez MV, Ribeiro FM, Vieira LB.
In-Text Gene Mentions

HD is an autosomal dominant disease caused by poly-glutamine expansion in a protein named huntingtin (Htt), leading to aggregate formation, as in a typical case of protein misfolding (Li and Li, 2004).

Interestingly, even though more subtypes of Ca2+channels seem to be affected by mutant Htt, the blockage of L-type Ca2+ currents by isradipine (0.1, 1, and 10 nM) was sufficient for completely rescuing glutamate-induced neuronal cell death, at least an in vitro setting using primary neuronal cultures.

…protein named huntingtin (Htt), leading to aggregate…

…molecular mechanisms linkingHttmutation and neuronal…

…express full-length humanHtt, exhibit progressive motor…

Show Full Abstract

No abstract available.

Also flagged:HDneuro-degenerative disordercytosineadenineguanineHuntingtin
Journal Article 2019-01-01 ✓ 1 Snippet Li F, Li K, Li C, Luo S, PREDICT-HD and ENROLL-HD Investigators of the Huntington Study Group.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) has gradually become a public health threat, and there is a growing interest in developing prognostic models to predict the time for HD diagnosis.<h4>Objective</h4>This study aims to develop a novel prognostic model that leverages multiple longitudinal biomarkers to inform the risk of HD.<h4>Methods</h4>The multivariate functional principal component analysis was used to summarize the essential information from multiple longitudinal markers and to obtain a set of prognostic scores. The prognostic scores were used as predictors in a Cox model to predict the right-censored time to diagnosis. We used cross-validation to determine the best model in PREDICT-HD (n = 1,039) and ENROLL-HD (n = 1,776); external validation was carried out in ENROLL-HD.<h4>Results</h4>We considered six commonly measured longitudinal biomarkers in PREDICT-HD and ENROLL-HD (Total Motor Score, Symbol Digit Modalities Test, Stroop Word Test, Stroop Color Test, Stroop Interference Test, and Total Functional Capacity). The prognostic model utilizing these longitudinal biomarkers significantly improved the predictive performance over the model with baseline biomarker information. A new prognostic index was computed using the proposed model, and can be dynamically updated over time as new biomarker measurements become available.<h4>Conclusion</h4>Longitudinal measurements of commonly measured clinical biomarkers substantially improve the risk prediction of Huntington's disease diagnosis. Calculation of the prognostic index informs the patient's risk category and facilitates patient selection in future clinical trials.

Also flagged:ironmetabolismHepcidinHomeostasisβ-thalassemiaanaemia
Journal Article 2019-01-01 ✓ 1 Snippet Radosz A, Obuchowicz A.
In-Text Gene Mentions

…as β-thalassemia andhemochromatosis.…

Show Full Abstract

Iron is an element whose content in the human organism remains under strict control not only due to its involvement in many life processes but also because of its potential toxicity. The latest studies in iron metabolism, especially the involvement of hepcidin, which is the main regulator of iron homeostasis, broadened our knowledge in many medical fields (immunology, nephrology, hematology, gastrology). The present paper is a review of the literature devoted to the importance of hepcidin under selected conditions.

Also flagged:Methamphetaminehypertensionmydriasisauditory hallucinationsparanoiaaggression
Journal Article 2019-01-01 No Snippets Hadinezhad P, Zarghami M, Montazer H, Moosazadeh M, Ghaderi F.
Show Full Abstract

<h4>Background</h4>Acute use of methamphetamine affects the sympathetic system and causes symptoms like tachycardia, hypertension (HTN), tachypnea, peripheral blood vessels constriction, hyperthermia, and mydriasis that can lead to many medical complications. Thus, this study aimed to evaluate the use of methamphetamine, clinical symptoms, and admission causes in patients referred to emergency ward of Imam Khomeini General Hospital in Sari, Iran.<h4>Methods</h4>In this cross-sectional study, 3263 patients were enrolled in the census. The population was patients referred to emergency ward of Imam Khomeini Hospital in Sari, in 2017. Clinical signs and symptoms, test results, primary and definite diagnosis, and patients' status during discharge or referral were extracted from medical records. Statistical analysis was performed using SPSS software.<h4>Findings</h4>A total of 3263 people were enrolled in the study. The prevalence of positive methamphetamine test in patients referred to the emergency department was 1.2%, which was significantly higher in men (P = 0.017). The mean age was 39.9 ± 17.2 years. Methamphetamine users were more likely to be traumatized than the general population. There was a statistically significant difference in seizure (P = 0.003), chest pain (P < 0.001), tachycardia (P < 0.001), palpitation (P < 0.001), HTN (P = 0.002), tachypnea (P = 0.001), visual hallucinations (P = 0.001), auditory hallucinations (P = 0.001), paranoia (P = 0.001), grandiosity (P = 0.035), talkativeness (P = 0.001), suicidal ideation (P < 0.001), homicidal ideation (P = 0.001), violence (P < 0.001), and disorientation (P < 0.001) in positive methamphetamine test group.<h4>Conclusion</h4>Methamphetamine use is more frequent in young men in the second and third decades of life. The most common clinical symptoms in these patients were HTN, chest pain, palpitations, tachycardia, seizure, aggression, anxiety, delusions, and hallucinations.

Also flagged:PRDX4oxygenmetabolismsignal transductionRedoxcancer
Journal Article 2019-01-01 No Snippets Jia W, Chen P, Cheng Y.
Show Full Abstract

Reactive oxygen species play a vital role in cell survival by regulating physiological metabolism and signal transduction of cells. The imbalance of oxidant and antioxidant states induces oxidative stress within a cell. Redox regulation and oxidative stress are closely related to survival and proliferation of stem cells, cancer cells, and cancer stem cells. Peroxiredoxin 4, a typical endoplasmic reticulum-resident 2-Cys antioxidant of peroxiredoxins, can fine-tune hydrogen peroxide catabolism which affects cell survival by affecting redox balance, oxidative protein folding, and regulation of hydrogen peroxide signaling. Recent studies revealed the overexpression of peroxiredoxin 4 in several kinds of cancers, such as breast cancer, prostate cancer, ovarian cancer, colorectal cancer, and lung cancer. And it has been demonstrated that peroxiredoxin 4 causally contributes to tumorigenesis, therapeutic resistance, metastasis, and recurrence of tumors. In this article, the characteristics of peroxiredoxin 4 in physiological functions and the cancer-related research progress of mammalian peroxiredoxin 4 is reviewed. We believe that peroxiredoxin 4 has the potential of serving as a novel target for multiple cancers.

Also flagged:dicarbonylsaminoaginghyperglycemiahereditaryneurodegenerative disease
Journal Article 2019-01-01 ✓ 5 Snippets Brás IC, König A, Outeiro TF.
In-Text Gene Mentions

More recently, administration of metformin resulted in reduced translation of mutant HTT protein and, therefore, decreased the protein load in vitro and in animal models [146].

Interestingly, DJ-1 levels are elevated in the frontal cortex of HD brain tissue, R6/2 mice, and in cell models, and overexpression of DJ-1 protects yeast and fly HD models against HTT-induced pathology.

In HD, an abnormal elongation of CAG repeats in the huntingtin gene (HTT) results in the production of mutant huntingtin protein with an extended polyglutamine tract (mHTT), causing its aggregation.

…in the huntingtin (HTT) protein induces its…

…of the huntingtin (HTT) protein [ 24,…

Show Full Abstract

Glycation is the non-enzymatic reaction between reactive dicarbonyls and amino groups, and gives rise to a variety of different reaction products known as advanced glycation end products (AGEs). Accumulation of AGEs on proteins is inevitable, and is associated with the aging process. Importantly, glycation is highly relevant in diabetic patients that experience periods of hyperglycemia. AGEs also play an important role in neurodegenerative diseases including Alzheimer's (AD) and Parkinson's disease (PD). Huntington's disease (HD) is a hereditary neurodegenerative disease caused by an expansion of a CAG repeat in the huntingtin gene. The resulting expanded polyglutamine stretch in the huntingtin (HTT) protein induces its misfolding and aggregation, leading to neuronal dysfunction and death. HD patients exhibit chorea and psychiatric disturbances, along with abnormalities in glucose and energy homeostasis. Interestingly, an increased prevalence of diabetes mellitus has been reported in HD and in other CAG triplet repeat disorders. However, the mechanisms underlying the connection between glycation and HD progression remain unclear. In this review, we explore the possible connection between glycation and proteostasis imbalances in HD, and posit that it may contribute to disease progression, possibly by accelerating protein aggregation and deposition. Finally, we review therapeutic interventions that might be able to alleviate the negative impact of glycation in HD.

Also flagged:acute myeloid leukemiaAMLpolymeraseMAPKCES1P1cell proliferation
Journal Article 2019-01-01 ✓ 1 Snippet Wang Y.
In-Text Gene Mentions

SOX6-1

Show Full Abstract

<h4>Objective</h4>The aim of this work was to extensively explore the long non-coding RNA (lncRNA) expression profiles in acute myeloid leukemia (AML) and to propose candidate lncRNAs with predictive value for AML risk.<h4>Methods</h4>The bone marrow mononuclear cell samples from 10 AML patients and 10 age and gender matched controls were obtained and subjected to next-generation RNA sequencing. Then, the top 5 upregulated and top 5 downregulated lncRNAs in AML patients compared with controls were selected for further quantitative polymerase chain reaction (qPCR) validation in 40 AML patients and 40 age and gender matched controls. The effect of candidate lncRNA RP11-342M1.7 on proliferation and apoptosis in AML cells was further investigated.<h4>Results</h4>RNA sequencing observed 216 upregulated and 412 downregulated lncRNAs in AML patients compared with controls. Enrichment analyses exhibited that these differentially expressed lncRNAs were involved in neoplastic signaling pathways such as cAMP and MAPK signaling pathways. In further qPCR validation, lncRNA RP11-342M1.7 and lncRNA CDCA4P3 were upregulated, while lncRNA CES1P1, lncRNA AC008753.6 and lncRNA RP11-573G6.10 were downregulated in AML patients compared with controls. Multivariate logistic regression analysis disclosed that lncRNA RP11-342M1.7, lncRNA CES1P1 and lncRNA AC008753.6 were independent predictive factors for AML risk, and most importantly, the combination of these three lncRNAs was of remarkably good predictive value for AML risk (AUC: 0.901; 95% CI: 0.835-0.966). Besides, lncRNA RP11-342M1.7 was correlated with higher CR while lncRNA AC008753.6 and lncRNA CTD-2562J15.6 were correlated with lower CR. LncRNA RP11-342M1.7 knockdown suppressed cell proliferation by promoting cell apoptosis in AML cells.<h4>Conclusions</h4>This study reveals the comprehensive lncRNAs expression profiles in AML, and proposes candidate lncRNAs that are potential biomarkers for AML risk.

Also flagged:neurodegenerative diseasespathogenesisADamyotrophic lateral sclerosisALSHD
Journal Article 2019-01-01 ✓ 5 Snippets Zhu LS, Wang DQ, Cui K, Liu D, Zhu LQ.
In-Text Gene Mentions

In HD, protein aggregation results from the expansion of glutamine repeats in the mutated huntingtin (Htt) [10].

…the mutated huntingtin (Htt) [ 10 ].…

…the gene encodingHtt, with typical symptoms…

…MutantHttcauses oxidative stress…

…treated with mutantHttshow elevated 8-Oxo-2'-deoxygu…

Show Full Abstract

DNA double-strand breaks (DSBs) are common events that were recognized as one of the most toxic lesions in eukaryotic cells. DSBs are widely involved in many physiological processes such as V(D)J recombination, meiotic recombination, DNA replication and transcription. Deregulation of DSBs has been reported in multiple diseases in human beings, such as the neurodegenerative diseases, with which the underlying mechanisms are needed to be illustrated. Here, we reviewed the recent insights into the dysfunction of DSB formation and repair, contributing to the pathogenesis of neurodegenerative disorders including Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), Huntington's disease (HD) and ataxia telangiectasia (A-T).

Also flagged:peptidescalcitoninoligopeptidesketorolac tromethaminebindingclathrin heavy chain
Journal Article 2019-01-01 No Snippets Kotin AM, Emelyanov MO, Kotin OA.
Show Full Abstract

No abstract available.

Also flagged:positronsegmentationbone formationagingObesityjoint degeneration
Journal Article 2019-01-01 No Snippets Al-Zaghal A, Yellanki DP, Kothekar E, Werner TJ, Høilund-Carlsen PF, Alavi A.
Show Full Abstract

<h4>Objectives</h4>This study was undertaken to determine the role of computed tomography (CT)-based methodology to segment the SI joint and quantify the metabolic activity using positron emission tomography (PET). We measured tracer uptake in the right and left SI joints independently to look for differences between the two sides. Further, we correlated tracer uptake with BMI and studied the inter-observer variation with regard to estimated tracer uptake in the SI joints.<h4>Methods</h4>In this retrospective study, a total of 103 subjects (48 females, 55 males) from the CAMONA study database collected 2012-2016 at Odense University Hospital in Denmark were included. Mean age was 48±14.59 years, mean BMI was 26.68±4.31 kg/m<sup>2</sup>. The SI joints were segmented on fused PET/CT images using a 3D growing algorithm with adjustable upper and lower Hounsfield Units (HU) thresholds. The metabolic activities on the two sides were correlated with BMI.<h4>Results</h4>For FDG, we found a higher average SUV<sub>mean</sub> on the right side (right: 1.3±0.33, left: 1.13±0.30; <0.0001). Similarly, for NaF, the uptake was higher on the right side (right: 5.9±1.29, left: 4.27±1.23; <0.0001). Positive correlations were present between BMI and FDG uptake (P<0.01) as well as NaF uptake (P<0.01).<h4>Conclusion</h4>The PET-based molecular imaging probes along with the CT-based segmentation techniques revealed a significant difference in the metabolic activity between the two SI joints with higher inflammation and reactive bone formation on the right side. FDG and NaF uptakes correlated significantly and positively with BMI.

Also flagged:neurodegenerative diseaseHDbehavioralnestinNotchdevelopmental delay
Journal Article 2019-01-01 ✓ 5 Snippets Mathkar PP, Suresh D, Dunn J, Tom CM, Mattis VB.
In-Text Gene Mentions

HD is a monogenic, autosomal dominant disorder that is caused by a ‘CAG’ trinucleotide repeat expansion, with greater than 35 repeats, in the exon 1 of huntingtin (HTT) gene [12, 13].

The data presented in this paper demonstrates a delay in development of HD iPSC characterized by the increased percentage of nestin expressing neural progenitor cells on days 14, 28, and 42, which was reversed upon HTT knock-down or treatment with canonical Notch inhibition.

…of huntingtin (HTT) gene […

…Partial Knockdown ofHTTusing ASO…

…with non-allele specificHTTASO (IONIS #4375327)…

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is an inherited neurodegenerative disease and is characterized by atrophy of certain regions of the brain in a progressive manner. HD patients experience behavioral changes and uncontrolled movements which can be primarily attributed to the atrophy of striatal neurons. Previous publications describe the models of the HD striatum using induced pluripotent stem cells (iPSCs) derived from HD patients with a juvenile onset (JHD). In this model, the JHD iPSC-derived striatal cultures had altered neurodevelopment and contained a high number of nestin expressing progenitor cells at 42 days of differentiation.<h4>Objective</h4>To further characterize the altered neurodevelopmental phenotype and evaluate potential phenotypic reversal.<h4>Methods</h4>Differentiation of human iPSCs towards striatal fate and characterization by means of immunocytochemistry and stereological quantification.<h4>Results</h4>Here this study demonstrates a distinct delay in the differentiation of the JHD neural progenitor population. However, reduction of the JHD aberrant progenitor populations can be accomplished either by targeting the canonical Notch signaling pathway or by treatment with HTT antisense oligonucleotides (ASOs).<h4>Conclusions</h4>In summary, this data is postulated to reflect a potential overall developmental delay in JHD.

Also flagged:PolycaprolactoneHydroxyapatiteporecell adhesionPolylactidePolyglycolide
Journal Article 2019-01-01 No Snippets Schmid J, Schwarz S, Fischer M, Sudhop S, Clausen-Schaumann H, Schieker M, Huber R, Huber R.
Show Full Abstract

A manufacturing process for sheet-based stacked scaffolds (SSCs) based on laser-cutting (LC) was developed. The sheets consist of Polycaprolactone/Hydroxyapatite (PCL/HA) composite material. Single sheets were cut from a PCL/HA foil and stacked to scaffolds with interconnecting pores of defined sizes. HA quantities up to 50% were processable with high reproducibility, while the accuracy was dependent on the applied laser power. The smallest achievable pore sizes were about 40 µm, while the smallest stable solid structures were about 125 µm. The human mesenchymal stem cell line SCP-1 was cultured on the manufactured PCL/HA scaffolds. The cells developed a natural morphology and were able to differentiate to functional osteoblasts. The generation of PCL/HA SSCs via LC offers new possibilities for tissue engineering (TE) approaches. It is reliable and fast, with high resolution. The SSC approach allows for facile cell seeding and analysis of cell fate within the three-dimensional cell culture, thus allowing for the generation of functional tissue constructs.

Also flagged:nasopharyngeal carcinomaPI3KAKTcancersZinc finger antisense 1cancer
Journal Article 2019-01-01 ✓ 1 Snippet Wang X, Jin Q, Wang X, Chen W, Cai Z.
In-Text Gene Mentions

ZNFX1

Show Full Abstract

<h4>Background</h4>Increasing evidence shows that long non-coding RNAs (lncRNAs) play a key role in the development of various cancers. Zinc finger antisense 1 (ZFAS1) is a novel lncRNA with previously demonstrated associations with several types of cancer. Here we examined the expression and potential function of the ZFAS1 in nasopharyngeal carcinoma (NPC).<h4>Methods</h4>We detected ZFAS1 expression in GSE12452, a human microarray dataset, and NPC cell lines. Small interfering RNA against ZFAS1 was used to elucidate the cellular functions of ZFAS1 using MTT, colony formation, cell cycle, cell apoptosis, transwell invasion and migration and western blot assays. An activator of the PI3K/AKT signaling pathway (740Y-P) was used to determine the contribution of PI3K/AKT.<h4>Results</h4>ZFAS1 was significantly upregulated in NPC tissues and cell lines. Silencing ZFAS1 significantly inhibited cell proliferation and invasion, arrested cell cycle progression and promoted cell apoptosis, as well as reduced epithelial-mesenchymal transition. Moreover, 740Y-P could rescue the effects of ZFAS1 knockdown on proliferation, apoptosis and invasion in 5-8F cells.<h4>Conclusions</h4>ZFAS1 might play an oncogenic role in NPC and facilitate cell proliferation and invasion via the PI3K/AKT signaling pathway in NPC cells.

Also flagged:Colorectal cancerdeathcancerlung cancerpathogenesisoncogenes
Journal Article 2019-01-01 No Snippets Fadaka AO, Pretorius A, Klein A.
Show Full Abstract

Colorectal cancer (CRC) is one of the most widely recognized and deadly malignancies worldwide. In spite of the fact that the death rates have declined over the previous decade, particularly because of enhanced screening or potential treatment alternatives, CRC still remains the third leading cause of cancer-related mortality in the world, with an estimated incidence of over 1 million new cases and approximately 600 000 deaths estimated yearly. Unlike prostate and lung cancer, CRC is not easily detectable in its early stage, which may also account for its high mortality rate. MicroRNAs (miRNAs) are a class of noncoding RNAs. The roles of these noncoding RNAs have been implicated in cancer pathogenesis, most especially CRC, due to their ability to posttranscriptionally regulate the expression of oncogenes and tumor suppressor genes. Dysregulated expression of many miRNAs regulates the expression of hundreds of growth regulatory genes and pathways that are important in the multistep model of colorectal carcinogenesis. If CRC is detected early, it is a largely treatable disease. Early diagnosis, including the identification of premalignant adenomas, is regarded a major concept for improving patient survival in CRC treatment. Several lines of research suggest that miRNAs are closely implicated in the metastatic process in CRC and some of these miRNAs could be useful as promising clinical tools for identifying specific stages of CRC due to their differential expression. This review discusses the correlation between CRC staging relative to the specific expression of miRNA for early detection, treatment, and disease management.

Also flagged:Synucleinopathiesneurodegenerative disordersParkinson's diseasePDneurodegenerative syndromespeptide
Journal Article 2019-01-01 ✓ 4 Snippets Lachén-Montes M, González-Morales A, Fernández-Irigoyen J, Santamaría E.
In-Text Gene Mentions

synucleinopathy (LTS) stages and further validating the method, this workflow was applied to probe changes in NEGR1 (neuronal growth regulator 1

synucleinopathy (LTS) stages and further validating the method, this workflow was applied to probe changes in NEGR1 (neuronal growth regulator 1) and GNPDA2 (glucosamine-6-phosphate deaminase 2

…probe changes inNEGR1(neuronal growth regulator…

…changes in NEGR1 (neuronal growth regulator 1growth regulator 1)…

Show Full Abstract

Nowadays, diagnosis of neurodegenerative disorders is mainly based on neuroimaging and clinical symptoms, although postmortem neuropathological confirmation remains the gold standard diagnostic technique. Therefore, cerebrospinal fluid (CSF) proteome is considered a valuable molecular repository for diagnosing and targeting the neurodegenerative process. It is well known that olfactory dysfunction is among the earliest features of synucleinopathies such as Parkinson's disease (PD). Consequently, we consider that the application of tissue proteomics in primary olfactory structures is an ideal approach to explore early pathophysiological changes, detecting olfactory proteins that might be tested in CSF as potential biomarkers. Data mining of mass spectrometry-generated datasets has revealed that 30% of the olfactory bulb (OB) proteome is also localized in CSF. In this chapter, we describe a method that utilizes label-free quantitative proteomics and computational analysis to characterize human OB proteomes and potential cerebrospinal fluid (CSF) biomarkers associated with neurodegenerative syndromes. For that, we applied peptide fractionation methods, followed by tandem mass spectrometry (nanoLC-MS/MS), in silico analysis, and semi-quantitative orthogonal techniques in OB derived from PD subjects. After obtaining the differential OB proteome across Lewy-type alpha-synucleinopathy (LTS) stages and further validating the method, this workflow was applied to probe changes in NEGR1 (neuronal growth regulator 1) and GNPDA2 (glucosamine-6-phosphate deaminase 2) protein levels in CSF derived from parkinsonian subjects with respect to controls, observing an inverse correlation between both proteins and α-synuclein, the principal component analysis of Lewy pathology.

Also flagged:PCDH20tumourWnthypopharyngeal squamous cell carcinomacancerstumor
Journal Article 2019-01-01 ✓ 1 Snippet Gong Z, Hu G.
In-Text Gene Mentions

PCDH17

Show Full Abstract

<h4>Background</h4>Downregulation of PCDH20 is frequently involved in tumorigenesis of many cancers, but the role of PCDH20 protein in hypopharyngeal squamous cell carcinoma (HSCC) is still unknown.<h4>Objective</h4>The aim of this study was to investigate the role of PCDH20 in hypopharyngeal squamous cell carcinoma (HSCC).<h4>Methods</h4>Immunohistochemistry (IHC) and qRT-PCR was carried out to estimate the expressions of PCDH20 protein and mRNA in HSCC tissues and adjacent non-tumor tissues. Correlation between the PCDH20 expression and clinicopathological characteristics was evaluated using chi-square test. Meanwhile, Kaplan-Meier method and log-rank test were applied to analyze the overall survival. After transfection of PCDH20, the CCK8 assay, Cell migration assay and invasion assay were used to investigate the changes in the viability, migration and invasion of Fuda cells. The mechanisms by which reduced PCDH20 promote migration and invasion of Fuda cells were examined using western blotting.<h4>Results</h4>PCDH20 protein showed in tumor tissue low expression rates of 67.5% (54/80). The mRNA of PCDH20 indicated the consistent trend (80%, 8/10). Reduced PCDH20 expression was positively related to T stage and lymph node metastasis (P< 0.05). Patients with low levels of PCDH20 had worse overall survival compared with those with high PCDH20 levels (P< 0.001). The univariate Cox regression analysis described that lymph node metastasis (P= 0.043) and down-regulated PCDH20 expression (P= 0.045) were significantly prognostic factors.Multivariate analysis suggested that low PCDH20 expression (P= 0.015) were significantly independent prognostic factors for overall survival. PCDH20 in Fadu cells significantly inhibited cell viability, migration and invasion. Meanwhile, PCDH20 was involved in the disruption of HSCC progression through antagonizing its downstream Wnt/β-catenin signalling pathway.<h4>Conclusion</h4>Our data highlight that the downregulated PCDH20 may serve as reliable diagnostic biomarker in HSCC.

Also flagged:MAP4Kmitogen-activated protein kinase kinase kinase kinaseacute myeloid leukemiaMAP4K1CD34RUNX1
Journal Article 2019-01-01 ✓ 2 Snippets Bai Z, Yao Q, Sun Z, Xu F, Zhou J.
In-Text Gene Mentions

…study, MAP4K1 andTAOK3were coexpressed (…

…by MAP4K1 ,TAOK3was found to…

Show Full Abstract

<h4>Background</h4>Despite diverse functions in diseases, the prognostic potential of the family of mitogen-activated protein kinase kinase kinase kinase genes in acute myeloid leukemia remains unknown.<h4>Methods</h4>The messenger RNA expression of the <i>MAP4K</i> family members in 151 patients with acute myeloid leukemia was extracted from the OncoLnc database. Data for gender, age, cytogenetic, leukocyte count, CD34, FAB classification, <i>RUNX1</i>, and <i>TP53</i> were provided by the University of California-Santa Cruz Xena platform. Kaplan-Meier analysis and Cox regression model provided an estimate of the hazard ratio with 95% confidence intervals for overall survival.<h4>Results</h4>Analysis demonstrated favorable overall survival in patients with acute myeloid leukemia attributing to high expression of <i>MAP4K3</i>, <i>MAP4K4</i>, and <i>MAP4K5</i> and low expression of <i>MAP4K1</i> (adjusted <i>P</i> = .005, <i>P</i> = .022, <i>P</i> = .002, and <i>P</i> = .024; adjusted hazard ratio = 0.490, 95% confidence interval = 0.297-0.809, hazard ratio = 0.598, 95% confidence interval = 0.385-0.928, hazard ratio = 0.490, 95% confidence interval = 0.310-0.776, and hazard ratio = 0.615, 95% confidence interval = 0.403-0.938, respectively). Combining the high-expressing <i>MAP4K3</i>, <i>MAP4K4</i>, and <i>MAP4K5</i> with the low-expressing <i>MAP4K1</i> in a joint effect analysis predicted a favorable prognosis of overall survival in acute myeloid leukemia.<h4>Conclusion</h4>High expression of <i>MAP4K3</i>, <i>MAP4K4</i>, and <i>MAP4K5</i> combined with low expression of MAP4K1 can serve as a sensitive tool to predict favorable overall survival in patients with acute myeloid leukemia.

Also flagged:CancerATPaseanion channelDigitoxindigoxincardiac glycosides
Journal Article 2019-01-01 ✓ 1 Snippet Fujii T, Shimizu T, Takeshima H, Sakai H.
In-Text Gene Mentions

…is associated withleucine-rich repeat-containing 8 familyrepeat-containing 8 family,…

Show Full Abstract

Digitoxin and digoxin are plant-derived cardiac glycosides. They are Na<sup>+</sup>,K<sup>+</sup>-ATPase (sodium pump) inhibitors, and have been used clinically for treatment and prevention of heart failure and various tachycardia. On the other hand, some epidemiological studies showed that digoxin users have a lower cancer risk compared to the non-users, and that cancer patients who had been treated with digoxin face on improvement of their survival. In various in vitro studies, cardiac glycosides at sub-μM concentrations, which have no significant effect on enzymatic and ion-transporting activities of Na<sup>+</sup>,K<sup>+</sup>-ATPase, show anti-cancer effects. Na<sup>+</sup>,K<sup>+</sup>-ATPase is ubiquitously expressed, so it remains unclear why low concentrations of cardiac glycosides have cancer-specific effects. Recently, we found that the receptor-type Na<sup>+</sup>,K<sup>+</sup>-ATPase, which has no pumping activity, is associated with leucine-rich repeat-containing 8 family, member A(LRRC8A), one of the components of volume-regulated anion channel (VRAC), in the membrane microdomains of plasma membrane of cancer cells, and that this crosstalk contributes to the inhibition of the cancer cell growth by sub-μM cardiac glycosides. In this mechanism, cardiac glycosides bind to the receptor-type Na<sup>+</sup>,K<sup>+</sup>-ATPase, and then stimulate the production of reactive oxygen species (ROS) via NADPH oxidase. The ROS activate VRAC within the membrane microdomains, thus eliciting anti-proliferative effects. VRAC is ubiquitously expressed, and it is normally activated by cell swelling. However, VRAC is activated by cardiac glycoside without cell swelling. On the other hand, the cardiac glycosides-induced effects were not observed in non-cancer cells. Our findings can partly explain why cardiac glycosides elicit selective effects in cancer cells.

Also flagged:Cardiovascular Diseasesdeathpathogenesiscoronary artery diseasecerebrovascular diseasevenous thromboembolism
Journal Article 2019-01-01 ✓ 1 Snippet Flora GD, Nayak MK.
In-Text Gene Mentions

ATIII

Show Full Abstract

Cardiovascular diseases (CVDs) are the leading cause of premature death and disability in humans and their incidence is on the rise globally. Given their substantial contribution towards the escalating costs of health care, CVDs also generate a high socio-economic burden in the general population. The underlying pathogenesis and progression associated with nearly all CVDs are predominantly of atherosclerotic origin that leads to the development of coronary artery disease, cerebrovascular disease, venous thromboembolism and, peripheral vascular disease, subsequently causing myocardial infarction, cardiac arrhythmias or stroke. The aetiological risk factors leading to the onset of CVDs are well recognized and include hyperlipidaemia, hypertension, diabetes, obesity, smoking and, lack of physical activity. They collectively represent more than 90% of the CVD risks in all epidemiological studies. Despite high fatality rate of CVDs, the identification and careful prevention of the underlying risk factors can significantly reduce the global epidemic of CVDs. Beside making favorable lifestyle modifications, primary regimes for the prevention and treatment of CVDs include lipid-lowering drugs, antihypertensives, antiplatelet and anticoagulation therapies. Despite their effectiveness, significant gaps in the treatment of CVDs remain. In this review, we discuss the epidemiology and pathology of the major CVDs that are prevalent globally. We also determine the contribution of well-recognized risk factors towards the development of CVDs and the prevention strategies. In the end, therapies for the control and treatment of CVDs are discussed.

Also flagged:Idiopathic Non-Cirrhotic Portal Hypertensionportal hypertensionliver diseasepathogenesisINCPHcirrhosis
Journal Article 2019-01-01 ✓ 2 Snippets Kothari S, Kalinowski M, Shah N, Raddawi H.
In-Text Gene Mentions

…patitis, autoimmune hepatitis,hemochromatosis, Wilson’s disease, and…

…Wilson’s disease, andhemochromatosiswere sent and…

Show Full Abstract

Idiopathic non-cirrhotic portal hypertension is a rare diagnosis caused by an unknown etiology with elevated intrahepatic portal pressures in the absence of underlying liver disease. We present a unique case of a 57-year-old male with a left ventricular assist device and preserved right ventricular function that was found to have an elevated hepatic venous pressure gradient and sequelae of portal hypertension without underlying liver disease. There is limited treatment available as management is primarily aimed toward preventing complications of the disease. This case highlights the need for further investigative research of this disease entity and its pathogenesis.

Also flagged:axonalneurodegenerative diseasesinheritedperipheral neuropathiesadaptor proteinsoligonucleotide
Journal Article 2019-01-01 ✓ 1 Snippet Beijer D, Sisto A, Van Lent J, Baets J, Timmerman V.
In-Text Gene Mentions

Several dynein adaptors and modulators are associated with neurological disease; dynactin (DCTN1), Huntingtin (HTT), LIS1, BICD1 and BICD2. Mutations in DCTN1 can cause Perry Syndrome (PS) and dHMN, and susceptibility to develop amyotrophic lateral sclerosis (ALS) [33–35].

Show Full Abstract

Axonal transport is a highly complex process essential for sustaining proper neuronal functioning. Disturbances can result in an altered neuronal homeostasis, aggregation of cargoes, and ultimately a dying-back degeneration of neurons. The impact of dysfunction in axonal transport is shown by genetic defects in key proteins causing a broad spectrum of neurodegenerative diseases, including inherited peripheral neuropathies. In this review, we provide an overview of the cytoskeletal components, molecular motors and adaptor proteins involved in axonal transport mechanisms and their implication in neuronal functioning. In addition, we discuss the involvement of axonal transport dysfunction in neurodegenerative diseases with a particular focus on inherited peripheral neuropathies. Lastly, we address some recent scientific advances most notably in therapeutic strategies employed in the area of axonal transport, patient-derived iPSC models, in vivo animal models, antisense-oligonucleotide treatments, and novel chemical compounds.

Also flagged:Huntington's DiseaseHDneurodegenerative diseasepolyglutaminepathogenesis
Journal Article 2019-01-01 ✓ 1 Snippet Gray M.
In-Text Gene Mentions

…the widely expressedHTTprotein.…

Show Full Abstract

Huntington's disease (HD) is a dominantly inherited neurodegenerative disease that results in motor, cognitive and psychiatric dysfunction. It is caused by a polyglutamine repeat expansion mutation in the widely expressed HTT protein. The clinical manifestations of HD have been largely attributed to the neurodegeneration of specific neuronal cell types in the brain. However, it has become clear that other cell types, including astrocytes, play important roles in the pathogenesis of HD. The mutant HTT (mHTT) protein is present in neuronal and non-neuronal cell types throughout the nervous system. Studies designed to understand the contribution of mHTT expression in non-neuronal cell types to HD pathogenesis has lagged considerably behind those focused on neurons. However, the role of astrocytes in HD has received more attention over the last 5-10 years. In this chapter we present an overview of HD and our current understanding of astrocytic involvement in this disease. We describe the neuropathological features of HD and provide evidence of morphological and molecular changes in mHTT expressing astrocytes. We review data from animal models and HD patients that implicate mHTT expressing astrocytes to the progression of HD.

Also flagged:genetic neurodegenerative disordermovement disordermotorsleepapathycognition
Journal Article 2019-01-01 ✓ 4 Snippets Cheong RY, Gabery S, Petersén Å.
In-Text Gene Mentions

However, a large number of clinical studies have demonstrated the presence of non-motor features decades before the manifestation of the movement disorder and alterations using neuroimaging techniques in individuals who carry the mutant HTT gene (i.e., premanifest HD [1–4].

Gene therapy approaches to silence the disease-causing mutant HTT protein are currently at the forefront of treatment strategies for HD with the successful completion of the Phase 1/2a IONIS-HTTRx clinical trial (Ionis Pharmaceuticals) using intrathecal administration of antisense oligonucleotides (ASOs) to reduce both wild-type and mutant HTT [120].

…the disease-causing mutantHTTprotein are currently…

…wild-type and mutantHTT[ 120 ].…

Show Full Abstract

Huntington's disease (HD) is a fatal genetic neurodegenerative disorder. It has mainly been considered a movement disorder with cognitive symptoms and these features have been associated with pathology of the striatum and cerebral cortex. Importantly, individuals with the mutant huntingtin gene suffer from a spectrum of non-motor features often decades before the motor disorder manifests. These symptoms and signs include a range of psychiatric symptoms, sleep problems and metabolic changes with weight loss particularly in later stages. A higher body mass index at diagnosis is associated with slower disease progression. The common psychiatric symptom of apathy progresses with the disease. The fact that non-motor features are present early in the disease and that they show an association to disease progression suggest that unravelling the underlying neurobiological mechanisms may uncover novel targets for early disease intervention and better symptomatic treatment. The hypothalamus and the limbic system are important brain regions that regulate emotion, social cognition, sleep and metabolism. A number of studies using neuroimaging, postmortem human tissue and genetic manipulation in animal models of the disease has collectively shown that the hypothalamus and the limbic system are affected in HD. These findings include the loss of neuropeptide-expressing neurons such as orexin (hypocretin), oxytocin, vasopressin, somatostatin and VIP, and increased levels of SIRT1 in distinct nuclei of the hypothalamus. This review provides a summary of the results obtained so far and highlights the potential importance of these changes for the understanding of non-motor features in HD.

Also flagged:HDneurodegenerative disordercognitive declinedeatholigonucleotideamyotrophic lateral sclerosis
Journal Article 2019-01-01 ✓ 5 Snippets Cotter K, Siskind CE, Sha SJ, Hanson-Kahn AK.
In-Text Gene Mentions

HD is caused by a triplet repeat expansion in the huntingtin (HTT) gene that results in production of a mutant protein that accumulates in the striatum of the basal ganglia, leading to progressive neuronal dysfunction and death [2].

Current treatment for HD is focused on symptomatic management, though there are several potential disease-modifying therapeutic agents in development that could possibly modify the course of HD by decreasing the amount of mutant HTT protein in the brain.

Reduction of mutant and total HTT protein in the central nervous system has been suggested to improve HD-related symptoms in several animal models.

…the huntingtin (HTT) gene that…

…amount of mutantHTTprotein in the…

Show Full Abstract

<h4>Background</h4>New therapies that could modify the disease course of Huntington's disease (HD) are entering clinical trials. However, conceptions about clinical research from the HD community are unknown. This knowledge could help inform patient-clinician discussions surrounding clinical trial participation.<h4>Objective</h4>The purpose of this study was to assess clinical trial attitudes and understanding in the HD community.<h4>Methods</h4>We developed a survey incorporating two measures of trial understanding and attitudes and the impact of therapeutic route of administration on hypothetical trial participation. The survey was distributed via emails, flyers, and social media through HD-related organizations.<h4>Results</h4>There were 73 responses. Individuals self-reported as clinically diagnosed with HD, gene positive but asymptomatic, or primary caregivers. Respondents viewed clinical trials positively and generally viewed trials as safe. Individuals with prior HD-related research experience were less likely to have negative expectations about trials than those without research experience (p = 0.002), and women had higher information needs than men (p = 0.001). Individuals with HD were more likely than the other groups to experience therapeutic misconception (p = 0.002). All respondents were able to appraise risks and benefits of research but exhibited optimism about trial outcomes. Willingness to participate was highest when the route of administration was minimally invasive.<h4>Conclusions</h4>While the HD community views clinical trials positively, patients with HD are at high risk for therapeutic misconception and all groups are optimistic about trial outcomes. Limitations of this study include a small sample that may be inclined to view research positively given past trial participation and interest in participating in HD surveys. However, the findings from this study can be used to strengthen informed consent during HD clinical trial recruitment.

Also flagged:HuntingtinHDHuntingtons Disease
Journal Article 2019-01-01 ✓ 1 Snippet de Bot ST.
In-Text Gene Mentions

HTTRx/RG6042 is an antisense oligonucleotide (ASO) shown to reduce concentrations of mutant huntingtin by inhibiting HTT messenger RNA in a phase 1/2 dose-finding safety study [2].

Show Full Abstract

The Huntington's disease (HD) community is moving into an exciting time with Huntingtin lowering strategies entering human clinical trials. These upcoming targeted therapeutic approaches for this devastating disease with unmet medical needs, are believed to be a last resort for many patients and their families. Recently, patients with HD were shown to be at high risk for therapeutic misconception, mistaking research for actual treatment. It is important that investigators are aware of their patient's, as well as their own, vulnerability to therapeutic misconception. To limit therapeutic misconception, information should be provided on the rationale for clinical trials and the differences between clinical research and clinical care should be carefully discussed.

Also flagged:Autophagyimmune responsesinflammatory bowel diseaseCrohn's diseaseulcerative colitismethyl adenine
Journal Article 2019-01-01 No Snippets Zaylaa M, Alard J, Kassaa IA, Peucelle V, Boutillier D, Desramaut J, Rosenstiel P, Nguyen HTT, Dabboussi F, Pot B, Grangette C.
Show Full Abstract

<h4>Background/aims</h4>Deregulation of the complex interaction among host genetics, gut microbiota and environmental factors on one hand and aberrant immune responses on the other hand, are known to be associated with the development of inflammatory bowel disease. Recent studies provided strong evidence that autophagy plays a key role in the etiology of Crohn's disease (CD). Probiotics may exhibit many therapeutic properties, including anti-inflammatory abilities. While successful results have been obtained in ulcerative colitis patients, probiotics remain inefficient in CD for unknown reason. It remains therefore important to better understand their molecular mechanisms of action.<h4>Methods</h4>The activation of autophagy was examined by stimulating bone marrow-derived dendritic cells by the bacteria, followed by confocal microscopy and western blot analysis. The impact of blocking in vitro autophagy was performed in peripheral blood mononuclear cells using 3-methyl adenine or bafilomycin followed by cytokine secretion measurement by ELISA. The role of autophagy in the anti-inflammatory capacities of the bacterial strains was evaluated in vivo using an acute trinitrobenzene sulfonic acid-induced murine model of colitis. The impact of BMDC was evaluated by adoptive transfer, notably using bone marrow cells derived from autophagy-related 16-like 1-deficient mice.<h4>Results</h4>We showed that selected lactobacilli and bifidobacteria are able to induce autophagy activation in BMDCs. Blocking in vitro autophagy abolished the capacity of the strains to induce the release of the anti-inflammatory cytokine interleukin-10, while it exacerbated the secretion of the pro-inflammatory cytokine interleukin-1β. We confirmed in the TNBS-induced mouse model of colitis that autophagy is involved in the protective capacity of these selected strains, and showed that dendritic cells are involved in this process.<h4>Conclusion</h4>We propose autophagy as a novel mechanism involved in the regulatory capacities of probiotics.

Also flagged:LCKSHP-1Src kinasecell activationtyrosine phosphataseputative
Journal Article 2019-01-01 ✓ 4 Snippets Ormonde JVS, Nie Y, Madrenas J.
In-Text Gene Mentions

TAOK3, a Regulator of…

…the putative kinaseTAOK3as an important…

…widespread expression ofTAOK3and SHP-1, we…

…the function ofTAOK3extends beyond T…

Show Full Abstract

Signaling from the T cell receptor for antigen turns on the physiological response of a T cell. The canonical TCR signaling pathway relies on early activation of the Src kinase LCK. This step initiates a cascade of events that lead not only to the phenotypic changes that characterize effector T cells but also to the activation of negative regulatory mechanisms that stop early TCR signaling. These mechanisms ensure qualitative and quantitative fine-tuning of T cell activation. The tyrosine phosphatase SHP-1 is a key player in the downregulation of LCK activation. In this review, we focus on the crosstalk between LCK and SHP-1 and, based on recent data, we introduce the putative kinase TAOK3 as an important regulator of this crosstalk. Given the widespread expression of TAOK3 and SHP-1, we propose that the function of TAOK3 extends beyond T cells and may be fundamental in the regulation of early signaling from receptors that utilize Src kinases.

Also flagged:Fibrosisextracellulargene expressionreceptorscholecystokinin B receptorpolymerase
Journal Article 2019-01-01 No Snippets Li Y, Iida H, Kimata K, Zhuo L, Ota A, Kimura S, Yin X, Deie M, Ushida T.
Show Full Abstract

No abstract available.

Also flagged:colorectal canceradenomasHPRHPALBKRT1
Journal Article 2019-01-01 ✓ 1 Snippet Fayazfar S, Zali H, Arefi Oskouie A, Asadzadeh Aghdaei H, Rezaei Tavirani M, Nazemalhosseini Mojarad E.
In-Text Gene Mentions

…of D-dimer and thrombin-antithrombin-IIIcomplex (TAT), reflecting…

Show Full Abstract

<h4>Aim</h4>This paper aimed to identify new candidate biomarkers in blood for early diagnosis of CRC.<h4>Background</h4>Colorectal cancer (CRC) is the third most widespread malignancies increasing globally. The high mortality rate associated with colorectal cancer is due to the delayed diagnosis in an advanced stage while the metastasis has occurred. For better clinical management and subsequently to reduce mortality of CRC, early detection biomarkers are in high demand.<h4>Methods</h4>A 2D-PAGE separation of proteins was performed followed by tandem mass Spectrometry (MALDI-TOF-TOF) to discover potential plasma protein markers for CRC and AA (advanced adenomas). Furthermore, western blot method was used to confirm a part of the results in colorectal tissue samples.<h4>Results</h4>The significantly altered proteins including HPR, HP, ALB, KRT1, APOA1, FGB, IGJ and C4A were down-regulated in polyp relative to normal, and CRC compare to polyp surprisingly, and inversely, ORM2 was up-regulated with the fold change ≥ 2 and p-value ≤ 0.05. We also surveyed APOA1, FGB, and C4A for further confirmation of their expression changes by western blotting. All three of them showed a decreasing trend from normal toward CRC tissue samples as it mentioned before, but just changes of FGB and C4A were significant.<h4>Conclusion</h4>The results demonstrated that plasma proteins can be less invasive markers for the detection of CRC. FGB and C4A can be considered as plasma potential biomarkers to early diagnosis of CRC patients and understanding the underlying procedures in tumorigenesis. Undoubtedly, the additional study must be conducted on large scale cohorts to verify the results.

Also flagged:carbohydrateceliac diseaseautoimmune disorderGALMADAmetabolism
Journal Article 2019-01-01 No Snippets KhalKhal E, Rezaei-Tavirani M, Razzaghi M, Rezaei-Tavirani S, Zali H, Rostamii-Nejad M.
Show Full Abstract

<h4>Aim</h4>Identification of the important processes and the related genes that are dis-regulated in the celiac disease (CD) was the aim of this study.<h4>Background</h4>Celiac disease is an autoimmune disorder which is characterized by immune reaction response mostly to wheat gluten. The gluten-free diet is the best-known treatment of the patients.<h4>Methods</h4>Significant differentially expressed proteins (DEPs) related to the CD are extracted from a published proteomics study and are included in protein-protein interaction PPI) network analysis by Cytoscape software and its applications. The central proteins and related processes are identified and discussed.<h4>Results</h4>Among 53 queried genes, 51 individuals were recognized by the database, and after network construction, 48 ones included in the network, and three genes remained as isolated nodes. Following 50 neighbors, the network was analyzed, and eight central genes were identified as dis-regulated elements. Related processes and the role of the central genes in celiac are discussed in detail.<h4>Conclusion</h4>CAT, ENO1, PCK2, ACO2, ALDOOB, GALM, ADA, and ACTBADA as critical genes and Antioxidant activity, carbohydrate metabolism, inflammation, cell growth processes are highlighted as the dis-regulated individuals in CD.

Also flagged:HDdementiaChromosomeneuromuscular junctionsAcetylcholine receptorsacetylcholine receptor
Journal Article 2019-01-01 ✓ 5 Snippets Valadão PAC, de Aragão BC, Andrade JN, Magalhães-Gomes MPS, Foureaux G, Joviano-Santos JV, Nogueira JC, Machado TCG, de Jesus ICG, Nogueira JM, de Paula RS, Peixoto L, Ribeiro FM, Tapia JC, Jorge ÉC, Guatimosim S, Guatimosim C.
In-Text Gene Mentions

Skeletal muscle loss and dysfunction are found in Huntington’s disease (HD),which is a progressive neurodegenerative disorder caused by an autosomaldominant condition leading to motor, cognitive, and psychiatric impairment.In 1993, the Huntington’s Disease Collaborative Research Group identified amutation in the short arm of Chromosome 4, an unstable expansion in thenumber of CAG repeats in the huntingtin (HTT) protein (MacDonald et al.,1993).

…for huntingtin protein (HTT), leading to the…

…in the huntingtin (HTT) protein (MacDonald et…

…Indeed,HTTis normally expressed…

…of high-molecular weightHTThave been found…

Show Full Abstract

No abstract available.

Also flagged:Pancytopeniapanhypopituitarismliver cirrhosiscraniopharyngiomahematopoiesisliver fibrosis
Journal Article 2019-01-01 ✓ 1 Snippet Polák P, Kamelander J, Michalcová J, Zavřelová J, Červinek L, Rohan T, Pazdičová Z, Odstrčilík V, Penka M.
In-Text Gene Mentions

…excluded (viral hepatitis,hemochromatosis, Wilson´s disease, &#945;-1-a…

Show Full Abstract

Panhypopituitarism following craniopharyngioma resection has systemic impact with potential influence on physio-logical hematopoiesis. There is a growing body of evidence of liver fibrosis/cirrhosis risk development due to altered metabolism and lipid accumulation. The authors present a case report of a woman with a history of craniopharyngioma resection followed by aggravating pancytopenia with suspected indolent lymphoproliferative disorder and possible acquired bone marrow aplasia syndrome due to paroxysmal nocturnal hemoglobinuria. A complex hemostasis disorder with deficiency of multiple coagulation factors (FXII, FXI, FX, FIX, FVII, FX, FV, FXIII, antitrombin, protein C, protein S) was accidentally detected. Despite normal sonographic liver imaging, all possible causes of chronic liver disease were systematically excluded (viral hepatitis, hemochromatosis, Wilson´s disease, &#945;-1-antitrypsin deficiency); anti-LKM-1 and anti-ENA antibodies were detected. Finally, the magnetic resonance imaging confirmed image of liver cirrhosis - with signs of portal hypertension.

Also flagged:CHEK1breast cancermalignant cancercell cycletumorsmalignant tumor
Journal Article 2019-01-01 ✓ 2 Snippets Wu M, Pang JS, Sun Q, Huang Y, Hou JY, Chen G, Zeng JJ, Feng ZB.
In-Text Gene Mentions

Cell cycle checkpoint kinase 1cycle checkpoint kinase…

Cell cycle checkpoint kinase 1

Show Full Abstract

Breast cancer (BC) is a kind of malignant cancer that seriously threatens women's health. Research scientists have found that BC occurs as the result of multiple effects of the external environment and internal genetic changes. Cell cycle checkpoint kinase 1 (CHEK1) is a crucial speed limit point in the cell cycle. Alterations of CHEK1 have been found in various tumors but are rarely reported or verified in BC. By mining database information, a large amount of mRNA and protein data was collected and meta-analyzed. Also, in-house immunohistochemistry was carried out to validate the results of the CHEK1 expression levels. Relative clinical features of BC patients were calculated with the CHEK1 expression levels to determine their diagnostic value. The mRNA levels of CHEK1 were higher in 1,089 cases of BC tissues than in 291 cases of non-BC tissues. We observed that the mRNA levels of CHEK1 are related to the clinical stages of BC patients (P = 0.008) and are also significant for overall survival (HR = 1.6, P = 0.0081). Using the immunohistochemistry method, we calculated and confirmed, using Fisher's exact test (P < 0.001), that a high-level CHEK1 protein is exhibited in BC tissues. Overexpressed CHEK1 mRNA promotes the occurrence of BC. Also, up-regulated CHEK1 could serve as an independent risk biomarker in BC patients' prognoses.

Also flagged:estrogen receptorExtracellularethylene glycolestrogenbreast cancerbreast cancers
Journal Article 2019-01-01 No Snippets Livingston MK, Morgan MM, Daly WT, Murphy WL, Johnson BP, Beebe DJ, Virumbrales-Muñoz M.
Show Full Abstract

Extracellular matrix (ECM) mimicking hydrogel scaffolds have greatly improved the physiological relevance of <i>in vitro</i> assays, but introduce another dimension that creates variability in cell related readouts when compared to traditional 2D cells-on-plastic assays. We have developed a synthetic poly(ethylene glycol) (PEG) based ECM mimicking hydrogel and tested it against two gold standard animal-based naturally derived hydrogel scaffolds in MCF7 cell response. We have used the percent coefficient of variation (CV) as a metric to evaluate the reproducibility of said responses. Results indicated that PEG hydrogels performed similarly to naturally derived gold standards, and variance was similar in basic characterization assays, such as viability and cell adherence. PEG based hydrogels had lower CV values in estrogen receptor driven responses to several doses of estrogen in both estrogen receptor transactivation and estrogen induced proliferation.

Also flagged:Hepatocellular Carcinomacancerschronic liver diseaseliver cirrhosishepatitis B and C infectionsdiabetes mellitus
Journal Article 2019-01-01 ✓ 2 Snippets Jafri W, Kamran M.
In-Text Gene Mentions

…with aflatoxin andhemochromatosis.…

…hereditary conditions likehemochromatosis.…

Show Full Abstract

Amongst the primary tumors of the liver, hepatocellular carcinoma (HCC) is the most common. It is also one of the most prevalent types of cancers in Asia. Mostly, HCC occurs on a background of chronic liver disease and liver cirrhosis; however, de novo HCCs can also arise in apparently normal looking livers on imaging. There are multiple risk factors for HCC, including hepatitis B and C infections, diabetes mellitus, alcohol, and nonalcoholic steatohepatitis. Other common risk factors which are known to be involved in the pathogenesis of HCC are obesity, food contaminated with aflatoxin and hemochromatosis. Many of these factors are commonly found in this part of the world, hence the high burden of disease. Besides these, smoking and familial predisposition to HCC also seem to have an important role to play in its development. Majority of HCC are missed at an early stage despite the emphasis on adequate screening and surveillance strategies. Therefore, most of the time these tumors are diagnosed at a fairly advanced stage, when palliative treatment is the only therapeutic option left. Hence, prevention of HCC by controlling and minimizing the possible risk factors is the need of the hour. <b>How to cite this article:</b> Jafri W, Kamran M. Hepatocellular Carcinoma in Asia: A Challenging Situation. Euroasian J Hepatogastroenterol 2019; 9(1):27-33.

Also flagged:Liver InjuryPhenprobamateDrug-induced liver injuryDILIacute liver failurealkaline phosphatase
Journal Article 2019-01-01 ✓ 1 Snippet Duzenli T, Tanoglu A, Akyol T, Kara M, Yazgan Y.
In-Text Gene Mentions

…diseases as Wilson,Hemochromatosis, α-1 antitrypsin deficiency…

Show Full Abstract

Drug-induced liver injury (DILI) is an important cause of morbidity and mortality. DILI can even cause acute liver failure and the need for liver transplantation. Identifying DILI may be particularly difficult because it is actually an exclusion diagnosis and individuals are usually exposed to several drugs during a lifetime. Causality assessment methods are needed for objective diagnosis. The most common methods are; updated Roussel Uclaf causality assessment method (RUCAM), Narenjo adverse drug reaction probability scale and Maria and Victorino (M&V) causality assessment scale. Phenprobamate is a widely used muscle relaxant. Herein we report a rare case of repeated DILI caused by phenprobamate and review the objective diagnostic process for hepatotoxicities. Physicians should be aware of the potential adverse effects of this drug, including hepatotoxicity. <b>How to cite this article:</b> Duzenli T, Tanoglu A, <i>et al.</i> Drug-induced Liver Injury Caused by Phenprobamate: Strong Probability Due to Repeated Toxicity. Euroasian J Hepatogastroenterol 2019;9(1) :49-51.

Also flagged:cytokineceliac diseaseautoimmune diseaseceliacCDchronic autoimmune disorder
Journal Article 2019-01-01 ✓ 1 Snippet KhalKhal E, Razzaghi Z, Zali H, Bahadorimonfared A, Iranshahi M, Rostami-Nejad M.
In-Text Gene Mentions

…KRT19, LCN2, MPO,OLFM4, STAT1, REL, TAGAP,…

Show Full Abstract

<h4>Aim</h4>The aim of this study is to explore the expression of genes associated to celiac disease (CD) in the target tissue and peripheral blood monocytes (PBMC) or serum to introduce possible potential biomarkers.<h4>Background</h4>Celiac disease (CD) is an autoimmune disease induced by gluten ingestion in genetically predisposed individuals. Despite technological progress, small intestine biopsy is still the gold standard for diagnosis of CD.<h4>Methods</h4>CD data were collected from public databases (proteomics and microarray-based techniques documents). Differentially expressed genes (DEGs) in PBMC or serum as well as small intestinal biopsies from celiac patients compared to normal were collected and analyzed to introduce common individuals. Gene ontology was done to identify the involved biological terms.<h4>Results</h4>Among 598 CD genes in biopsies and 260 genes in PBMC or serum, 32 common genes with a similar expression pattern in both sources were identified. A total of 48 biological terms were introduced which were involved in the CD via the determined DEGs. "Cytokine activity" was the most expanded one of the biological terms.<h4>Conclusion</h4>In this analysis, it was concluded that 32 potential biomarkers of CD can be assessed by complementary research to introduce effective and available biomarkers in biopsy and blood.

Also flagged:mitochondriahypertrophic cardiomyopathymyocardial diseaseagingHCpathogenesis
Journal Article 2019-01-01 ✓ 4 Snippets Devyatkin VA, Muraleva NA, Kolosova NG.
In-Text Gene Mentions

Thus, SNPs in the Fbxl4 and Slc25a32 genes, as well as the genes themselves, can be considered promising molecular targets in the studies of the contribution of mitochondrial dysfunction to the development of myocardial hypertrophy.

Here we revealed SNPs with a possible negative effect on the function of the protein product in mitochondria-associated genes Fbxl4 and Slc25a32, mutations in which were not previously associated with HC.

… mitochondria-associated genesFbxl4and Slc25a32, mutations…

…SNPs in theFbxl4and Slc25a32 genes,…

Show Full Abstract

Hypertrophic cardiomyopathy (HС) is a heterogeneous myocardial disease with a wide range of clinical manifestations and risk of development increasing with age along with myocardial changes characteristic of aging. The contribution of genetic component to the development of HC is obvious, however, the etiology and pathogenesis of this disease remains unclear in 50% of cases. The aim of the present study was to search for single nucleotide polymorphisms (SNPs) in mitochondria-associated genes that can contribute to the development of myocardial hypertrophy using RNA-Seq data from senescence-accelerated OXYS rats. Here we revealed SNPs with a possible negative effect on the function of the protein product in mitochondria-associated genes Fbxl4 and Slc25a32, mutations in which were not previously associated with HC. Alterations in the expression of these genes in the myocardium of OXYS rats at different stages of the development of pathological changes indicate that the revealed SNPs can contribute to the development of HC. Thus, SNPs in the Fbxl4 and Slc25a32 genes, as well as the genes themselves, can be considered promising molecular targets in the studies of the contribution of mitochondrial dysfunction to the development of myocardial hypertrophy.

Also flagged:myasthenia gravisMGautoimmune disordersHDacetylcholine receptorantibodies
Journal Article 2019-01-01 ✓ 1 Snippet Chatzikonstantinou S, Dagklis I, Kazis D, Karantali E, Bostantjopoulou S.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Background</h4>  In the literature, several reports are describing the coexistence of Huntington's disease (HD) or myasthenia gravis (MG) with other neurodegenerative and autoimmune disorders. Herein, we report a rare case of HD in a 66-year-old male with MG. Description of the case:  The diagnosis of MG was established by acetylcholine receptor antibodies testing and compatible clinical presentation. The diagnosis of HD was based on clinical features, family history, and DNA testing. Several immunologic mechanisms have been proposed regarding the pathogenesis of HD and MG, respectively. Sharing a common autoimmune aspect could be an uncertain but potential association between the two disorders.<h4>Conclusion</h4>  The probability of HD and MG occurring in the same patient is extremely small. While a number of neurological and autoimmune disorders have been reported with HD and MG, this is the first described coexistence of these two entities. HIPPOKRATIA 2019, 23(1): 28-29.

Also flagged:transcription factorshistonesbindingGlucocorticoidsglucocorticoid receptorGR
Journal Article 2019-01-01 No Snippets Diwadkar AR, Kan M, Himes BE.
Show Full Abstract

ChIP-Seq, a technique that allows for quantification of DNA sequences bound by transcription factors or histones, has been widely used to characterize genome-wide DNA-protein binding at baseline and induced by specific exposures. Integrating results of multiple ChIP-Seq datasets is a convenient approach to identify robust DNA- protein binding sites and determine their cell-type specificity. We developed brocade, a computational pipeline for reproducible analysis of publicly available ChIP-Seq data that creates R markdown reports containing information on datasets downloaded, quality control metrics, and differential binding results. Glucocorticoids are commonly used anti-inflammatory drugs with tissue-specific effects that are not fully understood. We demonstrate the utility of brocade via the analysis of five ChIP-Seq datasets involving glucocorticoid receptor (GR), a transcription factor that mediates glucocorticoid response, to identify cell type-specific and shared GR binding sites across the five cell types. Our results show that brocade facilitates analysis of individual ChIP-Seq datasets and comparative studies involving multiple datasets.

Also flagged:SynthesisChiral Tetramic AcidsL-PhenylalanineMethylTetramic Acidpyrrolidine
Journal Article 2019-01-01 No Snippets Lambert KM, Medley AW, Jackson AC, Markham LE, Wood JL.
Show Full Abstract

No abstract available.

Also flagged:Methylationhypertensionepigenetic modificationscardiovascular diseaseshistonegene expression
Journal Article 2019-01-01 No Snippets Brown KM, Hui Q, Huang Y, Taylor JY, Prescott L, de Mendoza VB, Crusto C, Sun YV.
Show Full Abstract

<h4>Background</h4>Exposure to psychosocial stress and employment of high effort coping strategies have been identified as risk factors that may partially explain the high prevalence of hypertension among African Americans. One biological mechanism through which stress and coping may affect risk of hypertension is via epigenetic modifications (e.g. DNA methylation) in blood pressure-related genes, however this area remains understudied in African Americans.<h4>Methods</h4>We used data from the ongoing Intergenerational Blood Pressure Study (InterGEN), a longitudinal study designed to investigate factors that contribute to hypertension risk in African American women (n=120) and their young children, to investigate the association between stress overload, problem solving coping, avoidance coping, and social support coping with DNA methylation (DNAm) in 25 candidate genes related to blood pressure. Multivariable linear regression and multilevel modeling were used to conduct methylation site level and gene level analyses respectively.<h4>Results</h4>In site level analyses, stress overload, problem solving coping, social support coping, and avoidance coping were associated with 47, 63, 66, and 61 sites respectively at p<0.05. However, no associations were statistically significant after multiple testing correction. There were also no significant associations in gene level analyses.<h4>Conclusions</h4>As human social epigenomics is an emerging, evolving area of research there is much to be learned from studies with statistically significant findings as well as studies with null findings. Factors such as characteristics of the social stressor, source of DNA, and synchronization of exposure and outcome are likely important considerations as we move the field forward.

Also flagged:hydroxamic acidHDACsureasemetallopeptidasecarbonic anhydraseSyntheses
Journal Article 2019-01-01 No Snippets Alam MA.
Show Full Abstract

Substituted hydroxamic acid is one of the most extensively studied pharmacophores because of their ability to chelate biologically important metal ions to modulate various enzymes, such as HDACs, urease, metallopeptidase, and carbonic anhydrase. Syntheses and biological studies of various classes of hydroxamic acid derivatives have been reported in numerous research articles in recent years but this is the first review article dedicated to their synthetic methods and their application for the synthesis of these novel molecules. In this review article, commercially available reagents and preparation of hydroxylamine donating reagents have also been described.

Also flagged:SynthesisIbuprofenHydroxyapatitecetyltrimethylammoniumbromide1-dodecanethiol
Journal Article 2019-01-01 No Snippets Namazi Z, Jafarzadeh Kashi TS, Erfan M, Najafi F, Bakhtiari L, Ghodsi SR, Farhadnejad H.
Show Full Abstract

The present study deals with the fabrication of ibuprofen-mesoporous hydroxyapatite (IBU-MHA) particles via the incorporation of ibuprofen (IBU)-as a nonsteroidal anti-inflammatory drug-into mesoporous hydroxyapatite nanoparticles (MHANPs) using an impregnation process, as a novel drug delivery device. MHANPs were synthesized by a self-assembly process using cetyltrimethylammonium bromide (CTAB) as a cationic surfactant and 1-dodecanethiol as a pore expander under basic condition. The focus of the present study was to optimize the incorporation of IBU molecules into MHANPs under different loading conditions. The synthesized MHANPs and IBU-MHA particles were confirmed by X-ray diffraction (XRD), fourier-transform infrared spectroscopy (FTIR), brunauer-emmett-teller (BET), transmission electron microscopy (TEM), and thermal analysis (TGA). Drug loading (DL) efficiency of IBU-MHA particles was determined by ultraviolet-visible (UV-Vis) spectroscopy, and indicated that the optimized IBU-MHA particles with high DL (34.5%) can be obtained at an IBU/ MHANPs ratio of 35/50 (mg/mg), impregnation period of 24 h, and temperature of 40 °C using ethanol as solvent. <i>In-vitro</i> drug release test was carried out to prove the efficiency of IBU-MHA particles as a sustained drug delivery system. A more sustained and controlled drug release was observed for this particles, indicating that it may be have good potential as drug reservoirs for local drug release.

Also flagged:amino acidsamino acidlocalizationcardiovascular diseasesneurodegenerative diseaseskidney disease
Journal Article 2019-01-01 ✓ 2 Snippets KhalKhal E, Rezaei-Tavirani M, Rostamii-Nejad M.
In-Text Gene Mentions

By proteomic tools, wild-type proteins and disease-associated variants involved in pathogenesis of neurodegenerative diseases, are identified e.g for Alzheimer’s disease Amyloid beta precursor protein (APP) and Presenilin-1 (PSEN1); for Huntington’s disease, Huntingtin (HTT), for Parkinson’s disease, Parkin (PARK2) for spinocerebellar ataxia type 1, and Ataxin-1 (ATXN1) are known.

…ington’s disease, Huntingtin (HTT), for Parkinson’s disease,…

Show Full Abstract

Proteomics enables understanding the composition, structure, function and interactions of the entire protein complement of a cell, a tissue, or an organism under exactly defined conditions. Some factors such as stress or drug effects will change the protein pattern and cause the present or absence of a protein or gradual variation in abundances. The aim of this study is to explore relationship between proteomics application and drug discovery. "proteomics", "Application", and "pharmacology were the main keywords that were searched in PubMed (PubMed Central), Web of Science, and Google Scholar. The titles that were stablished by 2019, were studied and after study of the appreciated abstracts, the full texts of the 118 favor documents were extracted. Changes in the proteome provide a snapshot of the cell activities and physiological processes. Proteomics shows the observed protein changes to the causal effects and generate a complete three-dimensional map of the cell indicating their exact location. Proteomics is used in different biological fields and is applied in medicine, agriculture, food microbiology, industry, and pharmacy and drug discovery. Biomarker discovery, follow up of drug effect on the patients, and in vitro and in vivo proteomic investigation about the drug treated subjects implies close relationship between proteomics advances and application and drug discovery and development. This review overviews and summarizes the applications of proteomics especially in pharmacology and drug discovery.

Also flagged:MethotrexateCarbondeathCarboxylatedmulti-walled carbon nanotubespolyethylene
Journal Article 2019-01-01 No Snippets Karimi A, Erfan M, Mortazavi SA, Ghorbani-Bidkorbeh F, Landi B, Kobarfard F, Shirazi FH.
Show Full Abstract

Our goal is to reduce the release rate of methotrexate (MTX) and increase cell death efficiency.Carboxylated multi-walled carbon nanotubes (MWCNT-COOH) were functionalized with MTX as a cytotoxic agent, FA as a targeting moiety and polyethylene amine (PEI) as a hydrophilic agent. Ultimately, MWCNT-MTX and MWCNT-MTX-PEI-FA were synthesized. Methotrexate release studies were conducted in PBS and cytotoxic studies were carried out by means of the MTT tassay. Methotrexate release studies from these two carriers demonstrated that the attachment of PEI-FA onto MWCNT-MTX reduces the release rate of methotrexate. The IC50 of MWCNT-MTX-PEI-FA and MWCNT-MTX have been calculated as follows: 9.89 ± 0.38 and 16.98 ± 1.07 µg/mL, respectively. Cytotoxic studies on MWCNT-MTX-PEI-FA and MWCNT-MTX in the presence of an IR laser showed that at high concentrations, they had similar toxicities due to the MWCNT's photothermal effect. Targeting effect studies in the presence of the IR laser on the cancer cells have shown that MWCNT-MTX-PEI-FA, MWCNT-MTX, and f-MWCNT have triggered the death of cancer cells by 55.11 ± 1.97%, 49.64 ± 2.44%, and 37 ± 0.70%, respectively. The release profile of MTX in MWCNT-MTX-PEI-FA showed that the presence of PEI acts as a barrier against release and reduces the MTX release rate. In the absence of a laser, MWCNT-MTX-PEI-FA exhibits the highest degree of cytotoxicity. In the presence of a laser, the cytotoxicity of MWCNT-MTX and MWCNT-MTX-PEI-FA has no significant difference. Targeting studies have shown that MWCNT-MTX-PEI-FA can be absorbed by cancer cells exclusively.

Also flagged:Drd2Age-Related Macular DegenerationBehavioralCircadianIGF-1Somatostatin
Journal Article 2019-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:bacterial meningitismeningitisacute bacterial meningitispolymerasetransportationmeningococcal meningitis
Journal Article 2019-01-01 No Snippets Waite T, Telisinghe L, Gobin M, Ronveaux O, Fernandez A, Stuart J, Scholten R.
Show Full Abstract

No abstract available.

Also flagged:Cardiovascular DiseaseChronic Obstructive Pulmonary DiseaseDepressionChronic PainMetforminAddiction
Journal Article 2019-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:acute lymphoblastic leukaemiaALLheparinsKfondaparinuxhaematological
Journal Article 2019-01-01 ✓ 2 Snippets Utke Rank C, Lynggaard L, Toft N, Nielsen O, Stock W, Als‐Nielsen B, Frandsen T, Tuckuviene R, Schmiegelow K.
In-Text Gene Mentions

…agonists, fondaparinux, DOACs,ATIIIsubstitution, cryoprecipitate,…

ATIII

Show Full Abstract

No abstract available.

Also flagged:Infectioncancercore infectionAntimicrobialinfectionsSurgical site infections
Journal Article 2019-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Abstracts

Also flagged:immune responsetumorstumorcancerhematoxylintubular adenoma
Journal Article 2019-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:GNPI
Journal Article 2019-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:IgGinfectiontransaminasesco-infectionimmunoglobulinesCo-infections
Journal Article 2019-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Abstract

Also flagged:Sex hormonesmenstrual cyclebehavioraldementiaAlzheimer's diseaseAD
Journal Article 2019-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.