Also flagged:CDC20mitosisCell division cycle 20 homologuecell cyclechromosomescancer
Journal Article2022-04-30No SnippetsBruno S, Ghelli Luserna di Rorà A, Napolitano R, Soverini S, Martinelli G, Simonetti G.
Show Full Abstract
Cell division cycle 20 homologue (CDC20) is a well-known regulator of cell cycle, as it controls the correct segregation of chromosomes during mitosis. Many studies have focused on the biological role of CDC20 in cancer development, as alterations of its functionality have been linked to genomic instability and evidence demonstrated that high CDC20 expression levels are associated with poor overall survival in solid cancers. More recently, novel CDC20 functions have been demonstrated or suggested, including the regulation of apoptosis and stemness properties and a correlation with immune cell infiltration. Here, we here summarize and discuss the role of CDC20 inside and outside mitosis, starting from its network of interacting proteins. In the last years, CDC20 has also attracted more interest in the blood cancer field, being overexpressed and showing an association with prognosis both in myeloid and lymphoid malignancies. Preclinical findings showed that selective CDC20 and APC/C<sup>CDC20</sup>/APC/C<sup>CDH1</sup> inhibitors, namely Apcin and proTAME, are effective against lymphoma and multiple myeloma cells, resulting in mitotic arrest and apoptosis and synergizing with clinically-relevant drugs. The evidence and hypothesis presented in this review provide the input for further biological and chemical studies aiming to dissect novel potential CDC20 roles and targeting strategies in hematological malignancies.
Also flagged:ATRTcentral nervous system tumorSMARCB1INI1SHHTYR
Journal Article2022-04-30✓ 2 SnippetsFederico A, Thomas C, Miskiewicz K, Woltering N, Zin F, Nemes K, Bison B, Johann PD, Hawes D, Bens S, Kordes U, Albrecht S, Dohmen H, Hauser P, Keyvani K, van Landeghem FKH, Lund EL, Scheie D, Mawrin C, Monoranu CM, Parm Ulhøi B, Pietsch T, Reinhard H, Riemenschneider MJ, Sehested A, Sumerauer D, Siebert R, Paulus W, Frühwald MC, Kool M, Hasselblatt M.
In-Text Gene Mentions
Results)
…Other SHH-1A associated genes were the neuroendocrine-specific tumor genes SST and SCG2; ARPP21, encoding an RNA-binding protein found in glioma [45], and SOX6, a tumor marker expressed by not fully differentiated neuronal and glial cells [41].…
Results)
…45 ], andSOX6, a tumor…
Show Full Abstract
Atypical teratoid/rhabdoid tumor (ATRT) is an aggressive central nervous system tumor characterized by loss of SMARCB1/INI1 protein expression and comprises three distinct molecular groups, ATRT-TYR, ATRT-MYC and ATRT-SHH. ATRT-SHH represents the largest molecular group and is heterogeneous with regard to age, tumor location and epigenetic profile. We, therefore, aimed to investigate if heterogeneity within ATRT-SHH might also have biological and clinical importance. Consensus clustering of DNA methylation profiles and confirmatory t-SNE analysis of 65 ATRT-SHH yielded three robust molecular subgroups, i.e., SHH-1A, SHH-1B and SHH-2. These subgroups differed by median age of onset (SHH-1A: 18 months, SHH-1B: 107 months, SHH-2: 13 months) and tumor location (SHH-1A: 88% supratentorial; SHH-1B: 85% supratentorial; SHH-2: 93% infratentorial, often extending to the pineal region). Subgroups showed comparable SMARCB1 mutational profiles, but pathogenic/likely pathogenic SMARCB1 germline variants were over-represented in SHH-2 (63%) as compared to SHH-1A (20%) and SHH-1B (0%). Protein expression of proneural marker ASCL1 (enriched in SHH-1B) and glial markers OLIG2 and GFAP (absent in SHH-2) as well as global mRNA expression patterns differed, but all subgroups were characterized by overexpression of SHH as well as Notch pathway members. In a Drosophila model, knockdown of Snr1 (the fly homologue of SMARCB1) in hedgehog activated cells not only altered hedgehog signaling, but also caused aberrant Notch signaling and formation of tumor-like structures. Finally, on survival analysis, molecular subgroup and age of onset (but not ASCL1 staining status) were independently associated with overall survival, older patients (> 3 years) harboring SHH-1B experiencing relatively favorable outcome. In conclusion, ATRT-SHH comprises three subgroups characterized by SHH and Notch pathway activation, but divergent molecular and clinical features. Our data suggest that molecular subgrouping of ATRT-SHH has prognostic relevance and might aid to stratify patients within future clinical trials.
Also flagged:cohesingene expressionorganizationsister chromatidNIPBLNip ped B - L ike
Journal Article2022-04-30✓ 1 SnippetJustice M, Bryan AF, Limas JC, Cook JG, Dowen JM.
In-Text Gene Mentions
Results)
…G9a, GLP andZNF644, facilitates deposition of…
Show Full Abstract
<h4>Background</h4>The cohesin complex is essential for proper chromosome structure and gene expression. Defects in cohesin subunits and regulators cause changes in cohesin complex dynamics and thereby alter three-dimensional genome organization. However, the molecular mechanisms that drive cohesin localization and function remain poorly understood.<h4>Results</h4>In this study, we observe that loss of WIZ causes changes to cohesin localization that are distinct from loss of the known WIZ binding partner G9a. Whereas loss of WIZ uniformly increases cohesin levels on chromatin at known binding sites and leads to new, ectopic cohesin binding sites, loss of G9a does not. Ectopic cohesin binding on chromatin after the loss of WIZ occurs at regions that are enriched for activating histone modifications and transcription factors motifs. Furthermore, loss of WIZ causes changes in cohesin localization that are distinct from those observed by loss of WAPL, the canonical cohesin unloading factor.<h4>Conclusions</h4>The evidence presented here suggests that WIZ can function independently from its previously identified role with G9a and GLP in heterochromatin formation. Furthermore, while WIZ limits the levels and localization pattern of cohesin across the genome, it appears to function independently of WAPL-mediated cohesin unloading.
Also flagged:metastatic gastric cancergastric cancerpathogenesisnucleotidecoagulationPOLE
Journal Article2022-04-30No SnippetsAjucarmelprecilla A, Pandi J, Dhandapani R, Ramanathan S, Chinnappan J, Paramasivam R, Thangavelu S, Mohammed Ghilan AK, Aljohani SAS, Oyouni AAA, Farasani A, Altayar MA, Althagafi HAE, Alzahrani OR, Durairaj K, Shrestha A.
Show Full Abstract
Perception of hub genes engaged in metastatic gastric cancer (mGC) promotes novel ways to diagnose and treat the illness. The goal of this investigation is to recognize the hub genes and reveal its molecular mechanism. In order to explore the potential facts for gastric cancer, the expression profiles of two different datasets were used (GSE161533 and GSE54129). The genes were confirmed to be part of the PPI network for gastric cancer pathogenesis and prognosis. In Cytoscape, the CytoHubba module was used to discover the hub genes. Responsible hub genes were identified. Data from Kaplan-Meier plotter confirmed the predictive value of these distinct genes in various stages of gastric malignancy. Upregulated and downregulated genes were identified to utilize for further analysis. Positive regulation by a host of viral process, positive regulation of granulocyte differentiation, negative regulation of histone H<sub>3</sub>-K<sub>9</sub> methylation were found in DEGs analysis. In addition, five KEGG pathways were identified as an essential enhancer that include nucleotide excision repair; base excision repair; DNA replication; homologous recombination; and complement and coagulation cascades. POLE, BUB1B, POLD4, C3, BLM, CCT7, PRPF31, APEX1, PSMA7, and CDC45 were chosen as hub genes after combining the PPI results. Our study recommends that BUB1B, CCT7, APEX1, PSMA7, and CDC45 might be potential biomarkers for gastric cancer. These biomarkers are upregulated genes. Therefore, suppression of these genes will increase the survival rate in gastric cancer patients.
Also flagged:Tumorliver cancermitochondrialmitochondrial-Gene ExpressionCancer
Journal Article2022-04-30✓ 5 SnippetsWang Y, Song F, Zhang X, Yang C.
In-Text Gene Mentions
Results)
…These 35 OS-related NMRGs were then enrolled in the LASSO Cox regression analysis, finally constructing a NMRG prognosis signature for HCC patients based on the transcriptional profiling of selected 25 NMRGs (NDUFV2, NDUFAF1, COX15, LRPPRC, MPV17, CARS2, DARS2, GARS, HARS2, LARS, PARS2, VARS2, MTFMT, TRMT10C, TRMU, C12ORF65, MRPL3, FRDA, ISCU, COQ6, COQ7, PDSS1, CABC1, SPG7, and ATAD3), with the optimal value of λ (λ = 0.0106127) (Figure 3(b)).…
Discussion)
…Some other NMRGs, such as LRPPRC [21], DARS2 [12], GARS [22], ATAD3 [23], TRMU [24], and PDSS1 [25] had been identified to be correlated with the carcinogenesis and progression in HCC.…
<h4>Background</h4>Hepatocellular carcinoma (HCC) is the most common subtype of primary liver cancer, which was highly correlated with metabolic dysfunction. Nevertheless, the association between nuclear mitochondrial-related transcriptome and HCC remained unclear.<h4>Materials and methods</h4>A total of 147 nuclear mitochondrial-related genes (NMRGs) were downloaded from the MITOMAP: A Human Mitochondrial Genome Database. The training dataset was downloaded from The Cancer Genome Atlas (TCGA), while validation datasets were retrieved from the International Cancer Genome Consortium (ICGC) and Gene Expression Omnibus (GEO). The univariate and multivariate, and least absolute shrinkage and selection operator (LASSO) Cox regression analyses were applied to construct a NMRG signature, and the value of area under receiver operating characteristic curve (AUC) was utilized to assess the signature and nomogram. Then, data from the Genomics of Drug Sensitivity in Cancer (GDSC) were used for the evaluation of chemotherapy response in HCC.<h4>Results</h4>Functional enrichment of differentially expressed genes (DEGs) between HCC and paired normal tissue samples demonstrated that mitochondrial dysfunction was significantly associated with HCC development. Survival analysis showed a total of 35 NMRGs were significantly correlated with overall survival (OS) of HCC, and the LASSO Cox regression analysis further identified a 25-NMRG signature and corresponding prognosis score based on their transcriptional profiling. HCC patients were divided into high- and low-risk groups according to the median prognosis score, and high-risk patients had significantly worse OS (median OS: 27.50 vs. 83.18 months, <i>P</i> < 0.0001). The AUC values for OS at 1, 3, and 5 years were 0.79, 0.77, and 0.77, respectively. The prognostic capacity of NMRG signature was verified in the GSE14520 dataset and ICGC-HCC cohort. Besides, the NMRG signature outperformed each NMRG and clinical features in prognosis prediction and could also differentiate whether patients presented with vascular invasions (VIs) or not. Subsequently, a prognostic nomogram (C-index: 0.753, 95% CI: 0.703~0.804) by the integration of age, tumor metastasis, and NMRG prognosis score was constructed with the AUC values for OS at 1, 3, and 5 years were 0.82, 0.81, and 0.82, respectively. Notably, significant enrichment of regulatory and follicular helper T cells in high-risk group indicated the potential treatment of immune checkpoint inhibitors for these patients. Interestingly, the NMRG signature could also identify the potential responders of sorafenib or transcatheter arterial chemoembolization (TACE) treatment. Additionally, HCC patients in high-risk group appeared to be more sensitive to cisplatin, vorinostat, and methotrexate, reversely, patients in low-risk group had significantly higher sensitivity to paclitaxel and bleomycin instead.<h4>Conclusions</h4>In summary, the development of NMRG signature provided a more comprehensive understanding of mitochondrial dysfunction in HCC, helped predict prognosis and tumor microenvironment, and provided potential targeted therapies for HCC patients with different NMRG prognosis scores.
Members of the Ras superfamily have been found to perform several functions leading to the development of eukaryotes. These small GTPases are divided into five major subfamilies, and their regulators can "turn on" and "turn off" signals. Recent studies have shown that this superfamily of proteins has various roles in the process of vascular development, such as vasculogenesis and angiogenesis. Here, we discuss the role of these subfamilies in the development of the vascular system in zebrafish.
Also flagged:Gene ExpressionLimb-girdle muscular dystrophy R12protein synthesismetabolismtranscription factormyosins
Journal Article2022-04-30No SnippetsDepuydt CE, Goosens V, Janky R, D'Hondt A, De Bleecker JL, Noppe N, Derveaux S, Thal DR, Claeys KG.
Show Full Abstract
Limb-girdle muscular dystrophy R12 (LGMD-R12) is caused by two mutations in anoctamin-5 (<i>ANO5</i>). Our aim was to identify genes and pathways that underlie LGMD-R12 and explain differences in the molecular predisposition and susceptibility between three thigh muscles that are severely (semimembranosus), moderately (vastus lateralis) or mildly (rectus femoris) affected in this disease. We performed transcriptomics on these three muscles in 16 male LGMD-R12 patients and 15 age-matched male controls. Our results showed that LGMD-R12 dystrophic muscle is associated with the expression of genes indicative of fibroblast and adipocyte replacement, such as fibroadipogenic progenitors and immune cell infiltration, while muscle protein synthesis and metabolism were downregulated. Muscle degeneration was associated with an increase in genes involved in muscle injury and inflammation, and muscle repair/regeneration. Baseline differences between muscles in healthy individuals indicated that muscles that are the most affected by LGMD-R12 have the lowest expression of transcription factor networks involved in muscle (re)generation and satellite stem cell activation. Instead, they show relative high levels of fetal/embryonic myosins, all together indicating that muscles differ in their baseline regenerative potential. To conclude, we profiled the gene expression landscape in LGMD-R12, identified baseline differences in expression levels between differently affected muscles and characterized disease-associated changes.
Also flagged:cognitive impairmentssubstance use disorderdepressionDRD2nucleusneuropsychiatric illness
Journal Article2022-04-30✓ 1 SnippetBraverman ER, Dennen CA, Gold MS, Bowirrat A, Gupta A, Baron D, Roy AK, Smith DE, Cadet JL, Blum K.
In-Text Gene Mentions
Abstract)
…the expression ofNEGR1in the hypothalamus…
Show Full Abstract
In 2021, over 100,000 people died prematurely from opioid overdoses. Neuropsychiatric and cognitive impairments are underreported comorbidities of reward dysregulation due to genetic antecedents and epigenetic insults. Recent genome-wide association studies involving millions of subjects revealed frequent comorbidity with substance use disorder (SUD) in a sizeable meta-analysis of depression. It found significant associations with the expression of NEGR1 in the hypothalamus and DRD2 in the nucleus accumbens, among others. However, despite the rise in SUD and neuropsychiatric illness, there are currently no standard objective brain assessments being performed on a routine basis. The rationale for encouraging a standard objective Brain Health Check (BHC) is to have extensive data available to treat clinical syndromes in psychiatric patients. The BHC would consist of a group of reliable, accurate, cost-effective, objective assessments involving the following domains: Memory, Attention, Neuropsychiatry, and Neurological Imaging. Utilizing primarily PUBMED, over 36 years of virtually all the computerized and written-based assessments of Memory, Attention, Psychiatric, and Neurological imaging were reviewed, and the following assessments are recommended for use in the BHC: Central Nervous System Vital Signs (Memory), Test of Variables of Attention (Attention), Millon Clinical Multiaxial Inventory III (Neuropsychiatric), and Quantitative Electroencephalogram/P300/Evoked Potential (Neurological Imaging). Finally, we suggest continuing research into incorporating a new standard BHC coupled with qEEG/P300/Evoked Potentials and genetically guided precision induction of "dopamine homeostasis" to diagnose and treat reward dysregulation to prevent the consequences of dopamine dysregulation from being epigenetically passed on to generations of our children.
…find any tissues pigments/hemochromatosis, fibrosis, portal hypertensio…
Show Full Abstract
Bats have a wide diversity of digeneans; however, even with the recent increased interest in studies of parasites on these hosts, there are no data on the microscopic alterations of this host-parasite interaction. The present work characterizes and compares the histological aspects of the liver, gallbladder, and intestine of non-parasitized and parasitized <i>Myotis nigricans</i> by digeneans. Ten specimens of <i>Myotis nigricans</i> collected in an urban area of Western Amazonia were analyzed for parasites. The digeneans were removed from the hosts and identified. Tissue samples of the liver, gallbladder, and intestines of parasitized and non-parasitized hosts were collected for histological studies. The gallbladder was observed in repletion and presents mucosa formed by simple epithelium that varies from cubic to cylindrical. The hepatic lobes do not have a classic polyhedral-hexagonal aspect. Variations in basophilia, acidophile, and cytoplasmatic granulations were observed in hepatocytes. The parasitism of the intestinal digeneans was restricted to space delimited by the extensions of villi in high association with the intestinal epithelium, not invading the region of the intestinal glands at the base of the villi. Trematodes maintained attached to the villus by the oral sucker and acetabulum, connected by a "pleat" composed of epithelium and lamina propria layers. We observed no signs of inflammatory processes and cellular defense infiltrates in host tissues. Cytochemistry alterations, size variation, and granular deposits in hepatocytes, enterocytes, and goblet cells were observed. Thus, this report is the first study of the natural parasite-host interaction in the liver, gallbladder, and intestine in <i>M. nigricans</i> in the neotropical region.
Nanomedicine is a speedily growing area of medical research that is focused on developing nanomaterials for the prevention, diagnosis, and treatment of diseases. Nanomaterials with unique physicochemical properties have recently attracted a lot of attention since they offer a lot of potential in biomedical research. Novel generations of engineered nanostructures, also known as designed and functionalized nanomaterials, have opened up new possibilities in the applications of biomedical approaches such as biological imaging, biomolecular sensing, medical devices, drug delivery, and therapy. Polymers, natural biomolecules, or synthetic ligands can interact physically or chemically with nanomaterials to functionalize them for targeted uses. This paper reviews current research in nanotechnology, with a focus on nanomaterial functionalization for medical applications. Firstly, a brief overview of the different types of nanomaterials and the strategies for their surface functionalization is offered. Secondly, different types of functionalized nanomaterials are reviewed. Then, their potential cytotoxicity and cost-effectiveness are discussed. Finally, their use in diverse fields is examined in detail, including cancer treatment, tissue engineering, drug/gene delivery, and medical implants.
Also flagged:Hepatocellular Carcinomacholangiocarcinomaliver cancerspathogenesiscancerantibodies
Journal Article2022-04-30✓ 1 SnippetTrifylli EM, Koustas E, Papadopoulos N, Sarantis P, Aloizos G, Damaskos C, Garmpis N, Garmpi A, Karamouzis MV.
In-Text Gene Mentions
Introduction)
…disorders such ashemochromatosis, as well as…
Show Full Abstract
Hepatocellular carcinoma (HCC) and cholangiocarcinoma (CCA) constitute highly malignant forms of primary liver cancers. Hepatocellular and bile duct carcinogenesis is a multiplex process, caused by various genetic and epigenetic alterations, the influence of environmental factors, as well as the implication of the gut microbiome, which was undervalued in the previous years. The molecular and immunological analysis of the above malignancies, as well as the identification of the crucial role of intestinal microbiota for hepatic and biliary pathogenesis, opened the horizon for novel therapeutic strategies, such as immunotherapy, and enhanced the overall survival of cancer patients. Some of the immunotherapy strategies that are either clinically applied or under pre-clinical studies include monoclonal antibodies, immune checkpoint blockade, cancer vaccines, as well as the utilization of oncolytic viral vectors and Chimeric antigen, receptor-engineered T (CAR-T) cell therapy. In this current review, we will shed light on the recent therapeutic modalities for the above primary liver cancers, as well as on the methods for the enhancement and optimization of anti-tumor immunity.
Nitroimidazole represents one of the most essential and unique scaffolds in drug discovery since its discovery in the 1950s. It was K. Maeda in Japan who reported in 1953 the first nitroimidazole as a natural product from <i>Nocardia mesenterica</i> with antibacterial activity, which was later identified as Azomycin <b>1</b> (2-nitroimidazole) and remained in focus until now. This natural antibiotic was the starting point for synthesizing numerous analogs and regio-isomers, leading to several life-saving drugs and clinical candidates against a number of diseases, including infections (bacterial, viral, parasitic) and cancers, as well as imaging agents in medicine/diagnosis. In the present decade, the nitroimidazole scaffold has again been given two life-saving drugs (Delamanid and Pretomanid) used to treat MDR (multi-drug resistant) tuberculosis. Keeping in view the highly successful track-record of the nitroimidazole scaffold in providing breakthrough therapeutic drugs, this comprehensive review focuses explicitly on presenting the activity profile and synthetic chemistry of functionalized nitroimidazole (2-, 4- and 5-nitroimidazoles as well as the fused nitroimidazoles) based drugs and leads published from 1950 to 2021. The present review also presents the miscellaneous examples in each class. In addition, the mutagenic profile of nitroimidazole-based drugs and leads and derivatives is also discussed.
Arteriovenous fistulas (AVFs), created for hemodialysis in end-stage renal disease patients, mature through the outward remodeling of the outflow vein. However, early thrombosis and chronic inflammation are detrimental to the process of AVF maturation and precipitate AVF maturation failure. For the successful remodeling of the outflow vein, blood flow through the fistula is essential, but early arterial thrombosis attenuates this blood flow, and the vessels become thrombosed and stenosed, leading to AVF failure. The altered expression of various proteins involved in maintaining vessel patency or thrombosis is regulated by genes of which the expression is regulated by transcription factors and microRNAs. In this study, using thrombosed and stenosed arteries following AVF creation, we delineated transcription factors and microRNAs associated with differentially expressed genes in bulk RNA sequencing data using upstream and causal network analysis. We observed changes in many transcription factors and microRNAs that are involved in angiogenesis; vascular smooth muscle cell proliferation, migration, and phenotypic changes; endothelial cell function; hypoxia; oxidative stress; vessel remodeling; immune responses; and inflammation. These factors and microRNAs play a critical role in the underlying molecular mechanisms in AVF maturation. We also observed epigenetic factors involved in gene regulation associated with these molecular mechanisms. The results of this study indicate the importance of investigating the transcriptional and epigenetic regulation of AVF maturation and maturation failure and targeting factors precipitating early thrombosis and stenosis.
Hepatocellular carcinoma (HCC) is a common form of cancer and the most common form of liver cancer. Multiple etiological factors leading to HCC include hepatitis B and C, diabetes, alcoholic fatty liver disease, and non-alcoholic fatty liver disease. Hepatocellular carcinoma in the late stages may present with tumor burden and thrombi that can extend into the right atrium (RA). This late-stage form of HCC has a poor prognosis. In this case, we present a 63-year-old male who presented to the hospital with acute encephalopathy with bilateral pulmonary emboli and a thrombus secondary to HCC extending into the RA. Clinical trials for non-surgical interventions are ongoing and are needed to treat patients with tumor burden who may be at bleeding risk from tumor resection.
Also flagged:diphtheriatetanuspertussisdetoxificationformaldehydeamine
Journal Article2022-04-30No SnippetsHesari T, Tahoori F, Nazari A, Salehi Najafabadi Z, Samianifard M, Faramarzi A, Soleimani M.
Show Full Abstract
Immunization has been considered a successful global health program that saves many persons' lives each year. The vaccines reduce the risk of getting the disease by building immunity in the body. Therefore, the constant availability of essential vaccines is an important factor in community health. One of the most important vaccines is the diphtheria vaccine, which is usually used as <i>Multivalent diphtheria-tetanus-pertussis</i> (DTP) combination vaccines. The production of this vaccine takes about 45 days, from the initial bacterial culture to the end of toxin production. However, the production of this vaccine can be optimized in case the production stages are carried out under normal conditions. In this study, a significant amount of impurities was removed after washing with phosphate buffer saline, and the toxin was then purified by Sephadex G-50. In this method, the toxin was concentrated to be stored in a smaller space (this removes the concerns for the provision of a suitable space). Another problem with the diphtheria vaccine is that it is reversible after detoxification of the toxin using formaldehyde. For this reason, it is suggested to use MPEG for detoxification, which will produce more stable covalent bonds between PEG and the first type of amine groups in the toxin chain. Tests were performed to evaluate factors, such as in vivo cytotoxicity, lack of edemas formation, the neutralizing activity of serum from guinea pigs immunized with the diphtheria toxoid inactivated with MPEG, and the immunogenic activity of the purified and modified toxin. Comparison of this PEG detoxification toxoid with the standard toxoid produced in Razi Vaccine and Serum Institution, Karaj, Iran, showed that washing with PBS and purification with Sephadex G-50 was an efficient method. The stability and reversibility of the toxoid approved by MPEG were acceptable. Therefore, the results of animal tests showed that the obtained product was stable and caused no wound or necrosis in the tested animals.
Also flagged:ageingextracellularvesiclesExtracellular vesiclesagerelated diseases
Journal Article2022-04-29No SnippetsMcIlvenna LC, Whitham M.
Show Full Abstract
Extracellular vesicles (EVs) can be released from most cells in the body and act as intercellular messengers transferring information in their cargo to affect cellular function. A growing body of evidence suggests that a subset of EVs, referred to here as 'small extracellular vesicles' (sEVs), can accelerate or slow the processes of ageing and age-related diseases dependent on their molecular cargo and cellular origin. Continued exploration of the vast complexity of the sEV cargo aims to further characterise these systemic vehicles that may be targeted to ameliorate age-related pathologies. Marked progress in the development of mass spectrometry-based technologies means that it is now possible to characterise a significant proportion of the proteome of sEVs (surface and cargo) via unbiased proteomics. This information is vital for identifying biomarkers and the development of sEV-based therapeutics in the context of ageing. Although exercise and physical activity are prominent features in maintaining health in advancing years, the mechanisms responsible are unclear. A potential mechanism by which plasma sEVs released during exercise could influence ageing and senescence is via the increased delivery of cargo proteins that function as antioxidant enzymes or inhibitors of senescence. These have been observed to increase in sEVs following acute and chronic exercise, as identified via independent interrogation of high coverage, publicly available proteomic datasets. Establishing tropism and exchange of functionally active proteins by these processes represents a promising line of enquiry in implicating sEVs as biologically relevant mediators of the ageing process.
Journal Article2022-04-29No SnippetsEl-Sabrout H, Ganta S, Guyon P, Ratnayaka K, Vaughn G, Perry J, Kimball A, Ryan J, Thornburg CD, Tucker S, Mo J, Hegde S, Nigro J, El-Said H.
Show Full Abstract
<h4>Background</h4>Neonatal myocardial infarction is rare and is associated with a high mortality of 40% to 50%. We report our experience with neonatal myocardial infarction, including presentation, management, outcomes, and our current patient management algorithm.<h4>Methods</h4>We reviewed all infants admitted with a diagnosis of coronary artery thrombosis, coronary ischemia, or myocardial infarction between January 2015 and May 2021.<h4>Results</h4>We identified 21 patients (median age, 1 [interquartile range (IQR), 0.25-9.00] day; weight, 3.2 [IQR, 2.9-3.7] kg). Presentation included respiratory distress (16), shock (3), and murmur (2). Regional wall motion abnormalities by echocardiogram were a key criterion for diagnosis and were present in all 21 with varying degrees of depressed left ventricular function (severe [8], moderate [6], mild [2], and low normal [5]). Ejection fraction ranged from 20% to 54% (median, 43% [IQR, 34%-51%]). Mitral regurgitation was present in 19 (90%), left atrial dilation in 15 (71%), and pulmonary hypertension in 18 (86%). ECG was abnormal in 19 (90%). Median troponin I was 0.18 (IQR, 0.12-0.56) ng/mL. Median BNP (B-type natriuretic peptide) was 2100 (IQR, 924-2325) pg/mL. Seventeen had documented coronary thrombosis by cardiac catheterization. Seventeen (81%) were treated with intracoronary tPA (tissue-type plasminogen activator) followed by systemic heparin, AT (antithrombin), and intravenous nitroglycerin, and 4 (19%) were treated with systemic heparin, AT, and intravenous nitroglycerin alone. Nineteen of 21 recovered. One died (also had infradiaphragmatic total anomalous pulmonary venous return). One patient required a ventricular assist device and later underwent heart transplant; this patient was diagnosed late at 5 weeks of age and did not respond to tPA. Nineteen of 21 (90%) regained normal left ventricular function (ejection fraction, 60%-74%; mean, 65% [IQR, 61%-67%]) at latest follow-up (median, 6.8 [IQR, 3.58-14.72] months). Two of 21 (10%) had residual trivial mitral regurgitation. After analysis of these results, we present our current algorithm, which developed and matured over time, to manage neonatal myocardial infarction.<h4>Conclusions</h4>We experienced a lower mortality rate for infants with neonatal infarction than that reported in the literature. We propose a post hoc algorithm that may lead to improvement in patient outcomes following coronary artery thrombus.
Also flagged:Genetic diseasesgene expressiontranscription factorbindinggenetic diseasechromatin
Journal Article2022-04-29✓ 1 SnippetMoyon L, Berthelot C, Louis A, Nguyen NTT, Roest Crollius H.
In-Text Gene Mentions
Results)
…the vicinity ofSERPINC1, one correctly…
Show Full Abstract
Whole genome sequencing is increasingly used to diagnose medical conditions of genetic origin. While both coding and non-coding DNA variants contribute to a wide range of diseases, most patients who receive a WGS-based diagnosis today harbour a protein-coding mutation. Functional interpretation and prioritization of non-coding variants represents a persistent challenge, and disease-causing non-coding variants remain largely unidentified. Depending on the disease, WGS fails to identify a candidate variant in 20-80% of patients, severely limiting the usefulness of sequencing for personalised medicine. Here we present FINSURF, a machine-learning approach to predict the functional impact of non-coding variants in regulatory regions. FINSURF outperforms state-of-the-art methods, owing in particular to optimized control variants selection during training. In addition to ranking candidate variants, FINSURF breaks down the score for each variant into contributions from individual annotations, facilitating the evaluation of their functional relevance. We applied FINSURF to a diverse set of 30 diseases with described causative non-coding mutations, and correctly identified the disease-causative non-coding variant within the ten top hits in 22 cases. FINSURF is implemented as an online server to as well as custom browser tracks, and provides a quick and efficient solution to prioritize candidate non-coding variants in realistic clinical settings.
Also flagged:Succinate dehydrogenase/complex IIcell proliferationimmune responsescytokinechromatintricarboxylic acid
Journal Article2022-04-29No SnippetsChen X, Sunkel B, Wang M, Kang S, Wang T, Gnanaprakasam JNR, Liu L, Cassel TA, Scott DA, Muñoz-Cabello AM, Lopez-Barneo J, Yang J, Lane AN, Xin G, Stanton BZ, Fan TW, Wang R.
Show Full Abstract
Effective T cell-mediated immune responses require the proper allocation of metabolic resources to sustain growth, proliferation, and cytokine production. Epigenetic control of the genome also governs T cell transcriptome and T cell lineage commitment and maintenance. Cellular metabolic programs interact with epigenetic regulation by providing substrates for covalent modifications of chromatin. By using complementary genetic, epigenetic, and metabolic approaches, we revealed that tricarboxylic acid (TCA) cycle flux fueled biosynthetic processes while controlling the ratio of succinate/α-ketoglutarate (α-KG) to modulate the activities of dioxygenases that are critical for driving T cell inflammation. In contrast to cancer cells, where succinate dehydrogenase (SDH)/complex II inactivation drives cell transformation and growth, SDH/complex II deficiency in T cells caused proliferation and survival defects when the TCA cycle was truncated, blocking carbon flux to support nucleoside biosynthesis. Replenishing the intracellular nucleoside pool partially relieved the dependence of T cells on SDH/complex II for proliferation and survival. SDH deficiency induced a proinflammatory gene signature in T cells and promoted T helper 1 and T helper 17 lineage differentiation. An increasing succinate/α-KG ratio in SDH-deficient T cells promoted inflammation by changing the pattern of the transcriptional and chromatin accessibility signatures and consequentially increasing the expression of the transcription factor, PR domain zinc finger protein 1. Collectively, our studies revealed a role of SDH/complex II in allocating carbon resources for anabolic processes and epigenetic regulation in T cell proliferation and inflammation.
…Serotonin transporter (5-HTT) binding deficits are reported in major depressive disorder (MDD).…
Results)
…Average 5-HTT [11C]DASB BPP across the entire non-parcellated serotonin axonal tract (Figure 1, middle) was 27.0% lower in MDD compared with HVs (p<0.001).…
Discussion)
…Interestingly, these regions do not overlap with the serotonin axonal tract; NRU 5-HT Atlas region 8 shows the greatest overlap with the tract (Supplementary Figure 1); however, does not include the brainstem and medial forebrain bundle areas where MDD 5-HTT deficits were greatest in the tract analysis, potentially explaining why region 8 did not reach post-hoc significance for MDD deficits.…
Discussion)
…We found evidence for 5-HTT deficits in MDD in a midline serotonin axonal tract and region-specific serotonergic pathology.…
Introduction)
…PET studies of the serotonin system have generally selected ROIs because they have been implicated in the pathophysiology of MDD and because they had sufficient 5-HTT binding for reliable PET quantification20,13.…
Show Full Abstract
Serotonin transporter (5-HTT) binding deficits are reported in major depressive disorder (MDD). However, most studies have not considered serotonin system anatomy when parcellating brain regions of interest (ROIs). We now investigate 5-HTT binding in MDD in two novel ways: (1) use of a 5-HTT tract-based analysis examining binding along serotonergic axons; and (2) using the Copenhagen University Hospital Neurobiology Research Unit (NRU) 5-HT Atlas, based on brain-wide binding patterns of multiple serotonin receptor types. [<sup>11</sup>C]DASB 5-HTT PET scans were obtained in 60 unmedicated participants with MDD in a current depressive episode and 31 healthy volunteers (HVs). Binding potential (BP<sub>P</sub>) was quantified with empirical Bayesian estimation in graphical analysis (EBEGA). Within the [<sup>11</sup>C]DASB tract, the MDD group showed significantly lower BP<sub>P</sub> compared with HVs (p = 0.02). This BP<sub>P</sub> diagnosis difference also significantly varied by tract location (p = 0.02), with the strongest MDD binding deficit most proximal to brainstem raphe nuclei. NRU 5-HT Atlas ROIs showed a BP<sub>P</sub> diagnosis difference that varied by region (p < 0.001). BP<sub>P</sub> was lower in MDD in 3/10 regions (p-values < 0.05). Neither [<sup>11</sup>C]DASB tract or NRU 5-HT Atlas BP<sub>P</sub> correlated with depression severity, suicidal ideation, suicide attempt history, or antidepressant medication exposure. Future studies are needed to determine the causes of this deficit in 5-HTT binding being more pronounced in proximal axon segments and in only a subset of ROIs for the pathogenesis of MDD. Such regional specificity may have implications for targeting antidepressant treatment, and may extend to other serotonin-related disorders.
Also flagged:colitiscolorectal cancerChronic inflammatory bowel diseaseCATcancerglycoprotein
Journal Article2022-04-29✓ 5 SnippetsChen Z, Zhang X, Zhang X, Xing Z, Lv S, Huang L, Liu J, Ye S, Li X, Chen M, Zuo S, Tao Y, He Y.
In-Text Gene Mentions
Abstract)
…Moreover, mice lacking OLFM4 in myeloid cells showed poor recruitment of PMN-MDSCs, impaired intestinal homeostasis, and delayed development from IBD to CRC, and increased response to anti-PD1 therapy.…
Abstract)
…Here, we discovered a glycoprotein, olfactomedin-4 (OLFM4), was highly expressed in PMN-MDSCs from colitis to colorectal cancer (CRC), and its expression level and PMN-MDSC population positively correlated with the progression of IBD to CRC.…
Title)
…OLFM4 deficiency delays the progression of colitis to colorectal cancer by abrogating PMN-MDSCs recruitment.…
Title)
…OLFM4deficiency delays the…
Abstract)
…glycoprotein, olfactomedin-4 (OLFM4), was highly expressed…
Show Full Abstract
Chronic inflammatory bowel disease (IBD) is strongly associated with the development of colitis-associated tumorigenesis (CAT). Despite recent advances in the understanding of polymorphonuclear myeloid-derived suppressor cell (PMN-MDSC) responses in cancer, the mechanisms of these cells during this process remain largely uncharacterized. Here, we discovered a glycoprotein, olfactomedin-4 (OLFM4), was highly expressed in PMN-MDSCs from colitis to colorectal cancer (CRC), and its expression level and PMN-MDSC population positively correlated with the progression of IBD to CRC. Moreover, mice lacking OLFM4 in myeloid cells showed poor recruitment of PMN-MDSCs, impaired intestinal homeostasis, and delayed development from IBD to CRC, and increased response to anti-PD1 therapy. The main mechanism of OLFM4-mediated PMN-MDSC activity involved the NF-κB/PTGS2 pathway, through the binding of LGALS3, a galactoside-binding protein expressed on PMN-MDSCs. Our results showed that the OLFM4/NF-κB/PTGS2 pathway promoted PMN-MDSC recruitment, which played an essential role in the maintenance of intestinal homeostasis, but showed resistance to anti-PD1 therapy in CRC.
Also flagged:Non-Hodgkin lymphomasNHLhematologictranslationallymphomatumor
Journal Article2022-04-29No SnippetsJakša R, Karolová J, Svatoň M, Kazantsev D, Grajciarová M, Pokorná E, Tonar Z, Klánová M, Winkowska L, Maláriková D, Vočková P, Forsterová K, Renešová N, Dolníková A, Nožičková K, Dundr P, Froňková E, Trněný M, Klener P.
Show Full Abstract
Non-Hodgkin lymphomas (NHL) represent the most common hematologic malignancies. Patient-derived xenografts (PDXs) are used for various aspects of translational research including preclinical in vivo validation of experimental treatment approaches. While it was repeatedly demonstrated that PDXs keep majority of somatic mutations with the primary lymphoma samples, from which they were derived, the composition of PDX tumor microenvironment (TME) has not been extensively studied. We carried out a comparative genetic and histopathological study of 15 PDX models derived from patients with various types of NHL including diffuse large B-cell lymphoma (DLBCL; n = 7), Burkitt lymphoma (BL; n = 1), mantle cell lymphoma (MCL; n = 2), and peripheral T-cell lymphomas (PTCL; n = 5). Whole exome sequencing (WES) of the PDXs and primary lymphoma cells was implemented in 13 out of 15 cases with available DNA samples. Standard immunohistochemistry (IHC) was used to analyze the composition of PDX TME. WES data confirmed that PDXs maintained the genetic heterogeneity with the original primary lymphoma cells. In contrast, IHC analysis revealed the following recurrently observed alterations in the composition of PDX tumors: more blastoid lymphoma cell morphology, increased proliferation rate, lack of non-malignant cellular components including T cells and (human or murine) macrophages, and significantly lower intratumoral microvessel density and microvessel area composed of murine vessels. In addition, PDX tumors derived from T-NHL displayed additional differences compared to the primary lymphoma samples including markedly lower desmoplasia (i.e., the extent of both reticular and collagen fibrosis), loss of expression of cytotoxic granules (i.e., perforin, TIA, granzyme B), or loss of expression of T-cell specific antigens (i.e., CD3, CD4, CD8). Our data suggest that despite keeping the same genetic profiles, PDX models of aggressive NHL do not recapitulate the microenvironmental heterogeneity of the original lymphomas. These findings have implications on the relevance of PDX models in the context of preclinical research.
Also flagged:neurodegenerative diseasesnucleocytoplasmicamyotrophic lateral sclerosisAlzheimer diseasefrontotemporal dementiaHuntington disease
Journal Article2022-04-29No SnippetsCoyne AN, Rothstein JD.
Show Full Abstract
The genetic underpinnings and end-stage pathological hallmarks of neurodegenerative diseases are increasingly well defined, but the cellular pathophysiology of disease initiation and propagation remains poorly understood, especially in sporadic forms of these diseases. Altered nucleocytoplasmic transport is emerging as a prominent pathomechanism of multiple neurodegenerative diseases, including amyotrophic lateral sclerosis, Alzheimer disease, frontotemporal dementia and Huntington disease. The nuclear pore complex (NPC) and interactions between its individual nucleoporin components and nuclear transport receptors regulate nucleocytoplasmic transport, as well as genome organization and gene expression. Specific nucleoporin abnormalities have been identified in sporadic and familial forms of neurodegenerative disease, and these alterations are thought to contribute to disrupted nucleocytoplasmic transport. The specific nucleoporins and nucleocytoplasmic transport proteins that have been linked to different neurodegenerative diseases are partially distinct, suggesting that NPC injury contributes to the cellular specificity of neurodegenerative disease and could be an early initiator of the pathophysiological cascades that underlie neurodegenerative disease. This concept is consistent with the fact that rare genetic mutations in some nucleoporins cause cell-type-specific neurological disease. In this Review, we discuss nucleoporin and NPC disruptions and consider their impact on cellular function and the pathophysiology of neurodegenerative disease.
Also flagged:autophagyAdenocarcinoma of the pancreasARGCancerARGsBAK1
Journal Article2022-04-29✓ 1 SnippetDeng J, Zhang Q, Lv L, Ma P, Zhang Y, Zhao N, Zhang Y.
In-Text Gene Mentions
Results)
…and that ofTNFSF4, CD44, TNFSF9, CD276,…
Show Full Abstract
Adenocarcinoma of the pancreas (PAAD) is a cancerous growth that deteriorates rapidly and has a poor prognosis. Researchers are investigating autophagy in PAAD to identify a new biomarker and treatment target. An autophagy-related gene (ARG) model for overall survival (OS) was constructed using multivariate Cox regression analyses. A cohort of the Cancer Genome Atlas (TCGA)-PAAD was used as the training group as a basis for model construction. This prediction model was validated with several external datasets. To evaluate model performance, the analysis with receiver operating characteristic curves (ROC) was performed. The Human Protein Atlas (HPA) and Cancer Cell Line Encyclopedia (CCLE) were investigated to validate the effects of ARGs expression on cancer cells. Comparing the levels of immune infiltration between high-risk and low-risk groups was finished through the use of CIBERSORT. The differentially expressed genes (DEGs) between the low-/high-risk groups were analyzed further via Gene Ontology biological process (GO-BP) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses, which were used to identify potential small-molecule compounds in Connectivity Map (CMap), followed by half-maximal inhibitory concentration (IC50) examination with PANC-1 cells. The risk score was finally calculated as follows: BAK1 × 0.34 + ITGA3 × 0.38 + BAG3 × 0.35 + APOL1 × 0.26-RAB24 × 0.67519. ITGA3 and RAB24 both emerged as independent prognostic factors in multivariate Cox regression. Each PAAD cohort had a significantly shorter OS in the high-risk group than in the low-risk group. The high-risk group exhibited infiltration of several immune cell types, including naive B cells (p = 0.003), plasma cells (p = 0.044), and CD8 T cells (nearly significant, p = 0.080). Higher infiltration levels of NK cells (p = 0.025), resting macrophages (p = 0.020), and mast cells (p = 0.007) were found in the high-risk group than the low-risk group. The in vitro and in vivo expression of signature ARGs was consistent in the CCLE and HPA databases. The top 3 enriched Gene Ontology biological processes (GO-BPs) were signal release, regulation of transsynaptic signaling, and modulation of chemical synaptic transmission, and the top 3 enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were MAPK, cAMP, and cell adhesion molecules. Four potential small-molecule compounds (piperacetazine, vinburnine, withaferin A and hecogenin) that target ARGs were also identified. Taking the results together, our research shows that the ARG signature may serve as a useful prognostic indicator and reveal potential therapeutic targets in patients with PAAD.
Also flagged:Chondrogenesischondrocyte differentiationCancerRetinoic acidacute promyelocytic leukemiacollagen type II
Journal Article2022-04-29No SnippetsYang X, Tian S, Fan L, Niu R, Yan M, Chen S, Zheng M, Zhang S.
Show Full Abstract
Chondrogenesis is the formation of chondrocytes and cartilage tissues and starts with mesenchymal stem cell (MSC) recruitment and migration, condensation of progenitors, chondrocyte differentiation, and maturation. The chondrogenic differentiation of MSCs depends on co-regulation of many exogenous and endogenous factors including specific microenvironmental signals, non-coding RNAs, physical factors existed in culture condition, etc. Cancer stem cells (CSCs) exhibit self-renewal capacity, pluripotency and cellular plasticity, which have the potential to differentiate into post-mitotic and benign cells. Accumulating evidence has shown that CSCs can be induced to differentiate into various benign cells including adipocytes, fibrocytes, osteoblast, and so on. Retinoic acid has been widely used in the treatment of acute promyelocytic leukemia. Previous study confirmed that polyploid giant cancer cells, a type of cancer stem-like cells, could differentiate into adipocytes, osteocytes, and chondrocytes. In this review, we will summarize signaling pathways and cytokines in chondrogenic differentiation of MSCs. Understanding the molecular mechanism of chondrogenic differentiation of CSCs and cancer cells may provide new strategies for cancer treatment.
Cancer-associated fibroblasts (CAFs) are critical components of the tumor microenvironment (TME) with diverse functions such as extracellular matrix (ECM) remodeling, modulation of metabolism and angiogenesis, and crosstalk with both cancer cells and infiltrating immune cells by production of growth factors, cytokines, and chemokines. Within the TME milieu, CAFs exhibit morphological and functional transitions with relatively specific markers and hold tremendous potential to facilitate tumorigenesis, development, and resistance towards multiple therapeutic strategies including chemotherapy, radiotherapy, targeted therapy, anti-angiogenesis therapy, immunotherapy, and endocrine therapy. Accordingly, CAFs themselves and the downstream effectors and/or signaling pathways are potential targets for optimizing the sensitivity of anti-cancer therapies. This review aims to provide a detailed landscape of the role that CAFs play in conferring therapeutic resistance in different cancers and the underlying mechanisms. The translational and therapeutic perspectives of CAFs in the individualized treatment of malignant tumors are also discussed.
Adult neurogenesis, the process by which neurons are generated in certain areas of the adult brain, declines in an age-dependent manner and is one potential target for extending cognitive healthspan. Aging is a major risk factor for neurodegenerative diseases and, as lifespans are increasing, these health challenges are becoming more prevalent. An age-associated loss in neural stem cell number and/or activity could cause this decline in brain function, so interventions that reverse aging in stem cells might increase the human cognitive healthspan. In this review, we describe the involvement of adult neurogenesis in neurodegenerative diseases and address the molecular mechanistic aspects of neurogenesis that involve some of the key aggregation-prone proteins in the brain (i.e., tau, Aβ, α-synuclein, …). We summarize the research pertaining to interventions that increase neurogenesis and regulate known targets in aging research, such as mTOR and sirtuins. Lastly, we share our outlook on restoring the levels of neurogenesis to physiological levels in elderly individuals and those with neurodegeneration. We suggest that modulating neurogenesis represents a potential target for interventions that could help in the fight against neurodegeneration and cognitive decline.
Also flagged:bindingorganellesextracellularvesicleswaterChromium
Journal Article2022-04-29No SnippetsSiedlik MJ, Issadore D.
Show Full Abstract
Droplet microfluidics is based on a toolbox of several established unit operations, including droplet generation, incubation, mixing, pico-injection, and sorting. In the last two decades, the development of droplet microfluidic systems, which incorporate these multiple unit operations into a workflow, has demonstrated unique capabilities in fields ranging from single-cell transcriptomic analyses to materials optimization. One unit operation that is sorely underdeveloped in droplet microfluidics is washing, exchange of the fluid in a droplet with a different fluid. Here, we demonstrate what we name the "pico-washer," a unit operation capable of simultaneously adding fluid to and removing fluid from droplets in flow while requiring only a small footprint on a microfluidic chip. We describe the fabrication strategy, device architecture, and process parameters required for stable operation of this technology, which is capable of operating with kHz droplet throughput. Furthermore, we provide an image processing workflow to characterize the washing process with microsecond and micrometer resolution. Finally, we demonstrate the potential for integrated droplet workflows by arranging two of these unit operations in series with a droplet generator, describe a design rule for stable operation of the pico-washer when integrated into a system, and validate this design rule experimentally. We anticipate that this technology will contribute to continued development of the droplet microfluidics toolbox and the realization of novel droplet-based, multistep biological and chemical assays.
Also flagged:cancercardiovascular diseaseribonucleic acidsNOD 2IRF 7chromosome
Journal Article2022-04-29No SnippetsGao J, Lan T, Zong X, Shi G, He S, Na Chen, Cui F, Tu Y.
Show Full Abstract
The health of radiation workers has always been our focus. Epidemiological investigation shows that long-term exposure to low-dose ionizing radiation can affect human health, especially cancer and cardiovascular disease, and there are many studies on it. However, up to now, there have been few reports on the research of blood and biological samples from radiation workers. In this study, radiation workers and healthy control groups were strictly screened, and the transcriptome of mRNA and circRNA was sequenced by extracting their peripheral venous blood. At the same time, appropriate data sets were selected in the GEO database for bioinformatics analysis, and circRNA-miRNA-mRNA network was constructed. We identified 9 different circular ribonucleic acids, 3 tiny ribonucleic acids, and 2 central genes (NOD 2 and IRF 7). These differentially expressed genes and non-coding RNA are closely related to ionizing radiation damage, and play an important role as biological markers. In conclusion, this study may provide new insights into the role of the circRNA-miRNA-mRNA regulatory network in the health of radiation workers, and provides a new strategy for the future study of radiation biology.
<h4>Background</h4>Gastric cancer is one of the most common malignant tumors, and it ranks third in global cancer-related mortality. This research was aimed at identifying new targeted treatments for gastric adenocarcinoma by constructing a ferroptosis-related lncRNA prognostic feature model.<h4>Methods</h4>The gene expression profile and clinical data of gastric adenocarcinoma patients were downloaded from TCGA database. FerrDb database was used to determine the expression of iron death-related genes. We used R software to clean the TCAG gastric adenocarcinoma gene expression cohort and screen iron death-related differential genes and lncRNAs. The potential prognostic markers and immune infiltration characteristics were determined by constructing prognostic model and multivariate validation of lncRNA related to ferroptosis prognosis. Finally, the characteristics of immune infiltration were determined by immune correlation analysis.<h4>Results</h4>We identified 26 ferroptosis-related lncRNAs with independent prognostic value. The Kaplan-Meier analysis identified high-risk lncRNAs associated with poor prognosis of STAD. The risk scoring model constructed by AC115619.1, AC005165.1, LINC01614, and AC002451.1 was better than traditional clinicopathological features. The 1-, 3-, and 5-year survival rates of STAD patients were predicted by the nomogram. GSEA reveals the oxidative respiration and tumor-related pathways in different risk groups. Immune analysis found significant differences in the expression of immune checkpoint-related genes TNFSF9, TNFSF4, and PDCD1LG2 between the two groups of patients. Meanwhile, there were significant differences in APC co stimulation, CCR, and checkpoint between the two groups.<h4>Conclusion</h4>Based on the prognostic characteristics of ferroptosis-related lncRNAs, we identified the potential ferroptosis-related lncRNAs and immune infiltration characteristics in gastric adenocarcinoma, which will help provide new targeted treatments for gastric adenocarcinoma.
<h4>Background and objectives</h4>Hepatocellular carcinoma occurs frequently in prosimians, but the cause of these liver cancers in this group is unknown. Characterizing the genetic changes associated with hepatocellular carcinoma in prosimians may point to possible causes, treatments and methods of prevention, aiding conservation efforts that are particularly crucial to the survival of endangered lemurs. Although genomic studies of cancer in non-human primates have been hampered by a lack of tools, recent studies have demonstrated the efficacy of using human exome capture reagents across primates.<h4>Methodology</h4>In this proof-of-principle study, we applied human exome capture reagents to tumor-normal pairs from five lemurs with hepatocellular carcinoma to characterize the mutational landscape of this disease in lemurs.<h4>Results</h4>Several genes implicated in human hepatocellular carcinoma, including <i>ARID1A</i>, <i>TP53</i> and <i>CTNNB1</i>, were mutated in multiple lemurs, and analysis of cancer driver genes mutated in these samples identified enrichment of genes involved with <i>TP53</i> degradation and regulation. In addition to these similarities with human hepatocellular carcinoma, we also noted unique features, including six genes that contain mutations in all five lemurs. Interestingly, these genes are infrequently mutated in human hepatocellular carcinoma, suggesting potential differences in the etiology and/or progression of this cancer in lemurs and humans.<h4>Conclusions and implications</h4>Collectively, this pilot study suggests that human exome capture reagents are a promising tool for genomic studies of cancer in lemurs and other non-human primates.<h4>Lay summary</h4>Hepatocellular carcinoma occurs frequently in prosimians, but the cause of these liver cancers is unknown. In this proof-of-principle study, we applied human DNA sequencing tools to tumor-normal pairs from five lemurs with hepatocellular carcinoma and compared the lemur mutation profiles to those of human hepatocellular carcinomas.
Also flagged:Colorectal Cancerpathogenesisadenomacarcinomagene expressioncancers
Journal Article2022-04-29✓ 1 SnippetTan ES, Knepper TC, Wang X, Permuth JB, Wang L, Fleming JB, Xie H.
In-Text Gene Mentions
S I O 001029)
…DCC encodes for a nectrin-1 receptor and functions as a tumor suppressor gene with apoptotic ability, while SMAD4 regulates the TGF-β pathway to limit tumor growth and invasion [30].…
Show Full Abstract
In colorectal cancer, somatic mutations have played an important role as prognostic and predictive biomarkers, with some also functioning as therapeutic targets. Another genetic aberration that has shown significance in colorectal cancer is copy number alterations (CNAs). CNAs occur when a change to the DNA structure propagates gain/amplification or loss/deletion in sections of DNA, which can often lead to changes in protein expression. Multiple techniques have been developed to detect CNAs, including comparative genomic hybridization with microarray, low pass whole genome sequencing, and digital droplet PCR. In this review, we summarize key findings in the literature regarding the role of CNAs in the pathogenesis of colorectal cancer, from adenoma to carcinoma to distant metastasis, and discuss the roles of CNAs as prognostic and predictive biomarkers in colorectal cancer.
The objective of this study was to uncover genomic regions explaining a substantial proportion of the genetic variance in milk production traits and somatic cell score in a Valle del Belice dairy sheep. Weighted single-step genome-wide association studies (WssGWAS) were conducted for milk yield (MY), fat yield (FY), fat percentage (FAT%), protein yield (PY), protein percentage (PROT%), and somatic cell score (SCS). In addition, our aim was also to identify candidate genes within genomic regions that explained the highest proportions of genetic variance. Overall, the full pedigree consists of 5534 animals, of which 1813 ewes had milk data (15,008 records), and 481 ewes were genotyped with a 50 K single nucleotide polymorphism (SNP) array. The effects of markers and the genomic estimated breeding values (GEBV) of the animals were obtained by five iterations of WssGBLUP. We considered the top 10 genomic regions in terms of their explained genomic variants as candidate window regions for each trait. The results showed that top ranked genomic windows (1 Mb windows) explained 3.49, 4.04, 5.37, 4.09, 3.80, and 5.24% of the genetic variances for MY, FY, FAT%, PY, PROT%, and total SCS, respectively. Among the candidate genes found, some known associations were confirmed, while several novel candidate genes were also revealed, including <i>PPARGC1A</i>, <i>LYPLA1</i>, <i>LEP</i>, and <i>MYH9</i> for MY; <i>CACNA1C, PTPN1, ROBO2, CHRM3,</i> and <i>ERCC6</i> for FY and FAT%; <i>PCSK5</i> and <i>ANGPT1</i> for PY and PROT%; and <i>IL26</i>, <i>IFNG</i>, <i>PEX26</i>, <i>NEGR1</i>, <i>LAP3</i>, and <i>MED28</i> for SCS. These findings increase our understanding of the genetic architecture of six examined traits and provide guidance for subsequent genetic improvement through genome selection.
Also flagged:DextranCeriumhydroxyapatitemineralcationsanions
Journal Article2022-04-29No SnippetsCiobanu CS, Nica IC, Dinischiotu A, Iconaru SL, Chapon P, Bita B, Trusca R, Groza A, Predoi D.
Show Full Abstract
Dextran coated cerium doped hydroxyapatite (Ca<sub>10-x</sub>Cex(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>), with x = 0.05 (5CeHAp-D) and x = 0.1 (10CeHAp-D) were deposited on Si substrates by radio frequency magnetron sputtering technique for the first time. The morphology, composition, and structure of the resulting coatings were examined by scanning electron microscopy (SEM), energy-dispersive x-ray spectroscopy (EDX), atomic force microscopy (AFM), metallographic microscopy (MM), Fourier transform infrared spectroscopy (FTIR), and glow discharge optical emission spectroscopy (GDOES), respectively. The obtained information on the surface morphologies, composition and structure was discussed. The surface morphologies of the CeHAp-D composite thin films are smooth with no granular structures. The constituent elements of the CeHAp-D target were identified. The results of the FTIR measurements highlighted the presence of peaks related to the presence of ν<sub>1</sub>, ν<sub>3</sub>, and ν<sub>4</sub> vibration modes of (PO<sub>4</sub><sup>3-</sup>) groups from the hydroxyapatite (HAp) structure, together with those specific to the dextran structure. The biocompatibility assessment of 5CeHAp-D and 10CeHAp-D composite coatings was also discussed. The human cells maintained their specific elongated morphology after 24 h of incubation, which confirmed that the behavior of gingival fibroblasts and their proliferative capacity were not disturbed in the presence of 5CeHAp-D and 10CeHAp-D composite coatings. The 5CeHAp-D and 10CeHAp-D coatings' surfaces were harmless to the human gingival fibroblasts, proving good biocompatibility.
Also flagged:translationalneurological disordersbrain developmentMitochondrial diseasesdevelopmental delayatrophy
Journal Article2022-04-29✓ 2 SnippetsRomero-Morales AI, Gama V.
In-Text Gene Mentions
Introduction)
…Domain Protein 2 (BRN2/POU3F2) in most layer…
Introduction)
…SOX5 andSOX6are expressed in…
Show Full Abstract
Mitochondrial homeostasis -including function, morphology, and inter-organelle communication- provides guidance to the intrinsic developmental programs of corticogenesis, while also being responsive to environmental and intercellular signals. Two- and three-dimensional platforms have become useful tools to interrogate the capacity of cells to generate neuronal and glia progeny in a background of metabolic dysregulation, but the mechanistic underpinnings underlying the role of mitochondria during human neurogenesis remain unexplored. Here we provide a concise overview of cortical development and the use of pluripotent stem cell models that have contributed to our understanding of mitochondrial and metabolic regulation of early human brain development. We finally discuss the effects of mitochondrial fitness dysregulation seen under stress conditions such as metabolic dysregulation, absence of developmental apoptosis, and hypoxia; and the avenues of research that can be explored with the use of brain organoids.
Also flagged:infectious diseasesSARSanxietypsychological distresschild abuseinfection
Journal Article2022-04-29No SnippetsGierszewski D, Kurotschka PK, Krauthausen M, Fröhlich W, Forster J, Pietsch F, Streng A, Rücker V, Wallstabe J, Hartmann K, Jans T, Engels G, Romanos M, Heuschmann P, Härtel C, Kurzai O, Liese J, Gágyor I.
Show Full Abstract
<h4>Background</h4>Feasibility of surveillance through continuous SARS-CoV-2 testing in pre-school children and childcare workers (CCWs) to prevent closure of day care centers (DCCs) was proven in the Wü-KiTa-CoV study. The purpose of this study was to describe the factors that facilitate or hinder the implementation of continuous SARS-CoV-2 testing from the perspective of parents and CCWs involved in the study.<h4>Methods</h4>A total of 148 semi-structured telephone interviews, repeated before and after the implementation of the surveillance protocols, were conducted with parents and CCWs belonging to the DCCs involved in Wü-KiTa-CoV and analyzed using qualitative content analysis.<h4>Results</h4>Five main topical categories that influences implementation of surveillance protocols for SARS-CoV-2 in DCCs emerged: Generating valuable knowledge, Impact on daily life, Communication and information, Children's wellbeing and the Sense of security. Smooth integration in daily routines, quickly delivered test results, and efficient communication and information between the study team and the participants were identified as factors that had a positive impact on implementation. To ensure children's wellbeing, the introduction of non-invasive testing procedures such as saliva testing, parental involvement to motivate, and prepare children for the procedure, the creation of a child-friendly environment for testing, and use of child-friendly explanations were considered critical. The surveillance was found to increase the sense of security during the pandemic. Conversely, reliability of tests in the surveillance protocols, low participation rates, non-transparent communication, the need to travel to testing sites, fear of quarantine in case of positive test results, concerns about higher workloads, the fear of unpleasant feelings for children, their young age, and changing test teams were considered as hindering factors.<h4>Conclusion</h4>This qualitative study of parents of children in day care and DCC staff under surveillance through continuous testing for SARS-CoV-2 in nine German DCCs identified several factors that facilitate or hinder its implementation. These should be considered when planning screening interventions to prevent the spread of SARS-CoV-2 or other infectious diseases in pre-school children DCCs.
Also flagged:Squamous Cell CarcinomaSquamous cell carcinomas of the esophagusESCCHNSCCneoplasmshead and neck cancers
Journal Article2022-04-29No SnippetsIacob R, Mandea M, Iacob S, Pietrosanu C, Paul D, Hainarosie R, Gheorghe C.
Show Full Abstract
Squamous cell carcinomas of the esophagus (ESCC) and of the head and neck (HNSCC) are two neoplasms that share common risk factors and have the same embryological origin, but a very different prognosis, the 5-year survival of HNSCC being almost double (40-50%) compared to the 5-year survival of ESCC (20%). Current guidelines emphasize the importance of screening for ESCC in patients diagnosed with head and neck cancers. A liquid biopsy is a novel tool for diagnosis, prognostic stratification, and personalized therapy. Liquid biopsy biomarkers for these two malignancies could help both their early detection, facilitate residual disease identification, and provide prognosis information. The present systematic review of the literature was aimed at describing the liquid biopsy biomarkers present in these two malignancies, with an emphasis on potential clinical applications.
Also flagged:Cell Migrationcell proliferationcancerMetastasisoral diseasesdental caries
Journal Article2022-04-29✓ 1 SnippetBai H, Yang J, Meng S, Liu C.
In-Text Gene Mentions
S I O 001029)
…P. gingivalis and F. nucleatum could also enhance the expression of EMT-associated transcription factors (Zeb1, Zeb2, Slug, Snail, Jag1, Notch, Twist, OLFM4 and RGCC) in oral epithelial cells and OSCC cells through diverse pathways, including the phosphorylation of glycogen synthase kinase-3β (GSK‐3β), EGF, tumor necrosis factor-α (TNF-α) and TGF-β1 (Bhattacharya et al., 2014; Sztukowska et al., 2016; Abdulkareem et al., 2018a; Abdulkareem et al., 2018b).…
Show Full Abstract
The oral cavity harbors approximately 1,000 microbial species, and both pathogenic and commensal strains are involved in the development of carcinogenesis by stimulating chronic inflammation, affecting cell proliferation, and inhibiting cell apoptosis. Moreover, some substances produced by oral bacteria can also act in a carcinogenic manner. The link between oral microbiota and chronic inflammation as well as cell proliferation has been well established. Recently, increasing evidence has indicated the association of the oral microbiota with cell migration, which is crucial in regulating devastating diseases such as cancer. For instance, increased cell migration induced the spread of highly malignant cancer cells. Due to advanced technologies, the mechanistic understanding of cell migration in carcinogenesis and cancer metastasis is undergoing rapid progress. Thus, this review addressed the complexities of cell migration in carcinogenesis and cancer metastasis. We also integrate recent findings on the molecular mechanisms by which the oral microbiota regulates cell migration, with emphasis on the effect of the oral microbiota on adhesion, polarization, and guidance. Finally, we also highlight critical techniques, such as intravital microscopy and superresolution microscopy, for studies in this field.
Also flagged:Diffuse gliomacentral nervous system tumorgliomagliomastumorsPPFIBP1
Journal Article2022-04-29✓ 5 SnippetsXu PF, Li C, Xi SY, Chen FR, Wang J, Zhang ZQ, Liu Y, Li X, Chen ZP.
In-Text Gene Mentions
Discussion)
…We also identified several genetic alterations with the potential to drive IDH mutant gliomas or GBMs recurrences, including amplification of PPFIBP1, KRAS, and PDE4DIP, deletion of TNFRSF14, CDKN2A, DCC and MSH6, and mutations in ATRX, ARID1A, KEL, TP53, ANK1, FAT4, MSH6, and KMT2B. In the GLASS dataset, the proportion of mutation in MSH6, KMT2B, ANK1, TP53, FAT4, ARID1A, and AFDN, deletion of MSH6 and CDKN2A, amplification of KRAS in recurrent tumors was also significantly higher than that in primary samples.…
Results)
…In IDH mutant gliomas, this included amplification of PPFIBP1 and KRAS, deletion of TNFRSF14, CDKN2A, and MSH6, and mutations in ATRX, ARID1A, and KEL. In GBM, mutations in TP53, MSH6, and KMT2B, amplification of PDE4DIP, and deletion of DCC were selected in recurrent samples.…
S I O 001029)
…Recurrent tumors continued to evolve independently with chemoradiotherapy and harbored multiple recurrence-selected genetic alterations, such as amplification of PPFIBP1, PDE4DIP, and KRAS, deletion of TNFRSF14, DCC, CDKN2A, and MSH6, and mutations in ATRX, ARID1A, KEL, TP53, MSH6, and KMT2B. Meanwhile, truncal variants within partial driver genes were identified among primary and recurrent gliomas, suggesting that they might be ideal therapeutic targets.…
Abstract)
…of TNFRSF14 ,DCC, CDKN2A ,…
Results)
…and deletion ofDCCwere selected in…
Show Full Abstract
Diffuse glioma is a highly heterogeneous central nervous system tumor that is refractory to conventional therapy. Residual glioma cells escape from surgery and chemoradiotherapy, leading to lethal recurrence. Understanding the molecular mechanism of this recurrence process is critical to the development of successful therapies. Here, we analyzed whole-exome sequencing (WES) data of 97 paired primary and recurrent samples from 46 patients with glioma via a uniform pipeline. Clonality and phylogenetic analyses revealed that branching evolution was widespread in the recurrent process of gliomas. Recurrent tumors continued to evolve independently with chemoradiotherapy and harbored multiple recurrence-selected genetic alterations, such as amplification of <i>PPFIBP1</i>, <i>PDE4DIP</i>, and <i>KRAS</i>, deletion of <i>TNFRSF14</i>, <i>DCC</i>, <i>CDKN2A</i>, and <i>MSH6</i>, and mutations in <i>ATRX</i>, <i>ARID1A</i>, <i>KEL</i>, <i>TP53</i>, <i>MSH6</i>, and <i>KMT2B</i>. Meanwhile, truncal variants within partial driver genes were identified among primary and recurrent gliomas, suggesting that they might be ideal therapeutic targets. Intriguingly, the immunogenicity of recurrent gliomas did not increase significantly compared to the primary tumors. Genomic analysis of recurrent gliomas provided an opportunity to identify potentially clinically informative alterations not detected in clinically sampled primary tumors.
Also flagged:hexanucleotideamyotrophic lateral sclerosisALSfrontotemporal dementiadipeptidepsychiatric disorders
Journal Article2022-04-29✓ 1 SnippetBreevoort S, Gibson S, Figueroa K, Bromberg M, Pulst S.
In-Text Gene Mentions
S I O 001029)
…C9ORF72 expansion is now recognized as the leading genetic cause of Huntington-like (Huntington disease [HD]-like) disease, which is clinically indistinguishable from HD but without the diagnostic CAG repeat expansion in the HTT gene.e32,e33 Further neuropathologic studies elucidating whether C9ORF72-mediated pathology occurs in HD-related brain regions are needed; however, there does not appear to be a causal relationship between C9ORF72 expansion and HD.…
Show Full Abstract
In 2011, a pathogenic hexanucleotide repeat expansion in the <i>C9ORF72</i> gene was discovered to be the leading genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Before this, the <i>C9ORF72</i> gene and its protein were unknown. The repeat expansion was found to cause both haploinsufficiency and gain of toxicity through aggregating RNA products and dipeptide repeat proteins. A worldwide effort was then initiated to define C9ORF72 ALS/FTD and unravel the pathogenic mechanism for the development of therapeutic options. A decade later, <i>C9ORF72</i> genetic testing is readily available. There is now an increasing appreciation that <i>C9ORF72</i> not only is the leading genetic cause of ALS/FTD but may contribute to a spectrum of disorders. This article reviews what is currently known about the <i>C9ORF72</i> expansion and how <i>C9ORF72</i> expansion manifests in ALS, FTD, psychiatric disorders, and movement disorders. With therapeutic strategies fast approaching the clinic, earlier recognition of possible <i>C9ORF72</i> expansion related disorders is even more paramount to improve patient care.
Also flagged:sulfatedfucosylpolysaccharidesEndo-fucoidanasesfucoidanoligosaccharides
Journal Article2022-04-29No SnippetsTran VHN, Nguyen TT, Meier S, Holck J, Cao HTT, Van TTT, Meyer AS, Mikkelsen MD.
Show Full Abstract
Fucoidans are complex bioactive sulfated fucosyl-polysaccharides primarily found in brown macroalgae. Endo-fucoidanases catalyze the specific hydrolysis of α-L-fucosyl linkages in fucoidans and can be utilized to tailor-make fucoidan oligosaccharides and elucidate new structural details of fucoidans. In this study, an endo-α(1,3)-fucoidanase encoding gene, <i>Mef2</i>, from the marine bacterium <i>Muricauda eckloniae</i>, was cloned, and the Mef2 protein was functionally characterized. Based on the primary sequence, Mef2 was suggested to belong to the glycosyl hydrolase family 107 (GH107) in the Carbohydrate Active enZyme database (CAZy). The Mef2 fucoidanase showed maximal activity at pH 8 and 35 °C, although it could tolerate temperatures up to 50 °C. Ca<sup>2+</sup> was shown to increase the melting temperature from 38 to 44 °C and was furthermore required for optimal activity of Mef2. The substrate specificity of Mef2 was investigated, and Fourier transform infrared spectroscopy (FTIR) was used to determine the enzymatic activity (Units per μM enzyme: U<i><sub>f</sub></i>/μM) of Mef2 on two structurally different fucoidans, showing an activity of 1.2 × 10<sup>-3</sup> U<i><sub>f</sub></i>/μM and 3.6 × 10<sup>-3</sup> U<i><sub>f</sub></i>/μM on fucoidans from <i>Fucus evanescens</i> and <i>Saccharina latissima</i>, respectively. Interestingly, Mef2 was identified as the first described fucoidanase active on fucoidans from <i>S. latissima</i>. The fucoidan oligosaccharides released by Mef2 consisted of a backbone of α(1,3)-linked fucosyl residues with unique and novel α(1,4)-linked fucosyl branches, not previously identified in fucoidans from <i>S. latissima</i>.
Also flagged:TitaniumHydroxyapatitefibronectinfocal adhesionlocalizationbromide
Journal Article2022-04-29No SnippetsKylmäoja E, Holopainen J, Abushahba F, Ritala M, Tuukkanen J.
Show Full Abstract
<h4>Background</h4>The increasing demand for bone implants with improved osseointegration properties has prompted researchers to develop various coating types for metal implants. Atomic layer deposition (ALD) is a method for producing nanoscale coatings conformally on complex three-dimensional surfaces. We have prepared hydroxyapatite (HA) coating on titanium (Ti) substrate with the ALD method and analyzed the biocompatibility of this coating in terms of cell adhesion and viability.<h4>Methods</h4>HA coatings were prepared on Ti substrates by depositing CaCO<sub>3</sub> films by ALD and converting them to HA by wet treatment in dilute phosphate solution. MC3T3-E1 preosteoblasts were cultured on ALD-HA, glass slides and bovine bone slices. ALD-HA and glass slides were either coated or non-coated with fibronectin. After 48h culture, cells were imaged with scanning electron microscopy (SEM) and analyzed by vinculin antibody staining for focal adhesion localization. An 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide (MTT) test was performed to study cell viability.<h4>Results</h4>Vinculin staining revealed similar focal adhesion-like structures on ALD-HA as on glass slides and bone, albeit on ALD-HA and bone the structures were thinner compared to glass slides. This might be due to thin and broad focal adhesions on complex three-dimensional surfaces of ALD-HA and bone. The MTT test showed comparable cell viability on ALD-HA, glass slides and bone.<h4>Conclusion</h4>ALD-HA coating was shown to be biocompatible in regard to cell adhesion and viability. This leads to new opportunities in developing improved implant coatings for better osseointegration and implant survival.
Also flagged:Dinucleotidetrinucleotideamino acidsnucleotideprotein synthesisbinding
Journal Article2022-04-29✓ 3 SnippetsBelkozhayev A, Niyazova R, Wilson C, Jainakbayev N, Pyrkova A, Ashirbekov Y, Akimniyazova A, Sharipov K, Ivashchenko A.
In-Text Gene Mentions
Results)
…, GLS ,HTT, IRF2BPL ,…
Results)
…, GNB2 ,HTT, IRF2BPL ,…
I A O 0000615)
…, FOXF2 ,HTT, IRF2BPL ,…
Show Full Abstract
The variability of nucleotide repeats is considered one of the causes of diseases, but their biological function is not understood. In recent years, the interaction of miRNAs and piRNAs with the mRNAs of genes responsible for developing neurodegenerative and oncological diseases and diabetes have been actively studied. We explored candidate genes with nucleotide repeats to predict associations with miRNAs and piRNAs. The parameters of miRNAs and piRNA binding sites with mRNAs of human genes having nucleotide repeats were determined using the MirTarget program. This program defines the start of the initiation of miRNA and piRNA binding to mRNAs, the localization of miRNA and piRNA binding sites in the 5'-untranslated region (5'UTR), coding sequence (CDS) and 3'-untranslated region (3'UTR); the free energy of binding; and the schemes of nucleotide interactions of miRNAs and piRNAs with mRNAs. The characteristics of miRNAs and piRNA binding sites with mRNAs of 73 human genes were determined. The 5'UTR, 3'UTR and CDS of the mRNAs of genes are involved in the development of neurodegenerative, oncological and diabetes diseases with GU, AC dinucleotide and CCG, CAG, GCC, CGG, CGC trinucleotide repeats. The associations of miRNAs, piRNAs and candidate target genes could be recommended for developing methods for diagnosing diseases, including neurodegenerative diseases, oncological diseases and diabetes.
Also flagged:Essential hypertensionioncardiovascular disordersHypertensionC2orf47SPATS2L
Journal Article2022-04-29No SnippetsAlsamman AM, Almabrazi H, Zayed H.
Show Full Abstract
Essential hypertension (EH) is a leading risk condition for cardiovascular and renal complications. While multiple genes are associated with EH, little is known about its genetic etiology. Therefore, this study aimed to screen for variants that are associated with EH in 100 hypertensive/100 control patients comprising Qatari individuals using GWASs of whole-genome sequencing and compare these findings with genetic data obtained from more than 10,000 published peer-reviewed studies on EH. The GWAS analysis performed with 21,096 SNPs revealed 38 SNPs with a significant ≥4 log-<i>p</i> value association with EH. The two highest EH-associated SNPs (rs921932379 and rs113688672) revealed a significance score of ≥5 log-<i>p</i> value. These SNPs are located within the inter-genic region of <i>GMPS-SETP14</i> and <i>ISCA1P6-AC012451.1</i>, respectively. Text mining yielded 3748 genes and 3078 SNPs, where 51 genes and 24 SNPs were mentioned in more than 30 and 10 different articles, respectively. Comparing our GWAS results to previously published articles revealed 194 that are unique to our patient cohort; of these, 13 genes that have 26 SNPs are the most significant with ≥4 log-<i>p</i> value. Of these genes, <i>C2orf47-SPATS2L</i> contains nine EH-associated SNPs. Most of EH-associated genes are related to ion gate channel activity and cardiac conduction. The disease-gene analysis revealed that a large number of EH-associated genes are associated with a variety of cardiovascular disorders. The clustering analysis using EH-associated SNPs across different ethnic groups showed high frequency for the minor allele in different ethnic groups, including Africans, East Asians, and South Asians. The combination of GWAS and text mining helped in identifying the unique genetic susceptibility profile of Qatari patients with EH. To our knowledge, this is the first small study that searched for genetic factors associated with EH in Qatari patients.
The lack of curative options for pulmonary arterial hypertension drives important research to understand the mechanisms underlying this devastating disease. Among the main identified pathways, the platelet-derived growth factor (PDGF) pathway was established to control vascular remodeling and anti-PDGF receptor (PDGFR) drugs were shown to reverse the disease in experimental models. Four different isoforms of PDGF are produced by various cell types in the lung. PDGFs control vascular cells migration, proliferation and survival through binding to their receptors PDGFRα and β. They elicit multiple intracellular signaling pathways which have been particularly studied in pulmonary smooth muscle cells. Activation of the PDGF pathway has been demonstrated both in patients and in pulmonary hypertension (PH) experimental models. Tyrosine kinase inhibitors (TKI) are numerous but without real specificity and Imatinib, one of the most specific, resulted in beneficial effects. However, adverse events and treatment discontinuation discouraged to pursue this therapy. Novel therapeutic strategies are currently under experimental evaluation. For TKI, they include intratracheal drug administration, low dosage or nanoparticles delivery. Specific anti-PDGF and anti-PDGFR molecules can also be designed such as new TKI, soluble receptors, aptamers or oligonucleotides.
Also flagged:-ConotoxinCalciumChannelsα-conotoxinpeptidenicotinic acetylcholine receptor
Journal Article2022-04-29No SnippetsWang S, Bartels P, Zhao C, Yousuf A, Liu Z, Yu S, Bony AR, Ma X, Dai Q, Sun T, Liu N, Yang M, Yu R, Du W, Adams DJ, Dai Q.
Show Full Abstract
A novel 4/8 subtype α-conotoxin, Vt1.27 (NCCMFHTCPIDYSRFNC-NH<sub>2</sub>), was identified from <i>Conus vitulinus</i> in the South China Sea by RACE methods. The peptide was synthesized and structurally characterized. Similar to other α-conotoxins that target neuronal nicotinic acetylcholine receptor (nAChR) subtypes, Vt1.27 inhibited the rat α3β2 nAChR subtype (IC<sub>50</sub> = 1160 nM) and was inactive at voltage-gated sodium and potassium channels in rat sensory neurons. However, Vt1.27 inhibited high voltage-activated N-type (Ca<sub>V</sub>2.2) calcium channels expressed in HEK293T cells with an IC<sub>50</sub> of 398 nM. An alanine scan of the peptide showed that residues Phe<sup>5</sup>, Pro<sup>9</sup>, Ile<sup>10</sup>, and Ser<sup>13</sup> contribute significantly to the inhibitory activity of Vt1.27. The molecular dockings indicate that Vt1.27 inhibits the transmembrane region of Ca<sub>V</sub>2.2, which is different from that of ω-conotoxins. Furthermore, Vt1.27 exhibited potent anti-allodynic effect in rat partial sciatic nerve injury (PNL) and chronic constriction injury (CCI) pain models at 10 nmol/kg level with the intramuscular injection. The pain threshold elevation of Vt1.27 groups was higher than that of α-conotoxin Vc1.1 in CCI rat models. These findings expand our knowledge of targets of α-conotoxins and potentially provide a potent, anti-allodynic peptide for the treatment of neuropathic pain.
Also flagged:Transcription Factorbindingsynapsespotassiumcationion channels
Journal Article2022-04-29No SnippetsChowdhury A, Bose A, Zhou S, Woodruff DP, Drineas P.
Show Full Abstract
Principal component analysis (PCA) is a widely used dimensionality reduction technique in machine learning and multivariate statistics. To improve the interpretability of PCA, various approaches to obtain sparse principal direction loadings have been proposed, which are termed Sparse Principal Component Analysis (SPCA). In this paper, we present ThreSPCA, a provably accurate algorithm based on thresholding the Singular Value Decomposition for the SPCA problem, without imposing any restrictive assumptions on the input covariance matrix. Our thresholding algorithm is conceptually simple; much faster than current state-of-the-art; and performs well in practice. When applied to genotype data from the 1000 Genomes Project, ThreSPCA is faster than previous benchmarks, at least as accurate, and leads to a set of interpretable biomarkers, revealing genetic diversity across the world.
medRxiv2022-04-29Preprint (No Snippets API)Hamilton F, Mitchell R, Ahmed H, Ghazal P, Timpson N.
Show Full Abstract
Iron deficiency is associated with a substantial burden of morbidity. However, supplementation of iron has been linked to increased rates of serious infection in randomised trials of children in sub-Saharan Africa. Randomised trials in other settings have been inconclusive and it is unknown if changes in levels of iron biomarkers – a mark of setpoint changes in iron homeostasis - are linked to sepsis in these other settings. We used genetic variants associated with levels of iron biomarkers as instrumental variables in a Mendelian randomisation (MR) analysis to test the hypothesis that increasing levels of iron biomarkers increase the risk of sepsis. In observational and MR analyses we found that increases in iron biomarkers increase the risk of sepsis. In stratified analyses, we show that this risk may be larger in those with iron deficiency and/or anaemia. Taken together, results here suggest a required caution in supplementation of iron and underline the role of iron homeostasis in severe infection.
Binge-eating disorder (BED) is the most common eating disorder yet its genetic architecture remains largely unknown. Studying BED is challenging because it is often comorbid with obesity, a common and highly polygenic trait, and it is underdiagnosed in biobank datasets. To address this limitation, we apply a supervised machine learning approach to estimate the probability of each individual having BED based on electronic medical records from the Million Veteran Program. We perform a genome-wide association study on individuals of African ( n = 77,574) and European ( n = 285,138) ancestry while controlling for body mass index to identify three independent loci near the HFE, MCHR2 and LRP11 genes, which are reproducible across three independent cohorts. We identify genetic association between BED and several neuropsychiatric traits and implicate iron metabolism in the pathophysiology of BED. Overall, our findings provide insights into the genetics underlying BED and suggest directions for future translational research.
Also flagged:cancer predisposition syndromescancersoft tissue sarcomasosteosarcomasbreast cancerleukemia
Journal Article2022-04-28✓ 1 SnippetXu F, Aref-Eshghi E, Wu J, Schubert J, Wertheim G, Bhatti T, Pogoriler J, Patel M, Cao K, Long A, Fan Z, Denenberg EH, Fanning EA, Wilmoth DM, Luo M, Conlin LK, Dain AS, Zelley K, Baldino S, Balamuth N, MacFarland S, Li MM, Zhong Y.
Li-Fraumeni syndrome (LFS) is one of the most common cancer predisposition syndromes that affects both children and adults. Individuals with LFS are at an increased risk of developing various types of cancer over their lifetime including soft tissue sarcomas, osteosarcomas, breast cancer, leukemia, brain tumors, and adrenocortical carcinoma. Heterozygous germline pathogenic variants in the tumor suppressor gene <i>TP53</i> are the known causal genetic defect for LFS. Single-nucleotide variants (SNVs) including missense substitutions that occur in the highly conserved DNA binding domain of the protein are the most common alterations, followed by nonsense and splice site variants. Gross copy-number changes in <i>TP53</i> are rare and account for <1% of all variants. Using next-generation sequencing (NGS) panels, we identified a paternally inherited germline intragenic duplication of <i>TP53</i> in a child with metastatic osteosarcoma who later developed acute myeloid leukemia (AML). Transcriptome sequencing (RNA-seq) demonstrated the duplication was tandem, encompassing exons 2-6 and 28 nt of the untranslated region (UTR) upstream of the start codon in exon 2. The inclusion of the 28 nt is expected to result in a frameshift with a stop codon 18 codons downstream from the exon 6, leading to a loss-of-function allele. This case highlights the significance of simultaneous identification of both significant copy-number variants as well as SNVs/indels using NGS panels.
Also flagged:CTSDcathepsin DSNCAα-SynucleinParkinson diseaseneurodegenerative disorder
Journal Article2022-04-28No SnippetsPrieto Huarcaya S, Drobny A, Marques ARA, Di Spiezio A, Dobert JP, Balta D, Werner C, Rizo T, Gallwitz L, Bub S, Stojkovska I, Belur NR, Fogh J, Mazzulli JR, Xiang W, Fulzele A, Dejung M, Sauer M, Winner B, Rose-John S, Arnold P, Saftig P, Zunke F.
Show Full Abstract
Parkinson disease (PD) is a neurodegenerative disorder characterized by the abnormal intracellular accumulation of SNCA/α-synuclein. While the exact mechanisms underlying SNCA pathology are not fully understood, increasing evidence suggests the involvement of autophagy as well as lysosomal deficiencies. Because CTSD (cathepsin D) has been proposed to be the major lysosomal protease involved in SNCA degradation, its deficiency has been linked to the presence of insoluble SNCA conformers in the brain of mice and humans as well as to the transcellular transmission of SNCA aggregates. We here postulate that SNCA degradation can be enhanced by the application of the recombinant human proform of CTSD (rHsCTSD). Our results reveal that rHsCTSD is efficiently endocytosed by neuronal cells, correctly targeted to lysosomes and matured to an enzymatically active protease. In dopaminergic neurons derived from induced pluripotent stem cells (iPSC) of PD patients harboring the A53T mutation within the <i>SNCA</i> gene, we confirm the reduction of insoluble SNCA after treatment with rHsCTSD. Moreover, we demonstrate a decrease of pathological SNCA conformers in the brain and within primary neurons of a <i>ctsd</i>-deficient mouse model after dosing with rHsCTSD. Boosting lysosomal CTSD activity not only enhanced SNCA clearance in human and murine neurons as well as tissue, but also restored endo-lysosome and autophagy function. Our findings indicate that CTSD is critical for SNCA clearance and function. Thus, enzyme replacement strategies utilizing CTSD may also be of therapeutic interest for the treatment of PD and other synucleinopathies aiming to decrease the SNCA burden.<b>Abbreviations:</b> aa: amino acid; SNCA/α-synuclein: synuclein alpha; APP: amyloid beta precursor protein; BBB: blood brain barrier; BF: basal forebrain; CBB: Coomassie Brilliant Blue; CLN: neuronal ceroid lipofuscinosis; CNL10: neuronal ceroid lipofuscinosis type 10; Corr.: corrected; CTSD: cathepsin D; CTSB: cathepsin B; DA: dopaminergic; DA-iPSn: induced pluripotent stem cell-derived dopaminergic neurons; dox: doxycycline; ERT: enzyme replacement therapy; Fx: fornix, GBA/β-glucocerebrosidase: glucosylceramidase beta; h: hour; HC: hippocampus; HT: hypothalamus; i.c.: intracranially; IF: immunofluorescence; iPSC: induced pluripotent stem cell; KO: knockout; LAMP1: lysosomal associated membrane protein 1; LSDs: lysosomal storage disorders; MAPT: microtubule associated protein tau; M6P: mannose-6-phosphate; M6PR: mannose-6-phosphate receptor; MB: midbrain; mCTSD: mature form of CTSD; neurofil.: neurofilament; PD: Parkinson disease; proCTSD: proform of CTSD; PRNP: prion protein; RFU: relative fluorescence units; rHsCTSD: recombinant human proCTSD; SAPC: Saposin C; SIM: structured illumination microscopy; T-insol: Triton-insoluble; T-sol: Triton-soluble; TEM: transmission electron microscopy, TH: tyrosine hydroxylase; Thal: thalamus.
Also flagged:transition metal oxidetransition metal oxidestransition metaloxidecarbonatefluorine
Journal Article2022-04-28No SnippetsBai P, Ji X, Zhang J, Zhang W, Hou S, Su H, Li M, Deng T, Cao L, Liu S, He X, Xu Y, Wang C.
Show Full Abstract
The capacity of transition metal oxide cathode for Li-ion batteries can be further enhanced by increasing the charging potential. However, these high voltage cathodes suffer from fast capacity decay because the large volume change of cathode breaks the active materials and cathode-electrolyte interphase (CEI), resulting in electrolyte penetration into broken active materials and continuous side reactions between cathode and electrolytes. Herein, a robust LiF-rich CEI was formed by potentiostatic reduction of fluorinated electrolyte at a low potential of 1.7 V. By taking LiCoO<sub>2</sub> as a model cathode, we demonstrate that the LiF-rich CEI maintains the structural integrity and suppresses electrolyte penetration at a high cut-off potential of 4.6 V. The LiCoO<sub>2</sub> with LiF-rich CEI exhibited a capacity of 198 mAh g<sup>-1</sup> at 0.5C and an enhanced capacity retention of 63.5 % over 400 cycles as compared to the LiF-free LiCoO<sub>2</sub> with only 17.4 % of capacity retention.
Also flagged:gestationinfectionclottingSPTBfibronectinpathogenesis
Journal Article2022-04-28✓ 3 SnippetsTiensuu H, Haapalainen AM, Tissarinen P, Pasanen A, Määttä TA, Huusko JM, Ohlmeier S, Bergmann U, Ojaniemi M, Muglia LJ, Hallman M, Rämet M.
In-Text Gene Mentions
Results)
…n-4 (PRDX4), peroxiredoxin-6 (PRDX6), protein S100-A6 (S100A6),…
Results)
…ERO1L, EZR, andPRDX6.…
Results)
…EZR, F13A1, andPRDX6) out of the…
Show Full Abstract
<h4>Background</h4>Preterm birth is defined as live birth before 37 completed weeks of pregnancy, and it is a major problem worldwide. The molecular mechanisms that lead to onset of spontaneous preterm birth are incompletely understood. Prediction and evaluation of the risk of preterm birth is challenging as there is a lack of accurate biomarkers. In this study, our aim was to identify placental proteins that associate with spontaneous preterm birth.<h4>Methods</h4>We analyzed the proteomes from placentas to identify proteins that associate with both gestational age and spontaneous labor. Next, rare and potentially damaging gene variants of the identified protein candidates were sought for from our whole exome sequencing data. Further experiments we performed on placental samples and placenta-associated cells to explore the location and function of the spontaneous preterm labor-associated proteins in placentas.<h4>Results</h4>Exome sequencing data revealed rare damaging variants in SERPINA1 in families with recurrent spontaneous preterm deliveries. Protein and mRNA levels of alpha-1 antitrypsin/SERPINA1 from the maternal side of the placenta were downregulated in spontaneous preterm births. Alpha-1 antitrypsin was expressed by villous trophoblasts in the placenta, and immunoelectron microscopy showed localization in decidual fibrinoid deposits in association with specific extracellular proteins. siRNA knockdown in trophoblast-derived HTR8/SVneo cells revealed that SERPINA1 had a marked effect on regulation of the actin cytoskeleton pathway, Slit-Robo signaling, and extracellular matrix organization.<h4>Conclusions</h4>Alpha-1 antitrypsin is a protease inhibitor. We propose that loss of the protease inhibition effects of alpha-1 antitrypsin renders structures critical to maintaining pregnancy susceptible to proteases and inflammatory activation. This may lead to spontaneous premature birth.
Also flagged:NDUFV1ataxialactic acidosisleukoencephalomyelopathyrespiratory chain diseaseComplex I
Journal Article2022-04-28✓ 1 SnippetGschwind M, Garcia Segarra N, Schaller A, Bolognini R, Nuoffer JM, Hourez R, Deprez M, Lhermitte B, Maeder P, Tran C, Kuntzer T.
In-Text Gene Mentions
Acknowledgments)
…search of aDARS2mutation which could…
Show Full Abstract
We present a patient who developed, after an early-onset, a stable course of spastic paraplegia and ataxia for 4 decades and eventually succumbed to two episodes of postinfectious lactic acidosis. Diagnostic workup including muscle biopsy and postmortem analysis, oxymetric analysis, spectrophotometric enzyme analysis, and MitoExome sequencing revealed a necrotizing leukoencephalomyelopathy due to the so far unreported biallelic variant of the NDUFV1 gene (p.(Pro122Leu)). This case extends our understanding of NDUFV1 variants with a 14-fold longer lifetime than so far reported cases, and will foster sensitivity toward respiratory chain disease also in adult patients with sudden deteriorating neurological deficits.
Also flagged:p85PI3Koleanolic acidbreast cancertamoxifenER
Journal Article2022-04-28No SnippetsIbadurrahman W, Hanif N, Hermawan A.
Show Full Abstract
<h4>Background</h4>Tamoxifen resistance in estrogen receptor positive (ER+) breast cancer therapy increases, which is the leading cause of cancer treatment failure, as it can impair patients' prognoses, cause cancer recurrence, metastasis, and death. Combination therapy with compounds is needed to overcome tamoxifen resistance. Oleanolic acid (OA) was known to increase tamoxifen sensitivity in tamoxifen-resistant breast cancer; however, the molecular mechanism of OA and its involvement in overcoming tamoxifen resistance remain unknown and need further investigation. This study was conducted to identify the potential gene targets and molecular mechanisms of OA in overcoming tamoxifen resistance.<h4>Results</h4>A bioinformatic approach for functional network analysis was used in silico by utilizing secondary data in the Gene Expression Omnibus (GEO) database and analyzing them with GEO2R to obtain data on differentially expressed genes (DEGs). The DEG data were further examined with Database for Annotation, Visualization, and Integrated Discovery (DAVID), STRING, cBioPortal website, and Cytoscape with its plugin CytoHubba. Molecular docking was performed to predict the binding properties of OA on the protein encoded by the potential gene. CD44, FGFR2, PIK3R1, and MDM2 were designated as potential target genes (PTGs), and PIK3R1 was suspected as the potential gene for OA to overcome tamoxifen resistance. Molecular docking confirms that OA can inhibit p85 activation. PIK3R1 is suggested to be the potential gene for OA in overcoming tamoxifen resistance in breast cancer therapy.<h4>Conclusion</h4>The predicted molecular mechanism of OA in overcoming tamoxifen resistance involves inhibiting p85 activation, leading to the inhibition of the downstream activity of the PI3K signaling pathway, causing breast cancer to respond to tamoxifen therapy once again. Results of this study need to be validated by further studies, including in vitro and in vivo.
Also flagged:AlbuminPD-L1programmed death ligand 1antibodiesblood circulationBSA
Journal Article2022-04-28No SnippetsGerke C, Zabala Gutierrez I, Méndez-González D, Cruz MCI, Mulero F, Jaque D, Rubio-Retama J.
Show Full Abstract
We present a simple methodology to design a pretargeted drug delivery system, based on clickable anti-programmed death ligand 1 (anti-PD-L1) antibodies (Abs) and clickable bovine serum albumin (BSA) nanoparticles (NPs). Pretargeted drug delivery is based on the decoupling of a targeting moiety and a drug-delivering vector which can then react in vivo after separate injections. This may be key to achieve active targeting of drug-delivering NPs toward cancerous tissue. In pretargeted approaches, drug-delivering NPs were observed to accumulate in a higher amount in the targeted tissue due to shielding-related enhanced blood circulation and size-related enhanced tissue penetration. In this work, BSA NPs were produced using the solvent precipitation methodology that renders colloidally stable NPs, which were subsequently functionalized with a clickable moiety based on chlorosydnone (Cl-Syd). Those reactive groups are able to specifically react with dibenzocyclooctyne (DBCO) groups in a click-type fashion, reaching second-order reaction rate constants as high as 1.9 M<sup>-1</sup>·s<sup>-1</sup>, which makes this reaction highly suitable for in vivo applications. The presence of reactive Cl-Syd was demonstrated by reacting the functionalized NPs with a DBCO-modified sulfo-cyanine-5 dye. With this reaction, it was possible to infer the number of reactive moieties per NPs. Finally, and with the aim of demonstrating the suitability of this system to be used in pretargeted strategies, functionalized fluorescent NPs were used to label H358 cells with a clickable anti-PD-L1 Ab, applying the reaction between Cl-Syd and DBCO as corresponding clickable groups. The results of these experiments demonstrate the bio-orthogonality of the system to perform the reaction in vitro, in a period as short as 15 min.
Also flagged:Protein Arginine Methyltransferase 4type I PRMTPRMT4argininemethylation-
Journal Article2022-04-28No SnippetsIannelli G, Milite C, Marechal N, Cura V, Bonnefond L, Troffer-Charlier N, Feoli A, Rescigno D, Wang Y, Cipriano A, Viviano M, Bedford MT, Cavarelli J, Castellano S, Sbardella G.
Show Full Abstract
Protein arginine methyltransferases (PRMTs) are important therapeutic targets, playing a crucial role in the regulation of many cellular processes and being linked to many diseases. Yet, there is still much to be understood regarding their functions and the biological pathways in which they are involved, as well as on the structural requirements that could drive the development of selective modulators of PRMT activity. Here we report a deconstruction-reconstruction approach that, starting from a series of type I PRMT inhibitors previously identified by us, allowed for the identification of potent and selective inhibitors of PRMT4, which regardless of the low cell permeability show an evident reduction of arginine methylation levels in MCF7 cells and a marked reduction of proliferation. We also report crystal structures with various PRMTs supporting the observed specificity and selectivity.
Journal Article2022-04-28✓ 1 SnippetModrzejewska-Zielonka E, Ren M, Młodak A, Marcinkowski JT, Zielonka D.
In-Text Gene Mentions
Abstract)
…mutation in theHTTgene.…
Show Full Abstract
Huntington's disease (HD) is a neurodegenerative, progressive disorder conditioned by a mutation in the HTT gene. Its progression is dependent on the causative mutation extension. Caregivers of individuals affected by HD, most often patients' relatives, are burdened with the care. This study aims to assess the caregivers' burden cross-sectionally and longitudinally and look for biological and clinical patients-related burdening factors. In total, 144 caregiver-patient pairs observed annually for up to 8 years were included in the study. In all of the patients, demographic data were collected, Unified Huntington&apos;s Disease Rating Scale (UHDRS) assessments were conducted, and disease burden (DB) was calculated when caregivers were assessed in Caregiver Burden Inventory (CBI). Caregivers' burden measured in CBI at the first visit reached 18.7 ± 18.4 scores. Longitudinal observation showed no evidence for any discrepancy between clinical progression measured in UHDRS, nor biological progression measured in DB and the caregivers' burden progression measured in CBI. Caregivers were burdened mostly by patients' dependence and a discrepancy between reality and life expectations. This study indicates factors to be addressed to reduce caregivers' burden. Strict relation between caregivers' burden and biological and clinical progression denies conception of overloaded with care tasks or adaptation to the burden.
Variations in the form of the human face, which plays a role in our individual identities and societal interactions, have fascinated scientists and artists alike. Here, we review our current understanding of the genetics underlying variation in craniofacial morphology and disease-associated dysmorphology, synthesizing decades of progress on Mendelian syndromes in addition to more recent results from genome-wide association studies of human facial shape and disease risk. We also discuss the various approaches used to phenotype and quantify facial shape, which are of particular importance due to the complex, multipartite nature of the craniofacial form. We close by discussing how experimental studies have contributed and will further contribute to our understanding of human genetic variation and then proposing future directions and applications for the field.
Also flagged:canceresophageal adenocarcinomaesophagusBarrettTP53esophageal cancer
Journal Article2022-04-28✓ 4 SnippetsPaulson TG, Galipeau PC, Oman KM, Sanchez CA, Kuhner MK, Smith LP, Hadi K, Shah M, Arora K, Shelton J, Johnson M, Corvelo A, Maley CC, Yao X, Sanghvi R, Venturini E, Emde AK, Hubert B, Imielinski M, Robine N, Reid BJ, Li X.
In-Text Gene Mentions
Results)
…, ERBB2 ,PCDH17, and GATA6…
Results)
…functional mutations inPCDH17( P =…
Results)
…functional mutation inPCDH17, and interactions…
Results)
…Mb gain andPCDH17) classified 38…
Show Full Abstract
While the genomes of normal tissues undergo dynamic changes over time, little is understood about the temporal-spatial dynamics of genomes in premalignant tissues that progress to cancer compared to those that remain cancer-free. Here we use whole genome sequencing to contrast genomic alterations in 427 longitudinal samples from 40 patients with stable Barrett's esophagus compared to 40 Barrett's patients who progressed to esophageal adenocarcinoma (ESAD). We show the same somatic mutational processes are active in Barrett's tissue regardless of outcome, with high levels of mutation, ESAD gene and focal chromosomal alterations, and similar mutational signatures. The critical distinction between stable Barrett's versus those who progress to cancer is acquisition and expansion of TP53-/- cell populations having complex structural variants and high-level amplifications, which are detectable up to six years prior to a cancer diagnosis. These findings reveal the timing of common somatic genome dynamics in stable Barrett's esophagus and define key genomic features specific to progression to esophageal adenocarcinoma, both of which are critical for cancer prevention and early detection strategies.
Also flagged:synthesismineralradiocarbonorganizationcollagenapatite
Journal Article2022-04-28No SnippetsPorpora F, Zaro V, Liccioli L, Modi A, Meoli A, Marradi G, Barone S, Vai S, Dei L, Caramelli D, Fedi M, Lari M, Carretti E.
Show Full Abstract
An innovative protocol for the consolidation of ancient bone remains based on the use of nanometric HydroxyAPatite (HAP) was set up and tested through a multidisciplinary approach. A new protocol for the synthesis of HAP nanoparticles was developed, and the composition of the obtained nanomaterial was investigated through Fourier Transform Infrared Spectroscopy (FTIR) and X-Ray Diffraction (XRD); sizes, shape and morphology of the synthesized particles were studied by Scanning Electron Microscopy (SEM). The consolidation performance was evaluated by testing the new nanomaterial on degraded ancient bone findings. An increase of the mineral density and of the micro-hardness of the bone were observed. The new consolidation method was also tested to assess possible effects on the palaeogenetic analysis and radiocarbon dating on the treated bones. The consolidation treatment does not introduce any contaminations that could affect radiocarbon dating and has no general detrimental impact on the genetic characterization of the skeletal remains. This consolidation procedure represents a more compatible conservation tool with respect to traditional procedures: it has been shown that the treatment is effective, easily-applicable and compatible with post-consolidation analysis.
Also flagged:bindinghistonechromatin-binding proteinschromosomeH1nucleosome
Journal Article2022-04-28✓ 1 SnippetLeicher R, Osunsade A, Chua GNL, Faulkner SC, Latham AP, Watters JW, Nguyen T, Beckwitt EC, Christodoulou-Rubalcava S, Young PG, Zhang B, David Y, Liu S.
In-Text Gene Mentions
Text
…linker histones…
Show Full Abstract
The H1 linker histone family is the most abundant group of eukaryotic chromatin-binding proteins. However, their contribution to chromosome structure and function remains incompletely understood. Here we use single-molecule fluorescence and force microscopy to directly visualize the behavior of H1 on various nucleic acid and nucleosome substrates. We observe that H1 coalesces around single-stranded DNA generated from tension-induced DNA duplex melting. Using a droplet fusion assay controlled by optical tweezers, we find that single-stranded nucleic acids mediate the formation of gel-like H1 droplets, whereas H1-double-stranded DNA and H1-nucleosome droplets are more liquid-like. Molecular dynamics simulations reveal that multivalent and transient engagement of H1 with unpaired DNA strands drives their enhanced phase separation. Using eGFP-tagged H1, we demonstrate that inducing single-stranded DNA accumulation in cells causes an increase in H1 puncta that are able to fuse. We further show that H1 and Replication Protein A occupy separate nuclear regions, but that H1 colocalizes with the replication factor Proliferating Cell Nuclear Antigen, particularly after DNA damage. Overall, our results provide a refined perspective on the diverse roles of H1 in genome organization and maintenance, and indicate its involvement at stalled replication forks.
Also flagged:N-glycosylationosteoarthritistype 2 diabetes mellitusobesityglycosylationpathogenesis
Journal Article2022-04-28No SnippetsLuo Y, Wu Z, Chen S, Luo H, Mo X, Wang Y, Tang J.
Show Full Abstract
Whether the relationship between type 2 diabetes mellitus (T2DM) and osteoarthritis (OA) can be solely attributed to the shared risk factors, such as obesity, remains controversial. Several studies have revealed the critical role of abnormal glycosylation in the pathogenesis of OA and T2DM. Therefore, we speculate that T2DM may contribute to the pathogenesis of OA through the intrinsic mechanisms of N-glycosylation aberrations. Using N-glycoproteomics, we compared the changes in N-glycosylated protein abundance in cartilage samples from patients with OA without and with T2DM (DM-OA), and from patients with traumatic joint injury (NC) as controls. We identified 847 N-glycosylation sites corresponding to 729 peptides fragments from 374 proteins. The number of N-glycosylated proteins in the DM-OA group tended to decrease compared with that in the OA and NC groups. We identified 22 upregulated and 1 down-regulated N-glycosylated peptides in the OA group compared to the NC group, while only fibronectin 1 (FN1) at position N1007, cartilage intermediate layer protein 1 (CILP) at N346, and collagen type VI alpha 1 chain (COL6A1) at N804, were also identified in the DM-OA group. Compared to the OA group, the downregulation of secreted protein acidic and rich in cysteine (SPARC) at N116, collagen type VI alpha 1 chain (COL6A2) at N785, and asporin (ASPN) at N282, and the upregulation of complement component C8 alpha chain (C8α) at N437, were the most remarkable alterations in the DM-OA group. The differentially expressed N-glycosylated proteins between the OA and DM-OA groups were mainly located extracellularly and enriched in the KEGG pathways involving PI3K/Akt signaling, focal adhesion, and ECM-receptor interaction. Their predicted protein-protein interactions were also depicted. We were thus able to show the general characteristics of N-glycosylation aberrations in OA and DM-OA. Moreover, the upregulated glycosylated complement C8α in the DM-OA group might augment membrane attack complex activity, thereby exacerbating cartilage destruction. Although further confirmation is required, our hypothesis proposes a possible explanation for the deduction that T2DM is an independent risk factor for OA.
<h4>Background</h4>Genetic progress for fertility and reproduction traits in dairy cattle has been limited due to the low heritability of most indicator traits. Moreover, most of the quantitative trait loci (QTL) and candidate genes associated with these traits remain unknown. In this study, we used 5.6 million imputed DNA sequence variants (single nucleotide polymorphisms, SNPs) for genome-wide association studies (GWAS) of 18 fertility and reproduction traits in Holstein cattle. Aiming to identify pleiotropic variants and increase detection power, multiple-trait analyses were performed using a method to efficiently combine the estimated SNP effects of single-trait GWAS based on a chi-square statistic.<h4>Results</h4>There were 87, 72, and 84 significant SNPs identified for heifer, cow, and sire traits, respectively, which showed a wide and distinct distribution across the genome, suggesting that they have relatively distinct polygenic nature. The biological functions of immune response and fatty acid metabolism were significantly enriched for the 184 and 124 positional candidate genes identified for heifer and cow traits, respectively. No known biological function was significantly enriched for the 147 positional candidate genes found for sire traits. The most important chromosomes that had three or more significant QTL identified are BTA22 and BTA23 for heifer traits, BTA8 and BTA17 for cow traits, and BTA4, BTA7, BTA17, BTA22, BTA25, and BTA28 for sire traits. Several novel and biologically important positional candidate genes were strongly suggested for heifer (SOD2, WTAP, DLEC1, PFKFB4, TRIM27, HECW1, DNAH17, and ADAM3A), cow (ANXA1, PCSK5, SPESP1, and JMJD1C), and sire (ELMO1, CFAP70, SOX30, DGCR8, SEPTIN14, PAPOLB, JMJD1C, and NELL2) traits.<h4>Conclusions</h4>These findings contribute to better understand the underlying biological mechanisms of fertility and reproduction traits measured in heifers, cows, and sires, which may contribute to improve genomic evaluation for these traits in dairy cattle.
Also flagged:colorectal cancercancersgene expressiontumorcancermethylation
Journal Article2022-04-28✓ 5 SnippetsWang R, Mao Y, Wang W, Zhou X, Wang W, Gao S, Li J, Wen L, Fu W, Tang F.
In-Text Gene Mentions
Results)
…On the other hand, organoid cells of patient #7 were initially cultured in a chemical-defined medium, and both tumor cells and normal epithelial cells showed similar expression levels of OLFM4 and CA2. After the organoid cells were transferred into conditioned medium, this expression pattern of OLFM4 and CA2 was still maintained (Fig. 5B).…
Results)
…For example, organoid cells of patient #4 were initially cultured in the conditioned medium and tumor cells highly expressed OLFM4 whereas the normal epithelial cells highly expressed CA2. After organoid cells were transferred to a chemical-defined medium, tumor cells, and normal epithelial cells still maintained this distinct expression patterns of OLFM4 and CA2 (Fig. 5A).…
Discussion)
…Next, by culturing the organoids in one medium for a period of time and then transferring them to another medium for further culturing, the expression of OLFM4 and CA2 in tumor tissue-derived organoid cells and normal tissue-derived organoid cells remained basically unchanged, indicating that the cultured medium that was initially used to derive the organoids plays a very critical role in the gene expression profiles of the organoids.…
Discussion)
…Similar to the corresponding epithelial cells in vivo, the tumor tissue-derived organoid cells in the conditioned medium showed high expression of stem/progenitor cell marker OLFM4 and low expression of differentiation marker CA2, while normal tissue-derived organoid cells showed low expression of OLFM4 and high expression of CA2. However, tumor tissue-derived organoid cells and normal tissue-derived organoid cells cultured in a chemical-defined medium have similar expression patterns of CA2 and OLFM4, which cannot accurately mimic the expression patterns of the corresponding cells in vivo.…
Results)
…In details, cancer cells in vivo and corresponding organoids cultured in a conditioned medium expressed higher levels of stem/progenitor cell maker gene OLFM4, while normal epithelial cells and corresponding organoids in a conditioned medium expressed higher levels of differentiation gene CA2. However, in a chemical-defined medium, tumor tissue-derived and normal tissue-derived organoid cells are mixed together, and there are no significant differences in the expression of CA2 and OLFM4, suggesting that chemical-defined medium favors stem cell-like features of normal epithelial cells whereas disfavors differentiation/mature features of them (Fig. 3C).…
Show Full Abstract
<h4>Background</h4>Patient-derived organoid culture is a powerful system for studying the molecular mechanisms of cancers, especially colorectal cancer (CRC), one of the most prevalent cancers worldwide. There are two main types of 3D culture methods for colonic cells, but the similarities and differences between gene expression patterns in different culture media remain largely unexplored.<h4>Results</h4>Here, we establish patient-derived organoids from colorectal cancer patients and perform single-cell RNA-Seq for pairwise samples from seven patients for both organoids and their corresponding tumor and normal tissues in vivo. We find that organoids derived from tumor tissues faithfully recapitulate the main gene expression signatures of cancer cells in vivo. On the other hand, organoids derived from normal tissues exhibited some tumor-like features at the whole transcriptome level but retained normal genomic features, such as CNVs, point mutations, and normal global DNA methylation levels, for both cultural media. More importantly, we show that conditioned medium outperforms chemical-defined medium in long-term culture of tumor epithelial cells. Finally, we mutually exchange the culture medium for the organoids and find that after interchanging the medium, the organoid cells basically maintain the transcriptome characteristics of the original medium.<h4>Conclusions</h4>Our work gives a thorough evaluation of both the cultural conditions and the biological features of organoids of CRC patients.
Also flagged:nucleotidenucleotidesC9orf72amyotrophic lateral sclerosisALSneurological disorders
Journal Article2022-04-28✓ 2 SnippetsFang L, Liu Q, Monteys AM, Gonzalez-Alegre P, Davidson BL, Wang K.
In-Text Gene Mentions
Methods)
…data of theHTTgene from Huntington…
Results)
…exon-1 of theHTTgene.…
Show Full Abstract
Despite recent improvements in basecalling accuracy, nanopore sequencing still has higher error rates on short-tandem repeats (STRs). Instead of using basecalled reads, we developed DeepRepeat which converts ionic current signals into red-green-blue channels, thus transforming the repeat detection problem into an image recognition problem. DeepRepeat identifies and accurately quantifies telomeric repeats in the CHM13 cell line and achieves higher accuracy in quantifying repeats in long STRs than competing methods. We also evaluate DeepRepeat on genome-wide or candidate region datasets from seven different sources. In summary, DeepRepeat enables accurate quantification of long STRs and complements existing methods relying on basecalled reads.
Also flagged:bronchopulmonary dysplasialung diseaseoxygenmethylationhypomethylationhematopoiesis
Journal Article2022-04-28No SnippetsWang X, Cho HY, Campbell MR, Panduri V, Coviello S, Caballero MT, Sambandan D, Kleeberger SR, Polack FP, Ofman G, Bell DA.
Show Full Abstract
<h4>Background</h4>Bronchopulmonary dysplasia (BPD) is a lung disease in premature infants caused by therapeutic oxygen supplemental and characterized by impaired pulmonary development which persists into later life. While advances in neonatal care have improved survival rates of premature infants, cases of BPD have been increasing with limited therapeutic options for prevention and treatment. This study was designed to explore the relationship between gestational age (GA), birth weight, and estimated blood cell-type composition in premature infants and to elucidate early epigenetic biomarkers associated with BPD.<h4>Methods</h4>Cord blood DNA from preterm neonates that went on to develop BPD (n = 14) or not (non-BPD, n = 93) was applied to Illumina 450 K methylation arrays. Blood cell-type compositions were estimated using DNA methylation profiles. Multivariable robust regression analysis elucidated CpGs associated with BPD risk. cDNA microarray analysis of cord blood RNA identified differentially expressed genes in neonates who later developed BPD.<h4>Results</h4>The development of BPD and the need for oxygen supplementation were strongly associated with GA (BPD, p < 1.0E-04; O<sub>2</sub> supplementation, p < 1.0E-09) and birth weight (BPD, p < 1.0E-02; O<sub>2</sub> supplementation, p < 1.0E-07). The estimated nucleated red blood cell (NRBC) percent was negatively associated with birth weight and GA, positively associated with hypomethylation of the tobacco smoke exposure biomarker cg05575921, and high-NRBC blood samples displayed a hypomethylation profile. Epigenome-wide association study (EWAS) identified 38 (Bonferroni) and 275 (false discovery rate 1%) differentially methylated CpGs associated with BPD. BPD-associated CpGs in cord blood were enriched for lung maturation and hematopoiesis pathways. Stochastic epigenetic mutation burden at birth was significantly elevated among those who developed BPD (adjusted p = 0.02). Transcriptome changes in cord blood cells reflected cell cycle, development, and pulmonary disorder events in BPD.<h4>Conclusions</h4>While results must be interpreted with caution because of the small size of this study, NRBC content strongly impacted DNA methylation profiles in preterm cord blood and EWAS analysis revealed potential insights into biological pathways involved in BPD pathogenesis.
Also flagged:Glycosphingolipid GlycansColorectal Cancerglycosylationglycosphingolipidcell surfacecarbohydrates
Journal Article2022-04-28✓ 5 SnippetsWang D, Wang D, Madunić K, Zhang T, Mayboroda OA, Lageveen-Kammeijer GSM, Wuhrer M.
In-Text Gene Mentions
Results)
…higher expression ofMLLT10, MSX1 ,…
Results)
…correlations with TFsMLLT10, MSX1 ,…
Results)
…, MYB ,MLLT10, SIX4 ,…
Results)
…but negatively withMLLT10, SIX4 ,…
Results)
…, MYB ,MLLT10, and MSX1…
Show Full Abstract
Colorectal cancer (CRC)-associated changes of protein glycosylation have been widely studied. In contrast, the expression of glycosphingolipid (GSL) patterns in CRC has, hitherto, remained largely unexplored. Even though GSLs are major carriers of cell surface carbohydrates, they are understudied due to their complexity and analytical challenges. In this study, we provide an in-depth analysis of GSL glycans of 22 CRC cell lines using porous graphitized carbon nano-liquid chromatography coupled with electrospray ionization-mass spectrometry. Our data revealed that the GSL expression varies among different cell line classifications, with undifferentiated cell lines showing high expression of blood group A, B, and H antigens while for colon-like cell lines the most prominent GSL glycans contained (sialyl)-Lewis<sup>A/X</sup> and Lewis<sup>B/Y</sup> antigens. Moreover, the GSL expression correlated with relevant glycosyltransferases that are involved in their biosynthesis as well as with transcription factors (TFs) implicated in colon differentiation. Additionally, correlations between certain glycosyltransferases and TFs at mRNA expression level were found, such as FUT3, which correlated with CDX1, ETS2, HNF1A, HNF4A, MECOM, and MYB. These TFs are upregulated in colon-like cell lines pointing to their potential role in regulating fucosylation during colon differentiation. In conclusion, our study reveals novel layers of potential GSL glycans regulation relevant for future research in colon differentiation and CRC.
<h4>Background & aims</h4>Fatty acid oxidation by absorptive enterocytes has been linked to the pathophysiology of type 2 diabetes, obesity, and dyslipidemia. Caco-2 and organoids have been used to study dietary lipid-handling processes including fatty acid oxidation, but are limited in physiological relevance or preclude simultaneous apical and basal access. Here, we developed a high-throughput planar human absorptive enterocyte monolayer system for investigating lipid handling, and then evaluated the role of fatty acid oxidation in fatty acid export, using etomoxir, C75, and the antidiabetic drug metformin.<h4>Methods</h4>Single-cell RNA-sequencing, transcriptomics, and lineage trajectory was performed on primary human jejunum. In vivo absorptive enterocyte maturational states informed conditions used to differentiate human intestinal stem cells (ISCs) that mimic in vivo absorptive enterocyte maturation. The system was scaled for high-throughput drug screening. Fatty acid oxidation was modulated pharmacologically and BODIPY (Thermo Fisher Scientific, Waltham, MA) (B)-labeled fatty acids were used to evaluate fatty acid handling via fluorescence and thin-layer chromatography.<h4>Results</h4>Single-cell RNA-sequencing shows increasing expression of lipid-handling genes as absorptive enterocytes mature. Culture conditions promote ISC differentiation into confluent absorptive enterocyte monolayers. Fatty acid-handling gene expression mimics in vivo maturational states. The fatty acid oxidation inhibitor etomoxir decreased apical-to-basolateral export of medium-chain B-C12 and long-chain B-C16 fatty acids, whereas the CPT1 agonist C75 and the antidiabetic drug metformin increased apical-to-basolateral export. Short-chain B-C5 was unaffected by fatty acid oxidation inhibition and diffused through absorptive enterocytes.<h4>Conclusions</h4>Primary human ISCs in culture undergo programmed maturation. Absorptive enterocyte monolayers show in vivo maturational states and lipid-handling gene expression profiles. Absorptive enterocytes create strong epithelial barriers in 96-Transwell format. Fatty acid export is proportional to fatty acid oxidation. Metformin enhances fatty acid oxidation and increases basolateral fatty acid export, supporting an intestine-specific role.
Also flagged:chromosomegene expressionX-chromosomeDosage compensationchromatindosage-compensation
Journal Article2022-04-28✓ 2 SnippetsMeyer BJ.
In-Text Gene Mentions
Text
…DCC…
Text
…Condensin…
Show Full Abstract
Abnormalities in chromosome dose can reduce organismal fitness and viability by disrupting the balance of gene expression. Unlike imbalances in chromosome dose that cause pathologies, differences in X-chromosome dose that determine sex are well tolerated. Dosage compensation mechanisms have evolved in diverse species to balance X-chromosome gene expression between sexes. Mechanisms underlying nematode X-chromosome counting to determine sex revealed how small quantitative differences in molecular signals are translated into dramatically different developmental fates. Mechanisms underlying X-chromosome dosage compensation revealed the interplay between chromatin modification and three-dimensional chromosome structure imposed by an X-specific condensin complex to regulate gene expression over vast chromosomal territories. In a surprising twist of evolution, this dosage-compensation condensin complex also regulates lifespan and tolerance to proteotoxic stress.
Also flagged:Dammarane-type triterpenoidsAMPKethanoltriterpenoidsbutanoladenosine monophosphate-activated protein kinase
Journal Article2022-04-28No SnippetsDinh TTT, Nguyen TT, Ngo HT, Tran TH, Le BV, Pham TH, Pham HTT, Pham TK, Do TH.
Show Full Abstract
Bioassay-guided fractionation of the 80% ethanol extract of Gynostemma compressum X. X. Chen & D. R. Liang (Cucurbitaceae) resulted in the isolation and identification of eight undescribed triterpenoids, gycomol VN1, gycomol VN2, and gycomosides VN1-6 from the bioactive n-butanol fraction. The structures of these compounds were elucidated by one- and two-dimensional nuclear magnetic resonance spectroscopy, high-resolution electrospray ionisation mass spectrometry, and chemical methods. All isolated compounds were evaluated for their 5'-adenosine monophosphate-activated protein kinase (AMPK) and acetyl-coenzyme A carboxylase (ACC) activation effects on 3T3-L1 cells. Importantly, gycomol VN2, gycomoside VN1, and gycomosides VN3-5 activated the phosphorylation of AMPK and its downstream substrate ACC in 3T3-L1 cells at a dose of 10 μM. These effects imply that the activation of AMPK and ACC by active compounds from G. compressum has considerable potential for the prevention of obesity and its related disorders by activating AMPK signaling pathways.
Also flagged:CCL18brain tumorchemokinestumorgene expressionglioma
Journal Article2022-04-28✓ 2 SnippetsGao W, Li Y, Zhang T, Lu J, Pan J, Qi Q, Dong S, Chen X, Su Z, Li J.
In-Text Gene Mentions
Results)
…The results showed that both CCLs and CXCLs expression levels were significantly associated with most checkpoint molecules, including TNFRSF14, LAIR1, TNFSF4, CD244, ICOS, CTLA4, CD48, CD28, CD200R1, HAVCR2, and CD80 in GBM (all p < 0.05, Figure 3C).…
<h4>Background</h4>Glioblastoma (GBM) is the most common and aggressive brain tumor in adults, in which chemokines are often upregulated and may play pivotal roles in their development and progression. Chemokines are a large subfamily of cytokines with leukocyte chemotactic activities involved in various tumor progression. However, gene expression patterns of the chemokines on a global scale were not known in GBM.<h4>Methods</h4>Differentially expressed chemokine genes in glioma and normal samples were screened by using The Cancer Genome Atlas (TCGA) database. Cox regression identified the prognosis-related genes in each glioma subtype. The protein expression levels of chemokines in 72 glioma tissues were detected by ELISA.<h4>Results</h4>We found that the transcripts of seven chemokines, including CCL2, CCL8, CCL18, CCL28, CXCL1, CXCL5, and CXCL13, were highly expressed in GBM that evidenced by involving immune cell infiltration regulation and accompanied with worse outcomes of GBM patients. The prognostic nomogram construction demonstrated that CCL18 held the highest risk score in patients with GBM. Furthermore, experiments on 72 glioma tissue samples confirmed that CCL18 protein expression was positively associated with tumor grade and IDH1 status but inversely with glioma patients' overall survival (OS).<h4>Conclusion</h4>Our study reveals comprehensive and comparable roles of chemokine members in glioblastoma, and identified CCL18 as a critical driver of GBM malignant behaviors, therefore providing a potential target for developing prognosis and therapy in human glioblastoma.
Also flagged:gene expressionporeEGFNogginR-SpondinEthanol
Journal Article2022-04-28✓ 1 SnippetBaghdadi MB, Kim TH.
In-Text Gene Mentions
Results)
…( Lgr5 ,Olfm4) ( Figure…
Show Full Abstract
This protocol describes the isolation and culture of 3D intestinal crypt organoids with stromal niche cells. We show a murine organoid culture system that utilizes conditioned media isolated from primary, mucosal enteric glial cell culture. We describe three assays of analyzing this organoid culture: flow cytometry, gene expression, and organoid morphology analyses. This protocol can also be used to study the mechanisms of stem cell interaction with other stromal niche cell types such as mesenchymal cells and innate immune cells. For complete details on the use and execution of this protocol, please refer to Baghdadi et al. (2021).
Also flagged:Tumorbreast cancerLRRC48CFAP69BRCAcancer
Journal Article2022-04-28No SnippetsTian Y, Wang J, Wen Q, Gao A, Huang A, Li R, Zhang Y, Su G, Sun Y.
Show Full Abstract
<h4>Purpose</h4>This study was designed to clarify the prognostic value of tumor microenvironment score and abnormal genomic alterations in TME for breast cancer patients.<h4>Method</h4>The TCGA-BRCA data were downloaded from TCGA and analyzed with R software. The results from analyses were further validated using the dataset from GSE96058, GSE124647, and GSE25066.<h4>Results</h4>After analyzing the TCGA data and verifying it with the GEO data, we developed a TMEscore model based on the TME infiltration pattern and validated it in 3273 breast cancer patients. The results suggested that our TMEscore model has high prognostic value. TME features with the TMEscore model can help to predict breast cancer patients' response to immunotherapy and provide new strategies for breast cancer treatment. Signature 24 was first found in breast cancer. In focal SCNAs, a total of 95 amplified genes and 169 deletion genes in the TMEscore high group were found to be significantly related to the prognosis of breast cancer patients, while 61 amplified genes and 174 deletion genes in the TMEscore low group were identified. LRRC48, CFAP69, and cg25726128 were first discovered and reported to be related to the survival of breast cancer patients. We identified specific mutation signatures that correlate with TMEscore and prognosis.<h4>Conclusion</h4>TMEscore model has high predictive value regarding prognosis and patients' response to immunotherapy. Signature 24 was first found in breast cancer. Specific mutation signatures that correlate with TMEscore and prognosis might be used for providing additional indicators for disease evaluation.
Currently, aquatic and terrestrial ecosystems are continuously and chronically polluted by cocktails of countless chemical compounds. The susceptibility to infections is tremendously increasing in a variety of organisms due to exposure to environmental pollutants. Pendimethalin, an herbicide, is continuously used in agriculture to remove unwanted broadleaf weeds across the globe. Therefore, this study investigates the mechanisms of toxicity of pendimethalin in freshwater fish bighead carp upon exposure to low and environmentally relevant concentrations. For this purpose, 48 fish without any clinical abnormalities were kept in a glass aquarium in different experimental groups (T0, T1, T2, and T3). These groups were treated with pendimethalin at 0.00, 0.25, 0.50, and 0.75 mg/L, respectively. Four fish were randomly picked from each experimental group and killed at 72, 96, and 120 hours of the trial to study hematobiochemical parameters and visceral tissues including the brain, liver, heart, gills, and kidneys for histopathology. Herbicide-treated fish indicated various physical and behavioral abnormalities including hypersecretion of mucus, erratic swimming, operculum movement, air gulping, tremors of fins, loss of equilibrium, and increased surface breathing. Histopathologically, gills tissues of treated fish indicated atrophied lamellae, uplifting of secondary lamellae, necrosis of primary and secondary lamellar epithelial cells, telogenesis, congestion, and lamellar fusion. Histopathological examination of liver tissues of treated fish showed mild to moderate congestion, necrosis of hepatocytes, and atrophy of hepatocytes while kidneys revealed degeneration of renal tubules, glomerular atrophy, ceroid, and necrosis of renal tubules. The erythrocyte counts, monocyte and lymphocyte counts, and hemoglobin values were significantly (<i>P</i> < 0.05) reduced in pendimethalin-treated fish. Results on serum biochemistry showed that the biomarkers of kidneys, heart, and liver were significantly higher in fish of treated groups. In addition, values of different biochemical reactions like reactive oxygen species (ROS), thiobarbituric acid reactive species (TBARS), total proteins, and quantity of different antioxidant enzymes including reduced glutathione (GSH), catalase, and superoxide dismutase (SOD) were significantly different when compared to untreated fish. Moreover, the percentile of different nuclear abnormalities in red blood cells and frequency of DNA damage increased significantly in treated fish. It can be concluded from the findings that pendimethalin causes its toxic effects via disruption of physiological and hematobiochemical reactions of fish.
Also flagged:PathogenesisLiver Fibrosiscirrhosishepatocellular carcinomaliver diseasecollagen
Journal Article2022-04-28✓ 1 SnippetNan Y, Su H, Lian X, Wu J, Liu S, Chen P, Liu S.
In-Text Gene Mentions
Abstract)
…diseases such ashemochromatosis.…
Show Full Abstract
Liver fibrosis is a pathological process of abnormal tissue proliferation in the liver caused by various pathogenic factors, which will further develop into cirrhosis or even hepatocellular carcinoma if liver injury is not intervened in time. As a diffuse progressive liver disease, its clinical manifestations are mostly excessive deposition of collagen-rich extracellular matrix resulting in scar formation due to liver injury. Hepatic fibrosis can be caused by hepatitis B and C, fatty liver, alcohol, and rare diseases such as hemochromatosis. As the metabolic center of the body, the liver regulates various vital activities. During the development of fibrosis, it is influenced by many other factors in addition to the central event of hepatic stellate cell activation. Currently, with the increasing understanding of TCM, the advantages of TCM with multiple components, pathways, and targets have been demonstrated. In this review, we will describe the factors influencing liver fibrosis, focusing on the effects of cells, intestinal flora, iron death, signaling pathways, autophagy and angiogenesis on liver fibrosis, and the therapeutic effects of herbal medicine on liver fibrosis.
Also flagged:neuropsychiatric disorderschizophrenialipidmetabolismcoagulationimmune response
Journal Article2022-04-28✓ 1 SnippetRodrigues JE, Martinho A, Santa C, Madeira N, Coroa M, Santos V, Martins MJ, Pato CN, Macedo A, Manadas B.
In-Text Gene Mentions
Discussion)
…, 81 ],antithrombin-III, ANT3 [ 67…
Show Full Abstract
Mass spectrometry (MS)-based techniques can be a powerful tool to identify neuropsychiatric disorder biomarkers, improving prediction and diagnosis ability. Here, we evaluate the efficacy of MS proteomics applied to human peripheral fluids of schizophrenia (SCZ) patients to identify disease biomarkers and relevant networks of biological pathways. Following PRISMA guidelines, a search was performed for studies that used MS proteomics approaches to identify proteomic differences between SCZ patients and healthy control groups (PROSPERO database: CRD42021274183). Nineteen articles fulfilled the inclusion criteria, allowing the identification of 217 differentially expressed proteins. Gene ontology analysis identified lipid metabolism, complement and coagulation cascades, and immune response as the main enriched biological pathways. Meta-analysis results suggest the upregulation of FCN3 and downregulation of APO1, APOA2, APOC1, and APOC3 in SCZ patients. Despite the proven ability of MS proteomics to characterize SCZ, several confounding factors contribute to the heterogeneity of the findings. In the future, we encourage the scientific community to perform studies with more extensive sampling and validation cohorts, integrating omics with bioinformatics tools to provide additional comprehension of differentially expressed proteins. The produced information could harbor potential proteomic biomarkers of SCZ, contributing to individualized prognosis and stratification strategies, besides aiding in the differential diagnosis.
Also flagged:Serotonin TransporterbehavioralserotoninSLC6A4synaptic cleftsthymine
Journal Article2022-04-28✓ 1 SnippetBonassi A, Cataldo I, Gabrieli G, Tandiono M, Foo JN, Lepri B, Esposito G.
In-Text Gene Mentions
Methods)
…dependent variable, the 5-HTTgene genotype rs25531…
Show Full Abstract
Human social interactions ensure recognition and approval from others, both in offline and online environments. This study applies a model from behavioral genetics on Instagram sociability to explore the impact of individual development on behavior on social networks. We hypothesize that sociable attitudes on Instagram resulted from an interaction between serotonin transporter gene alleles and the individual's social relationship with caregivers. We assess the environmental and genetic components of 57 Instagram users. The self-report questionnaire <i>Parental Bonding Instrument</i> is adopted to determine the quality of parental bonding. The number of posts, followed users ("followings"), and followers are collected from Instagram as measures of online social activity. Additionally, the ratio between the number of followers and followings ("Social Desirability Index") was calculated to estimate the asymmetry of each user's social network. Finally, buccal mucosa cell samples were acquired, and the polymorphism rs25531 (T/T homozygotes vs. C-carriers) within the serotonin transporter gene was examined. In the preliminary analysis, we identified a gender effect on the number of followings. In addition, we specifically found a gene-environment interaction on the standardized Instagram "Social Desirability Index" in line with our predictions. Users with the genotype more sensitive to environmental influences (T/T homozygotes) showed a higher Instagram "Social Desirability Index" than nonsensitive ones (C-carriers) when they experienced positive maternal care. This result may contribute to understanding online social behavior from a gene*environment perspective.
Also flagged:Epidermal Growth Factor ReceptorTyrosine KinaseEGFRNon-Small Cell Lung CancererdafitinibFGFR
Journal Article2022-04-28✓ 5 SnippetsRaphael A, Dudnik E, Hershkovitz D, Jain S, Olsen S, Soussan-Gutman L, Ben-Shitrit T, Dvir A, Nechushtan H, Peled N, Onn A, Agbarya A, On Behalf Of The Israel Lung Cancer Group.
In-Text Gene Mentions
I A O 0000606)
…ADC—adenocarcinoma; ALK—anaplastic lymphoma kinase; ALT—alanine transaminase; (a) NSCLC—(advanced) non-small lung cancer; BAM—binary alignment map; BICC1—Bicaudal C homolog 1; BRAF—v-raf murine sarcoma viral oncogene homolog B1; BZ—Bnei-Zion; CAP—college of American pathologists; CCDC6—coiled-coil domain-containing protein 6; CCND1—cyclin D1; CDK4—cyclin-dependent kinase 4; CLIA—Clinical Laboratory Improvement Amendments; cMET—tyrosine-protein kinase Met; (ct)DNA—(circulating tumor) deoxyribonucleic acid; CT—computer tomography; DCC—Davidoff Cancer Center; (dd) PCR—(droplet digital) polymerase chain reaction; ED—electronic database; EGFR—epidermal growth factor receptor; EML4—echinoderm microtubule-associated protein-like 4; F—female; FDG—fluorodeoxyglucose; (FDG)-PET/CT—fluorodeoxyglucose positron emission tomography/computer tomography; FFPE—formalin-fixed paraffin-embedded; FGFR—fibroblast growth factor receptor; GH—Guardant Health; IASLC—International Association for the Study of Lung Cancer; indels—insertions and deletions; KRAS—Kirsten rat sarcoma viral oncogene homolog; M—male; MAF—mutant allele frequency; mo—months; MYC—Myelocytomatosis viral oncogene homolog; NGS—next generation sequencing; NOS—non-small cell lung cancer non otherwise specified carcinoma; PFS—progression-free survival; PIK3CA—phosphatidylinositol-4,5-bisphosphate 3-kinase; pts—patients; RET—rearranged during transfection; RNA—ribonucleic acid; RT—reverse transcription; RTK—receptor tyrosine kinase; SHTN1/KIAA1598—shootin-1; SLC45A3—solute carrier family 45 member 3; SNV—single-nucleotide variants; SCC—squamous cellcarcinoma; TACC2/3—transforming acidic coiled-coil containing protein; TASMC—Tel-Aviv Sourasky medical center; TKI—tyrosine kinase inhibitor; TP53—tumor protein P53; (US) FDA—(United States) Food and Drug Administration Agency; WHSC1—Wolf-Hirschhorn syndrome candidate gene-1.…
Abstract)
…Of three patients from DCC and BZ with FGFR3-TACC3 fusions following progression on EGFR TKIs, two received EGFR TKI plus erdafitinib, an FGFR TKI, with clinical benefit duration of 13.0 and 6.0 months, respectively.…
Abstract)
…Patients with EGFR mutant aNSCLC progressing on EGFR TKIs and developing an FGFR1/2/3 fusion were selected from the ED of Davidoff Cancer Center (DCC) and Oncology Department, Bnei-Zion hospital (BZ) (April 2014–April 2021).…
Methods)
…Patients with an EGFR mutant aNSCLC progressing on EGFR TKIs and developing an FGFR1/2/3 fusion (detected either in the ctDNA or in the tumor tissue specimen) were selected from the ED of Davidoff Cancer Center (DCC) and the Oncology Department of Bnei-Zion hospital (BZ) (April 2014–April 2021, n = 3).…
Results)
…the ED ofDCCand BZ.…
Show Full Abstract
<h4>Background</h4><i>FGFR1/2/3</i> fusions have been reported infrequently in aNSCLC, including as a rare, acquired resistance mechanism following treatment with EGFR TKIs. Data regarding their prevalence and therapeutic implications are limited.<h4>Methods</h4>The Guardant Health (GH) electronic database (ED) was evaluated for cases of aNSCLC and <i>FGFR2/3</i> fusions; <i>FGFR2/3</i> fusion prevalence with and without a co-existing <i>EGFR</i> mutation was assessed. The ED of Tel-Aviv Sourasky Medical Center (TASMC, June 2020-June 2021) was evaluated for cases of aNSCLC and de novo <i>FGFR1/2/3</i> fusions. Patients with <i>EGFR</i> mutant aNSCLC progressing on EGFR TKIs and developing an <i>FGFR1/2/3</i> fusion were selected from the ED of Davidoff Cancer Center (DCC) and Oncology Department, Bnei-Zion hospital (BZ) (April 2014-April 2021). Clinicopathological characteristics, systemic therapies, and outcomes were assessed.<h4>Results</h4>In the GH ED (<i>n</i> = 57,445), the prevalence of <i>FGFR2</i> and <i>FGFR3</i> fusions were 0.02% and 0.26%, respectively. <i>FGFR3-TACC3</i> fusion predominated (91.5%). In 23.8% of cases, <i>FGFR2/3</i> fusions co-existed with <i>EGFR</i> sensitizing mutations (exon 19 del, 64.1%; L858R, 33.3%, L861Q, 2.6%). Among samples with concurrent <i>FGFR</i> fusions and <i>EGFR</i> sensitizing mutations, 41.0% also included <i>EGFR</i> resistant mutations. In TASMC (<i>n</i> = 161), 1 case of de novo <i>FGFR3-TACC3</i> fusion was detected (prevalence, 0.62%). Of three patients from DCC and BZ with <i>FGFR3-TACC3</i> fusions following progression on EGFR TKIs, two received EGFR TKI plus erdafitinib, an FGFR TKI, with clinical benefit duration of 13.0 and 6.0 months, respectively.<h4>Conclusions</h4>Over 23% of <i>FGFR2/3</i> fusions in aNSCLC may be associated with acquired resistance following treatment with EGFR TKIs. In this clinical scenario, a combination of EGFR TKIs and FGFR TKIs represents a promising treatment strategy.
Also flagged:Neurodegenerative Diseasespathogenesisamyloid proteinsα-synucleinepigallocatechin-3-gallatefibrils
Journal Article2022-04-28✓ 5 SnippetsWang C, Zheng C.
In-Text Gene Mentions
Introduction)
…In addition to promoting α-synuclein neurotoxicity in PD, curli also promoted the toxicity of Aβ, SOD1, and Htt-polyQ in C. elegans models of AD, ALS, and HD, respectively, likely through similar cross-seeding mechanisms (Wang C. et al., 2021).…
Introduction)
…The expression of Htt-Q150 led to weak neurotoxicity in ASH neurons, but the loss of a glutamine/proline-rich protein PQE-1 significantly enhanced polyQ repeats-induced neurodegeneration (Faber et al., 2002).…
Introduction)
…For HD, which is caused by the polyglutamine (polyQ) expansion in the human huntingtin protein (Htt), Htt fused with polyQ repeats of different lengths were expressed in the ASH sensory neurons, which mediate avoidance behaviors to chemo- and mechanosensory stimuli.…
Introduction)
…human huntingtin protein (Htt), Htt fused with…
Introduction)
…huntingtin protein (Htt),Httfused with polyQ…
Show Full Abstract
Emerging evidence from both clinical studies and animal models indicates the importance of the interaction between the gut microbiome and the brain in the pathogenesis of neurodegenerative diseases (NDs). Although how microbes modulate neurodegeneration is still mostly unclear, recent studies have started to probe into the mechanisms for the communication between microbes and hosts in NDs. In this review, we highlight the advantages of using <i>Caenorhabditis elegans</i> (C. elegans) to disentangle the microbe-host interaction that regulates neurodegeneration. We summarize the microbial pro- and anti-neurodegenerative factors identified using the <i>C. elegans</i> ND models and the effects of many are confirmed in mouse models. Specifically, we focused on the role of bacterial amyloid proteins, such as curli, in promoting proteotoxicity and neurodegeneration by cross-seeding the aggregation of endogenous ND-related proteins, such as α-synuclein. Targeting bacterial amyloid production may serve as a novel therapeutic strategy for treating NDs, and several compounds, such as epigallocatechin-3-gallate (EGCG), were shown to suppress neurodegeneration at least partly by inhibiting curli production. Because bacterial amyloid fibrils contribute to biofilm formation, inhibition of amyloid production often leads to the disruption of biofilms. Interestingly, from a list of 59 compounds that showed neuroprotective effects in <i>C. elegans</i> and mouse ND models, we found that about half of them are known to inhibit bacterial growth or biofilm formation, suggesting a strong correlation between the neuroprotective and antibiofilm activities. Whether these potential therapeutics indeed protect neurons from proteotoxicity by inhibiting the cross-seeding between bacterial and human amyloid proteins awaits further investigations. Finally, we propose to screen the long list of antibiofilm agents, both FDA-approved drugs and novel compounds, for their neuroprotective effects and develop new pharmaceuticals that target the gut microbiome for the treatment of NDs. To this end, the <i>C. elegans</i> ND models can serve as a platform for fast, high-throughput, and low-cost drug screens that target the microbe-host interaction in NDs.
Also flagged:Hepatocellular carcinomatumorCD8PDL1immune responsescancer
Journal Article2022-04-28✓ 3 SnippetsLi X, Zhang Z, Liu M, Fu X, A J, Chen G, Wu S, Dong JT.
In-Text Gene Mentions
Results)
…, HLA-DMB ,TNFSF4, HLA-DQA1 ,…
Results)
…CXCL20 , andTNFSF4(R S >…
Discussion)
…CXCL20 , andTNFSF4( Figure 7C…
Show Full Abstract
Hepatocellular carcinoma (HCC) is a common malignancy with higher mortality, and means are urgently needed to improve the prognosis. T cell exclusion (TCE) plays a pivotal role in immune evasion, and lncRNAs represent a large group of tumor development and progression modulators. Using the TCGA HCC dataset (n=374), we identified 2752 differentially expressed and 702 TCE-associated lncRNAs, of which 336 were in both groups. As identified using the univariate Cox regression analysis, those associated with overall survival (OS) were subjected to the LASSO-COX regression analysis to develop a prognosis signature. The model, which consisted of 11 lncRNAs and was named 11LNCPS for 11-lncRNA prognosis signature, was validated and performed better than two previous models. In addition to OS and TCE, higher 11LNCPS scores had a significant correlation with reduced infiltrations of CD8+ T cells and dendritic cells (DCs) and decreased infiltrations of Th1, Th2, and pro B cells. As expected, these infiltration alterations were significantly associated with worse OS in HCC. Analysis of published data indicates that HCCs with higher 11LNCPS scores were transcriptomically similar to those that responded better to PDL1 inhibitor. Of the 11LNCPS lncRNAs, <i>LINC01134</i> and <i>AC116025.2</i> seem more crucial, as their upregulations affected more immune cell types' infiltrations and were significantly associated with TCE, worse OS, and compromised immune responses in HCC. LncRNAs in the 11LNCPS impacted many cancer-associated biological processes and signaling pathways, particularly those involved in immune function and metabolism. The 11LNCPS should be useful for predicting prognosis and immune responses in HCC.
Also flagged:Autophagydegradationcytoplasmicorganelleslysosomeinfection
Journal Article2022-04-28No SnippetsLiu Y, Zhou T, Hu J, Jin S, Wu J, Guan X, Wu Y, Cui J.
Show Full Abstract
Autophagy is an evolutionarily conserved lysosomal degradation system which can recycle multiple cytoplasmic components under both physiological and stressful conditions. Autophagy could be highly selective to deliver different cargoes or substrates, including protein aggregates, pathogenic proteins or superfluous organelles to lysosome using a series of cargo receptor proteins. During viral invasion, cargo receptors selectively target pathogenic components to autolysosome to defense against infection. However, viruses not only evolve different strategies to counteract and escape selective autophagy, but also utilize selective autophagy to restrict antiviral responses to expedite viral replication. Furthermore, several viruses could activate certain forms of selective autophagy, including mitophagy, lipophagy, aggrephagy, and ferritinophagy, for more effective infection and replication. The complicated relationship between selective autophagy and viral infection indicates that selective autophagy may provide potential therapeutic targets for human infectious diseases. In this review, we will summarize the recent progress on the interplay between selective autophagy and host antiviral defense, aiming to arouse the importance of modulating selective autophagy as future therapies toward viral infectious diseases.
Precise wiring of neural circuits is essential for brain connectivity and function. During development, axons respond to diverse cues present in the extracellular matrix or at the surface of other cells to navigate to specific targets, where they establish precise connections with post-synaptic partners. Cell adhesion molecules (CAMs) represent a large group of structurally diverse proteins well known to mediate adhesion for neural circuit assembly. Through their adhesive properties, CAMs act as major regulators of axon navigation, fasciculation, and synapse formation. While the adhesive functions of CAMs have been known for decades, more recent studies have unraveled essential, non-adhesive functions as well. CAMs notably act as guidance cues and modulate guidance signaling pathways for axon pathfinding, initiate contact-mediated repulsion for spatial organization of axonal arbors, and refine neuronal projections during circuit maturation. In this review, we summarize the classical adhesive functions of CAMs in axonal development and further discuss the increasing number of other non-adhesive functions CAMs play in neural circuit assembly.
Also flagged:AutophagyHomeostasisAmyotrophic Lateral Sclerosisfrontotemporal dementianeurodegenerative disorderspathogenesis
Journal Article2022-04-28✓ 1 SnippetHoughton OH, Mizielinska S, Gomez-Suaga P.
In-Text Gene Mentions
Discussion)
…Indeed, SIDT2 was found to interact with expanded CAG repeats in exon1 of the HTT transcript, which code for polyglutamine-expanded proteins, linked to Huntington’s disease.…
Show Full Abstract
Amyotrophic lateral sclerosis and frontotemporal dementia are neurodegenerative disorders that lie on a disease spectrum, sharing genetic causes and pathology, and both without effective therapeutics. Two pathways that have been shown to play major roles in disease pathogenesis are autophagy and RNA homeostasis. Intriguingly, there is an increasing body of evidence suggesting a critical interplay between these pathways. Autophagy is a multi-stage process for bulk and selective clearance of malfunctional cellular components, with many layers of regulation. Although the majority of autophagy research focuses on protein degradation, it can also mediate RNA catabolism. ALS/FTD-associated proteins are involved in many stages of autophagy and autophagy-mediated RNA degradation, particularly converging on the clearance of persistent pathological stress granules. In this review, we will summarise the progress in understanding the autophagy-RNA homeostasis interplay and how that knowledge contributes to our understanding of the pathobiology of ALS/FTD.
Also flagged:Metabolismmyelinationneurotransmitter surface receptorsdendritic spinemyelinbehavioral disorders
Journal Article2022-04-28No SnippetsNarine M, Colognato H.
Show Full Abstract
Once believed to be part of the <i>nervenkitt</i> or "nerve glue" network in the central nervous system (CNS), oligodendroglial cells now have established roles in key neurological functions such as myelination, neuroprotection, and motor learning. More recently, oligodendroglia has become the subject of intense investigations aimed at understanding the contributions of its energetics to CNS physiology and pathology. In this review, we discuss the current understanding of oligodendroglial metabolism in regulating key stages of oligodendroglial development and health, its role in providing energy to neighboring cells such as neurons, as well as how alterations in oligodendroglial bioenergetics contribute to disease states. Importantly, we highlight how certain inputs can regulate oligodendroglial metabolism, including extrinsic and intrinsic mediators of cellular signaling, pharmacological compounds, and even dietary interventions. Lastly, we discuss emerging studies aimed at discovering the therapeutic potential of targeting components within oligodendroglial bioenergetic pathways.
Also flagged:Diterpene Alkaloids810epiagelasine Bagelasine Bsynthesis
Journal Article2022-04-28No SnippetsPech-Puch D, Forero AM, Fuentes-Monteverde JC, Lasarte-Monterrubio C, Martinez-Guitian M, González-Salas C, Guillén-Hernández S, Villegas-Hernández H, Beceiro A, Griesinger C, Rodríguez J, Jiménez C.
Show Full Abstract
Three new diterpene alkaloids, (+)-8-epiagelasine T (<b>1</b>), (+)-10-epiagelasine B (<b>2</b>), and (+)-12-hydroxyagelasidine C (<b>3</b>), along with three known compounds, (+)-<i>ent</i>-agelasine F (<b>4</b>), (+)-agelasine B (<b>5</b>), and (+)-agelasidine C (<b>6</b>), were isolated from the sponge <i>Agelas citrina</i>, collected on the coasts of the Yucatán Peninsula (Mexico). Their chemical structures were elucidated by 1D and 2D NMR spectroscopy, HRESIMS techniques, and a comparison with literature data. Although the synthesis of (+)-<i>ent</i>-agelasine F (<b>4</b>) has been previously reported, this is the first time that it was isolated as a natural product. The evaluation of the antimicrobial activity against the Gram-positive pathogens <i>Staphylococcus aureus</i>, <i>Streptococcus pneumoniae</i>, <i>Enterococcus faecalis</i> showed that all of them were active, with (+)-10-epiagelasine B (<b>2</b>) being the most active compound with an MIC in the range of 1-8 µg/mL. On the other hand, the Gram-negative pathogenes <i>Acinetobacter baumannii</i>, <i>Pseudomonas aeruginosa</i>, and <i>Klebsiella pneumoniae</i> were also evaluated, and only (+)-agelasine B (<b>5</b>) showed a moderate antibacterial activity with a MIC value of 16 μg/mL.
Also flagged:Ironagingsystemic disordershereditary hemochromatosisarthritiscirrhosis
Journal Article2022-04-28✓ 1 SnippetChen WJ, Kung GP, Gnana-Prakasam JP.
In-Text Gene Mentions
S I O 001029)
…Mutation in any of the genes involved in iron homeostasis, namely HFE (High Fe), hemojuvelin, hepcidin, ferroportin, or transferrin receptor, leads to a genetic disorder called hereditary hemochromatosis (HH) [25].…
Show Full Abstract
Iron progressively accumulates with age and can be further exacerbated by dietary iron intake, genetic factors, and repeated blood transfusions. While iron plays a vital role in various physiological processes within the human body, its accumulation contributes to cellular aging in several species. In its free form, iron can initiate the formation of free radicals at a cellular level and contribute to systemic disorders. This is most evident in high iron conditions such as hereditary hemochromatosis, when accumulation of iron contributes to the development of arthritis, cirrhosis, or cardiomyopathy. A growing body of research has further identified iron's contributory effects in neurodegenerative diseases, ocular disorders, cancer, diabetes, endocrine dysfunction, and cardiovascular diseases. Reducing iron levels by repeated phlebotomy, iron chelation, and dietary restriction are the common therapeutic considerations to prevent iron toxicity. Chelators such as deferoxamine, deferiprone, and deferasirox have become the standard of care in managing iron overload conditions with other potential applications in cancer and cardiotoxicity. In certain animal models, drugs with iron chelating ability have been found to promote health and even extend lifespan. As we further explore the role of iron in the aging process, iron chelators will likely play an increasingly important role in our health.
Also flagged:OsteoporosisteriparatidepeptidesInsulin Like Growth Factor 1IGF-Iskeletal disorder
Journal Article2022-04-28✓ 1 SnippetDel Real A, Ciordia S, Sañudo C, Garcia-Ibarbia C, Roa-Bautista A, Ocejo-Viñals JG, Corrales F, Riancho JA.
In-Text Gene Mentions
Results)
…FN1, F2, C3,SERPINC1, and ITIH2 (…
Show Full Abstract
The aim of the study was to explore new markers in serum proteome associated with the response to antiosteoporosis drugs, namely teriparatide and denosumab. We obtained serum samples from 14 patients with osteoporosis, both at baseline and after 6 months of treatment with teriparatide (n = 10) or denosumab (n = 4). Samples were analyzed by nanoliquid chromatography coupled to high-resolution mass spectrometry on a QTOF 5600 (SCIEX) apparatus. The spectrometry data were analyzed with Mascot against the UniProtKB base and then several quality-control filters were applied for the identification of peptides (false discovery rate, FDR q < 0.02) and their quantification (FDR q < 0.05). In the group treated with teriparatide, 28 proteins were identified with significant differences before and after treatment. A pathway analysis by using the Reactome database revealed significant enrichment in the Insulin Like Growth Factor 1 (IGF-I) (FDR q 4 × 10−2) and innate immune system (FDR q 2 × 10−3) pathways. Among patients treated with denosumab, we observed significant differences in the levels of 10 proteins, which were also enriched in the pathways related to the innate immune system (FDR q 3 × 10−2). These results suggest that the innate immune system may be involved in the response to antiosteoporosis drugs.
bioRxiv2022-04-28Preprint (No Snippets API)Korniotis S, Saichi M, Trichot C, Hoffmann C, Amblard E, Viguier A, Grondin S, Noel F, Mattoo H, Soumelis V.
Show Full Abstract
T follicular helper (Tfh) cells are specialized CD4 + T cells that regulate humoral immunity by providing B cell help. Tfh1 sub-population was recently identified and associated with severity in infection and autoimmune diseases. The cellular and molecular requirements to induce human Tfh1 differentiation are unknown. Our work investigated the role of human dendritic cells (DC) in promoting Tfh1 differentiation and their physiopathological implication in mycobacterium tuberculosis and mild COVID-19 infection. Activated human blood CD1c + DC were cocultured with allogeneic naive CD4 + T cells. Single-cell RNA sequencing was then used alongside protein validation to define the induced Tfh lineage. DC signature and correlation with Tfh1 cells in infected patients was established through bioinformatic analysis. Our results show that GM-CSF-activated DC drove the differentiation of Tfh1 cells, displaying typical Tfh molecular features, including 1) high levels of PD-1, CXCR5, and ICOS expression; 2) BCL6 and TBET co-expression; 3) IL-21 and IFN-γ secretion. Mechanistically, GM-CSF triggered the emergence of two distinct DC sub-populations defined by their differential expression of CD40 and ICOS-ligand (ICOS-L), and distinct phenotype, morphology, transcriptomic signature, and function. We showed that Tfh1 differentiation was efficiently and specifically induced by CD40 high ICOS-L low DC in a CD40-dependent manner. Tfh1 cells were positively associated with a CD40 high ICOS-L Low DC signature in patients with latent mycobacterium tuberculosis and mild COVID-19 infection. Our study uncovers a novel CD40-dependent human Tfh1 axis. Immunotherapy modulation of Tfh1 activity might contribute to control diseases where Tfh1 are known to play a key role, such as infections. <h4>Significance Statement</h4> Dendritic cells (DC) play a central role in triggering the adaptive immune response due to their T cell priming functions. Among different T cell subsets, it is still not clear how human type1 T follicular helper cells (Tfh1) differentiate. Tfh1 cells are implicated in several physiopathological conditions, including infections. Here we show that GM-CSF induces diversification of human DC. Only CD40 high ICOS-L Low DC were able to drive Tfh1 cell differentiation. We found that CD40 high ICOS-L Low DC signature was associated to Tfh1 cells in mycobacterium tuberculosis and COVID-19 patients. Our data reveal a previously undescribed pathway leading to human Tfh1 cell differentiation and highlight the importance of GM-CSF and CD40 as potential targets for the design of anti-infective therapies.
Also flagged:bacterial infectionsirondesferrioxaminecatecholssiderophoredioxetanes
Journal Article2022-04-27No SnippetsPeukert C, Popat Gholap S, Green O, Pinkert L, van den Heuvel J, van Ham M, Shabat D, Brönstrup M.
Show Full Abstract
The sensitive detection of bacterial infections is a prerequisite for their successful treatment. The use of a chemiluminescent readout was so far hampered by an insufficient probe enrichment at the pathogens. We coupled siderophore moieties, that harness the unique iron transport system of bacteria, with enzyme-activatable dioxetanes and obtained seven trifunctional probes with high signal-to-background ratios (S/B=426-859). Conjugates with efficient iron transport capability into bacteria were identified through a growth recovery assay. All ESKAPE pathogens were labelled brightly by desferrioxamine conjugates, while catechols were weaker due to self-quenching. Bacteria could also be detected inside lung epithelial cells. The best probe 8 detected 9.1×10<sup>3</sup> CFU mL<sup>-1</sup> of S. aureus and 5.0×10<sup>4</sup> CFU mL<sup>-1</sup> of P. aeruginosa, while the analogous fluorescent probe 10 was 205-305fold less sensitive. This qualifies siderophore dioxetane probes for the selective and sensitive detection of bacteria.
Also flagged:SorafenibLenvatinibhepatocellular carcinomahypertensionFGF4FGF23
Journal Article2022-04-27✓ 5 SnippetsWang L, Wang L, Xiao B, Cui M, Zhang B.
In-Text Gene Mentions
Discussion)
…UNC13C was found to be a novel tumor suppressor and an essential regulator of the EMT signaling pathway during oral squamous cell carcinoma progression [36].…
Discussion)
…With the activation of 3 DEMs, it was reasonable to hypothesize that 8 DEGs (FGF4, FGF23, UNC13C, RIMBP2, STXBP5L, PHOX2B, NEUROD4, and POU4F2) could be repressed in the lenvatinib treatment, which was further supported by our present results (Figure 2B).…
Results)
…By taking the intersection between sorafenib and lenvatinib, 8 genes were selected as the primary significant DEGs for lenvatinib: FGF4, FGF23, UNC13C, RIMBP2, STXBP5L, PHOX2B, NEUROD4, and POU4F2 (Figure 1E).…
I A O 0000615)
…Patients treated with lenvatinib developed 8 DEGs (FGF4, FGF23, UNC13C, RIMBP2, STXBP5L, PHOX2B, NEUROD4, and POU4F2) and 3 DEMs (has-miR-548ah, has-miR-888, and has-miR-196a-1).…
Abstract)
…Compared with patients with HCC treated with sorafenib, patients treated with lenvatinib developed 8 differentially expressed genes (DEGs, FGF4, FGF23, UNC13C, RIMBP2, STXBP5L, PHOX2B, NEUROD4, and POU4F2) and 3 miRNAs (DEMs, has-miR-548ah, has-miR-888, and has-miR-196a-1), of which hsa-miR-548 regulated 4 target genes, the largest number among the 3 miRNAs.…
Show Full Abstract
BACKGROUND The aim of this work was to systematically compare the differences between sorafenib and lenvatinib for patients with hepatocellular carcinoma (HCC) from genetic and clinical perspectives. MATERIAL AND METHODS The mRNA and miRNA sequencing information of patients with HCC treated with either sorafenib or lenvatinib was analyzed using differential expression and a protein-protein interaction assay. The clinical manifestations and adverse events of the 2 drugs were also investigated. RESULTS Compared with patients with HCC treated with sorafenib, patients treated with lenvatinib developed 8 differentially expressed genes (DEGs, FGF4, FGF23, UNC13C, RIMBP2, STXBP5L, PHOX2B, NEUROD4, and POU4F2) and 3 miRNAs (DEMs, has-miR-548ah, has-miR-888, and has-miR-196a-1), of which hsa-miR-548 regulated 4 target genes, the largest number among the 3 miRNAs. The functions of these DEMs and DEGs were verified by external experiments in the HCC cell line Hep3B2.1-7. We further investigated the adverse events of the drugs for patients with advanced HCC in clinical treatment. The patients in the sorafenib group developed less frequent symptoms of hypertension and diarrhea. Also, the frequency of hand-foot skin reactions in patients treated with lenvatinib was lower than that of patients treated with sorafenib (P<0.05). There were no significant differences in nausea, fatigue, frequent urination, and dizziness (P>0.05). CONCLUSIONS In a time of increasing interest in chemotherapy drug treatments for patients with HCC, this study provided a better understanding of the clinical evaluations of sorafenib and lenvatinib.
Also flagged:cytokinePhosphatidylserineapoptoticcell surfacephospholipase A2hemostasis
Journal Article2022-04-27No SnippetsKuypers FA.
Show Full Abstract
The cytokine storm (CS) in hyperinflammation is characterized by high levels of cytokines, extreme activation of innate as well as adaptive immune cells and initiation of apoptosis. High levels of apoptotic cells overwhelm the proper recognition and removal system of these cells. Phosphatidylserine on the apoptotic cell surface, which normally provides a recognition signal for removal, becomes a target for hemostatic proteins and secretory phospholipase A2. The dysregulation of these normal pathways in hemostasis and the inflammasome result in a prothrombotic state, cellular death, and end-organ damage. In this review, we provide the argument that this imbalance in recognition and removal is a common denominator regardless of the inflammatory trigger. The complex reaction of the immune defense system in hyperinflammation leads to self-inflicted damage. This common endpoint may provide additional options to monitor the progression of the inflammatory syndrome, predict severity, and may add to possible treatment strategies.
Also flagged:chondrocytetransposasechromatinmetabolismmitochondrialdegradation
Journal Article2022-04-27✓ 3 SnippetsChen Y, Yu Y, Wen Y, Chen J, Lin J, Sheng Z, Zhou W, Sun H, An C, Chen J, Wu W, Teng C, Wei W, Ouyang H, Ouyang H.
In-Text Gene Mentions
Methods)
…ense 5’GCTTGACGTGTGGCTTGTTC3’;Sox6: sense 5’CTGGCTGGGAACGACATGAT…
Results)
…, Gpx1 andPebp1, etc.)…
Results)
…( Acan ,Sox6, Sox9 and…
Show Full Abstract
Articular cartilage damage is a universal health problem. Despite recent progress, chondrocyte dedifferentiation has severely compromised the clinical outcomes of cell-based cartilage regeneration. Loss-of-function changes are frequently observed in chondrocyte expansion and other pathological conditions, but the characteristics and intermediate molecular mechanisms remain unclear. In this study, we demonstrate a time-lapse atlas of chondrocyte dedifferentiation to provide molecular details and informative biomarkers associated with clinical chondrocyte evaluation. We performed various assays, such as single-cell RNA sequencing (scRNA-seq), live-cell metabolic assays, and assays for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq), to develop a biphasic dedifferentiation model consisting of early and late dedifferentiation stages. Early-stage chondrocytes exhibited a glycolytic phenotype with increased expression of genes involved in metabolism and antioxidation, whereas late-stage chondrocytes exhibited ultrastructural changes involving mitochondrial damage and stress-associated chromatin remodeling. Using the chemical inhibitor BTB06584, we revealed that early and late dedifferentiated chondrocytes possessed distinct recovery potentials from functional phenotype loss. Notably, this two-stage transition was also validated in human chondrocytes. An image-based approach was established for clinical use to efficiently predict chondrocyte plasticity using stage-specific biomarkers. Overall, this study lays a foundation to improve the quality of chondrocytes in clinical use and provides deep insights into chondrocyte dedifferentiation.
Also flagged:CD8T cell receptorpeptideMHC-Icell cycleCD28
Journal Article2022-04-27✓ 1 SnippetPetkau G, Mitchell TJ, Chakraborty K, Bell SE, D Angeli V, Matheson L, Turner DJ, Saveliev A, Gizlenci O, Salerno F, Katsikis PD, Turner M.
In-Text Gene Mentions
Introduction)
…of Roquin (Rc3h1) and Regnase1…
Show Full Abstract
CD8<sup>+</sup> T cell differentiation into effector cells is initiated early after antigen encounter by signals from the T cell antigen receptor and costimulatory molecules. The molecular mechanisms that establish the timing and rate of differentiation however are not defined. Here we show that the RNA binding proteins (RBP) ZFP36 and ZFP36L1 limit the rate of differentiation of activated naïve CD8<sup>+</sup> T cells and the potency of the resulting cytotoxic lymphocytes. The RBP function in an early and short temporal window to enforce dependency on costimulation via CD28 for full T cell activation and effector differentiation by directly binding mRNA of NF-κB, Irf8 and Notch1 transcription factors and cytokines, including Il2. Their absence in T cells, or the adoptive transfer of small numbers of CD8<sup>+</sup> T cells lacking the RBP, promotes resilience to influenza A virus infection without immunopathology. These findings highlight ZFP36 and ZFP36L1 as nodes for the integration of the early T cell activation signals controlling the speed and quality of the CD8<sup>+</sup> T cell response.
Also flagged:systemic diseasesdoxorubicinPDmetabolismpolydimethylsiloxanecardiomyopathy
Journal Article2022-04-27No SnippetsRonaldson-Bouchard K, Teles D, Yeager K, Tavakol DN, Zhao Y, Chramiec A, Tagore S, Summers M, Stylianos S, Tamargo M, Lee BM, Halligan SP, Abaci EH, Guo Z, Jacków J, Pappalardo A, Shih J, Soni RK, Sonar S, German C, Christiano AM, Califano A, Hirschi KK, Chen CS, Przekwas A, Vunjak-Novakovic G.
Show Full Abstract
Engineered tissues can be used to model human pathophysiology and test the efficacy and safety of drugs. Yet, to model whole-body physiology and systemic diseases, engineered tissues with preserved phenotypes need to physiologically communicate. Here we report the development and applicability of a tissue-chip system in which matured human heart, liver, bone and skin tissue niches are linked by recirculating vascular flow to allow for the recapitulation of interdependent organ functions. Each tissue is cultured in its own optimized environment and is separated from the common vascular flow by a selectively permeable endothelial barrier. The interlinked tissues maintained their molecular, structural and functional phenotypes over 4 weeks of culture, recapitulated the pharmacokinetic and pharmacodynamic profiles of doxorubicin in humans, allowed for the identification of early miRNA biomarkers of cardiotoxicity, and increased the predictive values of clinically observed miRNA responses relative to tissues cultured in isolation and to fluidically interlinked tissues in the absence of endothelial barriers. Vascularly linked and phenotypically stable matured human tissues may facilitate the clinical applicability of tissue chips.
Also flagged:Chromatintransposasetranscription factorsgene expressionhistone proteinsDNA binding proteins
Journal Article2022-04-27No SnippetsGrandi FC, Modi H, Kampman L, Corces MR.
Show Full Abstract
The assay for transposase-accessible chromatin using sequencing (ATAC-seq) provides a simple and scalable way to detect the unique chromatin landscape associated with a cell type and how it may be altered by perturbation or disease. ATAC-seq requires a relatively small number of input cells and does not require a priori knowledge of the epigenetic marks or transcription factors governing the dynamics of the system. Here we describe an updated and optimized protocol for ATAC-seq, called Omni-ATAC, that is applicable across a broad range of cell and tissue types. The ATAC-seq workflow has five main steps: sample preparation, transposition, library preparation, sequencing and data analysis. This protocol details the steps to generate and sequence ATAC-seq libraries, with recommendations for sample preparation and downstream bioinformatic analysis. ATAC-seq libraries for roughly 12 samples can be generated in 10 h by someone familiar with basic molecular biology, and downstream sequencing analysis can be implemented using benchmarked pipelines by someone with basic bioinformatics skills and with access to a high-performance computing environment.
Also flagged:mitochondrialtranslation optimizationgastric cancertumorgastric tumoroxaliplatin
Journal Article2022-04-27✓ 3 SnippetsChang C, Zheng A, Wang P, Teng X.
In-Text Gene Mentions
Discussion)
…In this study, circ‐MTO1 was down‐regulated in gastric tumor tissue compared with adjacent tissue, which could be explained by that overexpression of circ‐MTO1 inhibited the proliferation of gastric cancer cells via multiple mechanisms such as regulating miR‐199a‐3p/PAWR axis, miR‐3200‐5p/PEBP1 axis, miR‐9/p21 axis, and Wnt/β‐catenin signaling pathway.19, 21, 22, 23…
Introduction)
…binding protein 1 (PEBP1) axis and miR‐199a‐3p/pro‐apo…
<h4>Objective</h4>Circular-mitochondrial translation optimization 1 (circ-MTO1) inhibits the progression of gastric cancer by regulating the growth, apoptosis, and invasion of tumor cells. However, its clinical potential as a biomarker for gastric cancer remains to be further evaluated. This study aimed to assess circ-MTO1 expression and its correlation with clinical features and prognosis in gastric cancer patients, as well as the effect of circ-MTO1 on the sensitivity to chemotherapy in gastric cancer cells.<h4>Methods</h4>Circ-MTO1 in tumor and adjacent tissues of 97 gastric cancer patients undergoing resection was examined by reverse transcription-quantitative polymerase chain reaction. HGC-27 and NCI-N87 cells transfected by circ-MOT1 overexpression plasmid (OE-circ-MOT1) and negative control (OE-NC) were treated with 0-6.4 μM oxaliplatin. Relative cell viability was detected using Cell Counting Kit-8.<h4>Results</h4>Circ-MTO1 was insufficiently expressed in gastric tumor tissue (median (interquartile range): 0.403 (0.288-0.518)) compared with adjacent tissue (median (interquartile range): 1.000 (0.715-1.524)) (p < 0.001). Besides, tumor circ-MTO1 was correlated with less lymph node metastasis (p = 0.014) and low TNM stage (p = 0.039), while was not correlated with demographic features or other clinical characteristics (all p > 0.05). Furthermore, tumor circ-MTO1 high expression was independently correlated with prolonged disease-free survival (DFS) (p = 0.013, adjusted hazard ratio (95% confidential interval): 0.314 (0.126-0.782)), but was not correlated with overall survival (p > 0.05). Lastly, in gastric cancer cells, OE-circ-MTO1 apparently decreased relative cell viabilities at oxaliplatin concentrations of 0.4, 0.8, 1.6, and 3.2 μM (all p < 0.05).<h4>Conclusion</h4>Circ-MTO1 correlates with less lymph node metastasis, prolonged DFS, and improved chemotherapy sensitivity in gastric cancer.
Also flagged:Serotonin transporterserotoninSUDEPtoinnervationtemporal lobe epilepsy
Journal Article2022-04-27No SnippetsPatodia S, Somani A, Liu J, Cattaneo A, Paradiso B, Garcia M, Othman M, Diehl B, Devinsky O, Mills JD, Foong J, Thom M.
Show Full Abstract
Several lines of evidence link deficient serotonin function and SUDEP. Chronic treatment with serotonin reuptake inhibitors (SRIs) reduces ictal central apnoea, a risk factor for SUDEP. Reduced medullary serotonergic neurones, modulators of respiration in response to hypercapnia, were reported in a SUDEP post-mortem series. The amygdala and hippocampus have high serotonergic innervation and are functionally implicated in seizure-related respiratory dysregulation. We explored serotonergic networks in mesial temporal lobe structures in a surgical and post-mortem epilepsy series in relation to SUDEP risk. We stratified 75 temporal lobe epilepsy patients with hippocampal sclerosis (TLE/HS) into high (N = 16), medium (N = 11) and low risk (N = 48) groups for SUDEP based on generalised seizure frequency. We also included the amygdala in 35 post-mortem cases, including SUDEP (N = 17), epilepsy controls (N = 10) and non-epilepsy controls (N = 8). The immunohistochemistry labelling index (LI) and axonal length (AL) of serotonin transporter (SERT)-positive axons were quantified in 13 regions of interest with image analysis. SERT LI was highest in amygdala and subiculum regions. In the surgical series, higher SERT LI was observed in high risk than low risk cases in the dentate gyrus, CA1 and subiculum (p < 0.05). In the post-mortem cases higher SERT LI and AL was observed in the basal and accessory basal nuclei of the amygdala and peri-amygdala cortex in SUDEP compared to epilepsy controls (p < 0.05). Patients on SRI showed higher SERT in the dentate gyrus (p < 0.005) and CA4 (p < 0.05) but there was no difference in patients with or without a psychiatric history. Higher SERT in hippocampal subfields in TLE/HS cases with SUDEP risk factors and higher amygdala SERT in post-mortem SUDEP cases than epilepsy controls supports a role for altered serotonergic networks involving limbic regions in SUDEP. This may be of functional relevance through reduced 5-HT availability.
Different effector arms of the immune system are optimized to protect from different classes of pathogens. In some cases, pathogens manipulate the host immune system to promote the wrong type of effector response-a phenomenon known as immune deviation. Typically, immune deviation helps pathogens to avoid destructive immune responses. Here, we report on a type of immune deviation whereby an opportunistic pathogen, Pseudomonas aeruginosa (P. aeruginosa), induces the type 2 immune response resulting in mucin production that is used as an energy source by the pathogen. Specifically, P. aeruginosa-secreted toxin, LasB, processed and activated epithelial amphiregulin to induce type 2 inflammation and mucin production. This "niche remodeling" by P. aeruginosa promoted colonization and, as a by-product, allergic sensitization. Our study thus reveals a type of bacterial immune deviation by increasing nutrient supply. It also uncovers a mechanism of allergic sensitization by a bacterial virulence factor.
Also flagged:myogenesispediatric cancertumorstumorEGFRRhabdomyosarcoma
Journal Article2022-04-27✓ 1 SnippetPatel AG, Chen X, Huang X, Clay MR, Komorova N, Krasin MJ, Pappo A, Tillman H, Orr BA, McEvoy J, Gordon B, Blankenship K, Reilly C, Zhou X, Norrie JL, Karlstrom A, Yu J, Wodarz D, Stewart E, Dyer MA.
In-Text Gene Mentions
Text
…SOX6…
Show Full Abstract
Rhabdomyosarcoma (RMS) is a pediatric cancer with features of skeletal muscle; patients with unresectable or metastatic RMS fare poorly due to high rates of disease recurrence. Here, we use single-cell and single-nucleus RNA sequencing to show that RMS tumors recapitulate the spectrum of embryonal myogenesis. Using matched patient samples from a clinical trial and orthotopic patient-derived xenografts (O-PDXs), we show that chemotherapy eliminates the most proliferative component with features of myoblasts within embryonal RMS; after treatment, the immature population with features of paraxial mesoderm expands to reconstitute the developmental hierarchy of the original tumor. We discovered that this paraxial mesoderm population is dependent on EGFR signaling and is sensitive to EGFR inhibitors. Taken together, these data serve as a proof of concept that targeting each developmental state in embryonal RMS is an effective strategy for improving outcomes by preventing disease recurrence.
Also flagged:Diabetic Kidney DiseaseMALAT1GAS5CASC2NEAT1ARAP1
Journal Article2022-04-27No SnippetsZhao Y, Yan G, Mi J, Wang G, Yu M, Jin D, Tong X, Wang X.
Show Full Abstract
<h4>Background</h4>Long noncoding RNA (lncRNA) is involved in the occurrence and development of diabetic kidney disease (DKD). It is necessary to identify the expression of lncRNA from DKD patients through systematic reviews, and then carry out silico analyses to recognize the dysregulated lncRNA and their associated pathways.<h4>Methods</h4>The study searched Pubmed, Embase, Cochrane Library, WanFang, VIP, CNKI, and CBM to find lncRNA studies on DKD published before March 1, 2021. Systematic review of the literature on this topic was conducted to determine the expression of lncRNA in DKD and non-DKD controls. For the dysregulated lncRNA in DKD patients, silico analysis was performed, and lncRNA2Target v2.0 and starBase were used to search for potential target genes of lncRNA. The Encyclopedia of Genomics (KEGG) pathway enrichment analysis was performed to better identify dysregulated lncRNAs in DKD and determine the associated signal pathways.<h4>Results</h4>According to the inclusion and exclusion criteria, 28 publications meeting the eligibility criteria were included in the systematic evaluation. A total of 3,394 patients were enrolled in this study, including 1,238 patients in DKD group, and 1,223 diabetic patients, and 933 healthy adults in control group. Compared with the control, there were eight lncRNA disorders in DKD patients (MALAT1, GAS5, MIAT, CASC2, NEAT1, NR_033515, ARAP1-AS2, and ARAP1-AS1). In addition, five lncRNAs (MALAT1, GAS5, MIAT, CASC2, and NEAT1) participated in disease-related signal pathways, indicating their role in DKD. <i>Discussion</i>. This study showed that there were eight lncRNAs in DKD that were persistently dysregulated, especially five lncRNAs which were closely related to the disease. Although systematic review included 28 studies that analyzed the expression of lncRNA in DKD-related tissues, the potential of these dysregulated lncRNAs as biomarkers or therapeutic targets for DKD remains to be further explored. Trial registration. PROSPERO (CRD42021248634).
Also flagged:gastric cancergene expressionsPTPN6stomach cancertumordeath
Journal Article2022-04-27✓ 1 SnippetXu R, Chen L, Wei W, Tang Q, Yu Y, Hu Y, Kadasah S, Xie J, Yu H.
In-Text Gene Mentions
Results)
…CD276, CD28, NRP1,TNFSF4, and VTCN1 were…
Show Full Abstract
<h4>Background</h4>Although incidences of gastric cancer have decreased in recent years, the disease remains a significant danger to human health. Lack of early symptoms often leads to delayed diagnosis of gastric cancer, so that many patients miss the opportunity for surgery. Treatment for advanced gastric cancer is often limited. Immunotherapy, targeted therapy, and the mRNA vaccine have all emerged as potentially viable treatments for advanced gastric cancer. However, our understanding of the immune microenvironment of gastric cancer is far from sufficient; now is the time to explore this microenvironment.<h4>Methods</h4>In our study, using TCGA dataset and the GEO dataset GSE62254, we performed in-depth transcriptome and single-cell sequencing analyses based on public databases. We analyzed differential gene expressions of immune cells in metastatic and nonmetastatic gastric cancer and constructed a prognostic model of gastric cancer patients based on these differential gene expressions. We also screened candidate vaccine genes for gastric cancer.<h4>Results</h4>This prognostic model can accurately predict the prognosis of gastric cancer patients by dividing them into high-risk and low-risk groups. In addition to this, we identified a candidate vaccine gene for gastric cancer: PTPN6.<h4>Conclusions</h4>Our study could provide new ideas for the treatment of gastric cancer.
Also flagged:HuntingtinguaninepolyglutaminenucleasefluoresceinHD
Journal Article2022-04-27✓ 5 SnippetsRiccardi C, D'Aria F, Digilio FA, Carillo MR, Amato J, Fasano D, De Rosa L, Paladino S, Melone MAB, Montesarchio D, Giancola C.
In-Text Gene Mentions
Introduction)
…Mutation in the first exon of Huntingtin (HTT) gene, which lies on the short arm of chromosome 4, has been identified as the main cause of HD disorder.…
Results)
…To this aim, we used a well-established Drosophila melanogaster model for HD (Q128HD-FL), which expresses the mutated human HTT protein, containing 128 glutamine repeats in the exon 1, in all neuronal tissues (genotype: elav-Gal4/+; UAS-HttFL-Q128/+) [64].…
Introduction)
…of Huntingtin (HTT) gene, which…
Introduction)
…a mutant, misfoldedHTTprotein (mHTT) featured…
Results)
…the mutated humanHTTprotein, containing 128…
Show Full Abstract
A set of guanine-rich aptamers able to preferentially recognize full-length huntingtin with an expanded polyglutamine tract has been recently identified, showing high efficacy in modulating the functions of the mutated protein in a variety of cell experiments. We here report a detailed biophysical characterization of the best aptamer in the series, named MS3, proved to adopt a stable, parallel G-quadruplex structure and show high nuclease resistance in serum. Confocal microscopy experiments on HeLa and SH-SY5Y cells, as models of non-neuronal and neuronal cells, respectively, showed a rapid, dose-dependent uptake of fluorescein-labelled MS3, demonstrating its effective internalization, even in the absence of transfecting agents, with no general cytotoxicity. Then, using a well-established <i>Drosophila melanogaster</i> model for Huntington's disease, which expresses the mutated form of human huntingtin, a significant improvement in the motor neuronal function in flies fed with MS3 was observed, proving the in vivo efficacy of this aptamer.
Also flagged:Synthesischannel proteinepilepsyischemic strokeindolenaphthalene
Journal Article2022-04-27No SnippetsCrocetti L, Guerrini G, Giovannoni MP, Melani F, Lamanna S, Di Cesare Mannelli L, Lucarini E, Ghelardini C, Wang J, Dahl G.
Show Full Abstract
The channel protein Panx-1 is involved in some pathologies, such as epilepsy, ischemic stroke, cancer and Parkinson's disease, as well as in neuropathic pain. These observations make Panx-1 an interesting biological target. We previously published some potent indole derivatives as Panx-1 blockers, and as continuation of the research in this field we report here the studies on additional chemical scaffolds, naphthalene and pyrazole, appropriately substituted with those functions that gave the best results as in our indole series (sulphonamide functions and one/two carboxylic groups) and in Panx-1 blockers reported in the literature (sulphonic acid). Compounds <b>4</b> and <b>13</b>, the latter being an analogue of the drug Probenecid, are the most potent Panx-1 blockers obtained in this study, with I = 97% and I = 93.7% at 50 µM, respectively. Both compounds, tested in a mouse model of oxaliplatin-induced neuropathic pain, showed a similar anti-hypersensitivity profile and are able to significantly increase the mouse pain threshold 45 min after the injection of the doses of 1 nmol and 3 nmol. Finally, the molecular dynamic studies and the PCA analysis have made it possible to identify a discriminating factor able to separate active compounds from inactive ones.
Also flagged:β-Arrestin2Thyrotropinthyrotropin-releasing hormoneTRHtaltirelinneurological disorders
Journal Article2022-04-27✓ 1 SnippetDrastichova Z, Trubacova R, Novotny J.
In-Text Gene Mentions
Results)
…phosphorylated, Arfgef1 andArfgef2in three phosphorylation…
Show Full Abstract
In recent years, thyrotropin-releasing hormone (TRH) and its analogs, including taltirelin (TAL), have demonstrated a range of effects on the central nervous system that represent potential therapeutic agents for the treatment of various neurological disorders, including neurodegenerative diseases. However, the molecular mechanisms of their actions remain poorly understood. In this study, we investigated phosphosignaling dynamics in pituitary GH1 cells affected by TRH and TAL and the putative role of β-arrestin2 in mediating these effects. Our results revealed widespread alterations in many phosphosignaling pathways involving signal transduction via small GTPases, MAP kinases, Ser/Thr- and Tyr-protein kinases, Wnt/β-catenin, and members of the Hippo pathway. The differential TRH- or TAL-induced phosphorylation of numerous proteins suggests that these ligands exhibit some degree of biased agonism at the TRH receptor. The different phosphorylation patterns induced by TRH or TAL in β-arrestin2-deficient cells suggest that the β-arrestin2 scaffold is a key factor determining phosphorylation events after TRH receptor activation. Our results suggest that compounds that modulate kinase and phosphatase activity can be considered as additional adjuvants to enhance the potential therapeutic value of TRH or TAL.
Also flagged:metalszeolitephosphateshydroxyapatitecalcium phosphateacid
Journal Article2022-04-27No SnippetsWu X, Hong N, Cen Q, Lu J, Wan H, Liu W, Zheng H, Ruan R, Cobb K, Liu Y.
Show Full Abstract
Constructed wetlands are an environmentally friendly and economically efficient sewage treatment technology. Heavy metals (HMs) removal is always regarded as one of the most important tasks in constructed wetlands, which have aroused increasing concern in the field of contamination control in recent times. The fillers of constructed wetlands play an important role in HMs removal. However, traditional wetland fillers (e.g., zeolite, sand, and gravel) are known to be imperfect because of their low adsorption capacity. Regarding HMs removal, our work involved the selection of prominent absorbents, the evaluation of adsorption stability for various treatments, and then the possibility of applying this HM removal technology to constructed wetlands. For this purpose, several phosphate materials were tested to remove the heavy metals Cu and Zn. Three good phosphates including hydroxyapatite (HAP), calcium phosphate (CP), and physic acid sodium salt hydrate (PAS) demonstrated fast removal efficiency of HMs (Cu<sup>2+</sup>, Zn<sup>2+</sup>) from aqueous solution. The maximum removal rates of Cu<sup>2+</sup> and Zn<sup>2+</sup> by HAP, CP, and PAS reached 81.6% and 95.8%; 66.9% and 70.4%; 98.8% and 1.99%, respectively. In addition, better adsorption stability of these heavy metals was found to occur with a wide variation of desorption time and pH range. The most remarkable efficiency for heavy metal removal among tested phosphates was PAS, followed by HAP and CP. This study can provide a basis for the application of HMs removal in manmade wetland systems.
Also flagged:AminoCalciumamino acidscarboxylic acidmethyl estermethyl esters
Journal Article2022-04-27No SnippetsBinette R, Desgagné M, Theaud C, Boudreault PL.
Show Full Abstract
In order to modify amino acids, the C-terminus carboxylic acid usually needs to be protected, typically as a methyl ester. However, standard cleavage of methyl esters requires either highly basic or acidic conditions, which are not compatible with Fmoc or acid-labile protecting groups. This highlights the need for orthogonal conditions that permit selective deprotection of esters to create SPPS-ready amino acids. Herein, mild orthogonal ester hydrolysis conditions are systematically explored using calcium(II) iodide as a protective agent for the Fmoc protecting group and optimized for a broad scope of amino esters. Our optimized reaction improved on the already known trimethyltin hydroxide, as it produced better yields with greener, inexpensive chemicals and a less extensive energy expenditure.
Also flagged:Gene ExpressionGlioblastomamalignant tumorcell cyclecancerSPARC
Journal Article2022-04-27✓ 5 SnippetsLi Q, Aishwarya S, Li JP, Pan DX, Shi JP.
In-Text Gene Mentions
Discussion)
…Genes, namely, PPP2R2C (protein phosphatase regulatory subunit B gamma), SH3GL2 (SH3 domain-containing GRB2-like 2, endophilin A1), BRSK1 (BR serine/threonine kinase 1), DDN (dendrin), CACNA1E (calcium voltage-gated channel subunit alpha1 E), and MAPK8IP2 (mitogen-activated protein kinase 8 interacting protein 2) were harmoniously underexpressed in GBM than in the normal tissues.…
Results)
…Lower expression levels of CACNA1E were found in pheochromocytoma, paraganglioma (PCPG), kidney renal clear cell carcinoma (KIRC), and sarcoma (SARC).…
Abstract)
…The genes CACNA1E (calcium voltage-gated channel subunit alpha1 e), SH3GL2 (SH3 domain-containing GRB2-like 2, endophilin A1), and DDN (dendrin) were identified as under-expressed genes as compared to the normal and pan-cancer tissues along with prominent putative prognostic biomarker potentials.…
Discussion)
…Altogether, through this study, we provide sufficient background for the genes SH3GL2, DDN, and CACNA1E to be the potential putative prognostic biomarker candidates of GBM.…
Discussion)
…Furthermore, pan-cancer analysis of the hub genes revealed three genes, namely, CACNA1E, DDN, and SH3GL2, which were predominantly downregulated in GBM but not identified in more than five cancer types, could also make them putative prognostic biomarkers for GBM.…
Show Full Abstract
Glioblastoma is an aggressive malignant tumor of the brain and spinal cord. Due to the blood-brain barrier, the accessibility of its treatments still remains significantly challenging. Unfortunately, the recurrence rates of glioblastoma upon surgery are very high too. Hence, understanding the molecular drivers of disease progression is valuable. In this study, we aimed to investigate the molecular drivers responsible for glioblastoma progression and identify valid biomarkers. Three microarray expression profiles GSE90604, GSE50601, and GSE134470 containing healthy and glioblastoma-affected samples revealed overlapping differentially expressed genes (DEGs). The interrelational pathway enrichment analysis elucidated the halt of cell cycle checkpoints and activation of signaling pathways and led to the identification of 6 predominant hub genes. Validation of hub genes in comparison with The Cancer Genome Atlas datasets identified the potential biomarkers of glioblastoma. The study evaluated two significantly upregulated genes, <i>SPARC</i> (secreted protein acidic and rich in cysteine) and <i>VIM</i> (vimentin) for glioblastoma. The genes <i>CACNA1E</i> (calcium voltage-gated channel subunit alpha1 e), <i>SH3GL2</i> (SH3 domain-containing <i>GRB2-</i>like 2, endophilin A1), and <i>DDN</i> (dendrin) were identified as under-expressed genes as compared to the normal and pan-cancer tissues along with prominent putative prognostic biomarker potentials. The genes <i>DDN</i> and <i>SH3GL2</i> were found to be upregulated in the proneural subtype, while <i>CACNA1E</i> in the mesenchymal subtype of glioblastoma exhibits good prognostic potential. The mutational analysis also revealed the benign, possibly, and probably damaging substitution mutations. The correlation between the DEG and survival in glioblastoma was evaluated using the Kaplan-Meier plots, and <i>VIM</i> had a greater life expectancy of 60.25 months. Overall, this study identified key candidate genes that might serve as predictive biomarkers for glioblastoma.
Lung adenocarcinoma (LUAD), a malignancy with high incidence and mortality rates worldwide, contains multiple genomic and epigenomic abnormalities. And the useful tumor markers associated with these abnormalities need further investigation. Whereas apoptosis is a form of programmed cell death, the expression of apoptosis-related genes in LUAD and its relationship with prognosis is unclear. In the present study, we identified 64 differentially expressed apoptosis-related genes (DEARGs) that were differentially expressed between LUAD tissue and normal lung tissue. Based on these DEARGs, all LUAD cases were classified into two subtypes using The Cancer Genome Atlas (TCGA) cohort to assess the prognostic value of apoptosis-related genes for survival. An 11-gene signature was established by applying the Least Absolute Shrinkage and Selection Operator (LASSO) Cox regression method to construct a multigene prediction model and classify all LUAD patients in the TCGA cohort into high or low AS-score groups. Patients in the low AS-score group had significantly higher survival and prognosis than those in the high AS-score group. Taking the median risk score of the AS-score, LUAD patients in the GSE68465 cohort were divided into two risk groups, low and high. The overall survival (OS) time was longer in the low AS-score group. Combined with clinical characteristics, the AS-score was an independent predictor of LUAD patients. Gene ontology (GO) and Kyoto Encylopedia of Genes and Genomes (KEGG) analyses showed that the differential genes between the two groups were mainly enriched in cellular immunity. Further analysis revealed higher immune checkpoint protein expression and higher tumor mutational burden (TMB) in the high AS-score group, suggesting better efficacy of immunotherapy in the high AS-score group than the low AS-score group. And the high AS-score group was better in chemotherapy and targeted therapy efficiency. In conclusion, the AS-score constructed based on apoptosis-related genes can predict the prognosis of LUAD patients and provide some guidance for the antitumor treatment of LUAD patients.
Also flagged:Epilepsyneurological disorderneurological disordersprimary epilepsy syndromebrain development disordersepileptic encephalopathy
Journal Article2022-04-27No SnippetsChuan Z, Ruikun C, Qian L, Shiyue M, Shengju H, Yong Y, Haibo L, Neng X, Yong Z, Huiqin X, Weijia W, Ling H, Bingbo Z, Zhang Q, Yan W, Zongfu C, Xu M.
Show Full Abstract
<b>Background:</b> Epilepsy in childhood is a common and diverse neurological disorder. We conducted a genetic and phenotype analysis of a Chinese cohort of infants and children with epilepsy. <b>Methods:</b> We conducted a pedigree analysis of 260 Chinese patients with epilepsy onset during infancy or childhood by whole exome sequencing (WES). <b>Results:</b> Of the 260 probands analyzed, a genetic diagnosis was established in 135 patients. One-hundred eighty-eight phenotypes were detected in those 135 positive/likely positive patients, 106 patients had more than two phenotypes, and 67 patients had more than three phenotypes. A total of 142 variants of 81 genes were detected among the positive/likely positive patients. Among these 142 variants, of which 87 of 66 genes were novel. <b>Conclusion:</b> Our findings extend the variant spectrum of genes related to epilepsy. Our results will be useful for genetic testing and counseling for patients with epilepsy.
Also flagged:cancersPNIPTENGFRA1CDKN2ABile duct carcinoma
Journal Article2022-04-27✓ 1 SnippetHurník P, Chyra Z, Ševčíková T, Štembírek J, Trtková KS, Gaykalova DA, Buchtová M, Hrubá E.
In-Text Gene Mentions
S I O 001029)
…On the contrary, hypermethylation was proven in CCNA1, DCC, TIMP3, EYA4, and WT1 genes in HPV-positive OSCC (Viet and Schmidt, 2008; Arantes et al., 2015).…
Show Full Abstract
Carcinomas of the oral cavity and oropharynx belong among the ten most common malignancies in the human population. The prognosis of head and neck squamous cell carcinoma (HNSCC) is determined by the degree of invasiveness of the primary tumor and by the extent of metastatic spread into regional and distant lymph nodes. Moreover, the level of the perineural invasion itself associates with tumor localization, invasion's extent, and the presence of nodal metastases. Here, we summarize the current knowledge about different aspects of epigenetic changes, which can be associated with HNSCC while focusing on perineural invasion (PNI). We review epigenetic modifications of the genes involved in the PNI process in HNSCC from the omics perspective and specific epigenetic modifications in OSCC or other neurotropic cancers associated with perineural invasion. Moreover, we summarize DNA methylation status of tumor-suppressor genes, methylation and demethylation enzymes and histone post-translational modifications associated with PNI. The influence of other epigenetic factors on the HNSCC incidence and perineural invasion such as tobacco, alcohol and oral microbiome is overviewed and HPV infection is discussed as an epigenetic factor associated with OSCC and related perineural invasion. Understanding epigenetic regulations of axon growth that lead to tumorous spread or uncovering the molecular control of axon interaction with cancer tissue can help to discover new therapeutic targets for these tumors.
Also flagged:Metabolic syndromemetabolic disordersmetabolismcerebral diseasesheart attackstroke
Journal Article2022-04-27No SnippetsJiang X, Yang Z, Wang S, Deng S.
Show Full Abstract
Metabolic syndrome (MetS) is characterized by the concurrence of multiple metabolic disorders resulting in the increased risk of a variety of diseases related to disrupted metabolism homeostasis. The prevalence of MetS has reached a pandemic level worldwide. In recent years, extensive amount of data have been generated throughout the research targeted or related to the condition with techniques including high-throughput screening and artificial intelligence, and with these "big data", the prevention of MetS could be pushed to an earlier stage with different data source, data mining tools and analytic tools at different levels. In this review we briefly summarize the recent advances in the study of "big data" applications in the three-level disease prevention for MetS, and illustrate how these technologies could contribute tobetter preventive strategies.
Also flagged:tumoursSTADmethylationtumourcell surfaceTumor
Journal Article2022-04-27No SnippetsLi X, Fan Y, Zhang Y, Wang Y, Zhao M, Tang M, Li H, Mi J, Geng Z, Wang Z, Su F.
Show Full Abstract
<b>Background:</b> Chondroitin sulphate synthase 3 (<i>CHSY3</i>) is an important enzyme that regulates glycosylation, but it has not been reported in tumours. This study explored for the first time the oncological features of <i>CHSY3</i> in stomach adenocarcinoma (STAD). <b>Methods:</b> We analysed <i>CHSY3</i> expression in STAD through the Cancer Genome Atlas (TCGA) database and verified our findings by immunohistochemical staining and Western blot experiments. The prognostic value of <i>CHSY3</i> in STAD was analysed through the biological aspects of <i>CHSY3</i> in STAD, such as communal clinical follow-up survival data, methylation sites, tumour immune microenvironment (TIME) and immune cell surface checkpoints. Finally, the immune-evasion potential of <i>CHSY3</i> in STAD was assessed on the Tumor Immune Dysfunction and Exclusion (TIDE) website and immunohistochemical staining experiment. <b>Results:</b> <i>CHSY3</i> overexpression in STAD was associated with a poor prognosis based on immunohistochemical staining and Western blot experiments. Multivariate Cox analysis suggested that <i>CHSY3</i> could be an independent prognostic risk factor. Pathway enrichment and TIME analysis demonstrated that <i>CHSY3</i> up-regulated mesenchymal activation and immune activation signals in STAD, while TIDE assessment revealed that the risk of immune evasion was significantly higher in the high <i>CHSY3</i> expression group than in the low <i>CHSY3</i> expression group. Risk model scores based on <i>CHSY3</i>-associated immune cell surface checkpoints also presented poor prognosis, and immune evasion was significantly higher in the high-risk group than in the low-risk group. <b>Conclusions:</b> This study analysed <i>CHSY3</i> from multiple biological perspectives and revealed that <i>CHSY3</i> can be a biomarker of poor prognosis and mediates the TIME immune-evasion status in STAD.
Also flagged:CCR6Chronic Thromboembolic Pulmonary HypertensionchemokinesCTEPHcytokineTNFα
Journal Article2022-04-27✓ 1 Snippetvan Uden D, Koudstaal T, van Hulst JAC, van den Bosch TPP, Vink M, Bergen IM, Lila KA, van den Bosch AE, Bresser P, Kool M, von der Thüsen JH, Hendriks RW, Boomars KA.
In-Text Gene Mentions
Methods)
…and detection withDCC(#760-240, Ventana) for…
Show Full Abstract
<h4>Introduction</h4>Previous studies have shown an increase of T cells and chemokines in vascular lesions of patients with chronic thromboembolic pulmonary hypertension (CTEPH). However, detailed characterization of these T cells is still lacking, nor have treatment effects been evaluated.<h4>Methods</h4>We included 41 treatment-naive CTEPH patients at diagnosis, 22 patients at 1-year follow-up, and 17 healthy controls (HCs). Peripheral blood T cells were characterized by flow cytometry for subset distribution, cytokine expression and activation marker profile. We used multiplex immunofluorescence to identify CCR6<sup>+</sup> T cells in endarterectomy tissue from 25 patients.<h4>Results</h4>At diagnosis, proportions of CCR6<sup>+</sup> CD4<sup>+</sup> T cells were increased in CTEPH patients compared with HCs. Patients displayed a significantly reduced production capacity of several cytokines including TNFα, IFNγ, GM-CSF and IL-4 in CD4<sup>+</sup> T cells, and TNFα and IFNγ in CD8<sup>+</sup> T cells. CD4<sup>+</sup> and CD8<sup>+</sup> T cells showed increased expression of the immune checkpoint protein CTLA4. Multivariate analysis separated CTEPH patients from HCs, based on CCR6 and CTLA4 expression. At 1-year follow-up, proportions of CCR6<sup>+</sup>CD4<sup>+</sup> T cells were further increased, IFNγ and IL-17 production capacity of CD4<sup>+</sup> T cells was restored. In nearly all vascular lesions we found substantial numbers of CCR6<sup>+</sup> T cells.<h4>Conclusion</h4>The observed increase of CCR6<sup>+</sup> T cells and modulation of the IFNγ and IL-17 production capacity of circulating CD4<sup>+</sup> T cells at diagnosis and 1-year follow-up - together with the presence of CCR6<sup>+</sup> T cells in vascular lesions - support the involvement of the Th17-associated CCR6<sup>+</sup> T cell subset in CTEPH.
Also flagged:Cholangiocarcinomabiliary system cancernucleotidescell proliferationcancerintrahepatic cholangiocarcinoma
Journal Article2022-04-27No SnippetsWu Y, Hayat K, Hu Y, Yang J.
Show Full Abstract
Cholangiocarcinoma (CCA) is a biliary system cancer that has the characteristics of strong invasiveness, poor prognosis, and few therapy choices. Furthermore, the absence of precise biomarkers for early identification and prognosis makes it hard to intervene in the early phase of initial diagnosis or recurring cholangiocarcinoma following surgery. Encouragingly, previous studies found that long non-coding RNA (lncRNA), a subgroup of RNA that is more than 200 nucleotides long, can affect cell proliferation, migration, apoptosis, and even drug resistance by altering numerous signaling pathways, thus reaching pro-cancer or anti-cancer outcomes. This review will take a retrospective view of the recent investigations on the work of lncRNAs in cholangiocarcinoma progression and the potential of lncRNAs serving as promising clinical biomarkers and therapeutic targets for CCA.
Also flagged:Type 1 Insulin-Like Growth Factor ReceptorLocalizationGliomaGliomassolid tumorshigh
Journal Article2022-04-27No SnippetsMartin A, Fernandez MC, Cattaneo ER, Schuster CD, Venara M, Clément F, Berenstein A, Lombardi MG, Bergadá I, Gutierrez M, Martí MA, Gonzalez-Baro MR, Pennisi PA.
Show Full Abstract
Gliomas are the most frequent solid tumors in children. Among these, high-grade gliomas are less common in children than in adults, though they are similar in their aggressive clinical behavior. In adults, glioblastoma is the most lethal tumor of the central nervous system. Insulin-like growth factor 1 receptor (IGF1R) plays an important role in cancer biology, and its nuclear localization has been described as an adverse prognostic factor in different tumors. Previously, we have demonstrated that, in pediatric gliomas, IGF1R nuclear localization is significantly associated with high-grade tumors, worst clinical outcome, and increased risk of death. Herein we explore the role of IGF1R intracellular localization by comparing two glioblastoma cell lines that differ only in their IGF1R capacity to translocate to the nucleus. <i>In vitro</i>, IGF1R nuclear localization enhances glioblastoma cell motility and metabolism without affecting their proliferation. <i>In vivo</i>, IGF1R has the capacity to translocate to the nucleus and allows not only a higher proliferation rate and the earlier development of tumors but also renders the cells sensitive to OSI906 therapy. With this work, we provide evidence supporting the implications of the presence of IGF1R in the nucleus of glioma cells and a potential therapeutic opportunity for patients harboring gliomas with IGF1R nuclear localization.
Also flagged:Hepatocellular carcinomacancerLiver Hepatocellular CarcinomaGene ExpressionLIHCliver cancer
Journal Article2022-04-27✓ 1 SnippetChen R, Zhao M, An Y, Liu D, Tang Q, Teng G.
In-Text Gene Mentions
Results)
…in LIHC: SPTA1,CACNA1E, HMCN1, ARID1A, XIRP2,…
Show Full Abstract
Hepatocellular carcinoma is the third most common cause of cancer-related deaths in China and immune-based therapy can improve patient outcomes. In this study, we investigated the relationship between immunity-associated genes and hepatocellular carcinoma from the prognostic perspective. The data downloaded from The Cancer Genome Atlas Liver Hepatocellular Carcinoma (TCGA-LIHC) and the Gene Expression Omnibus (GEO) was screened for gene mutation frequency using the maftools package. Immunity-associated eight-gene signature with strong prognostic ability was constructed and proved as an independent predictor of the patient outcome in LIHC. Seven genes in the immune-related eight-gene signature were strongly associated with the infiltration of M0 macrophages, resting mast cells, and regulatory T cells. Our research may provide clinicians with a quantitative method to predict the prognosis of patients with liver cancer, which can assist in the selection of the optimal treatment plan.
Also flagged:Cell Adhesion MoleculesNeuroblastomatumorcancertumorsextracellular
Journal Article2022-04-27✓ 3 SnippetsHeinly BE, Grant CN.
In-Text Gene Mentions
S I O 001029)
…suggests that there is also a link between N-cadherin and the deleted in colon cancer (DCC) protein, which is commonly aberrant in neuroblastoma (12).…
S I O 001029)
…overexpressed full-length and truncated DCC constructs in neuroblastoma cell lines and found that colonies produced by clones with truncated DCC had a scattered morphology, whereas full-length DCC transfected clones had a more epithelioid morphology (12).…
I A O 0000606)
…(OB-) cadherin, Osteoblast;DCC, Deleted in colon…
Show Full Abstract
Neuroblastoma, a biologically heterogeneous tumor derived from neural crest cells, accounts for approximately 15% of childhood deaths from cancer. Recently, scientific literature has explored the role of cell adhesion molecules (CAMs) in cancer metastasis through cell detachment, migration, and invasion. Through a review of the current literature, it is evident that expression of different CAMs on neuroblastoma tumors is associated with favorable or unfavorable clinical prognosis. In patients diagnosed with neuroblastoma, treatment strategies include chemotherapy, surgery, radiotherapy, stem cell transplant, and more recently, immunotherapy and other targeted therapies. Long term survival remains poor despite multimodality treatment, especially for children with high-risk neuroblastoma, making it more necessary to explore innovative targeted therapies. CAMs have immense potential as therapeutic targets, but there is a need for growth and scientific exploration before CAM therapies become clinically useful.
Amyotrophic lateral sclerosis (ALS) is the most prominent motor neuron disease in humans. Its etiology consists of progressive motor neuron degeneration resulting in a rapid decline in motor function starting in the limbs or bulbar muscles and eventually fatally impairing central organs most typically resulting in loss of respiration. Pathogenic variants in 4 main genes, <i>SOD1</i>, <i>TARDBP</i>, <i>FUS</i>, and <i>C9orf72</i>, have been well characterized as causative for more than a decade now. However, these only account for a small fraction of all ALS cases. In this review, we highlight many additional variants that appear to be causative or confer increased risk for ALS, and we reflect on the technologies that have led to these discoveries. Next, we call attention to new challenges and opportunities for ALS and suggest next steps to increase our understanding of ALS genetics. Finally, we conclude with a synopsis of gene therapy paradigms and how increased understanding of ALS genetics can lead us to developing effective treatments. Ultimately, a consolidated update of the field can provide a launching point for researchers and clinicians to improve our search for ALS-related genes, defining pathogenic mechanisms, form diagnostics, and develop therapies.
Also flagged:TumorCopolymercancerous diseasessynthesisdegradationpirarubicin
Journal Article2022-04-27No SnippetsŠubr V, Pola R, Gao S, Islam R, Hirata T, Miyake D, Koshino K, Zhou JR, Yokomizo K, Fang J, Etrych T.
Show Full Abstract
Biodegradable nanomedicines are widely studied as candidates for the effective treatment of various cancerous diseases. Here, we present the design, synthesis and evaluation of biodegradable polymer-based nanomedicines tailored for tumor-associated stimuli-sensitive drug release and polymer system degradation. Diblock polymer systems were developed, which enabled the release of the carrier drug, pirarubicin, via a pH-sensitive spacer allowing for the restoration of the drug cytotoxicity solely in the tumor tissue. Moreover, the tailored design enables the matrix-metalloproteinases- or reduction-driven degradation of the polymer system into the polymer chains excretable from the body by glomerular filtration. Diblock nanomedicines take advantage of an enhanced EPR effect during the initial phase of nanomedicine pharmacokinetics and should be easily removed from the body after tumor microenvironment-associated biodegradation after fulfilling their role as a drug carrier. In parallel with the similar release profiles of diblock nanomedicine to linear polymer conjugates, these diblock polymer conjugates showed a comparable in vitro cytotoxicity, intracellular uptake, and intratumor penetration properties. More importantly, the diblock nanomedicines showed a remarkable in vivo anti-tumor efficacy, which was far more superior than conventional linear polymer conjugates. These findings suggested the advanced potential of diblock polymer conjugates for anticancer polymer therapeutics.
Also flagged:Immune ResponsesMetabolic DisordersInfectionNewcastle disease (infectionspathogenesis
Journal Article2022-04-27No SnippetsCheng S, Liu X, Mu J, Yan W, Wang M, Chai H, Sha Y, Jiang S, Wang S, Ren Y, Gao C, Ding Z, Stoeger T, Tseren-Ochir EO, Dodovski A, Alfonso P, Mingala CN, Yin R.
Show Full Abstract
The highly virulent Newcastle disease virus (NDV) isolates typically result in severe systemic pathological changes and high mortality in Newcastle disease (ND) illness, whereas avirulent or low-virulence NDV strains can cause subclinical disease with no morbidity and even asymptomatic infections in birds. However, understanding the host's innate immune responses to infection with either a highly virulent strain or an avirulent strain, and how this response may contribute to severe pathological damages and even mortality upon infection with the highly virulent strain, remain limited. Therefore, the differences in epigenetic and pathogenesis mechanisms between the highly virulent and avirulent strains were explored, by transcriptional profiling of chicken embryonic visceral tissues (CEVT), infected with either the highly virulent NA-1 strain or the avirulent vaccine LaSota strain using RNA-seq. In our current paper, severe systemic pathological changes and high mortality were only observed in chicken embryos infected with the highly virulent NA-1 strains, although the propagation of viruses exhibited no differences between NA-1 and LaSota. Furthermore, virulent NA-1 infection caused intense innate immune responses and severe metabolic disorders in chicken EVT at 36 h post-infection (hpi), instead of 24 hpi, based on the bioinformatics analysis results for the differentially expressed genes (DEGs) between NA-1 and LaSota groups. Notably, an acute hyperinflammatory response, characterized by upregulated inflammatory cytokines, an uncontrolled host immune defense with dysregulated innate immune response-related signaling pathways, as well as severe metabolic disorders with the reorganization of host-cell metabolism were involved in the host defense response to the CEVT infected with the highly virulent NA-1 strain compared to the avirulent vaccine LaSota strain. Taken together, these results indicate that not only the host's uncontrolled immune response itself, but also the metabolic disorders with viruses hijacking host cell metabolism, may contribute to the pathogenesis of the highly virulent strain in ovo.
medRxiv2022-04-27Preprint (No Snippets API)Barth B, Arcego DM, de Mendonça Filho EJ, Merscher Sobreira de Lima R, Parent C, Dalmaz C, Portella AK, Pokhvisneva I, Meaney MJ, Silveira PP.
Show Full Abstract
Cardiometabolic and psychiatric disorders often co-exist and share common early life risk factors, such as low birth weight. However, the biological pathways linking early adversity to adult cardiometabolic/psychiatric comorbidity remain unknown. Dopamine (DA) neurotransmission in the striatum is sensitive to early adversity and influences the development of both cardiometabolic and psychiatric diseases. Here we show that a co-expression based polygenic score (ePGS) reflecting individual variations in the expression of the striatal dopamine transporter gene ( SLC6A3 ) network significantly interacts with birth weight to predict psychiatric and cardiometabolic comorbidities in both adults (UK Biobank, N= 225,972) and adolescents (ALSPAC, N= 1188). Decreased birth weight is associated with an increased risk for psychiatric and cardiometabolic comorbidities, but the effect is dependent on a striatal SLC6A3 ePGS, that reflects individual variation in gene expression of genes coexpressed with the SLC6A3 gene in the striatum. Neuroanatomical analyses revealed that SNPs from the striatum SLC6A3 ePGS were significantly associated with prefrontal cortex gray matter density, suggesting a neuroanatomical basis for the link between early adversity and psychiatric and cardiometabolic comorbidity. Our study reveals that psychiatric and cardiometabolic diseases share common developmental pathways and underlying neurobiological mechanisms that includes dopamine signaling in the prefrontal cortex.
Also flagged:fertilizationCatalaseCATsuperoxide dismutaseSODglutathione peroxidase
Journal Article2022-04-26✓ 1 Snippetvon Mengden L, De Bastiani MA, Arruda LS, Link CA, Klamt F.
In-Text Gene Mentions
Text
…PRDX6…
Show Full Abstract
<h4>Purpose</h4>To study whether the cumulus cell antioxidant system varies accordingly to patients clinical characteristics' as age, infertility diagnosis, BMI, and stimulation protocol applied and if the antioxidant profile of cumulus cells could be used as a predictor of embryo development.<h4>Methods</h4>A prospective study including 383 human cumulus samples provided by 191 female patients undergoing intracytoplasmic sperm injection during in vitro fertilization treatments from a local in vitro fertilization center and processed in university laboratories. Catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GPx), and glutathione S-transferase (GST) enzyme activity levels and reduced glutathione (GSH) levels were measured in cumulus oophorus cells individually collected from each aspirated cumulus-oocyte complex, and the results of each sample were compared considering the oocytes outcome after ICSI and patients clinical characteristics. A total of 223 other human cumulus samples from previous studies were submitted to a gene expression meta-analysis.<h4>Results</h4>The antioxidant system changes dramatically depending on patients' age, infertility diagnosis, stimulation protocol applied, and oocyte quality. SOD activity in cumulus cells revealed to be predictive of top-quality blastocysts for young patients with male factor infertility (P < 0.05), while GST levels were shown to be extremely influenced by infertility cause (P < 0.0001) and stimulation protocol applied (P < 0.05), but nonetheless, it can be used as a complementary tool for top-quality blastocyst prediction in patients submitted to intracytoplasmic sperm injection technique (ICSI) by male factor infertility (P < 0.05).<h4>Conclusion</h4>Through a simple and non-invasive analysis, the evaluation of redox enzymes in cumulus cells could be used to predict embryo development, in a personalized matter in specific patient groups, indicating top-quality oocytes and improving success rates in in vitro fertilization treatments.<h4>Trial registration</h4>The trial was registered at UFRGS Research Ethics Committee and Plataforma Brasil under approval number 68081017.2.0000.5347 in June 6, 2019.
Also flagged:liver cancermalignant tumorspathogenesisdigestionhepatocellular carcinomaNTCP
Journal Article2022-04-26✓ 1 SnippetLi JY, Wang LL, Fan J, Liu DX, Han JB, Zhang YF, Yin DD, Yi YX.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
Liver cancer (LC) is one of the most common malignant tumors worldwide. Since the mechanism of LC pathogenesis and metastasis cannot be carried out directly on the human body, it is particularly important to establish human liver cancer cell lines for research <i>in vitro</i>. In this study, tissue block adherence method combined with cell clumps digestion method was used to establish primary human hepatocytes (PHHs) with a successful rate of 60% (45/75). Short tandem repeat (STR) analysis proved the cells were derived from its paired tissues. These cells from hepatocellular carcinoma (HCC) expressed NTCP and secreted ALB and AAT as detected by western blot, and expressed hepatocyte-specific membrane protein ASGR1 as detected by flow cytometry. Liver cancer biomarkers like CK7 in ICC (intrahepatic cholangiocarcinoma), AFP, and GPC3 in HCC expressed of different degree as detected by immunohistochemical analysis. These cells displayed typical liver cancer cell morphological characteristics and can passage stably. In conclusion, we developed an effective method to establish PHHs. Further studies are necessary to study if these cells maintaining other liver function and reproduce the physiology of the tumors and how these cells behavior in the drug development.
Also flagged:TriphosphatesOligophosphatescoagulationsynthesisnucleosidepentaphosphates
Journal Article2022-04-26No SnippetsShepard SM, Jessen HJ, Cummins CC.
Show Full Abstract
Oligophosphates play essential roles in biochemistry, and considerable research has been directed toward the synthesis of both naturally occurring oligophosphates and their synthetic analogues. Greater attention has been given to mono-, di-, and triphosphates, as these are present in higher concentrations biologically and easier to synthesize. However, extended oligophosphates have potent biochemical roles, ranging from blood coagulation to HIV drug resistance. Sporadic reports have slowly built a niche body of literature related to the synthesis and study of extended oligophosphates, but newfound interests and developments have the potential to rapidly expand this field. Here we report on current methods to synthesize oligophosphates longer than triphosphates and comment on the most important future directions for this area of research. The state of the art has provided fairly robust methods for synthesizing nucleoside 5'-tetra- and pentaphosphates as well as dinucleoside 5',5'-oligophosphates. Future research should endeavor to push such syntheses to longer oligophosphates while developing synthetic methodologies for rarer morphologies such as 3'-nucleoside oligophosphates, polyphosphates, and phosphonate/thiophosphate analogues of these species.
Also flagged:ZMAT4SLC26A10FAM155ACOL4A1COL4A2MYO3B
Journal Article2022-04-26✓ 3 SnippetsKim HJ, Son HY, Sung J, Yun JM, Kwon H, Cho B, Kim JI, Park JH.
In-Text Gene Mentions
Results)
…FTO, BBS9, KCNK9,MLLT10, CYCSP30, and GLIS3…
Discussion)⭐ same-sentence co-mention
…and SAT (MLLT10/DNAJC1/EBLN1 ).…
Discussion)⭐ same-sentence co-mention
…and SAT ( MLLT10/DNAJC1/EBLN1 ).…
Show Full Abstract
<h4>Introduction</h4>Although previous genome-wide association studies (GWASs) have identified genetic susceptibility loci for abdominal adiposity, GWASs on Asian samples remain scarce. Therefore, we performed a GWAS for abdominal adipose tissue depots in a Korean population.<h4>Methods</h4>A total of 1,937 Korean men were included in the study. Areas of abdominal fat were quantified by computed tomography. We performed a GWAS analysis under an additive model, and a replication study was conducted on 480 additional Korean adult men.<h4>Results</h4>In the discovery step, we identified a total of 10 single-nucleotide polymorphisms (SNPs) associated with adiposity indicators (p < 1 × 10-5). The top SNP, rs1028014, for visceral adipose tissue (VAT) was located in the ZMAT4 gene and remained significant after adjustment for body mass index (BMI). Three additional SNPs were also associated with VAT-adj-BMI and located within the SLC26A10, FAM155A, and COL4A1-COL4A2 genes, respectively. In addition, we identified a SNP (rs4668224) of the MYO3B gene for visceral-to-subcutaneous fat ratio. For subcutaneous adipose tissue and total adipose tissue, two (rs6585735 and rs363527) and three SNPs (rs1487892, rs9357565, and rs1985358) were found, respectively. Overall, eight SNPs were used in the replication study; however, none of the SNPs reached our level of significance for replication (p < 0.0063). Nevertheless, rs4773144 of COL4A1-COL4A2 for VAT-adj-BMI was the most interesting SNP identified in previous GWASs for coronary artery disease (based on the same risk allele "G"), along with functional effects.<h4>Conclusion</h4>This study suggests for the first time that an SNP (rs4773144) of COL4A1-COL4A2 may contribute to the increase in VAT level, especially in adult Korean men.
Also flagged:Cul3E3 ubiquitin ligaseinfectionSERINC5restriction factorvirions
Journal Article2022-04-26✓ 5 SnippetsLi S, Li R, Ahmad I, Liu X, Johnson SF, Sun L, Zheng YH.
In-Text Gene Mentions
Methods)
…The pCMV6-KLHL20-5A-HA mutant, in which the residues V110, R112, I114, L147, and Q149 were each replaced by alanine, was generated by site-directed mutagenesis.…
Results)
…We generated two KLHL20 mutants, namely ∆K by deleting the Kelch-repeat domain, and 5A by replacing V110, R112, I114, L147, and Q149 with alanine, and tested their interaction with SERINC5 by IP (Fig. 1E).…
Methods)
…In brief, Ser5 and its indicated lysine mutant expression vector in the presence or absence of silencing vectors or expression vectors (KLHL20, Cul3) were transfected either in HEK293T or Jurkat-TAg cells.…
Title)
…Cul3-KLHL20E3 ubiquitin ligase…
Abstract)
…report that Cullin 3-KLHL20, a trans -Golgi…
Show Full Abstract
HIV-1 must counteract various host restrictions to establish productive infection. SERINC5 is a potent restriction factor that blocks HIV-1 entry from virions, but its activity is counteracted by Nef. The SERINC5 and Nef activities are both initiated from the plasma membrane, where SERINC5 is packaged into virions for viral inhibition or downregulated by Nef via lysosomal degradation. However, it is still unclear how SERINC5 is localized to and how its expression is regulated on the plasma membrane. We now report that Cullin 3-KLHL20, a trans-Golgi network (TGN)-localized E3 ubiquitin ligase, polyubiquitinates SERINC5 at lysine 130 via K33/K48-linked ubiquitination. The K33-linked polyubiquitination determines SERINC5 expression on the plasma membrane, and the K48-linked polyubiquitination contributes to SERINC5 downregulation from the cell surface. Our study reveals an important role of K130 polyubiquitination and K33/K48-linked ubiquitin chains in HIV-1 infection by regulating SERINC5 post-Golgi trafficking and degradation.
Cognate antigen signal controls CD8<sup>+</sup> T cell priming, expansion size and effector versus memory cell fates, but it is not known if and how it modulates the functional features of memory CD8<sup>+</sup> T cells. Here we show that the strength of T cell receptor (TCR) signaling controls the requirement for interleukin-2 (IL-2) signals to form a pool of memory CD8<sup>+</sup> T cells that competitively re-expand upon secondary antigen encounter. Combining strong TCR and intact IL-2 signaling during priming synergistically induces genome-wide chromatin accessibility in regions targeting a wide breadth of biological processes, consistent with greater T cell functional fitness. Chromatin accessibility in promoters of genes encoding for stem cell, cell cycle and calcium-related proteins correlates with faster intracellular calcium accumulation, initiation of cell cycle and more robust expansion. High-dimensional flow-cytometry analysis of these T cells also highlights higher diversity of T cell subsets and phenotypes with T cells primed with stronger TCR and IL-2 stimulation than those primed with weaker strengths of TCR and/or IL-2 signals. These results formally show that epitope selection in vaccine design impacts memory CD8<sup>+</sup> T cell epigenetic programming and function.
Also flagged:uveal melanomacentrosomeintraocular cancermetastatic diseasechromosomecancers
Journal Article2022-04-26✓ 1 SnippetSabat-Pośpiech D, Fabian-Kolpanowicz K, Kalirai H, Kipling N, Coupland SE, Coulson JM, Fielding AB.
In-Text Gene Mentions
Introduction)
…centrosome clustering proteinKinesin Family Member C1Family Member C1…
Show Full Abstract
Uveal melanoma (UM) is the most common intraocular cancer in adults. Whilst treatment of primary UM (PUM) is often successful, around 50% of patients develop metastatic disease with poor outcomes, linked to chromosome 3 loss (monosomy 3, M3). Advances in understanding UM cell biology may indicate new therapeutic options. We report that UM exhibits centrosome abnormalities, which in other cancers are associated with increased invasiveness and worse prognosis, but also represent a potential Achilles' heel for cancer-specific therapeutics. Analysis of 75 PUM patient samples revealed both higher centrosome numbers and an increase in centrosomes with enlarged pericentriolar matrix (PCM) compared to surrounding normal tissue, both indicative of centrosome amplification. The PCM phenotype was significantly associated with M3 (t-test, p < 0.01). Centrosomes naturally enlarge as cells approach mitosis; however, whilst UM with higher mitotic scores had enlarged PCM regardless of genetic status, the PCM phenotype remained significantly associated with M3 in UM with low mitotic scores (ANOVA, p = 0.021) suggesting that this is independent of proliferation. Phenotypic analysis of patient-derived cultures and established UM lines revealed comparable levels of centrosome amplification in PUM cells to archetypal triple-negative breast cancer cell lines, whilst metastatic UM (MUM) cell lines had even higher levels. Importantly, many UM cells also exhibit centrosome clustering, a common strategy employed by other cancer cells with centrosome amplification to survive cell division. As UM samples with M3 display centrosome abnormalities indicative of amplification, this phenotype may contribute to the development of MUM, suggesting that centrosome de-clustering drugs may provide a novel therapeutic approach.
Mucormycosis is a rare, potentially life-threatening disease that is growing during the Covid-19 pandemic. This study reports a case of an 11-year-old patient with fatal Covid-19-related pulmonary mucormicosis and diabetes mellitus with ketoacidosis. The diagnosis was set post mortem. It was based on histochemical detection of the causative agent. Massive hemoptysis due to erosion of a large pulmonary vessel caused mechanical asphyxia and lethal outcome. Pulmonary mucormycosis may be highly suspected in patients with long-term Covid-19, poorly controlled diabetes mellitus with ketoacidosis, and corticosteroid therapy. Early diagnosis and treatment with Amphotericin B are potentially curative options for this invasive fungal infection and can led to better outcome.
Also flagged:ferroptosistumourGPX4lipidcancerscancer
Journal Article2022-04-26✓ 5 SnippetsShi Y, Qiu B, Huang L, Lin J, Li Y, Ze Y, Huang C, Yao Y.
In-Text Gene Mentions
Methods)
…2 (Pum2)/peroxiredoxin 6 (PRDX6) axis ( Zhang…
Methods)
…which binds thePRDX6promoter to suppress…
Methods)
…promoter to suppressPRDX6expression ( Zhang…
Methods)
…PRDX6is a negative…
Methods)
…ferroptosis, and specificPRDX6phospholipase A2 inhibitors…
Show Full Abstract
Research on the biological role of exosomes is rapidly developing, and recent evidence suggests that exosomal effects involve ferroptosis. Exosomes derived from different tissues inhibit ferroptosis, which increases tumour cell chemoresistance. Therefore, exosome-mediated regulation of ferroptosis may be leveraged to design anticancer drugs. This review discusses three pathways of exosome-mediated inhibition of ferroptosis: (1) the Fenton reaction; (2) the ferroptosis defence system, including the Xc-GSH-GPX4 axis and the FSP1/CoQ<sub>10</sub>/NAD(P)H axis; and (3) lipid peroxidation. We also summarize three recent approaches for combining exosomes and ferroptosis in oncology therapy: (1) promoting exosome-inhibited ferroptosis to enhance chemotherapy; (2) encapsulating exosomes with ferroptosis inducers to inhibit cancers; and (3) developing therapies that combine exosomal inhibitors and ferroptosis inducers. This review will contribute toward establishing effective cancer therapies.
In this case report we describe a case of massive deep vein thrombosis in an adolescent. The case was complicated by severe antithrombin deficiency caused by a previously unreported mutation. We discuss the use of catheter directed thrombolysis and (F)Xa inhibitors in children and adolescents.
<h4>Purpose</h4>The aim of the present work was to investigate whether hepatitis C virus treatment by directly acting antivirals obligate shifting patients with type 2 diabetes from oral hypoglycemic drugs to insulin therapy.<h4>Methods</h4>This was a prospective study including 92 treatment-naïve patients with chronic hepatitis C virus infection and type 2 diabetes who were eligible for treatment with directly acting antivirals (sofosbuvir + daclatasvir ± ribavirin). Patients in the study were divided into two groups; group 1 included 22 patients on insulin therapy and group 2 included 70 patients on oral antidiabetic medications. Patients were advised to keep on their anti-diabetic treatment.<h4>Results</h4>All our patients achieved sustained virologic response with significantly lower HbA<sub>1c</sub> 12 weeks after the end of therapy (p. values 0.001 for group 1 and group 2). There was no statistically significant difference in HbA<sub>1c</sub> level post-treatment between both groups (p. value 0.352).<h4>Conclusion</h4>Achievement of sustained virologic response using interferon free, directly acting antivirals-based regimen was associated with significantly lower HbA<sub>1c</sub> 12 weeks after the end of therapy. The type of treatment used for type 2 diabetes (oral drugs or insulin) did not affect improved glycemic control observed after achieving sustained virologic response.
Also flagged:OX40TIM-3ovarian cancerprogrammed cell death protein-1PD-1ovarian tumors
Journal Article2022-04-26No SnippetsJames NE, Valenzuela AD, Emerson JB, Woodman M, Miller K, Hovanesian V, Ou J, Ribeiro JR.
Show Full Abstract
Patients with ovarian cancer exhibit low response rates to anti-programmed cell death protein-1 (PD-1) based therapies, despite ovarian tumors demonstrating measurable immune responses. Therefore, the aim of the present study was to comparatively examine expression of notable immune co-stimulatory and co-inhibitory receptors in order identify the most abundant receptors that could potentially serve as therapeutic targets to enhance immunotherapy response in high grade serous ovarian cancer (HGSOC). The Cancer Genome Atlas (TCGA) was employed to compare levels of various HGSOC and pan-cancer cohorts. To confirm these findings at the protein level, immunofluorescence of select receptors was performed in 29 HGSOC patient tissue samples. TCGA and Kaplan Meier analysis was employed to determine the association of highly expressed immune receptors with clinical outcomes. TIM-3 and OX40 exhibited the highest expression in HGSOC at both the gene and protein level, with TIM-3 demonstrating highest levels on both CD8<sup>+</sup> and CD4<sup>+</sup> T cell subsets. Pan-cancer analysis determined that TIM-3 and OX40 levels were similar to those in immunotherapy-responsive cancers, while PD-1 exhibited much lower expression in HGSOC. Finally, OX40 was most strongly associated with improved patient survival. Overall, the current study suggested that TIM-3 and OX40 are frequently expressed intratumoral immune receptors in HGSOC and thus represent promising immune targets. Furthermore, the present analysis strongly suggested that OX40 was significantly associated with a longer survival and could potentially be utilized as a prognostic factor for improved patient outcomes in HGSOC.
Also flagged:Metforminneurodegenerative diseasesmetabolisminflammatory responsedeathdimethyl biguanide hydrochloride
Journal Article2022-04-26✓ 1 SnippetDu MR, Gao QY, Liu CL, Bai LY, Li T, Wei FL.
In-Text Gene Mentions
S I O 001029)
…Vazquez-Manrique et al. (2016) confirmed that the AMPK pathway is over activated in Caenorhabditis elegans and mouse HD models, and they suggested that metformin may work as a protective role in the early progression of HD. This conclusion was confirmed by Jin et al. (2016). They found that metformin may weaken the toxic effect of Htt through activating the AMPK pathway. In addition, Gomez-Escribano et al. (2020) found that the low doses of metformin and salicylate could synergistically activate AMPK and alleviate the neurotoxic effects of extended polyQ and α-synuclein, which provided a new idea for the combination of metformin.…
Show Full Abstract
Metformin, one of the first-line of hypoglycemic drugs, has cardioprotective, anti-inflammatory and anticancer activities, in addition to its proven hypoglycemic effects. Furthermore, the preventive and therapeutic potential of metformin for neurodegenerative diseases has become a topic of concern. Increasing research suggests that metformin can prevent the progression of neurodegenerative diseases. In recent years, many studies have investigated the neuroprotective effect of metformin in the treatment of neurodegenerative diseases. It has been revealed that metformin can play a neuroprotective role by regulating energy metabolism, oxidative stress, inflammatory response and protein deposition of cells, and avoiding neuronal dysfunction and neuronal death. On the contrary, some have hypothesized that metformin has a two-sided effect which may accelerate the progression of neurodegenerative diseases. In this review, the results of animal experiments and clinical studies are reviewed to discuss the application prospects of metformin in neurodegenerative diseases.
Also flagged:Redox Signaling ProteinsperoxisomesAP-1thiolcytosolmitochondria
Journal Article2022-04-26✓ 3 SnippetsLismont C, Revenco I, Li H, Costa CF, Lenaerts L, Hussein MAF, De Bie J, Knoops B, Van Veldhoven PP, Derua R, Fransen M.
In-Text Gene Mentions
Results)
…PRDX3, PRDX4, PRDX5,PRDX6, TXN, and TXNRD2.…
Results)
…HPRT1, PRDX1, PRDX2,PRDX6, PRMT5, SKP1, and…
Results)
…PRDX2, PRDX3, PRDX4,PRDX6, TXN, and ERP44),…
Show Full Abstract
The involvement of peroxisomes in cellular hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) metabolism has been a central theme since their first biochemical characterization by Christian de Duve in 1965. While the role of H<sub>2</sub>O<sub>2</sub> substantially changed from an exclusively toxic molecule to a signaling messenger, the regulatory role of peroxisomes in these signaling events is still largely underappreciated. This is mainly because the number of known protein targets of peroxisome-derived H<sub>2</sub>O<sub>2</sub> is rather limited and testing of specific targets is predominantly based on knowledge previously gathered in related fields of research. To gain a broader and more systematic insight into the role of peroxisomes in redox signaling, new approaches are urgently needed. In this study, we have combined a previously developed Flp-In T-REx 293 cell system in which peroxisomal H<sub>2</sub>O<sub>2</sub> production can be modulated with a yeast AP-1-like-based sulfenome mining strategy to inventory protein thiol targets of peroxisome-derived H<sub>2</sub>O<sub>2</sub> in different subcellular compartments. By using this approach, we identified more than 400 targets of peroxisome-derived H<sub>2</sub>O<sub>2</sub> in peroxisomes, the cytosol, and mitochondria. We also observed that the sulfenylation kinetics profiles of key targets belonging to different protein families (e.g., peroxiredoxins, annexins, and tubulins) can vary considerably. In addition, we obtained compelling but indirect evidence that peroxisome-derived H<sub>2</sub>O<sub>2</sub> may oxidize at least some of its targets (e.g., transcription factors) through a redox relay mechanism. In conclusion, given that sulfenic acids function as key intermediates in H<sub>2</sub>O<sub>2</sub> signaling, the findings presented in this study provide valuable insight into how peroxisomes may be integrated into the cellular H<sub>2</sub>O<sub>2</sub> signaling network.
Also flagged:Crowned Dens Syndromecalcium pyrophosphatecalciumpyrophosphatecolchicinemagnesium
Journal Article2022-04-26✓ 1 SnippetHaas P, Hauser TK, Kandilaris K, Skardelly M, Tatagiba M, Adib SD.
In-Text Gene Mentions
Discussion)
…rheumatoid arthritis, andhemochromatosis( 21 ).…
Show Full Abstract
<h4>Background</h4>'Crowned dens syndrome' (CDS) is a special form of calcium pyrophosphate dihydrate deposition disease which is characterized radiologically by a halo-like or crown-like distribution in the periodontoid region and clinically by cervical pain. Herein, we will describe our experience of posterolateral epidural supra-C2-root approach (PESCA) for biopsy of retro-odontoid lesions in one surgical session after occipitocervical fixation and decompression in a patient with CDS and massive brainstem compression.<h4>Case presentation</h4>A 70-year-old woman presented to our department with a 4-week history of progressive walking impairment, neck pain, neck rigidity, fever, dizziness, slight palsy of the left hand, and multiple fall episodes. Magnetic resonance imaging (MRI) of the craniovertebral junction (CVJ) and cervical spine revealed a lesion of the odontoid process and the retro-odontoid region with mainly solid components, as well as small cystic components, and brainstem compression and displacement. In first step, fusion surgery of the CVJ C0-C4 was performed with occiptocervical decompression. After fusion and decompression the lower lateral part of the C1 arc and the lateral superior part of the left side of the C2 arc were removed. The entry point was located directly above the superior part of the C2 root. A biopsy of the lateral portions of the lesions was obtained by bioptic forceps under microscope guidance. Pathologic examination of the mass revealed deposition of birefringent crystals compatible with calcium pyrophosphate. In addition to the clinical symptoms (especially neck pain), the diagnosis of CDS was made. Non-steroidal inflammatory drugs (NSAIDs) and colchicine (and later magnesium) were started. At follow-up examination 6 months after surgery, an MRI scan of the cervical spine revealed regression of the pannus and the cyst with replacement of the brainstem, clinical improvement of walking, and increased strength of the left hand.<h4>Conclusions</h4>This study demonstrates that PESCA can be used to obtain tissue for pathological analysis in one surgical sitting after fusion and decompression and that fusion, decompression, and PESCA (in the same session) together with subsequent conservative management could be a good alternative for the treatment of CDS.
Also flagged:osteoarthritisOArheumatoid arthritisRAosteoporosisOP
Journal Article2022-04-26No SnippetsChen S, Chen T, Chen Y, Huang D, Pan Y, Chen S.
Show Full Abstract
<h4>Background</h4>Much observational research reported that tea consumption decreases the risk of osteoarthritis (OA), rheumatoid arthritis (RA), and osteoporosis (OP) which are the three major bone disorders. However, the observed correlation is inconclusive. To determine the causal relationship between genetically predicted tea intake and OA, RA, and OP, we performed a two-sample Mendelian randomization (MR) study based on large samples.<h4>Methods</h4>The European population's genome-wide association meta-analysis (GWAS) dataset identified SNPs associated with tea consumption was obtained from Neale Lab's analysis of UK Biobank data that comprised 349,376 participants of European ancestry. We extracted genetic data for knee OA (17,885 controls and 4,462 cases), hip OA (50,898 controls and 12,625 cases), and RA (43,923 controls and 14,361 cases) from the UK Biobank and OP cases (93083 controls and 1,175 cases) from FinnGen Data Freeze 2. A MR study was conducted to examine the effect of selected single nucleotide polymorphisms (SNPs) and OA, RA, and OP risk. Several sensitivity analyses were performed with weighted median and inverse-variance weighted methods for estimating the causal effects.<h4>Results</h4>In this MR study, the genetically predicted per one cup increase of tea consumption was not associated with knee OA (OR 1.11,95% CI: 0.79-1.55) using IVW with random effect. Genetic predisposition to tea consumption was not associated with hip OA (OR: 1.20, 95% CI: 0.84-1.71), RA (OR: 1.24 95% CI: 0.81-1.91), and OP (OR: 1.11, 95% CI: 0.89, 1.39). Following the sensitivity analysis, there was no potential pleiotropy.<h4>Conclusion</h4>According to our study, According to our study, there was no statistical power to confirm a causal relationship between tea consumption and the risk of knee OA, hip OA, RA, and OP.
Also flagged:Autophagymental illnessautophagy-relatedRAB1AGNAI3VAMP7
Journal Article2022-04-26✓ 2 SnippetsSun Y, Li J, Wang L, Cong T, Zhai X, Li L, Wu H, Li S, Xiao Z.
In-Text Gene Mentions
Results)
…B5.2, TMEM55A, RP11–488L18.10,OLFM4, and RAB33B (…
Results)
…DEFA4, CEACAM8, andOLFM4, which were the…
Show Full Abstract
<b>Background:</b> Major depressive disorder (MDD) is a serious mental illness characterized by mood changes and high suicide rates. However, no studies are available to support a blood test method for MDD diagnosis. The objective of this research was to identify potential peripheral blood biomarkers for MDD and characterize the novel pathophysiology. <b>Methods:</b> We accessed whole blood microarray sequencing data for MDD and control samples from public databases. Biological functions were analysed by GO and KEGG pathway enrichment analyses using the clusterprofile R package. Infiltrated immune cell (IIC) proportions were identified using the CIBERSORT algorithm. Clustering was performed using the ConsensusClusterPlus R package. Protein-protein interactions (PPI) were assessed by constructing a PPI network using STRING and visualized using Cytoscape software. Rats were exposed to chronic unpredictable mild stress (CUMS) for 6 weeks to induce stress behaviour. Stress behaviour was evaluated by open field experiments and forced swimming tests. Flow cytometry was used to analyse the proportion of CD8<sup>+</sup> T cells. The expression of the corresponding key genes was detected by qRT-PCR. <b>Results:</b> We divided MDD patients into CD8H and CD8L clusters. The functional enrichment of marker genes in the CD8H cluster indicated that autophagy-related terms and pathways were significantly enriched. Furthermore, we obtained 110 autophagy-related marker genes (ARMGs) in the CD8H cluster through intersection analysis. GO and KEGG analyses further showed that these ARMGs may regulate a variety of autophagy processes and be involved in the onset and advancement of MDD. Finally, 10 key ARMGs were identified through PPI analysis: RAB1A, GNAI3, VAMP7, RAB33B, MYC, LAMP2, RAB11A, HIF1A, KIF5B, and PTEN. In the CUMS model, flow cytometric analysis confirmed the above findings. qRT-PCR revealed significant decreases in the mRNA levels of Gnai3, Rab33b, Lamp2, and Kif5b in the CUMS groups. <b>Conclusion:</b> In this study, MDD was divided into two subtypes. We combined immune infiltrating CD8<sup>+</sup> T cells with autophagy-related genes and screened a total of 10 ARMG genes. In particular, RAB1A, GNAI3, RAB33B, LAMP2, and KIF5B were first reported in MDD. These genes may offer new hope for the clinical diagnosis of MDD.
Also flagged:keratinocyte differentiationinflammatory responsepsoriasisatopic dermatitisADcytokine
Journal Article2022-04-26✓ 1 SnippetShefler A, Patrick MT, Wasikowski R, Chen J, Sarkar MK, Gudjonsson JE, Tsoi LC.
In-Text Gene Mentions
Introduction)
…a complex withSTAU1(staufen double-stranded RNA…
Show Full Abstract
Long non-coding RNAs (lncRNAs) have attracted attention for their potential roles in modulating keratinocyte differentiation and inflammatory response; however, for many identified skin-expressing lncRNAs, there is no comprehensive characterization regarding their biological roles. In addition, the reported expression profiles for lncRNAs can be ambiguous due to their low-expressing nature. The objective of this review is to utilize large scale genomic data to characterize the prominent skin-expressing lncRNAs, aiming to provide additional insights for their potential roles in the pathology of inflammatory skin of psoriasis and atopic dermatitis by integrating <i>in vitro</i> and <i>in vivo</i> data. We highlighted the different skin-expressing lncRNAs, including <i>H19</i>, which is significantly down-regulated in lesional skin of AD/psoriasis and upon cytokine stimulation in keratinocytes; it is also negatively correlated with <i>CYP1A1</i> (<i>r</i> = -0.75, <i>p</i> = 8 × 10<sup>-73</sup>), a gene involved in drug metabolism and skin barrier homeostasis, in keratinocytes. In addition, <i>SPRR2C</i>, a potential regulator that modulates IL-22 stimulation, was upregulated in both atopic dermatitis and psoriasis lesional skin and was also downstream of the IL-17A and IL-17 + TNF signaling in keratinocytes. Using scRNAseq, we further revealed the cell type specificity of lncRNAs, including basal-expressing nature of <i>H19</i> in the epidermis. Interestingly, instead of having cell type specific expression profile, we found few lncRNAs that are express across different cell types in skin, including <i>MALAT1</i>, <i>NEAT1</i>, and <i>GAS5</i>. While lncRNAs in general have lower expression, our results combining <i>in vitro</i> and <i>in vivo</i> experimental data demonstrate how some of these lncRNAs can play mediator roles in the cytokine-stimulated pathway.
Also flagged:AdenosinesGlioblastomaTemozolomideGBMbrain tumorcancers
Journal Article2022-04-26✓ 2 SnippetsProto MC, Fiore D, Piscopo C, Laezza C, Bifulco M, Gazzerro P.
In-Text Gene Mentions
Discussion)
…CDK5RAP1(Cdk5 regulatory subunit-assoc…
Discussion)
…CDK5RAP1 (Cdk5 regulatory subunit-associated protein 1regulatory subunit-associated …
Show Full Abstract
Glioblastoma (GBM) is the most common and lethal primary malignant brain tumor, and due to its unique features, its management is certainly one of the most challenging ones among all cancers. N6-isopentenyladenosine (IPA) and its analog N6-benzyladenosine (N6-BA) are modified nucleosides endowed with potent antitumor activity on different types of human cancers, including GBM. Corroborating our previous finding, we demonstrated that IPA and N6-BA affect GBM cell line proliferation by modulating the expression of the F-box WD repeat domain-containing-7 (FBXW7), a tumor suppressor with a crucial role in the turnover of many proteins, such as SREBPs and Mcl1, involved in malignant progression and chemoresistance. Luciferase assay revealed that IPA-mediated upregulation of FBXW7 translates in transcriptional inactivation of its oncogenic substrates (Myc, NFkB, or HIF-1α). Moreover, downregulating MGMT expression, IPA strongly enhances the killing effect of temozolomide (TMZ), producing a favorable sensitizing effect starting from a concentration range much lower than TMZ EC50. Through DNA methyltransferase (DNMT) activity assay, analysis of the global DNA methylation, and the histone modification profiles, we demonstrated that the modified adenosines behave similar to 5-AZA-dC, known DNMT inhibitor. Overall, our results provide new perspectives for the first time, suggesting the modified adenosines as epigenetic tools able to improve chemo- and radiotherapy efficacy in glioblastoma and potentially other cancers.
…/kg) significantly upregulatedDCC, Slit-2, and Robo-1…
Show Full Abstract
Ischemic stroke elicits white matter injury typically signed by axonal disintegration and demyelination; thus, the development of white matter reorganization is needed. 2,3,5,6-Tetramethylpyrazine (TMP) is widely used to treat ischemic stroke. This study was aimed to investigate whether TMP could protect the white matter and promote axonal repair after cerebral ischemia. Male Sprague-Dawley rats were subjected to permanent middle cerebral artery occlusion (MCAO) and treated with TMP (10, 20, 40 mg/kg) intraperitoneally for 14 days. The motor function related to gait was evaluated by the gait analysis system. Multiparametric magnetic resonance imaging (MRI) was conducted to noninvasively identify gray-white matter structural integrity, axonal reorganization, and cerebral blood flow (CBF), followed by histological analysis. The expressions of axonal growth-associated protein 43 (GAP-43), synaptophysin (SYN), axonal growth-inhibitory signals, and guidance factors were measured by Western blot. Our results showed TMP reduced infarct volume, relieved gray-white matter damage, promoted axonal remodeling, and restored CBF along the peri-infarct cortex, external capsule, and internal capsule. These MRI findings were confirmed by histopathological data. Moreover, motor function, especially gait impairment, was improved by TMP treatment. Notably, TMP upregulated GAP-43 and SYN and enhanced axonal guidance cues such as Netrin-1/DCC and Slit-2/Robo-1 but downregulated intrinsic growth-inhibitory signals NogoA/NgR/RhoA/ROCK-2. Taken together, our data indicated that TMP facilitated poststroke axonal remodeling and motor functional recovery. Moreover, our findings suggested that TMP restored local CBF, augmented guidance cues, and restrained intrinsic growth-inhibitory signals, all of which might improve the intracerebral microenvironment of ischemic areas and then benefit white matter remodeling.
Also flagged:CurcuminIschemic strokedeathbrain ischemiaoxygenmitochondrial
Journal Article2022-04-26✓ 4 SnippetsFan F, Lei M.
In-Text Gene Mentions
Introduction)
…Xu et al. (2018) showed that a combination of curcumin and vagus nerve stimulation restored behavioral deficits by inhibiting apoptosis after cerebral ischemia, with the involvement of the Akt/ERK2 pathway. Notably, curcumin inhibits cellular damage and apoptosis by diminishing the endoplasmic reticulum stress (ERS) (Cheng et al., 2020; Keshk et al., 2020; Zhou et al., 2022). Chhunchha et al. (2013) reported that curcumin abated hypoxia-induced ERS-mediated cell death in mouse hippocampal cells by enhancing peroxiredoxin 6 (Prdx6) expressions and inhibiting NF-κB activation. Another in vitro research using the neuroblastoma cells exposed that curcumin relieved neurotoxicity via regulating the PERK-eIF2α pathway (Yan et al., 2022). Last, curcumin mitigated axonal injury and neuronal cellular apoptosis through the PERK/Nrf2 signaling pathway in a rat diffuse axonal injury model (Huang T. et al., 2018).…
Introduction)
…In addition, other signaling pathways such as SP1/Prdx6 (Jia et al., 2017), AMPK/UCP2 (Pu et al., 2013), Golgi reassembly, and stacking protein 65 (GRASP65) (Lin et al., 2016) are also involved in the antioxidant properties of curcumin.…
Introduction)
…pathways such as SP1/Prdx6( Jia et…
Introduction)
…enhancing peroxiredoxin 6 (Prdx6) expressions and inhibiting…
Show Full Abstract
Ischemic stroke is the leading cause of death and disability worldwide, and restoring the blood flow to ischemic brain tissues is currently the main therapeutic strategy. However, reperfusion after brain ischemia leads to excessive reactive oxygen species production, inflammatory cell recruitment, the release of inflammatory mediators, cell death, mitochondrial dysfunction, endoplasmic reticulum stress, and blood-brain barrier damage; these pathological mechanisms will further aggravate brain tissue injury, ultimately affecting the recovery of neurological functions. It has attracted the attention of researchers to develop drugs with multitarget intervention effects for individuals with cerebral ischemia. A large number of studies have established that curcumin plays a significant neuroprotective role in cerebral ischemia via various mechanisms, including antioxidation, anti-inflammation, anti-apoptosis, protection of the blood-brain barrier, and restoration of mitochondrial function and structure, restoring cerebral circulation, reducing infarct volume, improving brain edema, promoting blood-brain barrier repair, and improving the neurological functions. Therefore, summarizing the results from the latest literature and identifying the potential mechanisms of action of curcumin in cerebral ischemia will serve as a basis and guidance for the clinical applications of curcumin in the future.
Also flagged:Lysine MethyltransferaseArginine MethyltransferaseMethylationlysine and arginine methyltransferasesrenal diseaseenhancer of zeste homolog 2
Journal Article2022-04-26No SnippetsZhou X, Chen H, Li J, Shi Y, Zhuang S, Liu N.
Show Full Abstract
Methylation can occur in both histones and non-histones. Key lysine and arginine methyltransferases under investigation for renal disease treatment include enhancer of zeste homolog 2 (EZH2), G9a, disruptor of telomeric silencing 1-like protein (DOT1L), and protein arginine methyltransferases (PRMT) 1 and 5. Recent studies have shown that methyltransferases expression and activity are also increased in several animal models of kidney injury, such as acute kidney injury(AKI), obstructive nephropathy, diabetic nephropathy and lupus nephritis. The inhibition of most methyltransferases can attenuate kidney injury, while the role of methyltransferase in different animal models remains controversial. In this article, we summarize the role and mechanism of lysine methyltransferase and arginine methyltransferase in various kidney diseases and highlight methyltransferase as a potential therapeutic target for kidney diseases.
Also flagged:Viral Respiratory Tract Infections-19Covid-19respiratory tract infectionsSARS-CoV-2 infectionsinfluenza
Journal Article2022-04-26No SnippetsKolev E, Mircheva L, Edwards MR, Johnston SL, Kalinov K, Stange R, Gancitano G, Berghe WV, Kreft S.
Show Full Abstract
SARS-CoV-2 vaccination is effective in preventing severe Covid-19, but efficacy in reducing viral load and transmission wanes over time. In addition, the emergence of novel SARS-CoV-2 variants increases the threat of uncontrolled dissemination and additional antiviral therapies are urgently needed for effective containment. In previous <i>in vitro</i> studies <i>Echinacea purpurea</i> demonstrated strong antiviral activity against enveloped viruses, including SARS-CoV-2. In this study, we examined the potential of <i>Echinacea purpurea</i> in preventing and treating respiratory tract infections (RTIs) and in particular, SARS-CoV-2 infections. 120 healthy volunteers (m,f, 18-75 years) were randomly assigned to <i>Echinacea</i> prevention or control group without any intervention. After a run-in week, participants went through 3 prevention cycles of 2, 2 and 1 month with daily 2,400 mg <i>Echinacea purpurea</i> extract (Echinaforce<sup>®</sup>, EF). The prevention cycles were interrupted by breaks of 1 week. Acute respiratory symptoms were treated with 4,000 mg EF for up to 10 days, and their severity assessed <i>via</i> a diary. Naso/oropharyngeal swabs and venous blood samples were routinely collected every month and during acute illnesses for detection and identification of respiratory viruses, including SARS-CoV-2 <i>via</i> RT-qPCR and serology. Summarized over all phases of prevention, 21 and 29 samples tested positive for any virus in the EF and control group, of which 5 and 14 samples tested SARS-CoV-2 positive (RR = 0.37, Chi-square test, <i>p</i> = 0.03). Overall, 10 and 14 symptomatic episodes occurred, of which 5 and 8 were Covid-19 (RR = 0.70, Chi-square test, <i>p</i> > 0.05). EF treatment when applied during acute episodes significantly reduced the overall virus load by at least 2.12 log<sub>10</sub> or approx. 99% (<i>t</i>-test, <i>p</i> < 0.05), the time to virus clearance by 8.0 days for all viruses (Wilcoxon test, <i>p</i> = 0.02) and by 4.8 days for SARS-CoV-2 (<i>p</i> > 0.05) in comparison to control. Finally, EF treatment significantly reduced fever days (1 day vs 11 days, Chi-square test, <i>p</i> = 0.003) but not the overall symptom severity. There were fewer Covid-19 related hospitalizations in the EF treatment group (<i>N</i> = 0 vs <i>N</i> = 2). EF exhibited antiviral effects and reduced the risk of viral RTIs, including SARS-CoV-2. By substantially reducing virus loads in infected subjects, EF offers a supportive addition to existing mandated treatments like vaccinations. Future confirmatory studies are warranted.
Also flagged:VRK1Bladder Cancermalignant tumorsvaccinia-related kinase 1tumortumors
Journal Article2022-04-26✓ 3 SnippetsWu J, Li T, Ji H, Chen Z, Zhai B.
In-Text Gene Mentions
Discussion)
…VRK2 regulates tumor cell invasion through the over-activation of NFAT1 and the expression of cyclooxygenase 2 (Vázquez-Cedeira and Lazo, 2012).…
Discussion)
…which also includesVRK2and VRK3.…
Discussion)
…VRK2regulates tumor cell…
Show Full Abstract
Bladder cancer (BC) is one of the most common malignant tumors in the urinary system with growing morbidity and diagnostic rate in recent years. Therefore, identifying new molecular biomarkers that inhibit the progression of bladder cancer is needed for developing further therapeutics. This study found a new potential treatment target: vaccinia-related kinase 1 (VRK1) and explored the function and mechanism of VRK1 in the development of bladder cancer. First, TCGA database and tissue microarray analysis showed that VRK1 was significantly upregulated in bladder cancer. Kaplan-Meier survival analysis indicates that the OS and PFS of the VRK1 high expression group were significantly lower than the VRK1 low expression group (p = 0.002, p = 0.005). Cox multi-factor analysis results show that VRK1 expression is an independent risk factor affecting tumor progress. The maximum tumor diameter, staging, and adjuvant chemotherapy also have a certain impact on tumor progression (<i>p</i> < 0.05). In internal validation, the column C index is 0.841 (95% CI, 0.803-0.880). In addition, cell functional studies have shown that VRK1 can significantly inhibit the proliferation, migration, and invasiveness of bladder cancer cells. <i>In vivo</i>, nude mice transplanted tumors further prove that low VRK1 can significantly inhibit the proliferation capacity of bladder cancer cells. In summary, VRK1 expression is significantly related to the staging, grade, and poor prognosis of patients with bladder cancer. At the same time, <i>in vivo</i> and <i>in vitro</i> experiments have shown that downregulation of VRK1 can significantly inhibit the proliferation of bladder cancer cells. These findings provide a basis for using VRK1 as a potential therapeutic target for patients with bladder cancer.
Journal Article2022-04-26✓ 1 SnippetGuo Y, Wang B, Gao H, He C, Hua R, Gao L, Du Y, Xu J.
In-Text Gene Mentions
S I O 001029)
…Stress in RAS patients might also account for the alteration of the promoter region of the serotonin transporter (5-HTT) and result in decreased transcriptive activities for serotonin expression [118,119,123].…
Show Full Abstract
With the development of psychology and medicine, more and more diseases have found their psychological origins and associations, especially ulceration and other mucosal injuries, within the digestive system. However, the association of psychological factors with lesions of the oral mucosa, including oral squamous cell carcinoma (OSCC), burning mouth syndrome (BMS), and recurrent aphthous stomatitis (RAS), have not been fully characterized. In this review, after introducing the association between psychological and nervous factors and diseases, we provide detailed descriptions of the psychology and nerve fibers involved in the pathology of OSCC, BMS, and RAS, pointing out the underlying mechanisms and suggesting the clinical indications.
Also flagged:interferon-γVitamin Dmetabolismvitamin D 3CD3CD4
Journal Article2022-04-26✓ 1 SnippetBernicke B, Engelbogen N, Klein K, Franzenburg J, Borzikowsky C, Peters C, Janssen O, Junker R, Serrano R, Kabelitz D.
In-Text Gene Mentions
Introduction)
…notably BTN3A1 andBTN2A1[ 5 ,…
Show Full Abstract
In addition to its role in bone metabolism, vitamin D<sub>3</sub> exerts immunomodulatory effects and has been proposed to contribute to seasonal variation of immune cells. This might be linked to higher vitamin D<sub>3</sub> levels in summer than in winter due to differential sun exposure. γδ T cells comprise a numerically small subset of T cells in the blood, which contribute to anti-infective and antitumor immunity. We studied the seasonal fluctuation of γδ T cells, the possible influence of vitamin D<sub>3</sub>, and the effect of the active metabolite 1α,25(OH)<sub>2</sub>D<sub>3</sub> on the in vitro activation of human γδ T cells. In a retrospective analysis with 2625 samples of random blood donors, we observed higher proportions of γδ T cells in winter when compared with summer. In a prospective study over one year with a small cohort of healthy adults who did or did not take oral vitamin D<sub>3</sub> supplementation, higher proportions of γδ T cells were present in donors without oral vitamin D<sub>3</sub> uptake, particularly in spring. However, γδ T cell frequency in blood did not directly correlate with serum levels of 25(OH)D<sub>3</sub>. The active metabolite 1α,25(OH)<sub>2</sub>D<sub>3</sub> inhibited the in vitro activation of γδ T cells at the level of proliferation, cytotoxicity, and interferon-γ production. Our study reveals novel insights into the seasonal fluctuation of γδ T cells and the immunomodulatory effects of vitamin D<sub>3</sub>.
…overload, such ashemochromatosisor functional iron…
Show Full Abstract
Background: Anemia is the most common finding in patients with end-stage kidney disease undergoing renal replacement therapy. A certain percentage of patients does not respond adequately to erythropoietin (EPO) treatment, not being able to reach desirable hemoglobin levels even when treated with large-dose EPO and intravenous/oral iron. In our study, we wanted to further investigate how nutritional status is associated with erythropoietin responsiveness. To quantify EPO response, we used the Erythropoietin Resistance Index (ERI), which is defined as the weekly weight-adjusted dose of EPO divided by the hemoglobin level. Patients and methods: Seventy-eight patients undergoing hemodialysis were included. All of them were measured by a SECA mBCA body composition analyzer and evaluated by Kalantar-Zadeh’s MIS score. Routine biochemical tests were also taken into account. The Shapiro-Wilk test was used to study the distributions of quantitative variables, which were significantly different from normal (p < 0.05). We used nonparametric Mann-Whitney U-test to compare groups. Correlations were studied by means of Spearman’s rank correlation coefficient. Bonferroni correction for multiple testing was performed. To find independent determinants of ERI, we additionally performed multivariate analysis using the General Linear Model (GLM). Results: In terms of body composition, factors that are associated with high ERI are low BMI, low fat mass, low visceral fat volume, high total body water percentage, low phase angle and low fat-free mass. In addition to body composition parameters, total MIS score and IL-6 serum levels correlated positively with ERI value. IL-6 was an independent determinant of ERI value, based on multivariate analysis. After correction for multiple analysis, BMI and eGFR both remained significant factors associated with EPO response. Conclusions: It seems crucial to prevent inflammatory malnutrition as a part of a holistic approach to anemia treatment in dialysis patients.
Also flagged:Breast cancerhereditary breast cancerHBChereditary cancercancerBRCA
Journal Article2022-04-26✓ 5 SnippetsLiu Y, Helgadottir HT, Kharaziha P, Choi J, López-Giráldez F, Mane SM, Höiom V, Juhlin CC, Larsson C, Bajalica-Lagercrantz S.
In-Text Gene Mentions
Discussion)
…The FBXL4 gene is identified as a potential tumor suppressor in prostate cancer, since the loss of FBXL4 has been correlated with advanced tumor stage and poor survival [30].…
Results)
…MYH13 -rs767313943, andFBXL4-rs757154231, had CADD…
Results)
…the CLK1 gene,FBXL4, and MYH13 missense…
Discussion)
…TheFBXL4gene is identified…
Discussion)
…the loss ofFBXL4has been correlated…
Show Full Abstract
Breast cancer is the most prevalent malignancy among women worldwide and hereditary breast cancer (HBC) accounts for about 5−10% of the cases. Today, the most recurrent genes known are BRCA1 and BRCA2, accounting for around 25% of familial cases. Although thousands of loss-of-function variants in more than twenty predisposing genes have been found, the majority of familial cases of HBC remain unexplained. The aim of this study was to identify new predisposing genes for HBC in three non-BRCA families with autosomal dominant inheritance pattern using whole-exome sequencing and functional prediction tools. No pathogenic variants in known hereditary cancer-related genes could explain the breast cancer susceptibility in these families. Among 2122 exonic variants with maximum minor allele frequency (MMAF) < 0.1%, between 17−35 variants with combined annotation-dependent depletion (CADD) > 20 segregated with disease in the three analyzed families. Selected candidate genes, i.e., UBASH3A, MYH13, UTP11L, and PAX7, were further evaluated using protein expression analysis but no alterations of cancer-related pathways were observed. In conclusion, identification of new high-risk cancer genes using whole-exome sequencing has been more challenging than initially anticipated, in spite of selected families with pronounced family history of breast cancer. A combination of low- and intermediate-genetic-risk variants may instead contribute the breast cancer susceptibility in these families.
<h4>Purpose</h4>Advances in clinical genomic sequencing capabilities, including reduced costs and knowledge gains, have bolstered the consideration of genomic screening in healthy adult populations. Yet, little is known about the existing landscape of genomic screening programs in the United States. It can be difficult to find information on current implementation efforts and best practices, particularly in light of critical questions about equity, cost, and benefit.<h4>Methods</h4>In 2020, we searched publicly available information on the Internet and the scientific literature to identify programs and collect information, including: setting, program funding, targeted population, test offered, and patient cost. Program representatives were contacted throughout 2020 and 2021 to clarify, update, and supplement the publicly available information.<h4>Results</h4>Twelve programs were identified. Information was available on key program features, such as setting, genes tested, and target populations. Data on costs, outcomes, or long-term sustainability plans were not always available. Most programs offered testing at no or significantly reduced cost due to generous pilot funding, although the sustainability of these programs remains unknown. Gene testing lists were diverse, ranging from 11 genes (CDC tier 1 genes) to 59 genes (ACMG secondary findings list v.2) to broad exome and genome sequencing. This diversity presents challenges for harmonized data collection and assessment of program outcomes.<h4>Conclusions</h4>Early programs are exploring the logistics and utility of population genomic screening in various settings. Coordinated efforts are needed to take advantage of data collected about uptake, infrastructure, and intervention outcomes to inform future research, evaluation, and program development.
A synthetic route for adhesive core-multishell (CMS) nanocarriers for application to the oral mucosa was established using mussel-inspired catechol moieties. The three CMS nanocarriers with 8%, 13%, and 20% catechol functionalization were evaluated for loading capacity using Nile red, showing an overall loading of 1 wt%. The ability of Nile red loaded and functionalized nanocarriers to bind to a moist mucosal surface was tested in two complementary adhesion assays under static and dynamic conditions using monolayers of differentiated gingival keratinocytes. Adhesion properties of functionalized nanocarriers were compared to the adhesion of the non-functionalized nanocarrier. In both assays, the CMS nanocarrier functionalized with 8% catechol exhibited the strongest adhesion compared to its catechol-free counterpart and the CMS nanocarriers functionalized with 13% and 20% catechol.
Also flagged:hyaluronic acidextracellularchronic liver diseasesnonalcoholic fatty liver diseaseNAFLDsteatosis
Journal Article2022-04-26✓ 1 SnippetGuveli H, Ovunc Kurdas O.
In-Text Gene Mentions
Methods)
…lpha-1 antitrypsin deficiency,hemochromatosis, and Wilson’s disease.…
Show Full Abstract
<h4>Background and aim</h4>Hyaluronic acid (HA), a fundamental component of the extracellular matrix, is associated with chronic liver diseases. The aim of this study was to investigate quantitative HA measurement as a noninvasive marker for steatosis and fibrosis staging in nonalcoholic fatty liver disease (NAFLD) with biopsy evidence.<h4>Materials and methods</h4>In this study, 52 NAFLD patients with biopsy evidence and who met the inclusion criteria were included. Hepatic enzyme levels, HA levels, and other laboratory findings were examined. In addition, the degree of steatosis was determined via computed tomography (CT).<h4>Results</h4>According to the degree of steatosis, HA levels were 29.17±22.66, 39.85±60.28, and 32.05±19.40, respectively, and no significant difference was found between the groups (p=0.584). In addition, HA levels were not found to be significant according to the degrees of steatohepatitis (p=0.860). However, a statistically significant relationship was found between steatosis levels detected by CT and biopsy (p<0.01).<h4>Conclusion</h4>Serum HA level, other biochemical parameters, and steatosis severity measurement via CT did not appear to have any diagnostic value for nonalcoholic steatohepatitis. In this context, novel markers that may be useful for NAFLD diagnosis and severity assessment in risky individuals should be investigated.
Also flagged:cholangiocarcinomatumoriCCAbiliary tract cancersampullary carcinomashepatocellular carcinoma
Journal Article2022-04-26No SnippetsCarotenuto M, Sacco A, Forgione L, Normanno N.
Show Full Abstract
Improving the survival of patients with cholangiocarcinoma (CCA) has long proved challenging, although the treatment of this disease nowadays is on advancement. The historical invariability of survival outcomes and the limited number of agents known to be effective in the treatment of this disease has increased the number of studies designed to identify genetic targetable hits that can be efficacious for novel therapies. In this respect, the increasing feasibility of molecular profiling starting either from tumor tissue or circulating cell-free DNA (cfDNA) has led to an increased understanding of CCA biology. Intrahepatic CCA (iCCA) and extrahepatic CCA (eCCA) display different and typical patterns of actionable genomic alterations, which offer opportunity for therapeutic intervention. This review article will summarize the current knowledge on the genomic alterations of iCCA and eCCA, provide information on the main technologies for genomic profiling using either tumor tissue or cfDNA, and briefly discuss the main clinical trials with targeted agents in this disease.
Also flagged:ExtracellularSynthesistranslationaltumorWntBMP
Journal Article2022-04-26✓ 5 SnippetsXu ZY, Huang JJ, Liu Y, Chen CW, Qu GW, Wang GF, Zhao Y, Wu XW, Ren JA.
In-Text Gene Mentions
Results)
…(e.g., LGR5 andOLFM4) were significantly…
Results)
…markers LGR5 andOLFM4, antimicrobial protein…
Results)
…markers LGR5 andOLFM4was confirmed in…
Results)
…markers LGR5 andOLFM4, their mRNA…
Results)
…( LGR5 andOLFM4) did not…
Show Full Abstract
Organoids hold inestimable therapeutic potential in regenerative medicine and are increasingly serving as an in vitro research platform. Still, their expanding applications are critically restricted by the canonical culture matrix and system. Synthesis of a suitable bioink of bioactivity, biosecurity, tunable stiffness, and printability to replace conventional matrices and fabricate customized culture systems remains challenging. Here, we envisaged a novel bioink formulation based on decellularized extracellular matrix (dECM) from porcine small intestinal submucosa for organoids bioprinting, which provides intestinal stem cells (ISCs) with niche-specific ECM content and biomimetic microstructure. Intestinal organoids cultured in the fabricated bioink exhibited robust generation as well as a distinct differentiation pattern and transcriptomic signature. This bioink established a new co-culture system able to study interaction between epithelial homeostasis and submucosal cells and promote organoids maturation after transplantation into the mesentery of immune-deficient NODSCID-gamma (NSG) mice. In summary, the development of such photo-responsive bioink has the potential to replace tumor-derived Matrigel and facilitate the application of organoids in translational medicine and disease modeling.
Also flagged:tissue plasminogen activatorstroketPA
Journal Article2022-04-25No SnippetsJeffries NO, Troendle JF, Geller NL.
Show Full Abstract
Jeffries et al. (2018) investigated testing for a treatment difference in the setting of a randomized clinical trial with a single outcome measured longitudinally over a series of common follow-up times while adjusting for covariates. That paper examined the null hypothesis of no difference at any follow-up time versus the alternative of a difference for at least one follow-up time. We extend those results here by considering multivariate outcome measurements, where each individual outcome is examined at common follow-up times. We consider the case where there is interest in first testing for a treatment difference in a global function of the outcomes (e.g., weighted average or sum) with subsequent interest in examining the individual outcomes, should the global function show a treatment difference. Testing is conducted for each follow-up time and may be performed in the setting of a group sequential trial. Testing procedures are developed to determine follow-up times for which a global treatment difference exists and which individual combinations of outcome and follow-up time show evidence of a difference while controlling for multiplicity in outcomes, follow-up, and interim analyses. These approaches are examined in a study evaluating the effects of tissue plasminogen activator on longitudinally obtained stroke severity measurements.
To fulfill virus replication and persistent infection in hosts, viruses have to find ways to compromise innate immunity, including timely impedance on antiviral RNases and inflammatory responses. Porcine reproductive and respiratory syndrome virus (PRRSV) is a major swine pathogen causing immune suppression. MALT1 is a central immune regulator in both innate and adaptive immunity. In this study, MALT1 was confirmed to be induced rapidly upon PRRSV infection and mediate the degradation of two anti-PRRSV RNases, MCPIP1 and N4BP1, relying on its proteolytic activity, consequently facilitating PRRSV replication. Multiple PRRSV nsps, including nsp11, nsp7β, and nsp4, contributed to MALT1 elicitation. Interestingly, the elevated expression of MALT1 began to decrease once intracellular viral expression reached a high enough level. Higher infection dose brought earlier MALT1 inflection. Further, PRRSV nsp6 mediated significant MALT1 degradation via ubiquitination-proteasome pathway. Downregulation of MALT1 suppressed NF-κB signals, leading to the decrease in proinflammatory cytokine expression. In conclusion, MALT1 expression was manipulated by PRRSV in an elaborate manner to antagonize precisely the antiviral effects of host RNases without excessive and continuous activation of inflammatory responses. These findings throw light on the machinery of PRRSV to build homeostasis in infected immune system for viral settlement. <b>IMPORTANCE</b> PRRSV is a major swine pathogen, suppresses innate immunity, and causes persistent infection and coinfection with other pathogens. As a central immune mediator, MALT1 plays essential roles in regulating immunity and inflammation. Here, PRRSV was confirmed to manipulate MALT1 expression in an accurate way to moderate the antiviral immunity. Briefly, multiple PRRSV nsps induced MALT1 protease to antagonize anti-PRRSV RNases N4BP1 and MCPIP1 upon infection, thereby facilitating viral replication. In contrast, PRRSV nsp6 downregulated MALT1 expression via ubiquitination-proteasome pathway to suppress the inflammatory responses upon infection aggravation, contributing to immune defense alleviation and virus survival. These findings revealed the precise expression control on MALT1 by PRRSV for antagonizing antiviral RNases, along with recovering immune homeostasis. For the first time, this study enlightens a new mechanism of PRRSV adapting antiviral innate immunity by modulating MALT1 expression.
<h4>Background</h4>Major depressive disorder (MDD) is an emotional condition that interferes with sufferers' work and daily life. Numerous studies have found that miRNAs play a significant role in the development of MDD and can be utilized as a biomarker for its diagnosis and therapy. However, there have been few studies on nerve-immunity interaction treatment for the brains of MMD patients.<h4>Methods</h4>The work is performed on microarray data. We analyzed the differences of miRNAs (GSE58105, GSE81152, GSE152267, and GSE182194) and mRNA (GSE19738, GSE32280, GSE44593, GSE53987, and GSE98793) in MDD and healthy samples from GEO datasets. FunRich was used to predict the transcription factors and target genes of the miRNAs, and TF and GO enrichment analyses were performed. Then, by comparing the differential expression of the anticipated target genes and five mRNAs, intersecting mRNAs were discovered. The intersecting genes were submitted to GO and KEGG analyses to determine their functions. These intersecting potential genes and pathways that linked to MDD in neurological and immunological aspects have been identified for future investigation.<h4>Results</h4>We discovered five hub genes: KCND2, MYT1L, GJA1, CHL1, and SNAP25, which were all up-regulated genes. However, in MMD, the equivalent miRNAs, hsa-miR-206 and hsa-miR-338-3p, were both down-regulated. These miRNAs can activate or inhibit the T cell receptor signal pathway, JAK-STAT and other signal pathways, govern immune-inflammatory response, neuronal remodeling, and mediate the onset and development of MMD Conclusions: The results of a thorough bioinformatics investigation of miRNAs and mRNAs in MDD showed that miR-338-3P and miR-206 might be effective biomarkers and possible therapeutic targets for the treatment of MDD via nerve-immunity interaction.
Also flagged:Pcdh8Pcdh18recombinasereproductionNestinTumor
Journal Article2022-04-25No SnippetsKleinberger I, Sanders E, Staes K, Van Troys M, Hirano S, Hochepied T, Lemeire K, Martens L, Ampe C, van Roy F.
Show Full Abstract
<h4>Background</h4>Nonclustered mouse protocadherin genes (Pcdh) encode proteins with a typical single ectodomain and a cytoplasmic domain with conserved motifs completely different from those of classic cadherins. Alternative splice isoforms differ in the size of these cytoplasmic domains. In view of the compelling evidence for gene silencing of protocadherins in human tumors, we started investigations on Pcdh functions in mouse cancer models.<h4>Methods</h4>For Pcdh10, we generated two mouse lines: one with floxed exon 1, leading to complete Pcdh10 ablation upon Cre action, and one with floxed exons 2 and 3, leading to ablation of only the long isoforms of Pcdh10. In a mouse medulloblastoma model, we used GFAP-Cre action to locally ablate Pcdh10 in combination with Trp53 and Rb1 ablation. From auricular tumors, that also arose, we obtained tumor-derived cell lines, which were analyzed for malignancy in vitro and in vivo. By lentiviral transduction, we re-expressed Pcdh10 cDNAs. RNA-Seq analyses were performed on these cell families.<h4>Results</h4>Surprisingly, not only medulloblastomas were generated in our model but also tumors of tagged auricles (pinnae). For both tumor types, ablation of either all or only long isoforms of Pcdh10 aggravated the disease. We argued that the perichondrial stem cell compartment is at the origin of the pinnal tumors. Immunohistochemical analysis of these tumors revealed different subtypes. We obtained several pinnal-tumor derived (PTD) cell lines and analyzed these for anchorage-independent growth, invasion into collagen matrices, tumorigenicity in athymic mice. Re-expression of either the short or a long isoform of Pcdh10 in two PTD lines counteracted malignancy in all assays. RNA-Seq analyses of these two PTD lines and their respective Pcdh10-rescued cell lines allowed to identify many interesting differentially expressed genes, which were largely different in the two cell families.<h4>Conclusions</h4>A new mouse model was generated allowing for the first time to examine the remarkable tumor suppression activity of protocadherin-10 in vivo. Despite lacking several conserved motifs, the short isoform of Pcdh10 was fully active as tumor suppressor. Our model contributes to scrutinizing the complex molecular mechanisms of tumor initiation and progression upon PCDH10 silencing in many human cancers.
Also flagged:Hepatitis CHep CHepatitisHepblood-borne infectioninfectious diseases
Journal Article2022-04-25No SnippetsHaukoos JS, Rowan SE, Galbraith JW, Rothman RE, Hsieh YH, Hopkins E, Houk RA, Toerper MF, Kamis KF, Morgan JR, Linas BP, Al-Tayyib AA, Gardner EM, Lyons MS, Sabel AL, White DAE, Wyles DL, DETECT Hep C Trials Investigators.
Show Full Abstract
<h4>Background</h4>Early identification of HCV is a critical health priority, especially now that treatment options are available to limit further transmission and provide cure before long-term sequelae develop. Emergency departments (EDs) are important clinical settings for HCV screening given that EDs serve many at-risk patients who do not access other forms of healthcare. In this article, we describe the rationale and design of The Determining Effective Testing in Emergency Departments and Care Coordination on Treatment Outcomes (DETECT) for Hepatitis C (Hep C) Screening Trial.<h4>Methods</h4>The DETECT Hep C Screening Trial is a multi-center prospective pragmatic randomized two-arm parallel-group superiority trial to test the comparative effectiveness of nontargeted and targeted HCV screening in the ED with a primary hypothesis that nontargeted screening is superior to targeted screening when identifying newly diagnosed HCV. This trial will be performed in the EDs at Denver Health Medical Center (Denver, CO), Johns Hopkins Hospital (Baltimore, MD), and the University of Mississippi Medical Center (Jackson, MS), sites representing approximately 225,000 annual adult visits, and designed using the PRECIS-2 framework for pragmatic trials. When complete, we will have enrolled a minimum of 125,000 randomized patient visits and have performed 13,965 HCV tests. In Denver, the Screening Trial will serve as a conduit for a distinct randomized comparative effectiveness trial to evaluate linkage-to-HCV care strategies. All sites will further contribute to embedded observational studies to assess cost effectiveness, disparities, and social determinants of health in screening, linkage-to-care, and treatment for HCV.<h4>Discussion</h4>When complete, The DETECT Hep C Screening Trial will represent the largest ED-based pragmatic clinical trial to date and all studies, in aggregate, will significantly inform how to best perform ED-based HCV screening.<h4>Trial registration</h4>ClinicalTrials.gov ID: NCT04003454 . Registered on 1 July 2019.
Also flagged:Necrotizing enterocolitisNECpathogenesisgastrointestinalgastrointestinal infectionpneumatosis
Journal Article2022-04-25✓ 4 SnippetsCai X, Golubkova A, Hunter CJ.
In-Text Gene Mentions
Introduction)
…The SNPs of the transmembrane protease serine 6 gene (TMPRSS6) rs855791, and the hemochromatosis gene (HFE) rs1800562 and rs1799945 are known to be associated with increased serum iron levels in adults.…
Introduction)
…rs855791, and thehemochromatosisgene (HFE) rs1800562…
Introduction)
…the hemochromatosis gene (HFE) rs1800562 and rs1799945…
I A O 0000606)
…Hemochromatosisgene, human homeostatic…
Show Full Abstract
Necrotizing enterocolitis (NEC) is a multifactorial and complex disease. Our knowledge of the cellular and genetic basis of NEC have expanded considerably as new molecular mechanisms have been identified. This article will focus on the current understanding of the molecular pathogenesis of NEC with a focus on the inflammatory, immune, infectious, and genetic mechanisms that drive disease development.
Also flagged:CXC chemokineschemokinestumourCXC chemokinepancreatic ductal adenocarcinomapancreatic cancer
Journal Article2022-04-25No SnippetsJing Y, Wang F, Zhang K, Chen Z.
Show Full Abstract
<h4>Background</h4>The prognosis of pancreatic cancer is poor, with a 5-year survival rate of less than 10%. Studies have shown that chemokines in the tumour microenvironment are often altered, which is associated with immune infiltration and the prognosis and survival of pancreatic cancer patients.<h4>Methods</h4>Multiomics and bioinformatics tools were used to clarify CXC chemokine expression and its role in the pancreatic ductal adenocarcinoma (PDAC) immune microenvironment.<h4>Results</h4>Most CXC chemokines were upregulated in pancreatic cancer and correlated with patient prognosis. CXC chemokines can activate cancer-related signalling pathways and affect immune infiltration. Furthermore, most CXC chemokines were significantly correlated with the abundance of macrophages, neutrophils and dendritic cells. CXCL5 was selected as a hub gene, and a variety of immune checkpoints, including PD-1/PD-L1 and CTLA-4, were identified.<h4>Conclusion</h4>Our study provides novel insights into CXC chemokine expression and its role in the PDAC immune microenvironment. These results can provide more data about prognostic biomarkers and therapeutic targets of PDAC.
Also flagged:pathogenesiscolitisIL-23(IL)-23immune responseinterferon
Journal Article2022-04-25✓ 1 SnippetChen L, He Z, Reis BS, Gelles JD, Chipuk JE, Ting AT, Spicer JA, Trapani JA, Furtado GC, Lira SA.
In-Text Gene Mentions
Results)
…, Tnfsf10 ,Htt, Jun ,…
Show Full Abstract
The food colorant Red 40 is an environmental risk factor for colitis development in mice with increased expression of interleukin (IL)-23. This immune response is mediated by CD4<sup>+</sup> T cells, but mechanistic insights into how these CD4<sup>+</sup> T cells trigger and perpetuate colitis have remained elusive. Here, using single-cell transcriptomic analysis, we found that several CD4<sup>+</sup> T-cell subsets are present in the intestines of colitic mice, including an interferon (IFN)-γ-producing subset. In vivo challenge of primed mice with Red 40 promoted rapid activation of CD4<sup>+</sup> T cells and caused marked intestinal epithelial cell (IEC) apoptosis that was attenuated by depletion of CD4<sup>+</sup> cells and blockade of IFN-γ. Ex vivo experiments showed that intestinal CD4<sup>+</sup> T cells from colitic mice directly promoted apoptosis of IECs and intestinal enteroids. CD4<sup>+</sup> T cell-mediated cytotoxicity was contact-dependent and required FasL, which promoted caspase-dependent cell death in target IECs. Genetic ablation of IFN-γ constrained IL-23- and Red 40-induced colitis development, and blockade of IFN-γ inhibited epithelial cell death in vivo. These results advance the understanding of the mechanisms regulating colitis development caused by IL-23 and food colorants and identify IFN-γ<sup>+</sup> cytotoxic CD4<sup>+</sup> T cells as a new potential therapeutic target for colitis.
Also flagged:XPproteasomeDNA polymerasesrestriction enzymesacetateagarose
Journal Article2022-04-25No SnippetsShi YM, Hirschmann M, Shi YN, Ahmed S, Abebew D, Tobias NJ, Grün P, Crames JJ, Pöschel L, Kuttenlochner W, Richter C, Herrmann J, Müller R, Thanwisai A, Pidot SJ, Stinear TP, Groll M, Kim Y, Bode HB.
Show Full Abstract
Microorganisms contribute to the biology and physiology of eukaryotic hosts and affect other organisms through natural products. Xenorhabdus and Photorhabdus (XP) living in mutualistic symbiosis with entomopathogenic nematodes generate natural products to mediate bacteria-nematode-insect interactions. However, a lack of systematic analysis of the XP biosynthetic gene clusters (BGCs) has limited the understanding of how natural products affect interactions between the organisms. Here we combine pangenome and sequence similarity networks to analyse BGCs from 45 XP strains that cover all sequenced strains in our collection and represent almost all XP taxonomy. The identified 1,000 BGCs belong to 176 families. The most conserved families are denoted by 11 BGC classes. We homologously (over)express the ubiquitous and unique BGCs and identify compounds featuring unusual architectures. The bioactivity evaluation demonstrates that the prevalent compounds are eukaryotic proteasome inhibitors, virulence factors against insects, metallophores and insect immunosuppressants. These findings explain the functional basis of bacterial natural products in this tripartite relationship.
Interstitial cystitis/bladder pain syndrome (IC/BPS) has a significant impact on quality of life, but the etiopathogenesis remains largely unknown. The bladder microenvironment of patients with IC/BPS to obtain biological evidence supporting diagnosis and novel therapy is systematically characterized. Single-cell RNA sequencing (scRNA-seq) and image mass cytometry (IMC) are applied to bladder biopsies of the IC/BPS cohort. A total of 42 distinct cell clusters are identified from different groups. The increased hyperactivated Th1-biased response, but not Th2-biased response, and decreased immunosuppressive Treg are elucidated in the bladder microenvironment of non-Hunner-type IC (NHIC)/Hunner-type IC (HIC). M2/M2-like macrophage extends in the HIC and M1-like macrophage extends in NHIC, all of which secrete a range of chemokines with different pattern. The pro-inflammatory mediators, TNF-α, produced by tissue-resident macrophages and IL6, by the inflammatory fibroblasts are identified as key mediators of IC/BPS pathogenesis. Additionally, a regulatory network between different cell types is observed as a shift from structural cell communication in unaffected normal bladder to a Macrophage-Endothelial-dominated interactome in NHIC/HIC. The results demonstrate the high heterogeneity in NHIC/HIC, and provide an essential resource for diagnosis, and treatment of IC/BPS in the future by highlighting the importance of the microenvironment of bladder mucosa.
Also flagged:GlialRobo1Rac1Cdc42cell divisionstem cell division
Journal Article2022-04-25✓ 1 Snippetde Torres-Jurado A, Manzanero-Ortiz S, Carmena A.
In-Text Gene Mentions
Abstract)
…Netrin-Frazzled/DCCsignaling modulates, through…
Show Full Abstract
Asymmetric stem cell division (ASCD) is a key mechanism in development, cancer, and stem cell biology. Drosophila neural stem cells, called neuroblasts (NBs), divide asymmetrically through intrinsic mechanisms. Here, we show that the extrinsic axon guidance cues Netrins, secreted by a glial niche surrounding larval brain neural stem cell lineages, regulate NB ASCD. Netrin-Frazzled/DCC signaling modulates, through Abelson kinase, Robo1 signaling threshold levels in Drosophila larval brain neural stem and progenitor cells of NBII lineages. Unbalanced Robo1 signaling levels induce ectopic NBs and progenitor cells due to failures in the ASCD process. Mechanistically, Robo1 signaling directly impinges on the intrinsic ASCD machinery, such as aPKC, Canoe/Afadin, and Numb, through the small GTPases Rac1 and Cdc42, which are required for the localization in mitotic NBs of Par-6, a Cdc42 physical partner and a core component of the Par (Par-6-aPKC-Par3/Bazooka) apical complex.
Also flagged:Histone chaperone ASF1RIF1Replication timing regulatory factor 1p53-binding protein 53BP1histone chaperoneASF1
Journal Article2022-04-25✓ 2 SnippetsTang M, Chen Z, Wang C, Feng X, Lee N, Huang M, Zhang H, Li S, Xiong Y, Chen J.
In-Text Gene Mentions
Results)
…the recruitment ofMMS22L/TONSL to ssDNA to…
Discussion)
…CAF-1 help recruitMMS22L/TONSL to ssDNA to…
Show Full Abstract
Replication timing regulatory factor 1 (RIF1) acts downstream of p53-binding protein 53BP1 to inhibit the resection of DNA broken ends, which plays critical roles in determining the DNA double-strand break repair pathway choice between nonhomologous end joining and homologous recombination (HR). However, the mechanism by which this choice is made is not yet clear. In this study, we identified that histone chaperone protein ASF1 associates with RIF1 and regulates RIF1-dependent functions in the DNA damage response. Similar to loss of RIF1, we found that loss of ASF1 resulted in resistance to poly (ADP-ribose) polymerase (PARP) inhibition in BRCA1-deficient cells with restored HR and decreased telomere fusion in telomeric repeat-binding protein 2 (TRF2)-depleted cells. Moreover, we showed that these functions of ASF1 are dependent on its interaction with RIF1 but not on its histone chaperone activity. Thus, our study supports a new role for ASF1 in dictating double-strand break repair choice. Considering that the status of 53BP1-RIF1 axis is important in determining the outcome of PARP inhibitor-based therapy in BRCA1- or HR-deficient cancers, the identification of ASF1 function in this critical pathway uncovers an interesting connection between these S-phase events, which may reveal new strategies to overcome PARP inhibitor resistance.
Also flagged:basement membrane proteininnervationaxonalnetrin-1NTN1growth cone
Journal Article2022-04-25✓ 1 SnippetCaplan IF, Hernandez-Morato I, Pitman MJ.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
Laminin-111 is a basement membrane protein that participates in motor innervation and reinnervation. During axonal pathfinding, laminin-111 interacts with netrin-1 (NTN1) and changes its attractant growth cone properties into repulsion. While previous models of recurrent laryngeal nerve (RLN) transection show increased Laminin-111 and NTN1 production after injury, developmental expression in the larynx has not been defined. This study investigates the expression of laminin-111 in laryngeal muscles during primary laryngeal innervation of Sprague Dawley rats. Adult larynges and embryos were sectioned for immunohistochemistry with βIII-Tubulin, laminin subunit α-1 (LAMA1), NTN1, and α-bungarotoxin. Sections were processed for single-molecule inexpensive RNA fluorescence in situ hybridization analysis of LAMA1 mRNA. LAMA1 expression increased in all intrinsic laryngeal muscles, except the medial thyroarytenoid (MTA), at E20.5. At E20.5 there was increased expression in the lateral thyroarytenoid (LTA) and posterior cricoarytenoid (PCA) compared to the MTA. NTN1 upregulation was limited to the LTA and lateral cricoarytenoid (LCA) at E16.5 without any increase in the MTA or PCA. LAMA1 and NTN1 expression did not strictly follow expected patterns relative to the known timing of innervation and does not appear to be acting similarly to its role following RLN injury. These differences between developmental and post-injury innervation provide targets for investigations of therapeutics after nerve injury.
Also flagged:NecroptosisClear cell renal cell carcinomaccRCCrenal cell carcinomadeathinflammatory responses
Journal Article2022-04-25✓ 2 SnippetsBao JH, Li JB, Lin HS, Zhang WJ, Guo BY, Li JJ, Fu LM, Sun YP.
In-Text Gene Mentions
Discussion)
…For example, LncRNA ZNFX1-AS1 targets miR-193a-3p/SDC1 to regulate cell proliferation, migration, and invasion of bladder cancer cells [38].…
Discussion)
…For example, LncRNAZNFX1-AS1 targets miR-193a-3p/SDC1 …
Show Full Abstract
Clear cell renal cell carcinoma (ccRCC) is the most common histological and devastating subtype of renal cell carcinoma. Necroptosis is a form of programmed cell death that causes prominent inflammatory responses. miRNAs play a significant role in cancer progression through necroptosis. However, the prognostic value of necroptosis-related miRNAs remains ambiguous. In this study, 39 necroptosis-related miRNAs (NRMs) were extracted and 17 differentially expressed NRMs between normal and tumor samples were identified using data form The Cancer Genome Atlas (TCGA). After applying univariate Cox proportional hazard regression analysis and LASSO Cox regression model, six necroptosis-related miRNA signatures were identified in the training cohort and their expression levels were verified by qRT-PCR. Using the expression levels of these miRNAs, all patients were divided into the high- and low-risk groups. Patients in the high-risk group showed poor overall survival (<i>P</i> < 0.0001). Time-dependent ROC curves confirmed the good performance of our signature. The results were verified in the testing cohort and the entire TCGA cohort. Univariate and multivariate Cox regression models demonstrated that the risk score was an independent prognostic factor. Additionally, a predictive nomogram with good performance was constructed to enhance the implementation of the constructed signature in a clinical setting. We then employed miRBD, miRTarBase, and TargetScan to predict the target genes of six necroptosis-related miRNAs. Gene ontology and Kyoto Encyclopedia of Genes and Genomes analyses indicated that 392 potential target genes were enriched in cell proliferation-related biological processes. Six miRNAs and 59 differentially expressed target genes were used to construct an miRNA-mRNA interaction network, and 11 hub genes were selected for survival and tumor infiltration analysis. Drug sensitivity analysis revealed potential drugs that may contribute to cancer management. Hence, necroptosis-related genes play an important role in cancer biology. We developed, for the first time, a necroptosis-related miRNA signature to predict ccRCC prognosis.
Also flagged:Curcumincolon carcinomapolyacrylamideGSTP1Colorectal carcinomacancer
Journal Article2022-04-25✓ 5 SnippetsLi L, Yu L, Cao X, Zhang C, Liu Q, Chen J.
In-Text Gene Mentions
Discussion)
…Our research suggested that GSTP1 and PRDX6 might take part in the MDR of human colon carcinoma.…
Results)
…As indicated in Figure 6, GSTP1and PRDX6 were reduced in the curcumin-treated HCT-8/VCR cells, while similar decrease patterns were observed for mRNAs of GSTP1 and PRDX6 in the curcumin-treated HCT-8/VCR cells according to the two-DE and Western blotting analysis.…
Results)
…As shown in Figure 5, GSTP1 and PRDX6 were decreased in the curcumin-treated HCT-8/VCR cells, consistent using the data shown in Figure 2 obtained using proteomic approach.…
To further explore the mechanisms of curcumin reversing multidrug resistance (MDR) in HCT8/VCR cells. Here, we employed comparative analysis of proteomic of essential proteins of human colon carcinoma HCT8/VCR cells with or without treatment of curcumin by separating and quantifying the essential protein posttranslational modification through radical-free two-dimensional polyacrylamide gel electrophoresis with strong reductant. The reverse impact of curcumin on multidrug resistance of HCT8/VCR and HCT8/VCR cells was evaluated using MTT assay. After adding curcumin 25 <i>μ</i>M for 72 h, by 2-DE and mass spectrometry, twenty proteins were certified with changed expression levels. Three protein sites were upregulated and seventeen protein sites were downregulated in curcumin-treated HCT-8/VCR. Verification analyses were conducted using RT-PCR and Western blotting for downregulated proteins including GSTP1 and PRDX6. The proteins might have a direct or indirect contact with multidrug resistance. The finding of the research would provide novel sights for systematically comprehending the mechanisms of the reversal impacts of curcumin on MDR in HCT8/VCR cells and contribute to the recognition and application of new markers in clinical practice.
Also flagged:Nasopharyngeal CarcinomaGene Expressionoocyte maturationcytokinecell cycle-cancer
Journal Article2022-04-25✓ 5 SnippetsYue H, Zhu H, Luo D, Du Q, Xie Y, Huang S, Liu W.
In-Text Gene Mentions
Discussion)
…These studies show that VRK2 plays an important role in tumor metastasis, suggesting that VRK2 may be a biomarker for predicting metastasis in NPC patients after treatment, but its specific mechanism needs further experiments.…
Discussion)
…Vázquez-Cedeira et al. [26] confirmed for the first time that human VRK2 regulated the target and function of cancer cell invasion through the NFAT pathway and COX-2 expression.…
Discussion)
…VRK2-encoded proteins are effectors of signaling pathways that regulate tumor cell apoptosis and growth [25].…
Abstract)
…identified to beVRK2.…
Abstract)
…The expression ofVRK2in NPC samples…
Show Full Abstract
In this study, bioinformatics tools were used to identify key genes to study the molecular mechanism of nasopharyngeal carcinoma (NPC) development and to explore the correlation of these key genes with the recurrence and metastasis of NPC. The GSE61218 microarray dataset obtained from the Gene Expression Omnibus Database (GEO) was used. The limma R package was used to screen differentially expressed genes (DEGs) between NPC and normal nasopharyngeal (NP) tissues. KEGG functional enrichment was performed on these selected DEGs. Protein-protein interaction (PPI) networks were constructed using Cytoscape software to identify key node proteins. The NPC-metastasis microarray dataset GSE103611 was obtained from GEO to analyze the expression of DEGs in NPC metastasis. A total of 239 DEGs were identified. DEGs were mainly enriched in oocyte maturation-related pathways, cytokine-related pathways, cell cycle-related pathways, cancer-related pathways, and homologous recombination-related pathways. In addition, the top 10 nodes with the higher degree in the DEG PPI network were as follows: CDK1, CCNB2, BUB1, CCNA2, AURKB, BUB1B, MAD2L1, NDC80, BIRC5, and CENPF. The results indicated that DEGs may be involved in the pathogenesis of NPC by regulating cell cycle and mitosis, which can be used as molecular biomarkers for the diagnosis of NPC. In addition, we identified 87 DEGs with FC > 2 and <i>P</i> < 0.01 from the metastasis spectrum of NPC. The intersection gene between DEGs of NPC and normal NP tissue samples and those of the metastatic spectrum of NPC was identified to be VRK2. The expression of VRK2 in NPC samples was significantly higher than that in normal NP tissue, and similarly, VRK2 expression was significantly upregulated in metastatic samples compared with nonmetastatic samples (<i>P</i> < 0.05). Therefore, VRK2 may be a biomarker for predicting the metastasis of NPC patients after treatment.
…When POU3F2 is overexpressed in NSCs, several genes which are differentially expressed in the prefrontal cortex of people suffering from schizophrenia and bipolar disorder, are dysregulated.…
S I O 001029)⭐ same-sentence co-mention
…POU3F2 and PAX6 were found to regulate the transcription of TRIM8 (Ding et al., 2021) as well as the VRK2 (Pearl et al., 2019), other genes associated with schizophrenia and bipolar disorder (Gandal et al., 2018; Li et al., 2018; Ding et al., 2021).…
S I O 001029)
…Pou3f2 is located on human chromosome 6q16.1 and dysregulation of this gene has been reported in disorders such as schizophrenia and bipolar disorder, as well as in melanoma (Table 3; Goodall et al., 2004a; Simmons et al., 2017; Chen et al., 2018; Ding et al., 2021).…
S I O 001029)
…Upregulation of POU3F2 represses Microphthalmia-associated transcription factor (MITF) expression in some melanomas by binding to its promoter region, which drives the cells to adopt a more stem-like and aggressive phenotype (Goodall et al., 2004a; Bonvin et al., 2012).…
S I O 001029)
…POU3f2 has been found to be associated with schizophrenia and bipolar disorder, as a hub for a gene regulatory network related to these disorders (Potkin et al., 2009; Mühleisen et al., 2014; Chen et al., 2018; Pearl et al., 2019; Ding et al., 2021).…
Show Full Abstract
Forebrain development in vertebrates is regulated by transcription factors encoded by homeobox, bHLH and forkhead gene families throughout the progressive and overlapping stages of neural induction and patterning, regional specification and generation of neurons and glia from central nervous system (CNS) progenitor cells. Moreover, cell fate decisions, differentiation and migration of these committed CNS progenitors are controlled by the gene regulatory networks that are regulated by various homeodomain-containing transcription factors, including but not limited to those of the <i>Pax</i> (paired), <i>Nkx</i>, <i>Otx</i> (orthodenticle), <i>Gsx/Gsh</i> (genetic screened), and <i>Dlx</i> (distal-less) homeobox gene families. This comprehensive review outlines the integral role of key homeobox transcription factors and their target genes on forebrain development, focused primarily on the telencephalon. Furthermore, links of these transcription factors to human diseases, such as neurodevelopmental disorders and brain tumors are provided.
Also flagged:SynapseCCPCUBsynapsesTSP-1innate immunity
Journal Article2022-04-25No SnippetsGonzález-Calvo I, Cizeron M, Bessereau JL, Selimi F.
Show Full Abstract
The appearance of synapses was a crucial step in the creation of the variety of nervous systems that are found in the animal kingdom. With increased complexity of the organisms came a greater number of synaptic proteins. In this review we describe synaptic proteins that contain the structural domains CUB, CCP, or TSP-1. These domains are found in invertebrates and vertebrates, and CUB and CCP domains were initially described in proteins belonging to the complement system of innate immunity. Interestingly, they are found in synapses of the nematode <i>C. elegans</i>, which does not have a complement system, suggesting an ancient function. Comparison of the roles of CUB-, CCP-, and TSP-1 containing synaptic proteins in various species shows that in more complex nervous systems, these structural domains are combined with other domains and that there is partial conservation of their function. These three domains are thus basic building blocks of the synaptic architecture. Further studies of structural domains characteristic of synaptic proteins in invertebrates such as <i>C. elegans</i> and comparison of their role in mammals will help identify other conserved synaptic molecular building blocks. Furthermore, this type of functional comparison across species will also identify structural domains added during evolution in correlation with increased complexity, shedding light on mechanisms underlying cognition and brain diseases.
Also flagged:Gestational Diabetes MellitusmacrosomiaPhosphatidylinositol 3'-kinaseAktJanus kinasesignal transducers and activators of transcription
Journal Article2022-04-25✓ 2 SnippetsYuan Y, Li Y, Hu L, Wen J.
In-Text Gene Mentions
Results)
…Based on FC ≥ |3.0|, P < 0.001, and relatively high abundance, we then selected 5 mRNAs (NUTM1, GDF3, C17orf105, PROM1, and NFE2L1), 10 lncRNAs (AC073912.1, IL10RB-DT:19, lnc-FAM49B-4:1, lnc-ZFHX3-7:1, AC006064.4, lnc-HPS6-1:1, lnc-SEC11A-2:1, lnc-CAPZA3-3:2, lnc-TNFSF13B-2:1, and lnc-SOX6-1:1), and 10 circRNAs (circ_0012756, circ_0041183, circ_0065086, circ_0014635, circ_0075695, circ_0074153, circ_0068824, circ_0048469, circ_0066837, and circ_0026688) and validated their expression in cord blood exosomes from 20 patients with GDM-M and 20 controls.…
Results)
…:2, lnc-TNFSF13B-2:1, and lnc-SOX6-1:1), and 10 circRNAs…
Show Full Abstract
<h4>Introduction</h4>Exosomes are cell-derived vesicles that are present in many biological fluids. Exosomal RNAs in cord blood may allow intercellular communication between mother and fetus. We aimed to establish exosomal RNA expression profiles in cord blood from patients with gestational diabetes mellitus and macrosomia (GDM-M) and evaluate their prediction performance.<h4>Methods</h4>We used microarray technology to establish the differential messenger RNA (mRNA), long non-coding RNA (lncRNA), and circular RNA (circRNA) expression profiles in cord blood exosomes from 3 patients with GDM-M compared with 3 patients with GDM and normal neonatal weight, followed by qPCR validation in an additional 40 patients with GDM. Logistic regression, receiver operating characteristic (ROC) curves, and graphical nomogram were applied to evaluate the performance of exosomal RNA (in peripheral blood) in macrosomia prediction.<h4>Results</h4>A total of 98 mRNAs, 372 lncRNAs, and 452 circRNAs were differentially expressed in cord blood exosomes from patients with GDM-M. Pathway analysis based on screening data showed that the differential genes were associated with Phosphatidylinositol 3'-kinase (PI3acK)-Akt signaling pathway, Janus kinase/signal transducers and activators of transcription (JAK/STAT) signaling pathway, Transforming growth factor (TGF)-beta signaling pathway, insulin resistance, glycerolipid metabolism, fatty acid degradation, and mammalian target of rapamycin (mTOR) signaling pathway. After validation by qPCR, the expressions of GDF3, PROM1, AC006064.4, lnc-HPS6-1:1, and circ_0014635 were significantly increased and the expression of lnc-ZFHX3-7:1 was significantly decreased in cord blood exosomes of an additional 20 patients with GDM-M. The risk prediction performance of the expression of these validated genes (in peripheral blood exosomes) for GDM-related macrosomia was also evaluated. Only GDF3 expression and AC006064.4 expression showed well prediction performance [area under the curve (AUC) = 0.78 and 0.74, respectively]. Excitingly, the model including maternal age, fasting plasma glucose, 2-h plasma glucose, GDF3 expression, and AC006064.4 expression in peripheral blood exosomes had better prediction performance with an AUC of 0.86 (95% CI = 0.75-0.97).<h4>Conclusion</h4>These results showed that exosomal RNAs are aberrantly expressed in the cord blood of patients with GDM-M and highlighted the importance of exosomal RNAs in peripheral blood for GDM-M prediction.
<h4>Background</h4>The COVID-19 pandemic continues worldwide with fluctuating case numbers in the United States. This pandemic has affected every segment of the population with more recent hospitalizations in the pediatric population. Vertical transmission of COVID-19 is uncommon, but reports show that there are thrombotic, vascular, and inflammatory changes in the placenta to which neonates are prenatally exposed. Individuals exposed in utero to influenza during the 1918 pandemic had increased risk for heart disease, kidney disease, diabetes, stomach disease and hypertension. Early exposure of COVID-19 during fetal life may lead to altered gene expression with potential long-term consequences.<h4>Objective</h4>To determine if gene expression is altered in cord blood cells from term neonates who were exposed to COVID-19 during pregnancy and to identify potential gene pathways impacted by maternal COVID-19.<h4>Methods</h4>Cord blood was collected from 16 term neonates (8 exposed to COVID-19 during pregnancy and 8 controls without exposure to COVID-19). Genome-wide gene expression screening was performed using Human Clariom S gene chips on total RNA extracted from cord blood cells.<h4>Results</h4>We identified 510 differentially expressed genes (374 genes up-regulated, 136 genes down-regulated, fold change ≥1.5, <i>p</i>-value ≤ 0.05) in cord blood cells associated with exposure to COVID-19 during pregnancy. Ingenuity Pathway Analysis identified important canonical pathways associated with diseases such as cardiovascular disease, hematological disease, embryonic cancer and cellular development. Tox functions related to cardiotoxicity, hepatotoxicity and nephrotoxicity were also altered after exposure to COVID-19 during pregnancy.<h4>Conclusions</h4>Exposure to COVID-19 during pregnancy induces differential gene expression in cord blood cells. The differentially expressed genes may potentially contribute to cardiac, hepatic, renal and immunological disorders in offspring exposed to COVID-19 during pregnancy. These findings lead to a further understanding of the effects of COVID-19 exposure at an early stage of life and its potential long-term consequences as well as therapeutic targets.
Endomembrane alkali cation (Na<sup>+</sup>, K<sup>+</sup>)/proton (H<sup>+</sup>) exchangers (eNHEs) are increasingly associated with neurological disorders. These eNHEs play integral roles in regulating the luminal pH, processing, and trafficking of cargo along the secretory (Golgi and post-Golgi vesicles) and endocytic (early, recycling, and late endosomes) pathways, essential regulatory processes vital for neuronal development and plasticity. Given the complex morphology and compartmentalization of multipolar neurons, the contribution of eNHEs in maintaining optimal pH homeostasis and cargo trafficking is especially significant during periods of structural and functional development and remodeling. While the importance of eNHEs has been demonstrated in a variety of non-neuronal cell types, their involvement in neuronal function is less well understood. In this review, we will discuss their emerging roles in excitatory synaptic function, particularly as it pertains to cellular learning and remodeling. We will also explore their connections to neurodevelopmental conditions, including intellectual disability, autism, and attention deficit hyperactivity disorders.
Also flagged:behaviouralcircadian rhythmssleepmental disorderscancerbrain-related disorders
Journal Article2022-04-25✓ 1 SnippetYalçin M, Mundorf A, Thiel F, Amatriain-Fernández S, Kalthoff IS, Beucke JC, Budde H, Garthus-Niegel S, Peterburs J, Relógio A.
In-Text Gene Mentions
S I O 001029)
…Notably, HTT, whose mutation leads to HD (Li et al., 2003), also exhibited differential rhythmicity (Figure 3A).…
Show Full Abstract
A variety of organisms including mammals have evolved a 24h, self-sustained timekeeping machinery known as the circadian clock (biological clock), which enables to anticipate, respond, and adapt to environmental influences such as the daily light and dark cycles. Proper functioning of the clock plays a pivotal role in the temporal regulation of a wide range of cellular, physiological, and behavioural processes. The disruption of circadian rhythms was found to be associated with the onset and progression of several pathologies including sleep and mental disorders, cancer, and neurodegeneration. Thus, the role of the circadian clock in health and disease, and its clinical applications, have gained increasing attention, but the exact mechanisms underlying temporal regulation require further work and the integration of evidence from different research fields. In this review, we address the current knowledge regarding the functioning of molecular circuits as generators of circadian rhythms and the essential role of circadian synchrony in a healthy organism. In particular, we discuss the role of circadian regulation in the context of behaviour and cognitive functioning, delineating how the loss of this tight interplay is linked to pathological development with a focus on mental disorders and neurodegeneration. We further describe emerging new aspects on the link between the circadian clock and physical exercise-induced cognitive functioning, and its current usage as circadian activator with a positive impact in delaying the progression of certain pathologies including neurodegeneration and brain-related disorders. Finally, we discuss recent epidemiological evidence pointing to an important role of the circadian clock in mental health.
Also flagged:Neurodegenerative diseasesagingAlzheimer's diseaseADsecretionpro-inflammatory chemokines
Journal Article2022-04-25No SnippetsZang X, Chen S, Zhu J, Ma J, Zhai Y.
Show Full Abstract
For decades, it has been widely believed that the blood-brain barrier (BBB) provides an immune privileged environment in the central nervous system (CNS) by blocking peripheral immune cells and humoral immune factors. This view has been revised in recent years, with increasing evidence revealing that the peripheral immune system plays a critical role in regulating CNS homeostasis and disease. Neurodegenerative diseases are characterized by progressive dysfunction and the loss of neurons in the CNS. An increasing number of studies have focused on the role of the connection between the peripheral immune system and the CNS in neurodegenerative diseases. On the one hand, peripherally released cytokines can cross the BBB, cause direct neurotoxicity and contribute to the activation of microglia and astrocytes. On the other hand, peripheral immune cells can also infiltrate the brain and participate in the progression of neuroinflammatory and neurodegenerative diseases. Neurodegenerative diseases have a high morbidity and disability rate, yet there are no effective therapies to stop or reverse their progression. In recent years, neuroinflammation has received much attention as a therapeutic target for many neurodegenerative diseases. In this review, we highlight the emerging role of the peripheral and central immune systems in neurodegenerative diseases, as well as their interactions. A better understanding of the emerging role of the immune systems may improve therapeutic strategies for neurodegenerative diseases.
Also flagged:lipidureaperoxisome proliferator-activated receptorPPARimmune responseIntestinal Injury
Journal Article2022-04-25✓ 1 SnippetHan L, Tao H, Kang L, Wang S, Diao Q, Han D, Cui K.
In-Text Gene Mentions
Results)
…APOA3, CP, AFM,SERPINC1, LTF , and…
Show Full Abstract
Early feeding regime has a substantial lifelong effect on lambs and weaning ewe's milk can lead to the intestinal injury of lambs. To explore the molecular regulatory mechanism of intestinal injury of lambs under weaning stress, the jejunum was conducted transcriptome and then integrated analyzed with our previous proteome data. A total of 255 upregulated genes and 285 downregulated genes were significantly identified. These genes showed low overlapping with differentially expressed proteins identified by isobaric tags for relative and absolute quantification (iTRAQ). However, according to their functions, the differentially expressed genes (DEGs) and proteins with the same expression trend were enriched for the similar Gene Ontology (GO) terms and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, such as intestinal lipid absorption, urea cycle, peroxisome proliferator-activated receptor (PPAR) signaling pathway, and ferroptosis. Furthermore, the DEGs, including <i>FABP2, ACSL3, APOA2, APOC3</i>, and <i>PCK1</i>, might play essential roles in intestinal lipid absorption and immune response through the PPAR signaling pathway and ferroptosis. This study could provide new insights into early lamb breeding at the molecular level.
<h4>Background</h4>We previously reported that the larval <i>Echinococcus granulosus</i> (<i>E. granulosus</i>) infection can expand the population of regulatory B cells in mice, thereby inhibiting the anti-infective immunity. However, the underlying mechanism is still largely unknown. This study further investigated the holistic transcriptomic profiles of total splenic B cells following the chronic infection of the parasite.<h4>Methods</h4>The infection model of larval <i>E. granulosus</i> was established by intraperitoneal inoculation with 2000 protoscolexes. Magnetic-Activated Cell Separation (MACS) was used to isolate the total splenic B cells. RNA sequencing was performed to screen the differentially expressed genes (DEGs) after infection. The expression of selected DEGs was verified using qRT-PCR. Gene Ontology (GO) analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, and Co-expression network analysis were applied to predict these DEGs' underlying biological processes, pathways, and interactions respectively.<h4>Results</h4>A total of 413 DEGs were identified in larval <i>E. granulosus</i> infected B cells, including 303 up- and 110 down-regulated genes. Notably, most DEGs related to inflammation and chemotaxis were significantly upregulated after infection. In line with these changes, significant expression upregulation of DEGs associated with fatty acid oxidation, lipid synthesis, lipolysis, lipid transport, and cholesterol biosynthesis, were observed in infected B cells. Co-expression network analysis showed an intimate interaction between these DEGs associated with immune and metabolism.<h4>Conclusions</h4>The present study revealed that the larval <i>E. granulosus</i> infection induces metabolic reprogramming of B cells, which provides a novel clue to clarify the immunoregulatory mechanism of B cells in parasitic infection.
The link between substance abuse and the development of schizophrenia remains elusive. In this study, we assessed the molecular and behavioural alterations associated with schizophrenia, opioid addiction, and opioid withdrawal using zebrafish as a biological model. Larvae of 2 days post fertilization (dpf) were exposed to domperidone (DMP), a dopamine-D2 dopamine D2 receptor antagonist, and morphine for 3 days and 10 days, respectively. MK801, an N-methyl-D-aspartate (NMDA) receptor antagonist, served as a positive control to mimic schizophrenia-like behaviour. The withdrawal syndrome was assessed 5 days after the termination of morphine treatment. The expressions of schizophrenia susceptibility genes, i.e., <i>pi3k</i>, <i>akt1</i>, <i>slc6a4</i>, <i>creb1</i> and <i>adamts2</i>, in brains were quantified, and the levels of whole-body cyclic adenosine monophosphate (cAMP), serotonin and cortisol were measured. The aggressiveness of larvae was observed using the mirror biting test. After the short-term treatment with DMP and morphine, all studied genes were not differentially expressed. As for the long-term exposure, <i>akt1</i> was downregulated by DMP and morphine. Downregulation of <i>pi3k</i> and <i>slc6a4</i> was observed in the morphine-treated larvae, whereas <i>creb1</i> and <i>adamts2</i> were upregulated by DMP. The levels of cAMP and cortisol were elevated after 3 days, whereas significant increases were observed in all of the biochemical tests after 10 days. Compared to controls, increased aggression was observed in the DMP-, but not morphine-, treated group. These two groups showed reduction in aggressiveness when drug exposure was prolonged. Both the short- and long-term morphine withdrawal groups showed downregulation in all genes examined except <i>creb1</i>, suggesting dysregulated reward circuitry function. These results suggest that biochemical and behavioural alterations in schizophrenia-like symptoms and opioid dependence could be controlled by common mechanisms.
Also flagged:geneneurodegenerative diseasesamyotrophic lateral sclerosisneurodegenerative disordersMultiple SclerosisMS
Journal Article2022-04-25✓ 5 SnippetsNguyen TPN, Kumar M, Fedele E, Bonanno G, Bonifacino T.
In-Text Gene Mentions
S I O 001029)
…In addition, this study also confirmed HD-signaling genes regulated by miR-128a, including HTT and Huntingtin interaction protein 1, have a crucial role in the disease.…
S I O 001029)
…Huntington’s disease (HD) is a neurodegenerative disease caused by CAG repeat expansion in the Huntingtin gene (HTT), including a complex net of pathogenic mechanisms [159,160,161].…
MicroRNAs (miRNAs) are essential post-transcriptional gene regulators involved in various neuronal and non-neuronal cell functions and play a key role in pathological conditions. Numerous studies have demonstrated that miRNAs are dysregulated in major neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease, multiple sclerosis, amyotrophic lateral sclerosis, or Huntington's disease. Hence, in the present work, we constructed a comprehensive overview of individual microRNA alterations in various models of the above neurodegenerative diseases. We also provided evidence of miRNAs as promising biomarkers for prognostic and diagnostic approaches. In addition, we summarized data from the literature about miRNA-based therapeutic applications via inhibiting or promoting miRNA expression. We finally identified the overlapping miRNA signature across the diseases, including miR-128, miR-140-5p, miR-206, miR-326, and miR-155, associated with multiple etiological cellular mechanisms. However, it remains to be established whether and to what extent miRNA-based therapies could be safely exploited in the future as effective symptomatic or disease-modifying approaches in the different human neurodegenerative disorders.
Also flagged:calcium hydrophosphatessaltsacetonecells proliferationCalciumPyrophosphate
Journal Article2022-04-25No SnippetsSafronova T, Kiselev A, Selezneva I, Shatalova T, Lukina Y, Filippov Y, Toshev O, Tikhonova S, Antonova O, Knotko A.
Show Full Abstract
Ceramic samples based on β-calcium pyrophosphate β-Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub> were prepared from powders of γ-calcium pyrophosphate γ-Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub> with preset molar ratios Ca/P = 1, 0.975 and 0.95 using firing at 900, 1000, and 1100 °C. Calcium lactate pentahydrate Ca(C<sub>3</sub>H<sub>5</sub>O<sub>3</sub>)<sub>2</sub>⋅5H<sub>2</sub>O and monocalcium phosphate monohydrate Ca(H<sub>2</sub>PO<sub>4</sub>)<sub>2</sub>⋅H<sub>2</sub>O were treated in an aqua medium in mechanical activation conditions to prepare powder mixtures with preset molar ratios Ca/P containing calcium hydrophosphates with Ca/P = 1 (precursors of calcium pyrophosphate Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub>). These powder mixtures containing calcium hydrophosphates with Ca/P = 1 and non-reacted starting salts were heat-treated at 600 °C after drying and disaggregation in acetone. Phase composition of all powder mixtures after heat treatment at 600 °C was presented by γ-calcium pyrophosphate γ-Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub> according to the XRD data. The addition of more excess of monocalcium phosphate monohydrate Ca(H<sub>2</sub>PO<sub>4</sub>)<sub>2</sub>·H<sub>2</sub>O (with appropriate molar ratio of Ca/P = 1) to the mixture of starting components resulted in lower dimensions of γ-calcium pyrophosphate (γ-Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub>) individual particles. The grain size of ceramics increased both with the growth in firing temperature and with decreasing molar ratio Ca/P of powder mixtures. Calcium polyphosphate (t <sub>melt</sub> = 984 °C), formed from monocalcium phosphate monohydrate Ca(H<sub>2</sub>PO<sub>4</sub>)<sub>2</sub>⋅H<sub>2</sub>O, acted similar to a liquid phase sintering additive. It was confirmed by tests in vitro that prepared ceramic materials with preset molar ratios Ca/P = 1, 0.975, and 0.95 and phase composition presented by β-calcium pyrophosphate β-Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub> were biocompatible and could maintain bone cells proliferation.
Also flagged:Diabetic KetoacidosisType 1 Diabetes MellitusT1DMpolydipsiaglucosehypokalemia
Journal Article2022-04-25✓ 1 SnippetBatwa M, Alharthi L, Ghazal R, Alsulami M, Slaghour R, Aljuhani R, Bakhsh A.
In-Text Gene Mentions
Methods)
…cystic fibrosis, orhemochromatosis, or who left…
Show Full Abstract
<h4>Background</h4>Diabetic ketoacidosis (DKA) is a life-threatening complication of type 1 diabetes mellitus (T1DM) and a leading cause of morbidity and mortality in children. We aim to assess the frequency, clinical characteristics, biochemical findings, and outcomes of DKA at the onset of T1DM in young children and adolescents.<h4>Design and methods</h4>This retrospective cohort study analyzed the medical records of patients ≤ 16 years old seen in the emergency department at King Abdulaziz University Hospital, Jeddah, Saudi Arabia, between April 2015 and June 2019. The severity of DKA was classified according to the International Society for Pediatric and Adolescent Diabetes (ISPAD) criteria.<h4>Results</h4>Out of 207 patients with T1DM, 53 presented with DKA as a new onset. The mean age was 8.51 ± 3.81 years, with the majority being 5-10 years old (52.8%). Polyuria (98.1%), polydipsia (86.8%), weight loss (62.3%), and abdominal pain and vomiting (45.3%) were the most frequent symptoms. Mean random blood glucose was 424.09 ± 108.67 mg/dL and mean venous pH was 7.15 ± 0.36 mmol/L. Of patients, 66% had no associated complications, 24.4% had hypokalemia, 20.8% developed hypoglycemia, and 18.9% developed hyperchloremic metabolic acidosis. One patient had cerebral edema and coma. Based on metabolic acidosis, 24.5% had mild DKA, an equal percentage had severe DKA, and 9.4% had moderate DKA. Of patients, 88.7% were admitted to the pediatric ward and 15.1% to the intensive care unit.<h4>Conclusion</h4>A total of 25% of patients diagnosed with T1DM below the age of 17 years presented with DKA. No permanent disabilities or deaths were reported. Forming a registry dedicated to T1DM is needed to follow up on these patients, especially among school-age children, as well as aid in the development of future research locally.
<h4>Background</h4>At a global level, the COVID-19 disease outbreak has had a major impact on health services and has induced disruption in routine care of health institutions, exposing cancer patients to severe risks. To provide uninterrupted tumor treatment throughout a pandemic lockdown is a major obstacle. Coronavirus disease (COVID-19) and its causative virus, SARS-CoV-2, stance considerable challenges for the management of oncology patients. COVID-19 presents particularly severe respiratory and systemic infection in aging and immunosuppressed individuals, including patients with cancer.<h4>Objective</h4>In the present review, we focused on emergent evidence from cancer sufferers that have been contaminated with COVID-19 and cancer patients who were at higher risk of severe COVID-19, and indicates that anticancer treatment may either rise COVID-19 susceptibility or have a duple therapeutic impact on cancer as well as COVID-19; moreover, how SARS-CoV-2 infection impacts cancer cells. Also, to assess the global effect of the COVID-19 disease outbreak on cancer and its treatment.<h4>Methods</h4>A literature survey was conducted using PubMed, Web of Science (WOS), Embase, Cochrane Library, China National Knowledge Infrastructure (CNKI), and VIral Protein domain DataBase (VIP DB) between Dec 1, 2019 and Sep 23, 2021, for studies on anticancer treatments in patients with COVID-19. The characteristics of the patients, treatment types, mortality, and other additional outcomes were extracted and pooled for synthesis.<h4>Results</h4>This disease has a huge effect on sufferers who have cancer(s). Sufferers of COVID-19 have a greater percentage of tumor diagnoses than the rest of the population. Likewise, cancer and highest proportion is lung cancer sufferers are more susceptible to COVID-19 constriction than the rest of the population.<h4>Conclusion</h4>Sufferers who have both COVID-19 and tumor have a considerably elevated death risk than single COVID-19 positive patients overall. During the COVID-19 pandemic, there was a reduction in the screening of cancer and detection, and also deferral of routine therapies, which may contribute to an increase in cancer mortality there in future.
Also flagged:immune responsesallergic diseasesallergic rhinitisCD40immune responseallergic airway diseases
Journal Article2022-04-24No SnippetsPeng YQ, Wu ZC, Xu ZB, Fang SB, Chen DH, Zhang HY, Liu XQ, He BX, Chen D, Akdis CA, Fu QL.
Show Full Abstract
Mesenchymal stromal cells (MSCs) are well known for their immunoregulatory roles on allergic inflammation particularly by acting on T cells, B cells, and dendritic cells (DCs). MSC-derived small extracellular vesicles (MSC-sEV) are increasingly considered as one of the main factors for the effects of MSCs on immune responses. However, the effects of MSC-sEV on DCs in allergic diseases remain unclear. MSC-sEV were prepared from the induced pluripotent stem cells (iPSC)-MSCs by anion-exchange chromatography, and were characterized with the size, morphology, and specific markers. Human monocyte-derived DCs were generated and cultured in the presence of MSC-sEV to differentiate the so-called sEV-immature DCs (sEV-iDCs) and sEV-mature DCs (sEV-mDCs), respectively. The phenotypes and the phagocytic ability of sEV-iDCs were analyzed by flow cytometry. sEV-mDCs were co-cultured with isolated CD4<sup>+</sup> T cells or peripheral blood mononuclear cells (PBMCs) from patients with allergic rhinitis. The levels of Th1 and Th2 cytokines produced by T cells were examined by ELISA and intracellular flow staining. And the following mechanisms were further investigated. We demonstrated that MSC-sEV inhibited the differentiation of human monocytes to iDCs with downregulation of the expression of CD40, CD80, CD86, and HLA-DR, but had no effects on mDCs with these markers. However, MSC-sEV treatment enhanced the phagocytic ability of mDCs. More importantly, using anti-IL-10 monoclonal antibody or IL-10Rα blocking antibody, we identified that sEV-mDCs suppressed the Th2 immune response by reducing the production of IL-4, IL-9, and IL-13 via IL-10. Furthermore, sEV-mDCs increased the level of Treg cells. Our study identified that mDCs treated with MSC-sEV inhibited the Th2 responses, providing novel evidence of the potential cell-free therapy acting on DCs in allergic airway diseases.
Also flagged:TNF-αZIKV infectionmicrocephalyneurologic diseaseinfectionviral infection
Journal Article2022-04-24✓ 4 SnippetsKung PL, Chou TW, Lindman M, Chang NP, Estevez I, Buckley BD, Atkins C, Daniels BP.
In-Text Gene Mentions
Results)
…The 13 genes with the lowest p value in this analysis included Nr4a2, Itgb3, and Slc7a5, which were downregulated by ZIKV infection, along with Nlgn1, Myt1l, Dpp6, Thsd7a, Hepcam, Syn3, Cacna1e, Met, Pyhin1, and Tor3a, which were upregulated by ZIKV infection (Fig. 1B).…
Results)
…, Syn3 ,Cacna1e, Met ,…
Results)
…(Fig. 5 B),Cacna1e(Fig. 5 C),…
Results)
…, Dpp6 ,Cacna1e, and Tor3a…
Show Full Abstract
<h4>Background</h4>Zika virus (ZIKV) is an emerging flavivirus of global concern. ZIKV infection of the central nervous system has been linked to a variety of clinical syndromes, including microcephaly in fetuses and rare but serious neurologic disease in adults. However, the potential for ZIKV to influence brain physiology and host behavior following apparently mild or subclinical infection is less well understood. Furthermore, though deficits in cognitive function are well-documented after recovery from neuroinvasive viral infection, the potential impact of ZIKV on other host behavioral domains has not been thoroughly explored.<h4>Methods</h4>We used transcriptomic profiling, including unbiased gene ontology enrichment analysis, to assess the impact of ZIKV infection on gene expression in primary cortical neuron cultures. These studies were extended with molecular biological analysis of gene expression and inflammatory cytokine signaling. In vitro observations were further confirmed using established in vivo models of ZIKV infection in immunocompetent hosts.<h4>Results</h4>Transcriptomic profiling of primary neuron cultures following ZIKV infection revealed altered expression of key genes associated with major psychiatric disorders, such as bipolar disorder and schizophrenia. Gene ontology enrichment analysis also revealed significant changes in gene expression associated with fundamental neurobiological processes, including neuronal development, neurotransmission, and others. These alterations to neurologic gene expression were also observed in the brain in vivo using several immunocompetent mouse models of ZIKV infection. Mechanistic studies identified TNF-α signaling via TNFR1 as a major regulatory mechanism controlling ZIKV-induced changes to neurologic gene expression.<h4>Conclusions</h4>Our studies reveal that cell-intrinsic innate immune responses to ZIKV infection profoundly shape neuronal transcriptional profiles, highlighting the need to further explore associations between ZIKV infection and disordered host behavioral states.
Human coronaviruses have been recently implicated in neurological sequelae by insufficiently understood mechanisms. We here identify an amino acid sequence within the HCoV-OC43 p65-like protein homologous to the evolutionarily conserved motif of myelin basic protein (MBP). Because MBP-derived peptide exposure in the sciatic nerve produces pronociceptive activity in female rodents, we examined whether a synthetic peptide derived from the homologous region of HCoV-OC43 (OC43p) acts by molecular mimicry to promote neuropathic pain. OC43p, but not scrambled peptides, induces mechanical hypersensitivity in rats following intrasciatic injections. Transcriptome analyses of the corresponding spinal cords reveal upregulation of genes and signaling pathways with known nociception-, immune-, and cellular energy-related activities. Affinity capture shows the association of OC43p with an Na<sup>+</sup> /K<sup>+</sup> -transporting ATPase, providing a potential direct target and mechanistic insight into virus-induced effects on energy homeostasis and the sensory neuraxis. We propose that HCoV-OC43 polypeptides released during infection dysregulate normal nervous system functions through molecular mimicry of MBP, leading to mechanical hypersensitivity. Our findings might provide a new paradigm for virus-induced neuropathic pain.
Also flagged:extracellularvesiclesischemic strokebrain injurycerebral ischemiaIL-4
Journal Article2022-04-24✓ 2 SnippetsLi Y, Liu Z, Song Y, Pan JJ, Jiang Y, Shi X, Liu C, Ma Y, Luo L, Mamtilahun M, Shi Z, Khan H, Xie Q, Wang Y, Tang Y, Zhang Z, Yang GY.
In-Text Gene Mentions
Introduction)
…through directly repressingSox6, PDGFRα and Lingo1…
Results)
…Lingo1, DLX2, PTEN,SOX6, TEME98 and Ascl1…
Show Full Abstract
<b>Rationale:</b> White matter repair is critical for the cognitive and neurological functional recovery after ischemic stroke. M2 microglia are well-documented to enhance remyelination and their extracellular vesicles (EVs) mediate cellular function after brain injury. However, whether M2 microglia-derived EVs could promote white matter repair after cerebral ischemia and its underlying mechanism are largely unknown. <b>Methods:</b> EVs were isolated from IL-4 treated microglia (M2-EVs) and untreated microglia (M0-EVs). Adult ICR mice subjected to 90-minute transient middle cerebral artery occlusion received intravenous EVs treatment for seven consecutive days. Brain atrophy volume, neurobehavioral tests were examined within 28 days following ischemia. Immunohistochemistry, myelin transmission electron microscope and compound action potential measurement were performed to assess white matter structural remodeling, functional repair and oligodendrogenesis. The effects of M2-EVs on oligodendrocyte precursor cells (OPCs) were also examined <i>in vitro</i>. EVs' miRNA sequencing, specific miR-23a-5p knockdown in M2-EVs and luciferase reporter assay were used to explore the underlying mechanism. <b>Results:</b> M2-EVs reduced brain atrophy volume, promoted functional recovery, oligodendrogenesis and white matter repair <i>in vivo</i>, increased OPC proliferation, survival and differentiation <i>in vitro</i>. miR-23a-5p was enriched in M2-EVs and could promote OPC proliferation, survival and maturation, while knocking down miR-23a-5p in M2-EVs reversed the beneficial effects of M2-EVs both <i>in vitro</i> and <i>in vivo</i>. Luciferase reporter assay showed that miR-23a-5p directly targeted Olig3. <b>Conclusion:</b> Our results demonstrated that M2 microglia could communicate to OPCs through M2-EVs and promote white matter repair via miR-23a-5p possibly by directly targeting Olig3 after ischemic stroke, suggesting M2-EVs is a novel and promising therapeutic strategy for white matter repair in stroke and demyelinating disease.
Patients with clear cell renal cell carcinoma (ccRCC) have poor survival outcomes, especially if it has metastasized. It is of paramount importance to identify biomarkers in genomic data that could help predict the aggressiveness of ccRCC and its resistance to drugs. Thus, we conducted a study with the aims of evaluating gene signatures and proposing a novel one with higher predictive power and generalization in comparison to the former signatures. Using ccRCC cohorts of the Cancer Genome Atlas (TCGA-KIRC) and International Cancer Genome Consortium (ICGC-RECA), we evaluated linear survival models of Cox regression with 14 signatures and six methods of feature selection, and performed functional analysis and differential gene expression approaches. In this study, we established a 13-gene signature (AR, AL353637.1, DPP6, FOXJ1, GNB3, HHLA2, IL4, LIMCH1, LINC01732, OTX1, SAA1, SEMA3G, ZIC2) whose expression levels are able to predict distinct outcomes of patients with ccRCC. Moreover, we performed a comparison between our signature and others from the literature. The best-performing gene signature was achieved using the ensemble method Min-Redundancy and Max-Relevance (mRMR). This signature comprises unique features in comparison to the others, such as generalization through different cohorts and being functionally enriched in significant pathways: Urothelial Carcinoma, Chronic Kidney disease, and Transitional cell carcinoma, Nephrolithiasis. From the 13 genes in our signature, eight are known to be correlated with ccRCC patient survival and four are immune-related. Our model showed a performance of 0.82 using the Receiver Operator Characteristic (ROC) Area Under Curve (AUC) metric and it generalized well between the cohorts. Our findings revealed two clusters of genes with high expression (SAA1, OTX1, ZIC2, LINC01732, GNB3 and IL4) and low expression (AL353637.1, AR, HHLA2, LIMCH1, SEMA3G, DPP6, and FOXJ1) which are both correlated with poor prognosis. This signature can potentially be used in clinical practice to support patient treatment care and follow-up.
Also flagged:GlycosyltransferasesCancercarbohydrateglycosyltransferaseglycolipidbiosynthesis
Journal Article2022-04-24✓ 5 SnippetsPucci M, Duca M, Malagolini N, Dall'Olio F.
In-Text Gene Mentions
Abstract)
…GALNT2, B4GALNT1, POFUT1,B4GALT5, B3GNT5 and ST3GAL2…
Methods)
…B4GALT5is the major…
Methods)
…B4GALT5increases the stemness…
Discussion)
…glycolipids, such asB4GALT5and B4GALNT1.…
Discussion)
…GALNT2, B4GALNT1, POFUT1,B4GALT5, B3GNT5 and ST3GAL2.…
Show Full Abstract
Background: Glycosylation changes are a main feature of cancer. Some carbohydrate epitopes and expression levels of glycosyltransferases have been used or proposed as prognostic markers, while many experimental works have investigated the role of glycosyltransferases in malignancy. Using the transcriptomic data of the 21 TCGA cohorts, we correlated the expression level of 114 glycosyltransferases with the overall survival of patients. Methods: Using the Oncolnc website, we determined the Kaplan−Meier survival curves for the patients falling in the 15% upper or lower percentile of mRNA expression of each glycosyltransferase. Results: Seventeen glycosyltransferases involved in initial steps of N- or O-glycosylation and of glycolipid biosynthesis, in chain extension and sialylation were unequivocally associated with bad prognosis in a majority of cohorts. Four glycosyltransferases were associated with good prognosis. Other glycosyltransferases displayed an extremely high predictive value in only one or a few cohorts. The top were GALNT3, ALG6 and B3GNT7, which displayed a p < 1 × 10−9 in the low-grade glioma (LGG) cohort. Comparison with published experimental data points to ALG3, GALNT2, B4GALNT1, POFUT1, B4GALT5, B3GNT5 and ST3GAL2 as the most consistently malignancy-associated enzymes. Conclusions: We identified several cancer-associated glycosyltransferases as potential prognostic markers and therapeutic targets.
Also flagged:indomethacinulcercarrageenanalkylmembranesmethoxy
Journal Article2022-04-24No SnippetsKuskov A, Nikitovic D, Berdiaki A, Shtilman M, Tsatsakis A.
Show Full Abstract
Nanoparticles are increasingly utilized as drug delivery agents. Previously, we have developed a drug delivery system based on amphiphilic derivatives of poly-N-vinylpyrrolidone (PVP-OD4000) with excellent biocompatibility. In the current study, we assessed the pharmacokinetics, anti-inflammatory profile, and ulcerogenic potential of indomethacin (IMC)-loaded PVP-OD4000 nanoparticles compared to the free drug. Wistar male rats were utilized for a pharmacokinetics study and an anti-inflammatory study. Loaded IMC exhibited a slower elimination rate (p < 0.05) and a higher blood plasma concentration at 8 and 24 h after intraperitoneal injection compared with free IMC. In addition, decreased uptake of loaded IMC in the liver and kidney compared to free IMC (p < 0.05) was detected. Furthermore, PVP-OD4000 nanoparticles loaded with IMC showed an enhanced anti-inflammatory effect compared to free IMC (p < 0.05) in carrageenan-induced and complete Freund’s adjuvant-induced−(CFA) sub-chronic and chronic paw edema treatment (p < 0.01; p < 0.01). Notably, upon oral administration of loaded IMC, animals had a significantly lower ulcer score and Paul’s Index (3.9) compared to the free drug (p < 0.05). The obtained results suggest that IMC loaded to PVP nanoparticles exhibit superior anti-inflammatory activity in vivo and a safe gastrointestinal profile and pose a therapeutic alternative for the currently available NSAIDs’ administration.
Also flagged:AzobenzeneHyaluronatetumorwatermetabolismoxygen
Journal Article2022-04-24No SnippetsLee S, Kim Y, Lee ES.
Show Full Abstract
In this study, we developed ultra-small hyaluronate dot particles that selectively release phototoxic drugs into a hypoxic tumor microenvironment. Here, the water-soluble hyaluronate dot (dHA) was covalently conjugated with 4,4'-azodianiline (Azo, as a hypoxia-sensitive linker) and Ce6 (as a photodynamic antitumor agent), producing dHA particles with cleavable Azo bond and Ce6 (dHA-Azo-Ce6). Importantly, the inactive Ce6 (self-quenched state) in the dHA-Azo-Ce6 particles was switched to the active Ce6 (dequenched state) via the Azo linker (-N=N-) cleavage in a hypoxic environment. In vitro studies using hypoxia-induced HeLa cells (treated with CoCl<sub>2</sub>) revealed that the dHA-Azo-Ce6 particle enhanced photodynamic antitumor inhibition, suggesting its potential as an antitumor drug candidate in response to tumor hypoxia.
Also flagged:ironiron overload disorderiron storage diseasehemosiderosisdeathoxygen
Journal Article2022-04-24✓ 1 SnippetRoth TL, Philpott M, Wojtusik J.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
A consequence of the poaching crisis is that managed rhinoceros populations are increasingly important for species conservation. However, black rhinoceroses (BR; <i>Diceros bicornis</i>) and Sumatran rhinoceroses (SR; <i>Dicerorhinus Sumatrensis</i>) in human care often store excessive iron in organ tissues, a condition termed iron overload disorder (IOD). IOD research is impeded by the challenge of accurately monitoring body iron load in living rhinoceroses. The goals of this study were to (i) determine if labile plasma iron (LPI) is an accurate IOD biomarker and (ii) identify factors associated with iron-independent serum oxidative reduction potential (ORP). Serum (106 samples) from SRs (<i>n</i> = 8), BRs (<i>n</i> = 28), white rhinoceros (<i>n</i> = 24) and greater one-horned rhinoceros (GOH; <i>n</i> = 16) was analysed for LPI. Samples from all four species tested positive for LPI, and a higher proportion of GOH rhinoceros samples were LPI positive compared with those of the other three species (<i>P</i> < 0.05). In SRs, the only LPI-positive samples were those from individuals clinically ill with IOD, but samples from outwardly healthy individuals of the other three species were LPI positive. Serum ORP was lower in SRs compared with that in the other three species (<i>P</i> < 0.001), and iron chelation only reduced ORP in the GOH species (<i>P</i> < 0.01; ~5%). Serum ORP sex bias was revealed in three species with males exhibiting higher ORP than females (<i>P</i> < 0.001), the exception being the SR in which ORP was low for both sexes. ORP was not associated with age or serum iron concentrations (<i>P</i> ≥ 0.05), but was positively correlated with ferritin (<i>P</i> < 0.01). The disconnect between LPI and IOD was unanticipated, and LPI cannot be recommended as a biomarker of advanced rhino IOD. However, data provide valuable insight into the complex puzzle of rhinoceros IOD.
Also flagged:autophagypathogenesisthyroid carcinomarelatedCDKN2AFGF7
Journal Article2022-04-23✓ 1 SnippetLi C, Yuan Q, Xu G, Yang Q, Hou J, Zheng L, Wu G.
In-Text Gene Mentions
Discussion)
…encoding the Huntington (HTT) gene, is expressed…
Show Full Abstract
<h4>Background</h4>Numerous studies have implicated autophagy in the pathogenesis of thyroid carcinoma. This investigation aimed to establish an autophagy-related gene model and nomogram that can help predict the overall survival (OS) of patients with differentiated thyroid carcinoma (DTHCA).<h4>Methods</h4>Clinical characteristics and RNA-seq expression data from TCGA (The Cancer Genome Atlas) were used in the study. We also downloaded autophagy-related genes (ARGs) from the Gene Set Enrichment Analysis website and the Human Autophagy Database. First, we assigned patients into training and testing groups. R software was applied to identify differentially expressed ARGs for further construction of a protein-protein interaction (PPI) network for gene functional analyses. A risk score-based prognostic risk model was subsequently developed using univariate Cox regression and LASSO-penalized Cox regression analyses. The model's performance was verified using Kaplan-Meier (KM) survival analysis and ROC curve. Finally, a nomogram was constructed for clinical application in evaluating the patients with DTHCA. Finally, a 7-gene prognostic risk model was developed based on gene set enrichment analysis.<h4>Results</h4>Overall, we identified 54 differentially expressed ARGs in patients with DTHCA. A new gene risk model based on 7-ARGs (CDKN2A, FGF7, CTSB, HAP1, DAPK2, DNAJB1, and ITPR1) was developed in the training group and validated in the testing group. The predictive accuracy of the model was reflected by the area under the ROC curve (AUC) values. Univariate and multivariate Cox regression analysis indicated that the model could independently predict the prognosis of patients with THCA. The constrained nomogram derived from the risk score and age also showed high prediction accuracy.<h4>Conclusions</h4>Here, we developed a 7-ARG prognostic risk model and nomogram for differentiated thyroid carcinoma patients that can guide clinical decisions and individualized therapy.
Also flagged:viral infectionAPOL6EIF4A2PARP11PSMA2ACE2 receptor
Journal Article2022-04-23✓ 4 SnippetsLi C, Wang R, Wu A, Yuan T, Song K, Bai Y, Liu X.
In-Text Gene Mentions
Results)
…Additionally, the ZNFX1 gene was reported in a study to be upregulated among severe COVID-19 cases who had asthma [13].…
Abstract)
…d-3p/PSMA2 and hsa-miR-23b-3p/ZNFX1pairs.…
Results)
…indicated that genesZNFX1, PSMA2, APOL6 and…
Results)
…Additionally, theZNFX1gene was reported…
Show Full Abstract
<h4>Background</h4>MicroRNAs (miRNAs) are a class of small non-coding RNA that can downregulate their targets by selectively binding to the 3' untranslated region (3'UTR) of most messenger RNAs (mRNAs) in the human genome. MiRNAs can interact with other molecules such as viruses and act as a mediator for viral infection. In this study, we examined whether, and to what extent, the SARS-CoV-2 virus can serve as a "sponge" for human miRNAs.<h4>Results</h4>We identified multiple potential miRNA/target pairs that may be disrupted during SARS-CoV-2 infection. Using miRNA expression profiles and RNA-seq from published studies, we further identified a highly confident list of 5 miRNA/target pairs that could be disrupted by the virus's miRNA sponge effect, namely hsa-miR-374a-5p/APOL6, hsa-let-7f-1-3p/EIF4A2, hsa-miR-374a-3p/PARP11, hsa-miR-548d-3p/PSMA2 and hsa-miR-23b-3p/ZNFX1 pairs. Using single-cell RNA-sequencing based data, we identified two important miRNAs, hsa-miR-302c-5p and hsa-miR-16-5p, to be potential virus targeting miRNAs across multiple cell types from bronchoalveolar lavage fluid samples. We further validated some of our findings using miRNA and gene enrichment analyses and the results confirmed with findings from previous studies that some of these identified miRNA/target pairs are involved in ACE2 receptor network, regulating pro-inflammatory cytokines and in immune cell maturation and differentiation.<h4>Conclusion</h4>Using publicly available databases and patient-related expression data, we found that acting as a "miRNA sponge" could be one explanation for SARS-CoV-2-mediated pathophysiological changes. This study provides a novel way of utilizing SARS-CoV-2 related data, with bioinformatics approaches, to help us better understand the etiology of the disease and its differential manifestation across individuals.
Peripartum cardiomyopathy (PPCM) is a condition with an incompletely understood etiology, although many risk factors for this disorder have been mentioned. Preeclampsia (PE) is a rare but undoubtedly very important cause of PPCM. Early recognition and prompt treatment of preeclampsia and peripartum cardiomyopathy are essential to optimize pregnancy outcomes. An extensive manual search of major electronic databases was conducted in November 2021. The following literature review provides a comprehensive discussion of peripartum cardiomyopathy and preeclampsia and quantifies the prevalence of PE in women with PPCM. The authors highlighted aspects such as epidemiology, risk factors, cardiovascular changes, diagnosis and clinical presentation, and management and complications. Accumulating data indicate that both conditions have a similar pathogenesis characterized by vascular abnormalities. In both conditions we can observe an increase in interleukin-6 and gamma interferon, CCL2/MCP1, and decreased SOD activity. sFLT1 (a soluble form of fms-like tyrosine kinase 1), a substance with antiangiogenic and probably cardiotoxic effects, may be important. Preeclampsia and peripartum cardiomyopathy are characterized by recurrence rates that follow a similar pattern in subsequent pregnancies, and mortality remains a concern. Our analysis highlights the need to better understand the co-morbidity of PE and PPCM, and the need to qualify patients for the same clinical trials because of the common origin of these conditions.
Also flagged:FerroptosisdeathironlipidGPX4chronic disease
Journal Article2022-04-23No SnippetsDu H, Ren X, Bai J, Yang W, Gao Y, Yan S.
Show Full Abstract
Ferroptosis is a multistep regulated cell death process induced by iron accumulation and lipid peroxidation. Classical GPX4-dependent pathway and GPX4-independent pathways can independently and synergistically inhibit ferroptosis and jointly maintain the oxidative balance of the body. WHO defines obesity as "a condition of abnormal or excessive fat accumulation in adipose tissue, to the extent that health may be impaired," and obesity is also defined as an adiposity-based chronic disease (ABCD). Obesity is a systemic disease that leads to metabolic abnormalities in various systems, resulting in a series of complications including obesity cardiomyopathy, atherosclerosis, nonalcoholic fatty liver disease, and diabetes mellitus. Emerging evidence shows that ferroptosis is closely associated with the occurrence and progression of various diseases. In recent years, ferroptosis has been found to play critical roles in obesity and its complications. This review discusses the mechanisms of how ferroptosis is initiated and controlled and discusses the research progress of ferroptosis in obesity and its complications.
Also flagged:Acute Diarrheamalnutritioninfectious diarrheagastroenteritisinfectionRotavirus infection
Journal Article2022-04-23No SnippetsBukhari NT, Parveen G, Ali PA, Sami A, Lashari Y, Mukhtar N, Bano R, Haider N, Khowaja AH, Kazmi SU.
Show Full Abstract
One of the common viral pathogens in infectious diarrhea is <i>Rotavirus</i>; in developing countries, it is a primary cause of deaths in children less than five years of age. This study was planned to find out the etiologic agents of acute watery diarrhea. In this study, 1465 stool samples were analyzed with the symptoms of acute diarrhea. Demographic data analysis showed no. of episodes of diarrhea, vomiting, and fever. All samples were checked by ELISA technique for the presence of <i>Rotavirus</i> circulating strains. More than 6% patients were found to be positive with Rotavirus. Common <i>Rotavirus</i> genotypes, including G2P4, G2P6, G3P4, G8P4, G8P6, G9P4, and G10P4, were detected in patients through RT-PCR. This study concluded that detection of rotavirus strain diversity and management of diarrheal patients may identify assortment of emerging strains and reduce emergence of antimicrobial resistance and repeated episodes of diarrhea, which may also help to avoid and manage the essential nutrients lost leading to malnutrition and stunted growth, as well as to reduce high mortality rate in young children less than five years.
Also flagged:Gliomassialic acidsbrain developmentcancercell surfaceglioma
Journal Article2022-04-23No SnippetsFigarella-Branger D, Colin C, Baeza-Kallee N, Tchoghandjian A.
Show Full Abstract
A2B5 IgM recognizes c-series gangliosides with three sialic acids. The aim of this review was to focus on A2B5 expression in the central nervous system and gliomas. In brain development, A2B5+ cells are recorded in areas containing multipotent neural stem cells (NSC). In adults, A2B5+ cells persist in neurogenic areas and in white matter where it identifies oligodendrocyte precursor cells (OPCs) but also cells with NSC properties. Although the expression of A2B5 has been widely studied in culture, where it characterizes bipotential glial progenitor cells, its expression in vivo is less characterized mainly because of technical issues. A new interest was given to the NSCs and OPCs since the discovery of cancer stem cells (CSC) in gliomas. Among other cell surface molecules, A2B5 has been identified as an accurate marker to identify glioma CSCs. We and others have shown that all types of gliomas express A2B5, and that only A2B5+ cells, and not A2B5- cells, can generate a tumor after orthotopic implantation in immunocompromised animals. Moreover, A2B5 epitope expression is positively correlated with stemness and tumor growth. This review highlights that A2B5 is an attractive target to tackle glioma CSCs, and a better characterization of its expression in the developing and adult CNS will benefit to a better understanding of gliomagenesis.
…IL-1β reduces the expression of the antioxidant enzyme Prdx6 in OA chondrocytes compared to unstimulated ones, and this effect is reversed by medium/large EVs.…
Show Full Abstract
The use of mesenchymal stem cells constitutes a promising therapeutic approach, as it has shown beneficial effects in different pathologies. Numerous in vitro, pre-clinical, and, to a lesser extent, clinical trials have been published for osteoarthritis. Osteoarthritis is a type of arthritis that affects diarthritic joints in which the most common and studied effect is cartilage degradation. Nowadays, it is known that osteoarthritis is a disease with a very powerful inflammatory component that affects the subchondral bone and the rest of the tissues that make up the joint. This inflammatory component may induce the differentiation of osteoclasts, the bone-resorbing cells. Subchondral bone degradation has been suggested as a key process in the pathogenesis of osteoarthritis. However, very few published studies directly focus on the activity of mesenchymal stem cells on osteoclasts, contrary to what happens with other cell types of the joint, such as chondrocytes, synoviocytes, and osteoblasts. In this review, we try to gather the published bibliography in relation to the effects of mesenchymal stem cells on osteoclastogenesis. Although we find promising results, we point out the need for further studies that can support mesenchymal stem cells as a therapeutic tool for osteoclasts and their consequences on the osteoarthritic joint.
Also flagged:Colon CancerColorectal cancercancerobesitymismatch repairhypermethylation
Journal Article2022-04-23✓ 1 SnippetEl Zarif T, Yibirin M, De Oliveira-Gomes D, Machaalani M, Nawfal R, Bittar G, Bahmad HF, Bitar N.
In-Text Gene Mentions
Introduction)
…TP53 , andDCCmutations [ 7…
Show Full Abstract
Colorectal cancer (CRC) is the third most common cancer in the world. Despite improvement in standardized screening methods and the development of promising therapies, the 5-year survival rates are as low as 10% in the metastatic setting. The increasing life expectancy of the general population, higher rates of obesity, poor diet, and comorbidities contribute to the increasing trends in incidence. Drug repurposing offers an affordable solution to achieve new indications for previously approved drugs that could play a protagonist or adjuvant role in the treatment of CRC with the advantage of treating underlying comorbidities and decreasing chemotherapy toxicity. This review elaborates on the current data that supports drug repurposing as a feasible option for patients with CRC with a focus on the evidence and mechanism of action promising repurposed candidates that are widely used, including but not limited to anti-malarial, anti-helminthic, anti-inflammatory, anti-hypertensive, anti-hyperlipidemic, and anti-diabetic agents.
Fabrication of functional scaffolds for tissue engineering and regenerative medicine applications requires material systems with precise control over cellular performance. 3D printing is a powerful technique to create highly complex and multicomponent structures with well-defined architecture and composition. In this review paper, we explore extrusion-based 3D printing methods (EBP, i.e., Near Field Electrospinning (NFES), Melt Electrowriting (MEW), Fused Deposition Modeling (FDM), and extrusion bioprinting) in terms of their ability to produce scaffolds with bio-instructive properties. These material systems provide spatio-temporal guidance for cells, allowing controlled tissue regeneration and maturation. Multiple physical and biochemical cues introduced to the EBP scaffolds are evaluated in their ability to direct cell alignment, proliferation, differentiation, specific ECM production, and tissue maturation. We indicate that the cues have different impacts depending on the material system, cell type used, or coexistence of multiple cues. Therefore, they must be carefully chosen based on the targeted application. We propose future directions in bio-instructive materials development, including such concepts as metamaterials, hybrid living materials, and 4D printing. The review gathers the knowledge essential for designing new materials with a controlled cellular response, fabrication of advanced engineered tissue, and developing a better understanding of cell biology, especially in response to the biomaterial.
Journal Article2022-04-23✓ 5 SnippetsVrtel P, Slavik L, Vodicka R, Stellmachova J, Prochazka M, Prochazkova J, Ulehlova J, Rohon P, Simurda T, Stasko J, Martinkova I, Vrtel R.
In-Text Gene Mentions
Abstract)
…The overall mutation detection rate was 67.7%, highest in PC deficiency (76.9%), and six variants were newly detected—SERPINC1 c.398A > T (p.Gln133Leu), PROC c.450C > A (p.Tyr150Ter), c.715G > C (p.Gly239Arg) and c.866C > G (p.Pro289Arg), and PROS1 c.1468delA (p.Ile490fs) and c.1931T > A (p.Ile644Asn).…
Abstract)
…were newly detected—SERPINC1c.398A > T…
Introduction)
…key anticoagulant proteins—SERPINC1, PROS1 ,…
Methods)
…where the genesSERPINC1, PROC ,…
Methods)
…the following genes:SERPINC1, PROC ,…
Show Full Abstract
The deficiency of natural anticoagulants—antithrombin (AT), protein C (PC), and protein S (PS)—is a highly predisposing factor for thrombosis, which is still underdiagnosed at the genetic level. We aimed to establish and evaluate an optimal diagnostic approach based on a high-throughput sequencing platform suitable for testing a small number of genes. A fast, flexible, and efficient method involving automated amplicon library preparation and target sequencing on the Ion Torrent platform was optimized. The cohort consisted of a group of 31 unrelated patients selected for sequencing due to repeatedly low levels of one of the anticoagulant proteins (11 AT-deficient, 13 PC-deficient, and 7 PS-deficient patients). The overall mutation detection rate was 67.7%, highest in PC deficiency (76.9%), and six variants were newly detected—SERPINC1 c.398A > T (p.Gln133Leu), PROC c.450C > A (p.Tyr150Ter), c.715G > C (p.Gly239Arg) and c.866C > G (p.Pro289Arg), and PROS1 c.1468delA (p.Ile490fs) and c.1931T > A (p.Ile644Asn). Our data are consistent with those of previous studies, which mostly used time-consuming Sanger sequencing for genotyping, and the indication criteria for molecular genetic testing were adapted to this process in the past. Our promising results allow for a wider application of the described methodology in clinical practice, which will enable a suitable expansion of the group of indicated patients to include individuals with severe clinical findings of thrombosis at a young age. Moreover, this approach is flexible and applicable to other oligogenic panels.
Also flagged:cancercancerstumoursTYAImmature teratomaDysembryoplastic neuroepithelial tumour
Journal Article2022-04-22✓ 1 SnippetTrotman J, Armstrong R, Firth H, Trayers C, Watkins J, Allinson K, Jacques TS, Nicholson JC, Burke GAA, Genomics England Research Consortium, Behjati S, Murray MJ, Hook CE, Tarpey P.
In-Text Gene Mentions
I A O 0000326)
…MLLT10…
Show Full Abstract
<h4>Background</h4>Whole-genome sequencing (WGS) of cancers is becoming an accepted component of oncological care, and NHS England is currently rolling out WGS for all children with cancer. This approach was piloted during the 100,000 genomes (100 K) project. Here we share the experience of the East of England Genomic Medicine Centre (East-GMC), reporting the feasibility and clinical utility of centralised WGS for individual children locally.<h4>Methods</h4>Non-consecutive children with solid tumours were recruited into the pilot 100 K project at our Genomic Medicine Centre. Variant catalogues were returned for local scrutiny and appraisal at dedicated genomic tumour advisory boards with an emphasis on a detailed exploration of potential clinical value.<h4>Results</h4>Thirty-six children, representing one-sixth of the national 100 K cohort, were recruited through our Genomic Medicine Centre. The diagnoses encompassed 23 different solid tumour types and WGS provided clinical utility, beyond standard-of-care assays, by refining (2/36) or changing (4/36) diagnoses, providing prognostic information (8/36), defining pathogenic germline mutations (1/36) or revealing novel therapeutic opportunities (8/36).<h4>Conclusion</h4>Our findings demonstrate the feasibility and clinical value of centralised WGS for children with cancer. WGS offered additional clinical value, especially in diagnostic terms. However, our experience highlights the need for local expertise in scrutinising and clinically interpreting centrally derived variant calls for individual children.
Also flagged:antibody-transcription factorsextracellularsignal transductiontranscriptional regulators
Journal Article2022-04-22✓ 2 SnippetsTurner DJ, Saveliev A, Salerno F, Matheson LS, Screen M, Lawson H, Wotherspoon D, Kranc KR, Turner M.
In-Text Gene Mentions
Results)
…Rc3h1, Caprin1, and…
Results)
…the role forRc3h1as limiting proliferation…
Show Full Abstract
To identify roles of RNA binding proteins (RBPs) in the differentiation or survival of antibody secreting plasma cells we performed a CRISPR/Cas9 knockout screen of 1213 mouse RBPs for their ability to affect proliferation and/or survival, and the abundance of differentiated CD138 + cells in vitro. We validated the binding partners CSDE1 and STRAP as well as the m<sup>6</sup>A binding protein YTHDF2 as promoting the accumulation of CD138 + cells in vitro. We validated the EIF3 subunits EIF3K and EIF3L and components of the CCR4-NOT complex as inhibitors of CD138 + cell accumulation in vitro. In chimeric mouse models YTHDF2-deficient plasma cells failed to accumulate.
Also flagged:Huntington's Diseasetranscription coactivatorYes-associated protein 1neurogenesisneurulationBMP4
Journal Article2022-04-22✓ 2 SnippetsPiccolo FM, Kastan NR, Haremaki T, Tian Q, Laundos TL, De Santis R, Beaudoin AJ, Carroll TS, Luo JD, Gnedeva K, Etoc F, Hudspeth AJ, Brivanlou AH.
In-Text Gene Mentions
Discussion)
…evidence that connectsHTTactivity to developmental…
Discussion)
…human of theHTT−/− genotype is…
Show Full Abstract
The Hippo pathway, a highly conserved signaling cascade that functions as an integrator of molecular signals and biophysical states, ultimately impinges upon the transcription coactivator Yes-associated protein 1 (YAP). Hippo-YAP signaling has been shown to play key roles both at the early embryonic stages of implantation and gastrulation, and later during neurogenesis. To explore YAP's potential role in neurulation, we used self-organizing neuruloids grown from human embryonic stem cells on micropatterned substrates. We identified YAP activation as a key lineage determinant, first between neuronal ectoderm and nonneuronal ectoderm, and later between epidermis and neural crest, indicating that YAP activity can enhance the effect of BMP4 stimulation and therefore affect ectodermal specification at this developmental stage. Because aberrant Hippo-YAP signaling has been implicated in the pathology of Huntington's Disease (HD), we used isogenic mutant neuruloids to explore the relationship between signaling and the disease. We found that HD neuruloids demonstrate ectopic activation of gene targets of YAP and that pharmacological reduction of YAP's transcriptional activity can partially rescue the HD phenotype.
Also flagged:E2FFGFR4transcription factorsCD36skeletal muscle diseaseDuchenne muscular dystrophy
Journal Article2022-04-22✓ 1 SnippetNalbandian M, Zhao M, Kato H, Jonouchi T, Nakajima-Koyama M, Yamamoto T, Sakurai H.
In-Text Gene Mentions
Results)
…, SOX3 ,SOX6, and PAX6…
Show Full Abstract
Human pluripotent stem cell-derived muscle progenitor cells (hiPSC-MuPCs) resemble fetal-stage muscle progenitor cells and possess in vivo regeneration capacity. However, the heterogeneity of hiPSC-MuPCs is unknown, which could impact the regenerative potential of these cells. Here, we established an hiPSC-MuPC atlas by performing single-cell RNA sequencing of hiPSC-MuPC cultures. Bioinformatic analysis revealed four cell clusters for hiPSC-MuPCs: <i>myocytes</i>, <i>committed</i>, <i>cycling</i>, and <i>noncycling progenitors</i> Using FGFR4 as a marker for <i>noncycling progenitors</i> and <i>cycling</i> cells and CD36 as a marker for <i>committed</i> and <i>myocyte</i> cells, we found that FGFR4+ cells possess a higher regenerative capacity than CD36<sup>+</sup> cells. We also identified the family of E2F transcription factors are key regulators of hiPSC-MuPC proliferation. Our study provides insights on the purification of hiPSC-MuPCs with higher regenerative potential and increases the understanding of the transcriptional regulation of hiPSC-MuPCs.
Also flagged:Dbr1metallophosphoesteraseirondeferoxaminespliceosomeriboprotein
Journal Article2022-04-22✓ 1 SnippetClark NE, Katolik A, Taggart AJ, Buerer L, Holloway SP, Miller N, Phillips JD, Farrell CP, Damha MJ, Fairbrother WG.
In-Text Gene Mentions
Results)
…6 from theSUDS3gene, is shown…
Show Full Abstract
In eukaryotic cells, intron lariats produced by the spliceosome contain a 2'5' phosphodiester linkage. The RNA lariat debranching enzyme, Dbr1, is the only enzyme known to hydrolyze this bond. Dbr1 is a member of the metallophosphoesterase (MPE) family of enzymes, and recent X-ray crystal structures and biochemistry data demonstrate that Dbr1 from <i>Entamoeba histolytica</i> uses combinations of Mn<sup>2+</sup>, Zn<sup>2+</sup>, and Fe<sup>2+</sup> as enzymatic cofactors. Here, we examine the kinetic properties and metal dependence of the Dbr1 homolog from <i>Saccharomyces cerevisiae</i> (yDbr1). Elemental analysis measured stoichiometric quantities of Fe and Zn in yDbr1 purified following heterologous expression <i>E. coli</i> We analyzed the ability of Fe<sup>2+</sup>, Zn<sup>2+</sup>, and Mn<sup>2+</sup> to reconstitute activity in metal-free apoenzyme. Purified yDbr1 was highly active, turning over substrate at 5.6 sec<sup>-1</sup>, and apo-yDbr1 reconstituted with Fe<sup>2+</sup> was the most active species, turning over at 9.2 sec<sup>-1</sup> We treated human lymphoblastoid cells with the iron-chelator deferoxamine and measured a twofold increase in cellular lariats. These data suggest that Fe is an important biological cofactor for Dbr1 enzymes.
Also flagged:neurodegenerative disordersPDagingtranscription factorsFoxa2alpha-synuclein
Journal Article2022-04-22✓ 3 SnippetsChalazonitis A, Rao M, Sulzer D.
In-Text Gene Mentions
Abstract)
…example, Foxa2 andSox6are expressed by…
Introduction)
…for their migration (Sox6), and for terminal…
I A O 0000615)
…the dopaminergic fate:Sox6and Foxa2 in…
Show Full Abstract
In addition to the well-known degeneration of midbrain dopaminergic neurons, enteric neurons can also be affected in neurodegenerative disorders such as Parkinson's disease (PD). Dopaminergic neurons have recently been identified in the enteric nervous system (ENS). While ENS dopaminergic neurons have been shown to degenerate in genetic mouse models of PD, analyses of their survival in enteric biopsies of PD patients have provided inconsistent results to date. In this context, this review seeks to highlight the distinctive and shared factors and properties that control the evolution of these two sets of dopaminergic neurons from neuronal precursors to aging neurons. Although their cellular sources and developmental times of origin differ, midbrain and ENS dopaminergic neurons express many transcription factors in common and their respective environments express similar neurotrophic molecules. For example, Foxa2 and Sox6 are expressed by both populations to promote the specification, differentiation, and long-term maintenance of the dopaminergic phenotype. Both populations exhibit sustained patterns of excitability that drive intrinsic vulnerability over time. In disorders such as PD, colon biopsies have revealed aggregation of alpha-synuclein in the submucosal plexus where dopaminergic neurons reside and lack blood barrier protection. Thus, these enteric neurons may be more susceptible to neurotoxic insults and aggregation of α-synuclein that spreads from gut to midbrain. Under sustained stress, inefficient autophagy leads to neurodegeneration, GI motility dysfunction, and PD symptoms. Recent findings suggest that novel neurotrophic factors such as CDNF have the potential to be used as neuroprotective agents to prevent and treat ENS symptoms of PD.
Also flagged:fasudilAPPPS1Alzheimer's diseaseADdementia
Journal Article2022-04-22✓ 2 SnippetsYan H, Yan Y, Gao Y, Zhang N, Kumar G, Fang Q, Li Z, Li J, Zhang Y, Song L, Wang J, Sun J, Zhang HT, Ma CG.
In-Text Gene Mentions
Results)
…Peroxiredoxin 6 (PRDX6) attenuates Aβ pathology…
Results)
…of Peroxiredoxin 6 (Prdx6, ENSMUST00000051925).…
Show Full Abstract
Alzheimer's disease (AD) is the most common cause of progressive dementia. In the present study, we showed hippocampal tissue transcriptome analysis in APPswe/PSEN1dE9 (APP/PS1, AD model) mice treated with fasudil (ADF) and compared with AD mice treated with saline (ADNS) and wild type mice (WT). The competing endogenous RNA (ceRNA) network was constructed and validated the differential expression of mRNA, lncRNA, miRNA, and circRNA. Our study showed differentially expressed mRNAs (DEMs) between WT and ADNS, while enriched in cell growth and death and nervous system pathways. DEMs between ADNS-ADF were enriched in the nervous system, glycosaminoglycan biosynthesis-keratan sulfate (KS) and Quorum sensing pathways. We validated four genes with RT-PCR, whereas enrichment of Acyl-CoA Synthetase Long Chain Family Member 4 (Acsl4, ENSMUST00000112903) in Quorum sensing pathways, and BTG anti-proliferation factor 1 (Btg1, ENSMUST00000038377) in RNA degradation pathways were conducted. Expression of these two genes were higher in ADNS, but were significantly reduced in ADF. Histone H4 transcription factor (Hinfp, ENSMUST00000216508) orchestrate G1/S transition of mitotic cell cycle and co-expressed with mmu-miR-26a-2-3p-mediated ceRNA and mmu-miR-3065-5p-mediated ceRNA; Wnt family member 4 (Wnt4, ENSMUST00000045747) was enriched in mTOR, Hippo and Wnt signaling pathway. Expression of these two genes were significantly lower in ADNS, and fasudil treatment reverse it. The present studies demonstrated four genes: Acsl4, Btg1, Hinfp, Wnt4 could be potential biomarkers of AD and the targets of fasudil treatment. These results will pave a novel direction for future clinic studies for AD and fasudil treatment.
Cancer is a disease of the genome, therefore, its development has a clear Mendelian component, demonstrated by well-studied genes such as BRCA1 and BRCA2 in breast cancer risk. However, it is known that a single genetic variant is not enough for cancer to develop leading to the theory of multistage carcinogenesis. In many cases, it is a sequence of events, acquired somatic mutations, or simply polygenic components with strong epigenetic effects, such as in the case of brain tumours. The expression of many genes is the product of the complex interplay between several factors, including the organism's genotype (in most cases Mendelian-inherited), genetic instability, epigenetic factors (non-Mendelian-inherited) as well as the immune response of the host, to name just a few. In recent years the importance of the immune system has been elevated, especially in the light of the immune checkpoint genes discovery and the subsequent development of their inhibitors. As the expression of these genes normally suppresses self-immunoreactivity, their expression by tumour cells prevents the elimination of the tumour by the immune system. These discoveries led to the rapid growth of the field of immuno-oncology that offers new possibilities of long-lasting and effective treatment options. Here we discuss the recent advances in the understanding of the key mechanisms controlling the expression of immune checkpoint genes in tumour cells.
Also flagged:ferroptosislung adenocarcinomaLUADcancergene expressionTP53
Journal Article2022-04-22✓ 5 SnippetsZhou M, Zhu X.
In-Text Gene Mentions
Discussion)
…The selected 6 ferroptosis-related genes could be categorized into iron metabolism (CISD1), lipid metabolism (PEBP1, ACSL3), oxidant metabolism (NOX1, CHAC1), and energy metabolism (GLS2).[8] CISD1, an outer mitochondrial membrane protein, played a significant role in regulation of iron and reactive oxygen species (ROS) homeostasis and inhibiting mitochondrial iron uptake, lipid peroxidation as well as subsequent ferroptosis.[28,29] PEBP1 was shown to contribute to ferroptosis by complexing with lipoxygenases and allowing them to produce lipid peroxides.[30] ACSL3 activated monounsaturated fatty acids, which promoted a ferroptosis-resistant cell state by suppressing ROS accumulation at the plasma membrane and decreasing levels of phospholipids containing oxidizable polyunsaturated fatty acids.[31] Moreover, a recent study found that lymph protected metastasizing melanoma cells from ferroptosis due to higher levels of glutathione and oleic acid and less free iron in lymph when compared with blood plasma.…
Results)
…Compared with normal tissues, only PEBP1 were downregulated while other selected genes were upregulated in LUAD tissues.…
<h4>Abstract</h4>To construct and validate a ferroptosis-associated signature predictive of prognosis in lung adenocarcinoma (LUAD), and systematically evaluate the underlying molecular connections in cancer biology.We retrieved mRNAs sequencing profiles of LUAD from the cancer genome atlas (TCGA) data portal and clinical information from the cBio Cancer Genomics Portal. The differentially expressed ferroptosis-associated genes (DEFAGs) were screened between normal samples and LUAD by packages "limma" in R. Then the total TCGA cohort was randomly divided into training set and testing set. Based on the training set, a DEFAG signature was built and further validated in the test set, the total TCGA cohort and other independent cohorts from the gene expression omnibus data portal. A nomogram was constructed and validated, and the correlation between high-risk group and cancer biology was further evaluated.We initially identified 68 DEFAGs from TCGA cohort. A 6 DEFAG signature was built and further validated in the test set, the total TCGA cohort and other 2 independent cohorts including GSE31210 and GSE72094 from gene expression omnibus data portal. Further exploration indicated that high-risk group combined with TP53 mutation harbored the most unfavorable prognosis while low-risk group with TP53 wild-type status had the most favorable survival advantage over other groups. Moreover, high-risk group was associated with higher cancer stemness, tumor mutation burden, and CD274 (programmed cell death 1 ligand 1) expression.We constructed a robust ferroptosis-associated gene signature and a nomogram predictive of prognosis in LUAD, and provided a new perspective on associations between ferroptosis and cancer.
Also flagged:VimentinOral tongue squamous cell carcinomacanceroral precancersoral cancerprecancer
Journal Article2022-04-22No SnippetsSivagnanam A, Shyamsundar V, Kesavan P, Krishnamurthy A, Thangaraj SV, Venugopal DC, Kasirajan H, Ramani P, Sarma VR, Ramshankar V.
Show Full Abstract
Oral tongue squamous cell carcinoma (OTSCC) is an aggressive cancer with high morbidity and mortality rates, despite multimodality management. There are currently no clinically relevant molecular markers that identify patients at higher risk of recurrence and failure. We undertook 2D-DIGE proteomic profiling to study the differentially expressed proteins in OTSCC evaluating their role in prognosis. 2D-DIGE coupled with tandem mass spectrometry was performed on tissues obtained from early staged OTSCC along with its paired apparently adjacent normal tissue samples (<i>n</i> = 10). Top upregulated protein was validated using immunohistochemistry (<i>n</i> = 345), comprising of retrospective early stage OTSCC (<i>n</i> = 150) and prospective series of oral precancers, normal, and oral cancers (<i>n</i> = 195). Saliva samples collected from oral cancer and precancer samples were analyzed by ELISA (<i>n</i> = 146). We found statistically significant differential expression in 151 proteins out of 700 proteins quantified. Top ten differentially regulated proteins were identified using mass spectrometry analysis. We found vimentin, the mesenchymal protein, to be the most upregulated protein in tongue tumor tissues compared to adjacent apparent normal tissues. Vimentin was found to be significantly overexpressed in oral precancers along with cancers compared to normal tissues. The vimentin expression correlated significantly with differentiated states of oral precancers and cancers. Vimentin was also detected at significantly higher levels in saliva collected from oral precancer and cancer patients compared to normal healthy volunteers. Validation of vimentin in an independent series of retrospective early staged OTSCC showed that the vimentin expression is significantly associated with treatment failures and poorer DFS. The vimentin expression is useful as both poor prognostic and early detection marker in oral cancer. Vimentin detection in saliva can be a diagnostic test to detect oral precancers that may have malignant potential, needing closer follow-up, and disease monitoring.
Also flagged:pulmonary arterial hypertensionpathogenesisschistosomiasispulmonary hypertensionhepatosplenic diseaseassociated pulmonary arterial hypertension
Journal Article2022-04-22No SnippetsSinkala E, Ahmed HY, Sibomana JP, Lee MH, Kassa B, Kumar R, Mazimba S, Binegdie AB, Mpisa S, Wamundila K, Graham BB, Hilton JF.
Show Full Abstract
Schistosomiasis is a major cause of pulmonary arterial hypertension (PAH) worldwide, but the prevalence and risk factors for schistosomiasis-associated PAH (SchPAH) development are not well understood. Schistosomiasis-associated hepatosplenic disease (SchHSD) is thought to be a major risk factor for PAH development. Herein, we describe our plans for prospectively screening SchHSD subjects for clinical evidence of PAH at two major academic medical centers and national referral hospitals in Addis Ababa, Ethiopia and Lusaka, Zambia. The screening study will primarily be conducted by echocardiography, in addition to clinical assessments. Plasma samples will be drawn and banked for subsequent analysis based on preclinical animal model rationale. If successful, this study will demonstrate feasibility of conducting prospective cohort studies of SchPAH screening in schistosomiasis-endemic regions of Africa, and provide initial data on clinic-based disease prevalence and potential mechanistic biomarkers underlying disease pathogenesis.
Also flagged:tumorgene expressionALV-J infectionpathogenesisN6-methyladenosinemethylation
Journal Article2022-04-22No SnippetsZhao Q, Yao Z, Chen L, He Y, Xie Z, Zhang H, Lin W, Chen F, Xie Q, Zhang X.
Show Full Abstract
Avian Leukosis Virus Subgroup J (ALV-J) is a tumorigenic virus with high morbidity and rapid transmission. N6-methyladenosine (m<sup>6</sup>A) is a common epigenetic modification that may be closely related to the pathogenicity of ALV-J. Currently, there are no reports on whether m<sup>6</sup>A modification is related to ALV-J induced tumor formation. In this study, we used methylated RNA immunoprecipitation sequencing (MeRIP-seq) and RNA sequencing (RNA-seq) to examine the differences in m<sup>6</sup>A methylation and gene expression in normal livers and ALV-J-induced tumor livers systematically, with functional enrichment and co-expression analysis. The results identified 6,541 m<sup>6</sup>A methylated peaks, mainly enriched in CDS, and more than 83% of the transcripts contained 1-2 m<sup>6</sup>A peaks. For RNA-seq, 1,896 and 1,757 differentially expressed mRNAs and lncRNAs were identified, respectively. Gene enrichment analysis indicated that they may be involved in biological processes and pathways such as immunology-related and apoptosis. Moreover, we identified 17 lncRNAs, commonly existing in differently expressed methylome and transcriptome. Through co-expression analysis, 126 differentially expressed lncRNAs, and 18 potentially m<sup>6</sup>A-related methyltransferases were finally identified and connected, suggesting that m<sup>6</sup>A modifications might affect gene expression of lncRNAs and play a role in ALV-J induced tumor formation. This study provides the first comprehensive description of the m<sup>6</sup>A expression profile in tumor livers induced by ALV-J infection in chickens, which provides a basis for studying the role of m<sup>6</sup>A modification in ALV-J induced tumorigenesis. This study provides clues for studying the epigenetic etiology and pathogenesis of ALV-J.
Journal Article2022-04-22No SnippetsXing F, Hu Q, Qin Y, Xu J, Zhang B, Yu X, Wang W.
Show Full Abstract
Redox homeostasis is a lifelong pursuit of cancer cells. Depending on the context, reactive oxygen species (ROS) exert paradoxical effects on cancers; an appropriate concentration stimulates tumorigenesis and supports the progression of cancer cells, while an excessive concentration leads to cell death. The upregulated antioxidant system in cancer cells limits ROS to a tumor-promoting level. In cancers, redox regulation interacts with tumor initiation, proliferation, metastasis, programmed cell death, autophagy, metabolic reprogramming, the tumor microenvironment, therapies, and therapeutic resistance to facilitate cancer development. This review discusses redox control and the major hallmarks of cancer.
Also flagged:Colorectal Cancercancertumorcarcinoembryonic antigenCEAcoagulation
Journal Article2022-04-22✓ 4 SnippetsLiu C, Wang T, Yang J, Zhang J, Wei S, Guo Y, Yu R, Tan Z, Wang S, Dong W.
In-Text Gene Mentions
Discussion)
…SERPINC1 inhibits thrombin-induced tumor growth and angiogenesis, impairing proliferation and migration of cancer cells (36).…
Results)
…C member 1 (SERPINC1), fibrinogen gamma chain…
Discussion)
…AllSERPINC1, FGA, FGG, FGB,…
Discussion)
…SERPINC1inhibits thrombin-induced tumo…
Show Full Abstract
<h4>Aims</h4>This study aimed to investigate the distant metastasis pattern from newly diagnosed colorectal cancer (CRC) and also construct and validate a prognostic nomogram to predict both overall survival (OS) and cancer-specific survival (CSS) of CRC patients with distant metastases.<h4>Methods</h4>Primary CRC patients who were initially diagnosed from 2010 to 2016 in the SEER database were included in the analysis. The independent risk factors affecting the OS, CSS, all-cause mortality, and CRC-specific mortality of the patients were screened by the Cox regression and Fine-Gray competitive risk model. The nomogram models were constructed to predict the OS and CSS of the patients. The reliability and accuracy of the prediction model were evaluated by consistency index (C-index) and calibration curve. The gene chip GSE41258 was downloaded from the GEO database, and differentially expressed genes (DEGs) were screened by the GEO2R online tool (<i>p</i> < 0.05, |logFC|>1.5). The Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway and Gene Ontology (GO) annotation and String website were used for enrichment analysis and protein-protein interaction (PPI) analysis of DEGs, respectively, and Cytoscape software was used to construct PPI network and screen function modules and hub genes.<h4>Results</h4>A total of 57,835 CRC patients, including 47,823 without distant metastases and 10,012 (17.31%) with metastases, were identified. Older age, unmarried status, poorly differentiated or undifferentiated grade, right colon site, larger tumor size, N2 stage, more metastatic sites, and elevated carcinoembryonic antigen (CEA) might lead to poorer prognosis (all <i>p</i> < 0.01). The independent risk factors of OS and CSS were included to construct a prognosis prediction model for predicting OS and CSS in CRC patients with distant metastasis. C-index and calibration curve of the training group and validation group showed that the models had acceptable predictive performance and high calibration degree. Furthermore, by comparing CRC tissues with and without liver metastasis, 158 DEGs and top 10 hub genes were screened. Hub genes were mainly concentrated in liver function and coagulation function.<h4>Conclusion</h4>The big data in the public database were counted and transformed into a prognostic evaluation tool that could be applied to the clinic, which has certain clinical significance for the formulation of the treatment plan and prognostic evaluation of CRC patients with distant metastasis.
Also flagged:deathheat shock proteinsHSPsHSP70HSP90high-mobility group box 1 protein
Journal Article2022-04-22No SnippetsBirmpilis AI, Paschalis A, Mourkakis A, Christodoulou P, Kostopoulos IV, Antimissari E, Terzoudi G, Georgakilas AG, Armpilia C, Papageorgis P, Kastritis E, Terpos E, Dimopoulos MA, Kalbacher H, Livaniou E, Christodoulou MI, Tsitsilonis OE.
Show Full Abstract
The new and increasingly studied concept of immunogenic cell death (ICD) revealed a previously unknown perspective of the various regulated cell death (RCD) modalities, elucidating their immunogenic properties and rendering obsolete the notion that immune stimulation is solely the outcome of necrosis. A distinct characteristic of ICD is the release of danger-associated molecular patterns (DAMPs) by dying and/or dead cells. Thus, several members of the DAMP family, such as the well-characterized heat shock proteins (HSPs) HSP70 and HSP90, the high-mobility group box 1 protein and calreticulin, and the thymic polypeptide prothymosin α (proTα) and its immunoreactive fragment proTα(100-109), are being studied as potential diagnostic tools and/or possible therapeutic agents. Here, we present the basic aspects and mechanisms of both ICD and other immunogenic RCD forms; denote the role of DAMPs in ICD; and further exploit the relevance of human proTα and proTα(100-109) in ICD, highlighting their possible clinical applications. Furthermore, we present the preliminary results of our in vitro studies, which show a direct correlation between the concentration of proTα/proTα(100-109) and the levels of cancer cell apoptosis, induced by anticancer agents and γ-radiation.
Also flagged:Proteostasisprotein synthesisdegradationribosomopathiesproteinopathiesimmune responses
Journal Article2022-04-22No SnippetsPapendorf JJ, Krüger E, Ebstein F.
Show Full Abstract
Proteostasis, a portmanteau of the words protein and homeostasis, refers to the ability of eukaryotic cells to maintain a stable proteome by acting on protein synthesis, quality control and/or degradation. Over the last two decades, an increasing number of disorders caused by proteostasis perturbations have been identified. Depending on their molecular etiology, such diseases may be classified into ribosomopathies, proteinopathies and proteasomopathies. Strikingly, most-if not all-of these syndromes exhibit an autoinflammatory component, implying a direct cause-and-effect relationship between proteostasis disruption and the initiation of innate immune responses. In this review, we provide a comprehensive overview of the molecular pathogenesis of these disorders and summarize current knowledge of the various mechanisms by which impaired proteostasis promotes autoinflammation. We particularly focus our discussion on the notion of how cells sense and integrate proteostasis perturbations as danger signals in the context of autoinflammatory diseases to provide insights into the complex and multiple facets of sterile inflammation.
All the enantiomers of (1-amino-3-hydroxypropane-1,3-diyl)diphosphonic acid, newly design phosphonate analogues of 4-hydroxyglutamic acids, were obtained. The synthetic strategy involved Abramov reactions of diethyl (<i>R</i>)- and (<i>S</i>)-1-(<i>N</i>-Boc-amino)-3-oxopropylphosphonates with diethyl phosphite, separation of diastereoisomeric [1-(<i>N</i>-Boc-amino)-3-hydroxypropane-1,3-diyl]diphosphonates as <i>O</i>-protected esters, followed by their hydrolysis to the enantiomeric phosphonic acids. The absolute configuration of the enantiomeric phosphonates was established by comparing the <sup>31</sup>P NMR chemical shifts of respective (<i>S</i>)-<i>O</i>-methylmandelic acid esters obtained from respective pairs of <i>syn</i>- and <i>anti</i>-[1-(<i>N</i>-Boc-amino)-3-hydroxypropane-1,3-diyl]diphosphonates according to the Spilling rule.
Also flagged:1,3,4-Thiadiazoles1,3,4-oxadiazolesthiadiazolesynthesisviral infectionscancer
Journal Article2022-04-22No SnippetsEl-Masry RM, Kadry HH, Taher AT, Abou-Seri SM.
Show Full Abstract
The bioisosteres of 1,3,4-oxadiazoles and 1,3,4-thiadiazoles are well-known pharmacophores for many medicinally important drugs. Throughout the past 10 years, 1,3,4-oxa-/thiadiazole nuclei have been very attractive to researchers for drug design, synthesis, and the study of their potential activity towards a variety of diseases, including microbial and viral infections, cancer, diabetes, pain, and inflammation. This work is an up-to-date comparative study that identifies the differences between 1,3,4-thiadiazoles and 1,3,4-oxadiazoles concerning their methods of synthesis from different classes of starting compounds under various reaction conditions, as well as their biological activities and structure-activity relationship.
Also flagged:Anterior UveitisHerpetic anterior uveitisocular inflammationocular hypertensionglaucomahypertensive anterior uveitis
Journal Article2022-04-22No SnippetsChoi JA, Ju HH, Lee J, Kim JE, Paik SY, Skiba NP, Rao PV.
Show Full Abstract
Herpetic anterior uveitis-associated ocular inflammation is commonly manifested with ocular hypertension and glaucoma. Relative to other viruses, cytomegalovirus (CMV) positive hypertensive anterior uveitis is associated with high recurrences of uveitis, as well as with uncontrolled intraocular pressure (IOP) and a subsequent higher requirement for future glaucoma surgery. To gain novel insights into the pathogenesis of ocular hypertension in these patients, we investigated the proteome changes of the aqueous humor (AH) derived from the CMV hypertensive anterior uveitis (CMV-HAU; <i>n</i> = 10) patients and non-glaucoma (cataract; <i>n</i> = 10) patients using liquid chromatography with tandem mass spectrometry. Among a total of 562 proteins identified, fifty and fifteen proteins were significantly elevated and decreased, respectively, in the AH of CMV-HAU patients compared to the control subjects by ≥2 fold. Gene ontology (GO) enrichment and network analyses of elevated proteins revealed that the enrichment of protein was involved in the complement activation, the humoral immune response mediated by the circulating immunoglobulins, proteolysis, and platelet degranulation. In the AH of CMV-HAU, GDF (growth/differentiation factor)-15, the inflammatory marker belonging to the TGF-β superfamily proteins, was significantly increased, while vasorin, an anti-TGF-β protein, levels were decreased. The trabecular meshwork cells infected with CMV exhibited a significantly increased expression of inflammatory markers. Collectively, these data indicate increased complement factor associated inflammation and humoral immunity in CMV-HAU associated ocular hypertension.
Also flagged:GlucoseMigraineinsulintype 2 diabetesimpairedhomeostasis
Journal Article2022-04-22No SnippetsIslam MR, Nyholt DR.
Show Full Abstract
Migraine and glucose-related (glycaemic) traits (fasting glucose, fasting insulin, and type 2 diabetes) are common and complex comorbid disorders that cause major economic and social burdens on patients and their families. Studies on the relationship between migraine and glucose-related traits have yielded inconsistent results. The purpose of this review is to synthesise and discuss the information from the available literature on the relationship between fasting glucose, fasting insulin, and type 2 diabetes (T2D) with migraine. Publications on migraine and fasting glucose, migraine and fasting insulin, and migraine and T2D were identified from a PubMed and Google Scholar database search and reviewed for this article. Multiple publications have suggested that the comorbidity of migraine and glucose-related traits may have a similar complex pathogenic mechanism, including impaired glucose homeostasis, insulin resistance, reduced cerebrovascular reactivity, abnormal brain metabolism, shared genetic factors, neurotransmitters, and sex hormones. Furthermore, several studies have found a bi-directional link between migraine with insulin resistance and T2D. There is strong evidence for a biological association between migraine headache and glucose-related traits, and burgeoning evidence for shared genetic influences. Therefore, genetic research into these comorbid traits has the potential to identify new biomarkers and therapeutic targets and provide biological insight into their relationships. We encourage healthcare professionals to consider the co-occurrence of migraine with glucose-related traits in the evaluation and treatment of their patients.
Also flagged:AneurysmsProtein CPC) deficiencythrombophiliadeep vein thrombosisDVT
Journal Article2022-04-22✓ 2 SnippetsWeronska A, Potaczek DP, Oto J, Medina P, Undas A, Wypasek E.
In-Text Gene Mentions
Discussion)
…Sixteen out of twenty four (66.7%) patients with antithrombin deficiency carrying the homozygous SERPINC1 p.Leu131Phe mutation (antithrombin Budapest 3) had IVC system atresia, possibly caused by thrombosis in the developing fetal vessels.…
Discussion)
…carrying the homozygousSERPINC1p.Leu131Phe mutation (antithro…
Show Full Abstract
Objectives: Protein C (PC) deficiency is an inherited thrombophilia with a prevalence of 0.5% in the general population and 3% in subjects with a first-time deep vein thrombosis (DVT). Here we report a series of 14 PC-deficient Polish patients with comprehensive clinical and molecular characteristics, including long-term follow-up data and a deep mutational analysis of the PROC gene. Patients and Methods: Fourteen unrelated probands (mean ± SD age 43.8 ± 13.0 years) with suspicion of PC deficiency, who experienced thromboembolic events and a majority of whom received anticoagulants (92.8%), were screened for PROC mutations by sequencing the nine PROC exons and their flanking intron regions. Results: Ten probands (71.4%) had missense mutations, two patients (14.3%) carried nonsense variants, and the other two subjects (14.3%) had splice-site mutations, the latter including the c.401-1G>A variant, reported here for the very first time. The proband carrying the c.401-1A allele had a hepatic artery aneurysm with a highly positive family history of aneurysms and the absence of any mutations known to predispose to this vascular anomaly. Conclusion: A novel detrimental PROC mutation was identified in a family with aneurysms, which might suggest yet unclear links of thrombophilia to vascular anomalies, including aneurysms at atypical locations in women. The present case series also supports data indicating that novel oral anticoagulants (NOACs) are effective in PC deficient patients.
Also flagged:phenylboronic acidzinc oxidechrysinzinc oxide nanoparticlecancer
Journal Article2022-04-22No SnippetsMahalanobish S, Kundu M, Ghosh S, Das J, Sil PC.
Show Full Abstract
Recently, different natural bioactive compounds have been used as anticancer agents for their various therapeutic benefits and non-toxic nature to other organs. However, they have various restrictions in preclinical and clinical studies due to their non-targeting nature and insufficient bioavailability. As a result, a zinc oxide nanoparticle (ZnO) based drug delivery medium was constructed which has good bio-compatibility and bio-degradability. It also displays cancer cell-specific drug delivery in a targeted and controlled way. In the present study, phenylboronic acid (PBA) tagged ZnO nanoparticles (ZnO-PBA) was fabricated and in the next step, chrysin (a natural bio-active molecule) was loaded to it to form the nanoconjugate (ZnO-PBA-Chry). Different characterization techniques were used to confirm the successful fabrication of ZnO-PBA-Chry. PBA-tagging to the nanoparticle helps in targeted delivery of chrysin in lung cancer cells (A549) as PBA binds with sialic acid receptors which are over-expressed on the surface of A549 cells. As ZnO dissociates in acidic pH, it shows stimuli-responsive release of chrysin in tumor microenvironment. Application of ZnO-PBA-Chry nanohybrid in lung cancer cell line A549 caused oxidative stress mediated intrinsic cell death and cell cycle arrest. ZnO-PBA-Chry downregulated MMP-2 and VE-Cadherin, thereby inhibiting metastasis and the invasive property of A549 cells.
Also flagged:fluoridezinchydroxyapatiteTitaniumzinc oxidecalcium fluoride
Journal Article2022-04-22No SnippetsBhattacharjee A, Bandyopadhyay A, Bose S.
Show Full Abstract
Titanium (Ti) alloys show excellent fatigue and corrosion resistance, high strength to weight ratio, and no toxicity; however, poor osseointegration ability of Ti may lead to implant loosening <i>in vivo</i>. Plasma spraying of hydroxyapatite [HA, Ca<sub>10</sub> (PO<sub>4</sub>)<sub>6</sub> (OH)<sub>2</sub>] coating on Ti surfaces is commercially used to enhance osseointegration and the long-term stability of these implants. The biological properties of HA can be improved with the addition of both cationic and anionic dopants, such as zinc ions (Zn<sup>2+</sup>) and fluoride (F<sup>-</sup>). However, the hygroscopic nature of fluoride restricts its utilization in the radiofrequency (RF) plasma spray process. In addition, the amount of doping needs to be optimized to ensure cytocompatibility. We have fabricated zinc and fluoride doped HA-coated Ti6Al4V (Ti64) to mitigate these challenges using compositional and parametric optimizations. The RF induction plasma spraying method is utilized to prepare the coatings. Multiple parametric optimizations with amplitude and frequency during the processing result in coating thicknesses between 80 and 145 μm. No adverse effects on the adhesion properties of the coating are noticed because of doping. The antibacterial efficacy of each composition is tested against <i>S. aureus</i> for 24, 48, and 72 h, and showed that the addition of zinc oxide and calcium fluoride to HA leads to nearly 70 % higher antibacterial efficacy than pure HA-coated samples. The addition of osteogenic Zn<sup>2+</sup>and F<sup>-</sup> leads to 1.5 times higher osteoblast viability for the doped samples than pure HA-coated samples after 7-days of cell culture. Zn<sup>2+</sup> and F<sup>-</sup> doped HA-coated Ti64 with simultaneous improvements in anti-bacterial efficacy and <i>in vitro</i> biocompatibility can find application in load-bearing implants, particularly in revision surgeries and immune-compromised patients.
Also flagged:Gene expressionimmune responsesIntracerebral Hemorrhagehypertensioncerebral amyloid angiopathyinflammatory responses
Journal Article2022-04-22No SnippetsKnepp B, Ander BP, Jickling GC, Hull H, Yee AH, Ng K, Rodriguez F, Carmona-Mora P, Amini H, Zhan X, Hakoupian M, Alomar N, Sharp FR, Stamova B.
Show Full Abstract
The peripheral immune system response to Intracerebral Hemorrhage (ICH) may differ with ICH in different brain locations. Thus, we investigated peripheral blood mRNA expression of Deep ICH, Lobar ICH, and vascular risk factor-matched control subjects (n = 59). Deep ICH subjects usually had hypertension. Some Lobar ICH subjects had cerebral amyloid angiopathy (CAA). Genes and gene networks in Deep ICH and Lobar ICH were compared to controls. We found 774 differentially expressed genes (DEGs) and 2 co-expressed gene modules associated with Deep ICH, and 441 DEGs and 5 modules associated with Lobar ICH. Pathway enrichment showed some common immune/inflammatory responses between locations including Autophagy, T Cell Receptor, Inflammasome, and Neuroinflammation Signaling. Th2, Interferon, GP6, and BEX2 Signaling were unique to Deep ICH. Necroptosis Signaling, Protein Ubiquitination, Amyloid Processing, and various RNA Processing terms were unique to Lobar ICH. Finding amyloid processing pathways in blood of Lobar ICH patients suggests peripheral immune cells may participate in processes leading to perivascular/vascular amyloid in CAA vessels and/or are involved in its removal. This study identifies distinct peripheral blood transcriptome architectures in Deep and Lobar ICH, emphasizes the need for considering location in ICH studies/clinical trials, and presents potential location-specific treatment targets.
Also flagged:phospholipidsmetabolismcardiolipinhydroperoxyphosphatidylethanolamine15-lipoxygenases
Journal Article2022-04-21✓ 1 SnippetBayır H, Maguire JJ, Cadenas E.
In-Text Gene Mentions
Text
…PEBP1…
Show Full Abstract
Professor Valerian Kagan (PhD, 1972, MV Lomonosov Moscow State University; DSci, 1981, USSR, Academy of Sciences, Moscow) is recognized as a Redox Pioneer because he has published 4 articles in the field of redox biology that have been cited >1000 times and 138 articles in this field have been cited between 100 and 924 times. The central and most important impact of Dr. Kagan's research is in the field of redox lipidomics-a term coined for the first time by Dr. Kagan in 2004-and consequently the definition of signaling pathways by oxidatively modified phospholipids; this acquires further significance considering that oxygenated phospholipids play multifunctional roles as essential signals coordinating metabolism and physiology. Some examples are the selective oxidation of cardiolipin (CL) by a cytochrome <i>c</i> peroxidase activity leading to the activation of the intrinsic apoptotic pathway; the hydroperoxy-arachidonoyl/adrenoyl phosphatidylethanolamine (PE) species, driven by 15-lipoxygenases (15-LOX), as death signals leading to ferroptotic cell death; the regulation of ferroptosis by iNOS/NO<sup>•</sup> in pro-inflammatory conditions by a novel mechanism (realized <i>via</i> interactions of 15-LOX reaction intermediates formed from arachidonoyl phosphatidylethanolamine [PE] species) and Ca<sup>2+</sup>-independent phospholipase A2 (iPLA<sub>2</sub>β; <i>via</i> elimination of peroxidized PE); the involvement of oxygenated (phospho)lipids in immunosuppression by myeloid cells in the tumor microenvironment; hydrolysis of peroxidized CL by Ca<sup>2+</sup>-independent phospholipase A2 (iPLA<sub>2</sub>γ) leading to pro- and anti-inflammatory signals and lipid mediators. Kagan continues his investigations to decipher the roles of enzyme-linked oxygenated phospholipids. <i>Antioxid. Redox Signal.</i> 36, 813-823.
Also flagged:ironmetabolismgene expressionHCP1DMT1Zip8
Journal Article2022-04-21✓ 3 SnippetsBalusikova K, Dostalikova-Cimburova M, Tacheci I, Kovar J.
In-Text Gene Mentions
Methods)
…genotype of theHFEgene (i.e., C282Y…
Methods)
…mutations of theHFEgene were analysed…
Results)
…genotype of theHFEgene (diagnosis of…
Show Full Abstract
Duodenal biopsies are considered a suitable source of enterocytes for studies of dietary iron absorption. However, the expression level of molecules involved in iron absorption may vary along the length of duodenum. We aimed to determine whether the expression of molecules involved in the absorption of heme and non-heme iron differs depending on the location in the duodenum. Analysis was performed with samples of duodenal biopsies from 10 individuals with normal iron metabolism. Samples were collected at the following locations: (a) immediately post-bulbar, (b) 1-2 cm below the papilla of Vater and (c) in the distal duodenum. The gene expression was analyzed at the mRNA and protein level using real-time PCR and Western blot analysis. At the mRNA level, significantly different expression of HCP1, DMT1, ferroportin and Zip8 was found at individual positions of duodenum. Position-dependent expression of other molecules, especially of FLVCR1, HMOX1 and HMOX2 was also detected but with no statistical significances. At the protein level, we observed statistically significantly decreasing expression of transporters HCP1, FLVCR1, DMT1, ferroportin, Zip14 and Zip8 with advancing positions of duodenum. Our results are consistent with a gradient of diminishing iron absorption along the duodenum for both heme and non-heme iron.
Also flagged:ironisophthalamidemercurymetalsbindingoxygen
Journal Article2022-04-21✓ 1 SnippetCheng R, Gadde R, Fan Y, Kulkarni N, Shevale N, Bao K, Choi HS, Betharia S, Kim J.
In-Text Gene Mentions
Abstract)
…of NBMI inHfeH67D mutant mice,…
Show Full Abstract
N,N'-bis(2-mercaptoethyl)isophthalamide (NBMI) is a novel lipophilic metal chelator and antioxidant used in mercury poisoning. Recent studies have suggested that NBMI may also bind to other metals such as lead and iron. Since NBMI can enter the brain, we evaluated if NBMI removes excess iron from the iron-loaded brain and ameliorates iron-induced oxidative stress. First, NBMI exhibited preferential binding to ferrous (Fe<sup>2+</sup>) iron with a negligible binding affinity to ferric (Fe<sup>3+</sup>) iron, indicating a selective chelation of labile iron. Second, NBMI protected SH-SY5Y human neuroblastoma cells from the cytotoxic effects of high iron. NBMI also decreased cellular labile iron and lessened the production of iron-induced reactive oxygen species in these cells. Deferiprone (DFP), a commonly used oral iron chelator, failed to prevent iron-induced cytotoxicity or labile iron accumulation. Next, we validated the efficacy of NBMI in Hfe H67D mutant mice, a mouse model of brain iron accumulation (BIA). Oral gavage of NBMI for 6 weeks decreased iron accumulation in the brain as well as liver, whereas DFP showed iron chelation only in the liver, but not in the brain. Notably, depletion of brain copper and anemia were observed in BIA mice treated with DFP, but not with NBMI, suggesting a superior safety profile of NBMI over DFP for long-term use. Collectively, our study demonstrates that NBMI provides a neuroprotective effect against BIA and has therapeutic potential for neurodegenerative diseases associated with BIA.
Also flagged:Narcolepsychronic neurological disorderhypocretinsleepexcessive daytime sleepinessEDS
Journal Article2022-04-21No SnippetsLatorre D, Sallusto F, Bassetti CLA, Kallweit U.
Show Full Abstract
Narcolepsy is a rare chronic neurological disorder characterized by an irresistible excessive daytime sleepiness and cataplexy. The disease is considered to be the result of the selective disruption of neuronal cells in the lateral hypothalamus expressing the neuropeptide hypocretin, which controls the sleep-wake cycle. Diagnosis and management of narcolepsy represent still a substantial medical challenge due to the large heterogeneity in the clinical manifestation of the disease as well as to the lack of understanding of the underlying pathophysiological mechanisms. However, significant advances have been made in the last years, thus opening new perspective in the field. This review describes the current knowledge of clinical presentation and pathology of narcolepsy as well as the existing diagnostic criteria and therapeutic intervention for the disease management. Recent evidence on the potential immune-mediated mechanisms that may underpin the disease establishment and progression are also highlighted.
<h4>Purpose</h4>Animal studies have linked gastric herpesvirus infections to symptoms associated with functional gastrointestinal disorders (FGIDs). Herpesviruses have also been hypothesized to contribute to fibromyalgia (FM), a chronic pain syndrome frequently comorbid with FGIDs. The purpose of this study was to compare the prevalence of gastric herpesvirus infection in patients with FGIDs, with and without comorbid FM, to that of controls.<h4>Methods</h4>For this pilot case-control study, we enrolled 30 patients who met both the Rome IV diagnostic criteria for one or more FGIDs and the American College of Rheumatology 2010 criteria for FM, 15 patients with one or more FGIDs without comorbid FM, and 15 control patients. Following endoscopic examination, gastric biopsies were analyzed for herpesvirus DNA and protein, Helicobacter pylori infection, and histological evidence of gastritis. Importantly, the viral nonstructural protein ICP8 was used as a marker to differentiate cell-associated actively replicating virus from latent infection and/or free virus passing through the GI tract.<h4>Results</h4>Gastric herpes simplex virus type 1 (HSV-1) infection, as indicated by ICP8 presence, was significantly associated with FGIDs in the presence (OR 70.00, 95% CI 7.42-660.50; P < .001) and absence (OR 38.50, 95% CI 3.75-395.40; P < .001) of comorbid FM. Neither histological gastritis nor H. pylori infection were found to be associated with FGIDs or FM.<h4>Conclusions</h4>HSV-1 infection was identified in gastric mucosal biopsies from patients with diverse FGIDs, with and without comorbid FM. Larger, multi-center studies investigating the prevalence of this association are warranted.
Also flagged:cystic fibrosisCFmacrolideDCC2bronchiectasisMABC infection
Journal Article2022-04-21No SnippetsYoshida M, Chien JY, Morimoto K, Kinjo T, Aono A, Murase Y, Fujiwara K, Morishige Y, Nagano H, Jou R, Hasegawa N, Ato M, Hoshino Y, Hsueh PR, Mitarai S.
Show Full Abstract
Mycobacterium abscessus complex (MABC) is a group of emerging, highly antimicrobial-resistant non-tuberculous mycobacteria. Specific MABC clones are spreading globally in patients with cystic fibrosis (CF); however, associated genomic epidemiology is lacking in East Asia, with very few patients with CF. Here, we investigated MABC populations derived from non-CF patients in Japan and Taiwan. Analysis of whole-genome sequencing data of 220 MABC isolates revealed that 112, 105, and 3 were M. abscessus subsp. <i>abscessus</i> (ABS), M. abscessus subsp. <i>massiliense</i> (MAS), and M. abscessus subsp. <i>bolletii</i> (BOL), respectively. Moreover, >50% of ABS and >70% of MAS were related to four predominant clones in the region. Known mutations conferring macrolide resistance were rare (1.4%) and were not enriched in the predominant clones. Conversely, the macrolide-susceptible <i>erm</i>(41) T28C mutation was significantly enriched in one predominant ABS clone. The most predominant ABS clone was genetically related to the previously described dominant circulating clone (DCC)1 in patients with CF, whereas no isolates were related to DCC2; isolates related to DCC3 were not necessarily predominant in our sample set. We found that the <i>erm</i>(41) T28C mutants spread globally, and some of them reacquired the functional <i>erm</i>(41) gene through both point mutation and recombination. This study revealed predominant MABC clones in Japan and Taiwan and their relationship with the globally superadding clones in the patient community with CF. Our study provides insights into the genetic characteristics of globally dominant and area-specific strains isolated from patients with or without CF and differences between globally spread and regionally specific strains. <b>IMPORTANCE</b> Members of Mycobacterium abscessus complex (MABC) are frequently isolated from patients. Studies have reported that predominant clones of MABC (known as dominant circulating clones; DCCs) are distributed worldwide and transmitted from humans to humans in patients with cystic fibrosis (CF). However, associated genomic epidemiology has not yet been conducted in East Asia, including Japan and Taiwan, where there are only a few patients with CF. Using whole-genome sequencing data derived from non-CF patients in Japan and Taiwan, we revealed prevalent clones and the incidence of macrolide resistance-associated mutations in the MABC population in this region. We also clarified the associations between these predominant clones and DCCs in the global CF patient community. Our results would assist further studies in elucidating the genetic characteristics of strains isolated from patients with or without CF, the differences between globally spread and regionally specific strains, and the adaptive evolution of MABC within the host.
Also flagged:systemic diseaseinflammatory responsecoagulationdeathinterferon beta 1aIFN-β-1a
Journal Article2022-04-21✓ 1 SnippetViodé A, Smolen KK, Fatou B, Wurie Z, Van Zalm P, Konde MK, Keita BM, Ablam RA, Fish EN, Steen H.
In-Text Gene Mentions
Results)
…proteins such aslinker histoneshistones (H1-4 and…
Show Full Abstract
Ebola virus (EBV) disease (EVD) is a highly virulent systemic disease characterized by an aggressive systemic inflammatory response and impaired vascular and coagulation systems, often leading to uncontrolled hemorrhaging and death. In this study, the proteomes of 38 sequential plasma samples from 12 confirmed EVD patients were analyzed. Of these 12 cases, 9 patients received treatment with interferon beta 1a (IFN-β-1a), 8 survived EVD, and 4 died; 2 of these 4 fatalities had received IFN-β-1a. Our analytical strategy combined three platforms targeting different plasma subproteomes: a liquid chromatography-mass spectrometry (LC-MS)-based analysis of the classical plasma proteome, a protocol that combines the depletion of abundant plasma proteins and LC-MS to detect less abundant plasma proteins, and an antibody-based cytokine/chemokine multiplex assay. These complementary platforms provided comprehensive data on 1,000 host and viral proteins. Examination of the early plasma proteomes revealed protein signatures that differentiated between fatalities and survivors. Moreover, IFN-β-1a treatment was associated with a distinct protein signature. Next, we examined those proteins whose abundances reflected viral load measurements and the disease course: resolution or progression. Our data identified a prognostic 4-protein biomarker panel (histone H1-5, moesin, kininogen 1, and ribosomal protein L35 [RPL35]) that predicted EVD outcomes more accurately than the onset viral load. <b>IMPORTANCE</b> As evidenced by the 2013-2016 outbreak in West Africa, Ebola virus (EBV) disease (EVD) poses a major global health threat. In this study, we characterized the plasma proteomes of 12 individuals infected with EBV, using two different LC-MS-based proteomics platforms and an antibody-based multiplexed cytokine/chemokine assay. Clear differences were observed in the host proteome between individuals who survived and those who died, at both early and late stages of the disease. From our analysis, we derived a 4-protein prognostic biomarker panel that may help direct care. Given the ease of implementation, a panel of these 4 proteins or subsets thereof has the potential to be widely applied in an emergency setting in resource-limited regions.
Also flagged:infectionacute flaccid myelitisautophagosomesautophagosomelysosomeautophagy
Journal Article2022-04-21✓ 1 SnippetJassey A, Wagner MA, Galitska G, Paudel B, Miller K, Jackson WT.
In-Text Gene Mentions
Discussion)
…actors for ARF1: ARFGEF1/BIG1-ARFGEF2/BIG2 and GBF1 […
Show Full Abstract
Enterovirus D68 (EV-D68) is a respiratory pathogen associated with acute flaccid myelitis, a childhood paralysis disease. No approved vaccine or antiviral treatment exists against EV-D68. Infection with this virus induces the formation of autophagosomes to enhance its replication but blocks the downstream autophagosome- lysosome fusion steps. Here, we examined the impact of autophagy induction through starvation, either before (starvation before infection, SBI) or after (starvation after infection, SAI) EV-D68 infection. We showed that SAI, but not SBI, attenuated EV-D68 replication in multiple cell lines and abrogated the viral-mediated cleavage of host autophagic flux-related proteins. Furthermore, SAI induced autophagic flux during EV-D68 replication and prevented production of virus-induced membranes, which are required for picornavirus replication. Pharmacological inhibition of autophagic flux during SAI did not rescue EV-D68 titers. SAI had the same effect in multiple cell types, and restricted the replication of several medically relevant picornaviruses. Our results highlight the significance of autophagosomes for picornavirus replication and identify SAI as an attractive broad-spectrum anti-picornavirus strategy.<b>Abbreviations:</b> BAF: bafilomycin A<sub>1</sub>; CCCP: carbonyl cyanide m-chlorophenylhydrazone; CQ: chloroquine; CVB3: coxsackievirus B3; EV-D68: enterovirus D68; hpi: hour post-infection; MAP1LC3/LC3: microtubule associated protein 1 light chain 3; MOI: multiplicity of infection; NSP2B: nonstructural protein 2B; PV: poliovirus; RES: resveratrol; RV14: rhinovirus 14; SAI: starvation after infection; SBI: starvation before infection; SNAP29: synaptosome associated protein 29; SQSTM1/p62: sequestosome 1; TFEB: transcription factor EB.
Also flagged:ExtracellularVesicle SubpopulationsNeurodegenerative DiseaseExtracellular vesiclesHuntington's disease
Journal Article2022-04-21✓ 2 SnippetsMazouzi Y, Sallem F, Farina F, Loiseau A, Tartaglia NR, Fontaine M, Parikh A, Salmain M, Neri C, Boujday S.
In-Text Gene Mentions
Abstract)
…We applied this multisensing strategy to analyze small EVs isolated by differential ultracentrifugation from knock-in mouse striatal cells expressing either a mutated allele or wild-type allele of huntingtin (Htt), the Huntington's disease gene.…
Abstract)
…allele of huntingtin (Htt), the Huntington's disease…
Show Full Abstract
Extracellular vesicles (EVs) are secreted nanoparticles that are involved in intercellular communication and that modulate a wide range of biological processes in normal and disease conditions. However, EVs are highly heterogeneous in terms of origin in the cell, size, and density. As a result, complex protocols are required to identify and characterize specific EV subpopulations, limiting biomedical applications, notably in diagnostics. Here, we show that combining quartz crystal microbalance with dissipation (QCM-D) and nanoplasmonic sensing (NPS) provides a facile method to track the viscoelastic properties of small EVs. We applied this multisensing strategy to analyze small EVs isolated by differential ultracentrifugation from knock-in mouse striatal cells expressing either a mutated allele or wild-type allele of huntingtin (Htt), the Huntington's disease gene. Our results validate the sensing strategy coupling QCM-D and NPS and suggest that the mass and viscoelastic dissipation of EVs can serve as potent biomarkers for sensing the intercellular changes associated with the neurodegenerative condition.
Also flagged:ZFP36L2energy homeostasismetabolic disordersmyoblast proliferationdifferentiationacetyl-CoA carboxylase alpha
Journal Article2022-04-21✓ 1 SnippetCai B, Ma M, Zhang J, Kong S, Zhou Z, Li Z, Abdalla BA, Xu H, Zhang X, Lawal RA, Nie Q.
In-Text Gene Mentions
Results)
…genes such asSOX6, TNNC2 and…
Show Full Abstract
Skeletal muscle is the largest metabolic organ in the body, and its metabolic flexibility is essential for maintaining systemic energy homeostasis. Metabolic inflexibility in muscles is a dominant cause of various metabolic disorders, impeding muscle development. In our previous study, we found lncRNA ZFP36L2-AS (for "ZFP36L2-antisense transcript") is specifically enriched in skeletal muscle. Here, we report that ZFP36L2-AS is upregulated during myogenic differentiation, and highly expressed in breast and leg muscle. In vitro, ZFP36L2-AS inhibits myoblast proliferation but promotes myoblast differentiation. In vivo, ZFP36L2-AS facilitates intramuscular fat deposition, as well as activates fast-twitch muscle phenotype and induces muscle atrophy. Mechanistically, ZFP36L2-AS interacts with acetyl-CoA carboxylase alpha (ACACA) and pyruvate carboxylase (PC) to induce ACACA dephosphorylation and damaged PC protein stability, thus modulating muscle metabolism. Meanwhile, ZFP36L2-AS can activate ACACA to reduce acetyl-CoA content, which enhances the inhibition of PC activity. Our findings present a novel model about the regulation of lncRNA on muscle metabolism.
Also flagged:pancreatic cancerchromatincancerstranscription factorscancergene expression
Journal Article2022-04-21✓ 1 SnippetShi X, Li Y, Yuan Q, Tang S, Guo S, Zhang Y, He J, Zhang X, Han M, Liu Z, Zhu Y, Gao S, Wang H, Xu X, Zheng K, Jing W, Chen L, Wang Y, Jin G, Gao D.
In-Text Gene Mentions
Results)
…NEUROD1, NKX2-5 andPOU3F2, in neuroendocrine organoids…
Show Full Abstract
Chromatin accessibility plays an essential role in controlling cellular identity and the therapeutic response of human cancers. However, the chromatin accessibility landscape and gene regulatory network of pancreatic cancer are largely uncharacterized. Here, we integrate the chromatin accessibility profiles of 84 pancreatic cancer organoid lines with whole-genome sequencing data, transcriptomic sequencing data and the results of drug sensitivity analysis of 283 epigenetic-related chemicals and 5 chemotherapeutic drugs. We identify distinct transcription factors that distinguish molecular subtypes of pancreatic cancer, predict numerous chromatin accessibility peaks associated with gene regulatory networks, discover regulatory noncoding mutations with potential as cancer drivers, and reveal the chromatin accessibility signatures associated with drug sensitivity. These results not only provide the chromatin accessibility atlas of pancreatic cancer but also suggest a systematic approach to comprehensively understand the gene regulatory network of pancreatic cancer in order to advance diagnosis and potential personalized medicine applications.
Also flagged:COVID-19hepatitisautoimmune hepatitisliver failureLiverinjury
Journal Article2022-04-21✓ 3 SnippetsBoettler T, Csernalabics B, Salié H, Luxenburger H, Wischer L, Salimi Alizei E, Zoldan K, Krimmel L, Bronsert P, Schwabenland M, Prinz M, Mogler C, Neumann-Haefelin C, Thimme R, Hofmann M, Bengsch B.
In-Text Gene Mentions
Results)
…HFE genotyping did not reveal hemochromatosis-associated variations.…
Results)
…HFEgenotyping did not…
Results)
…did not revealhemochromatosis-associated variations.…
Show Full Abstract
<h4>Background & aims</h4>Autoimmune hepatitis episodes have been described following SARS-CoV-2 infection and vaccination but their pathophysiology remains unclear. Herein, we report the case of a 52-year-old male, presenting with bimodal episodes of acute hepatitis, each occurring 2-3 weeks after BNT162b2 mRNA vaccination. We sought to identify the underlying immune correlates. The patient received oral budesonide, relapsed, but achieved remission under systemic steroids.<h4>Methods</h4>Imaging mass cytometry for spatial immune profiling was performed on liver biopsy tissue. Flow cytometry was performed to dissect CD8 T-cell phenotypes and identify SARS-CoV-2-specific and EBV-specific T cells longitudinally. Vaccine-induced antibodies were determined by ELISA. Data were correlated with clinical laboratory results.<h4>Results</h4>Analysis of the hepatic tissue revealed an immune infiltrate quantitatively dominated by activated cytotoxic CD8 T cells with panlobular distribution. An enrichment of CD4 T cells, B cells, plasma cells and myeloid cells was also observed compared to controls. The intrahepatic infiltrate showed enrichment for CD8 T cells with SARS-CoV-2-specificity compared to the peripheral blood. Notably, hepatitis severity correlated longitudinally with an activated cytotoxic phenotype of peripheral SARS-CoV-2-specific, but not EBV-specific, CD8+ T cells or vaccine-induced immunoglobulins.<h4>Conclusions</h4>COVID-19 vaccination can elicit a distinct T cell-dominant immune-mediated hepatitis with a unique pathomechanism associated with vaccination-induced antigen-specific tissue-resident immunity requiring systemic immunosuppression.<h4>Lay summary</h4>Liver inflammation is observed during SARS-CoV-2 infection but can also occur in some individuals after vaccination and shares some typical features with autoimmune liver disease. In this report, we show that highly activated T cells accumulate and are evenly distributed in the different areas of the liver in a patient with liver inflammation following SARS-CoV-2 vaccination. Moreover, within the population of these liver-infiltrating T cells, we observed an enrichment of T cells that are reactive to SARS-CoV-2, suggesting that these vaccine-induced cells can contribute to liver inflammation in this context.
The coronavirus disease 2019 (COVID-19) pandemic has become the most serious global public health issue in the past two years, requiring effective therapeutic strategies. This viral infection is a contagious disease caused by new coronaviruses (nCoVs), also called severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Autophagy, as a highly conserved catabolic recycling process, plays a significant role in the growth and replication of coronaviruses (CoVs). Therefore, there is great interest in understanding the mechanisms that underlie autophagy modulation. The modulation of autophagy is a very complex and multifactorial process, which includes different epigenetic alterations, such as histone modifications and DNA methylation. These mechanisms are also known to be involved in SARS-CoV-2 replication. Thus, molecular understanding of the epigenetic pathways linked with autophagy and COVID-19, could provide novel therapeutic targets for COVID-19 eradication. In this context, the current review highlights the role of epigenetic regulation of autophagy in controlling COVID-19, focusing on the potential therapeutic implications.
Also flagged:CXCL12CXCR4-CellChemotaxispathogenesisCP
Journal Article2022-04-21✓ 5 SnippetsZhang M, Liu Y, Chen J, Chen L, Zhang L, Chen X, Hao Z, Liang C.
In-Text Gene Mentions
Results)
…TLR2, MMP12, CYP2B19,OLFM4, and CD44).…
Results)
…CXCR4, CD44, andOLFM4were expressed only…
Results)
…roles of CD44,OLFM4, and CXCR4 in…
Discussion)
…CXCR4, CD44, andOLFM4were expressed on…
Discussion)
…CXCL12, CD44, andOLFM4as diagnostic markers.…
Show Full Abstract
<h4>Background</h4>Chronic nonbacterial prostatitis (CNP) has a high incidence, low cure rate, and unclear pathogenesis. Here, we aimed to systematically identify effective diagnostic and therapeutic targets for CNP.<h4>Methods</h4>Prostate tissues were obtained from established mouse models and negative controls and were used for mRNA array sequencing and immunohistochemistry (IHC) staining. Predominant pathways were identified based on pathway enrichment analysis and pharmaceutical experiments. We also investigated the functional role of CXCL12 on CP, a critical factor belonging to the predominant chemotaxis pathway, and employed IHC staining to explore the influence of the CXCL12/CXCR4 axis on the activation of the NF-κB, AKT, and STAT3 signaling pathways. Serum samples derived from both CNP cases and healthy controls were used to determine the secretion level of CXCL12.<h4>Results</h4>By employing mRNA array sequencing and immunohistochemistry, we found that CXCR4, CXCL12, CD44, and OFLM4 were highly expressed in the infiltrated inflammatory T cells of the prostate tissues generated from CNP mice, while they were rarely expressed on the epithelial cells. Based on the pathway enrichment results, we applied pathway inhibitors to suppress the activity of these classic pathways. We found that targeting the CXCL12/CXCR4 axis with its specific antagonist AMD3100 remarkably alleviated inflammatory infiltration of the prostate in CNP models. Similar results were obtained when we replaced AMD3100 with adenovirus-associated virus (AAV)-sh<i>Cxcl12</i>. To clarify the potential mechanisms of how the CXCL12/CXCR4 axis influences the pathogenesis of CNP, we tested the classical downstream pathways. The results suggested that p-Akt, p-STAT3, and p-NF-κB were more highly expressed on the inflammatory cells of the prostate derived from the CNP model and were partly suppressed after applying AMD3100 or delivering AAV-sh<i>Cxcl12</i>, indicating that the CXCL12/CXCR4 axis potentially functioned through AKT/NF-κB and STAT3 signaling to influence the pathogenesis of CNP.<h4>Conclusion</h4>Our study provides potential diagnostic biomarkers and therapeutic targets for CNP.
Also flagged:Netrin-1Cognitive Impairmentspinal cord injuryNetrinlamininCognitive decline
Journal Article2022-04-21✓ 3 SnippetsMeng Y, Sun S, Cao S, Shi B.
In-Text Gene Mentions
Discussion)
…Netrin-1 alone toDCCresults in axonal…
Discussion)
…D coexists withDCC, Netrin-1 enables the…
Discussion)
…Netrin-1 enables theDCCP1 motif to…
Show Full Abstract
<h4>Objective</h4>Although cognitive impairment has received more attention in recent years as a result of spinal cord injury (SCI), the pathogenic process that causes it is still unknown. The neuroprotective effects of Netrin as a family of laminin-related secreted proteins were discovered. The purpose of this study was to determine the changes of serum Netrin-1 after SCI and its relationship with cognitive impairment.<h4>Methods</h4>96 SCI patients and 60 controls were included in our study. We collected baseline data from all participants, measured their serum Netrin-1 levels, and followed up their cognitive levels 3 months later.<h4>Results</h4>The clinical baseline values between the control and SCI groups were not significantly different (<i>p</i> > 0.05). However, the serum Netrin-1 level in the SCI group was significantly lower than that in the control group (528.4 ± 88.3 pg/ml vs. 673.5 ± 97.2 pg/ml, <i>p</i> < 0.05). According to the quartile level of serum Netrin-1 level in the SCI group, we found that with the increase of serum Netrin-1 level, the MoCA score also increased significantly (<i>p</i> < 0.001), indicating that the serum Netrin-1 level was positively correlated with the MoCA score after SCI. After controlling for baseline data, multiple regression analysis revealed that Netrin-1 remained an independent risk factor for cognitive impairment after SCI (=0.274, <i>p</i> = 0.036).<h4>Conclusions</h4>Netrin-1 may be a neuroprotective factor for cognitive impairment, which may serve as a serum marker to predict cognitive impairment after SCI.
Also flagged:water1-octanolglyceroldoxycyclinecodAcynR
Journal Article2022-04-21No SnippetsSeo S, Prabhakar RG, Disney-McKeethen S, Song X, Shamoo Y.
Show Full Abstract
Microdroplet emulsions allow investigators to build controllable microenvironments for applications in experimental evolution and synthetic ecology. We designed a microfluidic platform that uses highly homogenous microdroplets to enable these experiments. We also present a step-by-step protocol for the rapid production of highly homogeneous microdroplets suitable for experimental evolution. We also describe protocols for the propagation and serial passage of microbial populations across a range of selection schemes and potential spatial structures. For complete details on the use and execution of this protocol, please refer to Seo et al. (2021).
Also flagged:lipoproteincardiovascular diseasefamilial combined hyperlipidemiahypercholesterolemiaCHa
Journal Article2022-04-21No SnippetsChakraborty A, Chan DC, Ellis KL, Pang J, Barnett W, Woodward AM, Vorster M, Norman R, Moses EK, Watts GF.
Show Full Abstract
<h4>Objective</h4>Elevated lipoprotein(a) [Lp(a)] is a common inherited condition associated with cardiovascular disease. This study investigated whether cascade testing for Lp(a) was effective in detecting new cases of elevated Lp(a) in families.<h4>Methods</h4>Relatives from adult probands with Lp(a) concentration ≥100 mg/dL were tested for elevated Lp(a) (≥50 mg/dL) via a cascade testing program in a tertiary hospital setting. The prevalence and yield of detecting new cases of elevated Lp(a) among the relatives were assessed.<h4>Results</h4>Of the 83 probands, 43.4% had familial combined hyperlipidemia (FCHL) and 34.9% common hypercholesterolemia (CH). Among 182 relatives tested (151 adults and 31 children), elevated Lp(a) was found in 68.1%, with 32.9% having Lp(a) between 50 and 99 mg/dL and 35.2% having Lp(a) ≥100 mg/dL. One new case of elevated Lp(a) ≥50 mg/dL was identified for every 1.5 relatives tested and 1 new case of elevated Lp(a) ≥100 mg/dL for every 2.8 relatives tested. The proportion of relatives detected with elevated Lp(a) was significantly higher when tested from probands with Lp(a) >150 mg/dL compared with those with Lp(a) between 100 and 150 mg/dL (81.1% vs. 55.5%; <i>P</i> = 0.001). The concordance rates (kappa coefficient) for the detection of elevated Lp(a) with FCHL and CH were 34.8% (0.026) and 53.2% (0.099), respectively.<h4>Conclusion</h4>Cascade testing for elevated Lp(a) from affected probands with phenotypic dyslipidemia is highly effective in identifying new cases of high Lp(a) in families. The yield of detecting elevated Lp(a) is greater when probands have higher levels of Lp(a) and exceeds the detection of relatives with FCHL and CH.
…Indeed, HFE-deficient mice exhibited greater sensitivity to doxorubicin, with increased serum CK and mortality following chronic doxorubicin treatment (40).…
Show Full Abstract
Anthracyclines are a major component of chemotherapies used in many pediatric and adult malignancies. Anthracycline-associated cardiotoxicity (ACT) is a dose-dependent adverse effect that has substantial impact on morbidity and mortality. Therefore, the identification of genetic variants associated with increased risk of ACT has the potential for significant clinical impact to improve patient care. The goal of this review is to summarize the current evidence supporting genetic variants associated with ACT, identify gaps and limitations in current knowledge, and propose future directions for incorporating genetics into clinical practice for patients treated with anthracyclines. We will discuss mechanisms of ACT that could be illuminated by genetics and discuss clinical applications for the cardiologist/cardio-oncologist.
Also flagged:Esophageal CancerCancersESCAmalignant tumorlysosomal-associated membrane protein 2LAMP2
Journal Article2022-04-21✓ 3 SnippetsLiu SP, Li XM, Liu DM, Xie SH, Zhang SB, Li Y, Xie ZF.
In-Text Gene Mentions
Discussion)
…Using the STRING database, we also found that SLC40A1, TFR2, and HFE protein expression was meaningfully linked with LAMP2. SLC40A1 has been shown to be a significant risk gene with respect to OS in ESCC patients (48).…
Results)
…SLC40A1, TFR2, andHFE(P<0.001) ( Figure…
Discussion)
…SLC40A1, TFR2, andHFEprotein expression was…
Show Full Abstract
Esophageal cancer (ESCA) is a common malignant tumor with poor prognosis. Accumulating evidence indicates an important role of lysosomal-associated membrane protein 2 (LAMP2) in the progression and development of various cancers. In this study, we obtained RNA-sequencing raw count data and the corresponding clinical information for ESCA samples from The Cancer Genome Atlas and Gene Expression Omnibus databases. We comprehensively investigated the expression and prognostic significance of <i>LAMP2</i> and relationships between <i>LAMP2</i> expression and prognosis, different clinicopathological parameters, and immune cell infiltration in ESCA. We also obtained the differentially expressed genes between the high <i>LAMP2</i> expression and low <i>LAMP2</i> expression groups in ESCA and performed a functional enrichment analysis of the 250 linked genes most positively related to <i>LAMP2</i> expression. Moreover, we performed the pan-cancer analysis of <i>LAMP2</i> to further analyze the role of <i>LAMP2</i> in 25 commonly occurring types of human cancer. We also verified and compared the expression of <i>LAMP2</i> in 40 samples of human ESCA tissue and adjacent tissues. The results indicated that <i>LAMP2</i> expression was significantly upregulated in ESCA and various human cancers. In addition, <i>LAMP2</i> expression was associated with certain clinicopathological parameters, prognosis, and immune infiltration in ESCA and the other types of cancer. Our study represents a comprehensive pan-cancer analysis of <i>LAMP2</i> and supports the potential use of the modulation of <i>LAMP2</i> in the management of ESCA and various cancers.
Also flagged:Mitochondriaspermatogenesismembranerespiratory enzymessupercomplexesacrosomes
Journal Article2022-04-21No SnippetsRen M, Xu Y, Phoon CKL, Erdjument-Bromage H, Neubert TA, Rajan S, Hussain MM, Schlame M.
Show Full Abstract
Mammalian spermatogenesis is associated with the transient appearance of condensed mitochondria, a singularity of germ cells with unknown function. Using proteomic analysis, respirometry, and electron microscopy with tomography, we studied the development of condensed mitochondria. Condensed mitochondria arose from orthodox mitochondria during meiosis by progressive contraction of the matrix space, which was accompanied by an initial expansion and a subsequent reduction of the surface area of the inner membrane. Compared to orthodox mitochondria, condensed mitochondria respired more actively, had a higher concentration of respiratory enzymes and supercomplexes, and contained more proteins involved in protein import and expression. After the completion of meiosis, the abundance of condensed mitochondria declined, which coincided with the onset of the biogenesis of acrosomes. Immuno-electron microscopy and the analysis of sub-cellular fractions suggested that condensed mitochondria or their fragments were translocated into the lumen of the acrosome. Thus, it seems condensed mitochondria are formed from orthodox mitochondria by extensive transformations in order to support the formation of the acrosomal matrix.
Also flagged:E2FTranscription Factorstumorprostate cancerE2F transcription factorscancers
Journal Article2022-04-21✓ 1 SnippetHan Z, Mo R, Cai S, Feng Y, Tang Z, Ye J, Liu R, Cai Z, Zhu X, Deng Y, Zou Z, Wu Y, Cai Z, Liang Y, Zhong W.
In-Text Gene Mentions
Results)
…ABCA13, SYNE1, ATM,CACNA1E, and KMT2C (…
Show Full Abstract
Given the tumor heterogeneity, most of the current prognostic indicators cannot accurately evaluate the prognosis of patients with prostate cancer, and thus, the best opportunity to intervene in the progression of this disease is missed. E2F transcription factors (E2Fs) have been reported to be involved in the growth of various cancers. Accumulating studies indicate that prostate cancer (PCa) carcinogenesis is attributed to aberrant E2F expression or E2F alteration. However, the expression patterns and prognostic value of the eight E2Fs in prostate cancer have yet to be explored. In this study, The Cancer Genome Atlas (TCGA), Kaplan-Meier Plotter, Metascape, the Kyoto Encyclopedia of Genes and Genomes (KEGG), CIBERSORT, and cBioPortal and bioinformatic analysis were used to investigate E2Fs in patients with PCa. Our results showed that the expression of E2F1-3, E2F5, and E2F6 was higher in prostate cancer tissues than in benign tissues. Furthermore, elevated E2F1-3 and E2F5 expression levels were associated with a higher Gleason score (GS), advanced tumor stage, and metastasis. Survival analysis suggested that high transcription levels of E2F1-3, E2F5, E2F6, and E2F8 were associated with a higher risk of biochemical recurrence. In addition, we developed a prognostic model combining E2F1, E2F6, Gleason score, and the clinical stage that may accurately predict a biochemical recurrence-free survival. Functional enrichment analysis revealed that the E2F family members and their neighboring genes were mainly enriched in cell cycle-related pathways. Somatic mutations in different subgroups were also investigated, and immune components were predicted. Further experiments are warranted to clarify the biological associations between Pca-related E2F family genes, which may influence prognosis via the cell cycle pathway.
Annually, the influenza virus causes 500,000 deaths worldwide. Influenza-associated mortality and morbidity is especially high among the elderly, children, and patients with chronic diseases. While there are antivirals available against influenza, such as neuraminidase inhibitors and adamantanes, there is growing resistance against these drugs. Thus, there is a need for novel antivirals for resistant influenza strains. Host-directed therapies are a potential strategy for influenza as host processes are conserved and are less prone mutations as compared to virus-directed therapies. A literature search was performed for papers that performed viral-host interaction screens and the Reactome pathway database was used for the bioinformatics analysis. A total of 15 studies were curated and 1717 common interactors were uncovered among all these studies. KEGG analysis, Enrichr analysis, STRING interaction analysis was performed on these interactors. Therefore, we have identified novel host pathways that can be targeted for host-directed therapy against influenza in our review.
Also flagged:CortactinCTTNbindingcytoskeletal proteincell cortexSrc
Journal Article2022-04-21No SnippetsBandela M, Belvitch P, Garcia JGN, Dudek SM.
Show Full Abstract
Cortactin (CTTN) is an actin-binding and cytoskeletal protein that is found in abundance in the cell cortex and other peripheral structures of most cell types. It was initially described as a target for Src-mediated phosphorylation at several tyrosine sites within CTTN, and post-translational modifications at these tyrosine sites are a primary regulator of its function. CTTN participates in multiple cellular functions that require cytoskeletal rearrangement, including lamellipodia formation, cell migration, invasion, and various other processes dependent upon the cell type involved. The role of CTTN in vascular endothelial cells is particularly important for promoting barrier integrity and inhibiting vascular permeability and tissue edema. To mediate its functional effects, CTTN undergoes multiple post-translational modifications and interacts with numerous other proteins to alter cytoskeletal structures and signaling mechanisms. In the present review, we briefly describe CTTN structure, post-translational modifications, and protein binding partners and then focus on its role in regulating cellular processes and well-established functional mechanisms, primarily in vascular endothelial cells and disease models. We then provide insights into how CTTN function affects the pathophysiology of multiple lung disorders, including acute lung injury syndromes, COPD, and asthma.
Also flagged:PDdegenerative disease of thenervousdopaminedeathgene expression
Journal Article2022-04-21No SnippetsPantaleo E, Monaco A, Amoroso N, Lombardi A, Bellantuono L, Urso D, Lo Giudice C, Picardi E, Tafuri B, Nigro S, Pesole G, Tangaro S, Logroscino G, Bellotti R.
Show Full Abstract
The increased incidence and the significant health burden associated with Parkinson's disease (PD) have stimulated substantial research efforts towards the identification of effective treatments and diagnostic procedures. Despite technological advancements, a cure is still not available and PD is often diagnosed a long time after onset when irreversible damage has already occurred. Blood transcriptomics represents a potentially disruptive technology for the early diagnosis of PD. We used transcriptome data from the PPMI study, a large cohort study with early PD subjects and age matched controls (HC), to perform the classification of PD vs. HC in around 550 samples. Using a nested feature selection procedure based on Random Forests and XGBoost we reached an AUC of 72% and found 493 candidate genes. We further discussed the importance of the selected genes through a functional analysis based on GOs and KEGG pathways.
As an emergent picornavirus pathogenic to pigs, Senecavirus A (SVA) can replicate in pig kidneys and proliferates well in porcine kidney epithelial PK-15 cells. Here, tandem mass tags (TMT) labeling coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS) was used to analyze the proteome dynamic changes in PK-15 cells during SVA infection. In total, 314, 697 and 426 upregulated differentially expressed proteins (DEPs) and 131, 263 and 342 downregulated DEPs were identified at 12, 24 and 36 hpi, respectively. After ensuring reliability of the proteomic data by quantitative PCR and Western blot testing of five randomly selected DEPs, Mx1, eIF4E, G6PD, TOP1 and PGAM1, all the DEPs were subjected to multiple bioinformatics analyses, including GO, COG, KEGG and STRING. The results reveal that the DEPs were mainly involved in host innate and adaptive immune responses in the early and middle stages of SVA infection, while the DEPs mainly participated in various metabolic processes in the late stage of infection. Finally, we demonstrated that Mx1 protein exerts antiviral activity against SVA by interacting with VP1 and VP2 proteins dependent on its GTPase, oligomerization and interaction activities, while Mx1 interacts with VP3 only depending on its oligomerization activity. Collectively, our study provides valuable clues for further investigation of SVA pathogenesis.
Also flagged:Encephalomalaciagliosisdeep venous thrombosiscancerβ-amyloid precursor proteinAPP
Journal Article2022-04-21✓ 2 SnippetsNguyen KV.
In-Text Gene Mentions
Introduction)
…also known asSERPINC1, and is also…
I A O 0000613)
…and Berichrom ®Antithrombin-III(A), and Chromogenic…
Show Full Abstract
A heterozygous Arg393His point mutation at the reactive site of antithrombin (AT) gene causing thrombosis in a Vietnamese patient is reported and named as Arg393His in AT-Hanoi. The present variant is characterized by a severe reduction of functionally active AT plasma concentration to 42% of normal resulting in multiple severe thrombotic events such as cerebral venous thrombosis (CVT) (encephalomalacia/gliosis), recurrent deep venous thrombosis (DVT) and the development of kidney cancer. Today the complexity of thrombophilia has grown with appreciation that multiple inherited and acquired risk factors may interact to result in a clinically thrombotic phenotype. This article focuses on the following issues: (1) pathophysiology and clinical conditions of Arg393His in AT-Hanoi; (2) "two way association" between cancer and thrombosis in which venous thromboembolism (VTE) can be both a presenting sign and a complication of cancer; (3) efficacy of anticoagulants used for the prevention of cancer-related thrombosis; (4) conditions of acquired risk factors such as cancer or genetic disorders via epigenetic modifications in gene-gene (epistasis) and/or gene-environment interactions such as in Lesch-Nyhan disease (LND), in which the β-amyloid precursor protein (APP) that may interact to predispose a patient to thrombosis and cancer. It is also necessary to study the hypoxanthine-guanine phosphoribosyltransferase (HGprt) enzyme, AT, and APP using expression vectors for exploring their impact on LND, thrombosis as well as other human diseases, especially the ones related to APP such as Alzheimer's disease (AD) and cancer. For such a purpose, the construction of expression vectors for HGprt and APP, with or without the glycosyl-phosphatidylinositol (GPI) anchor, was performed as described in Ref. #148 (Nguyen, K. V., Naviaux, R. K., Nyhan, W. L. Lesch-Nyhan disease: I. Construction of expression vectors for hypoxanthine-guanine phosphoribosyltransferase (HGprt) enzyme and amyloid precursor protein (APP). <i>Nucleosides Nucleotides Nucleic Acids</i> 2020, 39: 905-922). In the same manner, the construction of expression vectors for AT and APP can be performed as shown in Figure 6. These expressions vectors, with or without GPI anchor, could be used as tools for (a) studying the effects of Arg393His mutation in AT; (b) studying the emerging role of Arg393His mutation in AT and cancer; (c) studying intermolecular interactions between APP and AT. Furthermore, the construction of expression vectors as described in Ref. #148, especially the one with GPI, can be used as a model for the construction of expression vectors for any protein targeting to the cell plasma membrane for studying intermolecular interactions and could be therefore useful in the vaccines as well as antiviral drugs development (studying intermolecular interactions between the spike glycoprotein of the severe acute respiratory syndrome coronavirus 2, SARS-CoV-2, as well as its variants and the angiotensin-converting enzyme 2, ACE2, in coronavirus disease 2019 (COVID-19) [155],[156], for example).
Also flagged:watergelatinstarchchloroplastsmitochondriamembrane
Journal Article2022-04-21No SnippetsZhou C, Zhu P, Tian Y, Shi R, Wang L.
Show Full Abstract
All-aqueous systems have attracted intensive attention as a promising platform for applications in cell separation, protein partitioning, and DNA extraction, due to their selective separation capability, rapid mass transfer, and good biocompatibility. Reliable generation of all-aqueous droplets with accurate control over their size and size distribution is vital to meet the increasingly growing demands in emulsion-based applications. However, the ultra-low interfacial tension and large effective interfacial thickness of the water-water interface pose challenges for the generation and stabilization of uniform all-aqueous droplets, respectively. Microfluidics technology has emerged as a versatile platform for the precision generation of all-aqueous droplets with improved stability. This review aims to systematize the controllable generation of all-aqueous droplets and summarize various strategies to improve their stability with microfluidics. We first provide a comprehensive review on the recent progress of all-aqueous droplets generation with microfluidics by detailing the properties of all-aqueous systems, mechanisms of droplet formation, active and passive methods for droplet generation, and the property of droplets. We then review the various strategies used to improve the stability of all-aqueous droplets and discuss the fabrication of biomaterials using all-aqueous droplets as liquid templates. We envision that this review will benefit the future development of all-aqueous droplet generation and its applications in developing biomaterials, which will be useful for researchers working in the field of all-aqueous systems and those who are new and interested in the field.
Also flagged:Cerebral PalsyCPtranslationsStrokeorganizationDisorders
Journal Article2022-04-20No SnippetsWilson YA, Smithers-Sheedy H, Ostojic K, Waight E, Kruer MC, Fahey MC, ICPGC Phenotype Working Group*, Baynam G, Gécz J, Badawi N, McIntyre S.
Show Full Abstract
<h4>Aim</h4>To define clinical common data elements (CDEs) and a mandatory minimum data set (MDS) for genomic studies of cerebral palsy (CP).<h4>Method</h4>Candidate data elements were collated following a review of the literature and existing CDEs. An online, three-round Delphi survey was used to rate each data element as either 'core', 'recommended', 'exploratory', or 'not required'. Members of the International Cerebral Palsy Genomics Consortium (ICPGC) rated the core CDEs as either mandatory or not, to form the MDS. For both the CDEs and the MDS, a data element was considered to have reached consensus if more than 75% of respondents agreed.<h4>Results</h4>Forty-six individuals from around the world formed the Delphi panel: consumers (n=2), scientists/researchers (n=17), medical (n=19), and allied health professionals (n=8). The CDEs include 107 data elements across six categories: demographics, diagnostics, family history, antenatal and neonatal details, clinical traits, and CP-specific assessments. Of these, 10 are mandatory, 42 core, 41 recommended, and 14 are exploratory.<h4>Interpretation</h4>The ICPGC CDEs provide a foundation for the standardization of phenotype data captured in CP genomic studies and will benefit international collaborations and pooling of data, particularly in rare conditions.<h4>What this paper adds</h4>A set of 107 common data elements (CDEs) for genomics studies in cerebral palsy is provided. The CDEs include standard definitions and data values domains. The CDEs will facilitate international data sharing, collaboration, and improved clinical interpretation of findings.
Also flagged:Nuclear respiratory factor 1glioblastomaGBMneuroepithelial brain tumorNRF1transcription factor
Journal Article2022-04-20✓ 2 SnippetsBhawe K, Das JK, Yoo C, Felty Q, Gong Z, Deoraj A, Liuzzi JP, Ehtesham NZ, Hasnain SE, Singh VP, Mohapatra I, Komotar RJ, Roy D.
In-Text Gene Mentions
Text
…CCDC92…
Text
…PLCL1…
Show Full Abstract
<h4>Purpose</h4>The mechanisms contributing to recurrence of glioblastoma (GBM), an aggressive neuroepithelial brain tumor, remain unknown. We have recently shown that nuclear respiratory factor 1 (NRF1) is an oncogenic transcription factor and its transcriptional activity is associated with the progression and prognosis of GBM. Herein, we extend our efforts to (1) identify influential NRF1-driven gene and microRNA (miRNA) expression for the aggressiveness of mesenchymal GBM; and (2) understand the molecular basis for its poor response to therapy.<h4>Methods</h4>Clinical data and RNA-Seq from four independent GBM cohorts were analyzed by Bayesian Network Inference with Java Objects (BANJO) and Markov chain Monte Carlo (MCMC)-based gene order to identify molecular drivers of mesenchymal GBM as well as prognostic indicators of poor response to radiation and chemotherapy.<h4>Results</h4>We are the first to report sex-specific NRF1 motif enriched gene signatures showing increased susceptibility to GBM. Risk estimates for GBM were increased by greater than 100-fold with the joint effect of NRF1-driven gene signatures-CDK4, DUSP6, MSH2, NRF1, and PARK7 in female GBM patients and CDK4, CASP2, H6PD, and NRF1 in male GBM patients. NRF1-driven causal Bayesian network genes were predictive of poor survival and resistance to chemoradiation in IDH1 wild-type mesenchymal GBM patients. NRF1-regulatable miRNAs were also associated with poor response to chemoradiation therapy in female IDH1 wild-type mesenchymal GBM. Stable overexpression of NRF1 reprogramed human astrocytes into neural stem cell-like cells expressing SOX2 and nestin. These cells differentiated into neurons and form tumorospheroids.<h4>Conclusions</h4>In summary, our novel discovery shows that NRF1-driven causal genes and miRNAs involved in cancer cell stemness and mesenchymal features contribute to cancer aggressiveness and recurrence of aggressive therapy-resistant glioblastoma.
Also flagged:Mitomycinwatermitomycin Cacetonepolyelectrolytedegradation
Journal Article2022-04-20No SnippetsLamch Ł, Wilk KA, Dékány I, Deák Á, Hornok V, Janovák L.
Show Full Abstract
Encapsulation of hydrophilic and amphiphilic drugs in appropriate colloidal carrier systems for sustained release is an emerging problem. In general, hydrophobic bioactive substances tend to accumulate in water-immiscible polymeric domains, and the release process is controlled by their low aqueous solubility and limited diffusion from the nanocarrier matrix. Conversely, hydrophilic/amphiphilic drugs are typically water-soluble and insoluble in numerous polymers. Therefore, a core-shell approach─nanocarriers comprising an internal core and external shell microenvironments of different properties─can be exploited for hydrophilic/amphiphilic drugs. To produce colloidally stable poly(lactic-<i>co</i>-glycolic) (PLGA) nanoparticles for mitomycin C (MMC) delivery and controlled release, a unique class of amphiphilic polymers─hydrophobically functionalized polyelectrolytes─were utilized as shell-forming materials, comprising both stabilization via electrostatic repulsive forces and anchoring to the core via hydrophobic interactions. Undoubtedly, the use of these polymeric building blocks for the core-shell approach contributes to the enhancement of the payload chemical stability and sustained release profiles. The studied nanoparticles were prepared via nanoprecipitation of the PLGA polymer and were dissolved in acetone as a good solvent and in an aqueous solution containing hydrophobically functionalized poly(4-styrenesulfonic-<i>co</i>-maleic acid) and poly(acrylic acid) of differing hydrophilic-lipophilic balance values. The type of the hydrophobically functionalized polyelectrolyte (HF-PE) was crucial for the chemical stability of the payload─derivatives of poly(acrylic acid) were found to cause very rapid degradation (hydrolysis) of MMC, in contrast to poly(4-styrenesulfonic-<i>co</i>-maleic acid). The present contribution allowed us to gain crucial information about novel colloidal nanocarrier systems for MMC delivery, especially in the fields of optimal HF-PE concentrations, appropriate core and shell building materials, and the colloidal and chemical stability of the system.
Also flagged:PD-L1cancerpheophorbide Aprogrammed death ligand-1tumordeath
Journal Article2022-04-20No SnippetsGuo Y, Zhang Q, Zhu Q, Gao J, Zhu X, Yu H, Li Y, Zhang C.
Show Full Abstract
Packaging multiple drugs into a nanocarrier with rational design to achieve synergistic cancer therapy remains a challenge due to the intrinsically varied pharmacodynamics of therapeutic agents. Especially difficult is combining small-molecule drugs and macromolecular biologics. Here, we successfully graft pheophorbide A (PPA) photosensitizers on DNA backbone at predesigned phosphorothioate modification sites. The synthesized four PPA-grafted DNAs are assembled into a tetrahedron framework, which further associates with a programmed death ligand-1 (PD-L1) small interfering RNA (siRNA) linker through supramolecular self-assembly to form an siRNA and PPA copackaged nanogel. With dual therapeutic agents inside, the nanogel can photodynamically kill tumor cells and induce remarkable immunogenic cell death. Also, it simultaneously silences the PD-L1 expression of the tumor cells, which substantially promotes the antitumor immune response and leads to an enhanced antitumor efficacy in a synergistic fashion.
Also flagged:Hepcidinpeptide hormonereninangiotensinangiotensin converting enzymes 1binding
Journal Article2022-04-20✓ 5 SnippetsPiesanen J, Valjakka J, Niemelä S, Borgenström M, Nikkari S, Hytönen V, Määttä J, Kunnas T.
In-Text Gene Mentions
Introduction)
…Previously, we have shown an association between genetic variants of HFE, HJV, BMP4 and arterial hypertension [14–16].…
Abstract)
…An association between genetic variants in the genes HFE, HJV, BMP4 and arterial hypertension has been shown earlier.…
Abstract)
…in the genesHFE, HJV ,…
Introduction)
…genetic variants ofHFE, HJV ,…
Introduction)
…prevalence between differentHFEgenotypes carriers.…
Show Full Abstract
An association between genetic variants in the genes HFE, HJV, BMP4 and arterial hypertension has been shown earlier. Proteins encoded by these genes participate in the signalling routes leading eventually to the production of the peptide hormone hepcidin. Mutations in these genes have been associated with the abnormal production of hepcidin in the body. This finding led to studies exploring the possible role of hepcidin in regulating the activity of blood pressure related renin-angiotensin system enzymes. We used molecular modelling to find out if it is possible for hepcidin to bind to the active site of the renin-angiotensin system enzymes, especially renin. Fluorometric assays were used to evaluate the inhibitory effect of hepcidin on renin as well as angiotensin converting enzymes 1 and 2. Finally, bio-layer interferometry technique was used to study hepcidin binding to renin. The molecular modelling showed that hepcidin seems to have similar binding properties to the renin active site as angiotensinogen does. Based on fluorometric enzyme activity assay, hepcidin has an inhibitory effect on renin in vitro, too. However, angiotensin converting enzymes 1 and 2 were not inhibited remarkably by hepcidin-25. In bio-layer interferometry analysis hepcidin-renin binding was concentration dependent. Our results suggest that hepcidin could act as an inhibitor to the renin. Nowadays, there is no known biological inhibitor for renin in vivo and our finding may thus have important clinical implications.
Also flagged:breast cancercancergene expressiontumorshormoneepidermal growth factor receptor 2
Journal Article2022-04-20No SnippetsFiroozbakht F, Rezaeian I, Rueda L, Ngom A.
Show Full Abstract
'De novo' drug discovery is costly, slow, and with high risk. Repurposing known drugs for treatment of other diseases offers a fast, low-cost/risk and highly-efficient method toward development of efficacious treatments. The emergence of large-scale heterogeneous biomolecular networks, molecular, chemical and bioactivity data, and genomic and phenotypic data of pharmacological compounds is enabling the development of new area of drug repurposing called 'in silico' drug repurposing, i.e., computational drug repurposing (CDR). The aim of CDR is to discover new indications for an existing drug (drug-centric) or to identify effective drugs for a disease (disease-centric). Both drug-centric and disease-centric approaches have the common challenge of either assessing the similarity or connections between drugs and diseases. However, traditional CDR is fraught with many challenges due to the underlying complex pharmacology and biology of diseases, genes, and drugs, as well as the complexity of their associations. As such, capturing highly non-linear associations among drugs, genes, diseases by most existing CDR methods has been challenging. We propose a network-based integration approach that can best capture knowledge (and complex relationships) contained within and between drugs, genes and disease data. A network-based machine learning approach is applied thereafter by using the extracted knowledge and relationships in order to identify single and pair of approved or experimental drugs with potential therapeutic effects on different breast cancer subtypes. Indeed, further clinical analysis is needed to confirm the therapeutic effects of identified drugs on each breast cancer subtype.
Also flagged:JMMLmyeloproliferative neoplasmRasNF1CBLKRAS
Journal Article2022-04-20✓ 2 SnippetsRamdas B, Yuen LD, Palam LR, Patel R, Pasupuleti SK, Jideonwo V, Zhang J, Maguire C, Wong E, Kanumuri R, Zhang C, Sandusky G, Chan RJ, Zhang C, Stieglitz E, Haneline L, Kapur R.
In-Text Gene Mentions
Results)
…Y-box 6 (Sox6) expression was…
Results)
…SOX6is involved in…
Show Full Abstract
Juvenile myelomonocytic leukemia (JMML) is an aggressive myeloproliferative neoplasia that lacks effective targeted chemotherapies. Clinically, JMML manifests as monocytic leukocytosis, splenomegaly with consequential thrombocytopenia. Most commonly, patients have gain-of-function (GOF) oncogenic mutations in PTPN11 (SHP2), leading to Erk and Akt hyperactivation. Mechanism(s) involved in co-regulation of Erk and Akt in the context of GOF SHP2 are poorly understood. Here, we show that Bruton's tyrosine kinase (BTK) is hyperphosphorylated in GOF Shp2-bearing cells and utilizes B cell adaptor for PI3K to cooperate with p110δ, the catalytic subunit of PI3K. Dual inhibition of BTK and p110δ reduces the activation of both Erk and Akt. In vivo, individual targeting of BTK or p110δ in a mouse model of human JMML equally reduces monocytosis and splenomegaly; however, the combined treatment results in a more robust inhibition and uniquely rescues anemia and thrombocytopenia. RNA-seq analysis of drug-treated mice showed a profound reduction in the expression of genes associated with leukemic cell migration and inflammation, leading to correction in the infiltration of leukemic cells in the lung, liver, and spleen. Remarkably, in a patient derived xenograft model of JMML, leukemia-initiating stem and progenitor cells were potently inhibited in response to the dual drug treatment.
The mechanisms by which exercise benefits patients with non-alcoholic fatty liver disease (NAFLD), the most common liver disease worldwide, remain poorly understood. A non-targeted liquid chromatography-mass spectrometry (LC-MS)-based metabolomics analysis was used to identify metabolic changes associated with NAFLD in humans upon exercise intervention (without diet change) across four different sample types-adipose tissue (AT), plasma, urine, and stool. Altogether, 46 subjects with NAFLD participated in this randomized controlled intervention study. The intervention group (n = 21) performed high-intensity interval training (HIIT) for 12 weeks while the control group (n = 25) kept their sedentary lifestyle. The participants' clinical parameters and metabolic profiles were compared between baseline and endpoint. HIIT significantly decreased fasting plasma glucose concentration (p = 0.027) and waist circumference (p = 0.028); and increased maximum oxygen consumption rate and maximum achieved workload (p < 0.001). HIIT resulted in sample-type-specific metabolite changes, including accumulation of amino acids and their derivatives in AT and plasma, while decreasing in urine and stool. Moreover, many of the metabolite level changes especially in the AT were correlated with the clinical parameters monitored during the intervention. In addition, certain lipids increased in plasma and decreased in the stool. Glyco-conjugated bile acids decreased in AT and urine. The 12-week HIIT exercise intervention has beneficial ameliorating effects in NAFLD subjects on a whole-body level, even without dietary changes and weight loss. The metabolomics analysis applied to the four different sample matrices provided an overall view on several metabolic pathways that had tissue-type specific changes after HIIT intervention in subjects with NAFLD. The results highlight especially the role of AT in responding to the HIIT challenge, and suggest that altered amino acid metabolism in AT might play a critical role in e.g. improving fasting plasma glucose concentration.Trial registration ClinicalTrials.gov (NCT03995056).
Also flagged:ADAlzheimer's diseaseAgingtaunucleusantibodies
Journal Article2022-04-20No SnippetsPotjewyd FM, Annor-Gyamfi JK, Aubé J, Chu S, Conlon IL, Frankowski KJ, Guduru SKR, Hardy BP, Hopkins MD, Kinoshita C, Kireev DB, Mason ER, Moerk CT, Nwogbo F, Pearce KH, Richardson TI, Rogers DA, Soni DM, Stashko M, Wang X, Wells C, Willson TM, Frye SV, Young JE, Axtman AD.
Show Full Abstract
<h4>Introduction</h4>The portfolio of novel targets to treat Alzheimer's disease (AD) has been enriched by the Accelerating Medicines Partnership Program for Alzheimer's Disease (AMP AD) program.<h4>Methods</h4>Publicly available resources, such as literature and databases, enabled a data-driven effort to identify existing small molecule modulators for many protein products expressed by the genes nominated by AMP AD and suitable positive control compounds to be included in the set. Compounds contained within the set were manually selected and annotated with associated published, predicted, and/or experimental data.<h4>Results</h4>We built an annotated set of 171 small molecule modulators targeting 98 unique proteins that have been nominated by AMP AD consortium members as novel targets for the treatment of AD. The majority of compounds included in the set are inhibitors. These small molecules vary in their quality and should be considered chemical tools that can be used in efforts to validate therapeutic hypotheses, but which will require further optimization. A physical copy of the AD Informer Set can be requested on the Target Enablement to Accelerate Therapy Development for Alzheimer's Disease (TREAT-AD) website.<h4>Discussion</h4>Small molecules that enable target validation are important tools for the translation of novel hypotheses into viable therapeutic strategies for AD.
Also flagged:Peritoneal mesotheliomaMesotheliomaglycerol carbonatepaclitaxelnanoparticletumor
Journal Article2022-04-20No SnippetsSabatelle RC, Liu R, Hung YP, Bressler E, Neal EJ, Martin A, Ekladious I, Grinstaff MW, Colson YL.
Show Full Abstract
Peritoneal mesothelioma is an aggressive disease with a median survival of under three years, due to a lack of effective treatment options. Mesothelioma is traditionally considered a "chemoresistant" tumor; however, low intratumoral drug levels coupled with the inability to administer high systemic doses suggests that therapeutic resistance may be due to poor drug delivery rather than inherent biology. While patient survival may improve with repetitive local intraperitoneal infusions of chemotherapy throughout the perioperative period, these regimens carry associated toxicities and significant peri-operative morbidity. To circumvent these issues, we describe ultra-high drug loaded nanoparticles (NPs) composed of a unique poly(1,2-glycerol carbonate)-graft-succinate-paclitaxel (PGC-PTX + PTX) conjugate. PGC-PTX + PTX NPs are cytotoxic, localize to tumor in vivo, and improve survival in a murine model of human peritoneal mesothelioma after a single intraperitoneal (IP) injection compared to multiple weekly doses of the clinically utilized formulation PTX-C/E. Given their unique pharmacokinetics, a second intraperitoneal dose of PGC-PTX + PTX NPs one month later more than doubles the overall survival compared to the clinical control (122 versus 58 days). These results validate the clinical potential of prolonged local paclitaxel to treat intracavitary malignancies such as mesothelioma using a tailored polymer-mediated nanoparticle formulation.
Also flagged:netrin-1colorectal cancerNTN1netrin-1 receptors deleted inmethylationhypermethylation
Journal Article2022-04-20✓ 2 SnippetsNakayama H, Ohnuki H, Nakahara M, Nishida-Fukuda H, Sakaue T, Fukuda S, Higashiyama S, Doi Y, Mitsuyoshi M, Okimoto T, Tosato G, Kusumoto C.
In-Text Gene Mentions
Abstract)
…colorectal cancer (DCC) and uncoordinated…
Text
…DCC…
Show Full Abstract
Netrin-1, the protein product of the NTN1 gene, is an axon guidance molecule implicated in regulation of cell survival and tumorigenesis. Expression of the netrin-1 receptors deleted in colorectal cancer (DCC) and uncoordinated 5 homolog (UNC5H) is frequently silenced in colorectal cancer (CRC) by either loss of heterozygosity or epigenetic mechanisms. However, netrin-1 expression and regulation in CRC are mostly unknown. Here, we report that NTN1 expression is significantly reduced in most CRC tissues compared to the adjacent normal intestinal mucosa, and that NTN1 DNA methylation is significantly higher in CRCs (24.6%) than in the adjacent normal intestinal mucosa (4.0%). In 6 CRC cell lines, NTN1 expression is low. Treatment with 5-Aza-2'-deoxycytidine increased expression of NTN1 in CRC cell lines, indicating that DNA methylation represses NTN1 transcription in CRCs. NTN1 DNA hypermethylation was significantly associated with advanced CRC disease. Median netrin-1 serum levels were significantly decreased in CRC patients (330.1 pg/mL) compared with normal individuals (438.6 pg/mL). Our results suggest that netrin-1 is a candidate biomarker for CRC.
Also flagged:Autoimmunityvesiclesmembranepathogenesisapoptotic cellsautoimmune diseases
Journal Article2022-04-20✓ 1 SnippetRother N, Yanginlar C, Pieterse E, Hilbrands L, van der Vlag J.
In-Text Gene Mentions
S I O 001029)
…Extrinsic apoptosis is triggered by the engagement of so-called death receptors (e.g. Fas-receptor) or by dependence receptors, a family of structurally unrelated membrane receptors that are activated as soon as their substrate concentration falls below a certain threshold level such as DCC (deleted in colorectal carcinoma), p75NTR (p75 neurotrophin receptor) (88–90).…
Show Full Abstract
Microparticles (MPs) are small (100 nm - 1 um) extracellular vesicles derived from the plasma membrane of dying or activated cells. MPs are important mediators of intercellular communication, transporting proteins, nucleic acids and lipids from the parent cell to other cells. MPs resemble the state of their parent cells and are easily accessible when released into the blood or urine. MPs also play a role in the pathogenesis of different diseases and are considered as potential biomarkers. MP isolation and characterization is technically challenging and results in different studies are contradictory. Therefore, uniform guidelines to isolate and characterize MPs should be developed. Our understanding of MP biology and how MPs play a role in different pathological mechanisms has greatly advanced in recent years. MPs, especially if derived from apoptotic cells, possess strong immunogenic properties due to the presence of modified proteins and nucleic acids. MPs are often found in patients with autoimmune diseases where MPs for example play a role in the break of immunological tolerance and/or induction of inflammatory conditions. In this review, we describe the main techniques to isolate and characterize MPs, define the characteristics of MPs generated during cell death, illustrate different mechanism of intercellular communication <i>via</i> MPs and summarize the role of MPs in pathological mechanisms with a particular focus on autoimmune diseases.
Also flagged:PathogenesisDiabetic kidney diseasediabetes mellitusinflammatory responseshemodynamic disorderscancer
Journal Article2022-04-20✓ 1 SnippetHu M, Ma Q, Liu B, Wang Q, Zhang T, Huang T, Lv Z.
In-Text Gene Mentions
S I O 001029)
…SOX6 has been reported to inhibit pancreatic β cell proliferation to negatively regulate insulin secretion (Iguchi et al., 2007) and participate in proliferation of renal tumor cells (Chen et al., 2020).…
Show Full Abstract
Diabetic kidney disease (DKD) is one of the major microvascular complications of diabetes mellitus, with relatively high morbidity and mortality globally but still in short therapeutic options. Over the decades, a large body of data has demonstrated that oxidative stress, inflammatory responses, and hemodynamic disorders might exert critical influence in the initiation and development of DKD, whereas the delicate pathogenesis of DKD remains profoundly elusive. Recently, long non-coding RNAs (lncRNAs), extensively studied in the field of cancer, are attracting increasing attentions on the development of diabetes mellitus and its complications including DKD, diabetic retinopathy, and diabetic cardiomyopathy. In this review, we chiefly focused on abnormal expression and function of lncRNAs in major resident cells (mesangial cell, endothelial cell, podocyte, and tubular epithelial cell) in the kidney, summarized the critical roles of lncRNAs in the pathogenesis of DKD, and elaborated their potential therapeutic significance, in order to advance our knowledge in this field, which might help in future research and clinical treatment for the disease.
Also flagged:Ulcerative Colitischronic inflammatory diseasepathogenesisBEST4inflammatory disease of theinflammatory bowel disease
Journal Article2022-04-20✓ 3 SnippetsSerigado JM, Foulke-Abel J, Hines WC, Hanson JA, In J, Kovbasnjuk O.
In-Text Gene Mentions
S I O 001029)
…In UC, the fate of SC markers LGR5, OLFM4, or AXIN2 is not clear, as these transcripts were not listed among those enriched or downregulated in UC in the Oxford study.…
S I O 001029)
…Additionally, OLFM4 is mainly upregulated in Stem and TA1 clusters in healthy epithelium, but in UC is elevated in TA and Absorptive Enterocytes.…
S I O 001029)
…In contrast, OLFM4 was slightly upregulated in stem cells and much more elevated in all TA clusters and in Enterocytes in UC.…
Show Full Abstract
Ulcerative Colitis (UC) is a chronic inflammatory disease of the intestinal tract for which a definitive etiology is yet unknown. Both genetic and environmental factors have been implicated in the development of UC. Recently, single cell RNA sequencing (scRNA-seq) technology revealed cell subpopulations contributing to the pathogenesis of UC and brought new insight into the pathways that connect genome to pathology. This review describes key scRNA-seq findings in two major studies by Broad Institute and University of Oxford, investigating the transcriptomic landscape of epithelial cells in UC. We focus on five major findings: (1) the identification of BEST4 + cells, (2) colonic microfold (M) cells, (3) detailed comparison of the transcriptomes of goblet cells, and (4) colonocytes and (5) stem cells in health and disease. In analyzing the two studies, we identify the commonalities and differences in methodologies, results, and conclusions, offering possible explanations, and validated several cell cluster markers. In systematizing the results, we hope to offer a framework that the broad scientific GI community and GI clinicians can use to replicate or corroborate the extensive new findings that RNA-seq offers.
Also flagged:mitochondrialC2TGM5NUP93C19orf12PROP1
Journal Article2022-04-20✓ 1 SnippetKaja E, Lejman A, Sielski D, Sypniewski M, Gambin T, Dawidziuk M, Suchocki T, Golik P, Wojtaszewska M, Mroczek M, Stępień M, Szyda J, Lisiak-Teodorczyk K, Wolbach F, Kołodziejska D, Ferdyn K, Dąbrowski M, Woźna A, Żytkiewicz M, Bodora-Troińska A, Elikowski W, Król ZJ, Zaczyński A, Pawlak A, Gil R, Wierzba W, Dobosz P, Zawadzka K, Zawadzki P, Sztromwasser P.
In-Text Gene Mentions
Results)
…in POL, i.e.,HTT(1 variant in…
Show Full Abstract
Although Slavic populations account for over 4.5% of world inhabitants, no centralised, open-source reference database of genetic variation of any Slavic population exists to date. Such data are crucial for clinical genetics, biomedical research, as well as archeological and historical studies. The Polish population, which is homogenous and sedentary in its nature but influenced by many migrations of the past, is unique and could serve as a genetic reference for the Slavic nations. In this study, we analysed whole genomes of 1222 Poles to identify and genotype a wide spectrum of genomic variation, such as small and structural variants, runs of homozygosity, mitochondrial haplogroups, and <i>de novo</i> variants. Common variant analyses showed that the Polish cohort is highly homogenous and shares ancestry with other European populations. In rare variant analyses, we identified 32 autosomal-recessive genes with significantly different frequencies of pathogenic alleles in the Polish population as compared to the non-Finish Europeans, including <i>C2</i>, <i>TGM5</i>, <i>NUP93</i>, <i>C19orf12</i>, and <i>PROP1</i>. The allele frequencies for small and structural variants, calculated for 1076 unrelated individuals, are released publicly as The Thousand Polish Genomes database, and will contribute to the worldwide genomic resources available to researchers and clinicians.
…Netrin receptor DCC (DCC) using Western blotting.…
Methods)
…for PTPRD andDCC[ 37 ]…
Show Full Abstract
The β-site Amyloid precursor protein Cleaving Enzyme 1 (BACE1) is an extensively studied therapeutic target for Alzheimer's disease (AD), owing to its role in the production of neurotoxic amyloid beta (Aβ) peptides. However, despite numerous BACE1 inhibitors entering clinical trials, none have successfully improved AD pathogenesis, despite effectively lowering Aβ concentrations. This can, in part, be attributed to an incomplete understanding of BACE1, including its physiological functions and substrate specificity. We propose that BACE1 has additional important physiological functions, mediated through substrates still to be identified. Thus, to address this, we computationally analysed a list of 533 BACE1 dependent proteins, identified from the literature, for potential BACE1 substrates, and compared them against proteins differentially expressed in AD. We identified 15 novel BACE1 substrates that were specifically altered in AD. To confirm our analysis, we validated Protein tyrosine phosphatase receptor type D (PTPRD) and Netrin receptor DCC (DCC) using Western blotting. These findings shed light on the BACE1 inhibitor failings and could enable the design of substrate-specific inhibitors to target alternative BACE1 substrates. Furthermore, it gives us a greater understanding of the roles of BACE1 and its dysfunction in AD.
Also flagged:WntT-Box Transcription Factor 3TBX3chromosomeTRIML1TRIML2
Journal Article2022-04-20No SnippetsLiu Z, Li H, Zhong Z, Jiang S.
Show Full Abstract
Teat number plays an important role in the reproductive performance of sows and the growth of piglets. However, the quantitative trait loci (QTLs) and candidate genes for the teat number-related traits in Qingping pigs remain unknown. In this study, we performed GWAS based on whole-genome single-nucleotide polymorphisms (SNPs) and insertions/deletions (Indels) for the total number of teats and five other related traits in 100 Qingping pigs. SNPs and Indels of all 100 pigs were genotyped using 10× whole genome resequencing. GWAS using General Linear Models (GLM) detected a total of 28 SNPs and 45 Indels as peak markers for these six traits. We also performed GWAS for the absolute difference between left and right teat number (ADIFF) using Fixed and random model Circulating Probability Unification (FarmCPU). The most strongly associated SNP and Indel with a distance of 562,788 bp were significantly associated with ADIFF in both GLM and FarmCPU models. In the 1-Mb regions of the most strongly associated SNP and Indel, there were five annotated genes, including <i>TRIML1</i>, <i>TRIML2</i>, <i>ZFP42</i>, <i>FAT1</i> and <i>MTNR1A</i>. We also highlighted <i>TBX3</i> as an interesting candidate gene for SSC14. Enrichment analysis of candidate genes suggested the Wnt signaling pathway may contribute to teat number-related traits. This study expanded significant marker-trait associations for teat number and provided useful molecular markers and candidate genes for teat number improvement in the breeding of sows.
Also flagged:SynthesisBenzamidecomplex IIbenzamidesamideester
Journal Article2022-04-20No SnippetsVairoletti F, Paulino M, Mahler G, Salinas G, Saiz C.
Show Full Abstract
A recent screen of 67,012 compounds identified a new family of compounds with excellent nematicidal activity: the <i>ortho</i>-substituted benzamide families Wact-11 and Wact-12. These compounds are active against <i>Caenorhabditis elegans</i> and parasitic nematodes by selectively inhibiting nematode complex II, and they display low toxicity in mammalian cells and vertebrate organisms. Although a big number of benzamides were tested against <i>C. elegans</i> in high-throughput screens, bioisosteres of the amide moiety were not represented in the chemical space examined. We thus identified an opportunity for the design, synthesis and evaluation of novel compounds, using bioisosteric replacements of the amide group present in benzamides. The compound Wact-11 was used as the reference scaffold to prepare a set of bioisosteres to be evaluated against <i>C. elegans</i>. Eight types of amide replacement were selected, including ester, thioamide, selenoamide, sulfonamide, alkyl thio- and oxo-amides, urea and triazole. The results allowed us to perform a structure-activity relationship, highlighting the relevance of the amide group for nematicide activity. Experimental evidence was complemented with in silico structural studies over a <i>C. elegans</i> complex II model as a molecular target of benzamides. Importantly, compound Wact-11 was active against the flatworm <i>Echinococcus granulosus</i>, suggesting a previously unreported pan-anthelmintic potential for benzamides.
Also flagged:Calciumextracellularmitochondriaendoplasmic reticulummitochondrial permeability transition poredeath
Journal Article2022-04-20No SnippetsMatuz-Mares D, González-Andrade M, Araiza-Villanueva MG, Vilchis-Landeros MM, Vázquez-Meza H.
Show Full Abstract
Calcium is used in many cellular processes and is maintained within the cell as free calcium at low concentrations (approximately 100 nM), compared with extracellular (millimolar) concentrations, to avoid adverse effects such as phosphate precipitation. For this reason, cells have adapted buffering strategies by compartmentalizing calcium into mitochondria and the endoplasmic reticulum (ER). In mitochondria, the calcium concentration is in the millimolar range, as it is in the ER. Mitochondria actively contribute to buffering cellular calcium, but if matrix calcium increases beyond physiological demands, it can promote the opening of the mitochondrial permeability transition pore (mPTP) and, consequently, trigger apoptotic or necrotic cell death. The pathophysiological implications of mPTP opening in ischemia-reperfusion, liver, muscle, and lysosomal storage diseases, as well as those affecting the central nervous system, for example, Parkinson's disease (PD), Alzheimer's disease (AD), Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS) have been reported. In this review, we present an updated overview of the main cellular mechanisms of mitochondrial calcium regulation. We specially focus on neurodegenerative diseases related to imbalances in calcium homeostasis and summarize some proposed therapies studied to attenuate these diseases.
Also flagged:annexin A6membranemineralizationapatiteminerallipid
Journal Article2022-04-20No SnippetsWang Y, Weremiejczyk L, Strzelecka-Kiliszek A, Maniti O, Amabile Veschi E, Bolean M, Ramos AP, Ben Trad L, Magne D, Bandorowicz-Pikula J, Pikula S, Millán JL, Bottini M, Goekjian P, Ciancaglini P, Buchet R, Dou WT, Tian H, Mebarek S, He XP, Granjon T.
Show Full Abstract
Matrix vesicles (MVs) are 100-300 nm spherical structures released by mineralization competent cells to initiate formation of apatite, the mineral component in bones. Among proteins present in MVs, annexin A6 (AnxA6) is thought to be ubiquitously distributed in the MVs' lumen, on the surface of the internal and external leaflets of the membrane and also inserted in the lipid bilayer. To determine the molecular mechanism(s) that lead to the different locations of AnxA6, we hypothesized the occurrence of a pH drop during the mineralization. Such a change would induce the AnxA6 protonation, which in turn, and because of its isoelectric point of 5.41, would change the protein hydrophobicity facilitating its insertion into the MVs' bilayer. The various distributions of AnxA6 are likely to disturb membrane phospholipid organization. To examine this possibility, we used fluorescein as pH reporter, and established that pH decreased inside MVs during apatite formation. Then, 4-(14-phenyldibenzo[a,c]phenazin-9(14H)-yl)-phenol, a vibration-induced emission fluorescent probe, was used as a reporter of changes in membrane organization occurring with the varying mode of AnxA6 binding. Proteoliposomes containing AnxA6 and 1,2-Dimyristoyl-<i>sn-</i>glycero-3phosphocholine (DMPC) or 1,2-Dimyristoyl-<i>sn-</i>glycero-3phosphocholine: 1,2-Dipalmitoyl-<i>sn-</i>glycero-3-phosphoserine (DMPC:DPPS 9:1), to mimic the external and internal MV membrane leaflet, respectively, served as biomimetic models to investigate the nature of AnxA6 binding. Addition of Anx6 to DMPC at pH 7.4 and 5.4, or DMPC:DPPS (9:1) at pH 7.4 induced a decrease in membrane fluidity, consistent with AnxA6 interactions with the bilayer surface. In contrast, AnxA6 addition to DMPC:DPPS (9:1) at pH 5.4 increased the fluidity of the membrane. This latest result was interpreted as reflecting the insertion of AnxA6 into the bilayer. Taken together, these findings point to a possible mechanism of AnxA6 translocation in MVs from the surface of the internal leaflet into the phospholipid bilayer stimulated upon acidification of the MVs' lumen during formation of apatite.
Also flagged:LipidMembranesHuntingtinHuntington's diseaseneurodegenerative disordermembrane
Journal Article2022-04-19✓ 5 SnippetsBeasley M, Frazee N, Groover S, Valentine SJ, Mertz B, Legleiter J.
In-Text Gene Mentions
Abstract)
…Huntington's disease is a neurodegenerative disorder caused by an expanded polyglutamine (polyQ) domain within the huntingtin protein (htt) that initiates toxic protein aggregation.…
Abstract)
…the huntingtin protein (htt) that initiates toxic…
Abstract)
…Httdirectly interacts with…
Abstract)
…phospholipid tails onhtt-lipid interaction and htt…
Abstract)
…htt-lipid interaction andhttaggregation was determined.…
Show Full Abstract
Huntington's disease is a neurodegenerative disorder caused by an expanded polyglutamine (polyQ) domain within the huntingtin protein (htt) that initiates toxic protein aggregation. Htt directly interacts with membranes, influencing aggregation and spurring membrane abnormalities. These interactions are facilitated by the 17 N-terminal residues (Nt17) that form an amphipathic α-helix implicated in both lipid binding and aggregation. Here, the impact of unsaturation in phospholipid tails on htt-lipid interaction and htt aggregation was determined. There was no correlation between the degree of htt-lipid complexation and the degree of htt aggregation in the presence of each lipid system, indicating that lipid systems with different properties uniquely alter the membrane-mediated aggregation mechanisms. Also, the association between Nt17 and membrane surfaces is determined by complementarity between hydrophobic residues and membrane defects and how easily the peptide can partition into the bilayer. Our results provide critical insights into how membrane physical properties influence downstream htt aggregation.
<h4>Objective</h4>This article describes the Personalized Reimbursement Model (PRM) program methodology, limitations, achievement and perspectives in using real-world data of cancer drugs use to improve and personalize drug pricing and reimbursement in France.<h4>Materials and methods</h4>PRM platform aggregates Electronic Pharmacy Records (EPR) data from French medical centers (PRM centers) to build retrospective cohorts of patients treated with injectable cancer drugs in a hospital setting. Data extracted on January 1st, 2020, from breast cancer (BC) patients who received trastuzumab, trastuzumab emtansin or pertuzumab since January 1st, 2011, and from lung cancer (LC) patients who received bevacizumab or atezolizumab since January 1st, 2015, enabled recovering their injectable cancer drugs history from diagnosis date until December 30th, 2019, and served as dataset for assessment.<h4>Results</h4>123 PRM centers provided data from 30,730 patients (25,660 BC and 5,070 LC patients respectively). Overall, 20,942 (82%) of BC and 4,716 (93%) of LC patients were analyzed. Completion rate was above 98% for patients characteristics, diagnostic and treatment related data. PRM centers cover 48% and 33% of BC and LC patients in-hospital therapeutic management in France, respectively. Distribution of BC and LC patients therapeutic management, by medical center category and geographic location, was similar in PRM centers to all French medical centers, ensuring the representativeness of the PRM platform.<h4>Conclusion</h4>PRM Platform enabled building a national database generating on demand Real-World Evidence based on EPR. This enabled the first performance-based risk-sharing arrangements based on PRM data, between the CEPS and Roche, for atezolizumab cancer immunotherapy in metastatic non-small cell lung cancer indication.
Also flagged:graphenedopaminenorepinephrineneurological diseaseaction potentialsmembrane
Journal Article2022-04-19No SnippetsWu G, Zhang N, Matarasso A, Heck I, Li H, Lu W, Phaup JG, Schneider MJ, Wu Y, Weng Z, Sun H, Gao Z, Zhang X, Sandberg SG, Parvin D, Seaholm E, Islam SK, Wang X, Phillips PEM, Castro DC, Ding S, Li DP, Bruchas MR, Zhang Y.
Show Full Abstract
The real-time monitoring of neurochemical release <i>in vivo</i> plays a critical role in understanding the biochemical process of the complex nervous system. Current technologies for such applications, including microdialysis and fast-scan cyclic voltammetry, suffer from limited spatiotemporal resolution or poor selectivity. Here, we report a soft implantable aptamer-graphene microtransistor probe for real-time monitoring of neurochemical release. As a demonstration, we show the monitoring of dopamine with nearly cellular-scale spatial resolution, high selectivity (dopamine sensor >19-fold over norepinephrine), and picomolar sensitivity, simultaneously. Systematic benchtop evaluations, <i>ex vivo</i> experiments, and <i>in vivo</i> studies in mice models highlight the key features and demonstrate the capability of capturing the dopamine release dynamics evoked by pharmacological stimulation, suggesting the potential applications in basic neuroscience studies and studying neurological disease-related processes. The developed system can be easily adapted for monitoring other neurochemicals and drugs by simply replacing the aptamers functionalized on the graphene microtransistors.
Also flagged:Alpha-1-antichymotrypsinglycoprotein alpha-1-antichymotrypsinAACTserine proteaseproteolysisglycosylation
Journal Article2022-04-19No SnippetsJin Y, Wang W, Wang Q, Zhang Y, Zahid KR, Raza U, Gong Y.
Show Full Abstract
The glycoprotein alpha-1-antichymotrypsin (AACT), a serine protease inhibitor, is mainly synthesized in the liver and then secreted into the blood and is involved in the acute phase response, inflammation, and proteolysis. The dysregulation of AACT and its glycosylation levels are associated with tumor progression and recurrence, and could be used as a biomarker for tumor monitoring. In this review, we summarized the expression level, glycosylation modification, and biological characteristics of AACT during inflammation, neurodegenerative or other elderly diseases, and tumorigenesis, as well as, focused on the biological roles of AACT in cancer. The aberrant expression of AACT in cancer might be due to genetic alterations and/or immune by bioinformatics analysis. Moreover, AACT may serve as a diagnostic or prognostic biomarker or therapeutic target in tumors. Furthermore, we found that the expression of AACT was associated with the overall survival of patients with human cancers. Decreased AACT expression was associated with poor survival in patients with liver cancer, increased AACT expression was associated with shorter survival in patients with pancreatic cancer, and decreased AACT expression was associated with shorter survival in patients with early lung cancer. The review confirmed the key roles of AACT in tumorigenesis, suggesting that the glycoprotein AACT may serve as a biomarker for tumor diagnosis and prognosis, and could be a potential therapeutic target for human diseases.
…The spectrum of pathologic effects of pathogenic HTT gene expansion has now expanded to include not simply the HD neurodegenerative phenotype, but also to include abnormalities during neurodevelopment, including a greater propensity for developmental malformations in the brain, as well as ALS [12, 27, 28, 30].…
Introduction)
…In Huntington disease (HD), the cardinal pathologic features are the worsening, topographic, degeneration of the neostriatum (caudate nucleus, putamen, and nucleus accumbens), in which the medium spiny neuron is the most vulnerable cell type, and the appearance of huntingtin inclusions due to abnormal polyglutamine (polyQ) expansion of the huntingtin protein (HTT) [13, 63, 64].…
Introduction)
…Herndon et al. applied the 1C2 antibody, which targets the polyQ stretch of the HTT protein, to a series of 19 HD brains and found widespread inclusions in the brains without noticeable differences of abundance between neocortices [25].…
Introduction)
…Becher et al. found step-wise increases in intranuclear HTT inclusion density with higher CAG repeat expansions in the cortex of 20 HD brains using a variety of HTT-specific antibodies and demonstrated intercortical variability of intranuclear inclusion density [1].…
Introduction)
…the huntingtin protein (HTT) [ 13 ,…
Show Full Abstract
Huntington disease is characterized by progressive neurodegeneration, especially of the striatum, and the presence of polyglutamine huntingtin (HTT) inclusions. Although HTT inclusions are most abundant in the neocortex, their neocortical distribution and density in relation to the extent of CAG repeat expansion in the HTT gene and striatal pathologic grade have yet to be formally established. We immunohistochemically studied 65 brains with a pathologic diagnosis of Huntington disease to investigate the cortical distributions and densities of HTT inclusions within the calcarine (BA17), precuneus (BA7), motor (BA4) and prefrontal (BA9) cortices; in 39 of these brains, a p62 immunostain was used for comparison. HTT inclusions predominate in the infragranular cortical layers (layers V-VI) and layer III, however, the densities of HTT inclusions across the human cerebral cortex are not uniform but are instead regionally contingent. The density of HTT and p62 inclusions (intranuclear and extranuclear) in layers V-VI increases caudally to rostrally (BA17 < BA7 < BA4 < BA9) with the median burden of HTT inclusions being 38-fold greater in the prefrontal cortex (BA9) than in the calcarine cortex (BA17). Conversely, intranuclear HTT inclusions prevail in the calcarine cortex irrespective of HTT CAG length. Neocortical HTT inclusion density correlates with CAG repeat expansion, but not with the neuropathologic grade of striatal degeneration (Vonsattel grade) or with the duration of clinical disease since motor onset. Extrapolation of these findings suggest that HTT inclusions are at a regionally-contingent, CAG-dependent, density during the advanced stages of HD. The distribution and density of HTT inclusions in HD therefore does not provide a measure of pathologic disease stage but rather infers the degree of pathogenic HTT expansion.
The gene regulation underlying axon formation and its exclusiveness to neurons remains elusive. TRIM46 is postulated to determine axonal fate. We show Trim46 mRNA is expressed before axonogenesis, but TRIM46 protein level is inhibited by alternative splicing of two cassette exons coupled separately to stability controls of Trim46 mRNA and proteins, effectively inducing functional knockout of TRIM46 proteins. Exon 8 inclusion causes nonsense-mediated mRNA decay of Trim46 transcripts. PTBP2-mediated exon 10 skipping produces transcripts encoding unstable TRIM46 proteins. During axonogenesis, transcriptional activation, decreased exon 8 inclusion, and enhanced exon 10 inclusion converge to increase TRIM46 proteins, leading to its neural-specific expression. Genetic deletion of these exons alters TRIM46 protein levels and shows TRIM46 is instructive though not always required for AnkG localization nor a determinant of AnkG density. Therefore, two concurrently but independently regulated alternative exons orchestrate the temporal induction and tissue-specific expression of TRIM46 proteins to mediate axon formation.
Also flagged:Cognitive ImpairmentDiffuse Brain InjuryTraumatic brain injurylipopolysaccharideCSF1Rgene expression
Journal Article2022-04-19✓ 1 SnippetBray CE, Witcher KG, Adekunle-Adegbite D, Ouvina M, Witzel M, Hans E, Tapp ZM, Packer J, Goodman E, Zhao F, Chunchai T, O'Neil S, Chattipakorn SC, Sheridan J, Kokiko-Cochran ON, Askwith C, Godbout JP.
In-Text Gene Mentions
Text
…Negr1…
Show Full Abstract
Traumatic brain injury (TBI) is associated with an increased risk of cognitive, psychiatric, and neurodegenerative complications that may develop after injury. Increased microglial reactivity following TBI may underlie chronic neuroinflammation, neuropathology, and exaggerated responses to immune challenges. Therefore, the goal of this study was to force turnover of trauma-associated microglia that develop after diffuse TBI and determine whether this alleviated chronic inflammation, improved functional recovery and attenuated reduced immune reactivity to lipopolysaccharide (LPS) challenge. Male mice received a midline fluid percussion injury (mFPI) and 7 d later were subjected to a forced microglia turnover paradigm using CSF1R antagonism (PLX5622). At 30 d postinjury (dpi), cortical gene expression, dendritic complexity, myelin content, neuronal connectivity, cognition, and immune reactivity were assessed. Myriad neuropathology-related genes were increased 30 dpi in the cortex, and 90% of these gene changes were reversed by microglial turnover. Reduced neuronal connectivity was evident 30 dpi and these deficits were attenuated by microglial turnover. TBI-associated dendritic remodeling and myelin alterations, however, remained 30 dpi independent of microglial turnover. In assessments of functional recovery, increased depressive-like behavior, and cognitive impairment 30 dpi were ameliorated by microglia turnover. To investigate microglial priming and reactivity 30 dpi, mice were injected intraperitoneally with LPS. This immune challenge caused prolonged lethargy, sickness behavior, and microglial reactivity in the TBI mice. These extended complications with LPS in TBI mice were prevented by microglia turnover. Collectively, microglial turnover 7 dpi alleviated behavioral and cognitive impairments associated with microglial priming and immune reactivity 30 dpi.<b>SIGNIFICANCE STATEMENT</b> A striking feature of traumatic brain injury (TBI), even mild injuries, is that over 70% of individuals have long-term neuropsychiatric complications. Chronic inflammatory processes are implicated in the pathology of these complications and these issues can be exaggerated by immune challenge. Therefore, our goal was to force the turnover of microglia 7 d after TBI. This subacute 7 d postinjury (dpi) time point is a critical transitional period in the shift toward chronic inflammatory processes and microglia priming. This forced microglia turnover intervention in mice attenuated the deficits in behavior and cognition 30 dpi. Moreover, microglia priming and immune reactivity after TBI were also reduced with microglia turnover. Therefore, microglia represent therapeutic targets after TBI to reduce persistent neuroinflammation and improve recovery.
Also flagged:sickle cell diseasethalassemiacancerarboviral infectionsantibodyHIV) infection
Journal Article2022-04-19No SnippetsJosephson CD, Glynn S, Mathew S, Birch R, Bakkour S, Baumann Kreuziger L, Busch MP, Chapman K, Dinardo C, Hendrickson J, Hod EA, Kelly S, Luban N, Mast A, Norris P, Custer B, Sabino E, Sachais B, Spencer BR, Stone M, Kleinman S, National Heart, Lung, and Blood Institute (NHLBI) Recipient Epidemiology and Donor Evaluation Study-IV-Pediatric (REDS-IV-P).
Show Full Abstract
<h4>Background</h4>The Recipient Epidemiology and Donor Evaluation Study-IV-Pediatric (REDS-IV-P) is a new iteration of prior National Heart, Lung, and Blood Institute (NHLBI) REDS programs that focus on improving transfusion recipient outcomes across the lifespan as well as the safety and availability of the blood supply.<h4>Study design and methods</h4>The US program includes blood centers and hospitals (22 including 6 free-standing Children's hospitals) in four geographic regions. The Brazilian program has 5 participating hemocenters. A Center for Transfusion Laboratory Studies (CTLS) and a Data Coordinating Center (DCC) support synergistic studies and activities over the 7-year REDS-IV-P program.<h4>Results</h4>The US is building a centralized, vein-to-vein (V2V) database, linking information collected from blood donors, their donations, the resulting manufactured components, and data extracts from hospital electronic medical records of transfused and non-transfused patients. Simultaneously, the Brazilian program is building a donor, donation, and component database. The databases will serve as the backbone for retrospective and prospective observational studies in transfusion epidemiology, transfusion recipient outcomes, blood component quality, and emerging blood safety issues. Special focus will be on preterm infants, patients with sickle cell disease, thalassemia or cancer, and the effect of donor biologic variability and component manufacturing on recipient outcomes. A rapid response capability to emerging safety threats has resulted in timely studies related to Severe Acute Respiratory Syndrome Corona Virus-2 (SARS-CoV-2).<h4>Conclusions</h4>The REDS-IV-P program endeavors to improve donor-recipient-linked research with a focus on children and special populations while also maintaining the flexibility to address emerging blood safety issues.
Journal Article2022-04-19No SnippetsJeong KT, Do JH, Lee SH, Lee JK, Chang WS.
Show Full Abstract
<h4>Background</h4>Atopic march (AM), a unique characteristic of allergic diseases, refers to the sequential progression of atopic dermatitis (AD) in infants to allergic asthma and allergic rhinitis in children and young adults, respectively. Although there are several studies on AM, the establishment of an AM murine model to expand our understanding of the underlying mechanism and to identify the potential biomarkers is yet to be achieved. In this study, an improved murine model was established by applying a method to minimize skin irritation in inducing AD, and it was used to perform integrated analyses to discover candidate biomarkers.<h4>Methods</h4>To induce atopic dermatitis, 2,4-dinitrochlorobenzene (DNCB) was applied to the ear skin once a week, and this was continued for 5 weeks. From the second application of DNCB, <i>Dermatophagoides pteronyssinus</i> (Dp) extract was applied topically 2 days after each DNCB application; this was continued for 4 weeks. Dp sensitization and intranasal challenges were then performed for 4 weeks to develop conditions mimicking AM.<h4>Results</h4>Exacerbated airway inflammation and allergic responses observed in the AM-induced group suggested successful AM development in our model. Two-dimensional gel electrophoresis (2-DE) and mass spectrometry analysis identified 753 candidate proteins from 124 2-DE spots differentially expressed among the experimental groups. Functional analyses, such as Gene Ontology (GO) annotation and protein-protein interaction (PPI) analysis were conducted to investigate the relationship among the candidate proteins. Seventy-two GO terms were significant between the two groups; heat shock protein 8 (Hspa8) was found to be included in six of the top 10 GO terms. Hspa8 scored high on the PPI parameters as well.<h4>Conclusion</h4>We established an improved murine model for AM and proposed Hspa8 as a candidate biomarker for AM.
Also flagged:Phosphorusreproductionwaterfertilizationdicalcium phosphate-
Journal Article2022-04-19No SnippetsHe H, Zhang L, Zang H, Sun M, Lv C, Li S, Bai L, Han W, Dai J.
Show Full Abstract
Investigating the phosphorus (P) sources, pathways, and final sinks are important to reduce P pollution and improve P management. In this study, substance flow analysis (SFA) was performed for P flow analysis from 1995 to 2016 in different crops of Dongying District, a core region of the alluvial delta at the estuary of the Yellow River. The results showed that P input steadily increased from 1.48 × 10<sup>4</sup> t in 1995 to 2.16 × 10<sup>4</sup> t in 2007, and then decreased from 1.90 × 10<sup>4</sup> t in 2010 to 1.78 × 10<sup>4</sup> t in 2016. Chemical fertilizers made the highest contribution to P input. The cotton with the highest P load was on the top of P load risk ranks. More importantly, this study applied the Partial Least Squares Path Modeling (PLS-PM) model for P flow analysis and established the numerical relationship between the variables (including fertilizers, straws return-to-field, harvested grains, discarded straw, and P erosion and runoff), P use efficiency (PUE) and P load. The analysis revealed that fertilizer and crop production are the key factors affecting the PUE. Therefore, optimizing the use of P-fertilizer whilst maintaining yields can be an effective strategy to improve the local region PUE.
Also flagged:LRP11toELP2CHAF1Ainnate immunityARRDC4
Journal Article2022-04-19✓ 1 SnippetYang X, Sun G, Xia T, Cha M, Zhang L, Pang B, Tang Q, Dou H, Zhang H.
In-Text Gene Mentions
Discussion)
…KRAB , andZNF311).…
Show Full Abstract
<i>Vulpes</i>are widely distributed throughout the world and have undergone drastic physiological and phenotypic changes in response to their environment. However, little is known about the underlying genetic causes of these traits, especially <i>Vulpes corsac</i>. In this study, RNA-Seq was used to obtain a comprehensive dataset for multiple pooled tissues of corsac fox, and selection analysis of orthologous genes was performed to identify the genes that may be influenced by the low-temperature environment. More than 6.32 Gb clean reads were obtained and assembled into a total of 173,353 unigenes with an average length of 557 bp for corsac fox. Selective pressure analysis showed that 16 positively selected genes (PSGs) were identified in corsac fox, red fox, and arctic fox. Enrichment analysis of PSGs showed that the <i>LRP11</i> gene was enriched in several pathways related to the low-temperature response and might play a key role in response to environmental stimuli of foxes. In addition, several positively selected genes were related to DNA damage repair (<i>ELP2</i> and <i>CHAF1A</i>), innate immunity (<i>ARRDC4</i> and <i>S100A12</i>), and the respiratory chain (<i>NDUFA5</i>), and these positively selected genes might play a role in adaptation to harsh wild fox environments. The results of common orthologous gene analysis showed that gene flow or convergent evolution might be an important factor in promoting regional differentiation of foxes. Our study provides a valuable transcriptomic resource for the evolutionary history of the corsac fox and the adaptations to the extreme environments.
Also flagged:Heparinsbindingpentasaccharideheparinase IIdigestionheparin
Journal Article2022-04-19✓ 5 SnippetsMourier P.
In-Text Gene Mentions
Title)
…Block Analysis ofATIIIAffinity Fractions of…
Title)
…Application to theATIIIBinding Capacity of…
Abstract)
…requirements of theATIIIbinding pentasaccharide.…
Abstract)
…sequences present inATIIIaffinity fractions of…
Abstract)
…increasing affinity forATIII.…
Show Full Abstract
In heparin, some 3-<i>O</i>-sulfated sequences do not meet the structural requirements of the ATIII binding pentasaccharide. These "non-conventional" sequences are the object of this study. In a previous paper (Mourier P. Heparinase digestion of 3-<i>O</i>-sulfated sequences: selective heparinase II digestion for separation and identification of binding sequences present in ATIII affinity fractions of bovine intestine heparins), we demonstrated that unsaturated 3-<i>O</i>-sulfated disaccharides detected in exhaustive heparin digests were specifically cleaved by heparinase I. Consequently, building blocks analyses of heparins using heparinases I+II+III digestion could be compared with experiments where only heparinase II is used. In these latter conditions of depolymerization, the 3-<i>O</i>-sulfated sequences digested into unsaturated 3-<i>O</i>-sulfated disaccharides with heparinases I+II+III, were heparinase II-resistant on their non-reducing side, resulting in longer new building blocks. These properties were used to study the structural neighborhood of these 3-<i>O</i>-sulfated moieties, which have still-undefined biological functions. In this part, heparinases I+II+III and heparinase II digestions of porcine mucosa, bovine mucosa and bovine lung heparins were compared in six fractions of increasing affinity for ATIII. Tagging of building blocks by reductive amination with sulfanilic acid was used. The distribution of 3-<i>O</i>-sulfated building blocks in the ATIII affinity fractions was used to examine the ATIII binding of these sequences.
…In addition, recent evidence indicate that HTT can regulate the activity of palmitoyl-acyl transferases (PATs), via protein-protein interactions, and increasing brain palmitoylation restores neuropathology, locomotor deficits, and anxio-depressive behaviors in an HD knock-in mouse model (Virlogeux et al., 2021).…
S I O 001029)
…HTT is a large protein of 3,144 amino acids (348-kDa) with numerous intracellular interactors (more than 350), which implicates HTT in diverse cellular functions, including transcription, intracellular transport, metabolism, and homeostasis (Saudou and Humbert, 2016).…
Introduction)
…Targeting the genetic cause of HD by lowering the product of huntingtin gene (HTT) or specifically the harmful HTT is still promising but preclinical findings are still essential to open new windows to treat HD by focusing on the cellular consequences of mutant HTT (mHTT) expression.…
Introduction)
…5′ end ofHTTgene on chromosome…
Introduction)
…HTTgene is non-pathogenic…
Show Full Abstract
Huntington's disease (HD) is an autosomal dominant genetic disorder caused by an expansion of the CAG repeat in the first exon of Huntingtin's gene. The associated neurodegeneration mainly affects the striatum and the cortex at early stages and progressively spreads to other brain structures. Targeting HD at its earlier stages is under intense investigation. Numerous drugs were tested, with a rate of success of only 3.5% approved molecules used as symptomatic treatment. The restoration of cholesterol metabolism, which is central to the brain homeostasis and strongly altered in HD, could be an interesting disease-modifying strategy. Cholesterol is an essential membrane component in the central nervous system (CNS); alterations of its homeostasis have deleterious consequences on neuronal functions. The levels of several sterols, upstream of cholesterol, are markedly decreased within the striatum of HD mouse model. Transcription of cholesterol biosynthetic genes is reduced in HD cell and mouse models as well as post-mortem striatal and cortical tissues from HD patients. Since the dynamic of brain cholesterol metabolism is complex, it is essential to establish the best method to target it in HD. Cholesterol, which does not cross the blood-brain-barrier, is locally synthesized and renewed within the brain. All cell types in the CNS synthesize cholesterol during development but as they progress through adulthood, neurons down-regulate their cholesterol synthesis and turn to astrocytes for their full supply. Cellular levels of cholesterol reflect the dynamic balance between synthesis, uptake and export, all integrated into the context of the cross talk between neurons and glial cells. In this review, we describe the latest advances regarding the role of cholesterol deregulation in neuronal functions and how this could be a determinant factor in neuronal degeneration and HD progression. The pathways and major mechanisms by which cholesterol and sterols are regulated in the CNS will be described. From this overview, we discuss the main clinical strategies for manipulating cholesterol metabolism in the CNS, and how to reinstate a proper balance in HD.
Also flagged:Tumorimmune responsesgastric cancercancerdeathHER-2
Journal Article2022-04-19✓ 5 SnippetsZhen Z, Shen Z, Sun P.
In-Text Gene Mentions
Results)
…Figure 1A presents the interaction of immune checkpoint molecules between T cells and tumor cells or antigen-presenting cells (APC). The GO enrichment analysis based on Metascape suggested that the 31 genes were enriched in the biological process of T cell activation regulation (Figure 1B, Supplementary Figure S1A). Examination of the CNV alteration suggested a prevalent CNV alteration in 31 ICGs (Figure 1C). Of these, the copy number of LGALS9, CD160, KIR3DL1, VSIR, TNFSF4, TNFSF18, CD40, and CD40LG was increased, while PDCD1, VTCN1, TNFSF9, CD70, and TNFSF14 had an overall frequency of CNV loss. The position of CNV alteration of some ICGs on the chromosome is displayed in Figure 1D. Also, we detected the frequency of somatic mutations in 31 ICGs in GC. Of 433 samples examined, 69 (13.63%) presented genetic alterations, mainly missense mutations. The highest mutation frequency was observed in TNFRSF9, followed by CD276 and KIR3DL1 (Figure 1E). Some ICGs had a significant mutation co-occurring relationship, such as CD274 and PDCD1LG2 (Supplementary Table S2). Interestingly, the mutation of TNFRSF9 with the highest mutation frequency was closely related to the expression of its ligand TNFSF9. TNFSF9 was significantly upregulated in TNFRSF9-mutant tumors compared to wild-type tumors (Supplementary Figure S1B). The expression levels of several other ICGs in the TNFRSF9-mutant and wild-type groups are quite different (Supplementary Figures S1C–E). We next performed a transcriptome comparison between GC tumor tissues and adjacent normal tissues to identify differentially expressed ICGs between these two groups. Apart from the downregulation of VSIR in tumor tissues, most ICGs were highly expressed in tumor tissues in relation to the adjacent normal controls (Figure 1F).…
Methods)
…TNFRSF4, TNFRSF9, TNFSF18,TNFSF4, TNFSF9), and 19…
Many studies suggest that immune checkpoint molecules play a vital role in tumor progression and immune responses. However, the impact of the comprehensive regulation pattern of immune checkpoint molecules on immune responses, tumor microenvironment (TME) formation, and patient prognosis is poorly understood. In this study, we evaluated immune checkpoint regulation patterns in 1,174 gastric cancer (GC) samples based on 31 immune checkpoint genes (ICGs). Three distinct immune checkpoint regulation patterns with significant prognostic differences were ultimately identified. Moreover, GC patients were divided into two subgroups according to immune checkpoint score (ICscore). Patients with lower ICscore were characterized by a favorable prognosis and enhanced immune infiltration as well as an increased tumor mutation burden, non-recurrence, and microsatellite instability-high. Collectively, this study indicated that immune checkpoint regulation patterns were essential to forming the diversity of TME and a better understanding of that will contribute to assessing the characteristics of TME in GC, which intends to improve the development of immunotherapy.
Also flagged:Amphotericin Bfungal infectionssalicylic acidcarboxylAmphotericin
BFungal
infections
Journal Article2022-04-19No SnippetsYu Y, Chen P, Gao M, Lan W, Sun S, Ma Z, Sultani R, Cui Y, Umar MN, Khan SW, Cai X, Liang Z, Tan H.
Show Full Abstract
Although Amphotericin B (AmB) is considered as the "gold standard" treatment for deep fungal infections, owing to its excellent antifungal effect, it often causes severe hemolytic toxicity and nephrotoxicity, which limits its clinical use. We designed and synthesized AmB derivatives by attaching salicylic acid (SA) to the carboxyl group and confirmed their structures using <sup>1</sup>H NMR, <sup>13</sup>C NMR, HR-MS, and IR. We evaluated its biological activity <i>in vitro</i> and measured its ultraviolet-visible (UV-vis) absorption spectrum. The AmB-SA conjugates exhibited good antifungal effects against <i>Candida albicans</i>, <i>Candida glabrata</i>, and <i>Cryptococcus neoformans</i> compared with AmB, and the renal cytotoxicity toward HEK 293T cells <i>in vitro</i> was significantly reduced, with almost no nephrotoxicity in the therapeutic window of the drug. At the same time, the hemolytic toxicity was significantly reduced. Therefore, modification of AmB by introducing SA is an effective strategy to maintain the broad antifungal activity of AmB and reduce its cytotoxicity. These AmB derivatives could be applied in clinical therapy in the future.
Arc/Arg3.1 (activity-regulated cytoskeletal-associated protein (ARC)) is a critical regulator of long-term synaptic plasticity and is involved in the pathophysiology of schizophrenia. The functions and mechanisms of human ARC action are poorly understood and worthy of further investigation. To investigate the function of the <i>ARC</i> gene in vitro, we generated an <i>ARC</i>-knockout (KO) HEK293 cell line via CRISPR/Cas9-mediated gene editing and conducted RNA sequencing and label-free LC-MS/MS analysis to identify the differentially expressed genes and proteins in isogenic <i>ARC</i>-KO HEK293 cells. Furthermore, we used bioluminescence resonance energy transfer (BRET) assays to detect interactions between the ARC protein and differentially expressed proteins. Genetic deletion of <i>ARC</i> disturbed multiple genes involved in the extracellular matrix and synaptic membrane. Seven proteins (HSPA1A, ENO1, VCP, HMGCS1, ALDH1B1, FSCN1, and HINT2) were found to be differentially expressed between <i>ARC</i>-KO cells and <i>ARC</i> wild-type cells. BRET assay results showed that ARC interacted with PSD95 and HSPA1A. Overall, we found that ARC regulates the differential expression of genes involved in the extracellular matrix, synaptic membrane, and heat shock protein family. The transcriptomic and proteomic profiles of <i>ARC</i>-KO HEK293 cells presented here provide new evidence for the mechanisms underlying the effects of ARC and molecular pathways involved in schizophrenia pathophysiology.
Also flagged:extracellularvesiclescoagulationtumorcytoskeletonorganization
Journal Article2022-04-19✓ 5 SnippetsUldry AC, Maciel-Dominguez A, Jornod M, Buchs N, Braga-Lagache S, Brodard J, Jankovic J, Bonadies N, Heller M.
In-Text Gene Mentions
Results)
…, HRG ,SERPINC1) and seven…
Results)
…HRG ), andantithrombin-III( SERPINC1 )…
Results)
…and antithrombin-III (SERPINC1) are proteins…
Results)
…SERPINC1is localized in…
Results)
…which, ST6GAL1 andSERPINC1, had already…
Show Full Abstract
Circulating extracellular vesicles (cEV) are released by many kinds of cells and play an important role in cellular communication, signaling, inflammation modulation, coagulation, and tumor growth. cEV are of growing interest, not only as biomarkers, but also as potential treatment targets. However, very little is known about the effect of transporting biological samples from the clinical ward to the diagnostic laboratory, notably on the protein composition. Pneumatic tube systems (PTS) and human carriers (C) are both routinely used for transport, subjecting the samples to different ranges of mechanical forces. We therefore investigated qualitatively and quantitatively the effect of transport by C and PTS on the human cEV proteome and particle size distribution. We found that samples transported by PTS were subjected to intense, irregular, and multidirectional shocks, while those that were transported by C mostly underwent oscillations at a ground frequency of approximately 4 Hz. PTS resulted in the broadening of nanoparticle size distribution in platelet-free (PFP) but not in platelet-poor plasma (PPP). Cell-type specific cEV-associated protein abundances remained largely unaffected by the transport type. Since residual material of lymphocytes, monocytes, and platelets seemed to dominate cEV proteomes in PPP, it was concluded that PFP should be preferred for any further analyses. Differential expression showed that the impact of the transport method on cEV-associated protein composition was heterogeneous and likely donor-specific. Correlation analysis was nonetheless able to detect that vibration dose, shocks, and imparted energy were associated with different terms depending on the transport, namely in C with cytoskeleton-regulated cell organization activity, and in PTS with a release of extracellular vesicles, mainly from organelle origin, and specifically from mitochondrial structures. Feature selection algorithm identified proteins which, when considered together with the correlated protein-protein interaction network, could be viewed as surrogates of network clusters.
Also flagged:Mineralocorticoid ReceptorMRsodiumaldosteroneRNA Binding Proteinsextracellular
Journal Article2022-04-19✓ 4 SnippetsVu TA, Lema I, Hani I, Cheval L, Atger-Lallier L, Souvannarath V, Perrot J, Souvanheuane M, Marie Y, Fabrega S, Blanchard A, Bouligand J, Kamenickỷ P, Crambert G, Martinerie L, Lombès M, Viengchareun S.
In-Text Gene Mentions
Methods)
…To analyze the impact of miR-324-5p overexpression on MR signaling, Sh-A1 and Sh-H8 clones cultured on filters onto 12 well-plates (1.2 × 106 cells/filter) were deprived in minimal medium lacking dexamethasone, EGF, DCC concurrently subjected to doxycycline (1 μg/mL) induction for 48 h then stimulated with 10 nM aldosterone for 1 h.…
Methods)
…Cells were cultured under isotonic medium (300 mOsM/kg) with DMEM/HAM’S F12 supplemented with 5% dextran charcoal-coated calf serum (DCC), 2 mM glutamine, 20 mM HEPES, pH 7.4, 100 U/mL penicillin, and 100 μg/mL streptomycin (Life Technologies, Villebon-sur-Yvette, France), 5 μg/mL Insulin (Sigma, Saint-Quentin-Fallavier, France), 5 μg/mL transferrin (Sigma, Saint-Quentin-Fallavier, France), 50 nM sodium selenite (Sigma, Saint-Quentin-Fallavier, France), 50 nM dexamethasone (Sigma, Saint-Quentin-Fallavier, France), 2 nM triiodothyronine T3 (Sigma, Saint-Quentin-Fallavier, France), 10 ng/mL epithelial growth factor (EGF) (PeproTech, Neuilly-sur-Seine, France).…
The Mineralocorticoid Receptor (MR) mediates the sodium-retaining action of aldosterone in the distal nephron, but mechanisms regulating MR expression are still poorly understood. We previously showed that RNA Binding Proteins (RBPs) regulate MR expression at the post-transcriptional level in response to variations of extracellular tonicity. Herein, we highlight a novel regulatory mechanism involving the recruitment of microRNAs (miRNAs) under hypertonicity. RT-qPCR validated miRNAs candidates identified by high throughput screening approaches and transfection of a luciferase reporter construct together with miRNAs Mimics or Inhibitors demonstrated their functional interaction with target transcripts. Overexpression strategies using Mimics or lentivirus revealed the impact on MR expression and signaling in renal KC3AC1 cells. miR-324-5p and miR-30c-2-3p expression are increased under hypertonicity in KC3AC1 cells. These miRNAs directly affect <i>Nr3c2</i> (MR) transcript stability, act with Tis11b to destabilize MR transcript but also repress <i>Elavl1</i> (HuR) transcript, which enhances MR expression and signaling. Overexpression of miR-324-5p and miR-30c-2-3p alter MR expression and signaling in KC3AC1 cells with blunted responses in terms of aldosterone-regulated genes expression. We also confirm that their expression is increased by hypertonicity in vivo in the kidneys of mice treated with furosemide. These findings may have major implications for the pathogenesis of renal dysfunctions, sodium retention, and mineralocorticoid resistance.
Also flagged:Schizophreniamental illnesscognitionsynapticcognitive impairmentssynapses
Journal Article2022-04-19No SnippetsWu XL, Yan QJ, Zhu F.
Show Full Abstract
Schizophrenia (SCZ) is a severe mental illness that affects several brain domains with relation to cognition and behaviour. SCZ symptoms are typically classified into three categories, namely, positive, negative, and cognitive. The etiology of SCZ is thought to be multifactorial and poorly understood. Accumulating evidence has indicated abnormal synaptic plasticity and cognitive impairments in SCZ. Synaptic plasticity is thought to be induced at appropriate synapses during memory formation and has a critical role in the cognitive symptoms of SCZ. Many factors, including synaptic structure changes, aberrant expression of plasticity-related genes, and abnormal synaptic transmission, may influence synaptic plasticity and play vital roles in SCZ. In this article, we briefly summarize the morphology of the synapse, the neurobiology of synaptic plasticity, and the role of synaptic plasticity, and review potential mechanisms underlying abnormal synaptic plasticity in SCZ. These abnormalities involve dendritic spines, postsynaptic density, and long-term potentiation-like plasticity. We also focus on cognitive dysfunction, which reflects impaired connectivity in SCZ. Additionally, the potential targets for the treatment of SCZ are discussed in this article. Therefore, understanding abnormal synaptic plasticity and impaired cognition in SCZ has an essential role in drug therapy.
Journal Article2022-04-19✓ 1 SnippetVartholomatos E, Mantziou S, Alexiou GA, Lazari D, Sioka C, Kyritsis A, Markopoulos GS.
In-Text Gene Mentions
Results)
…as TF, TFR2,HFE, DUSP14, ITGAL, IL12A,…
Show Full Abstract
High-grade gliomas are among the most aggressive malignancies, with significantly low median survival. Recent experimental research in the field has highlighted the importance of natural substances as possible antiglioma agents, also known for their antioxidant and anti-inflammatory action. We have previously shown that natural substances target several surface cluster of differentiation (CD) markers in glioma cells, as part of their mechanism of action. We analyzed the genome-wide NF-κB binding sites residing in consensus regulatory elements, based on ENCODE data. We found that NF-κB binding sites reside adjacent to the promoter regions of genes encoding CD markers targeted by antiglioma agents (namely, CD15/FUT4, CD28, CD44, CD58, CD61/SELL, CD71/TFRC, and CD122/IL2RB). Network and pathway analysis revealed that the markers are associated with a core network of genes that, altogether, participate in processes that associate tumorigenesis with inflammation and immune evasion. Our results reveal a core regulatory network that can be targeted in glioblastoma, with apparent implications in individuals that suffer from this devastating malignancy.
Also flagged:Coppercancerdeathdegradationliver failurenonalcoholic steatohepatitis
Journal Article2022-04-19✓ 1 SnippetTelouk P, Plissonnier ML, Merle P, Zoulim F, Fares N, Guilloreau P, Parent R, Bacchetta J, Danan M, Carandina S, Albarède F.
In-Text Gene Mentions
Introduction)
…indirectly, such ashemochromatosis, 17 Wilson disease,…
Show Full Abstract
<h4>Background and aims</h4>Hepatocellular carcinoma (HCC) is the third leading cause of cancer-related death worldwide, and finding a single reliable biomarker to follow liver degradation is a challenging task. To document the relationship between liver failure, hypoxia, and HCC, copper isotope variations (δ<sup>65</sup>Cu) were evaluated in the serum of HCC-negative and HCC-positive patients as a biomarker of hepatic failure.<h4>Methods</h4>We analyzed Cu isotope variations in serum samples from 293 patients with potentially degraded liver functions presenting hepatitis B virus, hepatitis C virus, nonalcoholic steatohepatitis, and alcohol uptake (OH) etiologies and 105 controls. Ninety-five of the patients were diagnosed with HCC.<h4>Results</h4>On average, the δ<sup>65</sup>Cu values of the serum of patients with F3-F4 fibrosis score or HCC-positive are low. The Cu isotope data are strikingly bimodal with well-defined δ<sup>65</sup>Cu modes which imperfectly reflect etiology. The population with normal values (ca -0.3‰) is progressively replaced by a population with atypical δ<sup>65</sup>Cu values (ca -0.8‰), which reflects the progressive degradation of hepatic functions.<h4>Conclusion</h4>The clear bimodality does not correspond to a progressive shift of the δ<sup>65</sup>Cu values but to a replacement of one population by another. This bimodality sheds light on the persisting difficulties epitomized by α-fetoprotein in finding high-sensitivity and high-specificity HCC biomarkers. It is interpreted as a switch in the resistance of hepatic tissues to the oxidative stress that eventually leads to HCC oncogenesis.
bioRxiv2022-04-19Preprint (No Snippets API)Gay L, Rouviere M, Mezouar S, Richaud M, Gorvel L, Foucher E, Madakamutil L, La Scola B, Menard A, Allardet-Servent J, Halfon P, Frohna P, Cano C, Mege J, Olive D.
Show Full Abstract
<h4>ABSTRACT</h4> Vγ9Vδ2 T cells play a key role in the innate immune response to viral infections, including SARS-CoV-1 and 2, and are activated through butyrophilin (BTN)-3A. Here, the objectives were to: 1) characterize the effects of SARS-CoV-2 infection on the number, phenotype, and activation of Vγ9Vδ2 T cells in infected patients, and 2) assess the effects of in vitro SARS-CoV-2 infection on the expression of BTN3A and its impact on the activation and response of Vγ9Vδ2 T cells to an anti-BTN3A antibody. Blood Vγ9Vδ2 T cells decreased in clinically mild SARS-CoV-2 infections compared to healthy volunteers (HV). This decrease was maintained up to 28 days and in the recovery period. Terminally differentiated Vγ9Vδ2 T cells tend to be enriched on the day of diagnosis, 28 days after and during the recovery period compared to HV. Furthermore, these cells showed cytotoxic and inflammatory activities as shown by TNFα, IFNγ and CD107a/b increase following anti-BTN3A activation. Moreover, BTN3A upregulation and Vγ9Vδ2 T cell infiltration were observed in a lung biopsy from a fatal SARS-CoV-2 infection, as compared to HV. In vitro , SARS-CoV-2 infection significantly increased BTN3A expression in macrophages and lung cell lines. The activation via BTN3A enhanced the anti-SARS-CoV-2 Vγ9Vδ2 T cells cytotoxicity and IFN-γ and TNFα in SARS-CoV-2 infected patient. Increasing concentrations of anti-BTN3A were accompanied by an inhibition of viral replication. Altogether, these data suggest that Vγ9Vδ2 T cells are important in the immune response against SARS-CoV-2 infection and that activation by an anti-BTN3A antibody may enhance their response. <h4>KEY POINTS</h4> SARS-CoV-2 mediates upregulation of the key receptor of Vγ9Vδ2 T cells BTN3A on lung tissues and cell lines as well as monocytes During SARS-CoV-2 infection, Vγ9Vδ2 are differentiated and efficiently degranulate and secrete cytokines upon activation with BTN3A mAb
Also flagged:Circadian Rhythmchronic noncommunicable diseasesmental diseasehypertensionheart failuremyocardial infarction
Journal Article2022-04-18✓ 1 SnippetDaiber A, Frenis K, Kuntic M, Li H, Wolf E, Kilgallen AB, Lecour S, Van Laake LW, Schulz R, Hahad O, Münzel T.
In-Text Gene Mentions
I A O 0000606)
…F-box/leucine rich-repeat protein 3rich-repeat protein 3…
Show Full Abstract
<b><i>Significance:</i></b> Risk factors in the environment such as air pollution and traffic noise contribute to the development of chronic noncommunicable diseases. <b><i>Recent Advances:</i></b> Epidemiological data suggest that air pollution and traffic noise are associated with a higher risk for cardiovascular, metabolic, and mental disease, including hypertension, heart failure, myocardial infarction, diabetes, arrhythmia, stroke, neurodegeneration, depression, and anxiety disorders, mainly by activation of stress hormone signaling, inflammation, and oxidative stress. <b><i>Critical Issues:</i></b> We here provide an in-depth review on the impact of the environmental risk factors air pollution and traffic noise exposure (components of the external exposome) on cardiovascular health, with special emphasis on the role of environmentally triggered oxidative stress and dysregulation of the circadian clock. Also, a general introduction on the contribution of circadian rhythms to cardiovascular health and disease as well as a detailed mechanistic discussion of redox regulatory pathways of the circadian clock system is provided. <b><i>Future Directions:</i></b> Finally, we discuss the potential of preventive strategies or "chrono" therapy for cardioprotection. <i>Antioxid. Redox Signal</i>. 37, 679-703.
Also flagged:HomocysteineMethylationcognitive declinebrain-derived neurotropic factorBDNFbehavioral
Journal Article2022-04-18No SnippetsWang SD, Wang X, Zhao Y, Xue BH, Wang XT, Chen YX, Zhang ZQ, Tian YR, Xie F, Qian LJ.
Show Full Abstract
Chronic stress is generally accepted as the main risk factor in the development of cognitive decline; however, the underlying mechanisms remain unclear. Previous data have demonstrated that the levels of homocysteine (Hcy) are significantly elevated in the plasma of stressed animals, which suggests that Hcy is associated with stress and cognitive decline. To test this hypothesis, we analyzed the cognitive function, plasma concentrations of Hcy, and brain-derived neurotropic factor (BDNF) levels in rats undergoing chronic unpredicted mild stress (CUMS). The results showed that decreased cognitive behavioral performance and decreased BDNF transcription and protein expression were correlated with hyperhomocysteinemia (HHcy) levels in stressed rats. Diet-induced HHcy mimicked the cognitive decline and BDNF downregulation in the same manner as CUMS, while Hcy reduction (by means of vitamin B complex supplements) alleviated the cognitive deficits and BDNF reduction in CUMS rats. Furthermore, we also found that both stress and HHcy disturbed the DNA methylation process in the brain and induced DNA hypermethylation in the BDNF promoter. In contrast, control of Hcy blocked BDNF promoter methylation and upregulated BDNF levels in the brain. These results imply the possibility of a causal role of Hcy in stress-induced cognitive decline. We also used ten-eleven translocation (TET1), an enzyme that induces DNA demethylation, to verify the involvement of Hcy and DNA methylation in the regulation of BDNF expression and the development of stress-related cognitive decline. The data showed that TET1-expressing viral injection into the hippocampus inhibited BDNF promoter methylation and significantly mitigated the cognitive decline in HHcy rats. Taken together, novel evidence from the present study suggests that Hcy is likely involved in chronic stress-induced BDNF reduction and related cognitive deficits. In addition, the negative side-effects of HHcy may be associated with Hcy-induced DNA hypermethylation in the BDNF promoter. The results also suggest the possibility of Hcy as a target for therapy and the potential value of vitamin B intake in preventing stress-induced cognitive decline.
Also flagged:POLR3Bneurodevelopmental disorderpathogenesisIDtranscription factorsprotein synthesis
Journal Article2022-04-18No SnippetsSaghi M, InanlooRahatloo K, Alavi A, Kahrizi K, Najmabadi H.
Show Full Abstract
<h4>Background</h4>Intellectual disability (ID) is a clinically important disease and a most prevalent neurodevelopmental disorder. The etiology and pathogenesis of ID are poorly recognized. Exome sequencing revealed a homozygous missense mutation in the POLR3B gene in a consanguineous family with three Intellectual disability with craniofacial anomalies patients. POLR3B gene encoding the second largest subunit of RNA polymerase III.<h4>Methods</h4>We performed RNA sequencing on blood samples to obtain insights into the biological pathways influenced by POLR3B mutation. We applied the results of our RNA-Seq analysis to several gene ontology programs such as ToppGene, Enrichr, KEGG.<h4>Results</h4>A significant decrease in expression of several spliceosomal RNAs, ribosomal proteins, and transcription factors was detected in the affected, compared to unaffected, family members.<h4>Conclusions</h4>We hypothesize that POLR3B mutation dysregulates the expression of some important transcription factors, ribosomal and spliceosomal genes, and impairments in protein synthesis and splicing mediated in part by transcription factors such as FOXC2 and GATA1 contribute to impaired neuronal function and concurrence of intellectual disability and craniofacial anomalies in our patients. Our study highlights the emerging role of the spliceosome and ribosomal proteins in intellectual disability.
Also flagged:CancerFAM134BBiPtumorendoplasmic reticulumunfolded
Journal Article2022-04-18✓ 4 SnippetsChipurupalli S, Ganesan R, Martini G, Mele L, Reggio A, Esposito M, Kannan E, Namasivayam V, Grumati P, Desiderio V, Robinson N.
In the tumor microenvironment, cancer cells experience hypoxia resulting in the accumulation of misfolded/unfolded proteins largely in the endoplasmic reticulum (ER). Consequently, ER proteotoxicity elicits unfolded protein response (UPR) as an adaptive mechanism to resolve ER stress. In addition to canonical UPR, proteotoxicity also stimulates the selective, autophagy-dependent, removal of discrete ER domains loaded with misfolded proteins to further alleviate ER stress. These mechanisms can favor cancer cell growth, metastasis, and long-term survival. Our investigations reveal that during hypoxia-induced ER stress, the ER-phagy receptor FAM134B targets damaged portions of ER into autophagosomes to restore ER homeostasis in cancer cells. Loss of FAM134B in breast cancer cells results in increased ER stress and reduced cell proliferation. Mechanistically, upon sensing hypoxia-induced proteotoxic stress, the ER chaperone BiP forms a complex with FAM134B and promotes ER-phagy. To prove the translational implication of our mechanistic findings, we identified vitexin as a pharmacological agent that disrupts FAM134B-BiP complex, inhibits ER-phagy, and potently suppresses breast cancer progression in vivo.
Nogo-66 receptors (NgR1-3) are glycosylphosphatidyl inositol-linked proteins that belong to the leucine-rich repeat superfamily. Through binding to myelin-associated inhibitors, NgRs contribute to the inhibition of axonal regeneration after spinal cord injury. Their role in limiting synaptic plasticity and axonal outgrowth in the adult CNS has been described previously, but not much is known about their role during the development of the nervous system. Here, we show that NgR1 and NgR3 mRNAs are expressed during spinal cord development of the chicken embryo. In particular, they are expressed in the dI1 subpopulation of commissural neurons during the time when their axons navigate toward and across the floorplate, the ventral midline of the spinal cord. To assess a potential role of NgR1 and NgR3 in axon guidance, we downregulated them using <i>in ovo</i> RNAi and analyzed the trajectory of commissural axons by tracing them in open-book preparations of spinal cords. Our results show that loss of either NgR1 or NgR3 causes axons to stall in the midline area and to interfere with the rostral turn of postcrossing axons. In addition, we also show that NgR1, but not NgR3, requires neuronal PlexinA2 for the regulation of commissural axon guidance.<b>SIGNIFICANCE STATEMENT</b> Over the last decades, many studies have focused on the role of NgRs, particularly NgR1, in axonal regeneration in the injured adult CNS. Here, we show a physiological role of NgRs in guiding commissural axons during early development of the chicken spinal cord <i>in vivo</i> Both NgR1 and NgR3 are required for midline crossing and subsequent turning of postcrossing axons into the longitudinal axis of the spinal cord. NgR1, but not NgR3, forms a receptor complex with PlexinA2 during axon guidance. Overall, these findings provide a link between neural regenerative mechanisms and developmental processes.
Also flagged:Neurofilament Light ProteinHuntington's diseaseHDMovement DisordersMovement Disordercognitive deficits
Journal Article2022-04-18✓ 1 SnippetByrne LM, Schultz JL, Rodrigues FB, van der Plas E, Langbehn D, Nopoulos PC, Wild EJ.
In-Text Gene Mentions
S I O 001029)
…We quantified plasma NfL levels in two unique pediatric patient populations: healthy children with HTT expansion mutations expected to produce adult‐onset disease (premanifest Huntington's disease [preHD]) and those with JOHD.…
Also flagged:DNasebaricitinibtocilizumabCOVID-19dexamethasoneheparin
Journal Article2022-04-18✓ 1 SnippetGavriilidis E, Antoniadou C, Chrysanthopoulou A, Ntinopoulou M, Smyrlis A, Fotiadou I, Zioga N, Kogias D, Natsi AM, Pelekoudas C, Satiridou E, Bakola SA, Papagoras C, Mitroulis I, Peichamperis P, Mikroulis D, Papadopoulos V, Skendros P, Ritis K.
In-Text Gene Mentions
Discussion)
…otentiating antithrombin III (ATIII) activity [ 38…
Show Full Abstract
Aiming to reduce mortality in COVID-19 with severe respiratory failure we administered a combined rescue treatment (COMBI) on top of standard-of-care (SOC: dexamethasone/heparin) consisted of inhaled DNase to dissolve thrombogenic neutrophil extracellular traps, plus agents against cytokine-mediated hyperinflammation, namely anti-IL-6-receptor tocilizumab and JAK1/2 inhibitor baricitinib. Patients with PaO2/FiO2 < 100 mmHg were analysed. COMBI group (n = 22) was compared with similar groups that had received SOC alone (n = 26) or SOC plus monotherapy with either IL-1-receptor antagonist anakinra (n = 19) or tocilizumab (n = 11). COMBI was significantly associated with lower in-hospital mortality and intubation rate, shorter duration of hospitalization, and prolonged overall survival after a median follow-up of 110 days. In vitro, COVID-19 plasma induced tissue factor/thrombin pathway in primary lung fibroblasts. This effect was inhibited by the immunomodulatory agents of COMBI providing a mechanistic explanation for the clinical observations. These results support the conduct of randomized trials using combined immunomodulation in COVID-19 to target multiple interconnected pathways of immunothrombosis.
Also flagged:neurological diseasesdeathautophagyFerroptosiscancerscardiovascular diseases
Journal Article2022-04-18No SnippetsOu M, Jiang Y, Ji Y, Zhou Q, Du Z, Zhu H, Zhou Z.
Show Full Abstract
<h4>Background</h4>Ferroptosis, as a new form of cell death, is different from other cell deaths such as autophagy or senescence. Ferroptosis involves in the pathophysiological progress of several diseases, including cancers, cardiovascular diseases, nervous system diseases, and kidney damage. Since oxidative stress and iron deposition are the broad pathological features of neurological diseases, the role of ferroptosis in neurological diseases has been widely explored.<h4>Scope of review</h4>Ferroptosis is mainly characterized by changes in iron homeostasis, iron-dependent lipid peroxidation, and glutamate toxicity accumulation, of which can be specifically reversed by ferroptosis inducers or inhibitors. The ferroptosis is mainly regulated by the metabolism of iron, lipids and amino acids through System Xc<sup>-</sup>, voltage-dependent anion channels, p53, p62-Keap1-Nrf2, mevalonate and other pathways. This review also focus on the regulatory pathways of ferroptosis and its research progress in neurological diseases.<h4>Major conclusions</h4>The current researches of ferroptosis in neurological diseases mostly focus on the key pathways of ferroptosis. At the same time, ferroptosis was found playing a bidirectional regulation role in neurological diseases. Therefore, the specific regulatory mechanisms of ferroptosis in neurological diseases still need to be further explored to provide new perspectives for the application of ferroptosis in the treatment of neurological diseases.
Also flagged:autophagy transport receptorcell cycle progression 1myeloid leukemiaIL-1βdectin-1antibody
Journal Article2022-04-18✓ 5 SnippetsWang LM, Chen XM, Yan HJ, Yan S, Sun XY, Zhang DW, Yang H, Lu DL, Che CY.
In-Text Gene Mentions
Abstract)
…Immunofluorescence showed the colocalization of CCPG1 and CLEC-1 in THP-1 macrophages.<h4>Conclusion</h4>As a specific autophagy protein of non-canonical autophagy pathway, CCPG1 is involved in corneal infection with <i>A.…
Abstract)
…Immunofluorescence was used to observe the colocalization of CCPG1 and C-type lectin-like receptor-1 (CLEC-1) in THP-1 macrophages.<h4>Results</h4>The expression of CCPG1 started to increase at 4h after infection and increased in a time-dependent manner in HCECs and THP-1 macrophages.…
Title)
…CCPG1 involved in corneal <i>Aspergillus fumigatus</i> infection.…
Title)
…CCPG1involved in corneal…
Abstract)
…cycle progression 1 (CCPG1) is involved in…
Show Full Abstract
<h4>Aim</h4>To investigate whether non-canonical autophagy transport receptor cell cycle progression 1 (CCPG1) is involved in the corneal antifungal immune response.<h4>Methods</h4>Human corneal epithelial cells (HCECs) and human myeloid leukemia mononuclear cells (THP-1) macrophages stimulated by <i>Aspergillus fumigatus</i> (<i>A. fumigatus</i>) were used as cell models. The expression of CCPG1 mRNA was detected by qRT-PCR. Western blot was used to determine the protein expression of CCPG1 and interleukin-1β (IL-1β). The dectin-1 neutralizing antibody was used to detect the association between dectin-1 and CCPG1. Immunofluorescence was used to observe the colocalization of CCPG1 and C-type lectin-like receptor-1 (CLEC-1) in THP-1 macrophages.<h4>Results</h4>The expression of CCPG1 started to increase at 4h after infection and increased in a time-dependent manner in HCECs and THP-1 macrophages. With dectin-1 neutralizing antibody pretreatment, the expression of IL-1β was down-regulated. CCPG1 up-regulation in response to <i>A. fumigatus</i> infection was independent of dectin-1. Immunofluorescence showed the colocalization of CCPG1 and CLEC-1 in THP-1 macrophages.<h4>Conclusion</h4>As a specific autophagy protein of non-canonical autophagy pathway, CCPG1 is involved in corneal infection with <i>A. fumigatus</i>.
Dimethacrylate-based resin composites restorations have become widely-used intraoral materials in daily dental practice. The increasing use of composites has greatly enhanced modern preventive and conservative dentistry. They have many superior features, especially esthetic properties, bondability, and elimination of mercury and galvanic currents. However, polymeric materials are highly susceptible to polymerization shrinkage and stresses that lead to microleakage, biofilm formation, secondary caries, and restoration loss. Several techniques have been investigated to minimize the side effects of these shrinkage stresses. The primary approach is through fabrications and modification of the resin matrices. Therefore, this review article focuses on the methods for testing the shrinkage, as well as formulations of resinous matrices available to reduce polymerization shrinkage and its associated stress. Furthermore, this article reviews recent cutting-edge developments on bioactive low-shrinkage-stress nanocomposites to effectively inhibit the growth and activities of cariogenic pathogens and enhance the remineralization process.
Also flagged:MetabolismChlorogenic AcidobesitydiabetesHepatocellular carcinomamitochondrial
Journal Article2022-04-18No SnippetsTakahashi S, Saito K, Li X, Jia H, Kato H.
Show Full Abstract
Epidemiological studies have suggested that coffee consumption is associated with a decrease in the risk of developing obesity and diabetes; however, the detailed mechanisms underlying these effects of coffee consumption remain poorly understood. In this study, we examined the effects of chlorogenic acid on energy metabolism in vitro. Hepatocellular carcinoma G2 (HepG2) cells were cultured in a medium containing chlorogenic acid. Chlorogenic acid increased the activity of mitochondrial enzymes, including citrate synthase, isocitrate dehydrogenase, and malate dehydrogenase (MDH), which are involved in the tricarboxylic acid (TCA) cycle. Proteome analysis using the isobaric tags for the relative and absolute quantitation (iTRAQ) method revealed the upregulation of proteins involved in the glycolytic system, electron transport system, and ATP synthesis in mitochondria. Therefore, we propose a notable mechanism whereby chlorogenic acid enhances energy metabolism, including the TCA cycle, glycolytic system, electron transport, and ATP synthesis. This mechanism provides important insights into understanding the beneficial effects of coffee consumption.
Also flagged:polycarbonatepolymethylmethacrylatepolydimethylsiloxanechromiumtoluenesilanes
Journal Article2022-04-18No SnippetsTan YL, Wang T, He J, Jiang JH.
Show Full Abstract
The quantification of trace nucleic acids in biological samples is a frequent requirement in experimental and clinical diagnostics. Here, we present a protocol for the digital quantification of multiple nucleic acid targets with droplet microfluidics-based loop-mediated isothermal amplification (dLAMP). Our protocol provides a fundamental platform for the absolute quantification of multiple nucleic acid targets with high specificity, allowing readily adaption in various <i>in vitro</i> diagnostic settings. For complete details on the use and execution of this protocol, please refer to Tan et al. (2021a, 2021b).
Globally, cervical cancer (CC) is the most common malignant tumor of the female reproductive system and its incidence is only second after breast cancer. Although screening and advanced treatment strategies have improved the rates of survival, some patients with CC still die due to metastasis and drug resistance. It is considered that cancer is driven by somatic mutations, such as single nucleotide, small insertions/deletions, copy number, and structural variations, as well as epigenetic changes. Previous studies have shown that cervical intraepithelial neoplasia is associated with copy number variants (CNVs) and/or mutations in cancer-related genes. Further, CC is also related to genetic mutations. The present study analyzed the data on somatic mutations of cervical squamous cell carcinoma (CESC) in the Cancer Genome Atlas database. It was evident that the Apolipoprotein B mRNA editing enzyme-catalyzed polypeptide-like (<i>APOBEC</i>)-related mutation of the <i>FLG</i> gene can upregulate the expression of the <i>JUN</i> gene and ultimately lead to poor prognosis for patients with CC. Therefore, the findings of the current study provide a new direction for future treatment of CC.
Also flagged:ThapsigarginRNA virus infectionshost cellinterferonmembraneSERCA
Journal Article2022-04-18No SnippetsShaban MS, Mayr-Buro C, Meier-Soelch J, Albert BV, Schmitz ML, Ziebuhr J, Kracht M.
Show Full Abstract
Despite the great success of vaccines that protect against RNA virus infections, and the development and clinical use of a limited number of RNA virus-specific drugs, there is still an urgent need for new classes of antiviral drugs against circulating or emerging RNA viruses. To date, it has proved difficult to efficiently suppress RNA virus replication by targeting host cell functions, and there are no approved drugs of this type. This opinion article discusses the recent discovery of a pronounced and sustained antiviral activity of the plant-derived natural compound thapsigargin against enveloped RNA viruses such as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), Middle East respiratory syndrome coronavirus (MERS-CoV), and influenza A virus. Based on its mechanisms of action, thapsigargin represents a new prototype of compounds with multimodal host-directed antiviral activity.
bioRxiv2022-04-18Preprint (No Snippets API)Sen P, Kaur H.
Show Full Abstract
COVID-19 is a severe respiratory disease caused by SARS-CoV-2, a novel human coronavirus. The host response to SARS-CoV-2 infection is not clearly understood. Patients infected with SARS-CoV-2 exhibit heterogeneous intensity of symptoms, i.e., asymptomatic, mild, and severe. Moreover, effects on organs also vary from person to person. These heterogeneous responses pose pragmatic hurdles for implementing appropriate therapy and management of COVID-19 patients. Post-COVID complications pose another major challenge in managing the health of these patients. Thus, understanding the impact of disease severity at the molecular level is vital to delineate the precise host response and management. In the current study, we performed a comprehensive transcriptomics analysis of publicly available seven asymptomatic and eight severe COVID-19 patients. Exploratory data analysis using Principal Component Analysis (PCA) showed the distinct clusters of asymptomatic and severe patients. Subsequently, the differential gene expression analysis using DESeq2 identified 1,224 significantly upregulated genes (logFC>= 1.5, p-adjusted value <0.05) and 268 significantly downregulated genes (logFC<= -1.5, p-adjusted value <0.05) in severe samples in comparison to asymptomatic samples. Eventually, Gene Set Enrichment Analysis (GSEA) of upregulated genes revealed significant enrichment of terms, i.e., anti-viral and anti-inflammatory pathways, secondary infections, Iron homeostasis, anemia, cardiac-related, etc. Gene set enrichment analysis of downregulated genes indicates lipid metabolism, adaptive immune response, translation, recurrent respiratory infections, heme-biosynthetic pathways, etc. In summary, severe COVID-19 patients are more susceptible to other health issues/concerns, non-viral pathogenic infections, atherosclerosis, autoinflammatory diseases, anemia, male infertility, etc. And eventually, these findings provide insight into the precise therapeutic management of severe COVID-19 patients and efficient disease management.
Also flagged:HDcognitivecognitive impairmentmotor disorderscognitive disordersHuntington's disease
Journal Article2022-04-17✓ 2 SnippetsPetracca M, Di Tella S, Solito M, Zinzi P, Lo Monaco MR, Di Lazzaro G, Calabresi P, Silveri MC, Bentivoglio AR.
In-Text Gene Mentions
Introduction)
…CAG is the genetic code for the amino acid glutamine; the mutant alleles produce a sequence of 36 or more glutamines in the N‐terminus of the Huntingtin protein (Htt), which results in selective neural cell death in the basal ganglia and cerebral cortex [3].…
Introduction)
…the Huntingtin protein (Htt), which results in…
Show Full Abstract
<h4>Background and purpose</h4>Huntington's disease (HD) is an autosomal dominant condition caused by CAG-triplet repeat expansions. CAG-triplet repeat expansion is inversely correlated with age of onset in HD and largely determines the clinical features. The aim of this study was to examine the phenotypic and genotypic correlates of late-onset HD (LoHD) and to determine whether LoHD is a more benign expression of HD.<h4>Methods</h4>This was a retrospective observational study of 5053 White European HD patients from the ENROLL-HD database. Sociodemographic, genetic and phenotypic variables at baseline evaluation of subjects with LoHD, common-onset HD (CoHD) and young-onset HD (YoHD) were compared. LoHD subjects were compared with healthy subjects (HS) aged ≥60 years. Differences between the CoHD and LoHD groups were also explored in subjects with 41 CAG triplets, a repeat number in the lower pathological expansion range associated with wide variability in age at onset.<h4>Results</h4>Late-onset HD presented predominantly as motor-onset disease, with a lower prevalence of both psychiatric history and current symptomatology. Absent/unknown HD family history was significantly more common in the LoHD group (31.2%) than in the other groups. The LoHD group had more severe motor and cognitive deficits than the HS group. Subjects with LoHD and CoHD with 41 triplets in the larger allele were comparable with regard to cognitive impairment, but those with LoHD had more severe motor disorders, less problematic behaviors and more often an unknown HD family history.<h4>Conclusions</h4>It is likely that cognitive disorders and motor symptoms of LoHD are at least partly age-related and not a direct expression of the disease. In addition to CAG-triplet repeat expansion, future studies should investigate the role of other genetic and environmental factors in determining age of onset.
Also flagged:OsteoporosisTCF4Chromatinage-mineralbone formation
Journal Article2022-04-17✓ 5 SnippetsZhu DL, Chen XF, Zhou XR, Hu SY, Tuo XM, Hao RH, Dong SS, Jiang F, Rong Y, Yang TL, Yang Z, Guo Y.
In-Text Gene Mentions
Title)
…An Osteoporosis Susceptibility Allele at 11p15 Regulates SOX6 Expression by Modulating TCF4 Chromatin Binding.…
Abstract)
…Collectively, our integrated analyses revealed how the noncoding genetic variants (rs1440702) affect osteoporosis predisposition via long-range gene regulatory mechanisms and identified its target gene SOX6 for downstream biomarker and drug development.…
Also flagged:Endometriosisinfertilityiron-oxidepeptidevascular endothelial growth factor receptor 2systemic disease
Journal Article2022-04-17No SnippetsPark Y, Demessie AA, Luo A, Taratula OR, Moses AS, Do P, Campos L, Jahangiri Y, Wyatt CR, Albarqi HA, Farsad K, Slayden OD, Taratula O.
Show Full Abstract
Endometriosis is a devastating disease in which endometrial-like tissue forms lesions outside the uterus. It causes infertility and severe pelvic pain in ≈176 million women worldwide, and there is currently no cure for this disease. Magnetic hyperthermia could potentially eliminate widespread endometriotic lesions but has not previously been considered for treatment because conventional magnetic nanoparticles have relatively low heating efficiency and can only provide ablation temperatures (>46 °C) following direct intralesional injection. This study is the first to describe nanoparticles that enable systemically delivered magnetic hyperthermia for endometriosis treatment. When subjected to an alternating magnetic field (AMF), these hexagonal iron-oxide nanoparticles exhibit extraordinary heating efficiency that is 6.4× greater than their spherical counterparts. Modifying nanoparticles with a peptide targeted to vascular endothelial growth factor receptor 2 (VEGFR-2) enhances their endometriosis specificity. Studies in mice bearing transplants of macaque endometriotic tissue reveal that, following intravenous injection at a low dose (3 mg per kg), these nanoparticles efficiently accumulate in endometriotic lesions, selectively elevate intralesional temperature above 50 °C upon exposure to external AMF, and completely eradicate them with a single treatment. These nanoparticles also demonstrate promising potential as magnetic resonance imaging (MRI) contrast agents for precise detection of endometriotic tissue before AMF application.
Also flagged:SynthesisdegradationcalciumapatiteBone defectssarcomas
Journal Article2022-04-17No SnippetsPonnusamy NK, Lee H, Yoo JM, Nam SY.
Show Full Abstract
Biocompatible <i>β</i>-Ca<sub>3</sub>(PO<sub>4</sub>)<sub>2</sub> and mechanically stable <i>t-</i>ZrO<sub>2</sub> composites are currently being combined to overcome the demerits of the individual components. A series of five composites were synthesized using an aqueous precipitation technique. Their structural and mechanical stability was examined through X-ray diffraction, Rietveld refinement, FTIR, Raman spectroscopy, high-resolution scanning electron microscopy, and nanoindentation. The characterization results confirmed the formation of <i>β</i>-Ca<sub>3</sub>(PO<sub>4</sub>)<sub>2</sub>-<i>t</i>-ZrO<sub>2</sub> composites at 1100 °C. Heat treatment above 900 °C resulted in the degradation of the composites because of cationic interdiffusion between Ca<sup>2+</sup> ions and O<sup>-2</sup> vacancy in Zr<sup>4+</sup> ions. Sequential thermal treatments correspond to four different fractional phases: calcium-deficient apatite, <i>β</i>-Ca<sub>3</sub>(PO<sub>4</sub>)<sub>2</sub>, <i>t</i>-ZrO<sub>2</sub>, and <i>m</i>-ZrO<sub>2</sub>. The morphological features confirm in situ synthesis, which reveals abnormal grain growth with voids caused by the upsurge in ZrO<sub>2</sub> content. The mechanical stability data indicate significant variation in Young's modulus and hardness throughout the composite.
Also flagged:Menarchecancersprostate cancertype 2 diabetesheart diseaseobesity
Journal Article2022-04-17No SnippetsJo EJ, Han S, Wang K.
Show Full Abstract
We use Mendelian randomization to estimate the causal effect of age at menarche on late pubertal height growth and total pubertal height growth. The instrument SNPs selected from the exposure genome-wide association study (GWAS) are validated in additional population-matched exposure GWASs. Based on the inverse variance weighting method, there is a positive causal relationship of age at menarche on late pubertal growth (β^=0.56, 95% CI: (0.34, 0.78), p=3.16×10-7) and on total pubertal growth (β^=0.36, 95% CI: (0.14, 0.58), p=1.30×10-3). If the instrument SNPs are not validated in additional exposure GWASs, the estimated effect on late pubertal height growth increases by 3.6% to β^=0.58 (95% CI: (0.42, 0.73), p=4.38×10-13) while the estimates on total pubertal height growth increases by 41.7% to β^=0.51 (95% CI: (0.35, 0.67), p=2.96×10-11).
Also flagged:chemical compoundscancerskin cancerBasal cell carcinomasquamous cell carcinomamelanoma
Journal Article2022-04-17No SnippetsDumitraș DA, Andrei S.
Show Full Abstract
Although conventional medicine, chemical drug synthesis and pharmaceutical research are advancing at a rapid pace, nature remains a major supplier of biological molecules. Natural bioactive compounds are studied closely especially as an alternative to the limitations of conventional therapy in many diseases, melanoma being one of them. Malignant melanoma is a highly aggressive type of cancer, and the current methods of treatment used are cryotherapy, external surgery, radiation therapy, chemotherapy, photodynamic therapy, biological therapy, and targeted drug therapy. Unfortunately, these treatment methods are often inefficient, extremely expensive and cause many side effects, which is why focusing on melanoma chemoprevention and adjuvant therapy with natural herbal phytoconstituents is an emerging strategy to prevent, cure or treat melanoma. This review aims to examine the latest discoveries in terms of potential natural bioactive compounds that possess important activity against the development and spread of murine melanoma cancer. In particular, the use of different phytochemicals such as phenolic acids, flavonoids, anthocyanins, terpenoids, essential oils and carotenoids in vitro and in vivo models will be discussed. These data are helpful in guiding researchers in the direction of studying phytonutrients with important effects in the prevention and treatment of melanoma.
Also flagged:glycerolcarboxylic acidaminebindingvancomycinfluorescein isothiocyanate
Journal Article2022-04-17No SnippetsSwift T, Pinnock A, Shivshetty N, Pownall D, MacNeil S, Douglas I, Garg P, Rimmer S.
Show Full Abstract
This paper outlined our method for developing polymer-linked contact lens type materials for rapid detection and differentiation of Gram-positive, Gram-negative bacteria and fungi in infected corneas. It can be applied to both model synthetic or ex-vivo corneal models and has been successfully trialed in an initial efficacy tested animal study. First a hydrogel substrate for the swab material is selected, we have demonstrated selective swabs using a glycerol monomethacrylate hydrogel. Alternatively any commercial material with carboxylic acid functional groups is suitable but risks nonspecific adhesion. This is then functionalised via use of N-hydroxysuccinimide reaction with amine groups on the specified highly branched polymer ligand (either individually gram negative, gram positive or fungal binding polymers or a combination of all three can be employed for desired sensing application). The hydrogel is then cut into swabs suitable for sampling, used, and then the presence of gram positive, game negative and fungi are disclosed by the sequential addition of dyes (fluorescent vancomycin, fluorescein isothiocyanate and calcofluor white). In summary this method presents: Method to produce glycerol monomethacrylate hydrogels to minimize nonspecific binding Methods of attaching pathogen binding highly branched polymers to produce selective hydrogel swabs Method for disclosing bound pathogens to this swab using sequential dye addition.
Also flagged:Cas9demyelinating neuropathiesACTN3ACEironmetabolism
Journal Article2022-04-16No SnippetsVarillas-Delgado D, Del Coso J, Gutiérrez-Hellín J, Aguilar-Navarro M, Muñoz A, Maestro A, Morencos E.
Show Full Abstract
The impact of genetics on physiology and sports performance is one of the most debated research aspects in sports sciences. Nearly 200 genetic polymorphisms have been found to influence sports performance traits, and over 20 polymorphisms may condition the status of the elite athlete. However, with the current evidence, it is certainly too early a stage to determine how to use genotyping as a tool for predicting exercise/sports performance or improving current methods of training. Research on this topic presents methodological limitations such as the lack of measurement of valid exercise performance phenotypes that make the study results difficult to interpret. Additionally, many studies present an insufficient cohort of athletes, or their classification as elite is dubious, which may introduce expectancy effects. Finally, the assessment of a progressively higher number of polymorphisms in the studies and the introduction of new analysis tools, such as the total genotype score (TGS) and genome-wide association studies (GWAS), have produced a considerable advance in the power of the analyses and a change from the study of single variants to determine pathways and systems associated with performance. The purpose of the present study was to comprehensively review evidence on the impact of genetics on endurance- and power-based exercise performance to clearly determine the potential utility of genotyping for detecting sports talent, enhancing training, or preventing exercise-related injuries, and to present an overview of recent research that has attempted to correct the methodological issues found in previous investigations.
Also flagged:mitochondrialMitochondriaaxonsneurodegenerative diseasesBrain injurydeath
Journal Article2022-04-16No SnippetsCheng XT, Huang N, Sheng ZH.
Show Full Abstract
Mitochondria generate ATP essential for neuronal growth, function, and regeneration. Due to their polarized structures, neurons face exceptional challenges to deliver mitochondria to and maintain energy homeostasis throughout long axons and terminal branches where energy is in high demand. Chronic mitochondrial dysfunction accompanied by bioenergetic failure is a pathological hallmark of major neurodegenerative diseases. Brain injury triggers acute mitochondrial damage and a local energy crisis that accelerates neuron death. Thus, mitochondrial maintenance defects and axonal energy deficits emerge as central problems in neurodegenerative disorders and brain injury. Recent studies have started to uncover the intrinsic mechanisms that neurons adopt to maintain (or reprogram) axonal mitochondrial density and integrity, and their bioenergetic capacity, upon sensing energy stress. In this review, we discuss recent advances in how neurons maintain a healthy pool of axonal mitochondria, as well as potential therapeutic strategies that target bioenergetic restoration to power neuronal survival, function, and regeneration.
…The same type of analysis in the dataset of exclusively upregulated mRNAs upon promastigote infection (i.e. PRO only UP) identified GO categories related to Apoptosis regulation (i.e. Bnip3, Cd274, Gclm), Hydrogen peroxide metabolism (Cat, Prdx1, Prdx6, Txnrd1), Response to protozoan (Cd40, Gbp2, Gbp3, Slc11a1), and Response to type I IFN (Ifit1, Ifit2, Igtp, Irgm1, Mnda) (Fig. 5A, middle panel, and Table S2).…
Results)
…, Prdx1 ,Prdx6, Txnrd1 ),…
Results)
…infection with amastigotes (SOX6, RUNX3, and STAT1)…
Show Full Abstract
Macrophages undergo swift changes in mRNA abundance upon pathogen invasion. Herein we describe early remodelling of the macrophage transcriptome during infection by amastigotes or promastigotes of Leishmania donovani. Approximately 10-16% of host mRNAs were differentially modulated in L. donovani-infected macrophages when compared to uninfected controls. This response was partially stage-specific as a third of changes in mRNA abundance were either exclusively driven by one of the parasite forms or significantly different between them. Gene ontology analyses identified categories associated with immune functions (e.g. antigen presentation and leukocyte activation) among significantly downregulated mRNAs during amastigote infection while cytoprotective-related categories (e.g. DNA repair and apoptosis inhibition) were enriched in upregulated transcripts. Interestingly a combination of upregulated (e.g. cellular response to IFNβ) and repressed (e.g. leukocyte activation, chemotaxis) immune-related transcripts were overrepresented in the promastigote-infected dataset. In addition, Ingenuity Pathway Analysis (IPA) associated specific mRNA subsets with a number of upstream transcriptional regulators predicted to be modulated in macrophages infected with L. donovani amastigotes (e.g. STAT1 inhibition) or promastigotes (e.g. NRF2, IRF3, and IRF7 activation). Overall, our results indicate that early parasite stage-driven transcriptional remodelling in macrophages contributes to orchestrate both protective and deleterious host cell responses during L. donovani infection.
Also flagged:vaccinia-related kinase 2A-related kinasesserine-threonine kinaseskinasestressTAK1
Journal Article2022-04-16✓ 4 SnippetsPuja R, Chakraborty A, Dutta S, Bose K.
In-Text Gene Mentions
Abstract)
…one such kinaseVRK2controls cell stress…
Introduction)
…only VRK1 andVRK2are catalytically active…
Introduction)
…VRK2(vaccinia related kinase…
Methods)
…AlphaFold predicted models (VRK2: AF-Q86Y07-F1 and TAK1:…
Show Full Abstract
Vaccinia-related kinases (VRK) are serine-threonine kinases that regulate several signaling pathways. The isoform-VRK2A of one such kinase VRK2 controls cell stress response by interacting with TAK1, a mitogen-activated protein 3 kinase (MAP3K), via its partly cytosolic C-terminal transmembrane domain (VTMD). To establish the driving force and identify the key residues of the VRK2A-TAK1 interaction, we expressed and purified the standalone 3.6 kDa VTMD in the bacterial system using a unique and atypical two-step approach, when the effort to obtain full-length VRK2A remained unsuccessful. Characterization of biophysical properties demonstrated that VTMD domain maintains its structural integrity. Furthermore, dissecting the VRK2A-TAK1 binding interface using <i>in silico</i> tools provided important cues toward engineering the VRK2A-TAK1 interface to modulate its functions with desired characteristics. Most importantly, this novel purification strategy demonstrates its universal applicability in protein biochemistry research by serving as a model system for obtaining difficult-to-purify small proteins or domains.•VRK2A is a highly disordered transmembrane (TM) kinase, whose TM domain interacts with TAK1 (transforming growth factor-β-activated kinase).•The standalone VRK2A-TM domain (VTMD) was purified using affinity chromatography followed by two-step centricon based approach.•Biophysical and <i>in silico</i> analyses confirmed structural integrity of the domain.
Abnormal DRP1 expression has been identified in a variety of human cancers. However, the prognostic potential and mechanistic role of DRP1 in head and neck cancer (HNC) are currently poorly understood. Here, we demonstrated a significant upregulation of DRP1 in HNC tissues, and that DRP1 expression correlates with poor survival of HNC patients. Diminished DRP1 expression suppressed tumor growth and metastasis in both in vitro and in vivo models. DRP1 expression was positively correlated with FOXM1 and MMP12 expression in HNC patient samples, suggesting pathological relevance in the context of HNC development. Moreover, DRP1 depletion affected aerobic glycolysis through the downregulation of glycolytic genes, and overexpression of MMP12 in DRP1-depleted cells could help restore glucose consumption and lactate production. Using ChIP-qPCR, we showed that DRP1 modulates FOXM1 expression, which can enhance MMP12 transcription by binding to its promoter. We also showed that miR-575 could target 3'UTR of DRP1 mRNA and suppress DRP1 expression. Collectively, our study provides mechanistic insights into the role of DRP1 in HNC and highlights the potential of targeting the miR-575/DRP1/FOXM1/MMP12 axis as a novel therapy for the prevention of HNC progression.
Also flagged:interstitial pneumoniausual interstitial pneumoniapulmonary fibrosismyofibroblast differentiationmyofibroblast migrationextracellular
Journal Article2022-04-15No SnippetsZhang J, Wang H, Chen H, Li H, Xu P, Liu B, Zhang Q, Lv C, Song X.
Show Full Abstract
Idiopathic pulmonary fibrosis (IPF) is characterized by lung scarring and has no effective treatment. Fibroblast-to-myofibroblast differentiation and myofibroblast proliferation and migration are major clinical manifestations of this disease; hence, blocking these processes is a practical treatment strategy. Here, highly upregulated <i>LINC00941/lncIAPF</i> was found to accelerate pulmonary fibrosis by promoting fibroblast-to-myofibroblast differentiation and myofibroblast proliferation and migration. Assay for transposase-accessible chromatin using sequencing and chromatin immunoprecipitation experiments elucidated that histone 3 lysine 27 acetylation (H3K27ac) activated the chromosome region opening in the <i>LINC00941</i> promoter. As a consequence, the transcription factor ATF3 (activating transcription factor 3) bound to this region, and <i>LINC00941</i> transcription was enhanced. RNA affinity isolation, RNA immunoprecipitation (RIP), RNase-RIP, half-life analysis, and ubiquitination experiments unveiled that <i>LINC00941</i> formed a RNA-protein complex with ELAVL1/HuR (ELAV like RNA binding protein 1) to exert its pro-fibrotic function. Dual-fluorescence mRFP-GFP-MAP1LC3/LC3 (microtubule associated protein 1 light chain 3) adenovirus monitoring technology, human autophagy RT<sup>2</sup> profiler PCR array, and autophagic flux revealed that the <i>LINC00941</i>-ELAVL1 axis inhibited autophagosome fusion with a lysosome. ELAVL1 RIP-seq, RIP-PCR, mRNA stability, and rescue experiments showed that the <i>LINC00941</i>-ELAVL1 complex inhibited autophagy by controlling the stability of the target genes <i>EZH2</i> (enhancer of zeste 2 polycomb repressive complex 2 subunit), <i>STAT1</i> (signal transducer and activators of transcription 1) and <i>FOXK1</i> (forkhead box K1). Finally, the therapeutic effect of <i>LINC00941</i> was confirmed in a mouse model and patients with IPF. This work provides a therapeutic target and a new effective therapeutic strategy related to autophagy for IPF.<b>Abbreviations:</b> ACTA2/a-SMA: actin alpha 2, smooth muscle; ATF3: activating transcription factor 3; ATG: autophagy related; Baf-A1: bafilomycin A<sub>1</sub>; BLM: bleomycin; CDKN: cyclin dependent kinase inhibitor; CLN3: CLN3 lysosomal/endosomal transmembrane protein, battenin; COL1A: collagen type I alpha; COL3A: collagen type III alpha; CXCR4: C-X-C motif chemokine receptor 4; DRAM2: DNA damage regulated autophagy modulator 2; ELAVL1/HuR: ELAV like RNA binding protein 1; EZH2: enhancer of zeste 2 polycomb repressive complex 2 subunit; FADD: Fas associated via death domain; FAP/FAPα: fibroblast activation protein alpha; FOXK1: forkhead box K1; FVC: forced vital capacity; GABARAP: GABA type A receptor-associated protein; GABARAPL2: GABA type A receptor associated protein like 2; IGF1: insulin like growth factor 1; IPF: idiopathic pulmonary fibrosis; LAMP: lysosomal associated membrane protein; lncRNA: long noncoding RNA; MAP1LC3/LC3: microtubule associated protein 1 light chain 3; NPC1: NPC intracellular cholesterol transporter 1; RGS: regulator of G protein signaling; RPLP0: ribosomal protein lateral stalk subunit P0; ROC: receiver operating characteristic; S100A4: S100 calcium binding protein A4; SQSTM1/p62: sequestosome 1; STAT1: signal transducers and activators of transcription 1; TGFB1/TGF-β1: transforming growth factor beta 1; TNF: tumor necrosis factor; UIP: usual interstitial pneumonia; ULK1: unc-51 like autophagy activating kinase 1; VIM: vimentin.
Also flagged:ANXA1LAMB3FN1KRT17KRT19pancreatic cancer
Journal Article2022-04-15No SnippetsLi W, Li T, Sun C, Du Y, Chen L, Du C, Shi J, Wang W.
Show Full Abstract
<h4>Background</h4>Pancreatic cancer (PC) is a malignancy with a poor prognosis and high mortality. Surgical resection is the only "curative" treatment. However, only a minority of patients with PC can obtain surgery. Improving the overall survival (OS) rate of patients with PC is still a major challenge. Molecular biomarkers are a significant approach for diagnostic and predictive use in PCs. Several prediction models have been developed for patients newly diagnosed with PC that is operable or patients with advanced and metastatic PC; however, these models require further validation. Therefore, precise biomarkers are urgently required to increase the efficiency of predicting a disease-free survival (DFS), OS, and sensitivity to immunotherapy in PC patients and to improve the prognosis of PC.<h4>Methods</h4>In the present study, we first evaluated the highly and selectively expressed targets in PC, using the GeoMxTM Digital Spatial Profiler (DSP) and then, we analyzed the roles of these targets in PCs using TCGA database.<h4>Results</h4>LAMB3, FN1, KRT17, KRT19, and ANXA1 were defined as the top five upregulated targets in PC compared with paracancer. The TCGA database results confirmed the expression pattern of LAMB3, FN1, KRT17, KRT19, and ANXA1 in PCs. Significantly, LAMB3, FN1, KRT19, and ANXA1 but not KRT17 can be considered as biomarkers for survival analysis, univariate and multivariate Cox proportional hazards model, and risk model analysis. Furthermore, in combination, LAMB3, FN1, KRT19, and ANXA1 predict the DFS and, in combination, LAMB3, KRT19, and ANXA1 predict the OS. Immunotherapy is significant for PCs that are inoperable. The immune checkpoint blockade (ICB) analysis indicated that higher expressions of FN1 or ANXA1 are correlated with lower ICB response. In contrast, there are no significant differences in the ICB response between high and low expression of LAMB3 and KRT19.<h4>Conclusions</h4>In conclusion, LAMB3, FN1, KRT19, and ANXA1 are good predictors of PC prognosis. Furthermore, FN1 and ANXA1 can be predictors of immunotherapy in PCs.
Also flagged:pulmonary thromboembolismovarian vein thrombosisgestationD-dimerdeep vein thrombosisDVT
Journal Article2022-04-15✓ 1 SnippetMurata T, Yoshimoto Y, Shibano Y, Owada K, Miyajima M, Nakamura S, Yamauchi R.
In-Text Gene Mentions
I A O 0000613)
…were as follows:antithrombin-III: 93%; protein-C activity:…
Show Full Abstract
<h4>Background</h4>Ovarian vein thrombosis (OVT) may cause maternal mortality by inducing pulmonary thromboembolism (PTE). However, the prevalence, etiology, risk factors, prognosis, and optimal treatments for asymptomatic OVT during and after pregnancies are unclear, which therefore requires a high clinical index of suspicion for certain diagnoses due to its vague presentation. We herein present a case of asymptomatic postpartum OVT that extended toward the inferior vena cava (IVC), resulting in a potential risk of PTE.<h4>Case presentation</h4>A 30-year-old postpartum woman presented with slight dyspnea after an uneventful vaginal delivery at 40 weeks of gestation. We checked her laboratory data to exclude lethal thrombosis; D-dimer levels were 85.6 μg/mL. We performed computed tomography (CT) to search the presence of PTE and deep vein thrombosis (DVT); although no signs of PTE and DVT in her legs were detected, CT and trans-abdominal ultrasonography (TAUS) revealed a right OVT. Heparin was administered, and D-dimer levels decreased; warfarin at a dose of 2 mg/day was subsequently administered to control anti-coagulopathy. However, D-dimer was re-elevated despite adequate anticoagulation treatment, and extension of the right OVT to the IVC was detected by CT and TAUS. With warfarin administration, CT and TAUS showed the disappearance of right OVT. The patient was discharged from the hospital 17 days after delivery.<h4>Conclusions</h4>Even asymptomatic postpartum OVT may lead to PTE. Universal screening guidelines and optimal treatment strategies for asymptomatic OVT in pregnant and postpartum women should be established through future studies.
Metabolites are intermediate products of cellular metabolism catalysed by various enzymes. Metabolic remodelling, as a biochemical fingerprint of cancer cells, causes abnormal metabolite accumulation. These metabolites mainly generate energy or serve as signal transduction mediators via noncovalent interactions. After the development of highly sensitive mass spectrometry technology, various metabolites were shown to covalently modify proteins via forms of lysine acylation, including lysine acetylation, crotonylation, lactylation, succinylation, propionylation, butyrylation, malonylation, glutarylation, 2-hydroxyisobutyrylation and β-hydroxybutyrylation. These modifications can regulate gene expression and intracellular signalling pathways, highlighting the extensive roles of metabolites. Lysine acetylation is not discussed in detail in this review since it has been broadly investigated. We focus on the nine aforementioned novel lysine acylations beyond acetylation, which can be classified into two categories: histone acylations and nonhistone acylations. We summarize the characteristics and common functions of these acylation types and, most importantly, provide a glimpse into their fine-tuned control of tumorigenesis and potential value in tumour diagnosis, monitoring and therapy.
Also flagged:non-small cell lung cancerNSCLCtumorEGFRMETLUAD
Journal Article2022-04-15No SnippetsAdib E, Nassar AH, Abou Alaiwi S, Groha S, Akl EW, Sholl LM, Michael KS, Awad MM, Jӓnne PA, Gusev A, Kwiatkowski DJ.
Show Full Abstract
<h4>Background</h4>Genomic alterations in 8 genes are now the targets of FDA-approved therapeutics in non-small cell lung cancer (NSCLC), but their distribution according to genetic ancestry, sex, histology, and smoking is not well established.<h4>Methods</h4>Using multi-institutional genetic testing data from GENIE, we characterize the distribution of targetable genomic alterations in 8 genes among 8675 patients with NSCLC (discovery cohort: DFCI, N = 3115; validation cohort: Duke, Memorial Sloan Kettering Cancer Center, Vanderbilt, N = 5560). For the discovery cohort, we impute genetic ancestry from tumor-only sequencing and identify differences in the frequency of targetable alterations across ancestral groups, smoking pack-years, and histologic subtypes.<h4>Results</h4>We identified variation in the prevalence of KRAS<sup>G12C</sup>, sensitizing EGFR mutations, MET alterations, ALK, and ROS1 fusions according to the number of smoking pack-years. A novel method for computing continental (African, Asian, European) and Ashkenazi Jewish ancestries from panel sequencing enables quantitative analysis of the correlation between ancestry and mutation rates. This analysis identifies a correlation between Asian ancestry and EGFR mutations and an anti-correlation between Asian ancestry and KRAS<sup>G12C</sup> mutation. It uncovers 2.7-fold enrichment for MET exon 14 skipping mutations and amplifications in patients of Ashkenazi Jewish ancestry. Among never/light smokers, targetable alterations in LUAD are significantly enriched in those with Asian (80%) versus African (49%) and European (55%) ancestry. Finally, we show that 5% of patients with squamous cell carcinoma (LUSC) and 17% of patients with large cell carcinoma (LCLC) harbor targetable alterations.<h4>Conclusions</h4>Among patients with NSCLC, there was significant variability in the prevalence of targetable genomic alterations according to genetic ancestry, histology, and smoking. Patients with LUSC and LCLC have 5% rates of targetable alterations supporting consideration for sequencing in those subtypes.
Also flagged:lung cancerpleural effusionsMalignant pleural effusionnon-small cell lung cancerNSCLCtranslational
Journal Article2022-04-15✓ 2 SnippetsSeo HY, Kim SC, Roh WL, Shin YK, Kim S, Kim DW, Kim TM, Ku JL.
In-Text Gene Mentions
Results)
…Multiple tumor driver genes that are associated with spermatogenesis pathway such as mTOR, EZH2, NF2, DCC and MLF1 had high enrichment score in the EGFR group (Fig. 3C).…
Results)
…, NF2 ,DCCand MLF1 had…
Show Full Abstract
Malignant pleural effusion (MPE) is an independent determinant of poor prognostic factor of non-small cell lung cancer (NSCLC). The course of anchorage independent growth within the pleural cavity likely reforms the innate molecular characteristics of malignant cells, which largely accounts for resistance to chemotherapy and poor prognosis after the surgical resection. Nevertheless, the genetic and transcriptomic features with respect to various drug responses of MPE-complicated NSCLC remain poorly understood. To obtain a clearer overview of the MPE-complicated NSCLC, we established 28 MPE-derived lung cancer cell lines which were subjected to genomic, transcriptomic and pharmacological analysis. Our results demonstrated MPE-derived NSCLC cell lines recapitulated representative driver mutations generally found in the primary NSCLC. It also exhibited the presence of distinct translational subtypes in accordance with the mutational profiles. The drug responses of several targeted chemotherapies accords with both genomic and transcriptomic characteristics of MPE-derived NSCLC cell lines. Our data also suggest that the impending drawback of mutation-based clinical diagnosis in evaluating MPE-complicated NSCLS patient responses. As a potential solution, our work showed the importance of comprehending transcriptomic characteristics in order to defy potential drug resistance caused by MPE.
Also flagged:Tumorcolorectal cancerscancertranslationalcolorectal cancermismatch repair
Journal Article2022-04-15✓ 5 SnippetsSeo MK, Kang H, Kim S.
In-Text Gene Mentions
Results)
…In addition, the expression pattern of the signature of preMSIm did not appear to suitably reflect genes important in gastric cancer, such as DDX27, SMAP1, and ZSWIM3, and in uterine cancer, such as DDX27, SHROMM4, SMAP1, and ZSWIM3, thereby making it unable to efficiently differentiate MSI and MSS tumors (|log2 fold change|< 0.5) in these cancer types (Fig. 3d,e).…
Results)
…mutated genes (DDX27, TGFBR2 , and…
Results)
…MLH1, RPL22L1, EPM2AIP1,DDX27, and SHROOM4…
Results)
…cancer, such asDDX27, SMAP1 , and…
Results)
…cancer, such asDDX27, SHROMM4, SMAP1 ,…
Show Full Abstract
Detecting microsatellite instability (MSI) in colorectal cancers (CRCs) is essential because it is the determinant of treatment strategies, including immunotherapy and chemotherapy. Yet, no attempt has been made to exploit transcriptomic profile and tumor microenvironment (TME) of it to unveil MSI status in CRC. Hence, we developed a novel TME-aware, single-transcriptome predictor of MSI for CRC, called MAP (Microsatellite instability Absolute single sample Predictor). MAP was developed utilizing recursive feature elimination-random forest with 466 CRC samples from The Cancer Genome Atlas, and its performance was validated in independent cohorts, including 1118 samples. MAP showed robustness and predictive power in predicting MSI status in CRC. Additional advantages for MAP were demonstrated through comparative analysis with existing MSI classifier and other cancer types. Our novel approach will provide access to untouched vast amounts of publicly available transcriptomic data and widen the door for MSI CRC research and be useful for gaining insights to help with translational medicine.
Also flagged:metabolismmidazolamadenosine triphosphateextracellulartranslationaltransporters
Journal Article2022-04-15✓ 5 SnippetsBiel C, Martinec O, Sibering B, van Summeren K, Wessels AMA, Touw DJ, de Jong KP, de Meijer VE, Faber KN, Klooster JPT, de Graaf IAM, Olinga P.
Human Precision-cut intestinal slices (hPCIS) are used to study intestinal physiology, pathophysiology, drug efficacy, toxicology, kinetics, and metabolism. However, the use of this ex vivo model is restricted to approximately a 24 h timeframe because of declining viability of the hPCIS during traditional culture. We hypothesized that we could extend the hPCIS viability by using organoid medium. Therefore, we cultured hPCIS for up to 72 h in organoid media [expansion medium (Emed) and differentiation medium (Dmed)]. After incubation, we assessed culture-induced changes on viability markers, specific cell type markers and we assessed the metabolic activity of enterocytes by measuring midazolam metabolite formation. We show that the adenosine triphosphate (ATP)/protein ratio of Emed-cultured hPCIS and morphology of both Emed- and Dmed-cultured hPCIS was improved compared to WME-cultured hPCIS. Emed-cultured hPCIS showed an increased expression of proliferation and stem cell markers, whereas Dmed-cultured hPCIS showed an increased expression of proliferation and enterocyte markers, along with increased midazolam metabolism. Using the Emed, the viability of hPCIS could be extended for up to 72 h, and proliferating stem cells remained preserved. Using Dmed, hPCS also remained viable for up to 72 h, and specifically rescued the metabolizing enterocytes during culture. In conclusion, by using two different organoid culture media, we could extend the hPCIS viability for up to 72 h of incubation and specifically steer stem cells or enterocytes towards their original function, metabolism, and proliferation, potentially allowing pharmacokinetic and toxicology studies beyond the 24 h timeframe.
Also flagged:Agingautophagyoxygenribosomedermal atrophyextracellular
Journal Article2022-04-15✓ 1 SnippetTsitsipatis D, Martindale JL, Ubaida-Mohien C, Lyashkov A, Yanai H, Kashyap A, Shin CH, Herman AB, Herman AB, Ji E, Yang JH, Munk R, Dunn C, Lukyanenko Y, Yang X, Chia CW, Karikkineth AC, Zukley L, D'Agostino J, Kaileh M, Cui CY, Beerman I, Ferrucci L, Gorospe M.
Changes in the proteome of different human tissues with advancing age are poorly characterized. Here, we studied the proteins present in primary skin fibroblasts collected from 82 healthy individuals across a wide age spectrum (22-89 years old) who participated in the GESTALT (Genetic and Epigenetic Signatures of Translational Aging Laboratory Testing) study of the National Institute on Aging, NIH. Proteins were extracted from lysed fibroblasts and subjected to liquid chromatography-mass spectrometry analysis, and the expression levels of 9341 proteins were analyzed using linear regression models. We identified key pathways associated with skin fibroblast aging, including autophagy, scavenging of reactive oxygen species (ROS), ribosome biogenesis, DNA replication, and DNA repair. Changes in these prominent pathways were corroborated using molecular and cell culture approaches. Our study establishes a framework of the global proteome governing skin fibroblast aging and points to possible biomarkers and therapeutic targets.
Also flagged:Hydroxyapatiteimmune responseCytokineschemokineshistamineIL-4
Journal Article2022-04-15No SnippetsLitak J, Czyzewski W, Szymoniuk M, Pastuszak B, Litak J, Litak G, Grochowski C, Rahnama-Hezavah M, Kamieniak P.
Show Full Abstract
Hydroxyapatite possesses desirable properties as a scaffold in tissue engineering: it is biocompatible at a site of implantation, and it is degradable to non-toxic products. Moreover, its porosity enables infiltration of cells, nutrients and waste products. The outcome of hydroxyapatite implantation highly depends on the extent of the host immune response. Authors emphasise major roles of the chemical, morphological and physical properties of the surface of biomaterial used. A number of techniques have been applied to transform the theoretical osteoconductive features of HAp into spinal fusion systems-from integration of HAp with autograft to synthetic intervertebral implants. The most popular uses of HAp in spine surgery include implants (ACDF), bone grafts in posterolateral lumbar fusion and transpedicular screws coating. In the past, autologous bone graft has been used as an intervertebral cage in ACDF. Due to the morbidity related to autograft harvesting from the iliac bone, a synthetic cage with osteoconductive material such as hydroxyapatite seems to be a good alternative. Regarding posterolateral lumbar fusion, it requires the graft to induce new bone growth and reinforce fusion between the vertebrae. Hydroxyapatite formulations have shown good results in that field. Moreover, the HAp coating has proven to be an efficient method of increasing screw fixation strength. It can decrease the risk of complications such as screw loosening after pedicle screw fixation in osteoporotic patients. The purpose of this literature review is to describe in vivo reaction to HAp implants and to summarise its current application in spine surgery.
Also flagged:TNF-αIFN-γInflammatory ResponseJNKSTAT1Skin inflammation
Journal Article2022-04-15✓ 1 SnippetGil TY, Kang SC, Jin BR, An HJ.
In-Text Gene Mentions
Abstract)
…including signal transducers,activators of transcription 1of transcription 1/3,…
Show Full Abstract
Skin inflammation may cause allergic diseases such as allergic rhinitis, asthma, and atopic dermatitis. <i>Euphorbia hirta</i> (<i>E. hirta</i>) is a member of the Euphorbiaceae family and is well-known for its anti-asthma effects. <i>E. hirta</i> has traditionally been used to treat respiratory ailments, dysentery, jaundice, and digestive problems. However, its effects on skin inflammation remain unclear. Here, we determined the effects of 70% ethanol extract of <i>E. hirta</i> leaves (ELE) in vitro using human keratinocyte HaCaT cells, which constitute most epidermal skin cells. We determined the inhibitory effects of ELE on the inflammation caused by tumor necrosis factor (TNF)-α/interferon (IFN)-γ in keratinocytes using ELISA, immunoblotting, and qRT-PCR assay. ELE was found to reduce the production and mRNA expression of pro-inflammatory cytokines such as TNF-α or interleukin-6 and the expression of various proteins, including signal transducers, activators of transcription 1/3, and mitogen-activated protein kinase. Expression levels of these proteins were found to be upregulated in the TNF-α/IFN-γ-stimulated condition and downregulated by ELE treatment. These results indicate that ELE protects HaCaT cells against TNF-α/IFN-γ-induced skin inflammation.
Also flagged:CalcitriolTacalcitolVitamin Dacute lymphoblastic leukemiaALLvitamin D receptor
Journal Article2022-04-15✓ 1 SnippetTurlej E, Goszczyński TM, Drab M, Orzechowska B, Maciejewska M, Banach J, Wietrzyk J.
In-Text Gene Mentions
Introduction)
…(AF9), MLLT1, andMLLT10(AF10) It is…
Show Full Abstract
Vitamin D analogs (VDAs) may directly inhibit the growth of normal and malignant (derived from acute lymphoblastic leukemia (ALL)) B cells, as both types of cells express vitamin D receptor (VDR). We performed anti-proliferative, morphology tests and phenotyping to evaluate the sensitivity of monocytes and iDCs (immature myeloid-derived dendritic cells) on calcitriol and tacalcitol treatment, phenotyping, morphology, and size distribution measurement to determine the characteristics of microvesicles (MVs) and exosomes (EXs) derived from them and, finally, phenotyping and Elisa test to determine the effects of VDAs on modulation of the phenotype of B cells through extracellular vesicles (EVs) released by iDCs. Our results confirmed that both SC cells and iDCs were sensitive to the VDAs and showed altered surface expression of markers associated with monocyte differentiation, which was resulting in the phenotypic changes in EVs derived from them. We also showed that obtained EVs could change the morphology and phenotype of ALL-B-derived precursor cells in a different way, depending on their origin. The differential effect of VDAs on ALL-B cells, which was associated with increased or decreased expression of CD27, CD24, CD38, and CD23 expression, was observed. Hence, further studies to explain the modulation in the composition of EVs by VDAs are required.
Also flagged:Relaxin-3 ReceptorRXFP3agingADP-ribosylation factorARF) GTPase activating protein GIT2GIT2
Journal Article2022-04-15✓ 5 SnippetsLeysen H, Walter D, Clauwaert L, Hellemans L, van Gastel J, Vasudevan L, Martin B, Maudsley S.
In-Text Gene Mentions
Introduction)
…and peroxiredoxin 6 (PRDX6) among the proteins…
Introduction)
…Loss ofPRDX6expression has previously…
Introduction)
…increased expression ofPRDX6, indicating a synergistic…
Introduction)
…Similar toPRDX6, SOD1 is also…
Introduction)
…ROS regulating factorPRDX6[ 24 ,…
Show Full Abstract
During the aging process our body becomes less well equipped to deal with cellular stress, resulting in an increase in unrepaired damage. This causes varying degrees of impaired functionality and an increased risk of mortality. One of the most effective anti-aging strategies involves interventions that combine simultaneous glucometabolic support with augmented DNA damage protection/repair. Thus, it seems prudent to develop therapeutic strategies that target this combinatorial approach. Studies have shown that the ADP-ribosylation factor (ARF) GTPase activating protein GIT2 (GIT2) acts as a keystone protein in the aging process. GIT2 can control both DNA repair and glucose metabolism. Through in vivo co-regulation analyses it was found that GIT2 forms a close coexpression-based relationship with the relaxin-3 receptor (RXFP3). Cellular RXFP3 expression is directly affected by DNA damage and oxidative stress. Overexpression or stimulation of this receptor, by its endogenous ligand relaxin 3 (RLN3), can regulate the DNA damage response and repair processes. Interestingly, RLN3 is an insulin-like peptide and has been shown to control multiple disease processes linked to aging mechanisms, e.g., anxiety, depression, memory dysfunction, appetite, and anti-apoptotic mechanisms. Here we discuss the molecular mechanisms underlying the various roles of RXFP3/RLN3 signaling in aging and age-related disorders.
Also flagged:CortisolSerotonin TransporterMajor Depressive Disorderbrain-derived neurotrophic factorBDNFanxiety
Journal Article2022-04-15✓ 5 SnippetsOkamoto N, Watanabe K, Tesen H, Ikenouchi A, Igata R, Konishi Y, Natsuyama T, Fujii R, Kakeda S, Kishi T, Iwata N, Yoshimura R.
In-Text Gene Mentions
Introduction)
…Serotonin transporter (5-HTT) mediates the reuptake and recycling of the released serotonin following neuronal stimulation [13].…
Introduction)
…The latter study used heterozygous 5-HTT knockout mice (having a 50% gene dose-dependent reduction of 5-HTT expression) and found that, although these mice did not show behavioral deficits when raised by mothers providing a lot of maternal care, they developed increased anxiety and depression-related behavior in adulthood when raised by mothers providing poor maternal care.…
Introduction)
…Serotonin transporter (5-HTT) mediates the reuptake…
Introduction)
…reduced expression of5-HTTmRNA [ 15…
Introduction)
…been shown that5-HTTknockout mutations moderate…
Show Full Abstract
The amygdala is a prominent region of the brain that plays a critical role in the pathophysiology of major depressive disorder (MDD). The amygdala is formed from a collection of interconnected substructures (nuclei) that relay signals from multiple brain areas, which suggests that the amygdala has different functions depending on its subregion. There are two main alleles of serotonin transporter gene polymorphism (<i>5-HTTLPR</i>): a 44-bp insertion (l-allele) or deletion (s-allele). The transcriptional activity of the l-allele of the gene is twice that of the s-allele. The present study aimed to investigate the association between the volume of the whole amygdala and subregions of the amygdala in 25 first-episode and drug-naive patients with MDD and 46 healthy controls (HCs) with the s/s genotype of <i>5-HTTLPR</i> and plasma levels of brain-derived neurotrophic factor (BDNF) or cortisol. No significant difference was observed in the amygdala total and subregion volumes between the HC and MDD groups. No significant difference was found in the plasma levels of BDNF and cortisol between the two groups. In addition, no correlations were found between the total and subregion amygdala volume and plasma levels of cortisol or BDNF.
Also flagged:Adenocarcinomacolon adenocarcinomaCOADtumorepithelial-mesenchymal transitionColorectal cancer
Journal Article2022-04-15✓ 1 SnippetYang T, Lei J, Feng Q, Song D, Wang X.
In-Text Gene Mentions
Results)
…, FADS3 ,LRRC7, NOTCH3 ,…
Show Full Abstract
<h4>Background</h4>Although microsatellite instability (MSI) is an indicator for active immunotherapy response, only 15% of colon adenocarcinoma (COAD) patients are with MSI. An investigation into the immune profiles in low MSI (MSI-L) and microsatellite stable (MSS) COAD remains lacking, whereas such exploration may provide new insights into COAD immunity.<h4>Methods</h4>We hierarchically clustered MSI-L/MSS COAD based on the enrichment levels of 28 immune signatures to identify its immune-specific subtypes. We also comprehensively compared molecular and clinicopathologic profiles among these subtypes.<h4>Results</h4>We identified three immune subtypes of MSI-L/MSS COAD (IM-H, IM-M, and IM-L), which had high, medium, and low immune signature scores, respectively. We demonstrated that this subtyping method was reproducible and predictable by analyzing five different datasets, including four bulk tumor datasets and one single-cell dataset. IM-H was characterized by high immunity, high stemness, strong potential of proliferation, invasion and metastasis, epithelial-mesenchymal transition, elevated expression of oncogenic pathways, low tumor purity, low intratumor heterogeneity (ITH), genomic instability, inferior response to chemotherapy, and unfavorable prognosis. IM-M was characterized by the highest ratio of immunostimulatory to immunosuppressive signatures, the best response to chemotherapy, and favorable prognosis. IM-L was characterized by low immunity, high tumor purity, high ITH, and genomic stability.<h4>Conclusion</h4>The immune-specific subtyping of MSI-L/MSS COAD may provide new insights into the tumor immunity as well as clinical implications for immunotherapy of the COAD patients who lack MSI.
Also flagged:Neurodegenerative Disordersneurodegenerative disorderpathogenesisbalance disordersamyotrophic lateral sclerosisALS
Journal Article2022-04-15✓ 1 SnippetDas R, Paul S, Mourya GK, Kumar N, Hussain M.
In-Text Gene Mentions
S I O 001029)
…The Huntingtin (HTT) gene mutation, due to expansion of CAG triplet (cytosine, adenine, and guanine), leads to polyglutamine tract elongation is often linked to HD (Xu et al., 2017).…
Show Full Abstract
The study of human movement and biomechanics forms an integral part of various clinical assessments and provides valuable information toward diagnosing neurodegenerative disorders where the motor symptoms predominate. Conventional gait and postural balance analysis techniques like force platforms, motion cameras, etc., are complex, expensive equipment requiring specialist operators, thereby posing a significant challenge toward translation to the clinics. The current manuscript presents an overview and relevant literature summarizing the umbrella of factors associated with neurodegenerative disorder management: from the pathogenesis and motor symptoms of commonly occurring disorders to current alternate practices toward its quantification and mitigation. This article reviews recent advances in technologies and methodologies for managing important neurodegenerative gait and balance disorders, emphasizing assessment and rehabilitation/assistance. The review predominantly focuses on the application of inertial sensors toward various facets of gait analysis, including event detection, spatiotemporal gait parameter measurement, estimation of joint kinematics, and postural balance analysis. In addition, the use of other sensing principles such as foot-force interaction measurement, electromyography techniques, electrogoniometers, force-myography, ultrasonic, piezoelectric, and microphone sensors has also been explored. The review also examined the commercially available wearable gait analysis systems. Additionally, a summary of recent progress in therapeutic approaches, viz., wearables, virtual reality (VR), and phytochemical compounds, has also been presented, explicitly targeting the neuro-motor and functional impairments associated with these disorders. Efforts toward therapeutic and functional rehabilitation through VR, wearables, and different phytochemical compounds are presented using recent examples of research across the commonly occurring neurodegenerative conditions [viz., Parkinson's disease (PD), Alzheimer's disease (AD), multiple sclerosis, Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS)]. Studies exploring the potential role of Phyto compounds in mitigating commonly associated neurodegenerative pathologies such as mitochondrial dysfunction, α-synuclein accumulation, imbalance of free radicals, etc., are also discussed in breadth. Parameters such as joint angles, plantar pressure, and muscle force can be measured using portable and wearable sensors like accelerometers, gyroscopes, footswitches, force sensors, etc. Kinetic foot insoles and inertial measurement tools are widely explored for studying kinematic and kinetic parameters associated with gait. With advanced correlation algorithms and extensive RCTs, such measurement techniques can be an effective clinical and home-based monitoring and rehabilitation tool for neuro-impaired gait. As evident from the present literature, although the vast majority of works reported are not clinically and extensively validated to derive a firm conclusion about the effectiveness of such techniques, wearable sensors present a promising impact toward dealing with neurodegenerative motor disorders.
Also flagged:tumorbreast cancerJTBcell growthpeptidesspindle assembly
Journal Article2022-04-15✓ 2 SnippetsJayathirtha M, Neagu AN, Whitham D, Alwine S, Darie CC.
In-Text Gene Mentions
Text
…Hemochromatosis…
Text
…HFE…
Show Full Abstract
Jumping translocation breakpoint (JTB) gene acts as a tumor suppressor or an oncogene in different malignancies, including breast cancer (BC), where it was reported as overexpressed. However, the molecular functions, biological processes and underlying mechanisms through which JTB protein causes increased cell growth, proliferation and invasion is still not fully deciphered. Our goal is to identify the functions of JTB protein by cellular proteomics approaches. MCF7 breast cancer cells were transfected with sense orientation of hJTB cDNA in HA, His and FLAG tagged CMV expression vector to overexpress hJTB and the expression levels were confirmed by Western blotting (WB). Proteins extracted from transfected cells were separated by SDS-PAGE and the in-gel digested peptides were analyzed by nano-liquid chromatography tandem mass spectrometry (nanoLC-MS/MS). By comparing the proteome of cells with upregulated conditions of JTB vs control and identifying the protein dysregulation patterns, we aim to understand the function of this protein and its contribution to tumorigenesis. Gene Set Enrichment Analysis (GSEA) algorithm was performed to investigate the biological processes and pathways that are associated with the JTB protein upregulation. The results demonstrated four significantly enriched gene sets from the following significantly upregulated pathways: mitotic spindle assembly, estrogen response late, epithelial-to-mesenchymal transition (EMT) and estrogen response early. JTB protein itself is involved in mitotic spindle pathway by its role in cell division/cytokinesis, and within estrogen response early and late pathways, contributing to discrimination between luminal and mesenchymal breast cancer. Thus, the overexpressed JTB condition was significantly associated with an increased expression of ACTNs, FLNA, FLNB, EZR, MYOF, COL3A1, COL11A1, HSPA1A, HSP90A, WDR, EPPK1, FASN and FOXA1 proteins related to deregulation of cytoskeletal organization and biogenesis, mitotic spindle organization, ECM remodeling, cellular response to estrogen, proliferation, migration, metastasis, increased lipid biogenesis, endocrine therapy resistance, antiapoptosis and discrimination between different breast cancer subtypes. Other upregulated proteins for overexpressed JTB condition are involved in multiple cellular functions and pathways that become dysregulated, such as tumor microenvironment (TME) acidification, the transmembrane transport pathways, glycolytic flux, iron metabolism and oxidative stress, metabolic reprogramming, nucleocytosolic mRNA transport, transcriptional activation, chromatin remodeling, modulation of cell death pathways, stress responsive pathways, and cancer drug resistance. The downregulated proteins for overexpressed JTB condition are involved in adaptive communication between external and internal environment of cells and maintenance between pro-apoptotic and anti-apoptotic signaling pathways, vesicle trafficking and secretion, DNA lesions repair and suppression of genes involved in tumor progression, proteostasis, redox state regulation, biosynthesis of macromolecules, lipolytic pathway, carbohydrate metabolism, dysregulation of ubiquitin-mediated degradation system, cancer cell immune escape, cell-to-cell and cell-to-ECM interactions, and cytoskeletal behaviour. There were no significantly enriched downregulated pathways.
Also flagged:paroxetinecancergastric adenocarcinomagastric cancerRad51HR23B
Journal Article2022-04-15✓ 1 SnippetLiu BH, Yuan TM, Huang CJ, Hsu DT, Chen SW, Hsiao NW, Lin SC, Wu SW, Lin YJ, Chuang SM.
In-Text Gene Mentions
Text
…POU3F2…
Show Full Abstract
To evaluate the potential anticancer effects of 1175 FDA-approved drugs, cell viability screening was performed using 25 human cancer cell lines covering 14 human cancer types. Here, we focus on the action of paroxetine, which demonstrated greater toxicity toward human gastric adenocarcinoma cell-line AGS cells compared with the other FDA-approved drugs, exhibiting an IC50 value lower than 10 μM. Evaluation of the underlying novel mechanisms revealed that paroxetine can enhance DNA damage in gastric cancer cells and involves downregulation of Rad51, HR23B and ERCC1 expression and function, as well as nucleotide shortage. Enhancement of autophagy counteracted paroxetine-induced apoptosis but did not affect paroxetine-induced DNA damage. Paroxetine also enhanced ROS generation in AGS cells, but a ROS scavenger did not improve paroxetine-mediated DNA damage, apoptosis, or autophagy, suggesting ROS might play a minor role in paroxetine-induced cell toxicity. In contrast, paroxetine did not enhance DNA damage, apoptosis, or autophagy in another insensitive gastric adenocarcinoma cell-line MKN-45 cells. Interestingly, co-administration of paroxetine with conventional anticancer agents sensitized MKN-45 cells to these agents: co-treated cells showed increased apoptosis relative to MKN-45 cells treated with the anticancer agent alone. Unequivocally, these data suggest that for the first time that paroxetine triggers cytotoxicity and DNA damage in AGS cells at least partly by reducing the gene expression of Rad51, HR23B, and ERCC1. Our findings also suggest that paroxetine is a promising candidate anticancer agent and/or chemosensitizing agent for use in combination with other anticancer drugs in cancer therapy. The molecular mechanisms underlying the anticancer activity of co-treatment with paroxetine and chemotherapy appear to be complex and are worthy of further investigation.
Also flagged:C10orf91LINC01224hepatocellular carcinomapathogenesishepatic diseasesliver cancer
Journal Article2022-04-15No SnippetsGong A, Luo X, Tan Y, Chen H, Luo G.
Show Full Abstract
<h4>Background</h4>The dysregulation of long non-coding RNAs (lncRNAs) has been implicated roles in the pathogenesis of many human diseases, including hepatic diseases. Several lncRNAs have been associated with the progression of hepatocellular carcinoma (HCC), but their function as diagnostic markers for liver cancer remain to be determined.<h4>Objective</h4>This study aimed to identify the potential diagnostic markers for liver cancer.<h4>Methods</h4>The Cancer Genome Atlas (TCGA) database was used to obtain the gene transcriptome data of liver cancer. In addition, this study enrolled 70 liver cancer patients admitted to the Yiwu Central Hospital and 50 healthy people who concurrently underwent physical examinations from February 2017 to January 2020. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to detect the expression of C10orf91 and LINC01224 in the patients' tissues and serum. A 5-year follow-up was conducted for survival observation. The potential and targeted miRs of C10orf91 and LINC01224 were predicted by online database for miRNA target prediction. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were conducted and competing endogenous RNA (ceRNA) network was plotted.<h4>Results</h4>A total of 175 differentially expressed lncRNAs were screened out, of which 173 were upregulated and 2 were downregulated. C10orf91, and LINC01224 were independent prognostic factors for liver cancer (P<0.05). C10orf91 and LINC01224 had diagnostic value for differentiating liver cancer, tumor node metastasis (TNM) staging, and lymphatic metastasis. GO and KEGG enrichment analysis showed that C10orf91 and LINC01224 were involved in 23 significant biological functions and 35 significant signal transduction pathways respectively.<h4>Conclusion</h4>C10orf91 and LINC01224 are highly expressed in liver cancer patients withpoor prognosis.
bioRxiv2022-04-15Preprint (No Snippets API)Fisher NC, Byrne RM, Leslie H, Wood C, Legrini A, Cameron AJ, Ahmaderaghi B, Corry S, Malla S, Amirkhah R, McCooey A, Rogan E, Redmond KL, Sakhnevych S, Domingo E, Jackson J, Loughrey MB, Leedham S, Maughan T, Lawler M, Sansom OJ, Lamrock F, Koelzer VH, Jamieson N, Dunne PD.
Show Full Abstract
Precise mechanism-based gene expression signatures (GESs) have been developed in appropriate in vitro and in vivo model systems, to identify important cancer-related signalling processes. However, some GESs originally developed to represent specific disease processes, primarily with an epithelial cell focus, are being applied to heterogeneous tumour samples where the expression of the genes in the signature may no longer be epithelial-specific. Therefore, unknowingly, even small changes in tumour stroma percentage can directly influence GESs, undermining the intended mechanistic signalling. Using colorectal cancer as an exemplar, we deployed numerous orthogonal profiling methodologies, including laser capture microdissection, flow cytometry, bulk and multiregional biopsy clinical samples, single cell RNAseq and finally spatial transcriptomics, to perform a comprehensive assessment of the potential for the most widely-used GESs to be influenced, or confounded, by stromal content in tumour tissue. To complement this work, we generated a freely-available resource, ConfoundR; https://confoundr.qub.ac.uk/ , that enables users to test the extent of stromal influence on an unlimited number of the genes/signatures simultaneously across colorectal, breast, pancreatic, ovarian and prostate cancer datasets. <h4>Findings: </h4> presented here demonstrate the clear potential for misinterpretation of the meaning of GESs, due to widespread stromal influences, which in-turn can undermine faithful alignment between clinical samples and preclinical data/models, particularly cell lines and organoids, or tumour models not fully recapitulating the stromal and immune microenvironment. As such, efforts to faithfully align preclinical models of disease using phenotypically-designed GESs must ensure that the signatures themselves remain representative of the same biology when applied to clinical samples.
Also flagged:CENPKZC3H13cervical cancercentromere protein Kgene expressiontumorsphere
Journal Article2022-04-14✓ 5 SnippetsLin X, Wang F, Chen J, Liu J, Lin YB, Li L, Chen CB, Xu Q.
In-Text Gene Mentions
Results)
…Furthermore, cycloheximide chase assays, Co-IP analyses, and cell fractionation assays all confirmed that CENPK knockdown led to increased p53 stability and inhibition of p53 ubiquitination and nuclear export, all of which were reversed by SOX6 knockdown (Fig. 5h-j).…
Discussion)
…In contrast, SOX6 is known to function in tumor suppression of several cancers [35–37], including cervical cancer [38].…
Abstract)
…directly bound toSOX6and disrupted the…
Introduction)
…to disruption ofSOX6interactions and dysregulation…
Introduction)
…ferase, ZC3H13, through CENPK/SOX6to the Wnt/β-catenin…
Show Full Abstract
<h4>Background</h4>Stemness and chemoresistance contribute to cervical cancer recurrence and metastasis. In the current study, we determined the relevant players and role of N<sup>6</sup>-methyladenine (m<sup>6</sup>A) RNA methylation in cervical cancer progression.<h4>Methods</h4>The roles of m<sup>6</sup>A RNA methylation and centromere protein K (CENPK) in cervical cancer were analyzed using bioinformatics analysis. Methylated RNA immunoprecipitation was adopted to detect m<sup>6</sup>A modification of CENPK mRNA. Human cervical cancer clinical samples, cell lines, and xenografts were used for analyzing gene expression and function. Immunofluorescence staining and the tumorsphere formation, clonogenic, MTT, and EdU assays were performed to determine cell stemness, chemoresistance, migration, invasion, and proliferation in HeLa and SiHa cells, respectively. Western blot analysis, co-immunoprecipitation, chromatin immunoprecipitation, and luciferase reporter, cycloheximide chase, and cell fractionation assays were performed to elucidate the underlying mechanism.<h4>Results</h4>Bioinformatics analysis of public cancer datasets revealed firm links between m<sup>6</sup>A modification patterns and cervical cancer prognosis, especially through ZC3H13-mediated m<sup>6</sup>A modification of CENPK mRNA. CENPK expression was elevated in cervical cancer, associated with cancer recurrence, and independently predicts poor patient prognosis [hazard ratio = 1.413, 95% confidence interval = 1.078 - 1.853, P = 0.012]. Silencing of CENPK prolonged the overall survival time of cervical cancer-bearing mice and improved the response of cervical cancer tumors to chemotherapy in vivo (P < 0.001). We also showed that CENPK was directly bound to SOX6 and disrupted the interactions of CENPK with β-catenin, which promoted β-catenin expression and nuclear translocation, facilitated p53 ubiquitination, and led to activation of Wnt/β-catenin signaling, but suppression of the p53 pathway. This dysregulation ultimately enhanced the tumorigenic pathways required for cell stemness, DNA damage repair pathways necessary for cisplatin/carboplatin resistance, epithelial-mesenchymal transition involved in metastasis, and DNA replication that drove tumor cell proliferation.<h4>Conclusions</h4>CENPK was shown to have an oncogenic role in cervical cancer and can thus serve as a prognostic indicator and novel target for cervical cancer treatment.
Also flagged:membranediabeteshemophiliacancerkidneycell migration
Journal Article2022-04-14No SnippetsOlov N, Bagheri-Khoulenjani S, Mirzadeh H.
Show Full Abstract
Tissue engineering, using a combination of living cells, bioactive molecules, and three-dimensional porous scaffolds, is a promising alternative to traditional treatments such as the use of autografts and allografts for bone and cartilage tissue regeneration. Scaffolds, in this combination, can be applied either through surgery by implantation of cell-seeded pre-fabricated scaffolds, or through injection of a solidifying precursor and cell mixture, or as an injectable cell-seeded pre-fabricated scaffold. In situ forming and pre-fabricated injectable scaffolds can be injected directly into the defect site with complex shape and critical size in a minimally invasive manner. Proper and homogeneous distribution of cells, biological factors, and molecular signals in these injectable scaffolds is another advantage over pre-fabricated scaffolds. Due to the importance of injectable scaffolds in tissue engineering, here different types of injectable scaffolds, their design challenges, and applications in bone and cartilage tissue regeneration are reviewed.
Also flagged:SNCAlung adenocarcinomaLUADmethylationCD8CD4
Journal Article2022-04-14No SnippetsZhang X, Wu Z, Ma K.
Show Full Abstract
<h4>Background</h4>The SNCA gene is a critical gene in Parkinson's disease (PD) pathology. Accumulating evidence indicates that SNCA is involved in tumorigenesis; however, the role of SNCA in lung adenocarcinoma (LUAD) remains unclear. This study aimed to explore the potential value of SNCA as a prognostic and diagnostic molecular marker in LUAD.<h4>Methods</h4>In this study, we explored the expression pattern, prognostic value, and promoter methylation status of SNCA in LUAD based on Oncomine, UALCAN, and Kaplan-Meier Plotter. Then, using TIMER, we investigated the correlation between SNCA expression and immune infiltration. And cBioPortal were used to analysis the correlation between SNCA expression and immune checkpoint. The transcriptome data of A549 cells overexpressing SNCA were used to further study the potential immune role of SNCA in LUAD. The effect of SNCA on proliferation of A549 cells were evaluated by CCK-8, EdU and colony formation. Finally, LUAD cell lines treated with 5-aza-dC were used to explore the correlation between increased promoter methylation and downregulated mRNA expression of SNCA.<h4>Results</h4>In general, the expression level of SNCA in LUAD tissue was lower than that in normal tissue, and high expression of SNCA was related to better prognosis. There were significant positive correlations between SNCA expression and immune infiltrations, including CD8+ T cells, macrophages, neutrophils, dendritic cells, B cells, and CD4+ T cells, and immune checkpoints, suggesting that immune infiltration was one of the reasons for the influence of SNCA on prognosis in LUAD. The transcriptome data of A549 cells overexpressing SNCA were further used to screen the relevant immune-related genes regulated by SNCA. Enrichment analysis confirmed that SNCA participates in the PI3K-AKT signaling pathway and other key tumor signaling pathways and regulates the expression of MAPK3, SRC, PLCG1, and SHC1. Cellular proliferation assay showed that SNCA could inhabit the growth of A549 cells via inhibiting activity of PI3K/AKT/ mTOR pathway. Finally, analysis of the methylation level of SNCA promoter showed that the promoter methylation negatively correlated with mRNA level. The expression of SNCA in LUAD cell lines was significantly upregulated by treatment with 5-aza-dC.<h4>Conclusion</h4>High methylation of SNCA promoter in LUAD is one of the reasons for the downregulation of SNCA mRNA level. Given that SNCA could inhibit the proliferation of A549 cells and correlates with immune infiltrates, it may serve as a prognostic biomarker in LUAD.
Also flagged:ferroptosisclear cell renal cell carcinomaccRCCrenal cell carcinomaRCCdeath
Journal Article2022-04-14✓ 4 SnippetsSun Z, Li T, Xiao C, Zou S, Zhang M, Zhang Q, Wang Z, Zhan H, Wang H.
In-Text Gene Mentions
Results)
…A total of 19 differentially expressed FRGs was eventually determined, including 13 downregulated genes (MT1G, ACSF2, CHAC1, ACSL4, AKR1C2, PEBP1, PTGS2, AKR1C1, CBS, GOT1, ACO1, FDFT1, and HMGCR) and 6 upregulated genes (ALOX12, CD44, SLC7A11, ALOX5, HMOX1, and ALOX15B) in ccRCC tissues (Fig. 1A and B).…
Results)
…CHAC1, ACSL4, AKR1C2,PEBP1, PTGS2, AKR1C1, CBS,…
Results)
…CD44, ACO1, AKR1C2,PEBP1, CHAC1, HMGCR, and…
Results)
…FDFT1, HMOX1, ACO1,PEBP1, and HMGCR) with…
Show Full Abstract
<h4>Background</h4>Clear cell renal cell carcinoma (ccRCC) is the most common and lethal renal cell carcinoma (RCC) histological subtype. Ferroptosis is a newly discovered programmed cell death and serves an essential role in tumor occurrence and development. The purpose of this study is to analyze ferroptosis-related gene (FRG) expression profiles and to construct a multi-gene signature for predicting the prognosis of ccRCC patients.<h4>Methods</h4>RNA-sequencing data and clinicopathological data of ccRCC patients were downloaded from The Cancer Genome Atlas (TCGA). Differentially expressed FRGs between ccRCC and normal tissues were identified using 'limma' package in R. GO and KEGG enrichment analyses were conducted to elucidate the biological functions and pathways of differentially expressed FRGs. Consensus clustering was used to investigate the relationship between the expression of FRGs and clinical phenotypes. Univariate and the least absolute shrinkage and selection operator (LASSO) Cox regression analysis were used to screen genes related to prognosis and construct the optimal signature. Then, a nomogram was established to predict individual survival probability by combining clinical features and prognostic signature.<h4>Results</h4>A total of 19 differentially expressed FRGs were identified. Consensus clustering identified two clusters of ccRCC patients with distinguished prognostic. Functional analysis revealed that metabolism-related pathways were enriched, especially lipid metabolism. A 7-gene ferroptosis-related prognostic signature was constructed to stratify the TCGA training cohort into high- and low-risk groups where the prognosis was significantly worse in the high-risk group. The signature was identified as an independent prognostic indicator for ccRCC. These findings were validated in the testing cohort, the entire cohort, and the International Cancer Genome Consortium (ICGC) cohort. We further demonstrated that the signature-based risk score was highly associated with the ccRCC progression. Further stratified survival analysis showed that the high-risk group had a significantly lower overall survival (OS) rate than those in the low-risk group. Moreover, we constructed a nomogram that had a strong ability to forecast the OS of the ccRCC patients.<h4>Conclusions</h4>We constructed a ferroptosis-related prognostic signature, which might provide a reliable prognosis assessment tool for the clinician to guide clinical decision-making and outcomes research.
Also flagged:extracellularcancertumormicrotubuletenascin Chyaluronan
Journal Article2022-04-14No SnippetsYan Y, Chen B, Yin Q, Wang Z, Yang Y, Wan F, Wang Y, Tang M, Xia H, Chen M, Liu J, Wang S, Zhang Q, Wang Y.
Show Full Abstract
Efficient delivery of payload to intracellular targets has been identified as the central principle for nanomedicine development, while the extracellular targets are equally important for cancer treatment. Notably, the contribution of extracellularly distributed nanoparticles to therapeutic outcome is far from being understood. Herein, we develop a pH/light dual-responsive monochromatic ratiometric imaging nanoparticle (MRIN), which functions through sequentially lighting up the intracellular and extracellular fluorescence signals by acidic endocytic pH and near-infrared light. Enabled by MRIN nanotechnology, we accurately quantify the extracellular and intracellular distribution of nanoparticles in several tumor models, which account for 65-80% and 20-35% of total tumor exposure, respectively. Given that the majority of nanoparticles are trapped in extracellular regions, we successfully dissect the contribution of extracellularly distributed nanophotosensitizer to therapeutic efficacy, thereby maximize the treatment outcome. Our study provides key strategies to precisely quantify nanocarrier microdistribtion and engineer multifunctional nanomedicines for efficient theranostics.
Journal Article2022-04-14✓ 3 SnippetsLiang X, Wang J, Liu Y, Wei L, Tian F, Sun J, Han G, Wang Y, Ding C, Guo Z.
In-Text Gene Mentions
Abstract)
…PTGS2, PTGER2 andPTGISgenes were genotyped…
Abstract)
…s2745557, PTGER2-rs2075797 andPTGIS-rs6125671 were all risk…
Abstract)
…s2745557, PTGER2-rs2075797 andPTGIS-rs6125671 were also related…
Show Full Abstract
<h4>Background</h4>The COX/PGE2 pathway is widely involved in the development of tumors and the regulation of tumor immune cells such as T cells, NK cells and DCs. However, little information is available on the single nucleotide polymorphisms (SNPs) of COX/PGE2 pathway-related genes in patients with lung cancer.<h4>Methods</h4>Seven SNPs of the PTGS2, PTGER2 and PTGIS genes were genotyped in a case-control cohort including 600 lung cancer cases and 600 controls using the MassARRAY platform.<h4>Results</h4>The minor alleles of PTGS2-rs4648298, PTGS2-rs2745557, PTGER2-rs2075797 and PTGIS-rs6125671 were all risk alleles that led to a different degree of elevated lung cancer risk (p < 0.001). The rs4648298-TC/CC, rs2745557-GA/AA, rs2075797-CG/GG and rs6125671-TC/CC genotypes were markedly associated with an elevated risk of lung cancer (p < 0.0001). Moreover, genetic model results showed that PTGS2-rs4648298 was correlated with a 4.91-, 6.90- and 4.21-fold increased risk of lung cancer under dominant, recessive and log-additive models, respectively (p < 0.0001). Similarly, PTGS2-rs2745557, PTGER2-rs2075797 and PTGIS-rs6125671 were also related to an elevated risk of the disease under the three genetic models (p < 0.001). In addition, stratification analysis based on smoking status and pathological types showed that these four SNPs were associated with the risk of lung cancer in both smokers and nonsmokers and in all three pathological types, including adenocarcinoma, squamous cell carcinoma, and small cell lung cancer (p < 0.014).<h4>Conclusion</h4>These results contribute to a better understanding of the pathogenesis of lung cancer and provide new clues for the early detection and personalized treatment of the disease.
Also flagged:Colorectal CancerLung Metastasissynthesisdegradationamino acidmetabolism
Journal Article2022-04-14✓ 2 SnippetsZhang J, Du Y, Zhang Y, Xu Y, Fan Y, Li Y.
In-Text Gene Mentions
Introduction)
…Using a combination of 1H NMR and DI-LC-MS/MS, the serum levels of DL-carnitine, PC-aa-C40:3, ethanol, octanoyl-L-carnitine, and methylmalonyl-L-carnitine were found to be related to melanoma progression.5 Yang et al identified 18 metabolites closely related to ovarian cancer, and these biomarker enrichment in fatty acid β-oxidation pathway, phospholipid metabolism pathway, and bile acid metabolism pathway.6 Yu et al analyzed 127 colorectal cancer serum samples and 90 normal serum samples using mass spectrometry, and found serine/threonine kinase 4 (MST1) was down regulated in CRC patients’ samples compared to the control group.7 They further proved that MST1 is a potential marker for distant metastasis of CRC.7 Fan et al found that serum levels of SERPINA1 (alpha-1-antitrypsin, A1AT), SERPINA3 (alpha-1-antichymotrypsin, AACT), and SERPINC1 (antithrombin-3, AT-III) could be good biomarkers to distinguish adenomatous polyps and colorectal carcinomas.8 In conclusion, the identification of serum biomarkers related to cancer progression would benefit the diagnosis and treatment of cancer.…
<h4>Background</h4>Lung metastasis is a common metastasis site of colorectal cancer which largely reduces the quality of life and survival rates of patients. The discovery of potential novel diagnostic biomarkers is very meaningful for the early diagnosis of colorectal cancer with lung metastasis.<h4>Methods</h4>In the present study, the metabonomic profiling of serum samples of lung metastasis mice was analyzed by <sup>1</sup>H-nuclear magnetic resonance (<sup>1</sup>H-NMR). Principal component analysis (PCA), partial least squares discriminant analysis (PLS-DA), and orthogonal partial least squares discriminant analysis (OPLS-DA) were used to elucidate the distinguishing metabolites between different groups, and all achieved excellent separations, which indicated that metastatic mice could be differentiated from control mice based on the metabolic profiles at serum levels. Furthermore, during lung metastasis of colorectal cancer, metabolic phenotypes changed significantly, and some of metabolites were identified.<h4>Results</h4>Among these metabolites, approximately 15 were closely associated with the lung metastasis process. Pathway enrichment analysis results showed deregulation of metabolic pathways participating in the process of lung metastasis, such as synthesis and degradation of ketone bodies pathway, amino acid metabolism pathway and pyruvate metabolism pathway.<h4>Conclusion</h4>The present study demonstrated the metabolic disturbances of serum samples of mice during the lung metastasis process of colorectal cancer and provides potential diagnostic biomarkers for the disease.
Also flagged:myeloid neoplasmsacute leukemiashematological diseasesAMLALLmyeloid neoplasm
Journal Article2022-04-14✓ 1 SnippetGargallo P, Molero M, Bilbao C, Stuckey R, Carrillo-Cruz E, Hermosín L, Pérez-López O, Jiménez-Velasco A, Soria E, Lázaro M, Carbonell P, Yáñez Y, Gómez I, Izquierdo-García M, Valero-García J, Ruiz C, Such E, Calabria I.
In-Text Gene Mentions
Results)
…was detected ( KMT2A-MLLT10).…
Show Full Abstract
A suitable diagnostic classification of myeloid neoplasms and acute leukemias requires testing for a large number of molecular biomarkers. Next-generation sequencing is a technology able to integrate identification of the vast majority of them in a single test. This manuscript includes the design, analytical validation and clinical feasibility evaluation of a molecular diagnostic kit for onco-hematological diseases. It is based on sequencing of the coding regions of 76 genes (seeking single-nucleotide variants, small insertions or deletions and CNVs), as well as the search for fusions in 27 target genes. The kit has also been designed to detect large CNVs throughout the genome by including specific probes and employing a custom bioinformatics approach. The analytical and clinical feasibility validation of the Haematology OncoKitDx panel has been carried out from the sequencing of 170 patient samples from 6 hospitals (in addition to the use of commercial reference samples). The analytical validation showed sensitivity and specificity close to 100% for all the parameters evaluated, with a detection limit of 2% for SNVs and SVs, and 20% for CNVs. Clinically relevant mutations were detected in 94% of all patients. An analysis of the correlation between the genetic risk classification of AML (according to ELN 2017) established by the hospitals and that obtained by the Haematology OncoKitDx panel showed an almost perfect correlation (K = 0.94). Among the AML samples with a molecular diagnosis, established by the centers according to the WHO, the Haematology OncoKitDx analysis showed the same result in 97% of them. The panel was able to adequately differentiate between MPN subtypes and also detected alterations that modified the diagnosis (<i>FIP1L1</i>-<i>PDGFRA</i>). Likewise, the cytogenetic risk derived from the CNV plot generated by the NGS panel correlated substantially with the results of the conventional karyotype (K = 0.71) among MDS samples. In addition, the panel detected the main biomarkers of prognostic value among patients with ALL. This validated solution enables a reliable analysis of a large number of molecular biomarkers from a DNA sample in a single assay.
Also flagged:platinumcisplatintumortumorsascorbic acidglutathione
Journal Article2022-04-14No SnippetsQu Y, Wang Z, Sun M, Zhao T, Zhu X, Deng X, Zhang M, Xu Y, Liu H.
Show Full Abstract
Although polymeric platinum(IV) (Pt(IV)) prodrugs can reduce the side effects of cisplatin, the efficacy of the prodrug is still limited by its non-targeted distribution, poor penetration in deep tumor tissue, and low cytotoxicity in tumor cells. To improve the clinical potential of polymeric prodrug micelle, we synthesized amphiphilic polymeric Pt(IV) with high Pt content (22.5%), then developed a theranostic nanocomplex by integrating polymeric Pt(IV) with superparamagnetic Mn<sub>0.6</sub>Zn<sub>0.4</sub>Fe<sub>2</sub>O<sub>4</sub> via simple self-assembly. Due to the high content of Mn<sub>0.6</sub>Zn<sub>0.4</sub>Fe<sub>2</sub>O<sub>4</sub> (41.7% <i>w</i>/<i>w</i>), the theranostic nanocomplex showed high saturation magnetization (103.1 emu g<sup>-1</sup>) and excellent magnetocaloric effect (404 W g<sup>-1</sup>), both of them indicating its advantages in efficient magnetic targeting (MT), magnetic hyperthermia (MH), and magnetic resonance imaging (MRI). In vitro, in combination with MH, the theranostic nanocomplex showed as high cytotoxicity as cisplatin because of a significant increase in platinum of cellular uptake. In vivo, the accumulation of theranostic nanocomplex in tumors was increased by MT and confirmed by MRI. Furthermore, MH improved penetration of theranostic nanocomplex in tumors as expanding blackened area in tumors was observed by MRI. Based on these properties, the theranostic nanocomplex, under the assistance of MT and MH, showed the highest tumor growth inhibition rate (88.38%) after different treatments, while the body weight of mice increased slightly, indicating low side effects compared to those of cisplatin. The study provided an advanced theranostic nanocomplex with low toxicity and high efficacy, indicating a great clinical potential of polymeric Pt(IV).
Also flagged:Cyclin-Dependent KinaseofnucleosomeorganizationorganellesCyclin-dependent kinases
Journal Article2022-04-14No SnippetsBencivenga D, Stampone E, Vastante A, Barahmeh M, Della Ragione F, Borriello A.
Show Full Abstract
It is now definitively established that a large part of the human genome is transcribed. However, only a scarce percentage of the transcriptome (about 1.2%) consists of RNAs that are translated into proteins, while the large majority of transcripts include a variety of RNA families with different dimensions and functions. Within this heterogeneous RNA world, a significant fraction consists of sequences with a length of more than 200 bases that form the so-called long non-coding RNA family. The functions of long non-coding RNAs range from the regulation of gene transcription to the changes in DNA topology and nucleosome modification and structural organization, to paraspeckle formation and cellular organelles maturation. This review is focused on the role of long non-coding RNAs as regulators of cyclin-dependent kinase inhibitors' (CDKIs) levels and activities. Cyclin-dependent kinases are enzymes necessary for the tuned progression of the cell division cycle. The control of their activity takes place at various levels. Among these, interaction with CDKIs is a vital mechanism. Through CDKI modulation, long non-coding RNAs implement control over cellular physiology and are associated with numerous pathologies. However, although there are robust data in the literature, the role of long non-coding RNAs in the modulation of CDKIs appears to still be underestimated, as well as their importance in cell proliferation control.
Also flagged:Agingheterochronic parabiosischronic diseasesC-reactive proteinCRPp16 INK4a
Journal Article2022-04-14No SnippetsKassab A, Rizk N, Prakash S.
Show Full Abstract
Advances in aging studies brought about by heterochronic parabiosis suggest that agingmight be a reversable process that is affected by changes in the systemic milieu of organs andcells. Given the broadness of such a systemic approach, research to date has mainly questioned theinvolvement of "shared organs" versus "circulating factors". However, in the absence of a clearunderstanding of the chronological development of aging and a unified platform to evaluate thesuccesses claimed by specific rejuvenation methods, current literature on this topic remains scattered.Herein, aging is assessed from an engineering standpoint to isolate possible aging potentiators via ajuxtaposition between biological and mechanical systems. Such a simplification provides a generalframework for future research in the field and examines the involvement of various factors in aging.Based on this simplified overview, the kidney as a filtration organ is clearly implicated, for the firsttime, with the aging phenomenon, necessitating a re-evaluation of current rejuvenation studies tountangle the extent of its involvement and its possible role as a potentiator in aging. Based on thesefindings, the review concludes with potential translatable and long-term therapeutics for aging whileoffering a critical view of rejuvenation methods proposed to date.
Also flagged:Carbonic AnhydrasesCarbonic Anhydrasecarbonic anhydrase related proteinspigmentationmetalloenzymescarbon dioxide
Journal Article2022-04-14No SnippetsAspatwar A, Syrjänen L, Parkkila S.
Show Full Abstract
During recent decades, zebrafish (<i>Danio rerio</i>) have become one of the most important model organisms in which to study different physiological and biological phenomena. The research field of carbonic anhydrases (CAs) and carbonic anhydrase related proteins (CARPs) is not an exception to this. The best-known function of CAs is the regulation of acid-base balance. However, studies performed with zebrafish, among others, have revealed important roles for these proteins in many other physiological processes, some of which had not yet been predicted in the light of previous studies and suggestions. Examples include roles in zebrafish pigmentation as well as motor coordination. Disruption of the function of these proteins may generate lethal outcomes. In this review, we summarize the current knowledge of CA-related studies performed in zebrafish from 1993-2021 that was obtained from PubMed search.
Also flagged:Diabetic CardiomyopathyDiabetes mellitusmitochondrialfatty acidmetabolismphosphorylation
Journal Article2022-04-14✓ 1 SnippetWang D, Liu K, Zhong J, Li X, Zhang J, Wang G, Li N, Li T, Davis H, El-Gaby I, Hao G, Ye H, Li D.
In-Text Gene Mentions
Results)
…groups: Hist2h2aa2 ,histone cluster 2 H2A family member A2cluster 2 H2A…
Show Full Abstract
Diabetes mellitus (DM) is associated with mitochondrial dysfunction and oxidative stress that can lead to diabetic cardiomyopathy (DCM), which can often remain undetected until late stages of the disease. However, myocardial injury occurs before the onset of measurable cardiac dysfunction, although its molecular correlates are poorly understood. In this study, we made a DM rat induced by a high-fat diet combined with low and high doses of streptozotocin (STZ) to emulate pre and early DCM. RNA-sequencing analysis of ventricular tissue revealed a differential transcriptome profile and abnormal activation of pathways involved in fatty acid metabolism, oxidative phosphorylation, cardiac structure and function, insulin resistance, calcium signalling, apoptosis, and TNF signalling. Moreover, using high glucose-treated human induced pluripotent stem cell-derived cardiomyocytes (iPSC-CM), we recapitulated the cardiac cellular phenotype of DM and identified several molecular correlates that may promote the development of DCM. In conclusion, we have developed an experimental framework to target pathways underlying the progression of DCM.
<i>Pneumocystis</i> is a life-threatening fungal pathogen that frequently causes fatal pneumonia (PCP) in immunocompromised individuals. Recently, B cells have been reported to play a crucial role in the pathogenesis of PCP through producing antibodies and activating CD4<sup>+</sup> T cell response. Exosomes are nanoscale small extracellular vesicles abundant with protein cargo and can mediate immune response during infectious disease. In this study, using tandem mass tag-based quantitative proteomics coupled with bioinformatic analysis, we attempted to characterize exosomes derived from B lymphocytes in response to PCP. Several proteins were verified by parallel reaction monitoring (PRM) analysis. Also, the effects of B cell exosomes on CD4<sup>+</sup> T cell response and phagocytic function of macrophages were clarified. Briefly, 1701 proteins were identified from B cell exosomes, and the majority of them were reported in Vesiclepedia. A total of 51 differentially expressed proteins of B cell exosomes were found in response to PCP. They were mainly associated with immune response and transcription regulation. PRM analysis confirmed the significantly changed levels of histone H1.3, vimentin, and tyrosine-protein phosphatase nonreceptor type 6 (PTPN6). Moreover, a functional study revealed the proinflammatory profile of B cell exosomes on CD4<sup>+</sup> T cell response in PCP. Taken together, our results suggest the involvement of exosomes derived from B cells in cell-to-cell communication, providing new information on the function of B cells in response to PCP.
Also flagged:Myelinationmyelincognitive impairmentcognitive impairment diseasecognitive diseaseaxons
Journal Article2022-04-14No SnippetsGao ZK, Shen XY, Han Y, Guo YS, Yuan M, Bi X.
Show Full Abstract
Myelination is regulated by various glial cells in the central nervous system (CNS), including oligodendrocytes (OLs), microglia, and astrocytes. Myelination of the CNS requires the generation of functionally mature OLs from OPCs. OLs are the myelin-forming cells in the CNS. Microglia play both beneficial and detrimental roles during myelin damage and repair. Astrocyte is responsible for myelin formation and regeneration by direct interaction with oligodendrocyte lineage cells. These glial cells are influenced by experience-dependent activities such as environmental enrichment (EE). To date, there are few studies that have investigated the association between EE and glial cells. EE with a complex combination of sensorimotor, cognitive, and social stimulation has a significant effect on cognitive impairment and brain plasticity. Hence, one mechanism through EE improving cognitive function may rely on the mutual effect of EE and glial cells. The purpose of this paper is to review recent research into the efficacy of EE for myelination and glial cells at cellular and molecular levels and offers critical insights for future research directions of EE and the treatment of EE in cognitive impairment disease.
Also flagged:GlycosylationHead and Neck Squamous Cell CarcinomaPD-L1HNSCCmalignant tumorsgene expression
Journal Article2022-04-14No SnippetsChen L, Ling Y, Yang H.
Show Full Abstract
<h4>Background</h4>Head and neck squamous cell carcinoma (HNSCC) is one of the worst and most common malignant tumors. This study is aimed at studying the complex interaction between glycosylation-related genes and HNSCC.<h4>Methods</h4>The Cancer Genome Atlas (TCGA) contains gene expression profile data of HNSCC and normal tissues, as well as patient survival and clinical data. Combining five glycosylation-related gene sets, bioinformatics was used to analyze the expression of glycosylation-related genes in TCGA-HNSCC datasets and to identify prognostic risk markers, analyze their prognostic value, and the influence of glycosylation-related genes on the tumor immune microenvironment.<h4>Results</h4>Gene expression profiles and corresponding clinical information of 499 cases of HNSCC and 44 cases of adjacent tissues were obtained. Using 11 glycosylation-related genes to construct a prognostic risk score, the Kaplan-Meier curve analysis found that the overall survival of the high-risk group was significantly different than that of the low-risk group (<i>P</i> < 0.001). ROC analysis was used to evaluate the prognostic efficacy of prognostic risk markers, and the results showed that the prognostic risk markers had good efficacy in predicting the prognosis of patients. We also found that there is a correlation between glycosylation-related genes, PD-L1, and immunocyte infiltration, and there is a dynamic effect between the change in the copy number of glycosylation-related genes and the number of tumor-infiltrating immune cells.<h4>Conclusions</h4>Our research shows that glycosylation-related prognostic risk markers may be independent risk factors for the prognosis of HNSCC. We have found that there may be subtle links between glycosylation-related genes, PD-L1, and immunocyte infiltration, which has certain significance for exploring the occurrence and development of HNSCC and exploring the research of targeted therapy.
Also flagged:immune responseCOVID-19deathinflammatoryacute respiratory distress syndromeARDS
Journal Article2022-04-14No SnippetsTorres M, Casado G, Vigón L, Rodríguez-Mora S, Mateos E, Ramos-Martín F, López-Wolf D, Sanz-Moreno J, Ryan-Murua P, Taboada-Martínez ML, López-Huertas MR, Cervero M, Coiras M, Multidisciplinary Group of Study of COVID-19 (MGS-COVID), Contributing members of the Multidisciplinary Group of Study of COVID-19 (in alphabetical order).
Show Full Abstract
Main cause of severe illness and death in COVID-19 patients appears to be an excessive but ineffectual inflammatory immune response that may cause severe acute respiratory distress syndrome (ARDS). Vitamin D may favour an anti-inflammatory environment and improve cytotoxic response against some infectious diseases. A multicenter, single-blind, prospective, randomized clinical trial was approved in patients with COVID-19 pneumonia and levels of 25-hydroxyvitamin D (25(OH)D) of 14.8 ng/ml (SD: 6.18) to test antiviral efficacy, tolerance and safety of 10,000 IU/day of cholecalciferol (vitamin D<sub>3</sub>) for 14 days, in comparison with 2000 IU/day. After supplementation, mean serum 25(OH)D levels increased to 19 ng/ml on average in 2000 IU/day versus 29 ng/ml in 10,000 IU/day group (p < 0.0001). Although levels of inflammatory cytokines were not modified by treatment with 10,000 IU/day, there was an increase of anti-inflammatory cytokine IL-10 and higher levels of CD4+ T cells, with predominance of T central memory subpopulation. Cytotoxic response against pseudotyped SARS-CoV-2 infected cells was increased more than 4-fold in patients who received 10,000 IU/day. Moreover, levels of IFNγ were significantly higher in this group. Beneficial effect of supplementation with 10,000 IU/day was also observed in participants who developed ARDS and stayed at the hospital for 8.0 days, whereas those who received 2000 IU/day stayed for 29.2 days (p = 0.0381). Administration of high doses of vitamin D<sub>3</sub> as adjuvant of the standard care treatment during hospitalization for COVID-19 may improve the inflammatory environment and cytotoxic response against pseudotyped SARS-CoV-2 infected cells, shortening the hospital stay and, possibly, improving the prognosis.
Also flagged:DepressionDepressive disorderspsychiatricmajor depressive disordermonoamineglutamate
Journal Article2022-04-14✓ 1 SnippetKhoodoruth MAS, Estudillo-Guerra MA, Pacheco-Barrios K, Nyundo A, Chapa-Koloffon G, Ouanes S.
In-Text Gene Mentions
Introduction)
…polymorphisms in the5-HTTpromoter region (5HTTLPR)…
Show Full Abstract
Depressive disorders are among the most common psychiatric conditions and contribute to significant morbidity. Even though the use of antidepressants revolutionized the management of depression and had a tremendous positive impact on the patient's outcome, a significant proportion of patients with major depressive disorder (MDD) show no or partial or response even with adequate treatment. Given the limitations of the prevailing monoamine hypothesis-based pharmacotherapy, glutamate and glutamatergic related pathways may offer an alternative and a complementary option for designing novel intervention strategies. Over the past few decades, there has been a growing interest in understanding the neurobiological underpinnings of glutamatergic dysfunctions in the pathogenesis of depressive disorders and the development of new pharmacological and non-pharmacological treatment options. There is a growing body of evidence for the efficacy of neuromodulation techniques, including transcranial magnetic stimulation, transcutaneous direct current stimulation, transcranial alternating current stimulation, and photo-biomodulation on improving connectivity and neuroplasticity associated with depression. This review attempts to revisit the role of glutamatergic neurotransmission in the etiopathogenesis of depressive disorders and review the current neuroimaging, neurophysiological and clinical evidence of these neuromodulation techniques in the pathophysiology and treatment of depression.
Also flagged:LipidLipid dropletsorganellescholesteryl esterstriacylglycerolsageing
Journal Article2022-04-14✓ 2 SnippetsIslimye E, Girard V, Gould AP.
In-Text Gene Mentions
Introduction)
…Additionally, mutations in Huntingtin (Htt), a scaffold protein connecting the selective autophagy receptor p62 to LD cargo disrupt LD macroautophagy (lipophagy) and lead to Huntington’s disease (Rui et al., 2015).…
Introduction)
…mutations in Huntingtin (Htt), a scaffold protein…
Show Full Abstract
Lipid droplets are highly dynamic intracellular organelles that store neutral lipids such as cholesteryl esters and triacylglycerols. They have recently emerged as key stress response components in many different cell types. Lipid droplets in the nervous system are mostly observed <i>in vivo</i> in glia, ependymal cells and microglia. They tend to become more numerous in these cell types and can also form in neurons as a consequence of ageing or stresses involving redox imbalance and lipotoxicity. Abundant lipid droplets are also a characteristic feature of several neurodegenerative diseases. In this minireview, we take a cell-type perspective on recent advances in our understanding of lipid droplet metabolism in glia, neurons and neural stem cells during health and disease. We highlight that a given lipid droplet subfunction, such as triacylglycerol lipolysis, can be physiologically beneficial or harmful to the functions of the nervous system depending upon cellular context. The mechanistic understanding of context-dependent lipid droplet functions in the nervous system is progressing apace, aided by new technologies for probing the lipid droplet proteome and lipidome with single-cell type precision.
Also flagged:Dementia Syndromeautosomal dominant inherited spinocerebellar ataxia type 48SCA48ataxicmovement disordercognitive affective syndrome
Journal Article2022-04-14✓ 2 SnippetsReis MC, Patrun J, Ackl N, Winter P, Scheifele M, Danek A, Nolte D.
In-Text Gene Mentions
Methods)
…Fragment-length analysis at the corresponding loci for FTD/amyotrophic lateral sclerosis (C9orf72), HD (HTT), and SCA17 (TBP) was performed by polymerase chain reaction (PCR) using a specific fluorescent-labeled primer in combination with an unlabeled reverse primer.…
Methods)
…), HD (HTT), and SCA17…
Show Full Abstract
Heterozygous pathogenic variants in the STIP1 homologous and U-box containing protein 1 (<i>STUB1</i>) gene have been identified as causes of autosomal dominant inherited spinocerebellar ataxia type 48 (SCA48). SCA48 is characterized by an ataxic movement disorder that is often, but not always, accompanied by a cognitive affective syndrome. We report a severe early onset dementia syndrome that mimics frontotemporal dementia and is caused by the intronic splice donor variant c.524+1G>A in <i>STUB1</i>. Impaired splicing was demonstrated by RNA analysis and in minigene assays of mutated and wild-type constructs of <i>STUB1</i>. The most striking consequence of this splicing impairment was retention of intron 3 in <i>STUB1</i>, which led to an in-frame insertion of 63 amino acids (aa) (p.Arg175_Glu176ins63) into the highly conserved coiled-coil domain of its encoded protein, C-terminus of HSP70-interacting protein (CHIP). To a lesser extent, activation of two cryptic splice sites in intron 3 was observed. The almost exclusively used one, c.524+86, was not predicted by <i>in silico</i> programs. Variant c.524+86 caused a frameshift (p.Arg175fs*93) that resulted in a truncated protein and presumably impairs the C-terminal U-box of CHIP, which normally functions as an E3 ubiquitin ligase. The cryptic splice site c.524+99 was rarely used and led to an in-frame insertion of 33 aa (p.Arg175_Glu176ins33) that resulted in disruption of the coiled-coil domain, as has been previously postulated for complete intron 3 retention. We additionally detected repeat expansions in the range of reduced penetrance in the TATA box-binding protein (<i>TBP</i>) gene by excluding other genes associated with dementia syndromes. The repeat expansion was heterozygous in one patient but compound heterozygous in the more severely affected patient. Therefore, we concluded that the observed severe dementia syndrome has a digenic background, making <i>STUB1</i> and <i>TBP</i> important candidate genes responsible for early onset dementia syndromes.
Rodents have been the dominant animal models in neurobiology and neurological disease research over the past 60 years. The prevalent use of rats and mice in neuroscience research has been driven by several key attributes including their organ physiology being more similar to humans, the availability of a broad variety of behavioral tests and genetic tools, and widely accessible reagents. However, despite the many advances in understanding neurobiology that have been achieved using rodent models, there remain key limitations in the questions that can be addressed in these and other mammalian models. In particular, <i>in vivo</i> imaging in mammals at the cell-resolution level remains technically difficult and demands large investments in time and cost. The simpler nervous systems of many non-mammalian models allow for precise mapping of circuits and even the whole brain with impressive subcellular resolution. The types of non-mammalian neuroscience models available spans vertebrates and non-vertebrates, so that an appropriate model for most cell biological questions in neurodegenerative disease likely exists. A push to diversify the models used in neuroscience research could help address current gaps in knowledge, complement existing rodent-based bodies of work, and bring new insight into our understanding of human disease. Moreover, there are inherent aspects of many non-mammalian models such as lifespan and tissue transparency that can make them specifically advantageous for neuroscience studies. Crispr/Cas9 gene editing and decreased cost of genome sequencing combined with advances in optical microscopy enhances the utility of new animal models to address specific questions. This review seeks to synthesize current knowledge of established and emerging non-mammalian model organisms with advances in cellular-resolution <i>in vivo</i> imaging techniques to suggest new approaches to understand neurodegeneration and neurobiological processes. We will summarize current tools and <i>in vivo</i> imaging approaches at the single cell scale that could help lead to increased consideration of non-mammalian models in neuroscience research.
Also flagged:breast carcinomacancerBreast cancerlung cancerhormone receptorHER2
Journal Article2022-04-14✓ 1 SnippetMehmood S, Faheem M, Ismail H, Farhat SM, Ali M, Younis S, Asghar MN.
In-Text Gene Mentions
S I O 001029)
…Some proteins suggest their active role in tumor suppression as they are subregulated during cancer invasion including Maspin, DCC, and DSG3.…
Show Full Abstract
In recent times, enormous progress has been made in improving the diagnosis and therapeutic strategies for breast carcinoma, yet it remains the most prevalent cancer and second highest contributor to cancer-related deaths in women. Breast cancer (BC) affects one in eight females globally. In 2018 alone, 1.4 million cases were identified worldwide in postmenopausal women and 645,000 cases in premenopausal females, and this burden is constantly increasing. This shows that still a lot of efforts are required to discover therapeutic remedies for this disease. One of the major clinical complications associated with the treatment of breast carcinoma is the development of therapeutic resistance. Multidrug resistance (MDR) and consequent relapse on therapy are prevalent issues related to breast carcinoma; it is due to our incomplete understanding of the molecular mechanisms of breast carcinoma disease. Therefore, elucidating the molecular mechanisms involved in drug resistance is critical. For management of breast carcinoma, the treatment decision not only depends on the assessment of prognosis factors but also on the evaluation of pathological and clinical factors. Integrated data assessments of these multiple factors of breast carcinoma through multiomics can provide significant insight and hope for making therapeutic decisions. This omics approach is particularly helpful since it identifies the biomarkers of disease progression and treatment progress by collective characterization and quantification of pools of biological molecules within and among the cancerous cells. The scrupulous understanding of cancer and its treatment at the molecular level led to the concept of a personalized approach, which is one of the most significant advancements in modern oncology. Likewise, there are certain genetic and non-genetic tests available for BC which can help in personalized therapy. Genetically inherited risks can be screened for personal predisposition to BC, and genetic changes or variations (mutations) can also be identified to decide on the best treatment. Ultimately, further understanding of BC at the molecular level (multiomics) will define more precise choices in personalized medicine. In this review, we have summarized therapeutic resistance associated with BC and the techniques used for its management.
To assess the burden of type 2 diabetes (T2D) and its genetic profile in endogamous populations of India given the paucity of data, we aimed to determine the prevalence of T2D and estimate its heritability using family-based cohorts from three distinct Endogamous Ethnic Groups (EEGs) representing Northern (Rajasthan [Agarwals: AG]) and Southern (Tamil Nadu [Chettiars: CH] and Andhra Pradesh [Reddys: RE]) states of India. For comparison, family-based data collected previously from another North Indian Punjabi Sikh (SI) EEG was used. In addition, we examined various T2D-related cardiometabolic traits and determined their heritabilities. These studies were conducted as part of the Indian Diabetes Genetic Studies in collaboration with US (INDIGENIUS) Consortium. The pedigree, demographic, phenotypic, covariate data and samples were collected from the CH, AG, and RE EEGs. The status of T2D was defined by ADA guidelines (fasting glucose ≥ 126 mg/dl or HbA1c ≥ 6.5% and/or use of diabetes medication/history). The prevalence of T2D in CH (N = 517, families = 21, mean age = 47y, mean BMI = 27), AG (N = 530, Families = 25, mean age = 43y, mean BMI = 27), and RE (N = 500, Families = 22, mean age = 46y, mean BMI = 27) was found to be 33%, 37%, and 36%, respectively, Also, the study participants from these EEGs were found to be at increased cardiometabolic risk (e.g., obesity and prediabetes). Similar characteristics for the SI EEG (N = 1,260, Families = 324, Age = 51y, BMI = 27, T2D = 75%) were obtained previously. We used the variance components approach to carry out genetic analyses after adjusting for covariate effects. The heritability (h<sup>2</sup>) estimates of T2D in the CH, RE, SI, and AG were found to be 30%, 46%, 54%, and 82% respectively, and statistically significant (P ≤ 0.05). Other T2D related traits (e.g., BMI, lipids, blood pressure) in AG, CH, and RE EEGs exhibited strong additive genetic influences (h<sup>2</sup> range: 17% [triglycerides/AG and hs-CRP/RE] - 86% [glucose/non-T2D/AG]). Our findings highlight the high burden of T2D in Indian EEGs with significant and differential additive genetic influences on T2D and related traits.
Also flagged:glucose-cellSemaphorinNeuropilinEphrin
Journal Article2022-04-14No SnippetsWaters BJ, Blum B.
Show Full Abstract
The islets of Langerhans, responsible for regulating blood glucose in vertebrates, are clusters of endocrine cells distributed throughout the exocrine pancreas. The spatial architecture of the different cell types within the islets controls cell-cell communication and impacts their ability to collectively regulate glucose. Islets rely on a range of chemotactic and adhesive cues to establish and manage intercellular relationships. Growing evidence indicates that axon guidance molecules such as Slit-Robo, Semaphorin-Neuropilin, Ephrin-Eph, and Netrins, influence endocrine progenitors' cell migration to establish correct architecture during islet morphogenesis, as well as directly regulating physical cell-cell communication in the mature islet to coordinate hormone secretion. In this mini-review, we discuss what is known and not yet known about how axon guidance molecules contribute to islet morphogenesis and function.
Also flagged:membranous nephropathyglomerular diseasesglomerulonephritisGNnephrotic syndromePLA2R
Journal Article2022-04-14✓ 4 SnippetsMuruve DA, Debiec H, Dillon ST, Gu X, Plaisier E, Can H, Otu HH, Libermann TA, Ronco P.
In-Text Gene Mentions
Results)
…Highly discriminatory proteins (Tables 2 and 3, Supplementary Tables S6, S7, S10, and S11) identified in the 70-protein MCD signature included members of the Serpin family (SERPINA10, SERPINA4, SERPINC1, SERPINF2, SERPINF1) that are decreased in MCD compared with MN and healthy controls.…
Discussion)
…MN was also associated with greater alterations in proteins of the coagulation pathway compared with MCD, including SERPINC1 (antithrombin III), SERPINA10, SERPINF2, F2 (prothrombin), and F10 (factor X), again consistent with the increased risk of thrombotic events in patients with MN.30…
<h4>Introduction</h4>Minimal change disease (MCD) and membranous nephropathy (MN) are glomerular diseases (glomerulonephritis [GN]) that present with the nephrotic syndrome. Although circulating PLA2R antibodies have been validated as a biomarker for MN, the diagnosis of MCD and PLA2R-negative MN still relies on the results of kidney biopsy or empirical corticosteroids in children. We aimed to identify serum protein biomarker signatures associated with MCD and MN pathogenesis using aptamer-based proteomics.<h4>Methods</h4>Quantitative SOMAscan proteomics was applied to the serum of adult patients with MCD (<i>n =</i> 15) and MN (<i>n =</i> 37) and healthy controls (<i>n =</i> 20). Associations between the 1305 proteins detected with SOMAscan were assessed using multiple statistical tests, expression pattern analysis, and systems biology analysis.<h4>Results</h4>A total of 208 and 244 proteins were identified that differentiated MCD and MN, respectively, with high statistical significance from the healthy controls (Benjamin-Hochberg [BH] <i>P</i> < 0.0001). There were 157 proteins that discriminated MN from MCD (BH <i>P</i> < 0.05). In MCD, 65 proteins were differentially expressed as compared with MN and healthy controls. When compared with MCD and healthy controls, 44 discriminatory proteins were specifically linked to MN. Systems biology analysis of these signatures identified cell death and inflammation as key pathways differentiating MN from MCD and healthy controls. Dysregulation of fatty acid metabolism pathways was confirmed in both MN and MCD as compared with the healthy subjects.<h4>Conclusion</h4>SOMAscan represents a promising proteomic platform for biomarker development in GN. Validation of a greater number of discovery biomarkers in larger patient cohorts is needed before these data can be translated for clinical care.
Also flagged:methylationmethylated cytosinescytosinesgene expressionfertilizationhistone
Journal Article2022-04-14✓ 2 SnippetsBraz CU, Taylor T, Namous H, Townsend J, Crenshaw T, Khatib H.
In-Text Gene Mentions
Results)
…CTNNA3, CAP2, COL19A1,LRRIQ3, and CDH12…
Results)
…( DIRAS3, CTNNA3,LRRIQ3, DLG2, LPAR1, AXDND1,…
Show Full Abstract
Transgenerational epigenetic inheritance (TEI) requires transmission of environmentally induced epigenetic changes and associated phenotypes to subsequent generations without continued exposure to the environmental factor that originated the change. TEI is well-established in plants and <i>Caenorhabditis elegans</i>; however, occurrence in mammals is debated and poorly understood. Here, we examined whether paternal diet from weaning to puberty-induced changes in sperm DNA methylation that were transmitted to subsequent generations. Over 100 methylated cytosines, environmentally altered in the F0 generation, were inherited by the F1 and F2 generations. Furthermore, the F0 paternal diet was associated with growth and male fertility phenotypes in subsequent generations. Differentially methylated cytosines were correlated with gene expression. Our results demonstrate that some sperm methylation sites may escape DNA methylation erasure and are transmitted to subsequent generations despite the 2 waves of epigenetic programming: in primordial germ cells and in embryos after fertilization. These results advance our understanding of the complex relationships between nature and nurture.
bioRxiv2022-04-14Preprint (No Snippets API)Tsujino T, Takai T, Hinohara K, Gui F, Tsutsumi T, Bai X, Miao C, Feng C, Gui B, Sztupinszki Z, Simoneau A, Xie N, Fazli L, Dong X, Azuma H, Choudhury AD, Mouw KW, Szallasi Z, Zou L, Kibel AS, Jia L.
Show Full Abstract
<h4>ABSTRACT</h4> Prostate cancer (PCa) harboring BRCA1/2 mutations is often exquisitely sensitive to PARP inhibition. However, genomic alterations in other DNA damage response genes have not been consistently predictive of clinical response to PARP inhibitors (PARPis). Here, we perform genome-wide CRISPR-Cas9 knockout screens in BRCA1/2-proficient PCa cell lines and identify novel genes whose loss has a profound impact on PARPi sensitivity and resistance. Specifically, MMS22L deletion, frequently observed (up to 14%) in PCa, renders cells hypersensitive to PARPis by disrupting RAD51 loading required for homologous recombination repair, although this response is TP53-dependent. Unexpectedly, loss of CHEK2 confers resistance rather than sensitivity to PARPis in PCa cells through increased expression of BRCA2, a target of CHEK2-TP53-E2F7-mediated transcriptional repression. Combined PARP and ATR inhibition overcomes PARPi resistance caused by CHEK2 loss. Our findings may inform the use of PARPis beyond BRCA1/2-deficient tumors and support reevaluation of currently used biomarkers for PARPi treatment in PCa.
bioRxiv2022-04-14Preprint (No Snippets API)Troike KM, Silver DJ, Ghosh PK, Mulkearns-Hubert EE, Hubert CG, Connor JR, Fox PL, Kristensen BW, Lathia JD.
Show Full Abstract
<h4>Background</h4> Glioblastoma (GBM) tumor cells modulate expression of iron-associated genes to enhance iron uptake from the surrounding microenvironment, driving proliferation and tumor growth. The homeostatic iron regulator ( HFE ) gene, encoding the iron sensing HFE protein, is upregulated in GBM and correlates with poor survival outcomes. However, the molecular mechanisms underlying these observations remain unclear. Identification of pathways for targeting iron dependence in GBM tumors is therefore a critical area of investigation. <h4>Methods</h4> We interrogated the impact of cell-intrinsic Hfe expression on proliferation and tumor growth through genetic loss and gain of function approaches in syngeneic mouse glioma models. We determined the expression of iron-associated genes and their relationship with survival in GBM using public datasets and identified differentially expressed pathways in Hfe knockdown cells through Nanostring transcriptional profiling. <h4>Results</h4> Loss of Hfe induced apoptotic cell death in vitro and inhibited tumor growth in vivo while overexpression of Hfe accelerated both proliferation and tumor growth. Analysis of iron gene signatures in Hfe knockdown cells revealed alterations in the expression of several iron-associated genes, suggesting global disruption of intracellular iron homeostasis. Analyzing differentially expressed pathways further identified oxidative stress as the top pathway upregulated with Hfe loss. Enhanced 55 Fe uptake and generation of reactive oxygen species (ROS) were found with Hfe knockdown, implicating toxic iron overload resulting in apoptotic cell death. <h4>Conclusions</h4> Collectively, these findings identify a novel role for HFE in regulating iron homeostasis in GBM tumors and provide a potential avenue for future therapeutic development. <h4>Key Points</h4> HFE is an iron sensor that is upregulated in GBM and negatively impacts survival. HFE overexpression drives proliferation and tumor growth in vivo . Loss of HFE increases production of reactive oxygen species and induces apoptosis, extending survival in vivo . <h4>Importance of Study</h4> Dysregulation of iron metabolism is an important feature of GBM contributing to tumor growth and negatively impacting survival. The identification of key iron regulators controlling this process is therefore important for therapeutic targeting. We identify HFE as an important regulator of iron homeostasis in GBM and suggest a role for sexual dimorphism in HFE-mediated tumor iron regulation that ultimately results in differential survival outcomes. Our findings demonstrate that HFE drives tumor cell proliferation and survival in GBM and may be a viable target for modulating tumor iron flux and inducing apoptosis in tumor cells.
<b><i>Aim:</i></b> To evaluate the effectiveness of tele-ophthalmology (TO) versus face-to-face screening for diabetic retinopathy (DR) in diabetes care centers (DCC) across India. <b><i>Methods:</i></b> This is an observational, multicenter, retrospective, cross-sectional study of DR screening in individuals with diabetes performed across 35 branches of a chain of DCC in 20 cities in India over 1 year. In 30 DCC, DR screening was performed by TO, where retinal images obtained using Fundus on Phone camera were uploaded through the telemedicine network for centralized DR grading by eight retina specialists. In five DCC, DR screening was performed by fundus examination (FE) by the same retina specialists. The rate of detection of sight-threatening DR (STDR) (defined as the presence of proliferative DR and/or diabetic macular edema) through the two modes was compared. <b><i>Results:</i></b> A total of 58,612 individuals were screened for DR from January 1, 2018 to December 31, 2018: 25,316 by TO and 33,296 by FE. The mean age and mean duration of diabetes of the individuals with diabetes screened by TO was 55.8 ± 11.2 years and 9.5 ± 7.3 years; and in individuals screened by FE, it was 57.5 ± 11.6 years and 11.5 ± 8.0 years respectively. The mean glycated hemoglobin was 8.8% ± 2.1% and 8.5% ± 1.9% in the two groups, respectively. Any DR was detected in 31.7% (95% confidence interval [CI]: 31.0-32.3) by tele-screening and in 38.5% (95% CI: 37.9-39.0) by FE, whereas STDR was detected in 7.3% (95% CI: 7.0-7.7) by TO and in 10.5% (95% CI: 10.2-10.9) by FE. Overall, 11.4% individuals with diabetes in the TO group, including 4.1% with ungradable images, were advised referral to retina specialists for further management. <b><i>Conclusion:</i></b> Screening for DR at DCC using TO is feasible and effective for STDR detection in India and may be adopted throughout India.
Arthropods host a range of sex-ratio-distorting selfish elements, including diverse maternally inherited endosymbionts that solely kill infected males. Male-killing heritable microbes are common, reach high frequency, but until recently have been poorly understood in terms of the host-microbe interaction. Additionally, while male killing should generate strong selection for host resistance, evidence of this has been scant. The interface of the microbe with host sex determination is integral to the understanding of how death is sex limited and how hosts can evolve evasion of male killing. We first review current knowledge of the mechanisms diverse endosymbionts use to induce male-specific death. We then examine recent evidence that these agents do produce intense selection for host nuclear suppressor elements. We argue, from our understanding of male-killing mechanisms, that suppression will commonly involve evolution of the host sex determination pathways and that the host's response to male-killing microbes thus represents an unrecognized driver of the diversity of arthropod sex determination. Further work is required to identify the genes and mechanisms responsible for male-killing suppression, which will both determine the components of sex determination (or other) systems associated with suppressor evolution, and allow insight into the mechanism of male killing itself.
Also flagged:Butyratep53mitosiscolorectal cancergene expressionButyrates
Journal Article2022-04-13✓ 5 SnippetsChang CC, Kao WY, Liu CY, Su HH, Kan YA, Lin PY, Ku WC, Chang KW, Yang RN, Huang CJ.
In-Text Gene Mentions
Discussion)
…Tumors with more intense nuclear staining of p53 and weaker CSE1L staining were especially found in mice bearing DMH/DSS-induced CRC that were administered with B. pullicaecorum.…
Results)
…Weak nuclear staining of p53 and increased expression of CSE1L were observed in large tumors with high-grade dysplasia (Fig. 5).…
Results)
…CSE1L expression in colon tumors of mice with B. pullicaecorum administration…
Introduction)
…To examine the molecular significance of butyrate supplementation on CSE1L expression and CRC alleviation, cellular physiology of buyrate-treated HCT116 p53−/− cells in vitro and the colon tumors from mice after B. pullicaecorum administration in vivo were used.…
Abstract)
…Lentiviral knockdown of CSE1L and p53, reverse transcription-quantitative PCR (CSE1L, c-Myc and p53), western blotting [CSE1L, p53, cyclin (CCN) A2, CCNB2 and CCND1], wound healing assay (cell migration), flow cytometry (cell cycle analysis) and immunofluorescence staining (CSE1L and tubulin) were adopted to verify the effects of butyrate on CSE1L-expressing CRC cells.…
Show Full Abstract
The chromosome segregation 1‑like (CSE1L) protein, which regulates cellular mitosis and apoptosis, was previously found to be overexpressed in colorectal cancer (CRC) cells harboring mutations. Therefore, regulating CSE1L expression may confer chemotherapeutic effects against CRC. The gut microflora can regulate gene expression in colonic cells. In particular, metabolites produced by the gut microflora, including the short‑chain fatty acid butyrate, have been shown to reduce CRC risk. Butyrates may exert antioncogenic potential in CRC cells by modulating p53 expression. The present study evaluated the association between CSE1L expression and butyrate treatment from two non‑transformed colon cell lines (CCD‑18Co and FHC) and six CRC cell lines (LS 174T, HCT116 p53<sup>+/+</sup>, HCT116 p53<sup>‑/‑</sup>, Caco‑2, SW480 and SW620). Lentiviral knockdown of CSE1L and p53, reverse transcription‑quantitative PCR (CSE1L, c‑Myc and p53), western blotting [CSE1L, p53, cyclin (CCN) A2, CCNB2 and CCND1], wound healing assay (cell migration), flow cytometry (cell cycle analysis) and immunofluorescence staining (CSE1L and tubulin) were adopted to verify the effects of butyrate on CSE1L‑expressing CRC cells. The butyrate‑producing gut bacteria <i>Butyricicoccus pullicaecorum</i> was administered to mice with 1,2‑dimethylhydrazine‑induced colon tumors before the measurement of CSE1L expression. The effects of <i>B. pullicaecorum</i> on CSE1L expression were then assessed by immunohistochemical staining for CSE1L and p53 in tissues from CRC‑bearing mice. Non‑cancerous colon cells with the R273H p53 mutation or CRC cells haboring p53 mutations were found to exhibit significantly higher CSE1L expression levels. CSE1L knockdown in HCT116 p53<sup>‑/‑</sup> cells resulted in G<sub>1</sub>‑and G<sub>2</sub>/M‑phase cell cycle arrest. Furthermore, in HCT116 p53<sup>‑/‑</sup> cells, CSE1L expression was already high at interphase, increased at prophase, peaked during metaphase before declining at cytokinesis but remained relatively high compared with that in HCT116 expressing wild‑type p53. Significantly decreased expression levels of CSE1L were also observed in HCT116 p53<sup>‑/‑</sup> cells that were treated with butyrate for 24 h. In addition, the migration of HCT116 p53<sup>‑/‑</sup> cells was significantly decreased after CSE1L knockdown or butyrate treatment. Tumors with more intense nuclear p53 staining and weaker CSE1L staining were found in mice bearing DMH/DSS‑induced CRC that were administered with <i>B. pullicaecorum</i>. Taken together, the results indicated that butyrate can impair CSE1L‑induced tumorigenic potential. In conclusion, butyrate‑producing microbes, such as <i>B. pullicaecorum</i>, may reverse the genetic distortion caused by p53 mutations in CRC by regulating CSE1L expression levels.
Also flagged:inflammatory bowel diseasesulcerative colitisinflammatory diseases of theCDNOD2IL23R
Journal Article2022-04-13No SnippetsGarza-Hernandez D, Sepulveda-Villegas M, Garcia-Pelaez J, Aguirre-Gamboa R, Lakatos PL, Estrada K, Martinez-Vazquez M, Trevino V.
Show Full Abstract
<h4>Background</h4>Crohn's disease is one of the two categories of inflammatory bowel diseases that affect the gastrointestinal tract. The heritability estimate has been reported to be 0.75. Several genes linked to Crohn's disease risk have been identified using a plethora of strategies such as linkage-based studies, candidate gene association studies, and lately through genome-wide association studies (GWAS). Nevertheless, to our knowledge, a compendium of all the genes that have been associated with CD is lacking.<h4>Methods</h4>We conducted functional analyses of a gene set generated from a systematic review where genes potentially related to CD found in the literature were analyzed and classified depending on the genetic evidence reported and putative biological function. For this, we retrieved and analyzed 2496 abstracts comprising 1067 human genes plus 22 publications regarding 133 genes from GWAS Catalog. Then, each gene was curated and categorized according to the type of evidence associated with Crohn's disease.<h4>Results</h4>We identified 126 genes associated with Crohn's disease risk by specific experiments. Additionally, 71 genes were recognized associated through GWAS alone, 18 to treatment response, 41 to disease complications, and 81 to related diseases. Bioinformatic analysis of the 126 genes supports their importance in Crohn's disease and highlights genes associated with specific aspects such as symptoms, drugs, and comorbidities. Importantly, most genes were not included in commercial genetic panels suggesting that Crohn's disease is genetically underdiagnosed.<h4>Conclusions</h4>We identified a total of 126 genes from PubMed and 71 from GWAS that showed evidence of association to diagnosis, 18 to treatment response, and 41 to disease complications in Crohn's disease. This prioritized gene catalog can be explored at http://victortrevino.bioinformatics.mx/CrohnDisease .
Also flagged:axonaltumorinnervationpancreatic ductal adenocarcinomaPDACtumors
Journal Article2022-04-13No SnippetsGuillot J, Dominici C, Lucchesi A, Nguyen HTT, Puget A, Hocine M, Rangel-Sosa MM, Simic M, Nigri J, Guillaumond F, Bigonnet M, Dusetti N, Perrot J, Lopez J, Etzerodt A, Lawrence T, Pudlo P, Hubert F, Scoazec JY, van de Pavert SA, Tomasini R, Chauvet S, Mann F.
Show Full Abstract
Neuronal nerve processes in the tumor microenvironment were highlighted recently. However, the origin of intra-tumoral nerves remains poorly known, in part because of technical difficulties in tracing nerve fibers via conventional histological preparations. Here, we employ three-dimensional (3D) imaging of cleared tissues for a comprehensive analysis of sympathetic innervation in a murine model of pancreatic ductal adenocarcinoma (PDAC). Our results support two independent, but coexisting, mechanisms: passive engulfment of pre-existing sympathetic nerves within tumors plus an active, localized sprouting of axon terminals into non-neoplastic lesions and tumor periphery. Ablation of the innervating sympathetic nerves increases tumor growth and spread. This effect is explained by the observation that sympathectomy increases intratumoral CD163<sup>+</sup> macrophage numbers, which contribute to the worse outcome. Altogether, our findings provide insights into the mechanisms by which the sympathetic nervous system exerts cancer-protective properties in a mouse model of PDAC.
Also flagged:CD4cholera toxin A1CTA1antibodyIL-17IL-21
Journal Article2022-04-13✓ 2 SnippetsArabpour M, Lebrero-Fernandez C, Schön K, Strömberg A, Börjesson V, Lahl K, Ballegeer M, Saelens X, Angeletti D, Agace W, Lycke N.
In-Text Gene Mentions
Results)
…IL-6, Tgfb1, Tgfb2,Tnfsf4( Ox40L ),…
Discussion)
…Tnfsf4-expression, encoding OX40L,…
Show Full Abstract
Migratory dendritic cells expressing CD103 are the targets for mucosal vaccines. These belong to either of two lineage-restricted subsets, cDC1 or cDC2 cells, which have been linked to priming of functionally distinct CD4 T cells. However, recent studies have identified plasticity in cDC2 cells with overlapping functions with cDC1 cells, while the converse has not been reported. We genetically engineered a vaccine adjuvant platform that targeted the cholera toxin A1 (CTA1) ADP-ribosylating enzyme to CD103<sup>+</sup> cDC1 and cDC2 cells using a single-chain antibody (scFv) to CD103. Unexpectedly, intranasal immunization with the CTA1-svFcCD103 adjuvant modified cDC1 cells to effectively prime Th17 cells, a function previously limited to cDC2 cells. In fact, cDC2 cells were dispensible, while cDC1 cells, lacking in Batf3-/- mice, were critical. Following intranasal immunizations isolated cDC1 cells from mLN exclusively promoted Rorgt<sup>+</sup> T cells and IL-17, IL-21, and IL-22 production. Strong CD8 T cell responses through antigen cross presentation by cDC1 cells were also observed. Single-cell RNAseq analysis revealed upregulation of Th17-promoting gene signatures in sorted cDC1 cells. Gene expression in isolated cDC2 cells was largely unaffected. Our finding represents a major shift of paradigm as we have documented functional plasticity in cDC1 cells.
Also flagged:hemostasissystemic lupus erythematosusSLECD40 ligandCD40Lcomplement proteins
Journal Article2022-04-13✓ 4 SnippetsLinge CP, Jern A, Tydén H, Gullstrand B, Yan H, Welinder C, Kahn R, Jönsen A, Semple JW, Bengtsson AA.
In-Text Gene Mentions
Results)
…22Among these 33 proteins (the seven immunoglobulins were excluded from this analysis), the top three most significantly overrepresented gene ontology (GO) terms of Biological Process were: “platelet degranulation,” “negative regulation of endopeptidase activity,” and “negative regulation of proteolysis” (Table 3). The network of proteins associated with platelet degranulation had the highest significance, with a FDR value of 1.66 × 10−16, suggesting that SLElowand SLEnorplatelets have an increased level of degranulation compared with platelets from HC. The proteins associated with negative regulation of endopeptidase activity and negative regulation of proteolysis, on the other hand, were essentially overlapping. These groups included several serine protease inhibitors from the superfamily of Serpins, named after their ability, to inhibit serine proteases. Serpins, including antithrombin-III (SERPINC1), alpha-1-antitrypsin (SERPINA1), heparin cofactor 2 (SERPIND1), and alpha-2-antiplasmin (SERPINF2) have important hemostatic functions,23suggesting that platelets from SLElowand SLEnorhave an altered hemostatic function, compared with platelets from HC. Additionally, we observed a relative accumulation of galectin-1 in SLElowrelative to SLEnorand HC. Galectin-1 is a β-galactoside-binding protein necessary for primary hemostasis.24Galectin-1 may also be involved in platelet activation and shedding of platelet microparticles25and proapoptotic features are reported in other cell types.26A manually curated categorization furthermore revealed that platelets from SLE patients shared an increased level of immunoglobulin proteins, complement-associated proteins, PS-binding proteins, and plasma proteins. Except for the immunoglobulin proteins, the protein profile of these categories was largely independent of platelet size (Table 3).…
…, including antithrombin-III (SERPINC1), alpha-1-antitrypsin (SERPIN…
Discussion)
…pins, including antithrombin (SERPINC1), alpha-1-antitrypsin (SERPIN…
Show Full Abstract
<h4>Background</h4> Systemic lupus erythematosus (SLE) is a complex disease characterized by autoimmunity toward apoptotic cells, excessive amounts of circulating immune complexes, and complement activation. A decreased platelet size has been observed in SLE and their nonhemostatic functions may play an active role in the disease. The main objective of this study was to find clues that could explain their decreased size and functional role, analyzing the entire platelet proteome.<h4>Methods</h4> Platelets were isolated from 23 patients with SLE. The five individuals with the highest and lowest average platelet forward scatter were selected for further analysis. Platelet protein content was analyzed using liquid chromatography with tandem mass spectrometry (LC-MS/MS) and compared with platelets from five healthy controls. Data are available via ProteomeXchange with identifier PXD031202.<h4>Results</h4> Out of 2,572 proteins identified, 396 had significantly different levels (ANOVA <i>q</i>-value ≤ 0.01). Forty proteins, including immunoglobulin-, complement- and phosphatidylserine-binding proteins had higher abundance in platelets from SLE patients, largely independent of size (fold difference of ≥1.5 and a <i>t</i>-test <i>p</i>-value of ≤0.05 as cut-off). Functional characterization revealed increased degranulation and skewed hemostatic balance in platelets from SLE patients. In the SLE proteome, immunoglobulin proteins were negatively correlated to serum complement C3 and C4 and the highest relative levels were detected in platelets of normal size.<h4>Conclusion</h4> Platelets from SLE patients shared a specific protein profile, including immunoglobulins, complement proteins, and autoantigens, largely independent of the platelet size and in agreement with an integrated role for platelets in SLE.
<h4>Background</h4>To assess the prevalence of genetic testing for inherited retinal diseases (IRDs) in a tertiary practice setting.<h4>Methods</h4>Single-centre retrospective analysis of patients with diagnosed or suspected IRD.<h4>Results</h4>Four hundred and sixty-four patient records were analysed. Patients had received care for different IRDs grouped as follows: panretinal pigmentary retinopathies (283, 61%), macular dystrophies (136, 29.3%), stationary diseases (23, 5%), hereditary vitreoretinopathies (14, 3%), and other IRDs (8, 1.7%). The suspected pattern of inheritance of patients' IRD was predominantly autosomal recessive (205, 44.2%). Genetic testing was performed with the corresponding results available for 44 patients (9.5%). Diagnostic yield was 65.9% for the results received. Genetic test results were available mostly for younger patients (13.1% for <45 years vs 6.2% ≥45 years of age, p = 0.01) and those who received greater than 12 months of care (16% for ≥12 months vs 4% for <12 months, p < 0.01). For patients without genetic testing results, reasons include awaiting a geneticist consultation (17.9%), awaiting test results (4.5%), or patient refusal (8.4%). Most clinical records (69.2%) did not document genetic testing status.<h4>Conclusion</h4>Genetic testing is increasingly being utilised in the work-up for patients with IRD worldwide. This large Australian private practice IRD cohort shows a low uptake of testing (around 10%), reflecting historical management patterns and accessibility of genetic counselling and testing. The results show that younger patients and those with a longer duration of care were more likely to have received genetic testing. As the importance of IRD genetic testing continues to increase, we expect to see a change in patient management within the Australian private ophthalmology system and testing rates to increase. Further research is required to identify and address clinician and patient barriers to improving genetic testing rates for IRD.
Also flagged:CoagulationAcute Necrotizing Pancreatitisinterstitial edema pancreatitisANPpathogenesiscomplement C3
Journal Article2022-04-13✓ 5 SnippetsZhang X, Li Z, Liu W, Du J, Liu Y, Yu N, Liu C, Zeng M, Zhang X.
In-Text Gene Mentions
Methods)
…The levels of complement C3 (C3), complement Factor I (CFI), alpha-2-macroglobulin (A2m), complement C9 (C9), and serpin family C member 1 (Serpinc1) in the serum of AP patients were determined using double antibody ELISA (Shanghai Enzyme-linked Biotechnology Co., Ltd., China) commercial kits (ml058121-J, ml063609-J, ml060470-J, ml060470-J, and ml060054-J, respectively) according to the manufacturer’s instructions.…
Discussion)
…Proteomics analysis of the pancreas of AP rats and ELISA analysis of the serum of AP patients showed that Serpinc1 expression was increased when ANP occurred.…
Discussion)
…However, there have been no reports about the relationship between Serpinc1 and AP.…
Abstract)
…m, C9, andSerpinc1, which belong to…
Methods)
…C member 1 (Serpinc1) in the serum…
Show Full Abstract
<h4>Purpose</h4>Acute pancreatitis can be classified histologically as interstitial edema pancreatitis (IEP) or as acute necrotizing pancreatitis (ANP). ANP has a higher mortality and long-term or short-term sequelae than IEP. Therefore, this work aims to explore the differences in pathogenesis between ANP and IEP and it has great clinical importance for the treatment and prevention of ANP.<h4>Methods</h4>In this work, whole blood samples from IEP and ANP patients were analyzed by whole gene sequencing (WGS). Serum samples from IEP and ANP patients were evaluated via enzyme-linked immunosorbent assay (ELISA). Meanwhile, pancreatic tissues of IEP and ANP rat models were subjected to data independent acquisition (DIA) proteomics assays. Then, the WGS analysis and DIA proteomics assay data were analyzed comprehensively.<h4>Results</h4>Six pathways were found to be significantly different in the ANP/IEP groups through WGS analysis. DIA proteomics found eleven different pathways. In both assays, the complement and coagulation cascades pathway was the most significantly different (<i>p</i> < 0.01) pathway between the two groups. WGS analysis showed base mutations in ten genes in the complement and coagulation cascades pathway. These results were consistent with the ten proteins detected by DIA proteomics analysis, which were significantly upregulated in the ANP/IEP groups. In addition, five of these proteins, complement C3, complement Factor I, alpha-2-macroglobulin, complement C9, and serpin family C member 1, were successfully verified by parallel reaction monitoring analysis and ELISA.<h4>Conclusion</h4>C3, CFI, A<sub>2</sub>m, C9, and Serpinc1, which belong to complement and coagulation cascades pathway, may promote pancreatic necrosis and aggravate the severity of ANP.
…In addition,hemochromatosis, Wilson disease, and…
Show Full Abstract
The incidence of hepatic steatosis is increasing globally, and it is important to identify those at risk to prevent comorbidities. Complete blood count is a simple, convenient, and inexpensive laboratory examination which can be used to obtain white blood cell (WBC) and platelet counts. The aims of this study were to investigate the relationships between WBC and platelet counts with hepatic steatosis, and whether WBC and platelet counts were associated with the severity of hepatic steatosis. We enrolled 1969 participants residing in southern Taiwan who took part in a health survey from June 2016 to September 2018 in this cross-sectional study. None of the participants were heavy alcohol users or had a history of hepatitis B or C. We collected laboratory data, and the severity of hepatic steatosis was determined by abdominal ultrasound. The overall prevalence rate of hepatic steatosis was 42.0%. There were significant trends of stepwise increases in WBC count (p < 0.001) corresponding to the severity of hepatic steatosis. After multivariable linear regression analysis, hepatic steatosis was significantly associated with high WBC count (coefficient β, 0.209; 95% confidence interval (CI), 0.055 to 0.364; p = 0.008) and high platelet count (coefficient β, 12.213; 95% CI, 6.092 to 18.334; p < 0.001); also, higher WBC counts corresponded with the severity of hepatic steatosis.
…PTGIS, PTGES, and PTGER4 up-regulation in the group of responders with HER2-positive breast cancer, known by its aggressive behavior [132,133], is associated with complete tumor response to treatment with fluorouracil, epirubicin, and cyclophosphamide (FEC).…
Results)
…It was found that only for breast or ovarian tumors, ROC curves for (PTGIS, PTGES, and PTGER4) or (TBXAS1, PTGES, TBXA2R, and PTGDR2), respectively, had Area Under Curve (AUC) values > 0.75 at the tumor/normal fold changes ≥ 2 (Figure S2A,B).…
Discussion)
…Figure 3 shows a simultaneous decrease in the expression of both PTGIS and PTGIR in eight tumor types, and therefore, we analyzed the possible causes of such changes (Table S10). It can be pointed out that down-regulation of PTGIS in KIRP, LUAD, THCA, and UCES tumors is accompanied by an increase in miR-34a levels, which mainly plays a considerable role in inhibiting tumor progression in thyroid tumors [143]. In LUSC tumors, there is a decrease in miR-34c, which, like miR-34a, possesses antitumor activity [144]. On the other hand, miR-326 expression is suppressed in lung cancer tissues. This oncomiR, as shown in [145], inhibits lung cancer cell proliferation, and colony formation and provokes apoptosis. It should also mention that the down-regulation of PTGIS is comparable to the lowering of a corresponding protein product in LUAD and UCEC tumors (Table 2). As for the predicted transcriptional master regulators of PTGIS and PTGIR (Table S10), there are fundamentally distinct tumor-specific patterns. Transcript and total protein accumulation of master regulator ZBTB7A as well as PTGIS and PTGIR were reduced in UCES tumors, which was markedly related to the stage and prognosis of this tumor type [146].…
Results)
…muTARGET web-based tool allowed us to predict genes, which expression patterns can be associated with genetic polymorphism in group #1 (TBXAS1, PTGIS, and AKR1C3) or group #2 (PTGDR, PTGFR, and PTGER3) in melanoma.…
Results)
…Gene sets co-expressed with PTGIS in DLCA, CHOL, COAD, READ, PRAD, TGCT tumors, and PTGES in ACC tumors are enriched in “muscle contraction” and “extracellular matrix organization” terms.…
Show Full Abstract
Cancer-associated disturbance of prostanoid signaling provides an aberrant accumulation of prostanoids. This signaling consists of 19 target genes, encoding metabolic enzymes and G-protein-coupled receptors, and prostanoids (prostacyclin, thromboxane, and prostaglandins E<sub>2</sub>, F<sub>2α</sub>, D<sub>2</sub>, H<sub>2</sub>). The study addresses the systems biology analysis of target genes in 24 solid tumors using a data mining pipeline. We analyzed differential expression patterns of genes and proteins, promoter methylation status as well as tissue-specific master regulators and microRNAs. Tumor types were clustered into several groups according to gene expression patterns. Target genes were characterized as low mutated in tumors, with the exception of melanoma. We found at least six ubiquitin ligases and eight protein kinases that post-translationally modified the most connected proteins PTGES3 and PTGIS. Models of regulation of <i>PTGIS</i> and <i>PTGIR</i> gene expression in lung and uterine cancers were suggested. For the first time, we found associations between the patient's overall survival rates with nine multigene transcriptomics signatures in eight tumors. Expression patterns of each of the six target genes have predictive value with respect to cytostatic therapy response. One of the consequences of the study is an assumption of prostanoid-dependent (or independent) tumor phenotypes. Thus, pharmacologic targeting the prostanoid signaling could be a probable additional anticancer strategy.
Studies regarding the variables that could predict the success of conservative treatment for knee hemarthrosis are lacking. This retrospective study evaluated the laboratory variables of patients who had unsatisfactory results from conservative treatment for knee hemarthrosis. Twenty-nine patients conservatively treated for knee hemarthrosis were included and divided into two groups: group A comprised 14 patients who underwent interventional angiography and selective embolization due to failed conservative treatment, and group B comprised 15 patients with successful results after conservative treatment. The results of the serological and synovial fluid tests were evaluated. The mean number of synovial red blood cells (RBCs) was 1,905,857 cells/µL and 7730 cells/µL in groups A and B, respectively (p = 0.01), while the mean number of RBCs per high-power field (HPF) was 68.9 and 3.2, respectively (p < 0.01). Patients who underwent interventional angiography and selective embolization after failed conservative treatment for knee hemarthrosis had higher synovial RBC counts and RBC counts per HPF than those with successful outcomes after conservative treatment. It is necessary to carefully interpret the results of the synovial fluid analysis in patients with knee hemarthrosis; if the synovial fluid analysis shows a synovial RBC count greater than 81,500 and RBC count per HPF greater than 16.3, we recommend immediate interventional angiography rather than continuing conservative treatment.
MicroRNAs (miRNAs) are widely involved in the growth and development of skeletal muscle through the negative regulation of target genes. In order to screen out the differentially expressed miRNAs (DEMs) associated with skeletal muscle development of Bian chickens at different embryonic ages, we used the leg muscles of fast-growing and slow-growing Bian chickens at the 14th and 20th embryonic ages (F14, F20, S14 and S20) for RNA-seq. A total of 836 known miRNAs were identified, and 121 novel miRNAs were predicted. In the F14 vs. F20 comparison group, 127 DEMs were screened, targeting a total of 2871 genes, with 61 miRNAs significantly upregulated and 66 miRNAs significantly downregulated. In the S14 vs. S20 comparison group, 131 DEMs were screened, targeting a total of 3236 genes, with 60 miRNAs significantly upregulated and 71 miRNAs significantly downregulated. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed that the predicted target genes were significantly enriched in 706 GO terms and 6 KEGG pathways in the F14 vs. F20 group and 677 GO terms and 5 KEGG pathways in the S14 vs. S20 group. According to the interaction network analysis, we screened five coexpressed DEMs (gga-miR-146a-3p, gga-miR-2954, gga-miR-34a-5p, gga-miR-1625-5p and gga-miR-18b-3p) with the highest connectivity degree with predicted target genes between the two comparison groups, and five hub genes (HSPA5, PKM2, Notch1, Notch2 and RBPJ) related to muscle development were obtained as well. Subsequently, we further identified nine DEMs (gga-let-7g-3p, gga-miR-490-3p, gga-miR-6660-3p, gga-miR-12223-5p, novel-miR-327, gga-miR-18a-5p, gga-miR-18b-5p, gga-miR-34a-5p and gga-miR-1677-3p) with a targeting relationship to the hub genes, suggesting that they may play important roles in the muscle development of Bian chickens. This study reveals the miRNA differences in skeletal muscle development between 14- and 20-day embryos of Bian chickens from fast- and slow-growing groups and provides a miRNA database for further studies on the molecular mechanisms of the skeletal muscle development in Bian chickens.
Renal Ca<sup>2+</sup> reabsorption plays a central role in the fine-tuning of whole-body Ca<sup>2+</sup> homeostasis. Here, we identified calreticulin (Calr) as a missing link in Ca<sup>2+</sup> handling in the kidney and showed that a shortage of Calr results in mitochondrial disease and kidney pathogenesis. We demonstrated that Calr<sup>+/-</sup> mice displayed a chronic physiological low level of Calr and that this was associated with progressive renal injury manifested in glomerulosclerosis and tubulointerstitial damage. We found that Calr<sup>+/-</sup> kidney cells suffer from a disturbance in functionally active calcium stores and decrease in Ca<sup>2+</sup> storage capacity. Consequently, the kidney cells displayed an abnormal activation of Ca<sup>2+</sup> signaling and NF-κB pathways, resulting in inflammation and wide progressive kidney injury. Interestingly, the disturbance in the Ca<sup>2+</sup> homeostasis and signaling in Calr<sup>+/-</sup> kidney mice cells triggered severe mitochondrial disease and aberrant mitophagy, resulting in a high level of oxidative stress and energy shortage. These findings provide novel mechanistic insight into the role of Calr in kidney calcium handling, function, and pathogenesis.
Also flagged:TrehaloseAutophagyneurodegenerative diseasesnucleolipidlipidacid
Journal Article2022-04-13No SnippetsCunha A, Gaubert A, Verget J, Thiolat ML, Barthélémy P, Latxague L, Dehay B.
Show Full Abstract
The Autophagy Lysosomal Pathway is one of the most important mechanisms for removing dysfunctional cellular components. Increasing evidence suggests that alterations in this pathway play a pathogenic role in Parkinson's disease, making it a point of particular vulnerability. Numerous studies have proposed nanotechnologies as a promising approach for delivering active substances within the central nervous system to treat and diagnose neurodegenerative diseases. In this context, the aim was to propose the development of a new pharmaceutical technology for the treatment of neurodegenerative diseases. We designed a trehalose-based nanosystem by combining both a small natural autophagy enhancer molecule named trehalose and an amphiphilic nucleolipid conjugate. To improve nucleolipid protection and cellular uptake, these conjugates were formulated by rapid mixing in either solid lipid nanoparticles (Ø = 120.4 ± 1.4 nm) or incorporated into poly(lactic-co-glycolic acid) nanoparticles (Ø = 167.2 ± 2.4 nm). In vitro biological assays demonstrated a safe and an efficient cellular uptake associated with autophagy induction. Overall, these nucleolipid-based formulations represent a promising new pharmaceutical tool to deliver trehalose and restore the autophagy impaired function.
Also flagged:SynthesischitosanMonodispersenanogelsacetic acidcell proliferation
Journal Article2022-04-13No SnippetsManivong S, Garcia Ac A, Patten SA, Fernandes JC, Benderdour M, Banquy X, Moldovan F, Roullin VG.
Show Full Abstract
One important challenge in treating avascular-degraded cartilage is the development of new drugs for both pain management and joint preservation. Considerable efforts have been invested in developing nanosystems using biomaterials, such as chitosan, a widely used natural polymer exhibiting numerous advantages, i.e., non-toxic, biocompatible and biodegradable. However, even if chitosan is generally recognized as safe, the safety and biocompatibility of such nanomaterials must be addressed because of potential for greater interactions between nanomaterials and biological systems. Here, we developed chitosan-based nanogels as drug-delivery platforms and established an initial biological risk assessment for osteocartilaginous applications. We investigated the influence of synthesis parameters on the physicochemical characteristics of the resulting nanogels and their potential impact on the biocompatibility on all types of human osteocartilaginous cells. Monodisperse nanogels were synthesized with sizes ranging from 268 to 382 nm according to the acidic solution used (i.e., either citric or acetic acid) with overall positive charge surface. Our results demonstrated that purified chitosan-based nanogels neither affected cell proliferation nor induced nitric oxide production in vitro. However, nanogels were moderately genotoxic in a dose-dependent manner but did not significantly induce acute embryotoxicity in zebrafish embryos, up to 100 µg∙mL<sup>-1</sup>. These encouraging results hold great promise for the intra-articular delivery of drugs or diagnostic agents for joint pathologies.
Journal Article2022-04-13No SnippetsNisticò Y, Fahmi S, Pallottino L, Semini C, Fink G.
Show Full Abstract
Legged robots are meant to autonomously navigate unstructured environments for applications like search and rescue, inspection, or maintenance. In autonomous navigation, a close relationship between locomotion and perception is crucial; the robot has to perceive the environment and detect any change in order to autonomously make decisions based on what it perceived. One main challenge in autonomous navigation for legged robots is locomotion over unstructured terrains. In particular, when the ground is slippery, common control techniques and state estimation algorithms may not be effective, because the ground is commonly assumed to be non-slippery. This paper addresses the problem of slip detection, a first fundamental step to implement appropriate control strategies and perform dynamic whole-body locomotion. We propose a slip detection approach, which is independent of the gait type and the estimation of the position and velocity of the robot in an inertial frame, that is usually prone to drift problems. To the best of our knowledge, this is the first approach of a quadruped robot slip detector that can detect more than one foot slippage at the same time, relying on the estimation of measurements expressed in a non-inertial frame. We validate the approach on the 90 kg Hydraulically actuated Quadruped robot (HyQ) from the Istituto Italiano di Tecnologia (IIT), and we compare it against a state-of-the-art slip detection algorithm.
Also flagged:demyelinating diseasesmultiple sclerosisMScapsuleexperimental autoimmune encephalomyelitisLingo1
Journal Article2022-04-13✓ 5 SnippetsJi J, Sun YQ, Zha Z, Xue B, Li JL, Jin LY, Qi F, Zhang N, Zhao H, Fan YP, Wang L.
In-Text Gene Mentions
I A O 0000615)
…Specifically, we found that BSYSC may promote remyelination by promoting miR-219 or miR-338 expression in exosomes and recruit OPCs by inhibiting Sox6, Hes5, and Lingo1 expression, thus promoting OPCs differentiation and improving the ability of OPCs to wrap around axons to ultimately ameliorate MS.…
Introduction)
…Therefore, based on preliminary research, the effects of BSYSC on the miR-219 and miR-338 levels in serum exosomes from mice with EAE as well as its regulatory effects on their target genes, Hes5, Sox6, and Lingo1, were investigated in this study by using an internationally recognized mouse model of EAE.…
Abstract)
…We further found that BSYSC elevated the expression of miR-219 or miR-338 in the serum exosomes of mice with EAE, thereby suppressing the expression of Sox6, Lingo1, and Hes5, which negatively regulate OPCs differentiation.…
Discussion)
…In animals with EAE, miR-338 regulates myelin maturation in coordination with miR-219 [29, 87], and these two miRs jointly target the degradation of Sox6.…
Abstract)
…the expression ofSox6, Lingo1, and Hes5,…
Show Full Abstract
Remyelination is a refractory feature of demyelinating diseases such as multiple sclerosis (MS). Studies have shown that promoting oligodendrocyte precursor cell (OPC) differentiation, which cannot be achieved by currently available therapeutic agents, is the key to enhancing remyelination. Bu Shen Yi Sui capsule (BSYSC) is a traditional Chinese herbal medicine over many years of clinical practice. We have found that BSYSC can effectively treat MS. In this study, the effects of BSYSC in promoting OPCs differentiation and remyelination were assessed using an experimental autoimmune encephalomyelitis (EAE) model in vivo and cultured OPCs in vitro. The results showed that BSYSC reduced clinical function scores and increased neuroprotection. The expression of platelet-derived growth factor receptor <i>α</i> (PDGFR-<i>α</i>) was decreased and the level of 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase) was increased in the brains and spinal cords of mice as well as in OPCs after treatment with BSYSC. We further found that BSYSC elevated the expression of miR-219 or miR-338 in the serum exosomes of mice with EAE, thereby suppressing the expression of Sox6, Lingo1, and Hes5, which negatively regulate OPCs differentiation. Therefore, serum exosomes of BSYSC-treated mice (exos-BSYSC) were extracted and administered to OPCs in which miR-219 or miR-338 expression was knocked down by adenovirus, and the results showed that Sox6, Lingo1, and Hes5 expression was downregulated, MBP expression was upregulated, OPCs differentiation was increased, and the ability of OPCs to wrap around neuronal axons was improved. In conclusion, BSYSC may exert clinically relevant effects by regulating microRNA (miR) levels in exosomes and thus promoting the differentiation and maturation of OPCs.
Also flagged:SOXMethylationhepatocellular carcinomaSOX11SOX12SOX17
Journal Article2022-04-13✓ 5 SnippetsQin S, Liu G, Jin H, Chen X, He J, Xiao J, Qin Y, Mao Y, Zhao L.
In-Text Gene Mentions
Introduction)
…Sex-determining region Y (Sry)-box-containing (SOX) family members (including SOX1, SOX2, SOX3, SOX4, SOX5, SOX6, SOX7, SOX8, SOX9, SOX10, SOX11, SOX12, SOX13, SOX15, SOX17, and SOX18) are transcription factors with a significant role such as tumor growth and invasion in various of cancers [15–19].…
Results)
…The high mRNA expression level of SOX4, SOX8, SOX9, SOX11, SOX12, SOX13, SOX15, SOX17, and SOX18 as well as the low mRNA expression level of SOX6 and SOX10 indicated HCC N0 progress.…
Results)
…And the mRNA expression level of SOX6, SOX7, SOX9, SOX13, and SOX15 showed no significant statistical difference in HCC patients' PFS (Figure 5).…
Results)
…However, the higher mRNA transcription levels of SOX2, SOX4, SOX6, SOX9, SOX11, and SOX12 showed shorter OS time in HCC.…
Results)
…Moreover, SOX6 and SOX10 had a low expression in HCC, which also indicated high grade of tumor.…
Show Full Abstract
<h4>Background</h4>Due to the molecular heterogeneity of hepatocellular carcinoma (HCC), majority of patients respond poorly among various of therapy. This study is aimed at conducting a comprehensive analysis about roles of SOX family in HCC for obtaining more therapeutic targets and biomarkers which may bring new ideas for the treatment of HCC.<h4>Methods</h4>UALCAN, Kaplan Meier plotter, cBioPortal, STRING, WebGestalt, Metascape, TIMER 2.0, DiseaseMeth, MethSurv, HPA, CCLE database, and Cytoscape software were used to comprehensively analyze the bioinformatic data.<h4>Results</h4>SOX2, SOX4, SOX8, SOX10, SOX11, SOX12, SOX17, and SOX18 were significantly differentially expressed in HCC and normal tissues and were valuable for the grade and survival of HCC patients. In addition, the gene alterations of SOX family happened frequently, and SOX4 and SOX17 had the highest mutation rate. The function of SOX family on HCC may be closely correlated with the regulation of angiogenesis-related signaling pathways. Moreover, SOX4, SOX8, SOX11, SOX12, SOX17, and SOX18 were correlation with 8 types of immune cells (including CD8+ T cell, CD4+ T cell, B cell, Tregs, neutrophil, macrophage, myeloid DC, and NK cell), and we found that most types of immune cells had a positive correlation with SOX family. Notably, CD4+ T cell and macrophage were positively related with all these SOX family. NK cells were negatively related with most SOX family genes. DNA methylation levels in promoter area of SOX2, SOX4, and SOX10 were lower in HCC than normal tissues, while SOX8, SOX11, SOX17, and SOX18 had higher DNA methylation levels than normal tissues. Moreover, higher DNA methylation level of SOX12 and SOX18 demonstrated worse survival rates in patients with HCC.<h4>Conclusion</h4>SOX family genes could predict the prognosis of HCC. In addition, the regulation of angiogenesis-related signaling pathways may participate in the development of HCC. DNA methylation level and immune microenvironment characteristics (especially CD4+ T cell and macrophage immune cell infiltration) could be a novel insight for predicting prognosis in HCC.
Also flagged:Pancreatic Cancercancerstumorpancreatic adenocarcinomaKDM5DKDM5A
Journal Article2022-04-13✓ 1 SnippetDuan Y, Du Y, Gu Z, Zheng X, Wang C.
In-Text Gene Mentions
Results)
…such as NT5E,TNFSF4, and TNFSF15, immunosuppressi…
Show Full Abstract
<b>Background:</b> The histone lysine demethylase KDM5 family is an important epigenetic state-modifying enzyme family. Increasing evidence supports that epigenetic abnormalities in the KDM5 family are related to multiple cancers in humans. However, the role of the KDM5 family in pancreatic cancer is not clear, and related research is very scarce. <b>Methods:</b> R software, Kaplan-Meier Plotter, cBioPortal, TIMER, LinkedOmics, STRING, Metascape, TISIDB, and the GSCA Lite online tool were utilized for bioinformatics analysis. <b>Results:</b> KDM5A/B/C was significantly overexpressed in many kinds of tumor tissues, including pancreatic adenocarcinoma (PAAD), while the expression of KDM5D was significantly downregulated. The high expression of KDM5A/B/C was related to poor clinical features, such as worse treatment efficacy, higher tumor grade, and more advanced clinical stage. Patients with a family history of breast cancer and melanoma, history of drinking or history chronic pancreatitis were more likely to have KDM5A/B/C gene abnormalities, which were related to a variety of adverse clinical features. The results of gene ontology (GO) and kyoto encyclopedia of genes and genomes (KEGG) pathway analyses of the KDM5 family and its 800 co-expressed genes showed that many gene terms related to cell proliferation, migration and many carcinogenic pathways. Notably, we found that the expression level of KDM5A/B/C was positively correlated with the expression of multiple key driver genes such as KRAS, BRCA1, and BRCA2 etc. In addition, PPI network analysis showed KDM5 family proteins have strong interactions with histone deacetylase family 1 (HDAC1), which could modify the lysines of histone H3, and co-act on many pathways, including the "longevity-regulating pathway" and "Notch signaling pathway". Moreover, the upregulation of KDM5A/B/C expression was associated with an increase in the infiltration of B cells, CD8<sup>+</sup> T cells and other infiltrating immune lymphocytes and the expression levels of immune molecules such as NT5E and CD274. Interestingly, the overexpression of KDM5A/C was also corelated with reduced sensitivity of pancreatic cancer cells to many kinds of pancreatic cancer-targeting or chemotherapeutic drugs, including axitinib and gemcitabine. <b>Conclusion:</b> KDM5 family members may be prognostic markers and new therapeutic targets for patients with pancreatic cancer.
Also flagged:Autism Spectrum Disorderneurodevelopmental disordersfragile X syndromeRett syndrometuberous sclerosisglucose
Journal Article2022-04-13✓ 5 SnippetsTan Z, Wei H, Song X, Mai W, Yan J, Ye W, Ling X, Hou L, Zhang S, Yan S, Xu H, Wang L.
In-Text Gene Mentions
S I O 001029)
…In addition, DAT binding in the orbitofrontal cortex was inversely correlated with 5-HTT binding in those with autism (Nakamura et al., 2010).…
S I O 001029)
…In a previously mentioned study of 20 high-functioning adult patients with autism and 20 typical developing controls, DAT was measured using [11C]WIN-35,428 in addition to imaging 5-HTT using [11C]McN-5652.…
Introduction)
…ydroxytryptamine transporter (5-HTT), also known as…
Introduction)
…by dysregulation of5-HTT, but the exact…
Introduction)
…exact relationship between5-HTTchanges and ASD…
Show Full Abstract
Autism spectrum disorder (ASD) is a basket term for neurodevelopmental disorders characterized by marked impairments in social interactions, repetitive and stereotypical behaviors, and restricted interests and activities. Subtypes include (A) disorders with known genetic abnormalities including fragile X syndrome, Rett syndrome, and tuberous sclerosis and (B) idiopathic ASD, conditions with unknown etiologies. Positron emission tomography (PET) is a molecular imaging technology that can be utilized <i>in vivo</i> for dynamic and quantitative research, and is a valuable tool for exploring pathophysiological mechanisms, evaluating therapeutic efficacy, and accelerating drug development in ASD. Recently, several imaging studies on ASD have been published and physiological changes during ASD progression was disclosed by PET. This paper reviews the specific radioligands for PET imaging of critical biomarkers in ASD, and summarizes and discusses the similar and different discoveries in outcomes of previous studies. It is of great importance to identify general physiological changes in cerebral glucose metabolism, cerebral blood flow perfusion, abnormalities in neurotransmitter systems, and inflammation in the central nervous system in ASD, which may provide excellent points for further ASD research.
Also flagged:Histone MethyltransferaseDOT1Lhistone lysine methyltransferaseDOT1-like histone lysine methyltransferaseregulation ofgene expression
Journal Article2022-04-13No SnippetsAlexandrova E, Salvati A, Pecoraro G, Lamberti J, Melone V, Sellitto A, Rizzo F, Giurato G, Tarallo R, Nassa G, Weisz A.
Show Full Abstract
The histone lysine methyltransferase DOT1L (DOT1-like histone lysine methyltransferase) is responsible for the epigenetic regulation of gene expression through specific methylation of lysine79 residue of histone H3 (H3K79) in actively transcribed genes. Its normal activity is crucial for embryonic development and adult tissues functions, whereas its aberrant functioning is known to contribute to leukemogenesis. DOT1L is the only lysine methyltransferase that does not contain a SET domain, which is a feature that allowed the development of selective DOT1L inhibitors that are currently investigated in Phase I clinical trials for cancer treatment. Recently, abnormal expression of this enzyme has been associated with poor survival and increased aggressiveness of several solid tumors. In this review evidences of aberrant DOT1L expression and activity in breast, ovarian, prostate, colon, and other solid tumors, and its relationships with biological and clinical behavior of the disease and response to therapies, are summarized. Current knowledge of the structural basis of DOT1L ability to regulate cell proliferation, invasion, plasticity and stemness, cell cycle progression, cell-to-cell signaling, epithelial-to-mesenchymal transition, and chemoresistance, through cooperation with several molecular partners including noncoding RNAs, is also reviewed. Finally, available options for the treatment of therapeutically challenging solid tumors by targeting DOT1L are discussed.
The periprostatic adipose tissue (PPAT) is a site of invasion of prostate cancer (PCa) and is part of the microenvironment. It was shown that PPAT secretes factors and fatty acids (FAs) that alter the microenvironment of the PCa. The PPAT secretome of patients with PCa-T3 stage (PPAT-T3) has a metabolic profile enriched in several pathways related to energy production, indicating a greater energy requirement by the tumor, when compared to that of patients in the PCa-T2 stage (PPAT-T2). PPAT-T3 also shows enrichment in pathways related to hormone response, polyamine synthesis, and control of protein synthesis, through amino acid, RNA, and nucleotide metabolism. PPAT-T2 and PPAT-BPH secretomes have less complex metabolic profile, both related with energy balance, while PPAT-BPH has hormone response through insulin pathway. Undoubtedly, a deeper characterization of the human PPAT will lead to a better understanding of the disease and possibly allow new stratification factors and the design of a specific therapy that targets crucial components of the tumor microenvironment as another way to treat or control the disease.
Also flagged:Bindingmetallo-oxidasemulticopper oxidaseLaccaseMulticopper oxidasesmetallo-oxidases
Journal Article2022-04-13No SnippetsBrissos V, Borges PT, Núñez-Franco R, Lucas MF, Frazão C, Monza E, Masgrau L, Cordeiro TN, Martins LO.
Show Full Abstract
Laccases are in increasing demand as innovative solutions in the biorefinery fields. Here, we combine mutagenesis with structural, kinetic, and <i>in silico</i> analyses to characterize the molecular features that cause the evolution of a hyperthermostable metallo-oxidase from the multicopper oxidase family into a laccase (<i>k</i> <sub>cat</sub> 273 s<sup>-1</sup> for a bulky aromatic substrate). We show that six mutations scattered across the enzyme collectively modulate dynamics to improve the binding and catalysis of a bulky aromatic substrate. The replacement of residues during the early stages of evolution is a stepping stone for altering the shape and size of substrate-binding sites. Binding sites are then fine-tuned through high-order epistasis interactions by inserting distal mutations during later stages of evolution. Allosterically coupled, long-range dynamic networks favor catalytically competent conformational states that are more suitable for recognizing and stabilizing the aromatic substrate. This work provides mechanistic insight into enzymatic and evolutionary molecular mechanisms and spots the importance of iterative experimental and computational analyses to understand local-to-global changes.
Also flagged:sugarmetabolismsynthesislactosylceramidehepatocellular carcinomacell proliferation
Journal Article2022-04-12✓ 5 SnippetsHan Y, Li Z, Wu Q, Liu H, Sun Z, Wu Y, Luo J.
In-Text Gene Mentions
Discussion)
…Our results show that the degree of immune infiltration level in HCC is significantly correlated with B4GALT5 expression, especially in macrophages and neutrophils.…
Results)
…Among the DEGs identified above, B4GALT5 was one of the genes with drastically increased expression in HCC tissues compared to normal ones.…
Results)
…It can be found that B4GALT5 co-expressed genes are mainly enriched in the glucose-related diseases and lipid metabolism closely linked to HCC.…
Results)
…Knockdown of B4GALT5 significantly reduces proliferation, migration and invasion of HCC cells…
Introduction)
…Our in vitro experiments showed that depletion of B4GALT5 significantly inhibited HCC cell proliferation, migration and invasion.…
Show Full Abstract
<h4>Background</h4>B4GALT5 is postulated to be an important protein in sugar metabolism that catalyzes the synthesis of lactosylceramide (LacCer). However, its role in hepatocellular carcinoma (HCC) remains unknown.<h4>Method</h4>We characterized the expression of B4GALT5 in HCC tissue compared to normal tissue, and explored its function of B4GALT5 in HCC by enrichment analysis based on its co-expressed gene set. Next, we checked whether B4GALT5 expression is correlated to immune infiltration level and clinical prognosis in hepatocellular carcinoma. Finally, we verified the expression of B4GALT5 using clinical samples evaluated by RT-PCR, and conducted in vitro experiments with B4GALT5-knockdown HCC cells to investigate the function of B4GALT5 in the HCC cell proliferation, migration and invasion.<h4>Results</h4>We found B4GALT5 mRNA and protein expression levels were significantly high in HCC tissue compared to normal tissue. The enrichment analysis of the gene sets that co-expressed with B4GALT5 showed specificity in HCC-related pathways and functions. Also, the expression pattern of B4GALT5 was significantly related to the immune infiltration level, especially CD4+ T cell and macrophage cells. B4GALT5 higher mRNA expression was associated with poor overall survival (OS) in HCC patients. Furthermore, In vitro experiments showed that depletion of B4GALT5 significantly inhibited HCC cell proliferation, migration and invasion. This study revealed the function and its mediated pathways of B4GALT5 in HCC, indicating that B4GALT5 may serve as a prognostic biomarker of HCC.
Also flagged:ADmetabolic diseasesobesitydyslipidemiasdiabetes mellitusgene expression
Journal Article2022-04-12No SnippetsPérez-Villarreal JM, Aviña-Padilla K, Beltrán-López E, Guadrón-Llanos AM, López-Bayghen E, Magaña-Gómez J, Meraz-Ríos MA, Varela-Echavarría A, Angulo-Rojo C.
Show Full Abstract
<h4>Background</h4>Down syndrome (DS) is the most common chromosomal survival aneuploidy. The increase in DS life expectancy further heightens the risk of dementia, principally early-onset Alzheimer's disease (AD). AD risk in DS is higher, considering that this population may also develop metabolic diseases such as obesity, dyslipidemias, and diabetes mellitus. The extra genetic material that characterizes DS causes an imbalance in the genetic dosage, including over-expression of AD's key pathophysiological molecules and the gene expression regulators, the microRNAs (miRNAs). Two miRNAs, chromosome 21-encoded, miR-155, and let-7c, are associated with cognitive impairment and dementia in adults; but, expression dynamics and relationship with clinical variables during the DS's lifespan had remained hitherto unexplored.<h4>Methods</h4>The anthropometric, clinical, biochemical, and profile expression of circulating miR-155 and let-7c were analyzed in a population of 52 control and 50 DS subjects divided into the young group (Aged ≤20 years) and the adult group (Aged ≥21 years).<h4>Results</h4>The expression changes for miR-155 were not significant; nevertheless, a negative correlation with HDL-Cholesterol concentrations was observed. Notably, let-7c was over-expressed in DS from young and old ages.<h4>Conclusion</h4>Overall, our results suggest that let-7c plays a role from the early stages of DS's cognitive impairment while overexpression of miR-155 may be related to lipid metabolism changes. Further studies of both miRNAs will shed light on their potential as therapeutic targets to prevent or delay DS's cognitive impairment.
Also flagged:esophageal squamous cell cancerESCCCell proliferationCell migrationSRY‐box transcription factor 6wound‐healing
Journal Article2022-04-12✓ 5 SnippetsWang J, Yao W, Li J, Zhang Q, Wei L.
In-Text Gene Mentions
Results)
…Among these potential targets, we focused on SOX6 because it has been shown to exert a tumor‐suppressive function in human ESCC by impacting cancer cell apoptosis and proliferation.30, 31, 39…
Abstract)
…Our findings uncover an undescribed molecular mechanism, the circ_0001946/miR‐1290/SOX6 ceRNA crosstalk, for the anti‐ESCC activity of circ_0001946.…
Discussion)
…SOX6 exerts a tumor‐suppressive activity in human ESCC by affecting cancer cell apoptosis and proliferation.30, 31, 39…
Discussion)
…Consistent with our findings, miR‐1269 and miR‐208 function as strong oncomirs in ESCC by targeting and repressing SOX6.31, 32…
Results)
…Moreover, the expression of SOX6 mRNA was closely associated with the tumor size, TNM stage, differentiation and lymph node metastasis of these tumors (Table 1).…
Show Full Abstract
<h4>Background</h4>Circular RNAs (circRNAs) can function as competing endogenous RNAs (ceRNAs) to impact the development of esophageal squamous cell cancer (ESCC). Human circ_0001946 has been identified as a potential anticancer factor in ESCC, yet our understanding of its molecular basis remains limited.<h4>Methods</h4>Circ_0001946, microRNA (miR)-1290 and SRY-box transcription factor 6 (SOX6) were quantified by quantitative reasl-time PCR (qRT-PCR) or immunoblotting. Cell proliferation was assessed by CCK-8 and EDU assays. Cell apoptosis and invasion were evaluated by flow cytometry and transwell assays, respectively. Cell migration was detected by transwell and wound-healing assays. The direct relationship between miR-1290 and circ_0001946 or SOX6 was determined by dual-luciferase reporter and RNA immunoprecipitation (RIP) assays. Xenograft model assays were used to assess the role of circ_0001946 in tumor growth.<h4>Results</h4>Circ_0001946 expression was attenuated in human ESCC, and circ_0001946 increase impeded cell proliferation, invasion, migration and enhanced apoptosis in vitro. Moreover, circ_0001946 increase diminished xenograft growth in vivo. Mechanistically, circ_0001946 bound to miR-1290, and re-expression of miR-1290 reversed circ_0001946-dependent cell properties. SOX6 was a miR-1290 target and it was responsible for the regulation of miR-1290 in cell properties. Furthermore, circ_0001946 functioned as a ceRNA to regulate SOX6 expression via miR-1290.<h4>Conclusion</h4>Our findings uncover an undescribed molecular mechanism, the circ_0001946/miR-1290/SOX6 ceRNA crosstalk, for the anti-ESCC activity of circ_0001946.
Also flagged:homocysteineHuntington diseaseHuntington's diseaseHDneurodegenerative disordercognition
Journal Article2022-04-12✓ 3 SnippetsMartínez-Lazcano JC, González-Guevara E, Boll C, Cárdenas G.
In-Text Gene Mentions
Abstract)
…Huntington's disease (HD), a neurodegenerative disorder caused by an expansion of the huntingtin triplet (Htt), is clinically characterized by cognitive and neuropsychiatric alterations.…
Abstract)
…the huntingtin triplet (Htt), is clinically characterized…
Abstract)
…related to mutantHtt(mHtt)-induced neurotoxicity, …
Show Full Abstract
Huntington's disease (HD), a neurodegenerative disorder caused by an expansion of the huntingtin triplet (Htt), is clinically characterized by cognitive and neuropsychiatric alterations. Although these alterations appear to be related to mutant Htt (mHtt)-induced neurotoxicity, several other factors are involved. The gut microbiota is a known modulator of brain-gut communication and when altered (dysbiosis), several complaints can be developed including gastrointestinal dysfunction which may have a negative impact on cognition, behavior, and other mental functions in HD through several mechanisms, including increased levels of lipopolysaccharide, proinflammatory cytokines and immune cell response, as well as alterations in Ca<sup>2+</sup> signaling, resulting in both increased intestinal and blood-brain barrier (BBB) permeability. Recently, the presence of dysbiosis has been described in both transgenic mouse models and HD patients. A bidirectional influence between host brain tissues and the gut microbiota has been observed. On the one hand, the host diet influences the composition and function of microbiota; and on the other hand, microbiota products can affect BBB permeability, synaptogenesis, and the regulation of neurotransmitters and neurotrophic factors, which has a direct effect on host metabolism and brain function. This review summarizes the available evidence on the pathogenic synergism of dysbiosis and homocysteine, and their role in the transgression of BBB integrity and their potential neurotoxicity of HD.
<i>Sox8</i> is a developmentally important transcription factor that plays an important role in sex maintenance and fertility of adult mice. In the B-type spermatogonial cells, <i>Sox8</i> is regulated by the long noncoding RNAs (lncRNA) <i>Mrhl</i> in a p68-dependant manner under the control of the Wnt signaling pathway. The downregulation of <i>Mrhl</i> leads to the meiotic commitment of the spermatogonial cells in a <i>Sox8</i>-dependant manner. While the molecular players involved in the regulation of transcription at the <i>Sox8</i> promoter have been worked out, our current study points to the involvement of the architectural proteins CTCF and cohesin in mediating a chromatin loop that brings the <i>Sox8</i> promoter in contact with a silencer element present within the gene body in the presence of lncRNA <i>Mrhl</i> concomitant with transcriptional repression. Further, lncRNA <i>Mrhl</i> interacts with the <i>Sox8</i> locus through the formation of a DNA:DNA:RNA triplex, which is necessary for the recruitment of PRC2 to the locus. The downregulation of lncRNA <i>Mrhl</i> results in the promoter-silencer loop giving way to a promoter-enhancer loop. This active transcription-associated chromatin loop is mediated by YY1 and brings the promoter in contact with the enhancer present downstream of the gene.
Also flagged:schizophreniamajor depression disordergene expressionTissue Expressionpsychiatric disorderscomplex
Journal Article2022-04-12No SnippetsLi X, Jiang L, Xue C, Li MJ, Li M.
Show Full Abstract
Linkage disequilibrium and disease-associated variants in the non-coding regions make it difficult to distinguish the truly associated genes from the redundantly associated genes for complex diseases. In this study, we proposed a new conditional gene-based framework called eDESE that leveraged an improved effective chi-squared statistic to control the type I error rates and remove the redundant associations. eDESE initially performed the association analysis by mapping variants to genes according to their physical distance. We further demonstrated that the isoform-level eQTLs could be more powerful than the gene-level eQTLs in the association analysis using a simulation study. Then the eQTL-guided strategies, that is, mapping variants to genes according to their gene/isoform-level variant-gene <i>cis</i>-eQTLs associations, were also integrated with eDESE. We then applied eDESE to predict the potential susceptibility genes of schizophrenia and found that the potential susceptibility genes were enriched with many neuronal or synaptic signaling-related terms in the Gene Ontology knowledgebase and antipsychotics-gene interaction terms in the drug-gene interaction database (DGIdb). More importantly, seven potential susceptibility genes identified by eDESE were the target genes of multiple antipsychotics in DrugBank. Comparing the potential susceptibility genes identified by eDESE and other benchmark approaches (i.e., MAGMA and S-PrediXcan) implied that strategy based on the isoform-level eQTLs could be an important supplement for the other two strategies (physical distance and gene-level eQTLs). We have implemented eDESE in our integrative platform KGGSEE (http://pmglab.top/kggsee/#/) and hope that eDESE can facilitate the prediction of candidate susceptibility genes and isoforms for complex diseases in a multi-tissue context.
<h4>Background</h4>Non-alcoholic fatty liver disease (NAFLD) is associated with an increased risk of cardiovascular events. HDL exerts various protective functions on the cardiovascular system including anti-inflammatory activity by suppressing adhesion molecules expression in inflammation-induced endothelial cells. This study was designed to search if the anti-inflammatory capacity of apolipoprotein B-depleted plasma (apoB-depleted plasma) is altered in NAFLD patients.<h4>Methods</h4>A total of 83 subjects including 42 NAFLD and 41 control subjects were included in this cross-sectional study. Anti-inflammatory function of HDL was determined as the ability of apoB-depleted plasma to inhibit tumor necrosis factor-α (TNF-α)-induced expression of adhesion molecules in human umbilical vein endothelial cells (HUVECs).<h4>Results</h4>Incubation of inflammation-stimulated HUVECs with the NAFLD patients' apo-B depleted plasma led to higher levels of expression of adhesion molecules compared to the control subjects' plasma samples, reflecting an impaired anti-inflammatory capacity of apoB-depleted plasma in the NAFLD patients. Impaired anti-inflammatory capacity of apoB-depleted plasma was correlated with fatty liver and obesity indices. After adjustment with obesity indices, the association of anti-inflammatory capacity of apoB-depleted plasma with NAFLD remained significant.<h4>Conclusion</h4>Impaired anti-inflammatory activity of apoB-depleted plasma was independently associated with NAFLD.
Also flagged:TransferrinObstructive Sleep ApneaObesityTFironmetabolism
Journal Article2022-04-12✓ 3 SnippetsMing X, Li Z, Yang X, Cai W, Wang G, Yang M, Pan D, Yuan Y, Chen X.
In-Text Gene Mentions
Discussion)
…Furthermore, TF serves as an upstream regulator of hepcidin, a liver-derived peptide hormone that controls iron homeostasis, by triggering hepcidin transcriptional activation via hemochromatosis-associated proteins (HFE and TfR2) [31].…
Methods)
…tion-related diseases (genetichemochromatosis), and taking iron…
Discussion)
…omatosis-associated proteins (HFEand TfR2) […
Show Full Abstract
<h4>Introduction</h4>Dysregulation of iron metabolism is closely associated with the development of obesity and obstructive sleep apnea (OSA), but little is known about the relationship between serum transferrin (TF) level and OSA severity. We aimed to verify this relationship and fit into account for obesity-related confounders among bariatric candidates.<h4>Methods</h4>We compared data retrospectively collected in 270 bariatric candidates. A propensity score-matched (PSM) analysis was used to determine the impact of iron metabolism on OSA severity independently of obesity. Univariate analysis was used to evaluate the relationship between serum TF level and the severity of OSA reflected by hypoxia and night awakenings parameters. Serum TF level to predict the severity of OSA was assessed by using univariate and multiple logistic regression model.<h4>Results</h4>The preliminary analysis showed that serum ferritin (113 ng/mL [50-203] vs. 79 ng/mL [40-130], p = 0.009) and TF (2.72 g/L [2.46-3.09] vs. 2.65 g/L [2.34-2.93], p = 0.039) level was significantly higher in the moderate/severe OSA group than the no/mild OSA group. After PSM analysis, there were 75 patients in each group and only serum TF level remained significant (p = 0.014). The proportion of patients with combined T2D and hyperlipidemia also remained higher in moderate/severe OSA groups. Univariate analysis showed that the group with higher degree of hypoxia had higher serum TF levels no matter the severity of OSA was grouped by oxygen desaturation index (ODI; 2.79 g/L [2.56-3.06] vs. 2.55 g/L [2.22-2.84], p < 0.001) or minimum oxygen saturation (SpO2nadir; 2.75 g/L [2.50-3.03] vs. 2.56 g/L [2.24-2.92], p = 0.009). Univariate and multiple logistic regression analysis further showed that serum TF level emerged as a significant and independent factor associated with OSA severity especially grouped by ODI (odds ratio: 2.91, 95% CI: 1.36-6.23, p = 0.006).<h4>Conclusion</h4>The existence of OSA exacerbates obesity comorbidities, particularly type 2 diabetes and hyperlipidemia. Serum TF level is associated with the severity of OSA independently of obesity and might be a potential identification and therapeutic targets.
Also flagged:diclofenac sodiumosteoarthritisjoint disorderOApathogenesisDiclofenac
Journal Article2022-04-12✓ 1 SnippetWang W, Yu S, Long Z, Liu Y, Yan Y, Sun T, Liu Z.
In-Text Gene Mentions
Methods)
…[RA], psoriatic arthritis),hemochromatosis, metabolic, or neuropathic…
Show Full Abstract
<h4>Background</h4>Hand osteoarthritis (OA) is a prevalent joint disorder and a great burden to both patients and society. While electroacupuncture (EA) and topical diclofenac sodium gel (DSG) are both currently used to treat OA, no head-to-head study of EA and topical DSG for hand OA exists. Thus, it remains unknown whether one intervention offers improved outcomes over the other. This study aims to compare the effects of EA and topical DSG in patients with hand OA.<h4>Methods</h4>A total of 108 participants with hand OA according to the American College of Rheumatology criteria will be recruited and randomly assigned to the EA group or topical DSG group with a 1:1 allocation ratio. Participants in the EA group will receive EA treatment thrice weekly for 4 weeks, followed by a 12-week follow-up. In the topical DSG group, topical DSG at a dose of 2 g over the affected joints per hand will be applied four times per day for 4 weeks. The outcomes will be measured at weeks 4, 8, and 16. The primary outcome will be the change in average overall finger joint pain intensity in the dominant hand from baseline to week 4. All outcome variables will be analyzed on an intention-to-treat principle. All statistical tests will be two-sided.<h4>Discussion</h4>This study will help determine which of the two treatment protocols, EA or topical DSG, is more effective for the clinical treatment of hand OA. Trial registration ClinicalTrials.gov identifier: NCT04402047. Registered 16 May 2020, https://clinicaltrials.gov/ct2/show/NCT04402047.
Also flagged:innate immunityimmune disorderscancersAkirin2Luciferasepro-inflammatory cytokines
Journal Article2022-04-12✓ 3 SnippetsLi S, Li L, Li J, Liang X, Song C, Zou Y.
In-Text Gene Mentions
Discussion)
…such as c-Jun,neuronal growth regulator 1growth regulator 1…
Discussion)
…growth regulator 1 (NEGR1), bcl-2, as well…
I A O 0000606)
…Neuronal growth regulator 1growth regulator 1…
Show Full Abstract
<h4>Background</h4>miR-203 was first indicated in maintaining skin homeostasis and innate immunity. Aberrant expression of miR-203 was found associated with pathological progressions of immune disorders, cancers, as well as neurodegenerations. Recently, increasing data on miR-203 in regulating neuroinflammation and neuronal apoptosis has raised extensive concern about the biological function of this microRNA.<h4>Methods</h4>Mouse model with ectopic miR-203 expression in the hippocampus was constructed by stereotactic injection of lentiviral expression vector of pre-miR-203. Association of miR-203 and mRNA of Akirin2, as well as the competition for miR-203 targeting between Akirin2 3'UTR and another recently characterized miR-203 target, 14-3-3θ, was verified using Dual-Luciferase Reporter Gene Assay and western blot. Microglia activation and pro-inflammatory cytokines expression in the hippocampus of mice overexpressing miR-203 was evaluated using immunohistochemistry analysis and western blot. Neuronal cell death was monitored using anti-caspase 8 in immunohistochemistry as well as TUNEL assay. Cognition of mice was assessed with a behavior test battery consisting of nesting behavior test, Barnes maze and fear conditioning test.<h4>Results</h4>Akirin2, an activator of NF-κB signaling, was identified as a direct target of miR-203. By also targeting 14-3-3θ, a negative regulator of NF-κB signaling, miR-203 displayed an overall pro-inflammatory role both in vitro and in vivo. Promoted nuclear translocation of NF-κB and increased expression of proinflammatory cytokines were observed in cultured BV2 cells transfected with miR-203 mimics. Microglia activation and upregulation of NF-κB, IL-1β and IL-6 were observed in mouse hippocampus with overexpression of miR-203. In addition, promoted neuronal cell death in the hippocampus and impaired neuronal activities resulted in cognitive dysfunction of mice with ectopic miR-203 expression in the hippocampus.<h4>Conclusion</h4>A pro-inflammatory and neurodisruptive role of miR-203 was addressed based on our data in this study. Given the identification of Akirin2 as a direct target of miR-203 and the competition with 14-3-3θ for miR-203 targeting, together with the findings of other signaling molecules in NF-κB pathway as targets of miR-203, we proposed that miR-203 was a master modulator, fine-tunning neuroinflammation by juggling different components of NF-κB signaling.
Also flagged:Chromosomesnucleichromatingene expressionorganizationmalaria
Journal Article2022-04-12No SnippetsLukyanchikova V, Nuriddinov M, Belokopytova P, Taskina A, Liang J, Reijnders MJMF, Ruzzante L, Feron R, Waterhouse RM, Wu Y, Mao C, Tu Z, Sharakhov IV, Fishman V.
Show Full Abstract
Chromosomes are hierarchically folded within cell nuclei into territories, domains and subdomains, but the functional importance and evolutionary dynamics of these hierarchies are poorly defined. Here, we comprehensively profile genome organizations of five Anopheles mosquito species and show how different levels of chromatin architecture influence each other. Patterns observed on Hi-C maps are associated with known cytological structures, epigenetic profiles, and gene expression levels. Evolutionary analysis reveals conservation of chromatin architecture within synteny blocks for tens of millions of years and enrichment of synteny breakpoints in regions with increased genomic insulation. However, in-depth analysis shows a confounding effect of gene density on both insulation and distribution of synteny breakpoints, suggesting limited causal relationship between breakpoints and regions with increased genomic insulation. At the level of individual loci, we identify specific, extremely long-ranged looping interactions, conserved for ~100 million years. We demonstrate that the mechanisms underlying these looping contacts differ from previously described Polycomb-dependent interactions and clustering of active chromatin.
Also flagged:deathtriple-negative breast cancerbreast cancerRegulated cell deathprogrammed cell deathcancer
Journal Article2022-04-12✓ 2 SnippetsLiao M, Qin R, Huang W, Zhu HP, Peng F, Han B, Liu B.
In-Text Gene Mentions
S I O 001029)
…In vivo, DCC-2036 could suppress the growth and metastasis of tumor-burden mice.…
S I O 001029)
…DCC-2036 was reported to exert an inhibitory effect on TNBC cells proliferation, migration and invasion, ultimately inducing apoptosis.…
Show Full Abstract
Triple-negative breast cancer (TNBC) is a subtype of human breast cancer with one of the worst prognoses, with no targeted therapeutic strategies currently available. Regulated cell death (RCD), also known as programmed cell death (PCD), has been widely reported to have numerous links to the progression and therapy of many types of human cancer. Of note, RCD can be divided into numerous different subroutines, including autophagy-dependent cell death, apoptosis, mitotic catastrophe, necroptosis, ferroptosis, pyroptosis and anoikis. More recently, targeting the subroutines of RCD with small-molecule compounds has been emerging as a promising therapeutic strategy, which has rapidly progressed in the treatment of TNBC. Therefore, in this review, we focus on summarizing the molecular mechanisms of the above-mentioned seven major RCD subroutines related to TNBC and the latest progress of small-molecule compounds targeting different RCD subroutines. Moreover, we further discuss the combined strategies of one drug (e.g., narciclasine) or more drugs (e.g., torin-1 combined with chloroquine) to achieve the therapeutic potential on TNBC by regulating RCD subroutines. More importantly, we demonstrate several small-molecule compounds (e.g., ONC201 and NCT03733119) by targeting the subroutines of RCD in TNBC clinical trials. Taken together, these findings will provide a clue on illuminating more actionable low-hanging-fruit druggable targets and candidate small-molecule drugs for potential RCD-related TNBC therapies.
Also flagged:rhodamine 6Gmethylacetic acidethylenediaminerhodaminecoumarin
Journal Article2022-04-12No SnippetsGheitarani B, Golshan M, Hosseini MS, Salami-Kalajahi M.
Show Full Abstract
Rhodamine 6G (Rh6G) is modified by ethylenediamine to obtain rhodamine with amine functional groups (Rh6G-NH<sub>2</sub>). Rh6G-NH<sub>2</sub> as an initial core is used to bond coumarin derivatives. Synthesized fluorescent colorants are specified using Fourier transform infrared spectroscopy (FT-IR), proton and carbon nuclear magnetic resonance (<sup>1</sup>H NMR and <sup>13</sup>C NMR), X-ray diffraction (XRD), and field emission scanning electron microscopy (FE-SEM) to analyze the structure of the fluorescent pigments. Fluorescence microscopy, fluorescence spectrophotometer, and UV-visible-NIR reflectance spectra are used to demonstrate the optical properties. UV-Vis-NIR reflectance spectra showed that synthesized colorants were transparent in NIR region. Also, photophysical properties of 2-(4-methyl-2-oxo-2H-chromen-7-yloxy) acetic acid (MOHCYAA), Rh6G-NH<sub>2</sub>, and hybrid 2-(4-methyl-2-oxo-2H-chromen-7-yloxy) acetic acid/rhodamine 6G (HMR) were investigated. Type of solvent had a strong effect on quantum yield. Rh6G-NH<sub>2</sub> (ϕ<sub>s</sub> = 0.66) and HMR (ϕ<sub>s</sub> = 0.72) displayed the maximum quantum yield in ethanol due to good interaction with ethanol and the formation of ring-opened amide form of rhodamine group. Finally, Rh6G-NH<sub>2</sub> and HMR displayed the maximum quantum yield in ethanol due to good interaction of structure with ethanol and the formation of ring-opened amide form of rhodamine group in compound.
Also flagged:Spinal cord injuryinflammatory responseaxonalmultiple sclerosisspinal cord ischemiaimmune response
Journal Article2022-04-12✓ 1 SnippetWu W, He S, Wu J, Chen C, Li X, Liu K, Qu JY.
In-Text Gene Mentions
Results)
…cord injured byDCCwere activated with…
Show Full Abstract
The spinal cord accounts for the main communication pathway between the brain and the peripheral nervous system. Spinal cord injury is a devastating and largely irreversible neurological trauma, and can result in lifelong disability and paralysis with no available cure. In vivo spinal cord imaging in mouse models without introducing immunological artifacts is critical to understand spinal cord pathology and discover effective treatments. We developed a minimally invasive intervertebral window by retaining the ligamentum flavum to protect the underlying spinal cord. By introducing an optical clearing method, we achieve repeated two-photon fluorescence and stimulated Raman scattering imaging at subcellular resolution with up to 15 imaging sessions over 6-167 days and observe no inflammatory response. Using this optically cleared intervertebral window, we study neuron-glia dynamics following laser axotomy and observe strengthened contact of microglia with the nodes of Ranvier during axonal degeneration. By enabling long-term, repetitive, stable, high-resolution and inflammation-free imaging of mouse spinal cord, our method provides a reliable platform in the research aiming at interpretation of spinal cord physiology and pathology.
Also flagged:Palmar fibromatosisfibrosispathogenesistranscription factorWilms Tumor 1WT1
Journal Article2022-04-12✓ 1 SnippetLuo J, Tugade T, Sun E, Pena Diaz AM, O'Gorman DB.
In-Text Gene Mentions
Text
…TNFSF4…
Show Full Abstract
Palmar fibromatosis, also known as Dupuytren's disease (DD), is a common and heritable fibrosis of the hand. It is characterized by the formation of myofibroblastic nodules that can progress to palmar-digital contractures and permanent loss of dexterity. The presence of inflammatory cell infiltrate within these nodules has been interpreted to suggest a pathogenesis mediated by a proinflammatory microenvironment. However, the molecular mechanisms driving the formation of pro-fibrotic microenvironments in this and other fibroses remain unclear. To gain insights into this process, we have assessed the contributions of an alternatively spliced, multi-functional transcription factor, Wilms Tumor 1 (WT1), previously shown to be upregulated in primary myofibroblasts derived from DD tissues. Proinflammatory cytokine stimuli of DD myofibroblasts enhanced the expression of several distinct WT1 variants, the most sustained being a 5' truncated version of WT1, alternative WT1 (AWT1). Constitutive adenoviral expression of AWT1 in myofibroblasts derived from phenotypically non-fibrotic palmar fascia significantly induced the expression and secretion of proinflammatory cytokines, including some with potential as novel therapeutic targets. In summary, these data implicate roles for sustained AWT1 expression in DD as a transcriptional driver of a proinflammatory fascial milieu.
Also flagged:copperarsenictinorganizationOctanewater
Journal Article2022-04-12No SnippetsCaricola I, Charles A, Tirillò J, Charlton F, Barton H, Breglia F, Rossi A, Deflorian MC, De Marinis AM, Harris S, Pellegrini A, Scacchetti F, Boccuccia P, Miari M, Dolfini A.
Show Full Abstract
The article discusses results of organic residue analysis performed on ten copper-alloy daggers from Bronze Age Pragatto, Italy, c.1550-1250 BCE. Metal daggers are widespread in Chalcolithic and Bronze Age Europe, yet their social and practical roles are still hotly debated. Are they symbolic or functional? Are they tools or weapons? How were they used? For what tasks and on what materials? The research addresses these questions through a novel application of biochemical staining and SEM-EDX analysis. The method has proved successful in extracting and identifying animal residues located on cutting edges including bone, muscle, and tendons. These are interpreted as evidence of prehistoric carcass butchering and carving. Further residues were observed on blade faces and hafting plates or tangs; these are interpreted as remnants of bone handles and sheaths, the latter made of either wood fibers or processed hide and fur. The readings proposed in the article are validated by original experiments with replica daggers, as detailed in the Supplementary Materials. The analysis and experiments shed new light on Bronze Age metal daggers, showing that they were fully functional tools (and perhaps tool-weapons) primarily utilized for the processing of animal carcasses. This original research result contributes significant knowledge towards interpreting an under-studied, yet socially salient, prehistoric metal artifact.
…ll-characterized patients withHFE hemochromatosishemochromatosis and liver…
Abstract)
…and 47 hadhemochromatosisarthritis.…
Show Full Abstract
<h4>Objective</h4>To evaluate whether arthritis predicts the likelihood of advanced hepatic fibrosis in HFE hemochromatosis.<h4>Patients and methods</h4>We conducted a retrospective, cross-sectional analysis of 112 well-characterized patients with HFE hemochromatosis and liver biopsy-validated fibrosis staging recruited between January 1, 1983, and December 31, 2013. Complete clinical, biochemical, hematologic, and noninvasive serum biochemical indices (aspartate aminotransferase to platelet ratio index [APRI] and fibrosis 4 index [FIB4]) were available. Scheuer fibrosis stages 3 and 4, APRI greater than 0.44, or FIB4 greater than 1.1 were used to define advanced hepatic fibrosis. Comparisons between groups were performed using categorical analysis, unpaired or paired t test.<h4>Results</h4>Male (n=76) and female (n=36) patients were similar in age. Nineteen patients had advanced hepatic fibrosis, and 47 had hemochromatosis arthritis. Arthritis was significantly associated with the presence of advanced hepatic fibrosis as determined by liver biopsy (sensitivity, 84%, [95% CI, 62% to 95%]; negative predictive value, 95% [95% CI, 87% to 99%]; relative risk, 7.4 [95% CI, 2.5 to 23]; P<.001), APRI (sensitivity, 75% [95% CI, 55% to 88%]; negative predictive value, 91% [95% CI, 81% to 96%]; relative risk, 4.5 [95% CI, 2.0 to 10.2]; P<.001), or FIB4 (sensitivity, 61% [95% CI, 41% to 78%]; negative predictive value, 67% [95% CI, 68% to 90%]; relative risk, 2.2 [95% CI, 1.1 to 4.6]; P=.03). Mean cell volume values were significantly higher pretreatment in patients with F3-4 fibrosis (96.7±1.1 fL) compared with F0-2 fibrosis (93.4±0.5 fL; P=.004) and declined following treatment (F3-4, 93.2±0.9 fL, P=.01; F0-2, 91.7±0.6 fL, P=.01).<h4>Conclusion</h4>Advanced hepatic fibrosis is strongly associated with arthritis in HFE hemochromatosis. The absence of arthritis predicts a low likelihood of advanced hepatic fibrosis, supporting its use as a clinical marker for advanced hepatic fibrosis in HFE hemochromatosis.
Axon guidance proteins are essential for axonal pathfinding during development. In adulthood, they have been described as pleiotropic proteins with multiple roles in different organs and tissues. While most studies on the roles of these proteins in the cornea have been performed on the Semaphorin family members, with few reports on Netrins or Ephrins, their function in corneal epithelium wound healing and functional nerve regeneration is largely unknown. Here, we studied the expression of ligands belonging to three distinct axon guidance families (Semaphorins, Ephrins, and Netrins) and their most commonly associated receptors in the cornea and trigeminal ganglia (TG) using immunofluorescence staining and RT-qPCR. We also evaluated how their expression recovers after corneal epithelium injury. We found that all ligands studied (Sema3A, Sema3F, EphrinB1, EphrinB2, Netrin-1, and Netrin-4) are abundantly expressed in both the TG and corneal epithelium. Similarly, their receptors (Neuropilin-1, Neuropilin-2, PlexinA1, PlexinA3, EphB2, EphB4, Neogenin, UNC5H1 and DCC) are also expressed in both tissues. Upon corneal epithelium injury, quick recovery of both ligands and receptors was observed at the protein and gene expression levels. While the timing and expression levels vary among these proteins, in general, most of them remained upregulated for several weeks after injury. We propose that the initial protein expression recovery may be related to corneal epithelium recovery since Sema3A, EphrinB2 and Netrin-4 accelerated corneal epithelial cells wound healing. The sustained high expression levels may be functionally related to nerve regeneration and/or patterning. Whilst further studies are required to test this hypothesis, this work contributes to unraveling their function in normal and injured cornea.
Also flagged:ADGene Expressionfocal adhesionextracellular matrix receptorMLECENTPD7
Journal Article2022-04-12No SnippetsLiu DB, He YF, Chen GJ, Huang H, Xie XL, Lin WJ, Peng ZJ.
Show Full Abstract
<h4>Background</h4>Aortic dissection (AD) is a rare and lethal disorder with its genetic basis remains largely unknown. Many studies have confirmed that circRNAs play important roles in various physiological and pathological processes. However, the roles of circRNAs in AD are still unclear and need further investigation. The present study aimed to elucidate the underlying molecular mechanisms of circRNAs regulation in AD based on the circRNA-associated competing endogenous RNA (ceRNA) network.<h4>Methods</h4>Expression profiles of circRNAs (GSE97745), miRNAs (GSE92427), and mRNAs (GSE52093) were downloaded from Gene Expression Omnibus (GEO) databases, and the differentially expressed RNAs (DERNAs) were subsequently identified by bioinformatics analysis. CircRNA-miRNA-mRNA ceRNA network, Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were used to predict the potential functions of circRNA-associated ceRNA network. RNA was isolated from human arterial blood samples after which qRT-PCR was performed to confirm the DERNAs.<h4>Results</h4>We identified 14 (5 up-regulated and 9 down-regulated) differentially expressed circRNAs (DEcircRNAs), 17 (8 up-regulated and 9 down-regulated) differentially expressed miRNAs (DEmiRNAs) and 527 (297 up-regulated and 230 down-regulated) differentially expressed mRNAs (DEmRNAs) (adjusted <i>P</i>-value <0.05 and | log2FC | > 1.0). KEGG pathway analysis indicated that DEmRNAs were related to focal adhesion and extracellular matrix receptor interaction signaling pathways. Simultaneously, the present study constructed a ceRNA network based on 1 circRNAs (hsa_circRNA_082317), 1 miRNAs (hsa-miR-149-3p) and 10 mRNAs (MLEC, ENTPD7, SLC16A3, SLC7A8, TBC1D16, PAQR4, MAPK13, PIK3R2, ITGA5, SERPINA1). qRT-PCR demonstrated that hsa_circRNA_082317 and ITGA5 were significantly up-regulated, and hsa-miR-149-3p was dramatically down-regulated in AD (n = 3).<h4>Conclusion</h4>This is the first study to demonstrate the circRNA-associated ceRNA network is altered in AD, implying that circRNAs may play important roles in regulating the onset and progression and thus may serve as potential biomarkers for the diagnosis and treatment of AD.
Also flagged:lipidglucose intoleranceglucoseinsulindetoxificationsecretion
Journal Article2022-04-12✓ 1 SnippetChazarin B, Benhaim-Delarbre M, Brun C, Anzeraey A, Bertile F, Terrien J.
In-Text Gene Mentions
Results)
…p = 0.067;PRDX6, +31%, p =…
Show Full Abstract
Grey mouse lemurs (<i>Microcebus murinus</i>) are primates that respond to environmental energetic constraints through strong physiological seasonality. They notably fatten during early winter (EW), and mobilize their lipid reserves while developing glucose intolerance during late winter (LW), when food availability is low. To decipher how the hepatic mechanisms may support such metabolic flexibility, we analyzed the liver proteome of adult captive male mouse lemurs, whose seasonal regulations are comparable to their wild counterparts. We highlight profound hepatic changes that reflect fat accretion in EW at the whole-body level, without triggering an ectopic storage of fat in the liver, however. Moreover, molecular regulations are consistent with the decrease in liver glucose utilization in LW, and therefore with reduced tolerance to glucose. However, no major regulation was seen in insulin signaling/resistance pathways. Fat mobilization in LW appeared possibly linked to the reactivation of the reproductive system while enhanced liver detoxification may reflect an anticipation to return to summer levels of food intake. Overall, these results show that the physiology of mouse lemurs during winter relies on solid molecular foundations in liver processes to adapt fuel partitioning while opposing the development of a pathological state despite large lipid fluxes.
Also flagged:OligonucleotidesSynthesisoligonucleotideDMDbile acidsfatty acids
Journal Article2022-04-12No SnippetsMarchesi E, Cortesi R, Preti L, Rimessi P, Sguizzato M, Bovolenta M, Perrone D.
Show Full Abstract
Our groups previously reported that conjugation at 3'-end with ursodeoxycholic acid (UDCA) significantly enhanced in vitro exon skipping properties of ASO 51 oligonucleotide targeting the human DMD exon 51. In this study, we designed a series of lipophilic conjugates of ASO 51, to explore the influence of the lipophilic moiety on exon skipping efficiency. To this end, three bile acids and two fatty acids have been derivatized and/or modified and conjugated to ASO 51 by automatized solid phase synthesis. We measured the melting temperature (<i>T</i><sub>m</sub>) of lipophilic conjugates to evaluate their ability to form a stable duplex with the target RNA. The exon skipping efficiency has been evaluated in myogenic cell lines first in presence of a transfection agent, then in gymnotic conditions on a selection of conjugated ASO 51. In the case of 5'-UDC-ASO 51, we also evaluated the influence of PS content on exon skipping efficiency; we found that it performed better exon skipping with full PS linkages. The more efficient compounds in terms of exon skipping were found to be 5'-UDC- and 5',3'-bis-UDC-ASO 51.
Also flagged:EpilepsyDepressionGene ExpressionCD3GSLCO3A1neurological disease
Journal Article2022-04-12✓ 1 SnippetLin H, Lin WH, Lin F, Liu CY, Che CH, Huang HP.
In-Text Gene Mentions
Results)
…on the chromosomes:VRK2/FANCL at 2p16.1, HIST1H2BN/PG…
Show Full Abstract
Current epidemiological and experimental studies have indicated the overlapping genetic foundation of epilepsy and depression. However, the detailed pleiotropic genetic etiology and neurobiological pathways have not been well understood, and there are many variants with underestimated effect on the comorbidity of the two diseases. Utilizing genome-wide association study (GWAS) summary statistics of epilepsy (15,212 cases and 29,677 controls) and depression (170,756 cases and 329,443 controls) from large consortia, we assessed the integrated gene-based association with both diseases by Multimarker Analysis of Genomic Annotation (MAGMA) and Fisher's meta-analysis. On the one hand, shared genes with significantly altered transcripts in Gene Expression Omnibus (GEO) data sets were considered as possible pleiotropic genes. On the other hand, the pathway enrichment analysis was conducted based on the gene lists with nominal significance in the gene-based association test of each disease. We identified a total of two pleiotropic genes (<i>CD3G</i> and <i>SLCO3A1</i>) with gene expression analysis validated and interpreted twenty-five common biological process supported with literature mining. This study indicates the potentially shared genes associated with both epilepsy and depression based on gene expression, meta-data analysis, and pathway enrichment strategy along with traditional GWAS and provides insights into the possible intersecting pathways that were not previously reported.
Also flagged:Histonelysinetranscription factorKLF4endometriosisH3
Journal Article2022-04-12✓ 2 SnippetsRytkönen KT, Faux T, Mahmoudian M, Heinosalo T, Nnamani MC, Perheentupa A, Poutanen M, Elo LL, Wagner GP.
In-Text Gene Mentions
Results)
…Several of the genes found with both H3K4me3 extension and upregulation in endometriosis are involved in cell survival (KLF2, NUAK1, NDRG1, and SGK1) and angiogenesis or fibrosis (RARRES2, SERPINE2, S100A10, TNFSF4, and ACTA2) (Table S5).…
Results)
…, S100A10 ,TNFSF4, and ACTA2…
Show Full Abstract
Trimethylation of histone H3 at lysine 4 (H3K4me3) is a marker of active promoters. Broad H3K4me3 promoter domains have been associated with cell type identity, but H3K4me3 dynamics upon cellular stress have not been well characterized. We assessed this by exposing endometrial stromal cells to hypoxia, which is a major cellular stress condition. We observed that hypoxia modifies the existing H3K4me3 marks and that promoter H3K4me3 breadth rather than height correlates with transcription. Broad H3K4me3 domains mark genes for endometrial core functions and are maintained or selectively extended upon hypoxia. Hypoxic extension of H3K4me3 breadth associates with stress adaptation genes relevant for the survival of endometrial cells including transcription factor KLF4, for which we found increased protein expression in the stroma of endometriosis lesions. These results substantiate the view on broad H3K4me3 as a marker of cell identity genes and reveal participation of H3K4me3 extension in cellular stress adaptation.
Also flagged:CellTranscriptomesgene expressioninfectioncell activationNF-kappa B
Journal Article2022-04-12✓ 5 SnippetsWang Q, Wang Z, Zhang J, Zhang Q, Zheng M, Wen J, Zhao G, Li Q.
In-Text Gene Mentions
Introduction)
…We also found that the expression of lncRNA MSTRG.14019.1 was significantly increased at 12 h post infection (hpi) with H5N1 AIV, which is contrary to the expression trend of CSE1L. Thus, these results suggest that lncRNA MSTRG.14019.1 may inhibit the replication of H5N1 AIV by inhibiting the expression of CSE1L.…
Discussion)
…We also mapped the regulatory networks of differential lncRNAs and their target genes during viral infection, and found that the cis-acting lncRNA MSTRG.14019.1 targeted CSE1L and may affect virus replication.…
Methods)
…After transfection with siRNA targeting the CSE1L gene or the negative control siRNA, all of the DF1 cells were infected with the SY virus at a multiplicity of infection of 0.1 PFU.…
Abstract)
…lncRNA MSTRG.14019.1 targetedCSE1Land may affect…
Introduction)
…influenza promoting gene,CSE1L, which may…
Show Full Abstract
H5N1 avian influenza virus (AIV) is a highly pathogenic influenza virus that poses a substantial threat to poultry production and public health. A comprehensive understanding of host-pathogen interactions for AIV requires knowledge of gene expression changes in both the pathogen and the host upon infection. We report the use of dual RNA sequencing technology to uncover trends in gene expression in H5N1 AIV and chickens (DF1 cells) during the course of infection. The expression of all viral genes increased continuously from 0 to 20 h post infection. We also identified 2,762 differentially expressed host genes during infection. Pathway analysis found that genes related to the signaling pathways of DNA replication, T cell activation, NF-kappa B signaling pathway, and RNA degradation were significantly enriched. We demonstrated that the <i>cis</i>-acting lncRNA MSTRG.14019.1 targeted <i>CSE1L</i> and may affect virus replication. This study provides a more comprehensive and detailed understanding of host-virus interactions at the RNA level during the course of H5N1 AIV infection.
Also flagged:NHE6NKCC1autoimmune inner ear diseasepresbycusisadherens junctionsTight junctions
Journal Article2022-04-12✓ 1 SnippetSekulic-Jablanovic M, Paproth J, Sgambato C, Albano G, Fuster DG, Bodmer D, Petkovic V.
In-Text Gene Mentions
Results)
…, Nov ,Ptgis, Lepr ,…
Show Full Abstract
Acoustic trauma, autoimmune inner ear disease, and presbycusis feature loss of the integrity of the blood-labyrinth barrier (BLB). Normal BLB function depends on endothelial structural integrity, which is supported and maintained by tight junctions and adherens junctions within the microvascular endothelial layer. When these junctions are disrupted, vascular leakage occurs. Tight junctions and adherens junctions are functionally and structurally linked, but the exact signaling pathways underlying their interaction remain unknown. In addition, solute carriers (SC) are essential for optimal exchange through BLB. Previously, we found that SC family member, the sodium-hydrogen exchanger NHE6, was expressed in all wildtype cochlear tissues, and that <i>Nhe6</i>-knockout mice displayed moderate hearing loss. Moreover, NHE6 depletion affected Trk protein turnover and endosomal signaling. Here, we investigated whether NHE6 might impact BLB integrity. We found that <i>Nhe6</i>-knockout, BLB-derived endothelial cells showed reduced expression of major junctional genes: <i>Tjp1</i>, <i>F11r</i>, <i>Ocln</i>, <i>Cdh5</i>, and <i>Cldn5</i>. Co-culturing BLB-derived endothelial cells with pericytes and/or perivascular resident macrophage-like melanocytes in a transwell system showed that monolayers of <i>Nhe6</i>-knockout BLB-derived cells had lower electrical resistance and higher permeability, compared to wildtype endothelial monolayers. Additionally, another SC, NKCC1, which was previously linked to congenital deafness, was downregulated in our <i>Nhe6</i>-knockout mouse model. Blocking NKCC1 with a NKCC1-specific inhibitor, bumetanide, in wildtype BLB-derived endothelial cells also caused the downregulation of major junctional proteins, particularly <i>Tjp1</i> and <i>F11r</i>, which encode the zonula occludens and junctional adhesion molecule-1 proteins, respectively. Moreover, bumetanide treatment increased cell permeability. In conclusion, we showed that the lack or inhibition of NHE6 or NKCC1 affected the permeability of endothelial BLB-derived cells. These findings suggested that NHE6 and NKCC1 could serve as potential targets for modifying BLB permeability to facilitate drug delivery across the BLB to the cochlea or to protect the cochlea from ototoxic insults.
Also flagged:peroxisome proliferator-activated receptorPPARinfectionTFF2LYPD8REG4
Journal Article2022-04-12✓ 5 SnippetsChen W, Lv X, Zhang W, Hu T, Cao X, Ren Z, Getachew T, Mwacharo JM, Haile A, Sun W.
In-Text Gene Mentions
Discussion)
…In our present study, we identified 3 genes (OLFM4, LYPD8, and REG4) that regulate the immune response of IECs, and these genes were notably more highly expressed in AN lambs than they were in SE lambs.…
It has long been recognized that enterotoxigenic <i>Escherichia coli</i> (ETEC) is the major pathogen responsible for vomiting and diarrhea. <i>E. coli</i> F17, a main subtype of ETEC, is characterized by high morbidity and mortality in young livestock. However, the transcriptomic basis underlying <i>E. coli</i> F17 infection has not been fully understood. In the present study, RNA sequencing was conducted to explore the expression profiles of mRNAs and long non-coding RNAs (lncRNAs) in the jejunum of lambs who were identified as resistant or sensitive to <i>E. coli</i> F17 that was obtained in a challenge experiment. A total of 772 differentially expressed (DE) mRNAs and 190 DE lncRNAs were detected between the <i>E. coli</i> F17-resistance and <i>E. coli</i> F17-sensitive lambs (i.e., <i>TFF2, LOC105606142, OLFM4, LYPD8, REG4, APOA4</i>, TCONS_00223467, and TCONS_00241897). Then, a two-step machine learning approach (RX) combination Random Forest and Extreme Gradient Boosting were performed, which identified 16 mRNAs and 17 lncRNAs as potential biomarkers, within which <i>PPP2R3A</i> and TCONS_00182693 were prioritized as key biomarkers involved in <i>E. coli</i> F17 infection. Furthermore, functional enrichment analysis showed that peroxisome proliferator-activated receptor (PPAR) pathway was significantly enriched in response to <i>E. coli</i> F17 infection. Our finding will help to improve the knowledge of the mechanisms underlying <i>E. coli</i> F17 infection and may provide novel targets for future treatment of E. coli F17 infection.
Also flagged:idiopathic achalasiaprimary esophageal motility disorderperistalsispathogenesisachalasiacell adhesion molecule
Journal Article2022-04-12✓ 3 SnippetsLu C, Wei F, He X, Yao X, Yu C.
In-Text Gene Mentions
Abstract)
…(Down FC: 4.60),NEGR1(Down FC: 2.335),…
Results)
…(Down FC: 10.43),NEGR1(Down FC: 2.335),…
Discussion)
…NTNG2, CADM1, NLGN1,NEGR1) and immune system…
Show Full Abstract
Idiopathic achalasia is a primary esophageal motility disorder characterized by the absence of esophageal peristalsis and impaired relaxation of the lower esophageal sphincter (LES). However, the pathogenesis of idiopathic achalasia remains unclear. To further understand the pathogenesis, we conducted lncRNA and mRNA microarray analyses. LES specimens from 5 patients and 4 controls were used for microarray. Potential target genes with significantly changed lncRNA and mRNA were predicted using cis/trans-regulatory algorithms, followed by the Gene Ontology and KEGG pathway enrichment analysis to understand the biophysical effect. Finally, 7,133 significantly dysregulated mRNAs (3,136 increased and 3,997 decreased), along with 6,892 significantly dysregulated lncRNAs (4,900 increased and 1,992 decreased). Biophysical function analysis revealed that the cell adhesion molecule (CAM) pathway was a common pathway. The predicted lncRNA targets of NRXN1 (Down FC: 9.07), NTNG2 (UP FC: 2.75), CADM1 (Down FC: 2.26), NLGN1 (Down FC: 4.60), NEGR1 (Down FC: 2.335), CD22 (Down FC: 5.62), HLA-DQB1 (Down FC: 5.06), and HLA-DOA (Down FC: 2.31) were inputted in this pathway, which was mainly located in the synapse part of the neural system and immune system. Our study demonstrates the lncRNAs and corresponding mRNAs that may play important roles in idiopathic achalasia.
<h4>Background</h4>Patients with liver cirrhosis have altered hepatic synthetic functions which theoretically result in reduced levels of pro-and anti-coagulant factors as well as thrombocytopenia. Initially, cirrhotic patients were thought to be at an increased risk of bleeding and a reduced risk of thrombosis. Several studies have recently reported an increased occurrence of venous thromboembolism (VTE) in cirrhotic patients. In this study, we aimed to assess the current practice of deep venous thrombosis (DVT) prophylaxis, the incidence and predictors of VTE, and the associated bleeding sequelae in patients with liver cirrhosis.<h4>Methods</h4>A retrospective cohort study was performed. We included all adult patients with a diagnosis of liver cirrhosis from January 2010 to June 2019 admitted to the hospital. Our cohort patients were divided into two groups, cirrhotic patients with pharmacological VTE prophylaxis and those with mechanical or no VTE prophylaxis.<h4>Results</h4>We included 601 cirrhotic patients in our study. The incidence of VTE occurring within the first 6 months of their admission was 1.5%. Seven patients (1.49%) developed VTE with the majority being DVTs while not on pharmacologic prophylaxis, and two patients developed VTE despite being on pharmacologic prophylaxis; however, there was no statistical difference. Alcohol use was the most common underlying cause of liver cirrhosis (40.4%), followed by chronic hepatitis C (21.1%), and nonalcoholic steatohepatitis (11.3%). Out of the 601 patients included, 69 patients received neither pharmacologic nor mechanical VTE prophylactic agent (11.48%), while the remaining majority received either pharmacological or mechanical prophylaxis (88.52%).<h4>Conclusions</h4>Our study did not show a statistically significant association between the use of pharmacological VTE prophylactic agents and a reduction in the risk of VTE in cirrhotic patients. The rates of usage of DVT prophylactic agents among our Northwell hospitals during the study period appeared to be no longer suboptimal when compared to prior studies. Low albumin appears to be a predictor factor to develop VTE. There was a statistically significant increase in bleeding risk and transfusion requirement in cirrhotic patients receiving no pharmacological VTE prophylactic agents. Further prospective trials are needed to shed more light on this subject and identify the group of cirrhotic patients who could safely benefit from pharmacologic VTE prophylaxis.
Exposure to fungi is inevitable, yet only a small number of patients with significant clinical risk develop invasive aspergillosis (IA). While timing of exposure in relation to immune status, environmental and occupational factors will influence the probability of developing IA, factors specific to the individual will likely play a role and variation in the host's genetic code associated with the immunological response to fungi have been linked to increased risk of developing IA. Screening for SNPs in genes significantly associated with IA (e.g. Pentraxin-3, Toll-like receptor 4, Dectin-1, DC-SIGN) could form part of the clinical work-up on admission or post allogeneic stem cell transplantation, to complement fungal biomarker screening. Through the combination of clinical and genetic risk with mycological evidence, we are approaching a time when we should be able to accurately predict the risk of IA in the haematology patient, using predictive modelling to stratifying each individual's management. Understanding the host and their immune responses to infection through genomics, transcriptomics and metabolomics/proteomics is critical to achieving how we manage the individual's risk of IA, underpinning personalized medicine. This review will investigate what is known about the genetic risk associated with developing IA, primarily in haematology patients and whether these strategies are ready to be incorporated into routine clinical practice, and if not what are the remaining hurdles to implementation.
Also flagged:genetic diseasesCRISPRCRISPR-Casfermentationcluster regularly interspaced short palindromicnuclease
Journal Article2022-04-12No SnippetsParsaeimehr A, Ebirim RI, Ozbay G.
Show Full Abstract
The CRISPR-Cas systems have offered a flexible, easy-to-use platform to precisely modify and control the genomes of organisms in various fields, ranging from agricultural biotechnology to therapeutics. This system is extensively used in the study of infectious, progressive, and life-threatening genetic diseases for the improvement of quality and quantity of major crops and in the development of sustainable methods for the generation of biofuels. As CRISPR-Cas technology continues to evolve, it is becoming more controllable and precise with the addition of molecular regulators, which will provide benefits for everyone and save many lives. Studies on the constant growth of CRISPR technology are important due to its rapid development. In this paper, we present the current applications and progress of CRISPR-Cas genome editing systems in several fields of research, we further highlight the applications of anti-CRISPR molecules to regulate CRISPR-Cas gene editing systems, and we discuss ethical considerations in CRISPR-Cas applications.
PsyArXiv2022-04-12Preprint (No Snippets API)Shapouri S.
Show Full Abstract
<p>Among four proposed origins of individualism-collectivism, modernization theory, rice versus wheat theory, climato-economic theory, and pathogen stress theory, the latter has gained more attention in cross cultural and evolutionary psychology. Parasite stress theory gained even more popularity after the COVID pandemic as it makes a connection between infectious diseases and cultural orientations. But despite extensive research on parasite stress theory, it is not still clear what kind of infectious disease contribute more to the emergence of cultures, what are the possible mechanism through which pathogenic threat give rise to cultural systems, and how parasite stress might affect vertical vs. horizontal dimensions of individualism-collectivism. This review summarizes and integrates major findings of parasite stress theory related to individualism-collectivism and discusses future directions that researchers can take to answer remaining questions.</p>
Research Square2022-04-12Preprint (No Snippets API)Song H, Zhu H, Xiao Y, Liu T, Zeng Y, Pan Z, Cheng F, Yang K.
Show Full Abstract
<title>Abstract</title> <p><bold>Background: </bold>Autophagy has been increasingly recognized as a critical regulatory mechanism in the maintenance of cellular homeostasis. A previous study showed that phospholipase C-like protein 1 (PLCL1) is associated with the lipid metabolism of clear cell renal cell carcinoma (ccRCC). However, it is unclear whether PLCL1 regulates autophagy, thereby influencing the progression of ccRCC.<bold>Results: </bold>Bioinformatics analysis revealed and confirmed that expression of PLCL1 is decreased in tumors and is correlated with prognosis in ccRCC patients. Elevated PLCL1 levels decreased proliferation capacity and invasion while promoting apoptosis, but PLCL1 knockdown reversed these changes in ccRCC cells compared to controls. Mechanistic investigations confirmed that PLCL1 induces autophagy by activating the AMPK/mTOR pathway and interacting with DEPP. The results in mouse models demonstrated that PLCL1 inhibits ccRCC tumor growth.<bold>Conclusion: </bold>Our data suggest that PLCL1 suppresses ccRCC progression by activating the AMPK/mTOR pathway and interacting with DEPP, initiating autophagy and inducing apoptosis. PLCL1 may be a promising target for the treatment of ccRCC patients.</p>
Also flagged:DCIScalcium phosphateHydroxyapatitemineralmagnesiumoctacalcium phosphate
Journal Article2022-04-11No SnippetsGosling S, Calabrese D, Nallala J, Greenwood C, Pinder S, King L, Marks J, Pinto D, Lynch T, Lyburn ID, Hwang ES, Grand Challenge Precision Consortium, Rogers K, Stone N.
Show Full Abstract
Ductal carcinoma <i>in situ</i> (DCIS) is frequently associated with breast calcification. This study combines multiple analytical techniques to investigate the heterogeneity of these calcifications at the micrometre scale. X-ray diffraction, scanning electron microscopy and Raman and Fourier-transform infrared spectroscopy were used to determine the physicochemical and crystallographic properties of type II breast calcifications located in formalin fixed paraffin embedded DCIS breast tissue samples. Multiple calcium phosphate phases were identified across the calcifications, distributed in different patterns. Hydroxyapatite was the dominant mineral, with magnesium whitlockite found at the calcification edge. Amorphous calcium phosphate and octacalcium phosphate were also identified close to the calcification edge at the apparent mineral/matrix barrier. Crystallographic features of hydroxyapatite also varied across the calcifications, with higher crystallinity centrally, and highest carbonate substitution at the calcification edge. Protein was also differentially distributed across the calcification and the surrounding soft tissue, with collagen and β-pleated protein features present to differing extents. Combination of analytical techniques in this study was essential to understand the heterogeneity of breast calcifications and how this may link crystallographic and physicochemical properties of calcifications to the surrounding tissue microenvironment.
Also flagged:histone variantRNA polymerase IIcancerlocalizationbreast cancerheterochromatin
Journal Article2022-04-11✓ 1 SnippetRecoules L, Heurteau A, Raynal F, Karasu N, Moutahir F, Bejjani F, Jariel-Encontre I, Cuvier O, Sexton T, Lavigne AC, Bystricky K.
In-Text Gene Mentions
Results)
…, HACE1 andFBXL4, which are…
Show Full Abstract
The histone variant macroH2A1.1 plays a role in cancer development and metastasis. To determine the underlying molecular mechanisms, we mapped the genome-wide localization of endogenous macroH2A1.1 in the human breast cancer cell line MDA-MB-231. We demonstrate that macroH2A1.1 specifically binds to active promoters and enhancers in addition to facultative heterochromatin. Selective knock down of macroH2A1.1 deregulates the expression of hundreds of highly active genes. Depending on the chromatin landscape, macroH2A1.1 acts through two distinct molecular mechanisms. The first mitigates excessive transcription by binding over domains including the promoter and the gene body. The second stimulates expression of RNA polymerase II (Pol II)-paused genes, including genes regulating mammary tumor cell migration. In contrast to the first mechanism, macroH2A1.1 specifically associates with the transcription start site of Pol II-paused genes. These processes occur in a predefined local 3D genome landscape, but do not require rewiring of enhancer-promoter contacts. We thus propose that macroH2A1.1 serves as a transcriptional modulator with a potential role in assisting the conversion of promoter-locked Pol II into a productive, elongating Pol II.
Also flagged:acute lymphoblastic leukemiasteroidpsychosishyperglycemiainsulinacute kidney injury
Journal Article2022-04-11✓ 3 SnippetsKranjčec I, Matijašić N, Abdović S, Hižar Gašpar I, La Grasta Sabolić L, Jadrijević-Cvrlje F.
In-Text Gene Mentions
Discussion)
…Hereditary hemochromatosis gene (HFE) mutations, which aggravate iron overload in ALL patients, were not detected in our case [24].…
Discussion)
…editary hemochromatosis gene (HFE) mutations, which aggravate…
Discussion)
…on choroid plexushemochromatosis, as it is…
Show Full Abstract
<h4>Background</h4>Adolescents and young adults diagnosed with acute lymphoblastic leukemia are treated according to pediatric-based regimens to achieve better results. However, implementation of intensive chemotherapy protocols in this age group is associated with increased treatment-related toxicities, affecting almost every organ and system. In this case, the focus of our interest was on rather rare entities: steroid-induced psychosis that seldom develops in children and adolescents, and choroid plexus hemosiderosis, infrequently identified as a first sign of iron overload.<h4>Case presentation</h4>The aim of this paper is to present a challenging case of a 15-year-old Caucasian male patient treated for high-risk acute lymphoblastic leukemia and who experienced various adverse incidents during intensive chemotherapy, thus necessitating a high-quality multidisciplinary approach. Slow minimal residual disease clearance was an additional concerning issue. Induction and re-induction were complicated by steroid-induced hyperglycemia that required multiple-week insulin. During consolidation, acute kidney injury on the basis of chronic kidney disease was verified, demanding subsequent drug dose modifications. By the end of re-induction, after dexamethasone cessation, infrequent steroid-induced psychosis, presented as incoherent speech, aggressive behavior, and mood swings, required intensive psychiatric support. Neurological evaluation of seizures revealed uncommon choroid plexus hemosiderosis by brain magnetic resonance imaging, warranting appropriate selection of iron chelation therapy in the context of preexisting nephropathy. Ultimately, iron deposits of moderate intensity were verified by liver magnetic resonance imaging, while heart tissue remained intact. The early diagnosis and adequate treatment of aforementioned difficult toxicities resulted in complete recovery of the patient.<h4>Conclusions</h4>Treating adolescents with high-risk acute leukemia and multiple therapy-related morbidities remains a challenge, even in the era of extensive and effective supportive therapy. Superior survival rates might be achieved by prompt recognition of both frequent and rarely encountered adverse episodes, as well as well-timed and appropriate management by a well-coordinated multidisciplinary team.
Also flagged:Tumoursolid tumourscancerextracellularcancerslung cancers
Journal Article2022-04-11No SnippetsGuo S, Chen X, Guo C, Wang W.
Show Full Abstract
Tumour-associated macrophages (TAMs) constitute a plastic and heterogeneous cell population of the tumour microenvironment (TME) that can account for up to 50% of solid tumours. TAMs heterogeneous are associated with different cancer types and stages, different stimulation of bioactive molecules and different TME, which are crucial drivers of tumour progression, metastasis and resistance to therapy. In this context, understanding the sources and regulatory mechanisms of TAM heterogeneity and searching for novel therapies targeting TAM subpopulations are essential for future studies. In this review, we discuss emerging evidence highlighting the redefinition of TAM heterogeneity from three different directions: origins, phenotypes and functions. We notably focus on the causes and consequences of TAM heterogeneity which have implications for the evolution of therapeutic strategies that targeted the subpopulations of TAMs.
Also flagged:Vitamin-D ReceptorVDRneuroblastomacarcinomas oftumorscancer
Journal Article2022-04-11No SnippetsKhazan N, Kim KK, Hansen JN, Singh NA, Moore T, Snyder CWA, Pandita R, Strawderman M, Fujihara M, Takamura Y, Jian Y, Battaglia N, Yano N, Teramoto Y, Arnold LA, Hopson R, Kishor K, Nayak S, Ojha D, Sharon A, Ashton JM, Wang J, Milano MT, Miyamoto H, Linehan DC, Gerber SA, Kawar N, Singh AP, Tabdanov ED, Dokholyan NV, Kakuta H, Jurutka PW, Schor NF, Rowswell-Turner RB, Singh RK, Moore RG.
Show Full Abstract
Vitamin-D receptor (VDR) mRNA is overexpressed in neuroblastoma and carcinomas of lung, pancreas, and ovaries and predicts poor prognoses. VDR antagonists may be able to inhibit tumors that overexpress VDR. However, the current antagonists are arduous to synthesize and are only partial antagonists, limiting their use. Here, we show that the VDR antagonist MeTC7 (<b>5</b>), which can be synthesized from 7-dehydrocholesterol (<b>6</b>) in two steps, inhibits VDR selectively, suppresses the viability of cancer cell-lines, and reduces the growth of the spontaneous transgenic TH-MYCN neuroblastoma and xenografts <i>in vivo</i>. The VDR selectivity of <b>5</b> against RXRα and PPAR-γ was confirmed, and docking studies using VDR-LBD indicated that <b>5</b> induces major changes in the binding motifs, which potentially result in VDR antagonistic effects. These data highlight the therapeutic benefits of targeting VDR for the treatment of malignancies and demonstrate the creation of selective VDR antagonists that are easy to synthesize.
Also flagged:oligonucleotidespolyethylene glycolbetainedimethylsulfoxideOligonucleotidenucleic acid
Journal Article2022-04-11No SnippetsHaegele JA, Boyanapalli R, Goyal J.
Show Full Abstract
As oligonucleotides (ONs) and similar nucleic acid therapeutic modalities enter development pipelines, there is continual need to develop bioanalytical methodologies addressing unique challenges they pose. Novel ONs back bone chemistries, especially those enabling stereochemical control, and base modifications are being exploited to improve pharmacological properties, potency, and increase half-lives. These changes have strained established methods, oftentimes precluding development of assays sensitive and specific enough to meet the needs of preclinical programs. For stereopure ONs representing a single molecular species, nontrivial presence of chain-shortened metabolites in biological samples necessitate assays with high specificity. To meet these needs, this report presents a toolbox of novel techniques, easy to implement for existing hybridization-ligation enzyme-linked immunosorbent assay formats, which address this challenge and yield significant sensitivity and specificity enhancements. Ligation efficiency was improved up to 61-fold through addition of polyethylene glycol, betaine, or dimethylsulfoxide, mitigating major differences among sequence-matched ONs of varying stereopurity, enabling sensitivities below 0.100 ng/mL for quantitation. These improvements enabled further refinement of capture probe designs engendering sufficient specificity to discriminate N-1 chain-shortened metabolites at both the 5' and 3' end of the ONs. These generalizable methods advance the performance of mainstay bioanalytical assays, facilitating research and development of innovative ONs therapeutics.
…Supplementary Figure 7E shows the signaling pathways that they may participate in, which is consistent with LUAD, primarily cell proliferation and is also related to remodeling of epithelial adherens junctions and multiple cancer signaling pathways as well as the possible signaling interaction relationship. Among these molecules, NCPAG and SLC2A1 are related to ALDOA (Supplementary Figure 7F), and PKM, SMARCA4, and TRIM28 are related to FBP1 (Supplementary Figure 7G). Similar gene ontology results between LUAD and LIHC indicate that similar molecules may be involved. The Venn diagram results identified 30 molecules related to ALDOA and FBP1 in both LUAD and LIHC (Figure 4C) (Supplementary Table 7). Notably, the IPA results not only showed involvement in glycolysis and gluconeogenesis but also showed that they were related to the kinetochore metaphase signaling pathway, Wnt/β-catenin signaling, sperm motility and Huntington's disease signaling (Figure 4D). According to the molecular interaction network of IPA, several molecules are coregulated by ALDOA and FBP1 (Figure 4E). To demonstrate that these molecules may correlate with ALDOA and FBP1 in LUAD or LIHC, the heatmap results of TCGA analysis are displayed in Figure 4F. The correlation results indicated that in LUAD and LIHC, PKM2, ENO1, PGAM5, HSP90AB1, FUS, WDR77, HIF1A, AGR2, and CUL4B were positively correlated with ALDOA and negatively correlated with FBP1. Conversely, STOM and NR4A1 were negatively correlated with ALDOA but positively correlated with FBP1. In addition, FLCN, HTT, and IL15 were negatively correlated with LUAD only, which may be caused by different genetic backgrounds (Figure 4G).…
Results)
…In addition, FLCN,HTT, and IL15 were…
Show Full Abstract
Metabolic reprogramming and elevated glycolysis levels are associated with tumor progression. However, despite cancer cells selectively inhibiting or expressing certain metabolic enzymes, it is unclear whether differences in gene profiles influence patient outcomes. Therefore, identifying the differences in enzyme action may facilitate discovery of gene ontology variations to characterize tumors. Fructose-1,6-bisphosphate (F-1,6-BP) is an important intermediate in glucose metabolism, particularly in cancer. Gluconeogenesis and glycolysis require fructose-1,6-bisphosphonates 1 (FBP1) and fructose-bisphosphate aldolase A (ALDOA), which participate in F-1,6-BP conversion. Increased expression of ALDOA and decreased expression of FBP1 are associated with the progression of various forms of cancer in humans. However, the exact molecular mechanism by which ALDOA and FBP1 are involved in the switching of F-1,6-BP is not yet known. As a result of their pancancer pattern, the relationship between ALDOA and FBP1 in patient prognosis is reversed, particularly in lung adenocarcinoma (LUAD) and liver hepatocellular carcinoma (LIHC). Using The Cancer Genome Atlas (TCGA), we observed that FBP1 expression was low in patients with LUAD and LIHC tumors, which was distinct from ALDOA. A similar trend was observed in the analysis of Cancer Cell Line Encyclopedia (CCLE) datasets. By dissecting downstream networks and possible upstream regulators, using ALDOA and FBP1 as the core, we identified common signatures and interaction events regulated by ALDOA and FBP1. Notably, the identified effectors dominated by ALDOA or FBP1 were distributed in opposite patterns and can be considered independent prognostic indicators for patients with LUAD and LIHC. Therefore, uncovering the effectors between ALDOA and FBP1 will lead to novel therapeutic strategies for cancer patients.
Also flagged:cytokinepathogenesisinflammatory diseasesimmune responsesinflammatory responsesimmune disorders
Journal Article2022-04-11No SnippetsLiu T, Wang S, Wornow M, Altman RB.
Show Full Abstract
The pathogenesis of many inflammatory diseases is a coordinated process involving metabolic dysfunctions and immune response-usually modulated by the production of cytokines and associated inflammatory molecules. In this work, we seek to understand how genes involved in pathogenesis which are often not associated with the immune system in an obvious way communicate with the immune system. We have embedded a network of human protein-protein interactions (PPI) from the STRING database with 14,707 human genes using feature learning that captures high confidence edges. We have found that our predicted Association Scores derived from the features extracted from STRING's high confidence edges are useful for predicting novel connections between genes, thus enabling the construction of a full map of predicted associations for all possible pairs between 14,707 human genes. In particular, we analyzed the pattern of associations for 126 cytokines and found that the six patterns of cytokine interaction with human genes are consistent with their functional classifications. To define the disease-specific roles of cytokines we have collected gene sets for 11,944 diseases from DisGeNET. We used these gene sets to predict disease-specific gene associations with cytokines by calculating the normalized average Association Scores between disease-associated gene sets and the 126 cytokines; this creates a unique profile of inflammatory genes (both known and predicted) for each disease. We validated our predicted cytokine associations by comparing them to known associations for 171 diseases. The predicted cytokine profiles correlate (p-value<0.0003) with the known ones in 95 diseases. We further characterized the profiles of each disease by calculating an "Inflammation Score" that summarizes different modes of immune responses. Finally, by analyzing subnetworks formed between disease-specific pathogenesis genes, hormones, receptors, and cytokines, we identified the key genes responsible for interactions between pathogenesis and inflammatory responses. These genes and the corresponding cytokines used by different immune disorders suggest unique targets for drug discovery.
Also flagged:lysozymenecrotizing enterocolitisNECinflammatory responseolfactomedin 4LYZ
Journal Article2022-04-11✓ 5 SnippetsDiez S, Renner M, Bahlinger V, Hartmann A, Besendörfer M, Müller H.
In-Text Gene Mentions
Title)
…Increased expression of OLFM4 and lysozyme during necrotizing enterocolitis in neonates: an observational research study…
Discussion)
…We observed extensive OLFM4 and LYZ staining of macrophages in intestinal tissue of infants with NEC.…
Discussion)
…This emphasizes the antimicrobial function of OLFM4 and LYZ during NEC.…
Abstract)
…The aim of this study was to analyze whether expression levels of both proteins of innate immunity, OLFM4 and lysozyme, were increased during NEC in neonates.…
Abstract)
…Both proteins, OLFM4 and lysozyme, may play a role in the pathogenesis of NEC in neonatal patients, but the exact mechanisms of OLFM4 and lysozyme function and their role in immunological responses have not yet been resolved in detail.…
Show Full Abstract
<h4>Background</h4>In neonatal patients with necrotizing enterocolitis (NEC) the inflammatory response is mediated by a plurality of different proteins. The proteins olfactomedin 4 (OLFM4) and lysozyme (LYZ) are part of the intestinal mucosal defense and especially OLFM4 has rarely been evaluated in neonatal gastrointestinal diseases. The aim of this study was to analyze whether expression levels of both proteins of innate immunity, OLFM4 and lysozyme, were increased during NEC in neonates.<h4>Methods</h4>Intestinal tissues of patients with NEC were examined with immunohistochemical staining of formalin-fixed and paraffin-embedded sections of resected tissue using antibodies against OLFM4 and lysozyme. Staining-positive tissues were semi-quantitatively scored from 0 (no staining), 1 (weak staining), 2 (moderate staining) to 3 (highly intense staining) by two individual investigators. Intestinal tissue of infants with volvulus was used as a control as other intestinal tissue without major inflammation was not available.<h4>Results</h4>Both applied antibodies against OLFM4 showed different staining patterns with higher staining intensity of the antibody OLFM4 (D1E4M). OLFM4 (median score of the antibody OLFM4 (D1E4M): 3.0) and lysozyme (median score: 3.0) are highly expressed in intestinal and immune cells during NEC. Expression of OLFM4 and lysozyme in the control samples with volvulus was observable but significantly lower (median score of the antibody OLFM4 (D1E4M): 1.25; median score of the antibody against LYZ: 2.0; p = 0.033 and p = 0.037, respectively).<h4>Conclusions</h4>Both proteins, OLFM4 and lysozyme, may play a role in the pathogenesis of NEC in neonatal patients, but the exact mechanisms of OLFM4 and lysozyme function and their role in immunological responses have not yet been resolved in detail. These observations add new insights as basis for further large-scale population research.
Also flagged:PTH2Rcell proliferationovarian cancergynecological diseasetumorstumor
Journal Article2022-04-11✓ 1 SnippetXiaowei W, Tong L, Yanjun Q, Lili F.
In-Text Gene Mentions
Results)
…CSMD3, AHANK andDNAH10genes; they were…
Show Full Abstract
<h4>Background</h4>Ovarian cancer is a common gynecological disease and seriously endangers women's health. Currently, there is still a lack of effective molecular markers for the diagnosis and treatment of ovarian cancer. The present study aimed to investigate the molecular markers associated with ovarian cancer.<h4>Methods</h4>The molecular and gene related to ovarian cancer were extracted from GEO database and TCGA database by bioinformatics, and the related genes and functions were further analyzed. The results were verified by qPCR, WB, CCK-8 and Transwell experiments.<h4>Results</h4>Data analysis showed that PTH2R gene was highly expressed in tumors, and 51 HUB genes were obtained. Finally, experimental verification showed that PTH2R gene was highly expressed in ovarian cancer, and PTH2R gene was involved in the proliferation, invasion and metastasis of ovarian cancer cells.<h4>Conclusions</h4>After experimental verification, we found that knocking down the expression of PTH2R can inhibit the proliferation, invasion and migration of tumor cells.PTH2R is expected to become a new molecular marker for ovarian cancer.
Also flagged:translationalWNTGSK3retinoid acidfibroblast growth factorFGF
Journal Article2022-04-11✓ 3 SnippetsHou X, Ma S, Fan W, Li F, Xu M, Yang C, Liu F, Yan Y, Wan J, Lan F, Liao B.
In-Text Gene Mentions
I A O 0000326)
…SHISA6…
Results)
…family member 6 (SHISA6), and sodium voltage-gated…
Discussion)
…example, TBX18 andSHISA6are the marker…
Show Full Abstract
<h4>Background</h4>Existing methods for in vitro differentiation of human pluripotent stem cells (hPSCs) into sinoatrial node-like cells (SANLCs) require complex and undefined medium constituents. This might hinder the elucidation of the molecular mechanisms involved in cardiac subtype specification and prevent translational application. In our study, we aimed to establish a chemically defined differentiation methods to generate SANLCs effectively and stably.<h4>Methods</h4>We induced human embryonic stem cells (hESCs)/induced PSCs (hiPSCs) to pan-cardiomyocytes by temporal modulation of the WNT/β-catenin (WNT) signaling pathway with GSK3 inhibitor and WNT inhibitor. During cardiac mesoderm stage of the differentiation process, signaling of WNT, retinoid acid (RA), and fibroblast growth factor (FGF) was manipulated by three specific molecules. Moreover, metabolic selection was designed to improve the enrichment of SANLCs. Finally, RT-PCR, immunofluorescence, flow cytometry, and whole cell patch clamp were used to identify the SANLCs.<h4>Results</h4>WNT, RA, and FGF signaling promote the differentiation of hPSCs into SANLCs in a concentration- and time window-sensitive manner, respectively. Synergetic modulation of WNT, FGF, and RA signaling pathways enhance the pacemaker phenotype and improve the differentiation efficiency of SANLCs (up to 45%). Moreover, the purification based on lactate metabolism and glucose starvation further reached approximately 50% of SANLCs. Finally, the electrophysiological data demonstrate that cells differentiated with the proposed protocol produce a considerable number of SANLCs that display typical electrophysiological characteristics of pacemaker cells in vitro.<h4>Conclusion</h4>We provide an optimized and chemically defined protocol to generate SANLCs by combined modulation of WNT, RA, and FGF signaling pathways and metabolic selection by lactate enrichment and glucose starvation. This chemically defined method for generating SANLCs might provide a platform for disease modeling, drug discovery, predictive toxicology, and biological pacemaker construction.
Three betacoronaviruses have crossed the species barrier and established human-to-human transmission causing significant morbidity and mortality in the past 20 years. The most current and widespread of these is SARS-CoV-2. The identification of CoVs with zoonotic potential in animal reservoirs suggests that additional outbreaks could occur. Monoclonal antibodies targeting conserved neutralizing epitopes on diverse CoVs can form the basis for prophylaxis and therapeutic treatments and enable the design of vaccines aimed at providing pan-CoV protection. We previously identified a neutralizing monoclonal antibody, CV3-25 that binds to the SARS-CoV-2 spike, neutralizes the SARS-CoV-2 Beta variant comparably to the ancestral Wuhan Hu-1 strain, cross neutralizes SARS-CoV-1 and binds to recombinant proteins derived from the spike-ectodomains of HCoV-OC43 and HCoV-HKU1. Here, we show that the neutralizing activity of CV3-25 is maintained against the Alpha, Delta, Gamma and Omicron variants of concern as well as a SARS-CoV-like bat coronavirus with zoonotic potential by binding to a conserved linear peptide in the stem-helix region. Negative stain electron microscopy and a 1.74 Å crystal structure of a CV3-25/peptide complex demonstrates that CV3-25 binds to the base of the stem helix at the HR2 boundary to an epitope that is distinct from other stem-helix directed neutralizing mAbs.
Also flagged:centrosomeProtein degradationubiquitinproteasomeautophagyHSP27
Journal Article2022-04-11✓ 2 SnippetsProsser SL, Tkach J, Gheiratmand L, Kim J, Raught B, Morrison CG, Pelletier L.
In-Text Gene Mentions
Results)
…AsHTTinteracts with PCM1…
Results)
…HTTcan bind to…
Show Full Abstract
Protein degradation is critical to maintaining cellular homeostasis, and perturbation of the ubiquitin proteasome system leads to the accumulation of protein aggregates. These aggregates are either directed towards autophagy for destruction or sequestered into an inclusion, termed the aggresome, at the centrosome. Utilizing high-resolution quantitative analysis, here, we define aggresome assembly at the centrosome in human cells. Centriolar satellites are proteinaceous granules implicated in the trafficking of proteins to the centrosome. During aggresome assembly, satellites were required for the growth of the aggresomal structure from an initial ring of phosphorylated HSP27 deposited around the centrioles. The seeding of this phosphorylated HSP27 ring depended on the centrosomal proteins CP110, CEP97 and CEP290. Owing to limiting amounts of CP110, senescent cells, which are characterized by the accumulation of protein aggregates, were defective in aggresome formation. Furthermore, satellites and CP110-CEP97-CEP290 were required for the aggregation of mutant huntingtin. Together, these data reveal roles for CP110-CEP97-CEP290 and satellites in the control of cellular proteostasis and the aggregation of disease-relevant proteins.
Also flagged:Silver NanoparticlesColorectal cancercancersilvercell-cell adhesioncytoplasm
Journal Article2022-04-11No SnippetsMartínez-Esquivias F, Gutiérrez-Angulo M, Becerra-Ruiz JS, Martinez-Perez LA, de la Cruz-Ahumada CJ, Guzmán-Flores JM.
Show Full Abstract
Colorectal cancer (CRC) is the most diagnosed cancer with the highest mortality rate each year globally. Although there are treatments for CRC, the development of resistance to therapies decreases the success of treatments. <i>In vitro</i> studies using the Caco-2 cell line have revealed the anticancer properties of silver nanoparticles (AgNPs) as a possible treatment for this disease. This study considered four researches that evaluated the proteomic profiles of cells of the Caco-2 line exposed to AgNPs. We performed a bioinformatics analysis to predict protein-protein interaction, hub genes, Gene Ontology (molecular function, biological process, and cellular components), KEGG pathways, analysis of expression, and immune cell infiltration. For these analyses, the STRING, DAVID, UALCAN, GEPIA2, and TISIDB databases were used. The results in Gene Ontology show that AgNPs cause a deregulation of genes related to cell-cell adhesion, the cytoplasm, the centriole, and carbon metabolism. Hub genes were identified, including <i>GADPH</i>, <i>ENO1</i>, <i>EEF2</i>, and <i>ATP5A1</i>, which showed differential expression in patients with adenocarcinoma of the colon and rectum. Additionally, the expression of the hub genes and immune cells was correlated. It was found that <i>ATP5A1</i> and <i>ENO1</i> were positively correlated with the infiltration of CD4+ T lymphocytes in colon adenocarcinoma and a negative correlation between <i>GADPH</i> and <i>PDIA3</i> with the infiltration of NK cells and CD4+ T lymphocytes in rectal adenocarcinoma, respectively. In conclusion, the administration of AgNPs causes an alteration of biological processes, cellular components, metabolic pathways, deregulation of hub genes, and the activity of immune cells leading to a potential anticancer effect.
Also flagged:Juvenile HemochromatosisHemochromatosis type 2ironliver fibrosiscirrhosiscardiomyopathy
Journal Article2022-04-11✓ 5 SnippetsMoreno-Risco MB, Méndez M, Moreno-Carralero MI, López-Moreno AM, Vagace-Valero JM, Morán-Jiménez MJ.
In-Text Gene Mentions
Abstract)
…family history ofhemochromatosis.…
Abstract)
…targeted gene panel:HFE, HJV ,…
Introduction)
…TheHFE, HJV ,…
Discussion)
…2 of theHFEgene in heterozygous…
Discussion)
…of therapy forhemochromatosisto prevent iron…
Show Full Abstract
Hemochromatosis type 2 or juvenile hemochromatosis has an early onset of severe iron overload resulting in organ manifestation such as liver fibrosis, cirrhosis, cardiomyopathy, arthropathy, hypogonadism, diabetes, osteopathic medicine, and thyroid abnormality, before age of 30. Juvenile hemochromatosis type 2a and 2b is an autosomal recessive disease caused by pathogenic variants in <i>HJV</i> and <i>HAMP</i> genes, respectively. We report a child with hepatic iron overload and family history of hemochromatosis. We aim to raise awareness of juvenile hemochromatosis, especially in families with a positive family history, as early diagnosis and treatment may prevent organ involvement and end-stage disease. The purpose of this study was to identify the gene variant that causes the disease. The genetic study was performed with a targeted gene panel: <i>HFE</i>, <i>HJV</i>, <i>HAMP</i>, <i>TFR2</i>, <i>SLC40A1</i>, <i>FTL</i>, and <i>FTH1</i>. We identified the variant c.309C > G (p.Phe103Leu) in the <i>HJV</i> gene in the homozygous state in the patient.
Also flagged:Immune Responseinfectionimmune responsesoncohematological diseasesCOVID-19antibodies
Journal Article2022-04-11✓ 3 SnippetsVigón L, Sánchez-Tornero A, Rodríguez-Mora S, García-Pérez J, Corona de Lapuerta M, Pérez-Lamas L, Casado-Fernández G, Moreno G, Torres M, Mateos E, Murciano-Antón MA, Alcamí J, Pérez-Olmeda M, López-Jiménez J, García-Gutiérrez V, Coiras M, On Behalf Of Multidisciplinary Group Of Study Of Covid-Mgs-Covid.
Oncohematological patients show a low immune response against SARS-CoV-2, both to natural infection and after vaccination. Most studies are focused on the analysis of the humoral response; therefore, the information available about the cellular immune response is limited. In this study, we analyzed the humoral and cellular immune responses in nine individuals who received chemotherapy for their oncohematological diseases, as well as consolidation with autologous stem cell transplantation (ASCT), after being naturally infected with SARS-CoV-2. All individuals had asymptomatic or mild COVID-19 and were not vaccinated against SARS-CoV-2. These results were compared with matched healthy individuals who also had mild COVID-19. The humoral response against SARS-CoV-2 was not detected in 6 of 9 oncohematological individuals prior to ASCT. The levels of antibodies and their neutralization capacity decreased after ASCT. Conversely, an enhanced cytotoxic activity against SARS-CoV-2-infected cells was observed after chemotherapy plus ASCT, mostly based on high levels of NK, NKT, and CD8+TCRγδ+ cell populations that were able to produce IFNγ and TNFα. These results highlight the importance of performing analyses not only to evaluate the levels of IgGs against SARS-CoV-2, but also to determine the quality of the cellular immune response developed during the immune reconstitution after ASCT.
Also flagged:Spitz neoplasmstumorNeoplasmsHRASMAP2K1ALK
Journal Article2022-04-11No SnippetsDal Pozzo CA, Cappellesso R.
Show Full Abstract
Spitz neoplasms are a heterogeneous group of melanocytic proliferations with a great variability in the histological characteristics and in the biological behavior. Thanks to recent discoveries, the morpho-molecular landscape of Spitz lineage is becoming clearer, with the identification of subtypes with recurrent features thus providing the basis for a more solid and precise tumor classification. Indeed, specific mutually exclusive driver molecular events, namely <i>HRAS</i> or <i>MAP2K1</i> mutations, copy number gains of 11p, and fusions involving <i>ALK, ROS, NTRK1, NTRK2, NTRK3, MET, RET, MAP3K8,</i> and <i>BRAF</i> genes, correlate with distinctive histological features. The accumulation of further molecular aberrations, instead, promotes the increasing malignant transformation of Spitz neoplasms. Thus, the detection of a driver genetic alteration can be achieved using the appropriate diagnostic tests chosen according to the histological characteristics of the lesion. This allows the recognition of subtypes with aggressive behavior requiring further molecular investigations. This review provides an update on the morpho-molecular correlations in Spitz neoplasms.
Also flagged:Myopiaophthalmological disorderspathogenesisretinal dystrophiesretinal dystrophyHigh
Journal Article2022-04-11✓ 5 SnippetsGonzález-Iglesias E, López-Vázquez A, Noval S, Nieves-Moreno M, Granados-Fernández M, Arruti N, Rosa-Pérez I, Pacio-Míguez M, Montaño VEF, Rodríguez-Solana P, Del Pozo A, Santos-Simarro F, Vallespín E.
In-Text Gene Mentions
I A O 0000615)
…Furthermore, 24 families had VUS, two families with variants in genes related to non-syndromic EoHM (SCO2 and ZNF644) and seven families with variants in genes associated with other retinal dystrophies (TRPM1, CACNA1F, KCNV2, RDH5 and MERTK).…
Introduction)
…Given that myopia is a refractive error disease, other studies have reported single nucleotide polymorphisms (SNPs) related to refractive error in PRSS56, BMP3, KCNQ5, LAMA2, TOX, TJP2, RDH5, ZIC2, RASGRF1, GJD2, RBFOX1, SHISA6, FAM150B-ACP1, LINC00340, FBN1, DIS3L-MAP2K1, ARID2-SNAT1 and SLC14A2 [22,23,24].…
Early-onset high myopia (EoHM) is a disease that causes a spherical refraction error of ≥-6 diopters before 10 years of age, with potential multiple ocular complications. In this article, we report a clinical and genetic study of 43 families with EoHM recruited in our center. A complete ophthalmological evaluation was performed, and a sample of peripheral blood was obtained from proband and family members. DNA was analyzed using a customized next-generation sequencing panel that included 419 genes related to ophthalmological disorders with a suspected genetic cause, and genes related to EoHM pathogenesis. We detected pathogenic and likely pathogenic variants in 23.9% of the families and detected variants of unknown significance in 76.1%. Of these, 5.7% were found in genes related to non-syndromic EoHM, 48.6% in genes associated with inherited retinal dystrophies that can include a syndromic phenotype, and 45.7% in genes that are not directly related to EoHM or retinal dystrophy. We found no candidate genes in 23% of the patients, which suggests that further studies are needed. We propose a systematic genetic analysis for patients with EoHM because it helps with follow-up, prognosis and genetic counseling.
Also flagged:SORL1ADdementiaautosomal dominant dementiacerebral amyloid angiopathyfamilial dementia
Journal Article2022-04-11✓ 1 SnippetAlvarez-Mora MI, Blanco-Palmero VA, Quesada-Espinosa JF, Arteche-Lopez AR, Llamas-Velasco S, Palma Milla C, Lezana Rosales JM, Gomez-Manjon I, Hernandez-Lain A, Jimenez Almonacid J, Gil-Fournier B, Ramiro-León S, González-Sánchez M, Herrero-San Martín AO, Pérez-Martínez DA, Gómez-Tortosa E, Carro E, Bartolomé F, Gomez-Rodriguez MJ, Sanchez-Calvin MT, Villarejo-Galende A, Moreno-Garcia M.
In-Text Gene Mentions
Results)
…two most commonHFEvariants (p.C282Y and…
Show Full Abstract
In the last few years, the SORL1 gene has been strongly implicated in the development of Alzheimer’s disease (AD). We performed whole-exome sequencing on 37 patients with early-onset dementia or family history suggestive of autosomal dominant dementia. Data analysis was based on a custom panel that included 46 genes related to AD and dementia. SORL1 variants were present in a high proportion of patients with candidate variants (15%, 3/20). We expand the clinical manifestations associated with the SORL1 gene by reporting detailed clinical and neuroimaging findings of six unrelated patients with AD and SORL1 mutations. We also present for the first time a patient with the homozygous truncating variant c.364C>T (p.R122*) in SORL1, who also had severe cerebral amyloid angiopathy. Furthermore, we report neuropathological findings and immunochemistry assays from one patient with the splicing variant c.4519+5G>A in the SORL1 gene, in which AD was confirmed by neuropathological examination. Our results highlight the heterogeneity of clinical presentation and familial dementia background of SORL1-associated AD and suggest that SORL1 might be contributing to AD development as a risk factor gene rather than as a major autosomal dominant gene.
Collagen I-based foams were modified with calcined or noncalcined hydroxyapatite or calcium phosphates with various particle sizes and pores to monitor their effect on cell interactions. The resulting scaffolds thus differed in grain size, changing from nanoscale to microscopic, and possessed diverse morphological characteristics and resorbability. The materials' biological action was shown on human bone marrow MSCs. Scaffold morphology was identified by SEM. Using viability test, qPCR, and immunohistochemical staining, we evaluated the biological activity of all of the materials. This study revealed that the most suitable scaffold composition for osteogenesis induction is collagen I foam with calcined hydroxyapatite with a pore size of 360 ± 130 µm and mean particle size of 0.130 µm. The expression of osteogenic markers RunX2 and ColI mRNA was promoted, and a strong synthesis of extracellular protein osteocalcin was observed. ColI/calcined HAP scaffold showed significant osteogenic potential, and can be easily manipulated and tailored to the defect size, which gives it great potential for bone tissue engineering applications.
Also flagged:dilateddilated cardiomyopathycardiacdeathTitinFilamin
Journal Article2022-04-11No SnippetsMori V, Sawhney JPS, Verma IC, Mehta A, Saxena R, Passey R, Mohanty A, Kandpal B, Vivek BS, Sharma M, Jain AK, Katare D.
Show Full Abstract
<h4>Aim</h4>To study genetic variants in patients of familial dilated cardiomyopathy.<h4>Methodology</h4>Patients with reduced ejection fraction of less than 45% and dilated left ventricle are considered to have dilated cardiomyopathy. Clinical history was taken and possible secondary causes of dilated cardiomyopathy were excluded. Family history of ≥2 affected relatives or sudden cardiac death in a relative with age less than 35 years were included. Such patients blood sample were sent for next generation sequencing and analysed for presence of genetic variants.<h4>Results</h4>As part of pilot study 20 patients (44% were female and 66% were male) were included. There was presence of 16 different pathogenic variants in 14 patients. Two patients had more than one variants in them. Most common of which were sarcomeric mutations constituting 32%. Titin followed by Filamin, Lamin and Desmosomal where the most commonly repeated mutations.<h4>Discussion</h4>In our patients of familial dilated cardiomyopathy, 70% were detected to have pathogenic variants in them. Most common variations were seen on Titin gene. Thus those with familial dilated cardiomyopathy should be considered for next generation sequencing. First degree relatives of those with pathogenic variants should be screened using cascade testing for earlier detection and disease monitoring in them.
Also flagged:cognitive dysfunctionneuronal intranuclear inclusion diseaseNIIDC9ORF72frontotemporal dementiaHuntington's disease
Journal Article2022-04-11✓ 1 SnippetZhang S, Shen L, Jiao B.
In-Text Gene Mentions
Introduction)
…the N-terminus ofHTTprotein (MacDonald et…
Show Full Abstract
With the development of the sequencing technique, more than 40 repeat expansion diseases (REDs) have been identified during the past two decades. Moreover, the clinical features of these diseases show some commonality, and the nervous system, especially the cognitive function was affected in part by these diseases. However, the specific cognitive domains impaired in different diseases were inconsistent. Here, we survey literature on the cognitive consequences of the following disorders presenting cognitive dysfunction and summarizing the pathogenic genes, epidemiology, and different domains affected by these diseases. We found that the cognitive domains affected in neuronal intranuclear inclusion disease (NIID) were widespread including the executive function, memory, information processing speed, attention, visuospatial function, and language. Patients with C9ORF72-frontotemporal dementia (FTD) showed impairment in executive function, memory, language, and visuospatial function. While in Huntington's disease (HD), the executive function, memory, and information processing speed were affected, in the fragile X-associated tremor/ataxia syndrome (FXTAS), executive function, memory, information processing speed, and attention were impaired. Moreover, the spinocerebellar ataxias showed broad damage in almost all the cognitive domains except for the relatively intact language ability. Some other diseases with relatively rare clinical data also indicated cognitive dysfunction, such as myotonic dystrophy type 1 (DM1), progressive myoclonus epilepsy (PME), Friedreich ataxia (FRDA), Huntington disease like-2 (HDL2), and cerebellar ataxia, neuropathy, vestibular areflexia syndrome (CANVAS). We drew a cognitive function landscape of the related REDs that might provide an aspect for differential diagnosis through cognitive domains and effective non-specific interventions for these diseases.
Also flagged:Bladder CancerNecroptosistumorstumorCERCAMPOLR1H
Journal Article2022-04-11✓ 5 SnippetsNie S, Huili Y, He Y, Hu J, Kang S, Cao F.
In-Text Gene Mentions
Discussion)
…We constructed a prognostic model based on Necroptosis subtype-related prognosis DEGS by lasso algorithm and multivariate COX analysis, which consists of 6 predictors (CERCAM POLR1H, KCNJ15, GSDMB, EHBP1, TRIM38), among which CERCAM is closely related to bladder cancer.…
Abstract)
…× 0.0295 +TRIM38× −0.0300.…
Results)
…× 0.0295 +TRIM38× −0.0300, where…
Results)
…and KCNJ15, GSDMB,TRIM38and POLR1H are…
Discussion)
…KCNJ15, GSDMB, EHBP1,TRIM38), among which CERCAM…
Show Full Abstract
<h4>Background</h4>Necroptosis is associated with the development of many tumors but in bladder cancer the tumor microenvironment (TME) and prognosis associated with necroptosis is unclear.<h4>Methods</h4>We classified patients into different necroptosis subtypes by the expression level of NRGS (necroptosis-related genes) and analyzed the relationship between necroptosis subtypes of bladder cancer and TME, then extracted differentially expressed genes (DEGS) of necroptosis subtypes, classified patients into different gene subtypes according to DEGS, and performed univariate COX analysis on DEGS to obtain prognosis-related DEGS. All patients included in the analysis were randomized into the Train and Test groups in a 1:1 ratio, and the prognostic model was obtained using the LASSO algorithm and multivariate COX analysis with the Train group as the sample, and external validation of the model was conducted using the GSE32894.<h4>Results</h4>Two necroptosis subtypes and three gene subtypes were obtained by clustering analysis and the prognosis-related DEGS was subjected to the LASSO algorithm and multivariate COX analysis to determine six predictors to construct the prognostic model using the formula: riskScore = CERCAM × 0.0035 + POLR1H × -0.0294 + KCNJ15 × -0.0172 + GSDMB × -0.0109 + EHBP1 × 0.0295 + TRIM38 × -0.0300. The results of the survival curve, roc curve, and risk curve proved the reliability of the prognostic model by validating the model with the test group and the results of the calibration chart of the Nomogram applicable to the clinic also showed its good accuracy. Necroptosis subtype A with high immune infiltration had a higher risk score than necroptosis subtype B, gene subtype B with low immune infiltration had a lower risk score than gene subtypes A and C, CSC index was negatively correlated with the risk score and drug sensitivity prediction showed that commonly used chemotherapeutic agents were highly sensitive to the high-risk group.<h4>Conclusion</h4>Our analysis of NRGS in bladder cancer reveals their potential role in TME, immunity, and prognosis. These findings may improve our understanding of necroptosis in bladder cancer and provide some reference for predicting prognosis and developing immunotherapies.
Hypertension is a major risk factor leading to cardiovascular disease, and is frequently treated with angiotensin I-converting enzyme (ACE) inhibitory peptides. The objective of this study was to separate and identify an ACE-inhibitory peptide from goat milk casein hydrolysates, and to evaluate its potential for improving angiotensin II (Ang II)-mediated adverse effects on vascular smooth muscle cells (VSMCs). A novel ACE-inhibitory peptide with the highest activity from the goat milk casein hydrolysates as determined by four steps of RP-HPLC was purified and identified as Phe-Pro-Gln-Tyr-Leu-Gln-Tyr-Pro-Tyr (FPQYLQYPY). The results of inhibitory kinetics studies indicated that the peptide was a non-competitive inhibitor against ACE. Gastrointestinal digest <i>in vitro</i> analysis showed that the hydrolysate of FPQYLQYPY was still active after digestion with gastrointestinal proteases. Moreover, we found that the peptide could significantly inhibit the proliferation and migration of Ang II-stimulated VSMCs. Further transcriptomic analysis revealed that differentially expressed genes (DEGs) were enriched in the cardiovascular disease-related pathways, and that the peptide may have the ability to regulate vascular remodeling. Our findings indicate the potential anti-hypertensive effects of FPQYLQYPY, as well-implicate its role in regulating vascular dysfunction.
Also flagged:Wilms tumorWTnephroblastomatumorBCL6CCNA1
Journal Article2022-04-11✓ 1 SnippetHuang G, Mao J.
In-Text Gene Mentions
Results)
…namely ADRA2A, BCL6,CA10, CCNA1, CTHRC1, DGKD,…
Show Full Abstract
Wilms tumor (WT), also known as nephroblastoma, is a rare primary malignancy in all kinds of tumor. With the development of second-generation sequencing, the discovery of new tumor markers and potential therapeutic targets has become easier. This study aimed to explore new WT prognostic biomarkers. In this study, WT-miRNA datasets GSE57370 and GSE73209 were selected for expression profiling to identify differentially expressed genes. The key gene miRNA, namely hsa-miR-30c-5p, was identified by overlapping, and the target gene of candidate hsa-miR-30c-5p was predicted using an online database. Furthermore, 384 genes were obtained by intersecting them with differentially expressed genes in the TARGET-WT database, and the genes were analyzed for pathway and functional enrichment. Kaplan-Meier survival analysis of the 384 genes yielded a total of 25 key genes associated with WT prognosis. Subsequently, a prediction model with 12 gene signatures (BCL6, CCNA1, CTHRC1, DGKD, EPB41L4B, ERRFI1, LRRC40, NCEH1, NEBL, PDSS1, ROR1, and RTKN2) was developed. The model had good predictive power for the WT prognosis at 1, 3, and 5 years (AUC: 0.684, 0.762, and 0.774). Finally, ERRFI1 (hazard ratios [HR] = 1.858, 95% confidence intervals [CI]: 1.298-2.660) and ROR1 (HR = 0.780, 95% CI: 0.609-0.998) were obtained as independent predictors of prognosis in WT patients by single, multifactorial Cox analysis.
Also flagged:MethylationIschemic Strokelarge-artery atherosclerosiscalciumcell-cell adhesionmembrane
Journal Article2022-04-11✓ 2 SnippetsSun H, Xu J, Hu B, Liu Y, Zhai Y, Sun Y, Sun H, Li F, Wang J, Feng A, Tang Y, Zhao J.
In-Text Gene Mentions
Discussion)
…A Study about myocardial infarction revealed overexpression of CDH2, CDH12, PCDH17, and PCDH18 in myocardial infarction vascular smooth muscle cells compared with controls (Derda et al., 2018).…
Discussion)
…, CDH12 ,PCDH17, and PCDH18…
Show Full Abstract
<b>Background:</b> Ischemic stroke is a highly complex disorder. This study aims to identify novel methylation changes in ischemic stroke. <b>Methods:</b> We carried out an epigenome-wide study of ischemic stroke using an Infinium HumanMethylation 850K array (cases:controls = 4:4). 10 CpG sites in 8 candidate genes from gene ontology analytics top-ranked pathway were selected to validate 850K BeadChip results (cases:controls = 20:20). We further qualified the methylation level of promoter regions in 8 candidate genes (cases:controls = 188:188). Besides, we performed subgroup analysis, dose-response relationship and diagnostic prediction polygenic model of candidate genes. <b>Results:</b> In the discovery stage, we found 462 functional DNA methylation positions to be associated with ischemic stroke. Gene ontology analysis highlighted the "calcium-dependent cell-cell adhesion via plasma membrane cell adhesion molecules" item, including 8 candidate genes (<i>CDH2/PCDHB10/PCDHB11/PCDHB14/PCDHB16/PCDHB3/PCDHB6/PCDHB9</i>). In the replication stage, we identified 5 differentially methylated loci in 20 paired samples and 7 differentially methylated genes (<i>CDH2/PCDHB10/PCDHB11/PCDHB14/PCDHB16/PCDHB3/PCDHB9</i>) in 188 paired samples. Subgroup analysis showed that the methylation level of above 7 genes remained significantly different in the male subgroup, large-artery atherosclerosis subgroup and right hemisphere subgroup. The methylation level of each gene was grouped into quartiles, and Q4 groups of the 7 genes were associated with higher risk of ischemic stroke than Q1 groups (<i>p</i> < 0.05). Besides, the polygenic model showed high diagnostic specificity (0.8723), sensitivity (0.883), and accuracy (0.8777). <b>Conclusion:</b> Our results demonstrate that DNA methylation plays a crucial part in ischemic stroke. The methylation of these 7 genes may be potential diagnostic biomarker for ischemic stroke.
Also flagged:Gene Expressionacute respiratory infectionsinfectionCOVID-19 infectioninfectionscoronavirus infection
Journal Article2022-04-11✓ 3 SnippetsJabeen A, Ahmad N, Raza K.
In-Text Gene Mentions
Abstract)
…NFKBIA, FN1, FAP, KANK4, COMP, FAM101B, COL1A2, ANKRD1, TAGLN, SPARC, ADAM19, OLFM4, CXCL10/11, OASL, FOS, APOBEC3A, IFI44L, IFI27, IFIT1, RSAD2, NDUFS1, SRSF6, HECTD1, CBX3, and DDX17 are among the genes that may be impacted by infection, according to our findings.…
Discussion)
…The leading genes which are affected as a result of coronavirus replication within the cell line cytoplasm are NFKBIA, FN1, KANK4, FAP, TAGLN, ADAM19, ANKRD1, TAGLN, SPARC, ADAM19, OLFM4, CXCL10/11, OASL, FOS, APOBEC3A, IFI44L, IFI27, IFIT1, and RSAD2 and the functional changes are mainly associated with these pathways TNF, cytokine, NF—kB, TLR, TCR, BCR, FOXO, and TGF signaling pathways are among them and there are additional pathways such as hippo signaling, apoptosis, estrogen signaling, regulating pluropotency of stem cells, ErbB, Wnt, p53, cAMP, MAPK, PI3K—AKT, oxidative phosphorylation, protein processing in endoplasmic reticulum, prolactin signaling, adipocytokine, neurotrophine signaling, and longevity regulating pathways.…
Coronavirus is an enclosed positive-sense RNA virus with club-like spikes protruding from its surface that causes acute respiratory infections in humans. Because it is considered a member of the complex pathogen group, it has been found to infect different host species and cause a variety of diseases. So far, it has been discovered that it may affect the immune, infection, and inflammatory systems, leading to the hypothesis that the immune and inflammatory systems (signaling pathways and components) fail to control infection, opening the door to look for potential targets primarily in these systems. The study's main purpose is to identify highly overexpressed genes and their functional implications as a result of COVID-19 infection, as well as to investigate probable infections, inflammation, and immune systems to better understand the impact of coronavirus infection. We explored the genes and pathways mostly linked with infection, inflammation, and the immune systems using the datasets available for COVID-19 infection gene expression compendium. NFKBIA, FN1, FAP, KANK4, COMP, FAM101B, COL1A2, ANKRD1, TAGLN, SPARC, ADAM19, OLFM4, CXCL10/11, OASL, FOS, APOBEC3A, IFI44L, IFI27, IFIT1, RSAD2, NDUFS1, SRSF6, HECTD1, CBX3, and DDX17 are among the genes that may be impacted by infection, according to our findings. The functional changes are mainly associated with these pathways TNF, cytokine, NF-kB, TLR, TCR, BCR, Foxo, and TGF signaling pathways are among them and there are additional pathways such as hippo signaling, apoptosis, estrogen signaling, regulating pluropotency of stem cells, ErbB, Wnt, p53, cAMP, MAPK, PI3K-AKT, oxidative phosphorylation, protein processing in endoplasmic reticulum, prolactin signaling, adipocytokine, neurotrophine signaling, and longevity regulating pathways. Moreover, we have also explored the potential herbal drug (apigenin, quercetin, and resveratrol) targets for the top-rated genes based on the overall analysis where we observe that quercetin and resveratrol as most effective.
Also flagged:chromatinchromosomeslipidmetabolismgene expressionnucleotide
Journal Article2022-04-11No SnippetsQiao G, Xu P, Guo T, Wu Y, Lu X, Zhang Q, He X, Zhu S, Zhao H, Lei Z, Sun W, Yang B, Yue Y.
Show Full Abstract
Dorper sheep (<i>Ovis aries</i>) (DPS), developed in the 1930s by crossing Dorset Horn and Blackhead Persian sheep in South Africa, is a world-famous composite breed for mutton production. The genetic basis underlying this breed is yet to be elucidated. Here, we report the sequencing and assembly of a highly contiguous Dorper sheep genome via integration of Oxford Nanopore Technology (ONT) sequencing and Hi-C (chromatin conformation capture) approaches. The assembled genome was around 2.64 Gb with a contig N50 of 73.33 Mb and 140 contigs in total. More than 99.5% of the assembled sequences could be anchored to 27 chromosomes and they were annotated with 20,450 protein-coding genes. Allele-specific expression (ASE) genes of Dorper sheep were revealed through ASE analysis and they were involved in the immune system, lipid metabolism, and environmental adaptation. A total of 5,701 and 456 allelic sites were observed in the SNP and indels loci identified from relevant whole-genome resequencing data. These allelic SNP and INDEL sites were annotated in 1,002 and 294 genes, respectively. Moreover, we calculated the number of variant sites and related genes derived from the maternal and paternal ancestors, revealing the genetic basis of outstanding phenotypic performance of Dorper sheep. In conclusion, this study reports the first reference genome of Dorper sheep and reveals its genetic basis through ASE. This study also provides a pipeline for mining genetic information of composite breeds, which has an implication for future hybrid-breeding practices.
Also flagged:Parkinson's diseasePDalpha-synucleinGFPdeathsynapses
Journal Article2022-04-11No SnippetsHöllerhage M, Stepath M, Kohl M, Pfeiffer K, Chua OWH, Duan L, Hopfner F, Eisenacher M, Marcus K, Höglinger GU.
Show Full Abstract
LUHMES cells share many characteristics with human dopaminergic neurons in the substantia nigra, the cells, the demise of which is responsible for the motor symptoms in Parkinson's disease (PD). LUHMES cells can, therefore, be used <i>bona fide</i> as a model to study pathophysiological processes involved in PD. Previously, we showed that LUHMES cells degenerate after 6 days upon overexpression of wild-type alpha-synuclein. In the present study, we performed a transcriptome and proteome expression analysis in alpha-synuclein-overexpressing cells and GFP-expressing control cells in order to identify genes and proteins that are differentially regulated upon overexpression of alpha-synuclein. The analysis was performed 4 days after the initiation of alpha-synuclein or GFP overexpression, before the cells died, in order to identify processes that preceded cell death. After adjustments for multiple testing, we found 765 genes being differentially regulated (439 upregulated, 326 downregulated) and 122 proteins being differentially expressed (75 upregulated, 47 downregulated). In total, 21 genes and corresponding proteins were significantly differentially regulated in the same direction in both datasets, of these 13 were upregulated and 8 were downregulated. In total, 13 genes and 9 proteins were differentially regulated in our cell model, which had been previously associated with PD in recent genome-wide association studies (GWAS). In the gene ontology (GO) analysis of all upregulated genes, the top terms were "regulation of cell death," "positive regulation of programmed cell death," and "regulation of apoptotic signaling pathway," showing a regulation of cell death-associated genes and proteins already 2 days before the cells started to die. In the GO analysis of the regulated proteins, among the strongest enriched GO terms were "vesicle," "synapse," and "lysosome." In total, 33 differentially regulated proteins were associated with synapses, and 12 differentially regulated proteins were associated with the "lysosome", suggesting that these intracellular mechanisms, which had been previously associated with PD, also play an important role in our cell model.
Also flagged:Venous ThromboembolismKidney Diseasesnephrotic syndromeNSchronic kidney diseasevein thrombosis
Journal Article2022-04-11No SnippetsWu T, Tang LV, Hu Y.
Show Full Abstract
<h4>Background</h4>Many renal diseases have been associated with profound clinical effects on thrombosis. To our knowledge, patients with nephrotic syndrome (NS) and chronic kidney disease (CKD) display an elevated risk of vein thrombosis, which is among the common causes of mortality in patients with renal diseases. In addition, venous thrombosis, as a complication, has also been reported in a variety of other renal diseases such as glomerulonephritis without the NS, hypertensive nephropathy, and polycystic kidney disease. With the increasing incidence of kidney diseases and the deeper understanding of the disease, clinicians are becoming more and more aware of the complications of thrombus formation in kidney disease.<h4>Summary</h4>We reviewed recent publications of vein thrombosis in kidney diseases, including primary and secondary glomerular diseases, CKD, hereditary kidney disease, renal transplantation, and hemodialysis-induced, catheter-related thrombus, focusing mainly on the main clinical manifestations, possible mechanisms, related risk factors as well as hereditary influencing factors.<h4>Key messages</h4>Vein thrombosis is a complicated complication of a wide spectrum of kidney diseases due to different possible underlying mechanisms.
Also flagged:ProteolysisAgingneurodegenerative diseasesimmunoglobulinsbindingCd5l
Journal Article2022-04-11✓ 1 SnippetShuken SR, Rutledge J, Iram T, Losada PM, Wilson EN, Andreasson KI, Leib RD, Wyss-Coray T.
In-Text Gene Mentions
Text
…Serpin C1…
Show Full Abstract
Cerebrospinal fluid (CSF) proteins and their structures have been implicated repeatedly in aging and neurodegenerative diseases. Limited proteolysis-mass spectrometry (LiP-MS) is a method that enables proteome-wide screening for changes in both protein abundance and structure. To screen for novel aging-associated changes in the CSF proteome, we performed LiP-MS on CSF from young and old mice with a modified analysis pipeline. We found 38 protein groups change in abundance with aging, most dominantly immunoglobulins of the IgM subclass. We discovered six high-confidence candidates that appeared to change in structure with aging, of which Kng1, Itih2, Lp-PLA<sub>2</sub>, and 14-3-3 proteins have binding partners or proteoforms known previously to change in the brain with Alzheimer's disease. Intriguingly, using orthogonal validation by Western blot we found the LiP-MS hit Cd5l forms a covalent complex with IgM in mouse and human CSF whose abundance increases with aging. SOMAmer probe signals for all six LiP-MS hits in human CSF, especially 14-3-3 proteins, significantly associate with several clinical features relevant to cognitive function and neurodegeneration. Together, our findings show that LiP-MS can uncover age-related structural changes in CSF with relevance to neurodegeneration.
Also flagged:atherosclerosisoxygenprobucolenzymesApolipoprotein Echronic inflammatory disease
Journal Article2022-04-11No SnippetsLiang X, Li H, Li X, Tian X, Zhang A, Luo Q, Duan J, Chen Y, Pang L, Li C, Liang XJ, Zeng Y, Yang J.
Show Full Abstract
In atherosclerosis, chronic inflammatory processes in local diseased areas may lead to the accumulation of reactive oxygen species (ROS). In this study, we devised a highly sensitive H<sub>2</sub>O<sub>2</sub>-scavenging nano-bionic system loaded with probucol (RPP-PU), to treat atherosclerosis more effectively. The RPP material had high sensitivity to H<sub>2</sub>O<sub>2</sub>, and the response sensitivity could be reduced from 40 to 10 μmol/L which was close to the lowest concentration of H<sub>2</sub>O<sub>2</sub> levels of the pathological environment. RPP-PU delayed the release and prolonged the duration of PU <i>in vivo</i>. In Apolipoprotein E deficient (ApoE<sup>‒/‒</sup>) mice, RPP-PU effectively eliminated pathological ROS, reduced the level of lipids and related metabolic enzymes, and significantly decreased the area of vascular plaques and fibers. Our study demonstrated that the H<sub>2</sub>O<sub>2</sub>-scavenging nano-bionic system could scavenge the abundant ROS in the atherosclerosis lesion, thereby reducing the oxidative stress for treating atherosclerosis and thus achieve the therapeutic goals with atherosclerosis more desirably.
Research Square2022-04-11Preprint (No Snippets API)Gomes JC, Barbosa VAdF, de Santana MA, de Lima CL, Calado RB, Junior CRB, Albuquerque JEdA, de Souza RG, de Araújo RJE, Moreno GMM, Soares LAL, Júnior LARM, de Souza RE, Santos WPd.
Show Full Abstract
<title>Abstract</title> <p> <bold>Purpose</bold> In December 2019, the Covid-19 pandemic began in the world. To reduce mortality, in addiction to mass vaccination, it is necessary to massify and accelerate clinical diagnosis, as well as creating new ways of monitoring patients that can help in the construction of specific treatments for the disease. Objective In this work, we propose rapid protocols for clinical diagnosis of Covid-19 through the automatic analysis of hematological parameters using Evolutionary Computing and Machine Learning. These hematological parameters are obtained from blood tests common in clinical practice. <bold>Method</bold> We investigated the best classifier architectures. Then, we applied the particle swarm optimization algorithm (PSO) to select the most relevant attributes: serum glucose, troponin, partial thromboplastin time, ferritin, D-dimer, lactic dehydrogenase, and indirect bilirubin. Finally, we used decision trees to build four rapid protocols for Covid-19 clinical diagnosis. <bold>Results</bold> We developed a web system for Covid-19 diagnosis support. Using a 100-tree Random Forest, we obtained results for accuracy, sensitivity and specificity superior to 99%. After feature selection, results were similar. The four empirical clinical protocols returned accuracies, sensitivities and specificities superior to 98%. <bold>Conclusion</bold> By using a reduced set of hematological parameters common in clinical practice, it was possible to achieve results of accuracy, sensitivity and specificity comparable to those obtained with RT-PCR. It was also possible to automatically generate clinical decision protocols, allowing relatively accurate clinical diagnosis even without the aid of the web decision support system. </p>
<h4>SUMMARY</h4> The uptake and digestion of host hemoglobin by malaria parasites during blood stage growth leads to significant oxidative damage of membrane lipids. Repair of lipid peroxidation damage is crucial for parasite survival. Here, we demonstrate that Plasmodium falciparum imports a host antioxidant enzyme, peroxiredoxin 6 (PRDX6), during hemoglobin uptake from the red blood cell cytosol. PRDX6 is a lipid peroxidation repair enzyme with phospholipase A 2 (PLA 2 ) activity. Inhibition of PRDX6 with a PLA 2 inhibitor, Darapladib, increases lipid peroxidation damage in the parasite and disrupts transport of hemoglobin-containing vesicles to the food vacuole, causing parasite death. Furthermore, inhibition of PRDX6 synergistically reduces the survival of artemisinin-resistant parasites following co-treatment of parasite cultures with artemisinin and Darapladib. Thus, PRDX6 is a unique host-derived drug target for development of antimalarial drugs that could help overcome artemisinin resistance. <h4>GRAPHICAL ABSTRACT</h4>
Also flagged:breast cancercellular apoptosis susceptibility proteinCAStumoursGene Expressioncomplement component 3
Journal Article2022-04-10✓ 4 SnippetsYe M, Chen Y, Liu J, Tian J, Wang X, Fok KL, Shi J, Chen H.
In-Text Gene Mentions
Title)
…Interfering with CSE1L/CAS inhibits tumour growth via C3 in triple-negative breast cancer.…
Abstract)
…Chromosome segregation 1-like (CSE1L), also called cellular apoptosis susceptibility protein (CAS), is highly expressed in breast cancer and plays a crucial role in the progression of various tumours.…
Title)
…Interfering withCSE1L/ CAS inhibits…
Abstract)
…hromosome segregation 1‐like (CSE1L), also called cellular…
Show Full Abstract
Triple-negative breast cancer (TNBC) is the most aggressive subtype of breast cancer. However, the treatment regimens for TNBC are limited. Chromosome segregation 1-like (CSE1L), also called cellular apoptosis susceptibility protein (CAS), is highly expressed in breast cancer and plays a crucial role in the progression of various tumours. However, the involvement of CAS in TNBC remains elusive. In this study, we showed that the expression of CAS was higher in TNBC samples than in non-TNBC samples in the Gene Expression Omnibus database. Knockdown of CAS inhibited MDA-MB-231 cell growth, migration and invasion. Further RNA-seq analysis revealed that complement pathway activity was significantly elevated. Of note, complement component 3 (C3), the key molecule in the complement pathway, was significantly upregulated, and the expression of C3 was negatively correlated with that of CAS in breast cancer. Lower C3 expression was related to poor prognosis. Interestingly, the expression level of C3 was positively correlated with the infiltration of multiple immune cells. Taken together, our findings suggest that CAS participates in the development of TNBC through C3-mediated immune cell suppression and might constitute a potential therapeutic target for TNBC.
Journal Article2022-04-10✓ 5 SnippetsLiu Y, Wang TV, Cui Y, Li C, Jiang L, Rao Y.
In-Text Gene Mentions
Results)
…MAP4K3, MAP4K5, TAOK2,TAOK3, and MYO3A (…
Results)
…6 A ),TAOK3, TAOK2, and MYO3A…
Results)
…), TAOK2, andTAOK3( Fig. 6…
Results)
…6 C ),TAOK3, PAK3, and PAK6…
Results)
…MAP4K6, STK10, STK39,TAOK3, TAOK2, OSR1, MYO3B,…
Show Full Abstract
We have recently purified mammalian sterile 20 (STE20)-like kinase 3 (MST3) as a kinase for the multifunctional kinases, AMP-activated protein kinase-related kinases (ARKs). However, unresolved questions from this study, such as remaining phosphorylation activities following deletion of the Mst3 gene from human embryonic kidney cells and mice, led us to conclude that there were additional kinases for ARKs. Further purification recovered Ca<sup>2+</sup>/calmodulin-dependent protein kinase kinases 1 and 2 (CaMKK1 and 2), and a third round of purification revealed mitogen-activated protein kinase kinase kinase kinase 5 (MAP4K5) as potential kinases of ARKs. We then demonstrated that MST3 and MAP4K5, both belonging to the STE20-like kinase family, could phosphorylate all 14 ARKs both in vivo and in vitro. Further examination of all 28 STE20 kinases detected variable phosphorylation activity on AMP-activated protein kinase (AMPK) and the salt-inducible kinase 3 (SIK3). Taken together, our results have revealed novel relationships between STE20 kinases and ARKs, with potential physiological and pathological implications.
Also flagged:coronavirus disease 2019COVID-19wound healingtissue regenerationnanofiberorganization
Journal Article2022-04-10No SnippetsWu S, Dong T, Li Y, Sun M, Qi Y, Liu J, Kuss MA, Chen S, Duan B.
Show Full Abstract
The pandemic of the coronavirus disease 2019 (COVID-19) has made biotextiles, including face masks and protective clothing, quite familiar in our daily lives. Biotextiles are one broad category of textile products that are beyond our imagination. Currently, biotextiles have been routinely utilized in various biomedical fields, like daily protection, wound healing, tissue regeneration, drug delivery, and sensing, to improve the health and medical conditions of individuals. However, these biotextiles are commonly manufactured with fibers with diameters on the micrometer scale (> 10 μm). Recently, nanofibrous materials have aroused extensive attention in the fields of fiber science and textile engineering because the fibers with nanoscale diameters exhibited obviously superior performances, such as size and surface/interface effects as well as optical, electrical, mechanical, and biological properties, compared to microfibers. A combination of innovative electrospinning techniques and traditional textile-forming strategies opens a new window for the generation of nanofibrous biotextiles to renew and update traditional microfibrous biotextiles. In the last two decades, the conventional electrospinning device has been widely modified to generate nanofiber yarns (NYs) with the fiber diameters less than 1000 nm. The electrospun NYs can be further employed as the primary processing unit for manufacturing a new generation of nano-textiles using various textile-forming strategies. In this review, starting from the basic information of conventional electrospinning techniques, we summarize the innovative electrospinning strategies for NY fabrication and critically discuss their advantages and limitations. This review further covers the progress in the construction of electrospun NY-based nanotextiles and their recent applications in biomedical fields, mainly including surgical sutures, various scaffolds and implants for tissue engineering, smart wearable bioelectronics, and their current and potential applications in the COVID-19 pandemic. At the end, this review highlights and identifies the future needs and opportunities of electrospun NYs and NY-based nanotextiles for clinical use.
Also flagged:Huntington DiseaseHDdegenerative neurological diseasedeathmethylationneurological progressive disorder
Journal Article2022-04-10✓ 1 SnippetAlfonso Perez G, Caballero Villarraso J.
In-Text Gene Mentions
Methods)
…two of them (ARFGEF2and GOLGA8G) were…
Show Full Abstract
Huntington Disease (HD) is a degenerative neurological disease that causes a significant impact on the quality of life of the patient and eventually death. In this paper we present an approach to create a biomarker using as an input DNA CpG methylation data to identify HD patients. DNA CpG methylation is a well-known epigenetic marker for disease state. Technological advances have made it possible to quickly analyze hundreds of thousands of CpGs. This large amount of information might introduce noise as potentially not all DNA CpG methylation levels will be related to the presence of the illness. In this paper, we were able to reduce the number of CpGs considered from hundreds of thousands to 237 using a non-linear approach. It will be shown that using only these 237 CpGs and non-linear techniques such as artificial neural networks makes it possible to accurately differentiate between control and HD patients. An underlying assumption in this paper is that there are no indications suggesting that the process is linear and therefore non-linear techniques, such as artificial neural networks, are a valid tool to analyze this complex disease. The proposed approach is able to accurately distinguish between control and HD patients using DNA CpG methylation data as an input and non-linear forecasting techniques. It should be noted that the dataset analyzed is relatively small. However, the results seem relatively consistent and the analysis can be repeated with larger data-sets as they become available.
Also flagged:TBK1cancerTANK-binding kinase 1serine/threonine kinaseinhibitor of nuclear factor-κBkinase
Journal Article2022-04-09No SnippetsRunde AP, Mack R, S J PB, Zhang J.
Show Full Abstract
The TANK-binding kinase 1 (TBK1) is a serine/threonine kinase belonging to the non-canonical inhibitor of nuclear factor-κB (IκB) kinase (IKK) family. TBK1 can be activated by pathogen-associated molecular patterns (PAMPs), inflammatory cytokines, and oncogenic kinases, including activated K-RAS/N-RAS mutants. TBK1 primarily mediates IRF3/7 activation and NF-κB signaling to regulate inflammatory cytokine production and the activation of innate immunity. TBK1 is also involved in the regulation of several other cellular activities, including autophagy, mitochondrial metabolism, and cellular proliferation. Although TBK1 mutations have not been reported in human cancers, aberrant TBK1 activation has been implicated in the oncogenesis of several types of cancer, including leukemia and solid tumors with KRAS-activating mutations. As such, TBK1 has been proposed to be a feasible target for pharmacological treatment of these types of cancer. Studies suggest that TBK1 inhibition suppresses cancer development not only by directly suppressing the proliferation and survival of cancer cells but also by activating antitumor T-cell immunity. Several small molecule inhibitors of TBK1 have been identified and interrogated. However, to this point, only momelotinib (MMB)/CYT387 has been evaluated as a cancer therapy in clinical trials, while amlexanox (AMX) has been evaluated clinically for treatment of type II diabetes, nonalcoholic fatty liver disease, and obesity. In this review, we summarize advances in research into TBK1 signaling pathways and regulation, as well as recent studies on TBK1 in cancer pathogenesis. We also discuss the potential molecular mechanisms of targeting TBK1 for cancer treatment. We hope that our effort can help to stimulate the development of novel strategies for targeting TBK1 signaling in future approaches to cancer therapy.
Most large-scale genetic studies of autism have focused on the discovery of genes by proving an enrichment of de novo mutations (DNMs) in autism probands or characterizing polygenic risk based on the association of common variants. We present evidence in support of an oligogenic model where two or more ultrarare mutations of more modest effect are preferentially transmitted to children with autism. Such private gene-disruptive mutations are enriched in families where there are multiple affected individuals, emerged two or three generations ago, and map to genes not previously associated with autism. Although no single gene has reached statistical significance, this class of variation should be considered along with genetic and nongenetic factors to better explain the etiology of this complex trait.
Also flagged:cancertumorbehavioralgene expressionmethylationhistone modifications
Journal Article2022-04-09No SnippetsJoshi S, Garlapati C, Aneja R.
Show Full Abstract
Breast cancer (BC) is the most commonly diagnosed cancer in women. Despite advancements in BC screening, prevention, and treatment, BC incidence and mortality remain high among African American (AA) women. Compared with European American (EA) women, AA women tend to be diagnosed with more advanced and aggressive tumors and exhibit worse survival outcomes. Most studies investigating the determinants of racial disparities in BC have focused on genetic factors associated with African ancestry. However, various environmental and social stressors over an individual's life course can also shape racial stratification in BC. These social and environmental exposures result in long-term changes in gene expression mediated by epigenetic mechanisms. Epigenetics is often portrayed as an intersection of socially patterned stress and genetic expression. The enduring nature of epigenetic changes makes them suitable for studying the effects of different environmental exposures over an individual's life course on gene expression. The role of differential social and environmental exposures in racial disparities in BC suggests varied epigenetic profiles or signatures associated with specific BC subtypes in AA and EA women. These epigenetic profiles in EA and AA women could be used as biomarkers for early BC diagnosis and disease prognosis and may prove valuable for the development of targeted therapies for BC. This review article discusses the current state of knowledge regarding epigenetic differences between AA and EA women with BC. We also discuss the role of socio-environmental factors, including psychosocial stress, environmental toxicants, and dietary factors, in delineating the different epigenetic profiles in AA and EA patients with BC.
Also flagged:metalspolylactidehydroxyapatiteinfectionspolyvinyl chloridevinyl acetate
Journal Article2022-04-09No SnippetsKroczek K, Turek P, Mazur D, Szczygielski J, Filip D, Brodowski R, Balawender K, Przeszłowski Ł, Lewandowski B, Orkisz S, Mazur A, Budzik G, Cebulski J, Oleksy M.
Show Full Abstract
Tissue engineering is an interdisciplinary field of science that has developed very intensively in recent years. The first part of this review describes materials with medical and dental applications from the following groups: metals, polymers, ceramics, and composites. Both positive and negative sides of their application are presented from the point of view of medical application and mechanical properties. A variety of techniques for the manufacture of biomedical components are presented in this review. The main focus of this work is on additive manufacturing and 3D printing, as these modern techniques have been evaluated to be the best methods for the manufacture of medical and dental devices. The second part presents devices for skull bone reconstruction. The materials from which they are made and the possibilities offered by 3D printing in this field are also described. The last part concerns dental transitional implants (scaffolds) for guided bone regeneration, focusing on polylactide-hydroxyapatite nanocomposite due to its unique properties. This section summarises the current knowledge of scaffolds, focusing on the material, mechanical and biological requirements, the effects of these devices on the human body, and their great potential for applications.
bioRxiv2022-04-09Preprint (No Snippets API)Bhuiyan S, Tyson JR, Belmadani M, Sicherman J, Snutch TP, Pavlidis P.
Show Full Abstract
<h4>ABSTRACT</h4> Voltage gated calcium channels (VGCCs) regulate the influx of calcium ions in many cell types, but our lack of knowledge about the plethora of VGCC splice variants remains a gap in our understanding of calcium channel function. A recent advance in profiling gene splice variation is to use long-read RNA-sequencing technology. We sequenced Cacna1e transcripts from the rat thalamus using Oxford Nanopore sequencing, yielding the full structure of 2,110 Cacna1e splice variants. However, we observed that only 154 Cacna1e splice variants were likely to encode for a functional VGCC based on predicted amino acid sequences. We then computationally prioritized these 154 splice variants using expression and evolutionary conservation and found that four splice variants are candidate functionally distinct splice isoforms. Our work not only provides long-read sequencing of Cacna1e for the first time, but also the first computational evaluation of which Cacna1e splice variants are the best candidates for future follow-up. <h4>SIGNIFICANCE STATEMENT</h4> Voltage gated calcium channels (Cacna1x genes) are implicated in many neurological disorders and their encoding genes are predicted to have complex patterns of alternative splicing. Previous approaches relied on short-read RNA-seq to characterize calcium channel splice variants. Here, we use long-read nanopore sequencing to establish a set of Cacna1e transcripts in the rat thalamus and use computational methods to prioritize four transcripts as functionally distinct splice isoforms. Our work to provide the field with prioritized transcripts will not only improve our understanding of Cacna1e function but its role in disease as well.
Also flagged:SARS-CoV-2 infectionIgGACEIFN-γcell proliferationimmune responses
Journal Article2022-04-08✓ 1 SnippetOgbe A, Pace M, Bittaye M, Tipoe T, Adele S, Alagaratnam J, Aley PK, Ansari MA, Bara A, Broadhead S, Brown A, Brown H, Cappuccini F, Cinardo P, Dejnirattisai W, Ewer KJ, Fok H, Folegatti PM, Fowler J, Godfrey L, Goodman AL, Jackson B, Jenkin D, Jones M, Longet S, Makinson RA, Marchevsky NG, Mathew M, Mazzella A, Mujadidi YF, Parolini L, Petersen C, Plested E, Pollock KM, Rajeswaran T, Ramasamy MN, Rhead S, Robinson H, Robinson N, Sanders H, Serrano S, Tipton T, Waters A, Zacharopoulou P, Barnes E, Dunachie S, Goulder P, Klenerman P, Screaton GR, Winston A, Hill AV, Gilbert SC, Carroll M, Pollard AJ, Fidler S, Fox J, Lambe T, Frater J.
In-Text Gene Mentions
Results)
…those of SARS-CoV-1,MERS-CoV-1, and HKU1 (…
Show Full Abstract
Duration of protection from SARS-CoV-2 infection in people living with HIV (PWH) following vaccination is unclear. In a substudy of the phase II/III the COV002 trial (NCT04400838), 54 HIV+ male participants on antiretroviral therapy (undetectable viral loads, CD4+ T cells > 350 cells/μL) received 2 doses of ChAdOx1 nCoV-19 (AZD1222) 4-6 weeks apart and were followed for 6 months. Responses to vaccination were determined by serology (IgG ELISA and Meso Scale Discovery [MSD]), neutralization, ACE-2 inhibition, IFN-γ ELISpot, activation-induced marker (AIM) assay and T cell proliferation. We show that, 6 months after vaccination, the majority of measurable immune responses were greater than prevaccination baseline but with evidence of a decline in both humoral and cell-mediated immunity. There was, however, no significant difference compared with a cohort of HIV-uninfected individuals vaccinated with the same regimen. Responses to the variants of concern were detectable, although they were lower than WT. Preexisting cross-reactive T cell responses to SARS-CoV-2 spike were associated with greater postvaccine immunity and correlated with prior exposure to beta coronaviruses. These data support the ongoing policy to vaccinate PWH against SARS-CoV-2, and they underpin the need for long-term monitoring of responses after vaccination.
Also flagged:tranexamic acidintracranial hemorrhagehemorrhagedeathhemorrhagicplasmin
Journal Article2022-04-08No SnippetsNishijima DK, VanBuren JM, Linakis SW, Hewes HA, Myers SR, Tran NK, Ghetti S, Bobinski M, Adelson PD, Roberts I, Holmes JF, Schalick WO, Dean JM, Casper TC, Kuppermann N, TIC‐TOC Collaborators of the Pediatric Emergency Care Applied Research Network (PECARN).
Show Full Abstract
<h4>Background</h4>The antifibrinolytic drug tranexamic acid (TXA) improves survival in adults with traumatic hemorrhage; however, the drug has not been evaluated in a trial in injured children. We assessed the feasibility of a large-scale trial evaluating the effects of TXA in children with severe hemorrhagic injuries.<h4>Methods</h4>Severely injured children (0 up to 18th birthday) were randomized into a double-blind randomized trial of (1) TXA 15 mg/kg bolus dose, followed by 2 mg/kg/h infusion over 8 h, (2) TXA 30 mg/kg bolus dose, followed by 4 mg/kg/h infusion over 8 h, or (3) normal saline placebo bolus and infusion. The trial was conducted at four pediatric Level I trauma centers in the United States between June 2018 and March 2020. We enrolled patients under federal exception from informed consent (EFIC) procedures when parents were unable to provide informed consent. Feasibility outcomes included the rate of enrollment, adherence to intervention arms, and ability to measure the primary clinical outcome. Clinical outcomes included global functioning (primary), working memory, total amount of blood products transfused, intracranial hemorrhage progression, and adverse events. The target enrollment rate was at least 1.25 patients per site per month.<h4>Results</h4>A total of 31 patients were randomized with a mean age of 10.7 years (standard deviation [SD] 5.0 years) and 22 (71%) patients were male. The mean time from injury to randomization was 2.4 h (SD 0.6 h). Sixteen (52%) patients had isolated brain injuries and 15 (48%) patients had isolated torso injuries. The enrollment rate using EFIC was 1.34 patients per site per month. All eligible enrolled patients received study intervention (nine patients TXA 15 mg/kg bolus dose, 10 patients TXA 30 mg/kg bolus dose, and 12 patients placebo) and had the primary outcome measured. No statistically significant differences in any of the clinical outcomes were identified.<h4>Conclusion</h4>Based on enrollment rate, protocol adherence, and measurement of the primary outcome in this pilot trial, we confirmed the feasibility of conducting a large-scale, randomized trial evaluating the efficacy of TXA in severely injured children with hemorrhagic brain and/or torso injuries using EFIC.
Also flagged:thrombintissue factorTFcoagulation factor XIFXIcoagulation factor X
Journal Article2022-04-08✓ 1 SnippetLakshmanan HHS, Estonilo A, Reitsma SE, Melrose AR, Subramanian J, Zheng TJ, Maddala J, Tucker EI, Gailani D, McCarty OJT, Jurney PL, Puy C.
In-Text Gene Mentions
Text
…ATIII…
Show Full Abstract
<h4>Background</h4>Biochemical reaction networks are self-regulated in part due to feedback activation mechanisms. The tissue factor (TF) pathway of blood coagulation is a complex reaction network controlled by multiple feedback loops that coalesce around the serine protease thrombin.<h4>Objectives</h4>Our goal was to evaluate the relative contribution of the feedback activation of coagulation factor XI (FXI) in TF-mediated thrombin generation using a comprehensive systems-based analysis.<h4>Materials and methods</h4>We developed a systems biology model that improves the existing Hockin-Mann (HM) model through an integrative approach of mathematical modeling and in vitro experiments. Thrombin generation measured using in vitro assays revealed that the feedback activation of FXI contributes to the propagation of thrombin generation based on the initial concentrations of TF or activated coagulation factor X (FXa). We utilized experimental data to improve the robustness of the HM model to capture thrombin generation kinetics without a role for FXI before including the feedback activation of FXI by thrombin to construct the extended (ext.) HM model.<h4>Results and conclusions</h4>Using the ext.HM model, we predicted that the contribution of positive feedback of FXI activation by thrombin can be abolished by selectively eliminating the inhibitory function of tissue factor pathway inhibitor (TFPI), a serine protease inhibitor of FXa and TF-activated factor VII (FVIIa) complex. This prediction from the ext.HM model was experimentally validated using thrombin generation assays with function blocking antibodies against TFPI and plasmas depleted of FXI. Together, our results demonstrate the applications of combining experimental and modeling techniques in predicting complex biochemical reaction systems.
Also flagged:cancertumorimprintinggene expressionluciferaseALB
Journal Article2022-04-08✓ 1 SnippetDietlein F, Wang AB, Fagre C, Tang A, Besselink NJM, Cuppen E, Li C, Sunyaev SR, Neal JT, Van Allen EM.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
We established a genome-wide compendium of somatic mutation events in 3949 whole cancer genomes representing 19 tumor types. Protein-coding events captured well-established drivers. Noncoding events near tissue-specific genes, such as <i>ALB</i> in the liver or <i>KLK3</i> in the prostate, characterized localized passenger mutation patterns and may reflect tumor-cell-of-origin imprinting. Noncoding events in regulatory promoter and enhancer regions frequently involved cancer-relevant genes such as <i>BCL6</i>, <i>FGFR2</i>, <i>RAD51B</i>, <i>SMC6</i>, <i>TERT</i>, and <i>XBP1</i> and represent possible drivers. Unlike most noncoding regulatory events, <i>XBP1</i> mutations primarily accumulated outside the gene's promoter, and we validated their effect on gene expression using CRISPR-interference screening and luciferase reporter assays. Broadly, our study provides a blueprint for capturing mutation events across the entire genome to guide advances in biological discovery, therapies, and diagnostics.
Also flagged:ulcerative colitisgranulomasabscessesinflammatory responsesmucin glycoproteinautophagy
Journal Article2022-04-08✓ 2 SnippetsShieh J, Chu TH, Liu Y, Kim J, Ruiz de Sabando A, Kobayashi S, Zee SY, Sheridan BS, Bialkowska AB, Yang VW.
In-Text Gene Mentions
Introduction)
…as Lgr5 ,Olfm4, Ascl2 ,…
Discussion)
…genes, Lgr5 ,Olfm4, Ascl2 ,…
Show Full Abstract
Inflammatory bowel disease (IBD) is a chronic illness characterized by dysregulated immune cascades in the intestines, in which the Th17 immune response plays an important role. We demonstrated that mice with intestinal epithelium-specific deletion of Krüppel-like factor 5 (Klf5) developed Th17-dependent colonic inflammation. In the absence of KLF5, there was aberrant cellular localization of phosphorylated STAT3, an essential mediator of the Th17-associated cytokine, IL-22, which is required for epithelial tissue regeneration. In contrast, mitigation of IL-17A with anti-IL-17A neutralizing antibody attenuated colitis in Klf5-deficient mice. There was also a considerable shift in the colonic microbiota of Klf5-deficient mice that phenocopied human IBD. Notably, the inflammatory response due to Klf5 deletion was alleviated by antibiotic treatment, implicating the role of microbiota in pathogenesis. Finally, human colitic tissues had reduced KLF5 levels when compared with healthy tissues. Together, these findings demonstrated the importance of KLF5 in protecting the intestinal epithelium against Th17-mediated immune and inflammatory responses. The mice described herein may serve as a potential model for human IBD.
Also flagged:fatty liver diseaseobesitymetabolic associated fatty liver diseasetriglyceridesinsulinALT
Journal Article2022-04-08✓ 1 SnippetOses M, Cadenas-Sanchez C, Medrano M, Galbete A, Miranda-Ferrua E, Ruiz JR, Sánchez-Valverde F, Ortega FB, Cabeza R, Villanueva A, Idoate F, Labayen I.
In-Text Gene Mentions
Results)
…rs13081389, PPARG rs1801282,HFErs1800562 and PNLPLA3…
Show Full Abstract
<h4>Background</h4>The early detection and management of children with metabolic associated fatty liver disease (MAFLD) is challenging.<h4>Objective</h4>To develop a non-invasive and accurate prediction protocol for the identification of MAFLD among children with overweight/obesity candidates to confirmatory diagnosis.<h4>Methods</h4>A total of 115 children aged 8-12 years with overweight/obesity, recruited at a primary care, were enrolled in this cross-sectional study. The external validation was performed using a cohort of children with overweight/obesity (N = 46) aged 8.5-14.0 years. MAFLD (≥5.5% hepatic fat) was diagnosed by magnetic resonance imaging (MRI). Fasting blood biochemical parameters were measured, and 25 candidates' single nucleotide polymorphisms (SNPs) were determined. Variables potentially associated with the presence of MAFLD were included in a multivariate logistic regression.<h4>Results</h4>Children with MAFLD (36%) showed higher plasma triglycerides (TG), insulin, homeostasis model assessment of insulin resistance (HOMA-IR), alanine aminotransferase (ALT), aspartate transaminase (AST), glutamyl-transferase (GGT) and ferritin (p < 0.05). The distribution of the risk-alleles of PPARGrs13081389, PPARGrs1801282, HFErs1800562 and PNLPLA3rs4823173 was significantly different between children with and without MAFLD (p < 0.05). Three biochemical- and/or SNPs-based predictive models were developed, showing strong discriminatory capacity (AUC-ROC: 0.708-0.888) but limited diagnostic performance (sensitivity 67%-82% and specificity 63%-69%). A prediction protocol with elevated sensitivity (72%) and specificity (84%) based on two consecutive steps was developed. The external validation showed similar results: sensitivity of 70% and specificity of 85%.<h4>Conclusions</h4>The HEPAKID prediction protocol is an accurate, easy to implant, minimally invasive and low economic cost tool useful for the early identification and management of paediatric MAFLD in primary care.
<h4>Purpose of review</h4>Increases in ambient levels of air pollutants have been linked to lung inflammation and remodeling, processes that lead to the development and exacerbation of allergic asthma. Conventional research has focused on the role of CD4<sup>+</sup> T helper 2 (T<sub>H</sub>2) cells in the pathogenesis of air pollution-induced asthma. However, much work in the past decade has uncovered an array of air pollution-induced non-T<sub>H</sub>2 immune mechanisms that contribute to allergic airway inflammation and disease.<h4>Recent findings</h4>In this article, we review current research demonstrating the connection between common air pollutants and their downstream effects on non-T<sub>H</sub>2 immune responses emerging as key players in asthma, including PRRs, ILCs, and non-T<sub>H</sub>2 T cell subsets. We also discuss the proposed mechanisms by which air pollution increases immune-mediated asthma risk, including pre-existing genetic risk, epigenetic alterations in immune cells, and perturbation of the composition and function of the lung and gut microbiomes. Together, these studies reveal the multifaceted impacts of various air pollutants on innate and adaptive immune functions via genetic, epigenetic, and microbiome-based mechanisms that facilitate the induction and worsening of asthma.
Also flagged:COVID-19SARS-CoV-2 infectionmulti-organ dysfunctionsinfectionIL1BAGT
Journal Article2022-04-08✓ 5 SnippetsPathak E, Atri N, Mishra R.
In-Text Gene Mentions
Results)
…Our analysis suggests that PRSS2, REG3A, REG1A, SPINK1 SPP1, MMP7, OLFM4, ISG15, ALB, IL32, and REG1B, AGT, IL1B, SERPINA, CRP, CD44, VTN, TTR, and CTSB are involved in the complement and coagulation cascade, extra-cellular matrix assembly, fluid balance, and immune response, and that their dysregulation may lead to sepsis.…
Results)
…OLFM4 is a glycoprotein that assists in cell adhesion and is an antiapoptotic factor, promoting tumour growth [62].…
Results)
…that SPINK1 ,OLFM4, ISG15 ,…
Results)
…, SPINK1 ,OLFM4, ISG15 ,…
Results)
…OLFM4is a glycoprotein…
Show Full Abstract
The SARS-CoV-2 infection affects the lungs, heart, kidney, intestine, olfactory epithelia, liver, and pancreas and brings forward multi-organ dysfunctions (MODs). However, mechanistic details of SARS-CoV-2-induced MODs are unclear. Here, we have investigated the role of pancreatic secretory proteins to mechanistically link COVID-19 with MODs using single-cell transcriptome analysis. Secretory proteins were identified using the Human Protein Atlas. Gene ontology, pathway, and disease enrichment analyses were used to highlight the role of upregulated pancreatic secretory proteins (secretome). We show that SARS-CoV-2 infection shifts the expression profile of pancreatic endocrine cells to acinar and ductal cell-specific profiles, resulting in increased expression of acinar and ductal cell-specific genes. Among all the secretory proteins, the upregulated expression of IL1B, AGT, ALB, SPP1, CRP, SERPINA1, C3, TFRC, TNFSF10, and MIF was mainly associated with disease of diverse organs. Extensive literature and experimental evidence are used to validate the association of the upregulated pancreatic secretome with the coagulation cascade, complement activation, renin-angiotensinogen system dysregulation, endothelial cell injury and thrombosis, immune system dysregulation, and fibrosis. Our finding suggests the influence of an upregulated secretome on multi-organ systems such as nervous, cardiovascular, immune, digestive, and urogenital systems. Our study provides evidence that an upregulated pancreatic secretome is a possible cause of SARS-CoV-2-induced MODs. This finding may have a significant impact on the clinical setting regarding the prevention of SARS-CoV-2-induced MODs.
Also flagged:gene expressionnasopharyngeal cancerFGFtumortumorsfibroblast growth factor
Journal Article2022-04-08No SnippetsTay JK, Zhu C, Shin JH, Zhu SX, Varma S, Foley JW, Vennam S, Yip YL, Goh CK, Wang Y, Loh KS, Tsao SW, Le QT, Sunwoo JB, West RB.
Show Full Abstract
Nasopharyngeal cancer (NPC) is an Epstein-Barr virus (EBV)-positive epithelial malignancy with an extensive inflammatory infiltrate. Traditional RNA-sequencing techniques uncovered only microenvironment signatures, while the gene expression of the tumor epithelial compartment has remained a mystery. Here, we use Smart-3SEQ to prepare transcriptome-wide gene expression profiles from microdissected NPC tumors, dysplasia, and normal controls. We describe changes in biological pathways across the normal to tumor spectrum and show that fibroblast growth factor (FGF) ligands are overexpressed in NPC tumors, while negative regulators of FGF signaling, including SPRY1, SPRY2, and LGALS3, are down-regulated early in carcinogenesis. Within the NF-κB signaling pathway, the critical noncanonical transcription factors, RELB and NFKB2, are enriched in the majority of NPC tumors. We confirm the responsiveness of EBV-positive NPC cell lines to targeted inhibition of these pathways, reflecting the heterogeneity in NPC patient tumors. Our data comprehensively describe the gene expression landscape of NPC and unravel the mysteries of receptor tyrosine kinase and NF-κB pathways in NPC.
Also flagged:polyglutamineaminoantibodiesHDautosomal dominant neurodegenerative disorderoligonucleotide
Journal Article2022-04-08✓ 5 SnippetsFischer DF, Dijkstra S, Lo K, Suijker J, Correia ACP, Naud P, Poirier M, Tessari MA, Boogaard I, Flynn G, Visser M, Lamers MBAC, McAllister G, Munoz-Sanjuan I, Macdonald D.
In-Text Gene Mentions
Methods)
…Full-length mouse HTT protein HTT-Q7 (1–3120) was expressed in a stable HEK293 in Expi293 expression system by Albany Molecular Research Inc. (Albany, USA), using a cloning vector pcDNA3.1 and restriction enzymes NheI and PmeI. C-terminal FLAG tagged recombinant proteins were purified by FLAG affinity chromatography followed by size exclusion, and equilibrated in 50 mM Tris pH 8.0, 500mM NaCL, 0.5% CHAPS, 1 mM TCEP and 5% glycerol.…
Discussion)
…Here we have revisited our previously-published assays that can quantify various human, mouse, and polyglutamine expanded forms of HTT protein in pre-clinical models of HD [16] and have replaced the polyclonal antibodies used in the original assays with mAbs.…
Methods)
…FLAG-tagged HTT proteins were eluted with 0.1 mg/ml FLAG® peptide in buffer A. Before size exclusion 0.4% CHAPS and 5 mM DTT was added and the proteins were loaded onto a SephacrylTM S-400 16/60 column equilibrated in 20 mM Tris pH 8, 500 mM NaCl, 5% glycerol, 0.4% CHAPS and 5 mM DTT.…
Introduction)
…Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by an expansion of a CAG trinucleotide repeat in exon 1 of the huntingtin (HTT) gene [1].…
Methods)
…Mouse monoclonal antibody 2B7 [21] was raised against the N-terminal domain of human and mouse HTT, whereas 4C9 was raised against the proline-rich region of human HTT (amino acid 65–84; [28]) and was custom produced by Pierce/Thermo Fisher.…
Show Full Abstract
Huntington's disease (HD) is caused by an expansion of the CAG trinucleotide repeat domain in the huntingtin gene that results in expression of a mutant huntingtin protein (mHTT) containing an expanded polyglutamine tract in the amino terminus. A number of therapeutic approaches that aim to reduce mHTT expression either locally in the CNS or systemically are in clinical development. We have previously described sensitive and selective assays that measure human HTT proteins either in a polyglutamine-independent (detecting both mutant expanded and non-expanded proteins) or in a polyglutamine length-dependent manner (detecting the disease-causing polyglutamine repeats) on the electrochemiluminescence Meso Scale Discovery detection platform. These original assays relied upon polyclonal antibodies. To ensure an accessible and sustainable resource for the HD field, we developed similar assays employing monoclonal antibodies. We demonstrate that these assays have equivalent sensitivity compared to our previous assays through the evaluation of cellular and animal model systems, as well as HD patient biosamples. We also demonstrate cross-site validation of these assays, allowing direct comparison of studies performed in geographically distinct laboratories.
Also flagged:membraneGene expressionLEPVEGFCSPARCBMP2
Journal Article2022-04-08✓ 1 SnippetYan X, Liu H, Hu J, Han X, Qi J, Ouyang Q, Hu B, He H, Li L, Wang J, Zeng X.
In-Text Gene Mentions
Introduction)
…Eight DEGs, includingPRDX6, TRIB2 ,…
Show Full Abstract
<h4>Background</h4>Egg production is one of the most important economic traits in the poultry industry. The hypothalamic-pituitary-gonadal (HPG) axis plays an essential role in regulating reproductive activities. However, the key genes and regulatory pathways within the HPG axis dominating egg production performance remain largely unknown in ducks.<h4>Results</h4>In this study, we compared the transcriptomic profiles of the HPG-related tissues between ducks with high egg production (HEP) and low egg production (LEP) to reveal candidate genes and regulatory pathways dominating egg production. We identified 543, 759, 670, and 181 differentially expressed genes (DEGs) in the hypothalamus, pituitary, ovary stroma, and F5 follicle membrane, respectively. Gene Ontology (GO) analysis revealed that DEGs from four HPG axis-related tissues were enriched in the "cellular component" category. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis indicated that the neuroactive ligand-receptor interaction pathway was significantly enriched based on DEGs commonly identified in all four HPG axis-related tissues. Gene expression profiles and Protein-Protein Interaction (PPI) network were performed to show the regulatory relationships of the DEGs identified. Five DEGs encoding secreted proteins in the hypothalamus and pituitary have interaction with DEGs encoding targeted proteins in the ovary stroma and F5 follicle membrane, implying that they were these DEGs might play similar roles in the regulation of egg production.<h4>Conclusions</h4>Our results revealed that neuroactive ligand-receptor interaction pathway and five key genes(VEGFC, SPARC, BMP2, THBS1, and ADAMTS15) were identified as the key signaling pathways and candidate genes within the HPG axis responsible for different egg production performance between HEP and LEP. This is the first study comparing the transcriptomic profiles of all HPG axis-related tissues in HEP and LEP using RNA-seq in ducks to the best of our knowledge. These data are helpful to enrich our understanding of the classical HPG axis regulating the egg production performance and identify candidate genes that can be used for genetic selection in ducks.
Also flagged:Breast cancerestrogen receptor alphaERtamoxifenestrogen receptorestrogens
Journal Article2022-04-08No SnippetsLiu Z, Liu J, Ebrahimi B, Pratap UP, He Y, Altwegg KA, Tang W, Li X, Lai Z, Chen Y, Shen L, Sareddy GR, Viswanadhapalli S, Tekmal RR, Rao MK, Vadlamudi RK.
Show Full Abstract
<h4>Background</h4>Methyltransferase SETDB1 is highly expressed in breast cancer (BC), however, the mechanisms by which SETDB1 promotes BC progression to endocrine therapy resistance remains elusive. In this study, we examined the mechanisms by which SETDB1 contribute to BC endocrine therapy resistance.<h4>Methods</h4>We utilized therapy sensitive (MCF7 and ZR75), therapy resistant (MCF7-TamR, MCF7-FR, MCF7-PELP1cyto, MCF7-SETDB1) estrogen receptor alpha positive (ER<sup>+</sup>)BC models and conducted in vitro cell viability, colony formation, 3-dimensional cell growth assays to investigate the role of SETDB1 in endocrine resistance. RNA-seq of parental and SETDB1 knock down ER<sup>+</sup> BC cells was used to identify unique pathways. SETDB1 interaction with PELP1 was identified by yeast-two hybrid screen and confirmed by immunoprecipitation and GST-pull down assays. Mechanistic studies were conducted using Western blotting, reporter gene assays, RT-qPCR, and in vitro methylation assays. Xenograft assays were used to establish the role of PELP1 in SETDB1 mediated BC progression.<h4>Results</h4>RNA-seq analyses showed that SETDB1 regulates expression of a subset of estrogen receptor (ER) and Akt target genes that contribute to endocrine therapy resistance. Importantly, using yeast-two hybrid screen, we identified ER coregulator PELP1 as a novel interacting protein of SETDB1. Biochemical analyses confirmed SETDB1 and PELP1 interactions in multiple BC cells. Mechanistic studies confirmed that PELP1 is necessary for SETDB1 mediated Akt methylation and phosphorylation. Further, SETDB1 overexpression promotes tamoxifen resistance in BC cells, and PELP1 knockdown abolished these effects. Using xenograft model, we provided genetic evidence that PELP1 is essential for SETDB1 mediated BC progression in vivo. Analyses of TCGA datasets revealed SETDB1 expression is positively correlated with PELP1 expression in ER<sup>+</sup> BC patients.<h4>Conclusions</h4>This study suggests that the PELP1/SETDB1 axis play an important role in aberrant Akt activation and serves as a novel target for treating endocrine therapy resistance in breast cancer.
Also flagged:dystonia parkinsonismX-linked dystonia-parkinsonismadult-onsetneurodegenerative disorderretrotransposonTAF1
Journal Article2022-04-08✓ 1 SnippetCampion LN, Mejia Maza A, Yadav R, Penney EB, Murcar MG, Correia K, Gillis T, Fernandez-Cerado C, Velasco-Andrada MS, Legarda GP, Ganza-Bautista NG, Lagarde JBB, Acuña PJ, Multhaupt-Buell T, Aldykiewicz G, Supnet ML, De Guzman JK, Go C, Sharma N, Munoz EL, Ang MC, Diesta CCE, Bragg DC, Ozelius LJ, Wheeler VC.
In-Text Gene Mentions
Discussion)
…Here, we show substantial correlation between brain region-specific levels of expansion of the XDP CCCTCT repeat and the HTT CAG repeat, as previously observed in a similar comparison between expansion of the HTT CAG repeat and of the ATXN1 CAG repeat underlying spinocerebellar ataxia type 1 (SCA1) [28].…
Show Full Abstract
X-linked dystonia-parkinsonism (XDP) is a progressive adult-onset neurodegenerative disorder caused by insertion of a SINE-VNTR-Alu (SVA) retrotransposon in the TAF1 gene. The SVA retrotransposon contains a CCCTCT hexameric repeat tract of variable length, whose length is inversely correlated with age at onset. This places XDP in a broader class of repeat expansion diseases, characterized by the instability of their causative repeat mutations. Here, we observe similar inverse correlations between CCCTCT repeat length with age at onset and age at death and no obvious correlation with disease duration. To gain insight into repeat instability in XDP we performed comprehensive quantitative analyses of somatic instability of the XDP CCCTCT repeat in blood and in seventeen brain regions from affected males. Our findings reveal repeat length-dependent and expansion-based instability of the XDP CCCTCT repeat, with greater levels of expansion in brain than in blood. The brain exhibits regional-specific patterns of instability that are broadly similar across individuals, with cerebellum exhibiting low instability and cortical regions exhibiting relatively high instability. The spectrum of somatic instability in the brain includes a high proportion of moderate repeat length changes of up to 5 repeats, as well as expansions of ~ 20- > 100 repeats and contractions of ~ 20-40 repeats at lower frequencies. Comparison with HTT CAG repeat instability in postmortem Huntington's disease brains reveals similar brain region-specific profiles, indicating common trans-acting factors that contribute to the instability of both repeats. Analyses in XDP brains of expansion of a different SVA-associated CCCTCT located in the LIPG gene, and not known to be disease-associated, reveals repeat length-dependent expansion at overall lower levels relative to the XDP CCCTCT repeat, suggesting that expansion propensity may be modified by local chromatin structure. Together, the data support a role for repeat length-dependent somatic expansion in the process(es) driving the onset of XDP and prompt further investigation into repeat dynamics and the relationship to disease.
…Drosophila PEBPs are associated with fitness through their role in innate immunity, which is evidenced by the upregulation of PEBP genes during infections [13, 14] and the protection against bacterial infections conferred by the overexpression of PEBP1 [16].…
Proteostasis reflects the well-balanced synthesis, trafficking and degradation of cellular proteins. This is a fundamental aspect of the dynamic cellular proteome, which integrates multiple signaling pathways, but it becomes increasingly error-prone during aging. Phosphatidylethanolamine-binding proteins (PEBPs) are highly conserved regulators of signaling networks and could therefore affect aging-related processes. To test this hypothesis, we expressed PEPBs in a heterologous context to determine their ectopic activity. We found that heterologous expression of the tobacco (<i>Nicotiana tabacum</i>) PEBP NtFT4 in <i>Drosophila melanogaster</i> significantly increased the lifespan of adult flies and reduced age-related locomotor decline. Similarly, overexpression of the Drosophila ortholog CG7054 increased longevity, whereas its suppression by RNA interference had the opposite effect. In tobacco, NtFT4 acts as a floral regulator by integrating environmental and intrinsic stimuli to promote the transition to reproductive growth. In Drosophila, NtFT4 engaged distinct targets related to proteostasis, such as HSP26. In older flies, it also prolonged <i>Hsp26</i> gene expression, which promotes longevity by maintaining protein integrity. In NtFT4-transgenic flies, we identified deregulated genes encoding proteases that may contribute to proteome stability at equilibrium. Our results demonstrate that the expression of NtFT4 influences multiple aspects of the proteome maintenance system via both physical interactions and transcriptional regulation, potentially explaining the aging-related phenotypes we observed.
Also flagged:deep vein thrombosisDVTInfectionVenous thromboembolismdeep-vein thrombosispulmonary embolism
Journal Article2022-04-08✓ 2 SnippetsCheng X, Lei X, Wu H, Luo H, Fu X, Gao Y, Wang X, Zhu Y, Yan J.
In-Text Gene Mentions
Results)
…nomogram, first, theATIII(%) of the…
Results)
…corresponding score (whenATIII< 80%, the…
Show Full Abstract
The fact that most of the patients with preoperative DVTs after calcaneal fractures are asymptomatic brought challenges to the early intervention, and periodic imaging examinations aggravated the financial burden of the patients in preoperative detumescence period. This study aimed to use routine clinical data, obtained from the database of Surgical Site Infection in Orthopaedic Surgery (SSIOS), to construct and validate a nomogram for predicting preoperative DVT risk in patients with isolated calcaneal fracture. The nomogram was established base on 7 predictors independently related to preoperative DVT. The performance of the model was tested by concordance index (C-index), receiver operating characteristic (ROC) curve, calibration curve, and decision curve analysis (DCA), and the results were furtherly verified internally and externally. 952 patients were enrolled in this study, of which 711 were used as the training set. The AUC of the nomogram was 0.870 in the training set and 0.905 in the validation set. After internal verification, the modified C-index was 0.846. Calibration curve and decision curve analysis both performed well in the training set and validation set. In short, we constructed a nomogram for predicting preoperative DVT risk in patients with isolated calcaneal fracture and verified its accuracy and clinical practicability.
Also flagged:MAOAanxietybehavioralcognitionserotonin transportermonoamine oxidase A
Journal Article2022-04-08✓ 5 SnippetsMartínez RM, Liao TT, Fan YT, Chen YC, Chen C.
In-Text Gene Mentions
Discussion)
…On one hand, it is reasonable that the MAOA-L genotype exerts its influence only on the fearful MMN amplitudes of those men who possess 5-HTT homozygous L alleles and those with 5-HTT heterozygous LS alleles, as those homozygous for the S allele would have an increased bioavailability of serotonin in their synaptic clefts, while at the same time, the MAOA-L would fail to degrade serotonin effectively, thus incurring in a ceiling effect.…
Discussion)
…This is probably due to the 5-HTT-LL/LS genotypes dispelling the ceiling effect of which the MAOA-L men homozygous for the S allele are subject of, as one of the two neural mechanisms tasked with regulating serotonin—namely, that of serotonin reuptake—could still be effectively exerting some reduction in regard to serotonergic-receptor excitation.…
Introduction)
…The S allele encodes less 5-HTT mRNA and protein in terms of quantity, which leads to the transporter carrying significantly less serotonin—relative to the L allele— back to the presynaptic neuron from the synaptic cleft; thus, the remaining excess of serotonin prolonging serotonergic receptor excitation2.…
Introduction)
…The serotonin transporter gene (SLC6A4) possesses a functional polymorphism (5-HTT) in its linked polymorphic region (5-HTTLPR), and which has been observed to be a genetic contributor towards anxiety-related traits and/or symptomatology1.…
Discussion)
…Furthermore, the differential threat-induced responses among individuals with varying 5-HTT pairs of alleles and MAOA-uVNTR enzymatic expressions may point toward the possibility of at least two anxiety subtypes, highly dependent on the dominance of either the serotonergic system or the noradrenergic system—as affected by the MAOA-L genotype’s low enzymatic activity.…
Show Full Abstract
Both the serotonin transporter polymorphism (5-HTTLPR) and the monoamine oxidase A gene (MAOA-uVNTR) are considered genetic contributors for anxiety-related symptomatology and aggressive behavior. Nevertheless, an interaction between these genes and the pre-attentive processing of threatening voices -a biological marker for anxiety-related conditions- has not been assessed yet. Among the entire sample of participants in the study with valid genotyping and electroencephalographic (EEG) data (N = 140), here we show that men with low-activity MAOA-uVNTR, and who were not homozygous for the 5-HTTLPR short allele (s) (n = 11), had significantly larger fearful MMN amplitudes -as driven by significant larger ERPs to fearful stimuli- than men with high-activity MAOA-uVNTR variants (n = 20). This is in contrast with previous studies, where significantly reduced fearful MMN amplitudes, driven by increased ERPs to neutral stimuli, were observed in those homozygous for the 5-HTT s-allele. In conclusion, using genetic, neurophysiological, and behavioral measurements, this study illustrates how the intricate interaction between the 5-HTT and the MAOA-uVNTR variants have an impact on threat processing, and social cognition, in male individuals (n = 62).
Also flagged:ADpeptideAβamyloid precursor proteinAPPβ-secretase
Journal Article2022-04-08No SnippetsHur JY.
Show Full Abstract
Alzheimer's disease (AD) is caused by synaptic and neuronal loss in the brain. One of the characteristic hallmarks of AD is senile plaques containing amyloid β-peptide (Aβ). Aβ is produced from amyloid precursor protein (APP) by sequential proteolytic cleavages by β-secretase and γ-secretase, and the polymerization of Aβ into amyloid plaques is thought to be a key pathogenic event in AD. Since γ-secretase mediates the final cleavage that liberates Aβ, γ-secretase has been widely studied as a potential drug target for the treatment of AD. γ-Secretase is a transmembrane protein complex containing presenilin, nicastrin, Aph-1, and Pen-2, which are sufficient for γ-secretase activity. γ-Secretase cleaves >140 substrates, including APP and Notch. Previously, γ-secretase inhibitors (GSIs) were shown to cause side effects in clinical trials due to the inhibition of Notch signaling. Therefore, more specific regulation or modulation of γ-secretase is needed. In recent years, γ-secretase modulators (GSMs) have been developed. To modulate γ-secretase and to understand its complex biology, finding the binding sites of GSIs and GSMs on γ-secretase as well as identifying transiently binding γ-secretase modulatory proteins have been of great interest. In this review, decades of findings on γ-secretase in AD are discussed.
Also flagged:schizophreniaglutamate receptorGRIN2Aneurodevelopmental disorderstranscription factorSP4
Journal Article2022-04-08✓ 1 SnippetTrubetskoy V, Pardiñas AF, Qi T, Panagiotaropoulou G, Awasthi S, Bigdeli TB, Bryois J, Chen CY, Dennison CA, Hall LS, Lam M, Watanabe K, Frei O, Ge T, Harwood JC, Koopmans F, Magnusson S, Richards AL, Sidorenko J, Wu Y, Zeng J, Grove J, Kim M, Li Z, Voloudakis G, Zhang W, Adams M, Agartz I, Atkinson EG, Agerbo E, Al Eissa M, Albus M, Alexander M, Alizadeh BZ, Alptekin K, Als TD, Amin F, Arolt V, Arrojo M, Athanasiu L, Azevedo MH, Bacanu SA, Bass NJ, Begemann M, Belliveau RA, Bene J, Benyamin B, Bergen SE, Blasi G, Bobes J, Bonassi S, Braun A, Bressan RA, Bromet EJ, Bruggeman R, Buckley PF, Buckner RL, Bybjerg-Grauholm J, Cahn W, Cairns MJ, Calkins ME, Carr VJ, Castle D, Catts SV, Chambert KD, Chan RCK, Chaumette B, Cheng W, Cheung EFC, Chong SA, Cohen D, Consoli A, Cordeiro Q, Costas J, Curtis C, Davidson M, Davis KL, de Haan L, Degenhardt F, DeLisi LE, Demontis D, Dickerson F, Dikeos D, Dinan T, Djurovic S, Duan J, Ducci G, Dudbridge F, Eriksson JG, Fañanás L, Faraone SV, Fiorentino A, Forstner A, Frank J, Freimer NB, Fromer M, Frustaci A, Gadelha A, Genovese G, Gershon ES, Giannitelli M, Giegling I, Giusti-Rodríguez P, Godard S, Goldstein JI, González Peñas J, González-Pinto A, Gopal S, Gratten J, Green MF, Greenwood TA, Guillin O, Gülöksüz S, Gur RE, Gur RC, Gutiérrez B, Hahn E, Hakonarson H, Haroutunian V, Hartmann AM, Harvey C, Hayward C, Henskens FA, Herms S, Hoffmann P, Howrigan DP, Ikeda M, Iyegbe C, Joa I, Julià A, Kähler AK, Kam-Thong T, Kamatani Y, Karachanak-Yankova S, Kebir O, Keller MC, Kelly BJ, Khrunin A, Kim SW, Klovins J, Kondratiev N, Konte B, Kraft J, Kubo M, Kučinskas V, Kučinskiene ZA, Kusumawardhani A, Kuzelova-Ptackova H, Landi S, Lazzeroni LC, Lee PH, Legge SE, Lehrer DS, Lencer R, Lerer B, Li M, Lieberman J, Light GA, Limborska S, Liu CM, Lönnqvist J, Loughland CM, Lubinski J, Luykx JJ, Lynham A, Macek M, Mackinnon A, Magnusson PKE, Maher BS, Maier W, Malaspina D, Mallet J, Marder SR, Marsal S, Martin AR, Martorell L, Mattheisen M, McCarley RW, McDonald C, McGrath JJ, Medeiros H, Meier S, Melegh B, Melle I, Mesholam-Gately RI, Metspalu A, Michie PT, Milani L, Milanova V, Mitjans M, Molden E, Molina E, Molto MD, Mondelli V, Moreno C, Morley CP, Muntané G, Murphy KC, Myin-Germeys I, Nenadić I, Nestadt G, Nikitina-Zake L, Noto C, Nuechterlein KH, O'Brien NL, O'Neill FA, Oh SY, Olincy A, Ota VK, Pantelis C, Papadimitriou GN, Parellada M, Paunio T, Pellegrino R, Periyasamy S, Perkins DO, Pfuhlmann B, Pietiläinen O, Pimm J, Porteous D, Powell J, Quattrone D, Quested D, Radant AD, Rampino A, Rapaport MH, Rautanen A, Reichenberg A, Roe C, Roffman JL, Roth J, Rothermundt M, Rutten BPF, Saker-Delye S, Salomaa V, Sanjuan J, Santoro ML, Savitz A, Schall U, Scott RJ, Seidman LJ, Sharp SI, Shi J, Siever LJ, Sigurdsson E, Sim K, Skarabis N, Slominsky P, So HC, Sobell JL, Söderman E, Stain HJ, Steen NE, Steixner-Kumar AA, Stögmann E, Stone WS, Straub RE, Streit F, Strengman E, Stroup TS, Subramaniam M, Sugar CA, Suvisaari J, Svrakic DM, Swerdlow NR, Szatkiewicz JP, Ta TMT, Takahashi A, Terao C, Thibaut F, Toncheva D, Tooney PA, Torretta S, Tosato S, Tura GB, Turetsky BI, Üçok A, Vaaler A, van Amelsvoort T, van Winkel R, Veijola J, Waddington J, Walter H, Waterreus A, Webb BT, Weiser M, Williams NM, Witt SH, Wormley BK, Wu JQ, Xu Z, Yolken R, Zai CC, Zhou W, Zhu F, Zimprich F, Atbaşoğlu EC, Ayub M, Benner C, Bertolino A, Black DW, Bray NJ, Breen G, Buccola NG, Byerley WF, Chen WJ, Cloninger CR, Crespo-Facorro B, Donohoe G, Freedman R, Galletly C, Gandal MJ, Gennarelli M, Hougaard DM, Hwu HG, Jablensky AV, McCarroll SA, Moran JL, Mors O, Mortensen PB, Müller-Myhsok B, Neil AL, Nordentoft M, Pato MT, Petryshen TL, Pirinen M, Pulver AE, Schulze TG, Silverman JM, Smoller JW, Stahl EA, Tsuang DW, Vilella E, Wang SH, Xu S, Indonesia Schizophrenia Consortium, PsychENCODE, Psychosis Endophenotypes International Consortium, SynGO Consortium, Adolfsson R, Arango C, Baune BT, Belangero SI, Børglum AD, Braff D, Bramon E, Buxbaum JD, Campion D, Cervilla JA, Cichon S, Collier DA, Corvin A, Curtis D, Forti MD, Domenici E, Ehrenreich H, Escott-Price V, Esko T, Fanous AH, Gareeva A, Gawlik M, Gejman PV, Gill M, Glatt SJ, Golimbet V, Hong KS, Hultman CM, Hyman SE, Iwata N, Jönsson EG, Kahn RS, Kennedy JL, Khusnutdinova E, Kirov G, Knowles JA, Krebs MO, Laurent-Levinson C, Lee J, Lencz T, Levinson DF, Li QS, Liu J, Malhotra AK, Malhotra D, McIntosh A, McQuillin A, Menezes PR, Morgan VA, Morris DW, Mowry BJ, Murray RM, Nimgaonkar V, Nöthen MM, Ophoff RA, Paciga SA, Palotie A, Pato CN, Qin S, Rietschel M, Riley BP, Rivera M, Rujescu D, Saka MC, Sanders AR, Schwab SG, Serretti A, Sham PC, Shi Y, St Clair D, Stefánsson H, Stefansson K, Tsuang MT, van Os J, Vawter MP, Weinberger DR, Werge T, Wildenauer DB, Yu X, Yue W, Holmans PA, Pocklington AJ, Roussos P, Vassos E, Verhage M, Visscher PM, Yang J, Posthuma D, Andreassen OA, Kendler KS, Owen MJ, Wray NR, Daly MJ, Huang H, Neale BM, Sullivan PF, Ripke S, Walters JTR, O'Donovan MC, Schizophrenia Working Group of the Psychiatric Genomics Consortium.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
Schizophrenia has a heritability of 60-80%<sup>1</sup>, much of which is attributable to common risk alleles. Here, in a two-stage genome-wide association study of up to 76,755 individuals with schizophrenia and 243,649 control individuals, we report common variant associations at 287 distinct genomic loci. Associations were concentrated in genes that are expressed in excitatory and inhibitory neurons of the central nervous system, but not in other tissues or cell types. Using fine-mapping and functional genomic data, we identify 120 genes (106 protein-coding) that are likely to underpin associations at some of these loci, including 16 genes with credible causal non-synonymous or untranslated region variation. We also implicate fundamental processes related to neuronal function, including synaptic organization, differentiation and transmission. Fine-mapped candidates were enriched for genes associated with rare disruptive coding variants in people with schizophrenia, including the glutamate receptor subunit GRIN2A and transcription factor SP4, and were also enriched for genes implicated by such variants in neurodevelopmental disorders. We identify biological processes relevant to schizophrenia pathophysiology; show convergence of common and rare variant associations in schizophrenia and neurodevelopmental disorders; and provide a resource of prioritized genes and variants to advance mechanistic studies.
Also flagged:ALLacute leukemiasALacute myeloid leukemiasacute undifferentiated leukemiasacute leukemia
Journal Article2022-04-08✓ 3 SnippetsGenescà E, la Starza R.
In-Text Gene Mentions
Introduction)
…Furthermore, several rearrangements, such as MLLT10, NUP214, and NUP98 translocations, are also shared between T-ALL and AML M0 subtypes, suggesting that specific genetic entities possibly prevail over phenotypic clustering [7,8,9,10,11].…
S I O 001029)
…PICALM-MLLT10, the most frequent fusion transcript in T-ALL, accounts for 7% of pediatric and 6% of adult T-ALL cases [51].…
Introduction)
…rearrangements, such asMLLT10, NUP214 ,…
Show Full Abstract
A wide range of immature acute leukemias (AL), ranging from acute myeloid leukemias with minimal differentiation to acute leukemias with an ambiguous lineage, i.e., acute undifferentiated leukemias and mixed phenotype acute leukemia with T- or B-plus myeloid markers, cannot be definitely assigned to a single cell lineage. This somewhat "grey zone" of AL expresses partly overlapping features with the most immature forms of T-cell acute lymphoblastic leukemia (T-ALL), i.e., early T-cell precursor ALL (ETP-ALL), near-ETP-ALL, and pro-T ALL. These are troublesome cases in terms of precise diagnosis because of their similarities and overlapping phenotypic features. Moreover, it has become evident that they share several genomic alterations, raising the question of how their phenotypes reflect distinct AL entities. The aim of this review was to provide a systematic overview of the genetic events associated with immature T-ALL and outline their relationship with treatment choices and outcomes, especially looking at the most recent preclinical and clinical studies. We wish to offer a basis for using the genetic information for new diagnostic algorithms, in order to better stratify patients and improve their management with more efficient and personalized therapeutic options. Understanding the genetic profile of this high-risk T-ALL subset is a prerequisite for changing the current clinical scenario.
Also flagged:Nrf2oxygenagingPeroxiredoxin 6dichlorofluoresceindeath
Journal Article2022-04-08✓ 5 SnippetsChhunchha B, Kubo E, Singh DP.
In-Text Gene Mentions
Methods)
…Briefly, amino acid exchanges at the Klf9 sites (RKBE 1 and RKBE 3) mutants (RKBE 1; GC to TT and RKBE 3; AC to TT) were produced by point mutations in the human promoter of Prdx6-linked to CAT plasmid as described earlier [11].…
…stress augmented Nrf2-mediatedPrdx6expression, while higher…
Show Full Abstract
Changes in intracellular reactive oxygen species (ROS) levels due to remodeling of antioxidant defense can affect the status of biological homeostasis in aging/oxidative stress. Peroxiredoxin 6 (Prdx6), an antioxidant gene downstream target for the Nrf2 pathway, plays a role in regulating ROS homeostasis. Using aging human (h) lens epithelial cells (LECs) or <i>Prdx6</i>-deficient (<i>Prdx6<sup>-/-</sup>)</i> mouse (m) LECs, here we showed that dichlorofluorescein (DCF) oxidation or H<sub>2</sub>O<sub>2</sub> were strictly controlled by Prdx6. We observed that a moderate degree of oxidative stress augmented Nrf2-mediated Prdx6 expression, while higher doses of H<sub>2</sub>O<sub>2</sub> (≥100 µM) caused a dramatic loss of Prdx6 expression, resulting in increased DCF oxidation and H<sub>2</sub>O<sub>2</sub> amplification and cell death. Mechanistically, at increased oxidative stress, Nrf2 upregulated transcriptional factor Klf9, and that Klf9 bound to the promoter and repressed the Prdx6 gene. Similarly, cells overexpressing Klf9 displayed Klf9-dependent Prdx6 suppression and DCF oxidation with H<sub>2</sub>O<sub>2</sub> amplification, while <i>Sh</i>Klf9 reversed the process. Our data revealed that H<sub>2</sub>O<sub>2</sub> and DCF oxidation levels play a hormetical role, and the Nrf2-Klf9-Prdx6 pathway is pivotal for the phenomena under the conditions of oxidative load/aging. On the whole, the results demonstrate that oxidative hormetical response is essentially based on levels of oxidative triggering and the status of Klf9-Prdx6 pathway activation; thus, Klf9 can be considered as a therapeutic target for hormetic shifting of cellular defense to improve protective resilience to oxidative stress.
Tryptophan, as the sole precursor of serotonin, mainly derived from diets, is essential for neurodevelopment and immunomodulation. Gestational tryptophan fluctuation may account for the maternal-fetal transmission in determining neuroembryogenesis with long-lasting effects on psychological development. Personality disorders and social exclusion are related to psychosocial problems, leading to impaired social functioning. However, it is not clear how the fluctuation in mother-child transmission regulates the neuroendocrine development and gut microbiota composition in progeny due to that tryptophan metabolism in pregnant women is affected by multiple factors, such as diets (tryptophan-enriched or -depleted diet), emotional mental states (anxiety, depression), health status (hypertension, diabetes), and social support as well as stresses and management skills. Recently, we have developed a non-mammal model to rationalize those discrepancies without maternal effects. This perspective article outlines the possibility and verified the hypothesis in bully-victim research with this novel model: (1). Summarizes the effects of the maternal tryptophan administration on the neuroendocrine and microbial development in their offspring; (2). Highlights the inconsistency and limitations in studying the relationship between gestational tryptophan exposure and psychosocial development in humans and viviparous animals; and (3). Evidences that embryonic exposure to tryptophan and its metabolite modify bullying interactions in the chicken model. With the current pioneer researches on the biomechanisms underlying the bully-victim interaction, the perspective article provides novel insights for developing appropriate intervention strategies to prevent psychological disorders among individuals, especially those who experienced prenatal stress, by controlling dietary tryptophan and medication therapy during pregnancy.
Also flagged:MembraneExtracellularstem cell differentiationTGF-β1BMP7cadherin
Journal Article2022-04-08No SnippetsMun S, Kim SM, Choi MJ, Jang YJ.
Show Full Abstract
Ligament-fibroblastic cells and cementoblasts, two types of progenitor cells that differentiate from periodontal ligament stem cells (hPDLSCs), are responsible for the formation of the adhesive tissues in the tooth root. Since one of the factors that determines the fate of stem cell differentiation is the change in the microenvironment of the stem/progenitor cells, this study attempted to compare and analyze the molecular differences in the membrane and ECM of the two progenitor cells. Single cells derived from hPDLSCs were treated with TGF-β1 and BMP7 to obtain ligament-fibroblastic and cementoblastic cells, respectively. The transcriptome profiles of three independent replicates of each progenitor were evaluated using next-generation sequencing. The representative differentially expressed genes (DEGs) were verified by qRT-PCR, Western blot analysis, and immunohistochemistry. Among a total of 2245 DEGs identified, 142 and 114 DEGs related to ECM and cell membrane molecules were upregulated in ligament-fibroblastic and cementoblast-like cells, respectively. The major types of integrin and cadherin were found to be different between the two progenitor cells. In addition, the representative core proteins for each glycosaminoglycan-specific proteoglycan class were different between the two progenitors. This study provides a detailed understanding of cell-cell and cell-ECM interactions through the specific components of the membrane and ECM for ligament-fibroblastic and cementoblastic differentiation of hPDLSCs.
Also flagged:DonepezilAlzheimer's diseaseADSTINGsynaptic transmissionneurodegenerative disorder
Journal Article2022-04-08No SnippetsLiu L, Zhu Y, Fu P, Yang J.
Show Full Abstract
<h4>Objective</h4>In order to explore and further understand the efficacy of donepezil (DNP) in the treatment of Alzheimer's disease (AD), this research was conducted based on network pharmacology and molecular docking.<h4>Method</h4>Compounds of DNP and its effective targets were collected using the TCMSP Chinese medicine system pharmacology database. Disease targets were screened and selected utilizing GeneCards, TTD, DrugBank, CTD, and other online databases. Then, Venn diagrams were generated to identify the intersections. A diseases-drug-active ingredient-key target protein interaction (PPI) network was constructed using the STING database. GO and KEGG enrichment analyses were conducted to predict the function and mechanism of DNP, which were visualized by graphs and bubble charts. After the screening, the top five interacting targets in the PPI network and the compound containing the most active target were selected for molecular docking.<h4>Results</h4>The study received 110 potential targeting genes and 155 signaling pathways. A strong association between DNP and modulation of chemical synaptic transmission and the regulation of trans-synaptic signaling is noted. Signaling pathways related to the proliferation, differentiation, and survival of cells are also found positively relative. The results revealed that the mechanism of its therapeutic effect is multi-component, multi-target, and multi-pathway, laying a foundation for the follow-up in-depth study of the mechanism of DNP in the treatment of AD.<h4>Conclusion</h4>This research provides a superior prediction that AD could be treated using DNP which targets the key proteins and essential pathways associated with the recovery of AD.
Also flagged:insomniadepressionseasonal affective disorderSADmajor depressive disorderhypersomnia
Journal Article2022-04-08✓ 1 SnippetHöller Y, Urbschat MM, Kristófersson GK, Ólafsson RP.
In-Text Gene Mentions
Introduction)
…SAD showed higher5-HTTlevels compared to…
Show Full Abstract
Induced by decreasing light, people affected by seasonal mood fluctuations may suffer from low energy, have low interest in activities, experience changes in weight, insomnia, difficulties in concentration, depression, and suicidal thoughts. Few studies have been conducted in search for biological predictors of seasonal mood fluctuations in the brain, such as EEG oscillations. A sample of 64 participants was examined with questionnaires and electroencephalography in summer. In winter, a follow-up survey was recorded and participants were grouped into those with at least mild (<i>N</i> = 18) and at least moderate (<i>N</i> = 11) mood decline and those without self-reported depressive symptoms both in summer and in winter (<i>N</i> = 46). A support vector machine was trained to predict mood decline by either EEG biomarkers alone, questionnaire data from baseline alone, or a combination of the two. Leave-one-out-cross validation with lasso regularization was used with logistic regression to fit a model. The accuracy for classification for at least mild/moderate mood decline was 77/82% for questionnaire data, 72/82% for EEG alone, and 81/86% for EEG combined with questionnaire data. Self-report data was more conclusive than EEG biomarkers recorded in summer for prediction of worsening of depressive symptoms in winter but it is advantageous to combine EEG with psychological assessment to boost predictive performance.
Also flagged:cancerautoimmune diseasessystemic sclerosissystemic autoimmune diseaseskinskin fibrosis
Journal Article2022-04-08No SnippetsLiu Y, Cheng L, Zhan H, Li H, Li X, Huang Y, Li Y.
Show Full Abstract
Noncoding RNAs (ncRNAs) constitute more than 90% of the RNAs in the human genome. In the past decades, studies have changed our perception of ncRNAs from "junk" transcriptional products to functional regulatory molecules that mediate critical processes, including chromosomal modifications, mRNA splicing and stability, and translation, as well as key signaling pathways. Emerging evidence suggests that ncRNAs are abnormally expressed in not only cancer but also autoimmune diseases, such as systemic sclerosis (SSc), and may serve as novel biomarkers and therapeutic targets for the diagnosis and treatment of SSc. However, the functions and underlying mechanisms of ncRNAs in SSc remain incompletely understood. In this review, we discuss the current findings on the biogenetic processes and functions of ncRNAs, including microRNAs and long noncoding RNAs, as well as explore emerging ncRNA-based diagnostics and therapies for SSc.
Also flagged:Transferrin Receptor 2Type 3 HemochromatosisTypehereditary hemochromatosisHHtype 3 HH
Journal Article2022-04-08✓ 5 SnippetsTang S, Bai L, Gao Y, Hou W, Song W, Liu H, Hu Z, Duan Z, Zhang L, Zheng S.
In-Text Gene Mentions
Title)
…Transferrin Receptor 2Hemochromatosis…
Abstract)
…of TFR2 -relatedhemochromatosiswith a novel…
Introduction)
…caused by theHFEgene mutation is…
Introduction)
…dominant form ofhemochromatosisdue to the…
Introduction)
…Hemochromatosis, which is associated…
Show Full Abstract
Type 3 hereditary hemochromatosis (HH) is a rare form of HH characterized by genetic mutation in the <i>TFR2</i> gene. Clinical features reported in patients with type 3 HH include abnormal liver function, liver fibrosis, cirrhosis, diabetes, hypogonadism, cardiomyopathy, and skin pigmentation. Since its original description in 2000, 33 pathogenic <i>TFR2</i> mutations associated with HH have been described until now. Here, we first reported a Chinese pedigree of <i>TFR2</i>-related hemochromatosis with a novel compound heterozygous mutation c.1288G > A (p.G430R)/c.960T > A (p.Y320X). Interestingly, different phenotypes were reported although the proband and his sister shared the same gene mutation. This inconsistency between genotypes and phenotypes indicates multifactorial etiology contributing to the development of HH. Our report broadens the mutation spectrum of the <i>TFR2</i> gene associated with HH.
Also flagged:ulcerative colitisbioaminesynthesisprotein synthesissecretionTPH1
Journal Article2022-04-08✓ 3 SnippetsLyu D, Kou G, Li S, Li L, Li B, Zhou R, Yang X, Tian W, Li Y, Zuo X.
In-Text Gene Mentions
Results)
…Most of the upregulated genes, such as REG1A, OLFM4, and CD74, were associated with inflammation and were also upregulated in the Epi-UC group (Figures 4C,D).…
Results)
…as REG1A ,OLFM4, and CD74…
Results)
…LCN2 , andOLFM4were expressed in…
Show Full Abstract
As a major component of the enteroendocrine system, enterochromaffin (EC) cells play a key role in ulcerative colitis (UC). However, the scarcity of EC cells has limited the investigation of their function. In this study, we applied digital spatial profiling to acquire transcriptomic data for EC cells and other epithelial cells from colonoscopic biopsy samples from eight patients with UC and seven healthy controls. Differential expression analysis, gene set enrichment analysis, and weighted gene coexpression network analysis were performed to identify differentially expressed genes and pathways and coexpression networks. Results were validated using an online dataset obtained by single-cell RNA sequencing, along with immunofluorescence staining and quantitative real-time PCR. In healthy participants, 10 genes were significantly enriched in EC cells, functionally concentrated in protein and bioamine synthesis. A coexpression network containing 17 hub genes, including <i>TPH1</i>, <i>CHGA</i>, and <i>GCLC</i>, was identified in EC cells. In patients with UC, EC cells gained increased capacity for protein synthesis, along with novel immunological functions such as antigen processing and presentation, whereas chemical sensation was downregulated. The specific expression of <i>CHGB</i> and <i>RGS2</i> in EC cells was confirmed by immunofluorescence staining. Our results illuminate the transcriptional signatures of EC cells in the human colon. EC cells' newly observed functional shift from sensation to secretion and immunity indicates their pivotal role in UC.
Pseudokinases regulate diverse cellular processes associated with normal cellular functions and disease. They are defined bioinformatically based on the absence of one or more catalytic residues that are required for canonical protein kinase functions. The ability to define pseudokinases based on primary sequence comparison has enabled the systematic mapping and cataloging of pseudokinase orthologs across the tree of life. While these sequences contain critical information regarding pseudokinase evolution and functional specialization, extracting this information and generating testable hypotheses based on integrative mining of sequence and structural data requires specialized computational tools and resources. In this chapter, we review recent advances in the development and application of open-source tools and resources for pseudokinase research. Specifically, we describe the application of an interactive data analytics framework, KinView, for visualizing the patterns of conservation and variation in the catalytic domain motifs of pseudokinases and evolutionarily related canonical kinases using a consistent set of curated alignments organized based on the widely used kinome evolutionary hierarchy. We also demonstrate the application of an integrated Protein Kinase Ontology (ProKinO) and an interactive viewer, ProtVista, for mapping and analyzing primary sequence motifs and annotations in the context of 3D structures and AlphaFold2 models. We provide examples and protocols for generating testable hypotheses on pseudokinase functions both for bench biologists and advanced users.
Research Square2022-04-08Preprint (No Snippets API)Collins S, Vliet Lv, Gielen F, Janeček M, Valladolid SW, Poudel C, Fusco G, De Simone A, Michel C, Kaminski C, Spring D, Hollfelder F, Schierle GSK.
Show Full Abstract
<title>Abstract</title> <p>Inhibiting the aggregation of amyloid β (1-42) is a promising strategy for the development of disease-modifying Alzheimer’s disease therapeutics. To date, however, no sufficiently efficacious inhibitors have been identified, despite the best efforts of >200 advanced drug development campaigns. This failure can be attributed to limitations in current compound screening and in vivo validation assays. Here, we report an in vitro to in vivo screening platform based on the use of a fluorescence lifetime aggregation sensor. The microfluidic “nanoFLIM” assay developed circumvents issues that plague conventional assays, such as lack of reproducibility, high cost and artefactual false read-outs. The fluorescence lifetime sensor can also dynamically monitor peptide aggregation in cellular and Caenorhabditis elegans disease models, providing directly comparable aggregation kinetics, which is not achievable by any other method. The power of this unified system for accelerating hit-to-lead strategies, lowering attrition rates and expediting in vivo screening, was demonstrated with a pilot screening campaign of 445 compounds, revealing a new inhibitor that can inhibit amyloid β self-assembly in vitro as well as in cellular and whole organism disease models.</p>
Also flagged:dengueDengue shock syndromeinfectionscoagulopathymulti-organ failuredeath
Journal Article2022-04-07No SnippetsTrieu HT, Khanh LP, Ming DKY, Quang CH, Phan TQ, Van VCN, Deniz E, Mulligan J, Wills BA, Moulton S, Yacoub S.
Show Full Abstract
<h4>Background</h4>Dengue shock syndrome (DSS) is one of the major clinical phenotypes of severe dengue. It is defined by significant plasma leak, leading to intravascular volume depletion and eventually cardiovascular collapse. The compensatory reserve Index (CRI) is a new physiological parameter, derived from feature analysis of the pulse arterial waveform that tracks real-time changes in central volume. We investigated the utility of CRI to predict recurrent shock in severe dengue patients admitted to the ICU.<h4>Methods</h4>We performed a prospective observational study in the pediatric and adult intensive care units at the Hospital for Tropical Diseases, Ho Chi Minh City, Vietnam. Patients were monitored with hourly clinical parameters and vital signs, in addition to continuous recording of the arterial waveform using pulse oximetry. The waveform data was wirelessly transmitted to a laptop where it was synchronized with the patient's clinical data.<h4>Results</h4>One hundred three patients with suspected severe dengue were recruited to this study. Sixty-three patients had the minimum required dataset for analysis. Median age was 11 years (IQR 8-14 years). CRI had a negative correlation with heart rate and moderate negative association with blood pressure. CRI was found to predict recurrent shock within 12 h of being measured (OR 2.24, 95% CI 1.54-3.26), P < 0.001). The median duration from CRI measurement to the first recurrent shock was 5.4 h (IQR 2.9-6.8). A CRI cutoff of 0.4 provided the best combination of sensitivity and specificity for predicting recurrent shock (0.66 [95% CI 0.47-0.85] and 0.86 [95% CI 0.80-0.92] respectively).<h4>Conclusion</h4>CRI is a useful non-invasive method for monitoring intravascular volume status in patients with severe dengue.
Also flagged:psychiatric disordersbehavioraldopamineinnervationaxonsnucleus
Journal Article2022-04-07✓ 5 SnippetsRestrepo-Lozano JM, Pokhvisneva I, Wang Z, Patel S, Meaney MJ, Silveira PP, Flores C.
In-Text Gene Mentions
Introduction)
…In adolescent rodents, DCC-mediated Netrin-1 signaling organizes the maturation of dopamine networks by promoting mesolimbic dopamine axon targeting in the NAcc and controlling the growth of dopamine axons to the PFC [12, 17].…
Methods)
…We used gene expression datasets from mice (see Supplementary Data file) because our study is guided by our previous findings in rodents linking variations in Dcc expression to changes in impulse control and in mesocorticolimbic dopamine axon targeting [13, 17, 51, 52].…
Introduction)
…cue receptor gene,DCC, and several psychiatric…
Introduction)
…expression of theDCCgene network in…
Introduction)
…that the Netrin-1/DCCguidance cue system…
Show Full Abstract
Inhibitory control deficits are prevalent in multiple neuropsychiatric conditions. The communication- as well as the connectivity- between corticolimbic regions of the brain are fundamental for eliciting inhibitory control behaviors, but early markers of vulnerability to this behavioral trait are yet to be discovered. The gradual maturation of the prefrontal cortex (PFC), in particular of the mesocortical dopamine innervation, mirrors the protracted development of inhibitory control; both are present early in life, but reach full maturation by early adulthood. Evidence suggests the involvement of the Netrin-1/DCC signaling pathway and its associated gene networks in corticolimbic development. Here we investigated whether an expression-based polygenic score (ePRS) based on corticolimbic-specific DCC gene co-expression networks associates with impulsivity-related phenotypes in community samples of children. We found that lower ePRS scores associate with higher measurements of impulsive choice in 6-year-old children tested in the Information Sampling Task and with impulsive action in 6- and 10-year-old children tested in the Stop Signal Task. We also found the ePRS to be a better overall predictor of impulsivity when compared to a conventional PRS score comparable in size to the ePRS (4515 SNPs in our discovery cohort) and derived from the latest GWAS for ADHD. We propose that the corticolimbic DCC-ePRS can serve as a novel type of marker for impulsivity-related phenotypes in children. By adopting a systems biology approach based on gene co-expression networks and genotype-gene expression (rather than genotype-disease) associations, these results further validate our methodology to construct polygenic scores linked to the overall biological function of tissue-specific gene networks.
Also flagged:membraneadherens junctionorganizationlocalizationslocalizationgene expression
Journal Article2022-04-07✓ 5 SnippetsZhang HB, Ding XB, Jin J, Guo WP, Yang QL, Chen PC, Yao H, Ruan L, Tao YT, Chen X.
In-Text Gene Mentions
Methods)
…wild type andOlfm4-knockout mice in…
Methods)
…used for theOlfm4(+/+) or Olfm4…
Methods)
…Olfm4 (+/+) orOlfm4-knockout (-/-) prostate…
Results)
…to re-analyse theOlfm4-knockout mice microarray…
Results)
…The olfactomedin 4 (OLFM4) gene in humans…
Show Full Abstract
The house mouse or Mus musculus has become a premier mammalian model for genetic research due to its genetic and physiological similarities to humans. It brought mechanistic insights into numerous human diseases and has been routinely used to assess drug efficiency and toxicity, as well as to predict patient responses. To facilitate molecular mechanism studies in mouse, we present the Mouse Interactome Database (MID, Version 1), which includes 155,887 putative functional associations between mouse protein-coding genes inferred from functional association evidence integrated from 9 public databases. These putative functional associations are expected to cover 19.32% of all mouse protein interactions, and 26.02% of these function associations may represent protein interactions. On top of MID, we developed a gene set linkage analysis (GSLA) web tool to annotate potential functional impacts from observed differentially expressed genes. Two case studies show that the MID/GSLA system provided precise and informative annotations that other widely used gene set annotation tools, such as PANTHER and DAVID, did not. Both MID and GSLA are accessible through the website http://mouse.biomedtzc.cn.
Also flagged:AUF1ferroptosissepsiscycloheximidenuclear factor E2-related factor 2NRF2
Journal Article2022-04-07✓ 1 SnippetWang Y, Chen D, Xie H, Jia M, Sun X, Peng F, Guo F, Tang D.
In-Text Gene Mentions
Text
…STAU1…
Show Full Abstract
<h4>Background</h4>The AU-rich element (ARE)-binding factor 1 (AUF1) acts as a switch for septic shock, although its underlying mechanisms remain largely unknown. In this study, we examined the biological significance and potential molecular mechanism of AUF1 in regulating ferroptosis in sepsis-induced acute lung injury (ALI).<h4>Methods</h4>Alveolar epithelial cells (AECs) challenged with ferroptosis-inducing compounds and cecum ligation and puncture (CLP)-induced ALI were used as the in vitro and in vivo model, respectively. The stability of AUF1 and its degradation by ubiquitin-proteasome pathway were examined by cycloheximide chase analysis and co-immunoprecipitation assay. The regulation of AUF1 on nuclear factor E2-related factor 2 (NRF2) and activation transcription factor 3 (ATF3) was explored by RNA immunoprecipitation (RIP), RNA pull-down, and mRNA stability assays. Functionally, the effects of altering AUF1, NRF2 or ATF3 on ferroptosis in AECs or ALI mice were evaluated by measuring cell viability, lipid peroxidation, iron accumulation, and total glutathione level.<h4>Results</h4>AUF1 was down-regulated in AECs challenged with ferroptosis-inducing compounds, both on mRNA and protein levels. The E3 ubiquitin ligase FBXW7 was responsible for protein degradation of AUF1 during ferroptosis. By up-regulating NRF2 and down-regulating ATF3, AUF1 antagonized ferroptosis in AECs in vitro. In the CLP-induced ALI model, the survival rate of AUF1 knockout mice was significantly reduced and the lung injuries were aggravated, which were related to the enhancement of lung ferroptosis.<h4>Conclusions</h4>FBXW7 mediates the ubiquitination and degradation of AUF1 in ferroptosis. AUF1 antagonizes ferroptosis by regulating NRF2 and ATF3 oppositely. Activating AUF1 pathway may be beneficial to the treatment of sepsis-induced ALI.
<h4>Background</h4>Age and preoperative anaemia are risk factors for poor surgical outcome and blood transfusion. The aim of this study was to examine the effect of iron supplementation in iron-deficient (ID) elderly patients undergoing major surgery.<h4>Method</h4>In this single-centre observational study, patients ≥ 65 years undergoing major surgery were screened for anaemia and ID. Patients were assigned to the following groups: A<sup>-</sup> (no anaemia); A<sup>-</sup>,ID<sup>+</sup>,T<sup>+</sup> (no anaemia, iron-deficient, intravenous iron supplementation); A<sup>+</sup> (anaemia); and A<sup>+</sup>,ID<sup>+</sup>,T<sup>+</sup> (anaemia, iron-deficient, intravenous iron supplementation).<h4>Results</h4>Of 4,381 patients screened at the anaemia walk-in clinic, 2,381 (54%) patients were ≥ 65 years old and 2,191 cases were included in analysis. The ID prevalence was 63% in patients with haemoglobin (Hb) < 8 g/dl, 47.2% in patients with Hb from 8.0 to 8.9 g/dl, and 44.3% in patients with Hb from 9 to 9.9 g/dl. In severely anaemic patients, an Hb increase of 0.6 (0.4; 1.2) and 1.2 (0.7; 1.6) g/dl was detected with iron supplementation 6-10 and > 10 days before surgery, respectively. Hb increased by 0 (-0.1; 0) g/dl with iron supplementation 1-5 days before surgery, 0.2 (-0.1; 0.5) g/dl with iron supplementation 6-10 days before surgery, and 0.2 (-0.2; 1.1) g/dl with supplementation > 10 days before surgery (p < 0.001 for 1-5 vs. 6-10 days). Overall, 58% of A<sup>+</sup>,ID<sup>+</sup>,T<sup>+</sup> patients showed an Hb increase of > 0.5 g/dl. The number of transfused red blood cell units was significantly lower in patients supplemented with iron (0 (0; 3)) compared to non-treated anaemic patients (1 (0; 4)) (p = 0.03). Patients with iron supplementation > 6 days before surgery achieved mobility 2 days earlier than patients with iron supplementation < 6 days.<h4>Conclusions</h4>Intravenous iron supplementation increases Hb level and thereby reduces blood transfusion rate in elderly surgical patients with ID anaemia.
Also flagged:glucoseHDAC4pathogenesisdiabetic nephropathyDND-glucose
Journal Article2022-04-07✓ 2 SnippetsLiu Q, Cui Y, Ding N, Zhou C.
In-Text Gene Mentions
Results)
…SOX6, CDKN1A, ROCK1, NFAT5, ICAM1 and HDAC4 were chosen for subsequent studies as these mRNAs potentially bound to miR-506-3p and contributed to DN progression.…
Results)
…SOX6, CDKN1A, ROCK1, NFAT5,…
Show Full Abstract
<h4>Background</h4>Previous data have indicated the importance of circular RNA (circRNA) in the pathogenesis of diabetic nephropathy (DN). The study is designed to investigate the effects of circ_0003928 on oxidative stress and apoptosis of high glucose (HG)-treated human tubular epithelial cells (HK-2) and the underlying mechanism.<h4>Methods</h4>The DN cell model was established by inducing HK-2 cells using 30 mmol/L D-glucose. RNA expression of circ_0003928, miR-506-3p and histone deacetylase 4 (HDAC4) was detected by quantitative real-time polymerase chain reaction. Cell viability and proliferation were investigated by cell counting kit-8 and 5-Ethynyl-29-deoxyuridine (EdU) assays, respectively. Oxidative stress was evaluated by commercial kits. Caspase 3 activity and cell apoptotic rate were assessed by a caspase 3 activity assay and flow cytometry analysis, respectively. Protein expression was detected by Western blotting analysis. The interactions among circ_0003928, miR-506-3p and HDAC4 were identified by dual-luciferase reporter and RNA pull-down assays.<h4>Results</h4>Circ_0003928 and HDAC4 expression were significantly upregulated, while miR-506-3p was downregulated in the serum of DN patients and HG-induced HK-2 cells. HG treatment inhibited HK-2 cell proliferation, but induced oxidative stress and cell apoptosis; however, these effects were reversed after circ_0003928 depletion. Circ_0003928 acted as a miR-506-3p sponge, and HDAC4 was identified as a target gene of miR-506-3p. Moreover, the circ_0003928/miR-506-3p/HDAC4 axis regulated HG-induced HK-2 cell dysfunction.<h4>Conclusion</h4>Circ_0003928 acted as a sponge for miR-506-3p to regulate HG-induced oxidative stress and apoptosis of HK-2 cells through HDAC4, which suggested that circ_0003928 might be helpful in the therapy of DN.
Also flagged:TMEM189ULK1autophagosomepost-translational modificationsTransmembrane protein 189plasmanylethanolamine desaturase 1
Journal Article2022-04-07✓ 1 SnippetYu J, Qu L, Xia Y, Zhang X, Zhang X, Feng J, Duan M, Guo P, Lou Y, Lv P, Lu W, Chen Y.
In-Text Gene Mentions
Introduction)
…The Cul3-KLHL20ubiquitin ligase was…
Show Full Abstract
ULK1 is crucial for initiating autophagosome formation and its activity is tightly regulated by post-translational modifications and protein-protein interactions. In the present study, we demonstrate that TMEM189 (Transmembrane protein 189), also known as plasmanylethanolamine desaturase 1 (PEDS1), negatively regulates the proteostasis of ULK1 and autophagy activity. In TMEM189-overexpressed cells, the formation of autophagesome is impaired, while TMEM189 knockdown increases cell autophagy. Further investigation reveals that TMEM189 interacts with and increases the instability of ULK1, as well as decreases its kinase activities. The TMEM189 N-terminal domain is required for the interaction with ULK1. Additionally, TMEM189 overexpression can disrupt the interaction between ULK1 and TRAF6, profoundly impairs K63-linked polyubiquitination of ULK1 and self-association, leading to the decrease of ULK1 stability. Moreover, in vitro and in vivo experiments suggest that TMEM189 deficiency results in the inhibition of tumorigenicity of gastric cancer. Our findings provide a new insight into the molecular regulation of autophagy and laboratory evidence for investigating the physiological and pathological roles of TMEM189.
Also flagged:polysaccharideinvasive bacterial diseaseinvasive pneumococcal diseasemeningitissepsispneumonia
Journal Article2022-04-07No SnippetsWróbel-Pawelczyk I, Ronkiewicz P, Wanke-Rytt M, Rykowska D, Górska-Kot A, Włodkowska K, Topczewska-Cabanek A, Jackowska T, Chruszcz J, Marchut W, Mastalerz-Migas A, Korzeniewski K, GIL Study Team, Skoczyńska A, Trzciński K.
Show Full Abstract
We investigated pneumococcal carriage among unvaccinated children under five years of age at a time when the conjugate polysaccharide vaccine (PCV) was introduced in Poland into the national immunization program (NIP). Paired nasopharyngeal swab (NPS) and saliva samples collected between 2016 and 2020 from n = 394 children were tested with conventional culture and using qPCR. The carriage rate detected by culture was 25.4% (97 of 394), by qPCR 39.1% (155 of 394), and 40.1% (158 of 394) overall. The risk of carriage was significantly elevated among day care center attendees, and during autumn/winter months. Among isolates cultured, the most common serotypes were: 23A, 6B, 15BC, 10A, 11A. The coverage of PCV10 and PCV13 was 23.2% (23 of 99) and 26.3% (26 of 99), respectively. Application of qPCR lead to detection of 168 serotype carriage events, with serogroups 15, 6, 9 and serotype 23A most commonly detected. Although the highest number of carriers was identified by testing NPS with qPCR, saliva significantly contributed to the overall number of detected carriers. Co-carriage of multiple serotypes was detected in 25.3% (40 of 158) of carriers. The results of this study represent a baseline for the future surveillance of effects of pneumococcal vaccines in NIP in Poland.
Also flagged:Type 2 diabetesdiabetesobesitychronic diseasesglucoseDiabetic Retinopathy
Journal Article2022-04-07No SnippetsLoh M, Zhang W, Ng HK, Schmid K, Lamri A, Tong L, Ahmad M, Lee JJ, Ng MCY, Petty LE, Spracklen CN, Takeuchi F, Islam MT, Jasmine F, Kasturiratne A, Kibriya M, Mohlke KL, Paré G, Prasad G, Shahriar M, Chee ML, de Silva HJ, Engert JC, Gerstein HC, Mani KR, Sabanayagam C, Vujkovic M, Wickremasinghe AR, Wong TY, Yajnik CS, Yusuf S, Ahsan H, Bharadwaj D, Anand SS, Below JE, Boehnke M, Bowden DW, Chandak GR, Cheng CY, Kato N, Mahajan A, Sim X, McCarthy MI, Morris AP, Kooner JS, Saleheen D, Chambers JC.
Show Full Abstract
South Asians are at high risk of developing type 2 diabetes (T2D). We carried out a genome-wide association meta-analysis with South Asian T2D cases (n = 16,677) and controls (n = 33,856), followed by combined analyses with Europeans (n<sub>eff</sub> = 231,420). We identify 21 novel genetic loci for significant association with T2D (P = 4.7 × 10<sup>-8</sup> to 5.2 × 10<sup>-12</sup>), to the best of our knowledge at the point of analysis. The loci are enriched for regulatory features, including DNA methylation and gene expression in relevant tissues, and highlight CHMP4B, PDHB, LRIG1 and other genes linked to adiposity and glucose metabolism. A polygenic risk score based on South Asian-derived summary statistics shows ~4-fold higher risk for T2D between the top and bottom quartile. Our results provide further insights into the genetic mechanisms underlying T2D, and highlight the opportunities for discovery from joint analysis of data from across ancestral populations.
Journal Article2022-04-07✓ 1 SnippetLiu L, Chen J, Zhang H, Ye J, Moore C, Lu C, Fang Y, Fu YX, Li B.
In-Text Gene Mentions
Results)
…factors including Tnfsf11,Tnfsf4, Tnfsf8 and transcription…
Show Full Abstract
Neoantigen vaccines aiming to induce tumor-specific T cell responses have achieved promising antitumor effects in early clinical trials. However, the underlying mechanism regarding response or resistance to this treatment is unclear. Here we observe that neoantigen vaccine-generated T cells can synergize with the immune checkpoint blockade for effective tumor control. Specifically, we performed single-cell sequencing on over 100,000 T cells and uncovered that combined therapy induces an antigen-specific CD8 T cell population with active chemokine signaling (Cxcr3<sup>+</sup>/Ccl5<sup>+</sup>), lower co-inhibitory receptor expression (Lag3<sup>-</sup>/Havcr2<sup>-</sup>) and higher cytotoxicity (Fasl<sup>+</sup>/Gzma<sup>+</sup>). Furthermore, generation of neoantigen-specific T cells in the draining lymph node is required for combination treatment. Signature genes of this unique population are associated with T cell clonal frequency and better survival in humans. Our study profiles the dynamics of tumor-infiltrating T cells during neoantigen vaccine and immune checkpoint blockade treatments and high-dimensionally identifies neoantigen-reactive T cell signatures for future development of therapeutic strategies.
Also flagged:NOTCHγ-secretasedibenzazepinestem cellcell proliferationLgr5
Journal Article2022-04-07✓ 5 SnippetsTsai YH, Wu A, Wu JH, Capeling MM, Holloway EM, Huang S, Czerwinkski M, Glass I, Higgins PDR, Spence JR.
In-Text Gene Mentions
Discussion)
…For example, injury of the adult stem cell domain through infection or inflammatory damage can lead to loss of canonical stem cell signature genes, including Lgr5 and Olfm4. Following loss of these stem cell genes, a “fetal reversion” of the gene signature occurs, where adult cells acquire a gene signature that is similar to that of the fetal gut (Nusse et al., 2018; Yui et al., 2018).…
Abstract)
…we observed thatOLFM4, a NOTCH…
Abstract)
…development progresses •OLFM4expression is a…
Introduction)
…Olfm4expression is a…
Introduction)
…2014 ), andOlfm4has been validated…
Show Full Abstract
NOTCH signaling is a key regulator involved in maintaining intestinal stem cell (ISC) homeostasis and for balancing differentiation. Using single-cell transcriptomics, we observed that OLFM4, a NOTCH target gene present in ISCs, is first expressed at 13 weeks post-conception in the developing human intestine and increases over time. This led us to hypothesize that the requirement for NOTCH signaling is acquired across human development. To test this, we established a series of epithelium-only organoids (enteroids) from different developmental stages and used γ-secretase inhibitors (dibenzazepine [DBZ] or DAPT) to functionally block NOTCH signaling. Using quantitative enteroid-forming assays, we observed a decrease in enteroid forming efficiency in response to γ-secretase inhibition as development progress. When DBZ was added to cultures and maintained during routine passaging, enteroids isolated from tissue before 20 weeks had higher recovery rates following single-cell serial passaging. Finally, bulk RNA sequencing (RNA-seq) analysis 1 day and 3 days after DBZ treatment showed major differences in the transcriptional changes between developing or adult enteroids. Collectively, these data suggest that ISC dependence on NOTCH signaling increases as the human intestine matures.
Also flagged:Heme oxygenase-1hemeHeme oxygenaseHOHO-1HO-2
Journal Article2022-04-07✓ 1 SnippetGamage SMK, Nanayakkara S, Macfarlane L, Hewage D, Cheng T, Aktar S, Lu CT, Dissabandara L, Islam F, Lam AK, Gopalan V.
In-Text Gene Mentions
Abstract)
…Sex,HFEexpression and lymph-vascular…
Show Full Abstract
<h4>Background</h4>Literature suggests Heme oxygenase (HO) system to be a double-edged sword which can promote both cytoprotection as well as carcinogenicity. The aim of this study was to investigate the role of heme in HO-1 and HO-2 induced colorectal carcinogenesis and the clinicopathological significance of their expressions in patients with colorectal carcinoma (CRC).<h4>Methods</h4>HO-1 and HO-2 expression alterations in normal colonic epithelial (FHC) and colon cancer cells (SW480) were explored following treatment with 0 µM, 25 µM, 100 µM and 250 µM concentrations of hemin, using qPCR. Fifty paired CRC and adjacent non-neoplastic samples were subjected to qPCR to determine the HO-1 and HO-2 expression. Clinicopathological associations of HO-1 and HO-2 expression levels were determined.<h4>Results</h4>Low concentrations of hemin caused upregulation and high concentration caused downregulation of HO-1 expression, whereas HO-2 expression was significantly downregulated with all hemin concentrations in FHC. HO-1 expression in SW480 was increased with all hemin concentrations and HO-2 expression was downregulated at the highest hemin concentration. HO-1 and HO-2 expressions in adjacent non-neoplastic tissue was significantly higher than that of CRC. Expression of HO-1 was significantly higher than HO-2, in both CRC and adjacent non-neoplastic tissue. Sex, HFE expression and lymph-vascular invasion were significantly correlated with HO-1 expression. HO-2 expression showed significant associations with staging, local spread and recurrence of tumour.<h4>Conclusion</h4>HO-1 and HO-2 expression is respectively induced and repressed by exogenous hemin in normal colon and colon cancer cells. HO-1 and HO-2 expression profiles in CRC are correlated with the assessed clinicopathological features of CRC, suggesting the possible implications of HO expression status in CRC pathogenesis.
Also flagged:Gene-ExpressionDiffuse Large B-Cell LymphomalymphomasDLBCLlocalizationstumor
Journal Article2022-04-07No Snippetsde Groot FA, de Groen RAL, van den Berg A, Jansen PM, Lam KH, Mutsaers PGNJ, van Noesel CJM, Chamuleau MED, Stevens WBC, Plaça JR, Mous R, Kersten MJ, van der Poel MMW, Tousseyn T, Woei-A-Jin FJSH, Diepstra A, Nijland M, Vermaat JSP.
Show Full Abstract
Gene-expression profiling (GEP) is used to study the molecular biology of lymphomas. Here, advancing insights from GEP studies in diffuse large B-cell lymphoma (DLBCL) lymphomagenesis are discussed. GEP studies elucidated subtypes based on cell-of-origin principles and profoundly changed the biological understanding of DLBCL with clinical relevance. Studies integrating GEP and next-generation DNA sequencing defined different molecular subtypes of DLBCL entities originating at specific anatomical localizations. With the emergence of high-throughput technologies, the tumor microenvironment (TME) has been recognized as a critical component in DLBCL pathogenesis. TME studies have characterized so-called "lymphoma microenvironments" and "ecotypes". Despite gained insights, unexplained chemo-refractoriness in DLBCL remains. To further elucidate the complex biology of DLBCL, we propose a novel targeted GEP consortium panel, called BLYM-777. This knowledge-based biology-driven panel includes probes for 777 genes, covering many aspects regarding B-cell lymphomagenesis (f.e., MYC signature, TME, immune surveillance and resistance to CAR T-cell therapy). Regarding lymphomagenesis, upcoming DLBCL studies need to incorporate genomic and transcriptomic approaches with proteomic methods and correlate these multi-omics data with patient characteristics of well-defined and homogeneous cohorts. This multilayered methodology potentially enhances diagnostic classification of DLBCL subtypes, prognostication, and the development of novel targeted therapeutic strategies.
The role of tumor-associated macrophages (TAMs) in the pathogenesis of hepatocellular carcinoma (HCC) is poorly understood. Most studies rely on platforms that remove intrahepatic macrophages from the microenvironment prior to evaluation. Cell isolation causes activation and phenotypic changes that may not represent their actual biology and function in situ. State-of-the-art methods provides new strategies to study TAMs without losing the context of tissue architecture and spatial relationship with neighboring cells. These technologies, such as multispectral imaging (e.g., Vectra Polaris), mass cytometry by time-of-flight (e.g., Fluidigm CyTOF), cycling of fluorochromes (e.g., Akoya Biosciences CODEX/PhenoCycler-Fusion, Bruker Canopy, Lunaphore Comet, and CyCIF) and digital spatial profiling or transcriptomics (e.g., GeoMx or Visium, Vizgen Merscope) are being utilized to accurately assess the complex cellular network within the tissue microenvironment. In cancer research, these platforms enable characterization of immune cell phenotypes and expression of potential therapeutic targets, such as PDL-1 and CTLA-4. Newer spatial profiling platforms allow for detection of numerous protein targets, in combination with whole transcriptome analysis, in a single liver biopsy tissue section. Macrophages can also be specifically targeted and analyzed, enabling quantification of both protein and gene expression within specific cell phenotypes, including TAMs. This review describes the workflow of each platform, summarizes recent research using these approaches, and explains the advantages and limitations of each.
Also flagged:Waterdiarrheal infectionsinfectionsinfectionBacterial gastrointestinal infectionswaterborne infections
Journal Article2022-04-07No SnippetsKhabo-Mmekoa CM, Genthe B, Momba MNB.
Show Full Abstract
The occurrence of diarrheal infections depends on the level of water and sanitation services available to households of immunocompromised individuals and children of less than five years old. It is therefore of paramount importance for immunocompromised individuals to be supplied with safe drinking water for better health outcomes. The current study aimed at ascertaining the probability of infection that <i>Escherichia coli</i>, <i>Salmonella typhimurium</i>, <i>Shigella dysenteriae</i>, <i>Vibrio cholerae</i>, and rotavirus might cause to rural dwellers as compared to urban dwellers. Both culture-based and molecular-based methods were used to confirm the presence of target microorganisms in drinking water samples, while Beta-Poisson and exponential models were used to determine the health risk assessment. Results revealed the presence of all targeted organisms in drinking water. The estimated health risks for single ingestion of water for the test pathogens were as follows: 1.6 × 10<sup>-7</sup> for <i>S. typhimurium</i>, 1.79 × 10<sup>-4</sup> for <i>S. dysenteriae</i>, 1.03 × 10<sup>-3</sup> for <i>V. cholerae</i>, 2.2 × 10<sup>-4</sup> for <i>E. coli</i> O157:H7, and 3.73 × 10<sup>-2</sup> for rotavirus. The general quantitative risk assessment undertaken in this study suggests that constant monitoring of household container-stored water supplies is vital as it would assist in early detection of microbial pathogens. Moreover, it will also allow the prompt action to be taken for the protection of public health, particularly for immunocompromised individuals and children who are prone to higher risk of infections.
Also flagged:TinzaparinCOVID-19coronavirus disease-2019coagulationhypercoagulabilityvenous thromboembolism
Journal Article2022-04-07✓ 1 SnippetAkinosoglou K, Savopoulos C, Pouliakis A, Triantafyllidis C, Markatis E, Golemi F, Liontos A, Vadala C, Papanikolaou IC, Dimakopoulou V, Xarras P, Varela K, Kaiafa G, Mitsianis A, Chatzistamati A, Randou E, Savvanis S, Pavlaki M, Efraimidis G, Samaras V, Papazoglou D, Konstantinidou A, Panagopoulos P, Milionis H, On Behalf Of The Interact Study Group.
In-Text Gene Mentions
Introduction)
…the PTT level);ATIIIdeficiency, which does…
Show Full Abstract
(1) Background: It is well-established that coronavirus disease-2019 (COVID-19) is highly pro-inflammatory, leading to activation of the coagulation cascade. COVID-19-induced hypercoagulability is associated with adverse outcomes and mortality. Current guidelines recommend that hospitalized COVID-19 patients should receive pharmacological prophylaxis against venous thromboembolism (VTE). (2) INTERACT is a retrospective, phase IV, observational cohort study aiming to evaluate the overall clinical effectiveness and safety of a higher than conventionally used prophylactic dose of anticoagulation with tinzaparin administered for VTE prevention in non-critically ill COVID-19 patients with moderate disease severity. (3) Results: A total of 705 patients from 13 hospitals in Greece participated in the study (55% men, median age 62 years). Anticoagulation with tinzaparin was initiated immediately after admission. A full therapeutic dose was received by 36.3% of the participants (mean ± SD 166 ± 33 IU/Kgr/day) and the remaining patients (63.9%) received an intermediate dose (mean ± SD 114 ± 22 IU/Kgr/day). The median treatment duration was 13 days (Q1−Q3: 8−20 days). During the study (April 2020 to November 2021), 14 thrombotic events (2.0%) were diagnosed (i.e., three cases of pulmonary embolism (PE) and 11 cases of deep venous thrombosis, DVT). Four bleeding events were recorded (0.6%). In-hospital death occurred in 12 patients (1.7%). Thrombosis was associated with increasing age (median: 74.5 years, Q1−Q3: 62−79, for patients with thrombosis vs. 61.9 years, Q1−Q3: 49−72, p = 0.0149), increased D-dimer levels for all three evaluation time points (at admission: 2490, Q1−Q3: 1580−6480 vs. 700, Q1−Q3: 400−1475, p < 0.0001), one week ± two days after admission (3510, Q1−Q3: 1458−9500 vs. 619, Q1−Q3: 352−1054.5, p < 0.0001), as well as upon discharge (1618.5, Q1−Q3: 1010−2255 vs. 500, Q1−Q3: 294−918, p < 0.0001). Clinical and laboratory improvement was affirmed by decreasing D-dimer and CRP levels, increasing platelet numbers and oxygen saturation measurements, and a drop in the World Health Organization (WHO) progression scale. (4) Conclusions: The findings of our study are in favor of prophylactic anticoagulation with an intermediate to full therapeutic dose of tinzaparin among non-critically ill patients hospitalized with COVID-19.
Also flagged:Allergic Rhinitisairway diseasesallergic sensitizationimmunoglobulin Eimmune responseasthma
Journal Article2022-04-07No SnippetsNur Husna SM, Tan HT, Md Shukri N, Mohd Ashari NS, Wong KK.
Show Full Abstract
Allergic rhinitis (AR) represents a global health concern where it affects approximately 400 million people worldwide. The prevalence of AR has increased over the years along with increased urbanization and environmental pollutants thought to be some of the leading causes of the disease. Understanding the pathophysiology of AR is crucial in the development of novel therapies to treat this incurable disease that often comorbids with other airway diseases. Hence in this mini review, we summarize the well-established yet vital aspects of AR. These include the epidemiology, clinical and laboratory diagnostic criteria, AR in pediatrics, pathophysiology of AR, Th2 responses in the disease, as well as pharmacological and immunomodulating therapies for AR patients.
Also flagged:acute leukemiaALChildhoodCancerchildhood cancerLeukemia
Journal Article2022-04-07✓ 1 SnippetVicente-Garcés C, Esperanza-Cebollada E, Montesdeoca S, Torrebadell M, Rives S, Dapena JL, Català A, Conde N, Camós M, Vega-García N.
In-Text Gene Mentions
Results)
…L::TAL1, RBM15::MKL1, PICALM::MLLT10) and novel…
Show Full Abstract
Development of next-generation sequencing (NGS) has provided useful genetic information to redefine diagnostic, prognostic, and therapeutic strategies for the management of acute leukemia (AL). However, the application in the clinical setting is still challenging. Our aim was to validate the AmpliSeq™ for Illumina® Childhood Cancer Panel, a pediatric pan-cancer targeted NGS panel that includes the most common genes associated with childhood cancer, and assess its utility in the daily routine of AL diagnostics. In terms of sequencing metrics, the assay reached all the expected values. We obtained a mean read depth greater than 1000×. The panel demonstrated a high sensitivity for DNA (98.5% for variants with 5% variant allele frequency (VAF)) and RNA (94.4%), 100% of specificity and reproducibility for DNA and 89% of reproducibility for RNA. Regarding clinical utility, 49% of mutations and 97% of the fusions identified were demonstrated to have clinical impact. Forty-one percent of mutations refined diagnosis, while 49% of them were considered targetable. Regarding RNA, fusion genes were more clinically impactful in terms of refining diagnostic (97%). Overall, the panel found clinically relevant results in the 43% of patients tested in this cohort. To sum up, we validated a reliable and reproducible method to refine pediatric AL diagnosis, prognosis, and treatment, and demonstrated the feasibility of incorporating a targeted NGS panel into pediatric hematology practice.
With increasing incidence of diabetes worldwide, there is an ever-expanding number of patients with chronic diabetic complications such as diabetic retinopathy (DR), one of the leading causes of blindness in the working age population. Early screening for the onset and severity of DR is essential for timely intervention. With recent advancements in genomic technologies, epigenetic alterations in DR are beginning to unravel. Long non-coding RNAs (lncRNAs), which are key epigenetic mediators, have demonstrated implications in several (DR) related processes. Based on the previous research, we have developed a serum-based, multi-panel PCR test using 9 lncRNAs (<i>ANRIL</i>, <i>MALAT1</i>, <i>WISPER</i>, <i>ZFAS1</i>, <i>H19</i>, <i>HOTAIR</i>, <i>HULC</i>, <i>MEG3</i>, and <i>MIAT</i>) to identify and validate whether this panel could be used as a diagnostic and prognostic tool for DR. We initially used a cell culture model (human retinal endothelial cells) and confirmed that 25 mM glucose induces upregulations of <i>ANRIL</i>, <i>HOTAIR</i>, <i>HULC</i>, <i>MALAT1</i>, and <i>ZFAS1</i>, and downregulation of <i>H19</i> compared to 5 mM glucose controls. Then as an initial proof-of-concept, we tested vitreous humor and serum samples from a small cohort of non-diabetic (N=10) and diabetic patients with proliferative retinopathy (PDR, N=11) and measured the levels of the 9 lncRNAs. Differential expressions of lncRNAs were found in the vitreous and serum of patients and showed significant correlations. We expanded our approach and assessed the same lncRNAs using samples from a larger cohort of diabetic (n= 59; M/F:44/15) and non-diabetic patients (n= 11; M/F:4/7). Significant increased lncRNA expressions of <i>ANRIL</i>, <i>H19</i>, <i>HOTAIR</i>, <i>HULC</i>, <i>MIAT</i>, <i>WISPER</i> and <i>ZFAS1</i> were observed in the serum of diabetic patients (with varying stages of DR) compared to non-diabetics. No significant correlations were demonstrated between lncRNA expressions and creatinine or glycated hemoglobin (HbA1C) levels. Using ROC and further analyses, we identified distinct lncRNA phenotype combinations, which may be used to identify patients with DR. Data from this study indicate that a panel of serum lncRNAs may be used for a potential screening test for DR. Further large-scale studies are needed to validate this notion.
Also flagged:Neural Cell Adhesion MoleculeNeurogenesiscell adhesion moleculetyrosine hydroxylasegene expressionthyroid hormone
Journal Article2022-04-07✓ 1 SnippetMoore A, Chinnaiya K, Kim DW, Brown S, Stewart I, Robins S, Dowsett GKC, Muir C, Travaglio M, Lewis JE, Ebling F, Blackshaw S, Furley A, Placzek M.
In-Text Gene Mentions
Results)
…of Hes1 andPrdx6— both previously implicated…
Show Full Abstract
Hypothalamic tanycytes are neural stem and progenitor cells, but little is known of how they are regulated. Here we provide evidence that the cell adhesion molecule, NrCAM, regulates tanycytes in the adult niche. NrCAM is strongly expressed in adult mouse tanycytes. Immunohistochemical and <i>in situ</i> hybridization analysis revealed that NrCAM loss of function leads to both a reduced number of tanycytes and reduced expression of tanycyte-specific cell markers, along with a small reduction in tyrosine hydroxylase-positive arcuate neurons. Similar analyses of NrCAM mutants at E16 identify few changes in gene expression or cell composition, indicating that NrCAM regulates tanycytes, rather than early embryonic hypothalamic development. Neurosphere and organotypic assays support the idea that NrCAM governs cellular homeostasis. Single-cell RNA sequencing (scRNA-Seq) shows that tanycyte-specific genes, including a number that are implicated in thyroid hormone metabolism, show reduced expression in the mutant mouse. However, the mild tanycyte depletion and loss of markers observed in NrCAM-deficient mice were associated with only a subtle metabolic phenotype.
Also flagged:pathogenesispsychiatric disordersschizophreniamood disordersmajor depressive disorderbipolar disorder
Journal Article2022-04-07No SnippetsFabbri C.
Show Full Abstract
Psychiatric disorders and related traits have a demonstrated genetic component, with heritability estimated by twin studies generally between 80% and 40%. Their pathogenesis is complex and multi-determined: environmental factors interact with a polygenic architecture, making difficult the development of models able to stratify patients or predict mental health outcomes. Despite this difficult challenge, relevant progress has been made in the field of psychiatric genetics in recent years. This review aims to present the main current methods in psychiatric genetics, their output, limitations, clinical applications, and possible future developments. Genome-wide association studies (GWASs) performed in increasingly large samples have led to the identification of replicated genetic loci associated with the risk of major psychiatric disorders, including schizophrenia and mood disorders. Statistical and biological approaches have been developed to improve our understanding of the etiopathogenetic mechanisms behind genome-wide significant associations, as well as for estimating the cumulative effect of risk variants at the individual level and the genetic overlap between different disorders, as pleiotropy is the rule rather than the exception. Clinical applications are available in the pharmacogenetics field. The main issues that remain to be addressed include improving ethnic diversity in genetic studies and the optimization of statistical power through methodological improvements, such as the definition of dimensional phenotypes with specific biological correlates and the integration of different types of omics data.
Research Square2022-04-07Preprint (No Snippets API)Yan Y, wang J, Hu Y, Du J, Gao X, Lyv X, Zuo W, Li Y, Song Y, Lin Q.
Show Full Abstract
<h4>Background: </h4> To study the lncRNA-mRNA interaction network structure and analyze the possible target mRNAs among the differentially expressed lncRNAs between healthy adults, newly diagnosed multiple myeloma patients, and refractory relapsed multiple myeloma patients. <h4>Methods: </h4> Public sequence data files were downloaded from the Sequence Read Archive (SRA). Totally 23 RNA-seq samples (GSE110486) related to myeloma published in 2018 (including transcriptome data of bone marrow plasma cells from healthy adults, newly diagnosed multiple myeloma patients and recurrent patients) were acquired, further analyses of differential lncRNAs, lncRNAs-mRNA co-expression, and WGCNA expression module and cis regulatory gene were performed. In addition, we performed differential expression analysis of lncRNAs and enrichment analysis of target mRNA regulated by lncRNAs from multiple myeloma patients and healthy controls which in order to verify the functions of these lncRNAs and their target mRNAs. <h4>Results: </h4> From the transcriptional samples in this study,1006 new lncRNAs were identified, which including 707 lncRNAs specifically up-regulated and 283 specifically down-regulated in relapsed myeloma. The mRNA genes co-expressed with specific lncRNAs in relapsed multiple myeloma were mainly enriched in the extracellular matrix organization, platelet activation, cell adhesion, inflammation response, T cell co-stimulation and immune response pathways. Target mRNA regulated by DE lncRNAs including IL23R, ELF3, IL32, TMIGD2, CD28, CD5, TNF, CX3CR1, ADAMTS20 etc, by GO analysis, these target genes were enriched into many biological processes, such as innate immunity, apoptosis and positive regulation of apoptosis. The cis-regulated lncRNA of these target mRNAs include U62631.5, XLOC_062939 and XLOC_027240, and their cis-regulatory targets include CD22, SSX1 and DCC. lncRNAs and enrichment analysis of target mRNA regulated by lncRNAs from multiple myeloma patients and healthy controls was consistent with the previous analysis. <h4>Conclusion: </h4> Target mRNAs regulated by DE lncRNAs and their cis-regulatory targets are involved in the immune cells remodeling of gene expression patterns during multiple myeloma relapse, and may have an important function in this pathological process, it deserves further study as a potential target for the treatment of multiple myeloma.
Research Square2022-04-07Preprint (No Snippets API)Giroux NS, Ding S, McClain MT, Burke TW, Petzold E, Chung HA, Rivera GO, Wang E, Xi R, Bose S, Rotstein T, Nicholson BP, Chen T, Henao R, Sempowski GD, Denny TN, De Ussel MI, Satterwhite LL, Ko ER, Ginsburg GS, Kraft BD, Tsalik EL, Shen X, Woods C.
Show Full Abstract
SARS-CoV-2 infection triggers profound and variable immune responses in human hosts. Chromatin remodeling has been observed in individuals severely ill or convalescing with COVID-19, but chromatin remodeling early in disease prior to anti-spike protein IgG seroconversion has not been defined. We performed the Assay for Transposase-Accessible Chromatin using sequencing (ATAC-seq) and RNA-seq on peripheral blood mononuclear cells (PBMCs) from outpatients with mild or moderate symptom severity at different stages of clinical illness. Early in the disease course prior to IgG seroconversion, modifications in chromatin accessibility associate with mild or moderate symptoms are already robust and include severity-associated changes in accessibility of genes in interleukin signaling, regulation of cell differentiation and cell morphology. Furthermore, single-cell analyses revealed evolution of the chromatin accessibility landscape and transcription factor motif accessibility for individual PBMC cell types over time. The most extensive remodeling occurred in CD14+ monocytes, where sub-populations with distinct chromatin accessibility profiles were observed prior to seroconversion. Mild symptom severity is marked by upregulation classical antiviral pathways including those regulating IRF1 and IRF7, whereas in moderate disease these classical antiviral signals diminish suggesting dysregulated and less effective responses. Together, these observations offer novel insight into the epigenome of early mild SARS-CoV-2 infection and suggest that detection of chromatin remodeling in early disease may offer promise for a new class of diagnostic tools for COVID-19.
Also flagged:Autophagopathiesautophagyautophagy-relatedendocrine diseasesLC3phagocytosis
Journal Article2022-04-06✓ 1 SnippetGrosjean I, Roméo B, Domdom MA, Belaid A, D'Andréa G, Guillot N, Gherardi RK, Gal J, Milano G, Marquette CH, Hung RJ, Landi MT, Han Y, Brest P, Von Bergen M, Klionsky DJ, Amos CI, Hofman P, Mograbi B.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
At a time when complex diseases affect globally 280 million people and claim 14 million lives every year, there is an urgent need to rapidly increase our knowledge into their underlying etiologies. Though critical in identifying the people at risk, the causal environmental factors (microbiome and/or pollutants) and the affected pathophysiological mechanisms are not well understood. Herein, we consider the variations of autophagy-related (<i>ATG</i>) genes at the heart of mechanisms of increased susceptibility to environmental stress. A comprehensive autophagy genomic resource is presented with 263 single nucleotide polymorphisms (SNPs) for 69 autophagy-related genes associated with 117 autoimmune, inflammatory, infectious, cardiovascular, neurological, respiratory, and endocrine diseases. We thus propose the term 'autophagopathies' to group together a class of complex human diseases the etiology of which lies in a genetic defect of the autophagy machinery, whether directly related or not to an abnormal flux in autophagy, LC3-associated phagocytosis, or any associated trafficking. The future of precision medicine for common diseases will lie in our ability to exploit these <i>ATG</i> SNP x environment relationships to develop new polygenetic risk scores, new management guidelines, and optimal therapies for afflicted patients.<b>Abbreviations:</b> ATG, autophagy-related; ALS-FTD, amyotrophic lateral sclerosis-frontotemporal dementia; ccRCC, clear cell renal cell carcinoma; CD, Crohn disease; COPD, chronic obstructive pulmonary disease; eQTL, expression quantitative trait loci; HCC, hepatocellular carcinoma; HNSCC, head and neck squamous cell carcinoma; GTEx, genotype-tissue expression; GWAS, genome-wide association studies; LAP, LC3-associated phagocytosis; LC3-II, phosphatidylethanolamine conjugated form of LC3; LD, linkage disequilibrium; LUAD, lung adenocarcinoma; MAF, minor allele frequency; MAP1LC3/LC3: microtubule associated protein 1 light chain 3; NSCLC, non-small cell lung cancer; OS, overall survival; PtdIns3K CIII, class III phosphatidylinositol 3 kinase; PtdIns3P, phosphatidylinositol-3-phosphate; SLE, systemic lupus erythematosus; SNPs, single-nucleotide polymorphisms; mQTL, methylation quantitative trait loci; ULK, unc-51 like autophagy activating kinase; UTRs, untranslated regions; WHO, World Health Organization.
Also flagged:FGF21mitochondrialmitochondrial integrated stressrespiratory chain deficiencymitochondrial cardiomyopathycytokine
Journal Article2022-04-06✓ 5 SnippetsCroon M, Szczepanowska K, Popovic M, Lienkamp C, Senft K, Brandscheid CP, Bock T, Gnatzy-Feik L, Ashurov A, Acton RJ, Kaul H, Pujol C, Rosenkranz S, Krüger M, Trifunovic A.
In-Text Gene Mentions
Results)
…Still, even in the absence of FGF21 in the heart, DARS2-deficient animals had lower circulating glucose levels (Fig. 2E).…
Results)
…Diminished activity of respiratory chain complexes caused by the loss of DARS2 led to cardiomyopathy characterized by increased expression of cardiac hypertrophy marker Nppa regardless of the presence of FGF21 at 6 weeks of age (fig.…
Results)
…We recently showed that already at 2 weeks of age, before the OXPHOS defect, the same proteins are the most up-regulated in DARS2-deficient hearts (17), suggesting that the primary stress response triggered by defective protein synthesis in mitochondria is directly related to the unbalanced amino acid metabolism.…
Introduction)
…dysfunction including theDars2-heart and skeletal…
Methods)
…aspartyl-tRNA synthetase (Dars2) gene targeting…
Show Full Abstract
The mitochondrial integrated stress response (mitoISR) has emerged as a major adaptive pathway to respiratory chain deficiency, but both the tissue specificity of its regulation, and how mitoISR adapts to different levels of mitochondrial dysfunction are largely unknown. Here, we report that diverse levels of mitochondrial cardiomyopathy activate mitoISR, including high production of FGF21, a cytokine with both paracrine and endocrine function, shown to be induced by respiratory chain dysfunction. Although being fully dispensable for the cell-autonomous and systemic responses to severe mitochondrial cardiomyopathy, in the conditions of mild-to-moderate cardiac OXPHOS dysfunction, FGF21 regulates a portion of mitoISR. In the absence of FGF21, a large part of the metabolic adaptation to mitochondrial dysfunction (one-carbon metabolism, transsulfuration, and serine and proline biosynthesis) is strongly blunted, independent of the primary mitoISR activator ATF4. Collectively, our work highlights the complexity of mitochondrial stress responses by revealing the importance of the tissue specificity and dose dependency of mitoISR.
Also flagged:acute lymphoblastic leukemiaT cell acute lymphoblastic leukemiaALLgene expressioncell differentiationLYL1
Journal Article2022-04-06✓ 4 SnippetsDai YT, Zhang F, Fang H, Li JF, Lu G, Jiang L, Chen B, Mao DD, Liu YF, Wang J, Peng LJ, Feng C, Chen HF, Mu JX, Zhang QL, Wang H, Ariffin H, Moy TA, Wang JH, Lou YJ, Chen SN, Wang Q, Liu H, Shan Z, Matsumura I, Miyazaki Y, Yasuda T, Dou LP, Yan XJ, Yan JS, Yeoh AE, Wu DP, Kiyoi H, Hayakawa F, Jin J, Wang SY, Sun XJ, Mi JQ, Chen Z, Huang JY, Chen SJ.
In-Text Gene Mentions
Discussion)
…Additionally, three subtypes with elevated expression of HOXA family genes were revealed—namely G4 (KMT2A-r), G5 (MLLT10-r), and G6 (HOXA10-fus)—each representing a small number of T-ALL patients, similar to G2, which might be the reason why they were not found as independent subtypes in a previous study (9).…
Results)
…KMT2A fusions andMLLT10rearrangements were regarded…
Results)
…rearrangement), G5 (MLLT10rearrangement), G6 (…
Discussion)
…-r), G5 (MLLT10-r), and G6…
Show Full Abstract
T cell acute lymphoblastic leukemia (T-ALL) is an aggressive hematological malignancy of T cell progenitors, known to be a heterogeneous disease in pediatric and adult patients. Here we attempted to better understand the disease at the molecular level based on the transcriptomic landscape of 707 T-ALL patients (510 pediatric, 190 adult patients, and 7 with unknown age; 599 from published cohorts and 108 newly investigated). Leveraging the information of gene expression enabled us to identify 10 subtypes (G1–G10), including the previously undescribed one characterized by GATA3 mutations, with GATA3R276Q capable of affecting lymphocyte development in zebrafish. Through associating with T cell differentiation stages, we found that high expression of LYL1/LMO2/SPI1/HOXA (G1–G6) might represent the early T cell progenitor, pro/precortical/cortical stage with a relatively high age of disease onset, and lymphoblasts with TLX3/TLX1 high expression (G7–G8) could be blocked at the cortical/postcortical stage, while those with high expression of NKX2-1/TAL1/LMO1 (G9–G10) might correspond to cortical/postcortical/mature stages of T cell development. Notably, adult patients harbored more cooperative mutations among epigenetic regulators, and genes involved in JAK-STAT and RAS signaling pathways, with 44% of patients aged 40 y or above in G1 bearing DNMT3A/IDH2 mutations usually seen in acute myeloid leukemia, suggesting the nature of mixed phenotype acute leukemia.
Also flagged:non-alcoholic fatty liver diseasealcoholliver diseasehepatitis CNAFLDcirrhosis
Journal Article2022-04-06✓ 1 SnippetCarol M, Pérez-Guasch M, Solà E, Cervera M, Martínez S, Juanola A, Ma AT, Avitabile E, Napoleone L, Pose E, Graupera I, Honrubia M, Korenjak M, Torres F, Ginès P, Fabrellas N, LiverHope Consortium Investigators.
<h4>Background and aims</h4>Stigmatization is a well-documented problem of some diseases. Perceived stigma is common in alcohol-related liver disease and hepatitis C, but little information exists on stigma in patients with non-alcoholic fatty liver disease (NAFLD). Aim of the study was to investigate frequency and characteristics of perceived stigma among patients with NAFLD.<h4>Methods</h4>One-hundred and ninety-seven patients seen at the liver clinic were included: a study group of 144 patients with NAFLD, 50 with cirrhosis (34 compensated, 16 decompensated), and a control group of 53 patients with alcohol-related cirrhosis. Demographic, clinical, and laboratory data were collected. Quality-of-life was assessed by chronic liver disease questionnaire (CLDQ). Perceived stigma was assessed using a specific questionnaire for patients with liver diseases categorized in 4 domains: stereotypes, discrimination, shame, and social isolation.<h4>Results</h4>Perceived stigma was common in patients with NAFLD (99 patients, 69%) and affected all 4 domains assessed. The frequency was slightly higher, yet not significant, in patients with NAFLD cirrhosis vs those without (72% vs 67%, respectively; p = 0.576). In patients without cirrhosis perceived stigma was unrelated to stage of disease, since frequency was similar in patients with no or mild fibrosis compared to those with moderate/severe fibrosis (66% vs 68%, respectively). There were no differences in perceived stigma between patients with compensated cirrhosis and these with decompensated cirrhosis. Among patients with cirrhosis, stigmatization was more common in alcohol-related vs NAFLD-cirrhosis, yet differences were only significant in two domains. In patients with NAFLD, perceived stigma correlated with poor quality-of-life, but not with demographic or clinical variables.<h4>Conclusions</h4>Perceived stigmatization is common among patients with NAFLD independently of disease stage, is associated with impaired quality-of-life, and may be responsible for stereotypes, discrimination, shame, and social isolation, which may affect human and social rights of affected patients.
Also flagged:tumorgastric cancerC-X-C motif chemokine receptor 4CXCR4C-X-C chemokine receptorimmune responses
Journal Article2022-04-06✓ 2 SnippetsWen F, Lu X, Huang W, Chen X, Ruan S, Gu S, Gu P, Li Y, Liu J, Liu S, Shu P.
In-Text Gene Mentions
Results)
…We identified 20 immunoinhibitors (ADORA2A,BTLA,CD160,CD244,CD274,CD96,CSFIR,CTLA4,HAVCR2,IDO1,IL10,KDR,LAG3,LGALS9,PDCD1,PDCD1LG2,PVRL2,TGFB1,TGFBR1, and TIGIT), 37 immunostimulators (CXCR4,ENTPDI,HHLA2,ICOS,ICOSLG,IL2RA,IL6,lL6R,KLRCI,KLRKI,LTA,PVR,TMEM173,TMlGD2,TNFRSF13B,TNFRSF13C,TNFRSF17,TNFRSF18,TNFRSF25,TNFRSF4,TNFRSF8,TNFRSF9,TNFSF13B,TNFSF14,TNFSF18,TNFSF4, and ULBP1) and 16 MHC molecules(MHC molecule: B2M,HLA-A,HLA-B,HLA-C,HLA-DMA,HLA-DMB,HLA-DOA,HLA-DOB,HLA-DPA1,HLA-DPB1,HLA-DQAI,HLA-DQA2,HLA-DQBI,HLA-DRA,HLA-DRB1, and HLA-E) significantly associated with CXCR4 in GC (Fig. 6A).…
Results)
…RSF9,TNFSF13B,TNFSF14,TNFSF18,TNFSF4, and ULBP1) and…
Show Full Abstract
The formation of gastric cancer (GC) is a complicated process involving multiple factors and multiple steps. The tumor-immune microenvironment is essential for the growth of GC and affects the prognosis of patients. We performed multiple machine learning algorithms to identify immunophenotypes and immunological characteristics in GC patients' information from the TCGA database and extracted immune genes relevance of the GC immune microenvironment. C-X-C motif chemokine receptor 4 (CXCR4), belongs to the C-X-C chemokine receptor family, which can promote the invasion and migration of tumor cells. CXCR4 expression is significantly correlated to metastasis and the worse prognosis. In this work, we assessed the condition of immune cells and identified the connection between CXCR4 and GC immune microenvironment, as well as the signaling pathways that mediate the immune responses involved in CXCR4. The work showed the risk scores generated by CXCR4-related immunomodulators could distinguish risk groups consisting of differential expression genes and could use for the personalized prognosis prediction. The findings suggested that CXCR4 is involved in tumor immunity of GC, and CXCR4 is considered as a potential prognostic biomarker and immunotherapy target of GC. The prognostic immune markers from CXCR4-associated immunomodulators can independently predict the overall survival of GC.
Also flagged:alcoholosteonecrosis of the femoral headAlcohol-induced osteonecrosis of the femoral headpathogenesiship osteoarthritisfracture
Journal Article2022-04-06✓ 1 SnippetLiao Z, Jin Y, Chu Y, Wu H, Li X, Deng Z, Feng S, Chen N, Luo Z, Zheng X, Bao L, Xu Y, Tan H, Zhao L.
In-Text Gene Mentions
Results)
…as JUND_extend (54g),SOX6_extend (17g) and PML_extend…
Show Full Abstract
Alcohol-induced osteonecrosis of the femoral head (ONFH) is a disabling disease with a high incidence and elusive pathogenesis. Here, we used single-cell RNA sequencing to explore the transcriptomic landscape of mid- and advanced-stage alcohol-induced ONFH. Cells derived from age-matched hip osteoarthritis and femoral neck fracture samples were used as control. Our bioinformatics analysis revealed the disorder of osteogenic-adipogenic differentiation of stromal cells in ONFH and altered regulons such as MEF2C and JUND. In addition, we reported that one of the endothelial cell clusters with ACKR1 expression exhibited strong chemotaxis and a weak angiogenic ability and expanded with disease progression. Furthermore, ligand-receptor-based cell-cell interaction analysis indicated that ACKR1+ endothelial cells might specifically communicate with stromal cells through the VISFATIN and SELE pathways, thus influencing stromal cell differentiation in ONFH. Overall, our data revealed single cell transcriptome characteristics in alcohol-induced ONFH, which may contribute to the further investigation of ONFH pathogenesis.
Also flagged:periodontitischronic inflammatory diseasepathogenesisimmune responsePDinfectious disease
Journal Article2022-04-06No SnippetsYu W, Gu Q, Wu D, Zhang W, Li G, Lin L, Lowe JM, Hu S, Li TW, Zhou Z, Miao MZ, Gong Y, Zhao Y, Lu E.
Show Full Abstract
<h4>Background and objective</h4>Periodontitis is a multifactorial chronic inflammatory disease that can lead to the irreversible destruction of dental support tissues. As an epigenetic factor, the expression of circRNA is tissue-dependent and disease-dependent. This study aimed to identify novel periodontitis-associated circRNAs and predict relevant circRNA-periodontitis regulatory network by using recently developed bioinformatic tools and integrating sequencing profiling with clinical information for getting a better and more thorough image of periodontitis pathogenesis, from gene to clinic.<h4>Material and methods</h4>High-throughput sequencing and RT-qPCR were conducted to identify differentially expressed circRNAs in gingival tissues from periodontitis patients. The relationship between upregulated circRNAs expression and probing depth (PD) was performed using Spearman's correlation analysis. Bioinformatic analyses including GO analysis, circRNA-disease association prediction, and circRNA-miRNA-mRNA network prediction were performed to clarify potential regulatory functions of identified circRNAs in periodontitis. A receiver-operating characteristic (ROC) curve was established to assess the diagnostic significance of identified circRNAs.<h4>Results</h4>High-throughput sequencing identified 70 differentially expressed circRNAs (68 upregulated and 2 downregulated circRNAs) in human periodontitis (fold change >2.0 and p < .05). The top five upregulated circRNAs were validated by RT-qPCR that had strong associations with multiple human diseases, including periodontitis. The upregulation of circRNAs were positively correlated with PD (R = .40-.69, p < .05, moderate). A circRNA-miRNA-mRNA network with the top five upregulated circRNAs, differentially expressed mRNAs, and overlapped predicted miRNAs indicated potential roles of circRNAs in immune response, cell apoptosis, migration, adhesion, and reaction to oxidative stress. The ROC curve showed that circRNAs had potential value in periodontitis diagnosis (AUC = 0.7321-0.8667, p < .05).<h4>Conclusion</h4>CircRNA-disease associations were predicted by online bioinformatic tools. Positive correlation between upregulated circRNAs, circPTP4A2, chr22:23101560-23135351+, circARHGEF28, circBARD1 and circRASA2, and PD suggested function of circRNAs in periodontitis. Network prediction further focused on downstream targets regulated by circRNAs during periodontitis pathogenesis.
Journal Article2022-04-06✓ 1 SnippetZullow HJ, Sankar A, Ingram DR, Samé Guerra DD, D'Avino AR, Collings CK, Lazcano R, Wang WL, Liang Y, Qi J, Lazar AJ, Kadoch C.
In-Text Gene Mentions
Text
…polycomb repressive…
Show Full Abstract
Mammalian SWI/SNF (mSWI/SNF or BAF) ATP-dependent chromatin remodeling complexes play critical roles in governing genomic architecture and gene expression and are frequently perturbed in human cancers. Transcription factors (TFs), including fusion oncoproteins, can bind to BAF complex surfaces to direct chromatin targeting and accessibility, often activating oncogenic gene loci. Here, we demonstrate that the FUS::DDIT3 fusion oncoprotein hallmark to myxoid liposarcoma (MLPS) inhibits BAF complex-mediated remodeling of adipogenic enhancer sites via sequestration of the adipogenic TF, CEBPB, from the genome. In mesenchymal stem cells, small-molecule inhibition of BAF complex ATPase activity attenuates adipogenesis via failure of BAF-mediated DNA accessibility and gene activation at CEBPB target sites. BAF chromatin occupancy and gene expression profiles of FUS::DDIT3-expressing cell lines and primary tumors exhibit similarity to SMARCB1-deficient tumor types. These data present a mechanism by which a fusion oncoprotein generates a BAF complex loss-of-function phenotype, independent of deleterious subunit mutations.
Also flagged:FGFto signalingcell cyclestem cell divisionsTissue homeostasistissue development
Journal Article2022-04-06✓ 1 SnippetAnllo L, DiNardo S.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
Tissue homeostasis often requires a properly placed niche to support stem cells. Morphogenetic processes that position a niche are just being described. For the Drosophila testis, we recently showed that pro-niche cells, specified at disparate positions during early gonadogenesis, must assemble into one collective at the anterior of the gonad. We now find that Slit and FGF signals emanating from adjacent visceral mesoderm regulate assembly. In response to signaling, niche cells express islet, which we find is also required for niche assembly. Without signaling, niche cells specified furthest from the anterior are unable to migrate, remaining dispersed. The function of such niches is severely disrupted, with niche cells evading cell cycle quiescence, compromised in their ability to signal the incipient stem cell pool, and failing to orient stem cell divisions properly. Our work identifies both extrinsic signaling and intrinsic responses required for proper assembly and placement of the testis niche.
Also flagged:GlioblastomaSOX9Glioblastoma multiformeGBMcancerCell proliferation
Journal Article2022-04-06✓ 5 SnippetsChen Z, Mai Q, Wang Q, Gou Q, Shi F, Mo Z, Cui W, Zhuang W, Li W, Xu R, Zhou Z, Chen X, Zhang J.
In-Text Gene Mentions
Abstract)
…To conclude, circPOLR2A enhanced the transcription of SOX9 through miR-2113/POU3F2 axis, thus exacerbating GBM cells growth.…
Title)
…Cells by Up-regulatingPOU3F2to Facilitate SOX9…
Abstract)
…to positively regulatePOU3F2expression.…
Abstract)
…POU3F2activated the transcription…
Abstract)
…of SOX9 through miR-2113/POU3F2axis, thus exacerbating…
Show Full Abstract
Glioblastoma multiforme (GBM) is the most common cancer in nervous system around the world. Little advancement has been achieved in promoting prognosis of GBM patients. Circular RNAs (circRNAs) are suggested as crucial effectors in modulating GBM development. Hsa_circRNA_092437 (circPOLR2A), an up-regulated circRNA in GBM cells, has not been studied yet. In this study, RT-qPCR and western blot assays were applied to detect RNA and protein levels. Cell proliferation and apoptosis were analyzed via functional assays. Subcellular fractionation assay was carried out to determine circPOLR2A distribution in cells. Bioinformatics analysis and mechanism assays were done for detecting relationships among different factors. Rescue assays were performed to confirm validity of circPOLR2A/SOX9 axis. According to experimental results, circPOLR2A was up-regulated in GBM cells and promoted GBM cell proliferation while inhibiting GBM cell apoptosis. CircPOLR2A mainly existed in cell cytoplasm and sponged miR-2113 to positively regulate POU3F2 expression. POU3F2 activated the transcription of SOX9 through interacting with SOX9 promoter (1-500). Rescue assays validated that circPOLR2A influenced GBM cell proliferation and apoptosis via SOX9. To conclude, circPOLR2A enhanced the transcription of SOX9 through miR-2113/POU3F2 axis, thus exacerbating GBM cells growth.
Also flagged:transcription factorFoxA2chondrocyte differentiationchondrocyte hypertrophydoxycycline-
Journal Article2022-04-06✓ 1 SnippetBell N, Bhagat S, Muruganandan S, Kim R, Ho K, Pierce R, Kozhemyakina E, Lassar AB, Gamer L, Rosen V, Ionescu AM.
In-Text Gene Mentions
Text
…Sox6…
Show Full Abstract
We previously found that FoxA factors are necessary for chondrocyte differentiation. To investigate whether FoxA factors alone are sufficient to drive chondrocyte hypertrophy, we build a FoxA2 transgenic mouse in which FoxA2 cDNA is driven by a reiterated Tetracycline Response Element (TRE) and a minimal CMV promoter. This transgenic line was crossed with a col2CRE;Rosa26<sup>rtTA/+</sup> mouse line to generate col2CRE;Rosa26<sup>rtTA/+</sup>;TgFoxA2<sup>+/-</sup> mice for inducible expression of FoxA2 in cartilage using doxycycline treatment. Ectopic expression of FoxA2 in the developing skeleton reveals skeletal defects and shorter skeletal elements in E17.5 mice. The chondro-osseous border was frequently mis-shaped in mutant mice, with small islands of col.10+ hypertrophic cells extending in the metaphyseal bone. Even though overexpression of FoxA2 causes an accumulation of hypertrophic chondrocytes, it did not trigger ectopic hypertrophy in the immature chondrocytes. This suggests that FoxA2 may need transcriptional co-factors (such as Runx2), whose expression is restricted to the hypertrophic zone, and absent in the immature chondrocytes. To investigate a potential FoxA2/Runx2 interaction in immature chondrocytes versus hypertrophic cells, we separated these two subpopulations by FACS to obtain CD24<sup>+</sup>CD200<sup>+</sup> hypertrophic chondrocytes and CD24<sup>+</sup>CD200<sup>-</sup> immature chondrocytes and we ectopically expressed FoxA2 alone or in combination with Runx2 via lentiviral gene delivery. In CD24<sup>+</sup>CD200<sup>+</sup> hypertrophic chondrocytes, FoxA2 enhanced the expression of chondrocyte hypertrophic markers collagen 10, MMP13, and alkaline phosphatase. In contrast, in the CD24<sup>+</sup>CD200<sup>-</sup> immature chondrocytes, neither FoxA2 nor Runx2 overexpression could induce ectopic expression of hypertrophic markers MMP13, alkaline phosphatase, or PTH/PTHrP receptor. Overall these findings mirror our in vivo data, and suggest that induction of chondrocyte hypertrophy by FoxA2 may require other factors in addition to Runx2 (i.e., Hif2α, MEF2C, or perhaps unknown factors), whose expression/activity is rate-limiting in immature chondrocytes.
Also flagged:Apixabanthromboembolic diseaseliver diseasetransaminitisnon-valvular atrial fibrillationvenous thromboembolism
Journal Article2022-04-06✓ 1 SnippetAnsari U, Asghar Z, Oswald M, Ng H.
In-Text Gene Mentions
Discussion)
…a diagnosis ofhemochromatosisless likely.…
Show Full Abstract
Apixaban is widely used to prevent and manage thromboembolic disease. Due to it being fairly new in the market, we are still understanding its complete risk profile. We present a case of a 61-year-old female with no prior history of liver disease, who developed severe transaminitis shortly after the initiation of apixaban and started trending down after its discontinuation.
Also flagged:membrane proteinneural cell communicationsynapsepsychiatric diseasesautismdepression
Journal Article2022-04-06✓ 5 SnippetsSim G, Jeong M, Seo H, Kim J, Lee S.
In-Text Gene Mentions
Abstract)
…Accumulating evidence indicates that NEGR1 is a generic risk factor for various psychiatric diseases including autism and depression.…
Discussion)
…The half-life of NEGR1, either stably or transiently expressed, was estimated to be ~30 min (Figure 5C,D), while the level of 6MT did not decrease even 24 h after cycloheximide addition.…
Results)
…To investigate the role of each N-glycan on the NEGR1 protein, we produced six single N-glycosylation site mutants containing asparagine (Asn) to glutamine (Gln) mutations using the pcDNA4-3FLAG-NEGR1 plasmid.…
Introduction)
…Recently, multiple genome-wide analyses have shown that genetic alterations in NEGR1 are associated with many major neurological disorders such as dyslexia [10], schizophrenia [11], Alzheimer’s disease [12], and depression [13].…
Results)
…After transfection of NEGR1 WT and 6MT into 293T cells, these were incubated with the protein synthesis inhibitor cycloheximide.…
Show Full Abstract
Neuronal growth regulator 1 (NEGR1) is a brain-enriched membrane protein that is involved in neural cell communication and synapse formation. Accumulating evidence indicates that NEGR1 is a generic risk factor for various psychiatric diseases including autism and depression. Endoglycosidase digestion of single NEGR1 mutants revealed that the wild type NEGR1 has six putative <i>N</i>-glycosylation sites partly organized in a Golgi-dependent manner. To understand the role of each putative <i>N</i>-glycan residue, we generated a series of multi-site mutants (2MT-6MT) with additive mutations. Cell surface staining and biotinylation revealed that NEGR1 mutants 1MT to 4MT were localized on the cell surface at different levels, whereas 5MT and 6MT were retained in the endoplasmic reticulum to form highly stable multimer complexes. This indicated 5MT and 6MT are less likely to fold correctly. Furthermore, the removal of two <i>N</i>-terminal sites N75 and N155 was sufficient to completely abrogate membrane targeting. An in vivo binding assay using the soluble NEGR1 protein demonstrated that glycans N286, N294 and N307 on the C-terminal immunoglobulin-like domain play important roles in homophilic interactions. Taken together, these results suggest that the <i>N</i>-glycan moieties of NEGR1 are closely involved in the folding, trafficking, and homodimer formation of NEGR1 protein in a site-specific manner.
Also flagged:Peptideserotoninmu-opioidMOPmorphinecodeine
Journal Article2022-04-06✓ 2 SnippetsRadoi V, Jakobsson G, Palada V, Nikosjkov A, Druid H, Terenius L, Kosek E, Vukojević V.
In-Text Gene Mentions
Introduction)
…Furthermore, gene-to-gene interactions between the mu-opioid receptor (MOP) gene (OPRM1) and the serotonin transporter (5-HTT) or 5-HT1A (HTR1A) genes had antagonistic effects on endogenous descending pain modulation in healthy subjects and in fibromyalgia patients [12].…
Introduction)
…serotonin transporter (5-HTT) or 5-HT…
Show Full Abstract
The importance of the dynamic interplay between the opioid and the serotonin neuromodulatory systems in chronic pain is well recognized. In this study, we investigated whether these two signalling pathways can be integrated at the single-cell level via direct interactions between the mu-opioid (MOP) and the serotonin 1A (5-HT1A) receptors. Using fluorescence cross-correlation spectroscopy (FCCS), a quantitative method with single-molecule sensitivity, we characterized in live cells MOP and 5-HT1A interactions and the effects of prolonged (18 h) exposure to selected non-peptide opioids: morphine, codeine, oxycodone and fentanyl, on the extent of these interactions. The results indicate that in the plasma membrane, MOP and 5-HT1A receptors form heterodimers that are characterized with an apparent dissociation constant Kdapp = (440 ± 70) nM). Prolonged exposure to all non-peptide opioids tested facilitated MOP and 5-HT1A heterodimerization and stabilized the heterodimer complexes, albeit to a different extent: Kd, Fentanylapp = (80 ± 70) nM), Kd,Morphineapp = (200 ± 70) nM, Kd, Codeineapp = (100 ± 70) nM and Kd, Oxycodoneapp = (200 ± 70) nM. The non-peptide opioids differed also in the extent to which they affected the mitogen-activated protein kinases (MAPKs) p38 and the extracellular signal-regulated kinase (Erk1/2), with morphine, codeine and fentanyl activating both pathways, whereas oxycodone activated p38 but not ERK1/2. Acute stimulation with different non-peptide opioids differently affected the intracellular Ca2+ levels and signalling dynamics. Hypothetically, targeting MOP−5-HT1A heterodimer formation could become a new strategy to counteract opioid induced hyperalgesia and help to preserve the analgesic effects of opioids in chronic pain.
Also flagged:NucleusIntervertebral discspinal disordersneurological disorderMYCKLF4
Journal Article2022-04-06✓ 5 SnippetsSeki S, Iwasaki M, Makino H, Yahara Y, Miyazaki Y, Kamei K, Futakawa H, Nogami M, Tran Canh Tung N, Hirokawa T, Tsuji M, Kawaguchi Y.
In-Text Gene Mentions
Abstract)
…, SOX5 ,SOX6, and SOX9…
Introduction)
…SOX5 andSOX6are required for…
Introduction)
…SOX5 andSOX6drive the expression…
Introduction)
…SOX5 −/− andSOX6−/− mice are…
Methods)
…OHu19789D, SOX5: OHu20243D,SOX6: OHu12492D) were obtained…
Show Full Abstract
Intervertebral disc (IVD) diseases are common spinal disorders that cause neck or back pain in the presence or absence of an underlying neurological disorder. IVD diseases develop on the basis of degeneration, and there are no established treatments for degeneration. IVD diseases may therefore represent a candidate for the application of regenerative medicine, potentially employing normal human dermal fibroblasts (NHDFs) induced to differentiate into nucleus pulposus (NP) cells. Here, we used a three-dimensional culture system to demonstrate that ectopic expression of <i>MYC</i>, <i>KLF4</i>, <i>NOTO</i>, <i>SOX5</i>, <i>SOX6</i>, and <i>SOX9</i> in NHDFs generated NP-like cells, detected using Safranin-O staining. Quantitative PCR, microarray analysis, and fluorescence-activated cell sorting revealed that the induced NP cells exhibited a fully differentiated phenotype. These findings may significantly contribute to the development of effective strategies for treating IVD diseases.
Also flagged:watertranscription factorsresponse to stressmetabolismresponse to hypoxiaangiogenesis
Journal Article2022-04-06✓ 1 SnippetCassar-Malek I, Pomiès L, de la Foye A, Tournayre J, Boby C, Hocquette JF.
In-Text Gene Mentions
Methods)
…were selected: UXT,MRPL39, CLN3 and TOP2B…
Show Full Abstract
In meat-producing animals, preslaughter operations (<i>e.g</i>., transportation, mixing unfamiliar animals, food and water deprivation) may be a source of stress with detrimental effects on meat quality. The objective of this work was to study the effect of emotional and physical stress by comparing the transcriptomes of two muscles (M. <i>longissimus thoracis, LT</i> and M. <i>semitendinosus, ST</i>) in Normand cows exposed to stress (<i>n</i> = 16) <i>vs</i>. cows handled with limited stress (<i>n</i> = 16). Using a microarray, we showed that exposure to stress resulted in differentially expressed genes (DEGs) in both muscles (62 DEGs in LT and 32 DEGs in ST, of which eight were common transcription factors (TFs)). Promoter analysis of the DEGs showed that 25 cis transcriptional modules were overrepresented, of which nine were detected in both muscles. Molecular interaction networks of the DEGs targeted by the most represented cis modules helped identify common regulators and common targets involved in the response to stress. They provided elements showing that the transcriptional response to stress is likely to (i) be controlled by regulators of energy metabolism, factors involved in the response to hypoxia, and inflammatory cytokines; and (ii) initiate metabolic processes, angiogenesis, corticosteroid response, immune system processes, and satellite cell activation/quiescence. The results of this study demonstrate that exposure to stress induced a core response to stress in both muscles, including changes in the expression of TFs. These factors could relay the physiological adaptive response of cattle muscles to cope with emotional and physical stress. The study provides information to further understand the consequences of these molecular processes on meat quality and find strategies to attenuate them.
Also flagged:Tiaprideneurodegenerative disorderchoreacognitive declinebehavioralHD
Journal Article2022-04-06✓ 3 SnippetsFeleus S, van Schaijk M, Roos RAC, de Bot ST.
In-Text Gene Mentions
I A O 0000606)
…AIMS = Abnormal Involuntary Movement Scale; BL = Baseline; CAG-repeat = Cytosine Adenine Guanine trinucleotide repeat; EU = Europe; EMG = Electromyography; FDA = United States (of America) Food and Drug Administration; FU = Follow-up; HD = Huntington’s Disease; HTT = Huntingtin; LTFU = Lost to follow-up; mg = milligram; n = number of; NA = Not applicable; p = p-value; RCT = Randomized Controlled Trial; UHDRS- TFC = Unified Huntington’s Disease Rating Scale—Total Functional Capacity; UHDRS-TMS = Unified Huntington’s Disease Rating Scale—Total Motor Score; uk = unknown; USA = United States of America; WHO = World Health Organization.…
Introduction)
…Huntington’s Disease (HD) is an autosomal, dominantly inherited neurodegenerative disorder caused by an expansion of the CAG repeat in the huntingtin (HTT) gene [1,2].…
Introduction)
…in the huntingtin (HTT) gene [ 1…
Show Full Abstract
Huntington's Disease (HD) is a rare, neurodegenerative disorder characterized by chorea, cognitive decline, and behavioral changes. Despite wide clinical use since the mid-1980s, tiapride was recently withdrawn from the Dutch market without rationale. Although alternatives are available, many patients experienced dysregulation after this unwanted change. We provide insight into the impact of sudden tiapride withdrawal by reviewing medical records of HD patients who were using tiapride at the time of withdrawal. In addition, we performed a systematic search in five databases on tiapride efficacy and its safety profile in HD. Original research and expert opinions were included. In our patient group on tiapride, 50% required tiapride import from abroad. Regarding the review, 12 articles on original datasets and three expert opinions were included. The majority of studies showed an improvement in chorea while patients were on tiapride. Due to limited sample sizes, not all studies performed statistical tests on their results. Fifty percent of clinical experts prefer tiapride as initial chorea monotherapy, especially when comorbid behavioral symptoms are present. Side effects are often rare and mild. No safety concerns were reported. In conclusion, tiapride is almost irreplaceable for some patients and is an effective and safe chorea treatment in HD.
Also flagged:Major Depressive Disordermental disorderpathogenesispsychiatric disorderspsychiatric disordercognition
Journal Article2022-04-06No SnippetsKamran M, Bibi F, Bibi F, Ur Rehman A, Morris DW.
Show Full Abstract
Major depressive disorder (MDD) is a common mental disorder generally characterized by symptoms associated with mood, pleasure and effectiveness in daily life activities. MDD is ranked as a major contributor to worldwide disability. The complex pathogenesis of MDD is not yet understood, and this is a major cause of failure to develop new therapies and MDD recurrence. Here we summarize the literature on existing hypotheses about the pathophysiological mechanisms of MDD. We describe the different approaches undertaken to understand the molecular mechanism of MDD using genetic data. Hundreds of loci have now been identified by large genome-wide association studies (GWAS). We describe these studies and how they have provided information on the biological processes, cell types, tissues and druggable targets that are enriched for MDD risk genes. We detail our understanding of the genetic correlations and causal relationships between MDD and many psychiatric and non-psychiatric disorders and traits. We highlight the challenges associated with genetic studies, including the complexity of MDD genetics in diverse populations and the need for a study of rare variants and new studies of gene-environment interactions.
Also flagged:Rheumatoid arthritisRAsystemic autoimmune diseasemTORWntcell proliferation
Journal Article2022-04-06✓ 1 SnippetHuang Z, Kuang N.
In-Text Gene Mentions
Discussion)
…EPC1, TNFSF10, DDX3X,RC3H1-IT1, and BRWD1-IT1) and…
Show Full Abstract
(1) Background: Rheumatoid arthritis (RA) is a common systemic autoimmune disease affecting many people and has an unclear and complicated physiological mechanism. The competing endogenous RNA (ceRNA) network plays an essential role in the development and occurrence of various human physiological processes. This study aimed to construct a ceRNA network related to RA. (2) Methods: We explored the GEO database for peripheral blood mononuclear cell (PBMC) samples and then analyzed the RNA of 52 samples (without treatment) to obtain lncRNAs (DELs), miRNAs (DEMs), and mRNAs (DEGs), which can be differentially expressed with statistical significance in the progression of RA. Next, a ceRNA network was constructed, based on the DELs, DEMs, and DEGs. At the same time, the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) analysis were used to validate the possible function of the ceRNA network. (3) Results: Through our analysis, 389 DELs, 247 DEMs, and 1081 DEGs were screened. After this, a ceRNA network was constructed for further statistical comparisons, including 16 lncRNAs, 1 miRNA, and 15 mRNAs. According to the GO and KEGG analysis, the ceRNA network was mainly enriched in the mTOR pathway, the dopaminergic system, and the Wnt signaling pathway. (4) Conclusions: The novel ceRNA network related to RA that we constructed offers novel insights into and targets for the underlying molecular mechanisms of the mTOR pathway, the dopaminergic system, and the Wnt signaling pathway (both classic and nonclassic pathways) that affect the level of the genetic regulator, which might offer novel ways to treat RA.
Also flagged:Vascular calcificationdiabetesatherosclerosischronic kidney diseasepathogenesisbone formation
Journal Article2022-04-06No SnippetsNiu Z, Su G, Li T, Yu H, Shen Y, Zhang D, Liu X.
Show Full Abstract
Vascular calcification (VC) is a complex ectopic calcification process and an important indicator of increased risk for diabetes, atherosclerosis, chronic kidney disease, and other diseases. Therefore, clarifying the pathogenesis of VC is of great clinical significance. Numerous studies have shown that the onset and progression of VC are similar to bone formation. Members of the bone morphogenetic protein (BMP) family of proteins are considered key molecules in the progression of vascular calcification. BMP type I receptor A (BMPR1A) is a key receptor of BMP factors acting on the cell membrane, is widely expressed in various tissues and cells, and is an important "portal" for BMP to enter cells and exert their biological effect. In recent years, many discoveries have been made regarding the occurrence and treatment of ectopic ossification-related diseases involving BMP signaling targets. Studies have confirmed that BMPR1A is involved in osteogenic differentiation and that its high expression in vascular endothelial cells and smooth muscle cells can lead to vascular calcification. This article reviews the role of BMPR1A in vascular calcification and the possible underlying molecular mechanisms to provide clues for the clinical treatment of such diseases.
Journal Article2022-04-06✓ 1 SnippetGoetzl L, Darbinian N, Merabova N, Devane LC, Ramamoorthy S.
In-Text Gene Mentions
Methods)
…names SLC6A4; Synonyms:HTT, SERT; Organism Homo…
Show Full Abstract
Patient and providers' fear of fetal exposure to medications may lead to discontinuation of treatment, disease relapse, and maternal morbidity. Placental drug transporters play a critical role in fetal exposure through active transport but the majority of data are limited to the 3rd trimester, when the majority of organogenesis has already occurred. Our objective was to define gestational age (GA) dependent changes in protein activity, expression and modifications of five major placental drug transporters: SERT, P-gp, NET, BCRP and MRP3. Apical brush border membrane fractions were prepared from fresh 1st, 2nd and 3rd trimester human placentas collected following elective pregnancy termination or planned cesarean delivery. A structured maternal questionnaire was used to identify maternal drug use and exclude exposed subjects. Changes in placental transporter activity and expression relative to housekeeping proteins were quantified. There was evidence for strong developmental regulation of SERT, NET, P-gp, BCRP and MRP3. P-gp and BCRP decreased with gestation (r = -0.72, <i>p</i> < 0.001 and r = -0.77, <i>p</i> < 0.001, respectively). Total SERT increased with gestation but this increase was due to a decrease in SERT cleavage products across trimesters. Uncleaved SERT increased with GA (r = 0.89, <i>p</i> < 0.001) while cleaved SERT decreased with GA (r = -0.94, <i>p</i> < 0.001). Apical membrane NET overall did not appear to be developmentally regulated (r = -0.08, <i>p</i> = 0.53). Two forms of MRP3 were identified; the 50 kD form did not change across GA; the 160 kD form was steady in the 1st and 2nd trimester and increased in the 3rd trimester (r = 0.24, <i>p</i> = 0.02). The 50 kD form was expressed at higher levels. The observed patterns of SERT, NET P-gp, BCRP and MRP3 expression and activity may be associated with transporter activity or decreased placental permeability in the 1st trimester to transporter specific substrates including commonly used psychoactive medications such as anti-depressants, anti-psychotics, and amphetamines, while transport of nutrients and serotonin is important in the 1st trimester. Overall these observations are consistent with a strong protective effect during organogenesis. 3rd trimester estimates of fetal exposure obtained from cord blood likely significantly overestimate early fetal exposure to these medications at any fixed maternal dose.
Also flagged:Cytokines5-HT2A ReceptorSleepcytokineserotonin 2A receptor5-HTR2A
Journal Article2022-04-06✓ 2 SnippetsWang J, Gao X, Gao P, Liu J.
In-Text Gene Mentions
Introduction)
…Its transporter (5-HTT) is an important adjustment factor of the 5-HT activity, which is highly correlated with insomnia (32).…
Introduction)
…Its transporter (5-HTT) is an important…
Show Full Abstract
<h4>Background</h4>Studies have shown that cytokine activity changes during the sleep-wake process, suggesting that inflammatory factors may be involved in a mechanism affecting sleep quality. Furthermore, the serotonergic system is also one of the essential components of airway relaxation during sleep, especially the serotonin 2A receptor (5-HTR2A) type that plays an important role in the sleep-wake process. Therefore, this research aimed to investigate the effects of cytokines and <i>5-HTR2A</i> polymorphisms on sleep quality in non-manual workers in Urumqi, Xinjiang in order to explore the relationship between the three.<h4>Methods</h4>This study used a cluster sampling method to randomly select non-manual workers who worked in Urumqi, Xinjiang for at least 1 year. From July 2016 and December 2017, this study recruited 1,500 non-manual workers for physical examination in the First Affiliated Hospital of Xinjiang Medical University. According to the inclusion and exclusion criteria, 1,329 non-manual workers were finally included in the questionnaire study. It used the Pittsburgh Sleep Quality Index questionnaire to assess sleep quality. Moreover, another 15% of respondents were randomly selected as the experimental study group. The polymerase chain reaction restriction fragment length polymorphism was used to detect <i>5-HTR2A</i> gene genotypes. Simultaneously, the cytokine (IL-1β, IL-2, IL-6, and TNF-α) content was evaluated using an enzyme-linked immunoassay.<h4>Results</h4>The results showed that among the 1,329 respondents, 870 had sleep quality problems, and the detection rate was 65.46%. The distribution of -1438G/A genotypes in the <i>5-HTR2A</i> gene was significantly different among different sleep quality groups (<i>p</i> < 0.05), with no statistical significance present when comparing to T102C (<i>p</i> > 0.05). Logistic regression analysis showed that the AG [odds ratio (OR) = 2.771, 95% confidence interval (CI): 1.054-7.287] and GG (OR = 4.037, 95% CI: 1.244-13.105) genotypes at -1438G/A loci were both associated with poor sleep quality and were thus considered the susceptibility genotypes for sleep problems. Furthermore, IL-1β was shown to be a protective factor for sleep quality (OR = 0.949, 95% CI: 0.925-0.974). The interaction results showed that AG × IL-1β (OR = 0.952, 95% CI: 0.918-0.987) was associated with a lower risk of sleep problems than AA × IL-1β.<h4>Conclusion</h4>Cytokines and <i>5-HTR2A</i> polymorphisms not only have independent effects on sleep but also may have cumulative effects. Therefore, it is necessary to further explore the related mechanisms affecting sleep quality to improve the sleep quality of non-manual workers.
Also flagged:infectionsevere combined immunodeficiencySCIDcombined immunodeficiencyImmune dysregulationdiseases of immune dysregulation
Journal Article2022-04-06✓ 1 SnippetAl Farsi T, Ahmed K, Alshekaili J, Al Kindi M, Cook M, Al-Hosni A, Ansari Z, Nasr I, Al Sukaiti N.
In-Text Gene Mentions
Results)
…( 17 ),ZNFX1( 18 )].…
Show Full Abstract
<h4>Background</h4>Inborn errors of immunity (IEIs) are being recognized as an important cause of morbidity and mortality in communities with a high frequency of consanguinity, such as Oman, and thus recessively inherited conditions. Various monogenic causes of IEI have been recently discovered; however, the disease phenotype may be variable and does not always include infection at presentation, leading to a delay in diagnosis and a poor outcome. It is now well recognized that immune dysregulation manifestations are observed in a significant proportion of patients with IEI and occasionally precede infection.<h4>Methods</h4>Here, we retrospectively report the epidemiological, clinical, immunological, and molecular findings and outcomes from 239 patients with IEI who were diagnosed and managed at the Royal Hospital, Oman, from January 2010 to October 2021.<h4>Results</h4>The estimated annual cumulative mean incidence of IEI was 25.5 per 100,000 Omani live births with a total prevalence of 15.5 per 100,000 Omani population. Both the high incidence and prevalence are attributed to the high rate of consanguinity (78.2%). Defects affecting cellular and humoral immunity including severe combined immunodeficiency (SCID), combined immunodeficiency (CID), and CID with syndromic features were the predominant defects in IEI (36%). Immune dysregulation was a prominent manifestation and occurred in approximately a third of all patients with IEI (32%), with a mean age of onset of 81 months and a mean diagnostic delay of 50.8 months. The largest percentage of patients who showed such clinical signs were in the category of diseases of immune dysregulation (41%), followed by predominantly antibody deficiency (18%). The overall mortality rate in our cohort was 25.1%, with higher death rates seen in CID including SCID and diseases of immune dysregulation.<h4>Conclusion</h4>Immune dysregulation is a frequent manifestation of Omani patients with IEI. Early detection through raising awareness of signs of IEI including those of immune dysregulation and implementation of newborn screening programs will result in early intervention and improved overall outcome.
Journal Article2022-04-06No SnippetsCai H, Zheng D, Yao Y, Yang L, Huang X, Wang L.
Show Full Abstract
Embryonic lethal abnormal vision-like (ELAVL) proteins are RNA binding proteins that were originally discovered as indispensable regulators of the development and functioning of the nervous system. Subsequent studies have shown that ELAVL proteins not only exist in the nervous system, but also have regulatory effects in other tissues. ELAVL proteins have attracted attention as potential therapeutic targets because they stabilize multiple mRNAs by binding within the 3'-untranslated region and thus promote the development of tumors, including hepatocellular carcinoma, pancreatic cancer, ovarian cancer, breast cancer, colorectal carcinoma and lung cancer. Previous studies have focused on these important relationships with downstream mRNAs, but emerging studies suggest that ELAVL proteins also interact with non-coding RNAs. In this review, we will summarize the relationship of the ELAVL protein family with mRNA and non-coding RNA and the roles of ELAVL protein family members in a variety of physiological and pathological processes.
Also flagged:glycansglycansynthesisGolgi apparatuslocalizationorganelle
Journal Article2022-04-06No SnippetsSahu P, Balakrishnan A, Di Martino R, Luini A, Russo D.
Show Full Abstract
Tumorigenesis is associated with the deregulation of multiple processes, among which the glycosylation of lipids and proteins is one of the most extensively affected. However, in most cases, it remains unclear whether aberrant glycosylation is a cause, a link in the pathogenetic chain, or a mere consequence of tumorigenesis. In other cases, instead, studies have shown that aberrant glycans can promote oncogenesis. To comprehend how aberrant glycans are generated it is necessary to clarify the underlying mechanisms of glycan synthesis at the Golgi apparatus, which are still poorly understood. Important factors that determine the glycosylation potential of the Golgi apparatus are the levels and intra-Golgi localization of the glycosylation enzymes. These factors are regulated by the process of cisternal maturation which transports the cargoes through the Golgi apparatus while retaining the glycosylation enzymes in the organelle. This mechanism has till now been considered a single, house-keeping and constitutive function. Instead, we here propose that it is a mosaic of pathways, each controlling specific set of functionally related glycosylation enzymes. This changes the conception of cisternal maturation from a constitutive to a highly regulated function. In this new light, we discuss potential new groups oncogenes among the cisternal maturation machinery that can contribute to aberrant glycosylation observed in cancer cells. Further, we also discuss the prospects of novel anticancer treatments targeting the intra-Golgi trafficking process, particularly the cisternal maturation mechanism, to control/inhibit the production of pro-tumorigenic glycans.
Also flagged:Proteasomesneurodegenerative disordersdementiaprotein homeostasisdegradationubiquitin
Journal Article2022-04-06✓ 3 SnippetsMee Hayes E, Sirvio L, Ye Y.
In-Text Gene Mentions
Introduction)
…Huntington’s disease is typically characterized by chorea and psychiatric symptoms, in which expansion of repeat sequences (poly-glutamine or poly-Q) in the huntingtin protein (HTT) drives its aggregation (Tabrizi et al., 2020).…
S I O 001029)
…In a rodent Huntington’s disease model, the loss of CHIP accelerates pathological phenotypes such as HTT aggregation and neurodegeneration (Miller et al., 2005).…
Introduction)
…the huntingtin protein (HTT) drives its aggregation…
Show Full Abstract
Insoluble protein deposits are hallmarks of neurodegenerative disorders and common forms of dementia. The aberrant aggregation of misfolded proteins involves a complex cascade of events that occur over time, from the cellular to the clinical phase of neurodegeneration. Declining neuronal health through increased cell stress and loss of protein homeostasis (proteostasis) functions correlate with the accumulation of aggregates. On the cellular level, increasing evidence supports that misfolded proteins may undergo liquid-liquid phase separation (LLPS), which is emerging as an important process to drive protein aggregation. Studying the reverse process of aggregate disassembly and degradation has only recently gained momentum, following reports of enzymes with distinct aggregate-disassembly activities. In this review, we will discuss how the ubiquitin-proteasome system and disaggregation machineries such as VCP/p97 and HSP70 system may disassemble and/or degrade protein aggregates. In addition to their canonically associated functions, these enzymes appear to share a common feature: reversibly assembling into liquid droplets in an LLPS-driven manner. We review the role of LLPS in enhancing the disassembly of aggregates through locally increasing the concentration of these enzymes and their co-proteins together within droplet structures. We propose that such activity may be achieved through the concerted actions of disaggregase machineries, the ubiquitin-proteasome system and their co-proteins, all of which are condensed within transient aggregate-associated droplets (TAADs), ultimately resulting in aggregate clearance. We further speculate that sustained engagement of these enzymatic activities within TAADs will be detrimental to normal cellular functions, where these activities are required. The possibility of facilitating endogenous disaggregation and degradation activities within TAADs potentially represents a novel target for therapeutic intervention to restore protein homeostasis at the early stages of neurodegeneration.
Research Square2022-04-06Preprint (No Snippets API)Long H, Tye E, Jinks E, Haigh T, Kaul B, Patel P, Parry H, Newby M, Crispin M, Kaur N, Moss P, Drennan S, Taylor G.
Show Full Abstract
<title>Abstract</title> <p>CD4 + T-cells are essential for protection against viruses including SARS-CoV-2. Mutations in SARS-CoV-2 variants of concern (VOC) can enhance infectivity and reduce antibody recognition. CD4 + T-cell sensitivity to mutations is less well understood because few epitopes have been mapped. Characterising > 100 SARS-CoV-2-specific CD4 + T-cell clones from convalescent healthcare workers, we mapped and HLAII restricted 21 epitopes across three viral proteins. Responses to the same spike epitopes were also present after vaccination of uninfected individuals. Lack of CD4 + T-cell cross-reactivity with endemic beta-coronaviruses suggests these responses arose from naïve T-cells rather than pre-existing cross-reactive coronavirus-specific T-cell responses. 10/17 spike epitopes were mutated in VOCs and CD4 + T-cell recognition of 7 was impaired, including 3 of 4 epitopes mutated in Omicron. Broad CD4 + T-cell targeting of epitopes likely limits evasion by current VOCs. However, continued genomic surveillance is vital to identify new emerging mutations able to evade CD4 + T-cell immunity.</p>
Also flagged:gene expressionmitochondrial diseasedinucleotidesmitochondrialmitochondrial disorderglucose
Journal Article2022-04-05No SnippetsYépez VA, Gusic M, Kopajtich R, Mertes C, Smith NH, Alston CL, Ban R, Beblo S, Berutti R, Blessing H, Ciara E, Distelmaier F, Freisinger P, Häberle J, Hayflick SJ, Hempel M, Itkis YS, Kishita Y, Klopstock T, Krylova TD, Lamperti C, Lenz D, Makowski C, Mosegaard S, Müller MF, Muñoz-Pujol G, Nadel A, Ohtake A, Okazaki Y, Procopio E, Schwarzmayr T, Smet J, Staufner C, Stenton SL, Strom TM, Terrile C, Tort F, Van Coster R, Vanlander A, Wagner M, Xu M, Fang F, Ghezzi D, Mayr JA, Piekutowska-Abramczuk D, Ribes A, Rötig A, Taylor RW, Wortmann SB, Murayama K, Meitinger T, Gagneur J, Prokisch H.
Show Full Abstract
<h4>Background</h4>Lack of functional evidence hampers variant interpretation, leaving a large proportion of individuals with a suspected Mendelian disorder without genetic diagnosis after whole genome or whole exome sequencing (WES). Research studies advocate to further sequence transcriptomes to directly and systematically probe gene expression defects. However, collection of additional biopsies and establishment of lab workflows, analytical pipelines, and defined concepts in clinical interpretation of aberrant gene expression are still needed for adopting RNA sequencing (RNA-seq) in routine diagnostics.<h4>Methods</h4>We implemented an automated RNA-seq protocol and a computational workflow with which we analyzed skin fibroblasts of 303 individuals with a suspected mitochondrial disease that previously underwent WES. We also assessed through simulations how aberrant expression and mono-allelic expression tests depend on RNA-seq coverage.<h4>Results</h4>We detected on average 12,500 genes per sample including around 60% of all disease genes-a coverage substantially higher than with whole blood, supporting the use of skin biopsies. We prioritized genes demonstrating aberrant expression, aberrant splicing, or mono-allelic expression. The pipeline required less than 1 week from sample preparation to result reporting and provided a median of eight disease-associated genes per patient for inspection. A genetic diagnosis was established for 16% of the 205 WES-inconclusive cases. Detection of aberrant expression was a major contributor to diagnosis including instances of 50% reduction, which, together with mono-allelic expression, allowed for the diagnosis of dominant disorders caused by haploinsufficiency. Moreover, calling aberrant splicing and variants from RNA-seq data enabled detecting and validating splice-disrupting variants, of which the majority fell outside WES-covered regions.<h4>Conclusion</h4>Together, these results show that streamlined experimental and computational processes can accelerate the implementation of RNA-seq in routine diagnostics.
Also flagged:pathogenesissubsquamous intestinal metaplasiareflux esophagitiswound-healingEMPBE
Journal Article2022-04-05✓ 1 SnippetZhang Q, Bansal A, Dunbar KB, Chang Y, Zhang J, Balaji U, Gu J, Zhang X, Podgaetz E, Pan Z, Spechler SJ, Souza RF.
In-Text Gene Mentions
Text
…OLFM4…
Show Full Abstract
The pathogenesis of subsquamous intestinal metaplasia (SSIM), in which glands of Barrett's esophagus (BE) are buried under esophageal squamous epithelium, is unknown. In a rat model of reflux esophagitis, we found that columnar-lined esophagus developed via a wound-healing process involving epithelial-mesenchymal plasticity (EMP) that buried glands under ulcerated squamous epithelium. To explore a role for reflux-induced EMP in BE, we established and characterized human Barrett's organoids and sought evidence of EMP after treatment with acidic bile salts (AB). We optimized media to grow human BE organoids from immortalized human Barrett's cells and from BE biopsies from seven patients, and we characterized histological, morphological, and molecular features of organoid development. Features and markers of EMP were explored following organoid exposure to AB, with and without a collagen I (COL1) matrix to simulate a wound-healing environment. All media successfully initiated organoid growth, but advanced DMEM/F12 (aDMEM) was best at sustaining organoid viability. Using aDMEM, organoids comprising nongoblet and goblet columnar cells that expressed gastric and intestinal cell markers were generated from BE biopsies of all seven patients. After AB treatment, early-stage Barrett's organoids exhibited EMP with loss of membranous E-cadherin and increased protrusive cell migration, events significantly enhanced by COL1. Using human BE biopsies, we have established Barrett's organoids that recapitulate key histological and molecular features of BE to serve as high-fidelity BE models. Our findings suggest that reflux can induce EMP in human BE, potentially enabling Barrett's cells to migrate under adjacent squamous epithelium to form SSIM.<b>NEW & NOTEWORTHY</b> Using Barrett's esophagus (BE) biopsies, we established organoids recapitulating key BE features. During early stages of organoid development, a GERD-like wound environment-induced features of epithelial-mesenchymal plasticity (EMP) in Barrett's progenitor cells, suggesting that reflux-induced EMP can enable Barrett's cells to migrate underneath squamous epithelium to form subsquamous intestinal metaplasia, a condition that may underlie Barrett's cancers that escape detection by endoscopic surveillance, and recurrences of Barrett's metaplasia following endoscopic eradication therapy.
Also flagged:chaperoninmacroautophagyautophagyautophagy receptorsCCT2receptor
Journal Article2022-04-05No SnippetsMa X, Zhang M, Ge L.
Show Full Abstract
Protein aggregation is related to many human diseases. Selective macroautophagy/autophagy is the major way to clear protein aggregates in eukaryotic cells. While multiple types of autophagy receptors have been reported to mediate autophagic clearance of protein condensates with liquidity, it has been unclear if and how solid aggregates could be degraded by autophagy. Our recent work identifies the chaperonin subunit CCT2 as a new type of aggrephagy receptor specifically facilitating the autophagic clearance of solid protein aggregates, and indicates that multiple aggrephagy pathways act in parallel to remove different types of protein aggregates. In addition, this work reveals a functional switch of the chaperonin system by showing that CCT2 acts both as a chaperonin component and an autophagy-receptor via complex and monomer formation.
Also flagged:TuberculosisTBisoniazidrifampinrifabutinpyrazinamide
Journal Article2022-04-05No SnippetsCrabtree-Ramirez B, Jenkins CA, Shepherd BE, Jayathilake K, Veloso VG, Carriquiry G, Gotuzzo E, Cortes CP, Padgett D, McGowan C, Sierra-Madero J, Koenig S, Pape JW, Sterling TR, CCASAnet Region of IeDEA.
Show Full Abstract
<h4>Background</h4>Some tuberculosis (TB) treatment guidelines recommend daily TB treatment in both the intensive and continuation phases of treatment in HIV-positive persons to decrease the risk of relapse and acquired drug resistance. However, guidelines vary across countries, and treatment is given 7, 5, 3, or 2 days/week. The effect of TB treatment intermittency in the continuation phase on mortality in HIV-positive persons on antiretroviral therapy (ART), is not well-described.<h4>Methods</h4>We conducted an observational cohort study among HIV-positive adults treated for TB between 2000 and 2018 and after enrollment into the Caribbean, Central, and South America network for HIV epidemiology (CCASAnet; Brazil, Chile, Haiti, Honduras, Mexico and Peru). All received standard TB therapy (2-month initiation phase of daily isoniazid, rifampin or rifabutin, pyrazinamide ± ethambutol) and continuation phase of isoniazid and rifampin or rifabutin, administered concomitantly with ART. Known timing of ART and TB treatment were also inclusion criteria. Kaplan-Meier and Cox proportional hazards methods compared time to death between groups. Missing model covariates were imputed via multiple imputation.<h4>Results</h4>2303 patients met inclusion criteria: 2003(87%) received TB treatment 5-7 days/week and 300(13%) 2-3 days/week in the continuation phase. Intermittency varied by site: 100% of patients from Brazil and Haiti received continuation phase treatment 5-7 days/week, followed by Honduras (91%), Peru (42%), Mexico (7%), and Chile (0%). The crude risk of death was lower among those receiving treatment 5-7 vs. 2-3 days/week (HR = 0.68; 95% CI = 0.51-0.91; P = 0.008). After adjusting for age, sex, CD4, ART use at TB diagnosis, site of TB disease (pulmonary vs. extrapulmonary), and year of TB diagnosis, mortality risk was lower, but not significantly, among those treated 5-7 days/week vs. 2-3 days/week (HR 0.75, 95%CI 0.55-1.01; P = 0.06). After also stratifying by study site, there was no longer a protective effect (HR 1.42, 95%CI 0.83-2.45; P = 0.20).<h4>Conclusions</h4>TB treatment 5-7 days/week was associated with a marginally decreased risk of death compared to TB treatment 2-3 days/week in the continuation phase in multivariable, unstratified analyses. However, little variation in TB treatment intermittency within country meant the results could have been driven by other differences between study sites. Therefore, randomized trials are needed, especially in heterogenous regions such as Latin America.
Also flagged:deathendocannabinoidCAPNS1CSNK2BPTP4A2GSTT1
Journal Article2022-04-05No SnippetsKim MJ, Do M, Han D, Son M, Shin D, Yeo I, Yun YH, Yoo SH, Choi HJ, Shin D, Rhee SJ, Ahn YM, Kim Y.
Show Full Abstract
Suicide is a leading cause of death worldwide, presenting a serious public health problem. We aimed to investigate the biological basis of suicide completion using proteomics on postmortem brain tissue. Thirty-six postmortem brain samples (23 suicide completers and 13 controls) were collected. We evaluated the proteomic profile in the prefrontal cortex (Broadmann area 9, 10) using tandem mass tag-based quantification with liquid chromatography-tandem mass spectrometry. Bioinformatics tools were used to elucidate the biological mechanisms related to suicide. Subgroup analysis was conducted to identify common differentially expressed proteins among clinically different groups. Of 9801 proteins identified, 295 were differentially expressed between groups. Suicide completion samples were mostly enriched in the endocannabinoid and apoptotic pathways (CAPNS1, CSNK2B, PTP4A2). Among the differentially expressed proteins, GSTT1 was identified as a potential biomarker among suicide completers with psychiatric disorders. Our findings suggest that the previously under-recognized endocannabinoid system and apoptotic processes are highly involved in suicide.
Also flagged:anxietyTRAPresponse to acute stressphosphorylationresponse to stressAS
Journal Article2022-04-05✓ 1 Snippetvon Ziegler LM, Floriou-Servou A, Waag R, Das Gupta RR, Sturman O, Gapp K, Maat CA, Kockmann T, Lin HY, Duss SN, Privitera M, Hinte L, von Meyenn F, Zeilhofer HU, Germain PL, Bohacek J.
In-Text Gene Mentions
Discussion)
…include the proteinsSHISA6, SHISA7, SHANK1, SHANK2…
Show Full Abstract
The acute stress response mobilizes energy to meet situational demands and re-establish homeostasis. However, the underlying molecular cascades are unclear. Here, we use a brief swim exposure to trigger an acute stress response in mice, which transiently increases anxiety, without leading to lasting maladaptive changes. Using multiomic profiling, such as proteomics, phospho-proteomics, bulk mRNA-, single-nuclei mRNA-, small RNA-, and TRAP-sequencing, we characterize the acute stress-induced molecular events in the mouse hippocampus over time. Our results show the complexity and specificity of the response to acute stress, highlighting both the widespread changes in protein phosphorylation and gene transcription, and tightly regulated protein translation. The observed molecular events resolve efficiently within four hours after initiation of stress. We include an interactive app to explore the data, providing a molecular resource that can help us understand how acute stress impacts brain function in response to stress.
Also flagged:Presequence proteasePrePmitochondrial M16C metalloproteasemitochondrialpeptidesbinding
Journal Article2022-04-05No SnippetsLiang WG, Wijaya J, Wei H, Noble AJ, Mancl JM, Mo S, Lee D, Lin King JV, Pan M, Liu C, Koehler CM, Zhao M, Potter CS, Carragher B, Li S, Tang WJ.
Show Full Abstract
Presequence protease (PreP), a 117 kDa mitochondrial M16C metalloprotease vital for mitochondrial proteostasis, degrades presequence peptides cleaved off from nuclear-encoded proteins and other aggregation-prone peptides, such as amyloid β (Aβ). PreP structures have only been determined in a closed conformation; thus, the mechanisms of substrate binding and selectivity remain elusive. Here, we leverage advanced vitrification techniques to overcome the preferential denaturation of one of two ~55 kDa homologous domains of PreP caused by air-water interface adsorption. Thereby, we elucidate cryoEM structures of three apo-PreP open states along with Aβ- and citrate synthase presequence-bound PreP at 3.3-4.6 Å resolution. Together with integrative biophysical and pharmacological approaches, these structures reveal the key stages of the PreP catalytic cycle and how the binding of substrates or PreP inhibitor drives a rigid body motion of the protein for substrate binding and catalysis. Together, our studies provide key mechanistic insights into M16C metalloproteases for future therapeutic innovations.
Also flagged:STAT6O-GlcNAcylationhelminth infectioninterleukin-25IL-25IL-33
Journal Article2022-04-05✓ 1 SnippetZhao M, Ren K, Xiong X, Xin Y, Zou Y, Maynard JC, Kim A, Battist AP, Koneripalli N, Wang Y, Chen Q, Xin R, Yang C, Huang R, Yu J, Huang Z, Zhang Z, Wang H, Wang D, Xiao Y, Salgado OC, Jarjour NN, Hogquist KA, Revelo XS, Burlingame AL, Gao X, von Moltke J, Lin Z, Ruan HB.
In-Text Gene Mentions
Text
…Olfm4…
Show Full Abstract
The epithelium is an integral component of mucosal barrier and host immunity. Following helminth infection, the intestinal epithelial cells secrete "alarmin" cytokines, such as interleukin-25 (IL-25) and IL-33, to initiate the type 2 immune responses for helminth expulsion and tolerance. However, it is unknown how helminth infection and the resulting cytokine milieu drive epithelial remodeling and orchestrate alarmin secretion. Here, we report that epithelial O-linked N-Acetylglucosamine (O-GlcNAc) protein modification was induced upon helminth infections. By modifying and activating the transcription factor STAT6, O-GlcNAc transferase promoted the transcription of lineage-defining Pou2f3 in tuft cell differentiation and IL-25 production. Meanwhile, STAT6 O-GlcNAcylation activated the expression of Gsdmc family genes. The membrane pore formed by GSDMC facilitated the unconventional secretion of IL-33. GSDMC-mediated IL-33 secretion was indispensable for effective anti-helminth immunity and contributed to induced intestinal inflammation. Protein O-GlcNAcylation can be harnessed for future treatment of type 2 inflammation-associated human diseases.
Also flagged:polyaminesnucleusnucleosomeagaroseH2BGFP
Journal Article2022-04-05✓ 1 SnippetImre L, Niaki EF, Bosire R, Nanasi P, Nagy P, Bacso Z, Hamidova N, Pommier Y, Jordan A, Szabo G.
In-Text Gene Mentions
Text
…linker histones…
Show Full Abstract
The roles and molecular interactions of polyamines (PAs) in the nucleus are not fully understood. Here their effect on nucleosome stability, a key regulatory factor in eukaryotic gene control, is reported, as measured in agarose embedded nuclei of H2B-GFP expressor HeLa cells. Nucleosome stability was assessed by quantitative microscopy [1,2] in situ, in close to native state of chromatin, preserving the nucleosome constrained topology of the genomic DNA. A robust destabilizing effect was observed in the millimolar concentration range in the case of spermine, spermidine as well as putrescine, which was strongly pH and salt concentration-dependent, and remained significant also at neutral pH. The integrity of genomic DNA was not affected by PA treatment, excluding DNA break-elicited topological relaxation as a factor in destabilization. The binding of PAs to DNA was demonstrated by the displacement of ethidium bromide, both from deproteinized nuclear halos and from plasmid DNA. The possibility that DNA methylation patterns may be influenced by PA levels is contemplated in the context of gene expression and DNA methylation correlations identified in the NCI-60 panel-based CellMiner database: methylated loci in subsets of high-ODC1 cell lines and the dependence of PER3 DNA methylation on PA metabolism.
Also flagged:DLBCLGene expressioncancerdiffuse large B-cell lymphomahypermethylationgene silencing
Journal Article2022-04-05✓ 5 SnippetsZorzan E, Elgendy R, Guerra G, Da Ros S, Gelain ME, Bonsembiante F, Garaffo G, Vitale N, Piva R, Marconato L, Aresu L, Dacasto M, Giantin M.
In-Text Gene Mentions
Abstract)
…Using four cDLBCL primary cell cultures and CLBL-1 cells, we found that CiDEA, MAL and PCDH17, which were significantly suppressed in DLBCL samples, were hypermethylated and also responsive (at the DNA, mRNA and protein level) to pharmacological unmasking with hypomethylating drugs and histone deacetylase inhibitors.…
Title)
…Hypermethylation-Mediated Silencing of CIDEA, MAL and PCDH17 Tumour Suppressor Genes in Canine DLBCL: From Multi-Omics Analyses to Mechanistic Studies…
Discussion)
…In this respect, epigenetic modulation of miR-196b, an oncogenic miRNA discovered in many human malignancies [58,59,60] and targeting PCDH17 mRNA [61] was seen in human leukaemia cells [62].…
Results)
…As a consequence, the gene expression analysis of tumour and control samples was performed for the following genes only: BMP7, CD1D, CiDEA, CXCL14, CYP1A1, LEF1, LHX8, MAL, PCDH17, RIPK4, SCN3B, SLC44A3 and TCF7.…
Discussion)
…PCDH17 has been recently defined as a new methylation driver gene that plays a critical role in the initiation, promotion and progression of different human tumours [16].…
Show Full Abstract
Gene expression is controlled by epigenetic deregulation, a hallmark of cancer. The DNA methylome of canine diffuse large B-cell lymphoma (cDLBCL), the most frequent malignancy of B-lymphocytes in dog, has recently been investigated, suggesting that aberrant hypermethylation of CpG loci is associated with gene silencing. Here, we used a multi-omics approach (DNA methylome, transcriptome and copy number variations) combined with functional in vitro assays, to identify putative tumour suppressor genes subjected to DNA methylation in cDLBCL. Using four cDLBCL primary cell cultures and CLBL-1 cells, we found that <i>CiDEA</i>, <i>MAL</i> and <i>PCDH17</i>, which were significantly suppressed in DLBCL samples, were hypermethylated and also responsive (at the DNA, mRNA and protein level) to pharmacological unmasking with hypomethylating drugs and histone deacetylase inhibitors. The regulatory mechanism underneath the methylation-dependent inhibition of those target genes expression was then investigated through luciferase and in vitro methylation assays. In the most responsive CpG-rich regions, an in silico analysis allowed the prediction of putative transcription factor binding sites influenced by DNA methylation. Interestingly, regulatory elements for <i>AP2, MZF1, NF-kB, PAX5</i> and <i>SP1</i> were commonly identified in all three genes. This study provides a foundation for characterisation and experimental validation of novel epigenetically-dysregulated pathways in cDLBCL.
Also flagged:MitochondriaNeurodegenerative Diseasesorganellesendoplasmic reticulumlysosomesendosomes
Journal Article2022-04-05✓ 2 SnippetsZhang S, Zhao J, Quan Z, Li H, Qing H.
In-Text Gene Mentions
S I O 001029)
…Hertz et al. (2013) found that the ATP analog kinetin triphosphate (KTP) can increase the activity of PINK1 harboring the PD-related variant G309D, resulting in enhanced recruitment of Parkin to depolarized mitochondria. Kinetin riboside ProTides can also promote PINK1 activity in cells (Osgerby et al., 2017). Importantly, Mdivi-1, a mitochondria division and Drp1 inhibitor, can reversibly inhibit complex I and attenuate pathological ROS production (Bordt et al., 2017). One study showed that Mdivi-1 exerts a protective effect on mitochondria and synapses in striatal neurons stably expressing mutant Htt (STHDhQ111/Q111) (Manczak and Reddy, 2015). Mdivi-1 and SS31 treatment also exert synergistic protective effects against mouse neuroblastoma (N2a) cells transfected with mutant AβPP cDNA (Swedish and Indiana mutations), resulting in lower Aβ40 and Aβ42 levels, reduced mitochondria dysfunction, and increased mtDNA copy number and cell survival (Reddy et al., 2018).…
S I O 001029)
…Treating striatal neurons carrying stably expressed mutant huntingtin (Htt) (STHDhQ111/Q111) with SS31 and MitoQ upregulated synaptophysin and PSD95 expression in neurons and largely normalized mitochondrial function (Yin et al., 2016).…
Show Full Abstract
The contribution of organelles to neural development has received increasing attention. Studies have shown that organelles such as mitochondria, endoplasmic reticulum (ER), lysosomes, and endosomes play important roles in neurogenesis. Specifically, metabolic switching, reactive oxygen species production, mitochondrial dynamics, mitophagy, mitochondria-mediated apoptosis, and the interaction between mitochondria and the ER all have roles in neurogenesis. Lysosomes and endosomes can regulate neurite growth and extension. Moreover, metabolic reprogramming represents a novel strategy for generating functional neurons. Accordingly, the exploration and application of mechanisms underlying metabolic reprogramming will be beneficial for neural conversion and regenerative medicine. There is adequate evidence implicating the dysfunction of cellular organelles-especially mitochondria-in neurodegenerative disorders, and that improvement of mitochondrial function may reverse the progression of these diseases through the reinforcement of adult neurogenesis. Therefore, these organelles have potential as therapeutic targets for the treatment of neurodegenerative diseases. In this review, we discuss the function of these organelles, especially mitochondria, in neural development, focusing on their potential as therapeutic targets in neurodegenerative disorders, including Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis.
…Huntington’s disease protein (HTT), MAPK Interacting Serine/Thr…
Show Full Abstract
Glutamate acts as a critical regulator of neurotransmitter balance, recycling, synaptic function and homeostasis in the brain and glutamate transporters control glutamate levels in the brain. SLC38A10 is a member of the SLC38 family and regulates protein synthesis and cellular stress responses. Here, we uncover the role of SLC38A10 as a transceptor involved in glutamate-sensing signaling pathways that control both the glutamate homeostasis and mTOR-signaling. The culture of primary cortex cells from SLC38A10 knockout mice had increased intracellular glutamate. In addition, under nutrient starvation, KO cells had an impaired response in amino acid-dependent mTORC1 signaling. Combined studies from transcriptomics, protein arrays and metabolomics established that SLC38A10 is involved in mTOR signaling and that SLC38A10 deficient primary cortex cells have increased protein synthesis. Metabolomic data showed decreased cholesterol levels, changed fatty acid synthesis, and altered levels of fumaric acid, citrate, 2-oxoglutarate and succinate in the TCA cycle. These data suggests that SLC38A10 may act as a modulator of glutamate homeostasis, and mTOR-sensing and loss of this transceptor result in lower cholesterol, which could have implications in neurodegenerative diseases.
Also flagged:Biliary Tract Cancercancerintraepithelial neoplasiabiliary stricturepancreatitisbiliary tract cancers
Journal Article2022-04-05No SnippetsKuwatani M, Kawakubo K, Sakamoto N.
Show Full Abstract
The undesired prognosis of biliary tract cancer is mainly attributed to the difficult detection of cancer lesions, including intraepithelial neoplasia and no standard examination for screening. In addition, pathological diagnosis of biliary stricture, whether it is malignant or benign, is not so easy, because of difficult optimal sampling by forceps biopsy and brush cytology, although various devices and methods for pathological diagnosis have been reported. Furthermore, we have to be careful about post-endoscopic retrograde cholangiography pancreatitis when we approach the biliary tract lesion via a transpapillary route. In order to improve the diagnostic accuracy, there have been several studies that indicate the feasibility and efficacy of genomic analysis for accurate diagnosis of biliary tract cancer by using pathological specimens, including endoscopic ultrasound-guided fine-needle aspiration/biopsy (EUS-FNA/FNB) samples. For efficient and precision medicine for patients with biliary tract cancer, future diagnosis and treatment should also be based on molecular and genetic analyses. In this article, we review and summarize the past knowledge and cutting edge of genomic testing for biliary tract cancer, using EUS-FNA/FNB specimens, and indicate some ingenuities in sample processing to promote effective clinical practice and future perspectives.
Also flagged:spermatogenesisIGF1RALKBH5HIF1ABRDTMAPK
Journal Article2022-04-05✓ 4 SnippetsJia B, Zhang L, Ma F, Wang X, Li J, Diao N, Leng X, Shi K, Zeng F, Zong Y, Liu F, Gong Q, Cai R, Yang F, Du R, Chang Z.
In-Text Gene Mentions
Results)
…CSF1, TCP11, SPAG17,PEBP1, AKAP3, CNOT7, PHB,…
Discussion)
…genes TCP11, SPAG17,PEBP1, AKAP3, CNOT7, and…
Discussion)
…PEBP1was specifically expressed…
Discussion)
…PEBP1could affect the…
Show Full Abstract
To elucidate the complex physiological process of testis development and spermatogenesis in Sika deer, this study evaluated the changes of miRNA and mRNA profiles in the four developmental stages of testis in the juvenile (1-year-old), adolescence (3-year-old), adult (5-year-old), and aged (10-year-old) stages. The results showed that a total of 198 mature, 66 novel miRNAs, and 23,558 differentially expressed (DE) unigenes were obtained; 14,918 (8,413 up and 6,505 down), 4,988 (2,453 up and 2,535 down), and 5,681 (2,929 up and 2,752 down) DE unigenes, as well as 88 (43 up and 45 down), 102 (44 up and 58 down), and 54 (18 up and 36 down) DE miRNAs were identified in 3- vs. 1-, 5- vs. 3-, and 10- vs. 5-year-old testes, respectively. By integrating miRNA and mRNA expression profiles, we predicted 10,790 mRNA-mRNA and 69,883 miRNA-mRNA interaction sites. The target genes were enriched by GO and KEGG pathways to obtain DE mRNA (IGF1R, ALKBH5, Piwil, HIF1A, BRDT, etc.) and DE miRNA (miR-140, miR-145, miR-7, miR-26a, etc.), which play an important role in testis development and spermatogenesis. The data show that DE miRNAs could regulate testis developmental and spermatogenesis through signaling pathways, including the MAPK signaling pathway, p53 signaling pathway, PI3K-Akt signaling pathway, Hippo signaling pathway, etc. miR-140 was confirmed to directly target mutant IGF1R-3'UTR by the Luciferase reporter assays. This study provides a useful resource for future studies on the role of miRNA regulation in testis development and spermatogenesis.
Also flagged:Phosphorusapatitecalciummagnesiummineralscitric acid
Journal Article2022-04-05No SnippetsDong Y, Yu R, Yan T, Zhao X, Zhang W.
Show Full Abstract
Phosphorus is a depletable resource, and the consumption of phosphorus fertilizer increases with the growing population size. Phosphorus recycled from incinerated sludge ash can be a complement to phosphatic fertilizers in districts suffering from phosphorus resource shortages (e.g., Germany, Japan, and Sweden). The apatite inorganic phosphorus (AP) content in incinerated sludge ash is a key factor influencing the recoverability and bioavailability. Biomass straw is rich in calcium and magnesium minerals and can be used as an additive to be blended with sludge to increase the AP content. However, most of the current studies added excessive amounts of calcium-based or biomass additives, and the bioavailability of various Ca-Mg-P minerals generated after the addition of biomass has not been systematically discussed. In this study, the changes of the phosphorus form in the mixed sludge and biomass with Ca/P in the range of 1.0-2.5 are studied, and the influence of temperature and additives on the phosphorus form and the bioavailability of phosphorus in the ash samples are discussed by combining X-ray diffraction and citric acid (CA) leaching experiments. The AP content is very low in the residue of the sludge or corn straw (CS) that has been burned individually. The sludge and the blended sludge and CS were incinerated at various temperatures. As the incineration temperature increased, the conversion of non-apatite inorganic phosphorus (NAIP) to AP was promoted, but the bioavailability did not change until 1050 °C for samples with a Ca/P of 2.5. In the range from 750 to 950 °C, higher temperature promotes the formation of Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub> and CaP<sub>2</sub>O<sub>6</sub>. CaP<sub>2</sub>O<sub>6</sub> is insoluble in CA; thus, the bioavailability changes little from 750 to 950 °C, although the AP content increases. With the increase of Ca/P, the conversion of NAIP to AP and the bioavailability of phosphorus were promoted. For the blended sludge and CS ash, Ca<sub>7</sub>Mg<sub>2</sub>P<sub>6</sub>O<sub>24</sub> appears at 950 and 1050 °C and the bioavailability also increases.
Also flagged:IronProgrammedFerroptosisdeathheart diseasebrain damage
Journal Article2022-04-05✓ 1 SnippetZhang J, Sheng S, Wang W, Dai J, Zhong Y, Ren J, Jiang K, Li S, Bian X, Liu L.
In-Text Gene Mentions
Introduction)
…such as decreasedhemochromatosis, increased use of…
Show Full Abstract
Ferroptosis, a newly identified, iron-dependent type of programmed cell death, is active in several diseases, such as heart disease, brain damage, and cancer. Its main characteristics commonly involve excess iron accumulation, elevated lipid peroxides and reactive oxygen species, and reduced levels of glutathione and glutathione peroxidase 4 levels. The effects of ferroptosis in eye diseases cannot be underestimated, with ferroptosis becoming a research target in ocular disorders and emerging evidence from a series of <i>in vivo</i> and <i>in vitro</i> researches into ferroptosis revealing its role in eye conditions. However, no report provides comprehensive information on the pathophysiology of ferroptosis in eye diseases and its possible treatments. In the current review, we present an up-to-date overview of ferroptosis biology and its involvement in the pathological processes of ocular diseases. Furthermore, we pose several outstanding questions and areas for future research in this topic. We deem ferroptosis-associated cell death a pivotal new field of scientific study in ocular diseases and consider it a new therapeutic target in the treatment of some eye disorders.
Also flagged:PCDH19epilepsyprotocadherin 19infantile-onset epilepsy syndromeautismcognitive impairment
Journal Article2022-04-05✓ 2 SnippetsCwetsch AW, Ziogas I, Narducci R, Savardi A, Bolla M, Pinto B, Perlini LE, Bassani S, Passafaro M, Cancedda L.
In-Text Gene Mentions
Results)
…Focal cortical dysplasia (FCD) is a congenital abnormality of brain development in which neurons in an area of the brain fail to migrate properly.37 Interestingly, FCD is often diagnosed in people with PCDH19-CE, epilepsy or autism spectrum disorder (ASD).9–11,38 Furthermore, approximately 32% of people with PCDH19-CE fulfill the criteria for ASD, which includes comorbidities such as sensory alterations.39 Recently, we demonstrated that downregulation in the upper layer of the SSc of another cell-adhesion molecule (Negr1)—with a similar pattern of expression as PCDH19 and associated with human ASD—resulted in migration defects and core symptoms related to ASD (along with sensory alterations) in rodents.40 Thus, we investigated whether PCDH19 downregulation by a shRNA strategy36 in the SSc also resulted in migration defects and ASD-related behaviours.…
Results)
…other cell-adhesion molecule (Negr1)—with a similar pattern…
Show Full Abstract
Protocadherin 19 gene-related epilepsy or protocadherin 19 clustering epilepsy is an infantile-onset epilepsy syndrome characterized by psychiatric (including autism-related), sensory, and cognitive impairment of varying degrees. Protocadherin 19 clustering epilepsy is caused by X-linked protocadherin 19 protein loss of function. Due to random X-chromosome inactivation, protocadherin 19 clustering epilepsy-affected females present a mosaic population of healthy and protocadherin 19-mutant cells. Unfortunately, to date, no current mouse model can fully recapitulate both the brain histological and behavioural deficits present in people with protocadherin 19 clustering epilepsy. Thus, the search for a proper understanding of the disease and possible future treatment is hampered. By inducing a focal mosaicism of protocadherin 19 expression using <i>in utero</i> electroporation in rats, we found here that protocadherin 19 signalling in specific brain areas is implicated in neuronal migration, heat-induced epileptic seizures, core/comorbid behaviours related to autism and cognitive function.
Hepatic glycogenosis (HG) is a rare complication of long-standing poorly controlled type 1 diabetes mellitus (T1DM), which is often misdiagnosed as non-alcoholic fatty liver disease (NAFLD). Despite the existence of several reports in the literature, it still is underrecognized, even among gastroenterologists. Differential diagnosis between these entities is essential since they have different prognoses. We report a case of an 18-year-old female, with a medical history of poorly controlled T1DM, admitted to an intensive care unit with severe diabetic ketoacidosis (DKA). Upon admission, aminotransferases were significantly elevated; bilirubin and coagulation tests were normal. Despite adequate DKA treatment, she had persistently elevated aminotransferases and hyperlactacidemia. Imaging studies showed hepatomegaly and bright liver parenchyma. Extensive laboratory workup was negative for other causes of liver disease. So, a liver biopsy was performed, which was consistent with the diagnosis of HG. Under strict metabolic control, she had progressive improvement, achieving biochemical normalization within 6 months. This case highlights the need for clinicians to be aware of this condition due to non-negligible differences between HG and NAFLD, with the latter progressing to fibrosis, and ultimately cirrhosis and hepatocarcinoma. On the opposite, HG is considered a benign condition, associated with an excellent prognosis that can be reversible after adequate metabolic control. Liver biopsy remains the gold standard method for HG diagnosis since it can distinguish it from NAFLD.
bioRxiv2022-04-05Preprint (No Snippets API)Periwal N, Rathod SB, Sarma S, Singh G, Jain A, Barnwal RP, Srivastava KR, Kaur B, Arora P, Sood V.
Show Full Abstract
The efforts of the scientific community to tame the recent SARS-CoV-2 pandemic seems to have been diluted by the emergence of new viral strains. Therefore, it becomes imperative to study and understand the effect of mutations on viral evolution, fitness and pathogenesis. In this regard, we performed a time-series analysis on 59541 SARS-CoV-2 genomic sequences from around the world. These 59541 genomes were grouped according to the months (January 2020-March 2021) based on the collection date. Meta-analysis of this data led us to identify highly significant mutations in viral genomes. Correlation and Hierarchical Clustering of the highly significant mutations led us to the identification of sixteen mutation pairs that were correlated with each other and were present in >30% of the genomes under study. Among these mutation pairs, some of the mutations have been shown to contribute towards the viral replication and fitness suggesting the possible role of other unexplored mutations in viral evolution and pathogenesis. Additionally, we employed various computational tools to investigate the effects of T85I, P323L, and Q57H mutations in Non-structural protein 2 (Nsp2), RNA-dependent RNA polymerase (RdRp) and Open reading frame 3a (ORF3a) respectively. Results show that T85I in Nsp2 and Q57H in ORF3a mutations are deleterious and destabilize the parent protein whereas P323L in RdRp is neutral and has a stabilizing effect. The normalized linear mutual information (nLMI) calculations revealed the significant residue correlation in Nsp2 and ORF3a in contrast to reduce correlation in RdRp protein.
Also flagged:inflammatory bowel diseaseinflammatory diseasepathogenesisE3 ubiquitin ligasesTRIMviral infection
Journal Article2022-04-04No SnippetsChen R, Tie Y, Lu J, Li L, Zeng Z, Chen M, Zhang S.
Show Full Abstract
Inflammatory bowel disease (IBD) is a chronic recurrent gastrointestinal inflammatory disease that poses a heavy burden to the global healthcare system. However, the current paucity of mechanistic understanding of IBD pathogenesis hampers the development of aetiology-directed therapies. Novel therapeutic options based on IBD pathogenesis are urgently needed for attaining better long-term prognosis for IBD patients. The tripartite motif (TRIM) family is a large protein family including more than 70 structurally conservative members, typically characterized by their RBCC structure, which primarily function as E3 ubiquitin ligases in post-translational modification. They have emerged as regulators of a broad range of cellular mechanisms, including proliferation, differentiation, transcription and immune regulation. TRIM family proteins are involved in multiple diseases, such as viral infection, cancer and autoimmune disorders, including inflammatory bowel disease. This review provides a comprehensive perspective on TRIM proteins' involvement in the pathophysiology and progression of IBD, in particular, on intestinal mucosal barriers, gene susceptibility and opportunistic infections, thus providing novel therapeutic targets for this complicated disease. However, the exact mechanisms of TRIM proteins in IBD pathogenesis and IBD-related carcinogenesis are still unknown, and more studies are warranted to explore potential therapeutic targets of TRIM proteins in IBD.
Also flagged:gene silencingchitosanlipidcannabidiolHuntington's diseasecytokine
Journal Article2022-04-04✓ 1 SnippetFihurka O, Sava V, Sanchez-Ramos J.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
<b>Background:</b> Nanocarriers loaded with siRNA can be administered intranasally to provide a noninvasive, safe alternative to direct intracerebral or intrathecal infusions. Dual-function nanocarriers can also be designed to deliver several payloads that address different components of the pathological process. <b>Aim:</b> To design and test a hybrid nanocarrier with the capacity to lower Huntington's Disease gene (<i>HTT</i>) expression and prevent or diminish inflammation. <b>Methods:</b> Novel hybrid nanoparticles were fabricated using a chitosan-based matrix core loaded with siRNA and an outer shell consisting of a lipid composition containing cannabidiol. <b>Results:</b> Incubation of hybrid nanoparticles in mesenchymal stem cell cultures obtained from a YAC128 transgenic mouse modeling Huntington's disease resulted in effective lowering of mutant <i>HTT</i> gene expression and reduced levels of expression of the proinflammatory cytokine IL-6. <b>Conclusion:</b> A novel hybrid nanocarrier system with dual actions is effective in lowering <i>HTT</i> gene expression and attenuating inflammatory processes.
Enhancers integrate transcription factor signaling pathways that drive cell fate specification in the developing brain. We paired enhancer labeling and single-cell RNA-sequencing (scRNA-seq) to delineate and distinguish specification of neuronal lineages in mouse medial, lateral, and caudal ganglionic eminences (MGE, LGE, and CGE) at embryonic day (E)11.5. We show that scRNA-seq clustering using transcription factors improves resolution of regional and developmental populations, and that enhancer activities identify specific and overlapping GE-derived neuronal populations. First, we mapped the activities of seven evolutionarily conserved brain enhancers at single-cell resolution in vivo, finding that the selected enhancers had diverse activities in specific progenitor and neuronal populations across the GEs. We then applied enhancer-based labeling, scRNA-seq, and analysis of in situ hybridization data to distinguish transcriptionally distinct and spatially defined subtypes of MGE-derived GABAergic and cholinergic projection neurons and interneurons. Our results map developmental origins and specification paths underlying neurogenesis in the embryonic basal ganglia and showcase the power of scRNA-seq combined with enhancer-based labeling to resolve the complex paths of neuronal specification underlying mouse brain development.
<h4>Introduction</h4>The ability to predict spontaneous preterm birth (sPTB) prior to labour onset is a challenge, and it is currently unclear which biomarker(s), may be potentially predictive of sPTB, and whether their predictive power has any utility. A systematic review was conducted to identify maternal blood biomarkers of sPTB.<h4>Methods</h4>This study was conducted according to PRISMA protocol for systematic reviews. Four databases (MEDLINE, EMBASE, CINAHL, Scopus) were searched up to September 2021 using search terms: "preterm labor", "biomarker" and "blood OR serum OR plasma". Studies assessing blood biomarkers prior to labour onset against the outcome sPTB were eligible for inclusion. Risk of bias was assessed based on the Newcastle Ottawa scale. Increased odds of sPTB associated with maternal blood biomarkers, as reported by odds ratios (OR), or predictive scores were synthesized. This review was not prospectively registered.<h4>Results</h4>Seventy-seven primary research articles met the inclusion criteria, reporting 278 unique markers significantly associated with and/or predictive of sPTB in at least one study. The most frequently investigated biomarkers were those measured during maternal serum screen tests for aneuploidy, or inflammatory cytokines, though no single biomarker was clearly predictive of sPTB based on the synthesized evidence. Immune and signaling pathways were enriched within the set of biomarkers and both at the level of protein and gene expression.<h4>Conclusion</h4>There is currently no known predictive biomarker for sPTB. Inflammatory and immune biomarkers show promise, but positive reporting bias limits the utility of results. The biomarkers identified may be more predictive in multi-marker models instead of as single predictors. Omics-style studies provide promising avenues for the identification of novel (and multiple) biomarkers. This will require larger studies with adequate power, with consideration of gestational age and the heterogeneity of sPTB to identify a set of biomarkers predictive of sPTB.
Also flagged:response toCOMTwarserotonin transportercatechol-O-methyltransferasebehavioral
Journal Article2022-04-04✓ 3 SnippetsMulligan CJ, Clukay CJ, Matarazzo A, Hadfield K, Nevell L, Dajani R, Panter-Brick C.
In-Text Gene Mentions
Abstract)
…genes (serotonin transporter,5-HTT, and catechol-O-methyltransfe…
Introduction)
…serotonin transporter gene5-HTTand the Val158Met…
Methods)
…serotonin gene (5-HTT) were assayed…
Show Full Abstract
Responses to early life adversity differ greatly across individuals. Elucidating which factors underlie this variation can help us better understand how to improve health trajectories. Here we used a case:control study of refugee and non-refugee youth, differentially exposed to war-related trauma, to investigate the effects of genetics and psychosocial environment on response to trauma. We investigated genetic variants in two genes (serotonin transporter, 5-HTT, and catechol-O-methyltransferase, COMT) that have been implicated in response to trauma. We collected buccal samples and survey data from 417 Syrian refugee and 306 Jordanian non-refugee youth who were enrolled in a randomized controlled trial to evaluate a mental health-focused intervention. Measures of lifetime trauma exposure, resilience, and six mental health and psychosocial stress outcomes were collected at three time points: baseline, ~13 weeks, and ~48 weeks. We used multilevel models to identify gene x environment (GxE) interactions and direct effects of the genetic variants in association with the six outcome measures over time. We did not identify any interactions with trauma exposure, but we did identify GxE interactions with both genes and resilience; 1) individuals with high expression (HE) variants of 5-HTTLPR and high levels of resilience had the lowest levels of perceived stress and 2) individuals homozygous for the Val variant of COMT with high levels of resilience showed stable levels of post-traumatic stress symptoms. We also identified a direct protective effect of 5-HTTLPR HE homozygotes on perceived insecurity. Our results point to novel interactions between the protective effects of genetic variants and resilience, lending support to ideas of differential susceptibility and altered stress reactivity in a cohort of war-affected adolescents.
<h4>Background</h4>The coronavirus nonstructural protein 5 (Nsp5) is a cysteine protease required for processing the viral polyprotein and is therefore crucial for viral replication. Nsp5 from several coronaviruses have also been found to cleave host proteins, disrupting molecular pathways involved in innate immunity. Nsp5 from the recently emerged SARS-CoV-2 virus interacts with and can cleave human proteins, which may be relevant to the pathogenesis of COVID-19. Based on the continuing global pandemic, and emerging understanding of coronavirus Nsp5-human protein interactions, we set out to predict what human proteins are cleaved by the coronavirus Nsp5 protease using a bioinformatics approach.<h4>Results</h4>Using a previously developed neural network trained on coronavirus Nsp5 cleavage sites (NetCorona), we made predictions of Nsp5 cleavage sites in all human proteins. Structures of human proteins in the Protein Data Bank containing a predicted Nsp5 cleavage site were then examined, generating a list of 92 human proteins with a highly predicted and accessible cleavage site. Of those, 48 are expected to be found in the same cellular compartment as Nsp5. Analysis of this targeted list of proteins revealed molecular pathways susceptible to Nsp5 cleavage and therefore relevant to coronavirus infection, including pathways involved in mRNA processing, cytokine response, cytoskeleton organization, and apoptosis.<h4>Conclusions</h4>This study combines predictions of Nsp5 cleavage sites in human proteins with protein structure information and protein network analysis. We predicted cleavage sites in proteins recently shown to be cleaved in vitro by SARS-CoV-2 Nsp5, and we discuss how other potentially cleaved proteins may be relevant to coronavirus mediated immune dysregulation. The data presented here will assist in the design of more targeted experiments, to determine the role of coronavirus Nsp5 cleavage of host proteins, which is relevant to understanding the molecular pathology of coronavirus infection.
Also flagged:Gene ExpressionHistoneMethylationCOVID-19arginase 1IL-1 receptor 2
Journal Article2022-04-04✓ 1 SnippetYang X, Rutkovsky AC, Zhou J, Zhong Y, Reese J, Schnell T, Albrecht H, Owens WB, Nagarkatti PS, Nagarkatti M.
In-Text Gene Mentions
Text
…MLLT10…
Show Full Abstract
The pandemic of COVID-19 has caused >5 million deaths in the world. One of the leading causes of the severe form of COVID-19 is the production of massive amounts of proinflammatory cytokines. Epigenetic mechanisms, such as histone/DNA methylation, miRNA, and long noncoding RNA, are known to play important roles in the regulation of inflammation. In this study, we investigated if hospitalized COVID-19 patients exhibit alterations in epigenetic pathways in their PBMCs. We also compared gene expression profiles between healthy controls and COVID-19 patients. Despite individual variations, the expressions of many inflammation-related genes, such as arginase 1 and IL-1 receptor 2, were significantly upregulated in COVID-19 patients. We also found the expressions of coagulation-related genes Von Willebrand factor and protein S were altered in COVID-19 patients. The expression patterns of some genes, such as IL-1 receptor 2, correlated with their histone methylation marks. Pathway analysis indicated that most of those dysregulated genes were in the TGF-β, IL-1b, IL-6, and IL-17 pathways. A targeting pathway revealed that the majority of those altered genes were targets of dexamethasone, which is an approved drug for COVID-19 treatment. We also found that the expression of bone marrow kinase on chromosome X, a member of TEC family kinases, was increased in the PBMCs of COVID-19 patients. Interestingly, some inhibitors of TEC family kinases have been used to treat COVID-19. Overall, this study provides important information toward identifying potential biomarkers and therapeutic targets for COVID-19 disease.
Expanding the exercise capacity of skeletal muscle is an emerging strategy to combat obesity-related metabolic diseases and this can be achieved by shifting skeletal muscle fibers toward slow-twitch oxidative type. Here, we report that Sirt6, an anti-aging histone deacetylase, is critical in regulating myofiber configuration toward oxidative type and that Sirt6 activator can be an exercise mimetic. Genetic inactivation of Sirt6 in skeletal muscle reduced while its transgenic overexpression increased mitochondrial oxidative capacity and exercise performance in mice. Mechanistically, we show that Sirt6 downregulated Sox6, a key repressor of slow fiber specific gene, by increasing the transcription of CREB. Sirt6 expression is elevated in chronically exercised humans, and mice treated with an activator of Sirt6 showed an increase in exercise endurance as compared to exercise-trained controls. Thus, the current study identifies Sirt6 as a molecular target for reprogramming myofiber composition toward the oxidative type and for improving muscle performance.
Also flagged:CDK6cell differentiationCoronary artery diseaseinflammatory diseasemonocytemyocardial infarction
Journal Article2022-04-04No SnippetsWitten A, Martens L, Schäfer AC, Troidl C, Pankuweit S, Vlacil AK, Oberoi R, Schieffer B, Grote K, Stoll M, Markus B.
Show Full Abstract
Coronary artery disease (CAD) is a long-lasting inflammatory disease characterized by monocyte migration into the vessel wall leading to clinical events like myocardial infarction (MI). However, the role of monocyte subsets, especially their miRNA-driven differentiation in this scenario is still in its infancy. Here, we characterized monocyte subsets in controls and disease phenotypes of CAD and MI patients using flow cytometry and miRNA and mRNA expression profiling using RNA sequencing. We observed major differences in the miRNA profiles between the classical (CD14<sup>++</sup>CD16<sup>-</sup>) and nonclassical (CD14<sup>+</sup>CD16<sup>++</sup>) monocyte subsets irrespective of the disease phenotype suggesting the Cyclin-dependent Kinase 6 (CDK6) to be an important player in monocyte maturation. Between control and MI patients, we found a set of miRNAs to be differentially expressed in the nonclassical monocytes and targeting CCND2 (Cyclin D2) that is able to enhance myocardial repair. Interestingly, miRNAs as miR-125b playing a role in vascular calcification were differentially expressed in the classical subset in patients suffering from CAD and not MI in comparison to control samples. In conclusion, our study describes specific peculiarities of monocyte subset miRNA expression in control and diseased samples and provides basis to further functional analysis and to identify new cardiovascular disease treatment targets.
Also flagged:Metabotropic glutamate receptor 5obesityatherosclerosisdiabetesinsulin resistancemGluR5
Journal Article2022-04-04✓ 4 SnippetsSantos RPM, Ribeiro R, Ferreira-Vieira TH, Aires RD, de Souza JM, Oliveira BS, Lima ALD, de Oliveira ACP, Reis HJ, de Miranda AS, Vieira EML, Ribeiro FM, Vieira LB.
In-Text Gene Mentions
Introduction)
…Furthermore, BACHD, a mouse model of HD which expresses full-length human HTT, exhibiting progressive neurodegeneration, alongside with increased body weight, impaired glucose metabolism and pronounced insulin and leptin resistance27.…
Introduction)
…HD is caused by an expansion of CAG sequence in the Huntingtin gene (IT-15), which leads to an altered huntingtin protein (HTT) that possesses an elongated polyglutamine tract20,21.…
Introduction)
…altered huntingtin protein (HTT) that possesses an…
Introduction)
…expresses full-length humanHTT, such as BACHD,…
Show Full Abstract
Obesity represents a global health problem and is characterized by metabolic dysfunctions and a low-grade chronic inflammatory state, which can increase the risk of comorbidities, such as atherosclerosis, diabetes and insulin resistance. Here we tested the hypothesis that the genetic deletion of metabotropic glutamate receptor 5 (mGluR5) may rescue metabolic and inflammatory features present in BACHD mice, a mouse model of Huntington's disease (HD) with an obese phenotype. For that, we crossed BACHD and mGluR5 knockout mice (mGluR5<sup>-/-</sup>) in order to obtain the following groups: Wild type (WT), mGluR5<sup>-/-</sup>, BACHD and BACHD/mGluR5<sup>-/-</sup> (double mutant mice). Our results showed that the double mutant mice present decreased body weight as compared to BACHD mice in all tested ages and reduced visceral adiposity as compared to BACHD at 6 months of age. Additionally, 12-month-old double mutant mice present increased adipose tissue levels of adiponectin, decreased leptin levels, and increased IL-10/TNF ratio as compared to BACHD mice. Taken together, our preliminary data propose that the absence of mGluR5 reduce weight gain and visceral adiposity in BACHD mice, along with a decrease in the inflammatory state in the visceral adipose tissue (VAT), which may indicate that mGluR5 may play a role in adiposity modulation.
α-Amino acids are essential for life as building blocks of proteins and components of diverse natural molecules. In both industry and academia, the incorporation of unnatural amino acids is often desirable for modulating chemical, physical and pharmaceutical properties. Here we report a protocol for the economical and practical synthesis of optically active α-amino acids based on an unprecedented stereocontrolled 1,3-nitrogen shift. Our method employs abundant and easily accessible carboxylic acids as starting materials, which are first connected to a nitrogenation reagent, followed by a highly regio- and enantioselective ruthenium- or iron-catalysed C(sp<sup>3</sup>)-H amination. This straightforward method displays a very broad scope, providing rapid access to optically active α-amino acids with aryl, allyl, propargyl and alkyl side chains, and also permits stereocontrolled late-stage amination of carboxylic-acid-containing drugs and natural products.
Also flagged:valeric acidTph25-hydroxytryptamineHTR2AbindingEP1
Journal Article2022-04-04✓ 1 SnippetZhu P, Lu T, Wu J, Fan D, Liu B, Zhu X, Guo H, Du Y, Liu F, Tian Y, Fan Z.
In-Text Gene Mentions
Text
…Olfm4…
Show Full Abstract
Lgr5<sup>+</sup> intestinal stem cells (ISCs) reside within specialized niches at the crypt base and harbor self-renewal and differentiation capacities. ISCs in the crypt base are sustained by their surrounding niche for precise modulation of self-renewal and differentiation. However, how intestinal cells in the crypt niche and microbiota in enteric cavity coordinately regulate ISC stemness remains unclear. Here, we show that ISCs are regulated by microbiota and niche enteric serotonergic neurons. The gut microbiota metabolite valeric acid promotes Tph2 expression in enteric serotonergic neurons via blocking the recruitment of the NuRD complex onto Tph2 promoter. 5-hydroxytryptamine (5-HT) in turn activates PGE2 production in a PGE2<sup>+</sup> macrophage subset through its receptors HTR2A/3 A; and PGE2 via binding its receptors EP1/EP4, promotes Wnt/β-catenin signaling in ISCs to promote their self-renewal. Our findings illustrate a complex crosstalk among microbiota, intestinal nerve cells, intestinal immune cells and ISCs, revealing a new layer of ISC regulation by niche cells and microbiota.
Journal Article2022-04-04✓ 3 SnippetsMcAllister B, Donaldson J, Binda CS, Powell S, Chughtai U, Edwards G, Stone J, Lobanov S, Elliston L, Schuhmacher LN, Rees E, Menzies G, Ciosi M, Maxwell A, Chao MJ, Hong EP, Lucente D, Wheeler V, Lee JM, MacDonald ME, Long JD, Aylward EH, Landwehrmeyer GB, Rosser AE, REGISTRY Investigators of the European Huntington’s disease network, Paulsen JS, PREDICT-HD Investigators of the Huntington Study Group, Williams NM, Gusella JF, Monckton DG, Allen ND, Holmans P, Jones L, Massey TH.
In-Text Gene Mentions
Results)
…Much of the apparent effect of non-canonical glutamine-encoding HTT repeat sequences on HD onset has been considered spurious, attributable to inaccurate residual age-at-onset calculations based on assumed canonical allele sequences8.…
Discussion)
…Here we have additionally shown that non-canonical glutamine-encoding HTT repeat sequences are significantly associated with HD onset, even after correcting for accurate CAG repeat lengths (Table 1).…
Methods)
…HTTallele structure determination…
Show Full Abstract
The age at onset of motor symptoms in Huntington's disease (HD) is driven by HTT CAG repeat length but modified by other genes. In this study, we used exome sequencing of 683 patients with HD with extremes of onset or phenotype relative to CAG length to identify rare variants associated with clinical effect. We discovered damaging coding variants in candidate modifier genes identified in previous genome-wide association studies associated with altered HD onset or severity. Variants in FAN1 clustered in its DNA-binding and nuclease domains and were associated predominantly with earlier-onset HD. Nuclease activities of purified variants in vitro correlated with residual age at motor onset of HD. Mutating endogenous FAN1 to a nuclease-inactive form in an induced pluripotent stem cell model of HD led to rates of CAG expansion similar to those observed with complete FAN1 knockout. Together, these data implicate FAN1 nuclease activity in slowing somatic repeat expansion and hence onset of HD.
Also flagged:neurogenesisHydrocephaluscerebral ventricular dilatationcongenital hydrocephalusCHTRIM71
Journal Article2022-04-04✓ 1 SnippetDuy PQ, Weise SC, Marini C, Li XJ, Liang D, Dahl PJ, Ma S, Spajic A, Dong W, Juusola J, Kiziltug E, Kundishora AJ, Koundal S, Pedram MZ, Torres-Fernández LA, Händler K, De Domenico E, Becker M, Ulas T, Juranek SA, Cuevas E, Hao LT, Jux B, Sousa AMM, Liu F, Kim SK, Li M, Yang Y, Takeo Y, Duque A, Nelson-Williams C, Ha Y, Selvaganesan K, Robert SM, Singh AK, Allington G, Furey CG, Timberlake AT, Reeves BC, Smith H, Dunbar A, DeSpenza T, Goto J, Marlier A, Moreno-De-Luca A, Yu X, Butler WE, Carter BS, Lake EMR, Constable RT, Rakic P, Lin H, Deniz E, Benveniste H, Malvankar NS, Estrada-Veras JI, Walsh CA, Alper SL, Schultze JL, Paeschke K, Doetzlhofer A, Wulczyn FG, Jin SC, Lifton RP, Sestan N, Kolanus W, Kahle KT.
In-Text Gene Mentions
Text
…POU3F2…
Show Full Abstract
Hydrocephalus, characterized by cerebral ventricular dilatation, is routinely attributed to primary defects in cerebrospinal fluid (CSF) homeostasis. This fosters CSF shunting as the leading reason for brain surgery in children despite considerable disease heterogeneity. In this study, by integrating human brain transcriptomics with whole-exome sequencing of 483 patients with congenital hydrocephalus (CH), we found convergence of CH risk genes in embryonic neuroepithelial stem cells. Of all CH risk genes, TRIM71/lin-41 harbors the most de novo mutations and is most specifically expressed in neuroepithelial cells. Mice harboring neuroepithelial cell-specific Trim71 deletion or CH-specific Trim71 mutation exhibit prenatal hydrocephalus. CH mutations disrupt TRIM71 binding to its RNA targets, causing premature neuroepithelial cell differentiation and reduced neurogenesis. Cortical hypoplasia leads to a hypercompliant cortex and secondary ventricular enlargement without primary defects in CSF circulation. These data highlight the importance of precisely regulated neuroepithelial cell fate for normal brain-CSF biomechanics and support a clinically relevant neuroprogenitor-based paradigm of CH.
Also flagged:ADAPOEAlzheimerneurodegenerative disorderdementiaaging
Journal Article2022-04-04✓ 1 SnippetSadick JS, O'Dea MR, Hasel P, Dykstra T, Faustin A, Liddelow SA.
In-Text Gene Mentions
Text
…SHISA6…
Show Full Abstract
Resolving glial contributions to Alzheimer's disease (AD) is necessary because changes in neuronal function, such as reduced synaptic density, altered electrophysiological properties, and degeneration, are not entirely cell autonomous. To improve understanding of transcriptomic heterogeneity in glia during AD, we used single-nuclei RNA sequencing (snRNA-seq) to characterize astrocytes and oligodendrocytes from apolipoprotein (APOE) Ɛ2/3 human AD and age- and genotype-matched non-symptomatic (NS) brains. We enriched astrocytes before sequencing and characterized pathology from the same location as the sequenced material. We characterized baseline heterogeneity in both astrocytes and oligodendrocytes and identified global and subtype-specific transcriptomic changes between AD and NS astrocytes and oligodendrocytes. We also took advantage of recent human and mouse spatial transcriptomics resources to localize heterogeneous astrocyte subtypes to specific regions in the healthy and inflamed brain. Finally, we integrated our data with published AD snRNA-seq datasets, highlighting the power of combining datasets to resolve previously unidentifiable astrocyte subpopulations.
Also flagged:LGR5autoimmune diseasetranscription factorspathogenesissclerodermaSystemic sclerosis
Journal Article2022-04-04✓ 2 SnippetsGur C, Wang SY, Sheban F, Zada M, Li B, Kharouf F, Peleg H, Aamar S, Yalin A, Kirschenbaum D, Braun-Moscovici Y, Jaitin DA, Meir-Salame T, Hagai E, Kragesteen BK, Avni B, Grisariu S, Bornstein C, Shlomi-Loubaton S, David E, Shreberk-Hassidim R, Molho-Pessach V, Amar D, Tzur T, Kuint R, Gross M, Barboy O, Moshe A, Fellus-Alyagor L, Hirsch D, Addadi Y, Erenfeld S, Biton M, Tzemach T, Elazary A, Naparstek Y, Tzemach R, Weiner A, Giladi A, Balbir-Gurman A, Amit I.
In-Text Gene Mentions
I A O 0000326)
…POU3F2…
Text
…PTGIS…
Show Full Abstract
Systemic sclerosis (scleroderma, SSc) is an incurable autoimmune disease with high morbidity and mortality rates. Here, we conducted a population-scale single-cell genomic analysis of skin and blood samples of 56 healthy controls and 97 SSc patients at different stages of the disease. We found immune compartment dysfunction only in a specific subtype of diffuse SSc patients but global dysregulation of the stromal compartment, particularly in a previously undefined subset of LGR5<sup>+</sup>-scleroderma-associated fibroblasts (ScAFs). ScAFs are perturbed morphologically and molecularly in SSc patients. Single-cell multiome profiling of stromal cells revealed ScAF-specific markers, pathways, regulatory elements, and transcription factors underlining disease development. Systematic analysis of these molecular features with clinical metadata associates specific ScAF targets with disease pathogenesis and SSc clinical traits. Our high-resolution atlas of the sclerodermatous skin spectrum will enable a paradigm shift in the understanding of SSc disease and facilitate the development of biomarkers and therapeutic strategies.
Also flagged:Lysophosphatidic acidlipidcell proliferationcytokinesecretiontamoxifen
Journal Article2022-04-04✓ 5 SnippetsLiang Z, He P, Han Y, Yun CC.
In-Text Gene Mentions
Methods)
…ncubation overnight with anti-OLFM4antibody (D6Y5A, 1:500…
Results)
…labeled enteroids forOLFM4, an alternative stem…
Results)
…decreased abundance ofOLFM4+ cells (…
Results)
…+ staining inOLFM4+ cells with…
Results)
…the disappearance ofOLFM4, and DNA fragmentation…
Show Full Abstract
<h4>Background & aims</h4>Regeneration of the epithelium by stem cells in the intestine is supported by intrinsic and extrinsic factors. Lysophosphatidic acid (LPA), a bioactive lipid mediator, regulates many cellular functions, including cell proliferation, survival, and cytokine secretion. Here, we identify LPA<sub>5</sub> receptor as a potent regulator of the survival of stem cells and transit-amplifying cells in the intestine.<h4>Methods</h4>We have used genetic mouse models of conditional deletion of Lpar5, Lpar5<sup>f/f</sup>;Rosa-Cre<sup>ERT</sup> (Lpar5<sup>KO</sup>), and intestinal epithelial cell-specific Lpar5<sup>f/f</sup>;AhCre (Lpar5<sup>IECKO</sup>) mice. Mice were treated with tamoxifen or β-naphthoflavone to delete Lpar5 expression. Enteroids derived from these mice were used to determine the effect of Lpar5 loss on the apoptosis and proliferation of crypt epithelial cells.<h4>Results</h4>Conditional loss of Lpar5 induced ablation of the intestinal mucosa, which increased morbidity of Lpar5<sup>KO</sup> mice. Epithelial regeneration was compromised with increased apoptosis and decreased proliferation of crypt epithelial cells by Lpar5 loss. Interestingly, intestinal epithelial cell-specific Lpar5 loss did not cause similar phenotypic defects in vivo. Lpar5 loss reduced intestinal stem cell marker gene expression and reduced lineage tracing from Lgr5<sup>+</sup> ISCs. Lpar5 loss induced CXCL10 expression which exerts cytotoxic effects on intestinal stem cells and progenitors in the intestinal crypts. By co-culturing Lpar5<sup>KO</sup> enteroids with wild-type or Lpar5<sup>KO</sup> splenocytes, we demonstrated that lymphocytes protect the intestinal crypts via a LPA<sub>5</sub>-dependent suppression of CXCL10.<h4>Conclusions</h4>LPA<sub>5</sub> is essential for the regeneration of intestinal epithelium. Our findings reveal a new finding that LPA<sub>5</sub> regulates survival of stem cells and transit-amplifying cells in the intestine.
<h4>Background</h4>Sepsis can progress to septic shock and death, and identifying biomarkers of this progression may permit timely intervention to prevent it. This study explored whether levels of tissue-type plasminogen activator-inhibitor complex (t-PAIC) in serum can predict septic shock early.<h4>Methods</h4>We retrospectively analyzed 311 sepsis patients who had been admitted to the intensive care unit (ICU) at our tertiary care hospital between May 2018 and April 2021, and we divided them into those who progressed to septic shock (<i>n</i> = 203) or not (<i>n</i> = 108) based on sepsis-3 definition. After matching patients in the two groups based on propensity scoring, we screened for risk factors of septic shock using logistic regression. We assessed potential predictors of such shock based on the area under the receiver-operating characteristic curve (AUC), Kaplan-Meier survival curves, and correlation analysis.<h4>Results</h4>After propensity score matching to generate two equal groups of 108 patients, we found that serum t-PAIC was significantly higher in septic shock patients. Uni- and multivariate logistic regression identified t-PAIC as an independent risk factor for septic shock (OR 1.14, 95% CI 1.09-1.19, <i>P</i> < 0.001) and a biomarker that predicted it with an AUC up to 0.875 (95% CI, 0.829-0.920). Based on the optimal cut-off of t-PAIC = 17.9 ng/mL, we found that patients at or above this threshold had significantly higher lactate levels and scores on the Acute Physiology and Chronic Health Evaluation II (APACHE II) and Sequential Organ Failure Assessment (SOFA). Such patients also had significantly worse survival (HR 2.4, 95% CI 1.38-4.34, <i>P</i> = 0.004). Spearman's correlation coefficients were 0.66 between t-PAIC and lactate, and 0.52 between t-PAIC and SOFA.<h4>Conclusions</h4>Serum levels of t-PAIC may be an independent risk factor for septic shock, and they may correlate with the severity of such shock.
Also flagged:FerroptosisHepatocellular Carcinomaoxygendeathironpolyunsaturated fatty acids
Journal Article2022-04-04✓ 2 SnippetsBekric D, Ocker M, Mayr C, Stintzing S, Ritter M, Kiesslich T, Neureiter D.
In-Text Gene Mentions
S I O 001029)
…In an established hereditary hemochromatosis mouse model that lacks the HFE and HJV genes, they observed that these mice displayed iron overload and increased lipid peroxidation compared to wild-type mice [64].…
Ferroptosis, an iron and reactive oxygen species (ROS)-dependent non-apoptotic type of regulated cell death, is characterized by a massive iron overload and peroxidation of polyunsaturated fatty acids (PUFAs), which finally results in cell death. Recent studies suggest that ferroptosis can influence carcinogenesis negatively and therefore may be used as a novel anti-cancer strategy. Hepatocellular carcinoma (HCC) is a deadly malignancy with poor chances of survival and is the second leading cause of cancer deaths worldwide. Diagnosis at an already late stage and general resistance to current therapies may be responsible for the dismal outcome. As the liver acts as a key factor in iron metabolism, ferroptosis is shown to play an important role in HCC carcinogenesis and, more importantly, may hold the potential to eradicate HCC. In this review, we summarize the current knowledge we have of the role of ferroptosis in HCC and the application of ferroptosis as a therapy option and provide an overview of the potential translation of ferroptosis in the clinical practice of HCC.
Also flagged:PolyglutamineHuntingtinneurological diseasesneurodegenerative diseasestrinucleotideshereditary ataxias
Journal Article2022-04-04✓ 5 SnippetsPradhan S, Gao R, Bush K, Zhang N, Wairkar YP, Sarkar PS.
In-Text Gene Mentions
Abstract)
…Due to the recent progress made in understanding the mechanisms of DNA repair in relation to HD, in this review, we will mainly focus on the mechanisms by which the wild-type huntingtin (HTT) protein helps in DNA repair during transcription, and the how polyglutamine expansions in HTT impedes this process in HD.…
Introduction)
…The mutation associated with HD was found to be an expansion of a polyQ tract at the N-terminal coding region of the huntingtin (HTT) protein due to an expansion of a polymorphic CAG trinucleotide repeat sequences in the mutant huntingtin (mHTT) gene, which leads to progressive deterioration of cognitive and motor functions in patients with HD (No authors listed, 1993; Vonsattel and DiFiglia, 1998; Ross and Tabrizi, 2011).…
Introduction)
…In another interesting report, the length of uninterrupted CAG repeats in DNA, rather than the polyQ length at the N-terminal of HTT was found to be a critical contributing factor in HD disease onset (Genetic Modifiers of Huntington’s Disease [GeM-HD] Consortium, 2019).…
S I O 001029)
…Increased association between HTT with the transcriptionally active genome and mHTT-mediated abrogation of TCR complex activity suggest that HTT-assembled TCR complex predominantly repairs the DNA lesions during transcription elongation, but polyQ expansion in HTT might impair the TCR activity, resulting in DNA damage accumulation predominantly within the actively transcribing regions of genome in HD.…
S I O 001029)
…The RNA polymerase large subunit A (POLR2A) also interacts with HTT and is detected in nuclear inclusions in the HD brain (Huang et al., 1998; Suhr et al., 2001).…
Show Full Abstract
Emerging evidence suggests that DNA repair deficiency and genome instability may be the impending signs of many neurological diseases. Genome-wide association (GWAS) studies have established a strong correlation between genes that play a role in DNA damage repair and many neurodegenerative diseases, including Huntington's disease (HD), and several other trinucleotides repeat expansion-related hereditary ataxias. Recently, many reports have documented a significant role played by the DNA repair processes in aging and in modifying many neurodegenerative diseases, early during their progression. Studies from our lab and others have now begun to understand the mechanisms that cause defective DNA repair in HD and surprisingly, many proteins that have a strong link to known neurodegenerative diseases seem to be important players in these cellular pathways. Mutations in <i>huntingtin</i> (<i>HTT</i>) gene that lead to polyglutamine repeat expansion at the N-terminal of HTT protein has been shown to disrupt transcription-coupled DNA repair process, a specialized DNA repair process associated with transcription. Due to the recent progress made in understanding the mechanisms of DNA repair in relation to HD, in this review, we will mainly focus on the mechanisms by which the wild-type huntingtin (HTT) protein helps in DNA repair during transcription, and the how polyglutamine expansions in HTT impedes this process in HD. Further studies that identify new players in DNA repair will help in our understanding of this process in neurons. Furthermore, it should help us understand how various DNA repair mechanism(s) coordinate to maintain the normal physiology of neurons, and provide insights for the development of novel drugs at prodromal stages of these neurodegenerative diseases.
Also flagged:CelastrolglucoselipidmetabolismsynthesisMetabolic disorder
Journal Article2022-04-04No SnippetsLi M, Xie F, Wang L, Zhu G, Qi LW, Jiang S.
Show Full Abstract
The liver plays an important role in glucose and lipid homeostasis, drug metabolism, and bile synthesis. Metabolic disorder and inflammation synergistically contribute to the pathogenesis of numerous liver diseases, such as metabolic-associated fatty liver disease (MAFLD), liver injury, and liver cancer. Celastrol, a triterpene derived from <i>Tripterygium wilfordii</i> Hook.f., has been extensively studied in metabolic and inflammatory diseases during the last several decades. Here we comprehensively review the pharmacological activities and the underlying mechanisms of celastrol in the prevention and treatment of liver diseases including MAFLD, liver injury, and liver cancer. In addition, we also discuss the importance of novel methodologies and perspectives for the drug development of celastrol. Although celastrol has been claimed as a promising agent against several metabolic diseases, both preclinical and clinical studies are highly required to accelerate the clinical transformation of celastrol in treating different liver illness. It is foreseeable that celastrol-derived therapeutics is evolving in the field of liver ailments.
Also flagged:Warfarinvitamin Kthromboembolic disordersvenous thromboembolismrheumatic heart diseasestrokes
Journal Article2022-04-04No SnippetsAsiimwe IG, Pirmohamed M.
Show Full Abstract
Warfarin has remained the most commonly prescribed vitamin K oral anticoagulant worldwide since its approval in 1954. Dosing challenges including having a narrow therapeutic window and a wide interpatient variability in dosing requirements have contributed to making it the most studied drug in terms of genotype-phenotype relationships. However, most of these studies have been conducted in Whites or Asians which means the current pharmacogenomics evidence-base does not reflect ethnic diversity. Due to differences in minor allele frequencies of key genetic variants, studies conducted in Whites/Asians may not be applicable to underrepresented populations such as Blacks, Hispanics/Latinos, American Indians/Alaska Natives and Native Hawaiians/other Pacific Islanders. This may exacerbate health inequalities when Whites/Asians have better anticoagulation profiles due to the existence of validated pharmacogenomic dosing algorithms which fail to perform similarly in the underrepresented populations. To examine the extent to which individual races/ethnicities are represented in the existing body of pharmacogenomic evidence, we review evidence pertaining to published pharmacogenomic dosing algorithms, including clinical utility studies, cost-effectiveness studies and clinical implementation guidelines that have been published in the warfarin field.
Also flagged:Mastitisimmunological diseasesautophagyBCL2MIFTNFAIP8L2
Journal Article2022-04-04No SnippetsXu H, Lin C, Li T, Zhu Y, Yang J, Chen S, Chen J, Chen X, Chen Y, Guo A, Hu C.
Show Full Abstract
Mastitis is a common disease that hinders the development of dairy industry and animal husbandry. It leads to the abuse of antibiotics and the emergence of super drug-resistant bacteria, and poses a great threat to human food health and safety. <i>Staphylococcus aureus</i> (<i>S. aureus</i>) and <i>Escherichia coli</i> (<i>E. coli</i>) are the most common pathogens of mastitis in dairy cows and usually cause subclinical or clinical mastitis. CircRNAs and N<sup>6</sup>-methyladenosine (m<sup>6</sup>A) play important roles in immunological diseases. However, the mechanisms by which m<sup>6</sup>A modifies circRNA in bovine mammary epithelial cells remain poorly understood. The aim of our study was to investigate m<sup>6</sup>A-modified circRNAs in bovine mammary epithelial cells (MAC-T cells) injured by <i>S. aureus</i> and <i>E. coli.</i> The profile of m<sup>6</sup>A-modified circRNA showed a total of 1,599 m<sup>6</sup>A peaks within 1,035 circRNAs in the control group, 35 peaks within 32 circRNAs in the <i>S. aureus</i> group, and 1,016 peaks within 728 circRNAs in the <i>E. coli</i> group. Compared with the control group, 67 peaks within 63 circRNAs were significantly different in the <i>S. aureus</i> group, and 192 peaks within 137 circRNAs were significantly different in the <i>E. coli</i> group. Furthermore, we found the source genes of these differentially m<sup>6</sup>A-modified circRNAs in the <i>S. aureus</i> and <i>E. coli</i> groups with similar functions according to GO and KEGG analyses, which were mainly associated with cell injury, such as inflammation, apoptosis, and autophagy. CircRNA-miRNA-mRNA interaction networks predicted the potential circRNA regulation mechanism in <i>S. aureus-</i> and <i>E. coli</i>-induced cell injury. We found that the mRNAs in the networks, such as BCL2, MIF, and TNFAIP8L2, greatly participated in the MAPK, WNT, and inflammation pathways. This is the first report on m<sup>6</sup>A-modified circRNA regulation of cells under <i>S. aureus</i> and <i>E. coli</i> treatment, and sheds new light on potential mechanisms and targets from the perspective of epigenetic modification in mastitis and other inflammatory diseases.
Also flagged:AntithrombinProthrombinFIIacute pulmonary embolism infarctionATecchymosis
Journal Article2022-04-04✓ 5 SnippetsZhang H, Hu Y, Pan D, Xv Y, Shen W.
In-Text Gene Mentions
Title)
…A NovelSERPINC1Mutation…
Abstract)
…p.Lys322stop) heterozygotes inSERPINC1.…
Abstract)
…novel mutation ofSERPINC1and a missense…
Introduction)
…found in theSERPINC1gene.…
Introduction)
…nonsense mutation inSERPINC1and a homozygous…
Show Full Abstract
<b>Background and Aims:</b> Antithrombin (AT) is the most important physiological inhibitor <i>in vivo</i>, and coagulation factor II (FII) or prothrombin is a coagulation factor vital to life. The purpose of our research was to illustrate the connection between gene mutations and the corresponding deficiencies of AT and FII. <b>Methods:</b> Functional and molecular analyses were performed. The possible impact of the mutation was analyzed by online bioinformatics software. ClustalX-2.1-win and PyMol/Swiss-Pdb Viewer software were used for conservative analyses and to generate molecular graphic images, respectively. <b>Results:</b> The proband showed a lower limb venous thrombosis and acute pulmonary embolism infarction with reduced AT activity (50%). His mother, with subcutaneous ecchymosis, had reduced activities of AT and FII, of 44 and 5%, respectively. Molecular analysis showed that both the proband and his mother carried c.964A > T (p.Lys322stop) heterozygotes in <i>SERPINC1</i>. The difference was that his mother carried homozygous c.494C > T (p.Thr165Met) in <i>F2</i>, while the proband was wild type. Bioinformatics and model analysis indicated that mutations may destroy the function and structure of AT and FII protein. <b>Conclusion:</b> This study identified a novel mutation of <i>SERPINC1</i> and a missense mutation of <i>F2</i>, which may be the molecular mechanism leading to AT and FII deficiency in this family. It will help genetic diagnosis and counseling for thrombotic families.
Also flagged:CD34oxygenironage-related diseasesanemiamyelin
Journal Article2022-04-04✓ 1 SnippetOkulu E, Haskologlu S, Guloglu D, Kostekci E, Erdeve O, Atasay B, Koc A, Soylemez F, Dogu F, Ikinciogullari A, Arsan S.
In-Text Gene Mentions
Discussion)
…The difference in the numbers of EPCs and CD34+ HSCs wasted by ICC compared with DCC and UCM approximately seemed to be 1⁄4 to half of this therapeutic dose in this study.…
Show Full Abstract
<h4>Background</h4>The umbilical cord blood contains a high concentration of stem cells. There is not any published study evaluating the amount of stem cells that have the potential to be transferred to the infant through placental transfusion methods as delayed cord clamping (DCC) and umbilical cord milking (UCM). The aim of this study is to measure the concentrations of endothelial progenitor cell (EPC) and CD34+ hematopoietic stem cell (HSC) in the placental residual blood volume (PRBV), and evaluate the delivery room adaptation and cerebral oxygenation of these infants.<h4>Methods</h4>Infants with ≥36 gestational weeks were randomized to receive DCC (120 s), UCM, or immediate cord clamping (ICC). EPC and CD34+ HSC were measured by flow cytometry from the cord blood. PRBV was collected in the setup. The cord blood gas analysis and complete blood count were performed. The heart rate (HR), oxygen saturation (SpO2), and cerebral regional oxygen saturation (crSO2) were recorded.<h4>Results</h4>A total of 103 infants were evaluated. The amount of PRBV (in ml and ml/kg) was higher in the ICC group (<i>p</i> < 0.001). The number of EPCs in the PRBV content (both ml and ml/kg) were the highest in the ICC group (<i>p</i> = 0.002 and <i>p</i> = 0.001, respectively). The number of CD34+ HSCs in PRBV content (ml and ml/kg) was similar in all groups, but nonsignificantly higher in the ICC group. The APGAR scores at the first and fifth min were lower in the ICC group (<i>p</i> < 0.05). The mean crSO2 values were higher at the 3rd and 10th min in the DCC group (<i>p</i> = 0.042 and <i>p</i> = 0.045, respectively). cFOE values were higher at the 3rd and 10th min in the ICC group (<i>p</i> = 0.011 and <i>p</i> < 0.001, respectively).<h4>Conclusion</h4>This study showed that placental transfusion methods, such as DCC and UCM, provide both higher blood volume, more stem cells transfer to the infant, and better cerebral oxygenation in the first minutes of life, whereas many lineages of stem cells is lost to the placenta by ICC with higher residual blood volume. These cord management methods rather than ICC do not require any cost or technology, and may be a preemptive therapeutic source for diseases of the neonatal period.
Also flagged:Erythromycinmetabolismmacrolidebiosynthesistype I polyketide synthaseshost cells
Journal Article2022-04-04No SnippetsYun K, Zhang Y, Li S, Wang Y, Tu R, Liu H, Wang M.
Show Full Abstract
Erythromycin is a clinically important drug produced by the rare actinomycete <i>Saccharopolyspora erythraea</i>. In the wide-type erythromycin producer <i>S. erythraea</i> NRRL 23338, there is a lack of systematical method for promoter engineering as well as a well-characterized promoter panel for comprehensive metabolic engineering. Here we demonstrated a systematical promoter acquiring process including promoter characterization, engineering and high-throughput screening by the droplet-microfluidic based platform in <i>S. erythraea</i> NRRL 23338, and rapidly obtained a panel of promoters with 21.5-fold strength variation for expression fine-tuning in the native host. By comparative qRT-PCR of <i>S. erythraea</i> NRRL 23338 and a high-producing strain S0, potential limiting enzymes were identified and overexpressed individually using two screened synthetic promoters. As a result, erythromycin production in the native host was improved by as high as 137.24 folds by combinational gene overexpression. This work enriches the accessible regulatory elements in the important erythromycin-producing strain <i>S. erythraea</i> NRRL 23338, and also provides a rapid and systematic research paradigm of promoter engineering and expression fine-tuning in the similar filamentous actinomycete hosts.
Also flagged:Histonechromatinhistonesnon-histone proteinsmetabolismchaperones
Journal Article2022-04-04✓ 2 SnippetsRajam SM, Varghese PC, Dutta D.
In-Text Gene Mentions
Introduction)
…(core histones andlinker histoneshistones) and the…
Introduction)
…less abundant oocyte specific-linker histoneshistones and the…
Show Full Abstract
Dynamicity and flexibility of the chromatin landscape are critical for most of the DNA-dependent processes to occur. This higher-order packaging of the eukaryotic genome into the chromatin is mediated by histones and associated non-histone proteins that determine the states of chromatin. Histone chaperones- "the guardian of genome stability and epigenetic information" controls the chromatin accessibility by escorting the nucleosomal and non-nucleosomal histones as well as their variants. This distinct group of molecules is involved in all facets of histone metabolism. The selectivity and specificity of histone chaperones to the histones determine the maintenance of the chromatin in an open or closed state. This review highlights the functional implication of the network of histone chaperones in shaping the chromatin function in the development of an organism. Seminal studies have reported embryonic lethality at different stages of embryogenesis upon perturbation of some of the chaperones, suggesting their essentiality in development. We hereby epitomize facts and functions that emphasize the relevance of histone chaperones in orchestrating different embryonic developmental stages starting from gametogenesis to organogenesis in multicellular organisms.
Also flagged:Huntington's DiseaseHDdystoniachoreaautosomal dominant neurodegenerative diseasecognitive decline
Journal Article2022-04-04✓ 1 SnippetScheid BH, Aradi S, Pierson RM, Baldassano S, Tivon I, Litt B, Gonzalez-Alegre P.
In-Text Gene Mentions
Introduction)
…expansion within theHTTgene.…
Show Full Abstract
The Unified Huntington's Disease Rating Scale (UHDRS) is the primary clinical assessment tool for rating motor function in patients with Huntington's disease (HD). However, the UHDRS and similar rating scales (e.g., UPDRS) are both subjective and limited to in-office assessments that must be administered by a trained and experienced rater. An objective, automated method of quantifying disease severity would facilitate superior patient care and could be used to better track severity over time. We conducted the present study to evaluate the feasibility of using wearable sensors, coupled with machine learning algorithms, to rate motor function in patients with HD. Fourteen participants with symptomatic HD and 14 healthy controls participated in the study. Each participant wore five adhesive biometric sensors applied to the trunk and each limb while completing brief walking, sitting, and standing tasks during a single office visit. A two-stage machine learning method was employed to classify participants by HD status and to predict UHDRS motor subscores. Linear discriminant analysis correctly classified all participants' HD status except for one control subject with abnormal gait (96.4% accuracy, 92.9% sensitivity, and 100% specificity in leave-one-out cross-validation). Two regression models accurately predicted individual UHDRS subscores for gait, and dystonia within a 10% margin of error. Our regression models also predicted a composite UHDRS score-a sum of left and right arm rigidity, total chorea, total dystonia, bradykinesia, gait, and tandem gait subscores-with an average error below 15%. Machine learning classifiers trained on brief in-office datasets discriminated between controls and participants with HD, and could accurately predict selected motor UHDRS subscores. Our results could enable the future use of biosensors for objective HD assessment in the clinic or remotely and could inform future studies for the use of this technology as a potential endpoint in clinical trials.
Also flagged:obesitydiabetesdyslipidemiadiabetes mellitusmetabolic syndromeinsulin resistance
Journal Article2022-04-04✓ 1 SnippetZeinalian R, Ahmadikhatir S, Esfahani EN, Namazi N, Larijani B.
In-Text Gene Mentions
Text
…NEGR1…
Show Full Abstract
<h4>Background & aims</h4>Nutrition is one of main environmental factor affecting obesity and its related complications such as diabetes and dyslipidemia. Due to growing prevalence of obesity across the world, it seems that nutritional advice alone is not able to combat this health problem. The present overview aimed to summarize the roles of personalized nutrition (PN) in obesity and diabetes management.<h4>Methods</h4>Scopus, PubMed and Google scholar were searched up to February 2021 to find relevant studies with English language in which the roles of PN in obesity and diabetes management were examined.<h4>Results</h4>Recent evidence revealed the importance of gene-environment interactions for management of diabetes mellitus and obesity. Moreover, microbiome research showed that personalized diet based on a combination of clinical and microbial features is likely to improve responses to therapeutic interventions. Epigenetics as well as genetic and environmental factors can also contribute to the treatment. In addition, articles showed significant roles of epigenetics and gut microbiome on providing an individualized diet for obese and diabetic patients.<h4>Conclusion</h4>PN compare to conventional diet can better improve metabolic status in obese and diabetic patients. Considering genetic differences and microbiome patterns along with environmental factors and their interactions are recommended for obesity and diabetes management. This approach can increase success in promoting health and preventing complications related to diabetes and obesity.
Also flagged:behavioralsleepalpha amylase-19diabetesiodine
Journal Article2022-04-04✓ 1 SnippetUrizar GG, Miller K.
In-Text Gene Mentions
Text
…5-HTT…
Show Full Abstract
The number of health psychology courses offered in higher education institutions has dramatically increased over the past 30 years. Health psychology courses provide students a unique opportunity to learn about important public health issues and health disparities affecting our society from a biopsychosocial perspective. Prior research indicates that students taking these courses, many of whom are non-biology majors, often report feeling anxious about learning the underlying biological mechanisms that affect health outcomes, particularly as they relate to stress and disease. Therefore, innovative teaching strategies, such as the use of active learning approaches, are needed to promote student confidence and engagement in learning these interdisciplinary models of health. Despite rapid advancements and innovations in health technologies, few health psychology courses have integrated these technologies as a modality of active learning. This article describes the implementation of health technologies (e.g., biosensors, biofeedback equipment, wearable technologies) as an active learning modality and innovative teaching approach to promote student engagement and learning outcomes in an undergraduate health psychology course taught in the U.S. Eighty students from a minority-serving university participated in this pilot course redesign. Student responses to the use of health technologies in their course were very positive. A description of the course curriculum is provided and results from student responses and feedback are presented. Implications and recommendations for implementing these technologies and pedagogies in future health courses are also discussed, including university support for sustaining these high impact teaching practices.
Also flagged:COVID-19-2 infectionNOTCH3CADASILCOVID-19 infectioninfection
Journal Article2022-04-04No SnippetsKról ZJ, Dorobek M, Dąbrowski M, Zielińska-Turek J, Mruk B, Walecki J, Sklinda K, Gil R, Pawlak A, Wojtaszewska M, Lejman A, Dobosz P, Zawadzki P, Pawłowska A, Szczepaniak M, Król D, Zaczyński A, Wierzba W.
Show Full Abstract
<h4>Introduction</h4>In the following study we describe the diagnostic process and further case analysis of a 30-year-old woman admitted with typical COVID-19 symptoms, who subsequently developed additional symptoms suggesting cerebral autosomal dominant arteriopathy with sub-cortical infarcts and leukoencephalopathy (CADASIL).<h4>Material and methods</h4>Other than the standard diagnostic procedures, whole genome sequencing (WGS) was used, which led to following findings. A new variant of the <i>NOTCH3</i> gene, which led to CADASIL-like symptoms, was found, and it had been most likely activated by the SARS-CoV-2 infection. This novel variant in NOTCH3 has not been found in existing databases and has never been mentioned in research concerning CADASIL before.<h4>Results</h4>Furthermore, after subjecting the patient's close relatives to WGS it was found that no other examined person demonstrated the same genetic mutation.<h4>Conclusions</h4>It seems therefore that the new variant of <i>NOTCH3</i> is of <i>de novo</i> origin in the patient's genome. Additionally, the relatively early onset of CADASIL and the unexpectedly severe COVID-19 infection suggest that the two occurred simultaneously: the infection with SARS-CoV-2 accelerated development of CADASIL symptoms and the unusual variant of the <i>NOTCH3</i> gene contributed to the more severe course of COVID-19.
Research Square2022-04-04Preprint (No Snippets API)Zhu Y, Shi M, Monsel A, Dai C, Dong X, Shen H, Li S, Chang J, Xu C, Li P, Wang J, Shen M, Ren C, Chen D, Qu J.
Show Full Abstract
<title>Abstract</title> <p><bold><italic>Background</italic></bold>Existing clinical studies supported the potential efficacy of mesenchymal stromal cells as well as derived exosomes in the treatment of COVID-19. We aimed to explore the safety and efficiency of aerosol inhalation of the exosomes derived from human adipose-derived MSCs (haMSC-Exos) in patients with COVID-19.<bold><italic>Methods</italic></bold>The MEXCOVID trial is a phase 2a single-arm, open-labelled, interventional trial and patients were enrolled in Jinyintan Hospital, Wuhan, China. Eligible 7 patients were assigned to receive the daily dose of haMSCs-Exos (2.0×10<sup>8</sup> nano vesicles) for consecutively 5 days. The primary outcomes included the incidence of prespecified inhalation-associated events and serious adverse events. We also observed the demographic data, clinical characteristics, laboratory results including lymphocyte count, levels of D-dimer and IL-6 as well as chest imaging.<bold><italic>Results</italic></bold>Seven severe COVID-19 related pneumonia patients (4 males and 3 females) were enrolled and received nebulized haMSC-Exos. The median age was 57 year (IQR, 43 year to 70 year). The median time from onset of symptoms to hospital admission and administration of nebulized haMSC-Exos was 30 days (IQR, 15 days to 40 days) and 54 d (IQR, 34 d to 69 d), respectively. All COVID-19 patients tolerated the haMSC-Exos nebulization well, with no evidence of prespecified adverse events or clinical instability during the nebulization or during the immediate post-nebulization period. All patients presented a slight increase of serum lymphocyte counts (median as 1.61×10<sup>9</sup>/L vs. 1.78×10<sup>9</sup>/L). Different degrees of resolution of pulmonary lesions after aerosol inhalation of haMSC-Exos were observed among all patients, more obviously in 4 of 7 patients.<bold><italic>Conclusions</italic></bold>Our trial shows that a consecutive 5 days inhalation dose of clinical grade haMSC-Exos up to a total amount of 2.0×10<sup>9</sup> nano vesicles was feasible and well tolerated in seven COVID-19 patients, with no evidence of prespecified adverse events, immediate clinical instability, or dose-relevant toxicity at any of the doses tested. This safety profile is seemingly followed by CT imaging improvement within 7 days. Further trials will have to confirm the long-term safety or efficacy in larger population.<bold><italic>Trial Registration</italic></bold>MEXCOVID, NCT04276987</p>
<h4>New findings</h4>What is the central question of this study? Is 1 week of exercise training sufficient to reduce local and systemic inflammation? Do obesity and short-term concurrent aerobic and resistance exercise training alter skeletal muscle extracellular vesicle (EV) contents? What is the main finding and its importance? Obesity alters skeletal muscle small EV microRNAs targeting inflammatory and growth pathways. Exercise training alters skeletal muscle small EV microRNAs targeting inflammatory pathways, indicative of reduced inflammation. Our findings provide support for the hypotheses that EVs play a vital role in intercellular communication during health and disease and that EVs mediate many of the beneficial effects of exercise.<h4>Abstract</h4>Obesity is associated with chronic inflammation characterized by increased levels of inflammatory cytokines, whereas exercise training reduces inflammation. Small extracellular vesicles (EVs; 30-150 nm) participate in cell-to-cell communication in part through microRNA (miRNA) post-transcriptional regulation of mRNA. We examined whether obesity and concurrent aerobic and resistance exercise training alter skeletal muscle EV miRNA content and inflammatory signalling. Vastus lateralis biopsies were obtained from sedentary individuals with (OB) and without obesity (LN). Before and after 7 days of concurrent aerobic and resistance training, muscle-derived small EV miRNAs and whole-muscle mRNAs were measured. Pathway analysis revealed that obesity alters small EV miRNAs that target inflammatory (SERPINF1, death receptor and Gα<sub>i</sub> ) and growth pathways (Wnt/β-catenin, PTEN, PI3K/AKT and IGF-1). In addition, exercise training alters small EV miRNAs in an anti-inflammatory manner, targeting the IL-10, IL-8, Toll-like receptor and nuclear factor-κB signalling pathways. In whole muscle, IL-8 mRNA was reduced by 50% and Jun mRNA by 25% after exercise training, consistent with the anti-inflammatory effects of exercise on skeletal muscle. Obesity and 7 days of concurrent exercise training differentially alter skeletal muscle-derived small EV miRNA contents targeting inflammatory and anabolic pathways.
Also flagged:tissue homeostasiscisplatinLHextracellularproteasesHtra1
Journal Article2022-04-03✓ 2 SnippetsMarcozzi S, Ciccosanti F, Fimia GM, Piacentini M, Caggiano C, Sette C, De Felici M, Klinger FG.
In-Text Gene Mentions
Results)
…No proteins were exclusive of CIS or LH, whereas potentially secreted Alb, Col3a1, Lyz2, Serpinc1 were present only in CTRL, and potentially secreted Col6a3, Col18a1, Htra1, Prss35, Igfbp5, Eef1a1, Isoc1, Tagln2, Tpi1, Pgam1 proteins were found exclusively in CIS + LH.…
Results)
…Alb, Col3a1, Lyz2,Serpinc1were present only…
Show Full Abstract
It is well known that secreted and exosomal proteins are associated with a broad range of physiological processes involving tissue homeostasis and differentiation. In the present paper, our purpose was to characterize the proteome of the culture medium in which the oocytes within the primordial/primary follicles underwent apoptosis induced by cisplatin (CIS) or were, for the most part, protected by LH against the drug. To this aim, prepubertal ovarian tissues were cultured under control and in the presence of CIS, LH, and CIS + LH. The culture media were harvested after 2, 12, and 24 h from chemotherapeutic drug treatment and analyzed by liquid chromatography-mass spectrometry (LC-MS). We found that apoptotic conditions generated by CIS in the cultured ovarian tissues and/or oocytes are reflected in distinct changes in the extracellular microenvironment in which they were cultured. These changes became evident mainly from 12 h onwards and were characterized by the inhibition or decreased release of a variety of compounds, such as the proteases Htra1 and Prss23, the antioxidants Prdx2 and Hbat1, the metabolic regulators Ldha and Pkm, and regulators of apoptotic pathways such as Tmsb4x. Altogether, these results confirm the biological relevance of the LH action on prepuberal ovaries and provide novel information about the proteins released by the ovarian tissues exposed to CIS and LH in the surrounding microenvironment. These data might represent a valuable resource for future studies aimed to clarify the effects and identify biomarkers of these compounds' action on the developing ovary.
Also flagged:CyclooxygenasePlatinumCOXindomethacinaspirincancer
Journal Article2022-04-03No SnippetsKhoury A, Sakoff JA, Gilbert J, Scott KF, Karan S, Gordon CP, Aldrich-Wright JR.
Show Full Abstract
Platinum(IV) prodrugs of the [Pt(P<sub>L</sub>)(A<sub>L</sub>)(COXi)(OH)]<sup>2+</sup> type scaffold (where P<sub>L</sub> is 1,10-phenanthroline or 5,6-dimethyl-1,10-phenanthroline, A<sub>L</sub> is 1<i>S</i>,2<i>S</i>-diaminocyclohexane, and COXi is a COX inhibitor, either indomethacin or aspirin) were synthesised and characterised, and their biological activity was explored. MTT assays showed that these complexes exhibit outstanding activity against a range of cancer cell lines, and nanomolar activities were observed. The most potent complex, <b>4</b>, exhibited a GI<sub>50</sub> of 3 nM in the Du145 prostate cancer cell line and was observed to display a 1614-fold increased activity against the HT29 colon cancer cell line relative to cisplatin. ICP-MS studies showed a linear correlation between increased cellular accumulation of the complexes and increased cytotoxicity, while an enzyme immunoassay showed that <b>1</b> and <b>2</b> inhibited COX-2 at 14 and 1.4 µM, respectively, which is comparable to the inhibition exhibited by indomethacin. These results suggest that while the cytotoxicity of prodrugs <b>1</b>-<b>4</b> was influenced by cellular uptake, it was not entirely dependent on either COX inhibition or lipophilicity.
Also flagged:colony stimulating factor-1 receptorCSF-1Rneurodegenerative diseasesALSprimary progressive multiple sclerosisMS
Journal Article2022-04-02✓ 5 SnippetsHan J, Chitu V, Stanley ER, Wszolek ZK, Karrenbauer VD, Harris RA.
In-Text Gene Mentions
Methods)
…The role of CSF-1R-dependent microglia in HD has been explored in transgenic R6/2 mice expressing the human HTT gene containing more than 100 CAG repeats [123].…
Methods)
…HD is an autosomal dominant devastating neurodegenerative disorder resulting from the abnormal CAG trinucleotide expansion (36 repeats or more) in exon 1 of the huntingtin (HTT) gene, encoding a long polyglutamine tract of the huntingtin protein [114, 115].…
Methods)
…Furthermore, PLX3397 treatment reduced the accumulation of mutant huntingtin (mHTT) by decreasing the numbers of intranuclear mHTT inclusion bodies in the striatum, without exerting significant influences on HTT gene expression.…
Methods)
…the huntingtin (HTT) gene, encoding…
Methods)
…expressing the humanHTTgene containing more…
Show Full Abstract
Microglia are specialized dynamic immune cells in the central nervous system (CNS) that plays a crucial role in brain homeostasis and in disease states. Persistent neuroinflammation is considered a hallmark of many neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS) and primary progressive multiple sclerosis (MS). Colony stimulating factor 1-receptor (CSF-1R) is predominantly expressed on microglia and its expression is significantly increased in neurodegenerative diseases. Cumulative findings have indicated that CSF-1R inhibitors can have beneficial effects in preclinical neurodegenerative disease models. Research using CSF-1R inhibitors has now been extended into non-human primates and humans. This review article summarizes the most recent advances using CSF-1R inhibitors in different neurodegenerative conditions including AD, PD, HD, ALS and MS. Potential challenges for translating these findings into clinical practice are presented.
Also flagged:synthesisIronmitochondriaorganelleoxygenmitochondrial
Journal Article2022-04-02No SnippetsCilibrizzi A, Pourzand C, Abbate V, Reelfs O, Versari L, Floresta G, Hider R.
Show Full Abstract
Iron levels in mitochondria are critically important for the normal functioning of the organelle. Abnormal levels of iron and the associated formation of toxic oxygen radicals have been linked to a wide range of diseases and consequently it is important to be able to both monitor and control levels of the mitochondrial labile iron pool. To this end a series of iron chelators which are targeted to mitochondria have been designed. This overview describes the synthesis of some of these molecules and their application in monitoring mitochondrial labile iron pools and in selectively removing excess iron from mitochondria.
…Shortened DCC length as inferred from NPHP1 expression is observed in both Spata7−/− and tamoxifen-injected Spata7flox/−; UbcCreERT2/+ mice.…
Results)
…reduced in theDCCin induced Spata7…
Results)
…destabilization in theDCC.…
Discussion)
…to mislocalization ofDCCproteins and destabilized…
Discussion)
…ShortenedDCClength as inferred…
Show Full Abstract
SPATA7, an early onset LCA3 retinal disease gene, encodes a putative scaffold protein that is essential for the proper assembly of the connecting cilium (CC) complex in photoreceptors. Previous studies have shown that SPATA7 interacts with other photoreceptor-specific ciliary proteins, such as RPGR and RPGRIP1, and maintains the integrity of CC integrity. However, although it is known that Spata7 is required for early formation of the CC, it is unclear if Spata7 is also required for the maintenance of the CC. To investigate Spata7 function in the retina at the adult stage, loss of function was induced in the adult retina upon tamoxifen induction of an inducible Spata7 knockout allele (Spata7<sup>flox/-</sup>; UbcCreERT2/<sup>+</sup>). The phenotype of mutant retina was characterized by a combination of histology, immunobiochemistry, and electroretinography (ERG). Our results demonstrated that Spata7 is also essential for maintaining the integrity of the mature retinal CC. Loss of Spata7 in adults caused phenotypes similar to those seen in germline mutant mice, including photoreceptor cell degeneration and defective ERG responses. Close examination of the CC revealed significantly shortened NPHP1 length as a result of Spata7 deletion. Furthermore, mislocalization of rhodopsin, leading to ER stress-mediated apoptosis, was observed in the retinal layers. Our results indicate that Spata7 is required not only for the establishment but also for the maintenance of the CC of photoreceptors.
Journal Article2022-04-02✓ 5 SnippetsRyaboshapkina M, Saitoski K, Hamza GM, Jarnuczak AF, Pechberty S, Berthault C, Sengupta K, Underwood CR, Andersson S, Scharfmann R.
In-Text Gene Mentions
I A O 0000326)
…CCDC92…
I A O 0000326)
…GPR52…
I A O 0000326)
…ZNF664…
I A O 0000326)
…PCDH17…
I A O 0000326)
…PEBP1…
Show Full Abstract
Early diabetes research is hampered by limited availability, variable quality, and instability of human pancreatic islets in culture. Little is known about the human β cell secretome, and recent studies question translatability of rodent β cell secretory profiles. Here, we verify representativeness of EndoC-βH1, one of the most widely used human β cell lines, as a translational human β cell model based on omics and characterize the EndoC-βH1 secretome. We profiled EndoC-βH1 cells using RNA-seq, data-independent acquisition, and tandem mass tag proteomics of cell lysate. Omics profiles of EndoC-βH1 cells were compared to human β cells and insulinomas. Secretome composition was assessed by data-independent acquisition proteomics. Agreement between EndoC-βH1 cells and primary adult human β cells was ∼90% for global omics profiles as well as for β cell markers, transcription factors, and enzymes. Discrepancies in expression were due to elevated proliferation rate of EndoC-βH1 cells compared to adult β cells. Consistently, similarity was slightly higher with benign nonmetastatic insulinomas. EndoC-βH1 secreted 783 proteins in untreated baseline state and 3135 proteins when stressed with nontargeting control siRNA, including known β cell hormones INS, IAPP, and IGF2. Further, EndoC-βH1 secreted proteins known to generate bioactive peptides such as granins and enzymes required for production of bioactive peptides. EndoC-βH1 secretome contained an unexpectedly high proportion of predicted extracellular vesicle proteins. We believe that secretion of extracellular vesicles and bioactive peptides warrant further investigation with specialized proteomics workflows in future studies.
…In these diseases, various pathogenic proteins have been identified as the substrates of CMA, such as α-synuclein in PD [60], Tau protein in AD [61], huntingtin (Htt) in HD [62,63], and TDP-43 in ALS and FTLD [64,65].…
Discussion)
…Important pathogenic proteins have been identified as the substrates of CMA, such as α-synuclein in PD [60], Tau protein in AD [61], huntingtin (Htt) in HD [62,63], and TDP-43 in ALS and FTLD [64,65].…
S I O 001029)
…Aberrant proteins, such as α-synuclein and LRRK2 in PD, RCAN1 and Tau protein in AD, Htt in HD, and TDP-43 in ALS and FTLD, are the substrates of CMA [4,14].…
S I O 001029)
…HD is a dominantly inherited disease caused by the accumulation and aggregation of mutant Htt protein in striatal and cortical neurons.…
S I O 001029)
…Dysfunction of Htt degradation is suggested as the main pathogenesis of HD.…
Show Full Abstract
Autophagy is an important function that mediates the degradation of intracellular proteins and organelles. Chaperone-mediated autophagy (CMA) degrades selected proteins and has a crucial role in cellular proteostasis under various physiological and pathological conditions. CMA dysfunction leads to the accumulation of toxic protein aggregates in the central nervous system (CNS) and is involved in the pathogenic process of neurodegenerative diseases, including Parkinson's disease and Alzheimer's disease. Previous studies have suggested that the activation of CMA to degrade aberrant proteins can provide a neuroprotective effect in the CNS. Recent studies have shown that CMA activity is upregulated in damaged neural tissue following acute neurological insults, such as cerebral infarction, traumatic brain injury, and spinal cord injury. It has been also suggested that various protein degradation mechanisms are important for removing toxic aberrant proteins associated with secondary damage after acute neurological insults in the CNS. Therefore, enhancing the CMA pathway may induce neuroprotective effects not only in neurogenerative diseases but also in acute neurological insults. We herein review current knowledge concerning the biological mechanisms involved in CMA and highlight the role of CMA in neurodegenerative diseases and acute neurological insults. We also discuss the possibility of developing CMA-targeted therapeutic strategies for effective treatments.
The proteomic profiles of Silky fowl egg yolk (SFEY) and Leghorn egg yolk (LEY) were analyzed by bottom-up label-free liquid chromatography-tandem mass spectrometry (LC-MS/MS). From a total of 186 identified proteins, 26 proteins were found significantly differentially abundant between two yolks, of which, 19 were up-regulated and 7 were down-regulated in SFEY, particularly, vitelline membrane outer layer protein 1, transthyretin and ovoinhibitor were up-regulated by 26, 25, and 16 times, respectively. In addition, there were 57 and 6 unique proteins in SFEY and LEY, respectively. Gene Ontology (GO) revealed SFEY contained relatively more abundant protease inhibitors and coagulation-related proteins. Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis revealed differentially abundant proteins in SFEY may be actively involved in the regulation of the neuroactive ligand-receptor interaction pathway. This study provides a theoretical basis for the understanding of proteomic and biological differences between these two yolks and can guide for further exploration of nutritional and biomedical use of Silky fowl egg.
Also flagged:HydroxyapatiteTricalcium Phosphatescalcium phosphatescalcium phosphatebone formationtitanium
Journal Article2022-04-02No SnippetsMohd N, Razali M, Ghazali MJ, Abu Kasim NH.
Show Full Abstract
Three-dimensional-printed scaffolds have received greater attention as an attractive option compared to the conventional bone grafts for regeneration of alveolar bone defects. Hydroxyapatite and tricalcium phosphates have been used as biomaterials in the fabrication of 3D-printed scaffolds. This scoping review aimed to evaluate the potential of 3D-printed HA and calcium phosphates-based scaffolds on alveolar bone regeneration in animal models. The systematic search was conducted across four electronic databases: Ovid, Web of Science, PubMed and EBSCOHOST, based on PRISMA-ScR guidelines until November 2021. The inclusion criteria were: (i) animal models undergoing alveolar bone regenerative surgery, (ii) the intervention to regenerate or augment bone using 3D-printed hydroxyapatite or other calcium phosphate scaffolds and (iii) histological and microcomputed tomographic analyses of new bone formation and biological properties of 3D-printed hydroxyapatite or calcium phosphates. A total of ten studies were included in the review. All the studies showed promising results on new bone formation without any inflammatory reactions, regardless of the animal species. In conclusion, hydroxyapatite and tricalcium phosphates are feasible materials for 3D-printed scaffolds for alveolar bone regeneration and demonstrated bone regenerative potential in the oral cavity. However, further research is warranted to determine the scaffold material which mimics the gold standard of care for bone regeneration in the load-bearing areas, including the masticatory load of the oral cavity.
Also flagged:Chromatingene expressionpost-translational modificationsmethylationNeurogenesisdifferentiation
Journal Article2022-04-02No SnippetsNothof SA, Magdinier F, Van-Gils J.
Show Full Abstract
Chromatin structure is an essential regulator of gene expression. Its state of compaction contributes to the regulation of genetic programs, in particular during differentiation. Epigenetic processes, which include post-translational modifications of histones, DNA methylation and implication of non-coding RNA, are powerful regulators of gene expression. Neurogenesis and neuronal differentiation are spatio-temporally regulated events that allow the formation of the central nervous system components. Here, we review the chromatin structure and post-translational histone modifications associated with neuronal differentiation. Studying the impact of histone modifications on neuronal differentiation improves our understanding of the pathophysiological mechanisms of chromatinopathies and opens up new therapeutic avenues. In addition, we will discuss techniques for the analysis of histone modifications on a genome-wide scale and the pathologies associated with the dysregulation of the epigenetic machinery.
Also flagged:Mitochondrial AtaxiasAtaxiamitochondrial diseasesPMDshereditary ataxiasPrimary mitochondrial diseases
Journal Article2022-04-02No SnippetsLopriore P, Ricciarini V, Siciliano G, Mancuso M, Montano V.
Show Full Abstract
Ataxia is increasingly being recognized as a cardinal manifestation in primary mitochondrial diseases (PMDs) in both paediatric and adult patients. It can be caused by disruption of cerebellar nuclei or fibres, its connection with the brainstem, or spinal and peripheral lesions leading to proprioceptive loss. Despite mitochondrial ataxias having no specific defining features, they should be included in hereditary ataxias differential diagnosis, given the high prevalence of PMDs. This review focuses on the clinical and neuropathological features and genetic background of PMDs in which ataxia is a prominent manifestation.
Also flagged:Beta-Thalassemiahemoglobinopathiessynthesisbeta-globinerythropoiesisanemia
Journal Article2022-04-02✓ 2 SnippetsMahajan PS, Kolleri JJ, Ait Souabni S, Prasad S, Belhaddad EH, Mohammed H.
In-Text Gene Mentions
Abstract)
…beta-thalassemia and secondaryhemochromatosisand developed atraumatic…
Introduction)
…major and secondaryhemochromatosis, who presented with…
Show Full Abstract
Beta-thalassemia represents a range of hemoglobinopathies that are a consequence of an impairment in the synthesis of beta-globin chains. They result in different degrees of hemolysis and ineffective erythropoiesis, depending on the underlying mutations. They can lead to severe complications mainly resulting from anemia. However, there is no bleeding tendency in this disorder, and it is uncommon to see hematoma formation in affected patients. To our knowledge, subperiosteal hematomas have been rarely described in the context of beta-thalassemia. Herein, we report a unique case of a 19-year-old boy who was diagnosed with transfusion-dependent beta-thalassemia and secondary hemochromatosis and developed atraumatic subperiosteal hematomas along the humerus.
Also flagged:PhosphorusdigestionexcretionElementaloxygenrock phosphate
Journal Article2022-04-02No SnippetsZhai H, Adeola O, Liu J.
Show Full Abstract
Phosphorus (P) is an essential nutrient for diverse biological processes, which aggregate to the animal's requirement for P, and nutritionists strive to meet this requirement accurately. The P demand for a growing pig comprises requirements for maintenance and tissue deposition. The P in feed ingredients, however, must be digested and absorbed before its ultimate partition between the 2 aforementioned requirement components. Phosphorus from various sources could behave differently during digestion and absorption, which results in their disparate bioavailability for pigs. The system of standardized total tract digestibility reflects true total tract digestibility of P and feed ingredient effects on specific endogenous P loss with relative ease of implementation, and this system guarantees satisfactory additivity in digestible P among the ingredients in a diet-the foundation for diet formulation. The basal endogenous P loss, which is much easier to measure than the specific endogenous P loss, is considered as part of the pig's maintenance requirement. With this arrangement, a digestibility framework is established both for measuring the P-providing capacity of various feed ingredients and for describing the pig's P requirement. This framework entails basic understanding of the function, digestion, absorption, excretion, and homeostasis of P as support pillars. Understanding the workings of this framework enables potential integration of factors such as environment conditions and disease status in future P requirement models. The current review discusses dietary sources, digestion, absorption, bioavailability and requirement of P for growing pigs to understand the status quo, revealing the points of consensus as well as those of debate, and to encourage further investigation to provide more clarity.
Also flagged:CD4neurocognitive declinelearning disabilityschizophreniaopportunistic infectiontoxoplasmosis
Journal Article2022-04-01No SnippetsEllis RJ, Paolillo E, Saloner R, Heaton RK.
Show Full Abstract
<h4>Background</h4>Age-related comorbidities accumulate faster in people with HIV (PWH) than in those without HIV. We evaluated whether a validated multimorbidity scale, the Charlson index, predicted neurocognitive trajectories in PWH.<h4>Methods</h4>Scaled scores of a comprehensive neuropsychological battery were averaged across all visits. Multilevel modeling examined between- and within-person predictors of global neurocognition. At the between-person level, averaged Charlson scores were examined as a predictor of neurocognitive change rate, covarying for HIV disease characteristics. Within-persons, visit-specific Charlson index was used to predict fluctuations in global neurocognition at the same and next visit, covarying for disease measures.<h4>Results</h4>Participants were 1195 PWH (mean baseline age: 43.0; SD: 9.7 years) followed for a mean of 7.1 years (range: 0.5-20.5). At the between-person level, more rapid neurocognitive worsening correlated with higher (worse) average Charlson scores (standardized β: -0.062; SE: 0.015; P = .001) and lower CD4 nadir (standardized β: 0.055; SE: 0.021; P = .011), but not viral suppression or average CD4+ lymphocytes (P > .05). At the within-person level, poorer visit-specific neurocognition was related to worse concurrent, but not preceding, Charlson scores (standardized β: -0.046; SE: 0.015; P = .003), detectable HIV viral load (standardized β: 0.018; SE: 0.006; P = .001), and higher CD4+ (standardized β: 0.043; SE: 0.009; P < .001).<h4>Conclusions</h4>The impact of comorbidities on neurocognitive decline exceeded that of HIV disease factors. Although correlative, the temporal relationships suggested that treatment of comorbidities might improve neurocognitive prognosis for PWH.
Journal Article2022-04-01✓ 1 SnippetLu Y, Shan Q, Ling M, Ni XA, Mao SS, Yu B, Cao QQ.
In-Text Gene Mentions
I A O 0000326)
…Mms22l…
Show Full Abstract
Peripheral nerve injury repair requires a certain degree of cooperation between axon regeneration and Wallerian degeneration. Therefore, investigating how axon regeneration and degeneration work together to repair peripheral nerve injury may uncover the molecular mechanisms and signal cascades underlying peripheral nerve repair and provide potential strategies for improving the low axon regeneration capacity of the central nervous system. In this study, we applied weighted gene co-expression network analysis to identify differentially expressed genes in proximal and distal sciatic nerve segments from rats with sciatic nerve injury. We identified 31 and 15 co-expression modules from the proximal and distal sciatic nerve segments, respectively. Functional enrichment analysis revealed that the differentially expressed genes in proximal modules promoted regeneration, while the differentially expressed genes in distal modules promoted neurodegeneration. Next, we constructed hub gene networks for selected modules and identified a key hub gene, Kif22, which was up-regulated in both nerve segments. In vitro experiments confirmed that Kif22 knockdown inhibited proliferation and migration of Schwann cells by modulating the activity of the extracellular signal-regulated kinase signaling pathway. Collectively, our findings provide a comparative framework of gene modules that are co-expressed in injured proximal and distal sciatic nerve segments, and identify Kif22 as a potential therapeutic target for promoting peripheral nerve injury repair via Schwann cell proliferation and migration. All animal experiments were approved by the Institutional Animal Ethics Committee of Nantong University, China (approval No. S20210322-008) on March 22, 2021.
Also flagged:systemic juvenile idiopathic arthritisSJIAinflammatory diseasearthritispathogenesisCD8
Journal Article2022-04-01✓ 5 SnippetsRen Y, Labinsky H, Palmowski A, Bäcker H, Müller M, Kienzle A.
In-Text Gene Mentions
Discussion)
…In total, we identified eight upregulated hub genes in patients with active SJIA: HP, MPO, MMP8, MMP9, ARG1, OLFM4, DEFA4, and PGLYRP1. We postulate these genes to be significantly involved in the inflammatory environment and subsequent disease progression in patients with active SJIA.…
Abstract)
…, MPO ,OLFM4, and PGLYRP1…
Results)
…of CD177 ,OLFM4, ARHGEF12 ,…
Discussion)
…, ARG1 ,OLFM4, DEFA4 ,…
Discussion)
…increased expression ofOLFM4, DEFA4 ,…
Show Full Abstract
Systemic juvenile idiopathic arthritis (SJIA) is a severe childhood-onset inflammatory disease characterized by arthritis accompanied by systemic auto-inflammation and extra-articular symptoms. While recent advances have unraveled a range of risk factors, the pathomechanisms involved in SJIA and potential prognostic markers for treatment success remain partly unknown. In this study, we included 70 active SJIA and 55 healthy control patients from the National Center for Biotechnology Information to analyze for differentially expressed genes (DEGs) using R. Functional enrichment analysis, protein-protein interaction (PPI), and gene module construction were performed for DEGs and hub gene set. We additionally examined immune system cell composition with CIBERSORT and predicted prognostic markers and potential treatment drugs for SJIA. In total, 94 upregulated and 24 downregulated DEGs were identified. Two specific modules of interest and eight hub genes (ARG1, DEFA4, HP, MMP8, MMP9, MPO, OLFM4, PGLYRP1) were screened out. Functional enrichment analysis suggested that complex neutrophil-related functions play a decisive role in the disease pathogenesis. CIBERSORT indicated neutrophils, M0 macrophages, CD8+ T cells, and naïve B cells to be relevant drivers of disease progression. Additionally, we identified TPM2 and GZMB as potential prognostic markers for treatment response to canakinumab. Moreover, sulindac sulfide, (-)-catechin, and phenanthridinone were identified as promising treatment agents. This study provides a new insight into molecular and cellular pathogenesis of active SJIA and highlights potential targets for further research.
Also flagged:pathogenesischromosomebehaviouralsynapsenucleuschorea
Journal Article2022-04-01✓ 2 SnippetsNair A, Razi A, Gregory S, Rutledge RB, Rees G, Tabrizi SJ.
In-Text Gene Mentions
Introduction)
…Huntington’s disease is an autosomal-dominant neurodegenerative condition caused by a triplet repeat expansion in the huntingtin (HTT) gene on chromosome 4.1,, 2…
Introduction)
…the huntingtin (HTT) gene on…
Show Full Abstract
The gating of movement depends on activity within the cortico-striato-thalamic loops. Within these loops, emerging from the cells of the striatum, run two opponent pathways-the direct and indirect basal ganglia pathways. Both are complex and polysynaptic, but the overall effect of activity within these pathways is thought to encourage and inhibit movement, respectively. In Huntington's disease, the preferential early loss of striatal neurons forming the indirect pathway is thought to lead to disinhibition, giving rise to the characteristic motor features of the condition. But early Huntington's disease is also associated with apathy, a loss of motivation and failure to engage in goal-directed movement. We hypothesized that in Huntington's disease, motor signs and apathy may be selectively correlated with indirect and direct pathway dysfunction, respectively. We used spectral dynamic casual modelling of resting-state functional MRI data to model effective connectivity in a model of these cortico-striatal pathways. We tested both of these hypotheses in vivo for the first time in a large cohort of patients with prodromal Huntington's disease. Using an advanced approach at the group level we combined parametric empirical Bayes and Bayesian model reduction procedures to generate a large number of competing models and compare them using Bayesian model comparison. With this automated Bayesian approach, associations between clinical measures and connectivity parameters emerge de novo from the data. We found very strong evidence (posterior probability > 0.99) to support both of our hypotheses. First, more severe motor signs in Huntington's disease were associated with altered connectivity in the indirect pathway components of our model and, by comparison, loss of goal-direct behaviour or apathy, was associated with changes in the direct pathway component. The empirical evidence we provide here demonstrates that imbalanced basal ganglia connectivity may play an important role in the pathogenesis of some of commonest and disabling features of Huntington's disease and may have important implications for therapeutics.
Journal Article2022-04-01✓ 4 SnippetsKhoury S, Parisien M, Thompson SJ, Vachon-Presseau E, Roy M, Martinsen AE, Winsvold BS, HUNT All-In Pain, Mundal IP, Zwart JA, Kania A, Mogil JS, Diatchenko L.
In-Text Gene Mentions
Abstract)
…cohort, with theDCCnetrin 1 receptor…
Abstract)
…netrin 1 receptor (DCC) as the top…
Abstract)
…analysis showed thatDCCis most strongly…
Abstract)
…icrostructure, suggesting thatDCC-dependent axonogenesis may co…
Show Full Abstract
Chronic pain is often present at more than one anatomical location, leading to chronic overlapping pain conditions. Whether chronic overlapping pain conditions represent a distinct pathophysiology from the occurrence of pain at only one site is unknown. Using genome-wide approaches, we compared genetic determinants of chronic single-site versus multisite pain in the UK Biobank. We found that different genetic signals underlie chronic single-site and multisite pain with much stronger genetic contributions for the latter. Among 23 loci associated with multisite pain, nine loci replicated in the HUNT cohort, with the DCC netrin 1 receptor (DCC) as the top gene. Functional genomics identified axonogenesis in brain tissues as the major contributing pathway to chronic multisite pain. Finally, multimodal structural brain imaging analysis showed that DCC is most strongly expressed in subcortical limbic regions and is associated with alterations in the uncinate fasciculus microstructure, suggesting that DCC-dependent axonogenesis may contribute to chronic overlapping pain conditions via corticolimbic circuits.
Also flagged:ALLleukemiasleukemiaBacute myeloid leukemiaAML
Journal Article2022-04-01✓ 1 SnippetChen C, Yu W, Alikarami F, Qiu Q, Chen CH, Flournoy J, Gao P, Uzun Y, Fang L, Davenport JW, Hu Y, Zhu Q, Wang K, Libbrecht C, Felmeister A, Rozich I, Ding YY, Hunger SP, Felix CA, Wu H, Brown PA, Guest EM, Barrett DM, Bernt KM, Tan K.
In-Text Gene Mentions
Results)
…MLLT3 , andMLLT10being the most…
Show Full Abstract
KMT2A-rearranged (KMT2A-r) infant acute lymphoblastic leukemia (ALL) is a devastating malignancy with a dismal outcome, and younger age at diagnosis is associated with increased risk of relapse. To discover age-specific differences and critical drivers that mediate poor outcome in KMT2A-r ALL, we subjected KMT2A-r leukemias and normal hematopoietic cells from patients of different ages to single-cell multiomics analyses. We uncovered the following critical new insights: leukemia cells from patients <6 months have significantly increased lineage plasticity. Steroid response pathways are downregulated in the most immature blasts from younger patients. We identify a hematopoietic stem and progenitor-like (HSPC-like) population in the blood of younger patients that contains leukemic blasts and form an immunosuppressive signaling circuit with cytotoxic lymphocytes. These observations offer a compelling explanation for the ability of leukemias in young patients to evade chemotherapy and immune-mediated control. Our analysis also revealed preexisting lymphomyeloid primed progenitors and myeloid blasts at initial diagnosis of B-ALL. Tracking of leukemic clones in 2 patients whose leukemia underwent a lineage switch documented the evolution of such clones into frank acute myeloid leukemia (AML). These findings provide critical insights into KMT2A-r ALL and have clinical implications for molecularly targeted and immunotherapy approaches. Beyond infant ALL, our study demonstrates the power of single-cell multiomics to detect tumor intrinsic and extrinsic factors affecting rare but critical subpopulations within a malignant population that ultimately determines patient outcome.
Also flagged:serotonin5-hydroxytryptaminenorepinephrinemajor depressive disorderNE transportersNET
Journal Article2022-04-01✓ 3 SnippetsAldosary F, Norris S, Tremblay P, James JS, Ritchie JC, Blier P.
In-Text Gene Mentions
Introduction)
…In the case of the 5-HT system, there is consistency between the affinity of various medications to bind to human 5-HTT in vitro, their capacity to inhibit 5-HT reuptake in various tissue preparations, the ex vivo assessment of 5-HT reuptake inhibition using the serum of patients undergoing pharmacological treatment of MDD, and the capacity of 5-HT reuptake inhibitors to displace positron emission tomography (PET) ligands from 5-HT reuptake sites in the brain of healthy participants and of patients with MDD (Owens et al., 1997; Tatsumi et al., 1997; Meyer et al., 2001; Gilmor et al., 2002).…
Introduction)
…and NE transporters (5-HTT, NET) and their…
Introduction)
…bind to human5-HTTin vitro, their…
Show Full Abstract
<h4>Background</h4>Venlafaxine is a dual serotonin (5-HT) and norepinephrine reuptake inhibitor. The specific dose at which it begins to efficiently engage the norepinephrine transporter (NET) remained to be determined. Paroxetine is generally considered as a selective 5-HT reuptake inhibitor but exhibits some affinity for NET. Atomoxetine is a NET inhibitor but also has some affinity for the 5-HT reuptake transporter (SERT).<h4>Methods</h4>This study examined the effects of forced titration of venlafaxine from 75 to 300 mg/d, paroxetine from 20 to 50 mg/d, or atomoxetine from 25 to 80 mg/d in 32 patients with major depressive disorder. Inhibition of SERT was estimated using the depletion of whole-blood 5-HT. Inhibition of NET was assessed using the attenuation of the systolic blood pressure produced by i.v. injections of tyramine.<h4>Results</h4>All 3 medications significantly reduced 5-HT levels at the initiating regimens: venlafaxine and paroxetine by approximately 60% and atomoxetine by 16%. The 3 subsequent regimens of venlafaxine and paroxetine reduced 5-HT levels by over 90%, but the highest dose of atomoxetine only reached a 40% inhibition. Atomoxetine dose dependently inhibited the tyramine pressor response from the lowest dose, venlafaxine from 225 mg/d, and paroxetine left it unaltered throughout.<h4>Conclusion</h4>These results confirm that venlafaxine and paroxetine are potent SERT inhibitors over their usual therapeutic range but that venlafaxine starts inhibiting NET only at 225 mg/d, whereas paroxetine remains selective for SERT up to 50 mg/d. Atomoxetine dose dependently inhibits NET from a low dose but does not inhibit SERT to a clinically relevant degree.
Also flagged:NCOA4ironiron deficiency anemiaanemiairon overload disorderstranscription factor
Journal Article2022-04-01✓ 4 SnippetsDas NK, Jain C, Sankar A, Schwartz AJ, Santana-Codina N, Solanki S, Zhang Z, Ma X, Parimi S, Rui L, Mancias JD, Shah YM.
In-Text Gene Mentions
Abstract)
…mouse model ofhemochromatosis, ablation of intestinal…
Title)
…mouse model ofhemochromatosis…
Abstract)
…iron homeostasis inhemochromatosis, but not in…
Text
…hemochromatosis…
Show Full Abstract
Intestinal iron absorption is activated during increased systemic demand for iron. The best-studied example is iron deficiency anemia, which increases intestinal iron absorption. Interestingly, the intestinal response to anemia is very similar to that of iron overload disorders, as both the conditions activate a transcriptional program that leads to a hyperabsorption of iron via the transcription factor hypoxia-inducible factor 2α (HIF2α). However, pathways for selective targeting of intestine-mediated iron overload remain unknown. Nuclear receptor coactivator 4 (NCOA4) is a critical cargo receptor for autophagic breakdown of ferritin and the subsequent release of iron, in a process termed ferritinophagy. Our work demonstrates that NCOA4-mediated intestinal ferritinophagy is integrated into systemic iron demand via HIF2α. To demonstrate the importance of the intestinal HIF2α/ferritinophagy axis in systemic iron homeostasis, whole-body and intestine-specific NCOA4-/- mouse lines were generated and assessed. The analyses revealed that the intestinal and systemic response to iron deficiency was not altered after disruption of intestinal NCOA4. However, in a mouse model of hemochromatosis, ablation of intestinal NCOA4 was protective against iron overload. Therefore, NCOA4 can be selectively targeted for the management of iron overload disorders without disrupting the physiological processes involved in the response to systemic iron deficiency.
Journal Article2022-04-01✓ 4 SnippetsVerhaegen ME, Harms PW, Van Goor JJ, Arche J, Patrick MT, Wilbert D, Zabawa H, Grachtchouk M, Liu CJ, Hu K, Kelly MC, Chen P, Saunders TL, Weidinger S, Syu LJ, Runge JS, Gudjonsson JE, Wong SY, Brownell I, Cieslik M, Udager AM, Chinnaiyan AM, Tsoi LC, Dlugosz AA.
In-Text Gene Mentions
Results)
…Variable numbers of tumor cells also expressed tLTAg and ATOH1 (Figure 2D) as well as multiple protein markers detected in human MCCs, including ISL1, INSM1, SOX2, POU3F2, and KRT8, the latter in a dot-like pattern highly characteristic of MCC (Figure 2E).…
Methods)
…Gross skin tumors (n = 11) arising between 11 and 22 weeks after transgene induction in SLAP mice (n = 8) were GFP+ and RFP+ and expressed ATOH1 and SOX2 as well as other markers, including ISL1, INSM1, POU3F2, and KRT8, in at least focal areas consistent with human MCC.…
Methods)
…including ISL1, INSM1,POU3F2, and KRT8, in…
Results)
…ISL1, INSM1, SOX2,POU3F2, and KRT8, the…
Show Full Abstract
Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer that frequently carries an integrated Merkel cell polyomavirus (MCPyV) genome and expresses viral transforming antigens (TAgs). MCC tumor cells also express signature genes detected in skin-resident, postmitotic Merkel cells, including atonal bHLH transcription factor 1 (ATOH1), which is required for Merkel cell development from epidermal progenitors. We now report the use of in vivo cellular reprogramming, using ATOH1, to drive MCC development from murine epidermis. We generated mice that conditionally expressed MCPyV TAgs and ATOH1 in epidermal cells, yielding microscopic collections of proliferating MCC-like cells arising from hair follicles. Immunostaining of these nascent tumors revealed p53 accumulation and apoptosis, and targeted deletion of transformation related protein 53 (Trp53) led to development of gross skin tumors with classic MCC histology and marker expression. Global transcriptome analysis confirmed the close similarity of mouse and human MCCs, and hierarchical clustering showed conserved upregulation of signature genes. Our data establish that expression of MCPyV TAgs in ATOH1-reprogrammed epidermal cells and their neuroendocrine progeny initiates hair follicle-derived MCC tumorigenesis in adult mice. Moreover, progression to full-blown MCC in this model requires loss of p53, mimicking the functional inhibition of p53 reported in human MCPyV-positive MCCs.
Journal Article2022-04-01✓ 1 SnippetFeresten AH, Bhat JM, Yu AJ, Zapf R, Safi H, Au V, Flibotte S, Doell C, Moerman DG, Hawkins N, Rankin CH, Hutter H.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
During nervous system development, axons navigate complex environments to reach synaptic targets. Early extending axons must interact with guidance cues in the surrounding tissue, while later extending axons can interact directly with earlier "pioneering" axons, "following" their path. In Caenorhabditis elegans, the AVG neuron pioneers the right axon tract of the ventral nerve cord. We previously found that aex-3, a rab-3 guanine nucleotide exchange factor, is essential for AVG axon navigation in a nid-1 mutant background and that aex-3 might be involved in trafficking of UNC-5, a receptor for the guidance cue UNC-6/netrin. Here, we describe a new gene in this pathway: ccd-5, a putative cdk-5 binding partner. ccd-5 mutants exhibit increased navigation defects of AVG pioneer as well as interneuron and motor neuron follower axons in a nid-1 mutant background. We show that ccd-5 acts in a pathway with cdk-5, aex-3, and unc-5. Navigation defects of follower interneuron and motoneuron axons correlate with AVG pioneer axon defects. This suggests that ccd-5 mostly affects pioneer axon navigation and that follower axon defects are largely a secondary consequence of pioneer navigation defects. To determine the consequences for nervous system function, we assessed various behavioral and movement parameters. ccd-5 single mutants have no significant movement defects, and nid-1 ccd-5 double mutants are less responsive to mechanosensory stimuli compared with nid-1 single mutants. These surprisingly minor defects indicate either a high tolerance for axon guidance defects within the motor circuit and/or an ability to maintain synaptic connections among commonly misguided axons.
Also flagged:Histone methyltransferase WHSC1MHC-Iantigen presentationIFN-γprogrammed death ligand 1PD-L1
Journal Article2022-04-01✓ 2 SnippetsRen J, Li N, Pei S, Lian Y, Li L, Peng Y, Liu Q, Guo J, Wang X, Han Y, Zhang G, Wang H, Li Y, Jiang J, Li Q, Tan M, Peng J, Hu G, Xiao Y, Li X, Lin M, Qin J.
IFN-γ-stimulated MHC class I (MHC-I) antigen presentation underlies the core of antitumor immunity. However, sustained IFN-γ signaling also enhances the programmed death ligand 1 (PD-L1) checkpoint pathway to dampen antitumor immunity. It remains unclear how these opposing effects of IFN-γ are regulated. Here, we report that loss of the histone dimethyltransferase WHSC1 impaired the antitumor effect of IFN-γ signaling by transcriptional downregulation of the MHC-I machinery without affecting PD-L1 expression in colorectal cancer (CRC) cells. Whsc1 loss promoted tumorigenesis via a non-cell-autonomous mechanism in an Apcmin/+ mouse model, CRC organoids, and xenografts. Mechanistically, we found that the IFN-γ/STAT1 signaling axis stimulated WHSC1 expression and, in turn, that WHSC1 directly interacted with NLRC5 to promote MHC-I gene expression, but not that of PD-L1. Concordantly, silencing Whsc1 diminished MHC-I levels, impaired antitumor immunity, and blunted the effect of immune checkpoint blockade. Patient cohort analysis revealed that WHSC1 expression positively correlated with enhanced MHC-I expression, tumor-infiltrating T cells, and favorable disease outcomes. Together, our findings establish a tumor-suppressive function of WHSC1 that relays IFN-γ signaling to promote antigen presentation on CRC cells and provide a rationale for boosting WHSC1 activity in immunotherapy.
Manual tissue decellularization is an onerous process that requires the application of many sequential treatments by an operator and can be prone to user error and result variability. While automated decellularization devices have been previously reported, with advances being made in recent years toward open-source platforms, previous automated decellularization devices have been reliant on hardware or software components that are closed-source and proprietary. The aim of the current work was to develop and validate a full open-source automated decellularization system to be available for others to adopt. The open-source decellularization apparatus is a low-cost (<$2000) device that may easily be adapted to an array of decellularization protocols, with an example parts' list provided herein. The automated decellularization device was used to decellularize hyaline cartilage, knee meniscus, and tendon tissues. Cartilage, meniscus, and tendon tissue demonstrated 97%, 99%, and 96% reduction in DNA content after decellularization, respectively, and with effective decellularization confirmed visually via histology. High retentions of glycosaminoglycans (GAGs), collagen, and other proteins were observed in meniscus and tendon following decellularization. Results with manual decellularization with meniscus tissue were consistent with the automated decellularization process. Decellularized cartilage (DCC) demonstrated a 34% decrease in GAG content, while the protein and collagen content did not significantly change. The current study demonstrated that native-like decellularized tissues were produced reproducibly using the reported open-source automated decellularization platform, providing an adoptable platform for production of decellularized tissues by others. Impact statement Decellularized extracellular matrix (ECM)-based materials are appealing for tissue engineering, but production of these materials is historically time-intensive, tedious, and prone to user error. Adoption of an automated system may be a barrier for many research groups due to cost and complexity. In this article, a low-cost open-source platform for automated decellularization is presented. This method is validated by decellularizing porcine musculoskeletal tissues and demonstrating the native-like compositional properties of these decellularized tissues. The ability to produce decellularized tissue in an automated manner is useful for further research of ECM-based materials and potential clinical applications.
Also flagged:Extracellular Vesiclesextracellularvesiclestumor necrosis factor-αdextransulfate
Journal Article2022-04-01✓ 1 SnippetLin Y, Lu Y, Huang Z, Wang Y, Song S, Luo Y, Ren F, Guo H, Guo H.
In-Text Gene Mentions
Abstract)
…(Lgr5), olfactomedin 4 (Olfm4), and Achaete-Scute Family…
Show Full Abstract
<h4>Scope</h4>Milk-derived small extracellular vesicles (M-sEVs) are critical bioactive components in milk. They are considered to be regulators in milk that may have promising applications. Understanding their biological effects would be important in nutrition. Intestinal organoids and mice are used to explore the effects of M-sEVs on intestinal regeneration.<h4>Methods and results</h4>M-sEVs could be absorbed by intestinal epithelia and upregulate expression of the microRNAs (miRNAs) expressed in milk: miR-148a, miR-22, miR-30, and miR-29a. Interestingly, M-sEVs promote proliferation of intestinal epithelia and repairs the epithelial damage that is caused by tumor necrosis factor-α in intestinal organoids. M-sEVs ameliorate intestinal mucosa damage in mice caused by treatment with dextran sulfate sodium, as well as increasing expression of the intestinal stem cells (ISC) markers leucine-rich repeat containing G-protein-coupled receptor 5 (Lgr5), olfactomedin 4 (Olfm4), and Achaete-Scute Family BHLH Transcription Factor 2 (Ascl2) and stimulating intestinal epithelial proliferation to repair epithelial damage. Furthermore, miR-29 is more abundant in M-sEVs-treated mice, and miR-29 could upregulate expression of ISC marker genes and accelerates intestinal regeneration to recover damaged intestinal epithelia.<h4>Conclusions</h4>We reveal that M-sEVs and miR-29 can accelerate intestinal stem cell-mediated epithelial regeneration and repair epithelial damage.
Also flagged:protein synthesishistaminetranscription factorisopropyltranslationaltranscription factors
Journal Article2022-04-01No SnippetsTabuchi T, Yokobayashi Y.
Show Full Abstract
Cell-free systems that display complex functions without using living cells are emerging as new platforms to test our understanding of biological systems as well as for practical applications such as biosensors and biomanufacturing. Those that use cell-free protein synthesis (CFPS) systems to enable genetically programmed protein synthesis have relied on genetic regulatory components found or engineered in living cells. However, biological constraints such as cell permeability, metabolic stability, and toxicity of signaling molecules prevent development of cell-free devices using living cells even if cell-free systems are not subject to such constraints. Efforts to engineer regulatory components directly in CFPS systems thus far have been based on low-throughput experimental approaches, limiting the availability of basic components to build cell-free systems with diverse functions. Here, we report a high-throughput screening method to engineer cell-free riboswitches that respond to small molecules. Droplet-sorting of riboswitch variants in a CFPS system rapidly identified cell-free riboswitches that respond to compounds that are not amenable to bacterial screening methods. Finally, we used a histamine riboswitch to demonstrate chemical communication between cell-sized droplets.
Also flagged:deathhypoxic-ischemic encephalopathyHIEencephalopathyvisionhearing
Journal Article2022-04-01No SnippetsShukla VV, Bann CM, Ramani M, Ambalavanan N, Peralta-Carcelen M, Hintz SR, Higgins RD, Natarajan G, Laptook AR, Shankaran S, Carlo WA.
Show Full Abstract
<h4>Objective</h4>To test the hypothesis that an Apgar score at 10 minutes is independently predictive for death or moderate or severe disability.<h4>Methods</h4>A secondary analysis of the Optimizing Cooling Trial (NCT01192776) including 347 infants with ≥36 weeks' gestational age at birth and hypoxic-ischemic encephalopathy and 18- to 22-month outcomes from 18 US centers in the National Institute of Child Health and Human Development Neonatal Research Network. The primary outcome was the composite of death or moderate/severe disability at 18 to 22 months of age. Generalized estimating equation models were used to examine the relationship between Apgar scores and outcomes, controlling for center, hypothermia treatment, and severity of hypoxic-ischemic encephalopathy (HIE). Classification and regression tree analyses were conducted to identify combinations of variables available during resuscitation that were most predictive for the composite outcome and death.<h4>Results</h4>The study revealed that 50% (13 of 26) of infants with a 10-minute Apgar score of 0 survived; 46% (6 of 13) had no disability, 16% (2 of 13) had mild disability, and 38% (5 of 13) had moderate or severe disability. The 10-minute Apgar score of 0 was independently associated with death or moderate or severe disability (adjusted relative risk = 1.72, 95% confidence interval 1.11-2.68, P value = .016), but the area under the curve analysis (AUC) was low (AUC = 0.56). The predictive accuracy improved when the 10-minute Apgar score was combined with other risk variables available during resuscitation by using a classification and regression tree analysis (AUC = 0.66).<h4>Conclusions</h4>A 10-minute Apgar score of 0 alone does not predict the risk of death or moderate or severe disability well. The current study provides evidence in support of the 2020 American Heart Association/International Liaison Committee on Resuscitation recommendation for continuing resuscitative efforts for infants who need cardiopulmonary resuscitation at 10 minutes after birth.
Also flagged:-Traumatic EpilepsyPost-traumatic epilepsytraumatic brain injuryepilepsyconcussionbrain injuries
Journal Article2022-04-01No SnippetsGolub VM, Reddy DS.
Show Full Abstract
Post-traumatic epilepsy (PTE) is one of the most devastating long-term, network consequences of traumatic brain injury (TBI). There is currently no approved treatment that can prevent onset of spontaneous seizures associated with brain injury, and many cases of PTE are refractory to antiseizure medications. Post-traumatic epileptogenesis is an enduring process by which a normal brain exhibits hypersynchronous excitability after a head injury incident. Understanding the neural networks and molecular pathologies involved in epileptogenesis are key to preventing its development or modifying disease progression. In this article, we describe a critical appraisal of the current state of PTE research with an emphasis on experimental models, molecular mechanisms of post-traumatic epileptogenesis, potential biomarkers, and the burden of PTE-associated comorbidities. The goal of epilepsy research is to identify new therapeutic strategies that can prevent PTE development or interrupt the epileptogenic process and relieve associated neuropsychiatric comorbidities. Therefore, we also describe current preclinical and clinical data on the treatment of PTE sequelae. Differences in injury patterns, latency period, and biomarkers are outlined in the context of animal model validation, pathophysiology, seizure frequency, and behavior. Improving TBI recovery and preventing seizure onset are complex and challenging tasks; however, much progress has been made within this decade demonstrating disease modifying, anti-inflammatory, and neuroprotective strategies, suggesting this goal is pragmatic. Our understanding of PTE is continuously evolving, and improved preclinical models allow for accelerated testing of critically needed novel therapeutic interventions in military and civilian persons at high risk for PTE and its devastating comorbidities. SIGNIFICANCE STATEMENT: Post-traumatic epilepsy is a chronic seizure condition after brain injury. With few models and limited understanding of the underlying progression of epileptogenesis, progress is extremely slow to find a preventative treatment for PTE. This study reviews the current state of modeling, pathology, biomarkers, and potential interventions for PTE and comorbidities. There's new optimism in finding a drug therapy for preventing PTE in people at risk, such as after traumatic brain injury, concussion, and serious brain injuries, especially in military persons.
Also flagged:GlycansNotchdigestionNOTCH1NOTCH2DLL1
Journal Article2022-04-01✓ 1 SnippetNauman M, Stanley P.
In-Text Gene Mentions
Text
…Olfm4…
Show Full Abstract
Intestinal homeostasis is key to the maintenance of good health. The small intestine plays important roles in absorption, digestion, hormonal and immune functions. Crypt base columnar (CBC) stem cells residing at the bottom of crypts are nurtured by Paneth cells, and together create the stem cell niche, the foundation of intestinal homeostasis. CBC stem cells replicate to replenish their number, or differentiate into a variety of epithelial cells with specialized functions. Notch signaling is a cell-cell signaling pathway that regulates both the proliferation and differentiation of CBC stem cells. NOTCH1 and NOTCH2 stimulated by canonical Notch ligands DLL1 and DLL4 mediate Notch signaling in the intestine that, in concert with other signaling pathways including the WNT and BMP pathways, determines cell fates. Importantly, interactions between Notch receptors and canonical Notch ligands are regulated by O-glycans linked to Ser/Thr in epidermal growth factor-like (EGF) repeats of the Notch receptor extracellular domain (NECD). The O-glycans attached to NECD are key regulators of the strength of Notch signaling. Imbalances in Notch signaling result in altered cell fate decisions and may lead to cancer in the intestine. In this review, we summarize the impacts of mutations in Notch pathway members on intestinal development and homeostasis, with a focus on the glycosyltransferases that transfer O-glycans to EGF repeats of NOTCH1, NOTCH2, DLL1 and DLL4.
Also flagged:CDK12waterskin diseasestranscription factorsepidermalcyclin-dependent kinases
Journal Article2022-04-01No SnippetsLi J, Tiwari M, Chen Y, Luanpitpong S, Sen GL.
Show Full Abstract
Proper differentiation of the epidermis is essential to prevent water loss and to protect the body from the outside environment. Perturbations in this process can lead to a variety of skin diseases that impacts 1 in 5 people. While transcription factors that control epidermal differentiation have been well characterized, other aspects of transcription control such as elongation are poorly understood. Here we show that of the two cyclin-dependent kinases (CDK12 and CDK13), that are known to regulate transcription elongation, only CDK12 is necessary for epidermal differentiation. Depletion of CDK12 led to loss of differentiation gene expression and absence of skin barrier formation in regenerated human epidermis. CDK12 binds to genes that code for differentiation promoting transcription factors (GRHL3, KLF4, and OVOL1) and is necessary for their elongation. CDK12 is necessary for elongation by promoting Ser2 phosphorylation on the C-terminal domain of RNA polymerase II and the stabilization of binding of the elongation factor SPT6 to target genes. Our results suggest that control of transcription elongation by CDK12 plays a prominent role in adult cell fate decisions.
Also flagged:RAGantibodiesT-cell receptorsgene expressionreverse transcriptionretrotransposon
Journal Article2022-04-01No SnippetsFrith MC.
Show Full Abstract
Genomes hold a treasure trove of protein fossils: Fragments of formerly protein-coding DNA, which mainly come from transposable elements (TEs) or host genes. These fossils reveal ancient evolution of TEs and genomes, and many fossils have been exapted to perform diverse functions important for the host's fitness. However, old and highly degraded fossils are hard to identify, standard methods (e.g. BLAST) are not optimized for this task, and few Paleozoic protein fossils have been found. Here, a recently optimized method is used to find protein fossils in vertebrate genomes. It finds Paleozoic fossils predating the amphibian/amniote divergence from most major TE categories, including virus-related Polinton and Gypsy elements. It finds 10 fossils in the human genome (eight from TEs and two from host genes) that predate the last common ancestor of all jawed vertebrates, probably from the Ordovician period. It also finds types of transposon and retrotransposon not found in human before. These fossils have extreme sequence conservation, indicating exaptation: some have evidence of gene-regulatory function, and they tend to lie nearest to developmental genes. Some ancient fossils suggest "genome tectonics," where two fragments of one TE have drifted apart by up to megabases, possibly explaining gene deserts and large introns. This paints a picture of great TE diversity in our aquatic ancestors, with patchy TE inheritance by later vertebrates, producing new genes and regulatory elements on the way. Host-gene fossils too have contributed anciently conserved DNA segments. This paves the way to further studies of ancient protein fossils.
Also flagged:Angiotensin-Converting EnzymeCRIM1NELL1CACNA1DVOPP1MYBPC1
Journal Article2022-04-01No SnippetsLee CJ, Choi B, Pak H, Park JM, Lee JH, Lee SH.
Show Full Abstract
<h4>Purpose</h4>Angiotensin-converting enzyme inhibitors (ACEIs) are medications generally prescribed for patients with high cardiovascular risk; however, they are suboptimally used due to frequent adverse events (AEs). The present study aimed to identify and replicate the genetic variants associated with ACEI-related AEs in the Korean population.<h4>Materials and methods</h4>A two-stage approach employing genome-wide association study (GWAS)-based discovery and replication through target sequencing was used. In total, 1300 individuals received ACEIs from 2001 to 2007; among these, 228 were selected for GWAS. An additional 336 patients were selected for replication after screening 1186 subjects treated from 2008 to 2018. Candidate genes for target sequencing were selected based on the present GWAS, previous GWASs, and data from the PharmGKB database. Furthermore, association analyses were performed between no AE and AE or cough groups after target sequencing.<h4>Results</h4>Five genes, namely <i>CRIM1</i>, <i>NELL1</i>, <i>CACNA1D</i>, <i>VOPP1</i>, and <i>MYBPC1</i>, were identified near variants associated with ACEI-related AEs. During target sequencing of 34 candidate genes, six single-nucleotide polymorphisms (SNPs; rs5224, rs8176786, rs10766756, rs561868018, rs4974539, and rs10946364) were replicated for association with all ACEI-related AEs. Four of these SNPs and rs147912715 exhibited associations with ACEI-related cough, whereas four SNPs (rs5224, rs81767786, rs10766756, and rs4974539 near <i>BDKRB2</i>, <i>NELL1</i>, <i>NELL1</i> intron, and <i>CPN2</i>, respectively) were significantly associated with both categories of AEs.<h4>Conclusion</h4>Several variants, including novel and known variants, were successfully replicated and found to have associations with ACEI-related AEs. These results provide rare and clinically relevant information for safer use of ACEIs.
Also flagged:bindingmRNA-binding proteinsT-cell co-receptorRoquinOx40RBP
Journal Article2022-04-01✓ 1 SnippetTants JN, Becker LM, McNicoll F, Müller-McNicoll M, Schlundt A.
In-Text Gene Mentions
Methods)
…expression of murineRoquin-1constructs a single,…
Show Full Abstract
Control of posttranscriptional mRNA decay is a crucial determinant of cell homeostasis and differentiation. mRNA lifetime is governed by cis-regulatory elements in their 3' untranslated regions (UTR). Despite ongoing progress in the identification of cis elements we have little knowledge about the functional and structural integration of multiple elements in 3'UTR regulatory hubs and their recognition by mRNA-binding proteins (RBPs). Structural analyses are complicated by inconsistent mapping and prediction of RNA fold, by dynamics, and size. We here, for the first time, provide the secondary structure of a complete mRNA 3'UTR. We use NMR spectroscopy in a divide-and-conquer strategy complemented with SAXS, In-line probing and SHAPE-seq applied to the 3'UTR of Ox40 mRNA, which encodes a T-cell co-receptor repressed by the protein Roquin. We provide contributions of RNA elements to Roquin-binding. The protein uses its extended bi-modal ROQ domain to sequentially engage in a 2:1 stoichiometry with a 3'UTR core motif. We observe differential binding of Roquin to decay elements depending on their structural embedment. Our data underpins the importance of studying RNA regulation in a full sequence and structural context. This study serves as a paradigm for an approach in analysing structured RNA-regulatory hubs and their binding by RBPs.
…measurements for theHtt‐transfected cells as well…
Methods)
…slightly for theHtt‐transfected cells on the…
Show Full Abstract
Protein aggregation is a hallmark of several severe neurodegenerative disorders such as Huntington's, Parkinson's, or Alzheimer's disease. Metal ions play a profound role in protein aggregation and altered metal-ion homeostasis is associated with disease progression. Here we utilize μ-X-ray fluorescence imaging in combination with rapid freezing to resolve the elemental distribution of phosphorus, sulfur, potassium, and zinc in huntingtin exon-1-mYFP expressing HeLa cells. Using quantitative XRF analysis, we find a threefold increase in zinc and a 10-fold enrichment of potassium that can be attributed to cellular stress response. While the averaged intracellular ion areal masses are significantly different in aggregate-containing cells, a local intracellular analysis shows no different ion content at the location of intracellular inclusion bodies. The results are compared to corresponding experiments on HeLa cells forming pseudoisocyanine chloride aggregates. As those show similar results, changes in ion concentrations are not exclusively linked to huntingtin exon-1 amyloid formation.
Also flagged:type 1 diabetes mellitusmitochondrialliverhepatocellular carcinomaglucosegene expression
Journal Article2022-04-01No SnippetsHou Y, Ding W, Wu P, Liu C, Ding L, Liu J, Wang X.
Show Full Abstract
<h4>Background</h4>Type 1 diabetes mellitus (T1D) is a worldwide health priority due to autoimmune destruction and is associated with an increased risk of multiorgan complications. Among these complications, effective interventions for liver injury, which can progress to liver fibrosis and hepatocellular carcinoma, are lacking. Although stem cell injection has a therapeutic effect on T1D, whether it can cure liver injury and the underlying mechanisms need further investigation.<h4>Methods</h4>Sprague-Dawley rats with streptozotocin (STZ)-induced T1D were treated with adipose-derived stem cell (ADSC) or PBS via the tail vein formed the ADSC group or STZ group. Body weights and blood glucose levels were examined weekly for 6 weeks. RNA-seq and PCR array were used to detect the difference in gene expression of the livers between groups.<h4>Results</h4>In this study, we found that ADSCs injection alleviated hepatic oxidative stress and injury and improved liver function in rats with T1D; potential mechanisms included cytokine activity, energy metabolism and immune regulation were potentially involved, as determined by RNA-seq. Moreover, ADSC treatment altered the fibroblast growth factor 21 (FGF21) and transforming growth factor β (TGF-β) levels in T1D rat livers, implying its repair capacity. Disordered intracellular energy metabolism, which is closely related to mitochondrial stress and dysfunction, was inhibited by ADSC treatment. PCR array and ingenuity pathway analyses suggested that the ADSC-induced suppression of mitochondrial stress is related to decreased necroptosis and apoptosis. Moreover, mitochondria-related alterations caused liver inflammation, resulting in liver injury involving the T lymphocyte-mediated immune response.<h4>Conclusions</h4>Overall, these results improve our understanding of the curative effect of ADSCs on T1D complications: ADSCs attenuate liver injury by inhibiting mitochondrial stress (apoptosis and dysfunctional energy metabolism) and alleviating inflammation (inflammasome expression and immune disorder). These results are important for early intervention in liver injury and for delaying the development of liver lesions in patients with T1D.
…ine-rich repeat-containing 7 (Lrrc7), and forkhead box…
Show Full Abstract
microRNA-592 (miR-592) has been linked to neurogenesis, but the influence of miR-592 knockout in vivo remains unknown. Here, we report that miR-592 knockout represses IPC-to-mature neuron transition, impairs motor coordination and reduces social interaction. Combining the RNA-seq and tandem mass tagging-based quantitative proteomics analysis (TMT protein quantification) and luciferase reporter assays, we identified MeCP2 as the direct targetgene of miR-592 in the mouse cortex. In Tg(MECP2) mice, lipofection of miR-592 efficiently reduced MECP2 expression in the brains of Tg(MECP2) mice at E14.5. Furthermore, treatment with miR-592 partially ameliorated the autism-like phenotypes observed in adult Tg(MECP2) mice. The findings demonstrate that miR-592 might play a novel role in treating the neurodevelopmental-associated disorder.
Also flagged:Colorectal cancertumorlocalizationTGF-βinterleukin-1FAP
Journal Article2022-04-01✓ 1 SnippetQi J, Sun H, Zhang Y, Wang Z, Xun Z, Li Z, Ding X, Bao R, Hong L, Jia W, Fang F, Liu H, Chen L, Zhong J, Zou D, Liu L, Han L, Ginhoux F, Liu Y, Ye Y, Su B.
In-Text Gene Mentions
Results)
…were positive forSOX6, FOXL1 ,…
Show Full Abstract
Colorectal cancer (CRC) is among the most common malignancies with limited treatments other than surgery. The tumor microenvironment (TME) profiling enables the discovery of potential therapeutic targets. Here, we profile 54,103 cells from tumor and adjacent tissues to characterize cellular composition and elucidate the potential origin and regulation of tumor-enriched cell types in CRC. We demonstrate that the tumor-specific FAP<sup>+</sup> fibroblasts and SPP1<sup>+</sup> macrophages were positively correlated in 14 independent CRC cohorts containing 2550 samples and validate their close localization by immuno-fluorescent staining and spatial transcriptomics. This interaction might be regulated by chemerin, TGF-β, and interleukin-1, which would stimulate the formation of immune-excluded desmoplasic structure and limit the T cell infiltration. Furthermore, we find patients with high FAP or SPP1 expression achieved less therapeutic benefit from an anti-PD-L1 therapy cohort. Our results provide a potential therapeutic strategy by disrupting FAP<sup>+</sup> fibroblasts and SPP1<sup>+</sup> macrophages interaction to improve immunotherapy.
Also flagged:Dopamineschizophreniabrain developmentD1RHaloperidolneurodevelopmental disorder
Journal Article2022-04-01✓ 1 SnippetBellon A, Feuillet V, Cortez-Resendiz A, Mouaffak F, Kong L, Hong LE, De Godoy L, Jay TM, Hosmalin A, Krebs MO.
In-Text Gene Mentions
Methods)
…one control hadhemochromatosis(Table 1 ).…
Show Full Abstract
The long lapse between the presumptive origin of schizophrenia (SCZ) during early development and its diagnosis in late adolescence has hindered the study of crucial neurodevelopmental processes directly in living patients. Dopamine, a neurotransmitter consistently associated with the pathophysiology of SCZ, participates in several aspects of brain development including pruning of neuronal extensions. Excessive pruning is considered the cause of the most consistent finding in SCZ, namely decreased brain volume. It is therefore possible that patients with SCZ carry an increased susceptibility to dopamine's pruning effects and that this susceptibility would be more obvious in the early stages of neuronal development when dopamine pruning effects appear to be more prominent. Obtaining developing neurons from living patients is not feasible. Instead, we used Monocyte-Derived-Neuronal-like Cells (MDNCs) as these cells can be generated in only 20 days and deliver reproducible results. In this study, we expanded the number of individuals in whom we tested the reproducibility of MDNCs. We also deepened the characterization of MDNCs by comparing its neurostructure to that of human developing neurons. Moreover, we studied MDNCs from 12 controls and 13 patients with SCZ. Patients' cells differentiate more efficiently, extend longer secondary neurites and grow more primary neurites. In addition, MDNCs from medicated patients expresses less D1R and prune more primary neurites when exposed to dopamine. Haloperidol did not influence our results but the role of other antipsychotics was not examined and thus, needs to be considered as a confounder.
Also flagged:NAFLDnonalcoholic fatty liver diseasetype 2 diabetes mellitusalcoholviral hepatitisnonalcoholic steatohepatitis
Journal Article2022-04-01✓ 1 SnippetNoureddin M, Ntanios F, Malhotra D, Hoover K, Emir B, McLeod E, Alkhouri N.
In-Text Gene Mentions
Discussion)
…biliary cholangitis, andhemochromatosis, could not be…
Show Full Abstract
This cohort analysis investigated the prevalence of nonalcoholic fatty liver disease (NAFLD) and NAFLD with fibrosis at different stages, associated clinical characteristics, and comorbidities in the general United States population and a subpopulation with type 2 diabetes mellitus (T2DM), using the National Health and Nutrition Examination Survey (NHANES) database (2017-2018). Machine learning was explored to predict NAFLD identified by transient elastography (FibroScan<sup>®</sup> ). Adults ≥20 years of age with valid transient elastography measurements were included; those with high alcohol consumption, viral hepatitis, or human immunodeficiency virus were excluded. Controlled attenuation parameter ≥302 dB/m using Youden's index defined NAFLD; vibration-controlled transient elastography liver stiffness cutoffs were ≤8.2, ≤9.7, ≤13.6, and >13.6 kPa for F0-F1, F2, F3, and F4, respectively. Predictive modeling, using six different machine-learning approaches with demographic and clinical data from NHANES, was applied. Age-adjusted prevalence of NAFLD and of NAFLD with F0-F1 and F2-F4 fibrosis was 25.3%, 18.9%, and 4.4%, respectively, in the overall population and 54.6%, 32.6%, and 18.3% in those with T2DM. The highest prevalence was among Mexican American participants. Test performance for all six machine-learning models was similar (area under the receiver operating characteristic curve, 0.79-0.84). Machine learning using logistic regression identified male sex, hemoglobin A1c, age, and body mass index among significant predictors of NAFLD (P ≤ 0.01). Conclusion: Data show a high prevalence of NAFLD with significant fibrosis (≥F2) in the general United States population, with greater prevalence in participants with T2DM. Using readily available, standard demographic and clinical data, machine-learning models could identify subjects with NAFLD across large data sets.
Also flagged:Toll-like receptorcytokineMyelodysplastic syndromeshematopoietic stem cell disorderspathogenesisTLR
Journal Article2022-04-01No SnippetsParacatu LC, Monlish DA, Greenberg ZJ, Fisher DAC, Walter MJ, Oh ST, Schuettpelz LG.
Show Full Abstract
Myelodysplastic syndromes (MDS) are hematopoietic stem cell disorders, the pathogenesis of which involves enhanced immune signaling that promotes or selects for mutant hematopoietic stem and progenitor cells (HSPCs). In particular, toll-like receptor (TLR) expression and signaling are enhanced in MDS, and their inhibition is an attractive therapeutic strategy. Although prior studies have reported increased expression of TLR2 and its binding partners TLR1 and TLR6 in the CD34<sup>+</sup> cells of patients with MDS (especially those with low-risk disease), TLR expression in other cell types throughout the bone marrow is largely unknown. To address this, we used mass cytometry to assess the expression of TLR1, TLR2, and TLR6 and cytokines in the bone marrow hematopoietic cells of six low/intermediate-risk and six high-risk unmatched MDS bone marrow samples, as well as healthy controls, both at baseline and in response to TLR agonists. We observed several consistent differences between the groups. Most notably, TLR expression was upregulated in multiple cell populations in the low/intermediate-risk, but not high-risk, patients. In addition, many cytokines, including interleukin-6, interleukin-8, tumor necrosis factor α, transforming growth factor β, macrophage inflammatory protein 1β, and granzyme B, were highly expressed from various cell types in low/intermediate-risk patients. However, these same cytokines, with the exception of transforming growth factor β, were expressed at lower levels in high-risk MDS. Together, these findings highlight the differential role of inflammation, and specifically TLR expression, in low/intermediate- versus high-risk MDS, and suggest that elevated TLR expression and cytokine production in multiple cell types likely influences the pathogenesis of MDS in lower-risk patients.
Also flagged:SETMARtransposasebindinglysine methyltransferaseTIRhydrogen
Journal Article2022-04-01✓ 1 SnippetChen Q, Bates AM, Hanquier JN, Simpson E, Rusch DB, Podicheti R, Liu Y, Wek RC, Cornett EM, Georgiadis MM.
In-Text Gene Mentions
Results)
…, NRSN1 ,NEGR1, TTPA ,…
Show Full Abstract
Extensive portions of the human genome have unknown function, including those derived from transposable elements. One such element, the DNA transposon Hsmar1, entered the primate lineage approximately 50 million years ago leaving behind terminal inverted repeat (TIR) sequences and a single intact copy of the Hsmar1 transposase, which retains its ancestral TIR-DNA-binding activity, and is fused with a lysine methyltransferase SET domain to constitute the chimeric SETMAR gene. Here, we provide a structural basis for recognition of TIRs by SETMAR and investigate the function of SETMAR through genome-wide approaches. As elucidated in our 2.37 Å crystal structure, SETMAR forms a dimeric complex with each DNA-binding domain bound specifically to TIR-DNA through the formation of 32 hydrogen bonds. We found that SETMAR recognizes primarily TIR sequences (∼5000 sites) within the human genome as assessed by chromatin immunoprecipitation sequencing analysis. In two SETMAR KO cell lines, we identified 163 shared differentially expressed genes and 233 shared alternative splicing events. Among these genes are several pre-mRNA-splicing factors, transcription factors, and genes associated with neuronal function, and one alternatively spliced primate-specific gene, TMEM14B, which has been identified as a marker for neocortex expansion associated with brain evolution. Taken together, our results suggest a model in which SETMAR impacts differential expression and alternative splicing of genes associated with transcription and neuronal function, potentially through both its TIR-specific DNA-binding and lysine methyltransferase activities, consistent with a role for SETMAR in simian primate development.
Longstanding racial/ethnic inequalities in morbidity and mortality persist in the United States. Although the determinants of health inequalities are complex, social and structural factors produced by inequitable and racialized systems are recognized as contributing sources. Social epigenetics is an emerging area of research that aims to uncover biological pathways through which social experiences affect health outcomes. A growing body of literature links adverse social exposures to epigenetic mechanisms, namely DNA methylation, offering a plausible pathway through which health inequalities may arise. This review provides an overview of social epigenetics and highlights existing literature linking social exposures-i.e., psychosocial stressors, racism, discrimination, socioeconomic position, and neighborhood social environment-to DNA methylation in humans. We conclude with a discussion of social epigenetics as a mechanistic link to health inequalities and provide suggestions for future social epigenetics research on health inequalities.
Also flagged:neurocristopathiesembryogenesisNCcancercardiac diseasesBone Morphogenic Protein
Journal Article2022-04-01No SnippetsAntonaci M, Wheeler GN.
Show Full Abstract
The neural crest (NC) is a vertebrate-specific migratory population of multipotent stem cells that originate during late gastrulation in the region between the neural and non-neural ectoderm. This population of cells give rise to a range of derivatives, such as melanocytes, neurons, chondrocytes, chromaffin cells, and osteoblasts. Because of this, failure of NC development can cause a variety of pathologies, often syndromic, that are globally called neurocristopathies. Many genes are known to be involved in NC development, but not all of them have been identified. In recent years, attention has moved from protein-coding genes to non-coding genes, such as microRNAs (miRNA). There is increasing evidence that these non-coding RNAs are playing roles during embryogenesis by regulating the expression of protein-coding genes. In this review, we give an introduction to miRNAs in general and then focus on some miRNAs that may be involved in NC development and neurocristopathies. This new direction of research will give geneticists, clinicians, and molecular biologists more tools to help patients affected by neurocristopathies, as well as broadening our understanding of NC biology.
Also flagged:neuropsychiatric diseasedopaminesynthesisnucleusbrain disordersgene expression
Journal Article2022-04-01✓ 1 SnippetPhillips RA, Tuscher JJ, Black SL, Andraka E, Fitzgerald ND, Ianov L, Day JJ.
In-Text Gene Mentions
Text
…Sox6…
Show Full Abstract
The ventral tegmental area (VTA) is a complex brain region that is essential for reward function and frequently implicated in neuropsychiatric disease. While decades of research on VTA function have focused on dopamine neurons, recent evidence has identified critical roles for GABAergic and glutamatergic neurons in reward processes. Additionally, although subsets of VTA neurons express genes involved in the synthesis and transport of multiple neurotransmitters, characterization of these combinatorial populations has largely relied on low-throughput methods. To comprehensively define the molecular architecture of the VTA, we performed single-nucleus RNA sequencing on 21,600 cells from the rat VTA. Analysis of neuronal subclusters identifies selective markers for dopamine and combinatorial neurons, reveals expression profiles for receptors targeted by drugs of abuse, and demonstrates population-specific enrichment of gene sets linked to brain disorders. These results highlight the heterogeneity of the VTA and provide a resource for further exploration of VTA gene expression.
DNA-binding transcription factors (TFs) remain challenging to target with molecular probes. Many TFs function in part through interaction with Mediator, a 26-subunit complex that controls RNA polymerase II activity genome-wide. We sought to block p53 function by disrupting the p53-Mediator interaction. Through rational design and activity-based screening, we characterize a stapled peptide, with functional mimics of both p53 activation domains, that blocks p53-Mediator binding and selectively inhibits p53-dependent transcription in human cells; importantly, this "bivalent" peptide has negligible impact, genome-wide, on non-p53 target genes. Our proof-of-concept strategy circumvents the TF entirely and targets the TF-Mediator interface instead, with desired functional outcomes (i.e., selective inhibition of p53 activation). Furthermore, these results demonstrate that TF activation domains represent viable starting points for Mediator-targeting molecular probes, as an alternative to large compound libraries. Different TFs bind Mediator through different subunits, suggesting this strategy could be broadly applied to selectively alter gene expression programs.
Also flagged:tumorEsophageal squamous cell carcinomaESCCmalignant tumorgene expressionHCP5
Journal Article2022-04-01✓ 1 SnippetWang Y, Yu Z, Shi W, Shen J, Guan Y, Ni F.
In-Text Gene Mentions
Introduction)
…via binding toSTAU1[ 12 ].…
Show Full Abstract
Esophageal squamous cell carcinoma (ESCC) is a deadly malignant tumor that threatens human health. Long noncoding RNA (lncRNA) is widely expressed in eukaryotes and is closely associated with human disease progression. However, its role in ESCC remains incompletely understood. In this study, we analyzed the results of three gene expression omnibus (GEO) databases containing lncRNA expression data of ESCC and normal tissues. The results showed that HCP5 was significantly overexpressed in ESCC tissues, which was further verified in our collected ESCC samples. The functional study suggested that HCP5 knockdown inhibited ESCC cell proliferation and invasion. Regarding the mechanism, HCP5 was able to directly interact with YTHDF1, a N6-methyladenosine (m<sup>6</sup>A) reader, enhancing the binding of YTHDF1 to m<sup>6</sup>A-modified HK2 mRNA, leading to increasing HK2 stability, thereby promoting the Warburg effect (aerobic glycolysis) of ESCC cells. The nude mice model showed that the knockdown of HCP5 in vivo remarkably reduced tumor size. Clinically, high HCP5 was positively correlated with larger tumor volume, higher TNM stage and lymph node metastasis. Moreover, ESCC patients with high HCP5 exerted shorter survival time than patients with low HCP5. These findings uncover the importance of HCP5 in human ESCC progression; the turbulence of HCP5/YTHDF1/HK2 axis may be responsible for ESCC carcinogenicity.
Also flagged:tumorFBXW7F-box and WD-repeat-domain-containing 7cell-cyclecell growthCYCLIN E1
Journal Article2022-04-01✓ 1 SnippetStephenson SEM, Costain G, Blok LER, Silk MA, Nguyen TB, Dong X, Alhuzaimi DE, Dowling JJ, Walker S, Amburgey K, Hayeems RZ, Rodan LH, Schwartz MA, Picker J, Lynch SA, Gupta A, Rasmussen KJ, Schimmenti LA, Klee EW, Niu Z, Agre KE, Chilton I, Chung WK, Revah-Politi A, Au PYB, Griffith C, Racobaldo M, Raas-Rothschild A, Ben Zeev B, Barel O, Moutton S, Morice-Picard F, Carmignac V, Cornaton J, Marle N, Devinsky O, Stimach C, Wechsler SB, Hainline BE, Sapp K, Willems M, Bruel AL, Dias KR, Evans CA, Roscioli T, Sachdev R, Temple SEL, Zhu Y, Baker JJ, Scheffer IE, Gardiner FJ, Schneider AL, Muir AM, Mefford HC, Crunk A, Heise EM, Millan F, Monaghan KG, Person R, Rhodes L, Richards S, Wentzensen IM, Cogné B, Isidor B, Nizon M, Vincent M, Besnard T, Piton A, Marcelis C, Kato K, Koyama N, Ogi T, Goh ES, Richmond C, Amor DJ, Boyce JO, Morgan AT, Hildebrand MS, Kaspi A, Bahlo M, Friðriksdóttir R, Katrínardóttir H, Sulem P, Stefánsson K, Björnsson HT, Mandelstam S, Morleo M, Mariani M, TUDP Study Group, Scala M, Accogli A, Torella A, Capra V, Wallis M, Jansen S, Weisfisz Q, de Haan H, Sadedin S, Broad Center for Mendelian Genomics, Lim SC, White SM, Ascher DB, Schenck A, Lockhart PJ, Christodoulou J, Tan TY.
In-Text Gene Mentions
Text
…FBXL4…
Show Full Abstract
Neurodevelopmental disorders are highly heterogenous conditions resulting from abnormalities of brain architecture and/or function. FBXW7 (F-box and WD-repeat-domain-containing 7), a recognized developmental regulator and tumor suppressor, has been shown to regulate cell-cycle progression and cell growth and survival by targeting substrates including CYCLIN E1/2 and NOTCH for degradation via the ubiquitin proteasome system. We used a genotype-first approach and global data-sharing platforms to identify 35 individuals harboring de novo and inherited FBXW7 germline monoallelic chromosomal deletions and nonsense, frameshift, splice-site, and missense variants associated with a neurodevelopmental syndrome. The FBXW7 neurodevelopmental syndrome is distinguished by global developmental delay, borderline to severe intellectual disability, hypotonia, and gastrointestinal issues. Brain imaging detailed variable underlying structural abnormalities affecting the cerebellum, corpus collosum, and white matter. A crystal-structure model of FBXW7 predicted that missense variants were clustered at the substrate-binding surface of the WD40 domain and that these might reduce FBXW7 substrate binding affinity. Expression of recombinant FBXW7 missense variants in cultured cells demonstrated impaired CYCLIN E1 and CYCLIN E2 turnover. Pan-neuronal knockdown of the Drosophila ortholog, archipelago, impaired learning and neuronal function. Collectively, the data presented herein provide compelling evidence of an F-Box protein-related, phenotypically variable neurodevelopmental disorder associated with monoallelic variants in FBXW7.
Also flagged:Inflammatory Myofibroblastic Tumormesenchymal tumortumorNSD1SOX9sintilimab
Journal Article2022-04-01No SnippetsMeng X, Zhang L, Wang Q, Chen J, Zhang C, Tao R, Wang Y.
Show Full Abstract
Inflammatory myofibroblastic tumor (IMT) is a rare mesenchymal tumor that can develop in numerous organs, most commonly in the lungs and rarely in the brain. Here, we reported a 55-year-old patient with nasopharyngeal IMT and the recurrence in the skull base, slope and pterygoid sinus who underwent cranial base and slope tumor resection. Postoperative magnetic resonance imaging (MRI) and multiplex immunohistochemistry (mIHC) showed tumor recurrence and metastasis to the intracalvarium. While genetic testing revealed no significant related gene mutations, tertiary mutations in NSD1 and SOX9 genes were identified in the tumor tissues. The patient achieved partial remission after receiving 7 cycles of immunotherapy (toripalimab 240 mg for 1 cycle followed by 6 cycles of sintilimab 200 mg), and MRI examination indicated an almost complete remission of intracranial IMT after 16 cycles of immunotherapy. In summary, the novel class of immune-targeted agents may be effective in clinical management of rare intracranial IMT.
Also flagged:Schiff Base2hydroxypyridinealkylpyridyltrypsin
Journal Article2022-04-01No SnippetsNada S, Hagar M, Farahat O, Hasanein AA, Emwas AH, Sharfalddin AA, Jaremko M, Zakaria MA.
Show Full Abstract
Three rings 2-hydroxypyridine liquid crystalline compounds have been prepared and fully characterized. The mesomorphic behavior of the prepared compounds has been investigated in terms of differential scanning calorimetry (DSC) and polarized optical microscopy (POM). Moreover, a comparative study between the prepared compounds and previously reported analogs has been discussed in terms of the orientation and position of the mesogenic core, in addition to the direction of the terminal alkyl chains. Furthermore, a detailed computational approach has been studied to illustrate the effect of geometrical and dimensional parameters on the type of the enhanced texture and the mesomorphic range and stability. The results of the DFT study revealed that the orientation of the mesogen could affect the mesomorphic behavior and this has been attributed in terms of the degree of the polarizability of the linking groups. This result has been confirmed by calculation of the net dipole moment and the molecular electrostatic potential that show how the mesogen orientation and position could impact the molecular charge separation. Finally, the effect of the pyridyl group has been also investigated in terms of the calculated aromaticity index and the π-π stacking.
Also flagged:HuntingtinTDP-43neurodegenerative disordersprotein aggregationHuntington diseaseamyotrophic lateral sclerosis
Journal Article2022-04-01✓ 5 SnippetsMarte L, Boronat S, Barrios R, Barcons-Simon A, Bolognesi B, Cabrera M, Ayté J, Hidalgo E.
In-Text Gene Mentions
Results)
…We expressed in S. pombe the Htt chimeras described by the Lindquist lab, which include the N-terminal domain of Htt fused to 25, 47, 97 and 103 polyQ repeats, followed by a proline-rich domain of Htt and the GFP tag [25] (Figure 1A).…
Results)
…Moreover, it has been described that depletion of the proline rich region of Htt is required to induce toxicity in budding yeast [27,44].…
Introduction)
…Regarding the ‘humanization’ of S. pombe to study the bases of neurodegenerative diseases, Supattapone and colleagues expressed Htt in fission yeast, to conclude that Htt.103Q can aggregate but cannot exert toxicity in this unicellular eukaryote [40,41].…
Introduction)
…In Huntington disease, the aggregation of a mutated protein, named Huntingtin (Htt) depends on the number of Q in the polyQ expansion [15,16,17].…
Introduction)
…Although the presence of aggregates often correlates with toxicity [18], it has been described that the oligomeric intermediates, formed before the constitution of the mature Htt deposits, are highly toxic and responsible for the cellular alterations observed in Huntington disease [19,20].…
Show Full Abstract
Many neurodegenerative disorders display protein aggregation as a hallmark, Huntingtin and TDP-43 aggregates being characteristic of Huntington disease and amyotrophic lateral sclerosis, respectively. However, whether these aggregates cause the diseases, are secondary by-products, or even have protective effects, is a matter of debate. Mutations in both human proteins can modulate the structure, number and type of aggregates, as well as their toxicity. To study the role of protein aggregates in cellular fitness, we have expressed in a highly tractable unicellular model different variants of Huntingtin and TDP-43. They each display specific patterns of aggregation and toxicity, even though in both cases proteins have to be very highly expressed to affect cell fitness. The aggregation properties of Huntingtin, but not of TDP-43, are affected by chaperones such as Hsp104 and the Hsp40 couple Mas5, suggesting that the TDP-43, but not Huntingtin, derivatives have intrinsic aggregation propensity. Importantly, expression of the aggregating form of Huntingtin causes a significant extension of fission yeast lifespan, probably as a consequence of kidnapping chaperones required for maintaining stress responses off. Our study demonstrates that in general these prion-like proteins do not cause toxicity under normal conditions, and in fact they can protect cells through indirect mechanisms which up-regulate cellular defense pathways.
<h4>Study objective</h4>Preoperative anemia results in two- to sixfold increased incidence of perioperative blood transfusion requirements and reduced postoperative hemoglobin (Hb) level. This prospective study was designed to investigate the effect of preoperative intravenous infusion of iron on Hb levels, blood transfusion requirements, and incidence of postoperative adverse events in patients undergoing coronary artery bypass grafting.<h4>Design</h4>Prospective randomized trial.<h4>Setting</h4>Academic university hospital.<h4>Patients</h4>Eighty patients (52-67 years old) underwent coronary artery bypass grafting and received either iron therapy or saline infusion preoperatively.<h4>Interventions</h4>Patients were randomly allocated to iron or placebo groups. In the iron group, patients received a single intravenous dose of ferric carboxymaltose (1000 mg in 100 mL saline) infused slowly over 15 min 7 days before surgery. In placebo group, patients received a single intravenous dose of saline (100 mL saline) infused slowly over 15 min 7 days before surgery.<h4>Measurements</h4>Patients were followed up with regards to incidence of anemia, Hb level on admission, preoperatively, postoperatively, 1 week and 4 weeks after discharge, aortic cross-clamp time, the number of packed red blood cells (pRBCs) units, the percentage of reticulocytes pre-postoperatively and 1 week later, hospital stay and intensive care unit (ICU) stay length, and the incidence of postoperative complications.<h4>Main results</h4>Iron therapy was associated with lower incidence of anemia 4 weeks after discharge (P < 0.001). Hb level was significantly higher in the iron group compared to the placebo group preoperatively and postoperatively, and 4 weeks after discharge (P < 0.001). Iron therapy resulted in shorter hospital and ICU stay (P < 0.001) and shorter aortic cross-clamp time, reduced pRBCs requirements postoperatively. Percentage of reticulocytes was significantly higher in placebo group than in iron group postoperatively and 1 week after discharge and the incidence of postoperative complications was similar to the placebo group.<h4>Conclusions</h4>Preoperative IV iron infusion is a safe and feasible way to manage preoperative anemia. Preoperative administration of IV iron is associated with a higher postoperative Hb level, shorter hospital and ICU stay, and reduced perioperative red blood cell transfusion requirements with insignificant difference in incidence of postoperative complications.
Also flagged:psychiatric diseaseserotonin transporterobsessive-compulsive disorderCOVID-19mental disorderpsychological distress
Journal Article2022-04-01✓ 5 SnippetsHarika-Germaneau G, Lafay-Chebassier C, Langbour N, Thirioux B, Wassouf I, Noël X, Jaafari N, Chatard A.
In-Text Gene Mentions
Introduction)
…gene (SLC6A4 or5-HTT).…
Introduction)
…the S-allele of5-HTT, compared to those…
Introduction)
…the S-allele of5-HTTmay confer a…
Methods)
…S/S) of the5-HTTgene.…
Results)
…allele of the5-HTTgene did not…
Show Full Abstract
<h4>Background</h4>The severity of symptoms represents an important source of distress in patients with a psychiatric disease. However, the extent to which this endogenous stress factor interacts with genetic vulnerability factors for predicting suicide risks remains unclear.<h4>Methods</h4>We evaluated whether the severity of symptoms interacts with a genetic vulnerability factor (the serotonin transporter gene-linked promoter region variation) in predicting the frequency of lifetime suicide attempts in patients with a psychiatric disease. Symptom severity and 5-HTTLPR polymorphism were collected from a sample of 95 patients with obsessive-compulsive disorder (OCD). Lifetime suicide attempt was the primary outcome, and antecedent of multiple suicide attempts was the secondary outcome.<h4>Results</h4>The gene-by-symptoms interaction was associated with an excess risk of suicide attempts (OR = 4.39, 95CI[1.44, 13.38], <i>p</i> < 0.009) and of multiple suicide attempts (OR = 4.18, 95CI[1.04, 16.77], <i>p</i> = 0.043). Symptom severity (moderate, severe, or extreme) was associated with an approximately five-fold increase in the odds of a lifetime suicide attempt in patients carrying one or two copies of the short allele of 5-HTTLPR. No such relationship was found for patients carrying the long allele.<h4>Conclusion</h4>This study provides preliminary evidence for the gene-by-stress interaction on suicide attempt when stress is operationalized as symptom severity. Progress in suicide research may come from efforts to investigate the gene-by-symptoms interaction hypothesis in a variety of diseases.
Also flagged:Lung Cancercancerhedgehogtissue homeostasisorgan developmenttumor
Journal Article2022-04-01✓ 2 SnippetsMa C, Hu K, Ullah I, Zheng QK, Zhang N, Sun ZG.
In-Text Gene Mentions
Introduction)
…The Kras/YY1/ZNF322/SHH transcriptional axis increases the expression levels of the SHH protein, leading to lung cancer malignant progression by inducing tumor angiogenesis (16).…
According to the latest statistics from the International Agency for Research on Cancer (IARC), lung cancer is one of the most lethal malignancies in the world, accounting for approximately 18% of all cancer-associated deaths. Yet, even with aggressive interventions for advanced lung cancer, the five-year survival rate remains low, at around 15%. The hedgehog signaling pathway is highly conserved during embryonic development and is involved in tissue homeostasis as well as organ development. However, studies have documented an increasing prevalence of aberrant activation of HH signaling in lung cancer patients, promoting malignant lung cancer progression with poor prognostic outcomes. Inhibitors targeting the HH pathway have been widely used in tumor therapy, however, they still cannot avoid the occurrence of drug resistance. Interestingly, natural products, either alone or in combination with chemotherapy, have greatly improved overall survival outcomes for lung cancer patients by acting on the HH signaling pathway because of its unique and excellent pharmacological properties. In this review, we elucidate on the underlying molecular mechanisms through which the HH pathway promotes malignant biological behaviors in lung cancer, as well as the potential of inhibitors or natural compounds in targeting HH signaling for clinical applications in lung cancer therapy.
Also flagged:infertilitygene expressionphosphorylationubiquitinproteolysisBcl6b
Journal Article2022-04-01No SnippetsDe Oliveira CS, Nixon B, Lord T.
Show Full Abstract
Spermatogonial stem cell (SSC) function is essential for male fertility, and these cells hold potential therapeutic value spanning from human infertility treatments to wildlife conservation. As <i>in vitro</i> culture is likely to be an integral component of many therapeutic pipelines, we have elected to explore changes in gene expression occurring in undifferentiated spermatogonia in culture that may be intertwined with the temporal reduction in regenerative capacity that they experience. Single cell RNA-sequencing analysis was conducted, comparing undifferentiated spermatogonia retrieved from the adult mouse testis with those that had been subjected to 10 weeks of <i>in vitro</i> culture. Although the majority of SSC signature genes were conserved between the two populations, a suite of differentially expressed genes were also identified. Gene ontology analysis revealed upregulated expression of genes involved in oxidative phosphorylation in cultured spermatogonia, along with downregulation of integral processes such as DNA repair and ubiquitin-mediated proteolysis. Indeed, our follow-up analyses have provided the first depiction of a significant accumulation of ubiquitinated proteins in cultured spermatogonia, when compared to those residing in the testis. The data produced in this manuscript will provide a valuable platform for future studies looking to improve SSC culture approaches and assess their safety for utilisation in therapeutic pipelines.
Also flagged:serotoninLmx1bPet1transcription factoraxonal growthaxonal
Journal Article2022-04-01No SnippetsKitt MM, Tabuchi N, Spencer WC, Robinson HL, Zhang XL, Eastman BA, Lobur KJ, Silver J, Mei L, Deneris ES.
Show Full Abstract
Neurons must function for decades of life, but how these non-dividing cells are preserved is poorly understood. Using mouse serotonin (5-HT) neurons as a model, we report an adult-stage transcriptional program specialized to ensure the preservation of neuronal connectivity. We uncover a switch in Lmx1b and Pet1 transcription factor function from controlling embryonic axonal growth to sustaining a transcriptomic signature of 5-HT connectivity comprising functionally diverse synaptic and axonal genes. Adult-stage deficiency of Lmx1b and Pet1 causes slowly progressing degeneration of 5-HT synapses and axons, increased susceptibility of 5-HT axons to neurotoxic injury, and abnormal stress responses. Axon degeneration occurs in a die back pattern and is accompanied by accumulation of α-synuclein and amyloid precursor protein in spheroids and mitochondrial fragmentation without cell body loss. Our findings suggest that neuronal connectivity is transcriptionally protected by maintenance of connectivity transcriptomes; progressive decay of such transcriptomes may contribute to age-related diseases of brain circuitry.
Also flagged:nivolumabrenal cell carcinomaRCCinterleukin-2 cytokinetumorlipase
Journal Article2022-04-01No SnippetsTannir NM, Cho DC, Diab A, Sznol M, Sznol M, Bilen MA, Balar AV, Grignani G, Puente E, Tang L, Chien D, Hoch U, Choudhury A, Yu D, Currie SL, Tagliaferri MA, Zalevsky J, Siefker-Radtke AO, Hurwitz ME.
Show Full Abstract
<h4>Background</h4>Immune checkpoint inhibitor-based combinations have expanded the treatment options for patients with renal cell carcinoma (RCC); however, tolerability remains challenging. The aim of this study was to evaluate the safety and efficacy of the immunostimulatory interleukin-2 cytokine prodrug bempegaldesleukin (BEMPEG) plus nivolumab (NIVO) as first-line therapy in patients with advanced clear-cell RCC.<h4>Methods</h4>This was an open-label multicohort, multicenter, single-arm phase 1/2 study; here, we report results from the phase 1/2 first-line RCC cohort (N=49). Patients received BEMPEG 0.006 mg/kg plus NIVO 360 mg intravenously every 3 weeks. The primary objectives were safety and objective response rate (ORR; patients with measurable disease at baseline and at least one postbaseline tumor response assessment). Secondary objectives included overall survival (OS) and progression-free survival (PFS). Exploratory biomarker analyses: association between baseline biomarkers and ORR.<h4>Results</h4>At a median follow-up of 32.7 months, the ORR was 34.7% (17/49 patients); 3/49 patients (6.1%) had a complete response. Of the 17 patients with response, 14 remained in response for >6 months, and 6 remained in response for >24 months. Median PFS was 7.7 months (95% CI 3.8 to 13.9), and median OS was not reached (95% CI 37.3 to not reached). Ninety-eight per cent (48/49) of patients experienced ≥1 treatment-related adverse event (TRAE) and 38.8% (19/49) had grade 3/4 TRAEs, most commonly syncope (8.2%; 4/49) and increased lipase (6.1%; 3/49). No association between exploratory biomarkers and ORR was observed. Limitations include the small sample size and single-arm design.<h4>Conclusions</h4>BEMPEG plus NIVO showed preliminary antitumor activity as first-line therapy in patients with advanced clear-cell RCC and was well tolerated. These findings warrant further investigation.
Journal Article2022-04-01✓ 1 SnippetDionisio LE, Yang XW.
In-Text Gene Mentions
Abstract)
…gain of polyQ-dependentHttinteracting partners is…
Show Full Abstract
In this issue of Cell Systems, Greco et al. define high-confidence polyglutamine-dependent huntingtin interactors using AP-MS and complementary approaches and categorize them based on their interaction abundance and stability. The study reveals that a toxic gain of polyQ-dependent Htt interacting partners is a robust feature of HD pathogenesis.
Endoplasmic reticulum quality control (ERQC) pathways comprising chaperones, folding enzymes, and degradation factors ensure the fidelity of ER protein folding and trafficking to downstream secretory environments. However, multiple factors, including tissue-specific secretory proteomes, environmental and genetic insults, and organismal aging, challenge ERQC. Thus, a key question is: how do cells adapt ERQC to match the diverse, ever-changing demands encountered during normal physiology and in disease? The answer lies in the unfolded protein response (UPR), a signaling mechanism activated by ER stress. In mammals, the UPR comprises three signaling pathways regulated downstream of the ER membrane proteins IRE1, ATF6, and PERK. Upon activation, these UPR pathways remodel ERQC to alleviate cellular stress and restore ER function. Here, we describe how UPR signaling pathways adapt ERQC, highlighting their importance for maintaining ER function across tissues and the potential for targeting the UPR to mitigate pathologies associated with protein misfolding diseases.
Also flagged:endoplasmic reticulummembrane-degradationmembranes-shaping
Journal Article2022-04-01No SnippetsGubas A, Dikic I.
Show Full Abstract
The endoplasmic reticulum (ER) is a hotspot for many essential cellular functions. The ER membrane is highly dynamic, which affects many cellular processes that take place within the ER. One such process is ER-phagy, a selective degradation of ER fragments (including membranes and luminal content), which serves to preserve the size of ER while adapting its morphology under basal and stress conditions. In order to be degraded, the ER undergoes selective fragmentation facilitated by specialized ER-shaping proteins that also act as ER-phagy receptors. Their ability to sense and induce membrane curvature, as well as to bridge the ER with autophagy machinery, allows for a successful ER fragmentation and delivery of these fragments to the lysosome for degradation and recycling. In this review, we provide insights into ER-phagy from the perspective of membrane remodeling. We highlight the importance of ER membrane dynamics during ER-phagy and emphasize how its dysregulation reflects on human physiology and pathology.
Also flagged:Myocardial InfarctionCOVID-19Acute myocardial infarctiondeathmultisystem inflammatory syndromeMIS-C
Journal Article2022-04-01✓ 1 SnippetCinteză E, Voicu C, Filip C, Ioniță M, Popescu M, Bălgrădean M, Nicolescu A, Mahmoud H.
In-Text Gene Mentions
I A O 0000613)
…T, CK, CK-MB,ATIII(to maintain a…
Show Full Abstract
Acute myocardial infarction (AMI) in children is rather anecdotic. However, following COVID-19, some conditions may develop which may favor thrombosis, myocardial infarction, and death. Such a condition is Kawasaki-like disease (K-lD). K-lD appears in children as a subgroup of the multisystem inflammatory syndrome (MIS-C). In some cases, K-lD patients may develop giant coronary aneurysms. The evolution and characteristics of coronary aneurysms from K-lD appear to be different from classical Kawasaki disease (KD) aneurysms. Differences include a lower percentage of aneurysm formation than in non-COVID-19 KD, a smaller number of giant forms, a tendency towards aneurysm regression, and fewer thrombotic events associated with AMI. We present here a review of the literature on the thrombotic risks of post-COVID-19 coronary aneurysms, starting from a unique clinical case of a 2-year-old boy who developed multiple coronary aneurysms, followed by AMI. In dehydration conditions, 6 months after COVID-19, the boy developed anterior descending artery occlusion and a slow favorable outcome of the AMI after thrombolysis. This review establishes severity criteria and risk factors that predispose to thrombosis and AMI in post-COVID-19 patients. These may include dehydration, thrombophilia, congenital malformations, chronic inflammatory conditions, chronic kidney impairment, acute cardiac failure, and others. All these possible complications should be monitored during acute illness. Ischemic heart disease prevalence in children may increase in the post-COVID-19 era, due to an association between coronary aneurysm formation, thrombophilia, and other risk factors whose presence will make a difference in long-term prognosis.
Also flagged:HDAC6ubiquitininfectionzincbindingstress granules
Journal Article2022-04-01✓ 1 SnippetWang L, Moreira EA, Kempf G, Miyake Y, Oliveira Esteves BI, Fahmi A, Schaefer JV, Dreier B, Yamauchi Y, Alves MP, Plückthun A, Matthias P.
In-Text Gene Mentions
Discussion)
…TDP-40, Tau, andHttin SGs (…
Show Full Abstract
The deacetylase HDAC6 has tandem catalytic domains and a zinc finger domain (ZnF) binding ubiquitin (Ub). While the catalytic domain has an antiviral effect, the ZnF facilitates influenza A virus (IAV) infection and cellular stress responses. By recruiting Ub via the ZnF, HDAC6 promotes the formation of aggresomes and stress granules (SGs), dynamic structures associated with pathologies such as neurodegeneration. IAV subverts the aggresome/HDAC6 pathway to facilitate capsid uncoating during early infection. To target this pathway, we generate designed ankyrin repeat proteins (DARPins) binding the ZnF; one of these prevents interaction with Ub in vitro and in cells. Crystallographic analysis shows that it blocks the ZnF pocket where Ub engages. Conditional expression of this DARPin reversibly impairs infection by IAV and Zika virus; moreover, SGs and aggresomes are downregulated. These results validate the HDAC6 ZnF as an attractive target for drug discovery.
Mitochondrion regulates cellular metabolism with the aid of its respiratory complexes; any defect within these complexes can result in mitochondrial malfunction and various conditions. One such mutation can occur in <i>SLC25A10</i>, resulting in mitochondrial DNA depletion syndrome. It should be noted that the pattern of inheritance of this syndrome is autosomal recessive. However, we present a case with compound heterozygous mutations within this gene resulting in disease. An 18-year-old female was referred to our clinic due to menopause with a medical history of hearing loss, spasticity, hypotonia and quadriparesis. The child's birth and development were uneventful until the initiation of movement reduction and hypotonia when she was 12 months old. Afterward, the hypotonia progressed to quadriparesis and spasticity throughout the years. Our patient became completely quadriplegic up to the age of 3 and became completely deaf at 10. Her puberty onset was at the age of 9, and no significant event took place until she was 17 years old when suddenly her periods, which were regular until that time, became irregular and ceased after a year; hence, a thorough evaluation began, but similar to her previous evaluations all tests were insignificant. Nonetheless, we suspected an underlying metabolic or genetic defect; thus, we ordered a whole-exome sequencing (WES) workup and found simultaneous heterozygous mutations within <i>SLC25A10</i>, <i>HFE</i> and <i>TTN</i> genes that could explain her condition. When all other tests fail, and we suspect an underlying genetic or metabolic cause, WES can be of great value.
Also flagged:tumorWNTtumorscanceresophageal carcinomaESCA
Journal Article2022-04-01✓ 1 SnippetFeng Y, Wang Y, Guo K, Feng J, Shao C, Pan M, Ding P, Liu H, Duan H, Lu D, Wang Z, Zhang Y, Zhang Y, Han J, Li X, Yan X.
In-Text Gene Mentions
Discussion)
…HMGB1, ENTPD1, TLR4,TNFSF4, BTN3A, ICAM1, IL1A,…
Show Full Abstract
<h4>Background</h4>Finding new immune-related biomarkers is one of the promising research directions for tumor immunotherapy. The <i>WNT5A</i> gene could stimulate the WNT pathway and regulate the progression of various tumors. Recent studies have partially revealed the relationship between <i>WNT5A</i> and tumor immunity, but the correlation and underlying mechanisms in pan-cancer remain obscure. Thus, we conducted this study aiming to characterize the prognostic value and immunological portrait of <i>WNT5A</i> in cancer.<h4>Methods</h4>The data obtained from The Cancer Genome Atlas (TCGA), Genotype-Tissue Expression (GTEx), and Cancer Cell Line Encyclopedia (CCLE) databases was utilized to analyze <i>WNT5A</i> expression levels by Kruskal-Wallis test and correlation to prognosis by Cox regression test and Kaplan-Meier test, while the data was also used to study the association between <i>WNT5A</i> expression and immune microenvironment, immune neoantigens, immune checkpoints, tumor mutational burden (TMB), and microsatellite instability (MSI) in pan-cancer. Gene set enrichment analysis (GSEA) was used to clarify the relevant signaling pathways. The R package was used for data analysis and to create the plots.<h4>Results</h4>The pan-cancer analysis revealed that the expression level of <i>WNT5A</i> is generally elevated in most tumors (19/34, 55.88%), and high <i>WNT5A</i> expression was correlated with poor prognosis in esophageal carcinoma (ESCA, P<0.05), low-grade glioma (LGG, P<0.01), adrenocortical carcinoma (ACC, P<0.01), pancreatic adenocarcinoma (PAAD, P<0.01), and head and neck squamous cell carcinoma (HNSC, P<0.05). In addition, <i>WNT5A</i> expression was positively associated with immune infiltration, stromal score, and immune checkpoints in most cancers, and correlated to immune neoantigens, TMB, and MSI. Finally, GSEA indicated that <i>WNT5A</i> is implicated in the transforming growth factor β (TGFβ), Notch, and Hedgehog signaling pathways, which may be related to tumor immunity.<h4>Conclusions</h4>The expression of <i>WNT5A</i> is elevated in most tumors and associated with tumor prognosis. Furthermore, <i>WNT5A</i> is associated with tumor immunity and may be an immunological biomarker in cancer.
Also flagged:Ferroptosismethylationbrain tumordeathtumorsGlioma
Journal Article2022-04-01✓ 1 SnippetZhong H, Wang Y, Jia J, Yang H, Zhang H, Li T, Liu H, Wang Y.
In-Text Gene Mentions
Discussion)
…SLC2A14had a difference…
Show Full Abstract
<h4>Background</h4>Glioblastoma multiforme (GBM) is the most aggressive type of primary brain tumor. Ferroptosis is a form of cell death that is involved in regulating the biological behavior of tumors, and could become a promising potential biomarker in tumor diagnosis and treatment.<h4>Methods</h4>We used the expression of ferroptosis related genes in the Cancer Genome Atlas (TCGA) and Chinese Glioma Cooperative Group (CGCG) datasets to construct a prognostic prediction model and verified the expression by real-time polymerase chain reaction (RT-qPCR). Using TCGA genomic and epigenetic data, we analyzed the factors that regulate the expression of these ferroptosis related genes.<h4>Results</h4>We used 15 ferroptosis related genes related to the prognosis of GBM to establish a prognostic predictive risk model. The area under the curve (AUC) of this model was 0.907, which had good utility in predicting the prognosis of GBM, and could be used as an independent prognostic indicator for GBM patients. We verified the expression of these risk genes by RT-qPCR in 30 independent pairs of tumors and adjacent tissues. Genomic and epigenetic analysis of risk genes found that the expressions of these genes were mainly regulated by methylation, not copy number variation in GBM.<h4>Conclusions</h4>The ferroptosis related characteristics proposed in this study can potentially predict the prognosis of GBM patients, and these prognostic-related genes are generally regulated by methylation.
Accumulating evidence indicates that ER-phagy serves as a key adaptive regulatory mechanism in response to various stress conditions. However, the exact mechanisms underlying ER-phagy in the pathogenesis of intervertebral disc degeneration remain largely unclear. In the present study, we demonstrated that RETREG1-mediated ER-phagy is induced by glucose deprivation (GD) treatment, along with ER stress activation and cell function decline. Importantly, ER-phagy was shown to be crucial for cell survival under GD conditions. Furthermore, ER stress was suggested as an upstream event of ER-phagy upon GD treatment and upregulation of ER-phagy could counteract the ER stress response. Therefore, our findings indicate that RETREG1-mediated ER-phagy activation protects against GD treatment-induced cell injury via modulating ER stress in human nucleus pulposus cells.
<h4>Aims</h4>Peroxiredoxins (PRDX6) regulates the occurrence and progression of cancer. The aim of this study is to investigate the effect of PRDX6 knockdown on the biological behavior of human gastric cancer cell line BGC-823 cells.<h4>Settings and design</h4>Research article.<h4>Subjects and methods</h4>The differential expression of PRDX6 in gastric cancer and normal gastric tissues was tested by immunohistochemistry. Ribonucleic acid plasmid of PRDX6 gene was packaged using a lentivirus, and BGC-823 cells were transfected with the lentivirus to obtain a BGC-823 cell line in which the expression of PRDX6 was stably silenced.<h4>Statistical analysis used</h4>The proliferation activity of BGC-823 cells was detected using the cell counting kit-8 method. The effect of PRDX6 on the migration and invasion of BGC-823 cells was evaluated using the scratch test and Transwell assay, and the expression of related proteins was detected by western blot.<h4>Results</h4>The expression of PRDX6 in gastric cancer was significantly increased (P < 0.05). Compared with those in the untransfected and negative control groups. The proliferation, migration, and invasion of gastric cancer BGC-823 cells were significantly inhibited, and the apoptotic rates were significantly increased in the lentivirus-transfected (short hairpin-PRDX6) group. Western blot analysis showed that the expression of Bax protein increased, whereas that of proliferating cell nuclear antigen, Bcl-2, PI3K, phospho (p-Akt), and phosphorylated-mammalian target of rapamycin (mTOR) decreased significantly compared with that in WT and vector groups (P < 0.05).<h4>Conclusion</h4>The knockdown of PRDX6 gene expression in BGC-823 cells can inhibit the proliferation, migration, and invasion of gastric cancer cells and promote apoptosis, thereby affecting gastric cancer cells.
Also flagged:non-alcoholic fatty liver diseasenon-alcoholic steatohepatitisNAFLDsimple steatosisNASHcirrhosis
Journal Article2022-04-01✓ 1 SnippetAl Danaf L, Hussein Kamareddine M, Fayad E, Hussain A, Farhat S.
In-Text Gene Mentions
Introduction)
…hepatitis alcohol abuse,hemochromatosis, and metabolic disorders…
Show Full Abstract
<h4>Background</h4>Non-alcoholic fatty liver disease (NAFLD) is a spectrum of disease ranging from simple steatosis to non-alcoholic steatohepatitis (NASH), through to advanced fibrosis and cirrhosis. Many patients with NAFLD remain undiagnosed and recognizing those at risk is very crucial. Although liver biopsy is the gold standard method for diagnosing and staging NAFLD, non-invasive imaging and lab modalities are also very promising in diagnosing these diseases.<h4>Aim</h4>To explore some of these non-invasive modalities in this context and assess how they hold up in terms of making a diagnosis while avoiding an invasive procedure like a liver biopsy.<h4>Methods</h4>This study was conducted on NAFLD/NASH patients (<i>n</i> = 73) who underwent Fibroscan examinations at Saint George Hospital University Medical Center over 17 mo in order to assess liver fibrosis. Obtained Fibroscan results were correlated to laboratory tests and calculated aspartate transaminase (AST)/alanine transaminase (ALT) ratio, AST platelet ratio index (APRI) score and Fibrosis-4 score.<h4>Results</h4>A significant age difference was observed across fibrosis stages of investigated patients. The mean stiffness score was 9.48 ± 11.77 KPa. A significant negative correlation was observed between ALT, AST, Albumin, gamma-glutamyl transferase, cholesterol, LDL, HDL, triglycerides, and ALP when compared across fibrosis stages. On the other hand, a significant positive correlation was found between Bilirubin, PT INR, partial thromboplastin time, glucose, and Platelet count when compared across fibrosis stages, in addition to AST/ALT ratio, APRI, and Fib-4 scores.<h4>Conclusion</h4>This study showed that Ultrasound alone is not efficient in the assessment of advancement of liver disease. Furthermore, the high positive relation between AST/ALT ratio, APRI and Fib-4 scores with fibrosis stages in NAFLD patients suggests that they could be used clinically in combination with Fibroscan to predict significant fibrosis and cirrhosis and to avoid liver biopsy.
Also flagged:cirrhosisrenal failureLiver cirrhosishepatocellular carcinomaintrahepatic cholangiocarcinomadeath
Journal Article2022-04-01✓ 1 SnippetBartolotta TV, Randazzo A, Bruno E, Taibbi A.
In-Text Gene Mentions
Introduction)
…causes (Wilson disease,hemochromatosis) and vascular or…
Show Full Abstract
Contrast-enhanced ultrasound (CEUS) represents a great innovation for the evaluation of focal liver lesions (FLLs). The main advantage of CEUS is the real-time imaging examination and the very low toxicity in patients with renal failure. Liver cirrhosis has been recognized as a major risk factor for the onset of hepatocellular carcinoma (HCC) and intrahepatic cholangiocarcinoma (ICC). HCC in liver cirrhosis develops as the last step of a complex that leads to the gradual transformation from regenerative nodule through dysplastic nodule to HCC. In patients with liver cirrhosis, a surveillance program is recommended consisting of ultrasound (US) for detecting small focal lesions. A wide spectrum of benign and malignant lesions other than HCC may be found in the cirrhotic liver and their differentiation is important to avoid errors in staging diseases that may preclude potentially curative therapies. Several published studies have explored the value of CEUS in liver cirrhosis and they have been shown to have excellent diagnostic and prognostic performances for the evaluation of non-invasive and efficient diagnosis of FLLs in patients at high risk for liver malignancies. The purpose of this article is to describe and discuss CEUS imaging findings of FLLs including HCC and ICC, all of which occur in cirrhotic livers with varying prevalence.
Also flagged:graft-versus-host diseaseGVHDpathogenesisacute intestinal GVHDmucositismembranes
Journal Article2022-04-01✓ 3 SnippetsJansen SA, Nieuwenhuis EES, Hanash AM, Lindemans CA.
In-Text Gene Mentions
Introduction)
…Olfm4is another marker…
Introduction)
…associated with increasedOlfm4+ ISCs and…
Introduction)
…increased numbers ofOlfm4+ ISCs per crypt…
Show Full Abstract
Despite advances in immunosuppressive prophylaxis and overall supportive care, gastrointestinal (GI) graft-versus-host disease (GVHD) remains a major, lethal side effect after allogeneic hematopoietic stem cell transplantation (allo-HSCT). It has become increasingly clear that the intestinal epithelium, in addition to being a target of transplant-related toxicity and GVHD, plays an important role in the onset of GVHD. Over the last two decades, increased understanding of the epithelial constituents and their microenvironment has led to the development of novel prophylactic and therapeutic interventions, with the potential to protect the intestinal epithelium from GVHD-associated damage and promote its recovery following insult. In this review, we will discuss intestinal epithelial injury and the role of the intestinal epithelium in GVHD pathogenesis. In addition, we will highlight possible approaches to protect the GI tract from damage posttransplant and to stimulate epithelial regeneration, in order to promote intestinal recovery. Combined treatment modalities integrating immunomodulation, epithelial protection, and induction of regeneration may hold the key to unlocking mucosal recovery and optimizing therapy for acute intestinal GVHD.
<h4>Ad libitum</h4>feeding in broiler breeder (BB) hens causes reduced egg production, lower fertility, and improper eggshell deposition. Restricted feeding (RF) is the only effective intervention available to normalize ovarian function and improve reproductive efficiency. This study aimed to assess the transcriptional changes in ovarian cortex of BB hens with free access to feed compared to those on a RF diet. RNA was isolated from the ovarian cortex of Cobb 500 pullets raised to 10 and 16 weeks of age on either a full-feeding (FF) or RF diet. Microarray analysis identified 386 differentially expressed genes between the two feeding groups at 16 weeks of age. Gene ontology enrichment identified overrepresentation of Neuroactive ligand-receptor interaction pathways, Cell adhesion molecules, Steroid hormone biosynthesis, and various KEGG pathways. From these groups, 46 genes were selected for follow-up validation by quantitative PCR. The findings show that 33 of the 46 genes had significantly different abundance by age and/or feeding level. Most of these genes were repressed in RF hens and belonged to the steroid biosynthesis and neuropeptide signaling groups. The VIPR2 receptor was higher in the FF group leading us to hypothesize that vasoactive intestinal peptide (VIP) is an important regulator of small cortical follicles. Culture of hen cortical follicles with VIP increased <i>Star</i>, an indication of increased steroidogenic activity, although did not elevate <i>Cyp11a1</i>. These results offer insights and suggest the possible mechanisms and pathways responsible for the increases in cortical follicle growth associated with excess feed intake in BB hens.<h4>Lay summary</h4>Giving breeder hens unrestricted access to feed can lead to problems with their ovaries, including excessive growth of the ovary and reduced fertility. Giving a limited amount of feed is the only effective way to reduce this growth of the ovaries and improve fertility. This study aimed to assess the changes in the molecules that make proteins in the body in hens fed unrestricted and restricted diets. In the hens fed a limited amount of feed, there were more of one type of molecules, while there were more of another type in the ovaries of hens with unrestricted access to feed. These results show that how much a hen eats can alter the number of these molecules in the ovary and this could help us understand why their ovaries grow excessively and why their eggs are less fertile.
Ribosome biogenesis is consecutive coordinated maturation of ribosomal precursors in the nucleolus, nucleoplasm, and cytoplasm. The formation of mature ribosomal subunits involves hundreds of ribosomal biogenesis factors that ensure ribosomal RNA processing, tertiary structure, and interaction with ribosomal proteins. Although the main features and stages of ribosome biogenesis are conservative among different groups of eukaryotes, this process in human cells has become more complicated due to the larger size of the ribosomes and pre-ribosomes and intricate regulatory pathways affecting their assembly and function. Many of the factors involved in the biogenesis of human ribosomes have been identified using genome-wide screening based on RNA interference. A previous part of this review summarized recent data on the processing of the primary rRNA transcript and compared the maturation of the small 40S subunit in yeast and human cells. This part of the review focuses on the biogenesis of the large 60S subunit of eukaryotic ribosomes.
Also flagged:Ewing sarcomaEWS-FLI1EWSzincFLI1Ewing cancer
Journal Article2022-04-01No SnippetsTak YE, Boulay G, Lee L, Iyer S, Perry NT, Schultz HT, Garcia SP, Broye L, Horng JE, Rengarajan S, Naigles B, Volorio A, Sander JD, Gong J, Riggi N, Joung JK, Rivera MN.
Show Full Abstract
Repeat elements can be dysregulated at a genome-wide scale in human diseases. For example, in Ewing sarcoma, hundreds of inert GGAA repeats can be converted into active enhancers when bound by EWS-FLI1. Here we show that fusions between EWS and GGAA-repeat-targeted engineered zinc finger arrays (ZFAs) can function at least as efficiently as EWS-FLI1 for converting hundreds of GGAA repeats into active enhancers in a Ewing sarcoma precursor cell model. Furthermore, a fusion of a KRAB domain to a ZFA can silence GGAA microsatellite enhancers genome wide in Ewing sarcoma cells, thereby reducing expression of EWS-FLI1-activated genes. Remarkably, this KRAB-ZFA fusion showed selective toxicity against Ewing sarcoma cells compared with non-Ewing cancer cells, consistent with its Ewing sarcoma-specific impact on the transcriptome. These findings demonstrate the value of ZFAs for functional annotation of repeats and illustrate how aberrant microsatellite activities might be regulated for potential therapeutic applications.
<h4>Background</h4>Lactate dehydrogenase (LDH), an intra-cellular enzyme present in all cells of the body, catalyses the final step of anaerobic glycolysis. This intra-cellular enzyme is released into the extra-cellular space after tissue disintegration, which is evident in oral squamous cell carcinoma (OSCC). However, investigations comparing Lactate dehydrogenase (LDH) levels in OSCC and healthy controls have shown conflicting findings in both serum and saliva samples. Further, Uric acid's anti-oxidant activity has been demonstrated in several diseases. Several cancers have been linked to increased uric acid levels. However, uric acid levels in oral squamous cell cancer have varied. There exists limitted research comparing serum and salivary uric acid with OSCC. Thus, the present investigation was conducted to evaluate the combined diagnostic abilities of serum and salivary LDH and uric acid in OSCC.<h4>Aim and objective</h4>To compare and correlate LDH and uric acid levels in serum and salivary samples of OSCC patients and healthy individuals.<h4>Material and methods</h4>LDH levels and uric acid levels were measured using an enzymatic method in serum and salivary samples of OSCC cases (<i>n</i> = 18) and healthy individuals (<i>n</i> = 18).<h4>Results</h4>This study indicated statistically significant elevated levels of LDH in serum and saliva samples of OSCC patients when compared to healthy individuals. Furthermore, serum and salivary uric acid were higher in OSCC patients than in controls. This increased levels of uric acid was significant only in serum but not in saliva samples. However, salivary uric acid was found to be co-relating with serum uric acid. In addition to this, the receiver operating characteristic (ROC) curve when plotted to assess combined diagnostic abilities of all the investigations to predict oscc, indicating the diagnostic ability to be 77%.<h4>Conclusion</h4>This study found an increase in uric acid levels in OSCC patients, which contradicts previous existing litratures. Salivary uric acid and LDH levels may be effective indicators for OSCC screening. However, because of the limited sample size, these findings should be viewed with caution.
Also flagged:antibodiesAMAautoimmune hepatitisprimary biliary cholangitisautoantibodiesALT
Journal Article2022-04-01✓ 1 SnippetÖztürk Ö, Dos Santos Duarte SD, Balaban HY, Şimşek H, Şener B.
In-Text Gene Mentions
Methods)
…Wilson’s disease, orhemochromatosis.…
Show Full Abstract
<h4>Background</h4>Antinuclear antibodies (ANA) and antimitochondrial antibodies (AMA) have essential markers for the diagnosis of autoimmune hepatitis (AIH) and primary biliary cholangitis (PBC). These autoantibodies are detecting different laboratory methods. In this study, we studied the diagnostic performance of used methods in detecting ANA and AMA.<h4>Methods</h4>The autoantibody profiles of patients with AIH and PBC groups were analyzed with the indirect immunofluorescence test (IIF) and liver-specific antigens containing immunoblot test (IB).<h4>Results</h4>There were 45 (87%) women in the study group and 8 (53%) women in the control group. The mean age of the patients was 50.5 ± 14.21 years old. The serum ALT and AST levels were higher in AIH, and ALP, GGT, and Ig M were higher in PBC. IIF test results among AIH/PBC groups; there was no difference in overall ANA positivity (p: 0.078). AMA was negative in all patients with AIH but positive in 83.3% of patients with PBC. IB test results among AIH/PBC groups; antibodies against PDGH, LKM-1, and Scl-70 were not observed in any patient with AIH/PBC. Except for M2 (p: 0.001) and M23E (p: 0.007) antibodies, there was no significant difference in antibodies between groups. Out of five PBC patients with negative AMA by IIF method, one was positive for AMA-M2, two were positive anti-gp210, and three were positive anti-M2-3E, but anti-sp100 was negative in all of them by the IB.<h4>Discussion</h4>AIH/PBC has complex associations with different autoantibodies, and some of these antibodies are not readily detected by the IIF test. IB assays with a wide variety of liver-specific antigens may be helpful in the diagnosis (especially in patients with AMA negative PBC) and follow-up in AIH/PBC patients.
bioRxiv2022-04-01Preprint (No Snippets API)Parashuraman S, Sahu P, Russo F, Agliarulo I, Rizzo R, Lo Monte M, Normanno N, Soddu S, Carlomagno F, Luini A.
Show Full Abstract
Cancer is a disease resulting from aberrant communication between cells of a multicellular organism. The glycan coat that surrounds the cells is an important player in cellular communication. While altered cell surface glycans are known biomarkers for cancer, glycan biosynthesis itself has not been considered a potential oncogenic pathway. So, to understand the oncogenic potential of the glycan biosynthetic pathways we have analyzed the copy number alterations (CNA) of genes encoding for glycosylation regulators (glycogenes) in cancer genome datasets and identify novel glyco-oncogenes and glyco-tumor suppressor genes (TSGs). CNA of oncogenes and TSGs is an important cancer-associated genetic alteration that associates with worst prognosis. Nevertheless, identity of the driver genes in the copy number altered segments of the genome remains obscure in most cases. We developed a prioritization pipeline based on bioinformatic and experimental criteria to identify putative driver genes. In addition to correctly identifying several well-established oncogenes/TSGs, this pipeline discerns several novel oncogenes and TSGs, some of which are glycogenes. Further, among glyco-oncogenes there is an enrichment for glycosphingolipid biosynthetic pathway and trans-Golgi associated lysosomal sorting machinery and among glyco-TSGs there is an enrichment for early N-glycan biosynthetic enzymes. As a proof-of-principle we show that one of the identified glycooncogene B4GALT5, encoding a key enzyme in the glycosphingolipid pathway exhibits oncogenic property of promoting increased growth of hepatocellular carcinoma cells. Thus, this study identifies glycosylation pathways with oncoregulatory properties and opens up a new group of enzymes as potential therapeutic targets for cancer.
bioRxiv2022-04-01Preprint (No Snippets API)Tortuyaux R, Oudart M, Mazaré N, Mailly P, Deschemin J, Vaulont S, Escartin C, Cohen-Salmon M.
Show Full Abstract
Astrocytes are thought to play a crucial role in brain iron homeostasis. How they accomplish this regulation in vivo remains unclear. In a recent transcriptomic analysis, we showed that polysomal Ftl1 and Fth1 mRNAs, encoding the ferritin light (Ftl) and heavy (Fth) chains that assemble into ferritin, a critical complex for iron storage and reduction, are enriched in perisynaptic astrocytic processes as compared to astrocytic soma. These data suggested that ferritin translation plays a specific role at the perisynaptic astrocytic interface and is tighly regulated by local translation. Here, we used our recently described AstroDot 3D in situ methodology to study the density and localization of ferritin mRNAs in astrocytes in the hippocampus in three different contexts in which local or systemic iron overload has been documented: ageing, the hepcidin knock-out mouse model of hemochromatosis and the APP/PS1dE9 mouse model of Alzheimer’s disease (AD). Our results showed that in wild type mice, Fth1 mRNA density was higher than Ftl1 and that both mRNAs were mostly distributed in astrocyte fine processes. Ageing and absence of hepcidin caused an increased Fth1/Ftl1 ratio in astrocytes and in the case of ageing, led to a redistribution of Fth1 mRNAs in astrocytic fine processes. In contrast, in AD mice, we observed a lower Fth1/Ftl1 ratio and Fth1 mRNAs became more somatic. Hence, we propose that regulation of ferritin mRNA density and distribution in astrocytes regulates iron homeostasis in physiology and pathophysiology.
SSRN2022-04-01Preprint (No Snippets API)Mai T, Foley A, McAleer M, Chang C.
Show Full Abstract
China wants to play a leading role in international carbon reduction and has ambitious reduction plans. National and regional carbon emissions markets now have increasing trading volumes to operate efficiently. However, trade wars and the COVID-19 pandemic may have created challenges for the Chinese government to create a competitive national market. As carbon emissions are now a key policy instrument and important financial asset, it is important to analyze volatility spillovers, as one of the largest carbon emitters globally makes an interesting case study. Here we investigate daily data for China’s carbon markets and analyzes prices, returns, and volatility spillovers. The Diagonal BEKK model is used to examine financial returns and determine conditional covariances and volatility spillovers across the national and regional markets before, during and after COVID-19. The empirical results show that the signs of the conditional means and covariances, and partial covolatility spillovers for regional returns are similar before and during COVID-19, but not for national returns. Moreover, the magnitudes of the spillovers during COVID-19 are much larger than before and after COVID-19. The impact of COVID-19 on China’s economy leads to greater risk transmission across carbon markets. The channels of risk transmission are discussed to help understand the relevance of carbon markets for investment decisions and public policy making. China’s experience (from regional to national) will be useful in informing any international carbon markets. Finally, motivations, challenges and possible forms of cooperation between China and the Euro zone on establishing a common carbon market are discussed.