Gene Literature Dashboard

Viewing May 2022 — 771 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← April 2022 June 2022 →
Also flagged:ExtracellularRIBONUCLEASE 1deathmembranefumonisin B1RNS1
Journal Article 2022-05-31 ✓ 5 Snippets Goodman HL, Kroon JTM, Tomé DFA, Hamilton JMU, Alqarni AO, Chivasa S.
In-Text Gene Mentions

…(SALK_023867) have impairedPLCL1(At1g13680) expression (Smith…

…between RNS1 andPLCL1expression…

…We previously identifiedPLCL1(At1g13680) as a…

…unable to expressPLCL1are immune to…

…between RNS1 andPLCL1, we measured…

Show Full Abstract

Extracellular ATP is a purinergic signal with important functions in regulating plant growth and stress-adaptive responses, including programmed cell death. While signalling events proximate to receptor activation at the plasma membrane have been characterised, downstream protein targets and the mechanism of cell death activation/regulation are unknown. We designed a proteomic screen to identify ATP-responsive proteins in Arabidopsis cell cultures exposed to mycotoxin stress via fumonisin B1 (FB1) application. Arabidopsis RIBONUCLEASE 1 (RNS1) was identified by the screen, and transgenic plants overexpressing native RNS1 showed greater susceptibility to FB1, while a gene knockout rns1 mutant and antisense RNS1 transgenic plants were resistant to FB1-induced cell death. Native RNS1 complemented rns1 mutants and restored the cell death response to FB1, while a catalytically inactive version of the ribonuclease could not. The FB1 resistance of salicylic acid (SA)-depleted nahG-expressing plants was abolished by transformation with native RNS1, but not the catalytically dead version. The mechanism of FB1-induced cell death is activation of RNS1-dependent RNA cleavage, which is blocked by ATP via RNS1 suppression, or enhanced by SA through induction of RNS1 expression. Our study reveals RNS1 as a previously unknown convergence point of ATP and SA signalling in the regulation of stress-induced cell death.

Also flagged:autoimmune diseasegene expressionimmune responsesCD4CCR7PSGL-1
Journal Article 2022-05-31 No Snippets Akama-Garren EH, Carroll MC.
Show Full Abstract

The germinal center serves as a site of B cell selection and affinity maturation, critical processes for productive adaptive immunity. In autoimmune disease tolerance is broken in the germinal center reaction, leading to production of autoreactive B cells that may propagate disease. Follicular T cells are crucial regulators of this process, providing signals necessary for B cell survival in the germinal center. Here, we review the emerging roles of follicular T cells in the autoreactive germinal center. Recent advances in immunological techniques have allowed study of the gene expression profiles and repertoire of follicular T cells at unprecedented resolution. These studies provide insight into the potential role follicular T cells play in preventing or facilitating germinal center loss of tolerance. Improved understanding of the mechanisms of T cell help in autoreactive germinal centers provides novel therapeutic targets for diseases of germinal center dysfunction.

Also flagged:viral infectionscoagulation-associated proteinsherpes virus infectionmetabolismneurocognitive disordersHAND
Journal Article 2022-05-31 ✓ 2 Snippets Ahmed S, Viode A, van Zalm P, Steen J, Mukerji SS, Steen H.
In-Text Gene Mentions

Antithrombin-III

SERPINC1

Show Full Abstract

State-of-the-art liquid chromatography/mass spectrometry (LC/MS)-based proteomic technologies, using microliter amounts of patient plasma, can detect and quantify several hundred plasma proteins in a high throughput fashion, allowing for the discovery of clinically relevant protein biomarkers and insights into the underlying pathobiological processes. Using such an in-house developed high throughput plasma proteomics allowed us to identify and quantify > 400 plasmas proteins in 15 min per sample, i.e., a throughput of 100 samples/day. We demonstrated the clinical applicability of our method in this pilot study by mapping the plasma proteomes from patients infected with human immunodeficiency virus (HIV) or herpes virus, both groups with involvement of the central nervous system (CNS). We found significant disease-specific differences in the plasma proteomes. The most notable difference was a decrease in the levels of several coagulation-associated proteins in HIV vs. herpes virus, among other dysregulated biological pathways providing insight into the differential pathophysiology of HIV compared to herpes virus infection. In a subsequent analysis, we found several plasma proteins associated with immunity and metabolism to differentiate patients with HIV-associated neurocognitive disorders (HAND) compared to cognitively normal people with HIV (PWH), suggesting the presence of plasma-based biomarkers to distinguishing HAND from cognitively normal PWH. Overall, our high-throughput plasma proteomics pipeline enables the identification of distinct proteomic signatures of HIV and herpes virus, which may help illuminate divergent pathophysiology behind virus-associated neurological disorders.

Also flagged:coronavirus diseaseCOVID-19hepatocellular carcinomatranscription factorTFIlomastat
Journal Article 2022-05-31 No Snippets Wang L, Ding Y, Zhang C, Chen R.
Show Full Abstract

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the cause of the coronavirus disease (COVID-19), which poses a major threat to humans worldwide. With the continuous progress of the pandemic, a growing number of people are infected with SARS-CoV-2, including hepatocellular carcinoma (HCC) patients. However, the relationship between COVID-19 and HCC has not been fully elucidated. In order to provide better treatment for HCC patients infected with SARS-CoV-2, it's urgently needed to identify common targets and find effective drugs for both. In our study, transcriptomic analysis was performed on both selected lung epithelial cell datasets of COVID-19 patients and the datasets of HCC patients to identify the synergistic effect of COVID-19 in HCC patients. What's more, common differentially expressed genes were identified, and a protein-protein interactions network was designed. Then, hub genes and basic modules were detected based on the protein-protein interactions network. Next, functional analysis was performed using gene ontology terminology and the Kyoto Encyclopedia of Genes and Genomes pathway. Finally, protein-protein interactions revealed COVID-19 interaction with key proteins associated with HCC and further identified transcription factor (TF) genes and microRNAs (miRNA) with differentially expressed gene interactions and transcription factor activity. This study reveals that COVID-19 and HCC are closely linked at the molecular level and proposes drugs that may play an important role in HCC patients with COVID-19. More importantly, according to the results of our research, two critical drugs, Ilomastat and Palmatine, may be effective for HCC patients with COVID-19, which provides clinicians with a novel therapeutic idea when facing possible complications in HCC patients with COVID-19.

Also flagged:metabolismrespiratory diseasesasthmachronic obstructive pulmonary diseaseamiodaronebusulfan
Journal Article 2022-05-31 ✓ 2 Snippets Djidrovski I, Georgiou M, Tasinato E, Leonard MO, Van den Bor J, Lako M, Armstrong L.
In-Text Gene Mentions

…transporter proteins (SLC2A14and SLC2A3 )…

…and 3 (SLC2A14, SLC2A3 ) and…

Show Full Abstract

The airway epithelium represents the main barrier between inhaled air and the tissues of the respiratory tract and is therefore an important point of contact with xenobiotic substances into the human body. Several studies have recently shown that in vitro models of the airway grown at an air-liquid interface (ALI) can be particularly useful to obtain mechanistic information about the toxicity of chemical compounds. However, such methods are not very amenable to high throughput since the primary cells cannot be expanded indefinitely in culture to obtain a sustainable number of cells. Induced pluripotent stem cells (iPSCs) have become a popular option in the recent years for modelling the airways of the lung, but despite progress in the field, such models have so far not been assessed for their ability to metabolise xenobiotic compounds and how they compare to the primary bronchial airway model (pBAE). Here, we report a comparative analysis by TempoSeq (oligo-directed sequencing) of an iPSC-derived airway model (iBAE) with a primary bronchial airway model (pBAE). The iBAE and pBAE were differentiated at an ALI and then evaluated in a 5-compound screen with exposure to a sub-lethal concentration of each compound for 24 h. We found that despite lower expression of xenobiotic metabolism genes, the iBAE similarly predicted the toxic pathways when compared to the pBAE model. Our results show that iPSC airway models at ALI show promise for inhalation toxicity assessments with further development.

Also flagged:chronic hepatitis Bvirionshepatitis B-core related antigenhepatitis B surface antigenglycosylationantibody
Journal Article 2022-05-31 ✓ 1 Snippet Murata A, Angata K, Sogabe M, Sato S, Ichida T, Narimatsu H, Genda T.
In-Text Gene Mentions

…biliary cholangitis, andhemochromatosis).…

Show Full Abstract

<h4>Background</h4>Serum hepatitis B surface antigen (HBsAg) is a component of both hepatitis B virus (HBV) virions and non-infectious subviral particles (SVPs). Recently, O-glycosylation of the PreS2 domain of middle HBsAg protein has been identified as a distinct characteristic of genotype C HBV virions versus SVPs. This study aimed to evaluate serum O-glycosylated HBsAg levels in patients with chronic hepatitis B (CHB) treated with nucleos(t)ide analogs (NAs).<h4>Methods</h4>Forty-seven treatment-naïve patients with genotype C CHB were retrospectively enrolled. Serum O-glycosylated HBsAg levels at baseline and after 48 weeks of NA therapy were quantified by immunoassay using a monoclonal antibody against the O-glycosylated PreS2 domain of middle HBsAg, and their correlations with conventional HBV marker levels were analyzed.<h4>Results</h4>At baseline, the serum O-glycosylated HBsAg levels were significantly correlated with the HBV DNA (P = 0.004), HBsAg (P = 0.005), and hepatitis B-core related antigen (HBcrAg, P = 0.001) levels. Both HBV DNA and O-glycosylated HBsAg levels were decreased after 48 weeks of NA therapy. The significant correlation of the O-glycosylated HBsAg level with the HBsAg or HBcrAg level was lost in patients who achieved undetectable HBV DNA (HBsAg, P = 0.429; HBcrAg, P = 0.065). Immunoprecipitation assays demonstrated that HBV DNA and RNA were detected in the O-glycosylated HBsAg-binding serum fraction, and the proportion of HBV RNA increased during NA therapy (P = 0.048).<h4>Conclusion</h4>Serum O-glycosylated HBsAg levels change during NA therapy and may reflect combined levels of serum HBV DNA and RNA virions. An O-glycosylated HBsAg-based immunoassay may provide a novel means to monitor viral kinetics during NA therapy.

Also flagged:lactatenitrogen2-oxoglutaratecarboncarbon fixationmetabolism
Journal Article 2022-05-31 ✓ 1 Snippet Huang A, Li Y, Duan J, Guo S, Cai X, Zhang X, Long H, Ren W, Xie Z.
In-Text Gene Mentions

…change) conditions wasPRDX6, which is involved…

Show Full Abstract

<h4>Background</h4>Phaeodactylum tricornutum accumulates lipids while the growth also increases under high CO<sub>2</sub>, shedding light on its potential application in the reduction of CO<sub>2</sub> emissions and at the same time acquiring biodiesel raw materials. However, the sensing and transducing of high C:N signals and the related response mechanism(s) remained unknown.<h4>Results</h4>In this study, a multiple omics analysis was performed with P. tricornutum under low nitrogen (LN) and high CO<sub>2</sub> (HC) conditions. The results indicated that 2-oxoglutarate was significantly increased under both LN and HC. Meanwhile, proteins involved in carbon concentration mechanism decreased, indicated that 2-oxoglutarate might regulate C:N balance through suppressing carbon fixation. Lactate, which acts in energy metabolism, signal transduction and 'LactoylLys' modification on proteins, was the most upregulated metabolite under both LN and HC conditions. Meanwhile, proteins involved in carbon, nitrogen and energy metabolisms were significantly regulated. Western blotting analysis suggested that non-histone L-lactylation modification was enhanced under LN and HC. Moreover, lactylated proteins were enriched in photosynthesis, central carbon metabolism, nitrogen metabolism, fatty acid synthesis and oxidative phosphorylation.<h4>Conclusion</h4>It is suggested that lactate might play important roles in energy homeostatic maintenance and C:N balance regulation in P. tricornutum through protein lactylation modification.

Also flagged:nucleotideSTRneurodegenerative diseasesmyotonic dystrophiesfragile X tremor/ataxia syndromeFXTAS
Journal Article 2022-05-31 ✓ 1 Snippet Liufu T, Zheng Y, Yu J, Yuan Y, Wang Z, Deng J, Hong D.
In-Text Gene Mentions

For HD, miRNA has been applied and successfully reduced transcript of huntingtin gene (HTT) levels, leading to improvement in neuropathology [75].

Show Full Abstract

Recently, inspired by the similar clinical and pathological features shared with fragile X-associated tremor/ataxia syndrome (FXTAS), abnormal expansion of CGG repeats in the 5' untranslated region has been found in neuronal intranuclear inclusion disease (NIID), oculopharyngeal myopathy with leukoencephalopathy (OPML), and oculopharyngodistal myopathy (OPDMs). Although the upstream open reading frame has not been elucidated in OPML and OPDMs, polyglycine (polyG) translated by expanded CGG repeats is reported to be as a primary pathogenesis in FXTAS and NIID. Collectively, these findings indicate a new disease entity, the polyG diseases. In this review, we state the common clinical manifestations, pathological features, mechanisms, and potential therapies in these diseases, and provide preliminary opinions about future research in polyG diseases.

Also flagged:periodontitisgingivitisof the oral cavitymicrobial infectionNOD-like receptor pyrin domain-containing 3NLRP3
Journal Article 2022-05-31 No Snippets Oyaro B, Lokken E, Alumera H, Hussein S, Richardson B, Mandaliya K, Jaoko W, Kinuthia J, Dimba E, Kemoli A, McClelland RS.
Show Full Abstract

<h4>Background</h4>Periodontitis has been associated with adverse pregnancy outcomes. Little is known about the burden and risk factors for periodontitis among reproductive age women in sub-Saharan Africa. This analysis aimed to determine the prevalence and correlates of periodontitis among Kenyan women planning to conceive.<h4>Methods</h4>HIV-seronegative, reproductive-age women who were planning to conceive were enrolled and underwent a periodontal examination. Following the US Centers for Disease Control and Prevention clinical case definitions, the presence and severity of periodontitis was determined by establishing the level of clinical periodontal attachment loss and graded in three categories: no/mild, moderate, and severe. Secondary outcomes included the scores on the Gingival Index and Decayed, Missing, and Filled Teeth (DMFT) Index. Correlates of periodontitis were examined using univariable and multivariable logistic regression.<h4>Results</h4>Of the 647 women in the study, 84% (n = 541) had no/mild periodontitis, 15% (n = 97) had moderate periodontitis, and 1% (n = 9) had severe periodontitis. Mild gingivitis was present in 61% (n = 396) of women, while 27% (n = 176) had moderate gingivitis, and 1% (n = 9) had severe gingivitis. The majority (75%, n = 487) of women had a DMFT index in the very low range (score < 5). Periodontitis was observed in 12% (12/101) of nulliparous women compared to 13% (36/286) of women with one prior delivery (prevalence ratio [PR] 1.03, 95% confidence interval [95% CI] 0.57-1.96), 21% (36/170) of women with two prior deliveries (PR 1.78, 95% CI 0.97-3.26), and 24% (22/90) of women with 3 or more prior deliveries (PR 2.06, 95% CI 1.08-3.92).<h4>Conclusion</h4>This study demonstrated a substantial prevalence of moderate-severe periodontitis among women planning to conceive in Kenya. These results highlight the need to address the oral care needs of reproductive age women, particularly those with multiple prior pregnancies.

Also flagged:organizationGCPE6
Journal Article 2022-05-31 No Snippets VanBuren JM, Roalstad S, Kay MT, Zuspan SJ, Dean JM, Brulotte M.
Show Full Abstract

<h4>Background</h4>In the past decade, regulatory agencies have released guidance around risk-based management with the goal of focusing on risks to critical aspects of a research study. Several tools have been developed aimed at implementing these guidelines. We designed a risk management tool to meet the demands of our academic data coordinating center.<h4>Methods</h4>We developed the Risk Assessment and Risk Management (RARM) tool on three fundamental criteria of our risk/quality program: (1) Quality by Design concepts applies to all employees, regardless of the employee's role; (2) the RARM process must be economically feasible and dynamically flexible during the study startup and implementation process; and (3) responsibility of the RARM lay with the entire study team as opposed to a single quality expert.<h4>Results</h4>The RARM tool has 20 elements for both risk assessment and risk management. The incorporation of both aspects of risk management allow for a seamless transition from identifying risks to actively monitoring risks throughout enrollment.<h4>Conclusion</h4>The RARM tool achieves a simplified, seamless approach to risk assessment and risk management. The tool incorporates the concept of Quality by Design into daily work by having every team member contribute to the RARM tool. It also combines the risk assessment and risk management processes into a single tool which allows for a seamless transition from identifying risks to managing the risks throughout the life of the study. The instructions facilitate documentation of de-risking protocols early in development and the tool can be implemented in any platform and organization.

Also flagged:immunotoxicityoxygencytokinesecretionsilverinflammatory response
Journal Article 2022-05-31 ✓ 1 Snippet Pavlin M, Lojk J, Strojan K, Hafner-Bratkovič I, Jerala R, Leonardi A, Križaj I, Drnovšek N, Novak S, Veranič P, Bregar VB.
In-Text Gene Mentions

…serum albumin (ALBU),antithrombin-III(ANT3), heat shock…

Show Full Abstract

Alongside physiochemical properties (PCP), it has been suggested that the protein corona of nanoparticles (NPs) plays a crucial role in the response of immune cells to NPs. However, due to the great variety of NPs, target cells, and exposure protocols, there is still no clear relationship between PCP, protein corona composition, and the immunotoxicity of NPs. In this study, we correlated PCP and the protein corona composition of NPs to the THP-1 macrophage response, focusing on selected toxicological endpoints: cell viability, reactive oxygen species (ROS), and cytokine secretion. We analyzed seven commonly used engineered NPs (SiO<sub>2</sub>, silver, and TiO<sub>2</sub>) and magnetic NPs. We show that with the exception of silver NPs, all of the tested TiO<sub>2</sub> types and SiO<sub>2</sub> exhibited moderate toxicities and a transient inflammatory response that was observed as an increase in ROS, IL-8, and/or IL-1β cytokine secretion. We observed a strong correlation between the size of the NPs in media and IL-1β secretion. The induction of IL-1β secretion was completely blunted in NLR family pyrin domain containing 3 (NLRP3) knockout THP-1 cells, indicating activation of the inflammasome. The correlations analysis also implicated the association of specific NP corona proteins with the induction of cytokine secretion. This study provides new insights toward a better understanding of the relationships between PCP, protein corona, and the inflammatory response of macrophages for different engineered NPs, to which we are exposed on a daily basis.

Also flagged:insulin resistancediabetesmemory impairmentphenolic compoundsADcholinesterase
Journal Article 2022-05-31 No Snippets Amir Rawa MS, Mazlan MKN, Ahmad R, Nogawa T, Wahab HA.
Show Full Abstract

Alzheimer's disease (AD) causes progressive memory loss and cognitive dysfunction. It is triggered by multifaceted burdens such as cholinergic toxicity, insulin resistance, neuroinflammation, and oxidative stress. <i>Syzygium</i> plants are ethnomedicinally used in treating inflammation, diabetes, as well as memory impairment. They are rich in antioxidant phenolic compounds, which can be multi-target neuroprotective agents against AD. This review attempts to review the pharmacological importance of the <i>Syzygium</i> genus in neuroprotection, focusing on anti-cholinesterase, anti-diabetic, anti-inflammatory, and antioxidant properties. Articles published in bibliographic databases within recent years relevant to neuroprotection were reviewed. About 10 species were examined for their anti-cholinesterase capacity. Most studies were conducted in the form of extracts rather than compounds. <i>Syzygium aromaticum</i> (particularly its essential oil and eugenol component) represents the most studied species owing to its economic significance in food and therapy. The molecular mechanisms of <i>Syzygium</i> species in neuroprotection include the inhibition of AChE to correct cholinergic transmission, suppression of pro-inflammatory mediators, oxidative stress markers, RIS production, enhancement of antioxidant enzymes, the restoration of brain ions homeostasis, the inhibition of microglial invasion, the modulation of ß-cell insulin release, the enhancement of lipid accumulation, glucose uptake, and adiponectin secretion via the activation of the insulin signaling pathway. Additional efforts are warranted to explore less studied species, including the Australian and Western <i>Syzygium</i> species. The effectiveness of the <i>Syzygium</i> genus in neuroprotective responses is markedly established, but further compound isolation, in silico, and clinical studies are demanded.

Also flagged:cathelicidinsLL-37cathelicidincarotenoidhydrogenperoxide
Journal Article 2022-05-31 No Snippets Kim SD, Kim GB, Lee GY, Yang SJ.
Show Full Abstract

Sequence type (ST) 5 methicillin-resistant <i>Staphylococcus aureus</i> (MRSA) with staphylococcal cassette chromosome <i>mec</i> (SCCmec) type II (ST5-MRSA-II) and ST72-MRSA-IV represent the most significant genotypes for healthcare- (HA) and community-associated (CA) MRSA in Korea, respectively. In addition to the human-type MRSA strains, the prevalence of livestock-associated (LA) MRSA clonal lineages, such as ST541 and ST398 LA-MRSA-V in pigs and ST692 LA-MRSA-V and ST188 LA-MRSA-IV in chickens, has recently been found. In this study, clonotype-specific resistance profiles to cathelicidins derived from humans (LL-37), pigs (PMAP-36), and chickens (CATH-2) were examined using six different ST groups of MRSA strains: ST5 HA-MRSA-II, ST72 CA-MRSA-IV, ST398 LA-MRSA-V, ST541 LA-MRSA-V, ST188 LA-MRSA-IV, and ST692 LA-MRSA-V. Phenotypic characteristics often involved in cathelicidin resistance, such as net surface positive charge, carotenoid production, and hydrogen peroxide susceptibility were also determined in the MRSA strains. Human- and animal-type MRSA strains exhibited clonotype-specific resistance profiles to LL-37, PMAP-36, or CATH-2, indicating the potential role of cathelicidin resistance in the adaptation and colonization of human and animal hosts. The ST5 HA-MRSA isolates showed enhanced resistance to all three cathelicidins and hydrogen peroxide than ST72 CA-MRSA isolates by implementing increased surface positive charge and carotenoid production. In contrast, LA-MRSA strains employed mechanisms independent of surface charge regulation and carotenoid production for cathelicidin resistance. These results suggest that human- and livestock-derived MRSA strains use different strategies to counteract the bactericidal action of cathelicidins during the colonization of their respective host species.

Also flagged:D-Methioninehydroxybeta-caseinprotein synthesismethionineacid
Journal Article 2022-05-31 No Snippets Jeon SW, Conejos JRV, Lee JS, Keum SH, Lee HG.
Show Full Abstract

This study aims to determine the effects of D-methionine (D-Met) isomer and the methionine precursor 2-hydroxy-4-methylthiobutanoic acid i (HMBi) supplementation on milk protein synthesis on immortalized bovine mammary epithelial cell (MAC-T). MAC-T cells were seeded using 10-cm dishes and cultured in Dulbecco's modified Eagle's medium/F12 (DMEM/F12) basic medium. The basic medium of DMEM/F12 was replaced with the lactogenic DMEM/F12 differentiation medium when 90% of MAC-T cells reached confluency. The best dosage at 0.6 mM of D-Met and HMBi and incubation time at 72 h were used uniformly for all treatments. Each treatment was replicated six times wherein treatments were randomly assigned in a 6-well plate. Cell, medium, and total protein were determined using a bicinchoninic acid protein assay kit. Genes, proteomics and metabolomics analyses were also done to determine the mechanism of the milk protein synthesis pathway. Data were analyzed by two-way analysis of variance (ANOVA) with supplement type and plate as fixed effects. The least significant difference test was used to evaluate the differences among treatments. The HMBi treatment group had the highest beta-casein and S6 kinase beta-1 (S6K1) mRNA gene expression levels. HMBi and D-Met treatments have higher gene expressions compared to the control group. In terms of medium protein content, HMBi had a higher medium protein quantity than the control although not significantly different from the D-Met group. HMBi supplementation stimulated the production of eukaryotic translation initiation factor 3 subunit protein essential for protein translation initiation resulting in higher medium protein synthesis in the HMBi group than in the control group. The protein pathway analysis results showed that the D-Met group stimulated fructose-galactose metabolism, glycolysis pathway, phosphoinositide 3 kinase, and pyruvate metabolism. The HMBi group stimulated the pentose phosphate and glycolysis pathways. Metabolite analysis revealed that the D-Met treatment group increased seven metabolites and decreased uridine monophosphate (UMP) production. HMBi supplementation increased the production of three metabolites and decreased UMP and N-acetyl-L-glutamate production. Taken together, D-Met and HMBi supplementation are effective in stimulating milk protein synthesis in MAC-T cells by genes, proteins, and metabolites stimulation linked to milk protein synthesis.

Also flagged:Cholesterolcardiovascular diseaseCVDlipidtriglyceridelipoprotein
Journal Article 2022-05-31 ✓ 1 Snippet Sun J, Zhang Z, Liu Z, Li J, Kang W.
In-Text Gene Mentions

…lpha-1-antitrypsin deficiency,hemochromatosis, and Wilson's disease);…

Show Full Abstract

<h4>Background</h4>To evaluate the detailed relationship between total percent fat (TPF) and cardiovascular disease (CVD)-related lipid biomarkers among adults and find a non-invasive indicator for screening and monitoring of the high CVD risk population.<h4>Methods</h4>Data of 13,160 adults were obtained from the National Health and Examination Survey (NHANES) from 1999 to 2018. TPF was assessed by dual-energy x-ray absorptiometry (DXA), and CVD-related lipid biomarkers included total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C). Multivariable linear regression models were used to examine associations between TPF with four kinds of lipid biomarkers, and smooth curve fittings and generalized additive models were used to address the non-linear relationship between them. The inflection points were calculated by the recursive algorithm when non-linearities were detected and then weighted two-piecewise linear regression models were constructed.<h4>Results</h4>In multivariable regression, increasing TPF was positively associated with TC, TG, and LDL-C and negatively with HDL-C (all <i>p</i> < 0.001). In addition, the non-linear relationships between them were also identified by generalized additive models and smooth curve fittings. When further stratified TPF by sex, the fitted smooth curves were nearly inverted U-shaped and U-shaped curves, the inflection points were calculated, and the weighted two-piecewise linear regression models were constructed, respectively. The same results existed between android percent fat and these four lipid biomarkers.<h4>Conclusions</h4>Total percent fat was significantly associated with CVD-related lipid biomarkers in adults, positively with TC, TG, and LDL-C and negatively with HDL-C. It could be used as a non-invasive screener and monitor of high CVD risk population when their TPF values were less than the inflection points.

Also flagged:Methylationlung adenocarcinomaLUADcancerSLC2A1PAX6
Journal Article 2022-05-31 ✓ 1 Snippet Cai W, Jing M, Wen J, Guo H, Xue Z.
In-Text Gene Mentions

…h-expression miRNAs, includingNEGR1, ITGA8 ,…

Show Full Abstract

This study focused on the epigenetic alterations of DNA methylation and miRNAs for lung adenocarcinoma (LUAD) diagnosis and treatment using bioinformatics analyses. DNA methylation data and mRNA and miRNA expression microarray data were obtained from The Cancer Genome Atlas (TCGA) database. The differentially methylated genes (DMGs), differentially expressed genes (DEGs), and differentially expressed miRNAs were analyzed by using the limma package. The DAVID database performed GO and KEGG pathway enrichment analyses. Using STRING and Cytoscape, we constructed the protein-protein interaction (PPI) network and achieved visualization. The online analysis tool CMap was used to identify potential small-molecule drugs for LUAD. In LUAD, 607 high miRNA-targeting downregulated genes and 925 low miRNA-targeting upregulated genes, as well as 284 hypermethylated low-expression genes and 315 hypomethylated high-expression genes, were obtained. They were mainly enriched in terms of pathways in cancer, neuroactive ligand-receptor interaction, cAMP signaling pathway, and cytosolic DNA-sensing pathway. In addition, 40 upregulated and 84 downregulated genes were regulated by both aberrant alternations of DNA methylation and miRNAs. Five small-molecule drugs were identified as a potential treatment for LUAD, and five hub genes (<i>SLC2A1</i>, <i>PAX6</i>, <i>LEP</i>, <i>KLF4</i>, and <i>FGF10</i>) were found in PPI, and two of them (<i>SLC2A1</i> and <i>KLF4</i>) may be related to the prognosis of LUAD. In summary, our study identified a series of differentially expressed genes associated with epigenetic alterations of DNA methylation and miRNA in LUAD. Five small-molecule drugs and five hub genes may be promising drugs and targets for LUAD treatment.

Also flagged:ATRLung AdenocarcinomaFLClung cancerpulmonary lung adenocarcinomaLUAD
Journal Article 2022-05-31 No Snippets Bao G, Guan X, Liang J, Yao Y, Xiang Y, Li T, Zhong X.
Show Full Abstract

<h4>Background</h4>Familial lung cancer (FLC) accounts for 8% of lung adenocarcinoma. It is known that a few germline mutations are associated with risk increasing and may provide new screening and treatment option. The goal of this study is to identify an FLC gene among three members of an FLC family.<h4>Methods</h4>To uncover somatic and embryonic mutations linked with familial lung cancer, whole exome sequencing was done on surgical tissues and peripheral blood from three sisters in a family diagnosed with pulmonary lung adenocarcinoma (LUAD). At the same time, single-cell RNA sequencing (scRNA-seq) and bulk RNA sequencing data in public databases were enrolled to identify specific gene expression level.<h4>Results</h4>Ataxia Telangiectasia and Rad3-Related Protein (ATR) gene C.7667C >G (p.T2556S) mutation were found in 3 patients with familial lung cancer. Whole-genome sequencing revealed that the three sisters exhibited similar somatic mutation patterns. Besides ATR mutations, common mutated genes (BRCA1, EGFR, and ROS1) that characterize LUAD were also found in 5 tumor samples. Analysis for the ATR expression in LUAD patients by single-cell sequencing data, we found ATR expression of tumor patients at high level in immune cells when compared with normal patients, but the expression of ATR in stromal cells has the opposite result.<h4>Conclusion</h4>We found a germline mutation in the ATR gene in three sisters of a Chinese family affected by familial lung cancer, which may be a genetic factor for lung cancer susceptibility.

Also flagged:metabolismosteoporosisosteoarthritisosteosarcomaosteomyelitisbone diseases
Journal Article 2022-05-31 No Snippets Chen Y, Wu X, Li J, Jiang Y, Xu K, Su J.
Show Full Abstract

Targeted delivery by either systemic or local targeting of therapeutics to the bone is an attractive treatment for various bone metabolism diseases such as osteoporosis, osteoarthritis, osteosarcoma, osteomyelitis, etc. To overcome the limitations of direct drug delivery, the combination of bone-targeted agents with nanotechnology has the opportunity to provide a more effective therapeutic approach, where engineered nanoparticles cause the drug to accumulate in the bone, thereby improving efficacy and minimizing side effects. Here, we summarize the current advances in systemic or local bone-targeting approaches and nanosystem applications in bone diseases, which may provide new insights into nanocarrier-delivered drugs for the targeted treatment of bone diseases. We envision that novel drug delivery carriers developed based on nanotechnology will be a potential vehicle for the treatment of currently incurable bone diseases and are expected to be translated into clinical applications.

Also flagged:gene expressioncolon cancersynapsetumorneurogenesisEGR2
Journal Article 2022-05-31 ✓ 1 Snippet Regan JL, Schumacher D, Staudte S, Steffen A, Lesche R, Toedling J, Jourdan T, Haybaeck J, Golob-Schwarzl N, Mumberg D, Henderson D, Győrffy B, Regenbrecht CRA, Keilholz U, Schäfer R, Lange M.
In-Text Gene Mentions

…, LRIG1 ,OLFM4, and PROM1…

Show Full Abstract

Recent evidence demonstrates that colon cancer stem cells (CSCs) can generate neurons that synapse with tumor innervating fibers required for tumorigenesis and disease progression. Greater understanding of the mechanisms that regulate CSC driven tumor neurogenesis may therefore lead to more effective treatments. RNA-sequencing analyses of ALDH<sup>Positive</sup> CSCs from colon cancer patient-derived organoids (PDOs) and xenografts (PDXs) showed CSCs to be enriched for neural development genes. Functional analyses of genes differentially expressed in CSCs from PDO and PDX models demonstrated the neural crest stem cell (NCSC) regulator <i>EGR2</i> to be required for tumor growth and to control expression of homebox superfamily embryonic master transcriptional regulator <i>HOX</i> genes and the neural stem cell and master cell fate regulator <i>SOX2</i>. These data support CSCs as the source of tumor neurogenesis and suggest that targeting <i>EGR2</i> may provide a therapeutic differentiation strategy to eliminate CSCs and block nervous system driven disease progression.

Also flagged:oxygenwaterinfectionstransportationphotonneutron
Journal Article 2022-05-31 ✓ 1 Snippet Obrador E, Salvador-Palmer R, Villaescusa JI, Gallego E, Pellicer B, Estrela JM, Montoro A.
In-Text Gene Mentions

Other likely biomarkers of IR-induced harm incorporate (but are not restricted to) oxidative stress markers (e.g., 8-hydroxy-2′-deoxyguanosine, isoprostanes and protein carbonyls), immune and inflammatory mediators (various cytokines and chemokines), altered gene expression and mutations (e.g., NF-κB activation, GADD45, CDKN1A, genes related with the nucleotide excision repair mechanism, TP53, PPP1R14C, TNFAIP8L1, DNAJC1, PRTFDC1, KLF10, TNFAIP8L1, Slfn4, Itgb5, Smim3, Tmem40, Litaf, Gp1bb, Cxx1c, FDXR), epigenetic markers (gene methylation and repetitive components), metabolomics-related markers (e.g., urine glyoxylate, threonate, thymine, uracil, citrate,2-oxoglutarate, thymidine, 2′-deoxyuridine, 2′-deoxyxanthosine; blood serum inositol, serine, lysine, glycine, threonine, glycerol, isocitrate, gluconic acid, stearic acid, methylglutarylcarnitine), proteomics-related markers (e.g., plasma ferredoxin reductase, α-2-macroglobulin, chromogranin-A, GPx-3, lipidomics-related markers (e.g., blood serum linoleic acid, palmitic acid, phosphatidylcholines, glycerolipids, glycerophospholipids and esterified sterols), and miRNAs (e.g., miR-150, miR-30a, miR-30c, miR-34a, miR-200b, miR-29a, miR-29b, miR-144-5p, miR-144-3p).

Show Full Abstract

Atomic and radiological crises can be caused by accidents, military activities, terrorist assaults involving atomic installations, the explosion of nuclear devices, or the utilization of concealed radiation exposure devices. Direct damage is caused when radiation interacts directly with cellular components. Indirect effects are mainly caused by the generation of reactive oxygen species due to radiolysis of water molecules. Acute and persistent oxidative stress associates to radiation-induced biological damages. Biological impacts of atomic radiation exposure can be deterministic (in a period range a posteriori of the event and because of destructive tissue/organ harm) or stochastic (irregular, for example cell mutation related pathologies and heritable infections). Potential countermeasures according to a specific scenario require considering basic issues, e.g., the type of radiation, people directly affected and first responders, range of doses received and whether the exposure or contamination has affected the total body or is partial. This review focuses on available medical countermeasures (radioprotectors, radiomitigators, radionuclide scavengers), biodosimetry (biological and biophysical techniques that can be quantitatively correlated with the magnitude of the radiation dose received), and strategies to implement the response to an accidental radiation exposure. In the case of large-scale atomic or radiological events, the most ideal choice for triage, dose assessment and victim classification, is the utilization of global biodosimetry networks, in combination with the automation of strategies based on modular platforms.

Also flagged:SynthesisAmino-Quinolineoxygenneurodegenerative diseasesquinolinecaffeic, and
Journal Article 2022-05-31 No Snippets Bacci A, Corsi F, Runfola M, Sestito S, Piano I, Manera C, Saccomanni G, Gargini C, Rapposelli S.
Show Full Abstract

Overproduction of reactive oxygen species (ROS) and alterations in metallostasis are common and related hallmarks in several neurodegenerative diseases (NDDs). Nature-based derivatives always represent an attractive tool in MTDL drug design, especially against ROS in NDDs. On this notion, we designed a new series of 8-quinoline-N-substituted derivatives with a natural antioxidant portion (i.e., lipoic, caffeic, and ferulic acids). These compounds were shown to chelate copper, a metal involved in ROS-induced degeneration, and scavenger oxygen radicals in DPPH assay. Then, selected compounds <b>4</b> and <b>5</b> were evaluated in an in vitro model of oxidative stress and shown to possess cytoprotective effects in 661W photoreceptor-like cells. The obtained results may represent a starting point for the application of the proposed class of compounds in retinal neurodegenerative diseases such as retinitis pigmentosa (RP), comprising a group of hereditary rod-cone dystrophies that represent a major cause of blindness in patients of working age, where the progression of the disease is a multifactorial event, with oxidative stress contributing predominantly.

Also flagged:CurcuminNanofibersHyaluronic AcidBacterial infectionsbiopolymercarbapenems
Journal Article 2022-05-31 No Snippets Snetkov P, Rogacheva E, Kremleva A, Morozkina S, Uspenskaya M, Kraeva L.
Show Full Abstract

Bacterial infections have accompanied humanity throughout its history and became vitally important in the pandemic area. The most pathogenic bacteria are multidrug-resistant strains, which have become widespread due to their natural biological response to the use of antibiotics, including uncontrolled use. The current challenge is finding highly effective antibacterial agents of natural origin, which, however, have low solubility and consequently poor bioavailability. Curcumin, derived from <i>Curcuma longa</i>, is an example of a natural biologically active agent with a wide spectrum of biological effects, particularly against Gram-positive bacteria. However, curcumin exhibits extremely low antibacterial activity against Gram-negative bacteria. Curcumin's hydrophobicity limits its use in medicine. As such, various polymeric systems have been used, especially biopolymer-based electrospun nanofibers. In the present study, the technological features of the fabrication of curcumin-loaded hyaluronic acid-based nanofibers are discussed in detail, their morphological characteristics, wettability, physico-chemical properties, and curcumin release profiles are demonstrated, and their antibacterial activity against multi-drug resistant ESKAPE pathogens (<i>Enterococcus faecium</i>, <i>Staphylococcus aureus</i>, <i>Klebsiella pneumoniae</i>, <i>Acinetobacter baumannii</i>, <i>Pseudomonas aeruginosa</i>, and <i>Enterobacter</i> species) are evaluated. It is noteworthy that the fibers containing a stable HA-curcumin complex showed high antibacterial activity against both Gram-positive and Gram-negative bacteria, which is an undeniable advantage. It is expected that the results of this work will contribute to the development of antibacterial drugs for topical and internal use with high efficacy and considerably lower side effects.

Also flagged:FOR INHERITED ARRHYTHMIALong QT syndromeKCNQ1KCNH2SCN5ACALM1
Journal Article 2022-05-31 ✓ 1 Snippet Wilde AAM, Semsarian C, Márquez MF, Sepehri Shamloo A, Ackerman MJ, Ashley EA, Sternick Eduardo B, Barajas-Martinez H, Behr ER, Bezzina CR, Breckpot J, Charron P, Chockalingam P, Crotti L, Gollob MH, Lubitz S, Makita N, Ohno S, Ortiz-Genga M, Sacilotto L, Schulze-Bahr E, Shimizu W, Sotoodehnia N, Tadros R, Ware JS, Winlaw DS, Kaufman ES, Aiba T, Bollmann A, Choi JI, Dalal A, Darrieux F, Giudicessi J, Guerchicoff M, Hong K, Krahn AD, Mac Intyre C, Mackall JA, Mont L, Napolitano C, Ochoa Juan P, Peichl P, Pereira AC, Schwartz PJ, Skinner J, Stellbrink C, Tfelt-Hansen J, Deneke T.
In-Text Gene Mentions

…e.g. sarcoidosis, amyloidosis,hemochromatosis, collagen vascular disease…

Show Full Abstract

No abstract available.

Also flagged:degradationosteogenesisLysosomeRibosomereverse‐transcriptionAminoacyl‐tRNA biosynthesis
Journal Article 2022-05-31 No Snippets Jiang TM.
Show Full Abstract

<h4>Background</h4>The genetic central dogma (GCD) has been demonstrated its essential function in many biological processes and diseases. However, its roles in the process of osteogenic differentiation of mesenchymal stem cells (MSCs) remain unclear.<h4>Methods</h4>In this project, we analyzed an online database of osteogenic differentiation of MSCs after 14 days and 28 days by osteoinductive medium (GSE83770). The differentially expressed genes were screened by GEO2R, with further conducting of KEGG pathways using DAVID. In addition, protein-protein interactions of the enriched pathways were performed using STRING with marked hub genes measured by the CytoHubba. Hub genes were verified by quantitative reverse-transcription polymerase chain reaction.<h4>Results</h4>Results showed that six pathways related to GCD, including DNA replication, Aminoacyl-tRNA biosynthesis, Mismatch repair, Ribosome, Spliceosome, and RNA degradation pathways enriched in the early stage (14 days vs. undifferentiated MSCs) of osteogenesis. The Lysosome pathway was highly enriched in the late stage (28 vs. 14 days) of osteogenesis, and Ribosome pathway plays a key role throughout the entire process (28 days vs. undifferentiated MSCs) of osteogenesis.<h4>Conclusion</h4>Both DNA replication and protein translation were functionally worked in the early stage of osteogenesis, whereas the Lysosome pathway was the only GCD-related one in the late stage of osteogenesis. The GCD-related Ribosome pathway occupied the entire process of osteogenesis.

Also flagged:agingaxon guidanceacetyl choline receptorsarcopeniagene expressioncation transporters
Journal Article 2022-05-31 No Snippets Graber TG, Maroto R, Thompson JK, Widen SG, Man Z, Pajski ML, Rasmussen BB.
Show Full Abstract

One inevitable consequence of aging is the gradual deterioration of physical function and exercise capacity, driven in part by the adverse effect of age on muscle tissue. We hypothesized that relationships exist between age-related differentially expressed genes (DEGs) in skeletal muscle and age-associated declines in physical function and exercise capacity. Previously, male C57BL/6mice (6m, months old, 24m, and 28m) were tested for physical function using a composite scoring system (comprehensive functional assessment battery, CFAB) comprised of five well-validated tests of physical function. In this study, total RNA was isolated from tibialis anterior samples (n = 8) randomly selected from each age group in the parent study. Using Next Generation Sequencing RNAseq to determine DEGs during aging (6m vs. 28m, and 6m vs. 24m), we found a greater than five-fold increase in DEGs in 28m compared to the 24m. Furthermore, regression of the normalized expression of each DEG with the CFAB score of the corresponding mouse revealed many more DEGs strongly associated (R ≥ |0.70|) with functional status in the older mice. Gene ontology results indicate highly enriched axon guidance and acetyl choline receptor gene sets, suggesting that denervation/reinnervation flux might potentially play a critical role in functional decline. We conclude that specific age-related DEG patterns are associated with declines in physical function, and the data suggest accelerated aging occurring between 24 and 28 months.

Also flagged:Glaucomablindnessdeathoptic nerve injurygene expressionretinal neurodegenerative disease
Journal Article 2022-05-31 ✓ 1 Snippet Amin D, Kuwajima T.
In-Text Gene Mentions

…factor 3), Csrp3 (cysteine and glycine rich protein 3and glycine rich…

Show Full Abstract

Retinal ganglion cells (RGCs) are the neurons in the retina which directly project to the brain and transmit visual information along the optic nerve. Glaucoma, one of the leading causes of blindness, is characterized by elevated intraocular pressure (IOP) and degeneration of the optic nerve, which is followed by RGC death. Currently, there are no clinical therapeutic drugs or molecular interventions that prevent RGC death outside of IOP reduction. In order to overcome these major barriers, an increased number of studies have utilized the following combined analytical methods: well-established rodent models of glaucoma including optic nerve injury models and transcriptomic gene expression profiling, resulting in the successful identification of molecules and signaling pathways relevant to RGC protection. In this review, we present a comprehensive overview of pathological features in a variety of animal models of glaucoma and top differentially expressed genes (DEGs) depending on disease progression, RGC subtypes, retinal regions or animal species. By comparing top DEGs among those different transcriptome profiles, we discuss whether commonly listed DEGs could be defined as potential novel therapeutic targets in glaucoma, which will facilitate development of future therapeutic neuroprotective strategies for treatments of human patients in glaucoma.

Also flagged:PyrinMelanomametastatic melanomafamilial Mediterranean fevertumorpathogenesis
Journal Article 2022-05-30 No Snippets Oswalt CJ, Al-Rohil RN, Theivanthiran B, Haykal T, Salama AKS, DeVito NC, Holtzhausen A, Ko DC, Hanks BA.
Show Full Abstract

The mechanisms underlying tumor immunosurveillance and their association with the immune-related adverse events (irAEs) associated with checkpoint inhibitor immunotherapies remain poorly understood. We describe a metastatic melanoma patient exhibiting multiple episodes of spontaneous disease regression followed by the development of several irAEs during the course of anti-programmed cell death protein 1 antibody immunotherapy. Whole-exome next-generation sequencing studies revealed this patient to harbor a pyrin inflammasome variant previously described to be associated with an atypical presentation of familial Mediterranean fever. This work highlights a potential role for inflammasomes in the regulation of tumor immunosurveillance and the pathogenesis of irAEs.

Also flagged:Adenosineinosineadenosinesadenosine deaminaseADARlocalization
Journal Article 2022-05-30 ✓ 5 Snippets Dredge WH, Li J, Fan X, Kozenkov A, Lalli M, Khalique S, Dracheva S, Mukamel EA, Breen MS.
In-Text Gene Mentions

…population markers NeuN,SOX6, and SOX10 were…

…non-neuronal nuclei (NeuN−);SOX6is a transcription…

…into adulthood, and anti-SOX6antibodies are used…

…nuclei of MGE-GABA (SOX6+) from GLU (SOX6−)…

…markers RBFOX3 ,SOX6, SOX10 )…

Show Full Abstract

Posttranscriptional adenosine-to-inosine modifications amplify the functionality of RNA molecules in the brain, yet the cellular and genetic regulation of RNA editing is poorly described. We quantify base-specific RNA editing across three major cell populations from the human prefrontal cortex: glutamatergic neurons, medial ganglionic eminence-derived GABAergic neurons, and oligodendrocytes. We identify more selective editing and hyper-editing in neurons relative to oligodendrocytes. RNA editing patterns are highly cell type-specific, with 189,229 cell type-associated sites. The cellular specificity for thousands of sites is confirmed by single nucleus RNA-sequencing. Importantly, cell type-associated sites are enriched in GTEx RNA-sequencing data, edited ~twentyfold higher than all other sites, and variation in RNA editing is largely explained by neuronal proportions in bulk brain tissue. Finally, we uncover 661,791 cis-editing quantitative trait loci across thirteen brain regions, including hundreds with cell type-associated features. These data reveal an expansive repertoire of highly regulated RNA editing sites across human brain cell types and provide a resolved atlas linking cell types to editing variation and genetic regulatory effects.

Also flagged:transposonsgene transferjuvenile hormone O-methyltransferasewaterhomeoboxmitochondrial cytochrome oxidase subunit I
Journal Article 2022-05-30 ✓ 1 Snippet So WL, Nong W, Xie Y, Baril T, Ma HY, Qu Z, Haimovitz J, Swale T, Gaitan-Espitia JD, Lau KF, Tobe SS, Bendena WG, Kai ZP, Hayward A, Hui JHL.
In-Text Gene Mentions

…Over recent years it has become clear thathorizontal transfer of transposons (HTT)is an important process in TE spread 20 , 21 .…

Show Full Abstract

Animals display a fascinating diversity of body plans. Correspondingly, genomic analyses have revealed dynamic evolution of gene gains and losses among animal lineages. Here we sequence six new myriapod genomes (three millipedes, three centipedes) at key phylogenetic positions within this major but understudied arthropod lineage. We combine these with existing genomic resources to conduct a comparative analysis across all available myriapod genomes. We find that millipedes generally have considerably smaller genomes than centipedes, with the repeatome being a major contributor to genome size, driven by independent large gains of transposons in three centipede species. In contrast to millipedes, centipedes gained a large number of gene families after the subphyla diverged, with gains contributing to sensory and locomotory adaptations that facilitated their ecological shift to predation. We identify distinct horizontal gene transfer (HGT) events from bacteria to millipedes and centipedes, with no identifiable HGTs shared among all myriapods. Loss of juvenile hormone O-methyltransferase, a key enzyme in catalysing sesquiterpenoid hormone production in arthropods, was also revealed in all millipede lineages. Our findings suggest that the rapid evolution of distinct genomic pathways in centipede and millipede lineages following their divergence from the myriapod ancestor, was shaped by differing ecological pressures.

Also flagged:cellsurface receptorplatelet-derived growth factor receptor αPDGFRαNG2 proteoglycan 2death
Journal Article 2022-05-30 ✓ 1 Snippet Zhen Y, Cullen CL, Ricci R, Summers BS, Rehman S, Ahmed ZM, Foster AY, Emery B, Gasperini R, Young KM.
In-Text Gene Mentions

…PCDH9 69 ,PCDH1770 , PCDH18…

Show Full Abstract

Oligodendrocyte progenitor cells (OPCs) express protocadherin 15 (Pcdh15), a member of the cadherin superfamily of transmembrane proteins. Little is known about the function of Pcdh15 in the central nervous system (CNS), however, Pcdh15 expression can predict glioma aggression and promote the separation of embryonic human OPCs immediately following a cell division. Herein, we show that Pcdh15 knockdown significantly increases extracellular signal-related kinase (ERK) phosphorylation and activation to enhance OPC proliferation in vitro. Furthermore, Pcdh15 knockdown elevates Cdc42-Arp2/3 signalling and impairs actin kinetics, reducing the frequency of lamellipodial extrusion and slowing filopodial withdrawal. Pcdh15 knockdown also reduces the number of processes supported by each OPC and new process generation. Our data indicate that Pcdh15 is a critical regulator of OPC proliferation and process motility, behaviours that characterise the function of these cells in the healthy CNS, and provide mechanistic insight into the role that Pcdh15 might play in glioma progression.

Also flagged:glucosaminesulfateosteoarthritis of theerosive osteoarthritis of the handosteoarthritisCrystalline
Journal Article 2022-05-30 ✓ 1 Snippet Tenti S, Veronese N, Cheleschi S, Seccafico I, Bruyère O, Reginster JY, Fioravanti A.
In-Text Gene Mentions

…OA, such ashemochromatosis, represented exclusion criter…

Show Full Abstract

<h4>Objective</h4>To evaluate the efficacy of prescription-grade Crystalline Glucosamine Sulfate (pCGS) as an add-on treatment to conventional therapy, compared to usual therapy alone, in patients with erosive osteoarthritis of the hand (EHOA).<h4>Methods</h4>This 6-month retrospective case-control study included patients with concomitant knee osteoarthritis and symptomatic EHOA. Participants were stratified into two groups based on whether or not pCGS (1500 mg/day) was added to the conventional therapy (education and training in ergonomic principles, exercise and use on-demand of symptomatic drugs) for hand osteoarthritis. Patients were evaluated at baseline, after 3 and 6 months. Primary outcomes were the change from baseline to month 6 in Visual Analogue Scale (VAS) hand pain and in Functional Index for Hand Osteoarthritis (FIHOA) score. A set of secondary parameters was also evaluated.<h4>Results</h4>123 patients were included as follows: 67 treated with pCGS in addition to conventional therapy (pCGS Group) and 56 with conventional therapy alone (Control Group). After 6 months a significant difference in VAS and in FIHOA score (p < 0.01 and p < 0.001, respectively) was observed in favor of pCGS Group. Similar results were found for morning stiffness duration (p < 0.05), health assessment questionnaire (p < 0.01) and physical and mental component score of 36-item short form (p < 0.05 and p < 0.001, respectively). A significant reduction of symptomatic drug consumption at 3 and 6 months was reported in the pCGS Group (p < 0.001). No serious adverse event was recorded in both groups.<h4>Conclusions</h4>Despite all the limitations inherent to an observational study, our results suggest the potential effectiveness of pCGS, when used in combination with conventional therapy in EHOA. Further randomized placebo-controlled trials are needed to confirm these positive findings.<h4>Trial registration</h4>ClinicalTrials.gov, http://www.<h4>Clinicaltrials</h4>gov , date of registration: February 2, 2022, NCT05237596. The present trial was retrospectively registered.

Also flagged:organelleaxonsorganellesaxoncytoplasmic dyneinkinesins
Journal Article 2022-05-30 ✓ 1 Snippet Cason SE, Holzbaur ELF.
In-Text Gene Mentions

Htt

Show Full Abstract

The active transport of organelles and other cargos along the axon is required to maintain neuronal health and function, but we are just beginning to understand the complex regulatory mechanisms involved. The molecular motors, cytoplasmic dynein and kinesins, transport cargos along microtubules; this transport is tightly regulated by adaptors and effectors. Here we review our current understanding of motor regulation in axonal transport. We discuss the mechanisms by which regulatory proteins induce or repress the activity of dynein or kinesin motors, and explore how this regulation plays out during organelle trafficking in the axon, where motor activity is both cargo specific and dependent on subaxonal location. We survey several well-characterized examples of membranous organelles subject to axonal transport - including autophagosomes, endolysosomes, signalling endosomes, mitochondria and synaptic vesicle precursors - and highlight the specific mechanisms that regulate motor activity to provide localized trafficking within the neuron. Defects in axonal transport have been implicated in conditions ranging from developmental defects in the brain to neurodegenerative disease. Better understanding of the underlying mechanisms will be essential to develop more-effective treatment options.

Also flagged:ironatrial fibrillationarrhythmiaAFstrokeoxygen
Journal Article 2022-05-30 ✓ 5 Snippets Wang T, Cheng J, Wang Y.
In-Text Gene Mentions

…and rs1799945 inHFEand rs855791 in…

…found that rs1799945 (HFEgene) has a…

…effect of rs1799945 (HFEgene) on the…

…alleles at rs1800562 (HFEgene) and rs1799945…

…gene) and rs1799945 (HFEgene) were associated…

Show Full Abstract

<h4>Background</h4>Atrial fibrillation is the most common arrhythmia disease. Animal and observational studies have found a link between iron status and atrial fibrillation. However, the causal relationship between iron status and AF remains unclear. The purpose of this investigation was to use Mendelian randomization (MR) analysis, which has been widely applied to estimate the causal effect, to reveal whether systemic iron status was causally related to atrial fibrillation.<h4>Methods</h4>Single nucleotide polymorphisms (SNPs) strongly associated (P < 5 × 10<sup>-8</sup>) with four biomarkers of systemic iron status were obtained from a genome-wide association study involving 48,972 subjects conducted by the Genetics of Iron Status consortium. Summary-level data for the genetic associations with atrial fibrillation were acquired from the AFGen (Atrial Fibrillation Genetics) consortium study (including 65,446 atrial fibrillation cases and 522,744 controls). We used a two-sample MR analysis to obtain a causal estimate and further verified credibility through sensitivity analysis.<h4>Results</h4>Genetically instrumented serum iron [OR 1.09; 95% confidence interval (CI) 1.02-1.16; p = 0.01], ferritin [OR 1.16; 95% CI 1.02-1.33; p = 0.02], and transferrin saturation [OR 1.05; 95% CI 1.01-1.11; p = 0.01] had positive effects on atrial fibrillation. Genetically instrumented transferrin levels [OR 0.90; 95% CI 0.86-0.97; p = 0.006] were inversely correlated with atrial fibrillation.<h4>Conclusion</h4>In conclusion, our results strongly elucidated a causal link between genetically determined higher iron status and increased risk of atrial fibrillation. This provided new ideas for the clinical prevention and treatment of atrial fibrillation.

Also flagged:Linoleic acidIntrahepatic bile duct stonetumorcarcinomametabolism9,12-octadecadienoic acid
Journal Article 2022-05-30 No Snippets Li J, Lu J, Lv S, Sun S, Liu C, Xu F, Sun H, Yang J, Wang X, Zhong X, Lu J.
Show Full Abstract

<h4>Background</h4>Intrahepatic cholangiocarcinoma (ICC) is the second most common primary hepatic malignancy with poor prognosis. Intrahepatic bile duct stone (IBDS) is one of the key causes to ICC occurrence and can increase morbidity rate of ICC about forty times. However, the specific carcinogenesis of IBDS is still far from clarified. Insight into the metabolic phenotype difference between IBDS and ICC can provide potential mechanisms and therapeutic targets, which is expected to inhibit the carcinogenesis of IBDS and improve the prognosis of ICC.<h4>Methods</h4>A total of 34 participants including 25 ICC patients and 9 IBDS patients were recruited. Baseline information inclusive of liver function indicators, tumor biomarkers, surgery condition and constitution parameters etc. from patients were recorded. ICC and IBDS pathological tissues, as well as ICC para-carcinoma tissues, were collected for GC-MS based metabolomics experiments. Multivariate analysis was performed to find differentially expressed metabolites and differentially enriched metabolic pathways. Spearman correlation analysis was then used to construct correlation network between key metabolite and baseline information of patients.<h4>Results</h4>The IBDS tissue and para-carcinoma tissue have blurred metabolic phenotypic differences, but both of them essentially distinguished from carcinoma tissue of ICC. Metabolic differences between IBDS and ICC were enriched in linoleic acid metabolism pathway, and the level of 9,12-octadecadienoic acid in IBDS tissues was almost two times higher than in ICC pathological tissues. The correlation between 9,12-octadecadienoic acid level and baseline information of patients demonstrated that 9,12-octadecadienoic acid level in pathological tissue was negative correlation with gamma-glutamyl transpeptidase (GGT) and alkaline phosphatase (ALP) level in peripheral blood. These two indicators were all cancerization marker for hepatic carcinoma and disease characteristic of IBDS.<h4>Conclusion</h4>Long-term monitoring of metabolites from linoleic acid metabolism pathway and protein indicators of liver function in IBDS patients has important guiding significance for the monitoring of IBDS carcinogenesis. Meanwhile, further insight into the causal relationship between linoleic acid pathway disturbance and changes in liver function can provide important therapeutic targets for both IBDS and ICC.

Also flagged:metabolismplaguebehaviorallipidneuropeptidesaging
Journal Article 2022-05-30 No Snippets Hou L, Guo S, Ding D, Du B, Wang X.
Show Full Abstract

Insect flight is a complex physiological process that involves sensory and neuroendocrinal control, efficient energy metabolism, rhythmic muscle contraction, and coordinated wing movement. As a classical study model for insect flight, locusts have attracted much attention from physiologists, behaviorists, and neuroendocrinologists over the past decades. In earlier research, scientists made extensive efforts to explore the hormone regulation of metabolism related to locust flight; however, this work was hindered by the absence of molecular and genetic tools. Recently, the rapid development of molecular and genetic tools as well as multi-omics has greatly advanced our understanding of the metabolic, molecular, and neuroendocrinal basis of long-term flight in locusts. Novel neural and molecular factors modulating locust flight and their regulatory mechanisms have been explored. Moreover, the molecular mechanisms underlying phase-dependent differences in locust flight have also been revealed. Here, we provide a systematic review of locust flight physiology, with emphasis on recent advances in the neuroendocrinal, genetic, and molecular basis. Future research directions and potential challenges are also addressed.

Also flagged:segmentationcalcium phosphateinfectioncancermineralcollagen
Journal Article 2022-05-30 No Snippets Ezzahmouly M, Essakhi A, El Ouahli A, El Byad H, Ed-Dhahraouy M, Hakim S, Gourri E, ELmoutaouakkil A, Hatim Z.
Show Full Abstract

One of the most difficult aims of modern biomaterial science is predicting the shape and volume of a bone defect and adjusting the implementation of a bone substitute. Prior to implantation, practitioners must carefully identify the architecture and volume of the defective bone to be filled. This information is often accessed via imaging techniques. The defective bone is frequently confused with its surroundings and the image background. The use of conventional segmentation for the selection and isolation of the cavity to be filled proves to be difficult. In this work, a defect in a dead bone is created and then imaged with the microtomography technique (343 cuts generated). The goal is to separate the defect's shape and volume from both the bone and the background image. An adaptive morphological operation technique was employed to complete these tasks. The proposed method allows for exact segmentation and calculation of the volume of the cavity to be filled. Using several calculated phantoms, the approach is subjectively and quantitatively evaluated: Compared to the high error value of the conventional method, the error value of the proposed one has no bearing on the overall data. The method's accuracy was also confirmed by comparing the calculated volume of the bone defect (0.91 cm<sup>3</sup>) and the volume of prepared calcium phosphate cement paste necessary for its filling (0.87 cm<sup>3</sup>). To challenge the method even further, another direct application on a mandibular bone is realized with an advanced number of cuts (1236 cuts). The result of this application proved that the proposed algorithm overcomes the performance of the classical approaches of segmentation with a gain of 2 min on average. A comparison study between the proposed method and other classical segmentation approaches is also presented. The effectiveness of the method is proved by the various reports and metrics generated. The automated procedure can be beneficial in implantology for realizing and guiding surgical acts, as well as in computer-aided scaffolding techniques.

Also flagged:Intellectual Disabilitybrain developmentneurodevelopmental disorderspathogenesisIDtranslational
Journal Article 2022-05-30 No Snippets Liaci C, Prandi L, Pavinato L, Brusco A, Maldotti M, Molineris I, Oliviero S, Merlo GR.
Show Full Abstract

In the human brain, long non-coding RNAs (lncRNAs) are widely expressed in an exquisitely temporally and spatially regulated manner, thus suggesting their contribution to normal brain development and their probable involvement in the molecular pathology of neurodevelopmental disorders (NDD). Bypassing the classic protein-centric conception of disease mechanisms, some studies have been conducted to identify and characterize the putative roles of non-coding sequences in the genetic pathogenesis and diagnosis of complex diseases. However, their involvement in NDD, and more specifically in intellectual disability (ID), is still poorly documented and only a few genomic alterations affecting the lncRNAs function and/or expression have been causally linked to the disease endophenotype. Considering that a significant fraction of patients still lacks a genetic or molecular explanation, we expect that a deeper investigation of the non-coding genome will unravel novel pathogenic mechanisms, opening new translational opportunities. Here, we present evidence of the possible involvement of many lncRNAs in the etiology of different forms of ID and NDD, grouping the candidate disease-genes in the most frequently affected cellular processes in which ID-risk genes were previously collected. We also illustrate new approaches for the identification and prioritization of NDD-risk lncRNAs, together with the current strategies to exploit them in diagnosis.

Also flagged:Actinantibodiescell motilityorganizationcellcell migration
Journal Article 2022-05-30 No Snippets Ju Z, Thomas TN, Chiu YJ, Yamanouchi S, Yoshida Y, Abe JI, Takahashi A, Wang J, Fujiwara K, Hada M.
Show Full Abstract

Cultured mammalian cells have been shown to respond to microgravity (μG), but the molecular mechanism is still unknown. The study we report here is focused on molecular and cellular events that occur within a short period of time, which may be related to gravity sensing by cells. Our assumption is that the gravity-sensing mechanism is activated as soon as cells are exposed to any new gravitational environment. To study the molecular events, we exposed cells to simulated μG (SμG) for 15 min, 30 min, 1 h, 2 h, 4 h, and 8 h using a three-dimensional clinostat and made cell lysates, which were then analyzed by reverse phase protein arrays (RPPAs) using a panel of 453 different antibodies. By comparing the RPPA data from cells cultured at 1G with those of cells under SμG, we identified a total of 35 proteomic changes in the SμG samples and found that 20 of these changes took place, mostly transiently, within 30 min. In the 4 h and 8 h samples, there were only two RPPA changes, suggesting that the physiology of these cells is practically indistinguishable from that of cells cultured at 1 G. Among the proteins involved in the early proteomic changes were those that regulate cell motility and cytoskeletal organization. To see whether changes in gravitational environment indeed activate cell motility, we flipped the culture dish upside down (directional change in gravity vector) and studied cell migration and actin cytoskeletal organization. We found that compared with cells grown right-side up, upside-down cells transiently lost stress fibers and rapidly developed lamellipodia, which was supported by increased activity of Ras-related C3 botulinum toxin substrate 1 (Rac1). The upside-down cells also increased their migratory activity. It is possible that these early molecular and cellular events play roles in gravity sensing by mammalian cells. Our study also indicated that these early responses are transient, suggesting that cells appear to adapt physiologically to a new gravitational environment.

Also flagged:Diabetes MellitusCognitive dysfunctionsmild cognitive impairmentdementiatype 2 diabetes mellituscognitive dysfunction
Journal Article 2022-05-30 ✓ 1 Snippet Ehtewish H, Arredouani A, El-Agnaf O.
In-Text Gene Mentions

The carriers of the E3/4 genotype had higher triglycerides and LDL-C and lower HDL-C levels, suggesting that the E3/4 genotype is a potential risk factor for AD in T2DM [74] Although ApoE E3/4 or E4/4 alleles were most common in dementia patients with T2DM, the association was significant when the E3/4 genotype was combined with hemochromatosis-HFE gene mutations (H63D and C282Y) in females and with prior cerebrovascular events in males [75].

Show Full Abstract

Cognitive dysfunctions such as mild cognitive impairment (MCI), Alzheimer's disease (AD), and other forms of dementia are recognized as common comorbidities of type 2 diabetes mellitus (T2DM). Currently, there are no disease-modifying therapies or definitive clinical diagnostic and prognostic tools for dementia, and the mechanisms underpinning the link between T2DM and cognitive dysfunction remain equivocal. Some of the suggested pathophysiological mechanisms underlying cognitive decline in diabetes patients include hyperglycemia, insulin resistance and altered insulin signaling, neuroinflammation, cerebral microvascular injury, and buildup of cerebral amyloid and tau proteins. Given the skyrocketing global rates of diabetes and neurodegenerative disorders, there is an urgent need to discover novel biomarkers relevant to the co-morbidity of both conditions to guide future diagnostic approaches. This review aims to provide a comprehensive background of the potential risk factors, the identified biomarkers of diabetes-related cognitive decrements, and the underlying processes of diabetes-associated cognitive dysfunction. Aging, poor glycemic control, hypoglycemia and hyperglycemic episodes, depression, and vascular complications are associated with increased risk of dementia. Conclusive research studies that have attempted to find specific biomarkers are limited. However, the most frequent considerations in such investigations are related to C reactive protein, tau protein, brain-derived neurotrophic factor, advanced glycation end products, glycosylated hemoglobin, and adipokines.

Also flagged:ChromatinerythropoiesisorganizationTranscription Factorscell cycleorganelle
Journal Article 2022-05-30 No Snippets Andrieu-Soler C, Soler E.
Show Full Abstract

Studies of the regulatory networks and signals controlling erythropoiesis have brought important insights in several research fields of biology and have been a rich source of discoveries with far-reaching implications beyond erythroid cells biology. The aim of this review is to highlight key recent discoveries and show how studies of erythroid cells bring forward novel concepts and refine current models related to genome and 3D chromatin organization, signaling and disease, with broad interest in life sciences.

Also flagged:PolysaccharidesFerroptosisLiver diseaseLiver injuriesascirrhosis
Journal Article 2022-05-30 No Snippets Ren Y, Li S, Song Z, Luo Q, Zhang Y, Wang H.
Show Full Abstract

Liver disease is a global health burden with high morbidity and mortality worldwide. Liver injuries can develop into severe end-stage diseases, such as cirrhosis or hepatocellular carcinoma, without valid treatment. Therefore, identifying novel drugs may promote liver disease treatment. Phytochemicals, including polysaccharides, flavonoids, alkaloids, and terpenes, are abundant in foods and medicinal plants and have various bioactivities, such as antioxidation, immunoregulation, and tumor killing. Recent studies have shown that many natural polysaccharides play protective roles in liver disease models in vitro and in vivo, such as fatty liver disease, alcoholic liver disease, drug-induced liver injury, and liver cancer. The mechanisms of liver disease are complex. Notably, ferroptosis, a new type of cell death driven by iron and lipid peroxidation, is considered to be the key mechanism in many hepatic pathologies. Therefore, polysaccharides and other types of phytochemicals with activities in ferroptosis regulation provide novel therapeutic strategies for ferroptosis-related liver diseases. This review summarizes our current understanding of the mechanisms of ferroptosis and liver injury and compelling preclinical evidence of natural bioactive polysaccharides and phytochemicals in treating liver disease.

Also flagged:Isoflavonoidmethyl jasmonateesteramidesamino acidindane-
Journal Article 2022-05-30 No Snippets Aristizábal D, Gil J, Quiñones W, Durango D.
Show Full Abstract

Eleven indanoyl derivatives were synthesized and, along with methyl jasmonate, evaluated as isoflavonoid-phytoalexin elicitors in two cultivars of common bean (<i>Phaseolus vulgaris</i> L. cvs. ICA-Cerinza and Uribe Rosado, tolerant and susceptible to anthracnose, respectively). Indanoyl derivatives (an ester, two amides, and eight indanoyl-amino acid conjugates) were obtained from 1-oxo-indane-4-carboxylic acid. In general, the accumulation of isoflavonoid-type phytoalexins, such as isoflavones (genistein, daidzein, and 2'-hydroxygenistein), isoflavanones (dalbergioidin and kievitone), isoflavan (phaseollinisoflavan), coumestrol, and pterocarpans (phaseollidin and phaseollin), was dependent on the common bean cultivar, the post-induction time, and the elicitor structure. Isoflavones, dalbergioidin, and coumestrol reached their highest amounts during the first 48 to 72 h, whereas kievitone, phaseollinisoflavano, and the pterocarpans reached maximum levels between 72 and 96 h. The 1-oxo-indanoyl-L-isoleucine methyl ester elicited the highest levels of phytoalexins (similar to those elicited by the methyl jasmonate) and showed no significant phytotoxic effects on common bean seedlings. The indanoyl-type synthetic elicitor, 1-oxo-indanoyl-L-isoleucine methyl ester, may represent a promising agronomic alternative for disease control in common bean by enhancing the accumulation of antimicrobial isoflavonoid phytoalexins.

Also flagged:Cholic AcidInfectionsmembranespeptidesheterocyclicoxygen
Journal Article 2022-05-30 No Snippets Kakkar H, Chaudhary N, Mehta D, Saini V, Maheshwari S, Singh J, Walia P, Bajaj A.
Show Full Abstract

Infections associated with Gram-positive bacteria like <i>S. aureus</i> pose a major threat as these bacteria can develop resistance and thereby limit the applications of antibiotics. Therefore, there is a need for new antibacterials to mitigate these infections. Bacterial membranes present an attractive therapeutic target as these membranes are anionic in nature and have a low chance of developing modifications in their physicochemical features. Antimicrobial peptides (AMPs) can disrupt the microbial membranes via electrostatic interactions, but the poor stability of AMPs halts their clinical translation. Here, we present the synthesis of eight <i>N</i>-methyl benzimidazole substituted cholic acid amphiphiles as antibacterial agents. We screened these novel heterocyclic cholic acid amphiphiles against different pathogens. Among the series, CABI-<b>6</b> outperformed the other amphiphiles in terms of bactericidal activity against <i>S. aureus.</i> The membrane disruptive property of CABI-<b>6</b> using a fluorescence-based assay has also been investigated, and it was inferred that CABI-<b>6</b> can enhance the production of reactive oxygen species. We further demonstrated that CABI-<b>6</b> can clear the pre-formed biofilms and can mitigate wound infection in murine models.

Also flagged:encephalitisInfectiondeathimmune responsemitosispathogenesis
Journal Article 2022-05-30 ✓ 4 Snippets Selinger M, Věchtová P, Tykalová H, Ošlejšková P, Rumlová M, Štěrba J, Grubhoffer L.
In-Text Gene Mentions

…(e.g., OAS1 ,TRIM38, SPSB4 ),…

…, CNTN2 ,DCC) as well…

…), receptors (e.g.,DCC, UTS2R ),…

…, CHRNB4 ,DCC, PTPRH ).…

Show Full Abstract

Tick-borne encephalitis virus (TBEV), the most medically relevant tick-transmitted flavivirus in Eurasia, targets the host central nervous system and frequently causes severe encephalitis. The severity of TBEV-induced neuropathogenesis is highly cell-type specific and the exact mechanism responsible for such differences has not been fully described yet. Thus, we performed a comprehensive analysis of alterations in host poly-(A)/miRNA/lncRNA expression upon TBEV infection <i>in vitro</i> in human primary neurons (high cytopathic effect) and astrocytes (low cytopathic effect). Infection with severe but not mild TBEV strain resulted in a high neuronal death rate. In comparison, infection with either of TBEV strains in human astrocytes did not. Differential expression and splicing analyses with an <i>in silico</i> prediction of miRNA/mRNA/lncRNA/vd-sRNA networks found significant changes in inflammatory and immune response pathways, nervous system development and regulation of mitosis in TBEV Hypr-infected neurons. Candidate mechanisms responsible for the aforementioned phenomena include specific regulation of host mRNA levels via differentially expressed miRNAs/lncRNAs or vd-sRNAs mimicking endogenous miRNAs and virus-driven modulation of host pre-mRNA splicing. We suggest that these factors are responsible for the observed differences in the virulence manifestation of both TBEV strains in different cell lines. This work brings the first complex overview of alterations in the transcriptome of human astrocytes and neurons during the infection by two TBEV strains of different virulence. The resulting data could serve as a starting point for further studies dealing with the mechanism of TBEV-host interactions and the related processes of TBEV pathogenesis.

Also flagged:saltscalcium ionsphosphate estersalkylsaltcalcium
Journal Article 2022-05-30 No Snippets Yokoi T, Mio A, Nakamura J, Sugawara-Narutaki A, Kawashita M, Ohtsuki C.
Show Full Abstract

Ceramic biomaterials have been used for the treatment of bone defects and have stimulated intense research on such materials. We have previously reported that a salt composed of calcium ions and a phosphate ester (SCPE) transformed into hydroxyapatite (HAp) in a simulated body fluid (SBF) modified with alkaline phosphatase (ALP), and proposed SCPEs as a new category of ceramic biomaterials, namely bioresponsive ceramics. However, the factors that affect the transformation of SCPEs to HAp in the SBF remained unclear. Therefore, in this study, we investigated the behaviour of calcium salts of methyl phosphate (CaMeP), ethyl phosphate (CaEtP), butyl phosphate (CaBuP), and dodecyl phosphate (CaDoP) in SBF with and without ALP modification. For the standard SBF, an X-ray diffraction (XRD) analysis indicated that these SCPEs did not readily transform into calcium phosphate. However, CaMeP, CaEtP, and CaBuP were transformed into HAp and octacalcium phosphate in the SBF modified with ALP; therefore, these SCPEs can be categorised as bioresponsive ceramics. Although CaDoP did not exhibit a sufficient response to ALP to be detected by XRD, it is likely to be a bioresponsive ceramic based on the results of morphological observations. The transformation rate for the SCPEs decreased with increasing size of the linear alkyl group of the phosphate esters. The rate-determining steps for the transformation reaction of the SCPEs were changed from the dissolution of the SCPEs to the hydrolysis of the phosphate esters with increasing size of the phosphate ester alkyl groups. These findings contribute to designing novel bioresponsive ceramic biomaterials.

Also flagged:melaninmethylationHERC2OCA2IRF4SLC24A4
Journal Article 2022-05-30 ✓ 2 Snippets Lona-Durazo F, Thakur R, Pairo-Castineira E, Funderburk K, Zhang T, Kovacs MA, Choi J, Jackson IJ, Brown KM, Parra EJ.
In-Text Gene Mentions

In addition, it may alter the motif of POU3F2, a transcription factor (TF) present in melanoma cell lines known to alter the expression of pigmentation genes (i.e. MITF, KITLG), although a recent study suggests that this TF does not have a role in normal skin melanocytes (Larue et al., 2010; Chitsazan et al., 2020).

…the motif ofPOU3F2, a transcription factor…

Show Full Abstract

Eye color is highly variable in populations with European ancestry, ranging from low to high quantities of melanin in the iris. Polymorphisms in the <i>HERC2/OCA2</i> locus have the largest effect on eye color in these populations, although other genomic regions also influence eye color. We performed genome-wide association studies of eye color in a Canadian cohort of European ancestry (N = 5,641) and investigated candidate causal variants. We uncovered several candidate causal signals in the <i>HERC2/OCA2</i> region, whereas other loci likely harbor a single causal signal. We observed colocalization of eye color signals with the expression or methylation profiles of cultured primary melanocytes. Genetic correlations of eye and hair color suggest high genome-wide pleiotropy, but locus-level differences in the genetic architecture of both traits. Overall, we provide a better picture of the polymorphisms underpinning eye color variation, which may be a consequence of specific molecular processes in the iris melanocytes.

Also flagged:α-SynucleinLewy body diseasesdementia with Lewy bodiesPDOCT4Gene expression
Journal Article 2022-05-30 ✓ 1 Snippet Natalwala A, Behbehani R, Yapom R, Kunath T.
In-Text Gene Mentions

…MYT1L , andPOU3F2, were significantly…

Show Full Abstract

α-Synuclein (αSyn) is a small, disordered protein that becomes aggregated in Lewy body diseases, such as Parkinson's disease (PD) and dementia with Lewy bodies (DLB). Human induced pluripotent stem cells (hiPSCs) potentially provide a tractable disease model to monitor early molecular changes associated with PD/DLB. We and others have previously derived hiPSC lines from patients with duplication and triplication of the <i>SNCA</i> gene, encoding for αSyn. It is now recognised that to perform meaningful disease modelling with these hiPSC lines, it is critical to generate isogenic control cell lines that lack the disease causing mutations. In order to complement the existing and emerging hiPSC models for PD/DLB, we have generated an allelic series of αSyn over-expressing hESC lines on the same isogenic background. An unresolved question is whether pluripotent stem cell lines, with elevated levels of αSyn, can undergo efficient differentiation into dopaminergic and cortical neurons to model PD and DLB, respectively. We took advantage of our isogenic collection of hESC lines to determine if increased expression of αSyn affects neural induction and neuronal differentiation. Clonal hESC lines with significantly different levels of αSyn expression proliferated normally and maintained expression of pluripotent markers, such as OCT4. All cell lines efficiently produced PAX6<sup>+</sup> neuroectoderm and there was no correlation between αSyn expression and neural induction efficiency. Finally, global transcriptomic analysis of cortical differentiation of hESC lines with low or high levels of αSyn expression demonstrated robust and similar induction of cortical neuronal expression profiles. Gene expression differences observed were unrelated to neural induction and neuronal differentiation. We conclude that elevated expression of αSyn in human pluripotent stem cells does not adversely affect their neuronal differentiation potential and that collections of isogenic cell lines with differing levels of αSyn expression are valid and suitable models to investigate synucleinopathies.

Also flagged:kinaseprotein kinasesmitogen-activated protein kinasesMAPKsMAPK1MAPK8
Journal Article 2022-05-30 ✓ 1 Snippet Xiao D, Caldow M, Kim HJ, Blazev R, Koopman R, Manandi D, Parker BL, Yang P.
In-Text Gene Mentions

…), collaborates withSOX6in repressing MYH7…

Show Full Abstract

Myogenesis is governed by signaling networks that are tightly regulated in a time-dependent manner. Although different protein kinases have been identified, knowledge of the global signaling networks and their downstream substrates during myogenesis remains incomplete. Here, we map the myogenic differentiation of C2C12 cells using phosphoproteomics and proteomics. From these data, we infer global kinase activity and predict the substrates that are involved in myogenesis. We found that multiple mitogen-activated protein kinases (MAPKs) mark the initial wave of signaling cascades. Further phosphoproteomic and proteomic profiling with MAPK1/3 and MAPK8/9 specific inhibitions unveil their shared and distinctive roles in myogenesis. Lastly, we identified and validated the transcription factor nuclear factor 1 X-type (NFIX) as a novel MAPK1/3 substrate and demonstrated the functional impact of NFIX phosphorylation on myogenesis. Altogether, these data characterize the dynamics, interactions, and downstream control of kinase signaling networks during myogenesis on a global scale.

Also flagged:Tumor Necrosis Factor ReceptorDiabetes mellitusCoronary artery diseasedeathtype 2 DMhyperglycemia
Journal Article 2022-05-30 ✓ 5 Snippets Hsu PC, Huang JC, Tsai WC, Hung WW, Chang WA, Wu LY, Chang CY, Tsai YC, Hsu YL.
In-Text Gene Mentions

…The primers (TNFRSF21,TNFSF4, cadherin 11 (CDH11),…

…Serum TNFRSF21 andTNFSF4in Supernatant of…

…(Cat DY144) andTNFSF4(Cat DY1054-5) levels…

…CAECs, TNFRSF21 andTNFSF4were soluble factors…

…affected TNFRSF21 andTNFSF4expression in CAECs.…

Show Full Abstract

Diabetes mellitus (DM) is an increasing threat to human health and regarded as an important public issue. Coronary artery disease is one of the main causes of death in type 2 DM patients. However, the effect of hyperglycemia on coronary artery endothelial cells (CAECs) and the pathophysiologic mechanisms are still not well-explored. This study aims to explore the signal pathway and novel biomarkers of injury of CAECs in DM in understanding the microenvironment changes and mechanisms of diabetic heart disease. Next-generation sequence (NGS) and bioinformatics analysis to analyze the CAECs of one type 2 DM patient and one normal individual was performed, and it was found that tumor necrosis factor receptor superfamily member 21 (TNFRSF21) was a soluble factor in circulating system. Further experiments confirmed that advanced glycation end products (AGEs), the metabolite derived by hyperglycemia, increased the expression of TNFRSF21 in CAECs. TNFRSF21 induced endothelial-mesenchymal transition (EndoMT) in CAECs, resulting in increased permeability of CAECs. In addition, levels of serum TNFRSF21 were higher in type 2 DM patients with left ventricular hypertrophy (LVH) than those without LVH. Serum TNFRSF21 levels were also positively correlated with the LV mass index and negatively with LV systolic function. Serum TNFRSF21 levels were associated with changes in cardiac structure and function in patients with type 2 DM. In conclusion, TNFRSF21 plays a pathogenic role in heart disease of type 2 DM, and can be used as a biomarker of the impairment of cardiac structure and function in type 2 DM patients.

Also flagged:Pseudomelanosis duodenidiabetes mellituschronic renal failurepseudomelanosisironhypertension
Journal Article 2022-05-30 ✓ 1 Snippet Cheema HI, Raghavapuram S, Boston I, Augustine T, Tharian B.
In-Text Gene Mentions

…odeni, eosinophilic enteritis,hemochromatosis, clofazimine-related pigmenta…

Show Full Abstract

Pseudomelanosis duodeni is a rare finding usually described as a black/brown speckled or tattooed appearance of the intestinal mucosa. Although an incidental finding, it has been associated with different medications and chronic medical conditions such as diabetes mellitus and chronic renal failure. We describe an elderly male who presented with epigastric pain and melena. Endoscopy showed pseudomelanosis duodeni related to intravenous (IV) iron transfusion. To our knowledge, this is the first report of pseudomelanosis duodeni related to IV iron use. In spite of its benign nature, the diagnosis of pseudomelanosis duodeni is essential to rule out other serious medical conditions that mimic its physical findings.

Also flagged:cancerTLR4antibodiestumorglycoproteinbinding
Journal Article 2022-05-30 No Snippets Yang D, Luo X, Lian Q, Gao L, Wang C, Qi X, Zhang R, Liu Z, Liao G.
Show Full Abstract

We present a new strategy for self-adjuvanting vaccine development that has different types of covalently-linked immunostimulants as the carrier molecule. Using Tn antigen as the model, a three-component vaccine (MPLA-Tn-KRN7000) containing the TLR4 ligand MPLA and the iNKT cell agonist KRN7000 was designed and synthesized. This expands fully synthetic self-adjuvanting vaccine studies that use a single carrier to one with two different types of carriers. The corresponding two-component conjugate vaccines Tn-MPLA, Tn-KRN7000 and Tn-CRM197 were also synthesized, as controls. The immunological evaluation found that MPLA-Tn-KRN7000 elicits robust Tn-specific and T cell-dependent immunity. The antibodies specifically recognized, bound to and exhibited complement-dependent cytotoxicity against Tn-positive cancer cells. In addition, MPLA-Tn-KRN7000 increased the survival rate and survival time of tumor-challenged mice, and surviving mice reject further tumor attacks without any additional treatment. Compared to the glycoprotein vaccine Tn-CRM197, the two-component conjugate vaccines, Tn-MPLA and Tn-KRN7000, and the physical mixture of Tn-MPLA and Tn-KRN7000, MPLA-Tn-KRN7000 showed the most effect at combating tumor cells both <i>in vitro</i> and <i>in vivo</i>. The comparison of immunological studies in wild-type and TLR4 knockout mice, along with the test of binding affinity to CD1d protein suggests that the covalently linked MPLA-KRN7000 immunostimulant induces a synergistic activation of TLR4 and iNKT cell that improves the immunogenicity of Tn. This work demonstrates that MPLA-Tn-KRN7000 has the potential to be a vaccine candidate and provides a new direction for fully synthetic vaccine design.

Also flagged:Autoimmune sclerosing cholangitisSARS-CoV-2 infectioncoronavirus disease 2019COVID-19cholestasisSevere acute
Journal Article 2022-05-30 ✓ 1 Snippet Zdanowicz K, Bobrus-Chociej A, Kopiczko A, Uścinowicz M, Tomczuk-Ostapczuk M, Janica J, Łotowska JM, Białokoz-Kalinowska I, Lebensztejn DM.
In-Text Gene Mentions

…40 µg/24 h),hemochromatosis(serum ferritin 330…

Show Full Abstract

The spectrum of liver involvement during coronavirus disease 2019 (COVID-19) is broad and mainly includes elevated liver enzymes and cholestasis. Severe acute respiratory syndrome corona- virus-2 (SARS-CoV-2) infection most often leads to a transient moderate increase in liver enzymes that is not accompanied by disturbances in the synthetic function of the liver. However, there is increasing evidence that SARS-CoV-2 infection is associated with the development of autoimmune disorders. The pathogenesis of autoimmune hepatobiliary diseases is not fully understood, taking into account genetic and environmental factors such as viral infections. We present a pediatric case of autoimmune sclerosing cholangitis (ASC), which was diagnosed 2 months after SARS-CoV-2 infection. To the best of our knowledge, ASC potentially triggered by COVID-19 has not been reported in pediatric patients. Further studies are needed to describe the clinical impact of the development of autoimmune liver diseases potentially associated with SARS-CoV-2 infection in pediatric patients. Our observations indicate that children with liver injury potentially caused by COVID-19 require long-term monitoring of liver function parameters.

Also flagged:non-alcoholic fatty liver diseaseschronic diseaseshepatic disordersnonalcoholic fatty liver diseasesNAFLDNon-alcoholic fatty liver disease
Journal Article 2022-05-29 ✓ 1 Snippet Farhadnejad H, Tehrani AN, Jahromi MK, Teymoori F, Mokhtari E, Salehi-Sahlabadi A, Mirmiran P.
In-Text Gene Mentions

…autoimmune liver disease,hemochromatosis, virus infection, and…

Show Full Abstract

<h4>Background</h4>Potential dietary inflammation can precursor chronic diseases such as hepatic disorders. We aimed to examine the association of empirical dietary inflammatory patterns (EDIP) and dietary inflammation scores (DIS) with the risk of nonalcoholic fatty liver diseases (NAFLD) in Iranian adults.<h4>Methods</h4>This case-control study was conducted on 225 newly diagnosed NAFLD cases and 450 controls aged 20-60 years. The individuals' dietary data were collected using a validated food frequency questionnaire. The detection of NAFLD in subjects was done using the ultrasonography scan of the liver and confirmation of gastroenterologists. To calculate of EDIP score, the average daily intakes of each item (15 food items) were multiplied by the proposed weights, and then all the weighted values were summed. Also, to calculate the DIS score, each food item (18 food items) is multiplied by its specific weight to obtain the weighted values of each item. The weighted values were then standardized using the Z-score. Finally, the standardized weighted values of all the items were summed to get the overall DIS score for the individuals. Logistic regression models, adjusted for potential confounders, were used to estimate the odds ratios and 95% confidence interval (CI) of NAFLD across tertiles of EDIP and DIS.<h4>Results</h4>The mean (SD) age and BMI of the study population (53% male) were 38.1 (8.8) years and 26.8 (4.3) kg/m<sup>2</sup>, respectively. The median (IQR) of EDIP and DIS scores in individuals were 0.52 (0.34, 0.73), and 0.04 (- 0.55, 0.59), respectively. Based on the multivariable-adjusted model, after controlling for age, sex, physical activity, smoking, marital status, waist-to-hip ratio, and dietary energy intake, individuals in the second (OR 2.01, 95% CI 1.07-3.76) and third tertiles of DIS (OR 2.54, 95% CI 1.39-4.63) had a higher odds of NAFLD compared to the lowest tertile of DIS (P<sub>trend</sub> = 0.003). Also, in the final model, there is a significant direct association between EDIP score and odds of NAFLD [(OR T2 vs. T1 = 0.88, 95% CI 0.50-1.57) and (OR T3 vs. T1 = 1.82, 95% CI 1.02-3.23)], (P<sub>trend</sub> = 0.031).<h4>Conclusion</h4>Our results suggested that higher scores of EDIP and DIS, indicating the high inflammatory potential of dietary pattern, are associated with increased odds of NAFLD in Iranian adults.

Also flagged:phyBcryptochrome 1COP1SPA2etiolationphotomorphogenesis
Journal Article 2022-05-29 ✓ 3 Snippets Su L, Zhou P, Guo L, Jia X, Wang S, Gao J, Li H, Liu B, Song M, Yang J.
In-Text Gene Mentions

(SPA2, full length) Amino acids 1–1,036; (SPA2–NT566, kinase‐like domain) amino acids 1–566; (SPA2–NT703, kinase‐like domain and coiled‐coil domain) amino acids 1–703; (SPA2–dCC, which lacks the coiled‐coil domain) amino acids 1–566 and 682–1,036; (phyA, full length) amino acids 1–1,122; (phyA–CT272) amino acids 851–1,122; (phyB, full length) amino acids 1–1,172; (CRY1‐CT192) amino acids 490–681.

To generate the BD‐SPA2–dCC, which lacks the coiled‐coil domain and has NT566 (amino acids 1–566) and CT355 (amino acids 682–1,036), two PCR fragments of NT566 and CT355 using primer pair of SPA2‐XBE1 and SPA2‐dCCR, or SPA2‐dCCF and SPA2‐1036XSXR, separately, were purified and mixed together as templates to do the second PCR next.

A C‐terminal 192‐amino acid fragment of CRY1 (CRY1–CT192, DAS domain) interacted with NT566, NT703, and a deletion derivative of SPA2 that lacked the coiled‐coil domain (dCC) (Figure 7c).

Show Full Abstract

In <i>Arabidopsis</i>, phytochrome (phy) A, phyB, and cryptochrome 1 (cry1) are representative far-red, red, and blue light photoreceptors, respectively. Members of the SUPPRESSOR OF PHYA-105 (SPA) protein family (SPA1-SPA4) form E3 ubiquitin ligase complexes with CONSTITUTIVE PHOTOMORPHOGENIC1 (COP1), which mediates the degradation of photomorphogenesis-promoting factors to desensitize light signaling. SPA2 has been reported to promote seedling etiolation in the dark. However, the unique roles of SPA2 and its three functional domains in suppressing photomorphogenesis under different light conditions are largely unknown. Here, we demonstrate that overexpression of the full-length or the central coiled-coil and C-terminal WD-repeat domains of <i>SPA2</i> cause hyper-etiolation phenotypes under several light conditions. The <i>SPA2</i> central coiled-coil and C-terminal WD-repeat domains are necessary and sufficient for repressing seedling de-etiolation, cotyledon unfolding, and promoting hypocotyl negative gravitropism under several light conditions. Furthermore, phyA, phyB, cry1, and COP1 repress protein accumulation or nuclear translocation of SPA2 through direct interactions with its kinase-like and coiled-coil domains located in the N-terminus in response to far-red, red, and blue light treatments, respectively. Taken together, our results demonstrate that SPA2 functions under multiple light conditions; moreover, light-activated photoreceptors rapidly suppress SPA2 activity via direct interactions in response to different light treatments.

Also flagged:Colorectal liver metastasesdeathmetastatic colorectal cancercancerscancertranslational
Journal Article 2022-05-29 No Snippets Wong GYM, Diakos C, Hugh TJ, Molloy MP.
Show Full Abstract

Colorectal liver metastases (CRLM) are the leading cause of death among patients with metastatic colorectal cancer (CRC). As part of multimodal therapy, liver resection is the mainstay of curative-intent treatment for select patients with CRLM. However, effective treatment of CRLM remains challenging as recurrence occurs in most patients after liver resection. Proposed clinicopathologic factors for predicting recurrence are inconsistent and lose prognostic significance over time. The rapid development of next-generation sequencing technologies and decreasing DNA sequencing costs have accelerated the genomic profiling of various cancers. The characterisation of genomic alterations in CRC has significantly improved our understanding of its carcinogenesis. However, the functional context at the protein level has not been established for most of this genomic information. Furthermore, genomic alterations do not always result in predicted changes in the corresponding proteins and cancer phenotype, while post-transcriptional and post-translational regulation may alter synthesised protein levels, affecting phenotypes. More recent advancements in mass spectrometry-based technology enable accurate protein quantitation and comprehensive proteomic profiling of cancers. Several studies have explored proteomic biomarkers for predicting CRLM after oncologic resection of primary CRC and recurrence after curative-intent resection of CRLM. The current review aims to rationalise the proteomic complexity of CRC and explore the potential applications of proteomic biomarkers in CRLM.

Also flagged:Neurological Disorderneurodegenerative disorderbehavioralneurodegenerative diseasesHDneurodegenerative disease
Journal Article 2022-05-29 ✓ 5 Snippets Gómez-Jaramillo L, Cano-Cano F, González-Montelongo MDC, Campos-Caro A, Aguilar-Diosdado M, Arroba AI.
In-Text Gene Mentions

Huntington’s disease (HD) is a devastating neurodegenerative disorder caused by a toxic, aggregation-prone expansion of the trinucleotides (cytosine/adenosine/guanine (CAG)) encoding for glutamine (Q) residues in the huntingtin (HTT) gene [5], with an age-dependent progression that leads to behavioral, cognitive and motor symptoms.

…repeats in theHTTgene with an…

…in the huntingtin (HTT) gene [ 5…

…Similar to wild-typeHTT, mutant HTT is…

…wild-type HTT, mutantHTTis expressed in…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by a toxic, aggregation-prone expansion of CAG repeats in the HTT gene with an age-dependent progression that leads to behavioral, cognitive and motor symptoms. Principally affecting the frontal cortex and the striatum, mHTT disrupts many cellular functions. In fact, increasing evidence shows that peripheral tissues are affected by neurodegenerative diseases. It establishes an active crosstalk between peripheral tissues and the brain in different neurodegenerative diseases. This review focuses on the current knowledge of peripheral tissue effects in HD animal and cell experimental models and identifies biomarkers and mechanisms involved or affected in the progression of the disease as new therapeutic or early diagnostic options. The particular changes in serum/plasma, blood cells such as lymphocytes, immune blood cells, the pancreas, the heart, the retina, the liver, the kidney and pericytes as a part of the blood-brain barrier are described. It is important to note that several changes in different mouse models of HD present differences between them and between the different ages analyzed. The understanding of the impact of peripheral organ inflammation in HD may open new avenues for the development of novel therapeutic targets.

Also flagged:Cell Activationsystemic autoimmune diseasedry eyedry mouthNotch2NF-kβ14
Journal Article 2022-05-29 ✓ 4 Snippets Peck AB, Nguyen CQ, Ambrus JL.
In-Text Gene Mentions

…These areTaok3(Tao kinase 3),…

…WhileTaok3is a factor…

…the genes encodingTaok3, Adam10, and Nicastrin…

…Interestingly,Taok3gene expression reveals…

Show Full Abstract

The C57BL/6.NOD-Aec1Aec2 mouse has been extensively studied to define the underlying cellular and molecular basis for the onset and development of Sjögren's syndrome (SS), a human systemic autoimmune disease characterized clinically as the loss of normal lacrimal and salivary gland functions leading respectively to dry eye and dry mouth pathologies. While an overwhelming majority of SS studies in both humans and rodent models have long focused primarily on pathophysiological events and the potential role of T lymphocytes in these events, recent studies in our murine models have indicated that marginal zone B (MZB) lymphocytes are critical for both development and onset of SS disease. Although migration and function of MZB cells are difficult to study in vivo and in vitro, we have carried out ex vivo investigations that use temporal global RNA transcriptomic analyses to track early cellular and molecular events in these exocrine glands of C57BL/6.NOD-Aec1Aec2 mice. In the present report, genome-wide transcriptome analyses of lacrimal glands indicate that genes and gene-sets temporally upregulated during early onset of disease define the Notch2/NF-kβ14 and Type1 interferon signal transduction pathways, as well as identify chemokines, especially Cxcl13, and Rho-GTPases, including DOCK molecules, in the cellular migration of immune cells to the lacrimal glands. We discuss how the current results compare with our recently published salivary gland data obtained from similar studies carried out in our C57BL/6.NOD-Aec1Aec2 mice, pointing out both similarities and differences in the etiopathogeneses underlying the autoimmune response within the two glands. Overall, this study uses the power of transcriptomic analyses to identify temporal molecular bioprocesses activated during the preclinical covert pathogenic stage(s) of SS disease and how these findings may impact future intervention therapies as the disease within the two exocrine glands may not be identical.

Also flagged:vasoconstrictionimmune responseacidmicrospheresproteolysispeptides
Journal Article 2022-05-29 No Snippets Agnihotri V, Agrawal Y, Goyal S, Sharma C, Ojha S.
Show Full Abstract

A lethal condition at the arterial-alveolar juncture caused the exhaustive remodeling of pulmonary arterioles and persistent vasoconstriction, followed by a cumulative augmentation of resistance at the pulmonary vascular and, consequently, right-heart collapse. The selective dilation of the pulmonary endothelium and remodeled vasculature can be achieved by using targeted drug delivery in PAH. Although 12 therapeutics were approved by the FDA for PAH, because of traditional non-specific targeting, they suffered from inconsistent drug release. Despite available inhalation delivery platforms, drug particle deposition into the microenvironment of the pulmonary vasculature and the consequent efficacy of molecules are influenced by pathophysiological conditions, the characteristics of aerosolized mist, and formulations. Uncertainty exists in peripheral hemodynamics outside the pulmonary vasculature and extra-pulmonary side effects, which may be further exacerbated by underlying disease states. The speedy improvement of arterial pressure is possible via the inhalation route because it has direct access to pulmonary arterioles. Additionally, closed particle deposition and accumulation in diseased tissues benefit the restoration of remolded arterioles by reducing fallacious drug deposition in other organs. This review is designed to decipher the pathological changes that should be taken into account when targeting the underlying pulmonary endothelial vasculature, especially with regard to inhaled particle deposition in the alveolar vasculature and characteristic formulations.

Also flagged:C6orf15ZSWIM4VARS2MUC21MUC22SLC19A1
Journal Article 2022-05-29 ✓ 1 Snippet Kitano Y, Nishimura S, Kato TM, Ueda A, Takigawa K, Umekage M, Nomura M, Kawakami A, Ogawa H, Xu H, Hotta A, Takasu N, Tsukahara M.
In-Text Gene Mentions

DCC

Show Full Abstract

In order to expand the promise of regenerative medicine using allogeneic induced pluripotent stem cells (iPSCs), precise and efficient genome editing of human leukocyte antigen (HLA) genes would be advantageous to minimize the immune rejection caused by mismatches of HLA type. However, clinical-grade genome editing of multiple HLA genes in human iPSC lines remains unexplored. Here, we optimized the protocol for good manufacturing practice (GMP)-compatible CRISPR-Cas9 genome editing to deplete the three gene locus (HLA-A, HLA-B, and CIITA genes) simultaneously in HLA homozygous iPSCs. The use of HLA homozygous iPSCs has one main advantage over heterozygous iPSCs for inducing biallelic knockout by a single gRNA. RNA-seq and flow cytometry analyses confirmed the successful depletion of HLAs, and lineage-specific differentiation into cardiomyocytes was verified. We also confirmed that the pluripotency of genome-edited iPSCs was successfully maintained by the three germ layers of differentiation. Moreover, whole-genome sequencing, karyotyping, and optical genome mapping analyses revealed no evident genomic abnormalities detected in some clones, whereas unexpected copy number losses, chromosomal translocations, and complex genomic rearrangements were observed in other clones. Our results indicate the importance of multidimensional analyses to ensure the safety and quality of the genome-edited cells. The manufacturing and assessment pipelines presented here will be the basis for clinical-grade genome editing of iPSCs.

medRxiv 2022-05-29 Preprint (No Snippets API) Skarping KD, Petersén Å, Gebre-Medhin S.
Show Full Abstract

Patients with Lynch syndrome (LS) are prone to cancer due to heterozygous germline pathogenic variants in genes encoding DNA mismatch repair proteins MLH1, MSH2, MSH6 and PMS2. LS cancer cells exhibit deficient DNA mismatch repair and microsatellite instability due somatic inactivation of the second copy of the affected gene. To study microsatellite characteristics in non-neoplastic cells in LS we determined CAG repeat size in the huntingtin gene ( HTT ) microsatellite in lymphocyte DNA from LS patients with germline pathogenic variants in MLH1 (n = 11), MSH2 (n = 9), MSH6 (n = 7) and non-LS controls (n=19). Mean repeat size in LS was 19,55 CAG ( MLH1 ), 19,39 CAG ( MSH2 ), 18.07 CAG ( MSH6 ), respectively compared to 18,42 CAG in controls. Standard deviation for CAG repeat size in LS was 4,183 CAG ( MLH1 ), 5,089 CAG ( MSH2 ), 3,075 CAG ( MSH6 ), respectively, compared to 3,342 CAG in controls. Peak CAG repeat size in LS was 32 CAG ( MLH1 ), 32 CAG ( MSH2 ), 24 CAG ( MSH6 ), respectively compared to 27 CAG in controls. Collectively, our data indicate that HTT CAG repeat size tends to be larger and more variable in individuals with LS caused by pathogenic variants in MLH1 and MSH2 .

Also flagged:phosphodiesterase-5sildenafilHDbehavioralAgingAD
Journal Article 2022-05-28 ✓ 2 Snippets Achenbach J, Faissner S, Saft C.
In-Text Gene Mentions

As inclusion criteria for manifest HD group, all participants had a diagnostic confidence level (DCL) of 4 (unequivocal signs of clinical manifest HD (> 99% confidence), a total motor-score (TMS) > 5 and a genetically confirmed report with ≥ 36 Cytosine-Adenine-Guanine (CAG)-repeats in the Huntingtin-gene (HTT).

…the Huntingtin-gene (HTT).…

Show Full Abstract

The phosphodiesterase-5 inhibitor sildenafil was postulated to reduce the risk for Alzheimer's Disease. Since preclinical data revealed beneficial effects in Huntington's Disease (HD), we now for the first time investigated effects of sildenafil in HD patients using the database ENROLL-HD. We demonstrate beneficial effects on motoric, functional and cognitive capacities in cross-sectional data. Those effects were not explained by underlying fundamental molecular genetic or demographic data. It remains unsolved, if effects are due to behavioral differences or due to direct dose-dependent neurobiological modulations.

Also flagged:receptor type protein tyrosine phosphatase DPTPRDrestless leg syndromeneurofibrillaryphosphotyrosine phosphoproteinphosphatase
Journal Article 2022-05-28 No Snippets Henderson IM, Marez C, Dokladny K, Smoake J, Martinez M, Johnson D, Uhl GR.
Show Full Abstract

The receptor type protein tyrosine phosphatase D (PTPRD) is expressed by neurons and implicated in interesting phenotypes that include reward from addictive substances, restless leg syndrome and neurofibrillary tangle densities in Alzheimer's disease (AD-NFTs). However, the brain phosphotyrosine phosphoprotein (PTPP) substrates for PTPRD's phosphatase have not been clearly defined. Although we have identified small molecule inhibitors of PTPRD's phosphatase that are candidates for reducing reward from addictive substances, no positive allosteric modulators of this phosphatase that might be candidates for reducing AD-NFTs have been reported. We now report identification of candidate brain substrates for PTPRD based on their increased phosphorylation in knockout vs wildtype animals, coexpression with PTPRD in neuronal subtypes and brisk dephosphorylation by recombinant human PTPRD phosphatase. We also report discovery that quercetin and other flavonols, though not closely-related flavones, enhance rates of PTPRD's dephosphorylation of a group of these candidate substrate PTPPs but not others. This substrate-selective positive allosteric modulation provides a novel pharmacological action. Flavonol-mediated increases in PTPRD's dephosphorylation of the GSK3 β and α kinases that hyperphosphorylate tau, the major component of AD-NFTs, could help to explain recent data concerning genetic and dietary impacts on Alzheimer's disease.

Also flagged:Methyl esterethermitragynineantibodiesalkaloidalbumin
Journal Article 2022-05-28 No Snippets Mustafa RR, Sukor R, Mohd Nor SM, Saari N.
Show Full Abstract

Mitragynine is an alkaloid from Mitragyna speciosa Korth. (kratom), a native tropical plant in Southeast Asia. It could render psychotropic effects and is often misused in substitution for commercial drugs. In recent years, the consumption of kratom has grown rapidly and has led some countries to ban its use. The misuse of kratom can be detected and monitored through the determination of mitragynine from biological samples of the users. Therefore, the development of a rapid and effective detection method is needed. In this study, polyclonal antibodies were produced using mitragynine coupled to a carrier protein (cationic bovine serum albumin, cBSA) as an immunogen, which was prepared with coupling agents (i.e., N, N- dicyclohexylcarbodiimide, DCC and N-hydroxysuccinimide, NHS). It was conjugated to different mitragynine structure, 16-COOCH<sub>3</sub> (methyl ester) and 9-OCH<sub>3</sub> (aromatic ether). 2,4,6-Trinitrobenzenesulfonic acid (TNBS) method showed that 45 and 46 amino groups were bound to C22-MG-cBSA and C9-MG-cBSA, respectively. Fourier-transform infrared spectroscopy (FTIR) spectral changes at C22- and C9-hydroxymitragynine indicated reduction and demethylation process. In UV-Vis spectra, conjugated mitragynine to cBSA and OVA were displayed at a spectral region at 240-300 nm. For the antibody titre, the C22-MG-cBSA anti-serum showed a significantly higher titre than the C9-MG-cBSA at 1/128000 and 1/32000 dilutions, respectively. The detection range of the developed competitive indirect ELISA (CI-ELISA) was 0.01 to 10.00 μg/mL (R<sup>2</sup> = 0.9964). The assay exhibited a limit of detection (LOD) and limit of quantification (LOQ) at 0.041 and 0.124 μg/mL, respectively. The antibody produced is a high-value biorecognition molecule that can be further used in developing immuno-based detection methods such as immunosensors and immunochromatographic lateral flow assays. This will benefit the task force or forensic agencies for toxicological screening with high speed and efficiency.

Also flagged:secretionpolycystic ovary syndromePCOSmetabolismcell adhesion moleculesendocrine disorder
Journal Article 2022-05-28 No Snippets Li J, Jiang X, Li C, Che H, Ling L, Wei Z.
Show Full Abstract

Embryo implantation is a complex developmental process that requires coordinated interactions among the embryo, endometrium, and the microenvironment of endometrium factors. Even though the impaired endometrial receptivity of patients with polycystic ovary syndrome (PCOS) is known, understanding of endometrial receptivity is limited. A proteomics study in three patients with PCOS and 3 fertile women was performed to understand the impaired endometrial receptivity in patients with PCOS during luteal phases. Through isobaric tags for relative and absolute quantitation (iTRAQ) analyses, we identified 232 unique proteins involved in the metabolism, inflammation, and cell adhesion molecules. Finally, our results suggested that energy metabolism can affect embryo implantation, whereas inflammation and cell adhesion molecules can affect both endometrial conversion and receptivity. Our results showed that endometrial receptive damage in patients with PCOS is not a single factor. It is caused by many proteins, pathways, systems, and abnormalities, which interact with each other and make endometrial receptive research more difficult.

Also flagged:prostanoidchronic obstructive pulmonary diseaseCOPDcell proliferationprostanoidsCOX-2
Journal Article 2022-05-28 ✓ 5 Snippets Alqarni AA, Brand OJ, Pasini A, Alahmari M, Alghamdi A, Pang L.
In-Text Gene Mentions

…(PGIS, coded byPTGISgene), TXA synthase…

…): 5'-TGTTGAAAAGTAGTTCTGGG-3';PTGIS(FW): 5'-GAAAGACTTTTACAAGGATGG…

…of PTGS2 ,PTGIS, and TBXAS1…

PTGISand TBXAS1 mRNA…

…CSE significantly reducedPTGISmRNA expression compared…

Show Full Abstract

<h4>Background</h4>Pulmonary hypertension is a common and serious complication of chronic obstructive pulmonary disease (COPD). Studies suggest that cigarette smoke can initiate pulmonary vascular remodelling by stimulating cell proliferation; however, the underlying cause, particularly the role of vasoactive prostanoids, is unclear. We hypothesize that cigarette smoke extract (CSE) can induce imbalanced vasoactive prostanoid release by differentially modulating the expression of respective synthase genes in human pulmonary artery smooth muscle cells (PASMCs) and endothelial cells (PAECs), thereby contributing to cell proliferation.<h4>Methods</h4>Aqueous CSE was prepared from 3R4F research-grade cigarettes. Human PASMCs and PAECs were treated with or without CSE. Quantitative real-time RT-PCR and Western blotting were used to analyse the mRNA and protein expression of vasoactive prostanoid syhthases. Prostanoid concentration in the medium was measured using ELISA kits. Cell proliferation was assessed using the cell proliferation reagent WST-1.<h4>Results</h4>We demonstrated that CSE induced the expression of cyclooxygenase-2 (COX-2), the rate-limiting enzyme in prostanoid synthesis, in both cell types. In PASMCs, CSE reduced the downstream prostaglandin (PG) I synthase (PGIS) mRNA and protein expression and PGI<sub>2</sub> production, whereas in PAECs, CSE downregulated PGIS mRNA expression, but PGIS protein was undetectable and CSE had no effect on PGI<sub>2</sub> production. CSE increased thromboxane (TX) A synthase (TXAS) mRNA expression and TXA<sub>2</sub> production, despite undetectable TXAS protein in both cell types. CSE also reduced microsomal PGE synthase-1 (mPGES-1) protein expression and PGE<sub>2</sub> production in PASMCs, but increased PGE<sub>2</sub> production despite unchanged mPGES-1 protein expression in PAECs. Furthermore, CSE stimulated proliferation of both cell types, which was significantly inhibited by the selective COX-2 inhibitor celecoxib, the PGI<sub>2</sub> analogue beraprost and the TXA<sub>2</sub> receptor antagonist daltroban.<h4>Conclusions</h4>These findings provide the first evidence that cigarette smoke can induce imbalanced prostanoid mediator release characterized by the reduced PGI<sub>2</sub>/TXA<sub>2</sub> ratio and contribute to pulmonary vascular remodelling and suggest that TXA<sub>2</sub> may represent a novel therapeutic target for pulmonary hypertension in COPD.

Also flagged:acromegalysomatostatin receptorSRLtumorE-cadherinGHRL
Journal Article 2022-05-28 ✓ 5 Snippets Gil J, Marques-Pamies M, Sampedro M, Webb SM, Serra G, Salinas I, Blanco A, Valassi E, Carrato C, Picó A, García-Martínez A, Martel-Duguech L, Sardon T, Simó-Servat A, Biagetti B, Villabona C, Cámara R, Fajardo-Montañana C, Álvarez-Escolá C, Lamas C, Alvarez CV, Bernabéu I, Marazuela M, Jordà M, Puig-Domingo M.
In-Text Gene Mentions

Considering all the models, a patient stratification based on the extrasellar growth of the tumor, sex, age and the expression of E-cadherin, GHRL, IN1-GHRL, DRD2, SSTR5 and PEBP1 is proposed, with accuracies that stand between 71 to 95%.

…, SSTR5 andPEBP1is proposed, with…

…the measurement ofPEBP1and SSTR5 allows…

…In particular,PEBP1was associated with…

…markers: E-cadherin, SSTR2,PEBP1, GHRL and…

Show Full Abstract

Predicting which acromegaly patients could benefit from somatostatin receptor ligands (SRL) is a must for personalized medicine. Although many biomarkers linked to SRL response have been identified, there is no consensus criterion on how to assign this pharmacologic treatment according to biomarker levels. Our aim is to provide better predictive tools for an accurate acromegaly patient stratification regarding the ability to respond to SRL. We took advantage of a multicenter study of 71 acromegaly patients and we used advanced mathematical modelling to predict SRL response combining molecular and clinical information. Different models of patient stratification were obtained, with a much higher accuracy when the studied cohort is fragmented according to relevant clinical characteristics. Considering all the models, a patient stratification based on the extrasellar growth of the tumor, sex, age and the expression of E-cadherin, GHRL, IN1-GHRL, DRD2, SSTR5 and PEBP1 is proposed, with accuracies that stand between 71 to 95%. In conclusion, the use of data mining could be very useful for implementation of personalized medicine in acromegaly through an interdisciplinary work between computer science, mathematics, biology and medicine. This new methodology opens a door to more precise and personalized medicine for acromegaly patients.

Also flagged:mGluR5Glutamate receptorsagingneurological diseasesneurodegenerative disordersneurodegenerative diseases
Journal Article 2022-05-28 ✓ 2 Snippets de Souza JM, Ferreira-Vieira TH, Maciel EMA, Silva NC, Lima IBQ, Doria JG, Olmo IG, Ribeiro FM.
In-Text Gene Mentions

As a model of progressive neurodegeneration, we choose BACHD, a transgenic mouse model of HD that expresses mutant huntingtin (htt) containing 97 glutamines in the amino-terminal region27.

…expresses mutant huntingtin (htt) containing 97 glutamines…

Show Full Abstract

Glutamate receptors, including mGluR5, are involved in learning and memory impairments triggered by aging and neurological diseases. However, each condition involves distinct molecular mechanisms. It is still unclear whether the mGluR5 cell signaling pathways involved in normal brain aging differ from those altered due to neurodegenerative disorders. Here, we employed wild type (WT), mGluR5<sup>-/-</sup>, BACHD, which is a mouse model of Huntington's Disease (HD), and mGluR5<sup>-/-</sup>/BACHD mice, at the ages of 2, 6 and 12 months, to distinguish the mGluR5-dependent cell signaling pathways involved in aging and neurodegenerative diseases. We demonstrated that the memory impairment exhibited by mGluR5<sup>-/-</sup> mice is accompanied by massive neuronal loss and decreased dendritic spine density in the hippocampus, similarly to BACHD and BACHD/mGluR5<sup>-/-</sup> mice. Moreover, mGluR5 ablation worsens some of the HD-related alterations. We also show that mGluR5<sup>-/-</sup> and BACHD/mGluR5<sup>-/-</sup> mice have decreased levels of PSD95, BDNF, and Arc/Arg3.1, whereas BACHD mice are mostly spared. PSD95 expression was affected exclusively by mGluR5 ablation in the aging context, making it a potential target to treat age-related alterations. Taken together, we reaffirm the relevance of mGluR5 for memory and distinguish the mGluR5 cell signaling pathways involved in normal brain aging from those implicated in HD.

Also flagged:methylationironmetabolismcytosineACO1CYBRD1
Journal Article 2022-05-28 ✓ 1 Snippet Zhao Q, Ge Z, Fu S, Wan S, Shi J, Wu Y, Zhang Y.
In-Text Gene Mentions

…(ACO1, CYBRD1, FLVCR1,HFE, HMOX2, IREB2, NEDD8,…

Show Full Abstract

The prevalence of iron overload in Tibetans in Tibet is higher than that in Han. DNA methylation (DNAm) is closely related to iron metabolism and iron level. Nevertheless, the epigenetic status of Tibetans with iron overload is unknown, and we therefore aimed to explore whether the phenomenon observed in the Tibetan population is regulated by epigenetics. The results showed that 2.26% of cytosine was methylated in the whole genome, and that the rate of CG cytosine methylation was higher in individuals in the iron overload (TH) group than in those in the iron normal (TL) group. We analyzed differentially methylated genes (DMGs) in whole-genome bisulfite sequencing data from the TH and TL groups of high-altitude Tibetans. Protein-protein interaction and pathway analyses of candidate DMGs related to iron uptake and transport showed that epigenetic changes in 10 candidate genes (ACO1, CYBRD1, FLVCR1, HFE, HMOX2, IREB2, NEDD8, SLC11A2, SLC40A1 and TFRC) are likely to relate to iron overload. This work reveals, for the first time, changes of DNAm in Tibetan people with iron overload, which suggest that DNAm is a mechanism underlying differences in iron content between individuals in the high-altitude Tibetan population. Our findings should contribute to the study of iron metabolism and the overall health status of Tibetans.

Also flagged:BaicalinLincomycinLiver Injurypathogenesisliverlipid
Journal Article 2022-05-28 ✓ 3 Snippets Zhang S, Zhong R, Tang S, Han H, Chen L, Zhang H.
In-Text Gene Mentions

…Galnt5 , Galnt10,Eci2, Hmgcr, Ehhah, Acat1,…

…mRNA expressions ofEci2, Ehhadh ,…

…Acot3 ,Eci2, Ehhadh ,…

Show Full Abstract

The adverse effects of short-term megadose of antibiotics exposure on the gastrointestinal and liver tissue reactions in young children have been reported. Antibiotic-induced intestinal and liver reactions are usually unpredictable and present a poorly understood pathogenesis. It is, therefore, necessary to develop strategies for reducing the adverse effects of antibiotics. Studies on the harm and rescue measures of antibiotics from the perspective of the gut-liver system are lacking. Here, we demonstrate that lincomycin exposure reduced body weight, disrupted the composition of gut microbiota and intestinal morphology, triggered immune-mediated injury and inflammation, caused liver dysfunction, and affected lipid metabolism. However, baicalin administration attenuated the lincomycin-induced changes. Transcriptome analysis showed that baicalin improved immunity in mice, as evidenced by the decreased levels of intestinal inflammatory cytokines and expression of genes that regulate Th1, Th2, and Th17 cell differentiation, and inhibited mucin type O-glycan biosynthesis pathways. In addition, baicalin improved liver function by upregulating the expression of genes involved in bile acid secretion and lipid degradation, and downregulating genes involved in lipid synthesis in lincomycin-treated mice. Bile acids can regulate intestinal immunity and strengthen hepatoenteric circulation. In addition, baicalin also improved anti-inflammatory bacteria abundance (<i>Blautia</i> and <i>Coprobacillus</i>) and reduced pathogenic bacteria abundance (<i>Proteobacteria</i>, <i>Klebsiella</i>, and <i>Citrobacter</i>) in lincomycin-treated mice. Thus, baicalin can ameliorate antibiotic-induced injury and its associated complications such as liver disease.

Also flagged:Digestionneurodegenerative diseaseneurodegenerative diseasespolyunsaturated fatty acidspolysaccharidescarotenoids
Journal Article 2022-05-28 ✓ 5 Snippets Martins B, Vieira M, Delerue-Matos C, Grosso C, Soares C.
In-Text Gene Mentions

HD is caused by a mutation in the huntingtin (HTT) gene on chromosome 4 that abnormally expands the number of CAG nucleotide repeats [68].

Activated microglia also appeared in HD brains indicating that mutant htt aggregates stimulate microglia activation [143].

…in the huntingtin (HTT) gene on chromosome…

…Aβ, α-synuclein, mutanthtt, and mutant or…

…indicating that mutanthttaggregates stimulate microglia…

Show Full Abstract

Currently, there is no known cure for neurodegenerative disease. However, the available therapies aim to manage some of the symptoms of the disease. Human neurodegenerative diseases are a heterogeneous group of illnesses characterized by progressive loss of neuronal cells and nervous system dysfunction related to several mechanisms such as protein aggregation, neuroinflammation, oxidative stress, and neurotransmission dysfunction. Neuroprotective compounds are essential in the prevention and management of neurodegenerative diseases. This review will focus on the neurodegeneration mechanisms and the compounds (proteins, polyunsaturated fatty acids (PUFAs), polysaccharides, carotenoids, phycobiliproteins, phenolic compounds, among others) present in seaweeds that have shown in vivo and in vitro neuroprotective activity. Additionally, it will cover the recent findings on the neuroprotective effects of bioactive compounds from macroalgae, with a focus on their biological potential and possible mechanism of action, including microbiota modulation. Furthermore, gastrointestinal digestion, absorption, and bioavailability will be discussed. Moreover, the clinical trials using seaweed-based drugs or extracts to treat neurodegenerative disorders will be presented, showing the real potential and limitations that a specific metabolite or extract may have as a new therapeutic agent considering the recent approval of a seaweed-based drug to treat Alzheimer's disease.

Also flagged:mitochondrial diseasesMitochondriamembranedcytoplasmicorganellesphosphorylation
Journal Article 2022-05-28 ✓ 1 Snippet Aldossary AM, Tawfik EA, Alomary MN, Alsudir SA, Alfahad AJ, Alshehri AA, Almughem FA, Mohammed RY, Alzaydi MM.
In-Text Gene Mentions

Moreover, excessive hair growth (hypertrichosis) and dysmorphic disorder are common clinical manifestations in children with mitochondrial diseases that are caused by mutations in SURF1 (Baertling et al., 2013) and FBXL4 (Ballout et al., 2019), respectively.

Show Full Abstract

Mitochondria are double-membraned cytoplasmic organelles that are responsible for the production of energy in eukaryotic cells. The process is completed through oxidative phosphorylation (OXPHOS) by the respiratory chain (RC) in mitochondria. Thousands of mitochondria may be present in each cell, depending on the function of that cell. Primary mitochondria disorder (PMD) is a clinically heterogeneous disease associated with germline mutations in mitochondrial DNA (mtDNA) and/or nuclear DNA (nDNA) genes, and impairs mitochondrial structure and function. Mitochondrial dysfunction can be detected in early childhood and may be severe, progressive and often multi-systemic, involving a wide range of organs. Understanding epigenetic factors and pathways mutations can help pave the way for developing an effective cure. However, the lack of information about the disease (including age of onset, symptoms, clinical phenotype, morbidity and mortality), the limits of current preclinical models and the wide range of phenotypic presentations hamper the development of effective medicines. Although new therapeutic approaches have been introduced with encouraging preclinical and clinical outcomes, there is no definitive cure for PMD. This review highlights recent advances, particularly in children, in terms of etiology, pathophysiology, clinical diagnosis, molecular pathways and epigenetic alterations. Current therapeutic approaches, future advances and proposed new therapeutic plans will also be discussed.

bioRxiv 2022-05-28 Preprint (No Snippets API) Prowse ENP, Chaudhary AR, Sharon D, Hendricks AG.
Show Full Abstract

Huntingtin (HTT) is a scaffolding protein that recruits motor proteins to vesicular cargoes, enabling it to regulate kinesin-1, dynein, and myosin-VI-dependent transport. To maintain the native stoichiometry of huntingtin with its interacting partners, we used CRISPR/Cas9 to induce a phosphomimetic mutation of the endogenous HTT at S421 (HTT-S421D). Using single particle tracking, optical tweezers, and immunofluorescence, we examined the effects of this mutation on the motility of early endosomes and lysosomes. In HTT-S421D cells, lysosomes exhibit longer displacements and higher processive fractions compared to wild-type (HTT-WT) cells. Kinesins and dyneins exert greater forces on early endosomes and lysosomes in cells expressing HTT-S421D. Additionally, endosomes bind to microtubules faster and are more resistant to detachment under load. The recruitment of kinesins and dyneins to microtubules is enhanced in HTT-S421D cells. In contrast, overexpression of HTT had variable effects on the processivity, displacement, and directional bias of both early endosomes and lysosomes. These data indicate that phosphorylation of the endogenous huntingtin causes early endosomes and lysosomes to move longer distances and more processively by recruiting and activating both kinesin-1 and dynein. <h4>Statement of Significance</h4> The ubiquitous scaffolding protein huntingtin regulates the recruitment and activity of microtubule motors. Huntingtin phosphorylation at S421 enhances the microtubule binding and force generation of kinesin and dynein on early endosomes and lysosomes. Using optical tweezers to measure the forces exerted on endosomes in CRISPR-engineered cells, we find that a phosphomimetic huntingtin mutation (S421D) enhances both kinesin- and dynein-driven forces on early endosomes and lysosomes. The ability to modulate motor activity on a range of organelles makes huntingtin unique and suggests a significant role for huntingtin in regulating intracellular transport.

bioRxiv 2022-05-28 Preprint (No Snippets API) Oketch JW, Wain LV, Hollox EJ.
Show Full Abstract

Short tandem repeat (STR) variation is an often overlooked source of variation between genomes. STRs comprise about 3% of the human genome and are highly polymorphic. Some cause Mendelian disease, and others affect gene expression. Their contribution to common disease is not well-understood, but recent software tools designed to genotype STRs using short read sequencing data are beginning to address this. Here, we compare software that genotypes common STRs and rarer STR expansions genome-wide, with the aim of applying them to population-scale genomes. By using the Genome-In-A-Bottle (GIAB) consortium and 1000 Genomes Project sequencing data, we compare performance in terms of sequence length, depth, computing resources needed, genotyping accuracy and number of STRs genotyped. To ensure broad applicability of our findings, we also measure genotyping performance against a set of genomes from clinical samples with known STR expansions, and a set of STRs commonly used for forensic identification. We find that HipSTR, ExpansionHunter and GangSTR perform well in genotyping common STRs, including the CODIS 13 core STRs used for forensic analysis. GangSTR and ExpansionHunter outperform HipSTR for genotyping call rate and memory usage. ExpansionHunter denovo (EHdn), STRling and GangSTR outperformed STRetch for detecting expanded STRs, and EHdn and STRling used considerably less processor time compared to GangSTR. Analysis on shared genomic sequence data provided by the GIAB consortium allows future performance comparisons of new software approaches on a common set of data, facilitating comparisons and allowing researchers to choose the best software that fulfils their needs.

bioRxiv 2022-05-28 Preprint (No Snippets API) Lewis JE, Shebelut CW, Drumheller BR, Zhang X, Shanmugam N, Attieh M, Horwath MC, Khanna A, Smith GH, Gutman DA, Aljudi A, Cooper LA, Jaye DL.
Show Full Abstract

<h4>ABSTRACT</h4> Pathologic diagnosis of bone marrow disorders relies in part on microscopic analysis of bone marrow aspirate (BMA) smears and manual counting of marrow nucleated cells to obtain a differential cell count (DCC). This manual process has significant limitations, including analysis of only a small subset of optimal slide areas and nucleated cells, and inter-observer variability due to differences in cell selection and classification. To address these shortcomings, we developed an automated machine learning-based pipeline for obtaining 11-component DCCs on whole-slide BMAs. This pipeline utilizes a sequential process of identifying optimal BMA regions with high proportions of marrow nucleated cells, detecting individual cells within these optimal areas, and classifying these cells into one of 11 DCC components. Convolutional neural network models were trained on 396,048 BMA region, 28,914 cell boundary, and 1,510,976 cell class images from manual annotations. The resulting automated pipeline produces 11-component DCCs that demonstrate high statistical and diagnostic concordance with manual DCCs among a heterogeneous group of testing BMA slides with varying pathologies and cellularities. Additionally, we show that automated analysis can reduce intra-slide variance in DCCs by analyzing the whole slide and marrow nucleated cells within optimal regions. Finally, pipeline outputs of region classification, cell detection, and cell classification can be visualized using whole-slide image analysis software. This study demonstrates the feasibility of a fully-automated pipeline for generating DCCs on scanned whole-slide BMA images, with the potential for improving the current standard of practice for utilizing BMA smears in the laboratory analysis of hematologic disorders.

Also flagged:Wntbone morphogenetic proteinBMPLgr5response to injury
Journal Article 2022-05-27 No Snippets Palikuqi B, Rispal J, Klein O.
Show Full Abstract

The intestinal epithelium undergoes continuous cellular turnover, making it an attractive model to study tissue renewal and regeneration. Intestinal stem cells (ISCs) can both self-renew and differentiate along all epithelial cell lineages. Decisions about which fate to pursue are controlled by a balance between high Wnt signaling at the crypt bottom, where <i>Lgr5</i> <sup>+</sup> ISCs reside, and increasing bone morphogenetic protein (BMP) levels toward the villus, where differentiated cells are located. Under stress conditions, epithelial cells in the intestine are quite plastic, with dedifferentiation, the reversal of cell fate from a differentiated cell to a more stem-like cell, allowing for most mature epithelial cell types to acquire stem cell-like properties. The ISC niche, mainly made up of mesenchymal, immune, enteric neuronal, and endothelial cells, plays a central role in maintaining the physiological function of the intestine. Additionally, the immune system and the microbiome play an essential role in regulating intestinal renewal. The development of various mouse models, organoid co-cultures and single-cell technologies has led to advances in understanding signals emanating from the mesenchymal niche. Here, we review how intestinal regeneration is driven by stem cell self-renewal and differentiation, with an emphasis on the niche that fine tunes these processes in both homeostasis and injury conditions.

Also flagged:tumor suppressor geneTSGtumortumorsgenes expressionchromatin
Journal Article 2022-05-27 No Snippets Mosaieby E, Martínek P, Ondič O.
Show Full Abstract

<h4>Introduction</h4>This study presents a novel molecular parameter potentially co-defining tumor biology-the total tumor suppressor gene (TSG) count at chromosomal loci harboring genes rearranged in fusion-defined tumors. It belongs to the family of molecular parameters created using a black-box approach.<h4>Method</h4>It is based on a public curated Texas TSG database. Its data are regrouped based on individual genes loci using another public database (Genecards). The total TSG count for NTRK (NTRK1; OMIM: 191315; NTRK2; OMIM: 600456; NTRK3; OMIM: 191316), NRG1 (OMIM: 142445), and RET (OMIM: 164761) rearranged tumors in patients treated with a theranostic approach is calculated using the results of recently published studies.<h4>Results</h4>Altogether 138 loci containing at least three TSGs are identified. These include 21 "extremely hot" spots, with 10 to 28 TSGs mapping to a given locus. However, the study falls short of finding a correlation between tumor regression or patient survival and the TSG count owing to a low number of cases meeting the study criteria.<h4>Conclusion</h4>The total TSG count alone cannot predict the biology of translocation-defined tumors. The addition of other parameters, including microsatellite instability (MSI), tumor mutation burden (TMB), homologous recombination repair deficiency (HRD), and copy number heterogeneity (CNH), might be helpful. Thus a multi-modal data integration is advocated. We believe that large scale studies should evaluate the significance and value of the total TSG count.

Also flagged:JAK2myeloproliferative neoplasmshereditary hemochromatosis
Journal Article 2022-05-27 No Snippets Loscocco GG, Santi R, Carrai V, Coltro G, Mannelli F, Guglielmelli P, Vannucchi AM.
Show Full Abstract

No abstract available.

Also flagged:COVID-19coronavirus disease 2019respiratory infectionsInterleukin-6IL-6c-reactive protein
Journal Article 2022-05-27 ✓ 1 Snippet Lampart M, Zellweger N, Bassetti S, Tschudin-Sutter S, Rentsch KM, Siegemund M, Bingisser R, Osswald S, Kuster GM, Twerenbold R.
In-Text Gene Mentions

…a sign ofhemochromatosis, malignancy, or infections.…

Show Full Abstract

<h4>Background</h4>Inflammatory biomarkers are associated with severity of coronavirus disease 2019 (COVID-19). However, direct comparisons of their utility in COVID-19 versus other respiratory infections are largely missing.<h4>Objective</h4>We aimed to investigate the prognostic utility of various inflammatory biomarkers in COVID-19 compared to patients with other respiratory infections.<h4>Materials and methods</h4>Patients presenting to the emergency department with symptoms suggestive of COVID-19 were prospectively enrolled. Levels of Interleukin-6 (IL-6), c-reactive protein (CRP), procalcitonin, ferritin, and leukocytes were compared between COVID-19, other viral respiratory infections, and bacterial pneumonia. Primary outcome was the need for hospitalisation, secondary outcome was the composite of intensive care unit (ICU) admission or death at 30 days.<h4>Results</h4>Among 514 patients with confirmed respiratory infections, 191 (37%) were diagnosed with COVID-19, 227 (44%) with another viral respiratory infection (viral controls), and 96 (19%) with bacterial pneumonia (bacterial controls). All inflammatory biomarkers differed significantly between diagnoses and were numerically higher in hospitalized patients, regardless of diagnoses. Discriminative accuracy for hospitalisation was highest for IL-6 and CRP in all three diagnoses (in COVID-19, area under the curve (AUC) for IL-6 0.899 [95%CI 0.850-0.948]; AUC for CRP 0.922 [95%CI 0.879-0.964]). Similarly, IL-6 and CRP ranged among the strongest predictors for ICU admission or death at 30 days in COVID-19 (AUC for IL-6 0.794 [95%CI 0.694-0.894]; AUC for CRP 0.807 [95%CI 0.721-0.893]) and both controls. Predictive values of inflammatory biomarkers were generally higher in COVID-19 than in controls.<h4>Conclusion</h4>In patients with COVID-19 and other respiratory infections, inflammatory biomarkers harbour strong prognostic information, particularly IL-6 and CRP. Their routine use may support early management decisions.

Also flagged:acid phosphatasephosphateACPorganic acidsorganic acidlactic acid
Journal Article 2022-05-27 No Snippets Abdelgalil SA, Kaddah MMY, Duab MEA, Abo-Zaid GA.
Show Full Abstract

There is indeed a tremendous increase in biotechnological production on a global scale, more and more innovative bioprocesses, therefore, require to perform ideally not only in a small lab- but also on large production scales. Efficient microbial process optimization is a significant challenge when accomplishing a variety of sustainable development and bioengineering application objectives. In Egypt's mines, several distinct types of rock phosphate (RP) are utilized as a source of phosphate fertilizers in agriculture. It is more ecologically beneficial to utilize RP bio-solubilization than acidulation. Therefore, this work aimed to strategically scale up the acid phosphatase (ACP) production and RP bio-solubilization by the newly-discovered Bacillus haynesii. The use of consecutive statistical experimental approaches of Plackett-Burman Design (PBD), and Rotatable Central Composite Design (RCCD), followed by pH-uncontrolled cultivation conditions in a 7 L bench-top bioreactor revealed an innovative medium formulation. These approaches substantially improved ACP production, reaching 207.6 U L<sup>-1</sup> with an ACP yield coefficient Y<sub>p/x</sub> of 25.2 and a specific growth rate (µ) of 0.07 h<sup>-1</sup>. The metals Na, Li, and Mn were the most efficiently released from RP during the solubilization process by B. haynesii. The uncontrolled pH culture condition is the most suitable setting for simultaneously improving the ACP and organic acids production. The most abundant organic acid produced through the cultivation process was lactic acid, followed by glutamic acid and hydroxybenzoic acid isomer. The findings of TGA, DSC, SEM, EDS, FTIR, and XRD analysis emphasize the significant influence of organic acids and ACP activity on the solubilization of RP particles.

Also flagged:GlioblastomaGBMbrain cancertumorepidermal growth factor receptortumors
Journal Article 2022-05-27 ✓ 1 Snippet Yeo AT, Rawal S, Delcuze B, Christofides A, Atayde A, Strauss L, Balaj L, Rogers VA, Uhlmann EJ, Varma H, Carter BS, Boussiotis VA, Charest A.
In-Text Gene Mentions

…, Ascl1 andSox6) (Fig. 2i…

Show Full Abstract

Glioblastoma (GBM) is an incurable primary malignant brain cancer hallmarked with a substantial protumorigenic immune component. Knowledge of the GBM immune microenvironment during tumor evolution and standard of care treatments is limited. Using single-cell transcriptomics and flow cytometry, we unveiled large-scale comprehensive longitudinal changes in immune cell composition throughout tumor progression in an epidermal growth factor receptor-driven genetic mouse GBM model. We identified subsets of proinflammatory microglia in developing GBMs and anti-inflammatory macrophages and protumorigenic myeloid-derived suppressors cells in end-stage tumors, an evolution that parallels breakdown of the blood-brain barrier and extensive growth of epidermal growth factor receptor<sup>+</sup> GBM cells. A similar relationship was found between microglia and macrophages in patient biopsies of low-grade glioma and GBM. Temozolomide decreased the accumulation of myeloid-derived suppressor cells, whereas concomitant temozolomide irradiation increased intratumoral GranzymeB<sup>+</sup> CD8<sup>+</sup>T cells but also increased CD4<sup>+</sup> regulatory T cells. These results provide a comprehensive and unbiased immune cellular landscape and its evolutionary changes during GBM progression.

Also flagged:childhood obesityobesitypubertyprecocious pubertysleepconduct problems
Journal Article 2022-05-27 No Snippets Yu T, Yu Y, Li X, Xue P, Yu X, Chen Y, Kong H, Lin C, Wang X, Mei H, Wang D, Liu S.
Show Full Abstract

<h4>Background</h4>Childhood obesity has important effects on the onset and development of puberty. Although a number of studies have confirmed the relationship between obesity and precocious puberty, little is known about the pleiotropic genes of obesity and precocious puberty and the interaction between genes and environment. There are four objectives: (1) to analyze the incidence of precocious puberty in the general population in China; (2) to verify the direct effect of obesity on children's precocious puberty using a variety of methods; (3) to verify the effect of obesity and its risk gene polymorphism on precocious puberty in a prospective cohort study; and (4) to analyze the interaction effect of genes and environment on pubertal development.<h4>Methods</h4>We will conduct a multi-center prospective cohort study in three cities, which are selected in southern, central, and northern China, respectively. Primary schools in these cities will be selected by a stratified cluster random sampling method. Primary school students from grade 1 to grade 3 (6 to 10 years old) will be selected for the cohort with extensive baseline data collection, including assessment of pubertal development, family demographic information, early development, sleep pattern, dietary pattern, and physical activity. Participants will be followed up for at least three years, and long-term follow-up will depend on future funding.<h4>Discussion</h4>The findings of this multicenter prospective population-based cohort study may expand previous related puberty development research as well as provide important information on the mechanism of early puberty. Targeted interventions can also be developed to improve adolescent health problems related to puberty development based on the available evidence.<h4>Trial registration</h4>ClinicalTrials.gov Identifier: NCT04113070 , prospectively registered on October 2, 2019.

Also flagged:methylationhistone modificationschromatingene expressionorganellebrain development
Journal Article 2022-05-27 No Snippets Koo B, Lee KH, Ming GL, Yoon KJ, Song H.
Show Full Abstract

Radial glial cells (RGCs) as primary neural stem cells in the developing mammalian cortex give rise to diverse types of neurons and glial cells according to sophisticated developmental programs with remarkable spatiotemporal precision. Recent studies suggest that regulation of the temporal competence of RGCs is a key mechanism for the highly conserved and predictable development of the cerebral cortex. Various types of epigenetic regulations, such as DNA methylation, histone modifications, and 3D chromatin architecture, play a key role in shaping the gene expression pattern of RGCs. In addition, epitranscriptomic modifications regulate temporal pre-patterning of RGCs by affecting the turnover rate and function of cell-type-specific transcripts. In this review, we summarize epigenetic and epitranscriptomic regulatory mechanisms that control the temporal competence of RGCs during mammalian corticogenesis. Furthermore, we discuss various developmental elements that also dynamically regulate the temporal competence of RGCs, including biochemical reaction speed, local environmental changes, and subcellular organelle remodeling. Finally, we discuss the underlying mechanisms that regulate the interspecies developmental tempo contributing to human-specific features of brain development.

Also flagged:AdiponectinHyperglycemiaRetinal Endothelial DysfunctionAPNtype 2 diabetespathogenesis
Journal Article 2022-05-27 ✓ 1 Snippet Bushra S, Al-Sadeq DW, Bari R, Sahara A, Fadel A, Rizk N.
In-Text Gene Mentions

…IL1B, MMP14, PECAM1,PTGIS, PTGS2, TEK, THBS1,…

Show Full Abstract

<h4>Background</h4>The pathophysiology of diabetic retinopathy (DR) is multifaced. A low level of circulating adiponectin (APN) in type 2 diabetes is associated with microvasculature complications, and its role in the evolution of DR is complex.<h4>Aim</h4>This study is designed to explore the potential impact of APN in the pathogenesis of DR, linking the changes in cellular and biological processes with the pathways, networks, and regulators involved in its actions.<h4>Methods</h4>Human microvascular retinal endothelial cells (HMRECs) were exposed to 30mM glucose (HG) and treated with globular adiponectin (30μg/mL) for 24 hours. The cells were evaluated for reactive oxidative stress (ROS) and apoptosis. RT-PCR profile arrays were utilized to evaluate the profile of genes involved in endothelial functions, angiogenesis, extracellular matrix, and adhesion molecules for hyperglycemic HMRECs treated with adiponectin. In addition, the barrier function, leukocyte migration, and angiogenesis were evaluated. The differential expressed genes (DEGs) were outlined, and bioinformatic analysis was applied.<h4>Results</h4>Adiponectin suppresses ROS production and apoptosis in HMRECs under HG conditions. Adiponectin improved migration and barrier functions in hyperglycemic cells. The bioinformatic analysis highlighted that the signaling pathways of integrin, HMGB1, and p38 AMPK, are mainly involved in the actions of APN on HMRECs. APN significantly affects molecular functions, including the adhesion of cells, chemotaxis, migration of WBCs, and angiogenesis. STAT3, NFKB, IKBKB, and mir-8 are the top upstream regulators, which affect the expressions of the genes of the data set, while TNF and TGFB1 are the top regulators.<h4>Conclusion</h4>Adiponectin significantly counteracts hyperglycemia at various cellular and molecular levels, reducing its impact on the pathophysiological progression towards DR in vitro using HMRECs. Adiponectin ameliorates inflammatory response, oxidative stress, and endothelial barrier dysfunction using a causal network of NFBk complex, TNF, and HMGB1 and integrin pathways.

Also flagged:ophthalmopathyRegulation ofgene expressionimmune responseNonspecific orbital inflammationidiopathic
Journal Article 2022-05-27 ✓ 2 Snippets Liu H, Chen L, Lei X, Ren H, Li G, Deng Z.
In-Text Gene Mentions

…SPARCL1, LYZ, LTF,OLFM4, and TIMP2 (Figures…

…SPARCL1, LYZ, LTF,OLFM4, and TIMP2.…

Show Full Abstract

<h4>Background</h4>Nonspecific orbital inflammation is a common ophthalmopathy with a high prevalence among adult females. Yet, its molecular mechanisms behind are poorly understood. Regulation of gene expression probably plays an important role in this disease. Thus, we utilized gene coexpression networks to identify key modules and hub genes involved in nonspecific orbital inflammation.<h4>Methods</h4>Data of gene expression in nonspecific orbital inflammation samples (<i>n</i> = 61) and healthy samples (<i>n</i> = 28) were obtained from the public Gene Expression Omnibus database. Afterward, differentially expressed genes were performed. Then, weighted correlation network analysis was done to define the key modules. Next, functional enrichment analysis was conducted by Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway in key modules. Finally, a protein-protein interaction network and Cytohubba plugin were used to screen hub genes.<h4>Results</h4>Differential expression of 716 genes was identified, among which 169 genes were upregulated and 547 genes were downregulated in the nonspecific orbital inflammation group. In weighted correlation network analysis, we clarified 2 key modules (MEturquoise and MEblue) that are likely to play key roles in nonspecific orbital inflammation. Functional enrichment analysis indicated that these genes are predominately involved in immune response and matrix homeostasis. In addition, among 2 key modules, there are 20 hub genes identified.<h4>Conclusion</h4>With this new approach, we identified several genes that could be critical to pathologies of nonspecific orbital inflammation. These findings may contribute to further therapeutic target development.

Also flagged:dysfunctionscoronavirus disease 2019COVID-19viral myocarditisheart failuredeath
Journal Article 2022-05-27 ✓ 4 Snippets Leng L, Ma J, Zhang PP, Xu SC, Li X, Jin Y, Cai J, Tang R, Zhao L, He ZC, Li MS, Zhang H, Zhou LR, Wu ZH, Li TR, Zhu YP, Wang YJ, Wu HB, Ping YF, Yao XH, Zhu CH, Guo HT, Tan LY, Liang ZY, Bian XW, Zhang SY.
In-Text Gene Mentions

For example, ECM regulators (HRG, ITIH2, ITIH1, and SERPINC1) and proteoglycan (LUM) that were downregulated in the COVID-19 sera were also decreased in the COVID-19 myocardia and microvessels of four heart regions.

Acute inflammatory response-associated proteins (SERPINA3, C7, FN1, PTGIS, PLA2G2A, LYZ, IL17D, and THBS1) and innate immune response-associated proteins (IGHG4 and PSMC6) were upregulated in the COVID-19 microvessels of LA (Figures 6A and 6B).

…(SERPINA3, C7, FN1,PTGIS, PLA2G2A, LYZ, IL17D,…

…ITIH2, ITIH1, andSERPINC1) and proteoglycan (LUM)…

Show Full Abstract

Direct myocardial and vascular injuries due to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection-driven inflammation is the leading cause of acute cardiac injury associated with coronavirus disease 2019 (COVID-19). However, in-depth knowledge of the injury characteristics of the heart affected by inflammation is lacking. In this study, using a quantitative spatial proteomics strategy that combines comparative anatomy, laser-capture microdissection, and histological examination, we establish a region-resolved proteome map of the myocardia and microvessels with obvious inflammatory cells from hearts of patients with COVID-19. A series of molecular dysfunctions of myocardia and microvessels is observed in different cardiac regions. The myocardia and microvessels of the left atrial are the most susceptible to virus infection and inflammatory storm, suggesting more attention should be paid to the lesion and treatment of these two parts. These results can guide in improving clinical treatments for cardiovascular diseases associated with COVID-19.

Also flagged:keratoconjunctivitis siccadry mouthautoimmune diseaseIFNsIL-17IL-22
Journal Article 2022-05-27 ✓ 1 Snippet Li P, Han M, Zhao X, Ren G, Mei S, Zhong C.
In-Text Gene Mentions

Though genes that directly induce SjS have already been identified through the large studies [10,11], several SNPs in molecules of signaling pathways, including IFN signature (IRF5 STAT1, STAT4 and IL12A), B- and T-cell signaling (BAFF, GTF2I, TNFSF4, CXCR5, CCL11 and TNFAIP3) and the NF-κB pathway (TNIP1, CARD8, IKBKE, IRAK1 and TANK), do appear to be involved in the pathogenesis of SjS.

Show Full Abstract

Sjögren's syndrome (SjS), characterized by keratoconjunctivitis sicca and dry mouth, is a common autoimmune disease, especially in middle-aged women. The immunopathogenesis of SjS is caused by the sequential infiltration of T and B cells into exocrine glands, including salivary and lacrimal glands. Effector cytokines produced by these immunocytes, such as interferons (IFNs), IL-17, IL-22, IL-21, IL-4, TNF-α, BAFF and APRIL, play critical roles in promoting autoimmune responses and inducing tissue damages. Epigenetic regulations, including DNA methylation, histone modification and non-coding RNAs, have recently been comprehensively studied during the activation of various immunocytes. The deficiency of key epigenetic enzymes usually leads to aberrant immune activation. Epigenetic modifications in T and B cells are usually found to be altered during the immunopathogenesis of SjS, and they are closely correlated with autoimmune responses. In particular, the important role of methylation in activating IFN pathways during SjS progression has been revealed. Thus, according to the involvement of epigenetic regulations in SjS, target therapies to reverse the altered epigenetic modifications in auto-responsive T and B cells are worthy of being considered as a potential therapeutic strategy for SjS.

Also flagged:Hu Antigen RHuRRNA-binding proteinscancerpathogenesishepatobiliary cancers
Journal Article 2022-05-27 No Snippets Lachiondo-Ortega S, Delgado TC, Baños-Jaime B, Velázquez-Cruz A, Díaz-Moreno I, Martínez-Chantar ML.
Show Full Abstract

Hu antigen R (HuR) is a 36-kDa ubiquitous member of the ELAV/Hu family of RNA-binding proteins (RBPs), which plays an important role as a post-transcriptional regulator of specific RNAs under physiological and pathological conditions, including cancer. Herein, we review HuR protein structure, function, and its regulation, as well as its implications in the pathogenesis, progression, and treatment of hepatobiliary cancers. In particular, we focus on hepatocellular carcinoma (HCC) and cholangiocarcinoma (CCA), tumors where the increased cytoplasmic localization of HuR and activity are proposed, as valuable diagnostic and prognostic markers. An overview of the main regulatory axes involving HuR, which are associated with cell proliferation, invasion, metastasis, apoptosis, and autophagy in HCC, is provided. These include the transcriptional, post-transcriptional, and post-translational modulators of HuR function, in addition to HuR target transcripts. Finally, whereas studies addressing the relevance of targeting HuR in CCA are limited, in the past few years, HuR has emerged as a potential therapeutic target in HCC. In fact, the therapeutic efficacy of some pharmacological inhibitors of HuR has been evaluated, in early experimental models of HCC. We, further, discuss the major findings and future perspectives of therapeutic approaches that specifically block HuR interactions, either with post-translational modifiers or cognate transcripts in hepatobiliary cancers.

Also flagged:gene expressionpathogenesisCPdepressionanxietypost-traumatic stress
Journal Article 2022-05-27 ✓ 1 Snippet Sabina S, Panico A, Mincarone P, Leo CG, Garbarino S, Grassi T, Bagordo F, De Donno A, Scoditti E, Tumolo MR.
In-Text Gene Mentions

…, KCNK3 ,CACNA1Eand soluble N-ethylmaleimide-s…

Show Full Abstract

Chronic pain is a major public health problem and an economic burden worldwide. However, its underlying pathological mechanisms remain unclear. MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate gene expression and serve key roles in physiological and pathological processes. This review aims to synthesize the human studies examining miRNA expression in the pathogenesis of chronic primary pain and chronic secondary pain. Additionally, to understand the potential pathophysiological impact of miRNAs in these conditions, an in silico analysis was performed to reveal the target genes and pathways involved in primary and secondary pain and their differential regulation in the different types of chronic pain. The findings, methodological issues and challenges of miRNA research in the pathophysiology of chronic pain are discussed. The available evidence suggests the potential role of miRNA in disease pathogenesis and possibly the pain process, eventually enabling this role to be exploited for pain monitoring and management.

Also flagged:rectal cancertumorcolorectal cancertumorspositronlocally advanced rectal cancer
Journal Article 2022-05-27 ✓ 4 Snippets Smolskas E, Mikulskytė G, Sileika E, Suziedelis K, Dulskas A.
In-Text Gene Mentions

…kinases VRK1 andVRK2(Human vaccinia-related kinase…

…2, VRK1 andVRK2), human homologous recombinat…

…the APC andNetrin receptor DCCreceptor DCC (DCC)…

…Netrin receptor DCC (DCC) genes, K-ras mutations,…

Show Full Abstract

According to current guidelines, the current treatment for locally advanced rectal cancer is neoadjuvant therapy, followed by a total mesorectal excision. However, radiosensitivity tends to differ among patients due to tumor heterogeneity, making it difficult to predict the possible outcomes of the neoadjuvant therapy. This review aims to investigate different types of tissue-based biomarkers and their capability of predicting tumor response to neoadjuvant therapy in patients with locally advanced rectal cancer. We identified 169 abstracts in NCBI PubMed, selected 48 reports considered to meet inclusion criteria and performed this systematic review. Multiple classes of molecular biomarkers, such as proteins, DNA, micro-RNA or tumor immune microenvironment, were studied as potential predictors for rectal cancer response; nonetheless, no literature to date has provided enough sufficient evidence for any of them to be introduced into clinical practice.

Also flagged:Type I IFNFucoidanpolysaccharideviral infectionsnucleic acid-sensing receptorsRLR
Journal Article 2022-05-27 No Snippets Choi S, Jeon SA, Heo BY, Kang JG, Jung Y, Duong PTT, Song IC, Kim JH, Kim SY, Kwon J.
Show Full Abstract

Fucoidan, a sulfated polysaccharide extracted from brown seaweed, has been proposed to effectively treat and prevent various viral infections. However, the mechanisms behind its antiviral activity are not completely understood. We investigate here the global transcriptional changes in bone marrow-derived dendritic cells (BMDCs) using RNA-Seq technology. Through both analysis of differentially expressed genes (DEG) and gene set enrichment analysis (GSEA), we found that fucoidan-treated BMDCs were enriched in virus-specific response pathways, including that of SARS-CoV-2, as well as pathways associated with nucleic acid-sensing receptors (RLR, TLR, NLR, STING), and type I interferon (IFN) production. We show that these transcriptome changes are driven by well-known regulators of the inflammatory response against viruses, including IRF, NF-κB, and STAT family transcription factors. Furthermore, 435 of the 950 upregulated DEGs are classified as type I IFN-stimulated genes (ISGs). Flow cytometric analysis additionally showed that fucoidan increased MHCII, CD80, and CD40 surface markers in BMDCs, indicative of greater antigen presentation and co-stimulation functionality. Our current study suggests that fucoidan transcriptionally activates PRR signaling, type I IFN production and signaling, ISGs production, and DC maturation, highlighting a potential mechanism of fucoidan-induced antiviral activity.

Also flagged:Quinineadamantanehydrochloridespyridinecarbonyl chloridesacetic acid
Journal Article 2022-05-27 No Snippets Mukusheva GK, Zhasymbekova AR, Seidakhmetova RB, Nurkenov OA, Akishina EA, Petkevich SK, Dikusar EA, Potkin VI.
Show Full Abstract

An efficient method of producing quinine derivatives via reaction of acylation with 4,5-dichloroisothiazole-3-, 5-arylisoxazole-3-, adamantane- and hydrochlorides of pyridine-3- and pyridine-4-carbonyl chlorides was developed. All synthesized compounds were tested for antiviral, antimicrobial and analgesic activity. The most pronounced antibacterial activity was shown by the compounds <b>2e</b>, <b>3b</b>, <b>3c</b> and <b>3e</b> with isoxazole and pyridine fragments. It was found that most of the tested compounds showed significant analgesic activity reducing the pain response of animals to the irritating effect of acetic acid.

Also flagged:creatinetumorLUADmalignant tumorSLC6A8Lung Adenocarcinoma
Journal Article 2022-05-27 ✓ 2 Snippets Fan Y, Zhou Y, Lou M, Gao Z, Li X, Yuan K.
In-Text Gene Mentions

Pearson correlation analysis identifies 44 immunomodulators (ADORA2A, BTLA, CD160, CD96, CSF1R, CTLA4, HAVCR2, IL10, IL10RB, KDR, LAG3, PDCD1, PDCD1LG2, TIGIT, VTCN1, CD27, CD28, CD40LG, CD48, CD70, CD80, CD86, CXCL12, CXCR4, ENTPD1, ICOS, IL2RA, KLRC1, LTA, MICB, NT5E, TMIGD2, TNFRSF13B, TNFRSF14, TNFRSF17, TNFRSF18, TNFRSF4, TNFRSF8, TNFRSF9, TNFSF13, TNFSF13B, TNFSF4, ULBP1, KIR2DL1) in the TCGA database associated with SLC6A8 expression in LUAD (Table 3).

…TNFRSF9, TNFSF13, TNFSF13B,TNFSF4, ULBP1, KIR2DL1 )…

Show Full Abstract

<b>Background:</b> Recent studies have demonstrated that creatine can promote tumor metastasis and has implications for immune cell function. <i>SLC6A8</i> encodes a membrane protein that can transport creatine inside and outside the cell. However, there are currently no studies of <i>SLC6A8</i> in lung adenocarcinoma (LUAD). <b>Methods:</b> In this study, the expression of <i>SLC6A8</i> in LUAD was analyzed using the Oncomine database, the Cancer Genome Atlas (TCGA) database, and immunohistochemical staining analysis. Survival analysis of patients with LUAD was performed using the cBioPortal and the Kaplan-Meier Plotter websites and clinical follow-up data. An analysis of the association between <i>SLC6A8</i> and the tumor immune microenvironment (TIME) of LUAD was performed through the TISIDB database and estimation of stromal and immune cells in malignant tumor tissues using expression data (ESTIMATE) algorithm. Then, based on the curated list of <i>SLC6A8</i>-related immunomodulators, three genes (<i>NT5E, CD40LG, CD80</i>) were selected to construct <i>SLC6A8</i>-related immune signatures to further evaluate the immune aspect of LUAD prognosis. <b>Results:</b> Our studies indicated that <i>SLC6A8</i> was overexpressed in LUAD, and the high expression of <i>SLC6A8</i> was associated with poor survival. Genetic alteration of <i>SLC6A8</i> was also associated with a poorer prognosis. Furthermore, multivariate Cox analysis indicated that <i>SLC6A8</i> could be used as an independent risk prognostic factor. Then, immune infiltration analysis indicated that <i>SLC6A8</i> was also strongly associated with poor prognosis in the TIME of LUAD. A multivariate Cox proportional hazard model was then constructed, and was shown effective at identifying high-risk patients. Univariate and multivariate Cox analysis showed that the risk scoring of the model was an independent prognostic risk factor in LUAD. <b>Conclusion:</b> <i>SLC6A8</i> may serve as a biomarker for poor prognosis in LUAD.

Also flagged:mastitisinfectionssubclinical mastitidesfootreproduction disorderssepsis
Journal Article 2022-05-27 ✓ 5 Snippets Farschtschi S, Mattes M, Pfaffl MW.
In-Text Gene Mentions

Furthermore, the DCC can be applied to evaluate a cow’s mastitis susceptibility, for example, by calculating the ratio of CD4+ to CD8+ T cells [19] or by the determination of viability of PMN [20].

…advantage to interpretDCCwith the aid…

…when recording extendedDCCin bovine body…

…validation of newDCC-based diagnostic tools.…

…in finding newDCC-based biomarkers, which could…

Show Full Abstract

A key challenge of the 21st century will be to provide the growing world population with a sustainable and secure supply of food. Consequently, the dairy farming's primary task is to lower milk losses and other inefficiencies associated with diseased cows. Moreover, a shift from curative to preventive health management would be desirable for mastitis and a wide variety of other infectious and non-infectious cattle diseases, some of which are known to have profound negative effects on the performance and well-being of cows. Differential cell counting (DCC), a procedure that aims to determine the proportions of different somatic cell types in raw milk samples, has not only the potential to optimize mastitis diagnostics, but it could furthermore serve as a diagnostic tool for monitoring the general and overall health status of dairy cows. Based on a broad search of the literature, the practical utility of various types of DCC is summarized and discussed in this review. Since it might be of advantage to interpret DCC with the aid of data from studies in humans, differences between the immune systems of humans and dairy cattle, with a special focus on surface marker expression profiles and γδ (gamma delta) T-cell characteristics, are also described.

Also flagged:Adenosine ReceptorCaffeineneurodegenerative diseasesHDadenosine receptorsAR
Journal Article 2022-05-27 ✓ 3 Snippets Achenbach J, Matusch A, Elmenhorst D, Bauer A, Saft C.
In-Text Gene Mentions

As inclusion criteria for the manifest HD group, we analyzed all participants with a diagnostic confidence level (DCL) of 4 (having unequivocal signs of clinical manifest HD (>99% confidence), a total motor-score (TMS) >5 and a genetically confirmed report with ≥36 Cytosine–Adenine–Guanine (CAG)-repeats in the Huntingtin-gene (HTT).

…huntingtin gene (HTT) is characterized…

…the Huntingtin-gene (HTT).…

Show Full Abstract

There is a controversy about potentially positive or negative effects of caffeine consumption on onset and disease progression of neurodegenerative diseases such as Huntington’s Disease (HD). On the molecular level, the psychoactive drug caffeine targets in particular adenosine receptors (AR) as a nonselective antagonist. The aim of this study was to evaluate clinical effects of caffeine consumption in patients suffering from premanifest and motor-manifest HD. Data of the global observational study ENROLL-HD were used, in order to analyze the course of HD regarding symptoms onset, motor, functional, cognitive and psychiatric parameters, using cross-sectional and longitudinal data of up to three years. We split premanifest and manifest participants into two subgroups: consumers of >3 cups of caffeine (coffee, cola or black tea) per day (>375 mL) vs. subjects without caffeine consumption. Data were analyzed using ANCOVA-analyses for cross-sectional and repeated measures analysis of variance for longitudinal parameters in IBM SPSS Statistics V.28. Within n = 21,045 participants, we identified n = 1901 premanifest and n = 4072 manifest HD patients consuming >3 cups of caffeine/day vs. n = 841 premanifest and n = 2243 manifest subjects without consumption. Manifest HD patients consuming >3 cups exhibited a significantly better performance in a series of neuropsychological tests. They also showed at the median a later onset of symptoms (all p < 0.001), and, during follow-up, less motor, functional and cognitive impairments in the majority of tests (all p < 0.050). In contrast, there were no beneficial caffeine-related effects on neuropsychological performance in premanifest HD mutation carriers. They showed even worse cognitive performances in stroop color naming (SCNT) and stroop color reading (SWRT) tests (all p < 0.050) and revealed more anxiety, depression and irritability subscores in comparison to premanifest participants without caffeine consumption. Similarly, higher self-reported anxiety and irritability were observed in genotype negative/control group high dose caffeine drinkers, associated with a slightly better performance in some cognitive tasks (all p < 0.050). The analysis of the impact of caffeine consumption in the largest real-world cohort of HD mutation carriers revealed beneficial effects on neuropsychological performance as well as manifestation and course of disease in manifest HD patients while premanifest HD mutation carrier showed no neuropsychological improvements, but worse cognitive performances in some tasks and exhibited more severe signs of psychiatric impairment. Our data point to state-related psychomotor-stimulant effects of caffeine in HD that might be related to regulatory effects at cerebral adenosine receptors. Further studies are required to validate findings, exclude potential other unknown biasing factors such as physical activity, pharmacological interventions, gender differences or chronic habitual influences and test for dosage related effects.

Also flagged:Hematological MalignanciespeptideMR1-specific receptorsimmune responseautoimmune diseases
Journal Article 2022-05-27 ✓ 2 Snippets Allegra A, Casciaro M, Lo Presti E, Musolino C, Gangemi S.
In-Text Gene Mentions

In particular, phosphoantigens activate Vγ9Vδ2 cells by binding butyrophilin 3A1 (BTN3A1) [14], which is ubiquitously expressed on tumor cells and cooperates with BTN2A1 to date, and is considered fundamental for the activation of γδ T cells [15].

…and cooperates withBTN2A1to date, and…

Show Full Abstract

Unconventional T cells and innate lymphoid cells (ILCs) make up a heterogeneous set of cells that characteristically show prompt responses toward specific antigens. Unconventional T cells recognize non-peptide antigens, which are bound and presented by diverse non-polymorphic antigen-presenting molecules and comprise γδ T cells, MR1-restricted mucosal-associated invariant T cells (MAITs), and natural killer T cells (NKTs). On the other hand, ILCs lack antigen-specific receptors and act as the innate counterpart to the T lymphocytes found in the adaptive immune response. The alteration of unconventional T cells and ILCs in frequency and functionality is correlated with the onset of several autoimmune diseases, allergy, inflammation, and tumor. However, depending on the physio-pathological framework, unconventional T cells may exhibit either protective or pathogenic activity in a range of neoplastic diseases. Nonetheless, experimental models and clinical studies have displayed that some unconventional T cells are potential therapeutic targets, as well as prognostic and diagnostic markers. In fact, cell-mediated immune response in tumors has become the focus in immunotherapy against neoplastic disease. This review concentrates on the present knowledge concerning the function of unconventional T cell sets in the antitumor immune response in hematological malignancies, such as acute and chronic leukemia, multiple myeloma, and lymphoproliferative disorders. Moreover, we discuss the possibility that modulating the activity of unconventional T cells could be useful in the treatment of hematological neoplasms, in the prevention of specific conditions (such as graft versus host disease), and in the formulation of an effective anticancer vaccine therapy. The exact knowledge of the role of these cells could represent the prerequisite for the creation of a new form of immunotherapy for hematological neoplasms.

Also flagged:gene expressionmatingmetabolismlipidsynthesisCAMK4
Journal Article 2022-05-27 No Snippets Huang Y, Yuan C, Zhao Y, Li C, Cao M, Li H, Zhao Z, Sun A, Basang W, Zhu Y, Chen L, He F, Huan C, Zhang B, Iqbal T, Wei Y, Fan W, Yi K, Zhou X.
Show Full Abstract

In this study, we explored the gene expression patterns of the pituitary gland and hypothalamus of Angus cows at different growth and developmental stages by deep sequencing and we identified genes that affect bovine reproductive performance to provide new ideas for improving bovine fertility in production practice. We selected three 6-month-old (weaning period), three 18-month-old (first mating period), and three 30-month-old (early postpartum) Angus cattle. The physiological status of the cows in each group was the same, and their body conformations were similar. After quality control of the sequencing, the transcriptome analyses of 18 samples yielded 129.18 GB of clean data. We detected 13,280 and 13,318 expressed genes in the pituitary gland and hypothalamus, respectively, and screened 35 and 50 differentially expressed genes (DEGs) for each, respectively. The differentially expressed genes in both tissues were mainly engaged in metabolism, lipid synthesis, and immune-related pathways in the 18-month-old cows as compared with the 6-month-old cows. The 30-month-old cows presented more regulated reproductive behavior, and pituitary CAMK4 was the main factor regulating the reproductive behavior during this period via the pathways for calcium signaling, longevity, oxytocin, and aldosterone synthesis and secretion. A variant calling analysis also was performed. The SNP inversions and conversions in each sample were counted according to the different base substitution methods. In all samples, most base substitutions were represented by substitutions between bases A and G, and the probability of base conversion exceeded 70%, far exceeding the transversion. Heterozygous SNP sites exceeded 37.68%.

Also flagged:ThrombophiliahypercoagulabilitycoagulationthrombocytopeniaCOVID-19viral infections
Journal Article 2022-05-27 No Snippets Badulescu OV, Sirbu PD, Filip N, Bordeianu G, Cojocaru E, Budacu CC, Badescu MC, Bararu-Bojan I, Veliceasa B, Ciocoiu M.
Show Full Abstract

Thrombophilia, also called hypercoagulability or prothrombotic condition, usually reflects a certain imbalance that occurs either in the coagulation cascade or in the anticoagulation/fibrinolytic system. A similar imbalance may be induced by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Thrombotic complications are associated with multiorgan failure and increased mortality. In this context, activation of coagulation and thrombocytopenia appeared as prognostic markers in COVID-19. Our work provides a structured and updated analysis of inherited thrombophilia and its involvement in COVID-19, emphasizing the importance of diagnosing and initiating thromboprophylaxis. Since the state of hypercoagulation is directly correlated with COVID-19, we consider that studies on the genetic profiles of proteins involved in thrombophilia in patients who have had COVID-19 and thrombotic events are of great importance, both in treating and in preventing deaths due to COVID-19.

Also flagged:innate immunityviral infectionsimmune responsecancerViral InfectionMiddle East
Journal Article 2022-05-27 ✓ 1 Snippet Cimini E, Agrati C.
In-Text Gene Mentions

…In particular,BTN2A1and BTN3A1 are…

Show Full Abstract

New emerging viruses belonging to the <i>Coronaviridae</i>, <i>Flaviviridae</i>, and <i>Filoviridae</i> families are serious threats to public health and represent a global concern. The surveillance to monitor the emergence of new viruses and their transmission is an important target for public health authorities. Severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) is an excellent example of a pathogen able to cause a pandemic. In a few months, SARS-CoV-2 has spread globally from China, and it has become a world health problem. Gammadelta (γδ) T cell are sentinels of innate immunity and are able to protect the host from viral infections. They enrich many tissues, such as the skin, intestines, and lungs where they can sense and fight the microbes, thus contributing to the protective immune response. γδ T cells perform their direct antiviral activity by cytolytic and non-cytolytic mechanisms against a wide range of viruses, and they are able to orchestrate the cellular interplay between innate and acquired immunity. For their pleiotropic features, γδ T cells have been proposed as a target for immunotherapies in both cancer and viral infections. In this review, we analyzed the role of γδ T cells in emerging viral infections to define the profile of the response and to better depict their role in the host protection.

Also flagged:toiminecarbonic anhydrase IICA IIbindingimines
Journal Article 2022-05-27 No Snippets Casciuc I, Osypenko A, Kozibroda B, Horvath D, Marcou G, Bonachera F, Varnek A, Lehn JM.
Show Full Abstract

Dynamic combinatorial libraries (DCLs) display adaptive behavior, enabled by the reversible generation of their molecular constituents from building blocks, in response to external effectors, e.g., protein receptors. So far, chemoinformatics has not yet been used for the design of DCLs-which comprise a radically different set of challenges compared to classical library design. Here, we propose a chemoinformatic model for theoretically assessing the composition of DCLs in the presence and the absence of an effector. An imine-based DCL in interaction with the effector human carbonic anhydrase II (CA II) served as a case study. Support vector regression models for the imine formation constants and imine-CA II binding were derived from, respectively, a set of 276 imines synthesized and experimentally studied in this work and 4350 inhibitors of CA II from ChEMBL. These models predict constants for all DCL constituents, to feed software assessing equilibrium concentrations. They are publicly available on the dedicated website. Models rationally selected two amines and two aldehydes predicted to yield stable imines with high affinity for CA II and provided a virtual illustration on how effector affinity regulates DCL members.

Also flagged:benzo[a]pyrenemethylationobesityaromatic hydrocarbonAcetylcholinesteraseneuron development
Journal Article 2022-05-27 ✓ 1 Snippet Wan T, Au DW, Mo J, Chen L, Cheung KM, Kong RY, Seemann F.
In-Text Gene Mentions

…( gabbr1 ),DCC netrin 1 receptornetrin 1 receptor…

Show Full Abstract

Previous studies have revealed that DNA methylation changes could serve as potential genomic markers for environmental benzo[a]pyrene (BaP) exposure and intergenerational inheritance of various physiological impairments (e.g. obesity and reproductive pathologies). As a typical aromatic hydrocarbon pollutant, direct BaP exposure has been shown to induce neurotoxicity. To unravel the inheritance mechanisms of the BaP-induced bone phenotype in freshwater medaka, we conducted whole-genome bisulfite sequencing of F1 sperm and identified 776 differentially methylated genes (DMGs). Ingenuity pathway analysis revealed that DMGs were significantly enriched in pathways associated with neuronal development and function. Therefore, it was hypothesized that parental BaP exposure (1 μg/l, 21 days) causes offspring neurotoxicity. Furthermore, the possibility for sperm methylation as an indicator for a neurotoxic phenotype was investigated. The F0 adult brains and F1 larvae were analyzed for BaP-induced direct and inherited toxicity. Acetylcholinesterase activity was significantly reduced in the larvae, together with decreased swimming velocity. Molecular analysis revealed that the marker genes associated with neuron development and growth (<i>alpha1-tubulin, mbp, syn2a, shh</i>, and <i>gap43</i>) as well as brain development (<i>dlx2, otx2</i>, and <i>krox-20</i>) were universally downregulated in the F1 larvae (3 days post-hatching). While parental BaP exposure at an environmentally relevant concentration could induce neurotoxicity in the developing larvae, the brain function of the exposed F0 adults was unaffected. This indicates that developmental neurotoxicity in larvae may result from impaired neuronal development and differentiation, causing delayed brain growth. The present study demonstrates that the possible adverse health effects of BaP in the environment are more extensive than currently understood. Thus, the possibility of multigenerational BaP toxicity should be included in environmental risk assessments.

Also flagged:GlucosamineChondroitin SulfateColorectal Cancercancerchondroitinosteoarthritis
Journal Article 2022-05-27 No Snippets Khan AA, Mannan V, Pervaiz MA, Akram A, Momin ES, Sanusi M, Kashyap T, Elshaikh AO.
Show Full Abstract

Currently, colorectal cancer is the third most common cancer in the world. Recently, glucosamine and chondroitin have gained popularity for their beneficial effects on cancer. They have already been recognized for their therapeutic role in osteoarthritis. This systematic review aims to analyze the relationship between the combined consumption of glucosamine and chondroitin and the prevention of colorectal cancer. Three databases: PubMed, Google Scholar, and Science Direct, were searched to collect relevant articles. After screening full-text articles, seven studies were included in the systematic review. The review found a supportive association between glucosamine and chondroitin and the decreased incidence of colorectal cancer. Through an anti-inflammatory effect on the cell signaling pathway, the supplementation caused a reduction in colorectal cancer occurrence. The dose, frequency of usage of the supplement, and weight of individuals, along with the use of non-steroidal anti-inflammatory drugs, also affected the efficacy. To further assess this relationship, it is necessary to conduct double-blind, randomized controls trials for the supplements in cancer prevention and further explore their safety and efficacy with different ethnicities, drugs, doses, and weight individuals.

Also flagged:chronic liver diseaseliver diseasecirrhosishepatocellular carcinomaliver fibrosischronic liver diseases
Journal Article 2022-05-26 ✓ 1 Snippet Schreiner AD, Zhang J, Moran WP, Koch DG, Marsden J, Livingston S, Mauldin PD, Gebregziabher M.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background and aims</h4>The Fibrosis-4 index (FIB-4) can reliably assess fibrosis risk in patients with chronic liver disease, and advanced fibrosis is associated with severe liver disease (SLD) outcomes. However, CLD is underdiagnosed in primary care. We examined the association between FIB-4 risk strata and the incidence of SLD preceding a CLD diagnosis while considering incident CLD diagnoses as competing risks.<h4>Methods</h4>Using primary care clinic data between 2007 and 2018, we identified patients with two FIB-4 scores and no liver disease diagnoses preceding the index FIB-4. Patients were followed from index FIB-4 until an incident SLD (a composite of cirrhosis, hepatocellular carcinoma or liver transplantation), CLD or were censored. Hazard ratios were computed using a Fine-Gray competing risk model.<h4>Results</h4>Of 20 556 patients, there were 54.8% in the low, 34.8% in the indeterminate, 6.6% in the high and 3.8% in the persistently high-risk FIB-4 strata. During a mean 8.2 years of follow-up, 837 (4.1%) patients experienced an SLD outcome and 11.5% of the sample received a CLD diagnosis. Of patients with an SLD event, 49% received no preceding CLD diagnosis. In the adjusted Fine-Gray model, the indeterminate (HR 1.41, 95% CI 1.17-1.71), high (HR 4.65, 95% CI 3.76-5.76) and persistently high-risk (HR 7.60, 95% CI 6.04-9.57) FIB-4 risk strata were associated with a higher incidence of SLD compared to the low-risk stratum.<h4>Conclusions</h4>FIB-4 scores with indeterminate- and high-risk values are associated with an increased incidence of SLD in primary care patients without known CLD.

Also flagged:Anaplastic lymphoma kinaseALKnon‐small cell lung cancerNSCLCcancerdeath
Journal Article 2022-05-26 No Snippets Wang Y, Shen S, Hu P, Geng D, Zheng R, Li X.
Show Full Abstract

<h4>Background</h4>Anaplastic lymphoma kinase (ALK) fusion is a prognostic indicator for patients with non-small cell lung cancer (NSCLC) receiving tyrosine kinase inhibitors (TKIs). The real-world data of ALK TKIs remain a major concern.<h4>Methods</h4>Patients with ALK-positive advanced NSCLC, who received crizotinib or alectinib treatment in first line, were retrospectively reviewed. ALK status was detected using immunohistochemistry (IHC) or next-generation sequencing (NGS). Clinical outcomes have been comprehensively analyzed between TKIs, ALK fusions, EML4-ALK variants, and next-generation TKIs after crizotinib failure.<h4>Results</h4>One hundred sixty-eight patients were successively enrolled (crizotinib, n = 109; alctinib, n = 59). Alectinib showed consistent superiority in progressive-free survival (PFS) over crizotinib (hazard ratio [HR]: 0.43, 95% confidential interval [CI]: 0.24-0.77, p = 0.004). Multivariate Cox regression showed chemotherapy (CT) prior to TKIs or synchronous chemotherapy seemed not to improve PFS compared to ALK inhibitors alone (p > 0.05). And, alectinib was superior to crizotinib in prolonging intracranial PFS (HR 0.12, 95% CI: 0.03-0.49, p = 0.003). Patients in EML4 group had a better prognosis than those in non-EML4 group after alectinib administration (HR 0.13, 95% CI: 0.03-0.60, p = 0.009). TP53 co-mutations were relatively common (34.0%) and associated with adverse outcome in ALK-positive patients (adjusted HR 2.22, 95% CI: 1.00-4.92, p = 0.049). After crizotinib failure, 33 patients received a sequential application of next-generation ALK TKIs. Compared to ceritinib and brigatinib, alectinib might have better PFS (p = 0.043).<h4>Conclusion</h4>Our results revealed alectinib had better PFS and higher intracranial efficacy compared to crizotinib in ALK-positive NSCLC, and might improve PFS by comparison with ceritinib and brigatinib after crizotinib failure.

Also flagged:Nonalcoholic fatty liver diseaseNAFLDchronic liver damagealcoholliver diseasessimple steatosis
Journal Article 2022-05-26 ✓ 1 Snippet Kasai Y, Kessoku T, Tanaka K, Yamamoto A, Takahashi K, Kobayashi T, Iwaki M, Ozaki A, Nogami A, Honda Y, Ogawa Y, Kato S, Imajo K, Higurashi T, Hosono K, Yoneda M, Usuda H, Wada K, Kawanaka M, Kawaguchi T, Torimura T, Kage M, Hyogo H, Takahashi H, Eguchi Y, Aishima S, Kobayashi N, Sumida Y, Honda A, Oyamada S, Shinoda S, Saito S, Nakajima A.
In-Text Gene Mentions

…hosis; sclerosing cholangitis;hemochromatosis; α1-antitrypsin deficiency; W…

Show Full Abstract

<h4>Introduction</h4>No reports on both blood and fecal bile acids (BAs) in patients with nonalcoholic fatty liver disease (NAFLD) exist. We simultaneously assessed the serum and fecal BA patterns in healthy participants and those with NAFLD.<h4>Methods</h4>We collected stool samples from 287 participants from 5 hospitals in Japan (healthy control [HC]: n = 88; mild fibrosis: n = 104; and advanced fibrosis group: n = 95). Blood samples were collected and analyzed for serum BAs and 7α-hydroxy-4-cholesten-3-one (C4)-a surrogate marker for BA synthesis ability-from 141 patients. Concentrations of BAs, including cholic acid (CA), deoxycholic acid (DCA), chenodeoxycholic acid, ursodeoxycholic acid, and lithocholic acid (LCA), were measured using liquid chromatography-mass spectrometry.<h4>Results</h4>The total fecal BA concentration was significantly higher in the NAFLD group with worsening of fibrosis than in the HC group. Most of the fecal BAs were secondary and unconjugated. In the fecal BA fraction, CA, DCA, chenodeoxycholic acid, ursodeoxycholic acid, and LCA were significantly higher in the NAFLD than in the HC group. The total serum BA concentration was higher in the NAFLD group with worsening of fibrosis than in the HC group. In the serum BA fraction, CA, LCA, and C4 concentrations were significantly higher in the NAFLD than in the HC group.<h4>Discussion</h4>Fecal and serum BA and C4 concentrations were high in patients with NAFLD with worsening of fibrosis, suggesting involvement of abnormal BA metabolism in NAFLD with fibrosis progression. Abnormalities in BA metabolism may be a therapeutic target in NAFLD with fibrosis.

Also flagged:fetal growth restrictionfetal growthoxygenlactatecardiovascular diseasesgestation
Journal Article 2022-05-26 No Snippets Verma A, Suryawanshi P, Chetan C, Oka G, Singh Y, Kallimath A, Singh P, Garegrat R.
Show Full Abstract

<h4>Purpose</h4>SGA infants with fetal growth restriction have reduced ability to adapt themselves to the postnatal life because of certain epigenetic changes in cardiac function. The aim of the present study is to assess and compare the cardiac functions of fetal growth restricted SGA newborns to the term stable AGA newborns, and evaluate any differences in the cardiac functions during the postnatal transitional circulation.<h4>Method</h4>This observational study was conducted at a multispecialty tertiary care hospital in Western India from June to November 2021. The newborns were evaluated using bedside echocardiography at 24-48 h and repeat screening after 48 h. The echocardiographic assessment of the systolic function was done using EF, FS, FAC and TAPSE; diastolic function using E/A wave ratio and global functioning using LV MPI.<h4>Result</h4>Twnety-four babies were included in cases and 30 in the control arm of the study. Maternal and newborn characteristics were comparable between the two groups. FS, EF for left ventricle and TAPSE, FAC for right ventricular systolic function were significantly lower in SGA group (p = 0.02, 0.02, 0.00 and 0.01; respectively). The current study revealed a lower tricuspid E/A ratio and higher mitral E/A ratio with a significant difference beyond 48 h in the first week of life (p value 0.00). Left ventricular MPI was significantly higher in SGA infants compared to AGA infants during two subsequent readings in immediate newborn period with p values 0.01 and 0.02 respectively. The subgroup analysis revealed that fetal growth-restricted neonates with absent end-diastolic flow had a greater impact on ventricular functions.<h4>Conclusion</h4>Present study showed a significant systolic and diastolic dysfunction during initial newborn period in growth restricted SGA infants.

Also flagged:pairingpurinehydrogenbase-pairingpyrimidinebase
Journal Article 2022-05-26 No Snippets Pérez de Alba Ortíz A, Vreede J, Ensing B.
Show Full Abstract

Hoogsteen (HG) base pairing is characterized by a 180° rotation of the purine base with respect to the Watson-Crick-Franklin (WCF) motif. Recently, it has been found that both conformations coexist in a dynamical equilibrium and that several biological functions require HG pairs. This relevance has motivated experimental and computational investigations of the base-pairing transition. However, a systematic simulation of sequence variations has remained out of reach. Here, we employ advanced path-based methods to perform unprecedented free-energy calculations. Our methodology enables us to study the different mechanisms of purine rotation, either remaining inside or after flipping outside of the double helix. We study seven different sequences, which are neighbor variations of a well-studied A⋅T pair in A6-DNA. We observe the known effect of A⋅T steps favoring HG stability, and find evidence of triple-hydrogen-bonded neighbors hindering the inside transition. More importantly, we identify a dominant factor: the direction of the A rotation, with the 6-ring pointing either towards the longer or shorter segment of the chain, respectively relating to a lower or higher barrier. This highlights the role of DNA's relative flexibility as a modulator of the WCF/HG dynamic equilibrium. Additionally, we provide a robust methodology for future HG proclivity studies.

Also flagged:chromatingene expressiontranscription factorbindingSox2Cdx2
Journal Article 2022-05-26 ✓ 2 Snippets Smith RJ, Zhang H, Hu SS, Yung T, Francis R, Lee L, Onaitis MW, Dirks PB, Zang C, Kim TH.
In-Text Gene Mentions

…(Abcam, ab13970, 1:1000),OLFM4(Cell Signaling Technology,…

…(Fig. 5c ),OLFM4(intestinal stem cells)…

Show Full Abstract

Development of the gastrointestinal system occurs after gut tube closure, guided by spatial and temporal control of gene expression. However, it remains unclear what forces regulate these spatiotemporal gene expression patterns. Here we perform single-cell chromatin profiling of the primitive gut tube to reveal organ-specific chromatin patterns that reflect the anatomical patterns of distinct organs. We generate a comprehensive map of epigenomic changes throughout gut development, demonstrating that dynamic chromatin accessibility patterns associate with lineage-specific transcription factor binding events to regulate organ-specific gene expression. Additionally, we show that loss of Sox2 and Cdx2, foregut and hindgut lineage-specific transcription factors, respectively, leads to fate shifts in epigenomic patterns, linking transcription factor binding, chromatin accessibility, and lineage fate decisions in gut development. Notably, abnormal expression of Sox2 in the pancreas and intestine impairs lineage fate decisions in both development and adult homeostasis. Together, our findings define the chromatin and transcriptional mechanisms of organ identity and lineage plasticity in development and adult homeostasis.

Also flagged:NFIfetalβ-globin-likeHBG1HBG2Cas9
Journal Article 2022-05-26 ✓ 2 Snippets Qin K, Huang P, Feng R, Keller CA, Peslak SA, Khandros E, Saari MS, Lan X, Mayuranathan T, Doerfler PA, Abdulmalik O, Giardine B, Chou ST, Shi J, Hardison RC, Weiss MJ, Blobel GA.
In-Text Gene Mentions

…molecular complex withSOX651 , a…

…However,SOX6did not score…

Show Full Abstract

The mechanisms by which the fetal-type β-globin-like genes HBG1 and HBG2 are silenced in adult erythroid precursor cells remain a fundamental question in human biology and have therapeutic relevance to sickle cell disease and β-thalassemia. Here, we identify via a CRISPR-Cas9 genetic screen two members of the NFI transcription factor family-NFIA and NFIX-as HBG1/2 repressors. NFIA and NFIX are expressed at elevated levels in adult erythroid cells compared with fetal cells, and function cooperatively to repress HBG1/2 in cultured cells and in human-to-mouse xenotransplants. Genomic profiling, genome editing and DNA binding assays demonstrate that the potent concerted activity of NFIA and NFIX is explained in part by their ability to stimulate the expression of BCL11A, a known silencer of the HBG1/2 genes, and in part by directly repressing the HBG1/2 genes. Thus, NFI factors emerge as versatile regulators of the fetal-to-adult switch in β-globin production.

Also flagged:spliceosomevirionbasepairingRNA-binding proteinscytoplasm
Journal Article 2022-05-26 No Snippets Nielsen AF, Bindereif A, Bozzoni I, Hanan M, Hansen TB, Irimia M, Kadener S, Kristensen LS, Legnini I, Morlando M, Jarlstad Olesen MT, Pasterkamp RJ, Preibisch S, Rajewsky N, Suenkel C, Kjems J.
Show Full Abstract

Circular RNAs (circRNAs) are formed in all domains of life and via different mechanisms. There has been an explosion in the number of circRNA papers in recent years; however, as a relatively young field, circRNA biology has an urgent need for common experimental standards for isolating, analyzing, expressing and depleting circRNAs. Here we propose a set of guidelines for circRNA studies based on the authors' experience. This Perspective will specifically address the major class of circRNAs in Eukarya that are generated by a spliceosome-catalyzed back-splicing event. We hope that the implementation of best practice principles for circRNA research will help move the field forward and allow a better functional understanding of this fascinating group of RNAs.

Also flagged:COVID-19IL-6pneumoniavesiclesCoronavirus disease 2019extracellular
Journal Article 2022-05-26 No Snippets Zhu YG, Shi MM, Monsel A, Dai CX, Dong X, Shen H, Li SK, Chang J, Xu CL, Li P, Wang J, Shen MP, Ren CJ, Chen DC, Qu JM.
Show Full Abstract

<h4>Background</h4>Existing clinical studies supported the potential efficacy of mesenchymal stromal cells as well as derived exosomes in the treatment of COVID-19. We aimed to explore the safety and efficiency of aerosol inhalation of the exosomes derived from human adipose-derived MSCs (haMSC-Exos) in patients with COVID-19.<h4>Methods</h4>The MEXCOVID trial is a phase 2a single-arm, open-labelled, interventional trial and patients were enrolled in Jinyintan Hospital, Wuhan, China. Eligible 7 patients were assigned to receive the daily dose of haMSCs-Exos (2.0 × 10<sup>8</sup> nano vesicles) for consecutively 5 days. The primary outcomes included the incidence of prespecified inhalation-associated events and serious adverse events. We also observed the demographic data, clinical characteristics, laboratory results including lymphocyte count, levels of D-dimer and IL-6 as well as chest imaging.<h4>Results</h4>Seven severe COVID-19 related pneumonia patients (4 males and 3 females) were enrolled and received nebulized haMSC-Exos. The median age was 57 year (interquartile range (IQR), 43 year to 70 year). The median time from onset of symptoms to hospital admission and administration of nebulized haMSC-Exos was 30 days (IQR, 15 days to 40 days) and 54 d (IQR, 34 d to 69 d), respectively. All COVID-19 patients tolerated the haMSC-Exos nebulization well, with no evidence of prespecified adverse events or clinical instability during the nebulization or during the immediate post-nebulization period. All patients presented a slight increase of serum lymphocyte counts (median as 1.61 × 10<sup>9</sup>/L vs. 1.78 × 10<sup>9</sup>/L). Different degrees of resolution of pulmonary lesions after aerosol inhalation of haMSC-Exos were observed among all patients, more obviously in 4 of 7 patients.<h4>Conclusions</h4>Our trial shows that a consecutive 5 days inhalation dose of clinical grade haMSC-Exos up to a total amount of 2.0 × 10<sup>9</sup> nano vesicles was feasible and well tolerated in seven COVID-19 patients, with no evidence of prespecified adverse events, immediate clinical instability, or dose-relevant toxicity at any of the doses tested. This safety profile is seemingly followed by CT imaging improvement within 7 days. Further trials will have to confirm the long-term safety or efficacy in larger population.<h4>Trial registration</h4>MEXCOVID, NCT04276987.

Also flagged:antibodyphosphatidylethanolamine binding protein 1pulmonary hypertension syndromeascitescancerangiogenesis
Journal Article 2022-05-26 ✓ 5 Snippets Li Q, Gu Y, Gao X, Guo X, Huang C, Liu P, Hu G, Li G, Fang W, Mai W, Wu C, Xu Z, Huang F, Liu P.
In-Text Gene Mentions

As a classical inhibitor of cancer metastasis, phosphatidylethanolamine binding protein 1 (PEBP1) regulates angiogenesis in the process of tumor metastasis through multiple signal pathways.

However, whether PEBP1 can regulate pulmonary artery remodeling in broilers with PHS has not been reported.

More interestingly, we found that the expression of PEBP1 protein decreased significantly in broilers with PHS.

In addition, the PEBP1 polyclonal antibody provided convenience for further study of the role of PEBP1 in PHS.

…binding protein 1 (PEBP1) regulates angiogenesis in…

Show Full Abstract

Pulmonary hypertension syndrome (PHS) is a disease that is difficult to overcome for fast-growing broilers. It causes pulmonary vascular remodeling and ascites in broilers. As a classical inhibitor of cancer metastasis, phosphatidylethanolamine binding protein 1 (PEBP1) regulates angiogenesis in the process of tumor metastasis through multiple signal pathways. However, whether PEBP1 can regulate pulmonary artery remodeling in broilers with PHS has not been reported. This study constructed the prokaryotic expression vector of [PEBP1]-pET32a by genetic engineering technology, the recombinant PEBP1 protein was expressed in large quantities, and the PEBP1 polyclonal antibody was prepared by immunizing rabbits with the recombinant PEBP1 protein. Western blot and immunofluorescence results showed that PEBP1 was expressed in many kinds of animal tissues. However, due to the species specificity of polyclonal antibodies, the expression level of PEBP1 protein in broilers and ducks with high homology was significantly higher than that in other species of animals. More interestingly, we found that the expression of PEBP1 protein decreased significantly in broilers with PHS. These studies laid a foundation for further exploration of the mechanism of pulmonary artery remodeling. In addition, the PEBP1 polyclonal antibody provided convenience for further study of the role of PEBP1 in PHS.

Also flagged:methylationhistonechromatinorganizationdemethylationhydroxymethylcytosine
Journal Article 2022-05-26 No Snippets Han X, Guo J, Wang M, Zhang N, Ren J, Yang Y, Chi X, Chen Y, Yao H, Zhao YL, Yang YG, Sun Y, Xu J.
Show Full Abstract

After implantation, complex and highly specialized molecular events render functionally distinct organ formation, whereas how the epigenome shapes organ-specific development remains to be fully elucidated. Here, nano-hmC-Seal, RNA bisulfite sequencing (RNA-BisSeq), and RNA sequencing (RNA-Seq) were performed, and the first multilayer landscapes of DNA 5-hydroxymethylcytosine (5hmC) and RNA 5-methylcytosine (m<sup>5</sup>C) epigenomes were obtained in the heart, kidney, liver, and lung of the human foetuses at 13-28 weeks with 123 samples in total. We identified 70,091 and 503 organ- and stage-specific differentially hydroxymethylated regions (DhMRs) and m<sup>5</sup>C-modified mRNAs, respectively. The key transcription factors (TFs), T-box transcription factor 20 (TBX20), paired box 8 (PAX8), krueppel-like factor 1 (KLF1), transcription factor 21 (TCF21), and CCAAT enhancer binding protein beta (CEBPB), specifically contribute to the formation of distinct organs at different stages. Additionally, 5hmC-enriched Alu elements may participate in the regulation of expression of TF-targeted genes. Our integrated studies reveal a putative essential link between DNA modification and RNA methylation, and illustrate the epigenetic maps during human foetal organogenesis, which provide a foundation for for an in-depth understanding of the epigenetic mechanisms underlying early development and birth defects.

Also flagged:high-sensitive C-reactive proteinCRPalanine aminotransferaseALTaspartate aminotransferaseAST
Journal Article 2022-05-26 ✓ 2 Snippets Slywitch E, Savalli C, Duarte AC, Escrivão MAMS.
In-Text Gene Mentions

…and hereditary causes (hemochromatosis, Wilson’s disease).…

…hypo or hyperthyroidism,hemochromatosis, cancer with possible…

Show Full Abstract

Our study evaluated the association between the increase in body mass index (BMI) in men and women (menstruating and non-menstruating) (n = 1340) with different dietary groups (omnivores, semi-vegetarians, lacto-ovo-vegetarian, and vegans) and the measurement of the biochemical markers high-sensitive C-reactive protein (hs-CRP), ferritin, alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyl transferase (GGT), glycated hemoglobin (HbA1C), and insulin resistance index (HOMA-IR). Increasing BMI values in all groups and dietary profiles were related to a significant increase in hs-CRP (p < 0.0001), ALT (p = 0.02), ferritin (p = 0.009), and HbA1C (p < 0.0001), with no difference between dietary groups (p < 0.05). The increase in BMI increases the levels of HOMA-IR (p < 0.0001) and GGT (p < 0.05), with higher values found in men when compared to women (p < 0.0001 for HOMA- IR and p = 0.0048 for GGT). The association between ALT and BMI was different between dietary groups, as it showed a decrease in vegan women who do not menstruate compared to other dietary groups (p = 0.0099). When including only obese individuals (BMI ≥ 30 kg/m2, n = 153) in the analysis, we observed lower concentrations of GGT and ferritin in vegetarians than in omnivores, regardless of gender and menstrual blood loss (p = 0.0395). Our data showed that for both vegetarians and omnivores, the higher the BMI, the worse the metabolic parameters. However, regarding obesity, vegetarians showed better antioxidant status (lower GGT elevation) and lower inflammatory status (lower ferritin elevation), which may provide them with potential protection in the development of morbidities associated with overweight.

Also flagged:NAFLDMetabolic Syndromelipidmetabolismnon-alcoholic fatty liver diseaseglucose
Journal Article 2022-05-26 ✓ 1 Snippet Montemayor S, Bouzas C, Mascaró CM, Casares M, Llompart I, Abete I, Angullo-Martinez E, Zulet MÁ, Martínez JA, Tur JA.
In-Text Gene Mentions

…ections, post-renal hematuria,hemochromatosis, protein overload, non-medica…

Show Full Abstract

<h4>Background</h4>Adults with fatty liver present unusual glycaemia and lipid metabolism; as a result, non-alcoholic fatty liver disease (NAFLD) is now considered as part of the metabolic syndrome (MetS).<h4>Objective</h4>To assess the 6- and 12-month effects of customized hypocaloric dietary and enhanced physical activity intervention on intrahepatic fat contents and progression of NAFLD, in patients with MetS.<h4>Design</h4>Cross-sectional study in 155 participants (40-60 years old) from Balearic Islands and Navarra (Spain) with a diagnosis of NAFLD and MetS, and BMI (body mass index) between 27 and 40 kg/m<sup>2</sup>; patients were randomized in a 1:1:1 ratio to either Conventional Diet, Mediterranean diet (MD)-high meal frequency, and MD-physical activity groups.<h4>Methods</h4>Dietary intake was assessed using a validated food frequency questionnaire. Adherence to Mediterranean diet, anthropometrics, physical activity, and biochemical parameters (fasting glucose, glycated hemoglobin, bilirubin, aspartate aminotransferase, alanine aminotransferase-ALT-, gamma-glutamyl transferase, uric acid, urea, creatinine, albumin, total cholesterol, high-density lipoprotein cholesterol-HDL-cholesterol-, and triglycerides) were also assessed.<h4>Results</h4>Subjects with NAFLD and MetS had reduced intrahepatic fat contents, and liver stiffness, despite the intervention the participants went through. All participants ameliorated BMI, insulin, Hb1Ac, diastolic blood pressure, HDL-cholesterol, and ALT, and improved consumption of total energy, fish, and legumes. Participants in the MD-HMF group improved waist circumference.<h4>Conclusions</h4>Customized hypocaloric dietary and enhanced physical activity interventions may be useful to ameliorate NAFLD.

Also flagged:Secreted Amyloid Precursor Protein AlphaAPPsynaptic vesicle proteinscytoskeletal proteinsorganelleproteasome
Journal Article 2022-05-26 No Snippets Peppercorn K, Kleffmann T, Jones O, Hughes S, Tate W.
Show Full Abstract

Secreted amyloid precursor protein alpha (sAPPα) processed from a parent human brain protein, APP, can modulate learning and memory. It has potential for development as a therapy preventing, delaying, or even reversing Alzheimer's disease. In this study a comprehensive analysis to understand how it affects the transcriptome and proteome of the human neuron was undertaken. Human inducible pluripotent stem cell (iPSC)-derived glutamatergic neurons in culture were exposed to 1 nM sAPPα over a time course and changes in the transcriptome and proteome were identified with RNA sequencing and Sequential Window Acquisition of All THeoretical Fragment Ion Spectra-Mass Spectrometry (SWATH-MS), respectively. A large subset (∼30%) of differentially expressed transcripts and proteins were functionally involved with the molecular biology of learning and memory, consistent with reported links of sAPPα to memory enhancement, as well as neurogenic, neurotrophic, and neuroprotective phenotypes in previous studies. Differentially regulated proteins included those encoded in previously identified Alzheimer's risk genes, APP processing related proteins, proteins involved in synaptogenesis, neurotransmitters, receptors, synaptic vesicle proteins, cytoskeletal proteins, proteins involved in protein and organelle trafficking, and proteins important for cell signalling, transcriptional splicing, and functions of the proteasome and lysosome. We have identified a complex set of genes affected by sAPPα, which may aid further investigation into the mechanism of how this neuroprotective protein affects memory formation and how it might be used as an Alzheimer's disease therapy.

Also flagged:inflammatory responsesneurodegenerative diseasesHomeostasisDiseasesmajor histocompatibility compleximmune responses
Journal Article 2022-05-26 No Snippets Park JH, Kang I, Lee HK.
Show Full Abstract

γδ T cells are a distinct subset of T cells expressing γδ T cell receptor (TCR) rather than αβTCR. Since their discovery, the critical roles of γδ T cells in multiple physiological systems and diseases have been investigated. γδ T cells are preferentially located at mucosal surfaces, such as the gut, although a small subset of γδ T cells can circulate the blood. Additionally, a subset of γδ T cells reside in the meninges in the central nervous system. Recent findings suggest γδ T cells in the meninges have critical roles in brain function and homeostasis. In addition, several lines of evidence have shown γδ T cells can infiltrate the brain parenchyma and regulate inflammatory responses in multiple diseases, including neurodegenerative diseases. Although the importance of γδ T cells in the brain is well established, their roles are still incompletely understood due to the complexity of their biology. Because γδ T cells rapidly respond to changes in brain status and regulate disease progression, understanding the role of γδ T cells in the brain will provide critical information that is essential for interpreting neuroimmune modulation. In this review, we summarize the complex role of γδ T cells in the brain and discuss future directions for research.

Also flagged:Zoledronic AcidHyaluronic AcidPolyethylene GlycolNanobisphosphonatemetastatic bone diseases
Journal Article 2022-05-26 No Snippets Xu Y, Qi J, Sun W, Zhong W, Wu H.
Show Full Abstract

Zoledronic acid (ZOL) has been approved as the only bisphosphonate for the prevention and treatment of metastatic bone diseases with acceptable safety and tolerability. However, systemic or direct injection of ZOL often causes severe side effects, which limits its clinical application. Here, an innovative nano-drug delivery system, ZOL-loaded hyaluronic acid/polyethylene glycol/nano-hydroxyapatite nanoparticles (HA-PEG-nHA-ZOL NPs), has been found to effectively inhibit the proliferation of three types of human osteosarcoma cell lines (143b, HOS, and MG63) at 1-10 μmol/L, while with low cell cytotoxicity on normal cells. The NPs significantly enhanced the apoptosis-related protein expression and tumor cell apoptosis rate. The NPs could also inhibit the proliferation of osteosarcoma cells by blocking the S phase of the cell cycle. In the orthotopic osteosarcoma nude mice model, local injection of the HA-PEG-nHA-ZOL NPs stimulated tumor necrosis, apoptosis, and granulocyte infiltration in the blood vessels. Altogether, the ZOL nano-delivery system possesses great potential for local treatment to prevent local tumor recurrence and can be applied in clinical osteosarcoma therapy.

Also flagged:DOT1LDisruptor of telomeric silencing 1DOT1methyltransferasehistonelysine
Journal Article 2022-05-26 ✓ 2 Snippets Arnold O, Barbosa K, Deshpande AJ, Zhu N.
In-Text Gene Mentions

Aberrant DOT1L activity is found in various hematopoietic malignancies including AML with KMT2A (MLL) gene rearrangements (Okada et al., 2005; Bernt et al., 2011; Jo et al., 2011), partial tandem duplications (Kühn et al., 2015), NPM1 mutations (Kühn et al., 2016), MLLT10 (AF10) gene fusions (Chen et al., 2013), and NUP98-rearranged AML (Deshpande et al., 2014).

…al., 2016 ),MLLT10(AF10) gene fusions…

Show Full Abstract

Disruptor of telomeric silencing 1 (DOT1) was first identified in yeast (DOT1p) and is the sole methyltransferase responsible for histone three lysine 79 (H3K79) mono-, di-, and tri-methylation. Mammalian DOT1 (DOT1-like protein or DOT1L) has been implicated in many cellular processes, such as cell cycle progression, DNA damage response, and development. A notable developmental process reliant on DOT1L function is normal hematopoiesis, as DOT1L knockout leads to impairment in blood lineage formation. Aberrant activity of DOT1L has been implicated in hematopoietic malignancies as well, especially those with high expression of the homeobox (HOX) genes, as genetic or pharmacological DOT1L inhibition causes defects in leukemic transformation and maintenance. Recent studies have uncovered methyltransferase-independent functions and a novel mechanism of DOT1L function. Here, we summarize the roles of DOT1L in normal and malignant hematopoiesis and the potential mechanism behind DOT1L function in hematopoiesis, in light of recent discoveries.

Also flagged:Cancermitochondrialribosomalribosomesmembranephosphorylation
Journal Article 2022-05-26 No Snippets Bao S, Wang X, Li M, Gao Z, Zheng D, Shen D, Liu L.
Show Full Abstract

Next-generation sequencing and bioinformatics analyses have clearly revealed the roles of mitochondrial ribosomal genes in cancer development. Mitochondrial ribosomes are composed of three RNA components encoded by mitochondrial DNA and 82 specific protein components encoded by nuclear DNA. They synthesize mitochondrial inner membrane oxidative phosphorylation (OXPHOS)-related proteins and participate in various biological activities <i>via</i> the regulation of energy metabolism and apoptosis. Mitochondrial ribosomal genes are strongly associated with clinical features such as prognosis and foci metastasis in patients with cancer. Accordingly, mitochondrial ribosomes have become an important focus of cancer research. We review recent advances in bioinformatics research that have explored the link between mitochondrial ribosomes and cancer, with a focus on the potential of mitochondrial ribosomal genes as biomarkers in cancer.

Also flagged:StilbeneNitroxylneurodegenerative diseasesstilbenesamyloid beta
Journal Article 2022-05-26 No Snippets Hilt S, Liu R, Maezawa I, Rojalin T, Aung HH, Budamagunta M, Slez R, Gong Q, Carney RP, Voss JC.
Show Full Abstract

Several neurodegenerative diseases are driven by misfolded proteins that assemble into soluble aggregates. These "toxic oligomers" have been associated with a plethora of cellular dysfunction and dysregulation, however the structural features underlying their toxicity are poorly understood. A major impediment to answering this question relates to the heterogeneous nature of the oligomers, both in terms of structural disorder and oligomer size. This not only complicates elucidating the molecular etiology of these disorders, but also the druggability of these targets as well. We have synthesized a class of bifunctional stilbenes to modulate both the conformational toxicity within amyloid beta oligomers (AβO) and the oxidative stress elicited by AβO. Using a neuronal culture model, we demonstrate this bifunctional approach has the potential to counter the molecular pathogenesis of Alzheimer's disease in a powerful, synergistic manner. Examination of AβO structure by various biophysical tools shows that each stilbene candidate uniquely alters AβO conformation and toxicity, providing insight towards the future development of structural correctors for AβO. Correlations of AβO structural modulation and bioactivity displayed by each provides insights for future testing <i>in vivo</i>. The multi-target activity of these hybrid molecules represents a highly advantageous feature for disease modification in Alzheimer's, which displays a complex, multifactorial etiology. Importantly, these novel small molecules intervene with intraneuronal AβO, a necessary feature to counter the cycle of dysregulation, oxidative stress and inflammation triggered during the earliest stages of disease progression.

Also flagged:diabetespathogenesisDNdeathgene expressiontranscription factors
Journal Article 2022-05-26 ✓ 1 Snippet Wang X, Jiang L, Liu XQ, Huang YB, Zhu W, Zeng HX, Gao L, Ma LJ, Zhang MY, Zhu QJ, Wu YG.
In-Text Gene Mentions

…Sp1-mediated upregulation ofPrdx6expression mitigated oxidative…

Show Full Abstract

<b>Aims/Introduction:</b> Diabetic nephropathy (DN) is one of the main complications of diabetes. Genomics may reveal the essential pathogenesis of DN. We analyzed datasets to search for key genes to explore pathological mechanisms of DN. <b>Materials and Methods:</b> In this study, weighted gene co-expression network analysis (WGCNA) was used to divide the differential expression genes (DEGs) from GSE142025 into different modules, and enrichment pathway analysis was conducted for each module to find key genes related to cell death pathway. Then, verification was carried out through network and histopathology. Finally, the regulatory mechanisms of key gene expression, including transcription factors (TFs), miRNA and E3 ligases related to ubiquitination, were predicted through website prediction and then miRNA results were validated using GSE51674 dataset. <b>Results:</b> The results of WGCNA and enrichment pathway analysis indicated that ferroptosis had significantly occurred in advanced DN (AND) group. Analysis of DEGs indicated that the occurrence and development of ferroptosis are mainly through ALOX15-mediated lipid metabolism pathway, which was found in all intrinsic cells of the glomerulus detected by IHC and IF staining. Moreover, network predictions were used for searching ALOX15-related TFs and ubiquitination. Meanwhile, the network predictions combining with other dataset furtherly discovered miRNAs which regulated ALOX15 expression. This study showed that the levels of mmu-miR-142-3p increased in DN mice kidney tissues, compared with the NC group. <b>Conclusion:</b> Ferroptosis existed in glomerular intrinsic cells of ADN group and its potential key candidate gene was ALOX15 which may be regulated by miR-142 and miRNA-650, TFs (CREBBP, EP300, HDAC1, MTA1, SPI1, STAT6) and E3 ligases related to ubiquitination (PML, ZMIZ1, MARCHF1, MARCHF3, MARCHF8, MARCHF11).

Also flagged:Glucose transporter type 1Glut1transporterglucoseGlut1 deficiency syndromemetabolic epileptic encephalopathy
Journal Article 2022-05-26 No Snippets Vulturar R, Chiș A, Pintilie S, Farcaș IM, Botezatu A, Login CC, Sitar-Taut AV, Orasan OH, Stan A, Lazea C, Al-Khzouz C, Mager M, Vințan MA, Manole S, Damian L.
Show Full Abstract

Glucose transporter type 1 (Glut1) is the main transporter involved in the cellular uptake of glucose into many tissues, and is highly expressed in the brain and in erythrocytes. Glut1 deficiency syndrome is caused mainly by mutations of the <i>SLC2A1</i> gene, impairing passive glucose transport across the blood-brain barrier. All age groups, from infants to adults, may be affected, with age-specific symptoms. In its classic form, the syndrome presents as an early-onset drug-resistant metabolic epileptic encephalopathy with a complex movement disorder and developmental delay. In later-onset forms, complex motor disorder predominates, with dystonia, ataxia, chorea or spasticity, often triggered by fasting. Diagnosis is confirmed by hypoglycorrhachia (below 45 mg/dL) with normal blood glucose, 18F-fluorodeoxyglucose positron emission tomography, and genetic analysis showing pathogenic <i>SLC2A1</i> variants. There are also ongoing positive studies on erythrocytes' Glut1 surface expression using flow cytometry. The standard treatment still consists of ketogenic therapies supplying ketones as alternative brain fuel. Anaplerotic substances may provide alternative energy sources. Understanding the complex interactions of Glut1 with other tissues, its signaling function for brain angiogenesis and gliosis, and the complex regulation of glucose transportation, including compensatory mechanisms in different tissues, will hopefully advance therapy. Ongoing research for future interventions is focusing on small molecules to restore Glut1, metabolic stimulation, and <i>SLC2A1</i> transfer strategies. Newborn screening, early identification and treatment could minimize the neurodevelopmental disease consequences. Furthermore, understanding Glut1 relative deficiency or inhibition in inflammation, neurodegenerative disorders, and viral infections including COVID-19 and other settings could provide clues for future therapeutic approaches.

Also flagged:metal oxidesmetallic nanoparticlescancerglutathioneconjugationantibodies
Journal Article 2022-05-26 No Snippets Bianchi E, Vigani B, Viseras C, Ferrari F, Rossi S, Sandri G.
Show Full Abstract

In recent decades, the demand for replacement of damaged or broken tissues has increased; this poses the attention on problems related to low donor availability. For this reason, researchers focused their attention on the field of tissue engineering, which allows the development of scaffolds able to mimic the tissues' extracellular matrix. However, tissue replacement and regeneration are complex since scaffolds need to guarantee an adequate hierarchical structured morphology as well as adequate mechanical, chemical, and physical properties to stand the stresses and enhance the new tissue formation. For this purpose, the use of inorganic materials as fillers for the scaffolds has gained great interest in tissue engineering applications, due to their wide range of physicochemical properties as well as their capability to induce biological responses. However, some issues still need to be faced to improve their efficacy. This review focuses on the description of the most effective inorganic nanomaterials (clays, nano-based nanomaterials, metal oxides, metallic nanoparticles) used in tissue engineering and their properties. Particular attention has been devoted to their combination with scaffolds in a wide range of applications. In particular, skin, orthopaedic, and neural tissue engineering have been considered.

Also flagged:gliomaextracellular spacehyaluronidasehyaluronic aciddigestiongene expression
Journal Article 2022-05-26 ✓ 2 Snippets Petkova AI, Kubajewska I, Vaideanu A, Schätzlein AG, Uchegbu IF.
In-Text Gene Mentions

…mutant huntingtin protein (HTT) where HTT mRNA…

…protein (HTT) whereHTTmRNA was reduced…

Show Full Abstract

Gene delivery to the cerebral cortex is challenging due to the blood brain barrier and the labile and macromolecular nature of DNA. Here we report gene delivery to the cortex using a glycol chitosan-DNA polyplex (GCP). In vitro, GCPs carrying a reporter plasmid DNA showed approximately 60% of the transfection efficiency shown by Lipofectamine lipoplexes (LX) in the U87 glioma cell line. Aiming to maximise penetration through the brain extracellular space, GCPs were coated with hyaluronidase (HYD) to form hyaluronidase-coated polyplexes (GCPH). The GCPH formulation retained approximately 50% of the in vitro hyaluronic acid (HA) digestion potential but lost its transfection potential in two-dimensional U87 cell lines. However, intranasally administered GCPH (0.067 mg kg<sup>-1</sup> DNA) showed high levels of gene expression (IVIS imaging of protein expression) in the brain regions. In a separate experiment, involving GCP, LX and naked DNA, the intranasal administration of the GCP formulation (0.2 mg kg<sup>-1</sup> DNA) resulted in protein expression predominantly in the cerebral cortex, while a similar dose of intranasal naked DNA led to protein expression in the cerebellum. Intranasal LX formulations did not show any evidence of protein expression. GCPs may provide a means to target protein expression to the cerebral cortex via the intranasal route.

Also flagged:malignant tumorsbiliary duct hamartomasbiliary hamartomasHamartomasbenign bile ductpolycystic liver
Journal Article 2022-05-26 ✓ 1 Snippet Sheikh AAE, Nguyen AP, Leyba K, Javed N, Shah S, Deradke A, Cormier C, Shekhar R, Sheikh AB.
In-Text Gene Mentions

…alcohol use (3.6%),hemochromatosis(1.4%), and tuberculosis…

Show Full Abstract

Biliary duct hamartomas are benign intrahepatic bile duct lesions. Despite being primarily incidental findings on imaging, these lesions can provide a diagnostic conundrum due to their shared characteristics with malignant tumors. The goal of this systematic review is to offer a thorough clinical profile of biliary duct hamartomas. There were 139 cases of biliary duct hamartomas identified in a structured systematic review of the literature. Patient demographics, clinical presentation, significant laboratory and imaging data, diagnostic modalities, treatment choices, and outcomes were all studied and reported. Biliary duct hamartomas present with mild symptoms and laboratory abnormalities, and while being visible on imaging, the results are non-specific and may require biopsy in case of red flag signs such as weight loss and a progressive increase in the size of the lesion. Furthermore, there are currently no published guidelines for the treatment of biliary duct hamartomas, and many people have had surgery despite the clinically benign nature of these abnormalities. As per the findings of the study, individuals who exhibit signs of malignancy should be investigated further. Eyeballing for red flag symptoms, followed by a specialized imaging scan and invasive treatment, is the three-step approach to biliary duct hamartomas. Since our recommendations include a shift in strategy and do not contradict existing rules, there are likely to be few roadblocks to improvement; the key barriers being technological equipment and image quality. In this study, we intended to pave the way for future research in the field. In our opinion, the next decade will bring a better understanding of the characteristics of biliary hamartomas, disease symptoms, and better recognition of any suspicious features. These indications will aid in reducing the number of unneeded surgical or invasive operations. Finally, the findings of these future studies will allow the medical community to improve and provide the best care possible.

Also flagged:pulmonary hypertensionnetrin-1PHaxon-guidingmyocardial infarctionnitric oxide
Journal Article 2022-05-26 ✓ 2 Snippets Murugesan P, Zhang Y, Youn JY, Cai H.
In-Text Gene Mentions

…of NO uponDCC/ERK1/2 dependent activation o…

…activate netrin-1 receptorDCCto lead to…

Show Full Abstract

Limited medical therapies have been implemented for the treatment of the devastating cardiorespiratory disease of pulmonary hypertension (PH) while none of which is sufficiently effective to stop or regress development of PH. We have previously shown that netrin-1, an axon-guiding protein during development, protects against ischemia reperfusion injury induced myocardial infarction via modest and stable production of nitric oxide (NO) and attenuation of oxidative stress. Since NO deficiency and oxidative stress-mediated vascular remodeling play important roles in the pathogenesis of PH, our present study investigated therapeutic effects on PH of netrin-1 and its derived small peptides. Infused into mice for 3 weeks during exposure to hypoxia, netrin-1 and netrin-1 derived small peptides V1, V2 or V3 substantially alleviated pathophysiological and molecular features of PH, as indicated by abrogated increases in mean pulmonary artery pressure (mPAP) and right ventricular systolic pressure (RVSP), attenuated right ventricular hypertrophy, diminished vascular remodeling of medial thickening and upregulation in smooth muscle alpha-actin (SMA) and proliferative cell nuclear antigen (PCNA), and alleviated perivascular and peribronchial fibrosis reflected by collagen deposition. NO bioavailability was substantially improved by treatment with netrin-1 and netrin-1 derived small peptides, while hypoxia induced increases in total superoxide production and eNOS uncoupling activity were all attenuated. These dual mechanisms of increasing NO bioavailability and decreasing oxidative stress at the same time, underlie robust protective effects on PH of netrin-1 and its derived small peptides, which are different from existing medications that primarily target NO signaling alone. Our data for the first time demonstrate intriguing findings that netrin-1 and netrin-1 derived small peptides can be used as novel and robust therapeutics for the treatment of PH.

Also flagged:CancerHomeostasisCalciumtumorCalcium release-activated calcium channel proteincalcium channels
Journal Article 2022-05-26 No Snippets Tombaz M, Yanyatan C, Keskus AG, Konu O.
Show Full Abstract

Regulation of intracellular calcium concentrations, <i>[Ca<sup>++</sup>]<sub>i</sub></i> is important in maintaining the viability of normal as well as cancer cells and can be mediated by tumor microenvironment. Calcium release-activated calcium channel protein (ORAI) calcium channels on the plasma membrane (PM) become physically connected by stromal interaction molecules (STIMs) to the endoplasmic reticulum (ER), on which paralogous receptors of inositol phosphate and of ryanodine are also present along with ATP2A/SERCA (sarco/endoplasmic reticulum calcium ATPases) subunits (also known as PM-ER geneset). Proper expression of this functionally and physically interconnected geneset is essential for the maintenance of <i>[Ca<sup>++</sup>]<sub>i</sub></i> , yet has not been interrogated as a whole for its role in cancer prognosis using multivariable Cox regression. In the present study, we examined whether the expression profile of the PM-ER geneset exhibited prognostic significance across different cancers found in The Cancer Genome Atlas (TCGA) by generating gene-cancer-by-survival networks, in which the nodes represented either genes or cancers and the edges, the logarithmically transformed hazard ratios for overall survival (OS). We then applied network clustering to identify the gene-cancer subnetworks with high connectivity, among which uveal melanoma (UVM) emerged exhibiting the highest degree of genes (<i>k</i> = 10). <i>BAP1</i>, a well-known <i>[Ca<sup>++</sup>]<sub>i</sub></i> regulator and a tumor suppressor, was not found to be significant in predicting OS by PM-ER geneset for UVM, yet it was for several others, including mesothelioma (MESO). Moreover, the best subset of the PM-ER geneset obtained by lasso predicted OS in the TCGA UVM cohort with an area under the receiver operating characteristics (AUC) of 91.4%, comparable to or better than previous prognostic signatures in the literature. Our findings indicate that homeostasis of <i>[Ca<sup>++</sup>]<sub>i</sub></i> is an essential determinant of prognosis in multiple cancers and particularly in UVM. The proposed gene-cancer-by-survival network approach can be extended with other gene sets as well as different survival types.

Research Square 2022-05-26 Preprint (No Snippets API) GUENICHI H, Nejib C.
Show Full Abstract

<title>Abstract</title> <p>To examine the effects of economic policy uncertainty (EPU) and pandemic uncertainty (PU) on Tunisian sectorial stock market returns, our paper contributes to the financial literature by providing a new study based on VAR-DCC-GARCH. This study uses the EPU and pandemic uncertainty indices and daily of eight Tunisian sector indices namely Automobile and Parts (AP), Banks, Basic Materials (BM), Building Construct Materials (BCM), Financials (FIN), Industrials (IND), Insurance (INS) and Food and Beverage (FB). The symmetric VAR-DCC-GJR-GARCH and VAR-DCC-EGARCH are the appropriate model for the empirical study. Results show a mixed sign of time varying correlation of sectors returns with EPU with respectively high and low significant long run and short run persistence of shocks. Evidence suggests that PU starts with a tranquil correlation and then becomes negative indicating the negative effect on sectors returns. In the last half of 2021, Tunisian investors succeed to overcome their fear and less risk averse.Jel codes : C32 ; D53 ; D74 ; G38 ; H12.</p>

bioRxiv 2022-05-26 Preprint (No Snippets API) Lim CK, McCallister TX, Saporito-Magriña C, McPheron GD, Krishnan R, Zeballos C MA, Powell JE, Clark LV, Perez-Pinera P, Gaj T.
Show Full Abstract

<h4>ABSTRACT</h4> CRISPR technology has demonstrated broad utility for controlling target gene expression; however, there remains a need for strategies capable of modulating expression via the precise editing of non-coding regulatory elements. Here we demonstrate that CRISPR base editors, a class of gene-modifying proteins capable of creating single-base substitutions in DNA, can be used to perturb gene expression via their targeted mutagenesis of cis -acting sequences. Using the promoter region of the human huntingtin (HTT) gene as an initial target, we show that editing of the binding site for the transcription factor NF-κB led to a marked reduction in HTT gene expression in base-edited cell populations. We found that these gene perturbations were persistent and specific, as a transcriptome-wide RNA analysis revealed minimal off-target effects resulting from the action of the base editor protein. We further demonstrate that this base-editing platform could influence gene expression in vivo as its delivery to a mouse model of Huntington’s disease led to a potent decrease in HTT mRNA in striatal neurons. Finally, to illustrate the applicability of this concept, we target the amyloid precursor protein, showing that multiplex editing of its promoter region significantly perturbed its expression. These findings demonstrate the potential for base editors to regulate target gene expression.

bioRxiv 2022-05-26 Preprint (No Snippets API) Zhang F, Zang T, Stevenson EM, Lei X, Copertino DC, Mota TM, Boucau J, Garcia-Beltran WF, Jones RB, Bieniasz PD.
Show Full Abstract

Viruses employ a variety of strategies to escape or counteract immune responses, including depletion of cell surface major histocompatibility complex class I (MHC-I), that would ordinarily present viral peptides to CD8+ cytotoxic T cells. As part of a screen to elucidate biological activities associated with individual SARS-CoV-2 viral proteins, we found that ORF7a reduced cell surface MHC-I levels by approximately 5-fold. Nevertheless, in cells infected with SARS-CoV-2, surface MHC-I levels were reduced even in the absence of ORF7a, suggesting additional mechanisms of MHC-I downregulation. ORF7a proteins from a sample of sarbecoviruses varied in their ability to induce MHC-I downregulation and, unlike SARS-CoV-2, the ORF7a protein from SARS-CoV lacked MHC-I downregulating activity. A single-amino acid at position 59 (T/F) that is variable among sarbecovirus ORF7a proteins governed the difference in MHC-I downregulating activity. SARS-CoV-2 ORF7a physically associated with the MHC-I heavy chain and inhibited the presentation of expressed antigen to CD8+ T-cells. Speficially, ORF7a prevented the assembly of the MHC-I peptide loading complex and causing retention of MHC-I in the endoplasmic reticulum. The differential ability of ORF7a proteins to function in this way might affect sarbecovirus dissemination and persistence in human populations, particularly those with infection- or vaccine-elicited immunity.

Also flagged:innate immunitycytoplasmcyclic GMP-AMP synthasecGASinfectioncytosol
Journal Article 2022-05-25 No Snippets Mosallanejad K, Kagan JC.
Show Full Abstract

Within the cytoplasm of mammalian cells is a protein called cyclic GMP-AMP synthase (cGAS), which acts to defend against infection and other threats to the host. cGAS operates in this manner through its ability to detect a molecular occurrence that should not exist in healthy cells - the existence of DNA in the cytosol. Upon DNA binding, cGAS synthesizes cyclic GMP-AMP (cGAMP), a cyclic dinucleotide that activates the endoplasmic reticulum-localized protein stimulator of interferon genes (STING). STING-mediated signaling culminates in host defensive responses typified by inflammatory cytokine and interferon expression, and the induction of autophagy. Studies over the past several years have established a consensus in the field of the enzymatic activities of cGAS in vitro, as it relates to DNA-induced production of cGAMP. However, much additional work is needed to understand the regulation of cGAS functions within cells, where multiple sources of DNA can create a problem of self and non-self discrimination. In this review, we provide an overview of how the cGAS-STING pathway mediates innate immune responses during infection and other cellular stresses. We then highlight recent progress in the understanding of the increasingly diverse ways in which this DNA-sensing machinery is regulated inside cells, including how cGAS remains inactive to host-derived DNA under conditions of homeostasis.

Also flagged:muscle atrophycancerdegradationamyotrophic lateral sclerosisALSdeath
Journal Article 2022-05-25 ✓ 1 Snippet Re Cecconi AD, Barone M, Gaspari S, Tortarolo M, Bendotti C, Porcu L, Terribile G, Piccirillo R.
In-Text Gene Mentions

…, Syvn1 ,Htt, and Nsfl1c…

Show Full Abstract

<h4>Background</h4>The p97 complex participates in the degradation of muscle proteins during atrophy upon fasting or denervation interacting with different protein adaptors. We investigated whether and how it might also be involved in muscle wasting in cancer, where loss of appetite occurs, or amyotrophic lateral sclerosis (ALS), where motoneuron death causes muscle denervation and fatal paralysis.<h4>Methods</h4>As cancer cachexia models, we used mice bearing colon adenocarcinoma C26, human renal carcinoma RXF393, or Lewis lung carcinoma, with breast cancer 4T1-injected mice as controls. As ALS models, we employed 129/SvHsd mice carrying the mutation G93A in human SOD1. The expression of p97 and its adaptors was analysed in their muscles by quantitative real-time polymerase chain reaction (qPCR) and western blot. We electroporated plasmids into muscles or treated mice with disulfiram (DSF) to test the effects of inhibiting p97 and nuclear protein localization protein 4 (Nploc4), one of its adaptors, on atrophy.<h4>Results</h4>The mRNA levels of p97 were induced by 1.5-fold to 2-fold in tibialis anterior (TA) of all the cachectic models but not in the non-cachectic 4T1 tumour-bearing mice (P ≤ 0.05). Similarly, p97 was high both in mRNA and protein in TA from 17-week-old SOD1<sup>G93A</sup> mice (P ≤ 0.01). Electroporation of a shRNA for murine p97 into mouse muscle reduced the fibre atrophy caused by C26 (P = 0.0003) or ALS (P ≤ 0.01). When we interrogated a microarray, we had previously generated for the expression of p97 adaptors, we found Derl1, Herpud1, Nploc4, Rnf31, and Hsp90ab1 induced in cachectic TA from C26-mice (Fold change > 1.2, adjusted P ≤ 0.05). By qPCR, we validated their inductions in TA of cachectic and ALS models and selected Nploc4 as the one also induced at the protein level by 1.5-fold (P ≤ 0.01). Electroporation of a CRISPR/Cas9 vector against Nploc4 into muscle reduced the fibre atrophy caused by C26 (P = 0.01) or ALS (P ≤ 0.0001). Because DSF uncouples p97 from Nploc4, we treated atrophying myotubes with DSF, and found accumulated mono and polyubiquitinated proteins and reduced degradation of long-lived proteins by 35% (P ≤ 0.0001), including actin (P ≤ 0.05). DSF halves Nploc4 in the soluble muscle fraction (P ≤ 0.001) and given to C26-bearing mice limited the body and muscle weight loss (P ≤ 0.05), with no effect on tumour growth.<h4>Conclusions</h4>Overall, cancer cachexia and ALS seem to display similar mechanisms of muscle wasting at least at the catabolic level. The p97-Nploc4 complex appears to have a crucial role in muscle atrophy during these disorders and disrupting this complex might serve as a novel drug strategy.

Also flagged:SASLTPnucleic acidLysmemorymetabolic process
Journal Article 2022-05-25 ✓ 2 Snippets Burns AM, Farinelli-Scharly M, Hugues-Ascery S, Sanchez-Mut JV, Santoni G, Gräff J.
In-Text Gene Mentions

…channel subunit (Cacna1e).…

…ion channel (Cacna1e), and again,…

Show Full Abstract

Long-term memory formation relies on synaptic plasticity, neuronal activity-dependent gene transcription, and epigenetic modifications. Multiple studies have shown that HDAC inhibitor (HDACi) treatments can enhance individual aspects of these processes and thereby act as putative cognitive enhancers. However, their mode of action is not fully understood. In particular, it is unclear how systemic application of HDACis, which are devoid of substrate specificity, can target pathways that promote memory formation. In this study, we explore the electrophysiological, transcriptional, and epigenetic responses that are induced by CI-994, a class I HDACi, combined with contextual fear conditioning (CFC) in mice. We show that CI-994–mediated improvement of memory formation is accompanied by enhanced long-term potentiation in the hippocampus, a brain region recruited by CFC, but not in the striatum, a brain region not primarily implicated in fear learning. Furthermore, using a combination of bulk and single-cell RNA-sequencing, we find that, when paired with CFC, HDACi treatment engages synaptic plasticity-promoting gene expression more strongly in the hippocampus, specifically in the dentate gyrus (DG). Finally, using chromatin immunoprecipitation-sequencing (ChIP-seq) of DG neurons, we show that the combined action of HDACi application and conditioning is required to elicit enhancer histone acetylation in pathways that underlie improved memory performance. Together, these results indicate that systemic HDACi administration amplifies brain region-specific processes that are naturally induced by learning.

Also flagged:filamin-Acell migration disorderFLNAperiventricular nodular heterotopiachromosomeneuronal migration
Journal Article 2022-05-25 ✓ 2 Snippets Gerlevik U, Saygı C, Cangül H, Kutlu A, Çaralan EF, Topçu Y, Özören N, Sezerman OU.
In-Text Gene Mentions

PNH is associated with Filamin-A (FLNA) and ADP ribosylation factor guanine nucleotide exchange factor 2 (ARFGEF2, OMIM 608097) mutations, and chromosome 5p duplications (OMIM 608098) [4].

…factor 2 (ARFGEF2, OMIM 608097)…

Show Full Abstract

<h4>Background</h4>Periventricular nodular heterotopia (PNH) is a cell migration disorder associated with mutations in Filamin-A (FLNA) gene on chromosome X. Majority of the individuals with PNH-associated FLNA mutations are female whereas liveborn males with FLNA mutations are very rare. Fetal viability of the males seems to depend on the severity of the variant. Splicing or severe truncations presumed loss of function of the protein product, lead to male lethality and only partial-loss-of-function variants are reported in surviving males. Those variants mostly manifest milder clinical phenotypes in females and thus avoid detection of the disease in females.<h4>Methods</h4>We describe a novel p.Arg484Gln variant in the FLNA gene by performing whole exome analysis on the index case, his one affected brother and his healthy non-consanguineous parents. The transmission of PNH from a clinically asymptomatic mother to two sons is reported in a fully penetrant classical X-linked dominant mode. The variant was verified via Sanger sequencing. Additionally, we investigated the impact of missense mutations reported in affected males on the FLNa protein structure, dynamics and interactions by performing molecular dynamics (MD) simulations to examine the disease etiology and possible compensative mechanisms allowing survival of the males.<h4>Results</h4>We observed that p.Arg484Gln disrupts the FLNa by altering its structural and dynamical properties including the flexibility of certain regions, interactions within the protein, and conformational landscape of FLNa. However, these impacts existed for only a part the MD trajectories and highly similar patterns observed in the other 12 mutations reported in the liveborn males validated this mechanism.<h4>Conclusion</h4>It is concluded that the variants seen in the liveborn males result in transient pathogenic effects, rather than persistent impairments. By this way, the protein could retain its function occasionally and results in the survival of the males besides causing the disease.

Also flagged:mucosal-associated invariantacute graft-versus-host diseaseaGVHDadaptive immunitycell receptorpeptide
Journal Article 2022-05-25 ✓ 1 Snippet Andrlová H, Miltiadous O, Kousa AI, Dai A, DeWolf S, Violante S, Park HY, Janaki-Raman S, Gardner R, El Daker S, Slingerland J, Giardina P, Clurman A, Gomes ALC, Nguyen C, da Silva MB, Armijo GK, Lee N, Zappasodi R, Chaligne R, Masilionis I, Fontana E, Ponce D, Cho C, Bush A, Hill L, Chao N, Sung AD, Giralt S, Vidal EH, Hosszu KK, Devlin SM, Peled JU, Cross JR, Perales MA, Godfrey DI, van den Brink MRM, Markey KA.
In-Text Gene Mentions

BTN2A1

Show Full Abstract

Microbial diversity is associated with improved outcomes in recipients of allogeneic hematopoietic cell transplantation (allo-HCT), but the mechanism underlying this observation is unclear. In a cohort of 174 patients who underwent allo-HCT, we demonstrate that a diverse intestinal microbiome early after allo-HCT is associated with an increased number of innate-like mucosal-associated invariant T (MAIT) cells, which are in turn associated with improved overall survival and less acute graft-versus-host disease (aGVHD). Immune profiling of conventional and unconventional immune cell subsets revealed that the prevalence of Vδ2 cells, the major circulating subpopulation of γδ T cells, closely correlated with the frequency of MAIT cells and was associated with less aGVHD. Analysis of these populations using both single-cell transcriptomics and flow cytometry suggested a shift toward activated phenotypes and a gain of cytotoxic and effector functions after transplantation. A diverse intestinal microbiome with the capacity to produce activating ligands for MAIT and Vδ2 cells appeared to be necessary for the maintenance of these populations after allo-HCT. These data suggest an immunological link between intestinal microbial diversity, microbe-derived ligands, and maintenance of unconventional T cells.

Also flagged:NFE2L1AMPKantioxidant transcription factorNrf1metabolismsystemic metabolic diseases
Journal Article 2022-05-25 No Snippets Qiu L, Yang Q, Zhao W, Xing Y, Li P, Zhou X, Ning H, Shi R, Gou S, Chen Y, Zhai W, Wu Y, Li G, Chen Z, Ren Y, Gao Y, Zhang Y, Qi Y.
Show Full Abstract

The antioxidant transcription factor NFE2L1 (also called Nrf1) acts as a core regulator of redox signaling and metabolism homeostasis, and thus, its dysfunction results in multiple systemic metabolic diseases. However, the molecular mechanism(s) by which NFE2L1 regulates glycose and lipid metabolism remains elusive. Here, we found that loss of NFE2L1 in human HepG2 cells led to a lethal phenotype upon glucose deprivation and NFE2L1 deficiency could affect the uptake of glucose. Further experiments revealed that glycosylation of NFE2L1 enabled it to sense the energy state. These results indicated that NFE2L1 can serve as a dual sensor and regulator of glucose homeostasis. The transcriptome, metabolome, and seahorse data further revealed that disruption of NFE2L1 could reprogram glucose metabolism to aggravate the Warburg effect in NFE2L1-silenced hepatoma cells, concomitant with mitochondrial damage. Co-expression and Co-immunoprecipitation experiments demonstrated that NFE2L1 could directly interact and inhibit AMPK. Collectively, NFE2L1 functioned as an energy sensor and negatively regulated AMPK signaling through directly interacting with AMPK. The novel NFE2L1/AMPK signaling pathway delineate the mechanism underlying of NFE2L1-related metabolic diseases and highlight the crosstalk between redox homeostasis and metabolism homeostasis.

Also flagged:biotinbiotin ligasebiotinylationaxonstransportersion channels
Journal Article 2022-05-25 ✓ 1 Snippet Rayaprolu S, Bitarafan S, Santiago JV, Betarbet R, Sunna S, Cheng L, Xiao H, Nelson RS, Kumar P, Bagchi P, Duong DM, Goettemoeller AM, Oláh VJ, Rowan M, Levey AI, Wood LB, Seyfried NT, Rangaraju S.
In-Text Gene Mentions

…calcium channel subunitsCacna1e, Cacna2d3, and NMDA…

Show Full Abstract

Proteomic profiling of brain cell types using isolation-based strategies pose limitations in resolving cellular phenotypes representative of their native state. We describe a mouse line for cell type-specific expression of biotin ligase TurboID, for in vivo biotinylation of proteins. Using adenoviral and transgenic approaches to label neurons, we show robust protein biotinylation in neuronal soma and axons throughout the brain, allowing quantitation of over 2000 neuron-derived proteins spanning synaptic proteins, transporters, ion channels and disease-relevant druggable targets. Next, we contrast Camk2a-neuron and Aldh1l1-astrocyte proteomes and identify brain region-specific proteomic differences within both cell types, some of which might potentially underlie the selective vulnerability to neurological diseases. Leveraging the cellular specificity of proteomic labeling, we apply an antibody-based approach to uncover differences in neuron and astrocyte-derived signaling phospho-proteins and cytokines. This approach will facilitate the characterization of cell-type specific proteomes in a diverse number of tissues under both physiological and pathological states.

Also flagged:Transcription FactorsForkhead-box-PFOXP1breast cancerBRCAFOXP3
Journal Article 2022-05-25 No Snippets Yi J, Tan S, Zeng Y, Zou L, Zeng J, Zhang C, Liu L, Fan P.
Show Full Abstract

Forkhead-box-P family include FOXP1/2/3/4 and its clinical significance still remains unclear in breast cancer (BRCA). We analysed the expressions of FOXPs in BRCA patients to determine diagnostic and prognostic values. Our results indicated that the transcriptional levels of FOXP3/4 were up-regulated in BRCA patients, but FOXP2 were down-regulated. No statistically significant correlation were found between the expression levels of FOXPs in Pathologic stage. FOXP2/3 had a significantly high AUC value in the detection of breast cancer, with 96.8% or 95.7% in accuracy respectively. Our study also suggested that BRCA patients with high transcription levels of FOXP1/2/4 were significantly associated with longer Overall Survival (OS). In contrast, BRCA patients with high transcription level of FOXP3 was not statistically related with OS. Our work revealed that FOXPs were closely related to the alteration of extensive immune checkpoints in breast invasive carcinoma. Additionally, FOXP3 has a significant positive correlation with PDCD1, CD274, CTLA4 and TMB in breast cancer, and FOXP3 expression showed a statistically significant correlation with infiltration of immune cells. Finally, we found that FOXP3 expression predicted the breast cancer cells response to anticancer drugs. Altogether, our work strongly suggested that FOXPs could serve as a biomarker for tumor detection, therapeutic design and prognosis.

Also flagged:tooth developmentFN1COL1A1COL1A2ACTBextracellular
Journal Article 2022-05-25 ✓ 5 Snippets Faruangsaeng T, Thaweesapphitak S, Khamwachirapitak C, Porntaveetus T, Shotelersuk V.
In-Text Gene Mentions

…GCTCATGGAGTTGAAG), and DNAAF4-CCPG1(F: CCAATTCGACCCTCTGGCAA, R:…

…the PITX1 and DNAAF4-CCPG1genes were significantly…

…2, comprising SULT1A3, DNAAF4-CCPG1, PITX1, ASB5, EPHA6,…

…The DNAAF4-CCPG1gene that had…

…DNAAF4 -CCPG1demonstrated significant diffe…

Show Full Abstract

The molecular control of tooth development is different between the maxilla and mandible, contributing to different tooth shapes and locations; however, whether this difference occurs in human permanent teeth is unknown. The aim of this study was to investigate and compare the transcriptome profiles of permanent maxillary and mandibular posterior teeth. Ten participants who had a pair of opposing premolars or molars extracted were recruited. The RNA obtained from cultured dental pulp stem cells underwent RNA-sequencing and qRT-PCR. The transcriptome profiles of two opposing premolar pairs and two molar pairs demonstrated that the upper premolars, lower premolars, upper molars, and lower molars expressed the same top-ranked genes, comprising FN1, COL1A1, COL1A2, ACTB, and EEFIA1, which are involved in extracellular matrix organization, immune system, signal transduction, hemostasis, and vesicle-mediated transport. Comparative transcriptome analyses of each/combined tooth pairs demonstrated that PITX1 was the only gene with different expression levels between upper and lower posterior teeth. PITX1 exhibited a 64-fold and 116-fold higher expression level in lower teeth compared with their upper premolars and molars, respectively. These differences were confirmed by qRT-PCR. Taken together, this study, for the first time, reveals that PITX1 is expressed significantly higher in mandibular posterior teeth compared with maxillary posterior teeth. The difference is more evident in the molars compared with premolars and consistent with its expression pattern in mouse developing teeth. We demonstrate that differences in lower versus upper teeth gene expression during odontogenesis occur in permanent teeth and suggest that these differences should be considered in molecular studies of dental pulp stem cells. Our findings pave the way to develop a more precise treatment in regenerative dentistry such as gene-based therapies for dentin/pulp regeneration and regeneration of different tooth types.

Also flagged:CNS disordersagingSod1nucleusAD
Journal Article 2022-05-25 ✓ 1 Snippet Burda JE, O'Shea TM, Ao Y, Suresh KB, Wang S, Bernstein AM, Chandra A, Deverasetty S, Kawaguchi R, Kim JH, McCallum S, Rogers A, Wahane S, Sofroniew MV.
In-Text Gene Mentions

…fluencing astrocyte functions,Htt27 , Sod1…

Show Full Abstract

Astrocytes respond to injury and disease in the central nervous system with reactive changes that influence the outcome of the disorder<sup>1-4</sup>. These changes include differentially expressed genes (DEGs) whose contextual diversity and regulation are poorly understood. Here we combined biological and informatic analyses, including RNA sequencing, protein detection, assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) and conditional gene deletion, to predict transcriptional regulators that differentially control more than 12,000 DEGs that are potentially associated with astrocyte reactivity across diverse central nervous system disorders in mice and humans. DEGs associated with astrocyte reactivity exhibited pronounced heterogeneity across disorders. Transcriptional regulators also exhibited disorder-specific differences, but a core group of 61 transcriptional regulators was identified as common across multiple disorders in both species. We show experimentally that DEG diversity is determined by combinatorial, context-specific interactions between transcriptional regulators. Notably, the same reactivity transcriptional regulators can regulate markedly different DEG cohorts in different disorders; changes in the access of transcriptional regulators to DNA-binding motifs differ markedly across disorders; and DEG changes can crucially require multiple reactivity transcriptional regulators. We show that, by modulating reactivity, transcriptional regulators can substantially alter disorder outcome, implicating them as therapeutic targets. We provide searchable resources of disorder-related reactive astrocyte DEGs and their predicted transcriptional regulators. Our findings show that transcriptional changes associated with astrocyte reactivity are highly heterogeneous and are customized from vast numbers of potential DEGs through context-specific combinatorial transcriptional-regulator interactions.

Also flagged:HuntingtonHDdominantcytosolnucleusvesicle
Journal Article 2022-05-25 ✓ 5 Snippets Calabrese G, Molzahn C, Mayor T.
In-Text Gene Mentions

Dynein, which requires dynactin for its activation, constitutively interacts with HTT (25, 225), whereas interaction with kinesin to recruit vesicle occurs only when HTT is phosphorylated on serine 421 (244, 245).

HTT is a large 3146 amino acid protein (if containing a 23-glutamine polyQ, or 23Q) that is ubiquitously expressed and is hypothesized to act as a scaffold for binding multiple protein assemblies (221).

The ATPase VCP can bind to the first 17 residues of HTT and is capable of disassembling mutHTT toxic aggregates via its disaggregase function both in vitro and in HD cellular models (283).

Accordingly, exogenous expression of E6-AP in tissue culture cells and HD mouse model reduces accumulation of HTT inclusions (274, 275).

For example, Huntington’s disease (HD) and spinocerebellar ataxia type 1 (SCA1) are linked to the expansion of the CAG repeat of the huntingtin (HTT) and ataxin 1 (ATXN1) genes, respectively, resulting in proteins with an unusually long polyglutamine (polyQ) tract that is very prone to aggregation and causes intracellular deposits in striatal neurons (5, 6).

Show Full Abstract

The accumulation of protein inclusions is linked to many neurodegenerative diseases that typically develop in older individuals, due to a combination of genetic and environmental factors. In rare familial neurodegenerative disorders, genes encoding for aggregation-prone proteins are often mutated. While the underlying mechanism leading to these diseases still remains to be fully elucidated, efforts in the past 20 years revealed a vast network of protein-protein interactions that play a major role in regulating the aggregation of key proteins associated with neurodegeneration. Misfolded proteins that can oligomerize and form insoluble aggregates associate with molecular chaperones and other elements of the proteolytic machineries that are the frontline workers attempting to protect the cells by promoting clearance and preventing aggregation. Proteins that are normally bound to aggregation-prone proteins can become sequestered and mislocalized in protein inclusions, leading to their loss of function. In contrast, mutations, posttranslational modifications, or misfolding of aggregation-prone proteins can lead to gain of function by inducing novel or altered protein interactions, which in turn can impact numerous essential cellular processes and organelles, such as vesicle trafficking and the mitochondria. This review examines our current knowledge of protein-protein interactions involving several key aggregation-prone proteins that are associated with Alzheimer's disease, Parkinson's disease, Huntington's disease, or amyotrophic lateral sclerosis. We aim to provide an overview of the protein interaction networks that play a central role in driving or mitigating inclusion formation, while highlighting some of the key proteomic studies that helped to uncover the extent of these networks.

Also flagged:transcription factorTFwounding healingresponse to oxidative stressriboseblood coagulation
Journal Article 2022-05-25 ✓ 5 Snippets Ren J, Wu J, Tang X, Chen S, Wang W, Lv Y, Wu L, Yang D, Zheng Y.
In-Text Gene Mentions

Prdx1, Prdx6, Tpi1, Ppia, Eno1, and Vwf might be circulatory factors that induce AAA in aged people, while Prdx2, Ffa, Ffb, and Ffg were differentially expressed based on comparisons with other studies.

However, in other studies, Prdx2 was found to be an inducer of ruptured AAA (Urbonavicius et al., 2009), while Prdx6 expression was elevated in patients with AAA; in addition, in AAA tissue, prdx6 colocalized with neutrophils, vascular SMCs, and oxidized lipids.

…Eno1, Prdx1, Ppia,Prdx6, Vwf, Prdx2, Fga,…

…Prdx1, Prdx2, andPrdx6( Fig. 4C…

…2009 ), whilePrdx6expression was elevated…

Show Full Abstract

<h4>Background</h4>Abdominal aortic aneurysm (AAA) is a disease of high prevalence in old age, and its incidence gradually increases with increasing age. There were few studies about differences in the circulatory system in the incidence of AAA, mainly because younger patients with AAA are fewer and more comorbid nonatherosclerotic factors.<h4>Method</h4>We induced AAA in ApoE<sup>-/-</sup> male mice of different ages (10 or 24 weeks) and obtained plasma samples. After the top 14 most abundant proteins were detected, the plasma was analyzed by a proteomic study using the data-dependent acquisition (DDA) technique. The proteomic results were compared between different groups to identify age-related differentially expressed proteins (DEPs) in the circulation that contribute to AAA formation. Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and protein-protein interaction (PPI) network analyses were performed by R software. The top 10 proteins were determined with the MCC method of Cytoscape, and transcription factor (TF) prediction of the DEPs was performed with iRegulon (Cytoscape).<h4>Results</h4>The aortic diameter fold increase was higher in the aged group than in the youth group (<i>p</i> < 0.01). Overall, 92 DEPs related to age and involved in AAA formation were identified. GO analysis of the DEPs showed enrichment of the terms wounding healing, response to oxidative stress, regulation of body fluid levels, ribose phosphate metabolic process, and blood coagulation. The KEGG pathway analysis showed enrichment of the terms platelet activation, complement and coagulation cascades, glycolysis/gluconeogenesis, carbon metabolism, biosynthesis of amino acids, and ECM-receptor interaction. The top 10 proteins were Tpi1, Eno1, Prdx1, Ppia, Prdx6, Vwf, Prdx2, Fga, Fgg, and Fgb, and the predicted TFs of these proteins were Nfe2, Srf, Epas1, Tbp, and Hoxc8.<h4>Conclusion</h4>The identified proteins related to age and involved in AAA formation were associated with the response to oxidative stress, coagulation and platelet activation, and complement and inflammation pathways, and the TFs of these proteins might be potential targets for AAA treatments. Further experimental and biological studies are needed to elucidate the role of these age-associated and AAA-related proteins in the progression of AAA.

Also flagged:Mitochondrial Homeostasiscardiovascular diseasesatherosclerosismitochondriamitochondrialOPA1
Journal Article 2022-05-25 ✓ 1 Snippet Yang Y, Li M, Liu Y, Wang Z, Fu X, He X, Wang Q, Li XX, Ma H, Wang K, Zou L, Wang JX, Yu T.
In-Text Gene Mentions

…they might promoteSTAU1-mediated mRNA decay via…

Show Full Abstract

Long noncoding RNAs (lncRNAs) are important regulators of various cellular functions. Recent studies have shown that a novel lncRNA termed Punisher is highly expressed in cardiovascular progenitors and has potential role in cardiovascular diseases. However, its role, especially in molecular mechanism, is unclear. In our present study, we observed that Punisher was obviously downregulated in atherosclerotic plaques. Further research proved that it can suppress the apoptosis of VSMCs potentially contributing to the progression of atherosclerosis. Intriguingly, Punisher revealed to regulate mitochondria fission as well as mitochondrial functions induced by hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) in VSMCs. Mechanistically, Punisher was further proved to serve as a ceRNA which directly binds to miR-664a-5p and consequently regulates its target OPA1, and finally contributes to the biological function of VSMCs. Particularly, Punisher overexpression distinctly suppressed neointima formation and VSMC apoptosis in vivo. Encouragingly, these results were in accordance with findings obtained with the clinical evaluation of patients with atherosclerosis. Our data provides the significant relationship among OPA1, mitochondrial homeostasis, VSMC apoptosis, and atherosclerosis. And lncRNA Punisher and miR-664a-5p could serve as the novel and potential targets in the diagnosis and treatment of cardiovascular diseases.

Also flagged:TumorLung adenocarcinomaLUADmitochondrial-relatedmultiple tumors
Journal Article 2022-05-25 ✓ 1 Snippet Li YP, Liu GX, Wu ZL, Tu PH, Wei G, Yuan M, Zhong MH, Deng KL.
In-Text Gene Mentions

…the expression ofTNFSF4was higher in…

Show Full Abstract

Lung adenocarcinoma (LUAD) remains the most common deadly disease and has a poor prognosis. More and more studies have reported that mitochondrial-related genes (MTRGs) were associated with the clinical outcomes of multiple tumors solely. In this study, we aimed to develop a novel prognostic model based on MTRGs. Differentially expressed MTRGs were identified from TCGA-LUAD and GSE31210 cohorts. Univariate Cox regression analysis was utilized to screen differentially expressed MTRGs that were related to prognosis of LUAD. Then, LASSO Cox regression analysis was used to develop a prognostic signature. ESTIMATE was used for estimating the fractions of immune cell types. In this study, we identified 44 overlapping differentially expressed MTRGs in TCGA-LUAD and GSE31210 cohorts. Among 44 overlapping differentially expressed MTRGs, nine genes were associated with prognosis of LUAD. When the penalty parameter lambda was the minimum, there were six genes meeting the conditions of constructing the signature, including SERPINB5, CCNB1, FGR MAOB, SH3BP5, and CYP24A1. The survival analysis suggested that prognosis of patients in the high-risk group was significantly worse than that in the low-risk group. Cox regression analyses showed that the risk score was an independent predictor of LUAD prognosis. As with the results of ESTIMATE score, the degree of immune cell infiltration in the low-risk group was higher than that in the high-risk group, such as TIL, Treg, and B cells. In addition, TMB and cancer stem cell infiltration were higher in the low-risk group than the high-risk group. In conclusion, we developed a novel MTRG signature acting as a negative independent prognostic factor. In the future, individualized treatments and medical decision-making may benefit from using the predicted model.

Also flagged:MetforminCell MaturationmucusWntenteropathyradiation-
Journal Article 2022-05-25 ✓ 5 Snippets Jang H, Kim S, Kim H, Oh SH, Kwak SY, Joo HW, Lee SB, Jang WI, Park S, Shim S.
In-Text Gene Mentions

Subsequently, we performed immunohistochemistry for the intestinal stem cell marker Olfm4 to evaluate intestinal stem cell damage in metformin-treated irradiated mice.

The mRNA levels of Olfm4 were significantly increased in metformin-treated IR mice compared to those in the IR group (Figure 4C).

The intestines of the IR group exhibited a few Olfm4-stained cells in the crypts, whereas those of the metformin-treated IR group showed an increased number of Olfm4-positive cells in the crypts (Figure 4A).

…USA), Ki-67 (Acris),Olfm4(Invitrogen), and-catenin (Cel…

…stem cell markerOlfm4to evaluate intestinal…

Show Full Abstract

Radiotherapy or accidental exposure to high-dose radiation can cause severe damage to healthy organs. The gastrointestinal (GI) tract is a radiation-sensitive organ of the body. The intestinal barrier is the first line of defense in the GI tract, and consists of mucus secreted by goblet cells and a monolayer of epithelium. Intestinal stem cells (ISCs) help in barrier maintenance and intestinal function after injury by regulating efficient regeneration of the epithelium. The Wnt/β-catenin pathway plays a critical role in maintaining the intestinal epithelium and regulates ISC self-renewal. Metformin is the most widely used antidiabetic drug in clinical practice, and its anti-inflammatory, antioxidative, and antiapoptotic effects have also been widely studied. In this study, we investigated whether metformin alleviated radiation-induced enteropathy by focusing on its role in protecting the epithelial barrier. We found that metformin alleviated radiation-induced enteropathy, with increased villi length and crypt numbers, and restored the intestinal barrier function in the irradiated intestine. In a radiation-induced enteropathy mouse model, metformin treatment increased tight-junction expression in the epithelium and inhibited bacterial translocation to mesenteric lymph nodes. Metformin increased the number of ISCs from radiation toxicity and enhanced epithelial repair by activating Wnt/β-catenin signaling. These data suggested that metformin may be a potential therapeutic agent for radiation-induced enteropathy.

Also flagged:HydroxyapatiteMethylCellulosemethylene bluehydroxypropyl methylcellulosebiopolymers
Journal Article 2022-05-25 No Snippets Akartasse N, Azzaoui K, Mejdoubi E, Hammouti B, Elansari LL, Abou-Salama M, Aaddouz M, Sabbahi R, Rhazi L, Siaj M.
Show Full Abstract

The aim of this study is to develop a new, efficient, and inexpensive natural-based adsorbent with high efficacy for the cationic dye methylene blue (MB). A natural-based nanocomposite based on hydroxyapatite (HAp) and hydroxypropyl methylcellulose (HPMC) was selected for this purpose. It was synthesized by the dissolution/reprecipitation method. A film with a homogeneous and smooth surface composed of nanoparticles was prepared from the nanocomposite. HPMC and HAp biopolymers were selected due to their compatibility, biodegradability, and non-toxicity. Total reflectance infrared spectroscopy (ATR-FTIR), scanning electron microscopy (SEM), and calorimetric/thermal gravimetric (DSC/TGA) analysis results revealed the existence of strong physical interaction between the composite components. Scanning electron microscopy (SEM) observations show a composite sheet with a homogenous and smooth surface, indicating excellent compatibility between HPMC and HAp in the composite. The nanocomposite was evaluated as an adsorbent for organic dyes in an aqueous solution. The effects of solution pH, initial MB concentration, composite concentration, and adsorption time on the adsorption efficiency were evaluated. The highest adsorption rate was seen as 52.0 mg of MB/g composite. The adsorption rate reached equilibrium in about 20 min. Fitting of the adsorption data to the Langmuir and Freundlich adsorption models was investigated. Results showed that the adsorption process follows the Langmuir isotherm model. The kinetic study results revealed that the adsorption process was pseudo-second-order. The herein composite is an excellent alternative for use as contemporary industrial-scale adsorbents.

Also flagged:AcylglycerolsMyristic Acidphytosterolssuccinatesynthesisdihydroxyacetone
Journal Article 2022-05-25 No Snippets Gładkowski W, Włoch A, Pruchnik H, Chojnacka A, Grudniewska A, Wysota A, Dunal A, Rubiano Castro D, Rudzińska M.
Show Full Abstract

New carriers of phytosterols; acylglycerols containing natural myristic acid at <i>sn</i>-1 and <i>sn</i>-3 positions and stigmasterol residue linked to <i>sn</i>-2 position by carbonate and succinate linker have been designed and synthesized in three-step synthesis from dihydroxyacetone (DHA). The synthetic pathway involved Steglich esterification of DHA with myristic acid; reduction of carbonyl group of 1,3-dimyristoylpropanone and esterification of 1,3-dimyristoylglicerol with stigmasterol chloroformate or stigmasterol hemisuccinate. The structure of the obtained hybrids was established by the spectroscopic methods (NMR; IR; HRMS). Obtained hybrid molecules were used to form new liposomes in the mixture with model phospholipid and their effect on their physicochemical properties was determined, including the polarity, fluidity, and main phase transition of liposomes using differential scanning calorimetry and fluorimetric methods. The results confirm the significant effect of both stigmasterol-containing acylglycerols on the hydrophilic and hydrophobic region of liposome membranes. They significantly increase the order in the polar heads of the lipid bilayer and increase the rigidity in the hydrophobic region. Moreover, the presence of both acylglycerols in the membranes shifts the temperature of the main phase transition towards higher temperatures. Our results indicate stabilization of the bilayer over a wide temperature range (above and below the phase transition temperature), which in addition to the beneficial effects of phytosterols on human health makes them more attractive components of novel lipid nanocarriers compared to cholesterol.

Also flagged:heterocyclesmitochondrial complex Itetrahydrofuranlactonecancernitrogen atom
Journal Article 2022-05-25 No Snippets Ohta K, Fushimi T, Okamura M, Akatsuka A, Dan S, Iwasaki H, Yamashita M, Kojima N.
Show Full Abstract

We studied hybrid molecules of annonaceous acetogenins and mitochondrial complex I-inhibiting insecticides to develop a novel anticancer agent. A structure-antitumor activity relationship study focusing on the connecting groups between the heterocycles and the linker moiety bearing the tetrahydrofuran moiety was conducted. Eleven hybrid acetogenins with 1-methylpyrazole instead of γ-lactone were synthesized and their growth inhibitory activities against 39 human cancer cell lines were evaluated. The nitrogen atom at the 2'-position of the linker moiety was essential for inhibiting cancer growth. The 1-methylpyrazole-5-sulfonamide analog showed potent growth inhibition of NCI-H23, a human lung cancer cell line, in a xenograft mouse assay without critical toxicity. Hence, the results of this study may pave the way for the development of novel anticancer agents, with both selective and broad anticancer activities.

Also flagged:Waterthermoregulationmelaninvasodilationnerve fiberslactose
Journal Article 2022-05-25 No Snippets Vilela RA, Lourenço Junior JB, Jacintho MAC, Barbosa AVC, Pantoja MHA, Oliveira CMC, Garcia AR.
Show Full Abstract

The thermolytic capacity test is used to assess the adaptability of animals to existing environmental conditions. However, there is insufficient information on the relationship between histomorphometry and adaptability of buffaloes. Thus, this study aimed to assess the use of thermolysis pathways by buffaloes reared in a hot and humid environment so as to understand the relationships between environment, skin morphological characteristics, and heat storage, as well as the intensity and proportionality of use of its ways of dissipating heat to maintain homeothermy. The heat tolerance test, associated with the evaluations <i>via</i> infrared thermography, was applied to 10 female Murrah buffaloes and tegument histomorphometry was carried out. The animals exhibited very high heat tolerance with an average of 9.66 ± 0.21 and used thermal polypnea as the main heat dissipation pathway. Their mean skin thickness was 6.03 ± 1.16 mm and the active sweat and sebaceous gland tissue were 1.57 ± 0.38% and 1.08 ± 0.39%, respectively. The buffaloes exhibited a positive correlation between eyeball temperature and internal body temperature (<i>r</i> = 0.84523, <i>p</i> < 0.0001) and a negative correlation between respiratory rate and skin thickness (<i>r</i> = -0.73371, <i>p</i> = 0.0157). The high thermolytic capacity in shade conditions confirms the importance of access to shade in buffalo rearing systems in tropical regions.

Also flagged:Non-Alcoholic Fatty Liver DiseaseNAFLDDiabetesAcute Pancreatitisglucosenew-onset diabetes
Journal Article 2022-05-25 ✓ 1 Snippet Lv Y, Zhang J, Yang T, Sun J, Hou J, Chen Z, Yu X, Yuan X, Lu X, Xie T, Yu T, Su X, Liu G, Zhang C, Li L.
In-Text Gene Mentions

…neoplasm, cystic fibrosis,hemochromatosis, fibrocalculous pancreatopath…

Show Full Abstract

<h4>Background</h4>Numerous studies validated frequent glucose dysfunction in patients with acute pancreatitis (AP). However, the prevalence of new-onset diabetes in individuals after a first episode of AP varies widely among previous studies. This study aims to determine the incidence of post-acute pancreatitis diabetes mellitus (PPDM-A) in Chinese people and further identify potential risk factors that influence diabetes development in patients with AP.<h4>Methods</h4>This was a multi-center retrospective cohort study including 6009 inpatients with a first attack of AP. A total of 1804 patients with AP without known endocrine pancreatic disorders or other pancreatic exocrine diseases were eligible for analysis. Data was collected from medical records by hospital information system and telephone follow-ups after discharge. The multiple logistic regression analysis was established to evaluate the potential influencing factors of PPDM-A.<h4>Results</h4>The prevalence of newly diagnosed diabetes after a first episode of AP in China was 6.2%. Data showed that patients who developed PPDM-A were more likely to be younger (X<sup>2</sup> = 6.329, <i>P</i> = 0.012), experienced longer hospital stays (X<sup>2</sup> = 6.949, <i>P</i> = 0.008) and had a higher frequency of overweight or obesity (X<sup>2</sup> = 11.559, <i>P</i> = 0.003) compared to those with normal glycemia. The frequency of stress hyperglycemia on admission (X<sup>2</sup> = 53.815, <i>P</i> < 0.001), hyperlipidemia (X<sup>2</sup> = 33.594, <i>P</i> < 0.001) and non-alcoholic fatty liver disease (NAFLD) (X<sup>2</sup> = 36.335, <i>P</i> < 0.001) were significantly higher among individuals with PPDM-A compared with control group. Also, patients with PPDM-A were more likely to be hyperlipidemic AP (X<sup>2</sup> = 16.304, <i>P</i> = 0.001) and show a higher degree of severity (X<sup>2</sup> = 7.834, <i>P</i> = 0.020) and recurrence rate (X<sup>2</sup> = 26.908, <i>P</i> < 0.001) of AP compared to those without diabetes. In addition, multiple logistic regression analysis indicated that stress hyperglycemia, hyperlipidemia, NAFLD and repeated attacks of AP were the independent influence factors for developing PPDM-A.<h4>Conclusion</h4>Our study first demonstrated the prevalence of secondary diabetes in Chinese patients after AP. The disorder of glucose metabolism in individuals with AP should be regularly evaluated in clinical practice. Further studies are needed to verify the relationship between liver and pancreas in keeping glucose homeostasis under AP condition.

Also flagged:amino acidgenetic diseasefamilial hypercholesterolemiaFHhereditary breast and ovarian cancerarrhythmogenic cardiomyopathy
Journal Article 2022-05-25 ✓ 2 Snippets Jones LK, Strande NT, Calvo EM, Chen J, Rodriguez G, McCormick CZ, Hallquist MLG, Savatt JM, Rocha H, Williams MS, Sturm AC, Buchanan AH, Glasgow RE, Martin CL, Rahm AK.
In-Text Gene Mentions

The current list of genes includes those on the ACMG secondary findings v2.0 list (Kalia et al., 2017) in addition to biallelic variants in the HFE gene leading to the C282Y amino acid substitution (Kelly et al., 2021).

…variants in theHFEgene leading to…

Show Full Abstract

<b>Introduction:</b> DNA-based population screening has been proposed as a public health solution to identify individuals at risk for serious health conditions who otherwise may not present for medical care. The clinical utility and public health impact of DNA-based population screening is a subject of active investigation. Geisinger, an integrated healthcare delivery system, was one of the first healthcare systems to implement DNA screening programs (MyCode Community Health Initiative (MyCode) and clinical DNA screening pilot) that leverage exome data to identify individuals at risk for developing conditions with potential clinical actionability. Here, we demonstrate the use of an implementation science framework, RE-AIM (Reach, Effectiveness, Adoption, Implementation and Maintenance), to conduct a post-hoc evaluation and report outcomes from these two programs to inform the potential impact of DNA-based population screening. <b>Methods:</b> Reach and Effectiveness outcomes were determined from the MyCode research program, while Adoption and Implementation outcomes were measured using the clinical DNA screening pilot. Reach was defined as the number of patients who were offered and consented to participate in MyCode. Effectiveness of DNA screening was measured by reviewing MyCode program publications and synthesizing findings from themes. Adoption was measured by the total number of DNA screening tests ordered by clinicians at the clinical pilot sites. Implementation was assessed by interviewing a subset of clinical pilot clinicians about the deployment of and recommended adaptations to the pilot that could inform future program dissemination. <b>Results:</b> <i>Reach</i>: As of August 2020, 68% (215,078/316,612) of individuals approached to participate in the MyCode program consented. Effectiveness: Published evidence reported from MyCode demonstrates that DNA screening identifies at-risk individuals more comprehensively than clinical ascertainment based on phenotypes or personal/family history. <i>Adoption</i>: From July 2018 to June 2021, a total of 1,026 clinical DNA screening tests were ordered by 60 clinicians across the three pilot clinic sites. <i>Implementation</i>: Interviews with 14 clinicians practicing at the pilot clinic sites revealed motivation to provide patients with DNA screening results and yielded future implementation strategies. <b>Conclusion:</b> The RE-AIM framework offers a pragmatic solution to organize, analyze, and report outcomes across differently resourced and designed precision health programs that include genomic sequencing and return of clinically actionable genomic information.

Also flagged:MEMyalgic Encephalomyelitis/Chronic Fatigue SyndromeME/viral infectioninfection
Journal Article 2022-05-25 No Snippets Tate W, Walker M, Sweetman E, Helliwell A, Peppercorn K, Edgar C, Blair A, Chatterjee A.
Show Full Abstract

Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS) is a disease now well-documented as having arisen commonly from a viral infection, but also from other external stressors, like exposure to agricultural chemicals, other types of infection, surgery, or other severe stress events. Research has shown these events produce a systemic molecular inflammatory response and chronic immune activation and dysregulation. What has been more difficult to establish is the hierarchy of the physiological responses that give rise to the myriad of symptoms that ME/CFS patients experience, and why they do not resolve and are generally life-long. The severity of the symptoms frequently fluctuates through relapse recovery periods, with brain-centered symptoms of neuroinflammation, loss of homeostatic control, "brain fog" affecting cognitive ability, lack of refreshing sleep, and poor response to even small stresses. How these brain effects develop with ME/CFS from the initiating external effector, whether virus or other cause, is poorly understood and that is what our paper aims to address. We propose the hypothesis that following the initial stressor event, the subsequent systemic pathology moves to the brain <i>via</i> neurovascular pathways or through a dysfunctional blood-brain barrier (BBB), resulting in chronic neuroinflammation and leading to a sustained illness with chronic relapse recovery cycles. Signaling through recognized pathways from the brain back to body physiology is likely part of the process by which the illness cycle in the peripheral system is sustained and why healing does not occur. By contrast, Long COVID (Post-COVID-19 condition) is a very recent ME/CFS-like illness arising from the single pandemic virus, SARS-CoV-2. We believe the ME/CFS-like ongoing effects of Long COVID are arising by very similar mechanisms involving neuroinflammation, but likely with some unique signaling, resulting from the pathology of the initial SARS-CoV-2 infection. The fact that there are very similar symptoms in both ongoing diseases, despite the diversity in the nature of the initial stressors, supports the concept of a similar dysfunctional CNS component common to both.

Also flagged:SARSpeptidehuman leukocyte antigen-DRβ1HLA-DRβ1antigen presentationimmune response
Journal Article 2022-05-25 No Snippets Patarroyo MA, Patarroyo ME, Pabón L, Alba MP, Bermudez A, Rugeles MT, Díaz-Arevalo D, Zapata-Builes W, Zapata MI, Reyes C, Suarez CF, Agudelo W, López C, Aza-Conde J, Melo M, Escamilla L, Oviedo J, Guzmán F, Silva Y, Forero M, Flórez-Álvarez L, Aguilar-Jimenez W, Moreno-Vranich A, Garry J, Avendaño C.
Show Full Abstract

Fifty ~20-amino acid (aa)-long peptides were selected from functionally relevant SARS-CoV-2 S, M, and E proteins for trial <b>B-21</b> and another 53 common ones, plus some new ones derived from the virus' main genetic variants for complementary trial <b>C-21</b>. Peptide selection was based on tremendous SARS-CoV-2 genetic variability for analysing them concerning vast human immunogenetic polymorphism for developing the first supramutational, Colombian SARS-protection (SM-COLSARSPROT), peptide mixture. Specific physicochemical rules were followed, i.e., aa predilection for polyproline type II left-handed (PPII<sub>L</sub>) formation, replacing β-branched, aromatic aa, short-chain backbone H-bond-forming residues, π-π interactions (n→π* and π-CH), aa interaction with π systems, and molecular fragments able to interact with them, disrupting PPII<sub>L</sub> propensity formation. All these modified structures had PPII<sub>L</sub> formation propensity to enable target peptide interaction with human leukocyte antigen-DRβ1* (HLA-DRβ1*) molecules to mediate antigen presentation and induce an appropriate immune response. Such modified peptides were designed for human use; however, they induced high antibody titres against S, M, and E parental mutant peptides and neutralising antibodies when suitably modified and chemically synthesised for immunising 61 major histocompatibility complex class II (MHCII) DNA genotyped <i>Aotus</i> monkeys (matched with their corresponding HLA-DRβ1* molecules), predicted to cover 77.5% to 83.1% of the world's population. Such chemically synthesised peptide mixture represents an extremely pure, stable, reliable, and cheap vaccine for COVID-19 pandemic control, providing a new approach for a logical, rational, and soundly established methodology for other vaccine development.

Also flagged:Salvianolic AcidIschemic StrokeISdeathcerebrovascular diseasesinflammatory response
Journal Article 2022-05-25 No Snippets Li X, Guo K, Zhang R, Wang W, Sun H, Yagüe E, Hu Y.
Show Full Abstract

Ischemic stroke (IS) is an acute neurological injury that occurs when a vessel supplying blood to the brain is obstructed, which is a leading cause of death and disability. S<i>alvia miltiorrhiza</i> has been used in the treatment of cardiovascular and cerebrovascular diseases for over thousands of years due to its effect activating blood circulation and dissipating blood stasis. However, the herbal preparation is chemically complex and the diversity of potential targets makes difficult to determine its mechanism of action. To gain insight into its mechanism of action, we analyzed "Salvianolic acid for injection" (SAFI), a traditional Chinese herbal medicine with anti-IS effects, using computational systems pharmacology. The potential targets of SAFI, obtained from literature mining and database searches, were compared with IS-associated genes, giving 38 common genes that were related with pathways involved in inflammatory response. This suggests that SAFI might function as an anti-inflammatory agent. Two genes associated with inflammation (<i>PTGS1</i> and <i>PTGS2</i>), which were inhibited by SAFI, were preliminarily validated <i>in vitro</i>. The results showed that SAFI inhibited PTGS1 and PTGS2 activity in a dose-dependent manner and inhibited the production of prostaglandin E2 induced by lipopolysaccharide in RAW264.7 macrophages and BV-2 microglia. This approach reveals the possible pharmacological mechanism of SAFI acting on IS, and also provides a feasible way to elucidate the mechanism of traditional Chinese medicine (TCM).

Also flagged:SLC9Bmembrane transport proteinscytoplasmicNHA1NHA2SLC9A
Journal Article 2022-05-25 ✓ 1 Snippet Anderegg MA, Gyimesi G, Ho TM, Hediger MA, Fuster DG.
In-Text Gene Mentions

…a putative NHE,SLC9C2( Pedersen and…

Show Full Abstract

The SLC9 gene family encodes Na<sup>+</sup>/H<sup>+</sup> exchangers (NHEs), a group of membrane transport proteins critically involved in the regulation of cytoplasmic and organellar pH, cell volume, as well as systemic acid-base and volume homeostasis. NHEs of the SLC9A subfamily (NHE 1-9) are well-known for their roles in human physiology and disease. Much less is known about the two members of the SLC9B subfamily, NHA1 and NHA2, which share higher similarity to prokaryotic NHEs than the SLC9A paralogs. NHA2 (also known as SLC9B2) is ubiquitously expressed and has recently been shown to participate in renal blood pressure and electrolyte regulation, insulin secretion and systemic glucose homeostasis. In addition, NHA2 has been proposed to contribute to the pathogenesis of polycystic kidney disease, the most common inherited kidney disease in humans. NHA1 (also known as SLC9B1) is mainly expressed in testis and is important for sperm motility and thus male fertility, but has not been associated with human disease thus far. In this review, we present a summary of the structure, function and regulation of expression of the SLC9B subfamily members, focusing primarily on the better-studied SLC9B paralog, NHA2. Furthermore, we will review the potential of the SLC9B subfamily as drug targets.

Also flagged:CollagenCarbonatedHydroxyapatiteextracellularpolyacrylamidepolycaprolactone
Journal Article 2022-05-25 No Snippets Kim SC, Heo SY, Oh GW, Yi M, Jung WK.
Show Full Abstract

In bone tissue regeneration, extracellular matrix (ECM) and bioceramics are important factors, because of their osteogenic potential and cell-matrix interactions. Surface modifications with hydrophilic material including proteins show significant potential in tissue engineering applications, because scaffolds are generally fabricated using synthetic polymers and bioceramics. In the present study, carbonated hydroxyapatite (CHA) and marine atelocollagen (MC) were extracted from the bones and skins, respectively, of <i>Paralichthys olivaceus</i>. The extracted CHA was characterized using Fourier transform infrared (FTIR) spectroscopy and X-ray diffraction (XRD) analysis, while MC was characterized using FTIR spectroscopy and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The scaffolds consisting of polycaprolactone (PCL), and different compositions of CHA (2.5%, 5%, and 10%) were fabricated using a three-axis plotting system and coated with 2% MC. Then, the MC3T3-E1 cells were seeded on the scaffolds to evaluate the osteogenic differentiation in vitro, and in vivo calvarial implantation of the scaffolds was performed to study bone tissue regeneration. The results of mineralization confirmed that the MC/PCL, 2.5% CHA/MC/PCL, 5% CHA/MC/PCL, and 10% CHA/MC/PCL scaffolds increased osteogenic differentiation by 302%, 858%, 970%, and 1044%, respectively, compared with pure PCL scaffolds. Consequently, these results suggest that CHA and MC obtained from byproducts of <i>P. olivaceus</i> are superior alternatives for land animal-derived substances.

Also flagged:AKT1hydrogensAlanineSS2BCHESS3
Journal Article 2022-05-25 ✓ 1 Snippet Shi H, Jiang N, Wei L, Cai J, Zhang W, Jiang Q, Loor JJ, Liu J.
In-Text Gene Mentions

…protein L39 (MRPL39), and ribosomal…

Show Full Abstract

To investigate the role of glucose in regulating milk fatty acid synthesis, 6 lactating Guanzhong dairy goats were infused with 0, 60, or 100 g/d glucose via the external pubic artery in a 3 × 3 repeated Latin square experiment. A concomitant in vitro experiment was conducted to investigate possible mechanisms whereby glucose regulates milk fatty acid synthesis. RNA sequencing was used for cellular transcriptome analysis. Drugs, MK-2206, rapamycin, and dorsomorphin were used to block cellular mammalian AMP-activated protein kinase (AMPK), AKT serine/threonine kinase 1, and mechanistic target of rapamycin kinase signaling pathways, respectively. Carbohydrate response element binding protein (<i>ChREBP</i>) was knockdown and overexpressed to investigate its role in regulating milk fatty acid synthesis in mammary epithelial cells. Glucose infusion linearly elevated the concentration of C8:0 (<i>P</i> = 0.039) and C10:0 (<i>P</i> = 0.041) in milk fat while it linearly decreased (<i>P</i> = 0.049) that of C16:0. This result was in agreement with the upregulation of genes related to de novo synthesis of fatty acids and lipid droplet formation, including adipose differentiation-related protein, butyrophilin subfamily 1 member A1, fatty acid synthase (<i>FASN</i>) and <i>ChREBP</i>. Their expression increased (<i>P</i> < 0.05) linearly in the lactating goat mammary gland. In vitro, glucose linearly stimulated the expression of genes related to de novo synthesis of fatty acids and cellular triacylglycerol in cultured mammary epithelial cells. RNA sequencing and inhibition studies revealed that glucose induced transcriptomic changes increasing lipogenic pathways, with AMPK responding to glucose by controlling <i>ChREBP</i> and <i>FASN</i>. Knockdown and overexpression of <i>ChREBP</i> highlighted its essential role in lipogenesis. The knockdown and overexpression of <i>ChREBP</i> protein also revealed an essential role in regulating the de novo synthesis of fatty acids. Collectively, our data highlight that glucose supplementation promotes de novo fatty acid synthesis via the AMPK-ChREBP axis, hence increasing milk fat yield in the goat mammary gland. Results from the current study provide possible strategies to manipulate the fatty acid composition as well as improve ruminant milk quality.

Also flagged:Calcium Pyrophosphatetumoralcalcium pyrophosphate dihydrate crystal deposition diseasepseudogoutinflammatory arthropathyproteoglycans
Journal Article 2022-05-25 ✓ 1 Snippet Tantillo TJ, Chang K, Tan S, Sirotnikov S, Goodman HJ.
In-Text Gene Mentions

…arathyroidism, hypothyroidism,hemochromatosis), and familial CPPDCD.…

Show Full Abstract

In this case report, we describe a novel occurrence of tumoral calcium pyrophosphate dihydrate crystal deposition disease (TCPPDCD) in a 76-year-old man that presented as an unusual, intraosseous, metadiaphyseal lesion of a long bone causing a pathologic fracture. A routine intralesional biopsy was performed, demonstrating granular deposits composed of polarizing, overlapping rhomboid crystals consistent with TCPPDCD. With limited numbers of reported cases of TCPPDCD, and the atypical intraosseous origin seen in this case, it is paramount to thoroughly evaluate all cases of TCPPDCD to clearly differentiate key findings that are essential in diagnosing and managing TCPPDCD.

Also flagged:idiopathic short statureendocrine diseasesskeletal dysplasiaTurner syndromegenetic syndromegrowth disorders
Journal Article 2022-05-25 No Snippets Mastromauro C, Chiarelli F.
Show Full Abstract

Short stature is a common reason for consulting a growth specialist during childhood. Normal height is a polygenic trait involving a complex interaction between hormonal, nutritional and psychosocial components. Genetic factors are becoming very important in the understanding of short stature. After exclusion of the most frequent causes of growth failure, clinicians need to evaluate whether a genetic cause might be taken into consideration. In fact, genetic causes of short stature are probably misdiagnosed during clinical practice and the underlying cause of short stature frequently remains unknown, thus classifying children as having idiopathic short stature (ISS). However, over the past decade, novel genetic techniques have led to the discovery of novel genes associated with linear growth and thus to the ability to define new possible aetiologies of short stature. In fact, thanks to the newer genetic advances, it is possible to properly re-classify about 25-40% of children previously diagnosed with ISS. The purpose of this article is to describe the main monogenic causes of short stature, which, thanks to advances in molecular genetics, are assuming an increasingly important role in the clinical approach to short children.

medRxiv 2022-05-25 Preprint (No Snippets API) Carmona-Berrio D, Adarve-Rengifo I, Marshall AG, Vue Z, Hall DD, Miller-Fleming TW, Actkins KV, Beasley HK, Almonacid PM, Barturen-Larrea P, Wells QS, Lopez MG, Garza-Lopez E, Dai D, Shao J, Neikirk K, Billings FT, Curci JA, Cox NJ, Gama V, Hinton A, Gomez JA.
Show Full Abstract

<h4>Background</h4> Abdominal and thoracic aortic aneurysms (AAA; TAA) remain a large cause of deaths worldwide. This is in part a result of the lack of prognostic markers or early warning signs, leading to undiagnosed aortic aneurysms. Sox6 has been found to function as a regulator of renin expression controlling the rate limiting step in the renin angiotensin aldosterone system. We hypothesized that the transcription factor Sox6 may serve as an important regulator of mechanisms contributing to hypertension induced aortic aneurysms. <h4>Methods</h4> Our approach includes mRNA analysis, immunohistology staining, and protein expression studies in human samples from patients affected with AAA and TAA. In vivo, we use Angiotensin (II) to induce AAA in mice with a tamoxifen inducible Cre to specifically knock out Sox6 in smooth muscle cells. Additionally, we utilize large-scale biobank data linking de-identified medical records with genotype information to perform phenotype and laboratory-wide association scans to assess the effects of SOX6 expression in a clinical cohort. <h4>Results</h4> In a large biobank population, SOX6 gene expression is associated with aortic aneurysm in humans of European ancestry. Protein expression of Sox6 and TNFα was upregulated in tissue from patients affected by AAA and TAA. Moreover, we found that knocking out Sox6 in smooth muscle cells protected mice from hypertension-induced AAA, suggesting that Sox6 may be a molecular target in aortic aneurysms. <h4>Conclusions</h4> The data presented here suggest that the transcription factor Sox6 functions in the development of abdominal aortic aneurysms, and hypertension-induced rupture. <h4>Clinical Perspective</h4> Using electronic health records and biobank samples, we found that the transcription factor SOX6 is associated with abdominal and thoracic aortic aneurysm and its expression is upregulated in tissue from patients affected by those diseases. Laboratory-wide association study (LabWAS) provides several clinical laboratory measurements associated with aortic aneurysm diagnosis that may be potential biomarkers for the disease. Mice with smooth muscle-specific Sox6 knock out attenuated hypertension-induced abdominal aortic aneurysm. These novel mice may be useful tools to elucidate the mechanisms associated with abdominal aortic aneurysm.

Also flagged:serotonin transportercognitionaffective disordersextracellularserotonin5‐HT transporter
Journal Article 2022-05-24 ✓ 1 Snippet Armand S, Ozenne B, Svart N, Frokjaer VG, Knudsen GM, Fisher PM, Stenbaek DS.
In-Text Gene Mentions

These biases can be modulated by changing extracellular serotonin (5‐HT) levels in the brain, for example, by pharmacologically blocking and downregulating the 5‐HT transporter (5‐HTT), which remediates negative affective bias.

Show Full Abstract

Cognitive affective biases describe the tendency to process negative information or positive information over the other. These biases can be modulated by changing extracellular serotonin (5-HT) levels in the brain, for example, by pharmacologically blocking and downregulating the 5-HT transporter (5-HTT), which remediates negative affective bias. This suggests that higher levels of 5-HTT are linked to a priority of negative information over positive, but this link remains to be tested in vivo in healthy individuals. We, therefore, evaluated the association between 5-HTT levels, as measured with [<sup>11</sup> C]DASB positron emission tomography (PET), and affective biases, hypothesising that higher 5-HTT levels are associated with a more negative bias. We included 98 healthy individuals with measures of [<sup>11</sup> C]DASB binding potential (BP<sub>ND</sub> ) and affective biases using The Emotional Faces Identification Task by subtracting the per cent hit rate for happy from that of sad faces (EFIT<sub>AB</sub> ). We evaluated the association between [<sup>11</sup> C]DASB BP<sub>ND</sub> and EFIT<sub>AB</sub> in a linear latent variable model, with the latent variable (5-HTT<sub>LV</sub> ) modelled from [<sup>11</sup> C]DASB BP<sub>ND</sub> in the fronto-striatal and fronto-limbic networks implicated in affective cognition. We observed an inverse association between 5-HTT<sub>LV</sub> and EFIT<sub>AB</sub> (β = -8% EFIT<sub>AB</sub> per unit 5-HTT<sub>LV</sub> , CI = -14% to -3%, p = .002). These findings show that higher 5-HTT levels are linked to a more negative bias in healthy individuals. High 5-HTT supposedly leads to high clearance of 5-HT, and thus, a negative bias could result from low extracellular 5-HT. Future studies must reveal if a similar inverse association exists in individuals with affective disorders.

Also flagged:neurodegenerative diseaseHDneurodegenerative diseasesClustered regularly-interspaced short palindromic repeatstranslationalHuntingtin
Journal Article 2022-05-24 ✓ 3 Snippets Qin Y, Li S, Li XJ, Yang S.
In-Text Gene Mentions

Huntington's disease (HD) is an autosomal dominantly-inherited neurodegenerative disease, which is caused by CAG trinucleotide expansion in exon 1 of the Huntingtin (HTT) gene.

…the Huntingtin (HTT) gene.…

HTT

Show Full Abstract

Huntington's disease (HD) is an autosomal dominantly-inherited neurodegenerative disease, which is caused by CAG trinucleotide expansion in exon 1 of the Huntingtin (HTT) gene. Although HD is a rare disease, its monogenic nature makes it an ideal model in which to understand pathogenic mechanisms and to develop therapeutic strategies for neurodegenerative diseases. Clustered regularly-interspaced short palindromic repeats (CRISPR) is the latest technology for genome editing. Being simple to use and highly efficient, CRISPR-based genome-editing tools are rapidly gaining popularity in biomedical research and opening up new avenues for disease treatment. Here, we review the development of CRISPR-based genome-editing tools and their applications in HD research to offer a translational perspective on advancing the genome-editing technology to HD treatment.

Also flagged:rabiesnucleusgene expressionglycoproteinrabies infectionGad2
Journal Article 2022-05-24 ✓ 2 Snippets Patiño M, Lagos WN, Patne NS, Tasic B, Zeng H, Callaway EM.
In-Text Gene Mentions

…expressing Lhx6 /Sox6, and two…

…genes Lhx6 ,Sox6, Cacna2d2 ,…

Show Full Abstract

Cortical circuit tracing using modified rabies virus can identify input neurons making direct monosynaptic connections onto neurons of interest. However, challenges remain in our ability to establish the cell type identity of rabies-labeled input neurons. While transcriptomics may offer an avenue to characterize inputs, the extent of rabies-induced transcriptional changes in distinct neuronal cell types remains unclear, and whether these changes preclude characterization of rabies-infected neurons according to established transcriptomic cell types is unknown. We used single-nucleus RNA sequencing to survey the gene expression profiles of rabies-infected neurons and assessed their correspondence with established transcriptomic cell types. We demonstrated that when using transcriptome-wide RNA profiles, rabies-infected cortical neurons can be transcriptomically characterized despite global and cell-type-specific rabies-induced transcriptional changes. Notably, we found differential modulation of neuronal marker gene expression, suggesting that caution should be taken when attempting to characterize rabies-infected cells with single genes or small gene sets.

Also flagged:GIRK2ALDH1A1dopamineaxonPDA9
Journal Article 2022-05-24 ✓ 1 Snippet Li H, Jiang H, Li H, Li L, Yan Z, Feng J.
In-Text Gene Mentions

SOX6

Show Full Abstract

The degeneration of nigral (A9) dopaminergic (DA) neurons causes motor symptoms in Parkinson's disease (PD). We use small-molecule compounds to direct the differentiation of human induced pluripotent stem cells (iPSCs) to A9 DA neurons that share many important properties with their in vivo counterparts. The method generates a large percentage of TH<sup>+</sup> neurons that express appropriate A9 markers, such as GIRK2 and ALDH1A1, but mostly not the A10 marker CALBINDIN. Functionally, they exhibit autonomous pacemaking based on L-type voltage-dependent Ca<sup>2+</sup> channels and show autoreceptor-dependent regulation of dopamine release. When transplanted in the striatum of 6-OHDA-lesioned athymic rats, the human A9 DA neurons manifest robust survival and axon outgrowth, and ameliorate motor deficits in the rat PD model. The ability to generate patient-specific A9 DA autonomous pacemakers will significantly improve PD research and facilitate the development of disease-modifying therapies.

Also flagged:Gene expressionmyopiaTNF-αNFκBMyogenesisCD4
Journal Article 2022-05-24 ✓ 1 Snippet Ni Y, Wang L, Liu C, Li Z, Yang J, Zeng J.
In-Text Gene Mentions

ZNF644

Show Full Abstract

<h4>Purpose</h4>Increasing evidence suggests myopia is not a simple refractive error, many other factors might also be involved. Here, we assessed myopic and normal corneas' gene expression profiles to identify possible diagnostic and therapeutic biomarkers for myopia.<h4>Materials and methods</h4>We obtained the expression profile of ten patients and seven normal control samples from the GSE112155 and GSE151631 datasets based on the Gene Expression Omnibus (GEO) database. We used the "limma" R package to determine the differentially expressed genes (DEGs) between myopic and normal corneas. Weighted gene co-expression network analysis (WGCNA) was used to identify critical co-expressed modules related to myopia, and enrichment analyses were used to annotate the function of genes encompassed in the compulsory module. We also validated these findings in two external datasets (GSE24641 and GSE136701).<h4>Results</h4>We identified that the DEGs were significantly enriched in ultraviolet (UV) response, TNF-α signaling via NFκB, Angiogenesis, Myogenesis pathways, etc. We used 2095 genes to construct the co-expression gene modules and found five interesting modules because the eigengene expression of these modules was significantly differentially expressed between myopic and normal corneas. Notably, the enrichment analysis found that the genes encompassed in lightgreen module were significantly enriched in immune-related pathways. These findings were proved by subsequent analysis based on Xcell software. We found the component of B cells, CD4+ memory T cells, CD8+ central memory T cells, plasmacytoid dendritic cells, T helper 2 (Th2) cells, regulatory T cells (Tregs), etc. were significantly increased in myopic corneas, while CD8+ T cells, CD4+ T central memory cells, natural killer T (NKT) cells, and T helper 1 (Th1) cells were significantly decreased.<h4>Conclusion</h4>Our findings identified some markers that might detect diagnosis and treatment for myopia from cornea aspect. Future studies are warranted to verify the functional role of immune-related pathways in cornea during the pathogenesis or progression of myopia.

Also flagged:ESCCmalignant tumorS100A8SAA1ENO1TPI1
Journal Article 2022-05-24 ✓ 1 Snippet Liu W, Wang Q, Chang J, Bhetuwal A, Bhattarai N, Zhang F, Tang J.
In-Text Gene Mentions

…(SOD1, PRDX2, CAP1,PRDX6, CAT, PARK7, MPO…

Show Full Abstract

<h4>Background</h4>Esophageal squamous cell carcinoma (ESCC) is a common digestive tract malignant tumor with high incidence and dismal prognosis worldwide. However, the reliable biomarkers for clinical diagnosis and the underlying signaling pathways insights of ESCC are not unequivocally understood yet. The serum proteome may provide valuable clues for the early diagnosis of ESCC and the discovery of novel molecular insights.<h4>Methods</h4>In the current study, an optimized proteomics approach was employed to discover novel serum-based biomarkers for ESCC, and unveil abnormal signal pathways. Gene ontology (GO) enrichment analysis was done by Gene Set Enrichment Analysis (GSEA) and Metascape database, respectively. Pathway analysis was accomplished by GeneCards database. The correlation coefficient was assessed using Pearson and distance correlation analyses. Prioritized candidates were further verified in two independent validation sets by enzyme-linked immunosorbent assay (ELISA) and immunohistochemistry (IHC) staining.<h4>Results</h4>A total of 633 non-redundant proteins were identified in the serum of patients with ESCC, of which 59 and 10 proteins displayed a more than 1.5-fold increase or decrease compared with healthy controls. Verification was performed for six candidate biomarkers, including S100A8/A9, SAA1, ENO1, TPI1 and PGAM1. Receiver operating characteristics (ROC) curve plotting showed the high diagnostic sensitivity and specificity of these six protein molecules as a biomarker panel: the area under characteristic curve (AUC) is up to 0.945. Differentially expressed proteins were subjected to functional enrichment analysis, which revealed the dysregulation of signaling pathways mainly involved in glycolysis, TLR4, HIF-1α, Cori cycle, TCA cycle, folate metabolism, and platelet degranulation. The latter finding was all the more noteworthy as a strong positive correlation was discovered between activated glycolysis and TLR4 pathways and unfavorable clinicopathological TNM stages in ESCC.<h4>Conclusions</h4>Our findings propose a potential serum biomarker panel for the early detection and diagnosis of ESCC, which could potentially broaden insights into the characteristics of ESCC from the proteomic perspective.

Also flagged:OsteoarthritisOAmetabolismagingobesityrhythm
Journal Article 2022-05-24 ✓ 2 Snippets Du Z, You X, Wu D, Huang S, Zhou Z.
In-Text Gene Mentions

…, Ppargc1b ,Sox6, Mef2a ,…

…orphan receptor A;Sox6: SRY-box transcription…

Show Full Abstract

Osteoarthritis (OA) is one of the main causes of disabilities among older people. To date, multiple disease-related molecular networks in OA have been identified, including abnormal mechanical loadings and local inflammation. These pathways have not, however, properly elucidated the mechanism of OA progression. Recently, sufficient evidence has suggested that rhythmic disturbances in the central nervous system (CNS) and local joint tissues affect the homeostasis of joint and can escalate pathological changes of OA. This is accompanied with an exacerbation of joint symptoms that interfere with the rhythm of CNS in reverse. Eventually, these processes aggravate OA progression. At present, the crosstalk between joint tissues and biological rhythm remains poorly understood. As such, the mechanisms of rhythm changes in joint tissues are worth study; in particular, research on the effect of rhythmic genes on metabolism and inflammation would facilitate the understanding of the natural rhythms of joint tissues and the OA pathology resulting from rhythm disturbance. Video Abstract.

Also flagged:5-HTTLPRserotonin transporterSLC6A4deathmajor depressionpanic disorder
Journal Article 2022-05-24 ✓ 2 Snippets Wilkinson AV, Swann AC, Graham DP, Patriquin MA, Salas R, Nielsen DA, Kosten TR.
In-Text Gene Mentions

5-HTT) transporter

5-HTT

Show Full Abstract

<h4>Background</h4>While the serotonin transporter (SLC6A4) gene, 5-HTTLPR, interacts with the social environment to influence both emotional self-regulation and smoking behavior, less is known about interactions between emotional self-regulation and 5-HTTLPR or their joint influence on tobacco use. Here, we examined such interactions among psychiatric inpatients, the population with the highest rates of smoking.<h4>Methods</h4>Participants (506 adults) were psychiatric inpatients at The Menninger Clinic in Houston TX between 2012 and 16. Most were white (89%), male (55%), with a mean age of 32.3 years. Participants completed the Difficulties in Emotional Regulation Scale (DERS) at admission. We examined interactions with smoking among three DERS subscales and 5-HTTLPR, controlling for sex, race and age.<h4>Results</h4>Smoking rates were higher among those with the 5-HTTPLR L'L' genotype compared to peers carrying an S' allele (47.9% vs. 37.4%, respectively). Among S' allele carrying participants, impulse control difficulties (OR = 1.09; 95%CI: 1.03-1.14) and lack of emotion clarity (OR = 1.06; 95%CI: 1.00-1.11) increased risk for ever using tobacco, while accessing more ways to regulate emotion (OR = 0.95; 95%CI: 0.92-0.99) offered a protective effect against ever using tobacco. Neither demographic nor DERS covariates were associated with using tobacco among the L'L' group.<h4>Limitations</h4>This ethnically homogenous sample limits generalizability and using a binary outcome can over-estimate a gene environment interaction effect.<h4>Conclusions</h4>Emotional self-regulation exerts a stronger influence on using tobacco among carriers of an S' allele of 5-HTTLPR than peers with the L'L' genotype. Promoting emotional self-regulatory skills may have benefits for preventing tobacco use.

Also flagged:synthesishepatocellular carcinomaliver cancerguaiane-typesesquiterpenoidcancer
Journal Article 2022-05-24 No Snippets Sun JJ, Wang JP, Li TZ, Ma YB, Xue D, Chen JJ.
Show Full Abstract

Our previous study demonstrated that guaiane-type sesquiterpenoid ludartin showed potent antihepatoma activity against two human hepatocellular carcinoma cell lines, HepG2 and Huh7, with IC<sub>50</sub> values of 32.7 and 34.3 μM, respectively. In this study, 34 ludartin derivatives were designed, synthesized and evaluated for their cytotoxic activities against HepG2 and Huh7 cell lines using an MTT assay in vitro. As a result, 17 compounds increased the activity against HepG2 cells, and 20 compounds enhanced the activity against Huh7 cells; 14 derivatives <b>2, 4-7, 9, 11, 17, 24, 28-30</b> and <b>32-33</b> were superior to ludartin on both HepG2 and Huh7 cells. In particular, dimeric derivative <b>33</b> as the most active compound showed 20-fold and 17-fold enhancement of cytotoxicity against HepG2 and Huh7 cells compared to that of ludartin. These results suggested that compound <b>33</b> could serve as a promising lead compound against liver cancer. Graphical abstract.

Also flagged:fertilizationmatingcopulationmitochondrialYchromosomal
Journal Article 2022-05-24 ✓ 1 Snippet Stevison LS, Bailey NP, Szpiech ZA, Novak TE, Melnick DJ, Evans BJ, Wall JD.
In-Text Gene Mentions

…these seven isHFE, which is associated…

Show Full Abstract

Genital divergence is thought to contribute to reproductive barriers by establishing a "lock-and-key" mechanism for reproductive compatibility. One such example, <i>Macaca arctoides</i>, the bear macaque, has compensatory changes in both male and female genital morphology as compared to close relatives. <i>M</i>. <i>arctoides</i> also has a complex evolutionary history, having extensive introgression between the <i>fascicularis</i> and <i>sinica</i> macaque species groups. Here, phylogenetic relationships were analyzed via whole-genome sequences from five species, including <i>M</i>. <i>arctoides</i>, and two species each from the putative parental species groups. This analysis revealed ~3x more genomic regions supported placement in the <i>sinica</i> species group as compared to the <i>fascicularis</i> species group. Additionally, introgression analysis of the <i>M</i>. <i>arctoides</i> genome revealed it is a mosaic of recent polymorphisms shared with both species groups. To examine the evolution of their unique genital morphology further, the prevalence of candidate genes involved in genital morphology was compared against genome-wide outliers in various population genetic metrics of diversity, divergence, introgression, and selection, while accounting for background variation in recombination rate. This analysis identified 67 outlier genes, including several genes that influence baculum morphology in mice, which were of interest since the bear macaque has the longest primate baculum. The mean of four of the seven population genetic metrics was statistically different in the candidate genes as compared to the rest of the genome, suggesting that genes involved in genital morphology have increased divergence and decreased diversity beyond expectations. These results highlight specific genes that may have played a role in shaping the unique genital morphology in the bear macaque.

Also flagged:Dementiamild cognitive impairmentcognitive declineADvascular diseaseAPOE
Journal Article 2022-05-24 No Snippets Oishi K, Soldan A, Pettigrew C, Hsu J, Mori S, Albert M, Oishi K, BIOCARD Research Team.
Show Full Abstract

The data show an association between measured and predicted changes in cognitive performance in older adults who are cognitively normal. Changes in cognitive performance over two years were assessed using the Cognitive Composite Score. The prediction of change in cognitive function was based on changes in pairwise functional connectivity between 80 gray matter regions examined by resting-state functional magnetic resonance imaging. A feature extraction process based on the Variable Importance Testing Approach (VITA) identified changes in 11 pairs of functional connections associated with the default mode network as features related to changes in cognitive performance. Linear and elastic net regression models were applied to these 11 features to predict changes in cognitive performance over two years. A relationship between the 11 features and the geriatric depression score was also shown. The dataset supplements the research findings in the "Changes in pairwise functional connectivity associated with changes in cognitive performance in cognitively normal older individuals: a two-year observational study" published in Oishi et al. (2022). The raw rs-fMRI correlation matrix and associated clinical data can be accessed upon request from the BIOCARD website (www.biocard-se.org) and can be reused for predictive model building.

Also flagged:amino acidlipidgelatinstructural proteinssarcoplasmic proteinsconnective tissue proteins
Journal Article 2022-05-24 No Snippets Nguyen HT, Bao HND, Dang HTT, Tómasson T, Arason S, Gudjónsdóttir M.
Show Full Abstract

Increasing protein demand has led to growing attention being given to the full utilization of proteins from side streams in industrial fish processing. In this study, proteins were recovered from three protein-rich side streams during Tra catfish (Pangasius hypophthalamus) processing (dark muscle; head-backbone; and abdominal cut-offs) by an optimized pH-shift process. Physicochemical characteristics of the resulting fish protein isolates (FPIs) were compared to industrial surimi from the same raw material batch. The pH had a significant influence on protein extraction, while extraction time and the ratio of the extraction solution to raw material had little effect on the protein and dry matter recoveries. Optimal protein extraction conditions were obtained at pH 12, a solvent to raw material ratio of 8, and an extraction duration of 150 min. The resulting FPI contained <10% of the fat and <15% of the ash of the raw material, while the FPI protein recovery was 83.0−88.9%, including a good amino acid profile. All FPIs had significantly higher protein content and lower lipid content than the surimi, indicating the high efficiency of using the pH-shift method to recover proteins from industrial Tra catfish side streams. The FPI made from abdominal cut-offs had high whiteness, increasing its potential for the development of a high-value product.

Also flagged:Fragile X Syndromeneurodevelopmental disorderdevelopmental delayintellectual disabilityautismattention-deficit/hyperactivity disorder
Journal Article 2022-05-24 No Snippets Lee A, Xu J, Wen Z, Jin P.
Show Full Abstract

Fragile X syndrome (FXS) is the most common inherited cause of intellectual disability and autism spectrum disorder. FXS is caused by a cytosine-guanine-guanine (CGG) trinucleotide repeat expansion in the untranslated region of the <i>FMR1</i> gene leading to the functional loss of the gene's protein product FMRP. Various animal models of FXS have provided substantial knowledge about the disorder. However, critical limitations exist in replicating the pathophysiological mechanisms. Human induced pluripotent stem cells (hiPSCs) provide a unique means of studying the features and processes of both normal and abnormal human neurodevelopment in large sample quantities in a controlled setting. Human iPSC-based models of FXS have offered a better understanding of FXS pathophysiology specific to humans. This review summarizes studies that have used hiPSC-based two-dimensional cellular models of FXS to reproduce the pathology, examine altered gene expression and translation, determine the functions and targets of FMRP, characterize the neurodevelopmental phenotypes and electrophysiological features, and, finally, to reactivate <i>FMR1</i>. We also provide an overview of the most recent studies using three-dimensional human brain organoids of FXS and end with a discussion of current limitations and future directions for FXS research using hiPSCs.

Also flagged:lactationcalciumfatty acidsβ-hydroxybutyric acidglutamate dehydrogenaseCD4
Journal Article 2022-05-24 No Snippets Farschtschi S, Hildebrandt A, Mattes M, Kirchner B, Pfaffl MW.
Show Full Abstract

Differential cell counts in milk offer a deeper insight into the immunology of the mammary gland and might even provide information about the systemic health status of a dairy cow. Consequently, their potential as a diagnostic method to identify biomarkers has been a subject of research for quite some time. The objective of our study was to closely monitor the immune status of eight healthy dairy cows throughout their whole lactation. For this, high-resolution differential cell counts in milk and blood were determined by means of flow cytometry, which included 10 subpopulations of the 3 main populations of immune cells and their viability. Milk and blood samples were taken twice a week in the first 100 days after calving and once a week during the remaining lactation period: in total, 55 (52-57) blood and 55 (52-57) milk samples per animal. In addition, six well-established routine laboratory biomarkers, i.e., haptoglobin, calcium, and different metabolic parameters (non-esterified fatty acids, β-hydroxybutyric acid, bilirubin, and glutamate dehydrogenase), were analyzed in all blood samples. Furthermore, a standard differential blood cell count was performed on all blood samples. We found substantial differences between cell count progressions in the blood and milk. The distribution of cell populations in the blood remained mostly stable throughout the lactation, albeit at different individual levels. Several cell populations in the milk showed a noticeable dynamic over time, which caused a separation of different lactation stages in clustering analyses. Gamma delta T cells and CD4<sup>+</sup> T cells in the milk stood out as they showed characteristic fluctuations during the course of lactation as well as minor changes in the case of inflammation. The determination of a differential cell count has the potential to be a sensitive diagnostic and prognostic tool in bovine milk. Further studies need to show to what extent the method is suitable for routine diagnostics and how to deal with animal-specific differences.

Also flagged:Neurodegenerative Diseasesagingneurogenerative diseasescalciumautophagylysosome
Journal Article 2022-05-24 ✓ 2 Snippets Kim S, Kim DK, Jeong S, Lee J.
In-Text Gene Mentions

The genetic mutation in HD is typically an expansion of CAG trinucleotide repeats in the first exon of the Huntington gene (HTT), leading to the translation of abnormally long stretches of aggregation-prone polyglutamine (PolyQ) tract in the N-terminus of the protein.

…homolog of humanHTT) was modified…

Show Full Abstract

Neurodegenerative diseases are inseparably linked with aging and increase as life expectancy extends. There are common dysfunctions in various cellular events shared among neurogenerative diseases, such as calcium dyshomeostasis, neuroinflammation, and age-associated decline in the autophagy-lysosome system. However, most of all, the prominent pathological feature of neurodegenerative diseases is the toxic buildup of misfolded protein aggregates and inclusion bodies accompanied by an impairment in proteostasis. Recent studies have suggested a close association between endoplasmic reticulum (ER) stress and neurodegenerative pathology in cellular and animal models as well as in human patients. The contribution of mutant or misfolded protein-triggered ER stress and its associated signaling events, such as unfolded protein response (UPR), to the pathophysiology of various neurodegenerative disorders, including Alzheimer's, Parkinson's, and Huntington's disease, amyotrophic lateral sclerosis, and prion disease, is described here. Impaired UPR action is commonly attributed to exacerbated ER stress, pathogenic protein aggregate accumulation, and deteriorating neurodegenerative pathologies. Thus, activating certain UPR components has been shown to alleviate ER stress and its associated neurodegeneration. However, uncontrolled activation of some UPR factors has also been demonstrated to worsen neurodegenerative phenotypes, suggesting that detailed molecular mechanisms around ER stress and its related neurodegenerations should be understood to develop effective therapeutics against aging-associated neurological syndromes. We also discuss current therapeutic endeavors, such as the development of small molecules that selectively target individual UPR components and address ER stress in general.

Also flagged:Ironmembranehemeferriciron regulatory proteinHepcidin
Journal Article 2022-05-24 ✓ 3 Snippets Berezovsky B, Frýdlová J, Gurieva I, Rogalsky DW, Rogalsky DW, Vokurka M, Krijt J.
In-Text Gene Mentions

…heart function inhemochromatosisor thalassemia, it…

…in experimental juvenilehemochromatosis, we used mice…

…of untreated juvenilehemochromatosis[ 2 ],…

Show Full Abstract

The purpose of the study was to investigate the expression of ferroportin protein following treatments that affect systemic hepcidin. Administration of erythropoietin to C57BL/6J mice decreased systemic hepcidin expression; it also increased heart ferroportin protein content, determined by immunoblot in the membrane fraction, to approximately 200% of control values. This increase in heart ferroportin protein is very probably caused by a decrease in systemic hepcidin expression, in accordance with the classical regulation of ferroportin by hepcidin. However, the control of heart ferroportin protein by systemic hepcidin could apparently be overridden by changes in heart non-heme iron content since injection of ferric carboxymaltose to mice at 300 mg Fe/kg resulted in an increase in liver hepcidin expression, heart non-heme iron content, and also a threefold increase in heart ferroportin protein content. In a separate experiment, feeding an iron-deficient diet to young Wistar rats dramatically decreased liver hepcidin expression, while heart non-heme iron content and heart ferroportin protein content decreased to 50% of controls. It is, therefore, suggested that heart ferroportin protein is regulated primarily by the iron regulatory protein/iron-responsive element system and that the regulation of heart ferroportin by the hepcidin-ferroportin axis plays a secondary role.

Also flagged:Gene Expressionhematologic cancerslymphomadiffuse large B cell lymphomaDLBCLclassical Hodgkin lymphoma
Journal Article 2022-05-24 No Snippets Stanwood SR, Chong LC, Steidl C, Jefferies WA.
Show Full Abstract

Cell surface calcium (Ca<sup>2+</sup>) channels permit Ca<sup>2+</sup> ion influx, with Ca<sup>2+</sup> taking part in cellular functions such as proliferation, survival, and activation. The expression of voltage-dependent Ca<sup>2+</sup> (Ca<sub>V</sub>) channels may modulate the growth of hematologic cancers. Profile analysis of Ca<sup>2+</sup> channels, with a focus on the Ca<sup>2+</sup> release-activated Ca<sup>2+</sup> (CRAC) and L-type Ca<sub>V</sub> channels, was performed on RNA sequencing data from lymphoma cell lines and samples derived from patients with diffuse large B cell lymphoma (DLBCL). Ca<sub>V</sub>1.2 expression was found to be elevated in classical Hodgkin lymphoma (CHL) cell lines when compared to other B cell lymphoma cell lines. In contrast, CHL exhibited reduced expression of ORAI2 and STIM2. In our differential expression analysis comparing activated B cell-like DLBCL (ABC-DLBCL) and germinal centre B cell-like DLBCL (GCB-DLBCL) patient samples, ABC-DLBCL revealed stronger expression of Ca<sub>V</sub>1.3, whereas Ca<sub>V</sub>1.1, Ca<sub>V</sub>1.2, and Ca<sub>V</sub>1.4 showed greater expression levels in GCB-DLBCL. Interestingly, no differences in ORAI/STIM expression were noted in the patient samples. As Ca<sup>2+</sup> is known to bind to calmodulin, leading to calcineurin activation and the passage of nuclear factor of activated T cells (NFAT) to the cell nucleus, pathways for calcineurin, calmodulin, NFAT, and Ca<sup>2+</sup> signaling were also analyzed by gene set enrichment analysis. The NFAT and Ca<sup>2+</sup> signaling pathways were found to be upregulated in the CHL cell lines relative to other B cell lymphoma cell lines. Furthermore, the calmodulin and Ca<sup>2+</sup> signaling pathways were shown to be downregulated in the ABC-DLBCL patient samples. The findings of this study suggest that L-type Ca<sub>V</sub> channels and Ca<sup>2+</sup>-related pathways could serve as differentiating components for biologic therapies in targeted lymphoma treatments.

Also flagged:NAFLDnon-alcoholic fatty liver diseaseglucosecholesterollipoproteinadiponectin
Journal Article 2022-05-24 No Snippets Derosa G, Guasti L, D'Angelo A, Martinotti C, Valentino MC, Di Matteo S, Bruno GM, Maresca AM, Gaudio GV, Maffioli P.
Show Full Abstract

<h4>Aim</h4>To evaluate if VSL#3<sup>®</sup> [a high-concentration multi-strain probiotic mix containing one strain of <i>Streptococcus thermophilus</i> BT01, three strains of <i>Bifidobacteria</i> (<i>B. breve</i> BB02; <i>B. animalis</i> subspecies [subsp.] <i>lactis</i> BL03, previously identified as <i>B. longum</i> BL03; and <i>B. animalis</i> subsp. <i>lactis</i> BI04, previously identified as <i>B. infantis</i> BI04), and four strains of <i>Lactobacilli</i> (<i>L. acidophilus</i> BA05, <i>L. plantarum</i> BP06, <i>L. paracasei</i> BP07, and <i>L. helveticus</i> BD08, previously identified as <i>L. delbrueckii</i> subsp. <i>bulgaricus</i> BD08)] therapy could improve hepatic parameters.<h4>Methods</h4>We enrolled 60 Caucasian patients aged ≥ 18 years of either sex with the diagnosis of non-alcoholic fatty liver disease (NAFLD), according to practice guidance, in a double-blind, placebo-controlled study. Patients were randomized to take placebo or VSL#3<sup>®</sup>, 2 sachets/day in the morning for 3 months. VSL#3<sup>®</sup> and placebo were self-administered.<h4>Results</h4>We did not observe any change in body mass index (BMI), circumferences, fasting plasma glucose (FPG), total cholesterol (TC), low-density lipoprotein-cholesterol (LDL-C), high-density lipoprotein-cholesterol (HDL-C), and adiponectin (ADN) with neither treatment. A statistically significant triglycerides (Tg) decrease (<i>p</i> < 0.05 vs. baseline, and <i>p</i> < 0.05 vs. placebo, respectively) and high-sensitivity C-reactive protein (Hs-CRP) decrease (<i>p</i> < 0.05 vs. baseline) was observed in the group of patients being treated with VSL#3<sup>®</sup> compared with placebo. Transaminases and gamma-glutamyltransferase (γ-GT) were significantly reduced in VSL#3<sup>®</sup> group (<i>p</i> < 0.05 vs. baseline and placebo, respectively) compared with the placebo group. Aspartate aminotransferase (AST)/alanine aminotransferase (ALT) ratio and hepatic steatosis index (HSI) were significantly lower than the VSL#3<sup>®</sup> group (<i>p</i> < 0.05 vs. baseline and placebo, respectively) compared with the placebo group. All patients reported an improvement or the disappearance of hepatic steatosis.<h4>Conclusion</h4>Probiotic therapy with VSL#3<sup>®</sup> ameliorates hepatic parameters and echography grading, while reducing Tg and the inflammatory status, without any difference between men and women.

Also flagged:5-MethylcytosineRNA transferasetumorhepatocellular carcinomacell proliferationimmune response
Journal Article 2022-05-24 ✓ 1 Snippet Pan Q, Yi C, Zhang Y.
In-Text Gene Mentions

…class II, andactivator of transcription 1of transcription 1.…

Show Full Abstract

<h4>Purpose</h4>Studies reported that 5-methylcytosine (m5C) RNA transferase alters tumor progression; however, studies of m5C-related lncRNA remain lacking. This article intends to study the lncRNA modified by m5C RNA transferase in hepatocellular carcinoma using a combination of computational biology and basic experiments.<h4>Method</h4>We identified 13 m5C RNA transferase-related genes and selected long non-coding RNAs with a Pearson correlation coefficient greater than 0.4. Univariate Cox regression analysis was used to screen m5C RNA transferase lncRNA related to survival phenotype. We divided TCGA-LIHC into two types of m5C RNA using non-negative matrix decomposition. According to WGCNA, the co-expression models of two lncRNA regulation modes were constructed to analyze the characteristic biological processes of the two m5C RNA transferase-related lncRNA gene models. Then, a predictive model of m5C RNA transferase lncRNA was using LASSO regression. Finally, we used cell experiments, transwell experiments, and clone formation experiments to test the relationship between SNHG4 and tumor cell proliferation in Hep-G2 and Hep-3b cells line.<h4>Results</h4>We identified 436 m5C RNA transferase-related lncRNAs. Using univariate Cox regression analysis, 43 prognostic-related lncRNAs were determined according to P < 0.001. We divided TCGA-LIHC into two regulation modes of m5C RNA transferase using non-negative matrix factorization. The two regulation modes showed significant differences in overall and disease-free survival. We used LASSO to construct m5c-related lncRNA prognostic signature. Thus, a predictive m5C-lncRNA model was established using four lncRNAs: AC026412.3, AC010969.2, SNHG4, and AP003392.5. The score calculated by the m5C-lncRNA model significantly correlated with the overall survival of hepatocellular carcinoma. The receiver operating characteristic curve and decision curve analysis verified the accuracy of the predictive model. We observed a more robust immune response in the high-risk score group. The transwell experiments and clone formation experiments suggested that m5C RNA transferase-related lncRNA SNHG4 promotes the proliferation and migration of Hep-G2 and Hep-3b cells line.<h4>Conclusion</h4>Two lncRNA expression patterns regulated by m5C RNA transferase were identified. The difference between the two expression patterns and the survival phenotype in the biological process was pointed out. A 5-methylcytosine RNA methyltransferases-related lncRNA overall survival signature was constructed. These results provide some understanding of the influence of m5C transferase on hepatocellular carcinoma. The prediction model of m5C transferase lncRNA has potential clinical value in managing hepatocellular carcinoma.

Also flagged:Necroptosisprogrammed cell deathreverse transcriptionpolymerasegene expressionbreast cancer
Journal Article 2022-05-24 ✓ 1 Snippet Xu Y, Zheng Q, Zhou T, Ye B, Xu Q, Meng X.
In-Text Gene Mentions

…checkpoints except forTNFSF4( Figures 7N,…

Show Full Abstract

<h4>Purpose</h4>Necroptosis is a mode of programmed cell death that overcomes apoptotic resistance. We aimed to construct a steady necroptosis-related signature and identify subtypes for prognostic and immunotherapy sensitivity prediction.<h4>Methods</h4>Necroptosis-related prognostic lncRNAs were selected by co-expression analysis, and were used to construct a linear stepwise regression model <i>via</i> univariate and multivariate Cox regression, along with least absolute shrinkage and selection operator (LASSO). Quantitative reverse transcription polymerase chain reaction (RT-PCR) was used to measure the gene expression levels of lncRNAs included in the model. Based on the riskScore calculated, we separated patients into high- and low-risk groups. Afterwards, we performed CIBERSORT and the single-sample gene set enrichment analysis (ssGSEA) method to explore immune infiltration status. Furthermore, we investigated the relationships between the signature and immune landscape, genomic integrity, clinical characteristics, drug sensitivity, and immunotherapy efficacy.<h4>Results</h4>We constructed a robust necroptosis-related 22-lncRNA model, serving as an independent prognostic factor for breast cancer (BRCA). The low-risk group seemed to be the immune-activated type. Meanwhile, it showed that the higher the tumor mutation burden (TMB), the higher the riskScore. PD-L1-CTLA4 combined immunotherapy seemed to be a promising treatment strategy. Lastly, patients were assigned to 4 clusters to better discern the heterogeneity among patients.<h4>Conclusions</h4>The necroptosis-related lncRNA signature and molecular clusters indicated superior predictive performance in prognosis and the immune microenvironment, which may also provide guidance to drug regimens for immunotherapy and provide novel insights into precision medicine.

Also flagged:CSF1Rmicroglial encephalopathycognitive impairmentscognitive impairmenthereditary leukodystrophyadult-onset orthochromatic leukodystrophy
Journal Article 2022-05-24 ✓ 1 Snippet Jiang J, Li W, Wang X, Du Z, Chen J, Liu Y, Li W, Lu Z, Wang Y, Xu J.
In-Text Gene Mentions

…, L2HGDH ,DARS2, EARS2 ,…

Show Full Abstract

<b>Objective:</b> To describe two novel heterozygous splicing variants of the <i>CSF1R</i> gene responsible for CSF1R-microglial encephalopathy in two unrelated Han Chinese families and further explore the relationship between the pathological and neuroimaging findings in this disease. <b>Methods:</b> The demographic data, detailed medical history, and clinical manifestations of two unrelated Han families with CSF1R-microglial encephalopathy were recorded. Some family members also underwent detailed neuropsychological evaluation, neuroimaging, and genetic testing. The probands underwent whole-exome sequencing (WES) or next-generation sequencing (NGS) to confirm the diagnosis. The findings were substantiated using Sanger sequencing, segregation analysis, and phenotypic reevaluation. <b>Results:</b> Both families presented with a dominant hereditary pattern. Five of 27 individuals (four generations) from the first family, including the proband and his sister, father, uncle, and grandmother, presented with cognitive impairments clinically during their respective lifetimes. Brain magnetic resonance imaging (MRI) depicted symmetric, confluent, and diffuse deep white matter changes, atrophy of the frontoparietal lobes, and thinning of the corpus callosum. The proband's brother remained asymptomatic; brain MRI revealed minimal white matter changes, but pseudo-continuous arterial spin labeling (pCASL) demonstrated a marked reduction in the cerebral blood flow (CBF) in the bilateral deep white matter and corpus callosum. Seven family members underwent WES, which identified a novel splice-site heterozygous mutation (c.2319+1C>A) in intron 20 of the <i>CSF1R</i> gene in four members. The proband from the second family presented with significant cognitive impairment and indifference; brain MRI depicted symmetric diffuse deep white matter changes and thinning of the corpus callosum. The proband's mother reported herself to be asymptomatic, while neuropsychological evaluation suggested mild cognitive impairment, and brain MRI demonstrated abnormal signals in the bilateral deep white matter and corpus callosum. NGS of 55 genes related to hereditary leukodystrophy was performed for three members, which confirmed a novel splice-site heterozygous mutation (c.1858+5G>A) in intron 13 of the <i>CSF1R</i> gene in two members. <b>Conclusions:</b> Our study identified two novel splicing mutation sites in the <i>CSF1R</i> gene within two independent Chinese families with CSF1R-microglial encephalopathy, broadening the genetic spectrum of CSF1R-microglial encephalopathy and emphasizing the value of pCASL for early detection of this disease.

Also flagged:watercarbohydratesmethylationhistonegene expressionsFTO
Journal Article 2022-05-24 No Snippets Hatmal MM, Al-Hatamleh MAI, Olaimat AN, Alshaer W, Hasan H, Albakri KA, Alkhafaji E, Issa NN, Al-Holy MA, Abderrahman SM, Abdallah AM, Mohamud R.
Show Full Abstract

Infants who are exclusively breastfed in the first six months of age receive adequate nutrients, achieving optimal immune protection and growth. In addition to the known nutritional components of human breast milk (HBM), i.e., water, carbohydrates, fats and proteins, it is also a rich source of microRNAs, which impact epigenetic mechanisms. This comprehensive work presents an up-to-date overview of the immunomodulatory constituents of HBM, highlighting its content of circulating microRNAs. The epigenetic effects of HBM are discussed, especially those regulated by miRNAs. HBM contains more than 1400 microRNAs. The majority of these microRNAs originate from the lactating gland and are based on the remodeling of cells in the gland during breastfeeding. These miRNAs can affect epigenetic patterns by several mechanisms, including DNA methylation, histone modifications and RNA regulation, which could ultimately result in alterations in gene expressions. Therefore, the unique microRNA profile of HBM, including exosomal microRNAs, is implicated in the regulation of the genes responsible for a variety of immunological and physiological functions, such as <i>FTO</i>, <i>INS</i>, <i>IGF1</i>, <i>NRF2</i>, <i>GLUT1</i> and <i>FOXP3</i> genes. Hence, studying the HBM miRNA composition is important for improving the nutritional approaches for pregnancy and infant's early life and preventing diseases that could occur in the future. Interestingly, the composition of miRNAs in HBM is affected by multiple factors, including diet, environmental and genetic factors.

Also flagged:NAFLDIronpsychiatric disordersschizophreniabipolar disorderdepression
Journal Article 2022-05-24 ✓ 2 Snippets May M, Barlow D, Ibrahim R, Houseknecht KL.
In-Text Gene Mentions

…Iron, Hemoglobin,Hemochromatosis, Anemia, Iron Metabolism,…

…reased transferrin co-receptorHFEand impaired vesicle…

Show Full Abstract

Atypical antipsychotic (AA) medications are widely prescribed for the treatment of psychiatric disorders, including schizophrenia, bipolar disorder and treatment-resistant depression. AA are associated with myriad metabolic and endocrine side effects, including systemic inflammation, weight gain, dyslipidemia and insulin resistance, all of which are associated with increased incidence of non-alcoholic fatty liver disease (NAFLD). NAFLD is highly prevalent in patients with mental illness, and AA have been shown to increase incidence of NAFLD pre-clinically and clinically. However, the underlying mechanisms have not been described. We mined multi-omic datasets from preclinical murine models of sub-chronic risperidone or olanzapine treatment, in vitro exposure of human cells to risperidone and psychiatric patients following onset of aripiprazole therapy focused on pathways associated with the pathophysiology of NAFLD, including iron accumulation, systemic inflammation and dyslipidemia. We identified numerous differentially expressed traits affecting these pathways conserved across study systems and AA medications. We used these findings to propose mechanisms for AA-associated development of NAFLD and dysregulated iron homeostasis.

bioRxiv 2022-05-24 Preprint (No Snippets API) Mušo M, Bentley L, Vizor L, Yon M, Burling K, Barker P, Zolkiewski LAK, Cox RD, Dumbell R.
Show Full Abstract

1. <h4>Background</h4> Increased waist-to-hip ratio (WHR) is associated with increased mortality and risk of type 2 diabetes and cardiovascular disease. The TBX15 - WARS2 locus has consistently been associated with increased WHR. Previous study of the hypomorphic Wars2 V117L/V117L mouse model found phenotypes including severely reduced fat mass, and white adipose tissue (WAT) browning, suggesting Wars2 could be a potential modulator of fat distribution and WAT browning. <h4>Methods</h4> To test for differences in browning induction across different adipose depots of Wars2 V117L/V117L mice, we measured multiple browning markers of a 4-month old chow-fed cohort in subcutaneous and visceral WAT and brown adipose tissue (BAT). To explain previously observed fat mass loss, we also tested for the upregulation of plasma mitokines FGF21 and GDF15 and for differences in food intake in the same cohort. Finally, to test for diet-associated differences in fat distribution, we placed Wars2 V117L/V117L mice on low-fat or high-fat diet (LFD, HFD) and assessed their body composition by Echo-MRI and compared terminal adipose depot weights at 6 months of age. <h4>Results</h4> The chow-fed Wars2 V117L/V117L mice showed more changes in WAT browning marker gene expression in the subcutaneous inguinal WAT depot (iWAT) than in the visceral gonadal WAT depot (gWAT). These mice also demonstrated reduced food intake and elevated plasma FGF21 and GDF15, and mRNA from heart and BAT. When exposed to HFD, the Wars2 V117L/V117L mice showed resistance to diet-induced obesity and a male and HFD-specific reduction of gWAT : iWAT ratio. <h4>Conclusion</h4> Severe reduction of Wars2 gene function causes a systemic phenotype which leads to upregulation of FGF21 and GDF15, resulting in reduced food intake and depot-specific changes in browning and fat mass.

Also flagged:bindingJAK2Janus kinase 2lymphomaleukemiathrombocytosis
Journal Article 2022-05-23 No Snippets Mai NT, Lan NT, Vu TY, Tung NT, Phung HTT.
Show Full Abstract

Janus kinase 2 (JAK2) inhibitors are potential anticancer drugs in the treatment of lymphoma, leukemia, thrombocytosis and particularly myeloproliferative diseases. However, the resemblance among JAK family members has challenged the identification of highly selective inhibitors for JAK2 to reduce undesired side effects. As a result, a robust search for promising JAK2 inhibitors using a computational approach that can effectively nominate new potential candidates to be further analyzed through laborious experimental operations has become necessary. In this study, the binding affinities of JAK2 inhibitors were rapidly and precisely estimated using the fast pulling of ligand (FPL) simulations combined with a modified linear interaction energy (LIE) method. The approach correlates with the experimental binding affinities of JAK2 inhibitors with a correlation coefficient of R = 0.82 and a root-mean-square error of 0.67 kcal•mol<sup>-1</sup>. The data reveal that the FPL/LIE method is highly approximate in anticipating the relative binding free energies of known JAK2 inhibitors with an affordable consumption of computational resources, and thus, it is very promising to be applied in in silico screening for new potential JAK2 inhibitors from a large number of molecules available.

Also flagged:synapsemethylationpolycomb repressive complex 2PRC2synapse-relatedhistone
Journal Article 2022-05-23 ✓ 1 Snippet Li J, Pinto-Duarte A, Zander M, Cuoco MS, Lai CY, Osteen J, Fang L, Luo C, Lucero JD, Gomez-Castanon R, Nery JR, Silva-Garcia I, Pang Y, Sejnowski TJ, Powell SB, Ecker JR, Mukamel EA, Behrens MM.
In-Text Gene Mentions

…, Lhx2 ,Pou3f2(Brn2 ), and Pax6…

Show Full Abstract

Two epigenetic pathways of transcriptional repression, DNA methylation and polycomb repressive complex 2 (PRC2), are known to regulate neuronal development and function. However, their respective contributions to brain maturation are unknown. We found that conditional loss of the de novo DNA methyltransferase <i>Dnmt3a</i> in mouse excitatory neurons altered expression of synapse-related genes, stunted synapse maturation, and impaired working memory and social interest. At the genomic level, loss of <i>Dnmt3a</i> abolished postnatal accumulation of CG and non-CG DNA methylation, leaving adult neurons with an unmethylated, fetal-like epigenomic pattern at ~222,000 genomic regions. The PRC2-associated histone modification, H3K27me3, increased at many of these sites. Our data support a dynamic interaction between two fundamental modes of epigenetic repression during postnatal maturation of excitatory neurons, which together confer robustness on neuronal regulation.

Also flagged:tumor necrosis factorTNFSFpathogenesisautoimmune diseasescancerimmune responses
Journal Article 2022-05-23 No Snippets Ware CF, Croft M, Neil GA.
Show Full Abstract

Advances in understanding the physiologic functions of the tumor necrosis factor superfamily (TNFSF) of ligands, receptors, and signaling networks are providing deeper insight into pathogenesis of infectious and autoimmune diseases and cancer. LIGHT (TNFSF14) has emerged as an important modulator of critical innate and adaptive immune responses. LIGHT and its signaling receptors, herpesvirus entry mediator (TNFRSF14), and lymphotoxin β receptor, form an immune regulatory network with two co-receptors of herpesvirus entry mediator, checkpoint inhibitor B and T lymphocyte attenuator, and CD160. Deciphering the fundamental features of this network reveals new understanding to guide therapeutic development. Accumulating evidence from infectious diseases points to the dysregulation of the LIGHT network as a disease-driving mechanism in autoimmune and inflammatory reactions in barrier organs, including coronavirus disease 2019 pneumonia and inflammatory bowel diseases. Recent clinical results warrant further investigation of the LIGHT regulatory network and application of target-modifying therapeutics for disease intervention.

Also flagged:TumorTranscription factorsRunx3CD4CD8 co-receptortumors
Journal Article 2022-05-23 No Snippets Schad SE, Chow A, Mangarin L, Pan H, Zhang J, Ceglia N, Caushi JX, Malandro N, Zappasodi R, Gigoux M, Hirschhorn D, Budhu S, Amisaki M, Arniella M, Redmond D, Chaft J, Forde PM, Gainor JF, Hellmann MD, Balachandran V, Shah S, Smith KN, Pardoll D, Elemento O, Wolchok JD, Merghoub T.
Show Full Abstract

Transcription factors ThPOK and Runx3 regulate the differentiation of "helper" CD4+ and "cytotoxic" CD8+ T cell lineages respectively, inducing single positive (SP) T cells that enter the periphery with the expression of either the CD4 or CD8 co-receptor. Despite the expectation that these cell fates are mutually exclusive and that mature CD4+CD8+ double positive (DP) T cells are present in healthy individuals and augmented in the context of disease, yet their molecular features and pathophysiologic role are disputed. Here, we show DP T cells in murine and human tumors as a heterogenous population originating from SP T cells which re-express the opposite co-receptor and acquire features of the opposite cell type's phenotype and function following TCR stimulation. We identified distinct clonally expanded DP T cells in human melanoma and lung cancer by scRNA sequencing and demonstrated their tumor reactivity in cytotoxicity assays. Our findings indicate that antigen stimulation induces SP T cells to differentiate into DP T cell subsets gaining in polyfunctional characteristics.

Also flagged:Spinal Cord Injurytumor necrosis factorTNFinflammatory responseTNF receptorsdeath
Journal Article 2022-05-23 No Snippets Lund MC, Clausen BH, Brambilla R, Lambertsen KL.
Show Full Abstract

Pre-clinical studies place tumor necrosis factor (TNF) as a central player in the inflammatory response after spinal cord injury (SCI), and blocking its production and/or activity has been proposed as a possible treatment option after SCI. This systematic review provides an overview of the literature on the temporal and cellular expression of TNF after SCI and clarifies the potential for its therapeutic manipulation in SCI. A systematic search was performed in EMBASE (Ovid), MEDLINE (Ovid), and Web of Science (Core Collection). The search terms were the MeSH forms of tumor necrosis factor and spinal cord injury in the different databases, and the last search was performed on February 3, 2021. We found twenty-four articles examining the expression of TNF, with most using a thoracic contusive SCI model in rodents. Two articles described the expression of TNF receptors in the acute phase after SCI. Twenty-one articles described the manipulation of TNF signaling using genetic knock-out, pharmaceutical inhibition, or gain-of-function approaches. Overall, TNF expression increased rapidly after SCI, within the first hours, in resident cells (neurons, astrocytes, oligodendrocytes, and microglia) and again in macrophages in the chronic phase after injury. The review underscores the complexity of TNF's role after SCI and indicates that TNF inhibition is a promising therapeutic option. This review concludes that TNF plays a significant role in the inflammatory response after SCI and suggests that targeting TNF signaling is a feasible therapeutic approach.

Also flagged:Huntington's diseasebehavioraldepressionanxietyHDneurodegenerative disorder
Journal Article 2022-05-23 ✓ 2 Snippets Reasoner EE, van der Plas E, Al-Kaylani HM, Langbehn DR, Conrad AL, Schultz JL, Epping EA, Magnotta VA, Nopoulos PC.
In-Text Gene Mentions

Huntington's disease (HD) is a fatal, neurodegenerative disorder caused by a CAG repeat expansion in the huntingtin (HTT) gene on chromosome 4 (OMIM 143100).

…the huntingtin (HTT) gene on…

Show Full Abstract

<h4>Introduction</h4>We compared neuropsychiatric symptoms between child and adolescent huntingtin gene-mutation carriers and noncarriers. Given previous evidence of atypical striatal development in carriers, we also assessed the relationship between neuropsychiatric traits and striatal development.<h4>Methods</h4>Participants between 6 and 18 years old were recruited from families affected by Huntington's disease and tested for the huntingtin gene expansion. Neuropsychiatric traits were assessed using the Pediatric Behavior Scale and the Behavior Rating Inventory of Executive Function. Striatal volumes were extracted from 3T neuro-anatomical images. Multivariable linear regression models were conducted to evaluate the impact of group (i.e., gene nonexpanded [GNE] or gene expanded [GE]), age, and trajectory of striatal growth on neuropsychiatric symptoms.<h4>Results</h4>There were no group differences in any behavioral measure with the exception of depression/anxiety score, which was higher in the GNE group compared to the GE group (estimate = 4.58, t(129) = 2.52, FDR = 0.051). The growth trajectory of striatal volume predicted depression scores (estimate = 0.429, 95% CI 0.15:0.71, p = .0029), where a negative slope of striatal volume over time was associated with lower depression/anxiety.<h4>Conclusions</h4>The current findings show that GE children may have lower depression/anxiety compared to their peers. Previously, we observed a unique pattern of early striatal hypertrophy and continued decrement in volume over time among GE children and adolescents. In contrast, GNE individuals largely show striatal volume growth. These findings suggest that the lower scores of depression and anxiety seen in GE children and adolescents may be associated with differential growth of the striatum.

Also flagged:fibrilsphotonlysozymesaltwatercharcoal
Journal Article 2022-05-23 No Snippets Grelich-Mucha M, Lipok M, Różycka M, Samoć M, Olesiak-Bańska J.
Show Full Abstract

Autofluorescence properties of amyloid fibrils are of much interest but, to date, the attention has been given mostly to one-photon excited fluorescence (1PEF), while the two-photon excited fluorescence (2PEF) properties of amyloids are much less explored. We investigate 1PEF and 2PEF of hen egg-white lysozyme (HEWL) in the form of monomers and fibrils. HEWL monomers feature some autofluorescence, which is enhanced in the case of fibrils. Moreover, by varying NaCl content, we introduce changes to fibrils morphology and show how the increase of the salt concentration is linked with an increase of 1PEF and 2PEF intensities. Interestingly, we observe 2PEF emission red-shifted in comparison to 1PEF. We confirm the presence of different relaxation pathways upon one- or two-photon excitation by different lifetimes of the fluorescence decays. Finally, we correlate the changes in optical properties of HEWL fibrils and monomers with salt-mediated changes in their morphology and the secondary structure.

Also flagged:cancercolorectal cancerSRCGTR1diamondspeptides
Journal Article 2022-05-23 ✓ 1 Snippet Tognetti M, Sklodowski K, Müller S, Kamber D, Muntel J, Bruderer R, Reiter L.
In-Text Gene Mentions

…IBP2, CD9, CAB45,OLFM4, BGH3) have previously…

Show Full Abstract

The plasma proteome has the potential to enable a holistic analysis of the health state of an individual. However, plasma biomarker discovery is difficult due to its high dynamic range and variability. Here, we present a novel automated analytical approach for deep plasma profiling and applied it to a 180-sample cohort of human plasma from lung, breast, colorectal, pancreatic, and prostate cancers. Using a controlled quantitative experiment, we demonstrate a 257% increase in protein identification and a 263% increase in significantly differentially abundant proteins over neat plasma. In the cohort, we identified 2732 proteins. Using machine learning, we discovered biomarker candidates such as STAT3 in colorectal cancer and developed models that classify the diseased state. For pancreatic cancer, a separation by stage was achieved. Importantly, biomarker candidates came predominantly from the low abundance region, demonstrating the necessity to deeply profile because they would have been missed by shallow profiling.

Also flagged:CBL0137Human African TrypanosomiasisAfrican trypanosomiasisbindingCBL0137-binding proteinsproteins
Journal Article 2022-05-23 ✓ 1 Snippet Sanz-Rodríguez CE, Hoffman B, Guyett PJ, Purmal A, Singh B, Pollastri MP, Mensa-Wilmot K.
In-Text Gene Mentions

DCC

Show Full Abstract

CBL0137 is a lead drug for human African trypanosomiasis, caused by <i>Trypanosoma brucei</i> Herein, we use a four-step strategy to 1) identify physiologic targets and 2) determine modes of molecular action of CBL0137 in the trypanosome. First, we identified fourteen CBL0137-binding proteins using affinity chromatography. Second, we developed hypotheses of molecular modes of action, using predicted functions of CBL0137-binding proteins as guides. Third, we documented effects of CBL0137 on molecular pathways in the trypanosome. Fourth, we identified physiologic targets of the drug by knocking down genes encoding CBL0137-binding proteins and comparing their molecular effects to those obtained when trypanosomes were treated with CBL0137. CBL0137-binding proteins included glycolysis enzymes (aldolase, glyceraldehyde-3-phosphate dehydrogenase, phosphofructokinase, phosphoglycerate kinase) and DNA-binding proteins [universal minicircle sequence binding protein 2, replication protein A1 (RPA1), replication protein A2 (RPA2)]. In chemical biology studies, CBL0137 did not reduce ATP level in the trypanosome, ruling out glycolysis enzymes as crucial targets for the drug. Thus, many CBL0137-binding proteins are not physiologic targets of the drug. CBL0137 inhibited 1) nucleus mitosis, 2) nuclear DNA replication, and 3) polypeptide synthesis as the first carbazole inhibitor of eukaryote translation. RNA interference (RNAi) against RPA1 inhibited both DNA synthesis and mitosis, whereas RPA2 knockdown inhibited mitosis, consistent with both proteins being physiologic targets of CBL0137. Principles used here to distinguish drug-binding proteins from physiologic targets of CBL0137 can be deployed with different drugs in other biologic systems. SIGNIFICANCE STATEMENT: To distinguish drug-binding proteins from physiologic targets in the African trypanosome, we devised and executed a multidisciplinary approach involving biochemical, genetic, cell, and chemical biology experiments. The strategy we employed can be used for drugs in other biological systems.

Also flagged:CDX1transcription factorsColorectal cancersEHFchromatintumour
Journal Article 2022-05-23 ✓ 1 Snippet Luk IY, Jenkins LJ, Schoffer KL, Ng I, Tse JWT, Mouradov D, Kaczmarczyk S, Nightingale R, Burrows AD, Anderson RL, Arango D, Dopeso H, Croft L, Richardson MF, Sieber OM, Liao Y, Mooi JK, Vukelic N, Reehorst CM, Afshar-Sterle S, Whitehall VLJ, Fennell L, Abud HE, Tebbutt NC, Phillips WA, Williams DS, Shi W, Mielke LA, Ernst M, Dhillon AS, Clemons NJ, Mariadason JM.
In-Text Gene Mentions

…stem cells (OLFM4, LGR5 and…

Show Full Abstract

Colorectal cancers (CRCs) often display histological features indicative of aberrant differentiation but the molecular underpinnings of this trait and whether it directly drives disease progression is unclear. Here, we identify co-ordinate epigenetic inactivation of two epithelial-specific transcription factors, EHF and CDX1, as a mechanism driving differentiation loss in CRCs. Re-expression of EHF and CDX1 in poorly-differentiated CRC cells induced extensive chromatin remodelling, transcriptional re-programming, and differentiation along the enterocytic lineage, leading to reduced growth and metastasis. Strikingly, EHF and CDX1 were also able to reprogramme non-colonic epithelial cells to express colonic differentiation markers. By contrast, inactivation of EHF and CDX1 in well-differentiated CRC cells triggered tumour de-differentiation. Mechanistically, we demonstrate that EHF physically interacts with CDX1 via its PNT domain, and that these transcription factors co-operatively drive transcription of the colonic differentiation marker, VIL1. Compound genetic deletion of Ehf and Cdx1 in the mouse colon disrupted normal colonic differentiation and significantly enhanced colorectal tumour progression. These findings thus reveal a novel mechanism driving epithelial de-differentiation and tumour progression in CRC.

Also flagged:ironmyelinalcoholcalciumextracellularIDP
Journal Article 2022-05-23 ✓ 5 Snippets Wang C, Martins-Bach AB, Alfaro-Almagro F, Douaud G, Klein JC, Llera A, Fiscone C, Bowtell R, Elliott LT, Smith SM, Tendler BC, Miller KL.
In-Text Gene Mentions

…SLC40A1 lead tohemochromatosis(Mendelian Inheritance in…

…regulator gene (HFE; cluster 27,…

…to rs1800562 (HFE), and rs9867473…

…modulated by theHFEprotein to regulate…

…Mutations inHFElead to hereditary…

Show Full Abstract

A key aim in epidemiological neuroscience is identification of markers to assess brain health and monitor therapeutic interventions. Quantitative susceptibility mapping (QSM) is an emerging magnetic resonance imaging technique that measures tissue magnetic susceptibility and has been shown to detect pathological changes in tissue iron, myelin and calcification. We present an open resource of QSM-based imaging measures of multiple brain structures in 35,273 individuals from the UK Biobank prospective epidemiological study. We identify statistically significant associations of 251 phenotypes with magnetic susceptibility that include body iron, disease, diet and alcohol consumption. Genome-wide associations relate magnetic susceptibility to 76 replicating clusters of genetic variants with biological functions involving iron, calcium, myelin and extracellular matrix. These patterns of associations include relationships that are unique to QSM, in particular being complementary to T2* signal decay time measures. These new imaging phenotypes are being integrated into the core UK Biobank measures provided to researchers worldwide, creating the potential to discover new, non-invasive markers of brain health.

Also flagged:Extracellular vesiclepancreatic cancercancersGPC1cancertumors
Journal Article 2022-05-23 No Snippets Jia E, Ren N, Shi X, Zhang R, Yu H, Yu F, Qin S, Xue J.
Show Full Abstract

<h4>Background</h4>Extracellular vesicle (EV) biomarkers have promising diagnosis and screening capacity for several cancers, but the diagnostic value for pancreatic cancer (PC) is controversial. The aim of our study was to review the diagnostic performance of EV biomarkers for PC.<h4>Methods</h4>We performed a systematic review of PubMed, Medline, and Web Of Science databases from inception to 18 Feb 2022. We identified studies reporting the diagnostic performance of EV biomarkers for PC and summarized the information of sensitivity, specificity, area under the curve (AUC), or receiver operator characteristic (ROC) curve) in according to a pre-designed data collection form. Pooled sensitivity and specificity was calculated using a random-effect model.<h4>Results</h4>We identified 39 studies, including 2037 PC patients and 1632 noncancerous, seven of which were conducted independent validation tests. Seventeen studies emphasized on EV RNAs, sixteen on EV proteins, and sixteen on biomarker panels. MiR-10b, miR-21, and GPC1 were the most frequently reported RNA and protein for PC diagnosis. For individual RNAs and proteins, the pooled sensitivity and specificity were 79% (95% CI: 77-81%) and 87% (95% CI: 85-89%), 72% (95% CI: 69-74%) and 77% (95% CI: 74-80%), respectively. the pooled sensitivity and specificity of EV RNA combined with protein panels were 84% (95% CI: 81-86%) and 89% (95% CI: 86-91%), respectively. Surprisingly, for early stage (stage I and II) PC EV biomarkers showed excellent diagnostic performance with the sensitivity of 90% (95% CI: 87-93%) and the specificity of 94% (95% CI: 92-95%). Both in sensitivity and subgroup analyses, we did not observe notable difference in pooled sensitivity and specificity. Studies might be limited by the isolation and detection techniques of EVs to a certain extent.<h4>Conclusions</h4>EV biomarkers showed appealing diagnostic preference for PC, especially for early stage PC. Solving the deficiency of technologies of isolation and detection EVs has important implications for application these novel noninvasive biomarkers in clinical practice.

Also flagged:obesityOACRTAC1FBN1SERPINF1osteoarthritis
Journal Article 2022-05-23 ✓ 4 Snippets Tardif G, Paré F, Gotti C, Roux-Dalvai F, Droit A, Zhai G, Sun G, Fahmi H, Pelletier JP, Martel-Pelletier J.
In-Text Gene Mentions

Some others, such as SERPINC1, coagulation factor XII (involved in contact activation pathways), and protein C (PROC), are involved in the coagulation/fibrinolysis pathways, which are known to be activated in OA, as well as in obesity [95–100].

…2, ApoC1 andSERPINC1were the proteins…

…others, such asSERPINC1, coagulation factor XII…

…including APOA1 andSERPINC1would be worthwhile…

Show Full Abstract

<h4>Background</h4>Osteoarthritis (OA) is a slowly developing and debilitating disease, and there are no validated specific biomarkers for its early detection. To improve therapeutic approaches, identification of specific molecules/biomarkers enabling early determination of this disease is needed. This study aimed at identifying, with the use of proteomics/mass spectrometry, novel OA-specific serum biomarkers. As obesity is a major risk factor for OA, we discriminated obesity-regulated proteins to target only OA-specific proteins as biomarkers.<h4>Methods</h4>Serum from the Osteoarthritis Initiative cohort was used and divided into 3 groups: controls (n=8), OA-obese (n=10) and OA-non-obese (n=10). Proteins were identified and quantified from the liquid chromatography-tandem mass spectrometry analyses using MaxQuant software. Statistical analysis used the Limma test followed by the Benjamini-Hochberg method. To compare the proteomic profiles, the multivariate unsupervised principal component analysis (PCA) followed by the pairwise comparison was used. To select the most predictive/discriminative features, the supervised linear classification model sparse partial least squares regression discriminant analysis (sPLS-DA) was employed. Validation of three differential proteins was performed with protein-specific assays using plasma from a cohort derived from the Newfoundland Osteoarthritis.<h4>Results</h4>In total, 509 proteins were identified, and 279 proteins were quantified. PCA-pairwise differential comparisons between the 3 groups revealed that 8 proteins were differentially regulated between the OA-obese and/or OA-non-obese with controls. Further experiments using the sPLS-DA revealed two components discriminating OA from controls (component 1, 9 proteins), and OA-obese from OA-non-obese (component 2, 23 proteins). Proteins from component 2 were considered related to obesity. In component 1, compared to controls, 7 proteins were significantly upregulated by both OA groups and 2 by the OA-obese. Among upregulated proteins from both OA groups, some of them alone would not be a suitable choice as specific OA biomarkers due to their rather non-specific role or their strong link to other pathological conditions. Altogether, data revealed that the protein CRTAC1 appears to be a strong OA biomarker candidate. Other potential new biomarker candidates are the proteins FBN1, VDBP, and possibly SERPINF1. Validation experiments revealed statistical differences between controls and OA for FBN1 (p=0.044) and VDPB (p=0.022), and a trend for SERPINF1 (p=0.064).<h4>Conclusion</h4>Our study suggests that 4 proteins, CRTAC1, FBN1, VDBP, and possibly SERPINF1, warrant further investigation as potential new biomarker candidates for the whole OA population.

Also flagged:sepsisnecrotizing enterocolitis-onset sepsisampicillingentamicinintrauterine infection
Journal Article 2022-05-23 No Snippets Morowitz MJ, Katheria AC, Polin RA, Pace E, Huang DT, Chang CH, Yabes JG.
Show Full Abstract

<h4>Background</h4>Early-onset sepsis is an important cause of neonatal morbidity and mortality in the preterm population. Infants perceived to be at increased risk for early-onset sepsis are often treated empirically with broad-spectrum antibiotics while awaiting confirmatory blood cultures, despite an overall incidence of early-onset sepsis of 2-3% among extremely-low-birthweight (ELBW) infants. Recent observational studies associate perinatal antibiotic use with an increased incidence of necrotizing enterocolitis, late-onset sepsis, and mortality among ELBW infants. Given currently available data and variability in clinical practice, we designed a prospective multi-institutional randomized controlled trial to determine the safety of early antibiotic use in ELBW infants.<h4>Methods</h4>The NICU Antibiotics and Outcomes (NANO) trial is a multicenter, double-blinded, randomized controlled trial. A sample of 802 ELBW preterm infants will undergo web-based stratified block randomization to receive empiric antibiotics (EA; ampicillin and gentamicin) or placebo during routine evaluation for early-onset sepsis. Participating sites will use preexisting institutional protocols for antibiotic dosage and duration. Infants born at participating sites with a gestational age of 29 weeks or less are eligible for enrollment. Exclusion criteria include maternal intrauterine infection, hemodynamic or respiratory instability, delivery by caesarean section for maternal indications without labor or prolonged rupture of membranes, and prior administration of antibiotics. The primary outcome is the composite incidence of necrotizing enterocolitis, late-onset sepsis, or death during participants' index hospitalization. Maternal and infant samples will be collected longitudinally and assessed for differences in microbiome composition and diversity.<h4>Discussion</h4>The NANO trial is designed to compare the rate of adverse outcomes of EA use at birth versus placebo in ELBW preterm infants. If EA at birth worsens clinical outcomes, then the results of the trial may help providers decrease antibiotic utilization in the NICU and subsequently decrease the incidence of complications associated with early antibiotic use in ELBW infants. If we instead find that EA improve outcomes, then the trial will validate a longstanding clinical practice that has not previously been supported by high-quality data. Future studies will assess long-term clinical and microbial outcomes in infants who received empiric antibiotics following delivery.<h4>Trial registration</h4>Trial registration data: June 25, 2019  NCT03997266 .

Also flagged:methylationhistonetumorcolon cancerZEB2histone modification
Journal Article 2022-05-23 ✓ 1 Snippet Zhou R, Xie F, Liu K, Zhou X, Chen X, Chen J, Xi S, Huang Z, Rong X.
In-Text Gene Mentions

…the level ofOLFM4+ stem cells…

Show Full Abstract

<h4>Background</h4>Alterations in histone modifications have been reported to be related to tumorigenicity and tumor progression. However, whether histone modification can aid the classification of patients or influence clinical behavior in patients with colon cancer remains unclear. Therefore, this study aimed to evaluate histone modifier expression patterns using the unsupervised clustering of the transcriptomic expressions of 88 histone acetylation and methylation regulators.<h4>Results</h4>In this study, by consensus clustering analysis based on the transcriptome data of 88 histone modification regulators, we identified four distinct expression patterns of histone modifiers associated with different prognoses, intrinsic fluorouracil sensitivities, biological pathways, and tumor microenvironment characteristics among 1372 colon cancer samples. In these four clusters, the HMC4 cluster represented a stroma activation phenotype characterized by both the worst prognosis and lowest response rates to fluorouracil treatment. Then, we established a scoring scheme comprising 155 genes designated as "HM_score" by using the Boruta algorithm to distinguish colon cancer patients within the HMC4 cluster. Patients with a high HM_score were considered to have high stromal pathway activation, high stromal fraction, and an unfavorable prognosis. Further analyses indicated that a high HM_score also correlated with reduced therapeutic benefits from fluorouracil chemotherapy. Moreover, through CRISPR library screening, ZEB2 was found to be a critical driver gene that mediates fluorouracil resistance, which is associated with histone modifier expression patterns.<h4>Conclusions</h4>This study highlights that characterizing histone modifier expression patterns may help better understand the epigenetic mechanisms underlying tumor heterogeneity in patients with colon cancer and provide more personalized therapeutic strategies.

Also flagged:oxygenendothelial dysfunctionmetabolismstatinsStatinhydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase
Journal Article 2022-05-23 No Snippets Na HR, Kwon OS, Kang JK, Kim YH, Lim JY.
Show Full Abstract

<h4>Background</h4>Despite advances in surgical and postoperative care, myocardial injury or infarction (MI) is still a common complication in patients undergoing coronary artery bypass surgery (CABG). Several studies that aimed to reduce postoperative myocardial injury, including those investigating statin loading, have been conducted but did not indicate any clear benefits. Evolocumab, a PCSK9 inhibitor, has been reported to lower lipids and prevent ischemic events in various medical conditions. However, the effect of evolocumab in cardiovascular surgery has not been evaluated. The objective of this trial is to evaluate the cardioprotective effects of evolocumab in elective CABG patients with multivessel coronary artery disease.<h4>Methods</h4>EVOCABG is a prospective, randomized, open, controlled, multicenter, superiority, phase III clinical trial. Patients with multivessel coronary artery disease without initial cardiac enzyme elevation will be recruited (n=100). Participants will be randomly allocated into two groups: a test group (evolocumab (140mg) administration once within 72 h before CABG) and a control group (no administration). The primary outcome is the change in peak levels of serum cardiac marker (troponin-I) within 3 days of CABG surgery compared to the baseline. Secondary outcomes include post-operative clinical events including death, myocardial infarction, heart failure, stroke, and atrial fibrillation.<h4>Discussion</h4>This trial is the first prospective randomized controlled trial to demonstrate the efficacy of evolocumab in reducing ischemic-reperfusion injury in patients undergoing CABG. This trial will provide the first high-quality evidence for preoperative use of evolocumab in mitigating or preventing ischemic-reperfusion-related myocardial injury during the surgery.<h4>Trial registration</h4>Clinical Research Information Service (CRIS) of the Republic of Korea KCT0005577 . Registered on 4 November 2020.

Also flagged:Lung Adenocarcinomasbindinggene expressionsuccinylationmitochondriacarboxylic acid
Journal Article 2022-05-23 ✓ 1 Snippet Wu J, Li N, Huang X, Chen J, Jia Y, He Z, Mo T, He L, Wang Y, Zhang H.
In-Text Gene Mentions

SERPINC1

Show Full Abstract

<h4>Background</h4>Epidemiological surveys in recent years have shown that the incidence of female lung adenocarcinomas has multiplied in both smoking and non-smoking populations. The cause of lung adenocarcinomas is still not clear. Protein post-translational modification is one of the causes of the development of cancer cells.<h4>Methods</h4>Lung adenocarcinoma and paracancerous tissue samples were collected from female patients with no history of smoking. The differences in protein acetylation and succinylation of cancerous tissues and paracancerous tissues were analysed by LC-MS/MS with a TMT labelling method. We distinguished the differentially modified proteins and annotated these proteins in terms of Go annotation, protein domains, protein complex analysis and KEGG pathway analysis.<h4>Results</h4>972 acetylation sites on 556 proteins were identified, among which 875 Kac sites on 507 proteins were quantified, 2373 succinylation sites on 1205 proteins were identified, and 2205 Ksu sites on 1131 proteins were quantified. The acetylation levels of proteins, which contribute to DNA binding and gene expression regulation, were up-regulated. The proteins for which the succinylation levels were up-regulated were mainly involved in mitochondria carboxylic acid metabolism. We also identified simultaneously up-regulated or down-regulated acetylated and succinylated proteins and depicted their interaction network.<h4>Conclusion</h4>This study provides insight into lung adenocarcinomas acetylation and succinylation profile alterations in carcinoma pathogenesis and provides a potential therapeutic target for lung adenocarcinomas.

Also flagged:Tenofovir disoproxil fumarateγ-globinCD34fetal hemoglobinSickle-cell diseaseβ-thalassemia
Journal Article 2022-05-23 ✓ 1 Snippet Khan F, Ali H, Musharraf SG.
In-Text Gene Mentions

…of BCL11A andSOX6, and their corresponding…

Show Full Abstract

Sickle-cell disease (SCD) and β-thalassemia are public health issues that affect people all over the world. Fetal hemoglobin (HbF) induction is a molecular intervention, including hydroxyurea, which has made an effort to improve current treatment. Tenofovir disoproxil fumarate (TDF) is formerly reported with improving levels of hemoglobin, mean corpuscular hemoglobin (MCH), and mean corpuscular volume (MCV). Hence, in this preclinical investigation, human peripheral whole blood-derived CD34<sup>+</sup> progenitor cells were cultured to prove the efficacy of TDF on erythroid proliferation, differentiation, γ-globin gene expression regulation, and ultimately HbF production. We observed that TDF increased the proliferation of immature erythroid cells, delayed the terminal erythroid maturation without cytotoxicity as correlated with other HbF inducers. Here, the presented data show that TDF can induce HbF expression by up-regulating the γ-globin gene transcription up to 7.1 ± 0.46-fold and subsequently increased the F-cells (10.79 ± 1.9-fold) population in terminally differentiated erythroid cells. Furthermore, our findings demonstrated that TDF-mediated γ-globin gene induction and HbF production was associated with down-fold regulation of BCL11A and SOX6, and their corresponding trans-acting regulators, FOP, KLF1, and GATA1. Collectively, our findings suggest TDF as an effective inducer of HbF in CD34<sup>+</sup> cells and pave the way to put forward the assessment of TDF as a new potential therapy in treating β-hemoglobinopathies.

Also flagged:Linker histone H1.0bampicillinlysozymeTritonNucleic acidshydroxyapatite
Journal Article 2022-05-23 ✓ 3 Snippets Hao F, Mishra LN, Jaya P, Jones R, Hayes JJ.
In-Text Gene Mentions

…upernatant fraction containinglinker histoneshistones was collected…

…upper band containedlinker histoneshistones H1A, H1B,…

…of higher eukaryotes,linker histoneshistones (H1s) are…

Show Full Abstract

As a key structural component of the chromatin of higher eukaryotes, linker histones (H1s) are involved in stabilizing the folding of extended nucleosome arrays into higher-order chromatin structures and function as a gene-specific regulator of transcription in vivo. The H1 C-terminal domain (CTD) is essential for high-affinity binding of linker histones to chromatin and stabilization of higher-order chromatin structure. Importantly, the H1 CTD is an intrinsically disordered domain that undergoes a drastic condensation upon binding to nucleosomes. Moreover, although phosphorylation is a prevalent post-translational modification within the H1 CTD, exactly where this modification is installed and how phosphorylation influences the structure of the H1 CTD remains unclear for many H1s. Using novel mass spectrometry techniques, we identified six phosphorylation sites within the CTD of the archetypal linker histone Xenopus H1.0. We then analyzed nucleosome-dependent CTD condensation and H1-dependent linker DNA organization for H1.0 in which the phosphorylated serine residues were replaced by glutamic acid residues (phosphomimics) in six independent mutants. We find that phosphomimetics at residues S117E, S155E, S181E, S188E, and S192E resulted in a significant reduction in nucleosome-bound H1.0 CTD condensation compared with unphosphorylated H1.0, whereas S130E did not alter CTD structure. Furthermore, we found distinct effects among the phosphomimetics on H1-dependent linker DNA trajectory, indicating unique mechanisms by which this modification can influence H1 CTD condensation. These results bring to light a novel role for linker histone phosphorylation in directly altering the structure of nucleosome-bound H1 and a potential novel mechanism for its effects on chromatin structure and function.

Also flagged:T-betTbx21Ncr1NKp46NK1.1Stat1
Journal Article 2022-05-23 No Snippets Schroeder JH, Howard JK, Lord GM.
Show Full Abstract

Mammalian innate lymphoid cells (ILCs) have functional relevance under both homeostatic and disease settings, such as inflammatory bowel disease (IBD), particularly in the context of maintaining the integrity of mucosal surfaces. Early reports highlighted group 1 and 3 ILC regulatory transcription factors (TFs), T-box expressed in T cells (T-bet; Tbx21) and RAR-related orphan nuclear receptor γt (RORγt; Rorc), as key regulators of ILC biology. Since then, other canonical TFs have been shown to have a role in the development and function of ILC subsets. In this review, we focus on recent insights into the balance between mature ILC1 and ILC3 based on these TFs and how they interact with other key cell-intrinsic molecular pathways. We outline how this TF interplay might be explored to identify novel candidate therapeutic avenues for human diseases.

Also flagged:Pathogenesisnon-alcoholic steatohepatitisNASHnucleartranscription factorsperoxisome-proliferator-activated receptor alpha
Journal Article 2022-05-23 No Snippets Todisco S, Santarsiero A, Convertini P, De Stefano G, Gilio M, Iacobazzi V, Infantino V.
Show Full Abstract

The strong relationship between metabolic alterations and non-alcoholic steatohepatitis (NASH) suggests a pathogenic interplay. However, many aspects have not yet been fully clarified. Nowadays, NASH is becoming the main cause of liver-associated morbidity and mortality. Therefore, an effort to understand the mechanisms underlying the pathogenesis of NASH is critical. Among the nuclear receptor transcription factors, peroxisome-proliferator-activated receptor alpha (PPARα) is highly expressed in the liver, where it works as a pivotal transcriptional regulator of the intermediary metabolism. In this context, PPARα's function in regulating the lipid metabolism is essential for proper liver functioning. Here, we review metabolic liver genes under the control of PPARα and discuss how this aspect can impact the inflammatory condition and pathogenesis of NASH.

Also flagged:TGF-βbrain developmentinjuryTransforming growth factor-βbrain injuryaging
Journal Article 2022-05-23 ✓ 3 Snippets Luo J.
In-Text Gene Mentions

The classical hypothesis postulates that HD pathogenesis stems from the toxicity of mutant HTT (mHTT) in neurons; however, increasing evidence has established that mHTT exerts toxic cell effects on other cell types of the CNS, which likely contribute to the pathogenesis of HD as well [6,264,268].

The upregulation of the TGF-β pathway is also observed in a human iPSC model of HD, which can be corrected to normal levels by replacing the expanded HTT CAG repeat with a non-pathogenic normal length [283].

The genetic cause of HD is an expansion of a polyglutamine-encoding CAG repeat in exon 1 of the huntingtin gene (HTT), with longer repeat lengths leading to an earlier onset and more severe disease [264].

Show Full Abstract

Astrocytes are essential for normal brain development and functioning. They respond to brain injury and disease through a process referred to as reactive astrogliosis, where the reactivity is highly heterogenous and context-dependent. Reactive astrocytes are active contributors to brain pathology and can exert beneficial, detrimental, or mixed effects following brain insults. Transforming growth factor-β (TGF-β) has been identified as one of the key factors regulating astrocyte reactivity. The genetic and pharmacological manipulation of the TGF-β signaling pathway in animal models of central nervous system (CNS) injury and disease alters pathological and functional outcomes. This review aims to provide recent understanding regarding astrocyte reactivity and TGF-β signaling in brain injury, aging, and neurodegeneration. Further, it explores how TGF-β signaling modulates astrocyte reactivity and function in the context of CNS disease and injury.

Also flagged:GDF15breast cancereribulingrowth differentiation factor 15GFRALantibody
Journal Article 2022-05-23 ✓ 1 Snippet Bellio C, Emperador M, Castellano P, Gris-Oliver A, Canals F, Sánchez-Pla A, Zamora E, Arribas J, Saura C, Serra V, Tabernero J, Littlefield BA, Villanueva J.
In-Text Gene Mentions

…vus Biologicals), rabbit anti-CSE1L(1:1000, Proteintech).…

Show Full Abstract

Drug tolerant persister (DTP) cells enter into a reversible slow-cycling state after drug treatment. We performed proteomic characterization of the breast cancer (BC) DTP cell secretome after eribulin treatment. We showed that the growth differentiation factor 15 (GDF15) is a protein significantly over-secreted upon eribulin treatment. The biomarker potential of GDF15 was confirmed in 3D-cell culture models using BC cells lines and PDXs, as well as in a TNBC in vivo model. We also found that GDF15 is required for survival of DTP cells. Direct participation of GDF15 and its receptor GFRAL in eribulin-induction of DTPs was established by the enhanced cell killing of DTPs by eribulin seen under GDF15 and GFRAL loss of function assays. Finally, we showed that combination therapy of eribulin plus an anti-GDF15 antibody kills BC-DTP cells. Our results suggest that targeting GDF15 may help eradicate DTP cells and block the onset of acquired resistance.

Also flagged:potassiummagnesium ionspairingreverse transcriptionGABRA4CHIC1
Journal Article 2022-05-23 No Snippets Magner D, Nowak R, Lenartowicz Onyekaa E, Pasternak A, Kierzek R.
Show Full Abstract

Among types of trinucleotide repeats, there is some disproportion in the frequency of their occurrence in the human exome. This research presents new data describing the folding and thermodynamic stability of short, tandem RNA repeats of 23 types, focusing on the rare, yet poorly analyzed ones. UV-melting experiments included the presence of PEG or potassium and magnesium ions to determine their effect on the stability of RNA repeats structures. Rare repeats predominantly stayed single-stranded but had the potential for base pairing with other partially complementary repeat tracts. A coexistence of suitably complementary repeat types in a single RNA creates opportunities for interaction in the context of the secondary structure of RNA. We searched the human transcriptome for model RNAs in which different, particularly rare trinucleotide repeats coexist and selected the <i>GABRA4</i> and <i>CHIC1</i> RNAs to study intramolecular interactions between the repeat tracts that they contain. In vitro secondary structure probing results showed that the UAA and UUG repeat tracts, present in <i>GABRA4</i> 3' UTR, form a double helix, which separates one of its structural domains. For the RNA <i>CHIC1</i> ORF fragment containing four short AGG repeat tracts and the CGU tract, we proved the formation of quadruplexes that blocked reverse transcription.

Also flagged:gene expressionneurogenesisL1retrotranspositioninnate immunityATP binding cassette subfamily D member 1
Journal Article 2022-05-23 No Snippets Chesnokova E, Beletskiy A, Kolosov P.
Show Full Abstract

Transposable elements (TEs) have been extensively studied for decades. In recent years, the introduction of whole-genome and whole-transcriptome approaches, as well as single-cell resolution techniques, provided a breakthrough that uncovered TE involvement in host gene expression regulation underlying multiple normal and pathological processes. Of particular interest is increased TE activity in neuronal tissue, and specifically in the hippocampus, that was repeatedly demonstrated in multiple experiments. On the other hand, numerous neuropathologies are associated with TE dysregulation. Here, we provide a comprehensive review of literature about the role of TEs in neurons published over the last three decades. The first chapter of the present review describes known mechanisms of TE interaction with host genomes in general, with the focus on mammalian and human TEs; the second chapter provides examples of TE exaptation in normal neuronal tissue, including TE involvement in neuronal differentiation and plasticity; and the last chapter lists TE-related neuropathologies. We sought to provide specific molecular mechanisms of TE involvement in neuron-specific processes whenever possible; however, in many cases, only phenomenological reports were available. This underscores the importance of further studies in this area.

Also flagged:glutamineHDMID1IKBKGIKBKBPPP2CA
Journal Article 2022-05-23 ✓ 5 Snippets Vagiona AC, Mier P, Petrakis S, Andrade-Navarro MA.
In-Text Gene Mentions

PolyQs with lengths above 40 amino acids cause mutant HTT proteins to misfold, form aggregates, become toxic, and cause disease [3].

MID1 leads to an aberrant overproduction of the mutant polyglutamine protein, inhibition of IKBKB has a protective effect on neurodegeneration, and IKBKG binds mutant HTT contributing to HD neurotoxicity [46,49,51].

Huntington’s disease (HD) is caused by the production of a mutant huntingtin (HTT) with an abnormally long poly-glutamine (polyQ) tract, forming aggregates and inclusions in neurons.

To search for proteins with active (functional) effects, which might be more effective in finding therapies and mechanisms of HD, we selected among the proteins that interact with HTT a total of 49 pairs of proteins that, while being paralogous to each other (and thus expected to have similar passive interaction with HTT), are located in different regions of the protein interaction network (suggesting participation in different pathways or complexes).

For HD, this expansion is located in the first exon of the huntingtin gene (htt) and results in an abnormally long poly-glutamine (polyQ) tract within the N-terminus of the huntingtin protein [1].

Show Full Abstract

Huntington's disease (HD) is caused by the production of a mutant huntingtin (HTT) with an abnormally long poly-glutamine (polyQ) tract, forming aggregates and inclusions in neurons. Previous work by us and others has shown that an increase or decrease in polyQ-triggered aggregates can be passive simply due to the interaction of proteins with the aggregates. To search for proteins with active (functional) effects, which might be more effective in finding therapies and mechanisms of HD, we selected among the proteins that interact with HTT a total of 49 pairs of proteins that, while being paralogous to each other (and thus expected to have similar passive interaction with HTT), are located in different regions of the protein interaction network (suggesting participation in different pathways or complexes). Three of these 49 pairs contained members with opposite effects on HD, according to the literature. The negative members of the three pairs, MID1, IKBKG, and IKBKB, interact with PPP2CA and TUBB, which are known negative factors in HD, as well as with HSP90AA1 and RPS3. The positive members of the three pairs interact with HSPA9. Our results provide potential HD modifiers of functional relevance and reveal the dynamic aspect of paralog evolution within the interaction network.

Also flagged:Fatty Acidfatty acidslinoleicalpha-linolenicacidscardiovascular diseases
Journal Article 2022-05-23 ✓ 4 Snippets Schettini GP, Peripolli E, Alexandre PA, Dos Santos WB, Pereira ASC, de Albuquerque LG, Baldi F, Curi RA.
In-Text Gene Mentions

The DNAJC1 and TSC22D2 genes were related to a large number of genes to suppress cell proliferation in tumor processes and adverse conditions [68,69].

…member C1 (DNAJC1), TSC22 domain…

…Otherwise, the TFDNAJC1(RIF1), TSC22D2 (RIF2),…

…TheDNAJC1and TSC22D2 genes…

Show Full Abstract

Beef is a source of essential fatty acids (EFA), linoleic (LA) and alpha-linolenic (ALA) acids, which protect against inflammatory and cardiovascular diseases in humans. However, the intramuscular EFA profile in cattle is a complex and polygenic trait. Thus, this study aimed to identify potential regulatory genes of the essential fatty acid profile in <i>Longissimus thoracis</i> of Nellore cattle finished in feedlot. Forty-four young bulls clustered in four groups of fifteen animals with extreme values for each FA were evaluated through differentially expressed genes (DEG) analysis and two co-expression methodologies (WGCNA and PCIT). We highlight the <i>ECHS1</i>, <i>IVD</i>, <i>ASB5</i>, and <i>ERLIN1</i> genes and the TF <i>NFIA</i>, indicated in both FA. Moreover, we associate the <i>NFYA</i>, <i>NFYB</i>, <i>PPARG</i>, <i>FASN</i>, and <i>FADS2</i> genes with LA, and the <i>RORA</i> and <i>ELOVL5</i> genes with ALA. Furthermore, the functional enrichment analysis points out several terms related to FA metabolism. These findings contribute to our understanding of the genetic mechanisms underlying the beef EFA profile in Nellore cattle finished in feedlot.

Also flagged:lung adenocarcinomaLUADtumorepithelial-mesenchymal transitionGene Expressioncancers
Journal Article 2022-05-23 ✓ 5 Snippets Han Y, Wong FC, Wang D, Kahlert C.
In-Text Gene Mentions

For instance, CD200 has been shown to induce EMT in head and neck squamous carcinoma through β-catenin-mediated nuclear translocation.47 A pan-cancer analysis involving 1934 tumors demonstrated high expression of the TNFSF4 gene (also known as OX40L) in tumors with the most mesenchymal EMT scores.48 Apart from that, it was also identified that CD47-SIRPα signaling induced EMT and cancer stemness, and was linked to a poor prognosis in patients with oral squamous carcinoma.49 In addition, this study found that EMT was significantly related to poor RFS and OS in patients with early-stage LUAD.

Moreover, our analyses revealed correlations between EMT and immune checkpoints in early-stage LUAD, such as CD200, TNFSF4 and SIRPA, which have also been demonstrated in other types of carcinomas.

Figure 1C illustrated the correlations between EMT and 18 types of TME cells, especially a significantly strong positive correlation with fibroblasts (r = .86 in GSE31210; r = .81 in GSE50081). Next, 31 immune checkpoint molecules shown in Supplemental Table S2 were selected for correlation analyses based on the current literature searches.26, , -29 The analysis revealed that EMT was significantly correlated to cluster of differentiation 200 (CD200), tumor necrosis factor ligand superfamily member 4 (TNFSF4) and signal regulatory protein alpha (SIRPA) in both cohorts (Figure 1D, P < .05). To evaluate the correlations of EMT with RFS and OS in the patients with early-stage LUAD, Kaplan-Meier method and log-rank test were used to perform RFS and OS analyses. The patients in the high EMT score group had significantly worse RFS (Figure 1E) and OS (Figure 1F) than those in the low EMT score group.

…member 4 (TNFSF4) and signal…

…such as CD200,TNFSF4and SIRPA, which…

Show Full Abstract

<h4>Background</h4>The potential micrometastasis tends to cause recurrence of lung adenocarcinoma (LUAD) after surgical resection and consequently leads to an increase in the mortality risk. Compelling evidence has suggested the underlying mechanisms of tumor metastasis could involve the activation of an epithelial-mesenchymal transition (EMT) program. Hence, the objective of this study was to develop an EMT-associated gene signature for predicting the recurrence of early-stage LUAD.<h4>Methods</h4>The mRNA expression data of patients with early-stage LUAD were downloaded from Gene Expression Omnibus (GEO) and The Cancer Genome Atlas (TCGA) available databases. Gene Set Variation Analysis (GSVA) was first performed to provide an assessment of EMT phenotype, whereas Weighted Gene Co-expression Network Analysis (WGCNA) was constructed to determine EMT-associated key modules and genes. Based on the genes, a novel EMT-associated signature for predicting the recurrence of early-stage LUAD was identified using a least absolute shrinkage and selection operator (LASSO) algorithm and a stepwise Cox proportional hazards regression model. Kaplan-Meier survival analysis, receiver operating characteristic (ROC) curves and Cox regression analyses were used to estimate the performance of the identified gene signature.<h4>Results</h4>GSVA revealed diverse EMT states in the early-stage LUAD. Further correlation analyses showed that the EMT states presented high correlations with several hallmarks of cancers, tumor purity, tumor microenvironment cells, and immune checkpoint genes. More importantly, Kaplan-Meier survival analyses indicated that patients with high EMT scores had worse recurrence-free survival (RFS) and overall survival (OS) than those with low EMT scores. A novel 5-gene signature (<i>AGL, ECM1, ENPP1, SNX7</i>, and <i>TSPAN12</i>) was established based on the EMT-associated genes from WGCNA and this signature successfully predicted that the high-risk patients had a higher recurrence rate compared with the low-risk patients. In further analyses, the signature represented robust prognostic values in 2 independent validation cohorts (GEO and TCGA datasets) and a combined GEO cohort as evaluated by Kaplan-Meier survival (<i>P</i>-value < .0001) and ROC analysis (AUC = 0.781). Moreover, the signature was corroborated to be independent of clinical factors by univariate and multivariate Cox regression analyses. Interestingly, the combination of the signature-based recurrence risk and tumor-node-metastasis (TNM) stage showed a superior predictive ability on the recurrence of patients with early-stage LUAD.<h4>Conclusion</h4>Our study suggests that patients with early-stage LUAD exhibit diverse EMT states that play a vital role in tumor recurrence. The novel and promising EMT-associated 5-gene signature identified and validated in this study may be applied to predict the recurrence of early-stage LUAD, facilitating risk stratification, recurrence monitoring, and individualized management for the patients after surgical resection.

Also flagged:CancerUHRF1MethylationUbiquitin-like PHD and ring finger domain protein 1histonetumors
Journal Article 2022-05-23 ✓ 1 Snippet Pan X, Li C, Cai Y, Wu S.
In-Text Gene Mentions

…to BTLA, LAIR1,TNFSF4, LAG3, ICOS, CTLA4,…

Show Full Abstract

Ubiquitin-like PHD and ring finger domain protein 1 (UHRF1) are members of the multifunctional UHRF family, which can participate in DNA methylation change and histone posttranslational change through particular domains and participate in the event and development of tumors. The purpose of this study was to decide the molecular traits and potential medicine-based importance of UHRF1 that helped settle methylated immune infiltration in generalized cancer by carefully studying the relationship between UHRF1 expression and a variety of tumors and to further check for truth the functional role of UHRF1 in kidney-related cancer. A comprehensive analysis of UHRF1 in 33 cancers was performed based on TCGA database. This research involves analysis of mRNA expression profiles, prognostic value, immune infiltration, immune neoantigens, TMB, microsatellite instability, DNA methylation, and gene set enrichment analysis (GSEA). Both immune infiltration and DNA methylation were used to evaluate the importance and method of UHRF1 in renal cancer. The results showed that tumor tissue had higher expression level of UHRF1 than usual tissue. The high expression level of UHRF1 is related to the survival rate of renal cancer. UHRF1 expression was associated with tumor mutation load and microsatellite instability in different cancer types, and enrichment analysis identified terminology and pathways associated with UHRF1. This study showed that UHRF1 plays an important role in the group of objects and development of 33 tumors. UHRF1 may serve as a biomarker of immune infiltration and poor outlook of cancer.

Also flagged:N-methyl- d -aspartate (NMDA) receptorγ-aminobutyric acid A (GABA A ) receptorsteroidsGABA A receptorsserotoninvoltage-gated calcium
Journal Article 2022-05-23 No Snippets Timic Stamenic T, Manzella FM, Maksimovic S, Krishnan K, Covey DF, Jevtovic-Todorovic V, Todorovic SM.
Show Full Abstract

We recently reported that a neurosteroid analogue with T-channel-blocking properties (3β,5β,17β)-3-hydroxyandrostane-17-carbonitrile (3β-OH), induced hypnosis in rat pups without triggering neuronal apoptosis. Furthermore, we found that the inhibition of the Ca<sub>V</sub>3.1 isoform of T-channels contributes to the hypnotic properties of 3β-OH in adult mice. However, the specific mechanisms underlying the role of other subtypes of voltage-gated calcium channels in thalamocortical excitability and oscillations <i>in vivo</i> during 3β-OH-induced hypnosis are largely unknown. Here, we used patch-clamp recordings from acute brain slices, <i>in vivo</i> electroencephalogram (EEG) recordings, and mouse genetics with wild-type (WT) and Ca<sub>V</sub>2.3 knock-out (KO) mice to further investigate the molecular mechanisms of neurosteroid-induced hypnosis. Our voltage-clamp recordings showed that 3β-OH inhibited recombinant Ca<sub>V</sub>2.3 currents. In subsequent current-clamp recordings in thalamic slices <i>ex vivo</i>, we found that selective Ca<sub>V</sub>2.3 channel blocker (SNX-482) inhibited stimulated tonic firing and increased the threshold for rebound burst firing in WT animals. Additionally, in thalamic slices we found that 3β-OH inhibited spike-firing more profoundly in WT than in mutant mice. Furthermore, 3β-OH reduced bursting frequencies in WT but not mutant animals. In ensuing <i>in vivo</i> experiments, we found that intra-peritoneal injections of 3β-OH were less effective in inducing LORR in the mutant mice than in the WT mice, with expected sex differences. Furthermore, the reduction in total α, β, and low γ EEG power was more profound in WT than in Ca<sub>V</sub>2.3 KO females over time, while at 60 min after injections of 3β-OH, the increase in relative β power was higher in mutant females. In addition, 3β-OH depressed EEG power more strongly in the male WT than in the mutant mice and significantly increased the relative δ power oscillations in WT male mice in comparison to the mutant male animals. Our results demonstrate for the first time the importance of the Ca<sub>V</sub>2.3 subtype of voltage-gated calcium channels in thalamocortical excitability and the oscillations that underlie neurosteroid-induced hypnosis.

Also flagged:Growth HormoneMetabolismamino acidlipidpolymerasemethionine
Journal Article 2022-05-23 ✓ 1 Snippet Ignatz EH, Hori TS, Kumar S, Benfey TJ, Braden LM, Runighan CD, Westcott JD, Rise ML.
In-Text Gene Mentions

…However, several classic indicators of heat stress were either upregulated [e.g., hsp90ab1 , serpinh1 (alias hsp47 , encoding Serpin H1)] or downregulated [e.g., mitochondrial uncoupling protein 2 ( ucp2 ), cold-inducible RNA-binding protein ( cirbp ), peroxiredoxin6 ( prdx6 )] at 16.5°C compared to 10.5°C ( Supplementary Table S1 ).…

Show Full Abstract

This study examined the impact of rearing temperature (10.5, 13.5 or 16.5°C) on the hepatic transcriptome of AquAdvantage Salmon (growth hormone transgenic female triploid Atlantic salmon) at an average weight of 800 g. Six stranded PE libraries were Illumina-sequenced from each temperature group, resulting in an average of over 100 M raw reads per individual fish. RNA-sequencing (RNA-seq) results showed the greatest difference in the number of differentially expressed transcripts (1750 DETs), as revealed by both DESeq2 and edgeR (<i>q</i> < 0.05; fold-change > |1.5|), was between the 10.5 and 16.5°C temperature groups. In contrast, 172 and 52 DETs were found in the 10.5 vs. 13.5°C and the 13.5 vs. 16.5°C comparisons, respectively. Considering the DETs between the 10.5 and 16.5°C groups, 282 enriched gene ontology (GO) terms were identified (<i>q</i> < 0.05), including "response to stress", "immune system process", "lipid metabolic process", "oxidation-reduction process", and "cholesterol metabolic process", suggesting elevated temperature elicited broad effects on multiple biological systems. Pathway analysis using ClueGO showed additional impacts on amino acid and lipid metabolism. There was a significant positive correlation between RNA-seq and real-time quantitative polymerase chain reaction (RT-qPCR) results for 8 of 9 metabolic-related transcripts tested. RT-qPCR results also correlated to changes in fillet tissue composition previously reported in these salmon (e.g., methionine and lysine concentrations positively correlated with <i>hsp90ab1</i> transcript expression), suggesting that rearing temperature played a significant role in mediating metabolic/biosynthetic pathways of AquAdvantage Salmon. Many transcripts related to lipid/fatty acid metabolism (e.g., <i>elovl2</i>, <i>fabpi</i>, <i>hacd2</i>, <i>mgll</i>, <i>s27a2</i>, <i>thrsp</i>) were downregulated at 16.5°C compared to both other temperature groups. Additionally, enrichment of stress-, apoptosis- and catabolism-relevant GO terms at 16.5°C suggests that this temperature may not be ideal for commercial production when using freshwater recirculating aquaculture systems (RAS). This study relates phenotypic responses to transcript-specific findings and therefore aids in the determination of an optimal rearing temperature for AquAdvantage Salmon. With approval to grow and sell AquAdvantage Salmon in the United States and Canada, the novel insights provided by this research can help industry expansion by promoting optimal physiological performance and health.

Also flagged:Cardiovascular DiseasesFerroptosisirondeathlipidnecroptosis
Journal Article 2022-05-23 No Snippets Guo Y, Zhang W, Zhou X, Zhao S, Wang J, Guo Y, Liao Y, Lu H, Liu J, Cai Y, Wu J, Shen M.
Show Full Abstract

Ferroptosis is an iron-dependent regulated cell death characterized by lipid peroxidation and iron overload, which is different from other types of programmed cell death, including apoptosis, necroptosis, autophagy, and pyroptosis. Over the past years, emerging studies have shown a close relation between ferroptosis and various cardiovascular diseases such as atherosclerosis, acute myocardial infarction, ischemia/reperfusion injury, cardiomyopathy, and heart failure. Herein, we will review the contributions of ferroptosis to multiple cardiovascular diseases and the related targets. Further, we discuss the potential ferroptosis-targeting strategies for treating different cardiovascular diseases.

Also flagged:GPCRG protein-coupled receptorsGPCRsextracellularlipidimmunoglobulin
Journal Article 2022-05-23 No Snippets Laeremans T, Sands ZA, Claes P, De Blieck A, De Cesco S, Triest S, Busch A, Felix D, Kumar A, Jaakola VP, Menet C.
Show Full Abstract

The human genome encodes 850 G protein-coupled receptors (GPCRs), half of which are considered potential drug targets. GPCRs transduce extracellular stimuli into a plethora of vital physiological processes. Consequently, GPCRs are an attractive drug target class. This is underlined by the fact that approximately 40% of marketed drugs modulate GPCRs. Intriguingly 60% of non-olfactory GPCRs have no drugs or candidates in clinical development, highlighting the continued potential of GPCRs as drug targets. The discovery of small molecules targeting these GPCRs by conventional high throughput screening (HTS) campaigns is challenging. Although the definition of success varies per company, the success rate of HTS for GPCRs is low compared to other target families (Fujioka and Omori, 2012; Dragovich et al., 2022). Beyond this, GPCR structure determination can be difficult, which often precludes the application of structure-based drug design approaches to arising HTS hits. GPCR structural studies entail the resource-demanding purification of native receptors, which can be challenging as they are inherently unstable when extracted from the lipid matrix. Moreover, GPCRs are flexible molecules that adopt distinct conformations, some of which need to be stabilized if they are to be structurally resolved. The complexity of targeting distinct therapeutically relevant GPCR conformations during the early discovery stages contributes to the high attrition rates for GPCR drug discovery programs. Multiple strategies have been explored in an attempt to stabilize GPCRs in distinct conformations to better understand their pharmacology. This review will focus on the use of camelid-derived immunoglobulin single variable domains (VHHs) that stabilize disease-relevant pharmacological states (termed ConfoBodies by the authors) of GPCRs, as well as GPCR:signal transducer complexes, to accelerate drug discovery. These VHHs are powerful tools for supporting in vitro screening, deconvolution of complex GPCR pharmacology, and structural biology purposes. In order to demonstrate the potential impact of ConfoBodies on translational research, examples are presented of their role in active state screening campaigns and structure-informed rational design to identify <i>de novo</i> chemical space and, subsequently, how such matter can be elaborated into more potent and selective drug candidates with intended pharmacology.

Also flagged:Carboxypeptidase N2CPN2metallo-proteaseamino acidspeptidescarboxypeptidases
Journal Article 2022-05-23 ✓ 1 Snippet Xu T, Zhang Z, Chen H, Cai R, Yang Q, Liu Q, Fan Y, Liu W, Yao C.
In-Text Gene Mentions

…protein 1 (PEBP1), and latrophilin…

Show Full Abstract

Carboxypeptidase N2 (CPN2) is a plasma metallo-protease that cleaves basic amino acids from the C-terminal of peptides and proteins. Emerging evidence showed that carboxypeptidases perform many diverse functions in the body and play key roles in tumorigenesis. However, the clinical significance and biological functions of CPN2 in lung adenocarcinoma remain unclear. Our study aimed to explore the potential role and functions of CPN2 in lung adenocarcinoma. The results showed that the transcription level of <i>CPN2</i> was significantly increased in the tumor tissues of lung adenocarcinoma patients compared to the adjacent normal tissues in The Cancer Genome Atlas cohort (<i>P</i> < 0.05). The survival plots showed that the overall survival of patients with a high expression of <i>CPN2</i> was significantly lower than that of patients with a low expression of <i>CPN2</i>, both in the Kaplan-Meier database and the clinical sample cohort (<i>P</i> < 0.05). The tissue microarray analysis found that CPN2 protein expression was significantly positively correlated with node status and tumor stage as well as tumor malignancy (<i>P</i> < 0.05). Further univariate and multivariate Cox regression analyses showed that CPN2 may act as an independent prognostic factor in patients with lung adenocarcinoma (<i>P</i> < 0.05). In addition, the analysis of co-expression genes from LinkedOmics showed that <i>CPN2</i> was positively associated with many genes of fibrillar collagen family members and the PI3K-Akt pathway. The gene set enrichment analysis showed that a higher expression of <i>CPN2</i> may participate in mTOR, TGF-BETA, NOTCH, TOLL-like-receptor, WNT, and MAPK signaling pathway in lung adenocarcinoma. Notably, the knockdown of <i>CPN2</i> significantly inhibited the ability of cell proliferation, clone formation, invasion, and migration. Our findings suggested that the upregulation of CPN2 is associated with a worse clinical outcome in lung adenocarcinoma and cancer-related pathways, which laid the foundation for further research on CPN2 during carcinogenesis.

Also flagged:agingmethylationinnervationAldh1l1AgrnSamd1
Journal Article 2022-05-23 ✓ 1 Snippet Dungan CM, Brightwell CR, Wen Y, Zdunek CJ, Latham CM, Thomas NT, Zagzoog AM, Brightwell BD, VonLehmden GL, Keeble AR, Watowich SJ, Murach KA, Fry CS.
In-Text Gene Mentions

…elevated genes duringSox6knockout-mediated fiber type-s…

Show Full Abstract

Murine exercise models can provide information on factors that influence muscle adaptability with aging, but few translatable solutions exist. Progressive weighted wheel running (PoWeR) is a simple, voluntary, low-cost, high-volume endurance/resistance exercise approach for training young mice. In the current investigation, aged mice (22-mo-old) underwent a modified version of PoWeR for 8 wk. Muscle functional, cellular, biochemical, transcriptional, and myonuclear DNA methylation analyses provide an encompassing picture of how muscle from aged mice responds to high-volume combined training. Mice run 6-8 km/d, and relative to sedentary mice, PoWeR increases plantarflexor muscle strength. The oxidative soleus of aged mice responds to PoWeR similarly to young mice in every parameter measured in previous work; this includes muscle mass, glycolytic-to-oxidative fiber type transitioning, fiber size, satellite cell frequency, and myonuclear number. The oxidative/glycolytic plantaris adapts according to fiber type, but with modest overall changes in muscle mass. Capillarity increases markedly with PoWeR in both muscles, which may be permissive for adaptability in advanced age. Comparison to published PoWeR RNA-sequencing data in young mice identified conserved regulators of adaptability across age and muscles; this includes <i>Aldh1l1</i> which associates with muscle vasculature. <i>Agrn</i> and <i>Samd1</i> gene expression is upregulated after PoWeR simultaneous with a hypomethylated promoter CpG in myonuclear DNA, which could have implications for innervation and capillarization. A promoter CpG in <i>Rbm10</i> is hypomethylated by late-life exercise in myonuclei, consistent with findings in muscle tissue. PoWeR and the data herein are a resource for uncovering cellular and molecular regulators of muscle adaptation with aging.

bioRxiv 2022-05-23 Preprint (No Snippets API) Linsenmeier M, Faltova L, Palmiero UC, Seiffert C, Küffner AM, Pinotsi D, Zhou J, Mezzenga R, Arosio P.
Show Full Abstract

The maturation of liquid-like protein condensates into amyloid fibrils has been associated with neurodegenerative diseases. Here, we analyze the amyloid formation mediated by condensation of the low-complexity domain of hnRNPA1, a protein involved in Amyotrophic Lateral Sclerosis (ALS). We show that phase separation and fibrillation are connected but distinct processes which are independently mediated by different regions of the protein sequence. By monitoring the spatial and temporal evolution of amyloid formation we demonstrate that the formation of fibrils does not occur homogeneously inside the droplets but is promoted at the interface of the condensates. Consistently, we further show that coating the interface of the droplets with surfactant molecules inhibits fibril formation. Our results indicate that the interface of biomolecular condensates can act as an important catalyst for fibril formation, and therefore could represent a possible therapeutic target against the formation of aberrant amyloids mediated by condensation.

Also flagged:N6-methyladenosinecardiovascular diseasescancersmethylationmethylation regulatory proteinsm6A demethylases
Journal Article 2022-05-22 No Snippets You Y, Fu Y, Huang M, Shen D, Zhao B, Liu H, Zheng Y, Huang L.
Show Full Abstract

N6-methyladenosine (m6A) is a post-transcriptional RNA modification and one of the most abundant types of RNA chemical modifications. m6A functions as a molecular switch and is involved in a range of biomedical aspects, including cardiovascular diseases, the central nervous system, and cancers. Conceptually, m6A methylation can be dynamically and reversibly modulated by RNA methylation regulatory proteins, resulting in diverse fates of mRNAs. This review focuses on m6A demethylases fat-mass- and obesity-associated protein (FTO) and alkB homolog 5 (ALKBH5), which especially erase m6A modification from target mRNAs. Recent advances have highlighted that FTO and ALKBH5 play an oncogenic role in various cancers, such as acute myeloid leukemias (AML), glioblastoma, and breast cancer. Moreover, studies in vitro and in <i>mouse</i> models confirmed that FTO-specific inhibitors exhibited anti-tumor effects in several cancers. Accumulating evidence has suggested the possibility of FTO and ALKBH5 as therapeutic targets for specific diseases. In this review, we aim to illustrate the structural properties of these two m6A demethylases and the development of their specific inhibitors. Additionally, this review will summarize the biological functions of these two m6A demethylases in various types of cancers and other human diseases.

Also flagged:N-elastaseproteinase 3cathepsin GazurocidinCD14complement factor P
Journal Article 2022-05-22 ✓ 1 Snippet Akula S, Lara S, Olsson AK, Hellman L.
In-Text Gene Mentions

…prostaglandin I synthase (PTGIS) with 90 and…

Show Full Abstract

Cell lines of monocyte/macrophage origin are often used as model systems to study monocyte/macrophage biology. A relevant question is how similar these cell lines are to their in vivo counterparts? To address this issue, we performed a detailed analysis of the transcriptome of two commonly used human monocyte/macrophage cell lines, Mono Mac 6 and THP-1. Both of these cell lines originate from leukemic cells with myelo-monocytic characteristics. We found that both Mono Mac 6 and THP-1 represent cells of very immature origin. Their transcriptomes show more similarities to immature neutrophils than cells of the monocyte/macrophage lineage. They express significant levels of N-elastase, proteinase 3, cathepsin G, and azurocidin but very low levels of CD14, ficolin, and complement factor P. All major MHC class II genes are also expressed at low levels. They show high levels of lysozyme and low levels of one of the immunoglobulin Fc receptors, FCGRIIA, which is characteristic of both neutrophils and monocytes. THP-1, but not Mono Mac 6, also expresses the high-affinity receptor for IgG, FCGRIA. Both cell lines lack the expression of the connective tissue components fibronectin, proteoglycan 4, and syndecan 3, which are characteristics of tissue macrophages but are absent in blood monocytes, indicating that they originate from bone marrow precursors and not yolk sac-derived hematopoietic cells. Both of these cell lines seem, therefore, to represent cells arrested during early myelo-monocytic development, at a branch point between neutrophil and monocyte differentiation. Their very immature phenotype indicates that great care should be taken when using these cell lines as models for normal monocyte/macrophage biology.

Also flagged:IL-9Atopic DermatitisIL-7IL-6TYK2AFR
Journal Article 2022-05-21 No Snippets Haddad EB, Cyr SL, Arima K, McDonald RA, Levit NA, Nestle FO.
Show Full Abstract

Type 2 immunity evolved to combat helminth infections by orchestrating a combined protective response of innate and adaptive immune cells and promotion of parasitic worm destruction or expulsion, wound repair, and barrier function. Aberrant type 2 immune responses are associated with allergic conditions characterized by chronic tissue inflammation, including atopic dermatitis (AD) and asthma. Signature cytokines of type 2 immunity include interleukin (IL)-4, IL-5, IL-9, IL-13, and IL-31, mainly secreted from immune cells, as well as IL-25, IL-33, and thymic stromal lymphopoietin, mainly secreted from tissue cells, particularly epithelial cells. IL-4 and IL-13 are key players mediating the prototypical type 2 response; IL-4 initiates and promotes differentiation and proliferation of naïve T-helper (Th) cells toward a Th2 cell phenotype, whereas IL-13 has a pleiotropic effect on type 2 inflammation, including, together with IL-4, decreased barrier function. Both cytokines are implicated in B-cell isotype class switching to generate immunoglobulin E, tissue fibrosis, and pruritus. IL-5, a key regulator of eosinophils, is responsible for eosinophil growth, differentiation, survival, and mobilization. In AD, IL-4, IL-13, and IL-31 are associated with sensory nerve sensitization and itch, leading to scratching that further exacerbates inflammation and barrier dysfunction. Various strategies have emerged to suppress type 2 inflammation, including biologics targeting cytokines or their receptors, and Janus kinase inhibitors that block intracellular cytokine signaling pathways. Here we review type 2 inflammation, its role in inflammatory diseases, and current and future therapies targeting type 2 pathways, with a focus on AD. INFOGRAPHIC.

Also flagged:Human chorionic gonadotropinhCGluteinising hormoneLHgonadotropin hormonesglycoproteins
Journal Article 2022-05-21 No Snippets Mann ON, Kong CS, Lucas ES, Brosens JJ, Hanyaloglu AC, Brighton PJ.
Show Full Abstract

The human luteinising hormone choriogonadotropin receptor (LHCGR) is a G-protein coupled receptor activated by both human chorionic gonadotropin (hCG) and luteinizing hormone (LH), two structurally related gonadotropins with essential roles in ovulation and maintenance of the corpus luteum. LHCGR expression predominates in ovarian tissues where it elicits functional responses through cyclic adenosine mononucleotide (cAMP), Ca<sup>2+</sup> and extracellular signal-regulated kinase (ERK) signalling. LHCGR expression has also been localized to the human endometrium, with purported roles in decidualization and implantation. However, these observations are contentious. In this investigation, transcripts encoding LHCGR were undetectable in bulk RNA sequencing datasets from whole cycling endometrial tissue and cultured human endometrial stromal cells (EnSC). However, analysis of single-cell RNA sequencing data revealed cell-to-cell transcriptional heterogeneity, and we identified a small subpopulation of stromal cells with detectable LHCGR transcripts. In HEK-293 cells expressing recombinant LHCGR, both hCG and LH elicited robust cAMP, Ca<sup>2+</sup> and ERK signals that were absent in wild-type HEK-293 cells. However, none of these responses were recapitulated in primary EnSC cultures. In addition, proliferation, viability and decidual transformation of EnSC were refractory to both hCG and LH, irrespective of treatment to induce differentiation. Although we challenge the assertion that LHCGR is expressed at a functionally active level in the human endometrium, the discovery of a discrete subpopulation of EnSC that express LHCGR transcripts may plausibly account for the conflicting evidence in the literature.

Also flagged:IGFsIGFinsulin-like growth factorscancerangiogenesistype-1 IGF receptor
Journal Article 2022-05-21 No Snippets Kerr A, Baxter RC.
Show Full Abstract

The insulin-like growth factors (IGFs) and their regulatory proteins-IGF receptors and binding proteins-are strongly implicated in cancer progression and modulate cell survival and proliferation, migration, angiogenesis and metastasis. By regulating the bioavailability of the type-1 IGF receptor (IGF1R) ligands, IGF-1 and IGF-2, the IGF binding proteins (IGFBP-1 to -6) play essential roles in cancer progression. IGFBPs also influence cell communications through pathways that are independent of IGF1R activation. Noncoding RNAs (ncRNAs), which encompass a variety of RNA types including microRNAs (miRNAs) and long-noncoding RNAs (lncRNAs), have roles in multiple oncogenic pathways, but their many points of intersection with IGF axis functions remain to be fully explored. This review examines the functional interactions of miRNAs and lncRNAs with IGFs and their binding proteins in cancer, and reveals how the IGF axis may mediate ncRNA actions that promote or suppress cancer. A better understanding of the links between ncRNA and IGF pathways may suggest new avenues for prognosis and therapeutic intervention in cancer. Further, by exploring examples of intersecting ncRNA-IGF pathways in non-cancer conditions, it is proposed that new opportunities for future discovery in cancer control may be generated.

Also flagged:Corona Virus Disease 2019COVID-19sodiumhypochloritehypochlorous acidchlorine
Journal Article 2022-05-21 No Snippets Wang K, Liu Y, Liu C, Zhu H, Li X, Yu M, Liu L, Sang G, Sheng W, Zhu B.
Show Full Abstract

The outbreak and spread of Corona Virus Disease 2019 (COVID-19) has led to a significant increase in the consumption of sodium hypochlorite (NaOCl) disinfectants. NaOCl hydrolyzes to produce hypochlorous acid (HOCl) to kill viruses, which is a relatively efficient chlorine-based disinfectant commonly used in public disinfection. While people enjoy the convenience of NaOCl disinfection, excessive and indiscriminate use of it will affect the water environment and threaten human health. Importantly, HOCl is an indispensable reactive oxygen species (ROS) in human body. Whether its concentration is normal or not is closely related to human health. Excessive production of HOCl in the body contributes to some inflammatory diseases and even cancer. Also, we noticed that the concentration of ROS in cancer cells is about 10 times higher than that in normal cells. Herein, we developed a HOCl-activatable biotinylated dual-function fluorescent probe BTH. For this probe, we introduced biotin on the naphthalimide fluorophore, which increased the water solubility and enabled the probe to aggregate in cancer cells by targeting specific receptor overexpressed on the surface of cancer cell membrane. After reacting to HOCl, the p-aminophenylether moiety of this probe was oxidatively removed and the fluorescence of the probe was recovered. As expected, in the PBS solution with pH of 7.4, BTH could give full play to the performance of detecting HOCl, and it has made achievements in detecting the concentration of HOCl in actual water samples. Besides that, BTH had effectively distinguished between cancer cells and normal cells through a dual-function discrimination strategy, which used biotin to enrich the probe in cancer cells and reacted with overexpressed HOCl in cancer cells. Importantly, this dual-function discrimination strategy could obtain the precision detection of cancer cells, thereby offering assistance for improving the accuracy of early cancer diagnosis.

Also flagged:neurodegenerative diseasechoreabehaviouralcognitive declineHDoligonucleotide
Journal Article 2022-05-21 ✓ 5 Snippets Ferguson MW, Kennedy CJ, Palpagama TH, Waldvogel HJ, Faull RLM, Kwakowsky A.
In-Text Gene Mentions

Huntington’s disease (HD) is an autosomal neurodegenerative disease that is characterized by an excessive number of CAG trinucleotide repeats within the huntingtin gene (HTT). HD patients can present with a variety of symptoms including chorea, behavioural and psychiatric abnormalities and cognitive decline.

In an HD rat model, Hu128/21 HD mice and HD patient derived neurons, AAV5-miHTT reduced mHTT mRNA and protein levels.154, -156 Hu128/21 HD mice result from crossing an HD mouse model, YAC128, with a wtHTT model, BAC21, giving them 2 full-length human HTT transcripts that are heterozygous for the HD mutation.157 Potent mHTT suppression was sustained for 7 months post-injection in Hu128/21 HD mice.158 In Q175 HD mice, AAV5-miHTT lowered human HTT protein and striatal (39%) and cortical mHTT aggregates 12 months post-injection.

Rodent studies showed successful exon skipping, a shorter HTT protein and reduced 586 amino acid N-terminal huntingtin fragments.149

Total HTT reducing and mHTT specific ASOs have improved cognitive and behavioural deficits in HD model mice with safety and tolerability, and reduced HTT in the cortex and limbic structures in non-human primate brains (where cognitive and behavioural symptoms largely originate).148 Another ASO induces exon 12 skipping in HTT pre-mRNA, preventing cleavage sites being expressed and therefore 586 amino acid N-terminal huntingtin fragments being created.

Hoffman-La Roche’s RO7234292 or Tominersen (previously called IONIS-HTTRx/RG6042; IONIS Pharmaceuticals) is an ASO that binds to wild type HTT (wtHTT) and mHTT mRNA, inducing degradation.126 It is currently the most developed HD ASO therapeutic.27

Show Full Abstract

Huntington's disease (HD) is an autosomal neurodegenerative disease that is characterized by an excessive number of CAG trinucleotide repeats within the huntingtin gene (<i>HTT).</i> HD patients can present with a variety of symptoms including chorea, behavioural and psychiatric abnormalities and cognitive decline. Each patient has a unique combination of symptoms, and although these can be managed using a range of medications and non-drug treatments there is currently no cure for the disease. Current therapies prescribed for HD can be categorized by the symptom they treat. These categories include chorea medication, antipsychotic medication, antidepressants, mood stabilizing medication as well as non-drug therapies. Fortunately, there are also many new HD therapeutics currently undergoing clinical trials that target the disease at its origin; lowering the levels of mutant huntingtin protein (mHTT). Currently, much attention is being directed to antisense oligonucleotide (ASO) therapies, which bind to pre-RNA or mRNA and can alter protein expression via RNA degradation, blocking translation or splice modulation. Other potential therapies in clinical development include RNA interference (RNAi) therapies, RNA targeting small molecule therapies, stem cell therapies, antibody therapies, non-RNA targeting small molecule therapies and neuroinflammation targeted therapies. Potential therapies in pre-clinical development include Zinc-Finger Protein (ZFP) therapies, transcription activator-like effector nuclease (TALEN) therapies and clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated system (Cas) therapies. This comprehensive review aims to discuss the efficacy of current HD treatments and explore the clinical trial progress of emerging potential HD therapeutics.

Also flagged:titaniummagnesiumcobaltchromiumdegradationinflammatory response
Journal Article 2022-05-21 No Snippets Amirtharaj Mosas KK, Chandrasekar AR, Dasan A, Pakseresht A, Galusek D.
Show Full Abstract

Metallic materials such as stainless steel (SS), titanium (Ti), magnesium (Mg) alloys, and cobalt-chromium (Co-Cr) alloys are widely used as biomaterials for implant applications. Metallic implants sometimes fail in surgeries due to inadequate biocompatibility, faster degradation rate (Mg-based alloys), inflammatory response, infections, inertness (SS, Ti, and Co-Cr alloys), lower corrosion resistance, elastic modulus mismatch, excessive wear, and shielding stress. Therefore, to address this problem, it is necessary to develop a method to improve the biofunctionalization of metallic implant surfaces by changing the materials' surface and morphology without altering the mechanical properties of metallic implants. Among various methods, surface modification on metallic surfaces by applying coatings is an effective way to improve implant material performance. In this review, we discuss the recent developments in ceramics, polymers, and metallic materials used for implant applications. Their biocompatibility is also discussed. The recent trends in coatings for biomedical implants, applications, and their future directions were also discussed in detail.

Also flagged:Huntington DiseaseHDbehaviouralneurodegenerative illnesscognitive declinedeath
Journal Article 2022-05-21 No Snippets Delussi M, Sciruicchio V, Taurisano P, Morgante F, Salvatore E, Ferrara IP, Clemente L, Sorbera C, de Tommaso M.
Show Full Abstract

Pain is a minor problem compared with other Huntington Disease (HD) symptoms. Nevertheless, in HD it is poorly recognized and underestimated. So far, no study evaluated the presence of chronic pain in HD. The aim of this pilot study was to evaluate the presence and features of chronic pain in a cohort of HD gene carriers. An observational cross-sectional study was conducted in a cohort of HD gene carriers compared to not gene carriers (n.134 HD subjects, n.74 not gene mutation carriers). A specific pain interview, alongside a neurological, cognitive and behavioural examination, was performed in order to classify the type of pain, subjective intensity. A significant prevalence of "no Pain" in HD was found, which tended to increase with HD progression and a reduced frequency of pain in the last 3 months. A clear difference was found between manifest and premanifest HD in terms of intensity of pain, which did not change significantly with HD progression; however, a tendency emerges to a progressive reduction. No significant group difference was present in analgesic use, type and the site of pain. These findings could support a lower prevalence of <i>chronic pain</i> in manifest HD. Prevalence and intensity of <i>chronic pain</i> seem directly influenced by the process of neurodegeneration rather than by an incorrect cognitive and emotional functioning.

Also flagged:Alcohol Use DisorderalcoholEthanolserotonindopaminegamma-aminobutyric acid
Journal Article 2022-05-21 No Snippets Yang W, Singla R, Maheshwari O, Fontaine CJ, Gil-Mohapel J.
Show Full Abstract

Alcohol use disorder (AUD) encompasses the dysregulation of multiple brain circuits involved in executive function leading to excessive consumption of alcohol, despite negative health and social consequences and feelings of withdrawal when access to alcohol is prevented. Ethanol exerts its toxicity through changes to multiple neurotransmitter systems, including serotonin, dopamine, gamma-aminobutyric acid, glutamate, acetylcholine, and opioid systems. These neurotransmitter imbalances result in dysregulation of brain circuits responsible for reward, motivation, decision making, affect, and the stress response. Despite serious health and psychosocial consequences, this disorder still remains one of the leading causes of death globally. Treatment options include both psychological and pharmacological interventions, which are aimed at reducing alcohol consumption and/or promoting abstinence while also addressing dysfunctional behaviours and impaired functioning. However, stigma and social barriers to accessing care continue to impact many individuals. AUD treatment should focus not only on restoring the physiological and neurological impairment directly caused by alcohol toxicity but also on addressing psychosocial factors associated with AUD that often prevent access to treatment. This review summarizes the impact of alcohol toxicity on brain neurocircuitry in the context of AUD and discusses pharmacological and non-pharmacological therapies currently available to treat this addiction disorder.

Also flagged:oxygenbirthepinephrinevasodilationgestationiron
Journal Article 2022-05-21 No Snippets Sankaran D, Lakshminrusimha S, Saugstad OD.
Show Full Abstract

The transition of a fetus to a newborn involves a sequence of well-orchestrated physiological events. Most neonates go through this transition without assistance but 5-10% may require varying degrees of resuscitative interventions at birth. The most crucial event during this transition is lung inflation with optimal concentrations of oxygen. Rarely, extensive resuscitation including chest compressions and medication may be required. In the past few decades, significant strides have been made in our understanding of the cardiorespiratory transition at birth from a fetus to a newborn and the subsequent resuscitation. This article reviews the physiology behind neonatal transition at birth and various interventions during neonatal resuscitation.

Also flagged:reproductioninfertilityfertilizationfemale infertilityovulation disorderstubal obstruction
Journal Article 2022-05-21 No Snippets Kanaka V, Proikakis S, Drakakis P, Loutradis D, Tsangaris GT.
Show Full Abstract

The evolution of the field of assisted reproduction technology (ART) in the last 40 years has significantly contributed to the management of global infertility. Despite the great numbers of live births that have been achieved through ART, there is still potential for increasing the success rates. As a result, there is a need to create optimum conditions in order to increase ART efficacy. The selection of the best sperm, oocyte, and embryo, as well as the achievement of optimal endometrial receptivity, through the contribution of new diagnostic and treatment methods, based on a personalized proteomic approach, may assist in the attainment of this goal. Proteomics represent a powerful new technological development, which seeks for protein biomarkers in human tissues. These biomarkers may aid to predict the outcome, prevent failure, and monitor in a personalized manner in vitro fertilization (IVF) cycles. In this review, we will present data from studies that have been conducted in the search for such biomarkers in order to identify proteins related to good sperm, oocyte, and embryo quality, as well as optimal endometrial receptivity, which may later lead to greater results and the desirable ART outcome.

Also flagged:GCCCancerprotein 2NPAS2AHNAK2lung adenocarcinoma
Journal Article 2022-05-21 ✓ 5 Snippets Zhou Z, Zheng Y, Mo S, Li S, Zheng X, Wei R, Fan T, Chen T, Xiao C, Li C, He J.
In-Text Gene Mentions

CCDC92 was dramatically deregulated in pan-cancer patients with a worse prognosis (Fig. S2), with a fold change ≥ 1.2.

…sense intronic toCCDC92, which was affiliated…

CCDC92was dramatically deregulated…

…the transcription ofCCDC92and the immune…

…concerned family member,CCDC92.…

Show Full Abstract

Our study aims at developing an interferon-stimulated genes (ISGs) signature that could predict overall survival (OS) in cancer patients, which enrolled a total of 5643 pan-cancer patients. Linear models for microarray data method analysis were conducted to identify the differentially expressed prognostic genes in the global ISGs family. Time-dependent receiver operating characteristic (ROC) and Kaplan-Meier survival analysis were used to test the efficiency of a multi-gene signature in predicting the prognosis of pan-cancer patients. The prognostic performance and potential biological function of gene signature were verified by quantitative real-time PCR in a pan-cancer independent cohort. Three ISGs genes were finally identified to build a classifier, a specific risk score formula, with which patients were classified into the low- or high-risk groups. Time-dependent ROC analyses proved prognostic accuracy. Then, its prognostic value was validated in seven external validation series. A nomogram was constructed to guide the individualized treatment of patients with lung adenocarcinoma. Biological pathway and tumor immune infiltration analysis showed that the signature might cause poor prognosis by blocking NK cell activation. Finally, the signature in our centers was confirmed by real-time quantitative PCR. A robust ISGs-related feature was discovered to effectively classify pan-cancer patients into subgroups with different OS.

Also flagged:Acute renal ischemiaacute renal failureheart ischemiamyocardial infarctioncerebral ischemiaMALAT1
Journal Article 2022-05-20 No Snippets Cao Y, Liu J, Lu Q, Huang K, Yang B, Reilly J, Jiang N, Shu X, Shang L.
Show Full Abstract

Ischemic injuries result from ischemia and hypoxia in cells. Tissues and organs receive an insufficient supply of nutrients and accumulate metabolic waste, which leads to the development of inflammation, fibrosis and a series of other issues. Ischemic injuries in the brain, heart, kidneys, lungs and other organs can cause severe adverse effects. Acute renal ischemia induces acute renal failure, heart ischemia induces myocardial infarction and cerebral ischemia induces cerebrovascular accidents, leading to loss of movement, consciousness and possibly, life‑threatening disabilities. Existing evidence suggests that long non‑coding RNAs (lncRNAs) are regulatory sequences involved in transcription, post‑transcription, epigenetic regulation and multiple physiological processes. lncRNAs have been shown to be differentially expressed following ischemic injury, with the severity of the ischemic injury being affected by the upregulation or downregulation of certain types of lncRNA. The present review article provides an extensive summary of the functional roles of lncRNAs in ischemic injury, with a focus on the brain, heart, kidneys and lungs. The present review mainly summarizes the functional roles of lncRNA MALAT1, lncRNA MEG3, lncRNA H19, lncRNA TUG1, lncRNA NEAT1, lncRNA AK139328 and lncRNA CAREL, among which lncRNA MALAT1, in particular, plays a crucial role in ischemic injury and is currently a hot research topic.

Also flagged:immune responsechromatinEzh2cell differentiationCD8microbial infection
Journal Article 2022-05-20 No Snippets Kanbar JN, Ma S, Kim ES, Kurd NS, Tsai MS, Tysl T, Widjaja CE, Limary AE, Yee B, He Z, Hao Y, Fu XD, Yeo GW, Huang WJ, Chang JT.
Show Full Abstract

During an immune response to microbial infection, CD8+ T cells give rise to short-lived effector cells and memory cells that provide sustained protection. Although the transcriptional programs regulating CD8+ T cell differentiation have been extensively characterized, the role of long noncoding RNAs (lncRNAs) in this process remains poorly understood. Using a functional genetic knockdown screen, we identified the lncRNA Malat1 as a regulator of terminal effector cells and the terminal effector memory (t-TEM) circulating memory subset. Evaluation of chromatin-enriched lncRNAs revealed that Malat1 grouped with trans lncRNAs that exhibit increased RNA interactions at gene promoters and gene bodies. Moreover, we observed that Malat1 was associated with increased H3K27me3 deposition at a number of memory cell-associated genes through a direct interaction with Ezh2, thereby promoting terminal effector and t-TEM cell differentiation. Our findings suggest an important functional role of Malat1 in regulating CD8+ T cell differentiation and broaden the knowledge base of lncRNAs in CD8+ T cell biology.

Also flagged:Gastric cancerpaclitaxelpyrimidineVSNL1CD44capecitabine
Journal Article 2022-05-20 No Snippets Oshima T, Tsuburaya A, Yoshida K, Yoshikawa T, Miyagi Y, Rino Y, Masuda M, Guan J, Tan P, Grabsch HI, Sakamoto J, Tanaka S.
Show Full Abstract

Biomarkers for selecting gastric cancer (GC) patients likely to benefit from sequential paclitaxel treatment followed by fluorinated-pyrimidine-based adjuvant chemotherapy (sequential paclitaxel) were investigated using tissue samples of patients recruited into SAMIT, a phase III randomized controlled trial. Total RNA was extracted from 556 GC resection samples. The expression of 105 genes was quantified using real-time PCR. Genes predicting the benefit of sequential paclitaxel on overall survival, disease-free survival, and cumulative incidence of relapse were identified based on the ranking of p-values associated with the interaction between the biomarker and sequential paclitaxel or monotherapy groups. Low VSNL1 and CD44 expression predicted the benefit of sequential paclitaxel treatment for all three endpoints. Patients with combined low expression of both genes benefitted most from sequential paclitaxel therapy (hazard ratio = 0.48 [95% confidence interval, 0.30-0.78]; p < 0.01; interaction p-value < 0.01). This is the first study to identify VSNL1 and CD44 RNA expression levels as biomarkers for selecting GC patients that are likely to benefit from sequential paclitaxel treatment followed by fluorinated-pyrimidine-based adjuvant chemotherapy. Our findings may facilitate clinical trials on biomarker-oriented postoperative adjuvant chemotherapy for patients with locally advanced GC.

Also flagged:lung cancercanceroncogenestumourmethylationCytosine
Journal Article 2022-05-20 ✓ 3 Snippets Petrovic D, Bodinier B, Dagnino S, Whitaker M, Karimi M, Campanella G, Haugdahl Nøst T, Polidoro S, Palli D, Krogh V, Tumino R, Sacerdote C, Panico S, Lund E, Dugué PA, Giles GG, Severi G, Southey M, Vineis P, Stringhini S, Bochud M, Sandanger TM, Vermeulen RCH, Guida F, Chadeau-Hyam M.
In-Text Gene Mentions

…< -0.5), whereasZNF664-FAM101A-cg0020446, RTKN-cg006…

…an association betweenZNF664-FAM101A and NTPCR genes…

…lung cancer, althoughZNF664-FAM101 expression was found…

Show Full Abstract

Smoking-related epigenetic changes have been linked to lung cancer, but the contribution of epigenetic alterations unrelated to smoking remains unclear. We sought for a sparse set of CpG sites predicting lung cancer and explored the role of smoking in these associations. We analysed CpGs in relation to lung cancer in participants from two nested case-control studies, using (LASSO)-penalised regression. We accounted for the effects of smoking using known smoking-related CpGs, and through conditional-independence network. We identified 29 CpGs (8 smoking-related, 21 smoking-unrelated) associated with lung cancer. Models additionally adjusted for Comprehensive Smoking Index-(CSI) selected 1 smoking-related and 49 smoking-unrelated CpGs. Selected CpGs yielded excellent discriminatory performances, outperforming information provided by CSI only. Of the 8 selected smoking-related CpGs, two captured lung cancer-relevant effects of smoking that were missed by CSI. Further, the 50 CpGs identified in the CSI-adjusted model complementarily explained lung cancer risk. These markers may provide further insight into lung cancer carcinogenesis and help improving early identification of high-risk patients.

Also flagged:hematopoiesisAMLacute myeloid leukemiaacute leukemiasmethylationgene expression
Journal Article 2022-05-20 No Snippets Neyazi S, Ng M, Heckl D, Klusmann JH.
Show Full Abstract

Long noncoding RNAs (lncRNAs) are increasingly emerging as regulators across human development and disease, and many have been described in the context of hematopoiesis and leukemogenesis. These studies have yielded new molecular insights into the contribution of lncRNAs to AML development and revealed connections between lncRNA expression and clinical parameters in AML patients. In this mini review, we illustrate the versatile functions of lncRNAs in AML, with a focus on pediatric AML, and present examples that may serve as future therapeutic targets or predictive factors.

Also flagged:Glabridindiabetic nephropathyferroptosisdiabetesDNglucose
Journal Article 2022-05-20 No Snippets Tan H, Chen J, Li Y, Li Y, Zhong Y, Li G, Liu L, Li Y.
Show Full Abstract

<h4>Background</h4>Glabridin (Glab) is a bioactive component of licorice that can ameliorate diabetes, but its role in diabetic nephropathy (DN) has seldom been reported. Herein, we explored the effect and underlying mechanism of Glab on DN.<h4>Methods</h4>The bioactive component-target network of licorice against DN was by a network pharmacology approach. The protective effect of Glab on the kidney was investigated by a high-fat diet with streptozotocin induced-diabetic rat model. High glucose-induced NRK-52E cells were used for in vitro studies. The effects of Glab on ferroptosis and VEGF/Akt/ERK pathways in DN were investigated in vivo and in vitro using qRT-PCR, WB, and IHC experiments.<h4>Results</h4>Bioinformatics analysis constructed a network comprising of 10 bioactive components of licorice and 40 targets for DN. 13 matching targets of Glab were mainly involved in the VEGF signaling pathway. Glab treatment ameliorated general states and reduced FBG, HOMA-β, and HOMA-insulin index of diabetic rats. The renal pathological changes and the impaired renal function (the increased levels of Scr, BUN, UREA, KIM-1, NGAL, and TIMP-1) were also improved by Glab. Moreover, Glab repressed ferroptosis by increasing SOD and GSH activity, and GPX4, SLC7A11, and SLC3A2 expression, and decreasing MDA and iron concentrations, and TFR1 expression, in vivo and in vitro. Mechanically, Glab significantly suppressed VEGF, p-AKT, p-ERK1/2 expression in both diabetic rats and HG-induced NRK-52E cells.<h4>Conclusions</h4>This study revealed protective effects of Glab on the kidney of diabetic rats, which might exert by suppressing ferroptosis and the VEGF/Akt/ERK pathway.

Also flagged:photonRobo3rhombomere 3receptorsaxonsDeleted in
Journal Article 2022-05-20 ✓ 1 Snippet Tsytsarev V, Kwon SE, Plachez C, Zhao S, O'Connor DH, Erzurumlu RS.
In-Text Gene Mentions

DCC

Show Full Abstract

In Robo3<sup>R3-5</sup>cKO mouse brain, rhombomere 3-derived trigeminal principal nucleus (PrV) neurons project bilaterally to the somatosensory thalamus. As a consequence, whisker-specific neural modules (barreloids and barrels) representing whiskers on both sides of the face develop in the sensory thalamus and the primary somatosensory cortex. We examined the morphological complexity of layer 4 barrel cells, their postsynaptic partners in layer 3, and functional specificity of layer 3 pyramidal cells. Layer 4 spiny stellate cells form much smaller barrels and their dendritic fields are more focalized and less complex compared to controls, while layer 3 pyramidal cells did not show notable differences. Using in vivo 2-photon imaging of a genetically encoded fluorescent [Ca<sup>2+</sup>] sensor, we visualized neural activity in the normal and Robo3<sup>R3-5</sup>cKO barrel cortex in response to ipsi- and contralateral single whisker stimulation. Layer 3 neurons in control animals responded only to their contralateral whiskers, while in the mutant cortex layer 3 pyramidal neurons showed both ipsi- and contralateral whisker responses. These results indicate that bilateral whisker map inputs stimulate different but neighboring groups of layer 3 neurons which normally relay contralateral whisker-specific information to other cortical areas.

Also flagged:Cbx1Sp3gene silencingheterochromatin protein Cbx1transcriptional activator protein PurBtranscription factor
Journal Article 2022-05-20 ✓ 4 Snippets Baksh SS, Pratt RE, Gomez J, Dzau VJ, Hodgkinson CP.
In-Text Gene Mentions

…the expression ofSox6; a transcription factor…

…As expected,Sox6expression increased during…

…Again,Sox6expression increased (…

…In contrast,Sox6expression increased during…

Show Full Abstract

miRNA-based cellular fate reprogramming offers an opportunity to investigate the mechanisms of long-term gene silencing. To further understand how genes are silenced in a tissue-specific manner, we leveraged our miRNA-based method of reprogramming fibroblasts into cardiomyocytes. Through screening approaches, we identified three proteins that were downregulated during reprogramming of fibroblasts into cardiomyocytes: heterochromatin protein Cbx1, transcriptional activator protein PurB, and transcription factor Sp3. We show that knockdown of Cbx1, PurB, and Sp3 was sufficient to induce cardiomyocyte gene expression in fibroblasts. Similarly, gene editing to ablate Cbx1, PurB, and Sp3 expression induced fibroblasts to convert into cardiomyocytes in vivo. Furthermore, high-throughput DNA sequencing and coimmunoprecipitation experiments indicated that Cbx1, PurB, and Sp3 also bound together as a complex and were necessary to localize nucleosomes to cardiomyocyte genes on the chromosome. Finally, we found that the expression of these genes led to nucleosome modification via H3K27me3 (trimethylated histone-H3 lysine-27) deposition through an interaction with the polycomb repressive PRC2 complex. In summary, we conclude that Cbx1, PurB, and Sp3 control cell fate by actively repressing lineage-specific genes.

Also flagged:degradationCOVID-19NSE-19
Journal Article 2022-05-20 No Snippets Sajeev KC, Afjal M.
Show Full Abstract

The fundamental aim of this study is to examine the contagion effect of Bitcoin on the National Securities Exchange, Shanghai Stock Exchange, London Stock Exchange, and Dow Jones Industrial Average by analyzing the volatility spillover and correlation between these markets to understand the short-term and long-term impact of this volatility ranging from the shocks during the period March 2017-May 2021. Irrespective of ups and downs happening in the cryptocurrency market, more investors are investing their money in the cryptocurrency market. This paper will contribute to the existing literature by studying volatility spillover in the market, its contagion effect, and to identify if there is a long-term and short-term impact between the Bitcoin and stock markets facilitating the transmission of volatility spillover. We employed the Diagonal BEKK and DCC MGARCH models to investigate the integration between Bitcoin and the stock markets. From the empirical analyses, we find the overall time-varying correlation between Bitcoin and the stock markets is low, indicating that Bitcoin can be taken as an asset to hedge against the risk of these stock markets. It was also evident that these stock markets responded more to the negative shocks during 2018 and 2021 than the positive shocks in the Bitcoin market. Our study may be helpful for investment decisions, academia, and policymakers.

Also flagged:osteoarthritisOAarticular diseaseageingobesitymetabolism
Journal Article 2022-05-20 ✓ 2 Snippets Oo WM, Hunter DJ, Hunter DJ.
In-Text Gene Mentions

An uncoupled remodelling process between bone formation and resorption in the subchondral bone results in microstructural changes, depending on the spontaneous stimulation (in early-stage OA) or inhibition (in late-stage OA) of osteoclastic bone resorption.15 Furthermore, bone pain can be induced by an acidic microenvironment created via H+ ions which bone-resorbing osteoclasts generated as shown in animal models of bone metastasis.16 Osteoclasts can produce Netrin-1, leading to sensory innervation and pain via its receptor DCC (deleted in colorectal cancer).17 These findings indicate the potential of bone-protective agents in DMOAD research.

…via its receptorDCC(deleted in colorectal…

Show Full Abstract

In spite of a major public health burden with increasing prevalence, current osteoarthritis (OA) management is largely palliative with an unmet need for effective treatment. Both industry and academic researchers have invested a vast amount of time and financial expense to discover the first diseasing-modifying osteoarthritis drugs (DMOADs), with no regulatory success so far. In this narrative review, we discuss repurposed drugs as well as investigational agents which have progressed into phase II and III clinical trials based on three principal endotypes: bone-driven, synovitis-driven and cartilage-driven. Then, we will briefly describe the recent failures and lessons learned, promising findings from predefined post hoc analyses and insights gained, novel methodologies to enhance future success and steps underway to overcome regulatory hurdles.

Also flagged:HesperidinCurcuminAmphotericin BLactate dehydrogenaseLDHconjugation
Journal Article 2022-05-20 No Snippets Akbar N, Kawish M, Khan NA, Shah MR, Alharbi AM, Alfahemi H, Siddiqui R.
Show Full Abstract

To combat the public health threat posed by multiple-drug-resistant (MDR) pathogens, new drugs with novel chemistry and modes of action are needed. In this study, several drugs including Hesperidin (HES), curcumin (CUR), and Amphotericin B (AmpB) drug-nanoparticle formulations were tested for antibacterial strength against MDR Gram-positive bacteria, including <i>Bacillus cereus</i>, <i>Streptococcus pyogenes</i>, Methicillin-resistant <i>Staphylococcus aureus</i> (MRSA), and <i>Streptococcus pneumoniae</i>, and Gram-negative bacteria, including <i>Escherichia coli</i> K1, <i>Pseudomonas aeruginosa</i>, <i>Salmonella enterica,</i> and <i>Serratia marcescens</i>. Nanoparticles were synthesized and subjected to Atomic force microscopy, Fourier transform-infrared spectroscopy, and Zetasizer for their detailed characterization. Antibacterial assays were performed to determine their bactericidal efficacy. Lactate dehydrogenase (LDH) assays were carried out to measure drugs' and drug-nanoparticles' cytotoxic effects on human cells. Spherical NPs ranging from 153 to 300 nm were successfully synthesized. Results from antibacterial assays revealed that drugs and drug-nanoparticle formulations exerted bactericidal activity against MDR bacteria. Hesperidin alone failed to exhibit antibacterial effects but, upon conjugation with cinnamic-acid-based magnetic nanoparticle, exerted significant bactericidal activity against both the Gram-positive and Gram-negative isolates. AmpB-LBA-MNPs produced consistent, potent antibacterial efficacy (100% kill) against all Gram-positive bacteria. AmpB-LBA-MNPs showed strong antibacterial activity against Gram-negative bacteria. Intriguingly, all the drugs and their conjugated counterpart except AmpB showed minimal cytotoxicity against human cells. In summary, these innovative nanoparticle formulations have the potential to be utilized as therapeutic agents against infections caused by MDR bacteria and represent a significant advancement in our effort to counter MDR bacterial infections.

Also flagged:PRC2EEDneuroblastomaPRCNBectoderm development
Journal Article 2022-05-20 ✓ 1 Snippet Shaliman D, Takenobu H, Sugino RP, Ohira M, Kamijo T.
In-Text Gene Mentions

…Epigenetic modifications bypolycomb repressiverepressive complex (PRC)…

Show Full Abstract

Epigenetic modifications by polycomb repressive complex (PRC) molecules appear to play a role in the tumorigenesis and aggressiveness of neuroblastoma (NB). Embryonic ectoderm development (EED) is a member of the PRC2 complex that binds to the H3K27me3 mark deposited by EZH2 via propagation on adjacent nucleosomes. We herein investigated the molecular roles of EED in MYCN-amplified NB cells using EED-knockdown (KD) shRNAs, EED-knockout sgRNAs, and the EED small molecule inhibitor EED226. The suppression of EED markedly inhibited NB cell proliferation and flat and soft agar colony formation. A transcriptome analysis using microarrays of EED-KD NB cells indicated the de-repression of cell cycle-regulated and differentiation-related genes. The results of a GSEA analysis suggested that inhibitory cell cycle-regulated gene sets were markedly up-regulated. Furthermore, an epigenetic treatment with the EED inhibitor EED226 and the HDAC inhibitors valproic acid/SAHA effectively suppressed NB cell proliferation and colony formation. This combined epigenetic treatment up-regulated cell cycle-regulated and differentiation-related genes. The ChIP sequencing analysis of histone codes and PRC molecules suggested an epigenetic background for the de-repression of down-regulated genes in MYCN-amplified/PRC2 up-regulated NB.

Also flagged:tumorsatherosclerosisoxygenCD68MCP1TNFα
Journal Article 2022-05-20 No Snippets Mu D, Wang X, Wang H, Sun X, Dai Q, Lv P, Liu R, Qi Y, Xie J, Xu B, Zhang B.
Show Full Abstract

<h4>Background</h4>Photodynamic therapy (PDT) has achieved continued success in the treatment of tumors, but its progress in the treatment of atherosclerosis has been limited, mainly due to the low tissue-penetration ability of the excitation light for photosensitizers.<h4>Methods</h4>In this study, we designed a chemiexcited system producing singlet oxygen in an attempt to apply PDT for the treatment of atherosclerosis without the irradiation of external light. The system designed was polymeric nanoparticles (NPs) equipped with chemical fuel and photosensitizers, cross-linked with an Fe<sup>3+</sup>-catechol complex for stabilization and magnetic resonance imaging (MRI).<h4>Results</h4>The system (FeCNPs for short) accumulated effectively in plaques, providing persistent and enhanced <i>T</i> <sub>1</sub>-weighted contrast ability. FeCNPs also prevented progression of atherosclerosis via macrophage elimination, and obviously reduced plaque size and thickness revealed by <i>T</i> <sub>1</sub>-weighted MRI. Expression of CD68, MCP1, and TNFα was significantly reduced after treatment. However, low doses of FeCNPs exhibited better therapeutic efficacy than high doses. Furthermore, low-dose FeCNPs exhibited effective macrophage elimination in aortic arches and abdominal aortae, but inefficiency in the thoracic aorta, aortic hiatus, and aorta-iliac bifurcation.<h4>Conclusion</h4>This study provides the first example of a combination of MRI and chemiexcited PDT for atherosclerosis, evidencing the effectiveness of PDT and providing significant pointers for developing nanotherapy on atherosclerosis.

Also flagged:Berberinealkaloidcentral nervous system diseasesneurodegenerative diseasesendoplasmic reticulumNeurodegenerative Disease
Journal Article 2022-05-20 ✓ 3 Snippets Cheng Z, Kang C, Che S, Su J, Sun Q, Ge T, Guo Y, Lv J, Sun Z, Yang W, Li B, Li X, Cui R.
In-Text Gene Mentions

Studies have found that berberine can effectively alleviate the motor dysfunction of HTT mice and prolong their survival time, further studies proves that berberine promote the degradation of mutant HTT protein through enhancing autophagy function, thereby reducing the accumulation of mutant huntingtin protein (Jiang et al., 2015b).

Huntington’s disease is mainly caused by an autosomal dominant mutation in either of the two copies of the Huntingtin (HTT) gene (Cicchetti et al., 2014; Fan D. et al., 2019b).

In previous studies, the expansion of polyglutamine (polyQ) bundles to 36 or more glutamine repeats will cause the HTT protein to misfold and aggregate, leading to neuronal death and symptoms of Huntington’s disease (Mangiarini et al., 1996).

Show Full Abstract

Berberine, as a natural alkaloid compound, is characterized by a diversity of pharmacological effects. In recent years, many researches focused on the role of berberine in central nervous system diseases. Among them, the effect of berberine on neurodegenerative diseases has received widespread attention, for example Alzheimer's disease, Parkinson's disease, Huntington's disease, and so on. Recent evidence suggests that berberine inhibits the production of neuroinflammation, oxidative, and endoplasmic reticulum stress. These effects can further reduce neuron damage and apoptosis. Although the current research has made some progress, its specific mechanism still needs to be further explored. This review provides an overview of berberine in neurodegenerative diseases and its related mechanisms, and also provides new ideas for future research on berberine.

Also flagged:Acute Lung Injuryacute respiratory distress syndromeARDSArtesunateartemisininlipopolysaccharide
Journal Article 2022-05-20 No Snippets Hao DL, Wang YJ, Yang JY, Xie R, Jia LY, Cheng JT, Ma H, Tian JX, Guo SS, Liu T, Sui F, Zhao Y, Chen YJ, Zhao QH.
Show Full Abstract

Acute lung injury (ALI) or its aggravated stage acute respiratory distress syndrome (ARDS) is a common severe clinical syndrome in intensive care unit, may lead to a life-threatening form of respiratory failure, resulting in high mortality up to 30-40% in most studies. Nanotechnology-mediated anti-inflammatory therapy is an emerging novel strategy for the treatment of ALI, has been demonstrated with unique advantages in solving the dilemma of ALI drug therapy. Artesunate (ART), a derivative of artemisinin, has been reported to have anti-inflammatory effects. Therefore, in the present study, we designed and synthesized PEGylated ART prodrugs and assessed whether ART prodrugs could attenuate lipopolysaccharide (LPS) induced ALI <i>in vitro</i> and <i>in vivo</i>. All treatment groups were conditioned with ART prodrugs 1 h before challenge with LPS. Significant increased inflammatory cytokines production and decreased GSH levels were observed in the LPS stimulated mouse macrophage cell line RAW264.7. Lung histopathological changes, lung W/D ratio, MPO activity and total neutrophil counts were increased in the LPS-induced murine model of ALI <i>via</i> nasal administration. However, these results can be reversed to some extent by treatment of ART prodrugs. The effectiveness of mPEG<sub>2k</sub>-SS-ART in inhibition of ALI induced by LPS was confirmed. In conclusion, our results demonstrated that the ART prodrugs could attenuate LPS-induced ALI effectively, and mPEG<sub>2k</sub>-SS-ART may serve as a novel strategy for treatment of inflammation induced lung injury.

Also flagged:immune responseHIFshypoxia-inducible factorsMAP kinaseironbinding
Journal Article 2022-05-20 No Snippets Suo N, Zhou ZX, Xu J, Cao DC, Wu BY, Zhang HY, Xu P, Zhao ZX.
Show Full Abstract

As an essential environmental factor that affects the economic benefits of aquaculture, hypoxia is one of the urgent problems to be solved in the aquaculture fish breeding industry. Common carp (<i>Cyprinus carpio</i>) is a critical economic fish in China, and at present, there are many breeding strains of common carp with different character advantages in China, including Hebao red carp (<i>C. carpio</i> var <i>wuyuanesis</i>) and Songpu mirror carp (<i>C. carpio</i> var <i>specularis</i>). Even if the environmental adaptation of common carp is generally strong, the genetic background of hypoxia tolerance in different strains of common carp is unclear yet. This study tested the hypoxia tolerance of Songpu minor carp, Hebao red carp, and their hybrid F1 population by an acute hypoxia treatment. Muscle and liver tissues were used for transcriptome sequencing analysis to identify the key factors for hypoxia tolerance and explore the potential genetic mechanism for breeding high hypoxia tolerance in common carp. The comparative transcriptomic analysis revealed abundant hypoxia response-related genes and their differential regulation mechanism in these two tissues of different common carp strains under acute hypoxia, including immune response, cellular stress response, HIFs (hypoxia-inducible factors), MAP kinase, iron ion binding, and heme binding. Our findings will facilitate future investigation on the hypoxia response mechanism and provide a solid theoretical basis for breeding projects in common carp.

Also flagged:moyamoya diseasestrokepathogenesisWntcerebrovascular diseasegene expressions
Journal Article 2022-05-20 No Snippets Kang K, Shen Y, Zhang Q, Lu J, Ju Y, Ji R, Li N, Wu J, Yang B, Lin J, Liang X, Zhang D, Zhao X.
Show Full Abstract

<b>Objective:</b> MicroRNAs (miRNAs) in exosomes had been implicated differentially expressed in patient with moyamoya disease (MMD), but the miRNAs expression in circulating leukocytes remains unclear. This study was investigated on the differential expression of miRNAs in peripheral leukocytes between MMD patients and healthy adults, and among patients with subtypes of MMD. <b>Materials and methods:</b> A total of 30 patients with MMD and 10 healthy adults were enrolled in a stroke center from October 2017 to December 2018. The gene microarray was used to detect the differential expression profiles of miRNA in leukocytes between MMD patients and controls, and the differentially expressed miRNAs were verified by the method of real-time PCR. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) were used to explore the key signaling pathways and possible pathogenesis of MMD. <b>Results:</b> The microarray results showed 12 differentially expressed miRNAs in leukocytes of MMD patients compared with controls (fold change >2.0, <i>p</i> < 0.05 and FDR <0.05), of which 8 miRNAs were upregulated (miRNA-142-5p, miRNA-29b-3p, miRNA-424-5p, MiRNA-582-5p, miRNA-6807-5p, miRNA-142-3p, miRNA-340-5p, miRNA-4270), and 4 miRNAs were downregulated (miRNA-144-3p, miRNA-451a, miRNA-486-5p, miRNA-363-3p). The real-time PCR confirmed seven differentially expressed miRNAs (<i>p</i> < 0.05), of which 4 miRNAs (miRNA-29b-3p, miRNA-142-3p, miRNA-340-5p, miRNA-582-5p) were upregulated, and 3 miRNAs (miRNA-363-3p, miRNA-451a and miRNA-486-5p) were downregulated. Both GO and KEGG analysis suggested that the Wnt signaling pathway may be involved in the pathogenesis of MMD. In addition, miRNAs were also differentially expressed among patients with subtypes of MMD. <b>Conclusion:</b> This study indicated that miRNAs are differentially expressed in peripheral leukocytes between MMD patients and healthy adults, and among patients with subtypes of MMD. The Wnt signaling pathway is probably involved in the pathogenesis of MMD.

Also flagged:OPRM1Opioid receptor mu 1NPYneuropeptide YCACNA1Ccalcium voltage-gated channel subunit alpha1 C
Journal Article 2022-05-20 ✓ 5 Snippets Cahill S, Chandola T, Hager R.
In-Text Gene Mentions

OPRM1 (Opioid receptor mu 1), NPY (neuropeptide Y), CACNA1C (calcium voltage-gated channel subunit alpha1 C), DCC (deleted in colorectal carcinoma), and FKBP5 (FKBP prolyl isomerase 5) had both animal and human variants associated with resilience, supporting the idea of shared biological pathways.

…subunit alpha1 C),DCC(deleted in colorectal…

…of GWAS identifiedDCCNetrin 1 Receptor…

…1 Receptor (DCC) as a potential…

…Serotonin Transporter (5-HTT, SLC6A4 )…

Show Full Abstract

Resilience is broadly defined as the ability to maintain or regain functioning in the face of adversity and is influenced by both environmental and genetic factors. The identification of specific genetic factors and their biological pathways underpinning resilient functioning can help in the identification of common key factors, but heterogeneities in the operationalisation of resilience have hampered advances. We conducted a systematic review of genetic variants associated with resilience to enable the identification of general resilience mechanisms. We adopted broad inclusion criteria for the definition of resilience to capture both human and animal model studies, which use a wide range of resilience definitions and measure very different outcomes. Analyzing 158 studies, we found 71 candidate genes associated with resilience. OPRM1 (Opioid receptor mu 1), NPY (neuropeptide Y), CACNA1C (calcium voltage-gated channel subunit alpha1 C), DCC (deleted in colorectal carcinoma), and FKBP5 (FKBP prolyl isomerase 5) had both animal and human variants associated with resilience, supporting the idea of shared biological pathways. Further, for OPRM1, OXTR (oxytocin receptor), CRHR1 (corticotropin-releasing hormone receptor 1), COMT (catechol-O-methyltransferase), BDNF (brain-derived neurotrophic factor), APOE (apolipoprotein E), and SLC6A4 (solute carrier family 6 member 4), the same allele was associated with resilience across divergent resilience definitions, which suggests these genes may therefore provide a starting point for further research examining commonality in resilience pathways.

Also flagged:IronAtherosclerosispro-inflammatory chemokinestransferrin receptor 1TfR1iron regulatory proteins
Journal Article 2022-05-20 ✓ 4 Snippets Ma J, Ma HM, Shen MQ, Wang YY, Bao YX, Liu Y, Ke Y, Qian ZM.
In-Text Gene Mentions

In the case of HH, the key is whether sequence variations in HFE gene, especially the most common variations of C282Y and H63D, can initiate iron-overload in the aortic tissues, and if not, how an increase in atherosclerosis could be observed in HH in spite of the existence of excess iron accumulation in multiple tissues including the heart.

It is reasonable to believe that “an increase in atherosclerosis” should not have been observed in HH if there is not excess iron accumulation in the aortic tissues or if sequence variations in HFE gene cannot initiate excess iron accumulation in the aortic tissues.

…sequence variations inHFEgene, especially the…

…sequence variations inHFEgene cannot initiate…

Show Full Abstract

The role of iron in atherosclerosis is still a controversial and unsolved issue. Here, we investigated serum iron, expression of iron regulatory, transport and storage proteins, pro-inflammatory chemokines and cytokines in ApoE<sup>-/-</sup> mice. We demonstrated that ApoE<sup>-/-</sup> induced atherosclerosis and an increase in iron contents, expression of transferrin receptor 1 (TfR1), iron regulatory proteins (IRPs), heme oxygenase 1 (HO1), cellular adhesion molecules and pro-inflammatory cytokines, production of reactive oxygen species (ROS), and a reduction in expression of superoxide dismutase and glutathione peroxidase enzyme in aortic tissues. All of these changes induced by ApoE deficiency could be significantly abolished by deferoxamine. The data showed that the increased iron in aortic tissues was mainly due to the increased iron uptake <i>via</i> IRP/TfR1 upregulation. These findings plus a brief analysis of the controversial results reported previously showed that ApoE deficiency-induced atherosclerosis is partly mediated by the increased iron in aortic tissues.

Also flagged:immune responsecancerinfectious diseasesantigen receptorchromosomechromosomes
Journal Article 2022-05-20 No Snippets Bhat J, Placek K, Faissner S.
Show Full Abstract

γδ T cells are unconventional T cells, distinguished from αβ T cells in a number of functional properties. Being small in number compared to αβ T cells, γδ T cells have surprised us with their pleiotropic roles in various diseases. γδ T cells are ambiguous in nature as they can produce a number of cytokines depending on the (micro) environmental cues and engage different immune response mechanisms, mainly due to their epigenetic plasticity. Depending on the disease condition, γδ T cells contribute to beneficial or detrimental response. In this review, we thus discuss the dichotomous nature of γδ T cells in cancer, neuroimmunology and infectious diseases. We shed light on the importance of equal consideration for systems immunology and personalized approaches, as exemplified by changes in metabolic requirements. While providing the status of immunotherapy, we will assess the metabolic (and other) considerations for better outcome of γδ T cell-based treatments.

Also flagged:Diabetic nephropathydiabetesdiabeticschronic kidney failurebindingmalignant tumors
Journal Article 2022-05-20 No Snippets Tu C, Wang L, Wei L, Jiang Z.
Show Full Abstract

Diabetic nephropathy (DKD) is the most common chronic microvascular complication of diabetes. About 20%-40% of diabetics develop DKD, which eventually leads to chronic kidney failure. Although progress has been made in diagnosis and treatment tools, diabetic nephropathy is still a major clinical problem. In recent years, circular RNA (CircRNA) has become a research hotspot. CircRNA is a non-coding RNA formed by covalently closing the 5 'and 3' ends of the precursor RNA. CircRNA has powerful biological functions. CircRNA can regulate the expression of target genes through competitive binding with microRNA, thus playing the biological role of endogenous RNA (CeRNA). Many studies have shown that circRNAs plays an important role in malignant tumors, autoimmune system diseases, coronary heart disease and other diseases. More and more studies have shown that it can also be used as a biomarker of diabetes and diabetic nephropathy. This review summarizes the origin, classification, biogenesis and regulatory mechanisms of circRNAs. In addition, the pathogenesis and clinical significance of circRNAs as competing endogenous RNAs involved in diabetic nephropathy were also introduced. This will help us fully understand the pathological mechanism of diabetic nephropathy and develop new therapeutic targets or treatment options to improve the prognosis of patients with diabetic nephropathy.

Also flagged:silicaporesDPX1001FLSS21
Journal Article 2022-05-20 No Snippets Liu C, Jin Y, Qi D, Ding X, Ren H, Wang H, Jiang J.
Show Full Abstract

Chiral recognition and discrimination is not only of significance in biological processes but also a powerful method to fabricate functional supramolecular materials. Herein, a pair of heterochiral porous organic cages (HPOC-1), out of four possible enantiomeric products, with mirror stereoisomeric crystal structures were cleanly prepared by condensation occurring in the exclusive combination of cyclohexanediamine and binaphthol-based tetraaldehyde enantiomers. Nuclear magnetic resonance and luminescence spectroscopy have been employed to monitor the assembly process of HPOC-1, revealing the clean formation of heterochiral organic cages due to the enantioselective recognition of (<i>S</i>,<i>S</i>)-binaphthol towards (<i>R</i>,<i>R</i>)-cyclohexanediamine derivatives and <i>vice versa</i>. Interestingly, HPOC-1 exhibits circularly polarized luminescence and enantioselective recognition of chiral substrates according to the circular dichroism spectral change. Theoretical simulations have been carried out, rationalizing both the enantioselective assembly and recognition of HPOC-1.

Authorea Preprints 2022-05-20 Preprint (No Snippets API) Diamandis DC, International H63D Syndrome Research Consortium, Research LG, III) JUoC(, Patients DMKAfHS, n.e.V LH, Adams J.
Show Full Abstract

Evidence-based medicine has shown for many years that homozygous mutations of the HFE gene H63D are by no means negligible. Not only can it cause, usually after a second hit, rather mild classical hemochromatosis, but it can also cause numerous other disorders of iron metabolism, such as hypotransferrinemia, changes in binding capacity, and others. In addition, it may lead-among other symptoms-to damages of the heart and the substantia nigra via a causal relationship that remains to be investigated, most likely via a cascade dysfunction in iron metabolism. The clinical facts are compelling. Any physician who dismisses mutations of the HFE gene H63D as clinically irrelevant risks the health and life of his patient. Therefore all main researcher working on H63D Syndrome decided to raise awareness for the "iron brother" of Morbus Wilson by renaming H63D Syndrome.

bioRxiv 2022-05-20 Preprint (No Snippets API) Saatci O, Akbulut O, Cetin M, Sikirzhytski V, Sahin O.
Show Full Abstract

Centrosome amplification (CA) is a hallmark of cancer that is strongly associated with highly aggressive disease and worse clinical outcome. However, there are no effective strategies targeting cancer cells with CA while sparing normal cells. Here, we identified Transforming Acidic Coiled-Coil Containing Protein 3 (TACC3) to be overexpressed in tumors with CA, and its high expression is associated with dramatically worse clinical outcome. We demonstrated that TACC3 forms distinct functional interactions in mitotic and non-mitotic cancer cells with CA to facilitate centrosome clustering (CC) and transcriptional repression of tumor suppressors, respectively. We showed, for the first time, that TACC3 interacts with the Kinesin Family Member C1 (KIFC1) via its TACC domain in mitotic cells with CA and inhibition of TACC3 blocks this interaction, leading to apoptosis via multipolar spindle formation and activation of spindle assembly checkpoint (SAC)/CDK1/p-Bcl2 axis. In interphase, TACC3 interacts with the members of the nucleosome remodeling and deacetylase (NuRD) complex (HDAC2 and MBD2) in nucleus, and its inhibition causes p53-independent G1 arrest and apoptosis by blocking these interactions and activating the transcription of key tumor suppressors (e.g., p21, p16 and APAF1). Notably, inducing CA by chemical (cytochalasin D) or genomic (PLK4 overexpression or p53 loss) modulations renders cancer cells highly sensitive to TACC3 inhibition. Targeting TACC3 by small molecule inhibitors or guide RNAs strongly inhibits growth of organoids and breast cancer cell line- and patient-derived xenografts with CA. Altogether our results pave the way towards therapeutic targeting of TACC3 in highly aggressive cancers.

Also flagged:gene expressionCOPDairway diseaseinterferonchronic obstructive pulmonary diseaseType 1 interferon
Journal Article 2022-05-19 ✓ 1 Snippet Yun JH, Lee S, Srinivasa P, Morrow J, Chase R, Saferali A, Xu Z, Cho M, Castaldi P, Hersh CP.
In-Text Gene Mentions

RABGAP1L

Show Full Abstract

<h4>Background</h4>The molecular basis of airway remodelling in chronic obstructive pulmonary disease (COPD) remains poorly understood. We identified gene expression signatures associated with chest computed tomography (CT) scan airway measures to understand molecular pathways associated with airway disease.<h4>Methods</h4>In 2396 subjects in the COPDGene Study, we examined the relationship between quantitative CT airway phenotypes and blood transcriptomes to identify airway disease-specific genes and to define an airway wall thickness (AWT) gene set score. Multivariable regression analyses were performed to identify associations of the AWT score with clinical phenotypes, bronchial gene expression and genetic variants.<h4>Results</h4>Type 1 interferon (IFN)-induced genes were consistently associated with AWT, square root wall area of a hypothetical airway with 10 mm internal perimeter (Pi10) and wall area percentage, with the strongest enrichment in AWT. A score derived from 18 genes whose expression was associated with AWT was associated with COPD-related phenotypes including reduced lung function (forced expiratory volume in 1 s percentage predicted β= -3.4; p<0.05) and increased exacerbations (incidence rate ratio 1.7; p<0.05). The AWT score was reproducibly associated with AWT in bronchial samples from 23 subjects (β=3.22; p<0.05). The blood AWT score was associated with genetic variant rs876039, an expression quantitative trait locus for <i>IKZF1</i>, a gene that regulates IFN signalling and is associated with inflammatory diseases.<h4>Conclusions</h4>A gene expression signature with IFN-stimulated genes from peripheral blood and bronchial brushings is associated with CT AWT, lung function and exacerbations. Shared genes and genetic associations suggest viral responses and/or autoimmune dysregulation as potential underlying mechanisms of airway disease in COPD.

Also flagged:peroxiredoxin 1Peroxiredoxinoxygenmalignant tumorstumorsPRDX1
Journal Article 2022-05-19 ✓ 3 Snippets Otsuka N, Ishimaru K, Murakami M, Goto M, Hirata A, Sakai H.
In-Text Gene Mentions

It has been shown that PRDX6 is overexpressed in canine HSA in comparison to hemangioma (HA) and that the apoptosis of HSA cell lines derived from dogs was induced by knockdown of PRDX6 [1].

…we demonstrated thatPRDX6overexpression protects agains…

PRDX6is a unique…

Show Full Abstract

Peroxiredoxin (PRDX) is an antioxidant enzyme family with six isoforms (PRDX1-6). The main function of PRDXs is to decrease cellular oxidative stress by reducing reactive oxygen species, such as hydrogen peroxide, to H<sub>2</sub>O. Recently, it has been reported that PRDXs are overexpressed in various malignant tumors in humans, and are involved in the development, proliferation, and metastasis of tumors. However, studies on the expression of PRDXs in tumors of animals are limited. Therefore, in the present study, we immunohistochemically investigated the expression of PRDX1 and 2 in spontaneous canine hemangiosarcoma (HSA) and hemangioma (HA), as well as in selected normal tissue and granulation tissue, including newly formed blood vessels. Although there were some exceptions, immunolocalization of PRDX1 and 2 in normal canine tissues was similar to those in humans, rats, or mice. In granulation tissue, angiogenic endothelial cells were strongly positive for PRDX1 and 2, whereas quiescent endothelial cells in mature vessels were negative. Both PRDX1 and 2 were significantly highly expressed in HSA compared to HA. There were no significant differences in the expression of PRDX1 and 2 among the subtypes and primary sites of HSA. These results suggest that PRDX1 and 2 may be involved in the angiogenic phenotypes of endothelial cells in granulation tissue as well as in the behavior in the malignant endothelial tumors.

Also flagged:brain degenerationcognitive declinedementiaADagingLOAD
Journal Article 2022-05-19 No Snippets Macciardi F, Giulia Bacalini M, Miramontes R, Boattini A, Taccioli C, Modenini G, Malhas R, Anderlucci L, Gusev Y, Gross TJ, Padilla RM, Fiandaca MS, Head E, Guffanti G, Federoff HJ, Mapstone M.
Show Full Abstract

Recent reports have suggested that the reactivation of otherwise transcriptionally silent transposable elements (TEs) might induce brain degeneration, either by dysregulating the expression of genes and pathways implicated in cognitive decline and dementia or through the induction of immune-mediated neuroinflammation resulting in the elimination of neural and glial cells. In the work we present here, we test the hypothesis that differentially expressed TEs in blood could be used as biomarkers of cognitive decline and development of AD. To this aim, we used a sample of aging subjects (age > 70) that developed late-onset Alzheimer's disease (LOAD) over a relatively short period of time (12-48 months), for which blood was available before and after their phenoconversion, and a group of cognitive stable subjects as controls. We applied our developed and validated customized pipeline that allows the identification, characterization, and quantification of the differentially expressed (DE) TEs before and after the onset of manifest LOAD, through analyses of RNA-Seq data. We compared the level of DE TEs within more than 600,000 TE-mapping RNA transcripts from 25 individuals, whose specimens we obtained before and after their phenotypic conversion (phenoconversion) to LOAD, and discovered that 1790 TE transcripts showed significant expression differences between these two timepoints (logFC ± 1.5, logCMP > 5.3, nominal p value < 0.01). These DE transcripts mapped both over- and under-expressed TE elements. Occurring before the clinical phenoconversion, this TE storm features significant increases in DE transcripts of LINEs, LTRs, and SVAs, while those for SINEs are significantly depleted. These dysregulations end with signs of manifest LOAD. This set of highly DE transcripts generates a TE transcriptional profile that accurately discriminates the before and after phenoconversion states of these subjects. Our findings suggest that a storm of DE TEs occurs before phenoconversion from normal cognition to manifest LOAD in risk individuals compared to controls, and may provide useful blood-based biomarkers for heralding such a clinical transition, also suggesting that TEs can indeed participate in the complex process of neurodegeneration.

Also flagged:Endosomal Sortingmembrane receptorsendosomesdemyelinating peripheral neuropathiesCharcot-Marie-Tooth(CMT) disease
Journal Article 2022-05-19 ✓ 1 Snippet McLean JW, Wilson JA, Tian T, Watson JA, VanHart M, Bean AJ, Scherer SS, Crossman DK, Ubogu E, Wilson SM.
In-Text Gene Mentions

Pou3f2

Show Full Abstract

Endosomal sorting plays a fundamental role in directing neural development. By altering the temporal and spatial distribution of membrane receptors, endosomes regulate signaling pathways that control the differentiation and function of neural cells. Several genes linked to inherited demyelinating peripheral neuropathies, known as Charcot-Marie-Tooth (CMT) disease, encode proteins that directly interact with components of the endosomal sorting complex required for transport (ESCRT). Our previous studies demonstrated that a point mutation in the ESCRT component hepatocyte growth-factor-regulated tyrosine kinase substrate (HGS), an endosomal scaffolding protein that identifies internalized cargo to be sorted by the endosome, causes a peripheral neuropathy in the neurodevelopmentally impaired <i>teetering</i> mice. Here, we constructed a Schwann cell-specific deletion of <i>Hgs</i> to determine the role of endosomal sorting during myelination. Inactivation of HGS in Schwann cells resulted in motor and sensory deficits, slowed nerve conduction velocities, delayed myelination and hypomyelinated axons, all of which occur in demyelinating forms of CMT. Consistent with a delay in Schwann cell maturation, HGS-deficient sciatic nerves displayed increased mRNA levels for several promyelinating genes and decreased mRNA levels for genes that serve as markers of myelinating Schwann cells. Loss of HGS also altered the abundance and activation of the ERBB2/3 receptors, which are essential for Schwann cell development. We therefore hypothesize that HGS plays a critical role in endosomal sorting of the ERBB2/3 receptors during Schwann cell maturation, which further implicates endosomal dysfunction in inherited peripheral neuropathies.<b>SIGNIFICANCE STATEMENT</b> Schwann cells myelinate peripheral axons, and defects in Schwann cell function cause inherited demyelinating peripheral neuropathies known as CMT. Although many CMT-linked mutations are in genes that encode putative endosomal proteins, little is known about the requirements of endosomal sorting during myelination. In this study, we demonstrate that loss of HGS disrupts the endosomal sorting pathway in Schwann cells, resulting in hypomyelination, aberrant myelin sheaths, and impairment of the ERBB2/3 receptor pathway. These findings suggest that defective endosomal trafficking of internalized cell surface receptors may be a common mechanism contributing to demyelinating CMT.

Also flagged:cancerbreast canceroncogenesKSR2MAP2K4MSI2
Journal Article 2022-05-19 ✓ 2 Snippets Barbirou M, Miller AA, Gafni E, Mezlini A, Zidi A, Boley N, Tonellato PJ.
In-Text Gene Mentions

Three of these genes, JAK1, FUBP1, and RBM15, are all associated with liver, blood, colorectal and pancreatic cancers; three, TPR, CDC73 and PIK3C2B are all associated with blood and colorectal cancers; and five, JUN, NEGR1, VTCN1, DDR2 and PBX1, are associated with blood, liver, pancreatic, sarcoma and gastric cancer, respectively.

…and five, JUN,NEGR1, VTCN1, DDR2 and…

Show Full Abstract

A cell-free DNA (cfDNA) assay would be a promising approach to early cancer diagnosis, especially for patients with dense tissues. Consistent cfDNA signatures have been observed for many carcinogens. Recently, investigations of cfDNA as a reliable early detection bioassay have presented a powerful opportunity for detecting dense tissue screening complications early. We performed a prospective study to evaluate the potential of characterizing cfDNA as a central element in the early detection of dense tissue breast cancer (BC). Plasma samples were collected from 32 consenting subjects with dense tissue and positive mammograms, 20 with positive biopsies and 12 with negative biopsies. After screening and before biopsy, cfDNA was extracted, and whole-genome next-generation sequencing (NGS) was performed on all samples. Copy number alteration (CNA) and single nucleotide polymorphism (SNP)/insertion/deletion (Indel) analyses were performed to characterize cfDNA. In the positive-positive subjects (cases), a total of 5 CNAs overlapped with 5 previously reported BC-related oncogenes (KSR2, MAP2K4, MSI2, CANT1 and MSI2). In addition, 1 SNP was detected in KMT2C, a BC oncogene, and 9 others were detected in or near 10 genes (SERAC1, DAGLB, MACF1, NVL, FBXW4, FANK1, KCTD4, CAVIN1; ATP6V0A1 and ZBTB20-AS1) previously associated with non-BC cancers. For the positive-negative subjects (screening), 3 CNAs were detected in BC genes (ACVR2A, CUL3 and PIK3R1), and 5 SNPs were identified in 6 non-BC cancer genes (SNIP1, TBC1D10B, PANK1, PRKCA and RUNX2; SUPT3H). This study presents evidence of the potential of using cfDNA somatic variants as dense tissue BC biomarkers from a noninvasive liquid bioassay for early cancer detection.

Also flagged:immune responsemycobacterial infectiontuberculosisTBinfectioninfections
Journal Article 2022-05-19 ✓ 1 Snippet Khan A, Zhang K, Singh VK, Mishra A, Kachroo P, Bing T, Won JH, Mani A, Papanna R, Mann LK, Ledezma-Campos E, Aguillon-Duran G, Canaday DH, David SA, Restrepo BI, Viet NN, Phan H, Graviss EA, Musser JM, Kaushal D, Gauduin MC, Jagannath C.
In-Text Gene Mentions

…Gal3/8 ) andTRIM38are biomarkers for…

Show Full Abstract

Mycobacterium tuberculosis (Mtb) is responsible for approximately 1.5 million deaths each year. Though 10% of patients develop tuberculosis (TB) after infection, 90% of these infections are latent. Further, mice are nearly uniformly susceptible to Mtb but their M1-polarized macrophages (M1-MΦs) can inhibit Mtb in vitro, suggesting that M1-MΦs may be able to regulate anti-TB immunity. We sought to determine whether human MΦ heterogeneity contributes to TB immunity. Here we show that IFN-γ-programmed M1-MΦs degrade Mtb through increased expression of innate immunity regulatory genes (Inregs). In contrast, IL-4-programmed M2-polarized MΦs (M2-MΦs) are permissive for Mtb proliferation and exhibit reduced Inregs expression. M1-MΦs and M2-MΦs express pro- and anti-inflammatory cytokine-chemokines, respectively, and M1-MΦs show nitric oxide and autophagy-dependent degradation of Mtb, leading to increased antigen presentation to T cells through an ATG-RAB7-cathepsin pathway. Despite Mtb infection, M1-MΦs show increased histone acetylation at the ATG5 promoter and pro-autophagy phenotypes, while increased histone deacetylases lead to decreased autophagy in M2-MΦs. Finally, Mtb-infected neonatal macaques express human Inregs in their lymph nodes and macrophages, suggesting that M1 and M2 phenotypes can mediate immunity to TB in both humans and macaques. We conclude that human MФ subsets show unique patterns of gene expression that enable differential control of TB after infection. These genes could serve as targets for diagnosis and immunotherapy of TB.

Also flagged:ORF6interferonIFNSTAT1localizationnuclear localization
Journal Article 2022-05-19 ✓ 1 Snippet Miyamoto Y, Itoh Y, Suzuki T, Tanaka T, Sakai Y, Koido M, Hata C, Wang CX, Otani M, Moriishi K, Tachibana T, Kamatani Y, Yoneda Y, Okamoto T, Oka M.
In-Text Gene Mentions

…also known asCSE1L) with RanGTP, and…

Show Full Abstract

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) ORF6 is an antagonist of interferon (IFN)-mediated antiviral signaling, achieved through the prevention of STAT1 nuclear localization. However, the exact mechanism through which ORF6 prevents STAT1 nuclear trafficking remains unclear. Herein, we demonstrate that ORF6 directly binds to STAT1 with or without IFN stimulation, resulting in the nuclear exclusion of STAT1. ORF6 also recognizes importin α subtypes with different modes, in particular, high affinity to importin α1 but a low affinity to importin α5. Although ORF6 potentially disrupts the importin α/importin β1-mediated nuclear transport, thereby suppressing the nuclear translocation of the other classical nuclear localization signal-containing cargo proteins, the inhibitory effect of ORF6 is modest when compared with that of STAT1. The results indicate that the drastic nuclear exclusion of STAT1 is attributed to the specific binding with ORF6, which is a distinct strategy for the importin α1-mediated pathway. Combined with the results from a newly-produced replicon system and a hamster model, we conclude that SARS-CoV-2 ORF6 acts as a virulence factor via regulation of nucleocytoplasmic trafficking to accelerate viral replication, resulting in disease progression.

Also flagged:infectionlung diseaseschronic obstructive pulmonary diseasesidiopathic pulmonary fibrosiscystic fibrosispulmonary edema
Journal Article 2022-05-19 ✓ 4 Snippets Chen C, Zheng Q, Wu D, Song Y, Xu G.
In-Text Gene Mentions

…long-term outcomes ofDCCfollowing lung transplantation…

…risk factors forDCC.…

…(23%) cases inDCCgroup but did…

…studies indicated thatDCCwas associated with…

Show Full Abstract

<h4>Purpose</h4>The clinical outcomes of delayed chest closure (DCC) compared with primary chest closure (PCC) following lung transplantation, including perioperative outcomes and long-term survival, remained controversial. This was the first systematic review and meta-analysis aimed to identify the short- and long-term outcomes of DCC following lung transplantation.<h4>Methods</h4>We comprehensively searched electronic literature from 4 databases up to April 1st, 2022. Dichotomous data and continuous data were pooled with odds ratio and weighted mean difference, respectively. The quality of included studies was assessed with the Newcastle-Ottawa Scale.<h4>Results</h4>Ten studies were included in the systematic review and 4 studies were included in the meta-analysis. Pooled analysis showed that DCC was associated with an increased risk of surgical site infection, prolonged hospital stays, and higher risk of primary graft dysfunction compared to PCC. The 30 day and 5 year survival were higher in PCC cohort compared with DCC cohort while differences in survival at 6 months was insignificant.<h4>Conclusion</h4>Our findings do not support the aggressive application of DCC. DCC should be cautiously applied since its association with worse perioperative outcomes and higher mortality. But it remains the life-saving steps under dangerous circumstances.

Also flagged:Diffuse intrinsic pontine gliomasDIPGcancerhistonetumorsdiffuse midline glioma
Journal Article 2022-05-19 ✓ 1 Snippet Lewis NA, Klein RH, Kelly C, Yee J, Knoepfler PS.
In-Text Gene Mentions

…including NOTCH1, RAP1GAP,POU3F2, and NEUROD1 as…

Show Full Abstract

<h4>Background</h4>The histone variant H3.3 K27M mutation is a defining characteristic of diffuse intrinsic pontine glioma (DIPG)/diffuse midline glioma (DMG). This histone mutation is responsible for major alterations to histone H3 post-translational modification (PTMs) and subsequent aberrant gene expression. However, much less is known about the effect this mutation has on chromatin structure and function, including open versus closed chromatin regions as well as their transcriptomic consequences.<h4>Results</h4>Recently, we developed isogenic CRISPR-edited DIPG cell lines that are wild-type for histone H3.3 that can be compared to their matched K27M lines. Here we show via ATAC-seq analysis that H3.3K27M glioma cells have unique accessible chromatin at regions corresponding to neurogenesis, NOTCH, and neuronal development pathways and associated genes that are overexpressed in H3.3K27M compared to our isogenic wild-type cell line. As to mechanisms, accessible enhancers and super-enhancers corresponding to increased gene expression in H3.3K27M cells were also mapped to genes involved in neurogenesis and NOTCH signaling, suggesting that these pathways are key to DIPG tumor maintenance. Motif analysis implicates specific transcription factors as central to the neuro-oncogenic K27M signaling pathway, in particular, ASCL1 and NEUROD1.<h4>Conclusions</h4>Altogether our findings indicate that H3.3K27M causes chromatin to take on a more accessible configuration at key regulatory regions for NOTCH and neurogenesis genes resulting in increased oncogenic gene expression, which is at least partially reversible upon editing K27M back to wild-type.

Also flagged:disodiummineraldiabetesmyocardial infarctionMIstroke
Journal Article 2022-05-19 No Snippets Lamas GA, Anstrom KJ, Navas-Acien A, Boineau R, Kim H, Rosenberg Y, Stylianou M, Jones TLZ, Joubert BR, Santella RM, Escolar E, Aude YW, Fonseca V, Elliott T, Lewis EF, Farkouh ME, Nathan DM, Mon AC, Gosnell L, Newman JD, Mark DB, TACT2 Investigators.
Show Full Abstract

<h4>Background</h4>Intravenous edetate disodium-based infusions reduced cardiovascular events in a prior clinical trial. The Trial to Assess Chelation Therapy 2 (TACT2) will replicate the initial study design.<h4>Methods</h4>TACT2 is an NIH-sponsored, randomized, 2x2 factorial, double masked, placebo-controlled, multicenter clinical trial testing 40 weekly infusions of a multi-component edetate disodium (disodium ethylenediamine tetra-acetic acid, or Na<sub>2</sub>EDTA)-based chelation solution and twice daily oral, high-dose multivitamin and mineral supplements in patients with diabetes and a prior myocardial infarction (MI). TACT2 completed enrollment of 1000 subjects in December 2020, and infusions in December 2021. Subjects are followed for 2.5 to 5 years. The primary endpoint is time to first occurrence of all-cause mortality, MI, stroke, coronary revascularization, or hospitalization for unstable angina. The trial has >;85% power to detect a 30% relative reduction in the primary endpoint. TACT2 also includes a Trace Metals and Biorepository Core Lab, to test whether benefits of treatment, if present, are due to chelation of lead and cadmium from patients. Design features of TACT2 were chosen to replicate selected features of the first TACT, which demonstrated a significant reduction in cardiovascular outcomes in the EDTA chelation arm compared with placebo among patients with a prior MI, with the largest effect in patients with diabetes.<h4>Results</h4>Results are expected in 2024.<h4>Conclusion</h4>TACT2 may provide definitive evidence of the benefit of edetate disodiumbased chelation on cardiovascular outcomes, as well as the clinical importance of longitudinal changes in toxic metal levels of participants.

Also flagged:colorectal cancerCircularcancerpathogenesisexonucleasenucleus
Journal Article 2022-05-19 ✓ 2 Snippets Liu LY, Jiang D, Qu Y, Wang H, Zhang Y, Yang S, Xie X, Wu S, Zhou H, Xu G.
In-Text Gene Mentions

The activation of oncogenes such as KRAS or the occurrence of a series of events such as adenomatous polyposis coli gene (APC), DCC and p53 inactivation lead to the gradual evolution of normal intestinal mucosa-adenomato-carcinoma.

…coli gene (APC),DCCand p53 inactivation…

Show Full Abstract

<h4>Background</h4>Circular RNAs (circRNAs) have been discovered in colorectal cancer (CRC), but there are few reports on the expression distribution and functional mining analysis of circRNAs.<h4>Methods</h4>Differentially expressed circRNAs in CRC tissues and adjacent normal tissues were screened and identified by microarray and qRT-PCR. ROC curves of the six circRNAs were analyzed. A series of bioinformatics analyses on differentially expressed circRNAs were performed.<h4>Results</h4>A total of 207 up-regulated and 357 down-regulated circRNAs in CRC were screened, and three top up-regulated and down-regulated circRNAs were chosen to be verified in 33 pairs of CRCs by qRT-PCR. 6 circRNAs showed high diagnostic values (AUC = 0.6860, AUC = 0.8127, AUC = 0.7502, AUC = 0.9945, AUC = 0.9642, AUC = 0.9486 for hsa_circRNA_100833, hsa_circRNA_103828, hsa_circRNA_103831 and hsa_circRNA_103752, hsa_circRNA_071106, hsa_circRNA_102293). A circRNA-miRNA-mRNA regulatory network (cirReNET) including six candidate circRNAs, 19 miRNAs and 210 mRNA was constructed, and the functions of the cirReNET were predicted and displayed via Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses on these mRNAs and protein-protein interaction (PPI) network of the hub genes acquired by string and CytoHubba.<h4>Conclusion</h4>A cirReNET containing potential diagnostic and predictive indicators of CRCs and several critical circRNA-miRNA-mRNA regulatory axes (cirReAXEs) in CRC were mined, and may provide a novel route to study the mechanism and clinical targets of CRC.

Also flagged:MucormycosisCOVID-19invasive fungal infectionsdiabetic ketoacidosisfungal co-infectiondiabetes mellitus
Journal Article 2022-05-19 ✓ 1 Snippet Alemayehu FM, Abate HK, Soboka TA, Huluka DK, Worke AB, Abrie MT, Dibaba DK, Asnake YB.
In-Text Gene Mentions

…therapy, severe burns,hemochromatosis, intravenous drug abusers,…

Show Full Abstract

<h4>Background</h4>There has been a rise in secondary invasive fungal infections reported in COVID-19 patients globally. We report the first published case of COVID-19 associated rhino-orbital-cerebral mucormycosis in Africa in a newly diagnosed diabetic female who presented with diabetic ketoacidosis (DKA) and discuss the prevalence and risk factors of fungal co-infection with the clinical presentation, diagnosis, and management of mucormycosis in COVID-19.<h4>Case presentation</h4>A 39 years old female patient was admitted to ICU with a diagnosis of severe COVID-19 and newly diagnosed diabetes mellitus (DM) with DKA based on HgbA1c of 13.8% and positive RT-PCR. The patient was treated with dexamethasone in line with evidence in the RECOVERY trial and developed right facial and orbital swelling on her second hospital day. Brain MRI showed characteristic peri-sinonasal invasion with central nervous system (CNS) involvement, features suggestive of invasive fungal infection. Despite all medical and surgical treatments including liposomal amphotericin B and debridement, the patient died within 7 days of symptom onset.<h4>Conclusion</h4>Clinicians should be aware of the potential for Rhino-Orbital-Cerebral Mucormycosis (ROCM) as a complication of COVID-19, especially in steroid taking diabetics who develop periorbital swelling and sinusitis. Timely diagnosis and multidisciplinary treatment are very critical.

Also flagged:TRPGliomaprimary tumortransient receptor potential (TRP) channelscancer
Journal Article 2022-05-19 ✓ 1 Snippet Fang C, Xu H, Liu Y, Huang C, Wang X, Zhang Z, Xu Y, Yuan L, Zhang A, Shao A, Lou M.
In-Text Gene Mentions

…CD44, TNFSF18, CD200R1,TNFSF4, CD200, NRP1, CTLA4,…

Show Full Abstract

(1) Background: glioma is the most prevalent primary tumor of the human central nervous system and accompanies extremely poor prognosis in patients. The transient receptor potential (TRP) channels family consists of six different families, which are closely associated with cancer cell proliferation, differentiation, migration, and invasion. TRP family genes play an essential role in the development of tumors. Nevertheless, the function of these genes in gliomas is not fully understood. (2) Methods: we analyze the gene expression data of 28 TRP family genes in glioma patients through bioinformatic analysis. (3) Results: the study showed the aberrations of TRP family genes were correlated to prognosis in glioma. Then, we set enrichment analysis and selected 10 hub genes that may play an important role in glioma. Meanwhile, the expression of 10 hub genes was further established according to different grades, survival time, IDH mutation status, and 1p/19q codeletion status. We found that TRPC1, TRPC3, TRPC4, TRPC5, TRPC6, MCOLN1, MCOLN2, and MCOLN3 were significantly correlated to the prognosis in glioma patients. Furthermore, we illustrated that the expression of hub genes was associated with immune activation and immunoregulators (immunoinhibitors, immunostimulators, and MHC molecules) in glioma. (4) Conclusions: we proved that TRP family genes are promising immunotherapeutic targets and potential clinical biomarkers in patients with glioma.

Also flagged:heat shock proteinsmembranelipidlysophosphatidylinositolsphingolipidendoplasmic reticulum
Journal Article 2022-05-19 No Snippets Tiszlavicz Á, Gombos I, Péter M, Hegedűs Z, Hunya Á, Dukic B, Nagy I, Peksel B, Balogh G, Horváth I, Vígh L, Török Z.
Show Full Abstract

Mild stress could help cells to survive more severe environmental or pathophysiological conditions. In the current study, we investigated the cellular mechanisms which contribute to the development of stress tolerance upon a prolonged (0-12 h) fever-like (40 °C) or a moderate (42.5 °C) hyperthermia in mammalian Chinese Hamster Ovary (CHO) cells. Our results indicate that mild heat triggers a distinct, dose-dependent remodeling of the cellular lipidome followed by the expression of heat shock proteins only at higher heat dosages. A significant elevation in the relative concentration of saturated membrane lipid species and specific lysophosphatidylinositol and sphingolipid species suggests prompt membrane microdomain reorganization and an overall membrane rigidification in response to the fluidizing heat in a time-dependent manner. RNAseq experiments reveal that mild heat initiates endoplasmic reticulum stress-related signaling cascades resulting in lipid rearrangement and ultimately in an elevated resistance against membrane fluidization by benzyl alcohol. To protect cells against lethal, protein-denaturing high temperatures, the classical heat shock protein response was required. The different layers of stress response elicited by different heat dosages highlight the capability of cells to utilize multiple tools to gain resistance against or to survive lethal stress conditions.

Also flagged:extracellularsolid cancerstumorcancergene expressionbreast cancer
Journal Article 2022-05-19 ✓ 1 Snippet Salinas-Vera YM, Valdés J, Hidalgo-Miranda A, Cisneros-Villanueva M, Marchat LA, Nuñez-Olvera SI, Ramos-Payán R, Pérez-Plasencia C, Arriaga-Pizano LA, Prieto-Chávez JL, López-Camarillo C.
In-Text Gene Mentions

…iRNAs, including miR-6780b-5p/ANKRD45and miR-7641/ CDK4…

Show Full Abstract

The 3D organotypic cultures, which depend on the growth of cells over the extracellular matrix (ECM) used as a scaffold, can better mimic several characteristics of solid cancers that influence tumor biology and the response to drug therapies. Most of our current knowledge on cancer is derived from studies in 2D cultures, which lack the ECM-mediated microenvironment. Moreover, the role of miRNAs that is critical for fine-tuning of gene expression is poorly understood in 3D cultures. The aim of this study was to compare the miRNA expression profiles of breast cancer cells grown in 2D and 3D conditions. On an on-top 3D cell culture model using a basement membrane matrix enriched with laminin, collagen IV, entactin, and heparin-sulfate proteoglycans, the basal B (Hs578T) and luminal (T47D) breast cancer cells formed 3D spheroid-like stellate and rounded mass structures, respectively. Morphological changes in 3D cultures were observed as cell stretching, cell-cell, and cell-ECM interactions associated with a loss of polarity and reorganization on bulk structures. Interestingly, we found prolongations of the cytoplasmic membrane of Hs578T cells similar to tunneled nanotubes contacting between neighboring cells, suggesting the existence of cellular intercommunication processes and the possibility of fusion between spheroids. Expression profiling data revealed that 354 miRNAs were differentially expressed in 3D relative to 2D cultures in Hs578T cells. Downregulated miRNAs may contribute to a positive regulation of genes involved in hypoxia, catabolic processes, and focal adhesion, whereas overexpressed miRNAs modulate genes involved in negative regulation of the cell cycle. Target genes of the top ten modulated miRNAs were selected to construct miRNA/mRNA coregulation networks. Around 502 interactions were identified for downregulated miRNAs, including miR-935/<i>HIF1A</i> and miR-5189-3p/<i>AKT</i> that could contribute to cell migration and the response to hypoxia. Furthermore, the expression levels of miR-935 and its target <i>HIF1A</i> correlated with the expression found in clinical tumors and predicted poor outcomes. On the other hand, 416 interactions were identified for overexpressed miRNAs, including miR-6780b-5p/<i>ANKRD45</i> and miR-7641/<i>CDK4</i> that may result in cell proliferation inhibition and cell cycle arrest in quiescent layers of 3D cultures. In conclusion, 3D cultures could represent a suitable model that better resembles the miRNA transcriptional programs operating in tumors, with implications not only in the understanding of basic cancer biology in 3D microenvironments, but also in the identification of novel biomarkers of disease and potential targets for personalized therapies in cancer.

Also flagged:Neuroendocrine Neoplasmstumourstumoursomatostatin receptorprimary tumourGallium
Journal Article 2022-05-19 No Snippets Manneh Kopp R, Espinosa-Olarte P, Alonso-Gordoa T.
Show Full Abstract

Neuroendocrine neoplasms (NENs) are a heterogeneous group of tumours with a diverse behaviour, biology and prognosis, whose incidence is gradually increasing. Their diagnosis is challenging and a multidisciplinary approach is often required. The combination of pathology, molecular biomarkers, and the use of novel imaging techniques leads to an accurate diagnosis and a better treatment approach. To determine the functionality of the tumour, somatostatin receptor expression, differentiation, and primary tumour origin are the main determining tumour-dependent factors to guide treatment, both in local and metastatic stages. Until recently, little was known about the biological behaviour of these tumours. However, in recent years, many advances have been achieved in the molecular characterization and diagnosis of NENs. The incorporation of novel radiotracer-based imaging techniques, such as <sup>68</sup>Gallium-DOTATATE PET-CT, has significantly increased diagnostic sensitivity, while introducing the theragnosis concept, offering new treatment strategies. Here, we will review current knowledge and novelties in the diagnosis of NENs, including molecular biology, pathology, and new radiotracers.

Also flagged:mucopolysaccharidosis type IIIBMPS IIIBSanfilippo B syndromegrowth arresthypogonadotropic hypogonadismcongenital heart disease
Journal Article 2022-05-19 ✓ 1 Snippet Fernández-Hernández L, Reyna-Fabián ME, Alcántara-Ortigoza MA, Aláez-Verson C, Flores-Lagunes LL, Carrillo-Sánchez K, González-Del Angel A.
In-Text Gene Mentions

…is responsible forhemochromatosistype 3 (HFE3,…

Show Full Abstract

We present an unusual Mexican patient affected with mucopolysaccharidosis type IIIB (MPS IIIB; also called Sanfilippo B syndrome, MIM #252920) bearing clinical features that have not previously been described for MPS IIIB (growth arrest, hypogonadotropic hypogonadism, and congenital heart disease). Chromosomal microarray analysis was useful in identifying runs of homozygosity at 17q11.1-q21.33 and supporting the diagnosis of an underlying autosomal recessive condition. Sanger sequencing of <i>NAGLU</i> (17q21.2, MIM*609701) allowed us to identify a pathogenic homozygous p.(Arg234Cys) genotype. This <i>NAGLU</i> allele could be related to that previously described in an Iberian MPS IIIB founder haplotype; results from the polymorphic marker D17S800 and rs2071046 led us to hypothesize that it may have been introduced to Mexico through the Spanish settlement. The analysis of a clinical exome sequencing ruled out other monogenic etiologies for the previously undescribed clinical MPS IIIB manifestations. Our findings contribute to further delineating the MPS IIIB phenotype and suggest possible phenotype-genotype correlations.

Also flagged:Lung cancercancersmall-cell lung carcinomaSCLCnon-small-cell lung carcinomaNSCLC
Journal Article 2022-05-19 ✓ 1 Snippet Zhao F, Tian H, Liu X, Guan Y, Zhu Y, Ren P, Zhang J, Dong Y, Fu L.
In-Text Gene Mentions

…CTLA4, LAIR1, ICOS,TNFSF4, CD274, CD44, PDCD1LG2,…

Show Full Abstract

<h4>Objective</h4>Recent studies have demonstrated that homeobox A1 (HOXA1) is upregulated in lung cancer due to RNA modifications (N<sup>6</sup>-methyladenosine), but the specific function of HOXA1 in lung adenocarcinoma (LUAD) remains indistinct. Herein, we investigated the role of HOXA1 in LUAD biology.<h4>Methods</h4>This study presented pancancer analysis of associations of HOXA1 with prognosis, TMB, and immune checkpoints. The expression of HOXA1 was detected in LUAD and normal tissues with immunohistochemistry and western blot. Through least absolute shrinkage and selection operator (LASSO) analysis, HOXA1-derived gene model was conducted in LUAD. Correlations of HOXA1 with immune cell infiltrations, immune checkpoints, HLAs, and chemotherapeutic sensitivity were evaluated. Colony formation, proliferation, and migration of LUAD cells with si-HOXA1 transfection were investigated, and the effects of HOXA1 on T cell exhaustion were assessed <i>in vitro</i>.<h4>Results</h4>HOXA1 expression was a risk factor of overall survival, disease-specific survival, and progression-free interval of LUAD. HOXA1 exhibited prominent associations with immune cell infiltration, immune checkpoints, and HLAs. HOXA1-derived gene signature reliably and independently predicted LUAD outcomes. Also, high-risk cases presented increased sensitivity to cisplatin, paclitaxel, docetaxel, vinorelbine, and etoposide. HOXA1 knockdown exhibited an inhibitory effect on proliferation and migration abilities of LUAD cells. Silencing HOXA1 weakened the expression of antioxidative stress markers Nrf2/HO-1 and T cell exhaustion marker CD155 in LUAD cells. Moreover, LUAD cells with HOXA1 knockdown enhanced the CD8+ T cell response.<h4>Conclusion</h4>Our data support the oncogenic function and prognostic significance of HOXA1 that facilitates immune escape and alleviates oxidative stress of LUAD.

Also flagged:Oral Squamous Cell CarcinomaType 2 DiabetesOSCCgene expressionCD8C1QC
Journal Article 2022-05-19 ✓ 5 Snippets Fan Y, Zhang J, Shi J, Chen L, Long J, Zhang S, Liu S.
In-Text Gene Mentions

No data regarding CSE1L and diabetes are available, making its role in T2D-related OSCC questionable.

There were five common genes (IL1RN, ABCD1, ALOX15, CSE1L, and PSMC4) in OSCC and T2D, which we marked as DE_Immune genes set 2.

The four genes, ABCD1, C1QC, CSE1L, and PSMC4, are immune-related genes and are differentially expressed in T2D and OSCC, playing a role as a bridge between the two diseases.

Four genes, i.e., ABCD1, C1QC, CSE1L, and PSMC4, were the most important immune-related cross-talk genes between T2D and OSCC.

CSE1L (human chromosomal segregation 1-like), which is an effector of apoptosis, invasiveness, and migration of cancer cells, was already found to be related with oral cancer [40].

Show Full Abstract

<h4>Background</h4>This bioinformatics study was aimed at evaluating type 2 diabetes (T2D) and oral squamous cell carcinoma (OSCC) with regard to related immune cells and prognosis.<h4>Methods</h4>We downloaded the data on OSCC from TCGA and for T2D from GEO database. Differentially expressed genes were analyzed, i.e., for OSCC genes with <i>p</i> value < 0.01, |log2(FC)| > 0; and for T2D, genes with <i>p</i> value < 0.05, |log2(FC)| > 0. The intersected genes between OSCC and T2D were cross-talk genes. The expression values of immune-related genes in case samples in OSCC and T2D were assessed and underwent multivariate and univariate analysis (Cox-PH model). The intersection between the immune genes and cross-talk genes was taken and further analyzed by recursive feature elimination (RFE), survival analysis, and ROC analysis.<h4>Results</h4>1008 cross-talk genes were acquired, including 28 common upregulated, 440 common downregulated, and 540 differently regulated DEGs. We extracted the gene expression value of 782 immune-related genes, of which seven increased immune cells were obtained. From the results, plasmacytoid dendritic cells and effector memory CD8 T cells were highly negatively correlated in both OSCC and T2D. After estimating a low- and high-risk model for survival, we found that activated dendritic cell was significantly different between high and low groups (<i>p</i> = 0.0095), followed by plasmacytoid dendritic cell. We integrated DE_Immune genes set 1 and DE_Immune genes set 2 and eight key immune-related cross-talk genes (C1QC, ABCD1, NOS2, PDIA4, IL1RN, ALOX15, CSE1L, and PSMC4) were evaluated. After ROC analysis, we obtained that ABCD1, C1QC, CSE1L, and PSMC4 had higher classification and prediction effects on OSCC and T2D.<h4>Conclusion</h4>This study revealed a close relationship between T2D and OSCC. Thereby, plasmacytoid dendritic cell and activated dendritic cell-related genes were associated with the survival of T2D-related OSCC, while ABCD1, C1QC, CSE1L, and PSMC4 were the most important immune-related cross-talk genes.

Also flagged:cognitive declinephenolcognitionlipoproteincholesterolneurological disease
Journal Article 2022-05-19 ✓ 2 Snippets Flanagan E, Cameron D, Sobhan R, Wong C, Pontifex MG, Tosi N, Mena P, Del Rio D, Sami S, Narbad A, Müller M, Hornberger M, Vauzour D.
In-Text Gene Mentions

…<88 on theACE-III, or had abnormal…

…this was theACE-III, which was conducted…

Show Full Abstract

<h4>Background</h4>Ageing is highly associated with cognitive decline and modifiable risk factors such as diet are believed to protect against this process. Specific dietary components and in particular, (poly)phenol-rich fruits such as berries have been increasingly recognised for their protection against age-related neurodegeneration. However, the impact of cranberries on cognitive function and neural functioning in older adults remains unclear.<h4>Design</h4>A 12-week parallel randomised placebo-controlled trial of freeze-dried cranberry powder was conducted in 60 older adults aged between 50 and 80 years. Cognitive assessment, including memory and executive function, neuroimaging and blood sample collection were conducted before and after the intervention to assess the impact of daily cranberry consumption on cognition, brain function and biomarkers of neuronal signalling.<h4>Results</h4>Cranberry supplementation for 12 weeks was associated with improvements in visual episodic memory in aged participants when compared to placebo. Mechanisms of action may include increased regional perfusion in the right entorhinal cortex, the accumbens area and the caudate in the cranberry group. Significant decrease in low-density lipoprotein (LDL) cholesterol during the course of the intervention was also observed. No significant differences were, however, detected for BDNF levels between groups.<h4>Conclusions</h4>The results of this study indicate that daily cranberry supplementation (equivalent to 1 small cup of cranberries) over a 12-week period improves episodic memory performance and neural functioning, providing a basis for future investigations to determine efficacy in the context of neurological disease. This trial was registered at clinicaltrials.gov as NCT03679533 and at ISRCTN as ISRCTN76069316.

Also flagged:CRALBPGSROretinal disordersSOX9extracellular
Journal Article 2022-05-19 ✓ 1 Snippet Ning R, Zheng D, Xie B, Gao G, Xu J, Xu P, Wang Y, Peng F, Jiang B, Ge J, Zhong X.
In-Text Gene Mentions

…as GRM6 andCA10, were downregulated…

Show Full Abstract

Müller glial cells (MGCs) play important roles in human retina during physiological and pathological conditions. However, the development process of human MGCs <i>in vivo</i> remains unclear, and how to obtain large numbers of human MGCs with high quality faces technical challenges, which hinder the further study and application of MGCs. Human induced pluripotent stem cell (hiPSC)-derived retinal organoids (ROs) with all retinal cell subtypes provide an unlimited cell resource and a platform for the studies of retinal development and disorders. This study explored the development of human MGCs in hiPSC-derived ROs and developed an approach to select and expand the induced MGCs (iMGCs). In ROs, retinal progenitor cells progressively differentiated into SOX9+ Ki67- MGC precursors during differentiation day (D) 60 to D90, while mature MGCs expressing markers CRALBP and GS gradually appeared since D120, which spanned the entire thickness of the neural retina layer. Cells isolated from ROs aged older than 120 days was an optimal source for the enrichment of iMGCs with high purity and expansion ability. They had typical features of human MGCs in morphological, structural, molecular and functional aspects, and could be passaged serially at least 10 times, yielding large numbers of cells in a short period. The transcriptome pattern of the expanded iMGCs was also revealed. This study firstly clarified the timecourse of human MGC development in the RO model, where the iMGCs could be enriched and expanded, paving the way for downstream investigation and application in MGC-related retinal disorders.

Also flagged:AntibodyPrimary Biliary CholangitisUrsodeoxycholic AcidAMAalkaline phosphatasecirrhosis
Journal Article 2022-05-19 ✓ 1 Snippet Chang ML, Chen WT, Chan TM, Lin CY, Chang MY, Chen SC, Chien RN.
In-Text Gene Mentions

…virus (HCV) infection,hemochromatosis, primary cancer, or…

Show Full Abstract

<h4>Background</h4>How anti-mitochondrial antibody (AMA) and liver biochemistry levels change in primary biliary cholangitis (PBC) patients treated with ursodeoxycholic acid (UDCA) remains unclear.<h4>Methods</h4>A 28-year cohort of 157 PBC patients was conducted. Patients with alkaline phosphatase (Alk-p) levels >1.67 × upper limit of normal after 1 year of UDCA treatment were considered nonresponders.<h4>Results</h4>At baseline, of 157 (mean age: 54.41 years), 136 (86.6%) were female, 51 (32.5%) had cirrhosis, and 128 (81.5%) had detectable AMAs (immunoglobulin G). UDCA nonresponders (n=61) were younger and had higher Alk-p and total bilirubin levels and cirrhosis rates than UDCA responders (n=84). Alk-p levels and cirrhosis were negatively associated with UDCA response. Regardless of cirrhosis and UDCA response, most PBC patients had decreased Alk-p and γ-glutamyltransferase levels at last follow-up (up to 28.73 years) compared with baseline levels. Patients with baseline cirrhosis (2.78 ± 2.56 vs. 6.84 ± 9.00 mg/dL, <i>p</i>=0.024) and UDCA nonresponders (2.54 ± 2.19 vs. 4.51 ± 6.99 mg/dL, <i>p</i>=0.006) had increased total bilirubin levels while patients without cirrhosis (AST: 91.5 ± 84.5 vs. 58.9 ± 43.7 U/L, <i>p</i><0.001; ALT: 107.3 ± 122.5 vs. 50.7 ± 36.8 U/L, <i>p</i><0.001) and UDCA responders (AST: 83.8 ± 101.3 vs. 45.58 ± 38.42 U/L, <i>p</i>=0.014; ALT: 95.10 ± 144.6 vs. 39.12 ± 30.65 U/L, <i>p</i>=0.009) had decreased aminotransferase levels. Only UDCA responders had decreased AMA titers from 1 year after UDCA treatment (<i>p</i>=0.028) until the last follow-up (<i>p</i><0.001).<h4>Conclusions</h4>UDCA responders exhibited decreased AMA titers 1 year after treatment. Regardless of UDCA response, PBC patients showed improved cholestatic features, but only UDCA responders and patients without baseline cirrhosis exhibited attenuated hepatobiliary damage following UDCA treatment.

Also flagged:MCM10ovarian cancerTumorpolymeraseCD8CD4
Journal Article 2022-05-19 ✓ 2 Snippets Wu Z, Wang Y, Li J, Wang H, Tuo X, Zheng J.
In-Text Gene Mentions

…immune checkpoints CTLA4,TNFSF4, TNFSF18, CD80, ICOSLG,…

…LGALS9, ICOSLG, TNFSF9,TNFSF4, CD70, TNFSF18, CD48,…

Show Full Abstract

<b>Background:</b> Microchromosome maintenance protein 10 (MCM10) is required for DNA replication in all eukaryotes, and it plays a key role in the development of many types of malignancies. However, we currently still do not know the relationship between MCM10 and ovarian cancer (OV) prognosis and immune checkpoints. <b>Methods</b>: The Gene Expression Profiling Interactive Analysis and Tumor Immunology Estimation Resource (TIMER) databases were used to investigate MCM10 expression in Fan cancer. The Kaplan-Meier Plotter and PrognoScan were used to assess the relationship between MCM10 and OV prognosis. The LinkedOmics database was used to analyze the MCM10 co-expression network and explore GO term annotation and the KEGG pathway. The relationship between MCM10 expression and immune infiltration in OV was investigated using the Tumor Immunology Estimation Resource database. cBioPortal database was used to explore the relationship between MCM10 expression and 25 immune checkpoints. Finally, quantitative real-time polymerase chain reaction (qRT-PCR) was performed to detect MCM10 expression. The prognosis was also analyzed by distinguishing between high and low expression groups based on median expression values. <b>Results</b>: The results of the three data sets (220,651_s_at, 222,962_s_at and 223,570_at) in KM Plotter all indicated that the overall survivalof the high MCM10 expression group was lower than that of the low expression group OV, and the results of GSE9891 also reached the same conclusion. The expression level of MCM10 was negatively correlated with B cells and CD8+T cells, and positively correlated with CD4+T Cells and Macrophages. GO term annotation and KEGG pathway analysis showed that the co-expressed genes of MCM10 were mainly enriched in cell cycle and DNA replication. The alterations in MCM10 coexisted statistically with the immune checkpoints CTLA4, TNFSF4, TNFSF18, CD80, ICOSLG, LILRB1 and CD200. PCR results displayed that MCM10 was highly expressed in OV tissues, and the increased expression of MCM10 was significantly associated with poor overall survival. <b>Conclusion</b>: These results demonstrated that high expression of MCM10 was associated with poor prognosis in OV and correlated with immune checkpoints.

Also flagged:nucleotidescancerscancerLINC00665gastrointestinal tumorsgynecological tumors
Journal Article 2022-05-19 ✓ 1 Snippet Zhang C, Xu SN, Li K, Chen JH, Li Q, Liu Y.
In-Text Gene Mentions

…regulation through ceRNA,STAU1-mediated mRNA degradation, in…

Show Full Abstract

Long non-coding RNAs (lncRNAs) are more than 200 nucleotides in length and are implicated in the development of human cancers, without protein-coding function. Mounting evidence indicates that cancer initiation and progression are triggered by lncRNA dysregulation. Recently, a growing number of studies have found that LINC00665, a long intergenic non-protein coding RNA, may be associated with various cancers, including gastrointestinal tumors, gynecological tumors, and respiratory neoplasms. LINC00665 was reported to be significantly dysregulated in cancers and has an important clinical association. It participates in cell proliferation, migration, invasion, and apoptosis through different biological pathways. In this review, we summarize the current findings on LINC00665, including its biological roles and molecular mechanisms in various cancers. LINC00665 may be a potential prognostic biomarker and novel therapeutic target for cancers.

Also flagged:Weak DepressionLipidCatabolismweakdepressionbehavioral
Journal Article 2022-05-19 ✓ 4 Snippets Shimada K, Nohara M, Yasuoka A, Kamei A, Shinozaki F, Kondo K, Inoue R, Kondo T, Abe K.
In-Text Gene Mentions

…SH condition, Huntingtin (HTT) and protein kinase…

…that express mutatedHTTprotein have been…

…is possible thatHTT-related signaling may be…

…cAMP, NR3C2, andHTTsignals in the…

Show Full Abstract

To establish a mouse model of weak depression, we raised 6-week-old C57BL/6N mice in single (SH) or group housing (GH) conditions for 2 weeks. The SH group showed less social interaction with stranger mice, learning disability in behavioral tests, and lower plasma corticosterone levels. The cecal microbiota of the SH group showed significant segregation from the GH group in the principal coordinate analysis (PCoA). Transcriptome analysis of the amygdala and liver detected multiple differentially expressed genes (DEGs). In the amygdala of SH mice, suppression of the cyclic adenine monophosphate (cAMP) signal was predicted and confirmed by the reduced immunoreactivity of phosphorylated cAMP-responsive element-binding protein. In the liver of SH mice, downregulation of beta-oxidation was predicted. Interestingly, the expression levels of over 100 DEGs showed a significant correlation with the occupancy of two bacterial genera, <i>Lactobacillus</i> (Lactobacillaceae) and <i>Anaerostipes</i> (Lachnospiraceae). These bacteria-correlated DEGs included JunB, the downstream component of cAMP signaling in the amygdala, and carnitine palmitoyltransferase 1A (Cpt1a), a key enzyme of beta-oxidation in the liver. This trans-omical analysis also suggested that nicotinamide adenine dinucleotide (NAD) synthesis in the liver may be linked to the occupancy of <i>Lactobacillus</i> through the regulation of nicotinamide phosphoribosyltransferase (NAMPT) and kynureninase (KYNU) genes. Our results suggested that SH condition along with the presence of correlated bacteria species causes weak depression phenotype in young mice and provides a suitable model to study food ingredient that is able to cure weak depression.

Also flagged:KCNMA1obesityhypertension
Journal Article 2022-05-19 No Snippets Zhou Y, Zhao Y, Zha L, Zhou M, Wang M, Cheng X, Huang Z, Liu M, Ke T, Tu X.
Show Full Abstract

No abstract available.

Also flagged:ironpostpartum hemorrhagegenetic disorderssynthesisCASPanemia
Journal Article 2022-05-18 No Snippets Peberdy L, Young J, Massey D, Kearney L.
Show Full Abstract

<h4>Background</h4>Umbilical cord clamp timing has implications for newborn health, which include increased iron stores up to 6 months of age. National and International cord clamping guidelines differ as do health professionals' practices. The rationale for differences in cord clamping practice is unclear.<h4>Aims and objective</h4>Studies on the knowledge, attitudes, and practices of maternity health care professionals about cord clamp timing were synthesized. Similarities and differences between professional groups and understanding of the optimal timing of cord clamp timing for term newborns were compared.<h4>Methods</h4>An integrative review was undertaken. PubMed, Scopus, MIDIRS, CINAHL, and Google Scholar were searched. Publication date limits were set between January 2007 and December 2020. Quality appraisal was undertaken using the Critical Appraisal Skills Program (CASP) tools.<h4>Results</h4>Eighteen studies met inclusion criteria, as they included primary research studies that investigated maternity health care professionals' knowledge, attitudes, and practices about umbilical cord clamping, and were written in English. Four main subject areas were identified: a) knowledge of optimal cord clamp timing; b) attitudes and perceptions of early vs deferred cord clamping; c) cord clamping practice; and d) rationale for cord clamping practice.<h4>Conclusions</h4>Different attitudes and practices were identified between midwifery and medical professionals in relation to cord clamp timing together with health professional knowledge and practice gaps pertaining to optimal cord clamp timing. Contemporary evidence should inform guidelines for clinical practice and be embedded into maternity health professional curricula and professional development programs.

Also flagged:DDX5METTL3METTL14YTHDF2DEAD/H-box helicasesmetabolism
Journal Article 2022-05-18 ✓ 2 Snippets Zhao L, Zhao Y, Liu Q, Huang J, Lu Y, Ping J, Ping J.
In-Text Gene Mentions

…DDX15, DDX17, DDX58,DDX27, METTL3, METTL14, or…

…DHX9, DDX15, DDX17,DDX27, and DDX58.…

Show Full Abstract

DEAD-box helicase 5 (DDX5), a member of the DEAD/H-box helicases, is known to participate in all aspects of RNA metabolism. However, its regulatory effect in antiviral innate immunity during replication of influenza virus remains unclear. Herein, we found that human DDX5 promotes replication of influenza virus in A549 cells. Moreover, our results further revealed that DDX5 relies on its N terminus to interact with the nucleoprotein (NP) of influenza virus, which is independent of RNA. Of course, we also observed colocalization of DDX5 with NP in the context of transfection or infection. However, influenza virus infection had no significant effect on the protein expression and nucleocytoplasmic distribution of DDX5. Importantly, we found that DDX5 suppresses antiviral innate immunity induced by influenza virus infection. Mechanistically, DDX5 downregulated the mRNA levels of interferon beta (IFN-β), interleukin 6 (IL-6), and DHX58 via the METTL3-METTL14/YTHDF2 axis. We revealed that DDX5 bound antiviral transcripts and regulated immune responses through YTHDF2-dependent mRNA decay. Taken together, our data demonstrate that the DDX5/METTL3-METTL14/YTHDF2 axis regulates the replication of influenza A virus. <b>IMPORTANCE</b> The replication and transcription of influenza virus depends on the participation of many host factors in cells. Exploring the relationship between viruses and host factors will help us fully understand the characteristics and pathogenic mechanisms of influenza viruses. In this study, we showed that DDX5 interacted with the NP of influenza virus. We demonstrated that DDX5 downregulated the expression of IFN-β and IL-6 and the transcription of antiviral genes downstream from IFN-β in influenza virus-infected A549 cells. Additionally, DDX5 downregulated the mRNA levels of antiviral transcripts via the METTL3-METTL14/YTHDF2 axis. Our findings provide a novel perspective to understand the mechanism by which DDX5 regulates antiviral immunity.

Also flagged:membranesextracellularlaminintype IV collagencell surfaceglycoprotein
Journal Article 2022-05-18 ✓ 2 Snippets Jayadev R, Morais MRPT, Ellingford JM, Srinivasan S, Naylor RW, Lawless C, Li AS, Ingham JF, Hastie E, Chi Q, Fresquet M, Koudis NM, Thomas HB, O'Keefe RT, Williams E, Adamson A, Stuart HM, Banka S, Smedley D, Genomics England Research Consortium, Sherwood DR, Lennon R.
In-Text Gene Mentions

…the netrin receptorDCC/UNC-40, and ROBO (…

…protein (ACAN), teneurins,DCC, and ROBO, suggesting…

Show Full Abstract

Basement membranes (BMs) are ubiquitous extracellular matrices whose composition remains elusive, limiting our understanding of BM regulation and function. By developing a bioinformatic and in vivo discovery pipeline, we define a network of 222 human proteins and their animal orthologs localized to BMs. Network analysis and screening in <i>C. elegans</i> and zebrafish uncovered BM regulators, including ADAMTS, ROBO, and TGFβ. More than 100 BM network genes associate with human phenotypes, and by screening 63,039 genomes from families with rare disorders, we found loss-of-function variants in <i>LAMA5</i>, <i>MPZL2</i>, and <i>MATN2</i> and show that they regulate BM composition and function. This cross-disciplinary study establishes the immense complexity of BMs and their impact on in human health.

Also flagged:Autophagyautophagy-relatedautophagy-related proteincytoplasmiclysosomeorganelles
Journal Article 2022-05-18 ✓ 1 Snippet González-Rodríguez P, Klionsky DJ, Joseph B.
In-Text Gene Mentions

…RETREG1/FAM134B, SEC62, andCCPG1on ER sheets,…

Show Full Abstract

Autophagy and RNA alternative splicing are two evolutionarily conserved processes involved in overlapping physiological and pathological processes. However, the extent of functional connection is not well defined. Here, we consider the role for alternative splicing and generation of autophagy-related gene isoforms in the regulation of autophagy in recent work. The impact of changes to the RNA alternative splicing machinery and production of alternative spliced isoforms on autophagy are reviewed with particular focus on disease relevance. The use of drugs targeting both alternative splicing and autophagy as well as the selective regulation of single autophagy-related protein isoforms, are considered as therapeutic strategies.

Also flagged:gene expressiontranscription factorbindingtranscription factorsTFchromatin
Journal Article 2022-05-18 No Snippets Jaura R, Yeh SY, Montanera KN, Ialongo A, Anwar Z, Lu Y, Puwakdandawa K, Rhee HS.
Show Full Abstract

Mammalian genomes comprise largely intergenic noncoding DNA with numerous cis-regulatory elements. Whether and how the size of intergenic DNA affects gene expression in a tissue-specific manner remain unknown. Here we show that genes with extended intergenic regions are preferentially expressed in neural tissues but repressed in other tissues in mice and humans. Extended intergenic regions contain twice as many active enhancers in neural tissues compared to other tissues. Neural genes with extended intergenic regions are globally co-expressed with neighboring neural genes controlled by distinct enhancers in the shared intergenic regions. Moreover, generic neural genes expressed in multiple tissues have significantly longer intergenic regions than neural genes expressed in fewer tissues. The intergenic regions of the generic neural genes have many tissue-specific active enhancers containing distinct transcription factor binding sites specific to each neural tissue. We also show that genes with extended intergenic regions are enriched for neural genes only in vertebrates. The expansion of intergenic regions may reflect the regulatory complexity of tissue-type-specific gene expression in the nervous system.

Also flagged:synaptic scaffold proteinDlgap4neuronal migrationheterotopiasepilepsyintellectual disability
Journal Article 2022-05-18 ✓ 2 Snippets Romero DM, Poirier K, Belvindrah R, Moutkine I, Houllier A, LeMoing AG, Petit F, Boland A, Collins SC, Soiza-Reilly M, Yalcin B, Chelly J, Deleuze JF, Bahi-Buisson N, Francis F.
In-Text Gene Mentions

Subependymal nodular heterotopias have been described in patients with chromosomal rearrangements, as well as associated with intragenic gene mutations (e.g., in FLNA, ARFGEF2, DCHS1, FAT4, ERMARD, and NEDD4L).

…in FLNA ,ARFGEF2, DCHS1 ,…

Show Full Abstract

Subcortical heterotopias are malformations associated with epilepsy and intellectual disability, characterized by the presence of ectopic neurons in the white matter. Mouse and human heterotopia mutations were identified in the microtubule-binding protein Echinoderm microtubule-associated protein-like 1, EML1. Further exploring pathological mechanisms, we identified a patient with an EML1-like phenotype and a novel genetic variation in DLGAP4. The protein belongs to a membrane-associated guanylate kinase family known to function in glutamate synapses. We showed that DLGAP4 is strongly expressed in the mouse ventricular zone (VZ) from early corticogenesis, and interacts with key VZ proteins including EML1. In utero electroporation of Dlgap4 knockdown (KD) and overexpression constructs revealed a ventricular surface phenotype including changes in progenitor cell dynamics, morphology, proliferation and neuronal migration defects. The Dlgap4 KD phenotype was rescued by wild-type but not mutant DLGAP4. Dlgap4 is required for the organization of radial glial cell adherens junction components and actin cytoskeleton dynamics at the apical domain, as well as during neuronal migration. Finally, Dlgap4 heterozygous knockout (KO) mice also show developmental defects in the dorsal telencephalon. We hence identify a synapse-related scaffold protein with pleiotropic functions, influencing the integrity of the developing cerebral cortex.

Also flagged:Uterine fibroidsleiomyomasneoplasms of the myometriumtumorsbenign smooth muscle tumorsextracellular
Journal Article 2022-05-18 ✓ 5 Snippets Banerjee S, Xu W, Chowdhury I, Driss A, Ali M, Yang Q, Al-Hendy A, Thompson WE.
In-Text Gene Mentions

The organoids were harvested to measure the established estrogen- and progesterone-stimulated genes, e.g., PCNA (proliferating cell nuclear antigen), CTGF (connective tissue growth factor), ET1 (endothelin 1), OLFM4 (olfactomedin-4), IHH (Indian hedgehog), SPP1 (secreted phosphoprotein 1), and PAEP (progestogen associated endometrial protein) in stem-cell-derived organoids obtained from both normal (MyoN) and fibroid tissues by RT-qPCR.

…ET1 (endothelin 1),OLFM4(olfactomedin-4), IHH (Indian…

…the stemness geneOLFM4in the fallopian…

…where E2 stimulatesOLFM4expression [ 64…

…significantly amplified theOLFM4expression in UFSC…

Show Full Abstract

Uterine fibroids (UFs) (leiomyomas or myomas) are the most common clonal neoplasms of the uterus in women of reproductive age worldwide. UFs originate from myometrium consist of smooth muscle and fibroblast components, in addition to a substantial amount of fibrous extracellular matrix which all contribute to the pathogenetic process. Current treatments are primarily limited to surgical and interventional. Here, we have established a novel and promising organoid model from both normal and patient myometrial stem cells (MMSCs). MMSCs embedded in Matrigel in stem cell media swiftly formed organoids which successfully proliferate and self-organized into complex structures developing a sustainable organoid culture that maintain their capacity to differentiate into the different cell types recapitulating their tissue of origin and shows responsiveness to the reproductive hormones (estrogen and progesterone). Gene expression analysis and structural features indicated the early onset of uterine fibrosis led to the accumulation of extracellular matrix suggesting the potential use of this model in better understanding of the pathophysiology associated with UFs and inventing novel therapeutics for the treatment of UFs.

Also flagged:cancercancerstumorvascular endothelial growth factorVEGFtransforming growth factor-beta
Journal Article 2022-05-18 No Snippets Tie Y, Tang F, Wei YQ, Wei XW.
Show Full Abstract

Immunotherapies like the adoptive transfer of gene-engineered T cells and immune checkpoint inhibitors are novel therapeutic modalities for advanced cancers. However, some patients are refractory or resistant to these therapies, and the mechanisms underlying tumor immune resistance have not been fully elucidated. Immunosuppressive cells such as myeloid-derived suppressive cells, tumor-associated macrophages, tumor-associated neutrophils, regulatory T cells (Tregs), and tumor-associated dendritic cells are critical factors correlated with immune resistance. In addition, cytokines and factors secreted by tumor cells or these immunosuppressive cells also mediate the tumor progression and immune escape of cancers. Thus, targeting these immunosuppressive cells and the related signals is the promising therapy to improve the efficacy of immunotherapies and reverse the immune resistance. However, even with certain success in preclinical studies or in some specific types of cancer, large perspectives are unknown for these immunosuppressive cells, and the related therapies have undesirable outcomes for clinical patients. In this review, we comprehensively summarized the phenotype, function, and potential therapeutic targets of these immunosuppressive cells in the tumor microenvironment.

Also flagged:Growth hormoneGHGH receptorIGF1metabolismcritical illnesses
Journal Article 2022-05-18 No Snippets Shao X, Le Stunff C, Cheung W, Kwan T, Lathrop M, Pastinen T, Bougnères P.
Show Full Abstract

<h4>Background</h4>Recombinant human growth hormone (rhGH) has shown a great growth-promoting potential in children with idiopathic short stature (ISS). However, the response to rhGH differs across individuals, largely due to genetic and epigenetic heterogeneity. Since epigenetic marks on the methylome can be dynamically influenced by GH, we performed a comprehensive pharmacoepigenomics analysis of DNA methylation changes associated with long-term rhGH administration in children with ISS.<h4>Results</h4>We measured DNA methylation profiles before and after GH treatment (with a duration of ~ 18 months in average) on 47 healthy children using customized methylC-seq capture sequencing. Their changes were compared and associated with changes in plasma IGF1 by adjusting sex, age, treatment duration and estimated blood proportions. We observed a considerable inter-individual heterogeneity of DNA methylation changes responding to GH treatment. We identified 267 response-associated differentially methylated cytosines (DMCs) that were enriched in promoter regions, CpG islands and blood cell-type-specific regulatory elements. Furthermore, the genes associated with these DMCs were enriched in the biology process of "cell development," "neuron differentiation" and "developmental growth," and in the TGF-beta signaling pathway, PPAR Alpha pathway, endoderm differentiation pathway, adipocytokine signaling pathway as well as PI3K-Akt signaling pathway, and cAMP signaling pathway.<h4>Conclusion</h4>Our study provides a first insight in DNA methylation changes associated with rhGH administration, which may help understand mechanisms of epigenetic regulation on GH-responsive genes.

Also flagged:gene expressioninfectionDTMUV infectionsignal transductionvirus infectioncell proliferation
Journal Article 2022-05-18 ✓ 2 Snippets Pan Y, Wu X, Cai W, Cheng A, Wang M, Chen S, Huang J, Yang Q, Wu Y, Sun D, Mao S, Zhu D, Liu M, Zhao X, Zhang S, Gao Q, Ou X, Tian B, Yin Z, Jia R.
In-Text Gene Mentions

TNFSF4/5/10 and TNFRSF4/8/9/13B were influenced during DTMUV infection and all these factors function as important proinflammatory genes and play vital roles in the inflammatory response [46, 47].

TNFSF4/5/10 and TNFRSF4/8/9/13B were…

Show Full Abstract

Duck Tembusu virus (DTMUV), a member of the family Flaviviridae and an economically important pathogen with a broad host range, leads to markedly decreased egg production. However, the molecular mechanism underlying the host-DTMUV interaction remains unclear. Here, we performed high-throughput RNA sequencing (RNA-Seq) to study the dynamic changes in host gene expression at 12, 24, 36, 48 and 60 h post-infection (hpi) in duck embryo fibroblasts (DEF) infected with DTMUV. A total of 3129 differentially expressed genes (DEG) were identified after DTMUV infection. Gene Ontology (GO) category and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis revealed that these DEG were associated with multiple biological functions, including signal transduction, host immunity, virus infection, cell apoptosis, cell proliferation, and pathogenicity-related and metabolic process signaling pathways. This study analyzed viral infection and host immunity induced by DTMUV infection from a novel perspective, and the results provide valuable information regarding the mechanisms underlying host-DTMUV interactions, which will prove useful for the future development of antiviral drugs or vaccines for poultry, thus benefiting the entire poultry industry.

Also flagged:genetic diseasegenetic diseasesX-chromosomefertilizationhuman leukocyte antigenHLA
Journal Article 2022-05-18 No Snippets Nakasato K, Yamamoto BA, Kato K.
Show Full Abstract

<h4>Background</h4>A number of countries are leading the way in creating regulatory frameworks for preimplantation genetic testing (PGT). Among these countries, a point of consensus is that PGT may be used to avoid the birth of a child with a serious genetic disease. However, standards for evaluating disease severity in this context are not always clear. Considering the numerous medical and social implications of defining a standard for serious disease, our study sought out to better understand how disease severity for PGT is being defined by analyzing and comparing the regulatory landscapes for PGT in various countries.<h4>Methods</h4>We carried out a multi-case study analysis using policy documents from the UK, Western Australia, and Japan. Documentary analysis was used to analyze and compare these documents in terms of medical indications for PGT, evaluation methods of applications for PGT, and review frameworks used during the evaluation process, which includes the specific medical and social factors that are considered.<h4>Results</h4>Within our three case studies, medical indications for PGT are based on an estimated risk of the woman giving birth to a child with a genetic abnormality with known clinical deficits. Evaluation methods for approving applications for PGT include reference to a pre-approved list of genetic conditions (the UK) and case-by-case reviews (all case studies). Review frameworks for case-by-case reviews include reference to a list of considered factors (the UK and Western Australia) and a definition statement of disease severity (Japan), which provide insight into interpretations of disease severity in each context.<h4>Conclusions</h4>The results of this study point to the possible medical and social impacts of PGT regulatory frameworks on multiple stakeholders. Furthermore, it suggests that impacts in this case are not only caused by whether PGT is permitted or not, but also by the circumstances under which it is allowed and how decisions regarding its approval are made. Our results may serve as valuable insights for countries that already have established policy for PGT but are considering revision, countries that are without policy, and for discussions on related genetic and reproductive technologies.

Also flagged:Gene ExpressionSignet Ring Cell CarcinomaCarcinomacarcinomasearly gastric cancerSRC
Journal Article 2022-05-18 No Snippets Yeo MK, Kang SH, Jeong KB, Lee HS, Jeon HJ, Eun HS, Lee ES, Moon HS, Kim SH, Sung JK, Lee BS, Jeong HY.
Show Full Abstract

<h4>Introduction</h4>Although signet ring cell carcinoma (SRC) is a subtype of poorly cohesive carcinoma (PC), the differences in the biological behavior between the 2 morphologically similar carcinomas have not been fully studied. Therefore, we performed transcriptome analysis to evaluate the differences of genetic expressions between SRC and PC.<h4>Methods</h4>The study group consisted of patients with SRC or PC pathology from patients with early gastric cancer (EGC) whose depth of invasion was localized in the mucosal layer. A total of 18 patients were enrolled. The patients were divided into 3 groups based on their histologic type and lymph node (LN) status. Group 1 consisted of patients with PC and positive LN metastasis, Group 2 consisted of patients with PC without LN metastasis, and Group 3 consisted of patients with SRC without LN metastasis. Transcriptome analysis was performed using the nCounter PanCancer Progression Panel Kit.<h4>Results</h4>The expression of 77 genes in Group 1 was altered compared to that in normal tissues. The expression of 49 and 13 genes in Groups 2 and 3, respectively, was altered when compared to that in normal tissues. Groups 1 and 2 showed similar genetic expressions. However, Group 3 showed numerous differences in gene expression including Roundabout4 (Robo4) compared to the other groups, especially Group 1.<h4>Conclusion</h4>Our data suggest that gene expression patterns were different between SRC and PC and expression of ROBO4 may play an important role in the prognosis of SRC and PC type of EGC.

Also flagged:pseudoaneurysmatrial fibrillationAFlumenchronic AFPSA
Journal Article 2022-05-18 No Snippets Berrio-Caicedo JJ, Muriel JPB, Cadavid HFE.
Show Full Abstract

<h4>Introduction and importance</h4>We present the case in which a large symptomatic pseudoaneurysm (PSA), 6 × 5 cm, with one year of evolution on the path of the right radial artery (RRA) appeared after its punction and cannulation for performing cardiac catheterism in an atrial fibrillation (AF) indefinite anticoagulated patient. Diagnosis and surgical planning were consolidated only by using color duplex ultrasound (CDU), contrasted images were not indicated. The open surgical management was performed during a short-time supraclavicular blockade of peripheral nerves without stopping nor bridging anticoagulant therapy. Complete excision of the deforming mass with no blood loss, decompression of the adjacent structures and direct closure of the arterial defect without compromising of its lumen and path were also achieved.<h4>Case presentation</h4>A 74-year-old, Hispanic male patient and former smoker underwent coronary catheterization for thoracic typical pain. One year after, he is admitted for move restrictive pain in distal right forearm and hand paresthesia related to a rapidly growing right radial artery PSA of 6 cm in diameter where the indefinite anticoagulation, indicated for chronic AF, confers a risk of major bleeding. After clinic and exclusive CDU assessing, the patient granted us written authorization for performing an open surgery. One year follow up showed an asymptomatic patient with no RRA residual lesions.<h4>Clinical discussion</h4>Although contrasted are the preferred diagnosis methods when arterial issues are suspected especially angiography since, when indicated, the endovascular treatment may be performed immediately after diagnosis. The CDU performed with a high-sensitivity transducer is the image of choice for an immediate differential diagnosis (Meola et al., 2021 [1]). In addition, it allowed us to see both, the particular PSA inside structure and the patency of ipsilateral ulnar artery, necessary details to propose the successful open surgical treatment finally conducted.<h4>Conclusion</h4>Vascular and trauma surgeons should be trained to ensure the correct diagnosis based on preexisting medical conditions, clinical findings and those provided by CDU in order to offer an appropriate and definitive management to peripheral vascular iatrogenic lesions with potential bleeding risk, especially in anticoagulated patients. Since large limb deforming PSAs are recommended to be excided through open access, they should also be trained to perform it without additional risks nor sequelae. Since the number of AF patients is increasing worldwide, main aspects on anticoagulation therapy have to be taught to every surgical team.

Also flagged:transmembrane receptorskinasecytoplasmicsignal transductioncancerTAM
Journal Article 2022-05-18 No Snippets Mikolajczyk A, Mitula F, Popiel D, Kaminska B, Wieczorek M, Pieczykolan J.
Show Full Abstract

Receptor tyrosine kinases (RTKs) are transmembrane receptors that bind growth factors and cytokines and contain a regulated kinase activity within their cytoplasmic domain. RTKs play an important role in signal transduction in both normal and malignant cells, and their encoding genes belong to the most frequently affected genes in cancer cells. The TAM family proteins (TYRO3, AXL, and MERTK) are involved in diverse biological processes: immune regulation, clearance of apoptotic cells, platelet aggregation, cell proliferation, survival, and migration. Recent studies show that TAMs share overlapping functions in tumorigenesis and suppression of antitumour immunity. MERTK and AXL operate in innate immune cells to suppress inflammatory responses and promote an immunosuppressive tumour microenvironment, while AXL expression correlates with epithelial-to-mesenchymal transition, metastasis, and motility in tumours. Therefore, TAM RTKs represent a dual target in cancer due to their intrinsic roles in tumour cell survival, migration, chemoresistance, and their immunosuppressive roles in the tumour microenvironment (TME). In this review, we discuss the potential of TAMs as emerging therapeutic targets in cancer treatment. We critically assess and compare current approaches to target TAM RTKs in solid tumours and the development of new inhibitors for both extra- and intracellular domains of TAM receptor kinases.

Also flagged:neurodegenerative diseasesneurological disorderHuntingtinHDocular disordersGNAT2
Journal Article 2022-05-18 ✓ 5 Snippets Mazur-Michałek I, Ruciński M, Sowiński M, Pietras P, Leśniczak-Staszak M, Szaflarski W, Isalan M, Mielcarek M.
In-Text Gene Mentions

To test the hypothesis that mutant HTT leads to transcriptional remodeling of the eye transcriptome, we used two types of well-established HD mouse models.

For further analysis, we focused on differentially expressed genes related to retina remodelling only, since it is already well established that mutant HTT also leads to HD-related skeletal muscle atrophy [16,18,43].

It has been shown that mutant HTT is expressed in the retina of two HD-fragment mouse models, namely R6/2 and R6/1.

Indeed, we have identified a spectrum of pathological events leading to HD-related cardiomyopathy in various HD mouse models [12,13,14], which is likely driven by the functions of intrinsic mutant HTT in the heart [15].

The list of such neurodegenerative disorders includes Huntington’s disease: this is a fatal, inherited neurodegenerative disease caused by CAG triplet expansions within exon 1 of the huntingtin gene (HTT) [4].

Show Full Abstract

Ocular abnormalities are becoming associated with a spectrum of pathological events in various neurodegenerative diseases. Huntington's disease (HD) is just such an example of a fatal neurological disorder, where mutated genes (CAG trinucleotide expansions in the <i>Huntingtin</i> gene) have widespread expression, leading to the production of mutant Huntingtin (mHTT) protein. It is well known that mutant HTT protein is prone to form toxic aggregates, which are a typical pathological feature, along with global transcriptome alterations. In this study, we employed well-established quantitative methods such as Affymetrix arrays and quantitative PCR (qPCR) to identify a set of transcriptional biomarkers that will track HD progression in three well-established mouse models: R6/2, R6/1, and <i>Hdh</i>Q150. Our array analysis revealed significantly deregulated networks that are related to visual processes and muscle contractions. Furthermore, our targeted quantitative analysis identified a panel of biomarkers with some being dysregulated even at the presymptomatic stage of the disease, e.g., <i>Opn1mw</i>, <i>Opn1sw</i>, and <i>Pfkfb2</i>. Some of the deregulated genes identified in this study have been linked to other genetic ocular disorders such as: GNAT2, a source of achromatopsia, and REEP6, linked to <i>Retinitis pigmentosa.</i> It may thus be a useful platform for preclinical evaluations of therapeutic interventions.

Also flagged:Kyrieleis ArteriolitisAcute Retinal Necrosisnecrosisherpes simplex virus type 1 encephalitisfoscarnetacyclovir
Journal Article 2022-05-18 ✓ 1 Snippet Makri OE, Tsekouras IK, Leonidou L, Kagkelaris K, Kozobolis V, Georgakopoulos CD.
In-Text Gene Mentions

…with Kyrieleis arteriolitisHSV type 1 encephalitistype 1 encephalitis.…

Show Full Abstract

We report the case of a 52-year-old woman who presented to the emergency department with acute retinal necrosis in her left eye secondary to herpes simplex virus type 1 encephalitis for which she had been hospitalized four months before. Treatment with intravitreal foscarnet and intravenous acyclovir was promptly commenced followed by the addition of oral prednisolone. PCR analysis of aqueous humor detected HSV type 1 DNA. The condition responded to therapy with partial resolution of intraocular inflammation and improvement of visual acuity, but the presence of Kyrieleis plaques was observed two weeks after the initiation of treatment, when five intravitreal foscarnet injections had been administered. The patient was switched to oral therapy with valacyclovir, and 10 weeks after commencing treatment, the patient's left eye was free of inflammation, having achieved a BCVA of 20/20. Oral steroid treatment was gradually tapered off, and the patient was instructed to remain on prophylactic antiviral therapy. Kyrieleis arteriolitis is an uncommon finding in the context of acute retinal necrosis. As far as we are aware, we report the first case of Kyrieleis arteriolitis in acute retinal necrosis secondary to viral encephalitis and the second one presenting Kyrieleis plaques in acute retinal necrosis caused by herpes simplex virus type 1. Prior reports of cases of Kyrieleis arteriolitis in acute retinal necrosis are also presented.

Also flagged:Cognitive Impairmentmild cognitive impairmentbindingADRB2ADRA1BDPP4
Journal Article 2022-05-18 No Snippets Chang Z, Wang YC, Tian D, Hu WY, Wang ZY, Liu GL, Ma HP, Hu YL, Wu B, Han ZY.
Show Full Abstract

<h4>Background</h4>Although traditional Chinese medicine (TCM) has good efficacy in the treatment of mild cognitive impairment (MCI), especially memory improvement and safety, its substance basis and intervention mechanism are particularly complex and unknown. Therefore, based on network pharmacology and data mining, this study aims to explore the rules, active ingredients and mechanism of TCM in the treatment of MCI.<h4>Methods</h4>By searching the GeneCard, OMIM, DisGeNET and DrugBank databases, we obtained the critical targets associated with MCI. We matched the components and herbs corresponding to the important targets in the TCMSP platform. Using Cytoscape 3.7.2 software, we constructed a target-component-herb network and conducted a network topology analysis to obtain the core components and herbs. Molecular docking was used to preliminarily analyze and predict the binding activities and main binding combinations of the core targets and components. Based on the analysis of the properties, flavor and meridian distribution of herbs, the rules of herbal therapy for MCI were summarized.<h4>Results</h4>Twenty-eight critical targets were obtained after the screening. Using the TCMSP platform, 492 components were obtained. After standardization, we obtained 387 herbs. Based on the target-composition-herb network analysis, the core targets were ADRB2, ADRA1B, DPP4, ACHE and ADRA1D. According to the screening, the core ingredients were beta-sitosterol, quercetin, kaempferol, stigmasterol and luteolin. The core herbs were matched to Danshen, Yanhusuo, Gancao, Gouteng and Jiangxiang. It was found that the herbs were mainly warm in nature, pungent in taste and liver and lung in meridian. The molecular docking results showed that most core components exhibited strong binding activity to the target combination regardless of the in or out of network combination.<h4>Conclusion</h4>The results of this study indicate that herbs have great potential in the treatment of MCI. This study provides a reference and basis for clinical application, experimental research and new drug development of herbal therapy for MCI.

Also flagged:LeukemiaConsortinCNST-Golgitransmembrane proteins
Journal Article 2022-05-18 ✓ 1 Snippet Liu H, Zhang X, Zhao Z, Zhu H, Li D, Yang Y, Zhao W, Zhang F, Wang Y, Zhu L, Ding Z, Li X.
In-Text Gene Mentions

…HINT1, LRRC75A-AS1, DSE,PEBP1.…

Show Full Abstract

Consortin (CNST) is a protein located on the trans-Golgi network that can target transmembrane proteins to the plasma membrane. Although CNST was discovered more than 10 years ago, there are still not enough studies on its function. During our search for possible new acute myeloid leukemia (AML) markers, we found that CNST was overexpressed in almost all patients with AML. By analyzing profiling data from public databases, we found that CNST expression inversely correlated with overall survival among AML patients. There was a great variation in CNST expression among different subtypes of AML, and the expression was the highest in the t(8,21) subtype, which was probably due to the direct regulation of CNST transcription by RUNX1-RUNX1T1. In addition, we analyzed the expression of CNST in different cells of the hematopoietic system. We found that CNST was associated with the low differentiation degrees of hematopoietic cells and had the highest expression level in leukemia stem cells (LSCs). Finally, we analyzed the CNST-related gene network and found that the genes negatively correlated with CNST are involved in various immune-related pathways, which indicates that CNST is likely related to immune evasion, LSC niche retention, and assembly of stress granules. In conclusion, our study suggests that CNST has the potential to be a diagnostic and prognostic biomarker for AML.

Also flagged:CPBiotinTARDBPtranscription coactivatorHBxubiquitin
Journal Article 2022-05-18 ✓ 5 Snippets Wei XF, Fan SY, Wang YW, Li S, Long SY, Gan CY, Li J, Sun YX, Guo L, Wang PY, Yang X, Wang JL, Cui J, Zhang WL, Huang AL, Hu JL.
In-Text Gene Mentions

To test whether STAU1 binds to the CP directly, we performed electrophoretic mobility shift assays (EMSA) using recombinant STAU1 expressed from E. coli and seven biotin-labeled probes covering the CP sequence (HBV 1,450–1,850), with HNF4α as a positive control (Figures 4K–4L).

The STAU1 siRNA and TARDBP siRNA were modified with cholesterol to improve the transfection efficiency.

The results showed that MG132 treatment attenuated the effect of STAU1 overexpression (Figures 9A and 9C) and abolished the effect of STAU1 knockdown on HBx (Figures 9B and 9D).

To evaluate the effect of STAU1 knockdown on HBV replication, we synthesized siRNA modified with cholesterol against STAU1.

…Identification ofSTAU1as a regulator…

Show Full Abstract

The core promoter (CP) of hepatitis B virus (HBV) is critical for HBV replication by controlling the transcription of pregenomic RNA (pgRNA). Host factors regulating the activity of the CP can be identified by different methods. Biotin-based proximity labeling, a powerful method with the capability to capture weak or dynamic interactions, has not yet been used to map proteins interacting with the CP. Here, we established a strategy, based on the newly evolved promiscuous enzyme TurboID, for interrogating host factors regulating the activity of HBV CP. Using this strategy, we identified STAU1 as an important factor involved in the regulation of HBV CP. Mechanistically, STAU1 indirectly binds to CP mediated by TARDBP, and recruits the SAGA transcription coactivator complex to the CP to upregulate its activity. Moreover, STAU1 binds to HBx and enhances the level of HBx by stabilizing it in a ubiquitin-independent manner.

Also flagged:Depressionpsychiatric diseaseMajor depression disordersexual abusePTSDpsychological disorders
Journal Article 2022-05-18 ✓ 3 Snippets An X, Guo W, Wu H, Fu X, Li M, Zhang Y, Li Y, Cui R, Yang W, Zhang Z, Zhao G.
In-Text Gene Mentions

Serotonin transporter (5-HTT) is one of the critical regulators of serotonin neurotransmission (Vai et al., 2020), with the highest density in the raphe nucleus.

González-Pardo et al. (2020) used the MS depression model of rats, and found that 5-HT in the PFC, 5-HT, and 5-hydroxyindoleacetic acid (5-HIAA) in the hippocampus was increased, and the 5-HIAA/5-HT ratio was decreased after MS in females; in males, 5-HT was decreased in the PFC and was significantly increased in the striatum after MS. Liu et al. (2021) applied C57BL/6N mice to administer limited nesting and a bedding material paradigm to implement ELS. In pharmacological behavior experiments, female mice showed deeper depression and more sensitivity to ELS than male mice. Immunohistochemistic (IHC) staining showed that female serotonin (SERT) in accumbens (NAcc) and basolateral amygdala (BLA) were decreased significantly, and application of vortioxetine could help to attenuate this change (Liu et al., 2021). Arborelius used the MS model for the study, separating the rat cubs for 180 min (long-term mother separation; LMS) or 15 min (short maternal separation; BMS), and they found that, in the LMS group, the levels of 5-HT and 5-HIAA in the dorsal raphe nucleus (DRN) were significantly increased in females, and the levels of 5-HIAA and homovanillic acid in the nucleus accumbens (NAc) were also higher than those of the animal facility reared (AFR) and BMS groups. In the cingulate cortex, both LMS and BMS reduced the level of norepinephrine (NA). In addition, BMS mainly affected monoaminergic levels in the amygdala (Arborelius and Eklund, 2007). Besides, 5-HTT± heterozygous mice were used to study the variation of serotonin transporter 5-HTT/SLC6A4. The results showed that, in the aspect of depression-like behavior, postnatal stress (PS) could increase the depression-like behavior in 5-HTT± mice, but not in the wild-type; the basic level in 5-HTT± was lower than that of wild-type along with a more significant level in male offspring. Concerning gene expression, significant changes occurred in MARK and the neurotrophic protein pathway for both the 5-HTT± group and the PS group, but changes in the cytokine and Wnt signal pathway occurred in the heterozygous + PS group instead of the others, in which sex differences were not identified (van den Hove et al., 2011). We could infer that the 5-HTT± genotype is more sensitive to external stimulation, which was also confirmed by Houwing et al. (2020), who used fluoxetine as external stimulation. In addition, on the aspect of the serotonin transporter-linked polymorphism (5-HTTLPR), Schwandt genotyped macaques with 5-HTTLPR and evaluated the effects of genotypes, ELS, and sex on behavioral response. Males showed a higher level of aggression and social/courage than females. Besides, if peers also raised males carrying the S allele in early adversity, their attack risk increased significantly (Schwandt et al., 2010). On the aspect of the 5-HT1A receptor, Spinelli et al. (2010) measured the density of 5-HT1A by positron emission tomography (PET) in young rhesus monkeys raised by females and peers, respectively. The examination showed that the density of 5-HT1A was decreased in peer-rearing rhesus, suggesting that the decrease of 5-HT1A receptor density during development may be a factor in increasing vulnerability (Spinelli et al., 2010). The chronic mild stress (CMS) depression model showed decreased 5-HT1AR mRNA expression in the lateral orbitofrontal cortex (OFC) of male rats. Reversing this effect with antidepressants, CMS increased 5-HT2Cr mRNA expression in the hippocampal CA4 region of both male and female rats. Overexpression of 5-HT1A in male mice was associated with a shorter immobility time in forced swimming test (FST) and contributed to the antidepressant response of citalopram (SSRI inhibitor) (Günther et al., 2011). Goodfellow et al. conducted an electrophysiological experiment on rat brain slices. The neurons of the prefrontal layer II/III vertebral body were directly inhibited by 5-HT1A, and the current of 5-HT1A was increased after ELS, and especially in females. This is the first electrophysiological examination of 5-HT1A (Goodfellow et al., 2009). Moreover, MAOA knockout mice are characterized by higher levels of serotonin and norepinephrine and increased aggressive behavior (Cases et al., 1995). For hyper-aggressive male mice who experienced peripubertal stress, MAOA expression and enzyme activity were reduced in the hypothalamus and were increased in the PFC. Hypomethylation in the PFC and hypermethylation in hypothalamus of the MAOA promoter were negatively associated with the expression pattern. In females, neither expression nor the epigenetic state of the MAOA gene was significantly altered between control and pre-pubertal stress (PPS) adult mice (Konar et al., 2019).

…levels of the5-HTTgene are different…

Show Full Abstract

Depression is a common psychiatric disease caused by various factors, manifesting with continuous low spirits, with its precise mechanism being unclear. Early life stress (ELS) is receiving more attention as a possible cause of depression. Many studies focused on the mechanisms underlying how ELS leads to changes in sex hormones, neurotransmitters, hypothalamic pituitary adrenocortical (HPA) axis function, and epigenetics. The adverse effects of ELS on adulthood are mainly dependent on the time window when stress occurs, sex and the developmental stage when evaluating the impacts. Therefore, with regard to the exact sex differences of adult depression, we found that ELS could lead to sex-differentiated depression through multiple mechanisms, including 5-HT, sex hormone, HPA axis, and epigenetics.

Also flagged:age-related neurodegenerative disorderβ-amyloidpeptidemicrotubule-associated protein taupathogenesis
Journal Article 2022-05-18 No Snippets Zong B, Yu F, Zhang X, Zhao W, Sun P, Li S, Li L.
Show Full Abstract

Alzheimer's disease (AD) is an age-related neurodegenerative disorder, characterized by the accumulation of proteinaceous aggregates and neurofibrillary lesions composed of β-amyloid (Aβ) peptide and hyperphosphorylated microtubule-associated protein tau, respectively. It has long been known that dysregulation of cholinergic and monoaminergic (i.e., dopaminergic, serotoninergic, and noradrenergic) systems is involved in the pathogenesis of AD. Abnormalities in neuronal activity, neurotransmitter signaling input, and receptor function exaggerate Aβ deposition and tau hyperphosphorylation. Maintenance of normal neurotransmission is essential to halt AD progression. Most neurotransmitters and neurotransmitter-related drugs modulate the pathology of AD and improve cognitive function through G protein-coupled receptors (GPCRs). Exercise therapies provide an important alternative or adjunctive intervention for AD. Cumulative evidence indicates that exercise can prevent multiple pathological features found in AD and improve cognitive function through delaying the degeneration of cholinergic and monoaminergic neurons; increasing levels of acetylcholine, norepinephrine, serotonin, and dopamine; and modulating the activity of certain neurotransmitter-related GPCRs. Emerging insights into the mechanistic links among exercise, the neurotransmitter system, and AD highlight the potential of this intervention as a therapeutic approach for AD.

Also flagged:breast cancercancerdeathsolid tumortumortumors
Journal Article 2022-05-18 No Snippets Liu Q, Hu P.
Show Full Abstract

In precise medicine, it is with great value to develop computational frameworks for identifying prognostic biomarkers which can capture both multi-genomic and phenotypic heterogeneity of breast cancer (BC). Radiogenomics is a field where medical images and genomic measurements are integrated and mined to solve challenging clinical problems. Previous radiogenomic studies suffered from data incompleteness, feature subjectivity and low interpretability. For example, the majority of the radiogenomic studies miss one or two of medical imaging data, genomic data, and clinical outcome data, which results in the data incomplete issue. Feature subjectivity issue comes from the extraction of imaging features with significant human involvement. Thus, there is an urgent need to address above-mentioned limitations so that fully automatic and transparent radiogenomic prognostic biomarkers could be identified for BC. We proposed a novel framework for BC prognostic radiogenomic biomarker identification. This framework involves an explainable DL model for image feature extraction, a Bayesian tensor factorization (BTF) processing for multi-genomic feature extraction, a leverage strategy to utilize unpaired imaging, genomic, and survival outcome data, and a mediation analysis to provide further interpretation for identified biomarkers. This work provided a new perspective for conducting a comprehensive radiogenomic study when only limited resources are given. Compared with baseline traditional radiogenomic biomarkers, the 23 biomarkers identified by the proposed framework performed better in indicating patients' survival outcome. And their interpretability is guaranteed by different levels of build-in and follow-up analyses.

Also flagged:CellDeathTumorProgrammed cell deathPCDlung adenocarcinoma
Journal Article 2022-05-18 ✓ 2 Snippets Pan S, Meng H, Fan T, Hao B, Song C, Li D, Li N, Geng Q.
In-Text Gene Mentions

…NOX1 )+(0.0659 PDX1)+(-0.2112PEBP1)+(-0.0517 PIM2)+(-0.0541 PLK3…

…NOX1, ACSL3, EMC2,PEBP1).…

Show Full Abstract

Programmed cell death (PCD) is a process that regulates the homeostasis of cells in the body, and it plays an important role in tumor immunity. However, the expression profile and clinical characteristics of PCD-related genes remain unclear. In this study, we comprehensively analysed the PCD genes with the tumor microenvironment (TME), drug sensitivity, immunothearapy response, and evaluated their prognostic value through systematic bioinformatics methods.We identified 125 PCD-related regulatory factors, which were expressed differently in lung adenocarcinoma (LUAD) and normal lung tissues. 32 PCD related prognostic genes associated with LUAD were identified by univariate Cox analysis. 23 PCD-related gene signature was constructed, and all LUAD patients in the Cancer Genome Atlas (TCGA) dataset were stratified as low-risk or high-risk groups according to the risk score. This signature had a powerful prognostic value, which was validated in three independent data sets and clinical subtypes. Additionally, it has unique properties in TME. Further analysis showed that different risk groups have different immune cell infiltration, immune inflammation profile, immune pathways, and immune subtypes. In addition, the low-risk group had a better immunotherapy response with higher levels of multiple immune checkpoints and lower Tumor immune dysfunction and exclusion (TIDE) score, while the high-risk group was sensitive to multiple chemotherapeutic drugs because of its lower IC50. In short, this is the first model to predict the prognosis and immunological status of LUAD patients based on PCD-related genes. It may be used as a predictor of immunotherapy response to achieve customized treatment of LUAD.

Also flagged:sensory transductionaxonalsynapse formationchromatintransductiontranscription factors
Journal Article 2022-05-18 No Snippets Pumo GM, Kitazawa T, Rijli FM.
Show Full Abstract

Spontaneous activity generated before the onset of sensory transduction has a key role in wiring developing sensory circuits. From axonal targeting, to synapse formation and elimination, to the balanced integration of neurons into developing circuits, this type of activity is implicated in a variety of cellular processes. However, little is known about its molecular mechanisms of action, especially at the level of genome regulation. Conversely, sensory experience-dependent activity implements well-characterized transcriptional and epigenetic chromatin programs that underlie heterogeneous but specific genomic responses that shape both postnatal circuit development and neuroplasticity in the adult. In this review, we focus on our knowledge of the developmental processes regulated by spontaneous activity and the underlying transcriptional mechanisms. We also review novel findings on how chromatin regulates the specificity and developmental induction of the experience-dependent program, and speculate their relevance for our understanding of how spontaneous activity may act at the genomic level to instruct circuit assembly and prepare developing neurons for sensory-dependent connectivity refinement and processing.

Also flagged:Gene ExpressionE7 oncoproteincutaneous tumorsE7bindingnucleosomes
Journal Article 2022-05-18 ✓ 5 Snippets Chen X, Li M, Tang Y, Liang Q, Hua C, He H, Song Y, Cheng H.
In-Text Gene Mentions

…ATF3 , andH4C8, associated with…

…were downregulated, includingZNF664, MYCN ,…

…, H2AC19 ,H4C8, H2BC21, and…

…26 genes, includingH4C8, H2BC21 ,…

…including JUN ,H4C8, H2C21 ,…

Show Full Abstract

<b>Background:</b> Human papillomavirus type 8 (HPV8) has been implicated in the progress of non-melanoma skin cancers and their precursor lesions. The HPV8 E7 oncoprotein plays a key role in the tumorigenesis of HPV-associated cutaneous tumors. However, the exact role of HPV8 E7 in human epidermal carcinogenesis has not been fully elucidated. <b>Methods:</b> To investigate the potential carcinogenic effects of HPV8 E7 on epithelial cells, we used RNA-sequencing technology to analyze the gene expression profile of HPV8 E7-overexpressed normal human epidermal keratinocytes (NHEKs). <b>Results:</b> RNA-sequencing revealed 831 differentially expressed genes (DEGs) between HPV8 E7-expressing NHEKs and control cells, among which, 631 genes were significantly upregulated, and 200 were downregulated. Gene ontology annotation enrichment analysis showed that HPV8 E7 mainly affected the expression of genes associated with protein heterodimerization activity, DNA binding, nucleosomes, and nucleosome assembly. Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis revealed that overexpression of HPV8 E7 affected the expression of gene clusters associated with viral carcinogenesis and transcriptional misregulation in cancer and necroptosis signaling pathways that reportedly play crucial roles in HPV infection promotion and cancer progression. We also found the DEGs, such as <i>HKDC1</i> and <i>TNFAIP3</i>, were associated with epigenetic modifications, immune regulation, and metabolic pathways. <b>Conclusion:</b> Our results demonstrate that the pro-carcinogenic effect of HPV8 expression in epithelial cells may be attributed to the regulatory effect of oncogene E7 on gene expression associated with epigenetic modifications and immune and metabolic status-associated gene expression. Although our data are based on an <i>in vitro</i> experiment, it provides the theoretical evidence that the development of squamous cell carcinoma can be caused by HPV.

Also flagged:addictionpsychosisepilepsybiopeptidesconopeptidesdisulfide
Journal Article 2022-05-18 No Snippets Fu Y, Zhang Y, Ju S, Ma B, Huang W, Luo S.
Show Full Abstract

<h4>Background</h4>Conopeptides from cone snail venom have aroused great interest related to the discovery of novel bioactive candidates, due to their excellent prospects for the treatment of various health problems such as pain, addiction, psychosis and epilepsy. In order to explore novel biopeptides, we investigated the structure and function of five novel conopeptides isolated from the venom of <i>Conus marmoreus</i> from South China Sea.<h4>Methods</h4><i>C. marmoreus</i> crude venom was prepared, fractionated and purified by HPLC system. The primary sequences of the five novel disulfide-poor conopeptides Mr-1 to Mr-5 were identified by comprehensive analysis of <i>de novo</i> MALDI-TOF tandem mass spectrometry and Edman degradation data. In order to investigate their function, these five conopeptides were synthesized by Fmoc-SPPS chemistry, and their biological effects at several heterologous rat nicotinic acetylcholine receptor (nAChR) subtypes (α1β1δε, α3β2, α3β4, α4β2) were determined by electrophysiological technique.<h4>Results</h4>Five novel disulfide-poor conopeptides were identified and named as follows: Mr-1 (DWEYHAHPKPNSFWT), Mr-2 (YPTRAYPSNKFG), Mr-3 (NVIQAPAQSVAPP NTST), Mr-4 [KENVLNKLKSK(L/I)] and Mr-5 [NAVAAAN(L/I)PG(L/I)V]. None of them contains a disulfide bond. The sequences of conopeptides Mr-2 to Mr-5 do not belong to any category of the known disulfide-poor conopeptides. No significant activity against the above nAChR subtypes were observed for the five conopeptides at 100 µM.<h4>Conclusion</h4>We purified and structurally characterized five novel disulfide-poor conopeptides from <i>C. marmoreus</i> crude venom and first investigated their nAChR inhibitory effects. This work expanded our knowledge on the structure and function of disulfide-poor conopeptides from this cone snail venom.

Also flagged:synthesisfarnesyl lipid Ipeptidelipidlipid Icell wall
Journal Article 2022-05-18 No Snippets Wingen LM, Braun C, Rausch M, Gross H, Schneider T, Menche D.
Show Full Abstract

Full details on the design, strategies and tactics for development of a novel synthetic sequence to farnesyl lipid I and II analogs is reported. The modular route was based on a three coupling strategy involving an efficient solid phase synthesis of the elaborate peptide fragment, which proceeded with excellent yield and stereoselectivity and was efficiently applied for the convergent synthesis of 3-lipid I and II. Furthermore, the generality of this route was demonstrated by synthesis of 3-lipid I congeners that are characteristic for <i>S. aureus</i> and <i>E. faecalis</i>. All 3-lipid I and II building blocks were obtained in high purity revealing high spectroscopic resolution.

Also flagged:chamomileFerritinsodiumwatersaltcheerios
Journal Article 2022-05-18 ✓ 2 Snippets Perzia BM, Ying GS, Dunaief JL, Dunaief DM.
In-Text Gene Mentions

…diseases such ashemochromatosis( 2 ),…

…includes phlebotomy forhemochromatosisor iron chelators…

Show Full Abstract

<h4>Background</h4>Ferritin is an iron-containing protein and acute-phase reactant, which may be elevated due to systemic iron overload or inflammation. Various diseases are associated with excess iron, but therapeutic iron chelation is suboptimal. Prior studies suggest that several plant phytochemicals possess iron-chelating properties, indicating that a plant-based diet may benefit patients with iron overload.<h4>Objectives</h4>The aim was to investigate whether patients who consume a nutrient-dense, dark-green leafy vegetable-rich diet, called the Low Inflammatory Foods Everyday (LIFE) diet, experience reductions in ferritin concentrations.<h4>Methods</h4>This was a retrospective study in which patients were intensively counseled to follow the LIFE diet. Compliance was assessed by patient interviews and serum B-carotene measurements. Primary outcomes included changes in ferritin, B-carotene, and C-reactive protein (CRP). Patients with elevated CRP concentrations at baseline were excluded in order to separate the impact of inflammation from iron overload on ferritin concentrations. Premenopausal women, who lose iron from menstruation, were also excluded.<h4>Results</h4>Thirty-two patients met the inclusion criteria. The median follow-up was 183 d.   Following the dietary intervention, ferritin decreased (-81 μg/L, <i>P</i> = 0.006) and B-carotene increased (46 μg/L, <i>P</i> < 0.0001), whereas CRP remained unchanged (-0.02 mg/L, <i>P</i> = 0.86). Adherent patients had greater reductions in ferritin compared with nonadherent patients (-138 μg/L vs. 15 μg/L, <i>P</i> = 0.001). Among all patients, there was an inverse relation between B-carotene and ferritin (-2.02, <i>P</i> = 0.03).<h4>Conclusions</h4>The LIFE diet, or similar dark-green leafy vegetable-rich, whole-food plant-based diets, may benefit patients with disorders of iron overload and iron-induced oxidative stress.

bioRxiv 2022-05-18 Preprint (No Snippets API) Marchionini DM, Liu J, Ambesi-Impiombato A, Cox K, Cirillo K, Bansal M, Mushlin R, Brunner D, Ramboz S, Kwan M, Kuhlbrodt K, Tillack K, Peters F, Rauhala L, Obenauer J, Greene JR, Hartl C, Khetarpal V, Lager B, Rosinski J, Aaronson J, Alam M, Signer E, Muñoz-Sanjuán I, Howland D, Zeitlin SO.
Show Full Abstract

We have developed a novel inducible Huntington’s disease (HD) mouse model that allows temporal control of whole-body allele-specific mutant Huntingtin (m Htt ) expression. We asked whether moderate global lowering of m Htt (∼50%) was sufficient for long-term amelioration of HD-related deficits and, if so, whether early m Htt lowering (before measurable deficits) was required. Both early and late m Htt lowering delayed behavioral dysfunction and mHTT protein aggregation, as measured biochemically. However, long-term follow up revealed that the benefits, in all m Htt lowering groups, attenuated by 12 months of age. While early m Htt lowering attenuated cortical and striatal transcriptional dysregulation evaluated at 6 months of age, the benefits diminished by 12- months of age and late m Htt lowering was unable to ameliorate striatal transcriptional dysregulation at 12 months of age. Only early m Htt lowering delayed the elevation in cerebrospinal fluid neurofilament light chain that we observed in our model starting at 9 months of age. As small-molecule HTT -lowering therapeutics progress to the clinic, our findings suggest that moderate m Htt lowering allows disease progression to continue, albeit at a slower rate, and could be relevant to the degree of m HTT lowering required to sustain long-term benefit in humans.

bioRxiv 2022-05-18 Preprint (No Snippets API) Hung C, Zhu C, Kittur FS, He M, Arning E, Zhang J, Johnson AJ, Jawa GS, Thomas MD, Ding TT, Xie J.
Show Full Abstract

Pathophysiology associated with Huntington’s disease (HD) has been studied extensively in various cell and animal models since the 1993 discovery of the mutant huntingtin (mHtt) with abnormally expanded polyglutamine (polyQ) tracts as the causative factor. However, the sequence of early pathophysiological events leading to HD still remains elusive. To gain new insights into the polyQ-induced early pathogenic events, we expressed Htt exon1 (Htt ex1 ) with a normal (21), or an extended (42 or 63) number of polyQ in tobacco plants, which lack an Htt ortholog to avoid any associated effects from endogenous Htt . Here, we show that transgenic plants accumulated Htt ex1 proteins with corresponding polyQ tracts, and that mHtt ex1 induced protein aggregation and affected plant growth, especially root and root hair development, in a polyQ length-dependent manner. Quantitative proteomic analysis of young roots from severely affected Htt ex1 Q63 and unaffected Htt ex1 Q21 plants showed that the most impaired protein by polyQ63 is a GTP cyclohydrolase I (GTPCH) along with many its related one-carbon (C 1 ) metabolic pathway enzymes. GTPCH is a key enzyme involved in folate biosynthesis in plants and tetrahydrobiopterin (BH 4 ) biosynthesis in mammals. Validating studies in 4-week-old R6/2 HD mice expressing a mHtt ex1 showed reduced levels of GTPCH and dihydrofolate reductase (DHFR, a key folate utilization/alternate BH 4 biosynthesis enzyme), and impaired C 1 and BH 4 metabolisms. Our findings from mHtt ex1 plants and mice reveal impaired expressions of GTPCH and DHFR and contribute to a better understanding of mHtt-altered C 1 metabolism and C 1 interconnected BH 4 metabolism leading to the pathogenesis of HD.

Also flagged:Hyaluronanelastin-like proteinHeart diseasedeathcardiovascular diseaseischemic heart disease
Journal Article 2022-05-17 ✓ 1 Snippet Suhar RA, Doulames VM, Liu Y, Hefferon ME, Figueroa O, Buabbas H, Heilshorn SC.
In-Text Gene Mentions

DCC

Show Full Abstract

Heart disease is the leading cause of death globally, and delivery of therapeutic cargo (<i>e.g.</i>, particles loaded with proteins, drugs, or genes and cells) through direct injection into the myocardium is a promising clinical intervention. However, retention of deliverables to the contracting myocardium is low, with as much as 60-90% of payload being lost within 24 hr. Commercially-available injectable hydrogels, including Matrigel, have been hypothesized to increase payload retention but have not yielded significant improvements in quantified analyses. Here, we assess a recombinant hydrogel composed of chemically modified hyaluronan and elastin-like protein (HELP) as an alternative injectable carrier to increase cargo retention. HELP is crosslinked using dynamic covalent bonds, and tuning the hyaluronan chemistry significantly alters hydrogel mechanical properties including stiffness, stress relaxation rate, and ease of injectability through a needle or catheter. These materials can be injected even after complete crosslinking, extending the time window for surgical delivery. We show that HELP gels significantly improve <i>in vivo</i> retention of microsphere cargo compared to Matrigel, both 1 day and 7 days post-injection directly into the rat myocardium. These data suggest that HELP gels may assist with the clinical translation of therapeutic cargo designed for delivery into the contracting myocardium by preventing acute cargo loss.

Also flagged:Sulfurdisulfidesthioesters
Journal Article 2022-05-17 ✓ 1 Snippet Orrillo AG, Furlan RLE.
In-Text Gene Mentions

DCCis currently witnessing…

Show Full Abstract

Sulfur has been important in dynamic covalent chemistry (DCC) since the beginning of the field. Mainly as part of disulfides and thioesters, dynamic sulfur-based bonds (DSBs) have a leading role in several remarkable reactions. Part of this success is due to the almost ideal properties of DSBs for the preparation of dynamic covalent systems, including high reactivity and good reversibility under mild aqueous conditions, the possibility of exploiting supramolecular interactions, access to isolable structures, and easy experimental control to turn the reaction on/off. DCC is currently witnessing an increase in the importance of DSBs. The chemical flexibility offered by DSBs opens the door to multiple applications. This Review presents an overview of all the DSBs used in DCC, their applications, and remarks on the interesting properties that they confer on dynamic chemical systems, especially those containing several DSBs.

Also flagged:Chemokine PF4InfectionsPlatelet factor 4PF4CXC chemokineCXCL4
Journal Article 2022-05-17 No Snippets Pei Z, Wang H, Zhao Z, Chen X, Huan C, Zhang W.
Show Full Abstract

Platelet factor 4 (PF4) or the CXC chemokine CXCL4 is the most abundant protein within the α-granules of platelets. Previous studies found that PF4 regulates infections of several viruses, including HIV-1, H1N1, hepatitis C virus (HCV), and dengue virus. Here, we show that PF4 is an inhibitor of enterovirus A71 (EV71) and coxsackievirus A16 (CA16) infections. The secreted form of PF4 from transfected cells or soluble purified PF4 from Escherichia coli, even lacking signal peptide affected secretion, obviously inhibited the propagation of EV71 and CA16. Mechanistically, we demonstrated that PF4 blocked the entry of the virus into the host cells by interactions with VP3 proteins of EV71/CA16 and the interaction with SCARB2 receptor-mediated EV71 and CA16 endocytosis. As expected, the incubation of anti-PF4 antibody with PF4 blocked PF4 inhibition on EV71 and CA16 infections further supported the above conclusion. Importantly, pretreatment of EV71 viruses with PF4 significantly protected the neonatal mice from EV71 lethal challenge and promoted the survival rate of infected mice. PF4 derived from natural platelets by EV71/CA16 activation also presented strong inhibition on EV71 and CA16. In summary, our study identified a new host factor against EV71 and CA16 infections, providing a novel strategy for EV71 and CA16 treatment. <b>IMPORTANCE</b> The virus's life cycle starts with binding to cell surface receptors, resulting in receptor-mediated endocytosis. Targeting the entry of the virus into target cells is an effective strategy to develop a novel drug. EV71 and CA16 are the major pathogens that cause hand, foot, and mouth disease (HFMD) outbreaks worldwide since 2008. However, the treatment of EV71 and CA16 infections is mainly symptomatic because there is no approved drug. Therefore, the underlying pathogenesis of EV71/CA16 and the interaction between host-EV71/CA16 need to be further investigated to develop an inhibitor. Here, we identified PF4 as a potent entry inhibitor of EV71 and CA16 via binding to VP3 proteins of EV71 and CA16 or binding to receptor SCARB2. In the EV71 infection model, PF4 protected mice from EV71 lethal challenge and promoted the survival rate of EV71-infected mice. Our study suggests that PF4 represents a potential candidate host factor for anti-EV71 and CA16 infections.

Also flagged:polyfluoroalkylcarbonfluorine atomsmethylmethylenecarbon atom
Journal Article 2022-05-17 No Snippets Carlson LM, Angrish M, Shirke AV, Radke EG, Schulz B, Kraft A, Judson R, Patlewicz G, Blain R, Lin C, Vetter N, Lemeris C, Hartman P, Hubbard H, Arzuaga X, Davis A, Dishaw LV, Druwe IL, Hollinger H, Jones R, Kaiser JP, Lizarraga L, Noyes PD, Taylor M, Shapiro AJ, Williams AJ, Thayer KA.
Show Full Abstract

<h4>Background</h4>Per- and polyfluoroalkyl substances (PFAS) are a large class of synthetic (man-made) chemicals widely used in consumer products and industrial processes. Thousands of distinct PFAS exist in commerce. The 2019 U.S. Environmental Protection Agency (U.S. EPA) Per- and Polyfluoroalkyl Substances (PFAS) Action Plan outlines a multiprogram national research plan to address the challenge of PFAS. One component of this strategy involves the use of systematic evidence map (SEM) approaches to characterize the evidence base for hundreds of PFAS.<h4>Objective</h4>SEM methods were used to summarize available epidemiological and animal bioassay evidence for a set of ∼150 PFAS that were prioritized in 2019 by the U.S. EPA's Center for Computational Toxicology and Exposure (CCTE) for <i>in vitro</i> toxicity and toxicokinetic assay testing.<h4>Methods</h4>Systematic review methods were used to identify and screen literature using manual review and machine-learning software. The Populations, Exposures, Comparators, and Outcomes (PECO) criteria were kept broad to identify mammalian animal bioassay and epidemiological studies that could inform human hazard identification. A variety of supplemental content was also tracked, including information on <i>in vitro</i> model systems; exposure measurement-only studies in humans; and absorption, distribution, metabolism, and excretion (ADME). Animal bioassay and epidemiology studies meeting PECO criteria were summarized with respect to study design, and health system(s) were assessed. Because animal bioassay studies with ≥21-d exposure duration (or reproductive/developmental study design) were most useful to CCTE analyses, these studies underwent study evaluation and detailed data extraction. All data extraction is publicly available online as interactive visuals with downloadable metadata.<h4>Results</h4>More than 40,000 studies were identified from scientific databases. Screening processes identified 44 animal and 148 epidemiology studies from the peer-reviewed literature and 95 animal and 50 epidemiology studies from gray literature that met PECO criteria. Epidemiological evidence (available for 15 PFAS) mostly assessed the reproductive, endocrine, developmental, metabolic, cardiovascular, and immune systems. Animal evidence (available for 40 PFAS) commonly assessed effects in the reproductive, developmental, urinary, immunological, and hepatic systems. Overall, 45 PFAS had evidence across animal and epidemiology data streams.<h4>Discussion</h4>Many of the ∼150 PFAS were data poor. Epidemiological and animal evidence were lacking for most of the PFAS included in our search. By disseminating this information, we hope to facilitate additional assessment work by providing the initial scoping literature survey and identifying key research needs. Future research on data-poor PFAS will help support a more complete understanding of the potential health effects from PFAS exposures. https://doi.org/10.1289/EHP10343.

Also flagged:nucleosomehistone proteinschromatinchromosomescationsNCP
Journal Article 2022-05-17 ✓ 1 Snippet Sun T, Minhas V, Mirzoev A, Korolev N, Lyubartsev AP, Nordenskiöld L.
In-Text Gene Mentions

…proteins such aslinker histoneshistones, transcription factor…

Show Full Abstract

The nucleosome core particle (NCP) is a large complex of 145-147 base pairs of DNA and eight histone proteins and is the basic building block of chromatin that forms the chromosomes. Here, we develop a coarse-grained (CG) model of the NCP derived through a systematic bottom-up approach based on underlying all-atom MD simulations to compute the necessary CG interactions. The model produces excellent agreement with known structural features of the NCP and gives a realistic description of the nucleosome-nucleosome attraction in the presence of multivalent cations (Mg(H<sub>2</sub>O)<sub>6</sub><sup>2+</sup> or Co(NH<sub>3</sub>)<sub>6</sub><sup>3+</sup>) for systems comprising 20 NCPs. The results of the simulations reveal structural details of the NCP-NCP interactions unavailable from experimental approaches, and this model opens the prospect for the rigorous modeling of chromatin fibers.

Also flagged:methylationagingdeathGene Expressionlipidneurological diseases
Journal Article 2022-05-17 ✓ 1 Snippet Horvath S, Lu AT, Haghani A, Zoller JA, Li CZ, Lim AR, Brooke RT, Raj K, Serres-Armero A, Dreger DL, Hogan AN, Plassais J, Ostrander EA.
In-Text Gene Mentions

…, TRPS1 ,SOX6, ZNF536 ,…

Show Full Abstract

DNA methylation profiles have been used to develop biomarkers of aging known as epigenetic clocks, which predict chronological age with remarkable accuracy and show promise for inferring health status as an indicator of biological age. Epigenetic clocks were first built to monitor human aging, but their underlying principles appear to be evolutionarily conserved, as they have now been successfully developed for many mammalian species. Here, we describe reliable and highly accurate epigenetic clocks shown to apply to 93 domestic dog breeds. The methylation profiles were generated using the mammalian methylation array, which utilizes DNA sequences that are conserved across all mammalian species. Canine epigenetic clocks were constructed to estimate age and also average time to death. We also present two highly accurate human–dog dual species epigenetic clocks (R = 0.97), which may facilitate the ready translation from canine to human use (or vice versa) of antiaging treatments being developed for longevity and preventive medicine. Finally, epigenome-wide association studies here reveal individual methylation sites that may underlie the inverse relationship between breed weight and lifespan. Overall, we describe robust biomarkers to measure aging and, potentially, health status in canines.

Also flagged:lung disorderLSacute respiratory distress syndromestyreneethylene glycolARDS
Journal Article 2022-05-17 No Snippets Kim S, Fesenmeier DJ, Park S, Torregrosa-Allen SE, Elzey BD, Won YY.
Show Full Abstract

We have recently discovered that pulmonary administration of nanoparticles (micelles) formed by amphiphilic poly(styrene-<i>block</i>-ethylene glycol) (PS-PEG) block copolymers has the potential to treat a lung disorder involving lung surfactant (LS) dysfunction (called acute respiratory distress syndrome (ARDS)), as PS-PEG nanoparticles are capable of reducing the surface tension of alveolar fluid, while they are resistant to deactivation caused by plasma proteins/inflammation products unlike natural LS. Herein, we report studies of the clearance pathways and kinetics of PS-PEG nanoparticles from the lung, which are essential for designing further preclinical IND-enabling studies. Using fluorescently labeled PS-PEG nanoparticles, we found that, following pharyngeal aspiration in mice, the retention of these nanoparticles in the lungs extends over 2 weeks, while their transport into other (secondary) organs is relatively insignificant. An analysis based on a multicompartmental pharmacokinetic model suggests a biphasic mechanism involving a fast mucociliary escalator process through the conducting airways and much slower alveolar clearance processes by the action of macrophages and also via direct translocation into the circulation. An excessive dose of PS-PEG nanoparticles led to prolonged retention in the lungs due to saturation of the alveolar clearance capacity.

Also flagged:developmental delaySIM1strabismuscleftFAXCCOQ3
Journal Article 2022-05-17 ✓ 3 Snippets Okazaki T, Kawaguchi T, Saiki Y, Aoki C, Kasagi N, Adachi K, Saida K, Matsumoto N, Nanba E, Maegaki Y.
In-Text Gene Mentions

Nasu et al. described the possible involvement of the POU3F2 gene in developmental delay and increased appetite in experiments from a mouse study7.

⭐ same-sentence co-mention

…in this region:POU3F2, FBXL4, FAXC, COQ3,…

⭐ same-sentence co-mention

…this region: POU3F2,FBXL4, FAXC, COQ3, PNISR,…

Show Full Abstract

There is only one report of patients with developmental delay due to a 6q16.1 deletion that does not contain the SIM1 gene. A 3-year-old female showed strabismus, cleft soft palate, hypotonia at birth, and global developmental delay. Exome sequencing detected a de novo 6q16.1 deletion (chr6: 99282717-100062596) (hg19). The following genes were included in this region: POU3F2, FBXL4, FAXC, COQ3, PNISR, USP45, TSTD3, CCNC, and PRDM13.

Also flagged:chromatinnucleotidemethyladenosinemethylationcell differentiationcancer
Journal Article 2022-05-17 ✓ 3 Snippets Luo Z, Zhang J, Fei J, Ke S.
In-Text Gene Mentions

…and rs121918213 inDARS2gene, the rs121918205…

…TheDARS2encodes mitochondrial aspartyl…

…modification in theDARS2transcript as a…

Show Full Abstract

The N<sup>6</sup>-methyladenosine (m<sup>6</sup>A) modification is deposited to nascent transcripts on chromatin, but its site-specificity mechanism is mostly unknown. Here we model the m<sup>6</sup>A deposition to pre-mRNA by iM6A (intelligent m<sup>6</sup>A), a deep learning method, demonstrating that the site-specific m<sup>6</sup>A methylation is primarily determined by the flanking nucleotide sequences. iM6A accurately models the m<sup>6</sup>A deposition (AUROC = 0.99) and uncovers surprisingly that the cis-elements regulating the m<sup>6</sup>A deposition preferentially reside within the 50 nt downstream of the m<sup>6</sup>A sites. The m<sup>6</sup>A enhancers mostly include part of the RRACH motif and the m<sup>6</sup>A silencers generally contain CG/GT/CT motifs. Our finding is supported by both independent experimental validations and evolutionary conservation. Moreover, our work provides evidences that mutations resulting in synonymous codons can affect the m<sup>6</sup>A deposition and the TGA stop codon favors m<sup>6</sup>A deposition nearby. Our iM6A deep learning modeling enables fast paced biological discovery which would be cost-prohibitive and unpractical with traditional experimental approaches, and uncovers a key cis-regulatory mechanism for m<sup>6</sup>A site-specific deposition.

Also flagged:degradationgene expressiongastric cancernon-small cell lung canceracute ischemic strokeneuroendocrine tumor
Journal Article 2022-05-17 ✓ 1 Snippet Wilson C, Dias NW, Pancini S, Mercadante V, Biase FH.
In-Text Gene Mentions

…, H4C4 ,H4C8, MSH5 ,…

Show Full Abstract

The transcriptome of peripheral white blood cells (PWBCs) are indicators of an organism's physiological state, thus making them a prime biological sample for mRNA-based biomarker discovery. Here, we designed an experiment to evaluate the impact of delayed processing of whole blood samples on gene transcript abundance in PWBCs. We hypothesized that storing blood samples for 24 h at 4 °C would cause RNA degradation resulting in altered transcriptome profiles. There were no statistical differences in RNA quality parameters among samples processed after one, three, six, or eight hours post collection. Additionally, no significant differences were noted in RNA quality parameters or gene transcript abundance between samples collected from the jugular and coccygeal veins. However, samples processed after 24 h of storage had a lower RNA integrity number value (P = 0.03) in comparison to those processed after one hour of storage. Using RNA-sequencing, we identified four and 515 genes with differential transcript abundance in samples processed after storage for eight and 24 h, respectively, relative to samples processed after one hour. Sequencing coverage of transcripts was similar between samples from the 24-h and one-hour groups, thus showing no indication of RNA degradation. This alteration in transcriptome profiles can impair the accuracy of mRNA-based biomarkers, therefore, blood samples collected for mRNA-based biomarker discovery should be refrigerated immediately and processed within six hours post-sampling.

Also flagged:runPax5CHSCHTgene expressionCG1
Journal Article 2022-05-17 ✓ 1 Snippet Oliveira ML, Veloso A, Garcia EG, Iyer S, Pereira C, Barreto VM, Langenau DM, Barata JT.
In-Text Gene Mentions

Importantly, we observed a unique transcriptional profile in Myc + IL7Rmut expressing T-ALLs, including activation of key STAT5 downstream target genes, such as cish or serpinc1 (Fig. 4A and Supplementary Table 3).

Show Full Abstract

T-cell acute lymphoblastic leukemia (T-ALL) is an aggressive pediatric cancer. Amongst the wide array of driver mutations, 10% of T-ALL patients display gain-of-function mutations in the IL-7 receptor α chain (IL-7Rα, encoded by IL7R), which occur in different molecular subtypes of this disease. However, it is still unclear whether IL-7R mutational activation is sufficient to transform T-cell precursors. Also, which genes cooperate with IL7R to drive leukemogenesis remain poorly defined. Here, we demonstrate that mutant IL7R alone is capable of inducing T-ALL with long-latency in stable transgenic zebrafish and transformation is associated with MYC transcriptional activation. Additionally, we find that mutant IL7R collaborates with Myc to induce early onset T-ALL in transgenic zebrafish, supporting a model where these pathways collaborate to drive leukemogenesis. T-ALLs co-expressing mutant IL7R and Myc activate STAT5 and AKT pathways, harbor reduced numbers of apoptotic cells and remake tumors in transplanted zebrafish faster than T-ALLs expressing Myc alone. Moreover, limiting-dilution cell transplantation experiments reveal that activated IL-7R signaling increases the overall frequency of leukemia propagating cells. Our work highlights a synergy between mutant IL7R and Myc in inducing T-ALL and demonstrates that mutant IL7R enriches for leukemia propagating potential.

Also flagged:Atrophymultiple system atrophyadult-onset neurodegenerative disorderautonomic dysfunctionparkinsonismataxia
Journal Article 2022-05-17 No Snippets Grossauer A, Sidoroff V, Heim B, Seppi K.
Show Full Abstract

Without any disease-modifying treatment strategy for multiple system atrophy (MSA), the therapeutic management of MSA patients focuses on a multidisciplinary strategy of symptom control. In the present review, we will focus on state of the art treatment in MSA and additionally give a short overview about ongoing randomized controlled trials in this field.

Also flagged:NAFLDSGLT2inonalcoholic fatty liver diseasetype 2 diabetes mellituscanagliflozininsulin resistance
Journal Article 2022-05-17 ✓ 1 Snippet Akuta N, Kawamura Y, Fujiyama S, Saito S, Muraishi N, Sezaki H, Hosaka T, Kobayashi M, Kobayashi M, Arase Y, Ikeda K, Suzuki F, Suzuki Y, Kumada H.
In-Text Gene Mentions

…deficiency, Wilson disease,hemochromatosis).…

Show Full Abstract

The aim of this study was to determine the impact at 5 years of sodium-glucose cotransporter 2 inhibitor (SGLT2i) in nonalcoholic fatty liver disease (NAFLD) with type 2 diabetes mellitus (T2DM) on liver histopathology and clinical features. In this retrospective study, the histological impacts at 5 years after the start of SGLT2i in NAFLD with T2DM were investigated. Six patients with NAFLD and T2DM were treated for the long term with canagliflozin of SGLT2i, and liver biopsies were obtained at the points of the pretreatment, 24 weeks, 3 years, and 5 years after the start of treatment. The primary outcome was liver histopathological changes at 5 years (defined as decrease in NAFLD activity score of one point or more without worsening in fibrosis stage, compared with the pretreatment). The additional treatment of glucagon-like peptide 1 receptor agonist (GLP-1RA) was performed in 2 patients after the point of 3 years, and evaluated as histological worsening. As the primary outcome, histological improvement, no change, and worsening were 50%, 17%, and 33% at 5 years, respectively. Overall, the scores of steatosis, lobular inflammation, ballooning, and fibrosis stage decreased at 5 years in 67%, 33%, 0%, and 33%, respectively. As the secondary outcomes, homeostasis model assessment of insulin resistance and serum ferritin decreased significantly at 5 years. None developed 3-point major adverse cardiovascular events. Two patients with the addition of GLP-1RA on SGLT2i did not show the worsening of steatosis, ballooning, and fibrosis stage at 5 years compared with 3 years. Conclusion: A 5-year follow-up study with SGLT2i indicated the favorable histological impact on NAFLD with T2DM.

Also flagged:Adrenocortical insufficiencypathogenesisoxygenmembranesappendicitisinflammatory bowel disease
Journal Article 2022-05-17 ✓ 1 Snippet Vance SJ, Horsley JT, Welch MP, Muterspaugh RD, Pandey J.
In-Text Gene Mentions

…26 ; amyloidosis;hemochromatosis, etc.…

Show Full Abstract

No abstract available.

Also flagged:Angiosarcomahepatic angiosarcomahepatocellular carcinomaHepatictumorliver tumor
Journal Article 2022-05-17 ✓ 1 Snippet Mangla A, Cioffi G, Barnholtz-Sloan JS, Lee RT.
In-Text Gene Mentions

…conditions such ashemochromatosisand neurofibromatosis are…

Show Full Abstract

Background: To determine the risk of mortality and factors associated with survival amongst patients diagnosed with primary hepatic angiosarcoma (PHA). Methods: All patients diagnosed with hepatocellular carcinoma (HCC) or PHA from 2004 to 2014 were identified from the National Cancer Database (NCDB). Further analysis was performed within the cohort of patients with PHA to assess the impact of surgery, chemotherapy, radiation, and facility type on overall survival (OS). A multivariable analysis using the Cox proportional methods and a survival analysis using the Kaplan−Meier method were used. Results: A total of 117,633 patients with HCC were identified, out of whom 346 patients had PHA. Patients with PHA had a mean age of 62.9 years (SD 13.7), the majority were men (64.7%), white (85.8%), and had a Charlson comorbidity index (CCI) of zero (66.2%). A third of the patients with PHA (35.7%) received chemotherapy, and 14.6% underwent a surgical resection. The median survival was 1.9 months (1.8−2.4 months) compared to patients with HCC (10.4 months, 10.2−10.5) (aHR-2.41, 95% CI: 2.10−2.77, p < 0.0001). Surgical resection was associated with a higher median survival (7.7 versus 1.8 months, aHR-0.23, 95% CI: 0.15−0.37, p < 0.0001). A receipt of chemotherapy was associated with a higher median survival than no chemotherapy (5.1 versus 1.2 months, aHR-0.44, 95% CI: 0.32−0.60, p < 0.0001), although the survival benefit did not persist long term. Conclusion: PHA is associated with poor outcomes. A surgical resection and chemotherapy are associated with improved survival outcomes; however, the long-term benefits of chemotherapy are limited.

Also flagged:Ironagingpathogenesisneurodegenerative disordersoxygenferroptosis
Journal Article 2022-05-17 ✓ 2 Snippets Dusek P, Hofer T, Alexander J, Roos PM, Aaseth JO.
In-Text Gene Mentions

The mutation p.C282Y in the homeostatic Fe regulator protein (HFE) gene is the most common cause of hereditary hemochromatosis and it was shown that it is associated with an earlier age of onset in WD [275].

…Fe regulator protein (HFE) gene is the…

Show Full Abstract

Disruption of cerebral iron regulation appears to have a role in aging and in the pathogenesis of various neurodegenerative disorders. Possible unfavorable impacts of iron accumulation include reactive oxygen species generation, induction of ferroptosis, and acceleration of inflammatory changes. Whole-brain iron-sensitive magnetic resonance imaging (MRI) techniques allow the examination of macroscopic patterns of brain iron deposits in vivo, while modern analytical methods ex vivo enable the determination of metal-specific content inside individual cell-types, sometimes also within specific cellular compartments. The present review summarizes the whole brain, cellular, and subcellular patterns of iron accumulation in neurodegenerative diseases of genetic and sporadic origin. We also provide an update on mechanisms, biomarkers, and effects of brain iron accumulation in these disorders, focusing on recent publications. In Parkinson's disease, Friedreich's disease, and several disorders within the neurodegeneration with brain iron accumulation group, there is a focal siderosis, typically in regions with the most pronounced neuropathological changes. The second group of disorders including multiple sclerosis, Alzheimer's disease, and amyotrophic lateral sclerosis shows iron accumulation in the globus pallidus, caudate, and putamen, and in specific cortical regions. Yet, other disorders such as aceruloplasminemia, neuroferritinopathy, or Wilson disease manifest with diffuse iron accumulation in the deep gray matter in a pattern comparable to or even more extensive than that observed during normal aging. On the microscopic level, brain iron deposits are present mostly in dystrophic microglia variably accompanied by iron-laden macrophages and in astrocytes, implicating a role of inflammatory changes and blood-brain barrier disturbance in iron accumulation. Options and potential benefits of iron reducing strategies in neurodegeneration are discussed. Future research investigating whether genetic predispositions play a role in brain Fe accumulation is necessary. If confirmed, the prevention of further brain Fe uptake in individuals at risk may be key for preventing neurodegenerative disorders.

Also flagged:Tumorhematoxylininvasive breast cancerBreast Cancertriple negative breast cancerprimary tumor
Journal Article 2022-05-17 No Snippets Garcia V, Elfer K, Peeters DJE, Ehinger A, Werness B, Ly A, Li X, Hanna MG, Blenman KRM, Salgado R, Gallas BD.
Show Full Abstract

The High Throughput Truthing project aims to develop a dataset for validating artificial intelligence and machine learning models (AI/ML) fit for regulatory purposes. The context of this AI/ML validation dataset is the reporting of stromal tumor-infiltrating lymphocytes (sTILs) density evaluations in hematoxylin and eosin-stained invasive breast cancer biopsy specimens. After completing the pilot study, we found notable variability in the sTILs estimates as well as inconsistencies and gaps in the provided training to pathologists. Using the pilot study data and an expert panel, we created custom training materials to improve pathologist annotation quality for the pivotal study. We categorized regions of interest (ROIs) based on their mean sTILs density and selected ROIs with the highest and lowest sTILs variability. In a series of eight one-hour sessions, the expert panel reviewed each ROI and provided verbal density estimates and comments on features that confounded the sTILs evaluation. We aggregated and shaped the comments to identify pitfalls and instructions to improve our training materials. From these selected ROIs, we created a training set and proficiency test set to improve pathologist training with the goal to improve data collection for the pivotal study. We are not exploring AI/ML performance in this paper. Instead, we are creating materials that will train crowd-sourced pathologists to be the reference standard in a pivotal study to create an AI/ML model validation dataset. The issues discussed here are also important for clinicians to understand about the evaluation of sTILs in clinical practice and can provide insight to developers of AI/ML models.

Also flagged:neoplasmsT-cell acute lymphoblastic leukemiaALLT-ALLTAcute Lymphoblastic Leukemia
Journal Article 2022-05-17 ✓ 1 Snippet Genescà E, González-Gil C.
In-Text Gene Mentions

In addition to point mutations, structural abnormalities such as rearrangements affecting KMT2A, MLLT10, NUP214, or NUP98, which trans activate HOXA genes, are often detected in ETP-ALL cases [44,45].

Show Full Abstract

As for many neoplasms, initial genetic data about T-cell acute lymphoblastic leukemia (T-ALL) came from the application of cytogenetics. This information helped identify some recurrent chromosomal alterations in T-ALL at the time of diagnosis, although it was difficult to determine their prognostic impact because of their low incidence in the specific T-ALL cohort analyzed. Genetic knowledge accumulated rapidly following the application of genomic techniques, drawing attention to the importance of using high-resolution genetic techniques to detect cryptic aberrations present in T-ALL, which are not usually detected by cytogenetics. We now have a clearer appreciation of the genetic landscape of the different T-ALL subtypes at diagnosis, explaining the particular oncogenetic processes taking place in each T-ALL, and we have begun to understand relapse-specific mechanisms. This review aims to summarize the latest advances in our knowledge of the genome in T-ALL. We highlight areas where the research in this subtype of ALL is progressing with the aim of identifying key questions that need to be answered in the medium-long term if this knowledge is to be applied in clinics.

Also flagged:COVID-19infectionsrespiratory illnessesribonuclease PRNase Pbehavioral
Journal Article 2022-05-17 No Snippets Cox K, Haggerty L, Abeln K, Hernandez L, Wicker J, Padgett L, Privitera MB.
Show Full Abstract

This study demonstrates that students in kindergarten through eighth grade can use the XpressCollect nasal swab to self-collect a specimen under the guidance of a teacher. This phased study was conducted with parents, teachers, and students. Phases 1 and 2 were conducted as interviews with teachers and parents to assess the suitability of the XpressCollect for children in kindergarten through eighth grade. Additionally, teacher and parent feedback was obtained to develop and optimize the instructional materials for subsequent phases. In Phases 3 and 4, teachers guided small groups and full classes of students through the sample collection process with XpressCollect. The samples collected by the students were sent to a laboratory to analyze the effectiveness of specimen self-collection based on the presence of ribonuclease P (RNase P) on each nasal swab. The presence of RNase P enables disease determination; thus, student samples were analyzed for adequate or inadequate sampling. All students in kindergarten through eighth grade are capable of self-collecting an anterior nares specimen with XpressCollect, as the laboratory results identified acceptable RNase P Ct values for the samples collected in a classroom setting.

Also flagged:Papillary Renal Cell CarcinomapRCCrenal cell carcinomaclear cell carcinomanon-clear cell renal cell carcinomasgene expression
Journal Article 2022-05-17 No Snippets Trevisani F, Floris M, Vago R, Minnei R, Cinque A.
Show Full Abstract

Papillary renal cell carcinoma (pRCC) represents the second most common subtype of renal cell carcinoma, following clear cell carcinoma and accounting for 10-15% of cases. For around 20 years, pRCCs have been classified according to their mere histopathologic appearance, unsupported by genetic and molecular evidence, with an unmet need for clinically relevant classification. Moreover, patients with non-clear cell renal cell carcinomas have been seldom included in large clinical trials; therefore, the therapeutic landscape is less defined than in the clear cell subtype. However, in the last decades, the evolving comprehension of pRCC molecular features has led to a growing use of target therapy and to better oncological outcomes. Nonetheless, a reliable molecular biomarker able to detect the aggressiveness of pRCC is not yet available in clinical practice. As a result, the pRCC correct prognosis remains cumbersome, and new biomarkers able to stratify patients upon risk of recurrence are strongly needed. Non-coding RNAs (ncRNAs) are functional elements which play critical roles in gene expression, at the epigenetic, transcriptional, and post-transcriptional levels. In the last decade, ncRNAs have gained importance as possible biomarkers for several types of diseases, especially in the cancer universe. In this review, we analyzed the role of long non-coding RNAs (lncRNAs) in the prognosis of pRCC, with a particular focus on their networking. In fact, in the competing endogenous RNA hypothesis, lncRNAs can bind miRNAs, resulting in the modulation of the mRNA levels targeted by the sponged miRNA, leading to additional regulation of the target gene expression and increasing complexity in the biological processes.

Also flagged:BDNFDARPP32D2Rgenetic disorderHDgamma-aminobutyric acid
Journal Article 2022-05-17 ✓ 5 Snippets Wenceslau CV, de Souza DM, Mambelli-Lisboa NC, Ynoue LH, Araldi RP, da Silva JM, Pagani E, Haddad MS, Kerkis I.
In-Text Gene Mentions

HD is caused by the expansion of a cytosine–adenine–guanine trinucleotide (CAG) repeat located in the first exon of the IT15 gene (locus 4p16.3), which encodes the huntingtin protein (Htt) [2].

…the huntingtin protein (Htt) [ 2 ].…

…TheHttprotein is crucial…

…ThisHttis enriched at…

…is because theHttinteracts with over…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative inherited genetic disorder, which leads to the onset of motor, neuropsychiatric and cognitive disturbances. HD is characterized by the loss of gamma-aminobutyric acid (GABA)ergic medium spiny neurons (MSNs). To date, there is no treatment for HD. Mesenchymal stem cells (MSCs) provide a substantial therapeutic opportunity for the HD treatment. Herein, we investigated the therapeutic potential of human immature dental pulp stem cells (hIDPSC), a special type of MSC originated from the neural crest, for HD treatment. Two different doses of hIDPSC were intravenously administrated in a subacute 3-nitropropionic acid (3NP)-induced rat model. We demonstrated hIDPSC homing in the striatum, cortex and subventricular zone using specific markers for human cells. Thirty days after hIDPSC administration, the cells found in the brain are still express hallmarks of undifferentiated MSC. Immunohistochemistry quantities analysis revealed a significant increase in the number of BDNF, DARPP32 and D2R positive stained cells in the striatum and cortex in the groups that received hIDPSC. The differences were more expressive in animals that received only one administration of hIDPSC. Altogether, these data suggest that the intravenous administration of hIDPSCs can restore the BDNF, DARPP32 and D2R expression, promoting neuroprotection and neurogenesis.

Also flagged:TransglutaminaseCeliac Diseasetissue transglutaminaseTG2cysteineautoimmune disease
Journal Article 2022-05-17 No Snippets Büchold C, Hils M, Gerlach U, Weber J, Pelzer C, Heil A, Aeschlimann D, Pasternack R.
Show Full Abstract

ZED1227 is a small molecule tissue transglutaminase (TG2) inhibitor. The compound selectively binds to the active state of TG2, forming a stable covalent bond with the cysteine in its catalytic center. The molecule was designed for the treatment of celiac disease. Celiac disease is an autoimmune-mediated chronic inflammatory condition of the small intestine affecting about 1-2% of people in Caucasian populations. The autoimmune disease is triggered by dietary gluten. Consumption of staple foods containing wheat, barley, or rye leads to destruction of the small intestinal mucosa in genetically susceptible individuals, and this is accompanied by the generation of characteristic TG2 autoantibodies. TG2 plays a causative role in the pathogenesis of celiac disease. Upon activation by Ca<sup>2+</sup>, it catalyzes the deamidation of gliadin peptides as well as the crosslinking of gliadin peptides to TG2 itself. These modified biological structures trigger breaking of oral tolerance to gluten, self-tolerance to TG2, and the activation of cytotoxic immune cells in the gut mucosa. Recently, in an exploratory proof-of-concept study, ZED1227 administration clinically validated TG2 as a "druggable" target in celiac disease. Here, we describe the specific features and profiling data of the drug candidate ZED1227. Further, we give an outlook on TG2 inhibition as a therapeutic approach in indications beyond celiac disease.

Also flagged:chocolatepolyphenolsflavonoidsflavonoidmineralwater
Journal Article 2022-05-17 No Snippets Jaćimović S, Popović-Djordjević J, Sarić B, Krstić A, Mickovski-Stefanović V, Pantelić NĐ.
Show Full Abstract

Cocoa beans are part of the cocoa plant fruit (<i>Theobroma cacao</i> L.) used to prepare various products such as chocolate, cocoa butter, jelly, liqueurs, cosmetics, etc. Dark chocolate is consumed worldwide by different populations and is known for its good taste, making it one of the most favoured food products. This work aimed to determine the content of total polyphenols (TPC), total flavonoids (TFC), and the antioxidant potential measured through the ability to scavenge DPPH free radicals (DPPH), ferric reducing power (FRAP), and total antioxidant capacity (TAC), as well as major and trace elements contained in twelve commercially available dark chocolate samples, with cocoa content ranging from 40% to 99%. The total polyphenols content ranged between 10.55 and 39.82 mg/g GAE, while the total flavonoid content was from 10.04 to 37.85 mg/g CE. All applied antioxidant assays indicate that the sample with the highest cocoa percentage shows the greatest antioxidant activity (DPPH: 48.34% of inhibition; FRAP: 89.00 mg/g GAE; TAC: 83.86 mg/g AAE). Statistical methods were applied to establish the differences between the samples concerning TPC, TFC, DPPH, FRAP and TAC, as well as to differentiate the samples according to the mineral content. The results indicated that the differences in TPC and TFC between different samples depended on the cocoa content and the addition of dried fruit pieces. A good correlation between antioxidant potency composite index (ACI) and declared cocoa content was noticed (<i>R</i><sup>2</sup> = 0.8034), indicating that the declared percentage of cocoa is a reliable indicator for antioxidant activity of analysed dark chocolate samples. The nutritional evaluation proved that the studied chocolate samples were an excellent source of Mg, Fe, Mn and Cu.

Also flagged:HuntingtinExtracellular VesiclesHDneurodegenerative disorderdeathextracellular
Journal Article 2022-05-17 ✓ 5 Snippets Ananbeh H, Novak J, Juhas S, Juhasova J, Klempir J, Doleckova K, Rysankova I, Turnovcova K, Hanus J, Hansikova H, Vodicka P, Kupcova Skalnikova H.
In-Text Gene Mentions

In addition, unlike Tau protein and α-synuclein, which have prevalent expression in brain, the HTT is expressed throughout the body and HD affects peripheral organs also [83,84].

In HD, information about protein composition of EVs is missing [57] and the presence of HTT protein or its fragments in the EVs isolated from blood plasma have not yet been reported.

(1) Background: Huntington’s disease (HD) is rare incurable hereditary neurodegenerative disorder caused by CAG repeat expansion in the gene coding for the protein huntingtin (HTT).

…the protein huntingtin (HTT).…

…Huntingtin (HTT) is a large…

Show Full Abstract

(1) Background: Huntington's disease (HD) is rare incurable hereditary neurodegenerative disorder caused by CAG repeat expansion in the gene coding for the protein huntingtin (HTT). Mutated huntingtin (mHTT) undergoes fragmentation and accumulation, affecting cellular functions and leading to neuronal cell death. Porcine models of HD are used in preclinical testing of currently emerging disease modifying therapies. Such therapies are aimed at reducing mHTT expression, postpone the disease onset, slow down the progression, and point out the need of biomarkers to monitor disease development and therapy efficacy. Recently, extracellular vesicles (EVs), particularly exosomes, gained attention as possible carriers of disease biomarkers. We aimed to characterize HTT and mHTT forms/fragments in blood plasma derived EVs in transgenic (TgHD) and knock-in (KI-HD) porcine models, as well as in HD patients' plasma. (2) Methods: Small EVs were isolated by ultracentrifugation and HTT forms were visualized by western blotting. (3) Results: The full length 360 kDa HTT co-isolated with EVs from both the pig model and HD patient plasma. In addition, a ~70 kDa mutant HTT fragment was specific for TgHD pigs. Elevated total huntingtin levels in EVs from plasma of HD groups compared to controls were observed in both pig models and HD patients, however only in TgHD were they significant (<i>p</i> = 0.02). (4) Conclusions: Our study represents a valuable initial step towards the characterization of EV content in the search for HD biomarkers.

Also flagged:Gene ExpressionLipidMetabolismHuman immunodeficiency virusHIV) infectiondeath
Journal Article 2022-05-17 ✓ 1 Snippet Jiménez-Osorio AS, Jaen-Vega S, Fernández-Martínez E, Ortíz-Rodríguez MA, Martínez-Salazar MF, Jiménez-Sánchez RC, Flores-Chávez OR, Ramírez-Moreno E, Arias-Rico J, Arteaga-García F, Estrada-Luna D.
In-Text Gene Mentions

A systematic review showed no association between the polymorphisms in APOC3 and PPAR-γ with lipodystrophy; although, there was an association between the G allele of the homeostatic iron regulator (HFE) and protection against the development of lipoatrophy when compared with the reference C allele.

Show Full Abstract

Human immunodeficiency virus (HIV) infection has continued to be the subject of study since its discovery nearly 40 years ago. Significant advances in research and intake of antiretroviral therapy (ART) have slowed the progression and appearance of the disease symptoms and the incidence of concomitant diseases, which are the leading cause of death in HIV+ persons. However, the prolongation of ART is closely related to chronic degenerative diseases and pathologies caused by oxidative stress (OS) and alterations in lipid metabolism (increased cholesterol levels), both of which are conditions of ART. Therefore, recent research focuses on using natural therapies to diminish the effects of ART and HIV infection: regulating lipid metabolism and reducing OS status. The present review summarizes current information on OS and cholesterol metabolism in HIV+ persons and how the consumption of certain phytochemicals can modulate these. For this purpose, MEDLINE and SCOPUS databases were consulted to identify publications investigating HIV disease and natural therapies and their associated effects.

Also flagged:Non-Alcoholic Fatty Liver DiseaseType 2 DiabetesFibroblast growth factor 21FGF21NAFLDpathogenesis
Journal Article 2022-05-17 ✓ 1 Snippet Mana MF, Parisi MCR, Correa-Giannella ML, Neto AM, Yamanaka A, Cunha-Silva M, Cavaleiro AM, Dos Santos CR, Pavan CR, Sevá-Pereira T, Dertkigil SSJ, Mazo DF.
In-Text Gene Mentions

…C, autoimmune hepatitis,hemochromatosis, alpha 1-antitrypsin deficien…

Show Full Abstract

Fibroblast growth factor 21 (FGF21) signaling and genetic factors are involved in non-alcoholic fatty liver disease (NAFLD) pathogenesis. However, these factors have rarely been studied in type 2 diabetes mellitus (T2D) patients from admixed populations such as in those of Brazil. Therefore, we aimed to evaluate rs738409 patanin-like phospholipase domain-containing protein (<i>PNPLA3</i>) and rs499765 <i>FGF21</i> polymorphisms in T2D, and their association with NAFLD, liver fibrosis, and serum biomarkers (FGF21 and cytokeratin 18 levels). A total of 158 patients were included, and the frequency of NAFLD was 88.6%, which was independently associated with elevated body mass index. Significant liver fibrosis (≥F2) was detected by transient elastography (TE) in 26.8% of NAFLD patients, and was independently associated with obesity, low density lipoprotein, and gamma-glutamyl transferase (GGT). <i>PNPLA3</i> GG genotype and GGT were independently associated with cirrhosis. <i>PNPLA3</i> GG genotype patients had higher GGT and AST levels; <i>PNPLA3</i> GG carriers had higher TE values than CG patients, and <i>FGF21</i> CG genotype patients showed lower gamma-GT values than CC patients. No differences were found in serum values of FGF21 and CK18 in relation to the presence of NAFLD or liver fibrosis. The proportion of NAFLD patients with liver fibrosis was relevant in the present admixed T2D population, and was associated with <i>PNPLA3</i> polymorphisms.

Also flagged:inflammatory responsewound healingprostaglandinspro-inflammatory cytokineschemokinesadhesion molecules
Journal Article 2022-05-17 No Snippets Rauf A, Badoni H, Abu-Izneid T, Olatunde A, Rahman MM, Painuli S, Semwal P, Wilairatana P, Mubarak MS.
Show Full Abstract

Neuroinflammation, a protective response of the central nervous system (CNS), is associated with the pathogenesis of neurodegenerative diseases. The CNS is composed of neurons and glial cells consisting of microglia, oligodendrocytes, and astrocytes. Entry of any foreign pathogen activates the glial cells (astrocytes and microglia) and overactivation of these cells triggers the release of various neuroinflammatory markers (NMs), such as the tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-1β (IL-10), nitric oxide (NO), and cyclooxygenase-2 (COX-2), among others. Various studies have shown the role of neuroinflammatory markers in the occurrence, diagnosis, and treatment of neurodegenerative diseases. These markers also trigger the formation of various other factors responsible for causing several neuronal diseases including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), multiple sclerosis (MS), ischemia, and several others. This comprehensive review aims to reveal the mechanism of neuroinflammatory markers (NMs), which could cause different neurodegenerative disorders. Important NMs may represent pathophysiologic processes leading to the generation of neurodegenerative diseases. In addition, various molecular alterations related to neurodegenerative diseases are discussed. Identifying these NMs may assist in the early diagnosis and detection of therapeutic targets for treating various neurodegenerative diseases.

Also flagged:penicillinerythromycinco-trimoxazoleinfectioninfectionsmeningitis
Journal Article 2022-05-17 No Snippets Kielbik K, Pietras A, Jablonska J, Bakiera A, Borek A, Niedzielska G, Grzegorczyk M, Grywalska E, Korona-Glowniak I.
Show Full Abstract

In 2017, Poland introduced the 10-valent pneumococcal conjugate vaccine (PCV) into its national immunization schedule. This prospective study was conducted between March and June 2020 to determine the impact of vaccination on prevalence of the nasopharyngeal carriage of <i>S. pneumoniae</i> in 176 healthy children and to determine how conjugate vaccines indirectly affect colonization of nasopharyngeal microbiota. Pneumococcal isolates were analyzed by serotyping and antimicrobial resistance tests. Nasopharyngeal microbiota were detected and identified using the culture method and real-time PCR amplification primers and hydrolysis-probe detection with the 16S rRNA gene as the target. In the vaccinated group of children, colonization was in 24.2% of children, compared to 21.4% in the unvaccinated group. Serotypes 23A and 23B constituted 41.5% of the isolates. Serotypes belonging to PCV10 and PCV13 constituted 4.9% and 17.1% of the isolates, respectively. <i>S. pneumoniae</i> isolates were resistant to penicillin (34.1%), erythromycin (31.7%), and co-trimoxazole (26.8%). Microbial DNA qPCR array correlated to increased amounts of <i>Streptococcus mitis</i> and <i>S. sanguinis</i> in vaccinated children, with reduced amounts of <i>C. pseudodiphtericum</i>, <i>S. aureus</i>, and <i>M. catarrhalis</i>. Introduction of PCV for routine infant immunization was associated with significant reductions in nasopharyngeal carriage of PCV serotypes and resistant strains amongst vaccine serotypes, yet carriage of non-PCV serotypes increased modestly, particularly serotype 23B.

Also flagged:Liver IschemiaNecroptosisischemia-reperfusion injuryphosphorylationMixed Lineage Kinase domain-like proteindeath
Journal Article 2022-05-17 No Snippets Shi S, Bonaccorsi-Riani E, Schurink I, van den Bosch T, Doukas M, Lila KA, Roest HP, Xhema D, Gianello P, de Jonge J, Verstegen MMA, van der Laan LJW.
Show Full Abstract

<h4>Background</h4>Early allograft dysfunction (EAD) following liver transplantation (LT) remains a major threat to the survival of liver grafts and recipients. In animal models, it is shown that hepatic ischemia-reperfusion injury (IRI) triggers phosphorylation of Mixed Lineage Kinase domain-like protein (pMLKL) inducing necroptotic cell death. However, the clinical implication of pMLKL-mediated cell death in human hepatic IRI remains largely unexplored. In this study, we aimed to investigate the expression of pMLKL in human liver grafts and its association with EAD after LT.<h4>Methods</h4>The expression of pMLKL was determined by immunohistochemistry in liver biopsies obtained from both human and rat LT. Human liver biopsies were obtained at the end of preservation (T0) and ~1 hour after reperfusion (T1). The positivity of pMLKL was quantified electronically and compared in rat and human livers and post-LT outcomes. Multiplex immunofluorescence staining was performed to characterize the pMLKL-expressing cells.<h4>Results</h4>In the rat LT model, significant pMLKL expression was observed in livers after IRI as compared to livers of sham-operation animals. Similarly, the pMLKL score was highest after IRI in human liver grafts (in T1 biopsies). Both in rats and humans, the pMLKL expression is mostly observed in the portal triads. In grafts who developed EAD after LT (n=24), the pMLKL score at T1 was significantly higher as compared to non-EAD grafts (n=40). ROC curve revealed a high predictive value of pMLKL score at T1 (AUC 0.70) and the ratio of pMLKL score at T1 and T0 (pMLKL-index, AUC 0.82) for EAD. Liver grafts with a high pMLKL index (>1.64) had significantly higher levels of serum ALT, AST, and LDH 24 hours after LT compared to grafts with a low pMLKL index. Multivariate logistical regression analysis identified the pMLKL-index (Odds ratio=1.3, 95% CI 1.1-1.7) as a predictor of EAD development. Immunohistochemistry on serial sections and multiplex staining identified the periportal pMLKL-positive cells as portal fibroblasts, fibrocytes, and a minority of cholangiocytes.<h4>Conclusion</h4>Periportal pMLKL expression increased significantly after IRI in both rat and human LT. The histological score of pMLKL is predictive of post-transplant EAD and is associated with early liver injury after LT. Periportal non-parenchymal cells (i.e. fibroblasts) appear most susceptible to pMLKL-mediated cell death during hepatic IRI.

Also flagged:ExtracellularVesicleExtracellular vesiclesmembranevesiclesextracellular space
Journal Article 2022-05-17 ✓ 1 Snippet Ali Moussa HY, Manaph N, Ali G, Maacha S, Shin KC, Ltaief SM, Gupta V, Tong Y, Ponraj J, Salloum-Asfar S, Mansour S, Al-Shaban FA, Kim HG, Stanton LW, Grivel JC, Abdulla SA, Al-Shammari AR, Park Y.
In-Text Gene Mentions

…BRN2, also calledPOU3F2, and CTIP2 (…

Show Full Abstract

Extracellular vesicles (EVs) are membrane vesicles released from cells to the extracellular space, involved in cell-to-cell communication by the horizontal transfer of biomolecules such as proteins and RNA. Because EVs can cross the blood-brain barrier (BBB), circulating through the bloodstream and reflecting the cell of origin in terms of disease prognosis and severity, the contents of plasma EVs provide non-invasive biomarkers for neurological disorders. However, neuronal EV markers in blood plasma remain unclear. EVs are very heterogeneous in size and contents, thus bulk analyses of heterogeneous plasma EVs using Western blot and ELISA have limited utility. In this study, using flow cytometry to analyze individual neuronal EVs, we show that our plasma EVs isolated by size exclusion chromatography are mainly CD63-positive exosomes of endosomal origin. As a neuronal EV marker, neural cell adhesion molecule (NCAM) is highly enriched in EVs released from induced pluripotent stem cells (iPSCs)-derived cortical neurons and brain organoids. We identified the subpopulations of plasma EVs that contain NCAM using flow cytometry-based individual EV analysis. Our results suggest that plasma NCAM-positive neuronal EVs can be used to discover biomarkers for neurological disorders.

Also flagged:cell adhesionchondrogenesisosteogenesisdegenerative diseasestumorinfection
Journal Article 2022-05-17 No Snippets Yang Z, Yi P, Liu Z, Zhang W, Mei L, Feng C, Tu C, Li Z.
Show Full Abstract

Tremendous advances in tissue engineering and regenerative medicine have revealed the potential of fabricating biomaterials to solve the dilemma of bone and articular defects by promoting osteochondral and cartilage regeneration. Three-dimensional (3D) bioprinting is an innovative fabrication technology to precisely distribute the cell-laden bioink for the construction of artificial tissues, demonstrating great prospect in bone and joint construction areas. With well controllable printability, biocompatibility, biodegradability, and mechanical properties, hydrogels have been emerging as an attractive 3D bioprinting material, which provides a favorable biomimetic microenvironment for cell adhesion, orientation, migration, proliferation, and differentiation. Stem cell-based therapy has been known as a promising approach in regenerative medicine; however, limitations arise from the uncontrollable proliferation, migration, and differentiation of the stem cells and fortunately could be improved after stem cells were encapsulated in the hydrogel. In this review, our focus was centered on the characterization and application of stem cell-laden hydrogel-based 3D bioprinting for bone and cartilage tissue engineering. We not only highlighted the effect of various kinds of hydrogels, stem cells, inorganic particles, and growth factors on chondrogenesis and osteogenesis but also outlined the relationship between biophysical properties like biocompatibility, biodegradability, osteoinductivity, and the regeneration of bone and cartilage. This study was invented to discuss the challenge we have been encountering, the recent progress we have achieved, and the future perspective we have proposed for in this field.

Also flagged:ascancercancerstumorend-joininggastric cancer
Journal Article 2022-05-17 No Snippets Wang L, Lu J, Song Y, Bai J, Sun W, Yu J, Cai M, Fu S.
Show Full Abstract

DNA repair mechanisms have been proven to be essential for cells, and abnormalities in DNA repair could cause various diseases, such as cancer. However, the diversity and complexity of DNA repair mechanisms obscure the functions of DNA repair in cancers. In addition, the relationships between DNA repair, the tumor mutational burden (TMB), and immune infiltration are still ambiguous. In the present study, we evaluated the prognostic values of various types of DNA repair mechanisms and found that double-strand break repair through single-strand annealing (SSA) and nonhomologous end-joining (NHEJ) was the most prognostic DNA repair processes in gastric cancer (GC) patients. Based on the activity of these two approaches and expression profiles, we constructed a HR-LR model, which could accurately divide patients into high-risk and low-risk groups with different probabilities of survival and recurrence. Similarly, we also constructed a cancer-normal model to estimate whether an individual had GC or normal health status. The prognostic value of the HR-LR model and the accuracy of the cancer-normal model were validated in several independent datasets. Notably, low-risk samples, which had higher SSA and NHEJ activities, had more somatic mutations and less immune infiltration. Furthermore, the analysis found that low-risk samples had higher and lower methylation levels in CpG islands (CGIs) and open sea regions respectively, and had higher expression levels of programmed death-ligand 1 (PD-L1) and lower methylation levels in the promoter of the gene encoding PD-L1. Moreover, low-risk samples were characterized primarily by higher levels of CD4<sup>+</sup> memory T cells, CD8<sup>+</sup> naive T cells, and CD8<sup>+</sup> TEM cells than those in high-risk samples. Finally, we proposed a decision tree and nomogram to help predict the clinical outcome of an individual. These results provide an improved understanding of the complexity of DNA repair, the TMB, and immune infiltration in GC, and present an accurate prognostic model for use in GC patients.

Also flagged:Cas9pathogenesisclustered regularly interspaced short palindromic repeatsCRISPR-associated protein 9cognitionzinc finger nucleases
Journal Article 2022-05-17 ✓ 2 Snippets Lin Y, Li J, Li C, Tu Z, Li S, Li XJ, Yan S.
In-Text Gene Mentions

Afterwards, in 2008, Yang et al. developed a transgenic model of Huntington’s disease (HD) in a rhesus macaque that expressed polyglutamine (polyQ)-expanded huntingtin protein (HTT) by injecting lentiviral vector into mature rhesus oocytes followed by fertilization through intracytoplasmic sperm injection and embryo transplantation (Yang et al., 2008).

Yan et al. used CRISPR/Cas9 to insert a large CAG repeat (150 CAGs) into the endogenous pig HTT gene in fibroblast cells and employed the SCNT to generate a HD KI pig model expressing full-length mutant HTT at the endogenous level (Yan et al., 2018), whose brains presented severe and preferential neurodegeneration in the medium spiny neurons like HD patients.

Show Full Abstract

The foundation for investigating the mechanisms of human diseases is the establishment of animal models, which are also widely used in agricultural industry, pharmaceutical applications, and clinical research. However, small animals such as rodents, which have been extensively used to create disease models, do not often fully mimic the key pathological changes and/or important symptoms of human disease. As a result, there is an emerging need to establish suitable large animal models that can recapitulate important phenotypes of human diseases for investigating pathogenesis and developing effective therapeutics. However, traditional genetic modification technologies used in establishing small animal models are difficultly applied for generating large animal models of human diseases. This difficulty has been overcome to a great extent by the recent development of gene editing technology, especially the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9). In this review, we focus on the applications of CRISPR/Cas9 system to establishment of large animal models, including nonhuman primates, pigs, sheep, goats and dogs, for investigating disease pathogenesis and treatment. We also discuss the limitations of large animal models and possible solutions according to our current knowledge. Finally, we sum up the applications of the novel genome editing tool Base Editors (BEs) and its great potential for gene editing in large animals.

Also flagged:brain developmentcell proliferationneurogenesiscell migrationmyelinationgene expression
Journal Article 2022-05-17 No Snippets Cheng M, Wu L, Han L, Huang X, Lai Y, Xu J, Wang S, Li M, Zheng H, Feng W, Huang Z, Jiang Y, Hao S, Li Z, Chen X, Peng J, Guo P, Zhang X, Lai G, Deng Q, Yuan Y, Yang F, Wei X, Liao S, Chen A, Volpe G, Esteban MA, Hou Y, Liu C, Liu L.
Show Full Abstract

No abstract available.

Also flagged:CD47Oral squamous cell carcinomaOSCCcancersdeathcell surface transmembrane protein
Journal Article 2022-05-17 No Snippets Tseng CC, Tsou CH, Huang SY, Wu CW, Hsieh TH.
Show Full Abstract

Oral squamous cell carcinoma (OSCC) is one of the most common cancers in the world, and the incidence and death rate of OSCC in men is twice that of women. CD47 is a ubiquitous cell surface transmembrane protein, also known as integrin-related protein (IAP). Previous studies have pointed out that CD47 can inhibit the growth of OSCC, but the detailed mechanism is not clear. This study aimed to explore the effect of CD47 gene expression profiles in OSCC. The OSCC cell lines, OECM-1 and OC-2, overexpressed CD47, and the expression profiles of mRNAs were analyzed through next-generation sequencing (NGS) with a bioinformatic approach. A total of 14 differentially expressed genes (DEGs) were listed. In addition, ingenuity pathway analysis (IPA) was used to analyze the molecular function (MF), biological process (BP), and cellular component (CC) network signaling. The human protein atlas (HPA) database was used to analyze gene expression and the survivability of human cancer. The results found that HSPA5, HYOU1, and PDIA4 were involved in the IPA network and when highly expressed, mediated the survivability of cancer. In addition, HSPA5 was positively and significantly correlated with CD47 expression (p < 0.0001) and induced by CD47-overexpression in the OECM-1 and OC-2 OSCC cancer cell lines. These findings provide important insights into possible new diagnostic strategies, including unfolded protein for OSCC-targeting CD47.

Also flagged:malignant tumorthyroid glandmembranestumorCD5CD117
Journal Article 2022-05-17 ✓ 5 Snippets Jiang L, Zheng WH, Chen C.
In-Text Gene Mentions

Notably, mutations in the MLLT10 and HLA‐B genes have not been found previously in the TCGA database of common thyroid or thymus tumor, which may indicate that CASTLE is different from thyroid and thymic carcinomas.

In our study, we for the first time used WES to detect the genomic variation of CASTLE tumors and found novel mutations in SMGs such as FBXL16, PAQR7, LEFTY1, UBA52, and FLNA, as well as in potential disease‐related driver genes such as MLLT10, FLNA, CYLD, HLA‐B, KMT2D, SFPQ, MUC16, EEF2, and KMT2C.

…genes such asMLLT10, FLNA ,…

…mutations in theMLLT10and HLA‐B genes…

MLLT10encodes a transcription…

Show Full Abstract

<h4>Background</h4>Carcinoma showing thymus-like elements (CASTLE) is a rare kind of malignant tumor of thyroid gland. The genetic mutation characteristics of CASTLE are not clear.<h4>Methods</h4>We retrospectively analyzed seven patients diagnosed as CASTLE tumor in our hospital, and performed whole exome sequencing (WES) in five cases to analyze the genomic variation of CASTLE in thyroid gland.<h4>Results</h4>The diagnosis of CASTLE was confirmed by histopathological and immunohistochemical results. Immunohistochemical staining showed that cell membranes of tumor samples in all cases were moderately to strongly positive for CD5 and CD117. WES presented a large number of single nucleotide variants (SNVs), insertions and deletions (InDel), and copy number variations (CNVs). By comparing with the TCGA database, we found novel mutations in significantly mutated genes such as <i>FBXL16</i>, <i>PAQR7</i>, <i>LEFTY1</i>, <i>UBA52</i>, and <i>FLNA</i>, as well as in potential disease-related driver genes such as <i>MLLT10</i>, <i>FLNA</i>, <i>CYLD</i>, <i>HLA-B</i>, <i>KMT2D</i>, <i>SFPQ</i>, <i>MUC16</i>, <i>EEF2</i>, and <i>KMT2C.</i><h4>Conclusions</h4>CASTLE tumors contain unique tumor driver gene mutations. The information about mutations in several novel genes obtained in this study may contribute to unraveling the molecular mechanisms responsible for the emergence of thyroid CASTLE tumors and help formulating possible in-roads for treatment.

Also flagged:Fibrillar protein aggregationamyloid-βtauAlzheimer's diseaseα-synucleinParkinson's disease
Journal Article 2022-05-17 No Snippets Sinnige T.
Show Full Abstract

Fibrillar protein aggregation is a hallmark of a variety of human diseases. Examples include the deposition of amyloid-β and tau in Alzheimer's disease, and that of α-synuclein in Parkinson's disease. The molecular mechanisms by which soluble proteins form amyloid fibrils have been extensively studied in the test tube. These investigations have revealed the microscopic steps underlying amyloid formation, and the role of factors such as chaperones that modulate these processes. This perspective explores the question to what extent the mechanisms of amyloid formation elucidated <i>in vitro</i> apply to human disease. The answer is not yet clear, and may differ depending on the protein and the associated disease. Nevertheless, there are striking qualitative similarities between the aggregation behaviour of proteins <i>in vitro</i> and the development of the related diseases. Limited quantitative data obtained in model organisms such as <i>Caenorhabditis elegans</i> support the notion that aggregation mechanisms <i>in vivo</i> can be interpreted using the same biophysical principles established <i>in vitro</i>. These results may however be biased by the high overexpression levels typically used in animal models of protein aggregation diseases. Molecular chaperones have been found to suppress protein aggregation in animal models, but their mechanisms of action have not yet been quantitatively analysed. Several mechanisms are proposed by which the decline of protein quality control with organismal age, but also the intrinsic nature of the aggregation process may contribute to the kinetics of protein aggregation observed in human disease.

Also flagged:APOEnucleotidesSLC6A4(5-HT) transportersmood disorders5-HTTLPR
Journal Article 2022-05-17 ✓ 1 Snippet van de Weijer MP, Pelt DHM, de Vries LP, Baselmans BML, Bartels M.
In-Text Gene Mentions

…10 –8 ):CSE1L- rs2075677 &…

Show Full Abstract

Ever since twin-family studies found that a substantial amount (± 40%) of the variation in well-being can be explained by genetic variation, several candidate genes have been proposed explaining this variation. However, these candidate gene and candidate gene-by-environment interaction studies have been surrounded by controversy regarding the validity and replication of their results. In the present study, we review the existing candidate gene literature for well-being. First, we perform a systematic literature search that results in the inclusion of 41 studies. After describing the results of the included studies, we evaluated the included candidate polymorphisms by (1) looking up the results for the studied candidate SNPs in a large well-being genome-wide association study, (2) performing association analyses in UK biobank (UKB) data for the candidate variable number tandem repeats (VNTR) and the APOE ε4 allele, and (3) studying possible candidate interactions with positive and negative environmental moderators using UKB data. We find no support for any of the candidate genes or candidate gene-environment interactions for well-being, with the exception of two SNPs that were chosen based on genome-wide evidence. While the generalizability of our findings is limited by our phenotype and environment definitions, we strongly advise well-being researchers to abandon the candidate gene approach in the field of well-being and move toward genome-wide approaches.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s10902-022-00538-x.

Also flagged:IGF2BP1TumorcancerPD-L1cucurbitacin Bimmune response
Journal Article 2022-05-17 No Snippets Liu Y, Guo Q, Yang H, Zhang XW, Feng N, Wang JK, Liu TT, Zeng KW, Tu PF.
Show Full Abstract

Tumor immune microenvironment (TIME) regulators are promising cancer immunotherapeutic targets. IGF2BP1, as a crucial <i>N</i> <sup>6</sup>-methyladenosine (m<sup>6</sup>A) reader protein, recognizes m<sup>6</sup>A target transcripts, ultimately leading to cancer development. However, currently, the biological function of IGF2BP1 in regulating the TIME is not well-understood. In this study, we report that IGF2BP1 knockdown induces cancer cell apoptosis, thereby significantly not only activating immune cell infiltration including CD4<sup>+</sup>, CD8<sup>+</sup> T cells, CD56<sup>+</sup> NK cells, and F4/80<sup>+</sup> macrophage but also decreasing PD-L1 expression in hepatocellular carcinoma (HCC). Then, chemical genetics identifies a small-molecule cucurbitacin B (CuB), which directly targets IGF2BP1 at a unique site (Cys253) in the KH1-2 domains. This leads to a pharmacological allosteric effect to block IGF2BP1 recognition of m<sup>6</sup>A mRNA targets such as <i>c-MYC</i>, which is highly associated with cell apoptosis and immune response. In vivo, CuB exhibits an obvious anti-HCC effect through inducing apoptosis and subsequently recruits immune cells to tumor microenvironment as well as blocking PD-L1 expression. Collectively, IGF2BP1 may serve as a novel pharmacological allosteric target for anticancer therapeutics via mediating TIME.

Also flagged:CongenitalThrombophiliaChronicchronic thromboembolic pulmonary hypertensionCTEPHcongenital thrombophilia
Journal Article 2022-05-17 ✓ 5 Snippets Lian TY, Liu JZ, Guo F, Zhou YP, Wu T, Wang H, Li JY, Yan XX, Peng FH, Sun K, Xu XQ, Han ZY, Jiang X, Wang DL, Miao Q, Jing ZC.
In-Text Gene Mentions

Genotype for patients with thrombophilia revealed that 10 (76.9%) protein C deficiency patients were PROC sequence variant carriers, 4 (21.1%) protein S deficiency were PROS1 sequence variant carriers, and 2 (50.0%) antithrombin III deficiency were SERPINC1 sequence variant carriers.

The pathogenic gene for AT III deficiency is SERPINC1 coding antithrombin, which has more than 250 reported detrimental sequence variants.27

The possible pathogenic variants would be identified in the reported thrombophilia-related gene, including PROC, PROS1, C4BPA, and SERPINC1.

In the 4 patients with AT III deficiency sequenced, 2 (50.0%) had a heterozygote deleterious sequence variant in SERPINC1.

…III deficiency wereSERPINC1sequence variant carriers.…

Show Full Abstract

<h4>Background</h4>The role of congenital thrombophilia in chronic thromboembolic pulmonary hypertension (CTEPH) remains unresolved.<h4>Objectives</h4>The purpose of this study was to investigate the prevalence, genetic background, and clinical phenotype of congenital thrombophilia in CTEPH.<h4>Methods</h4>In total, 367 patients with CTEPH from May 2013 to December 2020 were consecutively enrolled in this cross-sectional study in FuWai Hospital and Peking Union Medical College Hospital in China. The primary outcome was the occurrence of congenital thrombophilia diagnosed through tests for congenital anticoagulants activity (including protein C, protein S, and antithrombin III), factor V Leiden and prothrombin G20210A sequence variants. Next-generation sequencing was conducted for patients with congenital thrombophilia. Clinical phenotype was compared between patients with and without thrombophilia.<h4>Results</h4>A total of 36 (9.8%; 95% CI: 6.8%-12.9%) patients were diagnosed as congenital thrombophilia, including 13 protein C deficiency (3.5%; 95% CI: 1.6%-5.4%), 19 protein S deficiency (5.2%; 95% CI: 2.9%-7.5%), and 4 antithrombin III deficiency (1.1%; 95% CI: 0%-2.2%). No factor V Leiden or prothrombin G20210A sequence variants were identified. Genotype for patients with thrombophilia revealed that 10 (76.9%) protein C deficiency patients were PROC sequence variant carriers, 4 (21.1%) protein S deficiency were PROS1 sequence variant carriers, and 2 (50.0%) antithrombin III deficiency were SERPINC1 sequence variant carriers. In the logistic regression model, male sex (OR: 3.24; 95% CI: 1.43-7.31) and proximal lesion in pulmonary arteries (OR: 4.10; 95% CI: 1.91-8.85) had significant differences between the congenital thrombophilia and nonthrombophilia group in CTEPH patients.<h4>Conclusions</h4>Congenital thrombophilia was not rare. Male sex and proximal lesion in pulmonary arteries might be the specific clinical phenotype for CTEPH patients with congenital thrombophilia.

Also flagged:CAcardiac amyloidosisATTRheart failureconduction disorderscarpal tunnel syndrome
Journal Article 2022-05-16 No Snippets Aimo A, Merlo M, Porcari A, Georgiopoulos G, Pagura L, Vergaro G, Sinagra G, Emdin M, Rapezzi C.
Show Full Abstract

<h4>Aims</h4>An algorithm for non-invasive diagnosis of amyloid transthyretin cardiac amyloidosis (ATTR-CA) and novel disease-modifying therapies have prompted an active search for CA. We examined the prevalence of CA in different settings based on literature data.<h4>Methods and results</h4>We performed a systematic search for screening studies on CA, focusing on the prevalence, sex and age distribution in different clinical settings. The prevalence of CA in different settings was as follows: bone scintigraphy for non-cardiac reasons (n = 5 studies), 1% (95% confidence interval [CI] 0%-1%); heart failure with preserved ejection fraction (n = 6), 12% (95% CI 6%-20%); heart failure with reduced or mildly reduced ejection fraction (n = 2), 10% (95% CI 6%-15%); conduction disorders warranting pacemaker implantation (n = 1), 2% (95% CI 0%-4%); surgery for carpal tunnel syndrome (n = 3), 7% (95% CI 5%-10%); hypertrophic cardiomyopathy phenotype (n = 2), 7% (95% CI 5%-9%); severe aortic stenosis (n = 7), 8% (95% CI 5%-13%); autopsy series of 'unselected' elderly individuals (n = 4), 21% (95% CI 7%-39%). The average age of CA patients in the different settings ranged from 74 to 90 years, and the percentage of men from 50% to 100%. Many patients had ATTR-CA, but the average percentage of patients with amyloid light-chain (AL) CA was up to 18%.<h4>Conclusions</h4>Searching for CA in specific settings allows to identify a relatively high number of cases who may be eligible for treatment if the diagnosis is unequivocal. ATTR-CA accounts for many cases of CA across the different settings, but AL-CA is not infrequent. Median age at diagnosis falls in the eighth or ninth decades, and many patients diagnosed with CA are women.

Also flagged:mirCpaAgaroseNucleotidehost cellsMAPK
Journal Article 2022-05-16 No Snippets Jha N, Mangukia N, Gadhavi H, Patel M, Bhavsar M, Rawal R, Patel S.
Show Full Abstract

Several studies have demonstrated potential role of plant-derived miRNAs in cross-kingdom species relationships by transferring into non-plant host cells to regulate certain host cellular functions. How nutrient-rich plants regulate host cellular functions, which in turn alleviate physiological and disease conditions in the host remains to be explored in detail. This computational study explores the potential targets, putative role, and functional implications of miRNAs derived from Carica papaya L., one of the most cultivated tropical crops in the world and a rich source of phytochemicals and enzymes, in human diet. Using the next-generation sequencing, -Illumina HiSeq2500, ~ 30 million small RNA sequence reads were generated from C. papaya young leaves, resulting in the identification of a total of 1798 known and 49 novel miRNAs. Selected novel C. papaya miRNAs were predicted to regulate certain human targets, and subsequent annotation of gene functions indicated a probable role in various biological processes and pathways, such as MAPK, WNT, and GPCR signaling pathways, and platelet activation. These presumptive target gene in humans were predominantly linked to various diseases, including cancer, diabetes, mental illness, and platelet disorder. The computational finding of this study provides insights into how C. papaya-derived miRNAs may regulate certain conditions of human disease and provide a new perspective on human health. However, the therapeutic potential of C. papaya miRNA can be further explored through experimental studies.

Also flagged:reverse transcriptaseCOVID‐19 pneumoniapolymeraseSARSCoV‐2 infectioninfection
Journal Article 2022-05-16 No Snippets Ebrahimzadeh S, Islam N, Dawit H, Salameh JP, Kazi S, Fabiano N, Treanor L, Absi M, Ahmad F, Rooprai P, Al Khalil A, Harper K, Kamra N, Leeflang MM, Hooft L, van der Pol CB, Prager R, Hare SS, Dennie C, Spijker R, Deeks JJ, Dinnes J, Jenniskens K, Korevaar DA, Cohen JF, Van den Bruel A, Takwoingi Y, van de Wijgert J, Wang J, Pena E, Sabongui S, McInnes MD, Cochrane COVID-19 Diagnostic Test Accuracy Group.
Show Full Abstract

<h4>Background</h4>Our March 2021 edition of this review showed thoracic imaging computed tomography (CT) to be sensitive and moderately specific in diagnosing COVID-19 pneumonia. This new edition is an update of the review.<h4>Objectives</h4>Our objectives were to evaluate the diagnostic accuracy of thoracic imaging in people with suspected COVID-19; assess the rate of positive imaging in people who had an initial reverse transcriptase polymerase chain reaction (RT-PCR) negative result and a positive RT-PCR result on follow-up; and evaluate the accuracy of thoracic imaging for screening COVID-19 in asymptomatic individuals. The secondary objective was to assess threshold effects of index test positivity on accuracy.<h4>Search methods</h4>We searched the COVID-19 Living Evidence Database from the University of Bern, the Cochrane COVID-19 Study Register, The Stephen B. Thacker CDC Library, and repositories of COVID-19 publications through to 17 February 2021. We did not apply any language restrictions.<h4>Selection criteria</h4>We included diagnostic accuracy studies of all designs, except for case-control, that recruited participants of any age group suspected to have COVID-19. Studies had to assess chest CT, chest X-ray, or ultrasound of the lungs for the diagnosis of COVID-19, use a reference standard that included RT-PCR, and report estimates of test accuracy or provide data from which we could compute estimates. We excluded studies that used imaging as part of the reference standard and studies that excluded participants with normal index test results.<h4>Data collection and analysis</h4>The review authors independently and in duplicate screened articles, extracted data and assessed risk of bias and applicability concerns using QUADAS-2. We presented sensitivity and specificity per study on paired forest plots, and summarized pooled estimates in tables. We used a bivariate meta-analysis model where appropriate.<h4>Main results</h4>We included 98 studies in this review. Of these, 94 were included for evaluating the diagnostic accuracy of thoracic imaging in the evaluation of people with suspected COVID-19. Eight studies were included for assessing the rate of positive imaging in individuals with initial RT-PCR negative results and positive RT-PCR results on follow-up, and 10 studies were included for evaluating the accuracy of thoracic imaging for imagining asymptomatic individuals. For all 98 included studies, risk of bias was high or unclear in 52 (53%) studies with respect to participant selection, in 64 (65%) studies with respect to reference standard, in 46 (47%) studies with respect to index test, and in 48 (49%) studies with respect to flow and timing. Concerns about the applicability of the evidence to: participants were high or unclear in eight (8%) studies; index test were high or unclear in seven (7%) studies; and reference standard were high or unclear in seven (7%) studies. Imaging in people with suspected COVID-19 We included 94 studies. Eighty-seven studies evaluated one imaging modality, and seven studies evaluated two imaging modalities. All studies used RT-PCR alone or in combination with other criteria (for example, clinical signs and symptoms, positive contacts) as the reference standard for the diagnosis of COVID-19. For chest CT (69 studies, 28285 participants, 14,342 (51%) cases), sensitivities ranged from 45% to 100%, and specificities from 10% to 99%. The pooled sensitivity of chest CT was 86.9% (95% confidence interval (CI) 83.6 to 89.6), and pooled specificity was 78.3% (95% CI 73.7 to 82.3). Definition for index test positivity was a source of heterogeneity for sensitivity, but not specificity. Reference standard was not a source of heterogeneity. For chest X-ray (17 studies, 8529 participants, 5303 (62%) cases), the sensitivity ranged from 44% to 94% and specificity from 24 to 93%. The pooled sensitivity of chest X-ray was 73.1% (95% CI 64. to -80.5), and pooled specificity was 73.3% (95% CI 61.9 to 82.2). Definition for index test positivity was not found to be a source of heterogeneity. Definition for index test positivity and reference standard were not found to be sources of heterogeneity. For ultrasound of the lungs (15 studies, 2410 participants, 1158 (48%) cases), the sensitivity ranged from 73% to 94% and the specificity ranged from 21% to 98%. The pooled sensitivity of ultrasound was 88.9% (95% CI 84.9 to 92.0), and the pooled specificity was 72.2% (95% CI 58.8 to 82.5). Definition for index test positivity and reference standard were not found to be sources of heterogeneity. Indirect comparisons of modalities evaluated across all 94 studies indicated that chest CT and ultrasound gave higher sensitivity estimates than X-ray (P = 0.0003 and P = 0.001, respectively). Chest CT and ultrasound gave similar sensitivities (P=0.42). All modalities had similar specificities (CT versus X-ray P = 0.36; CT versus ultrasound P = 0.32; X-ray versus ultrasound P = 0.89). Imaging in PCR-negative people who subsequently became positive For rate of positive imaging in individuals with initial RT-PCR negative results, we included 8 studies (7 CT, 1 ultrasound) with a total of 198 participants suspected of having COVID-19, all of whom had a final diagnosis of COVID-19. Most studies (7/8) evaluated CT. Of 177 participants with initially negative RT-PCR who had positive RT-PCR results on follow-up testing, 75.8% (95% CI 45.3 to 92.2) had positive CT findings. Imaging in asymptomatic PCR-positive people For imaging asymptomatic individuals, we included 10 studies (7 CT, 1 X-ray, 2 ultrasound) with a total of 3548 asymptomatic participants, of whom 364 (10%) had a final diagnosis of COVID-19. For chest CT (7 studies, 3134 participants, 315 (10%) cases), the pooled sensitivity was 55.7% (95% CI 35.4 to 74.3) and the pooled specificity was 91.1% (95% CI 82.6 to 95.7).<h4>Authors' conclusions</h4>Chest CT and ultrasound of the lungs are sensitive and moderately specific in diagnosing COVID-19. Chest X-ray is moderately sensitive and moderately specific in diagnosing COVID-19. Thus, chest CT and ultrasound may have more utility for ruling out COVID-19 than for differentiating SARS-CoV-2 infection from other causes of respiratory illness. The uncertainty resulting from high or unclear risk of bias and the heterogeneity of included studies limit our ability to confidently draw conclusions based on our results.

Also flagged:azolesaspergillosisAzoletranscription factorsironbinding
Journal Article 2022-05-16 No Snippets Kühbacher A, Peiffer M, Hortschansky P, Merschak P, Bromley MJ, Haas H, Brakhage AA, Gsaller F.
Show Full Abstract

Aspergillus fumigatus is one of the deadliest fungal species, causing hundreds of thousands of deaths each year. Because azoles provide the preferred first-line option for treatment of aspergillosis, the increase in rates of resistance and the poor therapeutic outcomes for patients infected with a resistant isolate constitute a serious global health threat. Azole resistance is frequently associated with specific tandem repeat duplications of a promoter element upstream of <i>cyp51A</i>, the gene that encodes the target for this drug class in A. fumigatus. This promoter element is recognized by the activating transcription factors SrbA and AtrR. This region also provides a docking platform for the CCAAT-binding complex (CBC) and HapX, which cooperate in the regulation of genes involved in iron-consuming pathways, including <i>cyp51A</i>. Here, we studied the regulatory contributions of SrbA, AtrR, CBC, and HapX binding sites to <i>cyp51A</i> expression and azole resistance under different iron availability employing promoter mutational analysis and protein-DNA interaction analysis. This strategy revealed iron status-dependent and -independent roles of these regulatory elements. We show that promoter occupation by both AtrR and SrbA is required for iron-independent steady-state transcriptional activation of <i>cyp51A</i> and its induction during short-term iron exposure relies on HapX binding. We further reveal the HapX binding site as a repressor element, disruption of which increases <i>cyp51A</i> expression and azole resistance regardless of iron availability. <b>IMPORTANCE</b> First-line treatment of aspergillosis typically involves the use of azole antifungals. Worryingly, their future clinical use is challenged by an alarming increase in resistance. Therapeutic outcomes for such patients are poor due to delays in switching to alternative treatments and reduced efficacy of salvage therapeutics. Our lack of understanding of the molecular mechanisms that underpin resistance hampers our ability to develop novel therapeutic interventions. In this work, we dissect the regulatory motifs associated with azole resistance in the promoter of the gene that encodes the azole drug target Cyp51A. These motifs include binding platforms for SrbA and AtrR, as well as the CCAAT-binding complex and HapX. Employing mutational analyses, we uncovered crucial <i>cyp51A</i>-activating and -repressing functions of the binding sites. Remarkably, disrupting binding of the iron regulator HapX increased <i>cyp51A</i> expression and azole resistance in an iron-independent manner.

Also flagged:parvalbuminPVchromatinaminobutyric acid)somatostatin
Journal Article 2022-05-16 No Snippets Lawler AJ, Ramamurthy E, Brown AR, Shin N, Kim Y, Toong N, Kaplow IM, Wirthlin M, Zhang X, Phan BN, Fox GA, Wade K, He J, Ozturk BE, Byrne LC, Stauffer WR, Fish KN, Pfenning AR.
Show Full Abstract

Recent discoveries of extreme cellular diversity in the brain warrant rapid development of technologies to access specific cell populations within heterogeneous tissue. Available approaches for engineering-targeted technologies for new neuron subtypes are low yield, involving intensive transgenic strain or virus screening. Here, we present Specific Nuclear-Anchored Independent Labeling (SNAIL), an improved virus-based strategy for cell labeling and nuclear isolation from heterogeneous tissue. SNAIL works by leveraging machine learning and other computational approaches to identify DNA sequence features that confer cell type-specific gene activation and then make a probe that drives an affinity purification-compatible reporter gene. As a proof of concept, we designed and validated two novel SNAIL probes that target parvalbumin-expressing (PV+) neurons. Nuclear isolation using SNAIL in wild-type mice is sufficient to capture characteristic open chromatin features of PV+ neurons in the cortex, striatum, and external globus pallidus. The SNAIL framework also has high utility for multispecies cell probe engineering; expression from a mouse PV+ SNAIL enhancer sequence was enriched in PV+ neurons of the macaque cortex. Expansion of this technology has broad applications in cell type-specific observation, manipulation, and therapeutics across species and disease models.

Also flagged:amyotrophic lateral sclerosisCu/Zn-superoxide dismutaseSOD1Guanine nucleotide exchange C9orf72TAR DNA-binding protein 43TARDBP
Journal Article 2022-05-16 ✓ 1 Snippet Jensen KH, Stalder AK, Wernersson R, Roloff-Handschin TC, Hansen DH, Groenen PMA.
In-Text Gene Mentions

…the microtubular system (HTT, MAPs).…

Show Full Abstract

<h4>Background</h4>Despite the discovery of familial cases with mutations in Cu/Zn-superoxide dismutase (SOD1), Guanine nucleotide exchange C9orf72, TAR DNA-binding protein 43 (TARDBP) and RNA-binding protein FUS as well as a number of other genes linked to Amyotrophic Lateral Sclerosis (ALS), the etiology and molecular pathogenesis of this devastating disease is still not understood. As proteins do not act alone, conducting an analysis of ALS at the system level may provide new insights into the molecular biology of ALS and put it into relationship to other neurological diseases.<h4>Methods</h4>A set of ALS-associated genes/proteins were collected from publicly available databases and text mining of scientific literature. We used these as seed proteins to build protein-protein interaction (PPI) networks serving as a scaffold for further analyses. From the collection of networks, a set of core modules enriched in seed proteins were identified. The molecular biology of the core modules was investigated, as were their associations to other diseases. To assess the core modules' ability to describe unknown or less well-studied ALS biology, they were queried for proteins more recently associated to ALS and not involved in the primary analysis.<h4>Results</h4>We describe a set of 26 ALS core modules enriched in ALS-associated proteins. We show that these ALS core modules not only capture most of the current knowledge about ALS, but they also allow us to suggest biological interdependencies. In addition, new associations of ALS networks with other neurodegenerative diseases, e.g. Alzheimer's, Huntington's and Parkinson's disease were found. A follow-up analysis of 140 ALS-associated proteins identified since 2014 reveals a significant overrepresentation of new ALS proteins in these 26 disease modules.<h4>Conclusions</h4>Using protein-protein interaction networks offers a relevant approach for broadening the understanding of the biological context of known ALS-associated genes. Using a bottom-up approach for the analysis of protein-protein interaction networks is a useful method to avoid bias caused by over-connected proteins. Our ALS-enriched modules cover most known biological functions associated with ALS. The presence of recently identified ALS-associated proteins in the core modules highlights the potential for using these as a scaffold for identification of novel ALS disease mechanisms.

Also flagged:TRAF7MSH2HIC1TMEM14ATFDP1MUL1
Journal Article 2022-05-16 ✓ 3 Snippets Hong J, Li Q, Wang X, Li J, Ding W, Hu H, He L.
In-Text Gene Mentions

DCC

PTGIS

HTT

Show Full Abstract

<h4>Background</h4>Previous evidence has shown that apoptosis performs integral functions in the tumorigenesis and development of various tumors. Therefore, this study aimed to establish a molecular subtype and prognostic signature based on apoptosis-related genes (ARGs) to understand the molecular mechanisms and predict prognosis in patients with osteosarcoma.<h4>Methods</h4>The GEO and TARGET databases were utilized to obtain the expression levels of ARGs and clinical information of osteosarcoma patients. Consensus clustering analysis was used to explore the different molecular subtypes based on ARGs. GO, KEGG, GSEA, ESTIMATE, and ssGSEA analyses were performed to examine the differences in biological functions and immune characteristics between the distinct molecular subtypes. Then, we constructed an ARG signature by LASSO analysis. The prognostic significance of the ARG signature in osteosarcoma was determined by Kaplan-Meier plotter, Cox regression, and nomogram analyses.<h4>Results</h4>Two apoptosis-related subtypes were identified. Cluster 1 had a better prognosis, higher immunogenicity, and immune cell infiltration, as well as a better response to immunotherapy than Cluster 2. We discovered that patients in the high-risk cohort had a lower survival rate than those in the low-risk cohort according to the ARG signature. Furthermore, Cox regression analysis confirmed that a high risk score independently acted as an unfavorable prognostic marker. Additionally, the nomogram combining risk scores with clinical characteristics can improve prediction efficiency.<h4>Conclusion</h4>We demonstrated that patients suffering from osteosarcoma may be classified into two apoptosis-related subtypes. Moreover, we developed an ARG prognostic signature to predict the prognosis status of osteosarcoma patients.

Also flagged:β-thalassemialuciferaseantibodiesβ-globinchromosomeanemia
Journal Article 2022-05-16 ✓ 5 Snippets Yang F, Ruan H, Li S, Hou W, Qiu Y, Deng L, Su S, Chen P, Pang L, Lai K.
In-Text Gene Mentions

…that hsa-circRNA-100466 andSOX6were significantly down-regula…

…ircRNA-100466, miR-19b-3p, andSOX6were co-immunoprecipitated by…

…with hsa-circRNA-100466 andSOX6.…

…ircRNA-100466, miR-19b-3p, andSOX6.…

…3′-UTR of theSOX6mRNA was cloned…

Show Full Abstract

The involvement of circRNAs in β-thalassemia and their actions on fetal hemoglobin (HbF) is unclear. Here, the circRNAs in β-thalassemia carriers with high HbF levels were comprehensively analyzed and compared with those of healthy individuals. Differential expression of 2183 circRNAs was observed and their correlations with hematological parameters were investigated. Down-regulated hsa-circRNA-100466 had a strong negative correlation with HbF and HbA<sub>2</sub>. Bioinformatics was employed to construct a hsa-circRNA-100466‑associated competing endogenous RNA (ceRNA) network to identify hub genes and associated miRNAs. The hsa-circRNA-100466▁miR-19b-3p▁SOX6 pathway was identified using both present and previously published data. The ceRNA network was verified by qRT-PCR analysis of β-thalassemia samples, RNA immunoprecipitation of K562 cell lysates, and dual-luciferase reporter analysis. qRT-PCR confirmed that hsa-circRNA-100466 and SOX6 were significantly down-regulated, while miR-19b-3p was up-regulated. Hsa-circRNA-100466, miR-19b-3p, and SOX6 were co-immunoprecipitated by anti-argonaute antibodies, indicating involvement with HbF induction. A further dual-luciferase reporter assay verified that miR-19b-3p interacted directly with hsa-circRNA-100466 and SOX6. Furthermore, spearman correlation coefficients revealed their significant correlations with HbF. In conclusion, a novel hsa-circRNA-100466▁miR-19b-3p▁SOX6 pathway was identified, providing insight into HbF induction and suggesting targets β-thalassemia treatment.

Also flagged:malignant tumortumorsstomach adenocarcinomatumorTGF-βFoxO
Journal Article 2022-05-16 ✓ 3 Snippets Qian H, Cui N, Zhou Q, Zhang S.
In-Text Gene Mentions

…, NOVA1 ,POU3F2and PRICKLE2 )…

…, NOVA1 ,POU3F2and PRICKLE2 were…

…, NOVA1 ,POU3F2and PRICKLE2 which…

Show Full Abstract

<h4>Background</h4>Stomach adenocarcinoma (STAD) is a common malignant tumor in the world and its prognosis is poor, miRNA plays a role mainly by influencing the expression of mRNAs, and participates in the occurrence and development of tumors. However, reliable miRNA prognostic models for stomach adenocarcinoma remain to be identified.<h4>Results</h4>Using the data from the Cancer Genome Atlas (TCGA), a prognostic model of stomach adenocarcinoma was established including tumor stage and expression levels of 4 miRNAs (hsa-miR-379-3p, hsa-miR-2681-3p, hsa-miR-6499-5p and hsa-miR-6807-3p). A total of 50 ultimate target genes of these miRNAs were obtained through prediction. Enrichment analysis revealed that target genes were mainly concentrated in neural function and TGF-β and FoxO signaling pathways. Survival analysis showed that three model miRNAs (hsa-miR-379-3p, hsa-miR-2681-3p and hsa-miR-6807-3p) and five final target genes (DLC1, LRFN5, NOVA1, POU3F2 and PRICKLE2) were associated with the patient's overall survival outcome.<h4>Conclusions</h4>We used bioinformatics methods to screen new prognostic miRNA markers from TCGA and established a prognostic model of STAD, so as to provide a basis for the diagnosis, prognosis, and treatment of STAD in the future.

Also flagged:degenerative disc diseasesvertebral disc degenerationproteoglycanfibrilextracellularintervertebral disc degeneration
Journal Article 2022-05-16 No Snippets Che YJ, Guo JB, Hao YF, Luo ZP.
Show Full Abstract

<h4>Background</h4>Conservative treatment is the recommended first-line treatment for degenerative disc diseases. Traction therapy has historically been one of the most common clinical methods to address this, but the clinical effect remains controversial.<h4>Methods</h4>Forty-two six-month-old male Sprague-Dawley rats were randomly divided into six groups: the model group (Group A, four coccyx vertebrae (Co7-Co10) were fixed with customized external fixators, and the vertebral disc degeneration model was constructed by axial compression of the target segment Co8 - Co9 for 4 weeks), the experimental control group (Group B, after successful modeling, the external fixation device was removed and self-rehabilitation was performed) and four intervention groups (Groups C to F): Groups C and E: Co8 - Co9 vertebrae compressed for 4 weeks followed by two or 4 weeks of high tension traction (HTT), respectively, and Groups D and F: vertebrae compressed for 4 weeks followed by two or 4 weeks of low-tension traction (LTT), respectively. Imaging tests (X-ray and MRI) were performed to assess disc height and T2 signal intensity at each time point. After the experiment, the animals were euthanized, and the caudal vertebrae were collected for analysis of intervertebral disc histopathology, proteoglycan content, and micronanostructure of the annulus fibrosus, nucleus pulposus and bony endplate.<h4>Results</h4>Signs of tissue regeneration were apparent in all four intervention groups. After two to 4 weeks of intervention (HTT and LTT), the morphology of pores in the bony endplate, their number, and diameter had recovered significantly compared with those in Group A. The LTT group was superior to the HTT group, and the 4w in situ group was significantly superior to the 2w group. Meanwhile, the histological scores of discs, the mean fibril diameter and modulus of annulus fibrosus were significantly improved compared with the control groups, and the LTT group was superior to HTT group.<h4>Conclusions</h4>Low-tension traction better promotes active reconstruction of bony endplates and improves the elastic modulus and micro/nanostructure of the disc. Thus, it further promotes the regeneration and repair of intervertebral discs.

Also flagged:biological rhythmsmetabolismtranscription factorschromatinCircadian rhythmnorepinephrine
Journal Article 2022-05-16 ✓ 2 Snippets Gao W, Li R, Ye M, Zhang L, Zheng J, Yang Y, Wei X, Zhao Q.
In-Text Gene Mentions

…SOX family members,SOX6and SOX5, are…

SOX6is negatively regulated…

Show Full Abstract

The circadian clock refers to the intrinsic biological rhythms of physiological functions and behaviours. It synergises with the solar cycle and has profound effects on normal metabolism and organismal fitness. Recent studies have suggested that the circadian clock exerts great influence on the differentiation of stem cells. Here, we focus on the close relationship between the circadian clock and mesenchymal stem cell fate decisions in the skeletal system. The underlying mechanisms include hormone signals and the activation and repression of different transcription factors under circadian regulation. Additionally, the clock interacts with epigenetic modifiers and non-coding RNAs and is even involved in chromatin remodelling. Although the specificity and safety of circadian therapy need to be further studied, the circadian regulation of stem cells can be regarded as a promising candidate for health improvement and disease prevention.

Also flagged:neurogenerative disordersneurodegenerative disordersneurodegenerative diseasesbehavioralcognitionAD
Journal Article 2022-05-16 ✓ 1 Snippet Gubert C, Gasparotto J, H Morais L.
In-Text Gene Mentions

HD is a genetic neurodegenerative disorder with an autosomal dominance inheritance, caused by the expansion of the trinucleotide (CAG) tandem repeat in the huntingtin (HTT) gene, encoding an expanded polyglutamine tract in the huntingtin protein. There are no disease-modifying therapies so far and the progression of the disease is ∼15 years from diagnosis to death. The symptomatology is complex with the presence of progressive cognitive, psychiatric, and motor impairments

Show Full Abstract

Recent research has been uncovering the role of the gut microbiota for brain health and disease. These studies highlight the role of gut microbiota on regulating brain function and behavior through immune, metabolic, and neuronal pathways. In this review we provide an overview of the gut microbiota axis pathways to lay the groundwork for upcoming sessions on the links between the gut microbiota and neurogenerative disorders. We also discuss how the gut microbiota may act as an intermediate factor between the host and the environment to mediate disease onset and neuropathology. Based on the current literature, we further examine the potential for different microbiota-based therapeutic strategies to prevent, to modify, or to halt the progress of neurodegeneration.

Also flagged:Nanocovaxspike proteinspike glycoproteinsaluminiumhydroxideIgG
Journal Article 2022-05-16 No Snippets Nguyen TP, Do Q, Phan LT, Dinh DV, Khong H, Hoang LV, Nguyen TV, Pham HN, Chu MV, Nguyen TT, Pham QD, Le TM, Trang TNT, Dinh TT, Vo TV, Vu TT, Nguyen QBP, Phan VT, Nguyen LV, Nguyen GT, Tran PM, Nghiem TD, Tran TV, Nguyen TG, Tran TQ, Nguyen LT, Do AT, Nguyen DD, Ho SA, Nguyen VT, Pham DT, Tran HB, Vu ST, Hoang SX, Do TM, Nguyen XT, Le GQ, Tran T, Cao TM, Dao HM, Nguyen TTT, Doan UY, Le VTT, Tran LP, Nguyen NM, Nguyen NT, Pham HTT, Nguyen QH, Nguyen HT, Nguyen HLK, Tran VT, Tran MTN, Nguyen TTT, Ha PT, Huynh HT, Nguyen KD, Thuan UT, Doan CC, Do SM.
Show Full Abstract

<h4>Background</h4>Nanocovax is a recombinant severe acute respiratory syndrome coronavirus 2 subunit vaccine composed of full-length prefusion stabilized recombinant SARS-CoV-2 spike glycoproteins (S-2P) and aluminium hydroxide adjuvant.<h4>Methods</h4>We conducted a dose-escalation, open label trial (phase 1) and a randomized, double-blind, placebo-controlled trial (phase 2) to evaluate the safety and immunogenicity of the Nanocovax vaccine (in 25 mcg, 50 mcg, and 75 mcg doses, aluminium hydroxide adjuvanted (0·5 mg/dose) in 2-dose regime, 28 days apart (ClinicalTrials.gov number, NCT04683484). In phase 1, 60 participants received two intramuscular injection of the vaccine following dose-escalation procedure. The primary outcomes were reactogenicity and laboratory tests to evaluate the vaccine safety. In phase 2, 560 healthy adults received either vaccine doses similar in phase 1 (25 or 50 or 75 mcg S antigen in 0·5 mg aluminium per dose) or adjuvant (0·5 mg aluminium) in a ratio of 2:2:2:1. One primary outcome was the vaccine safety, including solicited adverse events for 7 day and unsolicited adverse events for 28 days after each injection as well as serious adverse event or adverse events of special interest throughout the study period. Another primary outcome was anti-S IgG antibody response (Index unit/ml). Secondary outcomes were surrogate virus neutralisation (inhibition percentage), wild-type SARS-CoV-2 neutralisation (dilution fold), and T-cell responses by intracellular staining for interferon gamma (IFNg). Anti-S IgG and neutralising antibody levels were compared with convalescent serum samples from symptomatic Covid-19 patients.<h4>Findings</h4>For phase 1 study, no serious adverse events were observed for all 60 participants. Most adverse events were grade 1 and disappeared shortly after injection. For phase 2 study, after randomisation, 480 participants were assigned to receive the vaccine with adjuvant, and 80 participants were assigned to receive the placebo (adjuvant only). Reactogenicity was absent or mild in the majority of participants and of short duration (mean ≤3 days). Unsolicited adverse events were mild in most participants. There were no serious adverse events related to Nanocovax. Regarding the immunogenicity, Nanocovax induced robust anti-S antibody responses. In general, there humoral responses were similar among vaccine groups which reached their peaks at day 42 and declined afterward. At day 42, IgG levels of vaccine groups were 60·48 [CI95%: 51·12-71·55], 49·11 [41·26-58·46], 57·18 [48·4-67·5] compared to 7·10 [6·32-13·92] of convalescent samples. IgG levels reported here can be converted to WHO international standard binding antibody unit (BAU/ml) by multiplying them to a conversion factor of 21·8. Neutralising antibody titre of vaccine groups at day 42 were 89·2 [52·2-152·3], 80·0 [50·8-125.9] and 95·1 [63·1-143·6], compared to 55·1 [33·4-91·0] of the convalescent group.<h4>Interpretation</h4>Up to day 90, Nanocovax was found to be safe, well tolerated, and induced robust immune responses.<h4>Funding</h4>This work was funded by the Coalition for Epidemic Preparedness Innovations (CEPI), the Ministry of Science and Technology of Vietnam, and Nanogen Pharmaceutical Biotechnology JSC.

Also flagged:toCGL1Ube2d2Ppp2r2dId2response to radiation
Journal Article 2022-05-16 No Snippets Peterson J, McTiernan CD, Thome C, Khaper N, Lees SJ, Boreham DR, Tai TC, Tharmalingam S.
Show Full Abstract

MicroRNAs (miRNAs) have emerged as a potential class of biomolecules for diagnostic biomarker applications. miRNAs are small non-coding RNA molecules, produced and released by cells in response to various stimuli, that demonstrate remarkable stability in a wide range of biological fluids, in extreme pH fluctuations, and after multiple freeze-thaw cycles. Given these advantages, identification of miRNA-based biomarkers for radiation exposures can contribute to the development of reliable biological dosimetry methods, especially for low-dose radiation (LDR) exposures. In this study, an miRNAome next-generation sequencing (NGS) approach was utilized to identify novel radiation-induced miRNA gene changes within the CGL1 human cell line. Here, irradiations of 10, 100, and 1000 mGy were performed and the samples were collected 1, 6, and 24 h post-irradiation. Corroboration of the miRNAome results with RT-qPCR verification confirmed the identification of numerous radiation-induced miRNA expression changes at all doses assessed. Further evaluation of select radiation-induced miRNAs, including miR-1228-3p and miR-758-5p, as well as their downstream mRNA targets, <i>Ube2d2</i>, <i>Ppp2r2d</i>, and <i>Id2</i>, demonstrated significantly dysregulated reciprocal expression patterns. Further evaluation is needed to determine whether the candidate miRNA biomarkers identified in this study can serve as suitable targets for radiation biodosimetry applications.

Also flagged:Rab GTPasesvesiclemembranepathogenesiscancerdiabetes
Journal Article 2022-05-16 No Snippets Jordan KL, Koss DJ, Outeiro TF, Giorgini F.
Show Full Abstract

Rab GTPases (Rabs) are small proteins that play crucial roles in vesicle transport and membrane trafficking. Owing to their widespread functions in several steps of vesicle trafficking, Rabs have been implicated in the pathogenesis of several disorders, including cancer, diabetes, and multiple neurodegenerative diseases. As treatments for neurodegenerative conditions are currently rather limited, the identification and validation of novel therapeutic targets, such as Rabs, is of great importance. This review summarises proof-of-concept studies, demonstrating that modulation of Rab GTPases in the context of Alzheimer's disease (AD) can ameliorate disease-related phenotypes, and provides an overview of the current state of the art for the pharmacological targeting of Rabs. Finally, we also discuss the barriers and challenges of therapeutically targeting these small proteins in humans, especially in the context of AD.

Also flagged:STINGBatf3CXCR3Immunitytumortumors
Journal Article 2022-05-16 No Snippets Reschke R, Olson DJ.
Show Full Abstract

In a T-cell-inflamed phenotype, tumor eradication works best and is potentiated by immunotherapy such as checkpoint blockade. However, a majority of patients die despite receiving immunotherapy. One reason is insufficient T cell priming and infiltration in the tumor. Nature provides us with innate immune mechanisms in T-cell-inflamed tumors that we can adopt for more personalized immunotherapy strategies. Tumor sensing through innate signaling pathways and efficient antigen-presenting possess a significant role in bridging innate and adaptive immunity and generating a T-cell-inflamed tumor. One approach to strengthen these innate immune mechanisms is to deliver innate immune factors such as STING or activated DCs into the tumor microenvironment, in particular in patients resistant to checkpoint blockade. The low number of DCs in the tumor bed could potentially be increased with the growth factor FMS-like tyrosine kinase 3 ligand (Flt3L). CD103+ DCs are integral for priming and recruiting of effector T cells. The presence of myeloid-cell-derived CXCL9 and CXCL10 in the tumor microenvironment can predict response to immunotherapy. We outline recent preclinical and clinical approaches to deliver these crucial components bridging innate and adaptive immunity into the tumor microenvironment.

Also flagged:PDmovement disorderstress-inducible phosphoprotein 1STIP1autoantibodiesco-chaperone
Journal Article 2022-05-16 ✓ 2 Snippets Tan JSY, Lee B, Lim J, Ma DR, Goh JX, Goh SY, Gulam MY, Koh SM, Lee WW, Feng L, Wang Q, Chao Y, Rötzschke O, Tan EK.
In-Text Gene Mentions

Wolfe et al. [36] showed that the absence of STIP1 exacerbated Huntingtin with 103Q glutamine stretch (Htt103Q) toxicity while STIP1 elevation suppressed the Htt toxicity in yeast.

…elevation suppressed theHtttoxicity in yeast.…

Show Full Abstract

Parkinson’s disease (PD) is a debilitating movement disorder characterised by the loss of dopaminergic neurons in the substantia nigra. As neuroprotective agents mitigating the rate of neurodegeneration are unavailable, the current therapies largely focus only on symptomatic relief. Here, we identified stress-inducible phosphoprotein 1 (STIP1) as a putative neuroprotective factor targeted by PD-specific autoantibodies. STIP1 is a co-chaperone with reported neuroprotective capacities in mouse Alzheimer’s disease and stroke models. With human dopaminergic neurons derived from induced pluripotent stem cells, STIP1 was found to alleviate staurosporine-induced neurotoxicity. A case-control study involving 50 PD patients (average age = 62.94 ± 8.48, Hoehn and Yahr >2 = 55%) and 50 age-matched healthy controls (HCs) (average age = 63.1 ± 8) further revealed high levels of STIP1 autoantibodies in 20% of PD patients compared to 10% of HCs. Using an overlapping peptide library covering the STIP1 protein, we identified four PD-specific B cell epitopes that were not recognised in HCs. All of these epitopes were located within regions crucial for STIP1’s chaperone function or prion protein association. Our clinical and neuro-immunological studies highlight the potential of the STIP1 co-chaperone as an endogenous neuroprotective agent in PD and suggest the possible involvement of autoimmune mechanisms via the production of autoantibodies in a subset of individuals.

Also flagged:tumorGene ExpressionLUADpathogenesisLung AdenocarcinomaADCY9
Journal Article 2022-05-16 No Snippets Ma Y, Zou H.
Show Full Abstract

<h4>Background</h4>Numerous studies have identified that circular RNAs (circRNAs) can serve as competing endogenous RNAs (ceRNAs) to regulate tumor progression. However, there are still a large number of circRNAs to be deciphered.<h4>Objective</h4>The purpose of this study was to reveal novel circRNAs and their potential role in lung adenocarcinoma (LUAD).<h4>Methods</h4>To unveil LUAD-related circRNAs, microRNA (miRNAs), and messenger RNA (mRNA) and elucidate their possible molecular mechanisms, we employed a strategy combining extensive data mining and bioinformatics methods. According to the results of bioinformatics workflow analysis, a novel circRNA-miRNA-mRNA network was constructed.<h4>Results</h4>Ten circRNAs with different expressions were acquired from four Gene Expression Omnibus (GEO) microarray datasets. Seven Prognostic-related differential miRNAs of LUAD were gained from The Cancer Genome Atlas (TCGA). Simultaneously, the miRNA reaction components corresponding to the ten circRNAs were predicted. Two circRNA-miRNA interactions including two circRNAs (hsa_circ_0008234 and hsa_circ_0002360) and two miRNAs (hsa-miR-490-3p and hsa-miR-1293) were identified above. Then, target genes of the two miRNAs and differently expressed genes (DEGs) from TCGA on LUAD were collected. Three hub-genes (<i>ADCY9</i>, <i>NMUR1</i>, <i>SYT1</i>) were determined according to prognosis in patients with LUAD ulteriorly.<h4>Conclusions</h4>hsa_circ_0008234/hsa-miR-490-3p/<i>SYT1</i> and hsa_circ_0002360/hsa-miR-1293/ (<i>ADCY9</i>, <i>NMUR1</i>) networks were established, and identified molecules may be involved in pathogenesis and prognosis in patients with LUAD.

Also flagged:PreeclampsiaPEhypertensionChromatinbindingGATA
Journal Article 2022-05-16 ✓ 2 Snippets Ma J, Zhan Z, Li N, Huang Y, Li Y, Liu L, Shen Q, Chu Q, Wang X, Wu B, Zhang H.
In-Text Gene Mentions

…five protein-coding genes—PTGIS, SERINC2 ,…

PTGISis a well-known…

Show Full Abstract

Preeclampsia (PE) is characterized by new-onset hypertension after 20 weeks of pregnancy and results in high maternal and fetal mortality worldwide. It has been reported that PE is associated with abnormalities in the umbilical cord and cord blood. However, previous studies were focused primarily on the transcriptomics level, while the underlying gene regulatory landscapes are still unclear. Thus, we performed the Assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq) using the umbilical cord blood samples collected from a patient with superimposed PE and three healthy donors to uncover the chromatin accessibility changes attributed to PE. We have identified genes associated with immunomodulation and hypoxia response that have higher chromatin accessibility close to their transcription start sites. Motif analysis indicated that the <i>GATA</i> family transcription factor binding was enriched in PE and may play an essential regulatory role in the disease progression. Overall, our findings provide an overview of gene regulatory programs and the corresponding downstream pathways associated with PE that may influence the placenta function and fetal growth.

Also flagged:ObesityFTOFABP2LEPLEPRMC4R
Journal Article 2022-05-16 ✓ 3 Snippets Maculewicz E, Leońska-Duniec A, Mastalerz A, Szarska E, Garbacz A, Lepionka T, Łakomy R, Anyżewska A, Bertrandt J.
In-Text Gene Mentions

They analyzed the five obesity-associated genetic variants (MC4R rs17782313, BDNF rs6265, FTO rs1421085, TMEM18 rs7561317, and NEGR1 rs2815752).

…, MTCH2 ,NEGR1, SEC16B ,…

…TMEM18 rs7561317, andNEGR1rs2815752).…

Show Full Abstract

Obesity is a complex multifactorial abnormality that has a well-confirmed genetic basis. However, the problem still lies in identifying the polymorphisms linked to body mass and composition. Therefore, this study aimed to analyze associations between FTO (rs9939609), FABP2 (rs1799883), and LEP (rs2167270), LEPR (rs1137101), and MC4R (rs17782313) polymorphisms and obesity-related parameters. Unrelated Caucasian males (n = 165) were recruited. All participants had similar physical activity levels. The participants were divided into two groups depending on their body mass index (BMI) and fat mass index (FMI). All samples were genotyped using real-time polymerase chain reaction (real-time PCR). When tested individually, only one statistically significant result was found. The FTO A/T polymorphism was significantly associated with FMI (p = 0.01). The chance of having increased FMI was >2-fold higher for the FTO A allele carriers (p < 0.01). Gene−gene interaction analyses showed the additional influence of all investigated genes on BMI and FMI. In summary, it was demonstrated that harboring the FTO A allele might be a risk factor for elevated fat mass. Additionally, this study confirmed that all five polymorphisms are involved in the development of common obesity in the studied population and the genetic risk of obesity is linked to the accumulation of numerous variants.

Also flagged:COVID-19infectionCMLTyrosine KinaseBTKMultiple Myeloma
Journal Article 2022-05-16 ✓ 5 Snippets Rodríguez-Mora S, Corona M, Torres M, Casado-Fernández G, García-Pérez J, Ramos-Martín F, Vigón L, Manzanares M, Mateos E, Martín-Moro F, Zurdo-Castronuño A, Murciano-Antón MA, Alcamí J, Pérez-Olmeda M, López-Jiménez J, García-Gutiérrez V, Coiras M, On Behalf Of The Multidisciplinary Group Of Study Of Covid-Mgs-Covid.
In-Text Gene Mentions

…showed the highestDCCactivity against SARS-CoV-2-in…

…were responsible forDCCresponse were analyzed…

…also evaluated theDCCactivity against SARS-CoV-2…

…CML, showed higherDCCresponse than healthy…

…ThisDCCresponse was mostly…

Show Full Abstract

Individuals with oncohematological diseases (OHD) may develop an impaired immune response against vaccines due to the characteristics of the disease or to its treatment. Humoral response against SARS-CoV-2 has been described to be suboptimal in these patients, but the quality and efficiency of the cellular immune response has not been yet completely characterized. In this study, we analyzed the early humoral and cellular immune responses in individuals with different OHD after receiving one dose of an authorized vaccine against SARS-CoV-2. Humoral response, determined by antibodies titers and neutralizing capacity, was overall impaired in individuals with OHD, except for the cohort of chronic myeloid leukemia (CML), which showed higher levels of specific IgGs than healthy donors. Conversely, the specific direct cytotoxic cellular immunity response (DCC) against SARS-CoV-2, appeared to be enhanced, especially in individuals with CML and chronic lymphocytic leukemia (CLL). This increased cellular immune response, developed earlier than in healthy donors, showed a modest cytotoxic activity that was compensated by significantly increased numbers, likely due to the disease or its treatment. The analysis of the immune response through subsequent vaccine doses will help establish the real efficacy of COVID-19 vaccines in individuals with OHD.

Also flagged:carbonGlassPoly-Ethylene TerephthalateGFRPEthylene Terephthalate
Journal Article 2022-05-16 No Snippets Chandramouli P, Jayaseelan R, Pandulu G, Sathish Kumar V, Murali G, Vatin NI.
Show Full Abstract

This research focuses on estimating the ACC (axial compression capacity) of concrete-filled double-skin tubular (CFDST) columns. The study utilised algorithms and 'six' evaluation methods (XGBoost, AdaBoost, Lasso, Ridge, Random Forest Regressor and artificial neural network (ANN) architecture-based regression) to study the empirical formulae and utilise the parameters as the research's features, in order to find the best model that has higher and accurate reliability by using the RMSE and R<sup>2</sup> scores as performance evaluation metrics. Thus, by identifying the best model in empirical formulae for estimating the ACC of CFDST, the research offers a reliable model for future research. Through findings, it was found that, out of the existing evaluation metrics, the ABR for AFRP, GFRP and Steel; RFR for CFRP; and RR for PETFRP were found to be the best models in the CFDST columns.

Also flagged:Phospholipidneurodegenerative illnessHuntingtinphospholipidsHDlipid
Journal Article 2022-05-16 ✓ 5 Snippets Phillips GR, Hancock SE, Jenner AM, McLean C, Newell KA, Mitchell TW.
In-Text Gene Mentions

DHA, Docosahexaenoic Acid; HD, Huntington’s Disease; HPLC, High-Performance Liquid Chromatography; HTT, Huntingtin Gene; HTT, Huntingtin Protein; LC-MS, Liquid Chromatography Mass Spectrometry; LPC, Lysophosphatidylcholine; LPE, Lysophopshatidylethanolamine; mHTT, Mutant Huntingtin Protein; MTBE, Methyl Tert Butyl Ether; PA, Phosphatidic Acid; PC, Phosphatidylcholine; PC1/2, Principal Component 1/2; PE, Phosphatidylethanolamine; PG, Phosphatidylglycerol; PI, Phosphatidylinositol; PLA2, Phospholipase A2; PS, Phosphatidylserine.

Whether the neurodegeneration in HD results from a loss of function of HTT or a gain of function of mHTT is not well understood [3].

HTT interacts with phospholipids in vitro; however, its interactions are changed when the protein is mutated in HD.

Huntington’s disease (HD) is an autosomal, dominant, neurodegenerative illness resulting from a CAG repeat mutation on exon-1 of the Huntingtin gene (HTT).

…the Huntingtin protein (HTT).…

Show Full Abstract

Huntington's disease (HD) is a genetic, neurodegenerative illness that onsets in late adulthood as a series of progressive and terminal cognitive, motor, and psychiatric deficits. The disease is caused by a polyQ mutation in the Huntingtin gene (<i>HTT</i>), producing a polyglutamine expansion in the Huntingtin protein (HTT). HTT interacts with phospholipids in vitro; however, its interactions are changed when the protein is mutated in HD. Emerging evidence suggests that the susceptibility of brain regions to pathological stimuli is influenced by lipid composition. This study aimed to identify <i>where</i> and <i>how</i> phospholipids are changed in human HD brain tissue. Phospholipids were extracted using a modified MTBE method from the post-mortem brain of 13 advanced-stage HD patients and 13 age- and sex-matched controls. Targeted precursor ion scanning mass spectrometry was used to detect phospholipid species. In the white cortex of HD patients, there was a significantly lower abundance of phosphatidylcholine (PC) and phosphatidylserine (PS), but no difference in phosphatidylethanolamine (PE). In HD putamen, ester-linked 22:6 was lower in all phospholipid classes promoting a decrease in the relative abundance of ester polyunsaturated fatty acids in PE. No differences in phospholipid composition were identified in the caudate, grey cortex or cerebellum. Ether-linked PE fatty acids appear protected in the HD brain, as no changes were identified. The nature of phospholipid alterations in the HD brain is dependent on the lipid (subclass, species, and bond type) and the location.

Also flagged:Calcium Phosphateimmune responsesosteoclastogenesisdegradationtumorcancer
Journal Article 2022-05-16 No Snippets Zhang Y, Shu T, Wang S, Liu Z, Cheng Y, Li A, Pei D.
Show Full Abstract

Calcium phosphate (CaP)-based bioceramics are the most widely used synthetic biomaterials for reconstructing damaged bone. Accompanied by bone healing process, implanted materials are gradually degraded while bone ultimately returns to its original geometry and function. In this progress report, we reviewed the complex and tight relationship between the bone healing response and CaP-based biomaterials, with the emphasis on the <i>in vivo</i> degradation mechanisms of such material and their osteoinductive properties mediated by immune responses, osteoclastogenesis and osteoblasts. A deep understanding of the interaction between biological healing process and biomaterials will optimize the design of CaP-based biomaterials, and further translate into effective strategies for biomaterials customization.

Also flagged:CD38multiple myelomaCD16bindingFc-receptoralbumin
Journal Article 2022-05-16 ✓ 5 Snippets Hambach J, Fumey W, Stähler T, Gebhardt AJ, Adam G, Weisel K, Koch-Nolte F, Bannas P.
In-Text Gene Mentions

NK92 hCD16-mediated cytolysis was induced more effectively by our nanobody-based BiKEs (BiKE-DCC) than by the conventional CD38-specific antibody daratumumab (ADCC).

The presence of albumin impaired neither BiKE-DCC nor daratumumab mediated ADCC (Figure 4C).

BiKE-DCC by HLE-nano-BiKEs was shown to rely on binding to both, CD38 on target myeloma cells and CD16 on effector NK cells.

In a final set of experiments, we assessed the efficacy of BiKE-DCC compared to ADCC mediated by daratumumab against primary multiple myeloma cells from bone marrow samples of five myeloma patients, at 10 nM of HLE-nano-BiKEs or daratumumab and an E:T ratio of ~ 3:1 (Figure 6).

BiKE-DCC and daratumumab induced ADCC was lowest in OPM-2 luc cells, consistent with the relatively low cell surface levels of CD38 on these cells (Figure 4A).

Show Full Abstract

CD38 is a target for immunotherapy of multiple myeloma. Llama-derived CD38-specific nanobodies allow easy reformatting into mono-, bi- and multispecific proteins. To evaluate the utility of nanobodies for constructing CD38-specific nanobody-based killer cell engagers (nano-BiKEs), we generated half-life extended nano-BiKEs (HLE-nano-BiKEs) by fusing a CD38-specific nanobody to a CD16-specific nanobody for binding to the Fc-receptor on NK cells and further to an albumin-specific nanobody to extend the half-life <i>in vivo</i>. HLE-nano-BiKEs targeting three different epitopes (E1, E2, E3) of CD38 were expressed in transiently transfected HEK-6E cells. We verified specific and simultaneous binding to CD38 on myeloma cells, CD16 on NK cells, and to albumin. We tested the capacity of these HLE-nano-BiKEs to mediate cytotoxicity against CD38-expressing multiple myeloma cell lines and primary myeloma cells from human bone marrow biopsies in bioluminescence and flowcytometry assays with NK92 cells as effector cells. The results revealed specific time- and dose-dependent cytolysis of CD38+ myeloma cell lines and effective depletion of CD38-expressing multiple myeloma cells from primary human bone marrow samples. Our results demonstrate the efficacy of CD38-specific HLE-nano-BiKEs <i>in vitro</i> and <i>ex vivo</i>, warranting further preclinical evaluation <i>in vivo</i> of their therapeutic potential for the treatment of multiple myeloma.

Also flagged:Prion DiseaseprionPrion diseasesneurodegenerative disordersprionsPrP
Journal Article 2022-05-16 ✓ 2 Snippets Slota JA, Medina SJ, Frost KL, Booth SA.
In-Text Gene Mentions

…glutathione peroxidase enzymePrdx6, shown to…

…In particular,Prdx6was commonly increased…

Show Full Abstract

Progressive dysfunction and loss of neurons ultimately culminates in the symptoms and eventual fatality of prion disease, yet the pathways and mechanisms that lead to neuronal degeneration remain elusive. Here, we used RNAseq to profile transcriptional changes in microdissected CA1 and thalamus brain tissues from prion infected mice. Numerous transcripts were altered during clinical disease, whereas very few transcripts were reliably altered at pre-clinical time points. Prion altered transcripts were assigned to broadly defined brain cell types and we noted a strong transcriptional signature that was affiliated with reactive microglia and astrocytes. While very few neuronal transcripts were common between the CA1 and thalamus, we described transcriptional changes in both regions that were related to synaptic dysfunction. Using transcriptional profiling to compare how different neuronal populations respond during prion disease may help decipher mechanisms that lead to neuronal demise and should be investigated with greater detail.

Also flagged:neurodegenerative diseasePDcognitive declinesleepdepressionshaking palsy
Journal Article 2022-05-16 No Snippets McComish SF, MacMahon Copas AN, Caldwell MA.
Show Full Abstract

Parkinson's disease (PD) is the second most common neurodegenerative disease and affects approximately 2-3% of the population over the age of 65. PD is characterised by the loss of dopaminergic neurons from the substantia nigra, leading to debilitating motor symptoms including bradykinesia, tremor, rigidity, and postural instability. PD also results in a host of non-motor symptoms such as cognitive decline, sleep disturbances and depression. Although existing therapies can successfully manage some motor symptoms for several years, there is still no means to halt progression of this severely debilitating disorder. Animal models used to replicate aspects of PD have contributed greatly to our current understanding but do not fully replicate pathological mechanisms as they occur in patients. Because of this, there is now great interest in the use of human brain-based models to help further our understanding of disease processes. Human brain-based models include those derived from embryonic stem cells, patient-derived induced neurons, induced pluripotent stem cells and brain organoids, as well as post-mortem tissue. These models facilitate <i>in vitro</i> analysis of disease mechanisms and it is hoped they will help bridge the existing gap between bench and bedside. This review will discuss the various human brain-based models utilised in PD research today and highlight some of the key breakthroughs they have facilitated. Furthermore, the potential caveats associated with the use of human brain-based models will be detailed.

Also flagged:cell differentiationsynthesischromosomemuscle cell differentiationmuscle cell developmentcalcium
Journal Article 2022-05-16 ✓ 2 Snippets Liu R, Han M, Liu X, Yu K, Bai X, Dong Y.
In-Text Gene Mentions

…, EFNB2 ,SOX6, MYOCD ,…

…, EFNB2 ,SOX6, PROX1 ,…

Show Full Abstract

There is an increasing understanding of the possible regulatory role of long non-coding RNAs (LncRNA). Studies on livestock have mainly focused on the regulation of cell differentiation, fat synthesis, and embryonic development. However, there has been little study of skeletal muscle of domestic animals and the potential role of lncRNA. In this study, the transcriptome numbers of longissimus muscle of different beef cattle (Shandong black catle and Luxi catlle) were used to construct muscle related lncRNAs-miRNA-mRNA interaction network through bioinformatics analysis. This is helpful to clarify the molecular mechanism of bovine muscle development, and can be used to promote animal husbandry and improve animal husbandry production. According to the screening criteria of |FC|≧2 and q < 0.05, a total of 1,415 transcripts (of which 480 were LncRNAs) were differentially expressed (<i>q</i> < 0.05) in the different breeds. Further, we found that the most differentially expressed LncRNAs were found on chromosome 9, in which the differentially expressed LncRNAs targeted 1,164 protein coding genes (<i>MYORG</i>, <i>Wnt4</i>, <i>PAK1</i>, <i>ADCY7,etc</i>) (upstream and downstream<50 Kb). In addition, Pearson's correlation coefficients of co-expression levels indicated a potential trans regulatory relationship between the differentially expressed LncRNAs and 43844 mRNAs (r > 0.9). The identified co-expressed mRNAs (<i>MYORG</i>, <i>Dll1</i>, <i>EFNB2</i>, <i>SOX6</i>, <i>MYOCD</i>, and <i>MYLK</i>3) are related to the formation of muscle structure, and enriched in muscle system process, strained muscle cell differentiation, muscle cell development, striated muscle tissue development, calcium signaling, and AMPK signaling. Additionally, we also found that some LncRNAs (<i>LOC112444238</i>, <i>LOC101903367</i>, <i>LOC104975788</i>, <i>LOC112441863</i>, <i>LOC112449549</i>, and <i>LOC101907194</i>) may interact with miRNAs related to cattle muscle growth and development. Based on this, we constructed a LncRNAs-miRNA-mRNA interaction network as the putative basis for biological regulation in cattle skeletal muscle. Interestingly, a candidate differential LncRNA (<i>LOC104975788</i>) and a protein-coding gene (<i>Pax7</i>) contain miR-133a binding sites and binding was confirmed by luciferase reporter assay. <i>LOC104975788</i> may combined miR-133a competitively with <i>Pax7</i>, thus relieving the inhibitory effect of miR-133a on <i>Pax7</i> to regulate skeletal muscle development. These results will provide the theoretical basis for further study of LncRNA regulation and activity in different cattle breeds.

Also flagged:GestationNF-κΒEGFRPTGS2reproductionparturition
Journal Article 2022-05-16 ✓ 1 Snippet Liu Z, Yang J, Li H, Zhong Z, Huang J, Fu J, Zhao H, Liu X, Jiang S.
In-Text Gene Mentions

…, PRL ,NEGR1, HOXA2 ,…

Show Full Abstract

Gestation length is a complex polygenic trait that affects pig fetal development. The Qingping (QP) pig, a Chinese native black pig breed, is characterized by short gestation length. However, the genetic architecture of short gestation length is still not clear. The present study aimed to explore the genetic architecture of short gestation length in QP pigs. In this study, selective sweep analyses were performed to detect selective sweep signatures for short gestation length traits between 100 QP pigs and 219 pigs from 15 other breeds. In addition, differentially expressed genes for the short gestation length between QP pigs and Large White pigs were detected by RNA sequencing. Comparing candidate genes from these methods with known genes for preterm birth in the database, we obtained 111 candidate genes that were known preterm birth genes. Prioritizing other candidate genes, 839 novel prioritized candidate genes were found to have significant functional similarity to preterm birth genes. In particular, we highlighted <i>EGFR</i>, which was the most prioritized novel candidate relative to preterm birth genes. Experimental validations in placental and porcine trophectoderm cells suggest that <i>EGFR</i> is highly expressed in the QP pigs with short gestation length and could regulate the NF-κΒ pathway and downstream expression of <i>PTGS2</i>. These findings comprehensively identified candidate genes for short gestation length trait at the genomic and transcriptomic levels. These candidate genes provide an important new resource for further investigation and genetic improvement of gestation length.

Also flagged:sickle cell diseasePolymeraseRHDRHCERHCE 1nucleotide
Journal Article 2022-05-16 No Snippets de Paula Vendrame TA, Arnoni CP, Latini FRM, Pereira Cortez AJ, Bénech C, Fichou Y, Castilho L.
Show Full Abstract

<h4>Background</h4>Hybrid genes are responsible for the formation of Rh variants and are common in patients with sickle cell disease (SCD). However, it is not usually possible to detect them by conventional molecular protocols. In the present study, hybrid genes were investigated using the Quantitative Multiplex Polymerase chain reaction of Short Fluorescent Fragments (QMPSF), a molecular protocol that quantifies the copy number of RHD and RHCE exons. In addition, we explored additional relevant information obtained with QMPSF, such as recognition of variant RHCE and RHD zygosity.<h4>Materials and methods</h4>Three groups of subjects were selected for the study: patients with SCD, self-declared African descent donors (SDA), and D-negative donors. RHD and RHCE hybrids genes were investigated by the QMPSF method. Real-time multiplex polymerase chain reaction (PCR) assay was used to confirm the copy number of the RHD in two samples. Cloning was performed to investigate the allele. Relative RhD antigen density was investigated by flow cytometry, and RhCE phenotyping was performed with both tube and gel methods.<h4>Results</h4>In the 507 samples analysed, hybrid allele frequencies were found in 20.08% of patients with SCD, in 18.22% of individuals in the SDA group, and 3.67% of D-negative donors. The SCD and SDA groups had a higher frequency of hybrid alleles, most commonly involving exon 8, with which we found an association with c.733C>G, a common polymorphism observed in individuals of African descent. Of note, two patients with SCD were shown to carry three gene copies, as confirmed by quantitative PCR; no increase in D expression was observed in these patients. In addition, the QMPSF guided the investigation of 144 RHCE variants and RHD zygosity, and two novel alleles were identified.<h4>Discussion</h4>The QMPSF was shown to identify hybrid alleles involved in altered Rh phenotypes in Brazilian donors and patients with SCD. The association of the hybrid RHCE-D(8)-CE allele with c.733C>G suggests this hybrid allele may be used as a marker to detect the most frequent variants found in patients with SCD.

Authorea Preprints 2022-05-16 Preprint (No Snippets API) Diamandis DC, Lazar M, Smith L, Ivanova O, Seideman D, Kaufmann M, Papadopoulou S, Tudor A, Feldman J, Schuster G, Honda R, Adams J.
Show Full Abstract

Evidence-based medicine has shown for many years that homozygous mutations of the HFE gene H63D are by no means negligible. Not only can it cause, usually after a second hit, rather mild classical hemochromatosis, but it can also cause numerous other disorders of iron metabolism, such as hypotransferrinemia, changes in binding capacity, and others. In addition, it may lead - among other symptoms - to damages of the heart and the substantia nigra via a causal relationship that remains to be investigated, most likely via a cascade dysfunction in iron metabolism. The clinical facts are compelling. Any physician who dismisses mutations of the HFE gene H63D as clinically irrelevant risks the health and life of his patient. We report two patients with an HFE H63D mutation who were treated almost too decades too late because of outdated expertise.

medRxiv 2022-05-16 Preprint (No Snippets API) Yang Z, Jain P, Drineas P, Paschou P.
Show Full Abstract

Depression is one of the most prevalent psychiatric disorders and is one of the leading causes of health ailment worldwide. It is known to be highly heritable and is frequently comorbid with other mental and physical traits. This observation motivated us to look deeper into the genetic and phenotypic connections between depression and other traits in order to identify correlations as well as potentially causal connections between them. In this study, we analyzed data from the UK biobank to systematically evaluate relationships between depression and other heritable traits both from a phenotypic and a genetic aspect. We compressed a total of 6,300 ICD codes into 412 heritable phecodes and we constructed a comorbidity network connecting depression and other disorders on over 300,000 participants of European ancestry. Additionally, we investigated the genetic correlation for each (phenotypic) connection in the resulting network. We also looked into potentially causal relationships using mendelian randomization for all pairs of significantly correlated disorders and uncovered horizontal pleiotropic genetic variants and genes contributing to disease etiologies. We found gastro-oesophageal reflux disease (GORD), body mass index, and osteoarthritis to be direct causes for depression, with GORD lying at the center of the causal network. Genes broadly expressed in various tissues, such as NEGR1, TCF4 , and BTN2A1 underlie the pathways that lead not only to depression but also to other related disorders. Our work highlights the broad connections between depression and diverse traits, indicating a complex etiology and possible existence of subtypes for depression. Our findings highlight the value of cross-trait analysis in order to better understand the neurobiology of complex psychiatric disease.

Also flagged:prediabeteslipoproteincholesteroldiabetes mellitusinsulin resistancemetabolic disorder syndrome
Journal Article 2022-05-15 ✓ 2 Snippets Kuang M, Peng N, Qiu J, Zhong Y, Zou Y, Sheng G.
In-Text Gene Mentions

Furthermore, there was a lot of evidence that the adiponectin gene, HFE hereditary hemochromatosis gene, etc. may also affect the susceptibility to type 2 DM; individuals with the susceptibility genes were more likely to develop prediabetes if environmental factors altered the expression of these genes [44].

…the adiponectin gene,HFE hereditary hemochromatosishereditary hemochromatosis gen…

Show Full Abstract

<h4>Background</h4>Low-density lipoprotein:high-density lipoprotein cholesterol ratio (LDL:HDL ratio) has a good performance in identifying diabetes mellitus (DM) and insulin resistance. However, it is not yet clear whether the LDL:HDL ratio is associated with a high-risk state of prediabetes.<h4>Methods</h4>This cohort study retrospectively analyzed the data of 100,309 Chinese adults with normoglycemia at baseline. The outcome event of interest was new-onset prediabetes. Using multivariate Cox regression and smoothing splines to assess the association of LDL:HDL ratio with prediabetes.<h4>Results</h4>During an average observation period of 37.4 months, 12,352 (12.31%) subjects were newly diagnosed with prediabetes. After adequate adjustment for important risk factors, the LDL:HDL ratio was positively correlated with the prediabetes risk, and the sensitivity analysis further suggested the robustness of the results. Additionally, in stratified analysis, we discovered significant interactions between LDL:HDL ratio and family history of DM, sex, body mass index and age (all P-interaction < 0.05); among them, the LDL:HDL ratio-related prediabetes risk decreased with the growth of body mass index and age, and increased significantly in women and people with a family history of DM.<h4>Conclusions</h4>The increased LDL:HDL ratio in the Chinese population indicates an increased risk of developing prediabetes, especially in women, those with a family history of DM, younger adults, and non-obese individuals.

Also flagged:homCancerphenolsucrosepolynucleotide kinaseDNA polymerase
Journal Article 2022-05-15 ✓ 2 Snippets Du Y, Gu Z, Li Z, Yuan Z, Zhao Y, Zheng X, Bo X, Chen H, Wang C, Wang C, Wang C.
In-Text Gene Mentions

…one involved theDCCand CTDP1 (Figure…

…the MAPK4 ,DCC, and CTDP1…

Show Full Abstract

Structural variations (SVs) are the greatest source of variations in the genome and can lead to oncogenesis. However, the identification and interpretation of SVs in human cancer remain technologically challenging. Here, long-read sequencing is first employed to depict the signatures of structural variations in carcinogenesis of human pancreatic ductal epithelium. Then widespread reprogramming of the 3D chromatin architecture is revealed by an in situ Hi-C technique. Integrative analyses indicate that the distribution pattern of SVs among the 3D genome is highly cell-type specific and the bulk remodeling effects of SVs in the chromatin organization partly depend on intercellular genomic heterogeneity. Meanwhile, contact domains tend to minimize these disrupting effects of SVs within local adjacent genomic regions to maintain overall stability. Notably, complex genomic rearrangements involving two key driver genes CDKN2A and SMAD4 are identified, and their influence on the expression of oncogenes MIR31HG, MYO5B, etc., are further elucidated from both a linear view and 3D perspective. Overall, this work provides a genome-wide resource and highlights the impact, complexity, and dynamicity of the interplay between structural variations and high-order chromatin organization, which expands the current understanding of the pathogenesis of SVs in human cancer.

Also flagged:Yellow nail syndromepathogenesisacute respiratory distress syndromeARDSsyndromesinusitis
Journal Article 2022-05-15 ✓ 1 Snippet Ahmed A, Y Yousif M, Abdelmageed I, Eljack MMF, Abbasher Hussien Mohamed Ahmed K, Tarig AbdAlla Mohamed M, Abdelkareim G Mohammed S, B Salih E, H Osman D.
In-Text Gene Mentions

…mellitus, thyroid dysfunction,hemochromatosis, obstructive sleep apnea,…

Show Full Abstract

Yellow nail syndrome is a rare lymphatic abnormality without clear pathogenesis. Hereby, we report a 70-year-old Sudanese female patient who presented with recurrent cough, recurrent lower limb swelling, and yellowish nail discoloration diagnosed as yellow nail syndrome but unfortunately passed away due to acute respiratory distress syndrome (ARDS).

Also flagged:Neurological Diseasestransfergenetic disordersNeurological disordersgene transferreproduction
Journal Article 2022-05-15 ✓ 2 Snippets Lunev E, Karan A, Egorova T, Bardina M.
In-Text Gene Mentions

The AAV-mediated HD modeling allows researchers to investigate the pathogenic effect of Htt poly(Q) sequences of various lengths.

In the first case, the authors packaged the gene of truncated Htt fragment with 100 CAG repeats in AAV8 to create a rapid-onset HD model in adult mice [45].

Show Full Abstract

Adeno-associated virus (AAV) vectors have become an attractive tool for efficient gene transfer into animal tissues. Extensively studied as the vehicles for therapeutic constructs in gene therapy, AAVs are also applied for creating animal models of human genetic disorders. Neurological disorders are challenging to model in laboratory animals by transgenesis or genome editing, at least partially due to the embryonic lethality and the timing of the disease onset. Therefore, gene transfer with AAV vectors provides a more flexible option for simulating genetic neurological disorders. Indeed, the design of the AAV expression construct allows the reproduction of various disease-causing mutations, and also drives neuron-specific expression. The natural and newly created AAV serotypes combined with various delivery routes enable differentially targeting neuronal cell types and brain areas in vivo. Moreover, the same viral vector can be used to reproduce the main features of the disorder in mice, rats, and large laboratory animals such as non-human primates. The current review demonstrates the general principles for the development and use of AAVs in modeling neurological diseases. The latest achievements in AAV-mediated modeling of the common (e.g., Alzheimer's disease, Parkinson's disease, ataxias, etc.) and ultra-rare disorders affecting the central nervous system are described. The use of AAVs to create multiple animal models of neurological disorders opens opportunities for studying their mechanisms, understanding the main pathological features, and testing therapeutic approaches.

Also flagged:Venous Thromboembolismgynecological cancerheparinfondaparinuxCancerdeath
Journal Article 2022-05-15 ✓ 1 Snippet Romano F, Di Lorenzo G, Stabile G, Mirandola M, Restaino S, Ianniello P, Mirenda G, Ricci G.
In-Text Gene Mentions

…the antithrombin III (ATIII) level.…

Show Full Abstract

(1) Background: This review aimed to summarize the indications for venous thromboembolic (VTE) events' prophylaxis in a gynecological cancer population, according to the most recent guidelines. (2) Methods: A systematic review of the guidelines in PubMed, SCOPUS, Web of Science, EMBASE, and CINHAL regarding VTE prevention in gynecological cancer patients was conducted according to PRISMA criteria. We compared the recommendations given by oncological and hematological societies regarding VTE prevention in gynecological cancer patients published from January 2010 through March 2021. We searched for the following keywords: "venous thromboembolism prevention", "cancer", and "guidelines". The AGREE II checklist was used to critically analyze the guidelines' quality. (3) Results: There were 1003 documents available; 14 met the inclusion criteria, 5 were excluded and, eventually, the guidelines of 10 societies were evaluated. (4) Conclusions: The guidelines agree that low-molecular-weight heparin (LMWH) and fondaparinux achieve better results in VTE prevention in gynecological cancer patients. Direct oral anticoagulants (DOACs) can be used to prevent VTE in outpatients and high-risk medical patients after discharge. VTE risk scores should be applied to all oncological patients to identify those who would benefit from a prevention program. More attention should be paid to mechanical prophylactic methods due to the high bleeding risk of gynecological cancer patients.

Also flagged:Molybdate Transporter Family 1MolybdenumMolybdatebiosynthesismolybdate transportersMOT
Journal Article 2022-05-15 ✓ 1 Snippet Minner-Meinen R, Weber JN, Kistner S, Meyfarth P, Saudhof M, van den Hout L, Schulze J, Mendel RR, Hänsch R, Kaufholdt D.
In-Text Gene Mentions

…( A. thalianaWall Associated-Kinase 2Associated-Kinase 2 (AT1G21270…

Show Full Abstract

Molybdate uptake and molybdenum cofactor (Moco) biosynthesis were investigated in detail in the last few decades. The present study critically reviews our present knowledge about eukaryotic molybdate transporters (MOT) and focuses on the model plant <i>Arabidopsis thaliana</i>, complementing it with new experiments, filling missing gaps, and clarifying contradictory results in the literature. Two molybdate transporters, MOT1.1 and MOT1.2, are known in <i>Arabidopsis</i>, but their importance for sufficient molybdate supply to Moco biosynthesis remains unclear. For a better understanding of their physiological functions in molybdate homeostasis, we studied the impact of <i>mot1.1</i> and <i>mot1.2</i> knock-out mutants, including a double knock-out on molybdate uptake and Moco-dependent enzyme activity, MOT localisation, and protein-protein interactions. The outcome illustrates different physiological roles for Moco biosynthesis: MOT1.1 is plasma membrane located and its function lies in the efficient absorption of molybdate from soil and its distribution throughout the plant. However, MOT1.1 is not involved in leaf cell imports of molybdate and has no interaction with proteins of the Moco biosynthesis complex. In contrast, the tonoplast-localised transporter MOT1.2 exports molybdate stored in the vacuole and makes it available for re-localisation during senescence. It also supplies the Moco biosynthesis complex with molybdate by direct interaction with molybdenum insertase Cnx1 for controlled and safe sequestering.

Also flagged:degradationosteogenesisangiogenesisMagnesiummetabolismhydrogen
Journal Article 2022-05-15 No Snippets Singh N, Batra U, Kumar K, Ahuja N, Mahapatro A.
Show Full Abstract

Mg and its alloys evince strong candidature for biodegradable bone implants, cardiovascular stents, and wound closing devices. However, their rapid degradation rate causes premature implant failure, constraining clinical applications. Bio-functional surface coatings have emerged as the most competent strategy to fulfill the diverse clinical requirements, besides yielding effective corrosion resistance. This article reviews the progress of biodegradable and advanced surface coatings on Mg alloys investigated in recent years, aiming to build up a comprehensive knowledge framework of coating techniques, processing parameters, performance measures in terms of corrosion resistance, adhesion strength, and biocompatibility. Recently developed conversion and deposition type surface coatings are thoroughly discussed by reporting their essential therapeutic responses like osteogenesis, angiogenesis, cytocompatibility, hemocompatibility, anti-bacterial, and controlled drug release towards in-vitro and in-vivo study models. The challenges associated with metallic, ceramic and polymeric coatings along with merits and demerits of various coatings have been illustrated. The use of multilayered hybrid coating comprising a unique combination of organic and inorganic components has been emphasized with future perspectives to obtain diverse bio-functionalities in a facile single coating system for orthopedic implant applications.

Also flagged:myelinationaxonOLIG2Oligodendrocyte transcription factor 2myelinaxons
Journal Article 2022-05-15 No Snippets Wang S, Wang Y, Zou S.
Show Full Abstract

Oligodendrocyte (OL) myelination is a critical process for the neuronal axon function in the central nervous system. After demyelination occurs because of pathophysiology, remyelination makes repairs similar to myelination. Proliferation and differentiation are the two main stages in OL myelination, and most factors commonly play converse roles in these two stages, except for a few factors and signaling pathways, such as OLIG2 (Oligodendrocyte transcription factor 2). Moreover, some OL maturation gene mutations induce hypomyelination or hypermyelination without an obvious function in proliferation and differentiation. Herein, three types of factors regulating myelination are reviewed in sequence.

Also flagged:heregulinendocrine-resistant breast cancerHER3heregulin-β2HRGHER2
Journal Article 2022-05-15 ✓ 1 Snippet Yang L, Vander Steen T, Espinoza I, Cuyàs E, Verdura S, Menendez JA, Lupu R.
In-Text Gene Mentions

STAU1

Show Full Abstract

The HER3/4 ligand heregulin-β2 (HRG) is a secreted growth factor that transactivates the ligand-less receptor HER2 to promote aggressive phenotypes in breast cancer. HRG can also localize to the nucleus of breast cancer cells, but both the nuclear translocation mechanism and the physiological role of nuclear HRG remain elusive. Here we show that nucleolin-driven nuclear moonlighting of HRG uncouples its role as a driver of endocrine resistance from its canonical HER network-activating role in breast cancer. Tandem affinity purification coupled to mass spectrometry identified the intracellular transporter nucleolin as a major HRG-binding protein. HRG interacts with nucleolin via a nuclear localization signal motif located at the N-terminal extracellular domain of HRG. Nucleolin interacts with HRG via aspartate/glutamate-rich acidic stretches located at the N-terminal domain of nucleolin. Depletion of nucleolin abolishes HRG nuclear translocation and decreases HRG mRNA and protein expression. Isolated deficiency of nuclear HRG abolishes the HRG-driven endocrine resistance phenotype <i>in vitro</i> and in mouse xenograft models, while preserving its capacity to activate the HRG/HER/MAPK autocrine signaling axis. Conversely, isolated deficiency of secreted HRG to bind HER2/3 receptors does not impair endocrine resistance. The discovery that the functions of dual compartment-resident HRG do not depend on the same effector (i.e., activation of HER2/3 receptors) establishes a new paradigm for the functional and therapeutic relevance of nuclear HRG in breast cancer.

Also flagged:MYBL2epithelial-mesenchymal transitionhepatoblastomaHBcell cycletranscriptional factors
Journal Article 2022-05-15 ✓ 1 Snippet Wei M, Yang R, Ye M, Zhan Y, Liu B, Meng L, Xie L, Du M, Wang J, Gao R, Chen D, Dong R, Dong K.
In-Text Gene Mentions

SOX6

Show Full Abstract

Hepatoblastoma (HB) accounts for the majority of hepatic malignancies in children. Although the prognosis of patients with HB has improved in past decades, metastasis is an indicator of poor overall survival. Herein, we applied single-cell RNA sequencing to explore the transcriptomic profiling of 25,264 metastatic cells isolated from the lungs of two patients with HB. The transcriptomes uncovered the heterogeneity of malignant cells after metastatic lung colonization, and these cells had varied expression signatures associated with the cell cycle, epithelial-mesenchymal plasticity, and hepatic differentiation. Single-cell regulatory network inference and clustering (SCENIC) was utilized to identify the co-expressed transcriptional factors which regulated and represented the different cell states. We further screened the key factor by bioinformatics analysis and found that MYBL2 upregulation was significantly associated with metastasis and poor prognosis. The relationship between ectopic MYBL2 and metastasis was subsequently proved by immunohistochemistry (IHC) of HB tissues, and the functions of MYBL2 in promoting proliferation, migration, and epithelial-to-mesenchymal transition (EMT) were verified by in vitro and in vivo assays. Importantly, the levels of Smad2/3 phosphorylation and SNAI1 expression were increased in <i>MYBL2</i>-transfected cells. Consequently, these results indicated that the MYBL2-controlled Smad/SNAI1 pathway induced EMT and promoted HB tumorigenesis and metastasis.

Also flagged:striatal atrophyHDNeurodegenerative diseasecognitive disordersNeurodegenerative disordersatrophy
Journal Article 2022-05-14 ✓ 5 Snippets Riad R, Lunven M, Titeux H, Cao XN, Hamet Bagnou J, Lemoine L, Montillot J, Sliwinski A, Youssov K, Cleret de Langavant L, Dupoux E, Bachoud-Lévi AC.
In-Text Gene Mentions

…of the mutantHttgene.…

…on the mutantHttgene of HD…

…carrying the mutantHttgene leading to…

…and premanifest mutantHttgene carriers while…

…of the mutantHttgene should not…

Show Full Abstract

<h4>Objectives</h4>Using brief samples of speech recordings, we aimed at predicting, through machine learning, the clinical performance in Huntington's Disease (HD), an inherited Neurodegenerative disease (NDD).<h4>Methods</h4>We collected and analyzed 126 samples of audio recordings of both forward and backward counting from 103 Huntington's disease gene carriers [87 manifest and 16 premanifest; mean age 50.6 (SD 11.2), range (27-88) years] from three multicenter prospective studies in France and Belgium (MIG-HD (ClinicalTrials.gov NCT00190450); BIO-HD (ClinicalTrials.gov NCT00190450) and Repair-HD (ClinicalTrials.gov NCT00190450). We pre-registered all of our methods before running any analyses, in order to avoid inflated results. We automatically extracted 60 speech features from blindly annotated samples. We used machine learning models to combine multiple speech features in order to make predictions at individual levels of the clinical markers. We trained machine learning models on 86% of the samples, the remaining 14% constituted the independent test set. We combined speech features with demographics variables (age, sex, CAG repeats, and burden score) to predict cognitive, motor, and functional scores of the Unified Huntington's disease rating scale. We provided correlation between speech variables and striatal volumes.<h4>Results</h4>Speech features combined with demographics allowed the prediction of the individual cognitive, motor, and functional scores with a relative error from 12.7 to 20.0% which is better than predictions using demographics and genetic information. Both mean and standard deviation of pause durations during backward recitation and clinical scores correlated with striatal atrophy (Spearman 0.6 and 0.5-0.6, respectively).<h4>Interpretation</h4>Brief and examiner-free speech recording and analysis may become in the future an efficient method for remote evaluation of the individual condition in HD and likely in other NDD.

Also flagged:heartcardiac disorderscardiomyopathiesmyocarditisamyloidosisstorage disorders
Journal Article 2022-05-14 ✓ 1 Snippet Porcari A, Baggio C, Fabris E, Merlo M, Bussani R, Perkan A, Sinagra G.
In-Text Gene Mentions

…endomyocardial fibrosis, CA,hemochromatosis).…

Show Full Abstract

Endomyocardial biopsy (EMB) is an invasive procedure originally developed for the monitoring of heart transplant rejection. Over the year, this procedure has gained a fundamental complementary role in the diagnostic work-up of several cardiac disorders, including cardiomyopathies, myocarditis, drug-related cardiotoxicity, amyloidosis, other infiltrative and storage disorders, and cardiac tumours. Major advances in EMB equipment and techniques for histological analysis have significantly improved diagnostic accuracy of EMB. In recent years, advanced imaging modalities such as echocardiography with three-dimensional and myocardial strain analysis, cardiac magnetic resonance and bone scintigraphy have transformed the non-invasive approach to diagnosis and prognostic stratification of several cardiac diseases. Therefore, it emerges the need to re-define the current role of EMB for diagnostic work-up and management of cardiovascular diseases. The aim of this review is to summarize current knowledge on EMB in light of the most recent evidences and to discuss current indications, including challenging scenarios encountered in clinical practice.

Also flagged:SUMO1TauSmall ubiquitin-like modifiersSUMOneurodegenerative diseasesconjugation
Journal Article 2022-05-14 ✓ 3 Snippets Takamura H, Nakayama Y, Ito H, Katayama T, Fraser PE, Matsuzaki S.
In-Text Gene Mentions

In addition, SUMO2-modified Htt is primarily found in the insoluble fractions from post-mortem tissue from Huntington’s disease cases suggesting that SUMOylation is involved in the pathogenic deposition aggregated proteins.

…for the huntingtin (Htt) protein where PIAS1-mediated…

…In addition, SUMO2-modifiedHttis primarily found…

Show Full Abstract

Small ubiquitin-like modifiers (SUMO) have been implicated in several neurodegenerative diseases. SUMO1 conjugation has been shown to promote aggregation and regulate phosphorylation of the tau protein linked to Alzheimer's disease and related tauopathies. The current study has demonstrated that SUMO1 co-localizes with intraneuronal tau inclusions in progressive supranuclear palsy (PSP). Immunoprecipitation of isolated and solubilized tau fibrils from PSP tissues revealed SUMO1 conjugation to a cleaved and N-terminally truncated tau. The effects of SUMOylation were examined using tau-SUMO fusion proteins which showed a higher propensity for tau oligomerization of PSP-truncated tau and accumulation on microtubules as compared to the full-length protein. This was found to be specific for SUMO1 as the corresponding SUMO2 fusion protein did not display a significantly altered cytoplasmic distribution or aggregation of tau. Blocking proteasome-mediated degradation promoted the aggregation of the tau fusion proteins with the greatest effect observed for truncated tau-SUMO1. The SUMO1 modification of the truncated tau in PSP may represent a detrimental event that promotes aggregation and impedes the ability of cells to remove the resulting protein deposits. This combination of tau truncation and SUMO1 modification may be a contributing factor in PSP pathogenesis.

Also flagged:Diabetestype 2 diabetesLPAmetabolismribosometype 1 diabetes
Journal Article 2022-05-14 ✓ 5 Snippets Bouland GA, Beulens JWJ, Nap J, van der Slik AR, Zaldumbide A, 't Hart LM, Slieker RC.
In-Text Gene Mentions

Several T2D-associated risk-alleles showed tissue-shared eQTL effects, including AP3S2, CCDC92, HLA-DQA2, CEP68, HSD17B12 and two lncRNAs RP11-613D13.10 and RP11-252K23.2.

Several diabetes risk variants increased the expression of genes in multiple tissues, including AP3S2 (rs4932265-T), CCDC92 (rs7978610-G), HLA-DQA2 (rs601945-G) and a lncRNA RP11-252K23.2 (Table S2, Fig. S1, rs3115960-G).

…including AP3S2 (rs4932265-T),CCDC92(rs7978610-G), HLA-DQA2 (rs601…

CCDC92has been associated…

…including AP3S2 ,CCDC92, HLA-DQA2, CEP68…

Show Full Abstract

<h4>Aims/hypothesis</h4>Numerous genome-wide association studies have been performed to understand the influence of genetic variation on type 2 diabetes etiology. Many identified risk variants are located in non-coding and intergenic regions, which complicates understanding of how genes and their downstream pathways are influenced. An integrative data approach will help to understand the mechanism and consequences of identified risk variants.<h4>Methods</h4>In the current study we use our previously developed method CONQUER to overlap 403 type 2 diabetes risk variants with regulatory, expression and protein data to identify tissue-shared disease-relevant mechanisms.<h4>Results</h4>One SNP rs474513 was found to be an expression-, protein- and metabolite QTL. Rs474513 influenced LPA mRNA and protein levels in the pancreas and plasma, respectively. On the pathway level, in investigated tissues most SNPs linked to metabolism. However, in eleven of the twelve tissues investigated nine SNPs were linked to differential expression of the ribosome pathway. Furthermore, seven SNPs were linked to altered expression of genes linked to the immune system. Among them, rs601945 was found to influence multiple HLA genes, including HLA-DQA2, in all twelve tissues investigated.<h4>Conclusion</h4>Our results show that in addition to the classical metabolism pathways, other pathways may be important to type 2 diabetes that show a potential overlap with type 1 diabetes.

Also flagged:central nervous system diseasesADtauaxonalphosphorylationneurodegenerative diseases
Journal Article 2022-05-14 No Snippets Weiner S, Sauer M, Visser PJ, Tijms BM, Vorontsov E, Blennow K, Zetterberg H, Gobom J.
Show Full Abstract

<h4>Background</h4>Cerebrospinal fluid (CSF) is an important biofluid for biomarkers of neurodegenerative diseases such as Alzheimer's disease (AD). By employing tandem mass tag (TMT) proteomics, thousands of proteins can be quantified simultaneously in large cohorts, making it a powerful tool for biomarker discovery. However, TMT proteomics in CSF is associated with analytical challenges regarding sample preparation and data processing. In this study we address those challenges ranging from data normalization over sample preparation to sample analysis.<h4>Method</h4>Using liquid chromatography coupled to mass-spectrometry (LC-MS), we analyzed TMT multiplex samples consisting of either identical or individual CSF samples, evaluated quantification accuracy and tested the performance of different data normalization approaches. We examined MS2 and MS3 acquisition strategies regarding accuracy of quantification and performed a comparative evaluation of filter-assisted sample preparation (FASP) and an in-solution protocol. Finally, four normalization approaches (median, quantile, Total Peptide Amount, TAMPOR) were applied to the previously published European Medical Information Framework Alzheimer's Disease Multimodal Biomarker Discovery (EMIF-AD MBD) dataset.<h4>Results</h4>The correlation of measured TMT reporter ratios with spiked-in standard peptide amounts was significantly lower for TMT multiplexes composed of individual CSF samples compared with those composed of aliquots of a single CSF pool, demonstrating that the heterogeneous CSF sample composition influences TMT quantitation. Comparison of TMT reporter normalization methods showed that the correlation could be improved by applying median- and quantile-based normalization. The slope was improved by acquiring data in MS3 mode, albeit at the expense of a 29% decrease in the number of identified proteins. FASP and in-solution sample preparation of CSF samples showed a 73% overlap in identified proteins. Finally, using optimized data normalization, we present a list of 64 biomarker candidates (clinical AD vs. controls, p < 0.01) identified in the EMIF-AD cohort.<h4>Conclusion</h4>We have evaluated several analytical aspects of TMT proteomics in CSF. The results of our study provide practical guidelines to improve the accuracy of quantification and aid in the design of sample preparation and analytical protocol. The AD biomarker list extracted from the EMIF-AD cohort can provide a valuable basis for future biomarker studies and help elucidate pathogenic mechanisms in AD.

Also flagged:PRRSviral diseasesmatrineglycyrrhizic acidsaponinCCL8
Journal Article 2022-05-14 No Snippets Zhang H, Cao Z, Sun P, Khan A, Guo J, Sun Y, Yu X, Fan K, Yin W, Li E, Sun N, Li H.
Show Full Abstract

<h4>Background</h4>Porcine Reproductive and Respiratory Syndrome (PRRS) is one of the most important porcine viral diseases which have been threatening the pig industry in China. At present, most commercial vaccines fail to provide complete protection because of highly genetic diversity of PRRSV strains. This study aimed to optimize a component formula from traditional Chinese medicine(TCM)compounds with defined chemical characteristics and clear mechanism of action against PRRSV.<h4>Methods</h4>A total of 13 natural compounds were screened for the anti-PRRSV activity using porcine alveolar macrophages (PAMs). Three compounds with strong anti-PRRSV activity were selected to identify their potential protein targets by proteomic analysis. The optimal compound formula was determined by orthogonal design based on the results of proteomics. MTT assay was used to determine the maximum non-cytotoxic concentration (MNTC) of each compound using PAMs. QPCR and western blot were used to investigate the PRRSV N gene and protein expression, respectively. The Tandem Mass Tag (TMT) technique of relative quantitative proteomics was used to detect the differential protein expression of PAMs treated with PRRSV, matrine (MT), glycyrrhizic acid (GA) and tea saponin (TS), respectively. The three concentrations of these compounds with anti-PRRSV activity were used for orthogonal design. Four formulas with high safety were screened by MTT assay and their anti-PRRSV effects were evaluated.<h4>Results</h4>MT, GA and TS inhibited PRRSV replication in a dose-dependent manner. CCL8, IFIT3, IFIH1 and ISG15 were the top four proteins in expression level change in cells treated with MT, GA or TS. The relative expression of IFIT3, IFIH1, ISG15 and IFN-β mRNAs were consistent with the results of proteomics. The component formula (0.4 mg/mL MT + 0.25 mg/mL GA + 1.95 μg/mL TS) showed synergistic anti-PRRSV effect.<h4>Conclusions</h4>The component formula possessed anti-PRRSV activity in vitro, in which the optimal dosage on PAMs was 0.4 mg/mL MT + 0.25 mg/mL GA + 1.95 μg/mL TS. Compatibility of the formula was superposition of the same target with GA and TS, while different targets of MT. IFN-β may be one of the targets of the component formula possessed anti-PRRSV activity.

Also flagged:COVID-19solid tumorssolid cancercancerimmunoglobulininterleukin 6
Journal Article 2022-05-14 No Snippets Ravera F, Borea R, Cirmena G, Dameri M, Ferrando L, Gallo M, Casini C, Fallani N, Stabile M, Barbero V, Murialdo R, Tixi L, Cappuccio M, Cuboni A, Sivieri I, Fornarini G, De Maria A, Ballestrero A, Zoppoli G.
Show Full Abstract

<h4>Background and rationale</h4>Little is known about SARS-CoV-2 seroconversion in asymptomatic patients affected by solid cancer, and whether it is associated with specific transcriptomics changes in peripheral blood mononuclear cells (PBMC).<h4>Methods</h4>Patients affected by solid cancer treated in a top comprehensive cancer center in Italy during the first COVID-19 pandemic wave, and negative for COVID-19-symptoms since the first detection of COVID-19 in Italy, were prospectively evaluated by SARS-CoV-2 serology in the period between April 14th and June 23rd 2020. Follow-up serologies were performed, every 21-28 days, until August 23rd 2020. All SARS-CoV-2 IgM + patients underwent confirmatory nasopharyngeal swab (NPS). PBMCs from a subset of SARS-CoV-2 IgM + patients were collected at baseline, at 2 months, and at 7 months for transcriptome sequencing.<h4>Results</h4>SARS-CoV-2 serology was performed on 446 of the 466 recruited patients. A total of 14 patients (3.14%) tested positive for at least one SARS-CoV-2 immunoglobulin in the period between April 14th and August 23rd 2020. Incidence of SARS-CoV-2 IgM decreased from 1.48% in the first month of the accrual to 0% in the last month. Viral RNA could not be detected in any of the NPS. PBMC serial transcriptomic analysis showed progressive downregulation of interleukin 6 upregulated signatures, chemokine-mediated signaling and chemokine-chemokine receptor KEGG pathways. B- and T-cell receptor pathways (p-values = 0.0002 and 0.017 respectively) were progressively upregulated.<h4>Conclusions</h4>SARS-CoV-2 seroconversion rate in asymptomatic patients affected by solid cancer is consistent with that of asymptomatic COVID-19 assessed in the general population through NPS at the peak of the first wave. Transcriptomic features over time in IgM + asymptomatic cases are suggestive of previous viral exposure.

Also flagged:cellulasecellulaseschromatin remodelingmethanolcellulosemonosaccharides
Journal Article 2022-05-14 No Snippets Yuan H, Zhou Y, Lin Y, Tu R, Guo Y, Zhang Y, Wang Q.
Show Full Abstract

<h4>Background</h4>Pichia pastoris is a widely used host organism for heterologous production of industrial proteins, such as cellulases. Although great progress has been achieved in improving protein expression in P. pastoris, the potential of the P. pastoris expression system has not been fully explored due to unknown genomic impact factors. Recently, whole-cell directed evolution, employing iterative rounds of genome-wide diversity generation and high-throughput screening (HTS), has been considered to be a promising strategy in strain improvement at the genome level.<h4>Results</h4>In this study, whole-cell directed evolution of P. pastoris, employing atmospheric and room temperature plasma (ARTP) mutagenesis and droplet-based microfluidic HTS, was developed to improve heterogenous cellulase production. The droplet-based microfluidic platform based on a cellulase-catalyzed reaction of releasing fluorescence was established to be suitable for methanol-grown P. pastoris. The validation experiment showed a positive sorting efficiency of 94.4% at a sorting rate of 300 droplets per second. After five rounds of iterative ARTP mutagenesis and microfluidic screening, the best mutant strain was obtained and exhibited the cellulase activity of 11,110 ± 523 U/mL, an approximately twofold increase compared to the starting strain. Whole-genome resequencing analysis further uncovered three accumulated genomic alterations in coding region. The effects of point mutations and mutant genes on cellulase production were verified using reconstruction of point mutations and gene deletions. Intriguingly, the point mutation Rsc1<sup>G22V</sup> was observed in all the top-performing producers selected from each round, and gene deletion analysis confirmed that Rsc1, a component of the RSC chromatin remodeling complex, might play an important role in cellulase production.<h4>Conclusions</h4>We established a droplet-based microfluidic HTS system, thereby facilitating whole-cell directed evolution of P. pastoris for enhancing cellulase production, and meanwhile identified genomic alterations by whole-genome resequencing and genetic validation. Our approaches and findings would provide guides to accelerate whole-cell directed evolution of host strains and enzymes of high industrial interest.

Also flagged:osteoarthritisosteophytesPDrheumatic joint diseasesOAaging
Journal Article 2022-05-14 ✓ 5 Snippets Gasperi N, Schreiber N, Bosch P, Adinolfi A, Kleyer A, Hagen M, Gasperi C, Weger M, Kiechl S, Willeit J, Schett G, Iagnocco A, Gasperi A, Mayr A, Dejaco C.
In-Text Gene Mentions

A linkage between variations in the HFE gene and HOA37 has been described, and it is well known that hereditary hemochromatosis,caused by mutations in the HFE gene, commonly affects MCP2 and MCP3with painful arthritis and extensive degenerative changes.37 While our cohort was not tested systematically for any HFE mutation, ourpatients had no clinical or laboratory sign of hemochromatosis.

…variations in theHFEgene and HOA…

…mutations in theHFEgene, commonly affects…

…systematically for anyHFEmutation, our patients…

…laboratory sign ofhemochromatosis.…

Show Full Abstract

<h4>Purpose</h4>The aim of this article is to examine the extent of structural and inflammatory lesions by ultrasound in elderly subjects with hand osteoarthritis (HOA) fulfilling the ACR classification criteria (Group A), in subjects with painless enlarged finger joints (Group B), and in individuals without clinical abnormalities at hands (Group C).<h4>Methods</h4>This study was nested within the population-based, prospective Bruneck study; 293 subjects of ⩾65 years of age were assessed. Clinical and ultrasound assessment was conducted at wrists and finger joints. Gray scale synovitis (GSS), Power Doppler (PD), osteophytes, and erosions were scored semiquantitatively (0-3). The Short Form Score for the Assessment and Quantification of Chronic Rheumatic Affections of the Hands (SF-SACRAH), the Health Assessment Questionnaire (HAQ), and the Functional Index for Hand Osteoarthritis (FIHOA) were retrieved.<h4>Results</h4>Most subjects had ⩾1 ultrasound abnormality, of which osteophytes were the most prevalent finding in all groups (Group A: 100%, Group B: 99.4%, and Group C: 93.9%). GSS and PD-signals were more common in Group A than in Group B (94% <i>versus</i> 67% and 33% <i>versus</i> 13%, respectively). In Group C, GSS was observed in 39.4% of subjects. In subjects with HOA, the SF-SACRAH correlated with osteophyte scores (corr<sub>coeff</sub> = 0.48), and the FIHOA correlated with the osteophyte (corr<sub>coeff</sub> = 0.42) and PD scores (corr<sub>coeff</sub> = 0.33).<h4>Conclusion</h4>GSS and PD were more frequent in patients with symptomatic HOA than in cases with painless bony enlargements and subjects without clinical joint abnormalities. Functional restriction in HOA is associated with structural and inflammatory ultrasound changes.

Also flagged:COVID-19coronavirus disease 2019polymerasewaterORF1abrecombinase
Journal Article 2022-05-14 No Snippets Lin C, Wang Y, Huang Z, Guo Y, Wu W.
Show Full Abstract

Programmed mini-pumps play a significant role in various fields, such as chemistry, biology, and medicine, to transport a measured volume of liquid, especially in the current detection of COVID-19 with PCR. In view of the cost of the current automatic pipetting pump being higher, which is difficult to use in a regular lab, this paper designed and assembled a three-dimensional programmed mini-pump with the common parts and components, such as PLC controller, motor, microinjector, etc. With the weighting calibration before and after pipetting operation, the error of the pipette in 10 μL (0.2%), 2 μL (1.8%), and 1 μL (5.6%) can be obtained. Besides, the contrast test between three-dimensional programmed mini-pump and manual pipette was conducted with the ORF1ab and pGEM-3Zf (+) genes in qPCR. The results proved that the custom-made three-dimensional programmed mini-pump has a stronger reproducibility compared with manual pipette (ORF1ab: 24.06 ± 0.33 vs. 23.50 ± 0.58, <i>p</i> = 0.1014; pGEM-3Zf (+): 11.83.06 ± 0.24 vs. 11.50 ± 0.34, <i>p</i> = 0.8779). These results can lay the foundation for the functional, fast, and low-cost programmed mini-pump in PCR or other applications for trace measurements.

Also flagged:genetic disordersfragile X-related disordersHuntington's diseasespinocerebellar ataxia type 1spinocerebellar ataxia type 2repeat
Journal Article 2022-05-13 ✓ 5 Snippets Zhao X, McHugh C, Coffey SR, Jimenez DA, Adams E, Carroll JB, Usdin K.
In-Text Gene Mentions

Repeat size analysis of the Fmr1, Atxn1, Atxn2 and Htt alleles in the FXD, SCA1, SCA2 and HD mice, respectively, was carried out using a fluorescent PCR assay with fluorescein amidite (FAM)-labeled primer pairs.

…, Atxn2 andHttalleles in the…

…used for theHttallele ( Lee…

…mix for theHttallele contained 2…

…to amplify theHttallele with the…

Show Full Abstract

Repeat expansion diseases are a large group of human genetic disorders caused by expansion of a specific short tandem repeat tract. Expansion in somatic cells affects age of onset and disease severity in some of these disorders. However, alleles in DNA derived from blood, a commonly used source of DNA, usually show much less expansion than disease-relevant cells in the central nervous system in both humans and mouse models. Here we examined the extent of expansion in different DNA sources from mouse models of the fragile X-related disorders, Huntington's disease, spinocerebellar ataxia type 1 and spinocerebellar ataxia type 2. We found that DNA isolated from stool is a much better indicator of somatic expansion than DNA from blood. As stool is a sensitive and noninvasive source of DNA, it can be useful for studies of factors affecting the risk of expansion, or the monitoring of treatments aimed at reducing expansion in preclinical trials, as it would allow expansions to be examined longitudinally in the same animal and allow significant changes in expansion to be observed much earlier than is possible with other DNA sources.

Also flagged:nucleussingle-nucleuslipidmuscle diseasesaltsalts
Journal Article 2022-05-13 ✓ 1 Snippet Eraslan G, Drokhlyansky E, Anand S, Fiskin E, Subramanian A, Slyper M, Wang J, Van Wittenberghe N, Rouhana JM, Waldman J, Ashenberg O, Lek M, Dionne D, Win TS, Cuoco MS, Kuksenko O, Tsankov AM, Branton PA, Marshall JL, Greka A, Getz G, Segrè AV, Aguet F, Rozenblatt-Rosen O, Ardlie KG, Regev A.
In-Text Gene Mentions

DCC

Show Full Abstract

Understanding gene function and regulation in homeostasis and disease requires knowledge of the cellular and tissue contexts in which genes are expressed. Here, we applied four single-nucleus RNA sequencing methods to eight diverse, archived, frozen tissue types from 16 donors and 25 samples, generating a cross-tissue atlas of 209,126 nuclei profiles, which we integrated across tissues, donors, and laboratory methods with a conditional variational autoencoder. Using the resulting cross-tissue atlas, we highlight shared and tissue-specific features of tissue-resident cell populations; identify cell types that might contribute to neuromuscular, metabolic, and immune components of monogenic diseases and the biological processes involved in their pathology; and determine cell types and gene modules that might underlie disease mechanisms for complex traits analyzed by genome-wide association studies.

Also flagged:infectionNOTCHimmune responsesBMPIL-13infections
Journal Article 2022-05-13 ✓ 1 Snippet Lindholm HT, Parmar N, Drurey C, Campillo Poveda M, Vornewald PM, Ostrop J, Díez-Sanchez A, Maizels RM, Oudhoff MJ.
In-Text Gene Mentions

…measured by countingOLFM4+ cells in crypts…

Show Full Abstract

The intestinal tract is a common site for various types of infections including viruses, bacteria, and helminths, each requiring specific modes of immune defense. The intestinal epithelium has a pivotal role in both immune initiation and effector stages, which are coordinated by lymphocyte cytokines such as IFNγ, IL-13, and IL-22. Here, we studied intestinal epithelial immune responses using organoid image analysis based on a convolutional neural network, transcriptomic analysis, and in vivo infection models. We found that IL-13 and IL-22 both induce genes associated with goblet cells, but the resulting goblet cell phenotypes are dichotomous. Moreover, only IL-13-driven goblet cells are associated with classical NOTCH signaling. We further showed that IL-13 induces the bone morphogenetic protein (BMP) pathway, which acts in a negative feedback loop on immune type 2-driven tuft cell hyperplasia. This is associated with inhibiting <i>Sox4</i> expression to putatively limit the tuft cell progenitor population. Blocking ALK2, a BMP receptor, with the inhibitor dorsomorphin homolog 1 (DMH1) interrupted the feedback loop, resulting in greater tuft cell numbers both in vitro and in vivo after infection with <i>Nippostrongylus brasiliensis</i>. Together, this investigation of cytokine effector responses revealed an unexpected and critical role for the BMP pathway in regulating type 2 immunity, which can be exploited to tailor epithelial immune responses.

Also flagged:DiGeorge syndromethymic hypoplasiagene expressionextracellularorganogenesisoxygen
Journal Article 2022-05-13 ✓ 2 Snippets Handel AE, Cheuk S, Dhalla F, Maio S, Hübscher T, Rota I, Deadman ME, Ekwall O, Lütolf M, Weinberg K, Holländer G.
In-Text Gene Mentions

…cell types, e.g.,Sox6was detected in…

…SOX10 , whereasSOX6was expressed in…

Show Full Abstract

The thymic stroma is composed of epithelial and nonepithelial cells providing separate microenvironments controlling homing, differentiation, and selection of hematopoietic precursor cells to functional T cells. Here, we explore at single-cell resolution the complex composition and dynamic changes of the nonepithelial stromal compartment across different developmental stages in the human and mouse thymus, and in an experimental model of the DiGeorge syndrome, the most common form of human thymic hypoplasia. The detected gene expression signatures identify previously unknown stromal subtypes and relate their individual molecular profiles to separate differentiation trajectories and functions, revealing an unprecedented heterogeneity of different cell types that emerge at discrete developmental stages and vary in their expression of key regulatory signaling circuits and extracellular matrix components. Together, these findings highlight the dynamic complexity of the nonepithelial thymus stroma and link this to separate instructive roles essential for normal thymus organogenesis and tissue maintenance.

Also flagged:depressioncardiovascular diseasecoronary artery diseasetype 2 diabetesc-reactive proteincholesterol
Journal Article 2022-05-13 No Snippets Torgersen K, Rahman Z, Bahrami S, Hindley GFL, Parker N, Frei O, Shadrin A, O'Connell KS, Tesli M, Smeland OB, Munkhaugen J, Djurovic S, Dammen T, Andreassen OA.
Show Full Abstract

Epidemiological and clinical studies have found associations between depression and cardiovascular disease risk factors, and coronary artery disease patients with depression have worse prognosis. The genetic relationship between depression and these cardiovascular phenotypes is not known. We here investigated overlap at the genome-wide level and in individual loci between depression, coronary artery disease and cardiovascular risk factors. We used the bivariate causal mixture model (MiXeR) to quantify genome-wide polygenic overlap and the conditional/conjunctional false discovery rate (pleioFDR) method to identify shared loci, based on genome-wide association study summary statistics on depression (n = 450,619), coronary artery disease (n = 502,713) and nine cardiovascular risk factors (n = 204,402-776,078). Genetic loci were functionally annotated using FUnctional Mapping and Annotation (FUMA). Of 13.9K variants influencing depression, 9.5K (SD 1.0K) were shared with body-mass index. Of 4.4K variants influencing systolic blood pressure, 2K were shared with depression. ConjFDR identified 79 unique loci associated with depression and coronary artery disease or cardiovascular risk factors. Six genomic loci were associated jointly with depression and coronary artery disease, 69 with blood pressure, 49 with lipids, 9 with type 2 diabetes and 8 with c-reactive protein at conjFDR < 0.05. Loci associated with increased risk for depression were also associated with increased risk of coronary artery disease and higher total cholesterol, low-density lipoprotein and c-reactive protein levels, while there was a mixed pattern of effect direction for the other risk factors. Functional analyses of the shared loci implicated metabolism of alpha-linolenic acid pathway for type 2 diabetes. Our results showed polygenic overlap between depression, coronary artery disease and several cardiovascular risk factors and suggest molecular mechanisms underlying the association between depression and increased cardiovascular disease risk.

Also flagged:gynecologic malignanciestumourendometrial cancerTNFICOSCancer
Journal Article 2022-05-13 ✓ 1 Snippet Yu Z, Zhang J, Zhang Q, Wei S, Shi R, Zhao R, An L, Grose R, Feng D, Wang H.
In-Text Gene Mentions

…proteins (FBLN2 andSOX6) and matrix modifying…

Show Full Abstract

<h4>Background</h4>Endometrial cancer (EC) is one of the most common gynecologic malignancies with increasing morbidity. Cell-cell and cell-matrix interactions within the tumour microenvironment (TME) exert a powerful influence over the progression of EC. Therefore, a comprehensive exploration of heterogeneity and intratumoral crosstalk is essential to elucidate the mechanisms driving EC progression and develop novel therapeutic approaches.<h4>Methods</h4>4 EC and 2 normal endometrium samples were applied for single-cell RNA sequencing (scRNA-seq) analysis. In addition, we also included the public database to explore the clinical benefits of the single cell analysis.<h4>Results</h4>9 types of cells were identified with specific expression of maker genes. Both the malignant epithelial cells and cells comprising the immune microenvironment displayed a high degree of intertumoral heterogeneity. Notably, the proliferation T cells also showed an exhausted feature. Moreover, the malignant cells may induce an immunosuppressive microenvironment through TNF-ICOS pair. Cancer-associated fibroblasts (CAFs) were divided into four subsets with distinct characteristics and they maintained frequent communications with malignant cells which facilitating the progression of EC. We also found that the existence of vascular CAF (vCAF) may indicate a worse prognosis for EC patients through integrating TCGA database.<h4>Conclusion</h4>The TME of human EC remains highly heterogeneous. Out finding that malignant cells interact closely with immune cells and vCAFs identifies potential therapeutic targets.

Also flagged:CYP3ARipretinibKIT kinasegastrointestinal stromal tumorskinaseimatinib
Journal Article 2022-05-13 No Snippets Li X, Shelton MJ, Wang J, Meade J, Ruiz-Soto R.
Show Full Abstract

Ripretinib is a switch control KIT kinase inhibitor approved for treatment of adults with advanced gastrointestinal stromal tumors who received prior treatment with 3 or more kinase inhibitors, including imatinib. Ripretinib and its active metabolite (DP-5439) are cleared mainly via cytochrome P450 enzyme 3A4/5 (CYP3A4/5), and ripretinib solubility is pH-dependent, thus the drug-drug interaction potentials of ripretinib with itraconazole (strong CYP3A inhibitor), rifampin (strong CYP3A inducer), and pantoprazole (proton pump inhibitor) were each evaluated in open-label, fixed-sequence study designs. Overall, 20 participants received ripretinib 50 mg alone and with itraconazole 200 mg once daily, 24 participants received ripretinib 100 mg alone and with rifampin 600 mg once daily, and 25 participants received ripretinib 50 mg alone and with pantoprazole 40 mg once daily. Ripretinib exposure increased with concomitant itraconazole, with geometric least-squares (LS) mean ratios of ripretinib area under the concentration-time curve from 0 to ∞ (AUC<sub>0-∞</sub> ) and maximum observed concentration (C<sub>max</sub> ) of 199% and 136%. Ripretinib exposure decreased with concomitant rifampin: geometric LS mean ratios for ripretinib AUC<sub>0-∞</sub> and C<sub>max</sub> were 39% and 82%. Pantoprazole coadministration had no effect on ripretinib pharmacokinetics. No unexpected safety signals occurred. No dose adjustment is required for ripretinib coadministered with gastric acid reducers and strong CYP3A inhibitors; patients also receiving strong CYP3A inhibitors should be monitored more frequently for adverse reactions. Concomitant ripretinib use with strong CYP3A inducers should be avoided. Prescribers should refer to approved labeling for specific dose recommendations with concomitant use of strong and moderate CYP3A inducers.

Also flagged:heterochromatinhistonehistone methyltransferasesgene repressionmethylationIFNB1
Journal Article 2022-05-13 No Snippets Padeken J, Methot SP, Gasser SM.
Show Full Abstract

Heterochromatin is characterized by dimethylated or trimethylated histone H3 Lys9 (H3K9me2 or H3K9me3, respectively) and is found at transposable elements, satellite repeats and genes, where it ensures their transcriptional silencing. The histone methyltransferases (HMTs) that methylate H3K9 - in mammals Suppressor of variegation 3-9 homologue 1 (SUV39H1), SUV39H2, SET domain bifurcated 1 (SETDB1), SETDB2, G9A and G9A-like protein (GLP) - and the 'readers' of H3K9me2 or H3K9me3 are highly conserved and show considerable redundancy. Despite their redundancy, genetic ablation or mistargeting of an individual H3K9 methyltransferase can correlate with impaired cell differentiation, loss of tissue identity, premature aging and/or cancer. In this Review, we discuss recent advances in understanding the roles of the known H3K9-specific HMTs in ensuring transcriptional homeostasis during tissue differentiation in mammals. We examine the effects of H3K9-methylation-dependent gene repression in haematopoiesis, muscle differentiation and neurogenesis in mammals, and compare them with mechanistic insights obtained from the study of model organisms, notably Caenorhabditis elegans and Drosophila melanogaster. In all these organisms, H3K9-specific HMTs have both unique and redundant roles that ensure the maintenance of tissue integrity by restricting the binding of transcription factors to lineage-specific promoters and enhancer elements.

Also flagged:TNFRSF4tumorstumorendometrial carcinomaCD4CD8
Journal Article 2022-05-13 ✓ 2 Snippets Ma H, Feng PH, Yu SN, Lu ZH, Yu Q, Chen J.
In-Text Gene Mentions

Initially, evidence was brought by Paterson, D.J [27], who identified TNFRSF4 as a specific marker of T-cell activation and survival when cross-linked with its ligand TNFSF4. Then emerging evidence highlighted that TNFRSF4 was a promising therapeutic target for T cell-mediated anti-tumor immunotherapy [28–30].

…with its ligandTNFSF4.…

Show Full Abstract

<h4>Background</h4>The interaction between tumor microenvironment (TME) and tumors offers various targets in mounting anti-tumor immunotherapies. However, the prognostic biomarkers in endometrial carcinoma (EC) are still limited. Here, we aimed to analyze the TME features and identify novel prognostic biomarkers for EC.<h4>Methods</h4>ESTIMATE, CIBERSORT, protein-protein interaction (PPI) network, univariate and multivariate Cox regression, and functional enrichment analysis were performed to identify immune- and survival-related hub genes as well as possible molecular mechanisms. The limma package and deconvolution algorithm were adopted to estimate the abundance of tumor-infiltrating immune cells (TICs) and their relationship with the target gene. In the validation section, tissue microarrays (TMAs) of EC and multiplex immunohistochemistry (m-IHC) were evaluated to validate the expression of TNFRSF4, and its correlation with immune markers, including CD4, CD8, and FOXP3. Besides, the receiver operating characteristic (ROC) curve was plotted to determine the diagnostic performance of TNFRSF4, CD4, CD8, and FOXP3 in EC.<h4>Results</h4>Two genes, TNFRSF4 and S1PR4, were screened out from 386 intersection differential expression genes (DEGs) shared by ImmuneScore and StromalScore in EC. Highlighted by TNFRSF4, we found that it was not only positively correlated with the TICs (mainly CD4<sup>+</sup> T cells, CD8<sup>+</sup> T cells, and Tregs) but significantly related to the prognosis in patients of EC, both verified by data from The Cancer Genome Altas (TCGA)-EC database and clinical samples. At the same time, the expression trend of TNFRSF4 was further confirmed by an integrated meta-analysis based on six microarrays from the Gene Expression Omnibus database (GEO).<h4>Conclusions</h4>Collectively, TNFRSF4, a previously unrecognized key player in EC, could serve as a potential biomarker for prognosis prediction and immunomodulation of EC.

Also flagged:cell adhesionorganizationbindingadhesion moleculesadhesion proteinsactomyosin
Journal Article 2022-05-13 No Snippets Tsai TY, Garner RM, Megason SG.
Show Full Abstract

Since the proposal of the differential adhesion hypothesis, scientists have been fascinated by how cell adhesion mediates cellular self-organization to form spatial patterns during development. The search for molecular tool kits with homophilic binding specificity resulted in a diverse repertoire of adhesion molecules. Recent understanding of the dominant role of cortical tension over adhesion binding redirects the focus of differential adhesion studies to the signaling function of adhesion proteins to regulate actomyosin contractility. The broader framework of differential interfacial tension encompasses both adhesion and nonadhesion molecules, sharing the common function of modulating interfacial tension during cell sorting to generate diverse tissue patterns. Robust adhesion-based patterning requires close coordination between morphogen signaling, cell fate decisions, and changes in adhesion. Current advances in bridging theoretical and experimental approaches present exciting opportunities to understand molecular, cellular, and tissue dynamics during adhesion-based tissue patterning across multiple time and length scales.

Also flagged:ColitisWntR-spondincell surfaceFrizzledlow-density lipoprotein receptor-related protein receptors
Journal Article 2022-05-13 ✓ 1 Snippet Xie L, Fletcher RB, Bhatia D, Shah D, Phipps J, Deshmukh S, Zhang H, Ye J, Lee S, Le L, Newman M, Chen H, Sura A, Gupta S, Sanman LE, Yang F, Meng W, Baribault H, Vanhove GF, Yeh WC, Li Y, Lu C.
In-Text Gene Mentions

…of F3 andSox6, recently reported…

Show Full Abstract

<h4>Background and aims</h4>Current management of inflammatory bowel disease leaves a clear unmet need to treat the severe epithelial damage. Modulation of Wnt signaling might present an opportunity to achieve histological remission and mucosal healing when treating IBD. Exogenous R-spondin, which amplifies Wnt signals by maintaining cell surface expression of Frizzled (Fzd) and low-density lipoprotein receptor-related protein receptors, not only helps repair intestine epithelial damage, but also induces hyperplasia of normal epithelium. Wnt signaling may also be modulated with the recently developed Wnt mimetics, recombinant antibody-based molecules mimicking endogenous Wnts.<h4>Methods</h4>We first compared the epithelial healing effects of RSPO2 and a Wnt mimetic with broad Fzd specificity in an acute dextran sulfate sodium mouse colitis model. Guided by Fzd expression patterns in the colon epithelium, we also examined the effects of Wnt mimetics with subfamily Fzd specificities.<h4>Results</h4>In the DSS model, Wnt mimetics repaired damaged colon epithelium and reduced disease activity and inflammation and had no apparent effect on uninjured tissue. We further identified that the FZD5/8 and LRP6 receptor-specific Wnt mimetic, SZN-1326-p, was associated with the robust repair effect. Through a range of approaches including single-cell transcriptome analyses, we demonstrated that SZN-1326-p directly impacted epithelial cells, driving transient expansion of stem and progenitor cells, promoting differentiation of epithelial cells, histologically restoring the damaged epithelium, and secondarily to epithelial repair, reducing inflammation.<h4>Conclusions</h4>It is feasible to design Wnt mimetics such as SZN-1326-p that impact damaged intestine epithelium specifically and restore its physiological functions, an approach that holds promise for treating epithelial damage in inflammatory bowel disease.

Also flagged:NXNEFNA3CASQ2FBLN1EFSBCHE
Journal Article 2022-05-13 ✓ 5 Snippets Wei C, Li M, Lin S, Xiao J.
In-Text Gene Mentions

PCDH17

NEGR1

…TNFSF14, TNFSF15, TNFSF18,TNFSF4, TNFSF9, VSIR, and…

…TNFSF14, TNFSF15, TNFSF18,TNFSF4, VSIR, and VTCN1…

…TNFSF14, TNFSF15, TNFSF18,TNFSF4, VSIR, and VTCN1)…

Show Full Abstract

<h4>Objective</h4>Tumor mutation burden (TMB) represents a useful biomarker for predicting survival outcomes and immunotherapy response. Here, we aimed to conduct TMB-based gene signature and molecular subtypes in gastric cancer.<h4>Methods</h4>Based on differentially expressed genes (DEGs) between high- and low-TMB groups in TCGA, a LASSO model was developed for predicting overall survival (OS) and disease-free survival (DFS). The predictive performance was externally verified in the GSE84437 dataset. Molecular subtypes were conducted via consensus clustering approach based on TMB-related DEGs. The immune microenvironment was estimated by ESTIMATE and ssGSEA algorithms.<h4>Results</h4>High-TMB patients had prolonged survival duration. TMB-related DEGs were distinctly enriched in cancer- (MAPK, P53, PI3K-Akt, and Wnt pathways) and immune-related pathways (T cell selection and differentiation). The TMB-based gene model was developed (including MATN3, UPK1B, GPX3, and RGS2), and high-risk score was predictive of poor prognosis and recurrence. ROC and multivariate analyses revealed the well predictive performance, which was confirmed in the external cohort. Furthermore, we established the nomogram containing the risk score, age, and stage for personalized prediction of OS and DFS. High-risk score was characterized by high stromal score, increased immune checkpoints, immune cell infiltrations, and enhanced sensitivity to gefitinib, vinorelbine, and gemcitabine. Three TMB-based molecular subtypes were conducted, characterized by distinct prognosis, immune microenvironment, and drug sensitivity.<h4>Conclusion</h4>Collectively, we established a prognostic signature and three distinct molecular subtypes based on TMB features for gastric cancer, which might be beneficial for prognostic prediction and clinical decision-making.

Also flagged:CoagulationPulmonary HypertensionSildenafilproliferativepathogenesisTissue Factor
Journal Article 2022-05-13 No Snippets Ma X, Wang XE, Xie LX, Lu S, Jiang C.
Show Full Abstract

Pulmonary hypertension (PAH) is a proliferative disease of pulmonary blood vessels, but the pathogenesis of pulmonary hypertension is still unclear. This article explores the role of tumor necrosis factor-<i>α</i> (TNF-<i>α</i>), tissue factor (TF), and coagulation function (CF) in the pathogenesis of PAH. PAH is often accompanied by vascular intima injury and muscular arterial media thickening. Coupled with the wide application of nanotargeted drugs in recent years, a targeted nanocarrier encapsulating sildenafil was prepared in this study. The particle size, PDI, zeta potential, drug loading, and encapsulation efficiency were 194.32 ± 17.31 nm, 0.28 ± 0.02, -6.34 ± 0.33, 24.61%, and 70.52%. The monocrotaline PAH rat model was constructed, and it was found that the levels of TNF-<i>α</i>, TF, and CF in the peripheral blood of PAH rats were abnormally increased. 30 PAH rats were randomly divided into 5 groups and injected with saline (NS group), sildenafil (sildenafil group), target the nanoempty carrier (TNC-E group), ordinary nanocarrier encapsulated sildenafil (CNC-sildenafil group), and targeted nanocarrier encapsulate sildenafil (TNC-sildenafil group). Compared with the NS group, the mean pulmonary artery pressure in the TNC-sildenafil group was lower (<i>P</i> < 0.05). Compared with the normal rat group, the pulmonary small blood vessel media thickness, TNF-<i>α</i> level, TF level, and the area of myocardial cells were increased in the NS group, sildenafil group, TNC-E group, and CNC-sildenafil group (<i>P</i> < 0.05). Compared with the NS group, the pulmonary small blood vessel media thickness, myocardial cell area, and the levels of TNF-<i>α</i> and TF in the TNC-sildenafil group were reduced (<i>P</i> < 0.05). Targeting nanocarrier encapsulation of sildenafil can obviously reduce the average pulmonary artery pressure in rats with pulmonary hypertension, improve pulmonary vascular media proliferation and myocardial hypertrophy, and restore the levels of TNF-<i>α</i>, TF, and CF to a normal state.

Also flagged:Cognitionschizophreniagene expressionbindingtranscription factorschromatin
Journal Article 2022-05-13 No Snippets Bhattacharyya U, Bhatia T, Deshpande SN, Thelma BK.
Show Full Abstract

Cognition is believed to be a product of human evolution, while schizophrenia is ascribed as the by-product with cognitive impairment as it's genetically mediated endophenotype. Genomic loci associated with these traits are enriched with recent evolutionary markers such as Human accelerated regions (HARs). HARs are markedly different in humans since their divergence with chimpanzees and mostly regulate gene expression by binding to transcription factors and/or modulating chromatin interactions. We hypothesize that variants within HARs may alter such functions and thus contribute to disease pathogenesis. 49 systematically prioritized variants from 2737 genome-wide HARs were genotyped in a north-Indian schizophrenia cohort (331 cases, 235 controls). Six variants were significantly associated with cognitive impairment in schizophrenia, thirteen with general cognition in healthy individuals. These variants were mapped to 122 genes; predicted to alter 79 transcription factors binding sites and overlapped with promoters, enhancers and/or repressors. These genes and TFs are implicated in neurocognitive phenotypes, autism, schizophrenia and bipolar disorders; a few are targets of common or repurposable antipsychotics suggesting their draggability; and enriched for immune response and brain developmental pathways. Immune response has been more strongly targeted by natural selection during human evolution and has a prominent role in neurodevelopment. Thus, its disruption may have deleterious consequences for neuronal and cognitive functions. Importantly, among the 15 associated SNPs, 12 showed association in several independent GWASs of different neurocognitive functions. Further analysis of HARs may be valuable to understand their role in cognition biology and identify improved therapeutics for schizophrenia.

Also flagged:Selenium NanoparticlesImmunomodulationSeleniumchitosanTroloxlipid
Journal Article 2022-05-13 No Snippets Xia IF, Kong HK, Wu MMH, Lu Y, Wong KH, Kwok KWH.
Show Full Abstract

Selenium nanoparticles (SeNPs) are a novel elemental form selenium and often reported to possess beneficial bioactivities such as anticancer, promoting bone growth and immunomodulation. Our previous study demonstrated that chitosan-stabilized SeNPs have strong activity in immunomodulation. However, the mechanism underlying the immunomodulation of SeNPs is still unknown. The aim of this study is to identify the molecular mechanisms involved in SeNP-induced immunomodulation. Using zebrafish, as a common immunological animal model with a highly conserved molecular mechanism with other vertebrates, we conducted serum proteomic and tissue transcriptome analyses on individuals fed with SeNP in healthy or disease conditions. We also compared differences between SeNPs and an exogenous antioxidant Trolox in immune activity and redox regulation. Our results suggest that the immunomodulation activity was highly related to antioxidant activity and lipid metabolism. Interestingly, the biological functions enhanced by SeNP were almost identical in the healthy and disease conditions. However, while the SeNP was suppressing ROS in healthy individuals, it promoted ROS formation during disease condition. This might be related to the defense mechanism against pathogens. SOD and NFkβ appeared to be the key molecular switch changing effect of SeNPs when individuals undergo infection, indicating the close relationship between immune and redox regulation.

Also flagged:COVID-19myogenesiscell proliferationcell growthcarbonfermentation
Journal Article 2022-05-13 No Snippets Knežić T, Janjušević L, Djisalov M, Yodmuang S, Gadjanski I.
Show Full Abstract

Global food systems are under significant pressure to provide enough food, particularly protein-rich foods whose demand is on the rise in times of crisis and inflation, as presently existing due to post-COVID-19 pandemic effects and ongoing conflict in Ukraine and resulting in looming food insecurity, according to FAO. Cultivated meat (CM) and cultivated seafood (CS) are protein-rich alternatives for traditional meat and fish that are obtained via cellular agriculture (CA) i.e., tissue engineering for food applications. Stem and progenitor cells are the building blocks and starting point for any CA bioprocess. This review presents CA-relevant vertebrate cell types and procedures needed for their myogenic and adipogenic differentiation since muscle and fat tissue are the primary target tissues for CM/CS production. The review also describes existing challenges, such as a need for immortalized cell lines, or physical and biochemical parameters needed for enhanced meat/fat culture efficiency and ways to address them.

Also flagged:Idiopathic pulmonary fibrosislung diseaserespiratory failureextracellularcollagenBMP
Journal Article 2022-05-13 ✓ 4 Snippets Ghandikota S, Sharma M, Ediga HH, Madala SK, Jegga AG.
In-Text Gene Mentions

Interestingly, we found 8 novel candidate genes (FRY, SEMA3B, SLC1A1, C5orf38, NINJ2, VSIG10, PDZD2, and SELENBP1) from the blue module (FDR p-value = 1.02 × 10−6) that were downregulated exclusively in IPF lung tissue samples with acute exacerbations.

Interestingly, we also found several genes (VSIG10, HSD17B6, N4BP1, PLLP, HPCAL1, MYRF, GPM6A, and AGER) that are downregulated in AT1 cells from IPF lung tissue [18] relative to healthy samples.

…several genes (VSIG10, HSD17B6, N4BP1, PLLP,…

…SLC1A1, C5orf38, NINJ2,VSIG10, PDZD2, and SELENBP1…

Show Full Abstract

Idiopathic pulmonary fibrosis (IPF) is a severe fibrotic lung disease characterized by irreversible scarring of the lung parenchyma leading to dyspnea, progressive decline in lung function, and respiratory failure. We analyzed lung transcriptomic data from independent IPF cohorts using weighted gene co-expression network analysis (WGCNA) to identify gene modules based on their preservation status in these cohorts. The consensus gene modules were characterized by leveraging existing clinical and molecular data such as lung function, biological processes, pathways, and lung cell types. From a total of 32 consensus gene modules identified, two modules were found to be significantly correlated with the disease, lung function, and preserved in other IPF datasets. The upregulated gene module was enriched for extracellular matrix, collagen metabolic process, and BMP signaling while the downregulated module consisted of genes associated with tube morphogenesis, blood vessel development, and cell migration. Using a combination of connectivity-based and trait-based significance measures, we identified and prioritized 103 "hub" genes (including 25 secretory candidate biomarkers) by their similarity to known IPF genetic markers. Our validation studies demonstrate the dysregulated expression of <i>CRABP2</i>, a retinol-binding protein, in multiple lung cells of IPF, and its correlation with the decline in lung function.

Also flagged:Opticneurodegenerative disorderHDmyelin sheathsmyelinmembrane
Journal Article 2022-05-13 ✓ 5 Snippets Mazur-Michałek I, Kowalska K, Zielonka D, Leśniczak-Staszak M, Pietras P, Szaflarski W, Isalan M, Mielcarek M.
In-Text Gene Mentions

The HD mutation occurs within the exon-1 of huntingtin HTT gene [29], which is ubiquitously expressed in all cell types and tissues [3,31], including ocular tissue [22].

It would be important to investigate the ultrastructural changes in other HD mouse models next, including so-called “full length” models such as HdhQ150, in which the CAG expansion has been introduced into the endogenous mouse Htt locus.

…the huntingtin gene (HTT).…

…the huntingtin protein (HTT), leading to the…

…exon-1 of huntingtinHTTgene [ 29…

Show Full Abstract

Huntington's disease (HD) is a fatal neurodegenerative disorder caused by a polyglutamine expansion in the huntingtin protein. HD-related pathological remodelling has been reported in HD mouse models and HD carriers. In this study, we studied structural abnormalities in the optic nerve by employing Spectral Domain Optical Coherence Tomography (SD-OCT) in pre-symptomatic HD carriers of Caucasian origin. Transmission Electron Microscopy (TEM) was used to investigate ultrastructural changes in the optic nerve of the well-established R6/2 mouse model at the symptomatic stage of the disease. We found that pre-symptomatic HD carriers displayed a significant reduction in the retinal nerve fibre layer (RNFL) thickness, including specific quadrants: superior, inferior and temporal, but not nasal. There were no other significant irregularities in the GCC layer, at the macula level and in the optic disc morphology. The ultrastructural analysis of the optic nerve in R6/2 mice revealed a significant thinning of the myelin sheaths, with a lamellar separation of the myelin, and a presence of myelonoid bodies. We also found a significant reduction in the thickness of myelin sheaths in peripheral nerves within the choroids area. Those ultrastructural abnormalities were also observed in HD photoreceptor cells that contained severely damaged membrane disks, with evident vacuolisation and swelling. Moreover, the outer segment of retinal layers showed a progressive disintegration. Our study explored structural changes of the optic nerve in pre- and clinical settings and opens new avenues for the potential development of biomarkers that would be of great interest in HD gene therapies.

Also flagged:Carnitine Palmitoyltransferase 1neurodegenerative disorderdeathmitochondrialcarnitinefatty acids
Journal Article 2022-05-13 ✓ 5 Snippets Bertapelle C, Carillo MR, Cacciola NA, Shidlovskii YV, Peluso G, Digilio FA.
In-Text Gene Mentions

To investigate the effect of reversible inhibition of CPT1, we used a well-established Drosophila model for Huntington’s disease [11] (Q128HD-FL) in which the human HTT complementary DNA (cDNA) with 128 glutamine repeats is expressed in all neuronal tissues (genotype: elav-Gal4/+; UAS-hFLHD-128Q/+;).

Huntington’s disease (HD) is a neurodegenerative disorder due to the abnormal expansion of the unstable CAG triplet repeats in exon 1 of the huntingtin (Htt) gene and the resulting formation of an abnormal polyglutamine tract in the protein [1].

…the huntingtin (Htt) gene and…

…The mutated misfoldedHTTprotein (mHTT), featured…

…Human HUNTINGTIN protein (HTT) is extensively expressed…

Show Full Abstract

Huntington's disease (HD) is a dramatic neurodegenerative disorder caused by the abnormal expansion of a CAG triplet in the huntingtin gene, producing an abnormal protein. As it leads to the death of neurons in the cerebral cortex, the patients primarily present with neurological symptoms, but recently metabolic changes resulting from mitochondrial dysfunction have been identified as novel pathological features. The carnitine shuttle is a complex consisting of three enzymes whose function is to transport the long-chain fatty acids into the mitochondria. Here, its pharmacological modification was used to test the hypothesis that shifting metabolism to lipid oxidation exacerbates the HD symptoms. Behavioural and transcriptional analyses were carried out on HD Drosophila model, to evaluate the involvement of the carnitine cycle in this pathogenesis. Pharmacological inhibition of <i>CPT1</i>, the rate-limiting enzyme of the carnitine cycle, ameliorates the HD symptoms in Drosophila, likely acting on the expression of carnitine-related genes.

Also flagged:Ethylene Glycolpyromellitic acidmethoxymineralizationwaterlanthanide ions
Journal Article 2022-05-13 No Snippets Chen T, Zhao S.
Show Full Abstract

An effective strategy was developed to fabricate novel lanthanide ions-pyromellitic acid-methoxy poly(ethylene glycol) (Ln-PMA-MPEG) nano-assemblies. The amphiphilic partially esterified derivative (PMA-MPEG) of pyromellitic acid with methoxy poly(ethylene glycol) was designed and synthesized via the coupling reaction. Ln-PMA-MPEG nano-assemblies were rapidly fabricated using PMA-MPEG as a polymer ligand with Eu<sup>3+</sup> ions or mixed Eu<sup>3+</sup>/Tb<sup>3+</sup> ions through biomimetic mineralization in neutral aqueous systems. The size of the as-prepared materials could be designed in the range 80-200 nm with a uniform distribution. The materials were readily dispersed in various solvents and displayed visible color variations and different photoluminescent properties for solvent recognition. The mixed Eu/Tb-PMA-MPEG nanomaterials were investigated as ratiometric sensors for the detection of trace water in DMF and Fe<sup>3+</sup> ions in aqueous solutions. The sensor materials can quantitatively detect trace water in DMF from 0% to 10% (<i>v</i>/<i>v</i>). The resultant materials also display a strong correlation between the double luminescence intensity ratios (<i>I</i><sub>Tb</sub>/<i>I</i><sub>Eu</sub>) and Fe<sup>3+</sup> concentration, with a good linear detection concentration in the range of 0-0.24 mM and a limit of detection of 0.46 μM, and other metal ions did not interfere with the sensing mechanism for Fe<sup>3+</sup> ions. The novel nano-assemblies have potential applications as ratiometric fluorescent nanosensors in the chemical industry as well as in biomedical fields.

Also flagged:SerotoninNeurogenesisObsessive-Compulsive DisorderSlitrk1Slitrk5DMRT2
Journal Article 2022-05-13 ✓ 1 Snippet Deng M, Wang Y, Yu S, Fan Q, Qiu J, Wang Z, Xiao Z.
In-Text Gene Mentions

…or SLC6A4, or5-HTT), tryptophan hydroxylase 2…

Show Full Abstract

Obsessive-compulsive disorder (OCD) is a deliberating disorder with complex genetic and environmental etiologies. Hypotheses about OCD mainly include dysregulated neurotransmitters, especially serotonin, and disturbed neurodevelopment. Single nucleotide polymorphism (SNP) association studies regarding OCD are often met with inconsistent results. However, stratification by age of onset may sometimes help to limit the heterogenicity of OCD patients. Therefore, we conducted a stratified SNP association study enrolling 636 patients and 612 healthy controls. Patients were stratified by age of onset as early-onset (EO-OCD) and late-onset (LO-OCD). Blood extracted from the patients was used to genotype 18 loci, including serotonin system genes, Slitrk1, Slitrk5, and DMRT2 and related miRNA genes. Logistic regression was used to compare allele and genotype frequencies of variants. A general linear model was used to evaluate the association between variants and trait anxiety. In our study, rs3824419 in DMRT2 was associated with EO-OCD, G allele was the risk allele. Rs2222722 in miR-30a-5p was associated with EO-OCD, with the C allele being the risk allele. Rs1000952 in HTR3D was found associated with trait anxiety in OCD patients. The significance disappeared after FDR correction. Our results supported neurodevelopment-related genes, DMRT2 and miR-30a-5p, to be related to EO-OCD. However, we cannot prove serotonin genes to be directly associated with EO-OCD. While an association between HTR3D and trait anxiety was discovered, comparisons based on biological or clinical traits may be helpful in future studies. As our detective powers were limited, more large-scale studies will be needed to confirm our conclusion.

Also flagged:Cancergene expressionnucleotidestomach cancermethylationGNN
Journal Article 2022-05-13 No Snippets Yin C, Cao Y, Sun P, Zhang H, Li Z, Xu Y, Sun H.
Show Full Abstract

Accurate molecular subtypes prediction of cancer patients is significant for personalized cancer diagnosis and treatments. Large amount of multi-omics data and the advancement of data-driven methods are expected to facilitate molecular subtyping of cancer. Most existing machine learning-based methods usually classify samples according to single omics data, fail to integrate multi-omics data to learn comprehensive representations of the samples, and ignore that information transfer and aggregation among samples can better represent them and ultimately help in classification. We propose a novel framework named multi-omics graph convolutional network (M-GCN) for molecular subtyping based on robust graph convolutional networks integrating multi-omics data. We first apply the Hilbert-Schmidt independence criterion least absolute shrinkage and selection operator (HSIC Lasso) to select the molecular subtype-related transcriptomic features and then construct a sample-sample similarity graph with low noise by using these features. Next, we take the selected gene expression, single nucleotide variants (SNV), and copy number variation (CNV) data as input and learn the multi-view representations of samples. On this basis, a robust variant of graph convolutional network (GCN) model is finally developed to obtain samples' new representations by aggregating their subgraphs. Experimental results of breast and stomach cancer demonstrate that the classification performance of M-GCN is superior to other existing methods. Moreover, the identified subtype-specific biomarkers are highly consistent with current clinical understanding and promising to assist accurate diagnosis and targeted drug development.

Also flagged:GSK-3βGlycogen synthase kinase-3βnucleuspancreatic ductal adenocarcinomaintraductal papillary mucinous neoplasmAQP5
Journal Article 2022-05-13 ✓ 2 Snippets Ding L, Roeck K, Zhang C, Zidek B, Rodman E, Hernandez-Barco Y, Zhang JS, Bamlet W, Oberg A, Zhang L, Bardeesy N, Li H, Billadeau D.
In-Text Gene Mentions

…Sox9, Sox4, Prom1,Olfm4and Onecut2 (…

…Sox9, Sox4, Spp1,Olfm4, and Prom1 in…

Show Full Abstract

Glycogen synthase kinase-3β (GSK-3β) is a downstream target of oncogenic KRas and can accumulate in the nucleus in pancreatic ductal adenocarcinoma (PDA). To determine the interplay between oncogenic KRas and nuclear GSK-3β in PDA development, we generated Lox-STOP-Lox (LSL) nuclear-targeted GSK-3β animals and crossed them with LSL-KRas<sup>G12D</sup> mice under the control of the Pdx1-cre transgene-referred to as KNGC. Interestingly, 4-week-old KNGC animals show a profound loss of acinar cells, the expansion of ductal cells, and the rapid development of cystic-like lesions reminiscent of intraductal papillary mucinous neoplasm (IPMN). RNA-sequencing identified the expression of several ductal cell lineage genes including AQP5. Significantly, the Aqp5<sup>+</sup> ductal cell pool was proliferative, phenotypically distinct from quiescent pancreatic ductal cells, and deletion of AQP5 limited expansion of the ductal pool. Aqp5 is also highly expressed in human IPMN along with GSK-3β highlighting the putative role of Aqp5<sup>+</sup> ductal cells in human preneoplastic lesion development. Altogether, these data identify nGSK-3β and KRas<sup>G12D</sup> as an important signaling node promoting the retention of pancreatic ductal progenitor cells, which could be used to further characterize pancreatic ductal development as well as lineage biomarkers related to IPMN and PDA.

Also flagged:Autophagydegradationautophagy-relatedmetabolismpathogenesismetabolic disorders
Journal Article 2022-05-13 No Snippets Kuramoto K, He C.
Show Full Abstract

Autophagy is a stress-induced lysosomal degradation pathway regulated by evolutionarily conserved autophagy-related (ATG) genes. Recent research has revealed that autophagy plays an important role in the regulation of energy metabolism, development of metabolic tissues, and pathogenesis of metabolic disorders. Bulk and selective degradation by autophagy helps maintain protein homeostasis and physiological function of cells. Aside from classical degradative roles, ATG proteins also carry out non-classical secretory functions of metabolic tissues. In this review, we summarize recent progresses and unanswered questions on the mechanisms of autophagy and ATG proteins in metabolic regulation, with a focus on organelle and nutrient storage degradation, as well as vesicular and hormonal secretion. Such knowledge broadens our understanding on the cause, pathophysiology, and prevention of metabolic diseases including obesity and diabetes.

Also flagged:gene expressionreverse transcriptaseRNase HDNA polymerasenucleotidesRBP
Journal Article 2022-05-13 ✓ 2 Snippets Guria A, Sharma P, Srikakulam N, Baby A, Natesan S, Pandi G.
In-Text Gene Mentions

…the other hand,DCCanalysis of HeLa…

…lines using theDCCcomputational pipeline.…

Show Full Abstract

Covalently closed circular RNAs are neoteric to the eukaryotic family of long non-coding RNAs emerging as a result of 5'-3' backsplicing from exonic, intronic, or intergenic regions spanning the parental gene. Owing to their unique structure and stability, circular RNAs have a multitude of functional properties such as micro-RNA and protein sponges, direct and indirect modulators of gene expression, protein translation, and many unproven activities apart from being potential biomarkers. However, due to their low abundance, most of the global circular RNA identification is carried out by high-throughput NGS-based approaches requiring millions of sequencing reads. This lag in methodological advancements demands for newer, more refined, and efficient identification techniques. Here, we aim to show an improved version of our previously reported template-dependent multiple displacement amplification (tdMDA)-NGS method by superimposing the ribosomal depletion step and use of H minus reverse transcriptase and RNase H. Implication of tdMDA using highly replicative Phi29 DNA polymerase after minimizing the linear and ribosomal RNA content further intensifies its detection limit toward even the abysmally expressing circular RNA at a low NGS depth, thereby decreasing the cost of identifying a single circular RNA. A >11-fold and >6-fold increase in total circular RNA was identified from the improved-tdMDA-NGS method over the traditional method of circRNA sequencing using DCC and CIRI2 pipelines, respectively, from <i>Oryza sativa</i> subsp. <i>Indica.</i> Furthermore, the reliability of the improved-tdMDA-NGS method was also asserted in HeLa cell lines, showing a significant fold difference in comparison with the existing traditional method of circRNA sequencing. Among the identified circular RNAs, a significant percentage from both rice (∼58%) and HeLa cell lines (∼84%) is found to be matched with the previously reported circular RNAs, suggesting that the improved-tdMDA-NGS method can be adapted to detect and characterize the circular RNAs from different biological systems.

Also flagged:Immune-Related RNA-Binding Proteincancerscancerlung adenocarcinomaLUADRBP
Journal Article 2022-05-13 ✓ 1 Snippet Xu L, Li W, Yang T, Hu S, Zou Q, Jiao J, Jiang N, Zhang Y.
In-Text Gene Mentions

…CAD, SCN1A, GCC2,LRRC7, SMARCA4, CSMD3, BMPER,…

Show Full Abstract

<b>Background:</b> Dysregulation of RNA-binding proteins (RBPs) in cancers is associated with immune and cancer development. Here, we aimed to profile immune-related RBPs in lung adenocarcinoma (LUAD) and construct an immune-related RBP signature (IRBPS) to predict the survival and response to immunotherapy. <b>Methods:</b> A correlation analysis was performed to establish a co-expression network of RBPs and immune-related genes (IRGs) to characterize immune-related RBPs in the TCGA-LUAD cohort (<i>n</i> = 497 cases). Then, a combination of the Random survival forest (RSF) and Cox regression analysis was performed to screen the RBPs and establish IRBPS. This was followed by independent validation of IRBPS in GSE72094 (<i>n</i> = 398 cases), GSE31210, (<i>n</i> = 226 cases), and GSE26939 (<i>n</i> = 114 cases). Differences between the low- and high-risk groups were compared in terms of gene mutations, tumor mutation burden, tumor-infiltrating lymphocytes, and biomarkers responsive to immunotherapy. <b>Results:</b> DDX56, CTSL, ZC3H12D, and PSMC5 were selected and used to construct IRBPS. The high-risk scores of patients had a significantly worse prognosis in both training and testing cohorts (<i>p</i> < 0.0001 and <i>p</i> < 0.05, respectively), and they tended to be older and have an advanced TNM stage. Furthermore, IRBPS was a prognostic factor independent of age, gender, smoking history, TNM stage, and EGFR mutation status (<i>p</i> = 0.002). In addition, high-risk scores of IRBPS were significantly correlated with tumor-infiltrating lymphocytes (<i>p</i> < 0.05). They also had a high level of PD-L1 protein expression (<i>p</i> < 0.01), number of neoantigens (<i>p</i> < 0.001), and TMB (<i>p</i> < 0.001), implying the possible prediction of IRBPS in the immunotherapy of LUAD. <b>Conclusion:</b> The currently established IRBPS encompassing immune-related RBPs might serve as a promising tool to predict survival, reflect the immune microenvironment, and predict the efficacy of immunotherapy among LUAD patients.

Also flagged:Glycocalyxcarbohydratecardiovascular disordersendothelial dysfunctionhypertensionaging
Journal Article 2022-05-13 ✓ 5 Snippets Milusev A, Rieben R, Sorvillo N.
In-Text Gene Mentions

…as antithrombin III (ATIII) ( 13 ).…

…and 2O-sulfation, andATIIIspecifically recognizes 3O-sul…

…for HS includeATIII( 11 ,…

…( 189 )ATIII( 188 ),…

…for hydrocortisone andATIII, is a direct…

Show Full Abstract

The physiological, anti-inflammatory, and anti-coagulant properties of endothelial cells (ECs) rely on a complex carbohydrate-rich layer covering the luminal surface of ECs, called the glycocalyx. In a range of cardiovascular disorders, glycocalyx shedding causes endothelial dysfunction and inflammation, underscoring the importance of glycocalyx preservation to avoid disease initiation and progression. In this review we discuss the physiological functions of the glycocalyx with particular focus on how loss of endothelial glycocalyx integrity is linked to cardiovascular risk factors, like hypertension, aging, diabetes and obesity, and contributes to the development of thrombo-inflammatory conditions. Finally, we consider the role of glycocalyx components in regulating inflammatory responses and discuss possible therapeutic interventions aiming at preserving or restoring the endothelial glycocalyx and therefore protecting against cardiovascular disease.

Also flagged:circadian rhythmtissue homeostasisosteoarthritiscircadian rhythmstransductionluciferase
Journal Article 2022-05-13 ✓ 5 Snippets Naven MA, Zeef LAH, Li S, Humphreys PA, Smith CA, Pathiranage D, Cain S, Woods S, Bates N, Au M, Wen C, Kimber SJ, Meng QJ.
In-Text Gene Mentions

…expression of SOX5,SOX6, SOX9 ,…

…SOX5,SOX6and SOX9, essential…

…with SOX5 andSOX6to drive chondrogenic…

…1 like (CSE1L), and Karyopherin…

…as SOX9 ,SOX6, COL2A1 and…

Show Full Abstract

The circadian clock in murine articular cartilage is a critical temporal regulatory mechanism for tissue homeostasis and osteoarthritis. However, translation of these findings into humans has been hampered by the difficulty in obtaining circadian time series human cartilage tissues. As such, a suitable model is needed to understand the initiation and regulation of circadian rhythms in human cartilage. <b>Methods:</b> We used a chondrogenic differentiation protocol on human embryonic stem cells (hESCs) as a proxy for early human chondrocyte development. Chondrogenesis was validated using histology and expression of pluripotency and differentiation markers. The molecular circadian clock was tracked in real time by lentiviral transduction of human clock gene luciferase reporters. Differentiation-coupled gene expression was assessed by RNAseq and differential expression analysis. <b>Results:</b> hESCs lacked functional circadian rhythms in clock gene expression. During chondrogenic differentiation, there was an expected reduction of pluripotency markers (e.g., <i>NANOG</i> and <i>OCT4</i>) and a significant increase of chondrogenic genes (<i>SOX9</i>, <i>COL2A1</i> and <i>ACAN</i>). Histology of the 3D cartilage pellets at day 21 showed a matrix architecture resembling human cartilage, with readily detectable core clock proteins (BMAL1, CLOCK and PER2). Importantly, the circadian clocks in differentiating hESCs were activated between day 11 (end of the 2D stage) and day 21 (10 days after 3D differentiation) in the chondrogenic differentiation protocol. RNA sequencing revealed striking differentiation coupled changes in the expression levels of most clock genes and a range of clock regulators. <b>Conclusions:</b> The circadian clock is gradually activated through a differentiation-coupled mechanism in a human chondrogenesis model. These findings provide a human 3D chondrogenic model to investigate the role of the circadian clock during normal homeostasis and in diseases such as osteoarthritis.

Also flagged:PC1acidificationgot2matingchromosomeaspartate aminotransferase
Journal Article 2022-05-13 No Snippets Liu J, Peng W, Yu F, Shen Y, Yu W, Lu Y, Lin W, Zhou M, Huang Z, Luo X, You W, Ke C.
Show Full Abstract

Aquaculture is one of the world's fastest-growing and most traded food industries, but it is under the threat of climate-related risks represented by global warming, marine heatwave (MHW) events, ocean acidification, and deoxygenation. For the sustainable development of aquaculture, selective breeding may be a viable method to obtain aquatic economic species with greater tolerance to environmental stressors. In this study, we estimated the heritability of heat tolerance trait of Pacific abalone <i>Haliotis discus hannai</i>, performed genome-wide association studies (GWAS) analysis for heat tolerance to detect single nucleotide polymorphisms (SNPs) and candidate genes, and assessed the potential of genomic selection (GS) in the breeding of abalone industry. A total of 1120 individuals were phenotyped for their heat tolerance and genotyped with 64,788 quality-controlled SNPs. The heritability of heat tolerance was moderate (0.35-0.42) and the predictive accuracy estimated using BayesB (0.55 ± 0.05) was higher than that using GBLUP (0.40 ± 0.01). A total of 11 genome-wide significant SNPs and 2 suggestive SNPs were associated with heat tolerance of abalone, and 13 candidate genes were identified, including <i>got2</i>,<i>znfx1</i>,<i>l(2)efl</i>, and <i>lrp5</i>. Based on GWAS results, the prediction accuracy using the top 5K SNPs was higher than that using randomly selected SNPs and higher than that using all SNPs. These results suggest that GS is an efficient approach for improving the heat tolerance of abalone and pave the way for abalone selecting breeding programs in rapidly changing oceans.

Research Square 2022-05-13 Preprint (No Snippets API) Liu Y, Huang T, Jiang X, Zhang W, Zhou H, Hu Q.
Show Full Abstract

<h4>Background: </h4> Thrombophilia is a group of disorders that predispose to thrombosis, involving the interaction between genetic and acquired factors, mainly manifested as recurrent venous thromboembolism (VTE). Mutations in SERPINC1 lead to deficiency in antithrombin (AT) which is an endogenous anticoagulant of normal hemostasis and could result in VTE. Herein, we report a case of hereditary thrombophilia manifested by recurrent thrombosis involving the deep veins of the lower extremities, splanchnic veins, and cerebral vein. Case presentation: A 61-year-old male patient with recurrent thrombosis involving the deep veins of the lower extremities, splanchnic veins, and cerebral vein. Laboratory tests revealed a type I AT deficiency in this patient and further whole exome sequencing (WES) identified a novel heterozygous frameshift duplication (c.233_236dup, p.Val80Alafs*26) in SERPINC1 gene. After diagnosis, the patient was treated with dabigatran and obtained a perfect therapeutic effect. <h4>Conclusion: </h4> A novel frameshift variation (c.233_236dup, p.Val80Alafs*26) within the SERPINC1 gene was identified in a multisystem VTE patient, which may play a significant role in human hereditary AT deficiencies. Our study enriches the insights of genetic factors for VTE and will facilitate the genetic diagnosis of this disease.

Also flagged:phosphatidylethanolamine binding protein 1cancerhydrogenursolic acids
Journal Article 2022-05-12 ✓ 3 Snippets Stitou M, Toufik H, Akabli T, Lamchouri F.
In-Text Gene Mentions

…Virtual screening ofPEBP1inhibitors by combining…

…validated the modeledPEBP1protein.…

…dominant in thePEBP1's pocket.…

Show Full Abstract

Human phosphatidylethanolamine binding protein 1 (hPEBP1) is a novel target affecting many cellular signaling pathways involved in the formation of metastases. It can be used in the treatment of many cases of cancer. For these reasons, pharmaceutical companies use computational approaches, including multi-QSAR (2D, 3D, and hologram QSAR) analysis, homology modeling, molecular docking analysis, and molecular dynamic simulations, to speed up the drug discovery process. In this paper, QSAR modeling was conducted using two quantum chemistry optimization methods (AM1 and DFT levels). As per PLS results, we found that the DFT/B3LYP method presents high predictability according to 2D-QSAR, CoMFA, CoMSIA, and hologram QSAR studies, with Q<sup>2</sup> of 0.81, 0.67, 0.79, and 0.67, and external power with R<sup>2</sup><sub>pred</sub> of 0.78, 0.58, 0.66, and 0.56, respectively. This result has been validated by CoMFA/CoMSIA graphics, which suggests that electrostatic fields combined with hydrogen bond donor/acceptor fields are beneficial to the antiproliferative activity. While the hologram QSAR models show the contributions of each fragment in improving the activity. The results from QSAR analyses revealed that ursolic acids with heterocyclic rings could improve the activities. Ramachandran plot validated the modeled PEBP1 protein. Molecular docking and MD simulations revealed that the hydrophobic and hydrogen bond interactions are dominant in the PEBP1's pocket. These results were used to predict in silico structures of three new compounds with potential anticancer activity. Similar molecular docking stability studies and molecular dynamics simulations were conducted.

Also flagged:Chaperoneneurodegenerative diseasesynucleincytoplasmiccytoplasmTDP-43
Journal Article 2022-05-12 ✓ 1 Snippet Peinado JR, Chaplot K, Jarvela TS, Barbieri EM, Shorter J, Lindberg I.
In-Text Gene Mentions

HTT

Show Full Abstract

As neurons age, protein homeostasis becomes less efficient, resulting in misfolding and aggregation. Chaperone proteins perform vital functions in the maintenance of cellular proteostasis, and chaperone-based therapies that promote sequestration of toxic aggregates may prove useful in blocking the development of neurodegenerative disease. We previously demonstrated that proSAAS, a small secreted neuronal protein, exhibits potent chaperone activity against protein aggregation in vitro and blocks the cytotoxic effects of amyloid and synuclein oligomers in cell culture systems. We now examine whether cytoplasmic expression of proSAAS results in interactions with protein aggregates in this cellular compartment. We report that expression of proSAAS within the cytoplasm generates dense, membraneless 2 μm proSAAS spheres which progressively fuse to form larger spheres, suggesting liquid droplet-like properties. ProSAAS spheres selectively accumulate a C-terminally truncated fluorescently tagged form of TDP-43, initiating its cellular redistribution; these TDP-43-containing spheres also exhibit dynamic fusion. Efficient encapsulation of TDP-43 into proSAAS spheres is driven by its C-terminal prion-like domain; spheres must be formed for sequestration to occur. Three proSAAS sequences, a predicted coiled-coil, a conserved region (residues 158-169), and the positively charged sequence 181-185, are all required for proSAAS to form spheres able to encapsulate TDP-43 aggregates. Substitution of lysines for arginines in the 181-185 sequence results in nuclear translocation of proSAAS and encapsulation of nuclear-localized TDP-43<sup>216-414</sup>. As a functional output, we demonstrate that proSAAS expression results in cytoprotection against full-length TDP-43 toxicity in yeast. We conclude that proSAAS can act as a functional holdase for TDP-43 via this phase-separation property, representing a cytoprotectant whose unusual biochemical properties can potentially be exploited in the design of therapeutic molecules.

Also flagged:EP4 receptoreicosanoidlipoxygenaseLOXcolorectal neoplasiaprostanoid synthases
Journal Article 2022-05-12 ✓ 5 Snippets Feddersen UR, Hendel SK, Berner-Hansen MA, Jepps TA, Berner-Hansen M, Bindslev N.
In-Text Gene Mentions

…prostaglandin I2 synthase (PTGIS) and the PGF…

…the expression ofPTGISwas significantly upregulated…

…We foundPTGISexpression to be…

…expression studies ofPTGIS/PGI 2 in CRC…

…no staining ofPTGISin normal tissue…

Show Full Abstract

<h4>Background</h4>Aberrations in cyclooxygenase and lipoxygenase (LOX) pathways in non-neoplastic, normal appearing mucosa from patients with colorectal neoplasia (CRN), could hypothetically qualify as predisposing CRN-markers.<h4>Methods</h4>To test this hypothesis, biopsies were obtained during colonoscopy from macroscopically normal colonic mucosa from patients with and without CRN. Prostaglandin E2 (PGE<sub>2</sub>) receptors, EP1-4, were examined in Ussing-chambers by exposing biopsies to selective EP receptor agonists, antagonists and PGE<sub>2</sub>. Furthermore, mRNA expression of EP receptors, prostanoid synthases and LOX enzymes were evaluated with qPCR.<h4>Results</h4>Data suggest that PGE<sub>2</sub> binds to both high and low affinity EP receptors. In particular, PGE<sub>2</sub> demonstrated EP4 receptor potency in the low nanomolar range. Similar results were detected using EP2 and EP4 agonists. In CRN patients, mRNA-levels were higher for EP1 and EP2 receptors and for enzymes prostaglandin-I synthase, 5-LOX, 12-LOX and 15-LOX.<h4>Conclusions</h4>In conclusion, normal appearing colonic mucosa from CRN patients demonstrates deviating expression in eicosanoid pathways, which might indicate a likely predisposition for early CRN development and furthermore that PGE<sub>2</sub> potently activates high affinity EP4 receptor subtypes, supporting relevance of testing EP4 antagonists in colorectal neoplasia management.

Also flagged:USP14ferroptosisdeathironInterleukin-6IL-6
Journal Article 2022-05-12 ✓ 1 Snippet Zhu G, Sui S, Shi F, Wang Q.
In-Text Gene Mentions

…in mice withhemochromatosis, IL-6/hepcidin signaling was…

Show Full Abstract

<h4>Background</h4>Ferroptosis, a novel manner of cell death depended on iron ion, contributed to goat mammary epithelial cell dysfunction. Interleukin-6 (IL-6) is a major pro-inflammatory factor during many inflammation-related diseases including mastitis, and a quite recently identified ferroptosis inducer. This study aims to explore the role of IL-6 in the dysfunction of goat mammary epithelial cells (GMECs) and how the level of IL-6 was regulated.<h4>Methods</h4>Primary GMECs were isolated, cultured and treated with lipopolysaccharide (LPS) alone or together with Ferrostatin-1 (Fer-1), a well-known ferroptosis inhibitor. CCK-8 was used to detect cell viability, ELISA was used to detect TNF-α content, and the levels of ROS, GSH and MDA were analyzed with DCFDA-cell ROS detection kit, GSH assay kit and MDA assay kit, respectively. The iron ion level was measured with an iron assay kit.<h4>Results</h4>The expression level of IL-6 protein in GMECs was up-regulated in response to LPS treatment, and the secretion of TNF-α, the cell oxidative stress level and the Fe<sup>2+</sup> ion content was robustly increased, which could be reversed by Fer-1 treatment. Knockdown of IL-6 decreased cell oxidative stress level and inhibited ferroptosis in LPS-treated GMECs. Further, ubiquitin experiment and co-immunoprecipitation assay showed that USP14 upregulated IL-6 protein expression by reducing the ubiquitination of IL-6, and overexpression of IL-6 reversed the inhibitory effect of USP14 shRNA on LPS-treated GMECs ferroptosis. The NRF2 inhibitor Brusatol reversed the inhibitory effect of IL-6 shRNA on LPS-treated ferroptosis.<h4>Conclusion</h4>IL-6 protein is deubiquitinated by USP14 and upregulated in LPS-treated GMECs, further promoting ferroptosis and inflammation through the NRF2 signaling pathway.

Also flagged:Peroxiredoxin 6curcuminacute lung injuryoxygenNF-κBP65
Journal Article 2022-05-12 ✓ 5 Snippets Li HT, Tan F, Zhang TH, Cao LH, Tan HY, Lin WQ, Zeng WA, Chi XJ.
In-Text Gene Mentions

Prdx6 mediated the protective function of curcumin by inhibiting the activation of the NF-κB pathway in ALI in vitro.

Pretreatment with curcumin restored Prdx6 downregulation and inhibited NF-κB pathway activation by suppressing the nuclear translocation of P65 and P50.

Similarly, Yang et al. found that deletion of Prdx6 exaggerated LPS-induced ALI with increased oxidative stress in vivo [19].

We further found that 40 μg/ml curcumin pretreatment could significantly alleviate OLV serum-induced inflammation and oxidative stress and was related to Prdx6 regulation.

The role of Prdx6 in the protective effects of curcumin pretreatment on serum from OLV patient-induced lung injury and its related mechanism

Show Full Abstract

<h4>Background</h4>Curcumin has attracted much attention due to its wide range of therapeutic effects. In this study, we used serum collected from patients undergoing one-lung ventilation (OLV) to establish an in vitro acute lung injury (ALI) model to explore the potential protective mechanism of curcumin on ALI. Our study provides a new reference for the prevention and treatment of ALI induced by OLV.<h4>Methods</h4>A549 cells were treated with 20% serum from patients undergoing OLV to establish an in vitro ALI model. Curcumin, at a dose of 40 μg/ml, was administered two hours prior to this model. The levels of inflammation and oxidative stress markers were observed by Western blot, qRT-PCR, ELISA and reactive oxygen species assay. Additionally, the expression of peroxiredoxin 6 (Prdx6) and proteins involved in the NF-κB signaling pathway was evaluated.<h4>Results</h4>Twenty percent of serum collected from patients undergoing OLV downregulated the expression of Prdx6, leading to the activation of the NF-κB signaling pathway, which was associated with the subsequent overproduction of inflammatory cytokines and reactive oxygen species. Pretreatment with curcumin restored Prdx6 downregulation and inhibited NF-κB pathway activation by suppressing the nuclear translocation of P65, eventually reducing inflammation and oxidative stress damage in A549 cells.<h4>Conclusions</h4>Prdx6 mediated the protective function of curcumin by inhibiting the activation of the NF-κB pathway in ALI in vitro.

Also flagged:extracellularvesiclesbronchopulmonary dysplasiaCD133phagocytosiscell proliferation
Journal Article 2022-05-12 No Snippets Zhu D, Krause M, Yawno T, Kusuma GD, Schwab R, Barabadi M, Maleken AS, Chan ST, Hunt R, Greening D, Wallace EM, Lim R.
Show Full Abstract

<h4>Background and rationale</h4>Extracellular vesicles (EVs) are a potential cell-free regenerative medicine. Human amniotic epithelial cells (hAECs) are a viable source of cell therapy for diseases like bronchopulmonary dysplasia (BPD). However, little is known about the impact of gestational age of the donor on the quality of hAEC-derived EVs.<h4>Aims</h4>To determine the impact of gestational age on hAEC-derived EVs in experimental BPD.<h4>Results</h4>Term hAEC-derived EVs displayed a significantly higher density of surface epitopes (CD142 and CD133) and induced greater macrophage phagocytosis compared to preterm hAEC-EVs. However, T cell proliferation was more significantly suppressed by preterm hAEC-EVs. Using a model of experimental BPD, we observed that term but not preterm hAEC-EVs improved tissue-to-airspace ratio and septal crest density. While both term and preterm hAEC-EVs reduced the levels of inflammatory cytokines on postnatal day 7, the improvement in lung injury was associated with increased type II alveolar cells which was only observed in term hAEC-EV treatment group. Furthermore, only neonatal term hAEC-EVs reduced airway hyper-responsiveness, mitigated pulmonary hypertension and protected against right ventricular hypertrophy at 6 weeks of age.<h4>Conclusion</h4>Term hAEC-EVs, but not preterm hAEC-EVs, have therapeutic efficacy in a mouse model of BPD-like lung injury. Therefore, the impact of donor criteria should be considered when applying perinatal cells-derived EV therapy for clinical use.

Also flagged:GDE2Amyotrophic lateral sclerosisALSneurodegenerative diseasepathogenesisGlycerophosphodiester phosphodiesterase 2
Journal Article 2022-05-12 No Snippets Westerhaus A, Joseph T, Meyers AJ, Jang Y, Na CH, Cave C, Sockanathan S.
Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease that affects the viability of upper and lower motor neurons. Current options for treatment are limited, necessitating deeper understanding of the mechanisms underlying ALS pathogenesis. Glycerophosphodiester phosphodiesterase 2 (GDE2 or GDPD5) is a six-transmembrane protein that acts on the cell surface to cleave the glycosylphosphatidylinositol (GPI)-anchor that tethers some proteins to the membrane. GDE2 is required for the survival of spinal motor neurons but whether GDE2 neuroprotective activity is disrupted in ALS is not known. We utilized a combination of mouse models and patient post-mortem samples to evaluate GDE2 functionality in ALS. Haplogenetic reduction of GDE2 exacerbated motor neuron degeneration and loss in SOD1<sup>G93A</sup> mice but not in control SOD1<sup>WT</sup> transgenic animals, indicating that GDE2 neuroprotective function is diminished in the context of SOD1<sup>G93A</sup>. In tissue samples from patients with ALS, total levels of GDE2 protein were equivalent to healthy controls; however, membrane levels of GDE2 were substantially reduced. Indeed, GDE2 was found to aberrantly accumulate in intracellular compartments of ALS motor cortex, consistent with a disruption of GDE2 function at the cell surface. Supporting the impairment of GDE2 activity in ALS, tandem-mass-tag mass spectrometry revealed a pronounced reduction of GPI-anchored proteins released into the CSF of patients with ALS compared with control patients. Taken together, this study provides cellular and biochemical evidence that GDE2 distribution and activity is disrupted in ALS, supporting the notion that the failure of GDE2-dependent neuroprotective pathways contributes to neurodegeneration and motor neuron loss in disease. These observations highlight the dysregulation of GPI-anchored protein pathways as candidate mediators of disease onset and progression and accordingly, provide new insight into the mechanisms underlying ALS pathogenesis.

Also flagged:persistent atrial fibrillationcognitive impairmentdepressionatrial fibrillationAFoxyhemoglobin
Journal Article 2022-05-12 No Snippets Yoshihisa A, Kono S, Kaneshiro T, Ichijo Y, Misaka T, Yamada S, Oikawa M, Miura I, Yabe H, Takeishi Y.
Show Full Abstract

Although the prevalence of cognitive impairment and depression is higher in patients with atrial fibrillation (AF) than in the general population, the mechanism has not been fully examined and impact of catheter ablation (CA) of AF also remains unclear. Recently, the development of near-infrared spectroscopy (NIRS) has enabled noninvasive measurements of regional cerebral blood volume and brain activity, in terms of cerebral oxyhemoglobin in the cerebral cortex. We assessed brain activities by NIRS, depressive symptoms by the Center for Epidemiologic Studies Depression Scale (CES-D) and cognitive function by Mini-Mental State Examination (MMSE). We then compared the results between AF patients (paroxysmal AF n = 18 and persistent AF n = 14) and control subjects (n = 29). Next, we also followed up persistent AF patients who kept sinus rhythm at 3 months after CA (n = 8) and measured their brain activities using NIRS, CES-D and MMSE after CA to investigate the associations of changes in brain activities with changes in both CES-D and MMSE. Our results showed that (1) frontal and temporal brain activities were lower in patients with persistent AF than both in control subjects and paroxysmal AF patients (P < 0.01), (2) frontal and temporal brain activities were improved in more than half of the persistent AF patients who kept sinus rhythm at 3 months after CA, especially in those who presented impaired brain activity before CA, and (3) improvement of frontal brain activity was associated with improvement of CES-D (R =  - 0.793, P = 0.019), whereas improvement of temporal brain activity was associated with improvement of MMSE (R = 0.749, P = 0.033). NIRS measurement showed reduced frontal and temporal brain activities in the persistent AF patients, CA improved frontal and temporal brain activities in some of these patients, and associated with improvement of depressive state and/or improvement of cognitive function.

Also flagged:UBR5tumorCDC73HECTE3 ubiquitin ligasebreast cancers
Journal Article 2022-05-12 ✓ 2 Snippets Xiang G, Wang S, Chen L, Chen L, Song M, Song X, Wang H, Zhou P, Ma X, Yu J.
In-Text Gene Mentions

…with costimulatory moleculesTNFSF4, TNFSF18 ,…

…of costimulatory moleculesTNFSF4, TNFSF18 ,…

Show Full Abstract

UBR5, a HECT-domain E3 ubiquitin ligase, is an attractive therapeutic target for aggressive breast cancers. Defining the substrates of UBR5 is crucial for scientific understanding and clinical intervention. Here, we demonstrate that CDC73, a component of the RNA polymerase II-associated factor 1 complex, is a key substrate that impedes UBR5's profound tumorigenic and metastatic activities in triple-negative breast cancer (TNBC) via mechanisms of regulating the expression of β-catenin and E-cadherin, tumor cell apoptosis and CD8<sup>+</sup> T cell infiltration. Expression of CDC73 is also negatively associated with the progression of breast cancer patients. Moreover, we show that UBR5 destabilizes CDC73 by polyubiquitination at Lys<sup>243</sup>, Lys<sup>247</sup>, and Lys<sup>257</sup> in a non-canonical manner that is dependent on the non-phosphorylation state of CDC73 at Ser<sup>465</sup>. CDC73 could serve as a molecular switch to modulate UBR5's pro-tumor activities and may provide a potential approach to developing breast cancer therapeutic interventions.

Also flagged:membranesynapsessynaptic vesiclescalciumvoltage-gated calcium channelsaxons
Journal Article 2022-05-12 No Snippets Jen HI, Singh S, Tao L, Maunsell HR, Segil N, Groves AK.
Show Full Abstract

GFI1 is a zinc finger transcription factor that is necessary for the differentiation and survival of hair cells in the cochlea. Deletion of Gfi1 in mice significantly reduces the expression of hundreds of hair cell genes: this is a surprising result, as GFI1 normally acts as a transcriptional repressor by recruiting histone demethylases and methyltransferases to its targets. To understand the mechanisms by which GFI1 promotes hair cell differentiation, we used CUT&RUN to identify the direct targets of GFI1 and ATOH1 in hair cells. We found that GFI1 regulates hair cell differentiation in two distinct ways-first, GFI1 and ATOH1 can bind to the same regulatory elements in hair cell genes, but while ATOH1 directly binds its target DNA motifs in many of these regions, GFI1 does not. Instead, it appears to enhance ATOH1's transcriptional activity by acting as part of a complex in which it does not directly bind DNA. Second, GFI1 can act in its more typical role as a direct, DNA-binding transcriptional repressor in hair cells; here it represses non-hair cell genes, including many neuronal genes. Together, our results illuminate the function of GFI1 in hair cell development and hair cell reprogramming strategies.

Also flagged:antibodyantibodiesviremiaglycanCD4binding
Journal Article 2022-05-12 No Snippets Julg B, Stephenson KE, Wagh K, Tan SC, Zash R, Walsh S, Ansel J, Kanjilal D, Nkolola J, Walker-Sperling VEK, Ophel J, Yanosick K, Borducchi EN, Maxfield L, Abbink P, Peter L, Yates NL, Wesley MS, Hassell T, Gelderblom HC, deCamp A, Mayer BT, Sato A, Gerber MW, Giorgi EE, Gama L, Koup RA, Mascola JR, Monczor A, Lupo S, Rolle CP, Arduino R, DeJesus E, Tomaras GD, Seaman MS, Korber B, Barouch DH.
Show Full Abstract

HIV-1 therapy with single or dual broadly neutralizing antibodies (bNAbs) has shown viral escape, indicating that at least a triple bNAb therapy may be needed for robust suppression of viremia. We performed a two-part study consisting of a single-center, randomized, double-blind, dose-escalation, placebo-controlled first-in-human trial of the HIV-1 V2-glycan-specific antibody PGDM1400 alone or in combination with the V3-glycan-specific antibody PGT121 in 24 adults without HIV in part 1, as well as a multi-center, open-label trial of the combination of PGDM1400, PGT121 and the CD4-binding-site antibody VRC07-523LS in five viremic adults living with HIV not on antiretroviral therapy (ART) in part 2 ( NCT03205917 ). The primary endpoints were safety, tolerability and pharmacokinetics for both parts and antiviral activity among viremic adults living with HIV and not on ART for part 2 of the study. The secondary endpoints were changes in CD4<sup>+</sup> T cell counts and development of HIV-1 sequence variations associated with PGDM1400, PGT121 and VRC07-523LS resistance in part 2. Intravenously administered PGDM1400 was safe and well-tolerated at doses up to 30 mg kg<sup>-1</sup> and when given in combination with PGT121 and VRC07-523LS. A single intravenous infusion of 20 mg kg<sup>-1</sup> of each of the three antibodies reduced plasma HIV RNA levels in viremic individuals by a maximum mean of 2.04 log<sub>10</sub> copies per ml; however, viral rebound occurred in all participants within a median of 20 days after nadir. Rebound viruses demonstrated partial to complete resistance to PGDM1400 and PGT121 in vitro, whereas susceptibility to VRC07-523LS was preserved. Viral rebound occurred despite mean VRC07-523LS serum concentrations of 93 µg ml<sup>-1</sup>. The trial met the pre-specified endpoints. Our data suggest that future bNAb combinations likely need to achieve broad antiviral activity, while also maintaining high serum concentrations, to mediate viral control.

Also flagged:glucosediabetesnephropathyretinopathyneuropathycalmodulin
Journal Article 2022-05-12 No Snippets Benchoula K, Mediani A, Hwa WE.
Show Full Abstract

The increase in blood glucose causes a myriad of pathways and molecular components to malfunction, leading to diabetes. Diabetes affects each organ differently by activating distinct pathways. It has an impact on the liver, pancreas, kidney (nephropathy), eyes (retinopathy), and nervous system (neuropathy). Understanding the effects of diabetes on each organ is the first step in developing a sustained treatment for the disease. Among the many cellular molecules impacted by diabetes is Ca<sup>2+</sup>/calmodulin-dependent protein kinase II (CaMKII), a complex Ca<sup>2+</sup>/calmodulin-activated serine/threonine-protein kinase. When intracellular [Ca<sup>2+</sup>] rises, it binds to calmodulin (CaM) to produce Ca<sup>2+</sup>/CaM, which activates CaMKIIs. This factor is involved in the pancreas, liver, heart, muscles, and various organs. Thus, Understanding CaMKII action in each organ is critical for gaining a complete picture of diabetic complications. Therefore, this review covers CaMKII's functions in many organs and how it affects and has been affected by diabetes.

Also flagged:septic shocksepsisnorepinephrinelactatevWFAT-III
Journal Article 2022-05-12 ✓ 1 Snippet Stahl K, Wand P, Seeliger B, Wendel-Garcia PD, Schmidt JJ, Schmidt BMW, Sauer A, Lehmann F, Budde U, Busch M, Wiesner O, Welte T, Haller H, Wedemeyer H, Putensen C, Hoeper MM, Bode C, David S.
In-Text Gene Mentions

…of procalcitonine (PCT),antithrombin-III(AT-III), protein C,…

Show Full Abstract

<h4>Background</h4>Recently, a randomized controlled trial (RCT) demonstrated rapid but individually variable hemodynamic improvement with therapeutic plasma exchange (TPE) in patients with septic shock. Prediction of clinical efficacy in specific sepsis treatments is fundamental for individualized sepsis therapy.<h4>Methods</h4>In the original RCT, patients with septic shock of < 24 h duration and norepinephrine (NE) requirement ≥ 0.4 μg/kg/min received standard of care (SOC) or SOC + one single TPE. Here, we report all clinical and biological endpoints of this study. Multivariate mixed-effects modeling of NE reduction was performed to investigate characteristics that could be associated with clinical response to TPE.<h4>Results</h4>A continuous effect of TPE on the reduction in NE doses over the initial 24 h was observed (SOC group: estimated NE dose reduction of 0.005 µg/kg/min per hour; TPE group: 0.018 µg/kg/min per hour, p = 0.004). Similarly, under TPE, serum lactate levels, continuously decreased over the initial 24 h in the TPE group, whereas lactate levels increased under SOC (p = 0.001). A reduction in biomarkers and disease mediators (such as PCT (p = 0.037), vWF:Ag (p < 0.001), Angpt-2 (p = 0.009), sTie-2 (p = 0.005)) along with a repletion of exhausted protective factors (such as AT-III (p = 0.026), Protein C (p = 0.012), ADAMTS-13 (p = 0.008)) could be observed in the TPE but not in the SOC group. In a multivariate mixed effects model, increasing baseline lactate levels led to greater NE dose reduction effects with TPE as opposed to SOC (p = 0.004).<h4>Conclusions</h4>Adjunctive TPE is associated with the removal of injurious mediators and repletion of consumed protective factors altogether leading to preserved hemodynamic stabilization in refractory septic shock. We identified that baseline lactate concentration as a potential response predictor might guide future designing of large RCTs that will further evaluate TPE with regard to hard endpoints. Trial registration Retrospectively registered 18th January 2020 at clinicaltrials.gov (Identifier: NCT04231994 ).

Also flagged:tumorscancercell cycletranslationalcancersneuroblastoma
Journal Article 2022-05-12 No Snippets Yin X, Lin H, Lin L, Miao L, He J, Zhuo Z.
Show Full Abstract

It is well known that noncoding RNAs (ncRNAs) cannot encode proteins, but they can play important regulatory roles in tumors by combining with proteins, RNAs, and DNAs. As more and more studies reveal the important roles and underlying mechanisms of long noncoding RNAs (lncRNAs) and circular RNAs (circRNAs) in cancer, their huge application potential in cancer therapy cannot be ignored. For example, lncRNAs can be involved in tumor-related signal transduction pathways, cell cycle control, DNA damage, epigenetic regulation, and microRNA control. A group of studies confirmed that abnormal expression of lncRNAs can affect cancer progression. Furthermore, as covalently closed continuous circular ncRNAs, many recent studies have shown that circRNAs have regulatory effects and other important biological significances in cancer. Interestingly, circRNAs were found to have translational functions. This has greatly attracted people's attention to circRNAs research. In this review, we introduce the important roles of lncRNAs and circRNAs in some representative cancers, respectively. Furthermore, we focus on the biological functions and important clinical therapeutic implications of lnRNAs and circRNAs in neuroblastoma. Our review also focuses on providing rationale and relevant references for novel biomarkers for neuroblastoma diagnosis, prognosis, and treatment.

Also flagged:GlutathioneMetabolismFerroptosisOsteoporosisNeurological disordersosteoblast differentiation
Journal Article 2022-05-12 No Snippets Wang Y, Jia Y, Xu Y, Liu X, Wang Z, Liu Y, Li B, Liu J.
Show Full Abstract

Disused osteoporosis is a kind of osteoporosis, a common age-related disease. Neurological disorders are major risk factors for osteoporosis. Though there are many studies on disuse osteoporosis, the genetic mechanisms for the association between glutathione metabolism and ferroptosis in osteoblasts with disuse osteoporosis are still unclear. The purpose of this study is to explore the key genes and other related mechanism of ferroptosis and glutathione metabolism in osteoblast differentiation and disuse osteoporosis. By weighted gene coexpression network analysis (WGCNA), the process of osteoblast differentiation-related genes was studied in GSE30393. And the related functional pathways were found through the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. By combining GSE1367 and GSE100933 together, key genes which were separately bound up with glutathione metabolism and ferroptosis were located. The correlation of these key genes was analyzed by the Pearson correlation coefficient. GSTM1 targeted agonist glutathione (GSH) selected by connectivity map (CMap) analysis was used to interfere with the molding disused osteoporosis process in MC3T3-E1 cells. RT-PCR and intracellular reactive oxygen species (ROS) were performed. Two important pathways, glutathione metabolism and ferroptosis pathways, were found. GSTM1 and TFRC were thought as key genes in disuse osteoporosis osteoblasts with the two mechanisms. The two genes have a strong negative correlation. Our experiment results showed that the expression of TFRC was consistent with the negative correlation with the activation process of GSTM1. The strong relationship between the two genes was proved. Glutathione metabolism and ferroptosis are important in the normal differentiation of osteoblasts and the process of disuse osteoporosis. GSTM1 and TFRC were the key genes. The two genes interact with each other, which can be seen as a bridge between the two pathways. The two genes participate in the process of reducing ROS in disuse osteoporosis osteoblasts.

Also flagged:thioterpenebindingbutanoic acidmembraneconjugationthioterpenoid
Journal Article 2022-05-12 No Snippets Guseva GB, Antina EV, Berezin MB, Smirnova AS, Pavelyev RS, Gilfanov IR, Shevchenko OG, Pestova SV, Izmest'ev ES, Rubtsova SA, Ostolopovskaya OV, Efimov SV, Klochkov VV, Rakhmatullin IZ, Timerova AF, Khodov IA, Lodochnikova OA, Islamov DR, Dorovatovskii PV, Nikitina LE, Boichuk SV.
Show Full Abstract

This paper presents the design and a comparative analysis of the structural and solvation factors on the spectral and biological properties of the BODIPY biomarker with a thioterpene fragment. Covalent binding of the thioterpene moiety to the butanoic acid residue of <i>meso</i>-substituted BODIPY was carried out to find out the membranotropic effect of conjugate to erythrocytes, and to assess the possibilities of its practical application in bioimaging. The molecular structure of the conjugate was confirmed via <i>X</i>-ray, UV/vis-, NMR-, and MS-spectra. It was found that dye demonstrates high photostability and high fluorescence quantum yield (to ~100%) at 514-519 nm. In addition, the marker was shown to effectively penetrate the erythrocytes membrane in the absence of erythrotoxicity. The conjugation of BODIPY with thioterpenoid is an excellent way to increase affinity dyes to biostructures, including blood components.

Also flagged:Coagulationdeathsepsisdisseminated intravascular coagulationhypercoagulabilitydysfunction
Journal Article 2022-05-12 ✓ 1 Snippet Zhang TN, Ba T, Li F, Chen Q, Chen ZP, Zhou B, Yan ZQ, Li Q, Cao SJ, Wang LF.
In-Text Gene Mentions

…group, and FIB,ATIII, and PLT were…

Show Full Abstract

<h4>Background</h4>Research on coagulation dysfunction following burns is controversial. This study aimed to describe the coagulation changes in severe burn patients by examining coagulation parameters.<h4>Methods</h4>Patients with third-degree total body surface area (TBSA) burns of ≥30% were enrolled between 2017 and 2020. Platelet (PLT) count and coagulation indexes (including APTT, INR, FIB, DD, and AT Ⅲ) were measured at admission and once weekly for 8 weeks, and statistical analysis was performed. The patient medical profiles were reviewed to extract demographic and clinical data, including TBSA, third-degree TBSA, and inhalation injury. The total intravenous fluids and transfusions of crystalloids, fresh frozen plasma (FFP), and red blood cells (RBC) were calculated during the forty-eight-hour period. The number of sepsis cases was recorded.<h4>Results</h4>We enrolled 104 patients , and while the overall coagulation trend fluctuated, inflection points appeared around one week and demonstrated hypercoagulability. INR was significantly higher in the non-survival group than in the survivors' group from admission to three weeks after burn (all p<0.01). From post-injury week 1 to post-injury week 3, the APTT in the non-survival group was greater than in the survival group, but the non-survival group's PLT count was lower than that in the survival group (all p<0.05). At two and three weeks after burns, the FIB levels in the non-survival group were significantly lower than those of the survival group (both p<0.01). The prevalence of inhalation injury and the proportion of sepsis cases were significantly higher in the non-survival group than in the survival group ( p < 0.05, p < 0.001, respectively). At the time of death, APTT, INR, and FDP levels were significantly higher in the non-survival group in the survivor group, and FIB, ATIII, and PLT were significantly lower than in the survivor group (all p<0.01). On the day of death, nine of the 12 dead patients had disseminated intravascular coagulation (DIC).<h4>Conclusions</h4>Coagulation dysfunction was most prominent in severe burn patients 1 week after injury and presented as hypercoagulability. Large-area burn injury, large amounts of fluid resuscitation, inhalation injury, and sepsis may all contribute to coagulation dysfunction, which can further develop into DIC and even death in severe burns patients.

Also flagged:odontogenesismineralwaterDentinmineralizationcollagen
Journal Article 2022-05-12 ✓ 4 Snippets Simmer JP, Zhang H, Moon SJH, Donnelly LA, Lee YL, Seymen F, Koruyucu M, Chan HC, Lee KY, Wu S, Hsiang CL, Tsai ATP, Slayton RL, Morrow M, Wang SK, Shields ED, Hu JC.
In-Text Gene Mentions

…Shields recognizedDGI-IIIas “a distinct…

…DD-II, DGI-II, andDGI-IIIare all autosomal…

…alteration that causedDGI-IIIin the Brandywine…

…the prototype forDGI-III, and was shown…

Show Full Abstract

Mutations in Dentin Sialophosphoprotein (DSPP) are known to cause, in order of increasing severity, dentin dysplasia type-II (DD-II), dentinogenesis imperfecta type-II (DGI-II), and dentinogenesis imperfecta type-III (DGI-III). DSPP mutations fall into two groups: a 5′-group that affects protein targeting and a 3′-group that shifts translation into the −1 reading frame. Using whole-exome sequence (WES) analyses and Single Molecule Real-Time (SMRT) sequencing, we identified disease-causing DSPP mutations in 12 families. Three of the mutations are novel: c.53T>C/p.(Val18Ala); c.3461delG/p.(Ser1154Metfs*160); and c.3700delA/p.(Ser1234Alafs*80). We propose genetic analysis start with WES analysis of proband DNA to identify mutations in COL1A1 and COL1A2 causing dominant forms of osteogenesis imperfecta, 5′-DSPP mutations, and 3′-DSPP frameshifts near the margins of the DSPP repeat region, and SMRT sequencing when the disease-causing mutation is not identified. After reviewing the literature and incorporating new information showing distinct differences in the cell pathology observed between knockin mice with 5′-Dspp or 3′-Dspp mutations, we propose a modified Shields Classification based upon the causative mutation rather than phenotypic severity such that patients identified with 5′-DSPP defects be diagnosed as DGI-III, while those with 3′-DSPP defects be diagnosed as DGI-II.

Also flagged:T cell receptorinfectious diseaseschromosomechromosomesinfectious animal diseasemating
Journal Article 2022-05-12 No Snippets Adeniyi OO, Simon R, Bytyqi H, Kugler W, Mehmeti H, Berisha K, Simčič M, Magdy M, Lühken G.
Show Full Abstract

There is a growing concern about the loss of animal genetic resources. The aim of this study was to analyze the genetic diversity and potential peculiarity of the endangered Kosovar sheep breed Balusha. For this purpose, a dataset consisting of medium-density SNP chip genotypes (39,879 SNPs) from 45 Balusha sheep was generated and compared with SNP chip genotypes from 29 individuals of a second Kosovar breed, Bardhoka. Publicly available SNP genotypes from 39 individuals of the relatively closely located sheep breeds Istrian Pramenka and Ruda were additionally included in the analyses. Analysis of heterozygosity, allelic richness and effective population size was used to assess the genetic diversity. Inbreeding was evaluated using two different methods (<i>F<sub>IS</sub></i>, <i>F<sub>ROH</sub></i>). The standardized <i>F<sub>ST</sub></i> (<i>d<sub>i</sub></i>) and cross-population extended haplotype homozygosity (XPEHH) methods were used to detect signatures of selection. We observed the lowest heterozygosity (<i>H<sub>O</sub></i> = 0.351) and effective population size (Ne<sub>5</sub> = 25, Ne<sub>50</sub> = 228) for the Balusha breed. The mean allelic richness levels (1.780-1.876) across all analyzed breeds were similar and also comparable with those in worldwide breeds. <i>F<sub>ROH</sub></i> estimates (0.023-0.077) were highest for the Balusha population, although evidence of decreased inbreeding was observed in <i>F<sub>IS</sub></i> results for the Balusha breed. Two Gene Ontology (GO) TERMs were strongly enriched for Balusha, and involved genes belonging to the melanogenesis and T cell receptor signaling pathways, respectively. This could result from selection for the special coat color pattern of Balusha (black head) and resistance to certain infectious diseases. The analyzed diversity parameters highlight the urgency to preserve the local Kosovar Balusha sheep as it is clearly distinguished from other sheep of Southeastern Europe, has the lowest diversity level and may harbor valuable genetic variants, e.g., for resistance to infectious diseases.

Also flagged:erythropoietin receptorangiotensin-1 converting enzymeACE IACEACTN3MCT1
Journal Article 2022-05-12 ✓ 5 Snippets Dzitkowska-Zabielska M, Bojarczuk A, Borczyk M, Piechota M, Korostyński M, Adamczyk JG, Trybek G, Massidda M, Cięszczyk P.
In-Text Gene Mentions

HFE encodes a homeostatic iron regulator that regulates iron, and thus is linked to hemochromatosis [18].

…, MYBPC3 andHFEgenes.…

HFEencodes a homeostatic…

…is linked tohemochromatosis[ 18 ].…

…Carriers ofHFEpolymorphisms have reduced…

Show Full Abstract

<h4>Background</h4>To date, nearly 300 genetic markers were linked to endurance and power/strength traits. The current study aimed to compare genotype distributions and allele frequencies of the common polymorphisms: <i>MCT1</i> rs1049434, <i>NRF2</i> rs12594956, <i>MYBPC3</i> rs1052373 and <i>HFE</i> rs1799945 in Polish elite athletes versus nonathletes.<h4>Methods</h4>The study involved 101 male elite Polish athletes and 41 healthy individuals from the Polish population as a control group. SNP data were extracted from whole-genome sequencing (WGS) performed using the following parameters: paired reads of 150 bps, at least 90 Gb of data per sample with 300 M reads and 30× mean coverage.<h4>Results</h4>All the analyzed polymorphisms conformed to Hardy-Weinberg equilibrium (HWE) in athletes and the control group, except the <i>MCT1</i> rs1049434, where allele T was over-represented in the elite trainers' group. No significant between-group differences were found for analyzed polymorphisms.<h4>Conclusions</h4>The <i>MCT1</i> rs1049434 transmission distortion might be characteristic of Polish athletes and the effect of strict inclusion criteria. This result and the lack of statistically significant changes in the frequency of other polymorphisms between the groups might result from the small group size.

Also flagged:neurodegenerative disorderHDHuntingtinvesiclecell divisionautophagy
Journal Article 2022-05-12 ✓ 5 Snippets Martí-Martínez S, Valor LM.
In-Text Gene Mentions

Huntington’s disease (HD) is a devastating neurodegenerative disorder that is caused by an abnormal expansion of CAG repeats in the Huntingtin (HTT) gene.

Noticeably, a small proportion of patients (<0.2%) affected by either FTD or ALS conditions also showed CAG expansions in the HTT gene in the pathological range in the absence of HD-associated striatal atrophy, suggesting a potential etiopathological relationship between HTT mutation and other degenerative disorders [66].

Saliva also contained increased levels of total HTT protein in HD patients compared to healthy controls, which significantly correlated with clinical outcomes measured using the UHDRS and total functional capacity (TFC) [143].

With an estimated prevalence of 1–15 cases per 100,000 inhabitants [1], Huntington’s disease (HD) (OMIM #143100) is a monogenic neurodegenerative disorder that similarly affects both sexes and is caused by an abnormal expansion of CAG repeats in the first exon of the Huntingtin (HTT) gene.

…the Huntingtin (HTT) gene.…

Show Full Abstract

Huntington's disease (HD) is a devastating neurodegenerative disorder that is caused by an abnormal expansion of CAG repeats in the Huntingtin (<i>HTT</i>) gene. Although the main symptomatology is explained by alterations at the level of the central nervous system, predominantly affecting the basal ganglia, a peripheral component of the disease is being increasingly acknowledged. Therefore, the manifestation of the disease is complex and variable among CAG expansion carriers, introducing uncertainty in the appearance of specific signs, age of onset and severity of disease. The monogenic nature of the disorder allows a precise diagnosis, but the use of biomarkers with prognostic value is still needed to achieve clinical management of the patients in an individual manner. In addition, we need tools to evaluate the patient's response to potential therapeutic approaches. In this review, we provide a succinct summary of the most interesting molecular biomarkers that have been assessed in patients, mostly obtained from body fluids such as cerebrospinal fluid, peripheral blood and saliva.

Also flagged:Gestational Diabetes Mellitusstillbirthdiabetesobesitycoagulationhypertensive disorders
Journal Article 2022-05-12 ✓ 1 Snippet Sriboonvorakul N, Hu J, Boriboonhirunsarn D, Ng LL, Tan BK.
In-Text Gene Mentions

…SPP24, SHBG,Antithrombin-IIIand SAP were…

Show Full Abstract

Gestational Diabetes Mellitus (GDM) is the most common metabolic complication during pregnancy and is associated with serious maternal and fetal complications such as pre-eclampsia and stillbirth. Further, women with GDM have approximately 10 times higher risk of diabetes later in life. Children born to mothers with GDM also face a higher risk of childhood obesity and diabetes later in life. Early prediction/diagnosis of GDM leads to early interventions such as diet and lifestyle, which could mitigate the maternal and fetal complications associated with GDM. However, no biomarkers identified to date have been proven to be effective in the prediction/diagnosis of GDM. Proteomic approaches based on mass spectrometry have been applied in various fields of biomedical research to identify novel biomarkers. Although a number of proteomic studies in GDM now exist, a lack of a comprehensive and up-to-date meta-analysis makes it difficult for researchers to interpret the data in the existing literature. Thus, we undertook a systematic review and meta-analysis on proteomic studies and GDM. We searched MEDLINE, EMBASE, Web of Science and Scopus from inception to January 2022. We searched Medline, Embase, CINHAL and the Cochrane Library, which were searched from inception to February 2021. We included cohort, case-control and observational studies reporting original data investigating the development of GDM compared to a control group. Two independent reviewers selected eligible studies for meta-analysis. Data collection and analyses were performed by two independent reviewers. The PROSPERO registration number is CRD42020185951. Of 120 articles retrieved, 24 studies met the eligibility criteria, comparing a total of 1779 pregnant women (904 GDM and 875 controls). A total of 262 GDM candidate biomarkers (CBs) were identified, with 49 CBs reported in at least two studies. We found 22 highly replicable CBs that were significantly different (nine CBs were upregulated and 12 CBs downregulated) between women with GDM and controls across various proteomic platforms, sample types, blood fractions and time of blood collection and continents. We performed further analyses on blood (plasma/serum) CBs in early pregnancy (first and/or early second trimester) and included studies with more than nine samples (nine studies in total). We found that 11 CBs were significantly upregulated, and 13 CBs significantly downregulated in women with GDM compared to controls. Subsequent pathway analysis using Database for Annotation, Visualization and Integrated Discovery (DAVID) bioinformatics resources found that these CBs were most strongly linked to pathways related to complement and coagulation cascades. Our findings provide important insights and form a strong foundation for future validation studies to establish reliable biomarkers for GDM.

Also flagged:Neuromuscular DisordersNeuromuscular diseasesinherited neuromuscular disordermuscular dystrophiesmyopathiesperipheral nerve diseases
Journal Article 2022-05-12 No Snippets Barbosa-Gouveia S, Vázquez-Mosquera ME, González-Vioque E, Hermida-Ameijeiras Á, Sánchez-Pintos P, de Castro MJ, León SR, Gil-Fournier B, Domínguez-González C, Camacho Salas A, Negrão L, Fineza I, Laranjeira F, Couce ML.
Show Full Abstract

Neuromuscular diseases are genetically highly heterogeneous, and differential diagnosis can be challenging. Over a 3-year period, we prospectively analyzed 268 pediatric and adult patients with a suspected diagnosis of inherited neuromuscular disorder (INMD) using comprehensive gene-panel analysis and next-generation sequencing. The rate of diagnosis increased exponentially with the addition of genes to successive versions of the INMD panel, from 31% for the first iteration (278 genes) to 40% for the last (324 genes). The global mean diagnostic rate was 36% (97/268 patients), with a diagnostic turnaround time of 4-6 weeks. Most diagnoses corresponded to muscular dystrophies/myopathies (68.37%) and peripheral nerve diseases (22.45%). The most common causative genes, <i>TTN</i>, <i>RYR1</i>, and <i>ANO5</i>, accounted for almost 30% of the diagnosed cases. Finally, we evaluated the utility of the differential diagnosis tool Phenomizer, which established a correlation between the phenotype and molecular findings in 21% of the diagnosed patients. In summary, comprehensive gene-panel analysis of all genes implicated in neuromuscular diseases facilitates a rapid diagnosis and provides a high diagnostic yield.

Also flagged:Deadenylasetranslationaldegradationgene expressiondeadenylasescancer
Journal Article 2022-05-12 ✓ 1 Snippet Kyritsis A, Papanastasi E, Kokkori I, Maragozidis P, Chatzileontiadou DSM, Pallaki P, Labrou M, Zarogiannis SG, Chrousos GP, Vlachakis D, Gourgoulianis KI, Balatsos NAA.
In-Text Gene Mentions

…HS6ST3, TM4SF20, andPLCL1from the downregulated…

Show Full Abstract

The poly(A) tail at the 3' end of mRNAs determines their stability, translational efficiency, and fate. The shortening of the poly(A) tail, and its efficient removal, triggers the degradation of mRNAs, thus, regulating gene expression. The process is catalyzed by a family of enzymes, known as deadenylases. As the dysregulation of gene expression is a hallmark of cancer, understanding the role of deadenylases has gained additional interest. Herein, the genetic association network shows that CNOT6 and CNOT7 are the most prevalent and most interconnected nodes in the equilibrated diagram. Subsequent silencing and transcriptomic analysis identifies transcripts possibly regulated by specific deadenylases. Furthermore, several gene ontologies are enriched by common deregulated genes. Given the potential concerted action and overlapping functions of deadenylases, we examined the effect of silencing a deadenylase on the remaining ones. Our results suggest that specific deadenylases target unique subsets of mRNAs, whilst at the same time, multiple deadenylases may affect the same mRNAs with overlapping functions.

Also flagged:Innate immunityinfectionimmune responsepattern recognition receptorsIFNinterferon regulatory transcription factors
Journal Article 2022-05-12 No Snippets Wang H, Li W, Zheng SJ.
Show Full Abstract

Innate immunity is not only the first line of host defense against pathogenic infection, but also the cornerstone of adaptive immune response. Upon pathogenic infection, pattern recognition receptors (PRRs) of host engage pathogen-associated molecular patterns (PAMPs) of pathogens, which initiates IFN production by activating interferon regulatory transcription factors (IRFs), nuclear factor-kappa B (NF-κB), and/or activating protein-1 (AP-1) signal transduction pathways in host cells. In order to replicate and survive, pathogens have evolved multiple strategies to evade host innate immune responses, including IFN-I signal transduction, autophagy, apoptosis, necrosis, inflammasome and/or metabolic pathways. Some avian viruses may not be highly pathogenic but they have evolved varied strategies to evade or suppress host immune response for survival, causing huge impacts on the poultry industry worldwide. In this review, we focus on the advances on innate immune evasion by several important avian immunosuppressive viruses (infectious bursal disease virus (IBDV), Marek's disease virus (MDV), avian leukosis virus (ALV), etc.), especially their evasion of PRRs-mediated signal transduction pathways (IFN-I signal transduction pathway) and IFNAR-JAK-STAT signal pathways. A comprehensive understanding of the mechanism by which avian viruses evade or suppress host immune responses will be of help to the development of novel vaccines and therapeutic reagents for the prevention and control of infectious diseases in chickens.

Also flagged:gene expressionBimPtenGadd45aB cell receptorsBCR
Journal Article 2022-05-12 ✓ 5 Snippets Ma F, Zhan Y, Bartolomé-Cabrero R, Ying W, Asano M, Huang Z, Xiao C, González-Martín A.
In-Text Gene Mentions

B4galt5fl/+ mice were…

…to obtain Mb1Cre;B4galt5fl/fl mice.…

…note, knockdown ofB4galt5, Phip and…

…transduced with shRNA-B4galt5and shRNA- Nsd1…

…different shRNAs forB4galt5was required for…

Show Full Abstract

A microRNA (miRNA) often regulates the expression of hundreds of target genes. A fundamental question in the field of miRNA research is whether a miRNA exerts its biological function through regulating a small number of key targets or through small changes in the expression of hundreds of target genes. We addressed this issue by performing functional analysis of target genes regulated by miR-148a. We previously identified miR-148a as a critical regulator of B cell central tolerance and found 119 target genes that may mediate its function. We selected 4 of them for validation and demonstrated a regulatory role for <i>Bim</i>, <i>Pten</i>, and <i>Gadd45a</i> in this process. In this study, we performed functional analysis of the other miR-148a target genes in <i>in vitro</i> and <i>in vivo</i> models of B cell central tolerance. Our results show that those additional target genes play a minimal role, if any, in miR-148a-mediated control of B cell central tolerance, suggesting that the function of miRNAs is mediated by a few key target genes. These findings have advanced our understanding of molecular mechanisms underlying miRNA regulation of gene expression and B cell central tolerance.

Also flagged:Ulcerative Colitischronic inflammatory diseasepathogenesisHeat shock family proteinsHeat Shockdeath
Journal Article 2022-05-12 No Snippets Gong M, Zhang F, Miao Y, Niu J.
Show Full Abstract

Ulcerative Colitis (UC) is a non-specific and chronic inflammatory disease of colonic mucosa whose exact etiology and mechanisms remain unclear. The incidence rate of UC is increasing year by year worldwide. What followed is that the medical costs are also rising rapidly. Therefore, it is urgent to understand the pathogenesis and find promising therapeutic targets for UC. Intestinal mucosal homeostasis is essential for normal bowel function, and its imbalance may be an important pathogenesis of UC. Endogenous homeostatic regulators play roles in repairing intestinal mucosa injury after stress. Heat shock family proteins are essential endogenous homeostasis factors. They can inhibit inflammation, regulate intestinal epithelial cells' survival and death, and promote mucosal healing. Thus, they play important roles in sustaining intestinal mucosal homeostasis and protecting against UC progression. However, the heat shock family may promote UC carcinogenesis. Here, we summarize the advances in the research of the functions of the heat shock family in UC. And this review is an attempt to light on the etiopathogenesis of UC, highlighting the endogenous protective mechanisms, hoping to provide a novel therapeutic target for UC treatment.

Also flagged:synthesisbutyratefatty acidssterolsphenylalaninechicoric acid
Journal Article 2022-05-12 ✓ 1 Snippet Spinelli V, Brasili E, Sciubba F, Ceci A, Giampaoli O, Miccheli A, Pasqua G, Persiani AM.
In-Text Gene Mentions

…ydroxycinnamoyl transferases (HTT) and a quinate…

Show Full Abstract

In this study, we investigated the biostimulant effect of fungal culture filtrates obtained from <i>Chaetomium globosum</i> and <i>Minimedusa polyspora</i> on growth performance and metabolomic traits of chicory (<i>Cichorium intybus</i>) plants. For the first time, we showed that <i>M. polyspora</i> culture filtrate exerts a direct plant growth-promoting effect through an increase of biomass, both in shoots and roots, and of the leaf area. Conversely, no significant effect on morphological traits and biomass yield was observed in <i>C. intybus</i> plants treated with <i>C. globosum</i> culture filtrate. Based on <sup>1</sup>H-NMR metabolomics data, differential metabolites and their related metabolic pathways were highlighted. The treatment with <i>C. globosum</i> and <i>M. polyspora</i> culture filtrates stimulated a common response in <i>C. intybus</i> roots involving the synthesis of 3-OH-butyrate through the decrease in the synthesis of fatty acids and sterols, as a mechanism balancing the NADPH/NADP<sup>+</sup> ratio. The fungal culture filtrates differently triggered the phenylpropanoid pathway in <i>C. intybus</i> plants: <i>C. globosum</i> culture filtrate increased phenylalanine and chicoric acid in the roots, whereas <i>M. polyspora</i> culture filtrate stimulated an increase of 4-OH-benzoate. Chicoric acid, whose biosynthetic pathway in the chicory plant is putative and still not well known, is a very promising natural compound playing an important role in plant defense. On the contrary, benzoic acids serve as precursors for a wide variety of essential compounds playing crucial roles in plant fitness and defense response activation. To the best of our knowledge, this is the first study that shows the biostimulant effect of <i>C. globosum</i> and <i>M. polyspora</i> culture filtrates on <i>C. intybus</i> growth and metabolome, increasing the knowledge on fungal bioresources for the development of biostimulants.

Also flagged:RNA HelicasesageingpathogenesiseIF4ADDX3XDHX36
Journal Article 2022-05-12 ✓ 2 Snippets Castelli LM, Benson BC, Huang WP, Lin YH, Hautbergue GM.
In-Text Gene Mentions

Autosomal-dominant glutamine-encoding CAG repeat expansions (>36-250) in exon 1 of the Huntingtin gene (HTT) cause HD, while >41 CAG repeats in the 3′terminal exon of Junctophilin 3 (JPH3) are involved in HDL2.

In addition, it was also shown that RAN translation also occur through the coding CAG repeat expansion in the HTT alternative reading frames leading overall to both canonical translation of the HTT poly-Q expansion protein and to four additional RAN-translated sense and antisense homo-polymeric repeat proteins (poly-alanine, poly-serine, poly-leucine, poly-cysteine) that are toxic and aggregate in a CAG repeat length dependent mechanism in autopsied brains from human HD patients (Bañez-Coronel et al., 2015).

Show Full Abstract

Short repeated sequences of 3-6 nucleotides are causing a growing number of over 50 microsatellite expansion disorders, which mainly present with neurodegenerative features. Although considered rare diseases in relation to the relatively low number of cases, these primarily adult-onset conditions, often debilitating and fatal in absence of a cure, collectively pose a large burden on healthcare systems in an ageing world population. The pathological mechanisms driving disease onset are complex implicating several non-exclusive mechanisms of neuronal injury linked to RNA and protein toxic gain- and loss- of functions. Adding to the complexity of pathogenesis, microsatellite repeat expansions are polymorphic and found in coding as well as in non-coding regions of genes. They form secondary and tertiary structures involving G-quadruplexes and atypical helices in repeated GC-rich sequences. Unwinding of these structures by RNA helicases plays multiple roles in the expression of genes including repeat-associated non-AUG (RAN) translation of polymeric-repeat proteins with aggregating and cytotoxic properties. Here, we will briefly review the pathogenic mechanisms mediated by microsatellite repeat expansions prior to focus on the RNA helicases eIF4A, DDX3X and DHX36 which act as modifiers of RAN translation in C9ORF72-linked amyotrophic lateral sclerosis/frontotemporal dementia (C9ORF72-ALS/FTD) and Fragile X-associated tremor/ataxia syndrome (FXTAS). We will further review the RNA helicases DDX5/17, DHX9, Dicer and UPF1 which play additional roles in the dysregulation of RNA metabolism in repeat expansion disorders. In addition, we will contrast these with the roles of other RNA helicases such as DDX19/20, senataxin and others which have been associated with neurodegeneration independently of microsatellite repeat expansions. Finally, we will discuss the challenges and potential opportunities that are associated with the targeting of RNA helicases for the development of future therapeutic approaches.

Also flagged:SNHG7Colon adenocarcinomaCOADdeathcancertumor
Journal Article 2022-05-12 No Snippets Huang J, Jiang S, Liang L, He H, Liu Y, Cong L, Jiang Y.
Show Full Abstract

Colon adenocarcinoma (COAD) is one of the most common malignancies, and its metastatic lesions are the leading cause of death in COAD patients. PANoptosis is a recently identified pathway for programmed cell death implicated in developing COAD. Long non-coding RNAs (lncRNAs) are key regulators of cancer occurrence and progress. Although their function has captured much attention in COAD, the relationship between COAD metastasis-associated lncRNA expression and PANoptosis remains elusive. Therefore, this study aimed to explore the potential regulatory roles of metastasis- and PANoptosis-associated lncRNAs in COAD. Nine lncRNAs associated with metastasis and PANoptosis in COAD were identified from The Cancer Genome Atlas (TCGA) and GEO databases. Their functions were analyzed by multiple bioinformatics methods, and the lncRNA-miRNA-mRNA network was constructed. Multivariate Cox analysis identified one lncRNA (SNHG7) significantly related to COAD prognosis. Subsequent analyses showed its expression correlated with tumor stage and lymph node metastasis. Moreover, drug sensitivity analysis and <i>in vitro</i> experiments suggest that lncRNA SNHG7 contributes to drug resistance in COAD. In summary, lncRNA SNHG7 is a potential target for diagnosing and treating COAD and plays a crucial role in regulating apoptosis, metastasis, and drug resistance in COAD.

Also flagged:Neurodegenerative Diseasesfibrilstype II diabetesprionorganizationposttranslational modifications
Journal Article 2022-05-12 ✓ 5 Snippets Landrieu I, Dupré E, Sinnaeve D, El Hajjar L, Smet-Nocca C.
In-Text Gene Mentions

Natively folded proteins involved in amyloidosis are for instance transthyretin (TTR) associated to familial amyloidotic cardiomyopathy, superoxide dismutase-1 (SOD-1) and transactive response DNA binding protein 43 (TDP-43) associated to familial amyotrophic lateral sclerosis (fALS), Huntingtin (Htt) associated to Huntington’s disease (HD), or the cellular form of prion protein PrPC associated to prion diseases or transmissible spongiform encephalopathies (TSEs).

More recently, a new chemoenzymatic semisynthesis of Htt N-terminal fragment (1–170) that forms nuclear and cytoplasmic inclusions in cell and animal models of HD enables the introduction of phosphorylation in exon3 (Kolla et al., 2021).

The N-terminal region of Htt is the site of HD-associated pathogenic changes through an elongation of the CAG repeat of htt gene encoding an expanded polyglutamine repeat.

Phosphorylation of the N-terminal fragment of Htt at T3 homogeneously obtained by EPL, either in wild-type (23Q) or mutant Htt protein (43Q) was shown to stabilize the α-helical conformation of the N-terminal 17 amino acids and significantly inhibit aggregation while K6 acetylation reverses the inhibitory effect of pT3 without exhibiting any intrinsic inhibitory effect by itself (Ansaloni et al., 2014; Chiki et al., 2017).

The synthesis and FRET analysis of a site-specific, dual-labeled Htt exon1 indicated a progressive compaction of the protein upon increasing polyQ length in contrast to the pathological threshold length associated to HD (Warner et al., 2017).

Show Full Abstract

Protein aggregation into highly ordered, regularly repeated cross-β sheet structures called amyloid fibrils is closely associated to human disorders such as neurodegenerative diseases including Alzheimer's and Parkinson's diseases, or systemic diseases like type II diabetes. Yet, in some cases, such as the HET-s prion, amyloids have biological functions. High-resolution structures of amyloids fibrils from cryo-electron microscopy have very recently highlighted their ultrastructural organization and polymorphisms. However, the molecular mechanisms and the role of co-factors (posttranslational modifications, non-proteinaceous components and other proteins) acting on the fibril formation are still poorly understood. Whether amyloid fibrils play a toxic or protective role in the pathogenesis of neurodegenerative diseases remains to be elucidated. Furthermore, such aberrant protein-protein interactions challenge the search of small-molecule drugs or immunotherapy approaches targeting amyloid formation. In this review, we describe how chemical biology tools contribute to new insights on the mode of action of amyloidogenic proteins and peptides, defining their structural signature and aggregation pathways by capturing their molecular details and conformational heterogeneity. Challenging the imagination of scientists, this constantly expanding field provides crucial tools to unravel mechanistic detail of amyloid formation such as semisynthetic proteins and small-molecule sensors of conformational changes and/or aggregation. Protein engineering methods and bioorthogonal chemistry for the introduction of protein chemical modifications are additional fruitful strategies to tackle the challenge of understanding amyloid formation.

Also flagged:mGluR5ScrapieMetabotropic glutamate receptor subtype 5G-protein-coupled receptorneurodegenerative diseasesprion diseases
Journal Article 2022-05-12 ✓ 2 Snippets Hu C, Chen C, Xia Y, Chen J, Yang W, Wang L, Chen DD, Wu YZ, Fan Q, Jia XX, Xiao K, Shi Q, Chen ZB, Dong XP.
In-Text Gene Mentions

…wild-type and mutanthtt( Ribeiro et…

…Mutanthttcan sensitize IP3-mediated…

Show Full Abstract

Metabotropic glutamate receptor subtype 5 (mGluR5) is a G-protein-coupled receptor found widely in the central nervous system. It has been involved in the development and progression of some neurodegenerative diseases, but its role in prion diseases is rarely described. In this study, the changes of mGluR5 and its downstream signaling pathways in prion-infected cell line SMB-S15 and the brains of scrapie-infected experimental rodents were evaluated by various methodologies. We found the levels of mGluR5 were significantly increased in a prion-infected cell line SMB-S15 and the cultured cells transiently express an abnormal form PrP (Cyto-PrP). Using immunoprecipitation tests and immunofluorescent assays (IFA), molecular interaction and morphological colocalization between PrP and mGluR5 were observed in the cultured cells. We identified that the (GPCRs)-IP3-IP3R-Ca<sup>2+</sup> pathway was activated and the levels of the downstream kinases p38, ERK, and JNK were increased in SMB-S15 cells. After treated with mGluR5 antagonist (MTEP) or the removal of prion replication by resveratrol in SMB-S15 cells, the upregulations of mGluR5 and the downstream kinases were restored in a certain degree. Moreover, increased mGluR5 contributes to the cell damage in prion-infected cells. Contrarily, the levels of mGluR5 in the brains of several scrapie-infected rodent models were decreased at terminal stage. IFA of the brain sections of scrapie-infected rodents demonstrated that the signals of mGluR5 were preferentially colocalized with the NeuN-positive cells, accompanying with severe neuron losses in Nissl staining, which might be a reason for the decrease of mGluR5. Our data indicate the different aberrant alterations of mGluR5 and the downstream signaling pathways during prion infection <i>in vivo</i> and <i>in vitro</i>.

Also flagged:EDARHair placode formationhair follicleluciferasebindingCell proliferation
Journal Article 2022-05-12 ✓ 1 Snippet Jiang Y, Liu H, Zou Q, Li S, Ding X.
In-Text Gene Mentions

…, such as MSTRG.223165/miR-21/SOX6in wool HF…

Show Full Abstract

Hair placode formation is an important stage of hair follicle morphogenesis and it is a complex process facilitated by non-coding RNAs. In this study, we conducted whole transcriptome sequencing analysis of skin, heart, liver, lung, and kidney tissues of day 41 (E41) normal and hairless pig embryos, and respectively detected 15, 8, and 515 skin-specific differentially expressed (DE) lncRNAs, miRNAs, and mRNAs. Furthermore, 18 competing endogenous RNA (ceRNA) networks were constructed. Following weighted gene co-expression network analysis (WGCNA) of stages E39, E41, E45, E52, and E60, between normal and hairless pig embryos, only two ceRNAs (lncRNA2162.1/miR-29a-5p/BMPR1b and lncRNA627.1/miR-29a-5p/EDAR) that showed period-specific differential expression in E41 skin were retained. Dual-luciferase reporter assays further indicated that <i>EDAR</i> was a direct, functioning target of <i>miR-29a-5p</i> and that no binding site was found in BMPR1b. Moreover, <i>miR-29a-5p</i> overexpression inhibited the mRNA and protein expression of <i>EDAR</i> while no significant differential expression of BMPR1b was detected. In addition, over-expressed lncRNA627.1 reduces the expression of <i>miR-29a-5p</i> and increase EDAR expression while inhibits lncRNA627.1 resulted in a opposite expression trend. Cell proliferation result demonstrated that lower expression of EDAR and lncRNA627.1 inhibited hair placode precursor cells (HPPCs) proliferation in a manner similar to that shown by over-expressed <i>miR-29a-5p</i>. This study identified that <i>miR-29a-5p</i> inhibited HPPCs proliferation <i>via</i> the suppression of <i>EDAR</i> expression in the EDA/EDAR signaling pathway, while lncRNA627.1 rescues EDAR expression. Our study provides a basis for a better understanding of the mechanisms underlying the ceRNA complex, miR29a-5p/EDA<i>R/</i>lncRNA627.1, that could regulate hair placode formation, which may help decipher diseases affecting human hair.

Also flagged:Gene Expressionrenal diseaseacute allograft rejectioncoagulationimmunoglobulin heavy constant alpha 1IGHA1
Journal Article 2022-05-12 No Snippets Han S, Zhao W, Wang C, Wang Y, Song R, Haller H, Jiang H, Chen J.
Show Full Abstract

A kidney transplant is often the best treatment for end-stage renal disease. Although immunosuppressive therapy sharply reduces the occurrence of acute allograft rejection (AR), it remains the main cause of allograft dysfunction. We aimed to identify effective biomarkers for AR instead of invasive kidney transplant biopsy. We integrated the results of several proteomics studies related to AR and utilized public data sources. Gene ontology (GO) and pathway analyses were used to identify important biological processes and pathways. The performance of the identified proteins was validated using several public gene expression omnibus (GEO) datasets. Samples that performed well were selected for further validation through RNA sequencing of peripheral blood mononuclear cells of patients with AR (<i>n</i> = 16) and non-rejection (<i>n</i> = 19) from our medical center. A total of 25 differentially expressed proteins (DEPs) overlapped in proteomic studies of urine and blood samples. GO analysis showed that the DEPs were mainly involved in the immune system and blood coagulation. Pathway analysis showed that the complement and coagulation cascade pathways were well enriched. We found that immunoglobulin heavy constant alpha 1 (IGHA1) and immunoglobulin κ constant (IGKC) showed good performance in distinguishing AR from non-rejection groups validated with several GEO datasets. Through RNA sequencing, the combination of IGHA1, IGKC, glomerular filtration rate, and donor age showed good performance in the diagnosis of AR with ROC AUC 91.4% (95% CI: 82-100%). Our findings may contribute to the discovery of potential biomarkers for AR monitoring.

Also flagged:synthesisammoniacarbonepi -BiotinSulfone
Journal Article 2022-05-12 No Snippets Chavan SP, Kalbhor DB, Gonnade RG.
Show Full Abstract

A synthesis of 2-<i>epi</i>-biotin sulfone was accomplished from commercially available l-cysteine. The synthesis features an unprecedented tandem <i>S</i>,<i>N</i>-carbonyl migration/aza-Michael/spirocyclization reaction from an l-cysteine-derived enone with aq. ammonia, in which three new sigma bonds and two rings are formed. In addition, the synthesis includes a highly diastereoselective late-stage Haller-Bauer reaction of sulfone for direct introduction of the carbon side chain.

Also flagged:adrenalinenoradrenalinevasoconstrictionglucoseglucocorticoidscortisol
Journal Article 2022-05-11 ✓ 1 Snippet McKetney J, Jenkins CC, Minogue C, Mach PM, Hussey EK, Glaros TG, Coon J, Dhummakupt ES.
In-Text Gene Mentions

DNAJC1

Show Full Abstract

By characterizing physiological changes that occur in warfighters during simulated combat, we can start to unravel the key biomolecular components that are linked to physical and cognitive performance. Viable field-based sensors for the warfighter must be rapid and noninvasive. In an effort to facilitate this, we applied a multiomics pipeline to characterize the stress response in the saliva of warfighters to correlate biomolecular changes with overall performance and health. In this study, two different stress models were observed - one of chronic stress and one of acute stress. In both models, significant perturbations in the immune, metabolic, and protein manufacturing/processing systems were observed. However, when differentiating between stress models, specific metabolites associated with the "fight or flight" response and protein folding were seen to be discriminate of the acute stress model.

Also flagged:VRK1BAFinfectionB12pseudokinasekinase
Journal Article 2022-05-11 ✓ 3 Snippets Linville AC, Rico AB, Teague H, Binsted LE, Smith GL, Albarnaz JD, Wiebe MS.
In-Text Gene Mentions

In addition, B12-mediated inhibition of VACV DNA replication has been determined to be cell type specific and influenced by the levels of host VRK2 protein, arguing that both viral and cellular enzymes modulate how B12 impacts on infection (11).

…levels of hostVRK2protein, arguing that…

…kinases, VRK1, andVRK2, and the pseudokinase…

Show Full Abstract

Poxvirus proteins remodel signaling throughout the cell by targeting host enzymes for inhibition and redirection. Recently, it was discovered that early in infection the vaccinia virus (VACV) B12 pseudokinase copurifies with the cellular kinase VRK1, a proviral factor, in the nucleus. Although the formation of this complex correlates with inhibition of cytoplasmic VACV DNA replication and likely has other downstream signaling consequences, the molecular mechanisms involved are poorly understood. Here, we further characterize how B12 and VRK1 regulate one another during poxvirus infection. First, we demonstrate that B12 is stabilized in the presence of VRK1 and that VRK1 and B12 coinfluence their respective solubility and subcellular localization. In this regard, we find that B12 promotes VRK1 colocalization with cellular DNA during mitosis and that B12 and VRK1 may be tethered cooperatively to chromatin. Next, we observe that the C-terminal tail of VRK1 is unnecessary for B12-VRK1 complex formation or its proviral activity. Interestingly, we identify a point mutation of B12 capable of abrogating interaction with VRK1 and which renders B12 nonrepressive during infection. Lastly, we investigated the influence of B12 on the host factor BAF and antiviral signaling pathways and find that B12 triggers redistribution of BAF from the cytoplasm to the nucleus. In addition, B12 increases DNA-induced innate immune signaling, revealing a new functional consequence of the B12 pseudokinase. Together, this study characterizes the multifaceted roles B12 plays during poxvirus infection that impact VRK1, BAF, and innate immune signaling. <b>IMPORTANCE</b> Protein pseudokinases comprise a considerable fraction of the human kinome, as well as other forms of life. Recent studies have demonstrated that their lack of key catalytic residues compared to their kinase counterparts does not negate their ability to intersect with molecular signal transduction. While the multifaceted roles pseudokinases can play are known, their contribution to virus infection remains understudied. Here, we further characterize the mechanism of how the VACV B12 pseudokinase and human VRK1 kinase regulate one another in the nucleus during poxvirus infection and inhibit VACV DNA replication. We find that B12 disrupts regulation of VRK1 and its downstream target BAF, while also enhancing DNA-dependent innate immune signaling. Combined with previous data, these studies contribute to the growing field of nuclear pathways targeted by poxviruses and provide evidence of unexplored roles of B12 in the activation of antiviral immunity.

Also flagged:nodedistal cholangiocarcinomametastasisLN metastasiscarbohydratemetastatic LN
Journal Article 2022-05-11 ✓ 1 Snippet Kurahara H, Mataki Y, Idichi T, Kawasaki Y, Mori S, Sasaki K, Arigami T, Nakajo A, Fukukura Y, Higashi M, Ohtsuka T.
In-Text Gene Mentions

…in patients withDCCand LN metastasis.…

Show Full Abstract

<h4>Background</h4>Lymphatic metastasis is a major route of metastasis in distal cholangiocarcinoma (DCC). The present study aimed to elucidate the pattern of lymph node (LN) metastasis and the effectiveness of LN dissection and postoperative adjuvant chemotherapy in patients with DCC.<h4>Methods</h4>Patients who underwent surgical resection with curative intent for DCC were enrolled. The nomenclature of the LN stations was defined according to the Japanese Society of Hepato-Biliary-Pancreatic Surgery guidelines. Effectiveness of LN dissection of each station was calculated using frequency of LN metastasis to the station and 5-year survival rate of patients with LN metastasis to that station.<h4>Results</h4>Of the 105 patients included in the study, 46 (43.8%) had LN metastasis, and 43 (41.0%) underwent postoperative adjuvant therapy. LN metastasis, serum carbohydrate antigen (CA) 19-9 level > 37 U/mL, and positive bile duct margin were independent risk factors for shorter overall survival (OS). The most common metastatic LN station at surgery was No. 13 (32.7%), followed by No. 12 (19.2%), No. 17 (9.6%), and No. 8 (6.6%). There was no effectiveness of LN dissection of the station No. 8, 14, and 16. Adjuvant chemotherapy was significantly associated with longer OS in patients with LN metastasis but not in those with positive ductal margins or serum CA 19-9 level > 37 U/mL.<h4>Conclusions</h4>Postoperative adjuvant chemotherapy was associated with a better prognosis in patients with DCC and LN metastasis. However, a more effective therapeutic strategy is required to improve the prognosis of patients with other negative prognostic factors.

Also flagged:long-term potentiationsynaptic transmissionsynapsesCbln4cell-surfaceneurexins
Journal Article 2022-05-11 ✓ 5 Snippets Liakath-Ali K, Polepalli JS, Lee SJ, Cloutier JF, Südhof TC.
In-Text Gene Mentions

…interacting with postsynapticDCC(deleted in colorectal…

DCCand neogenin-1 act…

…as such receptors,DCCor neogenin-1 might…

…neogenin-1, but notDCC, is abundantly expressed…

…contrast, Neo1 andDCCact as receptors…

Show Full Abstract

Five decades ago, long-term potentiation (LTP) of synaptic transmission was discovered at entorhinal cortex→dentate gyrus (EC→DG) synapses, but the molecular determinants of EC→DG LTP remain largely unknown. Here, we show that the presynaptic neurexin–ligand cerebellin-4 (Cbln4) is highly expressed in the entorhinal cortex and essential for LTP at EC→DG synapses, but dispensable for basal synaptic transmission at these synapses. Cbln4, when bound to cell-surface neurexins, forms transcellular complexes by interacting with postsynaptic DCC (deleted in colorectal cancer) or neogenin-1. DCC and neogenin-1 act as netrin and repulsive guidance molecule-a (RGMa) receptors that mediate axon guidance in the developing brain, but their binding to Cbln4 raised the possibility that they might additionally function in the mature brain as postsynaptic receptors for presynaptic neurexin/Cbln4 complexes, and that as such receptors, DCC or neogenin-1 might mediate EC→DG LTP that depends on Cbln4. Indeed, we observed that neogenin-1, but not DCC, is abundantly expressed in dentate gyrus granule cells, and that postsynaptic neogenin-1 deletions in dentate granule cells blocked EC→DG LTP, but again did not affect basal synaptic transmission similar to the presynaptic Cbln4 deletions. Thus, binding of presynaptic Cbln4 to postsynaptic neogenin-1 renders EC→DG synapses competent for LTP, but is not required for establishing these synapses or for otherwise enabling their function.

Also flagged:lipidGATBFHIP1AtriglycerideLPAFHIT
Journal Article 2022-05-11 No Snippets Choudhury A, Brandenburg JT, Chikowore T, Sengupta D, Boua PR, Crowther NJ, Agongo G, Asiki G, Gómez-Olivé FX, Kisiangani I, Maimela E, Masemola-Maphutha M, Micklesfield LK, Nonterah EA, Norris SA, Sorgho H, Tinto H, Tollman S, Graham SE, Willer CJ, AWI-Gen study, H3Africa Consortium, Hazelhurst S, Ramsay M.
Show Full Abstract

Genetic associations for lipid traits have identified hundreds of variants with clear differences across European, Asian and African studies. Based on a sub-Saharan-African GWAS for lipid traits in the population cross-sectional AWI-Gen cohort (N = 10,603) we report a novel LDL-C association in the GATB region (P-value=1.56 × 10<sup>-8</sup>). Meta-analysis with four other African cohorts (N = 23,718) provides supporting evidence for the LDL-C association with the GATB/FHIP1A region and identifies a novel triglyceride association signal close to the FHIT gene (P-value =2.66 × 10<sup>-8</sup>). Our data enable fine-mapping of several well-known lipid-trait loci including LDLR, PMFBP1 and LPA. The transferability of signals detected in two large global studies (GLGC and PAGE) consistently improves with an increase in the size of the African replication cohort. Polygenic risk score analysis shows increased predictive accuracy for LDL-C levels with the narrowing of genetic distance between the discovery dataset and our cohort. Novel discovery is enhanced with the inclusion of African data.

Also flagged:obesitybindingChild ObesityHemoglobinHBPIM1
Journal Article 2022-05-11 ✓ 1 Snippet Song M, Yu J, Li B, Dong J, Gao J, Shang L, Zhou X, Bai Y.
In-Text Gene Mentions

…genes ( ZNF566,RC3H1, KCTD15, FTO, ARSJ,…

Show Full Abstract

<h4>Background</h4>Genome-wide association studies (GWAS) have uncovered thousands of genetic variants that are associated with complex human traits and diseases. miRNAs are single-stranded non-coding RNAs. In particular, genetic variants located in the 3'UTR region of mRNAs may play an important role in gene regulation through their interaction with miRNAs. Existing studies have not been thoroughly conducted to elucidate 3'UTR variants discovered through GWAS. The goal of this study is to analyze patterns of GWAS functional variants located in 3'UTRs about their relevance in the network between hosting genes and targeting miRNAs, and elucidate the association between the genes harboring these variants and genetic traits.<h4>Methods</h4>We employed MIGWAS, ANNOVAR, MEME, and DAVID software packages to annotate the variants obtained from GWAS for 31 traits and elucidate the association between their harboring genes and their related traits. We identified variants that occurred in the motif regions that may be functionally important in affecting miRNA binding. We also conducted pathway analysis and functional annotation on miRNA targeted genes harboring 3'UTR variants for a trait with the highest percentage of 3'UTR variants occurring.<h4>Results</h4>The Child Obesity trait has the highest percentage of 3'UTR variants (75%). Of the 16 genes related to the Child Obesity trait, 5 genes (ETV7, GMEB1, NFIX, ZNF566, ZBTB40) had a significant association with the term DNA-Binding (p < 0.05). EQTL analysis revealed 2 relevant tissues and 10 targeted genes associated with the Child Obesity trait. In addition, Red Blood Cells (RBC), Hemoglobin (HB), and Package Cell Volume (PCV) have overlapping variants. In particular, the PIM1 variant occurred inside the HB Motif region 37,174,641-37,174,660, and LUC7L3 variant occurred inside RBC Motif region 50,753,918-50,753,937.<h4>Conclusion</h4>Variants located in 3'UTR can alter the binding affinity of miRNA and impact gene regulation, thus warranting further annotation and analysis. We have developed a bioinformatics bash pipeline to automatically annotate variants, determine the number of variants in different categories for each given trait, and check common variants across different traits. This is a valuable tool to annotate a large number of GWAS result files.

Also flagged:WntMigrainecomplexDKK1PDGFBFARS2
Journal Article 2022-05-11 ✓ 1 Snippet Tanha HM, International Headache Genetics Consortium, Nyholt DR.
In-Text Gene Mentions

…carbonic anhydrase 10 (CA10, r = –0.0092,…

Show Full Abstract

Migraine is a common complex disorder with a significant polygenic SNP heritability ([Formula: see text]). Here we utilise genome-wide association study (GWAS) summary statistics to study pleiotropy between blood proteins and migraine under the polygenic model. We estimate [Formula: see text] for 4625 blood protein GWASs and identify 325 unique proteins with a significant [Formula: see text] for use in subsequent genetic analyses. Pleiotropy analyses link 58 blood proteins to migraine risk at genome-wide, gene and/or single-nucleotide polymorphism levels-suggesting shared genetic influences or causal relationships. Notably, the identified proteins are largely distinct from migraine GWAS loci. We show that higher levels of DKK1 and PDGFB, and lower levels of FARS2, GSTA4 and CHIC2 proteins have a significant causal effect on migraine. The risk-increasing effect of DKK1 is particularly interesting-indicating a role for downregulation of β-catenin-dependent Wnt signalling in migraine risk, suggesting Wnt activators that restore Wnt/β-catenin signalling in brain could represent therapeutic tools against migraine.

Also flagged:gene expressionimmune responseextracellularcycleinseminationjunction
Journal Article 2022-05-11 ✓ 1 Snippet Abril-Parreño L, Meade KG, Krogenæs AK, Druart X, Cormican P, Fair S.
In-Text Gene Mentions

…NWS are theForkhead Box C1Box C1 (…

Show Full Abstract

<h4>Background</h4>Cervical artificial insemination (AI) with frozen-thawed semen results in unacceptably low pregnancy rates internationally. The exception is in Norway, where vaginal deposition of frozen-thawed semen to a natural oestrous routinely yields pregnancy rates in excess of 70%. Previous studies by our group has demonstrated that this is due to differences in cervical sperm transport. However, a potentially important contributory factor is that ewes are inseminated to a natural oestrous in Norway but to a synchronised oestrous across most of the rest of the world. In this study, we interrogated the gene expression of the sheep cervix of four ewe breeds with known differences in pregnancy rates following cervical AI using frozen-thawed semen under the effect of exogenous hormones to synchronise the oestrous cycle. These four ewe breeds (n = 8 to 11 ewes per breed) are from two countries: Ireland (Belclare and Suffolk; medium and low fertility, respectively) and Norway (Norwegian White Sheep (NWS) and Fur; both with high fertility compared to the Irish ewe breeds).<h4>Results</h4>RNA extracted from cervical biopsies collected from these breeds was analysed by RNA-sequencing and differential gene expression analysis. Using the low-fertility Suffolk breed as a reference level; 27, 1827 and 2641 genes were differentially expressed in Belclare, Fur and NWS ewes, respectively (P <  0.05 and FC > 1.5). Gene ontology (GO) analysis revealed that Fur and NWS had an up-regulation of enriched pathways involved in muscle contraction and development compared to Suffolk. However, there was a down-regulation of the immune response pathway in NWS compared to Suffolk. In addition, GO analysis showed similar expression patterns involved in muscle contraction, extracellular matrix (ECM) development and cell-cell junction in both Norwegian ewe breeds, which differed to the Irish ewe breeds.<h4>Conclusions</h4>This novel study has identified a number of conserved and breed-specific biological processes under the effect of oestrous synchronisation that may impact cervical sperm transport during the follicular phase of the reproductive cycle.

Also flagged:Peroxiredoxin VcanceroxygenPRDX5nitrogenlung cancer
Journal Article 2022-05-11 ✓ 1 Snippet Sun HN, Guo XY, Xie DP, Wang XM, Ren CX, Han YH, Yu NN, Huang YL, Kwon T.
In-Text Gene Mentions

…PRDX1, PRDX2, andPRDX6are mainly expressed…

Show Full Abstract

Administration of non-thermal plasma therapy via the use of plasma-activated medium (PAM) might be a novel strategy for cancer treatment, as it induces apoptosis by increasing reactive oxygen species (ROS) levels. Peroxiredoxin V (PRDX5) scavenges ROS and reactive nitrogen species and is known to regulate several physiological and pathological reactions. However, its role in lung cancer cells exposed to PAM is unknown. Here, we investigated the effect of <i>PRDX5</i> in PAM-treated A549 lung cancer cells and determined the mechanism underlying its cytotoxicity. Cell culture medium was treated with low temperature plasma at 16.4 kV for 0, 60, 120, or 180 s to develop PAM. <i>PRDX5</i> was knocked down in A549 cells via transfection with short hairpin RNA targeting <i>PRDX5</i>. Colony formation and wound healing assays, flow cytometry, fluorescence microscopy, and western blotting were performed to detect the effect of <i>PRDX5</i> knockdown on PAM-treated A549 cells. PAM showed higher cytotoxicity in lung cancer cells than in control cells, downregulated the mitogen-activated protein kinase signaling pathway, and induced apoptosis. <i>PRDX5</i> knockdown significantly inhibited cell colony formation and migration, increased ROS accumulation, and reduced mitochondrial membrane potential in lung cancer cells. Hence, <i>PRDX5</i> knockdown combined with PAM treatment represents an effective option for lung cancer treatment.

Also flagged:SLC35C1sphingolipid synthesisactinlocalizationSGPP1SLC3A2
Journal Article 2022-05-11 ✓ 3 Snippets Kono M, Hoachlander-Hobby LE, Majumder S, Schwartz R, Byrnes C, Zhu H, Proia RL.
In-Text Gene Mentions

B4GALT5

…A4GALT (Gb3 synthase),B4GALT5(lactosylceramide synthase), U…

…production (CERS2, UGCG,B4GALT5, A4GALT), proteins that…

Show Full Abstract

Sphingosine-1-phosphate (S1P) is a sphingolipid metabolite that serves as a potent extracellular signaling molecule. Metabolic regulation of extracellular S1P levels impacts key cellular activities through altered S1P receptor signaling. Although the pathway through which S1P is degraded within the cell and thereby eliminated from reuse has been previously described, the mechanism used for S1P cellular uptake and the subsequent recycling of its sphingoid base into the sphingolipid synthesis pathway is not completely understood. To identify the genes within this S1P uptake and recycling pathway, we performed a genome-wide CRISPR/Cas9 KO screen using a positive-selection scheme with Shiga toxin, which binds a cell-surface glycosphingolipid receptor, globotriaosylceramide (Gb3), and causes lethality upon internalization. The screen was performed in HeLa cells with their sphingolipid de novo pathway disabled so that Gb3 cell-surface expression was dependent on salvage of the sphingoid base of S1P taken up from the medium. The screen identified a suite of genes necessary for S1P uptake and the recycling of its sphingoid base to synthesize Gb3, including two lipid phosphatases, PLPP3 (phospholipid phosphatase 3) and SGPP1 (S1P phosphatase 1). The results delineate a pathway in which plasma membrane-bound PLPP3 dephosphorylates extracellular S1P to sphingosine, which then enters cells and is rephosphorylated to S1P by the sphingosine kinases. This rephosphorylation step is important to regenerate intracellular S1P as a branch-point substrate that can be routed either for dephosphorylation to salvage sphingosine for recycling into complex sphingolipid synthesis or for degradation to remove it from the sphingolipid synthesis pathway.

Also flagged:COVID-19deathkidney dysfunctionD-dimerthrombotic microangiopathy
Journal Article 2022-05-11 ✓ 1 Snippet Longato E, Morieri ML, Sparacino G, Di Camillo B, Cattelan A, Lo Menzo S, Trevenzoli M, Vianello A, Guarnieri G, Lionello F, Avogaro A, Fioretto P, Vettor R, Fadini GP.
In-Text Gene Mentions

…terol, triglycerides, glucose,antithrombin-III, activated partial thrombopla…

Show Full Abstract

<h4>Background and objective</h4>COVID-19 severity spans an entire clinical spectrum from asymptomatic to fatal. Most patients who require in-hospital care are admitted to non-intensive wards, but their clinical conditions can deteriorate suddenly and some eventually die. Clinical data from patients' case series have identified pre-hospital and in-hospital risk factors for adverse COVID-19 outcomes. However, most prior studies used static variables or dynamic changes of a few selected variables of interest. In this study, we aimed at integrating the analysis of time-varying multidimensional clinical-laboratory data to describe the pathways leading to COVID-19 outcomes among patients initially hospitalised in a non-intensive care setting.<h4>Methods</h4>We collected the longitudinal retrospective data of 394 patients admitted to non-intensive care units at the University Hospital of Padova (Padova, Italy) due to COVID-19. We trained a dynamic Bayesian network (DBN) to encode the conditional probability relationships over time between death and all available demographics, pre-existing conditions, and clinical laboratory variables. We applied resampling, dynamic time warping, and prototyping to describe the typical trajectories of patients who died vs. those who survived.<h4>Results</h4>The DBN revealed that the trajectory linking demographics and pre-existing clinical conditions to death passed directly through kidney dysfunction or, more indirectly, through cardiac damage. As expected, admittance to the intensive care unit was linked to markers of respiratory function. Notably, death was linked to elevation in procalcitonin and D-dimer levels. Death was associated with persistently high levels of procalcitonin from admission and throughout the hospital stay, likely reflecting bacterial superinfection. A sudden raise in D-dimer levels 3-6 days after admission was also associated with subsequent death, possibly reflecting a worsening thrombotic microangiopathy.<h4>Conclusions</h4>This innovative application of DBNs and prototyping to integrated data analysis enables visualising the patient's trajectories to COVID-19 outcomes and may instruct timely and appropriate clinical decisions.

Also flagged:Transcription FactorNRF2Cell Cyclecell division cyclegene expressionmitosis
Journal Article 2022-05-11 ✓ 1 Snippet Lastra D, Escoll M, Cuadrado A.
In-Text Gene Mentions

…; CDK5R1 ;CDK5RAP1; CDK6 ;…

Show Full Abstract

Transcription factor NRF2 is a master regulator of the multiple cytoprotective responses that confer growth advantages on a cell. However, its participation in the mechanisms that govern the cell division cycle has not been explored in detail. In this study, we used several standard methods of synchronization of proliferating cells together with flow cytometry and monitored the participation of NRF2 along the cell cycle by the knockdown of its gene expression. We found that the NRF2 levels were highest at S phase entry, and lowest at mitosis. NRF2 depletion promoted both G1 and M arrest. Targeted transcriptomics analysis of cell cycle regulators showed that NRF2 depletion leads to changes in key cell cycle regulators, such as <i>CDK2</i>, <i>TFDP1</i>, <i>CDK6</i>, <i>CDKN1A</i> (p21), <i>CDKN1B</i> (p27), <i>CCNG1</i>, and <i>RAD51</i>. This study gives a new dimension to NRF2 effects, showing their implication in cell cycle progression.

Also flagged:biosynthesisamino acidsimmune responseamino acidmetabolismglycine
Journal Article 2022-05-11 ✓ 2 Snippets Pezeshkian Z, Mirhoseini SZ, Ghovvati S, Ebrahimie E.
In-Text Gene Mentions

On the other hand, glycine can be converted to creatine by GATM which was over-expressed (or up-regulated) in the HFE turkey phenotype.

…down-regulated in theHFEgroup.…

Show Full Abstract

Feed efficiency is important due to the high cost of food, which accounts for about 70% of the total cost of a turkey breeding system. Native poultry are an important genetic resource in poultry breeding programs. This study aimed to conduct a global transcriptome analysis of native male turkeys which have been phenotyped for high and low feed efficiency. Feed efficiency traits were recorded during the experimental period. After slaughter, the three most efficient and three least efficient male turkeys were selected for RNA-Seq analysis. A total of 365 genes with different expressions in muscle tissue were identified between turkeys with a high feed efficiency compared to turkeys with a low feed efficiency. In the pathway analysis of up-regulated genes, major pathways included the "metabolism of glycine, serine, and threonine"; the "adipocytokine signaling pathway" and the "biosynthesis of amino acids". In the pathway analysis of down-regulated genes, the major pathways included "dorso-ventral axis formation" and "actin cytoskeleton regulation". In addition, gene set enrichment analyses were performed, which showed that high feed efficiency birds exhibit an increased expression of genes related to the biosynthesis of amino acids and low feed efficiency birds an increased expression of genes related to the immune response. Furthermore, functional analysis and protein network interaction analysis revealed that genes including <i>GATM</i>, <i>PSAT1</i>, <i>PSPH</i>, <i>PHGDH</i>, <i>VCAM1</i>, <i>CD44</i>, <i>KRAS</i>, <i>SRC</i>, <i>CAV3</i>, <i>NEDD9,</i> and <i>PTPRQ</i> were key genes for feed efficiency. These key genes may be good potential candidates for biomarkers of feed efficiency in genetic selection in turkeys.

Also flagged:Rectal CancerColorectal cancercancerdeathlocallytumor
Journal Article 2022-05-11 ✓ 2 Snippets Lee HH, Chen CH, Huang YH, Chiang CH, Huang MY.
In-Text Gene Mentions

The 5-fluorouracil response is strongly affected by MMR deficiency and the loss of heterozygosity for DCC (chromosome 18) and mutations in TGFbIIR are secondary [69].

…using four genes:LRRIQ3, FRMD3, SAMD5 and…

Show Full Abstract

Colorectal cancer is the second leading cause of cancer death globally. The gold standard for locally advanced rectal cancer (LARC) nowadays is preoperative concurrent chemoradiation (CCRT). Approximately three quarters of LARC patients do not achieve pathological complete response and hence suffer from relapse, metastases and inevitable death. The exploration of trustworthy and timely biomarkers for CCRT response is urgently called for. This review focused upon a broad spectrum of biomarkers, including circulating tumor cells, DNA, RNA, oncogenes, tumor suppressor genes, epigenetics, impaired DNA mismatch repair, patient-derived xenografts, in vitro tumor organoids, immunity and microbiomes. Utilizing proper biomarkers can assist in categorizing appropriate patients by the most efficient treatment modality with the best outcome and accompanied by minimal side effects. The purpose of this review is to inspect and analyze accessible data in order to fully realize the promise of precision oncology for rectal cancer patients.

Also flagged:OsteoarthritisOAjoint diseasesmembraneoxygentype I collagen
Journal Article 2022-05-11 ✓ 1 Snippet Mohd Yunus MH, Lee Y, Nordin A, Chua KH, Bt Hj Idrus R.
In-Text Gene Mentions

…factors, including SOX5,SOX6, SOX9, type II…

Show Full Abstract

Osteoarthritis (OA) is one of the leading joint diseases induced by abnormalities or inflammation in the synovial membrane and articular cartilage, causing severe pain and disability. Along with the cartilage malfunction, imbalanced oxygen uptake occurs, changing chondrocytes into type I collagen- and type X collagen-producing dedifferentiated cells, contributing to OA progression. However, mounting evidence suggests treating OA by inducing a hypoxic environment in the articular cartilage, targeting the inhibition of several OA-related pathways to bring chondrocytes into a normal state. This review discusses the implications of OA-diseased articular cartilage on chondrocyte phenotypes and turnover and debates the hypoxic mechanism of action. Furthermore, this review highlights the new understanding of OA, provided by tissue engineering and a regenerative medicine experimental design, modeling the disease into diverse 2D and 3D structures and investigating hypoxia and hypoxia-inducing biomolecules and potential cell therapies. This review also reports the mechanism of hypoxic regulation and highlights the importance of activating and stabilizing the hypoxia-inducible factor and related molecules to protect chondrocytes from mitochondrial dysfunction and apoptosis occurring under the influence of OA.

Also flagged:GangliosideGM3 SynthaseGangliosidesglycosphingolipidssialic acidssialyltransferase
Journal Article 2022-05-11 ✓ 1 Snippet Inamori KI, Inokuchi JI.
In-Text Gene Mentions

…(LacCerS, encoded byB4galt5or B4galt6 )…

Show Full Abstract

Gangliosides (glycosphingolipids containing one or more sialic acids) are highly expressed in neural tissues in vertebrates, and four species (GM1a, GD1a, GD1b, GT1b) are predominant in mammalian brains. GM3 is the precursor of each of these four species and is the major ganglioside in many nonneural tissues. GM3 synthase (GM3S), encoded by <i>ST3GAL5</i> gene in humans, is a sialyltransferase responsible for synthesis of GM3 from its precursor, lactosylceramide. <i>ST3GAL5</i> mutations cause an autosomal recessive form of severe infantile-onset neurological disease characterized by progressive microcephaly, intellectual disability, dyskinetic movements, blindness, deafness, intractable seizures, and pigment changes. Some of these clinical features are consistently present in patients with <i>ST3GAL5</i> mutations, whereas others have variable expression. GM3S knockout (KO) mice have deafness and enhanced insulin sensitivity, but otherwise do not display the above-described neurological defects reported in <i>ST3GAL5</i> patients. The authors present an overview of physiological functions and pathological aspects of gangliosides based on findings from studies of GM3S KO mice and discuss differential phenotypes of GM3S KO mice versus human GM3S-deficiency patients.

Also flagged:Naphthalenepolycyclic aromatic hydrocarbonscarbonoxygencompoundsbenzo(a)pyrene
Journal Article 2022-05-11 No Snippets Buss W, Hilber I, Graham MC, Mašek O.
Show Full Abstract

The content of polycyclic aromatic hydrocarbons (PAHs) in biochar has been studied extensively; however, the links between biomass feedstock, production process parameters, and the speciation of PAHs in biochar are understudied. Such an understanding is crucial, as the health effects of individual PAHs vary greatly. Naphthalene (NAP) is the least toxic of the 16 US EPA PAHs but comprises the highest proportion of PAHs in biochar. Therefore, we investigate which parameters favor high levels of non-NAP PAHs (∑16 US EPA PAHs without NAP) in a set of 73 biochars. On average, the content of non-NAP PAHs was 9 ± 29 mg kg<sup>-1</sup> (median 0.9 mg kg<sup>-1</sup>). Importantly, during the production of the biochars with the highest non-NAP PAH contents, the conditions in the post-pyrolysis area, where pyrolysis vapors and biochar are separated, favored condensation and deposition of PAHs on biochar. Under these conditions, NAP condensed to a lower degree because of its high vapor pressure. In biochars not contaminated through this process, the average non-NAP content was only 2 ± 3 mg kg<sup>-1</sup> (median 0.5 mg kg<sup>-1</sup>). Uneven heat distribution and vapor trapping during pyrolysis and cool zones in the post-pyrolysis area need to be avoided. This demonstrates that the most important factor yielding high contents of toxic PAHs in biochar was neither a specific pyrolysis parameter nor the feedstock but the pyrolysis unit design, which can be modified to produce clean and safe biochar.

Also flagged:tumornon-small cell lung carcinomaNSCLCALOX5APMIFPTPRC
Journal Article 2022-05-11 ✓ 1 Snippet Wu Z, Zhou J, Xiao Y, Ming J, Zhou J, Dong F, Zhou X, Xu Z, Zhao X, Lei P, Huang T.
In-Text Gene Mentions

…CD40, CD40LG, andTNFSF4.…

Show Full Abstract

<h4>Background</h4>As the indication for immunotherapy is rapidly expanding, it is crucial to accurately identify patients who are likely to respond. Infiltration of B cells into many tumor types correlates with a good response to immune checkpoint inhibitor (ICI) therapy. However, B cells' roles in the anti-tumor response are far from clear.<h4>Methods</h4>Based on single-cell transcriptomic data for ICI-treated patients, we identified a B-cell cluster [B<sub>IR</sub> (ICI-Responsive B) cells] and described the phenotype, cell-cell communication, biological processes, gene signature, and prognosis value of B<sub>IR</sub> cells through bioinformatic analysis, tissue immunofluorescence, and animal experiments. Surgery samples from 12 non-small cell lung carcinoma (NSCLC) patients with adjuvant checkpoint blockade were evaluated as external validation.<h4>Results</h4>B<sub>IR</sub> cells were identified as a subset of CD20<sup>+</sup>CD22<sup>+</sup>ADAM28<sup>+</sup> B cells with a memory phenotype. Bioinformatic analysis revealed that B<sub>IR</sub> cells had enhanced cell viability and epigenetic regulation, and that ALOX5AP, MIF, and PTPRC/CD45 expressed by myeloid cells may be critical coordinators of diverse biological processes of B<sub>IR</sub> cells. Immunofluorescence confirmed the presence of B<sub>IR</sub> cells in tertiary lymphoid structures (TLSs) in skin SCC, RCC, CRC, and breast cancer. B<sub>IR</sub>-associated gene signatures correlate with positive outcomes in patients with melanoma, glioblastoma, NSCLC, HNSCC, or RCC treated with ICI therapy, and B<sub>IR</sub>-cell density predicted NSCLC patients' response to checkpoint immunotherapy. In line with this, melanoma-bearing mice depleted of B<sub>IR</sub> cells were resistant to ICIs.<h4>Conclusions</h4>CD20<sup>+</sup>CD22<sup>+</sup>ADAM28<sup>+</sup> B<sub>IR</sub> cells were present in cancer-associated TLS and promoted the response to ICI therapy.

Also flagged:ATP7AACTHUbiquitinationsecretioncorticotroph adenomasvesicle
Journal Article 2022-05-11 ✓ 1 Snippet Zhao S, He Y, Wang H, Li D, Gong L, Zhang Y, Li C.
In-Text Gene Mentions

…MUL1, OSTM1, andRC3H1, with the confidence…

Show Full Abstract

Ubiquitination is reported to be a critical biological event on ACTH secretion in corticotroph adenomas. However, the effect of ubiquitylation on ACTH secretion in silent corticotroph adenomas (SCAs) remains unclear. The aim of our study was to explore the mechanism of decreased secretion of ACTH in SCAs with ubiquitinomics. The differently expressed ubiquitinated proteins between SCAs and functioning corticotroph adenomas (FCAs) were identified by 4D label-free mass spectrometer, followed by bioinformatics analysis. The function of the candidate ubiquitinated protein ATP7A (K333) was validated in AtT20 cells. A total of 111 ubiquitinated sites corresponding to 94 ubiquitinated proteins were typically different between SCAs and FCAs. Among all the ubiquitinated sites, 102 showed decreased ubiquitination in SCAs, which mapped to 85 ubiquitinated proteins. Pathway enrichment analysis revealed that ubiquitinated proteins were mainly enriched in vesicle pathway and protein secretion pathway. ATP7A (K333) was one of the proteins enriched in vesicle pathway and protein secretion pathway with decreased ubiquitination level in SCAs. <i>In vitro</i> assay indicated that both ATP7A siRNA and omeprazole (ATP7A protein inhibitor) increased the secretion of ACTH in AtT20 cell supernatant compared to control groups (p<0.05). These results indicated that ATP7A might be related to the abnormal expression of ACTH in SCAs and potential for the treatment of SCAs.

Also flagged:neurodegenerative diseasebehavioralHDskeletal muscle disordersfatty acidhereditary neurodegenerative disorder
Journal Article 2022-05-11 ✓ 2 Snippets Trovato B, Magrì B, Castorina A, Maugeri G, D'Agata V, Musumeci G.
In-Text Gene Mentions

…Huntingtin (HTT) protein is widely…

…the role ofHTTprotein in the…

Show Full Abstract

Huntington's disease (HD) is a rare, hereditary, and progressive neurodegenerative disease, characterized by involuntary choreatic movements with cognitive and behavioral disturbances. In order to mitigate impairments in motor function, physical exercise was integrated in HD rehabilitative interventions, showing to be a powerful tool to ameliorate the quality of life of HD-affected patients. This review aims to describe the effects of physical exercise on HD-related skeletal muscle disorders in both murine and human models. We performed a literature search using PubMed, Scopus, and Web of Science databases on the role of physical activity in mouse models of HD and human patients. Fifteen publications fulfilled the criteria and were included in the review. Studies performed on mouse models showed a controversial role played by exercise, whereas in HD-affected patients, physical activity appeared to have positive effects on gait, motor function, UHDMRS scale, cognitive function, quality of life, postural stability, total body mass, fatty acid oxidative capacity, and VO2 max. Physical activity seems to be feasible, safe, and effective for HD patients. However, further studies with longer follow-up and larger cohorts of patients will be needed to draw firm conclusions on the positive effects of exercise for HD patients.

Also flagged:Type 5 Metabotropic Glutamate ReceptorNeurodegenerative Diseasesneurodegenerative diseaseG protein-coupled receptormGlu 5amyotrophic lateral sclerosis
Journal Article 2022-05-11 ✓ 3 Snippets Budgett RF, Bakker G, Sergeev E, Bennett KA, Bradley SJ.
In-Text Gene Mentions

HD is caused by an inherited CAG trinucleotide repeat expansion in the gene that codes for the huntingtin protein (Htt), resulting in a mutant version of the protein that has an abnormally long polyglutamine repeat (mHtt) (MacDonald et al., 1993).

…the huntingtin protein (Htt), resulting in a…

…directly with bothHttand mHtt, and…

Show Full Abstract

The type 5 metabotropic glutamate receptor, mGlu<sub>5</sub>, has been proposed as a potential therapeutic target for the treatment of several neurodegenerative diseases. In preclinical neurodegenerative disease models, novel allosteric modulators have been shown to improve cognitive performance and reduce disease-related pathology. A common pathological hallmark of neurodegenerative diseases is a chronic neuroinflammatory response, involving glial cells such as astrocytes and microglia. Since mGlu<sub>5</sub> is expressed in astrocytes, targeting this receptor could provide a potential mechanism by which neuroinflammatory processes in neurodegenerative disease may be modulated. This review will discuss current evidence that highlights the potential of mGlu<sub>5</sub> allosteric modulators to treat neurodegenerative diseases, including Alzheimer's disease, Huntington's disease, Parkinson's disease, and amyotrophic lateral sclerosis. Furthermore, this review will explore the role of mGlu<sub>5</sub> in neuroinflammatory responses, and the potential for this G protein-coupled receptor to modulate neuroinflammation.

Also flagged:LRRC8A-Epore-formingvolume-regulated anion channelantibodyLRRC8Apore
Journal Article 2022-05-11 ✓ 1 Snippet Kasuya G, Nureki O.
In-Text Gene Mentions

…Members of theleucine-rich repeat-containing 8repeat-containing 8 (LRRC8)…

Show Full Abstract

Members of the leucine-rich repeat-containing 8 (LRRC8) protein family, composed of five LRRC8A-E isoforms, are pore-forming components of the volume-regulated anion channel (VRAC), which is activated by cell swelling and releases chloride ions (Cl<sup>-</sup>) or other osmolytes to counteract cell swelling. Although the LRRC8 protein family was identified as the molecular entity of VRAC only in 2014, due to recent advances in cryo-electron microscopy (cryo-EM), various LRRC8 structures, including homo-hexameric LRRC8A and LRRC8D structures, as well as inhibitor-bound and synthetic single-domain antibody-bound homo-hexameric LRRC8A structures, have been reported, thus extending our understanding of the molecular mechanisms of this protein family. In this review, we describe the important features of LRRC8 provided by these structures, particularly the overall architectures, and the suggested mechanisms underlying pore inhibition and allosteric modulation by targeting the intracellular leucine-rich repeat (LRR) domain.

Also flagged:MetabolismClear Cell Renal Cell Carcinomarenal cell carcinomagene expressiongrowth receptorcell cycle
Journal Article 2022-05-11 ✓ 1 Snippet Simon AG, Esser LK, Ellinger J, Ritter M, Kristiansen G, Muders MH, Mayr T, Toma MI.
In-Text Gene Mentions

…, PECAM1, SPARCL1,PCDH17, CDHR5 ).…

Show Full Abstract

The treatment of advanced renal cell carcinoma remains a challenge. To develop novel therapeutic approaches, primary cell cultures as an <i>in vitro</i> model are considered more representative than commercial cell lines. In this study, we analyzed the gene expression of previously established primary cell cultures of clear cell renal cell carcinoma by bulk (3'm)RNA sequencing and compared it to the tissue of origin. The objectives were the identification of dysregulated pathways under cell culture conditions. Furthermore, we assessed the suitability of primary cell cultures for studying crucial biological pathways, including hypoxia, growth receptor signaling and immune evasion. RNA sequencing of primary cell cultures of renal cell carcinoma and a following Enrichr database analysis revealed multiple dysregulated pathways under cell culture conditions. 444 genes were significantly upregulated and 888 genes downregulated compared to the tissue of origin. The upregulated genes are crucial in DNA repair, cell cycle, hypoxia and metabolic shift towards aerobic glycolysis. A downregulation was observed for genes involved in pathways of immune cell differentiation and cell adhesion. We furthermore observed that 7275 genes have a similar mRNA expression in cell cultures and in tumor tissue, including genes involved in the immune checkpoint signaling or in pathways responsible for tyrosine kinase receptor resistance. Our findings confirm that primary cell cultures are a representative tool for specified experimental approaches. The results presented in this study give further valuable insights into the complex adaptation of patient-derived cells to a new microenvironment, hypoxia and other cell culture conditions, which are often neglected in daily research, and allow new translational and therapeutic approaches.

Also flagged:gene expressiontranscription factorsmethylationnucleuscytoplasmmethyladenosine
Journal Article 2022-05-11 ✓ 1 Snippet Wang S, Zhang J, Ding Y, Zhang H, Wu X, Huang L, He J, Zhou J, Liu XM.
In-Text Gene Mentions

…to recruit thepolycomb repressiverepressive complex (PRC)…

Show Full Abstract

Long noncoding RNAs (lncRNAs) have emerged as vital regulators of gene expression during embryonic stem cell (ESC) self-renewal and differentiation. Here, we systemically analyzed the differentially regulated lncRNAs during ESC-derived cardiomyocyte (CM) differentiation. We established a perspicuous profile of lncRNA expression at four critical developmental stages and found that the differentially expressed lncRNAs were grouped into six distinct clusters. The cluster with specific expression in ESC enriches the largest number of lncRNAs. Investigation of lncRNA-protein interaction network revealed that they are not only controlled by classic key transcription factors, but also modulated by epigenetic and epitranscriptomic factors including N<sup>6</sup>-methyladenosine (m<sup>6</sup>A) effector machineries. A detailed inspection revealed that 28 out of 385 lncRNAs were modified by methylation as well as directly recruited by the nuclear m<sup>6</sup>A reader protein Ythdc1. Unlike other 27 non-coding transcripts, the ESC-specific lncRNA <i>Gm2379</i>, located in both nucleus and cytoplasm, becomes dramatically upregulated in response to the depletion of m<sup>6</sup>A or Ythdc1. Consistent with the role of m<sup>6</sup>A in cell fate regulation, depletion of <i>Gm2379</i> results in dysregulated expressions of pluripotent genes and crucial genes required for the formation of three germ layers. Collectively, our study provides a foundation for understanding the dynamic regulation of lncRNA transcriptomes during ESC differentiation and identifies the interplay between epitranscriptomic modification and key lncRNAs in the regulation of cell fate decision.

Also flagged:BevacizumabDocetaxelCisplatinCapecitabineGastric Cancerlocally advanced gastric cancer
Journal Article 2022-05-11 ✓ 5 Snippets Yu D, Wang Z, He T, Yang L.
In-Text Gene Mentions

The explanations might be that (1) BEV could inhibit the neovascularization and induce the regression of tumor blood vessels (16), meanwhile, chemotherapy exhibited the ability of anti-cancer cytotoxicity (27), therefore, BEV plus DCC might present a better anti-tumor effect; (2) BEV might enhance the chemosensitivity of gastric cancer cells via suppressing the VEGF- phosphatidylinositol 3 kinase/protein kinase B-survivin signaling cascade (28); thus, it combined with DCC could induce favorable outcomes.

…receive BEV plusDCCas a neoadjuvant…

…neoadjuvant BEV plusDCCin patients with…

…that BEV plusDCCas neoadjuvant therapy…

…numerically better thanDCCchemotherapy alone as…

Show Full Abstract

<h4>Background</h4>Bevacizumab (BEV) plus chemotherapy as a neoadjuvant regimen presents good efficacy in patients with locally advanced cancer. However, its role in patients with locally advanced gastric cancer (LAGC) is not clear. Thus, the study aimed to assess the efficacy and safety of neoadjuvant BEV plus chemotherapy in patients with LAGC.<h4>Methods</h4>Twenty resectable patients with LAGC who received BEV plus docetaxel/cisplatin/capecitabine (DCC) chemotherapy for 3 cycles with 21 days as one cycle as neoadjuvant regimen were involved. Besides, their treatment response, survival profiles, and adverse events were assessed.<h4>Results</h4>In total, two (10.0%), 9 (45.0%), 8 (40.0%), and 1 (5.0%) patients achieved complete remission, partial remission, stable disease, and progressive disease (PD) according to imaging evaluation, which resulted in 55.0% of objective response rate and 95.0% of disease control rate, respectively. Moreover, the number of patients with pathological response grades 1, 2, and 3 was 8 (40.0%), 8 (40.0%), and 3 (15.0%); while 1 (5.0%) patient did not receive surgery due to PD, thus the data of this patient was not assessable. Meanwhile, 18 (90.0%) patients achieved R0 resection. Regarding survival profile, the median disease-free survival or overall survival were both not reached. The 1-year, 2-, and 3-year disease-free survival rates were 88.8, 80.7, and 67.3%. Meanwhile, the 1-, 2-, and 3-year overall survival rates were 100.0%, 75.8%, and 75.8%, respectively. Additionally, the main adverse events were anemia (90.0%), alopecia (90.0%), leukopenia (70.0%), and anorexia (65.0%). Indeed, most adverse events were of grade 1 or 2 and were manageable.<h4>Conclusion</h4>Neoadjuvant BEV plus DCC chemotherapy presents a favorable pathological response and survival profile with acceptable safety in patients with LAGC.

Also flagged:chronic diseaseironcancerliver diseasesiron deficiencyanemia
Journal Article 2022-05-11 ✓ 1 Snippet Zhang L, Li H, Su S, Wood EM, Ma T, Sun Y, Guo L, Cheng Q, Gu X, Wu W, Wang L, Ding M, Zhang L, Shen Y, Yang J.
In-Text Gene Mentions

…may prevent cancer,hemochromatosis, and liver diseases…

Show Full Abstract

<h4>Purpose</h4>The Shaanxi Blood Donor Cohort was set up to investigate the impact of blood donation on the health of donors compared with non-blood donors. The specific aims of the study include (1) identifying the geographical and temporal trends of incidence for diseases in both blood donors and non-blood donors; (2) assessing the impact of environmental exposures, lifestyle, body mass index (BMI) and blood type on disease burdens, stratified between blood donors and non-blood donors; and (3) among blood donors, investigating if regular blood donation has a positive impact on donors' health profiles, based on a cohort with a mixed retrospective and prospective study design.<h4>Participants</h4>A total of 3.4 million adults, with an equal number and identical demographic characteristics (year of birth, sex and location of residence) of blood donors and non-blood donors, were enrolled on 2012. The one-to-one matching was conducted through a repeated random selection of individuals without any history of blood donation from the Shaanxi Electronic Health Records. The cohort has been so far followed up to the end of 2018, summing to nearly 24 million years of follow-up. The cohort will be followed up prospectively every 3 years until 2030.<h4>Findings to date</h4>Of the 1.7 million blood donors, 418,312 (24.5%) and 332,569 (19.5%) individuals were outpatients and inpatients, accounting for 1,640,483(96.2%) outpatient and 496,061 (29.1%) inpatient visits. Of the same number of non-blood donors, 407,798 (23.9%) and 346,097 (20.3%) individuals were hospital outpatients and inpatients, accounting for 1,655,725 (97.1%) outpatient and 562,337 (33.0%) inpatient visits. The number of outpatient and inpatient visits by non-blood donors was 0.9 and 3.9% higher than those of the blood donors (<i>p</i> < 0.01). Blood donors demonstrate significantly fewer inpatients visits than non-blood donors for major chronic disease categories (<i>p</i> < 0.01).<h4>Future plans</h4>We are currently exploring the long term benefits of blood donation on major chronic disease categories and multimorbidities in this large population cohort. The study results are adjusted by the "healthy donor effect." This cohort study will continue until 2030.

Also flagged:hydrogentripeptidesα-amino acidspeptidesα-amino acidsω-amino acids
Journal Article 2022-05-11 No Snippets Nandi SK, Sarkar R, Jaiswar A, Roy S, Haldar D.
Show Full Abstract

Canonically, protein β-hairpin motifs are stabilized by intramolecular hydrogen bonds. Here, we attempt to develop a rational design recipe for a miniature hairpin structure stabilized by hydrogen bonding as well as C-H···π interaction and try to understand how such a stabilization effect varies with different functional groups at each terminus. Database analysis shows that the α-amino acids with an aromatic side chain will not favor that kind of C-H···π stabilized hairpin structure. However, hybrid tripeptides with an N-terminal Boc-Trp-Aib corner residue and C-terminal aromatic ω-amino acids fold into the hairpin conformation with a central β-turn/open-turn that is reinforced by a C-H···π interaction. The CCDC database analysis further confirms that this C-H···π stabilized hairpin motif is general for Boc-protected tripeptides containing Aib in the middle and aromatic functionality at the C-terminus. The different α-amino acids like Leu/Ala/Phe/Pro/Ser at the N-terminus have a minor influence on the C-H···π interaction and stabilities of the folded structures in solid-state. However, the hybrid peptides exhibit different degrees of conformational heterogeneity both in the solid and solution phase, which is common for this kind of flexible small molecule. Conformational heterogeneity in the solution phase including the C-H···π stabilized β-hairpin structures are characterized by the molecular dynamics (MD) simulations explaining their plausible origin at an atomistic level.

Also flagged:FibromyalgiaDepressionchronic pain syndromepsychiatric disordersPathogenesisdopamine receptor
Journal Article 2022-05-11 ✓ 2 Snippets Yepez D, Grandes XA, Talanki Manjunatha R, Habib S, Sangaraju SL.
In-Text Gene Mentions

A polymorphism in the serotonin transporter (5-HTT) gene, involved in major depressive disorder (MDD), appears to be implicated in FM as well [33].

…the serotonin transporter (5-HTT) gene, involved in…

Show Full Abstract

Fibromyalgia (FM) is a chronic pain syndrome characterized by widespread, persistent pain that lasts more than three months without an evident organic lesion. FM has been considered controversial throughout history due to its validity as a diagnosis being constantly in question. Most patients diagnosed with FM are females. FM has been associated with multiple conditions, including irritable bowel and psychiatric disorders. Among all associated conditions, depression has been frequently found in patients with FM. Studies suggest that depression negatively affects the outcome of patients with FM. Moreover, a bidirectional relation between FM and depression has been depicted: depression increases the risk of FM being diagnosed later in life, as well as FM increases the risk of developing depression. In this article, we discussed aspects that FM and depression share and that might link both diseases, such as certain elements they seem to share in their pathophysiology: predisposing and triggering factors, central sensitization and kindling, areas of the brain implicated in both pain modulation and mood regulation, and hypothalamic-pituitary-adrenal axis (HPA axis) alterations. In addition, we highlighted the prevalence of depression in patients with FM, overlapping symptoms between FM and depression and how to assess them, and treatment strategies that have shown effective management of both conditions when concomitant. Due to the improvement of many aspects of FM when depression is appropriately targeted, screening for depression in patients with FM, despite its difficulty, has been encouraged.

Also flagged:tumour necrosis factor alpha induced protein 3auto-inflammatory diseaseautoimmune lupus nephritispolymeraseautoimmune haemolytic anaemiaautoantibodies
Journal Article 2022-05-11 No Snippets Zhang C, Han X, Sun L, Yang S, Peng J, Chen Y, Jin Y, Xu F, Liu Z, Zhou Q.
Show Full Abstract

<h4>Background</h4>Heterozygous loss-of-function mutations in the tumour necrosis factor alpha induced protein 3 (<i>TNFAIP3</i>) gene cause an early-onset auto-inflammatory disease named haploinsufficiency of A20 (HA20). Here we describe three unrelated patients with autoimmune lupus nephritis (LN) phenotypes carrying three novel mutations in the <i>TNFAIP3</i> gene.<h4>Methods</h4>Whole-exome sequencing (WES) was used to identify the causative mutations in three biopsy-proven LN patients. Sanger sequencing and quantitative polymerase chain reaction (qPCR) were used to validate the mutations identified by WES. RNA sequencing, qPCR and cytometric bead array was used to detect inflammatory signatures in the patients.<h4>Results</h4>The patients predominantly presented with an autoimmune phenotype, including autoimmune haemolytic anaemia, multipositive autoantibodies and LN. Additionally, novel phenotypes of allergy and pericardial effusion were first reported. WES identified three novel heterozygous mutations in the <i>TNFAIP3</i> gene, including a novel splicing mutation located in the canonical splicing site (c.634+2T>C) resulting in an intron 4 insertion containing a premature stop codon, a <i>de novo</i> novel copy number variation (exon 7-8 deletion) and a novel nonsense mutation c.1300_1301delinsTA causing a premature stop codon. We further identified hyperactivation signatures of nuclear factor- kappa B and type I IFN signalling and overproduction of pro-inflammatory cytokines in the blood. This report expanded the phenotype to a later age, as two girls were diagnosed at age 3 years and one man at age 29 years.<h4>Conclusions</h4>Kidney involvement may be the main feature of the clinical spectrum of HA20, even in adults. Genetic screening should be considered for early-onset LN patients.

Research Square 2022-05-11 Preprint (No Snippets API) Hamilton OS, Steptoe A, Ajnakina O.
Show Full Abstract

<title>Abstract</title> <p>Background. Suboptimal sleep durations and depression frequently cooccur. Short-sleep and long-sleep are commonly thought of as symptoms of depression, but a growing literature suggest that they may be prodromal. While each represents a process of mutual influence, directionality between them remains unclear. Using polygenetic scores (PGS), we investigate the prospective direction involved in suboptimal sleep durations and depression symptoms. Methods. Participants aged ≥ 50 were recruited from the English Longitudinal Study of Ageing (ELSA). PGS for sleep duration, short-sleep, and long-sleep were calculated using summary statistics data from the UK Biobank cohort. Sleep duration, categorised into short-sleep (“≤5hrs”), optimal-sleep (“>5-<9hrs”), and long-sleep (“≥9hrs”), was measured at baseline and across an average 8-year follow-up. Severe depression symptoms (measured with Centre for Epidemiological Studies Depression Scale) were also ascertained at baseline and across an average 8-year follow-up. Results. One standard deviation increase in PGS for short-sleep was associated with 14% higher odds of severe depression symptoms onset (95%CI = 1.03–1.25, <italic>p</italic> = 0.008). However, PGS for sleep duration (OR = 0.92, 95%CI = 0.84-1.00, p = 0.053) and long-sleep (OR = 0.97, 95%CI = 0.89–1.06, p = 0.544) were not associated with severe depression symptoms onset during follow-up. During the same period, PGS for depression was not associated with overall sleep duration, short-sleep, or long-sleep. Conclusion. Polygenetic predisposition to short-sleep was associated with severe depression symptoms onset over the average 8-year period. However, polygenic predisposition to depression was not associated with overall sleep duration, short-sleep or long-sleep, suggesting that different mechanisms underlie the relationship between depression and the subsequent onset of suboptimal sleep durations in older adults.</p>

bioRxiv 2022-05-11 Preprint (No Snippets API) Tshilenge K, Aguirre CG, Bons J, Basisty N, Song S, Rose J, Lopez-Ramirez A, Gerencser A, Naphade S, Loureiro A, Wehrfritz C, Holtz A, Mooney S, Schilling B, Ellerby LM.
Show Full Abstract

<h4>ABSTRACT</h4> Huntington’s disease (HD) is a neurodegenerative disease caused by a CAG repeat expansion in the Huntingtin ( HTT ) gene. The resulting polyglutamine (polyQ) tract alters the function of the HTT protein. Although HTT is expressed in different tissues, the medium spiny projection neurons (MSNs) in the striatum are particularly vulnerable in HD. Thus, we sought to define the proteome of human HD patient-derived MSNs. We differentiated HD72 induced pluripotent stem cells and isogenic controls into MSNs and carried out quantitative proteomic analysis by two approaches. First, using data-dependent acquisitions with FAIMS (FAIMS-DDA) for label-free quantification on the Orbitrap Lumos mass spectrometer, we identified 6,323 proteins with at least two unique peptides (FDR ≤ 0.01). Of these, 901 proteins were significantly altered in the HD72-MSNs, compared to isogenic controls. Second, we quantitatively validated protein candidates by comprehensive data-independent acquisitions on a TripleTOF 6600 mass spectrometer quantifying 3,106 proteins with at least two unique peptides. Functional enrichment analysis identified pathways related to the extracellular matrix, including TGF-ý regulation of extracellular matrix, epithelial-mesenchymal transition, DNA replication, senescence, cardiovascular system, organism development, regulation of cell migration and locomotion, aminoglycan glycosaminoglycan proteoglycan, growth factor stimulus and fatty acid processes. Conversely, processes associated with the downregulated proteins included neurogenesis-axogenesis, the brain-derived neurotrophic factor-signaling pathway, Ephrin-A: EphA pathway, regulation of synaptic plasticity, triglyceride homeostasis cholesterol, plasmid lipoprotein particle immune response, interferon-γ signaling, immune system major histocompatibility complex, lipid metabolism and cellular response to stimulus. Moreover, proteins involved in the formation and maintenance of axons, dendrites, and synapses (e.g., Septin protein members) are dysregulated in HD72-MSNs. Importantly, lipid metabolism pathways were altered, and we found that lipid droplets accumulated in the HD72-MSNs, suggesting a deficit in lipophagy. Our proteomics analysis of HD72-MSNs identified relevant pathways that are altered in MSNs and confirm current and new therapeutic targets for HD.

Also flagged:mesotheliomaMalignant mesotheliomatumourmesothelial neoplasmsmethylthioadenosine phosphorylaseMTAP
Journal Article 2022-05-10 ✓ 5 Snippets Anderson WJ, Sholl LM, Fletcher CDM, Schulte S, Wang LJ, Maclean FM, Hirsch MS.
In-Text Gene Mentions

SOX6 was positive in nine of 11 (82%) MMs and negative in all MUMPs and adenomatoid tumours.<h4>Conclusions</h4>Testicular MM exhibit a similar mutational profile to those of the pleura/peritoneum; however, alterations in CDKN2A and BAP1 are less common.

SOX6 is sensitive for MM; accordingly, the presence of SOX6 expression argues against a benign neoplastic process.

Thirteen adenomatoid tumours were also assessed with SOX6.

…transcription factor 6 (SOX6).…

…also assessed withSOX6.…

Show Full Abstract

<h4>Aims</h4>Malignant mesothelioma (MM) of the tunica vaginalis (TV) is a rare and aggressive tumour, and the molecular features and staining profile with contemporary immunohistochemical (IHC) biomarkers are largely unexplored. We characterise the clinicopathological, molecular and IHC features of MM (n = 13) and mesothelial neoplasms of uncertain malignant potential (MUMP) (n = 4).<h4>Methods and results</h4>Targeted next-generation sequencing was performed on seven MMs and two MUMPs. IHC was performed for methylthioadenosine phosphorylase (MTAP), BRCA1-associated protein 1 (BAP1) and SRY-box transcription factor 6 (SOX6). Thirteen adenomatoid tumours were also assessed with SOX6. MM were epithelioid (seven of 13) or biphasic (six of 13). In MM, NF2 (five of seven; 71%), CDKN2A (three of seven; 43%) and BAP1 (two of seven; 29%) were most frequently altered. Non-recurrent driver events were identified in PTCH1 and TSC1. In contrast, none of these alterations were identified in MUMPs; however, one MUMP harboured a TRAF7 missense mutation. By IHC, loss of MTAP (two of 12; 17%) and BAP1 (two of nine; 22%) was infrequent in MM, whereas both were retained in the MUMPs. SOX6 was positive in nine of 11 (82%) MMs and negative in all MUMPs and adenomatoid tumours.<h4>Conclusions</h4>Testicular MM exhibit a similar mutational profile to those of the pleura/peritoneum; however, alterations in CDKN2A and BAP1 are less common. These findings suggest that although MTAP and BAP1 IHC are specific for MM, their sensitivity in testicular MMs appears lower. In addition, rare tumours may harbour targetable alterations in driver genes (PTCH1 and TSC1) that are unusual in MMs at other anatomical sites. SOX6 is sensitive for MM; accordingly, the presence of SOX6 expression argues against a benign neoplastic process.

Also flagged:Proton pumphereditary anemiaIronhereditary anemiasesomeprazoleoverload
Journal Article 2022-05-10 ✓ 2 Snippets van Vuren A, Kerkhoffs JL, Schols S, Rijneveld A, Nur E, Peereboom D, Gandon Y, Welsing P, van Wijk R, Schutgens R, van Solinge W, Marx J, Leiner T, Biemond B, van Beers E.
In-Text Gene Mentions

…inhibition for secondaryhemochromatosisin hereditary anemia:…

…(PPI in secondaryhemochromatosis).…

Show Full Abstract

Iron overload is a severe general complication of hereditary anemias. Treatment with iron chelators is hampered by important side-effects, high costs, and the lack of availability in many countries with a high prevalence of hereditary anemias. In this phase III randomized placebo-controlled trial, we assigned adults with non-transfusion-dependent hereditary anemias with mild-to-moderate iron overload to receive esomeprazole (at a dose of 40 mg twice daily) or placebo for 12 months in a cross-over design. The primary end point was change of liver iron content measured by MRI. A total of 30 participants were enrolled in the trial. Treatment with esomeprazole resulted in a statistically significant reduction in liver iron content that was 0.55 mg Fe/g dw larger than after treatment with placebo (95%CI [0.05 to 1.06]; p = 0.03). Median baseline liver iron content at the start of esomeprazole was 4.99 versus 4.49 mg Fe/g dw at start of placebo. Mean delta liver iron content after esomeprazole treatment was -0.57 (SD 1.20) versus -0.11 mg Fe/g dw (SD 0.75) after placebo treatment. Esomeprazole was well tolerated, reported adverse events were mild and none of the patients withdrew from the study due to side effects. In summary, esomeprazole resulted in a significant reduction in liver iron content when compared to placebo in a heterogeneous group of patients with non-transfusion-dependent hereditary anemias. From an international perspective this result can have major implications given the fact that proton pump inhibitors may frequently be the only realistic therapy for many patients without access to or not tolerating iron chelators.

Also flagged:FMRPRAC1acral melanomacutaneous melanomamalignant tumormelanoma
Journal Article 2022-05-10 No Snippets Shang Q, Du H, Wu X, Guo Q, Zhang F, Gong Z, Jiao T, Guo J, Kong Y.
Show Full Abstract

<h4>Background</h4>Melanoma is a type of malignant tumor with high aggressiveness and poor prognosis. At present, metastasis of melanoma is still an important cause of death in melanoma patients. However, the potential functions and molecular mechanisms of most circular RNAs (circRNAs) in melanoma metastasis remain unknown.<h4>Methods</h4>circRNAs dysregulated in melanoma cell subgroups with different metastatic abilities according to a screening model based on repeated Transwell assays were identified with a circRNA array. The expression and prognostic significance of circZNF609 in skin cutaneous melanoma and acral melanoma cells and tissues were determined by qRT-PCR, nucleoplasmic separation assays and fluorescence in situ hybridization. In vitro wound healing, Transwell and 3D invasion assays were used to analyse melanoma cell metastasis ability. Tail vein injection and intrasplenic injection were used to study in vivo lung metastasis and liver metastasis, respectively. The mechanism of circZNF609 was further evaluated via RNA immunoprecipitation, RNA pull-down, silver staining, and immunofluorescence colocalization assays.<h4>Results</h4>circZNF609 was stably expressed at low levels in melanoma tissues and cells and was negatively correlated with Breslow depth, clinical stage and prognosis of melanoma patients. circZNF609 inhibited metastasis of acral and cutaneous melanoma in vivo and in vitro. Mechanistically, circZNF609 promoted the binding of FMRP protein and RAC1 mRNA, thereby enhancing the inhibitory effect of FMRP protein on the stability of RAC1 mRNA and ultimately inhibiting melanoma metastasis.<h4>Conclusions</h4>Our findings revealed that circZNF609 plays a vital role in the metastasis of acral and cutaneous melanoma through the circRNF609-FMRP-RAC1 axis and indicated that circZNF609 regulates the stability of RAC1 mRNA by combining with FMRP, which might provide insight into melanoma pathogenesis and a new potential target for treatment of melanoma.

Also flagged:autophagycancerorganelleenzymesmetabolismMacroautophagy
Journal Article 2022-05-10 No Snippets Russell RC, Guan KL.
Show Full Abstract

Autophagy is a cellular degradative pathway that plays diverse roles in maintaining cellular homeostasis. Cellular stress caused by starvation, organelle damage, or proteotoxic aggregates can increase autophagy, which uses the degradative capacity of lysosomal enzymes to mitigate intracellular stresses. Early studies have shown a role for autophagy in the suppression of tumorigenesis. However, work in genetically engineered mouse models and in vitro cell studies have now shown that autophagy can be either cancer-promoting or inhibiting. Here, we summarize the effects of autophagy on cancer initiation, progression, immune infiltration, and metabolism. We also discuss the efforts to pharmacologically target autophagy in the clinic and highlight future areas for exploration.

Also flagged:graphenenanodiamondssilica nanoparticlesplatelet aggregationgraphene oxidealbumin
Journal Article 2022-05-10 No Snippets Zadeh Mehrizi T, Shafiee Ardestani M.
Show Full Abstract

Despite the importance of the proper quality of blood products for safe transfusion, conventional methods for preparation and their preservation, they lack significant stability. Non-metal nanoparticles with particular features may overcome these challenges. This review study for the first time provided a comprehensive vision of the interaction of non-metal nanoparticles with each blood product (red blood cells, platelets and plasma proteins). The findings of this review on the most effective nanoparticle for improving the stability of RBCs indicate that graphene quantum dots and nanodiamonds show compatibility with RBCs. For increasing the stability of platelet products, silica nanoparticles exhibited a suppressive impact on platelet aggregation. Pristine graphene also shows compatibility with platelets. For better stability of plasma products, graphene oxide was indicated to preserve free human serum albumin from thermal shocks at low ionic strength. For increased stability of Factor VIII, mesoporous silica nanoparticles with large pores exhibit the superb quality of recovered proteins. Furthermore, 3.2 nm quantum dots exhibited anticoagulant effects. As the best promising nanoparticles for immunoglobulin stability, graphene quantum dots showed compatibility with γ-globulins. Overall, this review recommends further research on the mentioned nanoparticles as the most potential candidates for enhancing the stability and storage of blood components.

Also flagged:schizophreniacalcium ion channelcalcium ion channelscalcium channelmental disorderhallucinations
Journal Article 2022-05-10 No Snippets Toyama M, Takasaki Y, Branko A, Kimura H, Kato H, Nawa Y, Kushima I, Ishizuka K, Shimamura T, Ogi T, Ozaki N.
Show Full Abstract

<h4>Background</h4>Most sequencing studies of schizophrenia (SCZ) have focused on de novo genetic variants due to interpretability. However, investigating shared rare variants among patients in the same multiplex family is also important. Relatively large-scale analyses of SCZ multiplex families have been done in Caucasian populations, but whether detected variants are also pathogenic in the Japanese population is unclear because of ethnic differences in rare variants.<h4>Materials and methods</h4>We performed whole-exome sequencing (WES) of 14 Japanese SCZ multiplex families. After quality control and filtering, we identified rare variants shared among affected persons within the same family. A gene ontology (GO) analysis was performed to identify gene categories possibly affected by these candidate variants.<h4>Results</h4>We found 530 variants in 486 genes as potential candidate variants from the 14 SCZ multiplex families examined. The GO analysis demonstrated significant enrichment in calcium channel activity.<h4>Conclusion</h4>This study provides supporting evidence that calcium ion channel activity is involved in SCZ. WES of multiplex families is a potential means of identifying disease-associated rare variants for SCZ.

Also flagged:AutophagyPDGFRαinflammatory bowel diseasesdeathAtg5Wnt
Journal Article 2022-05-10 ✓ 5 Snippets Yang Y, Gomez M, Marsh T, Poillet-Perez L, Sawant A, Chen L, Park NR, Jackson SR, Hu Z, Alon N, Liu C, Debnath J, Guan JL, Davidson S, Verzi M, White E.
In-Text Gene Mentions

…marker Olfactomedin 4 (OLFM4) revealed almost complete…

…Immunofluorescence (IF) forOLFM4and p62 showed…

…aggregates colocalized withOLFM4in the Atg5…

…Combined IF forOLFM4and terminal deoxynucleotidyl…

…TUNEL colocalization withOLFM4in the Atg5…

Show Full Abstract

Autophagy defects are a risk factor for inflammatory bowel diseases (IBDs) through unknown mechanisms. Whole-body conditional deletion of autophagy-related gene (Atg) Atg7 in adult mice (Atg7Δ/Δ) causes tissue damage and death within 3 mo due to neurodegeneration without substantial effect on intestine. In contrast, we report here that whole-body conditional deletion of other essential Atg genes Atg5 or Fip200/Atg17 in adult mice (Atg5Δ/Δ or Fip200Δ/Δ) caused death within 5 d due to rapid autophagy inhibition, elimination of ileum stem cells, and loss of barrier function. Atg5Δ/Δ mice lost PDGFRα+ mesenchymal cells (PMCs) and Wnt signaling essential for stem cell renewal, which were partially rescued by exogenous Wnt. Matrix-assisted laser desorption ionization coupled to mass spectrometry imaging (MALDI-MSI) of Atg5Δ/Δ ileum revealed depletion of aspartate and nucleotides, consistent with metabolic insufficiency underlying PMC loss. The difference in the autophagy gene knockout phenotypes is likely due to distinct kinetics of autophagy loss, as deletion of Atg5 more gradually extended lifespan phenocopying deletion of Atg7 or Atg12. Thus, autophagy is required for PMC metabolism and ileum stem cell and mammalian survival. Failure to maintain PMCs through autophagy may therefore contribute to IBD.

Also flagged:chronic infectionstype 2 cytokinetissuehelminth infectionsimmune responsessecretion
Journal Article 2022-05-10 No Snippets Inclan-Rico JM, Rossi HL, Herbert DR.
Show Full Abstract

Helminths are remarkably successful parasites that can invade various mammalian hosts and establish chronic infections that can go unnoticed for years despite causing severe tissue damage. To complete their life cycles, helminths migrate through multiple barrier sites that are densely populated by a complex array of hematopoietic and non-hematopoietic cells. While it is clear that type 2 cytokine responses elicited by immune cells promote worm clearance and tissue healing, the actions of non-hematopoietic cells are increasingly recognized as initiators, effectors and regulators of anti-helminth immunity. This review will highlight the collective actions of specialized epithelial cells, stromal niches, stem, muscle and neuroendocrine cells as well as peripheral neurons in the detection and elimination of helminths at mucosal sites. Studies dissecting the interactions between immune and non-hematopoietic cells will truly provide a better understanding of the mechanisms that ensure homeostasis in the context of helminth infections.

Also flagged:TrimetazidineCardiac Fibrosisischemic cardiomyopathyconnective tissue growth factorCTGFendothelin-1
Journal Article 2022-05-10 ✓ 1 Snippet El-Khodary NM, Ghoneim AI, El-Tayaar AA, El-Touny EM.
In-Text Gene Mentions

…such as hepatitis,hemochromatosis, and Wilson disease;…

Show Full Abstract

<h4>Background</h4>Previous studies have shown that Trimetazidine (TMZ) improves vascular endothelial function and reduces the inflammatory process progression. However, limited data have been available regarding its effects on myocardial fibrosis following ischemia and causing left ventricular dysfunction.<h4>Purpose</h4>To investigate the impact of TMZ adjuvant therapy for ischemic cardiomyopathy (ICM) on cardiac fibrosis, vascular endothelial function, inflammation, and myocardial functions.<h4>Methods</h4>This randomized, double-blind controlled clinical trial included 48 patients (aged 59.4 ± 9 years) with ICM who were randomly assigned to two groups: TMZ 35 mg twice daily and placebo in addition to conventional ICM medications. All patients received the tablets for 3 months. Both groups were then compared in terms of connective tissue growth factor (CTGF), endothelin-1 (ET-1), tumor necrosis factor-alpha (TNF-α), and some echocardiographic indices, weekly angina attacks and nitrate consumption before and after treatment.<h4>Results</h4>No significant differences between CTGF, ET-1, and TNF-α levels, in addition to some echocardiographic indices, were observed between both groups before treatment. After treatment, the TMZ group had significantly lower ET-1 than the placebo group, with both groups exhibiting a substantial decrease in TNF-α and CTGF. The TMZ group had lower mean ± SD levels for TNF-α and CTGF and showed significant improvement in echocardiographic indices and weekly angina attacks after treatment.<h4>Conclusion</h4>Adjunctive TMZ therapy for ICM effectively improved vascular endothelial function and reduced inflammation. Furthermore, our exploratory findings may be used to provide new information on the potential effects of TMZ on myocardial fibrosis by downregulating CTGF.

Also flagged:glioblastomaGBMtumorstumorneurogenesisp300
Journal Article 2022-05-10 ✓ 2 Snippets Shafi O, Siddiqui G.
In-Text Gene Mentions

Other SOX including Sox5, Sox6, and Sox17 also contribute to GBM.

…SOX including Sox5,Sox6, and Sox17 also…

Show Full Abstract

<h4>Background</h4>Glioblastoma is one of the most aggressive tumors. The etiology and the factors determining its onset are not yet entirely known. This study investigates the origins of GBM, and for this purpose, it focuses primarily on developmental gliogenic processes. It also focuses on the impact of the related neurogenic developmental processes in glioblastoma oncogenesis. It also addresses why glial cells are at more risk of tumor development compared to neurons.<h4>Methods</h4>Databases including PubMed, MEDLINE, and Google Scholar were searched for published articles without any date restrictions, involving glioblastoma, gliogenesis, neurogenesis, stemness, neural stem cells, gliogenic signaling and pathways, neurogenic signaling and pathways, and astrocytogenic genes.<h4>Results</h4>The origin of GBM is dependent on dysregulation in multiple genes and pathways that accumulatively converge the cells towards oncogenesis. There are multiple layers of steps in glioblastoma oncogenesis including the failure of cell fate-specific genes to keep the cells differentiated in their specific cell types such as p300, BMP, HOPX, and NRSF/REST. There are genes and signaling pathways that are involved in differentiation and also contribute to GBM such as FGFR3, JAK-STAT, and hey1. The genes that contribute to differentiation processes but also contribute to stemness in GBM include notch, Sox9, Sox4, c-myc gene overrides p300, and then GFAP, leading to upregulation of nestin, SHH, NF-κB, and others. GBM mutations pathologically impact the cell circuitry such as the interaction between Sox2 and JAK-STAT pathway, resulting in GBM development and progression.<h4>Conclusion</h4>Glioblastoma originates when the gene expression of key gliogenic genes and signaling pathways become dysregulated. This study identifies key gliogenic genes having the ability to control oncogenesis in glioblastoma cells, including p300, BMP, PAX6, HOPX, NRSF/REST, LIF, and TGF beta. It also identifies key neurogenic genes having the ability to control oncogenesis including PAX6, neurogenins including Ngn1, NeuroD1, NeuroD4, Numb, NKX6-1 Ebf, Myt1, and ASCL1. This study also postulates how aging contributes to the onset of glioblastoma by dysregulating the gene expression of NF-κB, REST/NRSF, ERK, AKT, EGFR, and others.

Also flagged:TRIP13NedaplatinEsophageal Squamous Cell CarcinomaThyroid hormone receptor interactor 13cancerESCC
Journal Article 2022-05-10 No Snippets Zhang LT, Ke LX, Wu XY, Tian HT, Deng HZ, Xu LY, Li EM, Long L.
Show Full Abstract

Thyroid hormone receptor interactor 13 (TRIP13) plays a crucial role in poor prognosis and chemotherapy resistance of cancer patients. This present study is aimed at investigating the role of high expression of TRIP13 inducing nedaplatin (NDP) resistance in esophageal squamous cell carcinoma (ESCC) cells. High expression of TRIP13 promoted the proliferation and migration of ESCC cells performed by MTS assay, colony formation assay, wound healing assay, and transwell assay. High TRIP13 expression induced NDP resistance to ESCC based on the cell proliferation promoting/inhibition rate and cell migration promoting/inhibition rate analysis, flow cytometry assay of apoptotic subpopulations with a combination of Annexin V-FITC and propidium iodide, and Western blot analysis downregulating cleaved PARP, <i>γ</i>H2A.X, cleaved caspase-3, and Bax and upregulating Bcl-2 expression. This study indicated that high expression of TRIP13 promoted proliferation and migration of ESCC cells and induced NDP resistance via enhancing repair of DNA damage and inhibiting apoptosis. This will provide a preliminary reference for the clinical use of NDP in ESCC treatment.

Also flagged:ankylosing spondylitisASgene expressionHUBpathogenesischronic inflammatory disease
Journal Article 2022-05-10 No Snippets Feng R, Lu M, Liu L, Xu K, Xu P.
Show Full Abstract

This study aimed to identify susceptibility genes and pathways associated with ankylosing spondylitis (AS) by integrating whole transcriptome-wide association study (TWAS) analysis and mRNA expression profiling data. AS genome-wide association study (GWAS) summary data from the large GWAS database were used. This included data of 1265 AS patients and 452264 controls. A TWAS of AS was conducted using these data. The analysis software used was FUSION, and Epstein-Barr virus-transformed lymphocytes, transformed fibroblasts, peripheral blood, and whole blood were used as gene expression references. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed for the important genes identified <i>via</i> TWAS. Protein-protein interaction (PPI) network analysis based on the STRING database was also performed to detect genes shared by TWAS and mRNA expression profiles in AS. TWAS identified 920 genes (P <0.05) and analyzed mRNA expression profiles to obtain 1183 differential genes. Following comparison of the TWAS results and mRNA expression characteristics, we obtained 70 overlapping genes and performed GO and KEGG enrichment analyses of these genes to obtain 16 pathways. <i>Via</i> PPI network analysis, we obtained the protein interaction network and performed MCODE analysis to acquire the HUB genes. Similarly, we performed GO and KEGG analyses on the genes identified by TWAS, obtained 98 pathways after screening, and analyzed protein interactions <i>via</i> the PPI network. Through the integration of TWAS and mRNA expression analysis, genes related to AS and GO and KEGG terms were determined, providing new evidence and revealing the pathogenesis of AS. Our AS TWAS work identified novel genes associated with AS, as well as suggested potential tissues and pathways of action for these TWAS AS genes, providing a new direction for research into the pathogenesis of AS.

Also flagged:Sepsisimmune depressionnosocomial infectiondeathimmune paralysisimmune responses
Journal Article 2022-05-10 ✓ 1 Snippet Yao RQ, Ren C, Zheng LY, Xia ZF, Yao YM.
In-Text Gene Mentions

Moreover, consecutive studies revealed that the increased representation of olfactomedin-4 (OLFM4)+ neutrophils was significantly associated with a high risk of short-term mortality in sepsis and septic shock patients (95, 96).

Show Full Abstract

Sepsis represents a life-threatening organ dysfunction due to an aberrant host response. Of note is that majority of patients have experienced a severe immune depression during and after sepsis, which is significantly correlated with the occurrence of nosocomial infection and higher risk of in-hospital death. Nevertheless, the clinical sign of sepsis-induced immune paralysis remains highly indetectable and ambiguous. Given that, specific yet robust biomarkers for monitoring the immune functional status of septic patients are of prominent significance in clinical practice. In turn, the stratification of a subgroup of septic patients with an immunosuppressive state will greatly contribute to the implementation of personalized adjuvant immunotherapy. In this review, we comprehensively summarize the mechanism of sepsis-associated immunosuppression at the cellular level and highlight the recent advances in immune monitoring approaches targeting the functional status of both innate and adaptive immune responses.

Also flagged:MefloquinePapain-Like Protease-inhibitionInfectionsCOVID-19viral genome
Journal Article 2022-05-10 No Snippets Kulandaisamy R, Kushwaha T, Dalal A, Kumar V, Singh D, Baswal K, Sharma P, Praneeth K, Jorwal P, Kayampeta SR, Sharma T, Maddur S, Kumar M, Kumar S, Polamarasetty A, Singh A, Sehgal D, Gholap SL, Appaiahgari MB, Katika MR, Inampudi KK.
Show Full Abstract

The pandemic caused by SARS-CoV-2 (SCoV-2) has impacted the world in many ways and the virus continues to evolve and produce novel variants with the ability to cause frequent global outbreaks. Although the advent of the vaccines abated the global burden, they were not effective against all the variants of SCoV-2. This trend warrants shifting the focus on the development of small molecules targeting the crucial proteins of the viral replication machinery as effective therapeutic solutions. The PLpro is a crucial enzyme having multiple roles during the viral life cycle and is a well-established drug target. In this study, we identified 12 potential inhibitors of PLpro through virtual screening of the FDA-approved drug library. Docking and molecular dynamics simulation studies suggested that these molecules bind to the PLpro through multiple interactions. Further, IC<sub>50</sub> values obtained from enzyme-inhibition assays affirm the stronger affinities of the identified molecules for the PLpro. Also, we demonstrated high structural conservation in the catalytic site of PLpro between SCoV-2 and Human Coronavirus 229E (HCoV-229E) through molecular modelling studies. Based on these similarities in PLpro structures and the resemblance in various signalling pathways for the two viruses, we propose that HCoV-229E is a suitable surrogate for SCoV-2 in drug-discovery studies. Validating our hypothesis, Mefloquine, which was effective against HCoV-229E, was found to be effective against SCoV-2 as well in cell-based assays. Overall, the present study demonstrated Mefloquine as a potential inhibitor of SCoV-2 PLpro and its antiviral activity against SCoV-2. Corroborating our findings, based on the <i>in vitro</i> virus inhibition assays, a recent study reported a prophylactic role for Mefloquine against SCoV-2. Accordingly, Mefloquine may further be investigated for its potential as a drug candidate for the treatment of COVID.

Also flagged:Gliomamalignant diseasescancerpyroptosistumortumors
Journal Article 2022-05-10 ✓ 1 Snippet Ma S, Wang F, Wang N, Jin J, Yan X, Wang L, Zheng X, Hu S, Du J.
In-Text Gene Mentions

…TNFRSF15 , andTNFSF4were upregulated in…

Show Full Abstract

Glioma is one of the most human malignant diseases and the leading cause of cancer-related deaths worldwide. Nevertheless, the present stratification systems do not accurately predict the prognosis and treatment benefit of glioma patients. Currently, no comprehensive analyses of multi-omics data have been performed to better understand the complex link between pyroptosis and immune. In this study, we constructed four pyroptosis immune subgroups by pyroptosis regulators and obtained nine pyroptosis immune signatures by analyzing the differentially expressed genes between the four pyroptosis immune subgroups. Nine novel pyroptosis immune signatures were provided for assessing the complex heterogeneity of glioma by the analyses of multi-omics data. The pyroptosis immune prognostic model (PIPM) was constructed by pyroptosis immune signatures, and the PIPM risk score was established for glioma cohorts with a total of 1716 samples. Then, analyses of the tumor microenvironment revealed an unanticipated correlation of the PIPM risk score with stemness, immune checkpoint expression, infiltrating the immune system, and therapy response in glioma. The low PIPM risk score patients had a better response to immunotherapy and showed sensitivity to radio-chemotherapy. The results of the pan-cancer analyses revealed the significant correlation between the PIPM risk score and clinical outcome, immune infiltration, and stemness. Taken together, we conclude that pyroptosis immune signatures may be a helpful tool for overall survival prediction and treatment guidance for glioma and other tumors patients.

Also flagged:ExtracellularAtherosclerosisASdeathsecretionExtracellular vesicles
Journal Article 2022-05-10 ✓ 3 Snippets Li T, Wang B, Ding H, Chen S, Cheng W, Li Y, Wu X, Wang L, Jiang Y, Lu Z, Teng Y, Su S, Han X, Zhao M.
In-Text Gene Mentions

5-HTT, 5-hydroxytryptamine transporter; α-SMA, smooth muscle acting; ABCA1, ATP-binding cassette transporter A1; ACTA2, actin alpha 2; AS, atherosclerosis; ECM, extracellular matrix; ECs, endothelial cells; EEVs, endothelial cell–derived EVs; EMPs, endothelial microparticles; EPCs, endothelial progenitor cells; EVs, extracellular vesicles; ICAM-1, intercellular cell adhesion molecule-1; IL-1β, interleukin-1β; KLF2, Krüppel-like factor 2; LncRNA, long noncoding RNA; LRP6, lipoprotein receptor–related protein 6; MAPK, mitogen-activated protein kinase; MCP-1, monocyte chemoattractant protein-1; MEVs, macrophage-derived EV; MoEVs, monocyte-derived EVs; MMPs matrix metalloproteinases.

Krüppel-like factor 2 (KLF2), 5-hydroxytryptamine transporter (5-HTT) inhibitor, miR-33a-5p antagomir, and miR-221 agomir are the protective factors of atherosclerosis.

5-HTT, 5-hydroxytryptamine transpor…

Show Full Abstract

Atherosclerosis (AS)-related diseases are still the main cause of death in clinical patients. The phenotype switching, proliferation, migration, and secretion of vascular smooth muscle cells (VSMCs) have a pivotal role in atherosclerosis. Although numerous research studies have elucidated the role of VSMCs in AS, their potential functional regulations continue to be explored. The formation of AS involves various cells, such as endothelial cells, smooth muscle cells, and macrophages. Therefore, intercellular communication of blood vessels cannot be ignored due to closely connected endothelia, media, and adventitia. Extracellular vesicles (EVs), as the vectors of cell-to-cell communication, can deliver proteins and nucleic acids of parent cells to the recipient cells. EVs have emerged as being central in intercellular communication and play a vital role in the pathophysiologic mechanisms of AS. This review summarizes the effects of extracellular vesicles (EVs) derived from multiple cells (endothelial cells, macrophages, mesenchymal stem cells, etc.) on VSMCs in AS. The key findings of this review are as follows: 1) endothelial cell-derived EVs (EEVs) have anti- or pro-atherogenic effects on VSMCs; 2) macrophage-derived EVs (MEVs) aggravate the proliferation and migration of VSMCs; 3) mesenchymal stem cells can inhibit VSMCs; and 4) the proliferation and migration of VSMCs can be inhibited by the treatment of EVs with atherosclerosis-protective factors and promoted by noxious stimulants. These results suggested that EVs have the same functional properties as treated parent cells, which might provide vital guidance for treating AS.

Also flagged:Gastric CancerTGFβcancertumortumorsmethylation
Journal Article 2022-05-10 ✓ 1 Snippet Han B, Fang T, Wang Y, Zhang Y, Xue Y.
In-Text Gene Mentions

…(ACVR2A, ARID1A andCACNA1E) ( Figure 7C…

Show Full Abstract

TGFβ signaling plays a key role in cancer progression and by shaping tumor architecture and inhibiting the anti-tumor activity of immune cells. It was reported that high expression of TGFβ can promote the invasion and metastasis of cancer cells in a variety of tumors. However, there are few studies on TGFβ2 and its methylation in gastric cancer. We analyzed the Harbin Medical University Cancer Hospital (HMUCH) sequencing data and used public data to explore the potential function and prognostic value of TGFβ2 and its methylation in gastric cancer. In this study, we used the ssGSEA algorithm to quantify 23 methylation sites related to TGFβ2. Survival analysis showed that high expression of TGFβ2 and hypomethylation levels of TGFβ2 were negative factors in the prognosis of gastric cancer. Functional enrichment analysis of methylation revealed that methylation of different TGFβ2 methylation scores was mainly involved in energy metabolism, extracellular matrix formation and cell cycle regulation. In the gastric cancer microenvironment TGFβ2 was associated with high levels of multiple immune cell infiltration and cytokine expression, and high TGFβ2 expression was significantly and positively correlated with stemness markers, stromalscore and EMT. Gene set enrichment analysis also revealed an important role of TGFβ2 in promoting EMT. In addition, we discussed the relationship between TGFβ2 and immunotherapy. The expression of PD-1, PD-L1 and CTLA-4 was elevated in the TGFβ2 high expression group. Also when TGFβ2 was highly expressed, the responsiveness of immune checkpoint blockade (ICB) was significantly enhanced. This indicates that TGFβ2 may become an indicator for predicting the efficacy of immunosuppressive agents and a potential target for immunotherapy.

Also flagged:genomeshost genomenucleotideTc1transposonstannin
Journal Article 2022-05-10 ✓ 2 Snippets Ahmad A, Su X, Harris AJ, Ren Z.
In-Text Gene Mentions

HTTis well reported…

…putative cases ofHTTdetected in this…

Show Full Abstract

Horizontal transfer of transposons (HTT) is an essential source of genomic evolution in eukaryotes. The HTT dynamics are well characterized in eukaryotes, including insects; however, there is a considerable gap in knowledge about HTT regarding many eukaryotes' species. In this study, we analyzed the events of the HTT between <i>Rhus</i> gall aphids (Hemiptera) and other insects. We analyzed the <i>Mariner</i>-like transposable elements (MLEs) belonging to <i>Rhus</i> gall aphids for the possible HT events. The MLEs have a patchy distribution and high similarity over the entire element length with insect MLEs from different orders. We selected representative sequences from the <i>Rhus</i> gall MLEs and identified five events of HT between MLEs of <i>Rhus</i> gall aphids and other insects from five different orders. We also found multiple HTT events among the MLEs of insects from the five orders, demonstrating that these <i>Mariner</i> elements have been involved in recurrent HT between <i>Rhus</i> gall aphids and other insects. Our current study closed the knowledge gap surrounding HTT and reported the events between <i>Rhus</i> gall aphids and other insects for the first time. We believe that this study about HTT events will help us understand the evolution and spread of transposable elements in the genomes of <i>Rhus</i> gall aphids.

Also flagged:Sox2transcription factorvisionintellectual disabilitybrain developmentBrain
Journal Article 2022-05-10 No Snippets Mercurio S, Serra L, Pagin M, Nicolis SK.
Show Full Abstract

SOX2 is a transcription factor conserved throughout vertebrate evolution, whose expression marks the central nervous system from the earliest developmental stages. In humans, <i>SOX2</i> mutation leads to a spectrum of CNS defects, including vision and hippocampus impairments, intellectual disability, and motor control problems. Here, we review how conditional <i>Sox2</i> knockout (cKO) in mouse with different Cre recombinases leads to very diverse phenotypes in different regions of the developing and postnatal brain. Surprisingly, despite the widespread expression of <i>Sox2</i> in neural stem/progenitor cells of the developing neural tube, some regions (hippocampus, ventral forebrain) appear much more vulnerable than others to <i>Sox2</i> deletion. Furthermore, the stage of <i>Sox2</i> deletion is also a critical determinant of the resulting defects, pointing to a stage-specificity of SOX2 function. Finally, cKOs illuminate the importance of SOX2 function in different cell types according to the different affected brain regions (neural precursors, GABAergic interneurons, glutamatergic projection neurons, Bergmann glia). We also review human genetics data regarding the brain defects identified in patients carrying mutations within human <i>SOX2</i> and examine the parallels with mouse mutants. Functional genomics approaches have started to identify SOX2 molecular targets, and their relevance for SOX2 function in brain development and disease will be discussed.

Also flagged:Ironmyoglobinoxygensynthesiscell proliferationmetabolism
Journal Article 2022-05-10 No Snippets Correnti M, Gammella E, Cairo G, Recalcati S.
Show Full Abstract

Iron is necessary for essential processes in every cell of the body, but the erythropoietic compartment is a privileged iron consumer. In fact, as a necessary component of hemoglobin and myoglobin, iron assures oxygen distribution; therefore, a considerable amount of iron is required daily for hemoglobin synthesis and erythroid cell proliferation. Therefore, a tight link exists between iron metabolism and erythropoiesis. The liver-derived hormone hepcidin, which controls iron homeostasis via its interaction with the iron exporter ferroportin, coordinates erythropoietic activity and iron homeostasis. When erythropoiesis is enhanced, iron availability to the erythron is mainly ensured by inhibiting hepcidin expression, thereby increasing ferroportin-mediated iron export from both duodenal absorptive cells and reticuloendothelial cells that process old and/or damaged red blood cells. Erythroferrone, a factor produced and secreted by erythroid precursors in response to erythropoietin, has been identified and characterized as a suppressor of hepcidin synthesis to allow iron mobilization and facilitate erythropoiesis.

Also flagged:chromosomespairingchromosomenucleusmetabolismX-chromosomes
Journal Article 2022-05-10 ✓ 1 Snippet Komoto T, Fujii M, Awazu A.
In-Text Gene Mentions

…showing values ofDCC≥1.25 were expected…

Show Full Abstract

X chromosome inactivation center (Xic) pairing occurs during the differentiation of embryonic stem (ES) cells from female mouse embryos, and is related to X chromosome inactivation, the circadian clock, intra-nucleus architecture, and metabolism. However, the mechanisms underlying the identification and approach of X chromosome pairs in the crowded nucleus are unclear. To elucidate the driving force of Xic pairing, we developed a coarse-grained molecular dynamics model of intranuclear chromosomes in ES cells and in cells 2 days after the onset of differentiation (2-day cells) by considering intrachromosomal epigenetic-structural feature-dependent mechanics. The analysis of the experimental data showed that X-chromosomes exhibit the rearrangement of their distributions of open/closed chromatin regions on their surfaces during cell differentiation. By simulating models where the excluded volume effects of closed chromatin regions are stronger than those of open chromatin regions, such rearrangement of open/closed chromatin regions on X-chromosome surfaces promoted the mutual approach of the Xic pair. These findings suggested that local intrachromosomal epigenetic features may contribute to the regulation of cell species-dependent differences in intranuclear architecture.

Also flagged:Squaric Acid Bisphposphonatesbone metastasessynthesissquaric acidBone MetastasisZoledronate
Journal Article 2022-05-10 No Snippets Greifenstein L, Engelbogen N, Máthé D, Grus T, Rösch F, Bergmann R.
Show Full Abstract

Bisphosponates are an interesting molecular class and in recent years their application has found its way into radiopharmaceutical research and thus into molecular imaging. In addition to great imaging of bone metastases, bisphospnate-based tracers for imaging also have some significant drawbacks. For example, their synthesis is often difficult. Additionally, this can lead to complex and almost impossible purification and quality control. This has limited the production and labeling of suitable molecular and their widespread use to a few facilities. Our squaric acid-based approach provides a way to overcome these problems and makes the synthesis as well as the purification of the compounds much easier. In addition, we were able to demonstrate that labeling with <sup>68</sup>Ga is possible under the typical conditions.

medRxiv 2022-05-10 Preprint (No Snippets API) González-Serna D, Shi C, Kerick M, Hankinson J, Ding J, McGovern A, Tutino M, Martin GV, Ortego-Centeno N, Luis Callejas J, Martin J, Orozco G.
Show Full Abstract

<h4>ABSTRACT</h4> <h4>Objectives</h4> Systemic sclerosis (SSc) is a complex autoimmune disease with a strong genetic component. However, most of the genes associated to the disease are still unknown because associated variants affect mostly non-coding intergenic elements of the genome. The challenge now is to use functional genomics to translate the genetic findings into a better understanding of the disease. <h4>Methods</h4> Promoter capture Hi-C and RNA sequencing experiments were performed in CD4 + T cells and CD14 + monocytes samples from 10 SSc patients and 5 healthy controls to link SSc-associated variants with their target genes, followed by differential expression and differential interaction analyses between cell types. <h4>Results</h4> We linked SSc-associated loci to 39 new potential target genes and confirm 7 previously known genes. We highlight novel causal genes, such as CXCR5 as the most probable candidate gene for the DDX6 locus. Some previously known SSc associated genes such as IRF8, STAT4 , or CD247 interestingly showed cell type specific interactions. We also identified 15 potential drug targets already in use in other similar immune-mediated diseases that could be repurposed for SSc treatment. Furthermore, we observed that interactions are directly correlated with the expression of important genes implicated in cell type specific pathways and find evidence that chromatin conformation is associated with genotype. <h4>Conclusions</h4> Our study reveals potential causal genes for SSc-associated loci, some of them acting in a cell type specific manner, suggesting novel biological mechanisms that might mediate SSc pathogenesis.

Also flagged:macroautophagyautophagyTAX1BP1toll-like receptor 3TLR4DDX58
Journal Article 2022-05-09 No Snippets White J, Suklabaidya S, Vo MT, Choi YB, Harhaj EW.
Show Full Abstract

TAX1BP1 is a selective macroautophagy/autophagy receptor that plays a central role in host defense to pathogens and in regulating the innate immune system. TAX1BP1 facilitates the xenophagic clearance of pathogenic bacteria such as <i>Salmonella typhimurium</i> and <i>Mycobacterium tuberculosis</i> and regulates TLR3 (toll-like receptor 3)-TLR4 and DDX58/RIG-I-like receptor (RLR) signaling by targeting TICAM1 and MAVS for autophagic degradation respectively. In addition to these canonical autophagy receptor functions, TAX1BP1 can also exert multiple accessory functions that influence the biogenesis and maturation of autophagosomes. In this review, we will discuss and integrate recent findings related to the autophagy function of TAX1BP1 and highlight outstanding questions regarding its functions in autophagy and regulation of innate immunity and host defense.<b>Abbreviations:</b> ATG: autophagy related; CALCOCO: calcium binding and coiled-coil domain; CC: coiled-coil; CHUK/IKKα: conserved helix-loop-helix ubiquitous kinase; CLIR: noncanonical LC3-interacting region; GABARAP: gamma-aminobutyric acid receptor associated protein; HTLV-1: human T-lymphotropic virus 1; IFN: interferon; IL1B/IL1β: interleukin 1 beta; LIR: LC3-interacting region; LPS: lipopolysaccharide; MAP1LC3/LC3: microtubule-associated protein 1 light chain 3; MAPK/JNK: mitogen-activated protein kinase; mATG8: mammalian Atg8 homolog; MAVS: mitochondrial antiviral signaling protein; MEF: mouse embryonic fibroblast; MTB: <i>Mycobacterium tuberculosis</i>; MYD88: myeloid differentiation primary response gene 88; NBR1: NBR1, autophagy cargo receptor; NFKB/NF-κB: nuclear factor of kappa light polypeptide gene enhancer in B cells; OPTN: optineurin; Poly(I:C): polyinosinic:polycytidylic acid; PTM: post-translational modification; RB1CC1: RB1-inducible coiled-coil 1; RIPK: receptor (TNFRSF)-interacting serine-threonine kinase; RLR: DDX58/RIG-I-like receptor; RSV: respiratory syncytia virus; SKICH: SKIP carboxyl homology; SLR: SQSTM1 like receptor; SQSTM1: sequestosome 1; TAX1BP1: Tax1 (human T cell leukemia virus type I) binding protein 1; TBK1: TANK-binding kinase 1; TICAM1: toll-like receptor adaptor molecule 1; TLR: toll-like receptor; TNF: tumor necrosis factor; TNFAIP3: TNF alpha induced protein 3; TNFR: tumor necrosis factor receptor; TOM1: target of myb1 trafficking protein; TRAF: TNF receptor-associated factor; TRIM32: tripartite motif-containing 32; UBD: ubiquitin binding domain; ZF: zinc finger.

Also flagged:cagAHelicobacter pylori infectionpraziquantelopisthorchiasisLiver fluke infectionhepatobiliary diseases
Journal Article 2022-05-09 No Snippets Phung HTT, Deenonpoe R, Suttiprapa S, Mairiang E, Edwards SW, Sripa B.
Show Full Abstract

<h4>Background</h4>Liver fluke infection caused by Opisthorchis viverrini is associated with several hepatobiliary diseases including advanced periductal fibrosis (APF) and cholangiocarcinoma. Recently, we demonstrated a persistent APF in over one-third of opisthorchiasis patients after worm removal by praziquantel (PZQ) treatment. However, the underlying mechanism(s) of this phenomena is unclear. Given a co-infection with Helicobacter pylori (H. pylori) especially cagA-positive strain enhances APF, we hypothesized that H. pylori with CagA virulent factor contributes to persistent APF.<h4>Materials and methods</h4>Seventy-five opisthorchiasis patients who underwent ultrasonography and treatment with PZQ were recruited in the 2-year follow-up study. Helicobacter and its cagA in the feces were examined by conventional and qPCR. Correlations between prevalence or bacterial loads of Helicobacter spp., H. pylori, and cagA-positive H. pylori before and after PZQ treatment were analyzed among resolved, slowly resolved, relapsed, and persistent APF groups.<h4>Results</h4>Overall, prevalence of Helicobacter spp., H. pylori, and cagA-positive H. pylori declined after PZQ treatment. However, only the prevalence and bacterial loads of cagA-positive H. pylori detected at 2-year post-treatment were significantly lower than those before treatment (p < .05). In addition, both prevalence and bacterial loads of cagA-positive H. pylori were significantly lower in the resolved APF group after PZQ treatment, while there were no significant changes in the slowly resolved, relapsed, and persistent APF groups. Among the APF subgroups, cagA-positive H. pylori prevalence in both relapsed and persistent APF groups were significantly higher than the resolved APF group.<h4>Conclusion</h4>The results support our hypothesis that H. pylori, especially cagA-positive strain, contributes to the relapsed and persistent APF. A supplementary antibiotic treatment for H. pylori to reduce persistent APF and eventually CCA is warranted.

Also flagged:SerineProteaseCOVID-19infectionssevere acute respiratory syndromeSARS-CoV-2 infection
Journal Article 2022-05-09 ✓ 5 Snippets Rosendal E, Mihai IS, Becker M, Das D, Frängsmyr L, Persson BD, Rankin GD, Gröning R, Trygg J, Forsell M, Ankarklev J, Blomberg A, Henriksson J, Överby AK, Lenman A.
In-Text Gene Mentions

HBEC ALI cultures were pretreated apically with individual recombinant SERPINA1, SERPINE1, and SERPINC1 proteins, and the infection was monitored over time.

Additionally, SERPINC1, known as antithrombin III, is an FDA-approved anticoagulant and was included here due to its therapeutic potential against COVID-19 (ClinicalTrials.gov registration no. NCT04745442).

Recombinant SERPINE1 protein (PAI-1, 1786-PI), SERPINA1 protein (A1AT, 1268-PI), SERPINC1 protein (ATIII, 1267-PI), and nafamostat mesylate (3081) were purchased from R&D Systems.

Although not identified in our data set, low levels of antithrombin III (SERPINC1) have been associated with increased mortality in COVID-19 (29).

Recombinant TMPRSS2 and viral S-protein were incubated with or without recombinant SERPINA1, SERPINE1, and SERPINC1 protein or the positive control, nafamostat mesylate (20), followed by detection of SARS-CoV-2 S-protein and its cleavage products by Western blotting.

Show Full Abstract

The coronavirus disease 2019, COVID-19, is a complex disease with a wide range of symptoms from asymptomatic infections to severe acute respiratory syndrome with lethal outcome. Individual factors such as age, sex, and comorbidities increase the risk for severe infections, but other aspects, such as genetic variations, are also likely to affect the susceptibility to SARS-CoV-2 infection and disease severity. Here, we used a human 3D lung cell model based on primary cells derived from multiple donors to identity host factors that regulate SARS-CoV-2 infection. With a transcriptomics-based approach, we found that less susceptible donors show a higher expression level of serine protease inhibitors SERPINA1, SERPINE1, and SERPINE2, identifying variation in cellular serpin levels as restricting host factors for SARS-CoV-2 infection. We pinpoint their antiviral mechanism of action to inhibition of the cellular serine protease, TMPRSS2, thereby preventing cleavage of the viral spike protein and TMPRSS2-mediated entry into the target cells. By means of single-cell RNA sequencing, we further locate the expression of the individual serpins to basal, ciliated, club, and goblet cells. Our results add to the importance of genetic variations as determinants for SARS-CoV-2 susceptibility and suggest that genetic deficiencies of cellular serpins might represent risk factors for severe COVID-19. Our study further highlights TMPRSS2 as a promising target for antiviral intervention and opens the door for the usage of locally administered serpins as a treatment against COVID-19. <b>IMPORTANCE</b> Identification of host factors affecting individual SARS-CoV-2 susceptibility will provide a better understanding of the large variations in disease severity and will identify potential factors that can be used, or targeted, in antiviral drug development. With the use of an advanced lung cell model established from several human donors, we identified cellular protease inhibitors, serpins, as host factors that restrict SARS-CoV-2 infection. The antiviral mechanism was found to be mediated by the inhibition of a serine protease, TMPRSS2, which results in a blockage of viral entry into target cells. Potential treatments with these serpins would not only reduce the overall viral burden in the patients, but also block the infection at an early time point, reducing the risk for the hyperactive immune response common in patients with severe COVID-19.

Also flagged:PotassiumLithiumcarbonate esteraluminumcoppersalt
Journal Article 2022-05-09 No Snippets Yuan F, Li Z, Zhang D, Wang Q, Wang H, Sun H, Yu Q, Wang W, Wang B.
Show Full Abstract

Potassium-ion batteries (PIBs) exhibit a considerable application prospect for energy storage systems due to their low cost, high operating voltage, and superior ionic conductivity. As a vital configuration in PIBs, the two-phase interface, which refers to K-ion diffusion from the electrolyte to the electrode surface (solid-liquid interface) and K-ion migration between different particles (solid-solid interface), deeply determines the diffusion/reaction kinetics and structural stability, thus significantly affecting the rate performance and cyclability. However, researches on two-phase interface are still in its infancy and need further attentions. This review first starts from the fundamental understanding of solid-liquid and solid-solid interfaces to in-depth analyzing the effect mechanism of different improvement strategies on them, such as optimization of electrolyte and binders, heterostructure design, modulation of interlayer spacing, etc. Afterward, the research progress of these improvement strategies is summarized comprehensively. Finally, the major challenges are proposed, and the corresponding solving strategies are presented. This review is expected to give an insight into the importance of two-phase interface on diffusion/reaction kinetics, and provides a guidance for developing other advanced anodes in PIBs.

Also flagged:PeptideamideAllergic contact dermatitisallergic respiratory diseasesoccupational diseasesdermal diseases
Journal Article 2022-05-09 No Snippets Graham JC, Trejo-Martin A, Chilton ML, Kostal J, Bercu J, Beutner GL, Bruen US, Dolan DG, Gomez S, Hillegass J, Nicolette J, Schmitz M.
Show Full Abstract

Peptide couplers (also known as amide bond-forming reagents or coupling reagents) are broadly used in organic chemical syntheses, especially in the pharmaceutical industry. Yet, occupational health hazards associated with this chemical class are largely unexplored, which is disconcerting given the intrinsic reactivity of these compounds. Several case studies involving occupational exposures reported adverse respiratory and dermal health effects, providing initial evidence of chemical sensitization. To address the paucity of toxicological data, a pharmaceutical cross-industry task force was formed to evaluate and assess the potential of these compounds to cause eye and dermal irritation as well as corrosivity and dermal sensitization. The goal of our work was to inform health and safety professionals as well as pharmaceutical and organic chemists of the occupational health hazards associated with this chemical class. To that end, 25 of the most commonly used peptide couplers and five hydrolysis products were selected for <i>in vivo, in vitro</i>, and <i>in silico</i> testing. Our findings confirmed that dermal sensitization is a concern for this chemical class with 21/25 peptide couplers testing positive for dermal sensitization and 15 of these being strong/extreme sensitizers. We also found that dermal corrosion and irritation (8/25) as well as eye irritation (9/25) were health hazards associated with peptide couplers and their hydrolysis products (4/5 were dermal irritants or corrosive and 4/5 were eye irritants). Resulting outcomes were synthesized to inform decision making in peptide coupler selection and enable data-driven hazard communication to workers. The latter includes harmonized hazard classifications, appropriate handling recommendations, and accurate safety data sheets, which support the industrial hygiene hierarchy of control strategies and risk assessment. Our study demonstrates the merits of an integrated, <i>in vivo</i> -<i>in silico</i> analysis, applied here to the skin sensitization endpoint using the Computer-Aided Discovery and REdesign (CADRE) and Derek Nexus programs. We show that experimental data can improve predictive models by filling existing data gaps while, concurrently, providing computational insights into key initiating events and elucidating the chemical structural features contributing to adverse health effects. This interactive, interdisciplinary approach is consistent with Green Chemistry principles that seek to improve the selection and design of less hazardous reagents in industrial processes and applications.

Also flagged:COVID-19bindingantibodyspike proteinSNAP1oligonucleotides
Journal Article 2022-05-09 No Snippets Yang LF, Kacherovsky N, Panpradist N, Wan R, Liang J, Zhang B, Salipante SJ, Lutz BR, Pun SH.
Show Full Abstract

The COVID-19 pandemic is among the greatest health and socioeconomic crises in recent history. Although COVID-19 vaccines are being distributed, there remains a need for rapid testing to limit viral spread from infected individuals. We previously identified the SARS-CoV-2 spike protein N-terminal domain (NTD) binding DNA aptamer 1 (SNAP1) for detection of SARS-CoV-2 virus by aptamer-antibody sandwich enzyme-linked immunoassay (ELISA) and lateral flow assay (LFA). In this work, we identify a new aptamer that also binds at the NTD, named SARS-CoV-2 spike protein NTD-binding DNA aptamer 4 (SNAP4). SNAP4 binds with high affinity (<30 nM) for the SARS-CoV-2 spike protein, a 2-fold improvement over SNAP1. Furthermore, we utilized both SNAP1 and SNAP4 in an aptamer sandwich LFA (AptaFlow), which detected SARS-CoV-2 UV-inactivated virus at concentrations as low as 10<sup>6</sup> copies/mL. AptaFlow costs <$1 per test to produce, provides results in <1 h, and detects SARS-CoV-2 at concentrations that indicate higher viral loads and a high probability of contagious transmission. AptaFlow is a potential approach for a low-cost, convenient antigen test to aid the control of the COVID-19 pandemic.

Also flagged:olfactionAnxietyNeurological Tissue Injurybehavioralrhinosinusitispathogenesis
Journal Article 2022-05-09 ✓ 1 Snippet Hernandez M, Vaughan J, Gordon T, Lippmann M, Gandy S, Chen LC.
In-Text Gene Mentions

Prdx6

Show Full Abstract

<b>Objective:</b> Previous <i>in vitro</i> and in vivo World Trade Center particulate matter (WTC<sub>PM</sub>) exposure studies have provided evidence of exposure-driven oxidative/nitrative stress and inflammation on respiratory tract and aortic tissues. What remains to be fully understood are secondary organ impacts due to WTC<sub>PM</sub> exposure. This study was designed to test if WTC particle-induced nasal and neurologic tissue injury may result in unforeseen functional and behavioral outcomes.<b>Material and Methods:</b> WTC<sub>PM</sub> was intranasally administered in mice, evaluating genotypic, histopathologic, and olfaction latency endpoints.<b>Results:</b> WTC<sub>PM</sub> exposure was found to incite neurologic injury and olfaction latency in intranasally (IN) exposed mice. Single high-dose and repeat low-dose nasal cavity insults from WTC<sub>PM</sub> dust resulted in significant olfaction delays and enduring olfaction deficits. Anxiety-dependent behaviors also occurred in mice experiencing olfaction loss including significant body weight loss, increased incidence and time spent in hind stretch postures, as well as increased stationary time and decreased exploratory time. Additionally, WTC<sub>PM</sub> exposure resulted in increased whole brain wet/dry ratios and wet whole brain to body mass ratios that were correlated with exposure and increased exposure dose (<i>p</i><0.05).<b>Discussion:</b> The potential molecular drivers of WTC<sub>PM</sub>-driven tissue injury and olfaction latency may be linked to oxidative/nitrative stress and inflammatory cascades in both upper respiratory nasal and brain tissues.<b>Conclusion:</b> Cumulatively, these data provide evidence of WTC<sub>PM</sub> exposure in relation to tissue damage related to oxidative stress-driven inflammation identified in the nasal cavity, propagated to olfactory bulb tissues and, potentially, over extended periods, to other CNS tissues.

Also flagged:medroxyprogesteroneacetatecytokinetranscription factorRELANFKB1
Journal Article 2022-05-09 No Snippets Bradley F, Franzén Boger M, Kaldhusdal V, Åhlberg A, Edfeldt G, Lajoie J, Bergström S, Omollo K, Damdimopoulos A, Czarnewski P, Månberg A, Oyugi J, Kimani J, Nilsson P, Fowke K, Tjernlund A, Broliden K.
Show Full Abstract

Depot medroxyprogesterone acetate (DMPA) is an injectable hormonal contraceptive used by millions of women worldwide. However, experimental studies have associated DMPA use with genital epithelial barrier disruption and mucosal influx of human immunodeficiency virus (HIV) target cells. We explored the underlying molecular mechanisms of these findings. Ectocervical biopsies and cervicovaginal lavage (CVL) specimens were collected from HIV-seronegative Kenyan sex workers using DMPA (n = 32) or regularly cycling controls (n = 64). Tissue samples were assessed by RNA-sequencing and quantitative imaging analysis, whereas protein levels were measured in CVL samples. The results suggested a DMPA-associated upregulation of genes involved in immune regulation, including genes associated with cytokine-mediated signaling and neutrophil-mediated immunity. A transcription factor analysis further revealed DMPA-associated upregulation of RELA and NFKB1 which are involved in several immune activation pathways. Several genes significantly downregulated in the DMPA versus the control group were involved in epithelial structure and function, including genes encoding keratins, small proline-rich proteins, and cell-cell adhesion proteins. Pathway analyses indicated DMPA use was associated with immune activation and suppression of epithelium development, including keratinization and cornification processes. The cervicovaginal microbiome composition (Lactobacillus dominant and non-Lactobacillus dominant) had no overall interactional impact on the DMPA associated tissue gene expression. Imaging analysis verified that DMPA use was associated with an impaired epithelial layer as illustrated by staining for the selected epithelial junction proteins E-cadherin, desmoglein-1 and claudin-1. Additional staining for CD4+ cells revealed a more superficial location of these cells in the ectocervical epithelium of DMPA users versus controls. Altered protein levels of SERPINB1 and ITIH2 were further observed in the DMPA group. Identification of specific impaired epithelial barrier structures at the gene expression level, which were verified at the functional level by tissue imaging analysis, illustrates mechanisms by which DMPA adversely may affect the integrity of the genital mucosa.

Also flagged:Nitratenitrogengene expressionmetabolismrootpentose
Journal Article 2022-05-09 No Snippets Saito M, Konishi M, Miyagi A, Sakuraba Y, Kawai-Yamada M, Yanagisawa S.
Show Full Abstract

Nitrate is a nutrient signal that regulates growth and development through NLP transcription factors in plants. Here we identify the L-aspartate oxidase gene (AO) necessary for de novo NAD<sup>+</sup> biosynthesis as an NLP target in Arabidopsis. We investigated the physiological significance of nitrate-induced AO expression by expressing AO under the control of the mutant AO promoter lacking the NLP-binding site in the ao mutant. Despite morphological changes and severe reductions in fresh weight, the loss of nitrate-induced AO expression resulted in minimum effects on NAD(H) and NADP(H) contents, suggesting compensation of decreased de novo NAD<sup>+</sup> biosynthesis by reducing the growth rate. Furthermore, metabolite profiling and transcriptome analysis revealed that the loss of nitrate-induced AO expression causes pronounced impacts on contents of TCA cycle- and urea cycle-related metabolites, gene expression profile, and their modifications in response to changes in the nitrogen nutrient condition. These results suggest that proper maintenance of metabolic balance requires the coordinated regulation of multiple metabolic pathways by NLP-mediated nitrate signaling in plants.

Also flagged:colorectal cancermismatch repairtumormethylationtumorscancer
Journal Article 2022-05-09 ✓ 2 Snippets Sibilio P, Belardinilli F, Licursi V, Paci P, Giannini G.
In-Text Gene Mentions

Also, in this comparison we found repressed genes (i.e. SIRPA, BTN2A1 and PVR), some of which followed the same trend of HM tumors, while others where rather specific for this subset (i.e. CD70, CD40).

…genes (i.e. SIRPA,BTN2A1and PVR), some…

Show Full Abstract

<h4>Background</h4>Historically, the molecular classification of colorectal cancer (CRC) was based on the global genomic status, which identified microsatellite instability in mismatch repair (MMR) deficient CRC, and chromosomal instability in MMR proficient CRC. With the introduction of immune checkpoint inhibitors, the microsatellite and chromosomal instability classification regained momentum as the microsatellite instability condition predicted sensitivity to immune checkpoint inhibitors, possibly due to both high tumor mutation burden (TMB) and high levels of infiltrating lymphocytes. Conversely, proficient MMR CRC are mostly resistant to immunotherapy. To better understand the relationship between the microsatellite and chromosomal instability classification, and eventually discover additional CRC subgroups relevant for therapeutic decisions, we developed a computational pipeline that include molecular integrative analysis of genomic, epigenomic and transcriptomic data.<h4>Results</h4>The first step of the pipeline was based on unsupervised hierarchical clustering analysis of copy number variations (CNVs) versus hypermutation status that identified a first CRC cluster with few CNVs enriched in Hypermutated and microsatellite instability samples, a second CRC cluster with a high number of CNVs mostly including non-HM and microsatellite stable samples, and a third cluster (7.8% of the entire dataset) with low CNVs and low TMB, which shared clinical-pathological features with Hypermutated CRCs and thus defined Hypermutated-like CRCs. The mutational features, DNA methylation profile and base substitution fingerprints of these tumors revealed that Hypermutated-like patients are molecularly distinct from Hypermutated and non-Hypermutated tumors and are likely to develop and progress through different genetic events. Transcriptomic analysis highlighted further differences amongst the three groups and revealed an inflamed tumor microenvironment and modulation Immune Checkpoint Genes in Hypermutated-like CRCs.<h4>Conclusion</h4>Therefore, our work highlights Hypermutated-like tumors as a distinct and previously unidentified CRC subgroup possibly responsive to immune checkpoint inhibitors. If further validated, these findings can lead to expanding the fraction of patients eligible to immunotherapy.

Also flagged:Hepatocellular CarcinomaSTAT3liver cancerdeathSignal transducer and activator of transcription 3N
Journal Article 2022-05-09 ✓ 1 Snippet Darwish NM, Elshaer MMA, Almutairi SM, Chen TW, Mohamed MO, Ghaly WBA, Rasheed RA.
In-Text Gene Mentions

…Aflatoxin B1, andhemochromatosis[ 3 ,…

Show Full Abstract

Hepatocellular carcinoma (HCC) is a common type of liver cancer and is a leading cause of death worldwide. Signal transducer and activator of transcription 3 (STAT3) is involved in HCC progression, migration, and suppression of apoptosis. This study investigates the apoptotic effect of the dietary antioxidant (n-3 PUFAs) on HepG2 cells and analyzes the underlying molecular mechanisms of this effect both in vivo and in vitro. In vivo study: Seventy-five adult male albino rats were divided into three groups (n = 25): Group I (control): 0.9% normal saline, intraperitoneal. Group II: N-Nitrosodiethylamine (200 mg/kg b.wt) intraperitoneal, followed by phenobarbital 0.05% in drinking water. Group III: as group II followed by n-3 PUFAs intubation (400 mg/kg/day). In vivo study: liver specimens for biochemical, histopathological, and immunohistochemical examination. In vitro study: MTT assay, cell morphology, PCR, Western blot, and immunohistochemical analysis. n-3 PUFAs significantly improved the histopathologic features of HCC and decreased the expression of anti-apoptotic proteins. Further, HepG2 cells proliferation was suppressed through inhibition of the STAT3 signaling pathway, cyclin D1, and Bcl-2 activity. Here we report that n-3 PUFAs may be an ideal cancer chemo-preventive candidate by targeting STAT3 signaling, which is involved in cell proliferation and apoptosis.

Also flagged:behaviourmemoryCPI
Journal Article 2022-05-09 No Snippets Caporale GM, Claudio-Quiroga G, Gil-Alana LA.
Show Full Abstract

This paper aims to provide new evidence on the relationship between prices and output in both the US and the UK (which is important to discriminate between different macroeconomic theories) by focusing on the long run. For this purpose, it applies fractional integration and long-range dependence techniques that are more general than the standard modelling approach based on the stationary <i>I</i> (0) versus nonstationary <i>I</i> (1) dichotomy which has been used in previous studies. All series appear to be highly trended and to exhibit high degrees of integration and persistence, especially in the case of CPI. Since the two variables have different degrees of integration in each of the two countries, fractional cointegration tests cannot be carried out. We assume instead weak exogeneity of each of them in turn and test for causality by regressing the other variable against lagged values of the weakly exogenous one. We find that the only significant relationship implies the existence of a lagged effect of prices on output in the case of the US, which suggests a dominant role for demand shocks.

Also flagged:YTHDF2glioblastomaGBMconjugationTNFAIP3EPHB3
Journal Article 2022-05-09 ✓ 1 Snippet Chen Y, Wang YL, Qiu K, Cao YQ, Zhang FJ, Zhao HB, Liu XZ.
In-Text Gene Mentions

…EPHB3, TNFRSF1B, BAALC,TAOK3, BAMB1 and TNFAIP3…

Show Full Abstract

<h4>Objectives</h4>Temozolomide (TMZ) resistance is a key factor that restricts the therapeutic effect of glioblastoma (GBM). YTH-domain family member 2 (YTHDF2) is highly expressed in GBM tissues, while the mechanism of YTHDF2 in TMZ resistance in GBM remains not fully elucidated.<h4>Methods</h4>The YTHDF2 expression in TMZ-resistant tissues and cells was detected. Kaplan-Meier analysis was employed to evaluate the prognostic value of YTHDF2 in GBM. Effect of YTHDF2 in TMZ resistance in GBM was explored via corresponding experiments. RNA sequence, FISH in conjugation with fluorescent immunostaining, RNA immunoprecipitation, dual-luciferase reporter gene and immunofluorescence were applied to investigate the mechanism of YTHDF2 that boosted TMZ resistance in GBM.<h4>Results</h4><i>YTHDF2</i> was up-regulated in TMZ-resistant tissues and cells, and patients with high expression of YTHDF2 showed lower survival rate than the patients with low expression of YTHDF2. The elevated YTHDF2 expression boosted TMZ resistance in GBM cells, and the decreased YTHDF2 expression enhanced TMZ sensitivity in TMZ-resistant GBM cells. Mechanically, YTHDF2 bound to the N6-methyladenosine (m<sup>6</sup>A) sites in the 3'UTR of EPHB3 and TNFAIP3 to decrease the mRNA stability. YTHDF2 activated the PI3K/Akt and NF-κB signals through inhibiting expression of EPHB3 and TNFAIP3, and the inhibition of the two pathways attenuated YTHDF2-mediated TMZ resistance.<h4>Conclusion</h4>YTHDF2 enhanced TMZ resistance in GBM by activation of the PI3K/Akt and NF-κB signalling pathways via inhibition of EPHB3 and TNFAIP3.

Also flagged:mucositiscanceroxygenmitochondrialpathogenesiscisplatin
Journal Article 2022-05-09 No Snippets Yu QQ, Zhang H, Guo Y, Han B, Jiang P.
Show Full Abstract

Chemotherapy-induced intestinal mucositis (CIM) is a significant dose-limiting adverse reaction brought on by the cancer treatment. Multiple studies reported that reactive oxygen species (ROS) is rapidly produced during the initial stages of chemotherapy, when the drugs elicit direct damage to intestinal mucosal cells, which, in turn, results in necrosis, mitochondrial dysfunction, and ROS production. However, the mechanism behind the intestinal redox system-based induction of intestinal mucosal injury and necrosis of CIM is still undetermined. In this article, we summarized relevant information regarding the intestinal redox system, including the composition and regulation of redox enzymes, ROS generation, and its regulation in the intestine. We innovatively proposed the intestinal redox "Tai Chi" theory and revealed its significance in the pathogenesis of CIM. We also conducted an extensive review of the English language-based literatures involving oxidative stress (OS) and its involvement in the pathological mechanisms of CIM. From the date of inception till July 31, 2021, 51 related articles were selected. Based on our analysis of these articles, only five chemotherapeutic drugs, namely, MTX, 5-FU, cisplatin, CPT-11, and oxaliplatin were shown to trigger the ROS-based pathological mechanisms of CIM. We also discussed the redox system-mediated modulation of CIM pathogenesis via elaboration of the relationship between chemotherapeutic drugs and the redox system. It is our belief that this overview of the intestinal redox system and its role in CIM pathogenesis will greatly enhance research direction and improve CIM management in the future.

Also flagged:TNFSFcell proliferationTNFtumourTNFRSF11bTNFRSF12a
Journal Article 2022-05-09 ✓ 2 Snippets Tao R, Liu Q, Huang R, Wang K, Sun Z, Yang P, Wang J.
In-Text Gene Mentions

Jiang et al. reported that oncolytic adenovirus combined with the immune costimulator OX40 ligand (OX40L, TNFSF4) could enable immune cells to accurately recognise tumour-associated antigens and reduce the adverse effects caused by the activation of irrelevant T cells [21].

…OX40 ligand (OX40L,TNFSF4) could enable immune…

Show Full Abstract

<h4>Purpose</h4>Tumour necrosis factor (TNF) superfamilies play important roles in cell proliferation, migration, differentiation, and apoptosis. We believe that TNF has a huge potential and might cast new insight into antitumour therapies. Therefore, we established this signature based on TNF superfamilies.<h4>Results</h4>A six-gene signature derived from the TNF superfamilies was established. The Riskscore correlated significantly with the expression of immune checkpoint genes and infiltrating M2 macrophages in the tumour specimen. This signature was also associated with mutations in genes that regulate tumour cell proliferation. Univariate and multivariate regression analyses further confirmed the Riskscore, TNFRSF11b, and TNFRSF12a as independent risk factors in The Cancer Genome Atlas and Chinese Glioma Genome Atlas datasets.<h4>Conclusion</h4>Our signature could accurately predict the prognosis of lower-grade gliomas (LGG). In addition, this six-gene signature could predict the immunosuppressive status of LGG and provide evidence that TNF superfamilies had correlations with some critical mutations that could be effectively targeted now.

Also flagged:Metabolismoxygensynaptic transmissionTransmissionsignalmitochondria
Journal Article 2022-05-09 ✓ 1 Snippet Geßner C, Krüger A, Folkow LP, Fehrle W, Mikkelsen B, Burmester T.
In-Text Gene Mentions

…of SOD1 ,PRDX6and GSTP6 ,…

Show Full Abstract

The mammalian brain is characterized by high energy expenditure and small energy reserves, making it dependent on continuous vascular oxygen and nutritional supply. The brain is therefore extremely vulnerable to hypoxia. While neurons of most terrestrial mammals suffer from irreversible damage after only short periods of hypoxia, neurons of the deep-diving hooded seal (<i>Cystophora cristata</i>) show a remarkable hypoxia-tolerance. To identify the molecular mechanisms underlying the intrinsic hypoxia-tolerance, we excised neurons from the visual cortices of hooded seals and mice (<i>Mus musculus</i>) by laser capture microdissection. A comparison of the neuronal transcriptomes suggests that, compared to mice, hooded seal neurons are endowed with an enhanced aerobic metabolic capacity, a reduced synaptic transmission and an elevated antioxidant defense. Publicly available whole-tissue brain transcriptomes of the bowhead whale (<i>Balaena mysticetus</i>), long-finned pilot whale (<i>Globicephala melas</i>), minke whale (<i>Balaenoptera acutorostrata</i>) and killer whale (<i>Orcinus orca</i>), supplemented with 2 newly sequenced long-finned pilot whales, suggest that, compared to cattle (<i>Bos taurus</i>), the cetacean brain also displays elevated aerobic capacity and reduced synaptic transmission. We conclude that the brain energy balance of diving mammals is preserved during diving, due to reduced synaptic transmission that limits energy expenditure, while the elevated aerobic capacity allows efficient use of oxygen to restore energy balance during surfacing between dives.

Also flagged:tumortranscriptional regulatorsbindingcancertumorspathogenesis
Journal Article 2022-05-09 No Snippets Wang S, Qian L, Cao T, Xu L, Jin Y, Hu H, Fu Q, Li Q, Wang Y, Wang J, Xia Y, Huang X.
Show Full Abstract

Recent studies have revealed that circRNAs can affect tumor DNA damage and repair, apoptosis, proliferation, and invasion and influence the transport of intratumor substances by acting as miRNA sponges and transcriptional regulators and binding to proteins in a variety of ways. However, research on the role of circRNAs in cancer radiotherapy and chemoresistance is still in its early stages. Chemotherapy is a common approach to oncology treatment, but the development of tumor resistance limits the overall clinical efficacy of chemotherapy for cancer patients. The current study suggests that circRNAs have a facilitative or inhibitory effect on the development of resistance to conventional chemotherapy in a variety of tumors, suggesting that circRNAs may serve as a new direction for the study of antitumor drug resistance. In this review, we will briefly discuss the biological features of circRNAs and summarize the recent progression of the involvement of circRNAs in the development and pathogenesis of cancer chemoresistance.

Also flagged:Kawasaki Diseasesystemic vasculitispathogenesisGene ExpressionSPI1S100A12
Journal Article 2022-05-09 No Snippets Srivastava P, Bamba C, Pilania RK, Kumari A, Kumrah R, Sil A, Singh S.
Show Full Abstract

Kawasaki disease (KD) is a common childhood systemic vasculitis with a special predilection for coronary arteries. Even after more than five decades of the initial description of the disease, the etiology of KD remains an enigma. This transcriptome data re-analysis study aimed to elucidate the underlying pathogenesis of KD using a bioinformatic approach to identify differentially expressed genes (DEGs) to delineate common pathways involved in KD. Array datasets from the Gene Expression Omnibus database were extracted and subjected to comparative meta-analysis for the identification of prominent DEGs. Fifteen hub genes with high connectivity were selected from these DEGs (<i>IL1B, ITGAM, TLR2, CXCL8, SPI1, S100A12, MMP9, PRF1, TLR8, TREM1, CD44, UBB, FCER1G, IL7R, and FCGR1A</i>). Of these 15 genes, five genes (<i>CXCL8, FCGR1A, IL1B, TLR2, and TLR8</i>) were found to be involved in neutrophil degranulation. To gain further insight into the molecular mechanism, a protein-protein network was established. Significantly enriched pathways based on the above-mentioned genes were mainly centered on biological regulation and signaling events. In addition, the pathway analysis also indicated that the majority of the DEGs in KD were enriched in systemic lupus erythematosus, suggesting a strong interplay between immunological and genetic factors in the pathogenesis of KD. These findings could significantly aid in identifying therapeutic targets and understanding KD biosignatures to design a biomarker panel for early diagnosis and severity of the disease.

Also flagged:estrogen receptorgene expressionERbreast cancerLignanbinding
Journal Article 2022-05-09 ✓ 1 Snippet López-Rojas P, Amesty Á, Guerra-Rodríguez M, Brito-Casillas Y, Guerra B, Fernández-Pérez L, Estévez-Braun A.
In-Text Gene Mentions

When the E2-deprived experiments were carried out, the ERα+ BC cell line was placed in growth media modified by replacement of 10% FBS with 10% dextran-charcoal treated FBS (DCC-FBS) (Biowest, Riverside, MO, USA) one week prior to assay.

Show Full Abstract

Based on molecular docking studies on the ERα, a series of lignan derivatives (<b>3</b>-<b>16</b>) were designed and semisynthesized from the natural dibenzylbutyrolactones bursehernin (<b>1</b>) and matairesinol dimethyl ether (<b>2</b>). To examine their estrogenic and antiestrogenic potencies, the effects of these compounds on estrogen receptor element (ERE)-driven reporter gene expression and viability in human ER+ breast cancer cells were evaluated. Lignan compounds induced ERE-driven reporter gene expression with very low potency as compared with the pure agonist E2. However, coincubation of 5 μM of lignan derivatives <b>1</b>, <b>3</b>, <b>4</b>, <b>7</b>, <b>8</b>, <b>9</b>, <b>11</b>, <b>13</b>, and <b>14</b> with increasing concentrations of E2 (from 0.01 pM to 1 nM) reduced both the potency and efficacy of pure agonists. The binding to the rhERα-LBD was validated by TR-FRET competitive binding assay and lignans bound to the rhERα with IC<sub>50</sub> values from 0.16 μM (compound <b>14</b>) to 6 μM (compound <b>4</b>). Induced fit docking (IFD) and molecular dynamics (MD) simulations for compound <b>14</b> were carried out to further investigate the binding mode interactions. Finally, the in silico ADME predictions indicated that the most potent lignan derivatives exhibited good drug-likeness.

Also flagged:Peripheral nerve injuryaxonofgene expressionnerve injuryextracellular
Journal Article 2022-05-09 No Snippets Liu M, Li P, Jia Y, Cui Q, Zhang K, Jiang J.
Show Full Abstract

Peripheral nerve injury (PNI) may lead to disability and neuropathic pain, which constitutes a substantial economic burden to patients and society. It was found that the peripheral nervous system (PNS) has the ability to regenerate after injury due to a permissive microenvironment mainly provided by Schwann cells (SCs) and the intrinsic growth capacity of neurons; however, the results of injury repair are not always satisfactory. Effective, long-distance axon regeneration after PNI is achieved by precise regulation of gene expression. Numerous studies have shown that in the process of peripheral nerve damage and repair, differential expression of non-coding RNAs (ncRNAs) significantly affects axon regeneration, especially expression of microRNAs (miRNAs), long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs). In the present article, we review the cellular and molecular mechanisms of axon regeneration after PNI, and analyze the roles of these ncRNAs in nerve repair. In addition, we discuss the characteristics and functions of these ncRNAs. Finally, we provide a thorough perspective on the functional mechanisms of ncRNAs in nervous injury repair, and explore the potential these ncRNAs offer as targets of nerve injury treatment.

Also flagged:PIWIcancernucleotidesgene expressionmethylationchromatin
Journal Article 2022-05-09 ✓ 1 Snippet Jia DD, Jiang H, Zhang YF, Zhang Y, Qian LL, Zhang YF.
In-Text Gene Mentions

CDK5 regulatory subunit-associated protein 1regulatory subunit-associated …

Show Full Abstract

Piwi-interacting RNAs (piRNAs) are a class of short chain noncoding RNAs that are constituted by 26-30 nucleotides (nt) and can couple with PIWI protein family. piRNAs were initially described in germline cells and are believed to be critical regulators of the maintenance of reproductive line. Increasing evidence has extended our perspectives on the biological significance of piRNAs and indicated that they could still affect somatic gene expression through DNA methylation, chromatin modification and transposon silencing, etc. Many studies have revealed that the dysregulation of piRNAs might contribute to diverse diseases through epigenetic changes represented by DNA methylation and chromatin modification. In this review, we summarized piRNA/PIWI protein-mediated DNA methylation regulation mechanisms and methylation changes caused by piRNA/PIWI proteins in different diseases, especially cancers. Since DNA methylation and inhibitory chromatin marks represented by histone H3 lysine 9 (H3K9) methylation frequently cooperate to silence genomic regions, we also included methylation in chromatin modification within this discussion. Furthermore, we discussed the potential clinical applications of piRNAs as a new type promising biomarkers for cancer diagnosis, as well as the significance of piRNA/PIWI protein-associated methylation changes in treatment, providing disparate insights into the potential applications of them.

Also flagged:tumorcancerdeathgastric cancerligand-receptorgastric tumor
Journal Article 2022-05-09 ✓ 1 Snippet Li Y, Hu X, Lin R, Zhou G, Zhao L, Zhao D, Zhang Y, Li W, Zhang Y, Ma P, Ren H, Liao X, Niu P, Wang T, Zhang X, Wang W, Gao R, Li Q, Church G, He J, Chen Y.
In-Text Gene Mentions

…F3, PDGFRA andSOX6( Table S6…

Show Full Abstract

<b>Background:</b> Gastric cancer remains the third most common cause of cancer-related death worldwide. The development of novel therapeutic strategies for gastric cancer requires a deep understanding of the tumor cells and microenvironment of gastric cancer. <b>Methods:</b> We performed the single-cell RNA sequencing (scRNA-seq) on nine untreated non-metastatic gastric cancer patients. The transcriptomic atlas and ligand-receptor-based intercellular communication networks of the single cells were characterized. <b>Results:</b> Here, we profiled the transcriptomes of 47,304 cells from nine patients with gastric cancer. Tregs cells were significantly enriched in the gastric tumor tissues with increased expression of immune suppression related genes, which suggest a more immunosuppressive microenvironment. We also observed the absence of separate exhausted CD8+ T cell cluster, and the low expression level of exhaustion markers PDCD1, CTLA4, HAVCR2, LAG-3, and TIGIT in those specific cells. These may serve as molecular-level evidence for the limited benefit of immunotherapy among gastric cancer patients. In addition, we found ACKR1 specifically expressed in tumor endothelial cells, associated with poor prognosis in the cohort data and potentially provided a novel target of gastric cancer treatment. Furthermore, the tight interaction between endothelial cells and fibroblast implied the important roles of fibroblast in tumor angiogenesis and the maintenance of tumor vasculature. <b>Conclusions:</b> In conclusion, this single-cell atlas provide understanding the cellular heterogeneity from molecular level in gastric cancer and will serve as a valuable resource for developing innovative early and companion diagnostics, as well as discovering novel targeted therapies for gastric cancer.

Also flagged:non-alcoholic fatty liver diseaseNAFLDhyperferritinemiaFerritinliver fibrosischronic liver disease
Journal Article 2022-05-09 ✓ 3 Snippets Trasolini R, Cox B, Galts C, Yoshida EM, Marquez V.
In-Text Gene Mentions

Exclusion criteria included genetic disorders of metabolism and other causes of liver disease including hepatitis B, hepatitis C, Wilson’s disease, autoimmune hepatitis, primary biliary cholangitis, primary sclerosing cholangitis, drug-induced liver injury, alpha-1-antitrypsin deficiency, and those with known hereditary hemochromatosis (HFE heterozygous or homozygous) or other diseases of iron overload (eg, transfusion associated).

HFE

hemochromatosis

Show Full Abstract

<h4>Background</h4>Non-alcoholic fatty liver disease (NAFLD) is common with widely ranging severity. Non-invasive risk scores for risk stratification are recommended but misclassify a significant proportion of patients. In situations where non-invasive risk scores do not provide guidance, referral is typically made to a Hepatologist for transient elastography or liver biopsy. Serum ferritin is elevated in many patients with NAFLD related to dysmetabolic and inflammatory hyperferritinemia. Ferritin is widely available and part of a standard workup for chronic liver disease.<h4>Methods</h4>To explore the association of ferritin and risk of fibrosis in NAFLD, we reviewed patients diagnosed with NAFLD at the hepatology clinic of the Vancouver General Hospital between the years of 2015 and 2018. We collected data on 317 patients retrospectively assessing for a relationship between serum ferritin and elastography score.<h4>Results</h4>Two hundred twenty-four patients were included in the final analysis. Median ferritin was 145 µg/L (IQR 62-311). Median liver stiffness was 5.2 kPa with 14.3% of patients having liver stiffness ≥8.7 kPa and 17.4% ≥ 8.0 kPa. ROC curve analysis using a liver stiffness ≥8.0 kPa as a cutoff for F2 fibrosis showed an AUROC of 0.54 for serum ferritin levels. At a cut-off of both 300 µg/L; and 450 µg/L median liver stiffness did not differ significantly in those with ferritin above the cutoff (ferritin ≥300 µg/L; <i>p</i> = 0.099, ferritin ≥450 µg/L; <i>p</i> = 0.12). Ferritin was significantly higher in male patients (198 versus 91 µg/L; <i>p</i> = 0.0001). There was a weak linear association between AST and ferritin levels.<h4>Conclusion</h4>In this cohort of 224 patients with NAFLD, serum ferritin was not predictive of significant liver fibrosis.

Also flagged:CD105TGF-βSmad2stem cell surfaceCD44collagen type 1
Journal Article 2022-05-09 ✓ 1 Snippet Thamm JR, Jounaidi Y, Mueller ML, Rosen V, Troulis MJ, Guastaldi FPS.
In-Text Gene Mentions

Sox6

Show Full Abstract

<h4>Objective</h4>A specific type of mesenchymal stem/progenitor cells (MSPCs), CD105<sup>+</sup> is reported to aid in cartilage regeneration through TGF-β/Smad2-signalling. The purpose of this study was to identify and characterize CD105<sup>+</sup> MSPCs in temporomandibular joint (TMJ) cartilage.<h4>Materials and methods</h4>MSPCs were isolated from mouse TMJ condyle explants and evaluated for their clonogenicity and pluripotential abilities. MSPC were examined for CD105 antigen using immunohistochemistry and flow cytometry.<h4>Results</h4>Immunohistochemistry revealed presence of CD105<sup>+</sup> MSPCs in the proliferative zone of condyle's cartilage. Only 0.2% of isolated MSPCs exhibited CD105, along with the stem cell surface markers CD44 and Sca-1. In CD105<sup>+</sup> MSPCs, intracellular immunostaining revealed significantly higher (<i>p</i> < 0.05) protein levels of collagen type 1, 2, proteoglycan 4. Ability for chondrogenic differentiation was found to be significantly higher (<i>p</i> < 0.05) after 4 weeks compared to CD105<sup>-</sup> cells, using alcian blue staining. CD105<sup>+</sup> cells were found to resemble an early MSPC subgroup with significantly higher gene expression of biglycan, proteoglycan 4, collagen type 2, Gli2, Sox5 (<i>p</i> < 0.001) and Sox9 (<i>p</i> < 0.05). In contrast, significantly lower levels of Runx2 (<i>p</i> < 0.05), Osterix, Trps1, Col10a1 (<i>p</i> < 0.01), Ihh (<i>p</i> < 0.001) related to chondrocyte senescence and commitment to osteogenic lineage, were observed compared to CD105<sup>-</sup> cells.<h4>Conclusion</h4>The study showed the existence of a CD105<sup>+</sup> MSPC subgroup within TMJ fibrocartilage that may be activated to aid in fibrocartilage repair.

Research Square 2022-05-09 Preprint (No Snippets API) Huang T, Zhao J, Pan R, Jiang T, Fu X, Huang Q, Wang X, Gong P, Zhang Y, Tian Y.
Show Full Abstract

<title>Abstract</title> <p>Parkinson’s disease (PD) is the second most common progressive neurodegenerative disorder. The emerging evidence suggests that long non-coding RNAs (lncRNAs) are involved in the pathogenesis of PD. In this study, we used gene expression profiles from GEO database to construct a PD-specific lncRNA-miRNA-mRNA ceRNA network. Functional enrichment analysis suggested that ceRNA network might participate in the development of PD. The PPI network was constructed to identify these interactions between proteins translated by the screened differentially expressed genes, and the ceRNA subnetwork based on five hub genes was set up. In a cohort of 32 PD patients and 31 healthy controls, the expression of 10 DElncRNAs (TTC3-AS1, LINC01259, ZMYND10-AS1, CHRM3-AS1, MYO16-AS1, AGBL5-IT1, HOTAIRM1, RABGAP1L-IT1, HLCS-IT1, and LINC00393) were further verified. Consistent with the microarray data, expression of LINC01259 was lower in total patients compared with total controls (P = 0.008), and other lncRNAs expression levels were not significantly different in the two groups. Intriguingly, such difference was only observed between male patients and male controls when dividing study participants based on their gender (P = 0.016). Receiver operating characteristic (ROC) curve analysis revealed that LINC01259 has diagnostic power of 0.694. Moreover, expression of LINC01259 was not correlated with age of patients, disease duration, disease stage, MDS-UPDRS and MMSE. The current study provides further evidence for dysregulation of lncRNAs in the circulation of PD patients and revealed LINC01259 has clinical potential as a biomarker for PD diagnosis.</p>

Also flagged:Dissociative disorderspsychiatric disorderscortisol receptorresponse to stressdepersonalization/derealization disorderdissociative amnesia
Journal Article 2022-05-08 ✓ 2 Snippets Rajkumar RP.
In-Text Gene Mentions

…monoaminergic transmission (5-HTT, COMT ), neural…

…case of the5-HTT, COMT, OXTR and…

Show Full Abstract

Dissociative disorders are a common and frequently undiagnosed group of psychiatric disorders, characterized by disruptions in the normal integration of awareness, personality, emotion and behavior. The available evidence suggests that these disorders arise from an interaction between genetic vulnerability and stress, particularly traumatic stress, but the attention paid to the underlying genetic diatheses has been sparse. In this paper, the existing literature on the molecular genetics of dissociative disorders, as well as of clinically significant dissociative symptoms not reaching the threshold of a disorder, is reviewed comprehensively across clinical and non-clinical samples. Association studies suggest a link between dissociative symptoms and genes related to serotonergic, dopaminergic and peptidergic transmission, neural plasticity and cortisol receptor sensitivity, particularly following exposure to childhood trauma. Genome-wide association studies have identified loci of interest related to second messenger signaling and synaptic integration. Though these findings are inconsistent, they suggest biologically plausible mechanisms through which traumatic stress can lead to pathological dissociation. However, methodological concerns related to phenotype definition, study power, and correction for the confounding factors limit the value of these findings, and they require replication and extension in studies with better design.

Also flagged:CarbonCarbon dotssynthesiscarbon nanomaterialsion channelsglomerular filtration
Journal Article 2022-05-08 No Snippets Wang B, Cai H, Waterhouse GIN, Qu X, Yang B, Lu S.
Show Full Abstract

Carbon dots (CDs), comprising crystalline graphitized carbon cores and polymer surface groups, are currently attracting a lot of interest in biological fields owing to their fluorescent properties, high photostability, biocompatibility and low toxicity. In addition, the easy preparation and functionalization of CDs stimulate the development of CDs-based composite materials with specific functions. Presently, the biological applications of CDs are growing at a remarkable speed, justifying the need for up-to-date review articles that capture recent progress in this blossoming field. In this review, breakthroughs in the synthesis, modification, optical properties, toxicology and biocatalytic platforms of CDs are described. Further, recent research related to bioimaging, biosensing, drug delivery, antibacterial, anticancer (photothermal therapy, photodynamic therapy and synergistic therapy) and antiviral therapies involving CDs are discussed in detail. Finally, a perspective on the prospects and challenges of CDs in the fields of biomedicine and biotechnology is provided.

Also flagged:PRDM16transcriptional regulatorepithelial cells proliferationPR domain containing 16Fgf20Notch
Journal Article 2022-05-07 ✓ 1 Snippet Ebeid M, Barnas K, Zhang H, Yaghmour A, Noreikaite G, Bjork BC.
In-Text Gene Mentions

…and downregulation ofPou3f2, Itga8, Ethd1, Clic6,…

Show Full Abstract

<h4>Background</h4>PR domain containing 16 (PRDM16) is a key transcriptional regulator in the development of craniofacial, adipose, and neural tissues. Our lab identified PRDM16 expression in the epithelial cells of the Kölliker's organ (KO) that starts at ~E13.5 and is maintained until KO disappearance. A transgenic mouse model that carries a gene trap null allele of Prdm16 (Prdm16<sup>cGT</sup> ) was used to characterize the impact of Prdm16 loss on cochlear development.<h4>Results</h4>At P0 Prdm16<sup>cGT</sup> null cochlea exhibited hypoplastic KO, shortened cochlear duct, increased density of hair cells (HCs) and supporting cells (SCs) in the apical turn as well as multiple isolated ectopic HCs within the KO domain. KO epithelial cells proliferation rate was reduced in the apical turn of the developing Prdm16<sup>cGT</sup> null cochlea vs controls. Bulk RNA sequencing of cochlear duct cells at E14.5 followed by quantitative real time PCR and mRNA Fluorescence in-situ hybridization (FISH) validation identified differentially expressed genes in Prdm16<sup>cGT</sup> null vs littermate control cochleae. Upregulated genes at E14.5 included Fgf20, as well as several Notch pathway genes (Lfng, Hes1, and Jag1).<h4>Conclusions</h4>This study characterizes Prdm16 expression during cochlear development and establishes its requirement for KO development.

Also flagged:Secretioncaspase-3ApoB100Lipin-1GAPDHsteatosis
Journal Article 2022-05-07 ✓ 1 Snippet Lin H, Wang L, Liu Z, Long K, Kong M, Ye D, Chen X, Wang K, Wu KK, Fan M, Song E, Wang C, Hoo RL, Hui X, Hallenborg P, Piao H, Xu A, Cheng KK.
In-Text Gene Mentions

…liver diseases (includinghemochromatosis, α 1‐antitrypsin deficiency,…

Show Full Abstract

Dysfunctional triglyceride-very low-density lipoprotein (TG-VLDL) metabolism is linked to metabolic-associated fatty liver disease (MAFLD); however, the underlying cause remains unclear. The study shows that hepatic E3 ubiquitin ligase murine double minute 2 (MDM2) controls MAFLD by blocking TG-VLDL secretion. A remarkable upregulation of MDM2 is observed in the livers of human and mouse models with different levels of severity of MAFLD. Hepatocyte-specific deletion of MDM2 protects against high-fat high-cholesterol diet-induced hepatic steatosis and inflammation, accompanied by a significant elevation in TG-VLDL secretion. As an E3 ubiquitin ligase, MDM2 targets apolipoprotein B (ApoB) for proteasomal degradation through direct protein-protein interaction, which leads to reduced TG-VLDL secretion in hepatocytes. Pharmacological blockage of the MDM2-ApoB interaction alleviates dietary-induced hepatic steatohepatitis and fibrosis by inducing hepatic ApoB expression and subsequent TG-VLDL secretion. The effect of MDM2 on VLDL metabolism is p53-independent. Collectively, these findings suggest that MDM2 acts as a negative regulator of hepatic ApoB levels and TG-VLDL secretion in MAFLD. Inhibition of the MDM2-ApoB interaction may represent a potential therapeutic approach for MAFLD treatment.

Also flagged:hydroxyapatitemineralvascular endothelial growth factorVEGFbone morphogenetic protein 2BMP-2
Journal Article 2022-05-07 No Snippets Camacho-Alonso F, Tudela-Mulero MR, Navarro JA, Buendía AJ, Mercado-Díaz AM.
Show Full Abstract

<h4>Objective</h4>To compare new bone formation in mandibular symphysis critical-sized bone defects (CSBDs) in healthy and osteoporotic rats filled with bioceramics (BCs) with or without buccal fat pad mesenchymal stem cells (BFPSCs).<h4>Materials and methods</h4>Thirty-two adult female Sprague-Dawley rats were randomized to two groups (n = 16 per group): group 1 healthy and group 2 osteoporotic (with bilateral ovariectomy). The central portion of the rat mandibular symphysis was used as a physiological CSBD. In each group, eight defects were filled with BC (hydroxyapatite 60% and β-tricalcium phosphate 40%) alone and eight with BFPSCs cultured on BC. The animals were sacrificed at 4 and 8 weeks, and the mandibles were processed for micro-computed tomography to analyze radiological union and bone mineral density (BMD); histological analysis of the bone union; and immunohistochemical analysis, which included immunoreactivity of vascular endothelial growth factor (VEGF) and bone morphogenetic protein 2 (BMP-2).<h4>Results</h4>In both groups, CSBDs filled with BC + BFPSCs showed greater radiological bone union, BMD and histological bone union, and more VEGF and BMP-2 positivity, compared with CSBDs treated with BC alone at 4 and 8 weeks.<h4>Conclusions</h4>The application of BFPSCs cultured on BCs improves bone regeneration in CSBDs compared with BCs alone in healthy and osteoporotic rats.<h4>Clinical relevance</h4>Our results may aid bone regeneration of maxillofacial CSBDs of both healthy and osteoporotic patients, but further studies are necessary.

Also flagged:FBXO2SUN2degradationSAD1/UNC84 domain protein-2tumorcancer
Journal Article 2022-05-07 ✓ 5 Snippets Ji J, Shen J, Xu Y, Xie M, Qian Q, Qiu T, Shi W, Ren D, Ma J, Liu W, Liu B.
In-Text Gene Mentions

Next, we showed the expression of SOX6 and FBXO2 was also positively correlated in some tumor types in the TCGA database, including OV (Fig. 2B, C), suggesting that SOX6 may be involved in the regulation of FBXO2 expression in OV.

In summary, we have revealed a tumor-promoting role of FBXO2 and a connection with SOX6 in OV.

…The transcription factorSOX6promoted FBXO2 expression…

…revealed a newSOX6-FBXO2-SUN2 axis that contribu…

…shRNA plasmids againstSOX6or FBXO2 were…

Show Full Abstract

SAD1/UNC84 domain protein-2 (SUN2) plays a tumor suppressor role in various types of cancer by inhibiting cancer cell proliferation, migration and promoting apoptosis. However, the post-translational regulation of SUN2 and the cellular mechanism responsible for its proteasomal degradation remains largely unknown. Here, we show that FBXO2, an E3 ubiquitin ligase of the F-box proteins (FBPs) family targets glycosylated SUN2 for ubiquitination and degradation via the ubiquitin-proteasome system (UPS). By integrating the Cancer Genome Atlas (TCGA), Gene Expression Omnibus (GEO), and the Encyclopedia of Cancer Cell Lines (CCLE) databases, we revealed that FBXO2 was selectively highly expressed in ovarian cancer (OV) tissues and cells. Patients with relatively high FBXO2 expression levels were associated with worse prognosis. Manipulation of the expression of FBXO2 affecting ovarian cancer cell proliferation, migration/invasion in vitro, and tumor growth in mice in vivo. The transcription factor SOX6 promoted FBXO2 expression by recognizing a putative response element localized on the promoter region of FBXO2. Abnormally highly expressed FBXO2 recognized and targeted glycosylated SUN2 protein for ubiquitination-depended degradation to prevent cell apoptosis, promote cell proliferation, and ultimately promote the progression of OV. Thus, we revealed a new SOX6-FBXO2-SUN2 axis that contributed to the development of OV, and targeting this axis may represent an effective OV treatment strategy.

Also flagged:HDbehavioralHuntington's diseasedeathneurodegenerative diseasechromosome
Journal Article 2022-05-07 ✓ 2 Snippets Varela LE, Arias MM, Martorell-Poveda MA, Giraldo CV, Estrada-Acuña RA.
In-Text Gene Mentions

The normal HTT gene contains a sequence of up to 36 Cytosine-Adenine-Guanine (CAG) amino acids, but when the number of CAG repeats increases, especially above 40, the HTT gene is considered mutated.

…gene called huntingtin (HTT), located on chromosome…

Show Full Abstract

<h4>Background</h4>People with Huntington's disease (HD) have increased functional and cognitive dependence. While numerous clinical, genetic, and therapeutic management studies have been carried out, few studies have investigated the disease from the personal experience and the context of people living with HD. To better serve these patients, our purpose is to understand, from the perspective of the patient and their families, how people with HD cope with their daily lives outside the clinical setting.<h4>Methods</h4>Thirty-three affected or at-risk people participated in this study. Participants were interviewed at their homes on distinct occasions during a family visit. We analyzed the data using Grounded Theory, which allowed us to understand how people live with the disease on their own terms.<h4>Results</h4>Living with HD is a process that begins with acceptance or denial that one is at risk for the disease or, growing awareness of the condition due to motor, behavioral, and cognitive changes, and, finally, loss of autonomy with physical dependence on another person, and loss of sense of self and family.<h4>Conclusion</h4>While the daily life of patients before disease onset was characterized by physical and mental/cognitive independence, with HD they become increasingly trapped in their bodies, and their complications are due to the lack of effective curable therapy.

Also flagged:PRDX2Extracellular MatrixSynthesisWnt5aYAP1CTGF
Journal Article 2022-05-07 No Snippets Sun X, Gu X, Peng J, Yang L, Zhang X, Ran Z, Xiong J.
Show Full Abstract

Although peroxiredoxin 2 (PRDX2) plays a vital role in relieving oxidative stress, its physiological function in cartilage development remains almost unknown. In this study, we found that the expression of PRDX2 significantly increased in the chondrocytes compared with pre-chondrocytes. PRDX2 knockdown significantly decreased the expression of extracellular matrix (ECM) protein (Col2a and Aggrecan), which led to blocked cartilage formation. Moreover, PRDX2 knockdown also inhibited the expression of connective tissue growth factor (CTGF). CTGF is an important growth factor that regulates synthesis of ECM proteins. We explored the possible regulatory mechanism by which PRDX2 regulated the expression of CTGF. Our results demonstrated that PRDX2 knockdown downregulated the expression of CTGF by inhibiting Wnt5a/Yes-associated protein 1 (YAP1) pathway. In addition, PRDX2 knockdown promoted the expression of interleukin 6 (IL-6), indicating PRDX2 expression had an anti-inflammatory function during antler growth. Mechanistically, PRDX2 knockdown promoted cartilage matrix degradation by activating the IL-6-mediated Janus Kinase 2/Signal Transducer and Activator of Transcription 3 (JAK2/STAT3) signaling pathway. These results reveal that PRDX2 is a potential regulator that promotes cartilage extracellular matrix synthesis.

Also flagged:Glycansbiosynthesisglycogenegalactosemucinfucose
Journal Article 2022-05-07 ✓ 3 Snippets Guindolet D, Woodward AM, Gabison EE, Argüeso P.
In-Text Gene Mentions

B4GALT5 is a glycosyltransferase responsible for the addition of galactose to N-glycans on proteins and carbohydrate moieties of glycolipids, and whose expression has been associated with the maintenance of stemness in breast cancer stem cells by inducing Frizzled-1 glycosylation and by constantly activating the canonical Wnt signaling pathway [16].

…expressed glycogenes wereB4GALT5and C1GALT1 .…

B4GALT5is a glycosyltransferase…

Show Full Abstract

Glycans function as valuable markers of stem cells but also regulate the ability of these cells to self-renew and differentiate. Approximately 2% of the human genome encodes for proteins that are involved in the biosynthesis and recognition of glycans. In the present study, we evaluated the expression of a small subset of glycogenes in human limbal epithelial cells with distinct clonogenic potential. Individual clones were classified as abortive or clonogenic, based on the fraction of the terminal colonies produced; clones leading exclusively to terminal colonies were referred to as abortive while those with half or fewer terminal colonies were referred to as clonogenic. An analysis of glycogene expression in clonogenic cultures revealed a high content of transcripts regulating the galactose and mannose metabolic pathways. Abortive clones were characterized by increased levels of <i>GCNT4</i> and <i>FUCA2</i>, genes that are responsible for the branching of mucin-type O-glycans and the hydrolysis of fucose residues on N-glycans, respectively. The expansion of primary cultures of human limbal epithelial cells for 10 days resulted in stratification and a concomitant increase in <i>MUC16</i>, <i>GCNT4</i> and <i>FUCA2</i> expression. These data indicate that the clonogenic potential of human limbal epithelial cells is associated with specific glycosylation pathways. Mucin-type O-glycan branching and increased fucose metabolism are linked to limbal epithelial cell differentiation.

Also flagged:Immunomodulationcognitive declinecopolymerrelapsing remitting multiple sclerosisneurodegenerative diseasesMS
Journal Article 2022-05-07 ✓ 1 Snippet Kasindi A, Fuchs DT, Koronyo Y, Rentsendorj A, Black KL, Koronyo-Hamaoui M.
In-Text Gene Mentions

HD is associated with a genetic mutation: a trinucleotide repeat expansion, CAG, in the Huntingtin (HTT) gene of humans.

Show Full Abstract

Novel, neuroprotective uses of Copaxone (generic name: glatiramer acetate-GA) are being examined, primarily in neurological conditions involving cognitive decline. GA is a well-studied synthetic copolymer that is FDA-approved for immune-based treatment of relapsing remitting multiple sclerosis (RRMS). Clinical studies have explored the potential mechanism of action (MOA) and outcomes of GA immunization in patients. Furthermore, results from these and animal studies suggest that GA has a direct immunomodulatory effect on adaptive and innate immune cell phenotypes and responses. These MOAs have been postulated to have a common neuroprotective impact in several neuroinflammatory and neurodegenerative diseases. Notably, several clinical studies report that the use of GA mitigated MS-associated cognitive decline. Its propensity to ameliorate neuro-proinflammatory and degenerative processes ignites increased interest in potential alternate uses such as in age-related macular degeneration (AMD), amyotrophic lateral sclerosis (ALS), and Alzheimer's disease (AD). Preclinical studies are exploring less frequent subcutaneous administration of GA, such as once weekly or monthly or a single dosing regimen. Indeed, cognitive functions were found to be either preserved, reversed, or improved after the less frequent treatment regimens with GA in animal models of AD. In this systematic review, we examine the potential novel uses of GA across clinical and pre-clinical studies, with evidence for its beneficial impact on cognition. Future investigation in large-size, double-blind clinical trials is warranted to establish the impact of GA immunomodulation on neuroprotection and cognitive preservation in various neurological conditions.

Also flagged:Copolymerstumorpolyfluorenedoxorubicinmethacrylatepolytyrosine
Journal Article 2022-05-07 No Snippets Liu F, Wang D, Wang J, Ma L, Yu C, Wei H.
Show Full Abstract

Bottlebrush copolymers with different chemical structures and compositions as well as diverse architectures represent an important kind of material for various applications, such as biomedical devices. To our knowledge, zwitterionic conjugated bottlebrush copolymers integrating fluorescence imaging and tumor microenvironment-specific responsiveness for efficient intracellular drug release have been rarely reported, likely because of the lack of an efficient synthetic approach. For this purpose, in this study, we reported the successful preparation of well-defined theranostic zwitterionic bottlebrush copolymers with unique brush-on-brush architecture. Specifically, the bottlebrush copolymers were composed of a fluorescent backbone of polyfluorene derivate (PFONPN) possessing the fluorescence resonance energy transfer with doxorubicin (DOX), primary brushes of poly(2-hydroxyethyl methacrylate) (PHEMA), and secondary graft brushes of an enzyme-degradable polytyrosine (PTyr) block as well as a zwitterionic poly(oligo (ethylene glycol) monomethyl ether methacrylate-co-sulfobetaine methacrylate) (P(OEGMA-<i>co</i>-SBMA)) chain with super hydrophilicity and highly antifouling ability via elegant integration of Suzuki coupling, NCA ROP and ATRP techniques. Notably, the resulting bottlebrush copolymer, PFONPN<sub>9</sub>-<i>g</i>-(PHEMA<sub>15</sub>-<i>g</i>-(PTyr<sub>16</sub>-<i>b</i>-P(OEGMA<sub>6</sub>-<i>co</i>-SBMA<sub>6</sub>)<sub>2</sub>)) (P<sub>2</sub>) with a lower MW ratio of the hydrophobic side chains of PTyr and hydrophilic side chains of P(OEGMA-<i>co</i>-SBMA) could self-assemble into stabilized unimolecular micelles in an aqueous phase. The resulting unimolecular micelles showed a fluorescence quantum yield of 3.9% that is mainly affected by the pendant phenol groups of PTyr side chains and a drug-loading content (DLC) of approximately 15.4% and entrapment efficiency (EE) of 90.6% for DOX, higher than the other micelle analogs, because of the efficient supramolecular interactions of π-π stacking between the PTyr blocks and drug molecules, as well as the moderate hydrophilic chain length. The fluorescence of the PFONPN backbone enables fluorescence resonance energy transfer (FRET) with DOX and visualization of intracellular trafficking of the theranostic micelles. Most importantly, the drug-loaded micelles showed accelerated drug release in the presence of proteinase K because of the enzyme-triggered degradation of PTyr blocks and subsequent deshielding of P(OEGMA-<i>co</i>-SBMA) corona for micelle destruction. Taken together, we developed an efficient approach for the synthesis of enzyme-responsive theranostic zwitterionic conjugated bottlebrush copolymers with a brush-on-brush architecture, and the resulting theranostic micelles with high DLC and tumor microenvironment-specific responsiveness represent a novel nanoplatform for simultaneous cell image and drug delivery.

Also flagged:SMIM1SEZ6L2intervertebral disc degenerationpyroptosisnucleuscancer
Journal Article 2022-05-07 ✓ 3 Snippets Wang N, Liu X, Fang X, Chen S, Xi Z, Zhang X, Xue C, Liu X, Xie L.
In-Text Gene Mentions

…SMIM1, FBLN2, ZFP2,B4GALT5, HCRT SLC6A17, MUSK,…

…6(c) ), andB4GALT5was not highly…

…SMIM1, FBLN2, ZFP2,B4GALT5, HCRT, SLC6A17, MUSK,…

Show Full Abstract

<h4>Background</h4>Inflammatory reactions and pyroptosis play an important role in the pathology of intervertebral disc degeneration (IDD). The aim of the present study was to investigate pyroptosis in the nucleus pulposus cells (NPCs) of inflammatory induced IDD by bioinformatic methods and to search for possible diagnostic biomarkers.<h4>Methods</h4>Gene expression profiles related to IDD were downloaded from the GEO database to identify differentially expressed genes (DEGs) between inflammation-induced IDD and non-inflammatory intervention samples. Pyroptosis genes were then searched for, and their expression in IDD was analyzed. Weighted gene co-expression network analysis (WGCNA) was then used to search for modules of IDD genes associated with pyroptosis and intersected with DEGs to discover candidate genes that would be diagnostically valuable. A LASSO model was developed to screen for genes that met the requirements, and ROC curves were created to clarify the diagnostic value of the genetic markers. Ultimately, the screened genes were further validated, and their diagnostic value assessed by selecting gene sets from the GEO database. RT-PCR was used to assess the mRNA expression of diagnostic markers in the nucleus pulposus (NP). Pan-cancer analysis was applied to demonstrate the expression and prognostic value of the screened genes in various tumors.<h4>Results</h4>A total of 733 DEGs were identified in GSE41883 and GSE27494, which were mainly enriched in transmembrane receptor protein serine/threonine, kinase signaling pathway, response to lipopolysaccharide, and other biological processes, and they were mainly related to TGF beta signaling pathway, toll-like receptor signaling pathway, and TNF signaling pathway. A total of 81 genes related to pyroptosis were identified in the literature, and eight genes related to IDD were identified in the Veen diagram, namely, IL1A, IL1B, NOD2, GBP1, IL6, AK1, EEF2K, and PYCARD. Eleven candidate genes were obtained after locating the intersection of pyroptosis-related module genes and DEGs according to WGCNA analysis. A total of six valid genes were obtained after constructing a machine learning model, and five key genes were finally identified after correlation analysis. GSE23132 and GSE56081 validated the candidate genes, and the final IDD-related diagnostic markers were obtained as SMIM1 and SEZ6L2. RT-PCR results indicated that the mRNA expression of both was significantly elevated in IDD. The pan-cancer analysis demonstrated that SMIM1 and SEZ6L2 have important roles in the expression and prognosis of various tumors.<h4>Conclusion</h4>In conclusion, this research identifies SMIM1 and SEZ6L2 as important biomarkers of IDD associated with pyroptosis, which will help to unravel the development and pathogenesis of IDD and determine potential therapeutic targets.

Also flagged:HBV) infectionhepatocellular carcinomatumorsHBV infectiontumorhepatitis B surface antigen
Journal Article 2022-05-07 ✓ 2 Snippets Yu J, Zhang H, Zhang Y, Zhang X.
In-Text Gene Mentions

…ARNT2, ATOH8, MT1X,SOX6, TAGLN, and STMN1…

…ARNT2, ATOH8, MT1X,SOX6, and TAGLN were…

Show Full Abstract

Hepatitis B virus (HBV) infection is the most prominent risk factor for developing hepatocellular carcinoma (HCC), which can increase the incidence of HCC by more than 100 times. Accumulated evidence has revealed that non-coding RNAs (ncRNAs) play a regulatory role in various tumors through the long non-coding RNA (lncRNA)-microRNA (miRNA)-mRNA regulation axis. However, the involvement of the ncRNA regulatory network in the progression of HBV infection-induced HCC remains elusive. In the current work, five tumor samples from patients with hepatitis B surface antigen (HBsAg)-positive HCC and three tumor samples from patients with HBsAg-negative HCC were collected for whole-transcriptome sequencing. Between the two groups, 841 lncRNAs, 54 miRNAs, and 1118 mRNAs were identified to be differentially expressed (DE). The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses indicated that DE genes were mainly involved in cancer-related pathways, including Wnt and MAPK signaling pathways. The Gene Expression Omnibus (GEO) analysis further validated the selected DE mRNAs. The DE lncRNA-miRNA-mRNA network was built to explore the effect of HBV infection on the regulation of ncRNAs in HCC. These findings provide novel insights into the role of HBV infection in the progression of HCC.

Also flagged:Liver Injuryandrogen receptorandrogen receptorssteroidsosteoporosisprostate cancers
Journal Article 2022-05-07 ✓ 2 Snippets Weinblatt D, Roy S.
In-Text Gene Mentions

…homeostatic iron regulator (HFE) gene testing, and…

…by a negativeHFEgene testing.…

Show Full Abstract

Selective androgen receptor modulators (SARMs) are compounds that bind to androgen receptors and have similar anabolic properties to anabolic steroids. Unlike anabolic steroids, which bind to androgen receptors in many tissues all over the body, individual SARMs selectively bind androgen receptors in certain tissues, but not in others. This selectivity has attracted researchers due to the possibility of using SARMs for the potential benefits of androgen receptor stimulation, such as increased muscle mass and increased bone density, while minimizing the adverse effects, such as erythrocytosis and hepatotoxicity. Enobosarm, a SARM, has been studied for use in treatment of cachexia, osteoporosis, breast and prostate cancers, and stress urinary incontinence. Enobosarm can be found in some over-the-counter muscle-building supplements. We report a 31-year-old man with no significant personal or family medical history who presented with itching and dark-colored urine for 1 week. Three weeks prior to presentation, he had begun using a muscle-building supplement containing enobosarm. Diagnostic workup concluded a drug-induced hepatocellular liver injury secondary to enobosarm, which subsequently improved after discontinuation of enobosarm-containing muscle-building supplement use. As enobosarm and other SARMs are increasingly found in the over-the-counter supplements and being studied for other clinical applications, it is important to recognize their potential for liver toxicity.

SSRN 2022-05-07 Preprint (No Snippets API) Kovac M, Mitic G, Milenkovic M, Basaraic D, Tomic B, Markovic O, Zdravkovic M, Ignjatovic V.
Show Full Abstract

Background: Coagulation dysfunction represents a serious complication in patients during the COVID-19 infection, while fulminant thrombotic complications emerge as critical issues in individuals with severe COVID-19. In addition to a serious clinical presentation, comorbidities and age significantly contribute to the development of thrombotic complications. However, there is very little data on association of congenital thrombophilia and thrombotic events in the setting of COVID-19. Our study aimed to evaluate the risk of COVID-19 associated thrombosis in patients with congenital thrombophilia.<br><br>Methods: This prospective, case control study included patients with confirmed COVID-19 infection, followed 6 months post-confirmation. The final outcome was a thrombotic event. In total, 90 COVID-19 patients, 30 with known congenital thrombophilia and 60 patients with no thrombophilia within the period July 2020-November 2021, were included in the study. Evaluation of hemostatic parameters including FVIII activity and D-dimer was performed for all patients at 1 month, 3 months and 6 months post-COVID-19 diagnosis.<br><br>Results: Symptomatic thrombotic events were observed in 7/30 (23%) COVID-19 patients with thrombophilia and 12/60 (20%) without thrombophilia, P = 0.715. In addition, the two groups had comparable distribution of thrombosis localization, time to thrombotic event, effect of antithrombotic treatment and changes in FVIII activity, while D-dimer levels were significantly higher in patients without thrombophilia.<br><br>Conclusion: Our findings suggest that patients with congenital thrombophilia, irrespective of their age, a mild clinical picture and absence of comorbidities, should receive anticoagulant prophylaxis, adjusted based on the specific genetic defect.

Also flagged:paclitaxellipidmembraneTGF-βSMADperitoneal fibrosis
Journal Article 2022-05-06 No Snippets Silva FMO, Carvalho PO, Costalonga EC, Pepineli R, Maranhão RC, Noronha IL.
Show Full Abstract

<h4>Background</h4>Progressive fibrous thickening of peritoneal membrane (PM) is a major complication of long-term peritoneal dialysis. TGF-β/SMAD pathway activation, inflammation and neoangiogenesis have an important role in PM changes induced by peritoneal dialysis. Here, we investigated the effects of paclitaxel (PTX) carried in lipid core nanoparticles (LDE) on the development of peritoneal fibrosis (PF) in rats.<h4>Methods</h4>To induce PF, 21 male Wistar rats (300-350g) were injected with chlorhexidine gluconate for 15 consecutive days and randomly assigned to three groups: 1)PF, n = 5: no treatment; 2)LDE, n = 8: treated with LDE only, 3/3 days during 15 days; 3)LDE-PTX, n = 8: treated with PTX (4mg/kg) associated with LDE, 3/3 days during 15 days. A Control group without PF induction (n = 5) was designed, received saline solution, 3/3 days. Peritoneum function tests were performed, and anterior abdominal wall samples of the PM were collected for analyses of peritoneal thickness, immunohistochemitry, and gene expression.<h4>Results</h4>LDE-PTX treatment preserved the membrane function, maintaining the ultrafiltration rate and mass transfer of glucose at normal levels. LDE-PTX also prevented PM thickening induced by chlorhexidine gluconate injections. LDE-PTX treatment reduced the number of myofibroblasts infiltrating PM and inhibited the cell proliferation. Gene expression of fibronectin, FSP-1, VEGF, TGF-β, and SMAD3 were reduced by LDE-PTX.<h4>Conclusions</h4>LDE-PTX was effective to prevent development of PF and preserve the PM filtration capacity in this rat model, with clear-cut actions on pro-fibrotic mechanisms. Thus, LDE-PTX can be candidate for future clinical trials as adjuvant to peritoneal dialysis to prevent PF development, since this preparation is devoid of toxicity as shown previously.

Also flagged:Hemoglobin
Journal Article 2022-05-06 No Snippets Amendolia B, Kilic N, Afridi F, Qari O, Bhat V, Nakhla D, Sadre S, Eckardt R, Nakhla T, Bhandari V, Aghai ZH.
Show Full Abstract

<h4>Objectives</h4>To assess the impact of delayed cord clamping (DCC) for 45 seconds on hemoglobin at birth and close to discharge in very low birth weight (VLBW) infants and to compare modes of delivery in infants who received DCC.<h4>Study design</h4>In a retrospective study, 888 VLBW infants (≤1,500 g) who survived to discharge and received immediate cord clamping (ICC) were compared with infants who received DCC. Infants who received DCC and born via Cesarean section (C-section) were compared with those born via vaginal birth.<h4>Results</h4>A total of 555 infants received ICC and 333 DCC. Only 188 out of 333 VLBW infants (56.5%) born during the DCC period received DCC. DCC was associated with higher hemoglobin at birth (15.9 vs. 14.9 g/dL, <i>p</i> = 0.001) and close to discharge (10.7 vs. 10.1 g/dL, <i>p</i> < 0.001) and reduced need for blood transfusion (39.4 vs. 54.9%, <i>p</i> < 0.001). In the DCC group, hemoglobin at birth and close to discharge was similar in infants born via C-section and vaginal birth.<h4>Conclusion</h4>DCC for 45 seconds increased hemoglobin at birth and close to discharge and reduced need for blood transfusion in VLBW infants. DCC for 45 seconds was equally effective for infants born by C-section and vaginal delivery. Approximately 44% of VLBW infants did not receive DCC even after implementing DCC guidelines.<h4>Key points</h4>· Studies to date have shown that DCC improves mortality and short- and long-term outcomes in VLBW infants.. · No consistent guidelines for the duration of DCC in preterm and term neonates.. · DCC for 45 seconds increased hemoglobin at birth and close to discharge in VLBW infants..

Also flagged:PI3KAKTmTORC1FOXM1transcription factorspermatogenesis
Journal Article 2022-05-06 No Snippets La HM, Liao J, Legrand JMD, Rossello FJ, Chan AL, Vaghjiani V, Cain JE, Papa A, Lee TL, Hobbs RM.
Show Full Abstract

Maintenance of male fertility requires spermatogonial stem cells (SSCs) that self-renew and generate differentiating germ cells for production of spermatozoa. Germline cells are sensitive to genotoxic drugs and patients receiving chemotherapy can become infertile. SSCs surviving treatment mediate germline recovery but pathways driving SSC regenerative responses remain poorly understood. Using models of chemotherapy-induced germline damage and recovery, here we identify unique molecular features of regenerative SSCs and characterise changes in composition of the undifferentiated spermatogonial pool during germline recovery by single-cell analysis. Increased mitotic activity of SSCs mediating regeneration is accompanied by alterations in growth factor signalling including PI3K/AKT and mTORC1 pathways. While sustained mTORC1 signalling is detrimental for SSC maintenance, transient mTORC1 activation is critical for the regenerative response. Concerted inhibition of growth factor signalling disrupts core features of the regenerative state and limits germline recovery. We also demonstrate that the FOXM1 transcription factor is a target of growth factor signalling in undifferentiated spermatogonia and provide evidence for a role in regeneration. Our data confirm dynamic changes in SSC functional properties following damage and support an essential role for microenvironmental growth factors in promoting a regenerative state.

Also flagged:MFN1MFN2peroxisomesMitochondriaorganelleslipid
Journal Article 2022-05-06 ✓ 2 Snippets Huo Y, Sun W, Shi T, Gao S, Zhuang M.
In-Text Gene Mentions

Dual organelle targeting protein ECI2organelle targeting protein…

ECI2and Pex34 are…

Show Full Abstract

Mitochondria and peroxisomes are two types of functionally close-related organelles, and both play essential roles in lipid and ROS metabolism. However, how they physically interact with each other is not well understood. In this study, we apply the proximity labeling method with peroxisomal proteins and report that mitochondrial protein mitofusins (MFNs) are in proximity to peroxisomes. Overexpression of MFNs induces not only the mitochondria clustering but also the co-clustering of peroxisomes. We also report the enrichment of MFNs at the mitochondria-peroxisome interface. Induced mitofusin expression gives rise to more mitochondria-peroxisome contacting sites. Furthermore, the tethering of peroxisomes to mitochondria can be inhibited by the expression of a truncated MFN2, which lacks the transmembrane region. Collectively, our study suggests MFNs as regulators for mitochondria-peroxisome contacts. Our findings are essential for future studies of inter-organelle metabolism regulation and signaling, and may help understand the pathogenesis of mitofusin dysfunction-related disease.

Also flagged:ATRTpediatric tumor of thepediatric cancersgene expressionMAP7
Journal Article 2022-05-06 No Snippets Xu X, Yuan H, Pan J, Chen W, Chen C, Li Y, Li F.
Show Full Abstract

<h4>Background</h4>Atypical teratoid/rhabdoid tumor (AT/RT) is a malignant pediatric tumor of the central nervous system (CNS) with high recurrence and low survival rates that is often misdiagnosed. MicroRNAs (miRNAs) are involved in the tumorigenesis of numerous pediatric cancers, but their roles in AT/RT remain unclear.<h4>Methods</h4>In this study, we used miRNA sequencing and gene expression microarrays from patient tissue to study both the miRNAome and transcriptome traits of AT/RT.<h4>Results</h4>Our findings demonstrate that 5 miRNAs were up-regulated, 16 miRNAs were down-regulated, 179 mRNAs were up-regulated and 402 mRNAs were down-regulated in AT/RT. qPCR revealed that hsa-miR-17-5p and MAP7 mRNA were the most significantly differentially expressed miRNA and mRNA in AT/RT tissues. Furthermore, the results from analyses using the miRTarBase database identified MAP7 mRNA as a target gene of hsa-miR-17-5p.<h4>Conclusions</h4>Our findings suggest that the dysregulation of hsa-miR-17-5p may be a pivotal event in AT/RT and miRNAs that may represent potential therapeutic targets and diagnostic biomarkers.

Also flagged:idiopathic pulmonary fibrosisfibrotic diseasetransforming growth factor-βTGF-βoxygenextracellular
Journal Article 2022-05-06 No Snippets Liu J, Wu Z, Liu Y, Zhan Z, Yang L, Wang C, Jiang Q, Ran H, Li P, Wang Z.
Show Full Abstract

<h4>Background</h4>Idiopathic pulmonary fibrosis (IPF) is a progressive fibrotic disease with pathophysiological characteristics of transforming growth factor-β (TGF-β), and reactive oxygen species (ROS)-induced excessive fibroblast-to-myofibroblast transition and extracellular matrix deposition. Macrophages are closely involved in the development of fibrosis. Nuclear factor erythroid 2 related factor 2 (Nrf2) is a key molecule regulating ROS and TGF-β expression. Therefore, Nrf2 signaling modulation might be a promising therapy for fibrosis. The inhalation-based drug delivery can reduce systemic side effects and improve therapeutic effects, and is currently receiving increasing attention, but direct inhaled drugs are easily cleared and difficult to exert their efficacy. Therefore, we aimed to design a ROS-responsive liposome for the Nrf2 agonist dimethyl fumarate (DMF) delivery in the fibrotic lung. Moreover, we explored its therapeutic effect on pulmonary fibrosis and macrophage activation.<h4>Results</h4>We synthesized DMF-loaded ROS-responsive DSPE-TK-PEG@DMF liposomes (DTP@DMF NPs). DTP@DMF NPs had suitable size and negative zeta potential and excellent capability to rapidly release DMF in a high-ROS environment. We found that macrophage accumulation and polarization were closely related to fibrosis development, while DTP@DMF NPs could attenuate macrophage activity and fibrosis in mice. RAW264.7 and NIH-3T3 cells coculture revealed that DTP@DMF NPs could promote Nrf2 and downstream heme oxygenase-1 (HO-1) expression and suppress TGF-β and ROS production in macrophages, thereby reducing fibroblast-to-myofibroblast transition and collagen production by NIH-3T3 cells. In vivo experiments confirmed the above findings. Compared with direct DMF instillation, DTP@DMF NPs treatment presented enhanced antifibrotic effect. DTP@DMF NPs also had a prolonged residence time in the lung as well as excellent biocompatibility.<h4>Conclusions</h4>DTP@DMF NPs can reduce macrophage-mediated fibroblast-to-myofibroblast transition and extracellular matrix deposition to attenuate lung fibrosis by upregulating Nrf2 signaling. This ROS-responsive liposome is clinically promising as an ideal delivery system for inhaled drug delivery.

Also flagged:tumormelanomatumorsinterferoncancerscancer
Journal Article 2022-05-06 No Snippets Reticker-Flynn NE, Zhang W, Belk JA, Basto PA, Escalante NK, Pilarowski GOW, Bejnood A, Martins MM, Kenkel JA, Linde IL, Bagchi S, Yuan R, Chang S, Spitzer MH, Carmi Y, Cheng J, Tolentino LL, Choi O, Wu N, Kong CS, Gentles AJ, Sunwoo JB, Satpathy AT, Plevritis SK, Engleman EG.
Show Full Abstract

For many solid malignancies, lymph node (LN) involvement represents a harbinger of distant metastatic disease and, therefore, an important prognostic factor. Beyond its utility as a biomarker, whether and how LN metastasis plays an active role in shaping distant metastasis remains an open question. Here, we develop a syngeneic melanoma mouse model of LN metastasis to investigate how tumors spread to LNs and whether LN colonization influences metastasis to distant tissues. We show that an epigenetically instilled tumor-intrinsic interferon response program confers enhanced LN metastatic potential by enabling the evasion of NK cells and promoting LN colonization. LN metastases resist T cell-mediated cytotoxicity, induce antigen-specific regulatory T cells, and generate tumor-specific immune tolerance that subsequently facilitates distant tumor colonization. These effects extend to human cancers and other murine cancer models, implicating a conserved systemic mechanism by which malignancies spread to distant organs.

Also flagged:lipidglycosylphosphatidylinositol-anchored membrane proteinobesitydepressionautismcluster of differentiation 36
Journal Article 2022-05-06 ✓ 5 Snippets Yoo A, Joo Y, Cheon Y, Lee SJ, Lee S.
In-Text Gene Mentions

In a previous study, we found that NEGR1 is involved in cholesterol transport by interacting with the Niemann-Pick diseases type C 2 protein, which functions critically in intracellular cholesterol trafficking (20).

Thus, our new findings on the NEGR1-CD36 association may be useful for identifying a potential target for controlling intracellular fatty acid and cholesterol levels.

Multiple genome-wide association studies have revealed that genetic alterations in NEGR1 are associated with obesity (13), intellectual disability (14), schizophrenia (15), depression (16), and Alzheimer’s disease (17).

Then, we examined NEGR1-deficient MEFs with or without preincubation in 0.1 mM oleic acid for 24 h.

Similarly, ROS production of NEGR1−/− MEFs increased more severely with the addition of oleic acid to the culture media (Fig. 7D), suggesting that NEGR1-deficient cells have higher levels of oxidative stress.

Show Full Abstract

Neuronal growth regulator 1 (NEGR1) is a glycosylphosphatidylinositol-anchored membrane protein associated with several human pathologies, including obesity, depression, and autism. Recently, significantly enlarged white adipose tissue, hepatic lipid accumulation, and decreased muscle capacity were reported in Negr1-deficient mice. However, the mechanism behind these phenotypes was not clear. In the present study, we found NEGR1 to interact with cluster of differentiation 36 (CD36), the major fatty acid translocase in the plasma membrane. Binding assays with a soluble form of NEGR1 and in situ proximal ligation assays indicated that NEGR1-CD36 interaction occurs at the outer leaflet of the cell membrane. Furthermore, we show that NEGR1 overexpression induced CD36 protein destabilization in vitro. Both mRNA and protein levels of CD36 were significantly elevated in the white adipose tissue and liver tissues of Negr1<sup>-/-</sup> mice. Accordingly, fatty acid uptake rate increased in NEGR1-deficient primary adipocytes. Finally, we demonstrated that Negr1<sup>-/-</sup> mouse embryonic fibroblasts showed elevated reactive oxygen species levels and decreased adenosine monophosphate-activated protein kinase activation compared with control mouse embryonic fibroblasts. Based on these results, we propose that NEGR1 regulates cellular fat content by controlling the expression of CD36.

Also flagged:acidpsychiatric disordersautism spectrum disorderparvalbuminPVautism
Journal Article 2022-05-06 ✓ 1 Snippet Yu D, Li T, Delpech JC, Zhu B, Kishore P, Koshi T, Luo R, Pratt KJB, Popova G, Nowakowski TJ, Villeda SA, Piao X.
In-Text Gene Mentions

…Lhx8 , andSox6—gives rise to…

Show Full Abstract

Parvalbumin-positive (PV<sup>+</sup>) interneurons play a critical role in maintaining circuit rhythm in the brain, and their reduction is implicated in autism spectrum disorders. Animal studies demonstrate that maternal immune activation (MIA) leads to reduced PV<sup>+</sup> interneurons in the somatosensory cortex and autism-like behaviors. However, the underlying molecular mechanisms remain largely unknown. Here, we show that MIA down-regulates microglial <i>Gpr56</i> expression in fetal brains in an interleukin-17a-dependent manner and that conditional deletion of microglial <i>Gpr56</i> [<i>Gpr56</i> conditional knockout (cKO)] mimics MIA-induced PV<sup>+</sup> interneuron defects and autism-like behaviors in offspring. We further demonstrate that elevated microglial tumor necrosis factor-α expression is the underlying mechanism by which MIA and <i>Gpr56</i> cKO impair interneuron generation. Genetically restoring <i>Gpr56</i> expression in microglia ameliorates PV<sup>+</sup> interneuron deficits and autism-like behaviors in MIA offspring. Together, our study demonstrates that microglial GPR56 plays an important role in PV<sup>+</sup> interneuron development and serves as a salient target of MIA-induced neurodevelopmental disorders.

Also flagged:cancerchromosomenucleotideTP53CHEK1MET
Journal Article 2022-05-06 ✓ 1 Snippet Li Q, Ren Z, Cao K, Li MM, Wang K, Zhou Y.
In-Text Gene Mentions

…, BROX ,BTN3A3, EFCAB13 ,…

Show Full Abstract

Several knowledgebases are manually curated to support clinical interpretations of thousands of hotspot somatic mutations in cancer. However, discrepancies or even conflicting interpretations are observed among these databases. Furthermore, many previously undocumented mutations may have clinical or functional impacts on cancer but are not systematically interpreted by existing knowledgebases. To address these challenges, we developed CancerVar to facilitate automated and standardized interpretations for 13 million somatic mutations based on the AMP/ASCO/CAP 2017 guidelines. We further introduced a deep learning framework to predict oncogenicity for these variants using both functional and clinical features. CancerVar achieved satisfactory performance when compared to several independent knowledgebases and, using clinically curated datasets, demonstrated practical utility in classifying somatic variants. In summary, by integrating clinical guidelines with a deep learning framework, CancerVar facilitates clinical interpretation of somatic variants, reduces manual work, improves consistency in variant classification, and promotes implementation of the guidelines.

Also flagged:DolutegravirbindingRhamnetinhydrogen-methyltransferase2019-nCoV
Journal Article 2022-05-06 No Snippets Rowaiye AB, Oli AN, Onuh OA, Emeter NW, Bur D, Obideyi OA, Dayisi OC, Akpa JN, Birah L, Omaka EE, Iseghohi FO, Otitoju AP, Uzor PF, Okoyeh JN.
Show Full Abstract

<h4>Background</h4>The 2'-O-methyltransferase is responsible for the capping of SARS-CoV-2 mRNA and consequently the evasion of the host's immune system. This study aims at identifying prospective natural inhibitors of the active site of SARS-CoV-2 2'O-methyltransferase (2'-OMT) through an in silico approach.<h4>Materials and methods</h4>The target was docked against a library of natural compounds obtained from edible African plants using PyRx - virtual screening software. The antiviral agent, Dolutegravir which has a binding affinity score of -8.5 kcal mol<sup>-1</sup> with the SARS-CoV-2 2'-OMT was used as a standard. Compounds were screened for bioavailability through the SWISSADME web server using their molecular descriptors. Screenings for pharmacokinetic properties and bioactivity were performed with PKCSM and Molinspiration web servers respectively. The PLIP and Fpocket webservers were used for the binding site analyses. The Galaxy webserver was used for simulating the time-resolved motions of the apo and holo forms of the target while the MDWeb web server was used for the analyses of the trajectory data.<h4>Results</h4>The Root-Mean-Square-Deviation (RMSD) induced by Rhamnetin is 1.656A<sup>0</sup> compared to Dolutegravir (1.579A<sup>0</sup>). The average B-factor induced by Rhamnetin is 113.75 while for Dolutegravir is 78.87; the Root-Mean-Square-Fluctuation (RMSF) for Rhamnetin is 0.75 and for Dolutegravir is 0.67. Also, at the active site, Rhamnetin also has a binding affinity score of -9.5 kcal mol<sup>-1</sup> and forms 7 hydrogen bonds compared to Dolutegravir which has -8.5 kcal mol<sup>-1</sup> and forms 4 hydrogen bonds respectively.<h4>Conclusion</h4>Rhamnetin showed better inhibitory activity at the target's active site than Dolutegravir.

Also flagged:Calciumsilicondicalcium silicatealbumincalcium phosphatehydroxyapatite
Journal Article 2022-05-06 No Snippets Ressler A, Bauer L, Prebeg T, Ledinski M, Hussainova I, Urlić I, Ivanković M, Ivanković H.
Show Full Abstract

Increasing attention is focused on developing biomaterials as temporary scaffolds that provide a specific environment and microstructure for bone tissue regeneration. The aim of the present work was to synthesize silicon-doped biomimetic multi-phase composite scaffolds based on bioactive inorganic phases and biocompatible polymers (poly(ε-caprolactone), PCL) using simple and inexpensive methods. Porous multi-phase composite scaffolds from cuttlefish bone were synthesized using a hydrothermal method and were further impregnated with (3-aminopropyl)triethoxysilane 1-4 times, heat-treated (1000 °C) and coated with PCL. The effect of silicon doping and the PCL coating on the microstructure and mechanical and biological properties of the scaffolds has been investigated. Multi-phase scaffolds based on calcium phosphate (hydroxyapatite, <i>α</i>-tricalcium phosphate, <i>β</i>-tricalcium phosphate) and calcium silicate (wollastonite, larnite, dicalcium silicate) phases were obtained. Elemental mapping revealed homogeneously dispersed silicon throughout the scaffolds, whereas silicon doping increased bovine serum albumin protein adsorption. The highly porous structure of cuttlefish bone was preserved with a composite scaffold porosity of ~78%. A compressive strength of ~1.4 MPa makes the obtained composite scaffolds appropriate for non-load-bearing applications. Cytocompatibility assessment by an MTT assay of human mesenchymal stem cells revealed the non-cytotoxicity of the obtained scaffolds.

Also flagged:spinal cord injurychemokinesaxonal
Journal Article 2022-05-06 No Snippets Wang R, Zhou R, Chen Z, Gao S, Zhou F.
Show Full Abstract

It is been over 100 years since glial cells were discovered by Virchow. Since then, a great deal of research was carried out to specify these further roles and properties of glial cells in central nervous system (CNS). As it is well-known that glial cells, such as astrocytes, microglia, oligodendrocytes (OLs), and oligodendrocyte progenitor cells (OPCs) play an important role in supporting and enabling the effective nervous system function in CNS. After spinal cord injury (SCI), these glial cells play different roles in SCI and repair. In this review, we will discuss in detail about the role of glial cells in the healthy CNS and how they respond to SCI.

Also flagged:Nuclear Factor-κBWntβ-CateninMyalgic Encephalomyelitischronic fatigue spectrum disordersME
Journal Article 2022-05-06 ✓ 3 Snippets Maes M, Kubera M, Kotańska M.
In-Text Gene Mentions

…(63), SOD2 (57),PRDX6(47), peroxides (45),…

…and peroxiredoxin 6 (PRDX6) (catalyzes the reduction…

…NOS1, NOS3, andPRDX6.…

Show Full Abstract

There is evidence that chronic fatigue spectrum disorders (CFAS-Ds), including myalgic encephalomyelitis (ME), chronic fatigue syndrome (CFS), and chronic fatigue with physiosomatic symptoms including when due to comorbid medical disease, are characterized by neuroimmune and neuro-oxidative biomarkers. This study was performed to delineate the protein-protein interaction (PPI) network of CFAS-D and to discover the pathways, molecular patterns, and domains enriched in their PPI network. We performed network, enrichment, and annotation analyses using differentially expressed proteins and metabolics, which were established in patients with CFAS-D. The PPI network analysis revealed that the backbone of the highly connective CFAS-D network comprises <i>NFKB1</i>, <i>CTNNB1</i>, <i>ALB</i>, peroxides, <i>NOS2</i>, tumor necrosis factor (<i>TNF</i>), and interleukin-6 (<i>IL-6</i>) and that the network comprises interconnected immune-oxidative-nitrosative and Wnt/β-catenin subnetworks. Multiomics enrichment analysis shows that the CFAS-D network is highly significantly associated with cellular (antioxidant) detoxification, hydrogen peroxide metabolic process, peroxidase and oxidoreductase activity, interleukin-10 (IL-10) anti-inflammatory signaling and neurodegenerative canonical Wnt, the β-catenin complex, cadherin domains, cell-cell junctions and TLR2/4 pathways, and the transcription factors nuclear factor kappa B (NF-κB) and RELA. The top 10 DOID annotations of the CFAS-D network include four intestinal, three immune system disorders, cancer, and infectious disease. The custom Gene Ontology (GO) term annotation analysis revealed that the CFAS-D network is associated with a response to a toxic substance, lipopolysaccharides, bacterium, or virus. In conclusion, CFAS-D may be triggered by a variety of stimuli and their effects are mediated by aberrations in the cross-talks between redox, NF-κB, and Wnt/β-catenin signaling pathways leading to dysfunctions in multicellular organismal homeostatic processes.

Also flagged:cardiovascular diseasesironsegmentationinterstitial fibrosiswaterextracellular
Journal Article 2022-05-06 ✓ 1 Snippet Ogier AC, Bustin A, Cochet H, Schwitter J, van Heeswijk RB.
In-Text Gene Mentions

…be caused byhemochromatosis(hereditary or post-transfusio…

Show Full Abstract

Parametric mapping of the heart has become an essential part of many cardiovascular magnetic resonance imaging exams, and is used for tissue characterization and diagnosis in a broad range of cardiovascular diseases. These pulse sequences are used to quantify the myocardial T<sub>1</sub>, T<sub>2</sub>, T 2 * , and T<sub>1ρ</sub> relaxation times, which are unique surrogate indices of fibrosis, edema and iron deposition that can be used to monitor a disease over time or to compare patients to one another. Parametric mapping is now well-accepted in the clinical setting, but its wider dissemination is hindered by limited inter-center reproducibility and relatively long acquisition times. Recently, several new parametric mapping techniques have appeared that address both of these problems, but substantial hurdles remain for widespread clinical adoption. This review serves both as a primer for newcomers to the field of parametric mapping and as a technical update for those already well at home in it. It aims to establish what is currently needed to improve the reproducibility of parametric mapping of the heart. To this end, we first give an overview of the metrics by which a mapping technique can be assessed, such as bias and variability, as well as the basic physics behind the relaxation times themselves and what their relevance is in the prospect of myocardial tissue characterization. This is followed by a summary of routine mapping techniques and their variations. The problems in reproducibility and the sources of bias and variability of these techniques are reviewed. Subsequently, novel fast, whole-heart, and multi-parametric techniques and their merits are treated in the light of their reproducibility. This includes state of the art segmentation techniques applied to parametric maps, and how artificial intelligence is being harnessed to solve this long-standing conundrum. We finish up by sketching an outlook on the road toward inter-center reproducibility, and what to expect in the future.

Also flagged:membranemitochondrialpathogenesisNeurodegenerative DiseasesGolgiAD
Journal Article 2022-05-06 ✓ 1 Snippet Yoshida S, Hasegawa T.
In-Text Gene Mentions

The cardinal genetic defect in HD is the abnormally elongated polyglutamine repeat expansion in the huntingtin (HTT), and striatal medium spiny neurons (MSNs) are known as the most vulnerable cells in HD.

Show Full Abstract

Retromer is a highly integrated multimeric protein complex that mediates retrograde cargo sorting from endosomal compartments. In concert with its accessory proteins, the retromer drives packaged cargoes to tubular and vesicular structures, thereby transferring them to the <i>trans</i>-Golgi network or to the plasma membrane. In addition to the endosomal trafficking, the retromer machinery participates in mitochondrial dynamics and autophagic processes and thus contributes to cellular homeostasis. The retromer components and their associated molecules are expressed in different types of cells including neurons and glial cells, and accumulating evidence from genetic and biochemical studies suggests that retromer dysfunction is profoundly involved in the pathogenesis of neurodegenerative diseases including Alzheimer's Disease and Parkinson's disease. Moreover, targeting retromer components could alleviate the neurodegenerative process, suggesting that the retromer complex may serve as a promising therapeutic target. In this review, we will provide the latest insight into the regulatory mechanisms of retromer and discuss how its dysfunction influences the pathological process leading to neurodegeneration.

Also flagged:matingtranscription factorssex-determinationtranscription factordeterminationgene expression
Journal Article 2022-05-06 No Snippets Kim D, Kim B.
Show Full Abstract

Studies on sexual dimorphism in the structure and function of the nervous system have been pivotal to understanding sex differences in behavior. Such studies, especially on invertebrates, have shown the importance of neurons specific to one sex (sex-specific neurons) in shaping sexually dimorphic neural circuits. Nevertheless, recent studies using the nematode <i>C. elegans</i> have revealed that the common neurons that exist in both sexes (sex-shared neurons) also play significant roles in generating sex differences in the structure and function of neural circuits. Here, we review the anatomical and functional differences in the sex-shared neurons of <i>C. elegans</i>. These sexually dimorphic characteristics include morphological differences in neurite projection or branching patterns with substantial changes in synaptic connectivity, differences in synaptic connections without obvious structural changes, and functional modulation in neural circuits with no or minimal synaptic connectivity changes. We also cover underlying molecular mechanisms whereby these sex-shared neurons contribute to the establishment of sexually dimorphic circuits during development and function differently between the sexes.

Also flagged:ProteinsmetabolismUNC5DIGFBP1SCG3ST3GAL6
Journal Article 2022-05-06 ✓ 5 Snippets Li A, Liao W, Xie J, Song L, Zhang X.
In-Text Gene Mentions

CA10 and TMEM132, which were upregulated by passive smoking, are predicted risk factors for lung cancer and tinnitus, respectively (Figure 3).

…NRSN1, TMEM132A, andCA10that are affected…

…132A (TMEM132A) andcarbonic anhydrase-related protein 10anhydrase-related protein 10…

…anhydrase-related protein 10 (CA10) while decreasing the…

CA10and TMEM132, which…

Show Full Abstract

Harsh work environments can include very cold, hot, dusty, and noisy workplaces, as well as exposure in the workplace with chemicals and other fumes, cigarette smoke, and diesel exhaust. Although working in these harsh environments can have a negative effect on health, there are no effective biomarkers for monitoring health conditions until workers develop disease symptoms. Plasma protein concentrations, which reflect metabolism and immune status, have great potential as biomarkers for various health conditions. Using a Mendelian-randomization (MR) design, this study analyzed the effects of these harsh environments on plasma proteins to identify proteins that can be used as biomarkers of health status. Preliminary analysis using inverse variance weighted (IVW) method with a <i>p</i>-value cutoff of 0.05 showed that workplace environments could affect the concentrations of hundreds of plasma proteins. After filtering for sensitivity via MR-Egger, and Weighted Median MR approaches, 28 plasma proteins altered by workplace environments were identified. Further MR analysis showed that 20 of these plasma proteins, including UNC5D, IGFBP1, SCG3, ST3GAL6, and ST3GAL2 are affected by noisy workplace environments; TFF1, RBM39, ACYP2, STAT3, GRB2, CXCL1, EIF1AD, CSNK1G2, and CRKL that are affected by chemical fumes; ADCYAP1, NRSN1, TMEM132A, and CA10 that are affected by passive smoking; LILRB2, and TENM4 that are affected by diesel exhaust, are associated with the risk of at least one disease. These proteins have the potential to serve as biomarkers to monitor the occupational hazards risk of workers working in corresponding environments. These findings also provide clues to study the biological mechanisms of occupational hazards.

Also flagged:malignant tumorsMHCNK receptorscancerchimeric antigen receptorCAR
Journal Article 2022-05-06 ✓ 2 Snippets Dong R, Zhang Y, Xiao H, Zeng X.
In-Text Gene Mentions

ACT, Adoptive cell therapy; AMPK, AMP-activated protein kinase; BTN2A1, Butyrophilin 2A1; BTN3A1, Butyrophilin 3A1; CAR, chimeric antigen receptor; CD3 CC, CD3 conformational change; DETCs, dendritic epidermal T cells; EphA2, ephrin type-A receptor 2; FDA, Food and Drug Administration; FPPS, farnesyl-diphosphate-synthase; GD2, disialoganglioside 2; GVHD, graft-versus-host disease; HVGA, host-versus-graft activities; iNKT, invariant natural killer T; IPP, Isopentenyl pyrophosphate; Klrk1, killer cell lectin-like receptor K1; MART-1, melanoma antigen recognized by T cells 1; MHC, major histocompatibility complex; MICA/B, MHC I chain-related molecules A and B; MR1, MHC-related protein 1; MSCP, melanoma cell surface chondroitin sulfate proteoglycan; MUC1, Mucin 1; NCRs, NK cytotoxicity receptors; NKG2D, Natural killer group 2D; NKG2DL, NKG2D ligand; NKRs, NK cell receptors; P-Ag, phosphoantigens; RAG, recombination activating gene; PRS, proline-rich sequence; Rae1, retinoic acid early transcripts-1; RCC, renal cell carcinoma; scFv, single-chain fragment variable; TAA, tumor associated antigen; TCR, T cell receptors; ULBP, UL16-binding protein; ZOL, zoledronate.

…AMP-activated protein kinase;BTN2A1, Butyrophilin 2A1; BTN3A1,…

Show Full Abstract

Adoptive cell therapy (ACT) with engineered T cells has emerged as a promising strategy for the treatment of malignant tumors. Among them, there is great interest in engineered γδ T cells for ACT. With both adaptive and innate immune characteristics, γδ T cells can be activated by γδ TCRs to recognize antigens in a MHC-independent manner, or by NK receptors to recognize stress-induced molecules. The dual recognition system enables γδ T cells with unique activation and cytotoxicity profiles, which should be considered for the design of engineered γδ T cells. However, the current designs of engineered γδ T cells mostly follow the strategies that used in αβ T cells, but not making good use of the specific characteristics of γδ T cells. Therefore, it is no surprising that current engineered γδ T cells in preclinical or clinical trials have limited efficacy. In this review, we summarized the patterns of antigen recognition of γδ T cells and the features of signaling pathways for the functions of γδ T cells. This review will additionally discuss current progress in engineered γδ T cells and provide insights in the design of engineered γδ T cells based on their specific characteristics.

Also flagged:STINGStimulator of interferon genesendoplasmic-reticulumimmune responsesmicrobial infectionsautoinflammatory diseases
Journal Article 2022-05-06 No Snippets Kang J, Wu J, Liu Q, Wu X, Zhao Y, Ren J.
Show Full Abstract

Stimulator of interferon genes (STING) is an endoplasmic-reticulum resident protein, playing essential roles in immune responses against microbial infections. However, over-activation of STING is accompanied by excessive inflammation and results in various diseases, including autoinflammatory diseases and cancers. Therefore, precise regulation of STING activities is critical for adequate immune protection while limiting abnormal tissue damage. Numerous mechanisms regulate STING to maintain homeostasis, including protein-protein interaction and molecular modification. Among these, post-translational modifications (PTMs) are key to accurately orchestrating the activation and degradation of STING by temporarily changing the structure of STING. In this review, we focus on the emerging roles of PTMs that regulate activation and inhibition of STING, and provide insights into the roles of the PTMs of STING in disease pathogenesis and as potential targeted therapy.

Also flagged:infertilityunexplained infertilityEstrogenprogesteroneSex hormonesgestation
Journal Article 2022-05-06 ✓ 1 Snippet Li B, Duan H, Wang S, Wu J, Li Y.
In-Text Gene Mentions

…PSMC4, PSMC3, DCTN3,BTN2A2, and RAD21).…

Show Full Abstract

<h4>Background</h4>A receptive endometrium is a prerequisite for successful embryo implantation. Mounting evidence shows that nearly one-third of infertility and implantation failures are caused by defective endometrial receptivity. This study pooled 218 subjects from multiple datasets to investigate the association of the immune infiltration level with reproductive outcome. Additionally, macrophage-endometrium interaction modules were constructed to explore an accurate and cost-effective approach to endometrial receptivity assessment.<h4>Methods</h4>Immune-infiltration levels in 4 GEO datasets (n=218) were analyzed and validated through meta-analysis. Macrophage-endometrium interaction modules were selected based on the weighted gene co-expression network in GSE58144 and differentially expressed genes dominated by GSE19834 dataset. Xgboost, random forests, and regression algorithms were applied to predictive models. Subsequently, the efficacy of the models was compared and validated in the GSE165004 dataset. Forty clinical samples (RT-PCR and western blot) were performed for expression and model validation, and the results were compared to those of endometrial thickness in clinical pregnancy assessment.<h4>Results</h4>Altered levels of Mϕs infiltration were shown to critically influence embryo implantation. The three selected modules, manifested as macrophage-endometrium interactions, were enrichment in the immunoreactivity, decidualization, and signaling functions and pathways. Moreover, hub genes within the modules exerted significant reproductive prognostic effects. The xgboost algorithm showed the best performance among the machine learning models, with AUCs of 0.998 (95% CI 0.994-1) and 0.993 (95% CI 0.979-1) in GSE58144 and GSE165004 datasets, respectively. These results were significantly superior to those of the other two models (random forest and regression). Similarly, the model was significantly superior to ultrasonography (endometrial thickness) with a better cost-benefit ratio in the population.<h4>Conclusion</h4>Successful embryo implantation is associated with infiltration levels of Mϕs, manifested in genetic modules involved in macrophage-endometrium interactions. Therefore, utilizing the hub genes in these modules can provide a platform for establishing excellent machine learning models to predict reproductive outcomes in patients with defective endometrial receptivity.

Also flagged:host silencingchromosomeschromosomeKRAB zinc-finger proteinsmethylationchromatin
Journal Article 2022-05-06 No Snippets Yoth M, Jensen S, Brasset E.
Show Full Abstract

Transposable elements (TEs) are mobile DNA sequences that can jump from one genomic locus to another and that have colonized the genomes of all living organisms. TE mobilization and accumulation are an important source of genomic innovations that greatly contribute to the host species evolution. To ensure their maintenance and amplification, TE transposition must occur in the germ cell genome. As TE transposition is also a major threat to genome integrity, the outcome of TE mobility in germ cell genomes could be highly dangerous because such mutations are inheritable. Thus, organisms have developed specialized strategies to protect the genome integrity from TE transposition, particularly in germ cells. Such effective TE silencing, together with ongoing mutations and negative selection, should result in the complete elimination of functional TEs from genomes. However, TEs have developed efficient strategies for their maintenance and spreading in populations, particularly by using horizontal transfer to invade the genome of novel species. Here, we discuss how TEs manage to bypass the host's silencing machineries to propagate in its genome and how hosts engage in a fightback against TE invasion and propagation. This shows how TEs and their hosts have been evolving together to achieve a fine balance between transposition and repression.

Also flagged:localizationkidney stonekidney stone diseasestone diseasestendinopathiesvascular endothelial growth factor
Journal Article 2022-05-06 No Snippets Wuerfel T, Schmitz C, Jokinen LLJ.
Show Full Abstract

Extracorporeal shock wave therapy (ESWT) is a safe and effective treatment option for various pathologies of the musculoskeletal system. Many studies address the molecular and cellular mechanisms of action of ESWT. However, to date, no uniform concept could be established on this matter. In the present study, we perform a systematic review of the effects of exposure of musculoskeletal tissue to extracorporeal shock waves (ESWs) reported in the literature. The key results are as follows: (i) compared to the effects of many other forms of therapy, the clinical benefit of ESWT does not appear to be based on a single mechanism; (ii) different tissues respond to the same mechanical stimulus in different ways; (iii) just because a mechanism of action of ESWT is described in a study does not automatically mean that this mechanism is relevant to the observed clinical effect; (iv) focused ESWs and radial ESWs seem to act in a similar way; and (v) even the most sophisticated research into the effects of exposure of musculoskeletal tissue to ESWs cannot substitute clinical research in order to determine the optimum intensity, treatment frequency and localization of ESWT.

Also flagged:Autistic Spectrum DisorderAutistic spectrum disordersCYP1A2CYP2C19CYP2D6SLC6A4
Journal Article 2022-05-06 ✓ 5 Snippets Arranz MJ, Salazar J, Bote V, Artigas-Baleri A, Serra-LLovich A, Triviño E, Roige J, Lombardia C, Cancino M, Hernandez M, Cendros M, Duran-Tauleria E, Maraver N, Hervas A.
In-Text Gene Mentions

Patients with the SLC6A4 LPR s/s genotype associated with reduced expression of the serotonin transporter (5-HTT), the main target of selective serotonin reuptake inhibitors (SSRIs), were given alternative treatments (atomoxetine, guanfacine or antipsychotics such as clozapine, olanzapine and risperidone).

SSRIs’ mechanism of action includes the blocking of the 5-HTT protein to inhibit the reuptake of serotonin.

…argets (serotonin transporter,5-HTTand serotonin receptor…

…the serotonin transporter (5-HTT), the main target…

…activity of the5-HTTtarget protein were…

Show Full Abstract

<h4>Background</h4>Autistic spectrum disorders (ASD) are severe neurodevelopmental alterations characterised by deficits in social communication and repetitive and restricted behaviours. About a third of patients receive pharmacological treatment for comorbid symptoms. However, 30-50% do not respond adequately and/or present severe and long-lasting side effects.<h4>Methods</h4>Genetic variants in <i>CYP1A2</i>, <i>CYP2C19</i>, <i>CYP2D6</i> and <i>SLC6A4</i> were investigated in N = 42 ASD sufferers resistant to pharmacological treatment. Clinical recommendations based on their pharmacogenetic profiles were provided within 24-48 h of receiving a biological sample.<h4>Results</h4>A total of 39 participants (93%) improved after the pharmacogenetic intervention according to their CGI scores (difference in basal-final scores: 2.26, SD 1.55) and 37 participants (88%) according to their CGAS scores (average improvement of 20.29, SD 11.85). Twenty-three of them (55%) achieved symptom stability (CGI ≤ 3 and CGAS improvement ≥ 20 points), requiring less frequent visits to their clinicians and hospital stays. Furthermore, the clinical improvement was higher than that observed in a control group (N = 62) with no pharmacogenetic interventions, in which 66% responded to treatment (difference in CGI scores: -0.87, SD 9.4, <i>p</i> = 1 × 10<sup>-5</sup>; difference in CGAS scores: 6.59, SD 7.76, <i>p</i> = 5 × 10<sup>-8</sup>).<h4>Conclusions</h4>The implementation of pharmacogenetic interventions has the potential to significantly improve the clinical outcomes in severe comorbid ASD populations with drug treatment resistance and poor prognosis.

Also flagged:Palmoplantar PustulosisapremilastustekinumabguselkumabIL-23PDE4
Journal Article 2022-05-06 ✓ 1 Snippet Chandler A, Wood H, Nezamololama N, Gooderham MJ.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Palmoplantar pustulosis (PPP) is a chronic skin condition characterized by sterile pustules on the palms and soles. This condition is more commonly reported among women and smokers causing considerable discomfort and interference with daily activities. Although there are various off-label treatment options available for PPP, there remains a demand to identify more effective and safer treatments.<h4>Objective</h4>To review the patient demographics and treatment patterns of our PPP patient population.<h4>Methods</h4>A retrospective chart review was performed at a dermatology office with two locations in Ontario, Canada.<h4>Results</h4>We identified 71 adult PPP patients. A third of patients did not return for follow up after diagnosis. Among those who returned for follow-up, 20% were managed with topical therapy alone. Of our patients who took systemic treatment for PPP, apremilast, followed by ustekinumab and guselkumab, had the greatest retention of therapy.<h4>Conclusion</h4>Targeting PDE4, IL-12/23 and IL-23 provided some benefit for our patients with PPP leading to greatest retention of therapy over time. Further investigation is required into the cause for high no-show rates and the search for effective and safe treatment options.

Also flagged:cystic fibrosisCFtype 2 diabetesinsulincarbohydratesglucose
Journal Article 2022-05-05 ✓ 1 Snippet Sugrue M, Liddy AM, McDermott JH, Sreenan S.
In-Text Gene Mentions

…of diabetes orhemochromatosis.…

Show Full Abstract

No abstract available.

Also flagged:Huntington DiseaseSupranuclear Palsyprogressive supranuclear palsyfrontotemporal degenerationamyotrophic lateral sclerosisALS
Journal Article 2022-05-05 No Snippets Dewan R, Jaunmuktane Z, Garcia-Segura ME, Strand C, Wild E, Villar J, Dalgard CL, Tabrizi SJ, Traynor BJ, Proukakis C.
Show Full Abstract

No abstract available.

Also flagged:cancerscrizotinibROS1ALKnon‐small cell lung cancersheparin
Journal Article 2022-05-05 No Snippets Ng TL, Tsui DCC, Wang S, Usari T, Patil T, Wilner K, Camidge DR.
Show Full Abstract

<h4>Background</h4>ROS1- and ALK-rearranged advanced NSCLCs are associated with increased thromboembolic risk. We hypothesized that a prothrombotic phenotype offers an evolutionary advantage to subsets of these cancers. The impact of this phenotype could alter outcomes from targeted therapy.<h4>Methods</h4>In a retrospective analysis of ROS1- and ALK-rearranged NSCLCs treated with crizotinib in a phase 1 trial, we compared progression-free survival (PFS) and objective response rate (ORR) based on the history of anticoagulation use (a possible surrogate of thromboembolism) at baseline (within 90 days before study enrollment) or within 90 days of study treatment.<h4>Results</h4>Twelve out of 53 (22.6%) ROS1- and 39 out of 153 (25.5%) ALK-rearranged NSCLCs received anticoagulation before or during the trial. Most ROS1 and ALK patients on anticoagulation received low-molecular-weight heparin (75% and 64.1%, respectively). In the ROS1-rearranged group, the median PFS (95% CI) values were 5.1 (4.4-14.4) and 29.0 (16.5-48.8) months, and the ORR values were 41.7% (95% CI: 15.2 to 72.3) and 80.5% (95% CI: 65.1 to 91.2) among those with and without anticoagulation treatment, respectively. In the ALK-rearranged group, the median PFS (95% CI) was 7.1 (5.4-7.7) and 12.0 (9.4-18.3) months, and the ORR was 41% (95% CI: 25.6 to 57.9) and 74.3% (95% CI: 65.3 to 82.1) among those with and without anticoagulation, respectively.<h4>Conclusions</h4>Anticoagulation (as a potential surrogate of a prothrombotic subset) in ROS1- and ALK-rearranged NSCLCs may be associated with a lower PFS and ORR to crizotinib.<h4>Clinicaltrial</h4>gov: NCT00585195.

Also flagged:SoxSox2transcription factortranscription factorsbindingHMGB
Journal Article 2022-05-05 No Snippets Hamilton DJ, Hein AE, Holmes ZE, Wuttke DS, Batey RT.
Show Full Abstract

There is a growing body of evidence that a substantial number of protein domains identified as DNA-binding also interact with RNA to regulate biological processes. Several recent studies have revealed that the Sox2 transcription factor binds RNA through its high-mobility group box (HMGB) domain <i>in vitro</i> and <i>in vivo</i>. A high degree of conservation of this domain among members of the Sox family of transcription factors suggests that RNA-binding activity may be a general feature of these proteins. To address this hypothesis, we examined a subset of HMGB domains from human Sox family of proteins for their ability to bind both DNA and RNA <i>in vitro</i>. We observed selective, high-affinity interactions between Sox family HMGB domains and various model RNA elements, including a four-way junction RNA, a hairpin RNA with an internal bulge, G-quadruplex RNA, and a fragment of long noncoding RNA ES2, which is known to directly interact with Sox2. Importantly, the HMGB domains bind these RNA ligands significantly tighter than nonconsensus dsDNA and in some cases with affinities rivaling those of their consensus dsDNA sequences. These data suggest that RNA binding is a conserved feature of the Sox family of transcription factors with the potential to modulate unappreciated biological functions.

Also flagged:extracellularpyrophosphatemetabolismvascular calcificationgenetic diseaseschronic kidney disease
Journal Article 2022-05-05 No Snippets Villa-Bellosta R.
Show Full Abstract

Conventionally, ATP is considered to be the principal energy source in cells. However, over the last few years, a novel role for ATP as a potent extracellular signaling molecule and the principal source of extracellular pyrophosphate, the main endogenous inhibitor of vascular calcification, has emerged. A large body of evidence suggests that two principal mechanisms are involved in the initiation and progression of ectopic calcification: high phosphate concentration and pyrophosphate deficiency. Pathologic calcification of cardiovascular structures, or vascular calcification, is a feature of several genetic diseases and a common complication of chronic kidney disease, diabetes, and aging. Previous studies have shown that the loss of function of several enzymes and transporters involved in extracellular ATP/pyrophosphate metabolism is associated with vascular calcification. Therefore, pyrophosphate homeostasis should be further studied to facilitate the design of novel therapeutic approaches for ectopic calcification of cardiovascular structures, including strategies to increase pyrophosphate concentrations by targeting the ATP/pyrophosphate metabolism cycle.

Also flagged:hormonesecretionmetabolismCA7gene expressionssulfate
Journal Article 2022-05-05 ✓ 3 Snippets Li H, Wang X, Wang Y, Zhang M, Hong F, Wang H, Cui A, Zhao J, Ji W, Chen YG.
In-Text Gene Mentions

…, Ascl2 ,Olfm4, Smoc2 and…

…in five species:OLFM4, CDCA7 ,…

OLFM4, ASCL2 ,…

Show Full Abstract

Animal models are widely used for biomedical studies and drug evaluation. The small intestine plays key roles in nutrient absorption, hormone secretion, microbiota defense and drug absorption and metabolism. Although the intestinal structure of mammals is conserved, the differences on epithelial cell composition, functional assignments and drug absorption among mammals are largely unknown. Here, cross-species analysis of single-cell transcriptomic atlas of the ileum epithelium from mouse, rat, pig, macaque and human reveals the conserved and differential cell types and functions among species, identifies a new CA7<sup>+</sup> cell type in pig, macaque and human ileum, uncovers the distinct expression pattern in enterocytes, enteroendocrine cells and Paneth cells, and defines the conserved and species-specific intestinal stem cell signature genes. The examination of drug absorption across species suggests that drug metabolism in mouse ileum is closer to human while drug transport in macaque ileum is more similar to human. Together, our data provide the comprehensive information about cell composition and functional assignments in five species, and offer the valuable guidance for animal model selection and drug testing.

Also flagged:reninangiotensinaldosteroneRAASextracellularprotease
Journal Article 2022-05-05 ✓ 4 Snippets Broeker KAE, Schrankl J, Fuchs MAA, Kurtz A.
In-Text Gene Mentions

After deletion of Sox6 in renin-lineage cells, recruitment of VSMCs is impaired under salt restriction and dehydration or in renal arterial stenosis [90, 91].

Sox6is a transcription…

Sox6binds to the…

…After deletion ofSox6in renin-lineage cells,…

Show Full Abstract

The protease renin, the key enzyme of the renin-angiotensin-aldosterone system, is mainly produced and secreted by juxtaglomerular cells in the kidney, which are located in the walls of the afferent arterioles at their entrance into the glomeruli. When the body's demand for renin rises, the renin production capacity of the kidneys commonly increases by induction of renin expression in vascular smooth muscle cells and in extraglomerular mesangial cells. These cells undergo a reversible metaplastic cellular transformation in order to produce renin. Juxtaglomerular cells of the renin lineage have also been described to migrate into the glomerulus and differentiate into podocytes, epithelial cells or mesangial cells to restore damaged cells in states of glomerular disease. More recently, it could be shown that renin cells can also undergo an endocrine and metaplastic switch to erythropoietin-producing cells. This review aims to describe the high degree of plasticity of renin-producing cells of the kidneys and to analyze the underlying mechanisms.

Also flagged:bovine mastitisMastitisinfectionclinical mastitisinfectionsmethicillin
Journal Article 2022-05-05 No Snippets Javed S, McClure J, Syed MA, Obasuyi O, Ali S, Tabassum S, Ejaz M, Zhang K.
Show Full Abstract

Buffalo represent a major source of milk in Pakistan. However, production is impacted by the disease bovine mastitis. Mastitis causes significant economic losses, with Staphylococcus aureus (S. aureus) being one of its major causative agents. While much work has been done understanding the epidemiology of bovine mastitis in Pakistan, detailed molecular characterization of the associated S. aureus is unavailable. In the current study both the epidemiological and molecular characterization of S. aureus from bovine mastitis in the Hazara division of Pakistan are examined. S. aureus was isolated from 18.41% of the animals, and left quarters more prone to infection (69.6%) than right quarters (30.4%). Sub-clinical mastitis (75.31%) was more prevalent than clinical mastitis (24.69%), with infections evenly distributed amongst the eight districts. Molecular characterization revealed that only 19.6% of the isolates were methicillin-resistant, and four strains types identified, including ST9-t7867-MSSA, ST9-MSSA, ST101-t2078-MSSA, and ST22-t8934-MRSA-IVa. Antiseptic resistance genes were not detected in the isolates, and low levels of antibiotic resistance were also noted, however the methicillin-resistant strains had higher overall antibiotic resistance. This study represents the most complete molecular typing data for S. aureus causing bovine mastitis in the Hazara district of Pakistan, and the country as a whole.

Also flagged:dopaminePDAGTR1TP53NR2F2nucleus
Journal Article 2022-05-05 ✓ 5 Snippets Kamath T, Abdulraouf A, Burris SJ, Langlieb J, Gazestani V, Nadaf NM, Balderrama K, Vanderburg C, Macosko EZ.
In-Text Gene Mentions

…( NM_001258276.1 ),SOX6( NM_001145811.2 ),…

…/ AGTR1 /SOX6and TH /…

…subtypes CALB1 andSOX6), TH and CALB1…

…association of theSOX6+ signature with…

…experiment (left) andSOX6/AGTR1 experiment (right).…

Show Full Abstract

The loss of dopamine (DA) neurons within the substantia nigra pars compacta (SNpc) is a defining pathological hallmark of Parkinson's disease (PD). Nevertheless, the molecular features associated with DA neuron vulnerability have not yet been fully identified. Here, we developed a protocol to enrich and transcriptionally profile DA neurons from patients with PD and matched controls, sampling a total of 387,483 nuclei, including 22,048 DA neuron profiles. We identified ten populations and spatially localized each within the SNpc using Slide-seq. A single subtype, marked by the expression of the gene AGTR1 and spatially confined to the ventral tier of SNpc, was highly susceptible to loss in PD and showed the strongest upregulation of targets of TP53 and NR2F2, nominating molecular processes associated with degeneration. This same vulnerable population was specifically enriched for the heritable risk associated with PD, highlighting the importance of cell-intrinsic processes in determining the differential vulnerability of DA neurons to PD-associated degeneration.

Also flagged:gene expressiontranscription factorinflammatory responsescell proliferationheart failurerenal failure
Journal Article 2022-05-05 ✓ 1 Snippet Sun F, Ou J, Shoffner AR, Luan Y, Yang H, Song L, Safi A, Cao J, Yue F, Crawford GE, Poss KD.
In-Text Gene Mentions

…function (POU5F1, FOXC1,POU3F2, ZNF24), hematopoiesis (Arid3…

Show Full Abstract

Acute trauma stimulates local repair mechanisms but can also impact structures distant from the injury, for example through the activity of circulating factors. To study the responses of remote tissues during tissue regeneration, we profiled transcriptomes of zebrafish brains after experimental cardiac damage. We found that the transcription factor gene cebpd was upregulated remotely in brain ependymal cells as well as kidney tubular cells, in addition to its local induction in epicardial cells. cebpd mutations altered both local and distant cardiac injury responses, altering the cycling of epicardial cells as well as exchange between distant fluid compartments. Genome-wide profiling and transgenesis identified a hormone-responsive enhancer near cebpd that exists in a permissive state, enabling rapid gene expression in heart, brain and kidney after cardiac injury. Deletion of this sequence selectively abolished cebpd induction in remote tissues and disrupted fluid regulation after injury, without affecting its local cardiac expression response. Our findings suggest a model to broaden gene function during regeneration in which enhancer regulatory elements define short- and long-range expression responses to injury.

Also flagged:oxygenanemiacongenital heart diseasetwin-transfusion syndromeisoimmune hemolytic disease
Journal Article 2022-05-05 No Snippets Chock VY, Smith E, Tan S, Ball MB, Das A, Hintz SR, Kirpalani H, Bell EF, Chalak LF, Carlo WA, Cotten CM, Widness JA, Kennedy KA, Ohls RK, Seabrook RB, Patel RM, Laptook AR, Mancini T, Sokol GM, Walsh MC, Yoder BA, Poindexter BB, Chawla S, D'Angio CT, Higgins RD, Van Meurs KP, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Background</h4>Extremely low birth weight (ELBW) infants are at risk for end-organ hypoxia and ischemia. Regional tissue oxygenation of the brain and gut as monitored with near-infrared spectroscopy (NIRS) may change with postnatal age, but normal ranges are not well defined.<h4>Methods</h4>A prospective study of ELBW preterm infants utilized NIRS monitoring to assess changes in cerebral and mesenteric saturation (Csat and Msat) over the first week after birth. This secondary study of a multicenter trial comparing hemoglobin transfusion thresholds assessed cerebral and mesenteric fractional tissue oxygen extraction (cFTOE and mFTOE) and relationships with perinatal variables.<h4>Results</h4>In 124 infants, both Csat and Msat declined over the first week, with a corresponding increase in oxygen extraction. With lower gestational age, lower birth weight, and 5-min Apgar score ≤5, there was a greater increase in oxygen extraction in the brain compared to the gut. Infants managed with a lower hemoglobin transfusion threshold receiving ≥2 transfusions in the first week had the lowest Csat and highest cFTOE (p < 0.001).<h4>Conclusion</h4>Brain oxygen extraction preferentially increased in more immature and anemic preterm infants. NIRS monitoring may enhance understanding of cerebral and mesenteric oxygenation patterns and inform future protective strategies in the preterm ELBW population.<h4>Impact</h4>Simultaneous monitoring of cerebral and mesenteric tissue saturation demonstrates the balance of oxygenation between preterm brain and gut and may inform protective strategies. Over the first week, oxygen saturation of the brain and gut declines as oxygen extraction increases. A low hemoglobin transfusion threshold is associated with lower cerebral saturation and higher cerebral oxygen extraction compared to a high hemoglobin transfusion threshold, although this did not translate into clinically relevant differences in the TOP trial primary outcome. Greater oxygen extraction by the brain compared to the gut occurs with lower gestational age, lower birth weight, and 5-min Apgar score ≤5.

Also flagged:cancerhypertensionnucleotideepithelial to mesenchymal transitionhormone androgen receptorreceptor tyrosine kinase
Journal Article 2022-05-05 ✓ 5 Snippets Jiang Y, Shi C, Tian S, Zhi F, Shen X, Shang D, Tian J.
In-Text Gene Mentions

In one study, reduced PTGIS expression was observed in human non-small cell lung cancer compared with that in controls [27].

The three genes with the highest amplification frequencies in cancer were CYP11B2 (which encodes aldosterone synthase), PTGIS (which encodes prostacyclin synthase), and Ren (which encodes renin) (Fig. 1).

Regarding the mutational profile, PTGIS exhibited the most mutation frequencies in uterine carcinosarcoma.

…CYP11B2 ,PTGIS, REN ,…

…the mutational profile,PTGISexhibited the most…

Show Full Abstract

<h4>Background</h4>During cancer treatment, patients have a significantly higher risk of developing cardiovascular complications such as hypertension. In this study, we investigated the internal relationships between hypertension and different types of cancer.<h4>Methods</h4>First, we comprehensively characterized the involvement of 10 hypertension-related genes across 33 types of cancer. The somatic copy number alteration (CNA) and single nucleotide variant (SNV) of each gene were identified for each type of cancer. Then, the expression patterns of hypertension-related genes were analyzed across 14 types of cancer. The hypertension-related genes were aberrantly expressed in different types of cancer, and some were associated with the overall survival of patients or the cancer stage. Subsequently, the interactions between hypertension-related genes and clinically actionable genes (CAGs) were identified by analyzing the co-expressions and protein-protein interactions.<h4>Results</h4>We found that certain hypertension-related genes were correlated with CAGs. Next, the pathways associated with hypertension-related genes were identified. The positively correlated pathways included epithelial to mesenchymal transition, hormone androgen receptor, and receptor tyrosine kinase, and the negatively correlated pathways included apoptosis, cell cycle, and DNA damage response. Finally, the correlations between hypertension-related genes and drug sensitivity were evaluated for different drugs and different types of cancer. The hypertension-related genes were all positively or negatively correlated with the resistance of cancer to the majority of anti-cancer drugs. These results highlight the importance of hypertension-related genes in cancer.<h4>Conclusions</h4>This study provides an approach to characterize the relationship between hypertension-related genes and cancers in the post-genomic era.

Also flagged:transposaseCas9ribonucleoproteintargetingdigestionwater
Journal Article 2022-05-05 ✓ 5 Snippets Breau KA, Ok MT, Gomez-Martinez I, Burclaff J, Kohn NP, Magness ST.
In-Text Gene Mentions

…complexes at theOLFM4locus.…

…expressing the highestOLFM4levels exhibit the…

OLFM4targeting plasmid generation…

OLFM4homology regions were…

…TheOLFM4gRNA was designed…

Show Full Abstract

Two-dimensional (2D) cultures of intestinal and colonic epithelium can be generated using human intestinal stem cells (hISCs) derived from primary tissue sources. These 2D cultures are emerging as attractive and versatile alternatives to three-dimensional organoid cultures; however, transgenesis and gene-editing approaches have not been developed for hISCs grown as 2D monolayers. Using 2D cultured hISCs we show that electroporation achieves up to 80% transfection in hISCs from six anatomical regions with around 64% survival and produces 0.15% transgenesis by PiggyBac transposase and 35% gene edited indels by electroporation of Cas9-ribonucleoprotein complexes at the OLFM4 locus. We create OLFM4-emGFP knock-in hISCs, validate the reporter on engineered 2D crypt devices, and develop complete workflows for high-throughput cloning and expansion of transgenic lines in 3-4 weeks. New findings demonstrate small hISCs expressing the highest OLFM4 levels exhibit the most organoid forming potential and show utility of the 2D crypt device to evaluate hISC function.

Also flagged:pro-inflammatory cytokinechemokineautoimmune diseasesTTPRNA-binding proteinsbinding
Journal Article 2022-05-05 No Snippets Snyder BL, Blackshear PJ.
Show Full Abstract

Abnormal regulation of pro-inflammatory cytokine and chemokine mediators can contribute to the excess inflammation characteristic of many autoimmune diseases, such as rheumatoid arthritis, psoriasis, Crohn's disease, type 1 diabetes, and many others. The tristetraprolin (TTP) family consists of a small group of related RNA-binding proteins that bind to preferred AU-rich binding sites within the 3'-untranslated regions of specific mRNAs to promote mRNA deadenylation and decay. TTP deficient mice develop a severe systemic inflammatory syndrome consisting of arthritis, myeloid hyperplasia, dermatitis, autoimmunity and cachexia, due at least in part to the excess accumulation of proinflammatory chemokine and cytokine mRNAs and their encoded proteins. To investigate the possibility that increased TTP expression or activity might have a beneficial effect on inflammatory diseases, at least two mouse models have been developed that provide proof of principle that increasing TTP activity can promote the decay of pro-inflammatory and other relevant transcripts, and decrease the severity of mouse models of inflammatory disease. Animal studies of this type are summarized here, and we briefly review the prospects for harnessing these insights for the development of TTP-based anti-inflammatory treatments in humans.

Also flagged:secretionprotein secretionIL6hepatocarcinomaAPRcytokine
Journal Article 2022-05-05 ✓ 2 Snippets Knecht S, Eberl HC, Bantscheff M.
In-Text Gene Mentions

…ALB, TF, TTR,SERPINC1, RBP4.…

…e.g. , F2,SERPINC1, SERPIND1, CPB2, C6,…

Show Full Abstract

Mass spectrometry-based secretomics approaches frequently utilize serum-free culture conditions to circumvent serum-induced interference and to increase analytical depth. However, this can negatively affect a wide range of cellular functions and cell viability. These effects become particularly apparent when investigating transcriptionally regulated secretion events and feedback-loops in response to perturbations that require 48 h or more to fully manifest. We present an "interval-based" secretomics workflow, which determines protein secretion rates in short serum-free time windows. Relative quantification using tandem mass tags enables precise monitoring of time-dependent changes. We applied this approach to determine temporal profiles of protein secretion in the hepatocyte model cell lines HepG2 and HepaRG after stimulation of the acute-phase response (APR) by the cytokines IL1b and IL6. While the popular hepatocarcinoma cell line HepG2 showed an incomplete APR, secretion patterns derived from differentiated HepaRG cells recapitulated the expected APR more comprehensively. For several APR response proteins, substantial secretion was only observed after 72 h, a time window at which cell fitness is substantially impaired under serum-free cell culture conditions. The interval-based secretomics approach enabled the first comprehensive analysis of time-dependent secretion of liver cell models in response to these proinflammatory cytokines. The extended time range facilitated the observation of distinct chronological phases and cytokine-dependent secretion phenotypes of the APR. IL1b directed the APR toward pathogen defense over three distinct phases-chemotaxis, effector, clearance-while IL6 directed the APR toward regeneration. Protein shedding on the cell surface was pronounced upon IL1b stimulation, and small molecule inhibition of ADAM and matrix metalloproteases identified induced as well as constitutive shedding events. Inhibition of ADAM proteases with TAPI-0 resulted in reduced shedding of the sorting receptor SORT1, and an attenuated cytokine response suggesting a direct link between cell surface shedding and cytokine secretion rates.

Also flagged:Hepatocellular Carcinomatumormalignant tumor of the livermalignant tumorshepatitis Balcohol
Journal Article 2022-05-05 ✓ 1 Snippet Li X, Yao Q, Liu C, Wang J, Zhang H, Li S, Cai P.
In-Text Gene Mentions

…food, hereditary diseases (hemochromatosisand hepatic glycogen…

Show Full Abstract

Hepatocellular carcinoma is one of the most common malignancies globally. Recently, a newly identified histological subtype, designated as "macrotrabecular-massive hepatocellular carcinoma" (MTM-HCC), has been associated with an aggressive phenotype and has received extensive attention. MTM-HCC was a strong independent prognostic predictor of early and overall recurrence because it is closely related to tumor molecular subclass, gene mutation, carcinogenesis pathways, and immunohistochemical markers. In addition, preoperative imaging examination can potentially provide an essential clue for diagnosing MTM-HCC, intratumor necrosis or ischemia is an independent predictor for MTM-HCC on Gd-EOB-DTPA enhanced MRI or CT. Early diagnosis and appropriate treatment of MTM-HCC could prove beneficial for preventing early recurrence and could improve outcomes.

Also flagged:Cullin 3Familial Hyperkalemic HypertensionCullin3-Ring-E3 LigaseCRL3CUL3Cullin3 Ring E3-ligases
Journal Article 2022-05-05 No Snippets Kouranti I, Abdel Khalek W, Mazurkiewicz S, Loisel-Ferreira I, Gautreau AM, Pintard L, Jeunemaitre X, Clauser E.
Show Full Abstract

Cullin 3 (CUL3) is the scaffold of Cullin3 Ring E3-ligases (CRL3s), which use various BTB-adaptor proteins to ubiquitinate numerous substrates targeting their proteasomal degradation. <i>CUL3</i> mutations, responsible for a severe form of familial hyperkalemia and hypertension (FHHt), all result in a deletion of exon 9 (amino-acids 403-459) (CUL3-∆9). Surprisingly, while CUL3-∆9 is hyperneddylated, a post-translational modification that typically activates CRL complexes, it is unable to ubiquitinate its substrates. In order to understand the mechanisms behind this loss-of function, we performed comparative label-free quantitative analyses of CUL3 and CUL3-∆9 interactome by mass spectrometry. It was observed that CUL3-∆9 interactions with COP9 and CAND1, both involved in CRL3 complexes' dynamic assembly, were disrupted. These defects result in a reduction in the dynamic cycling of the CRL3 complexes, making the CRL3-∆9 complex an inactive BTB-adaptor trap, as demonstrated by SILAC experiments. Collectively, the data indicated that the hyperneddylated CUL3-∆9 protein is inactive as a consequence of several structural changes disrupting its dynamic interactions with key regulatory partners.

Also flagged:Multiple SclerosisMSneurodegenerative disease of thepathogenesisinflammatory responseCD4
Journal Article 2022-05-05 ✓ 5 Snippets Sandi D, Kokas Z, Biernacki T, Bencsik K, Klivényi P, Vécsei L.
In-Text Gene Mentions

In 2015, Yun et al. found peroxiredoxin 6 (PRDX6) to be elevated in the spine of EAE mice and that PRDX6 transgenic mice presented with a significantly less aggressive disease course [200].

…hanolamine-binding protein 1 (PEBP1) and reticulon 3…

…the case ofPEBP1on an independent…

…found peroxiredoxin 6 (PRDX6) to be elevated…

…mice and thatPRDX6transgenic mice presented…

Show Full Abstract

Multiple sclerosis (MS) is the inflammatory demyelinating and neurodegenerative disease of the central nervous system (CNS) that affects approximately 2.8 million people worldwide. In the last decade, a new era was heralded in by a new phenotypic classification, a new diagnostic protocol and the first ever therapeutic guideline, making personalized medicine the aim of MS management. However, despite this great evolution, there are still many aspects of the disease that are unknown and need to be further researched. A hallmark of these research are molecular biomarkers that could help in the diagnosis, differential diagnosis, therapy and prognosis of the disease. Proteomics, a rapidly evolving discipline of molecular biology may fulfill this dire need for the discovery of molecular biomarkers. In this review, we aimed to give a comprehensive summary on the utility of proteomics in the field of MS research. We reviewed the published results of the method in case of the pathogenesis of the disease and for biomarkers of diagnosis, differential diagnosis, conversion of disease courses, disease activity, progression and immunological therapy. We found proteomics to be a highly effective emerging tool that has been providing important findings in the research of MS.

Also flagged:glucangastrointestinal diseasesirritable bowel syndromegastrointestinal disordersurogenital infectionsatopic dermatitis
Journal Article 2022-05-05 No Snippets Siesto G, Pietrafesa R, Infantino V, Thanh C, Pappalardo I, Romano P, Capece A.
Show Full Abstract

Nowadays, the interest toward products containing probiotics is growing due to their potential health benefits to the host and the research is focusing on search of new probiotic microorganisms. The present work was focused on the characterization of indigenous <i>Saccharomyces cerevisiae</i> strains, isolated from different food matrixes, with the goal to select strains with probiotic or health-beneficial potential. A preliminary screening performed on fifty <i>S. cerevisiae</i> indigenous strains, in comparison to a commercial probiotic strain, allowed to individuate the most suitable ones for potential probiotic aptitude. Fourteen selected strains were tested for survival ability in the gastrointestinal tract and finally, the strains characterized for the most important probiotic features were analyzed for health-beneficial traits, such as the content of glucan, antioxidant and potential anti-inflammatory activities. Three strains, 4LBI-3, LL-1, TA4-10, showing better attributes compared to the commercial probiotic <i>S.</i><i>cerevisiae</i> var. <i>boulardii</i> strain, were characterized by interesting health-beneficial traits, such as high content of glucan, high antioxidant and potential anti-inflammatory activities. Our results suggest that some of the tested <i>S. cerevisiae</i> strains have potential as probiotics and candidate for different applications, such as dietary supplements, and starter for the production of functional foods or as probiotic to be used therapeutically.

Also flagged:Polyphenolscancerredox enzymethyroid cancerhormonesynthesis
Journal Article 2022-05-05 ✓ 1 Snippet Heydarzadeh S, Kia SK, Zarkesh M, Pakizehkar S, Hosseinzadeh S, Hedayati M.
In-Text Gene Mentions

PRDX1, PRDX2, and PRDX3 expressions downregulated in papillary and anaplastic thyroid cancers, PRDX4 mRNA expression was moderately increased in anaplastic thyroid cancer tissues, and PRDX6 expression status showed similar levels as well as normal thyroid and thyroid cancers [128].

Show Full Abstract

The most serious hallmark step of carcinogenesis is oxidative stress, which induces cell DNA damage. Although in normal conditions ROS are important second messengers, in pathological conditions such as cancer, due to imbalanced redox enzyme expression, oxidative stress can occur. Recent studies with firmly established evidence suggest an interdependence between oxidative stress and thyroid cancer based on thyroid hormone synthesis. Indeed, a reduced antioxidant defense system might play a part in several steps of progression in thyroid cancer. Based on studies that have been conducted previously, future drug designs for targeting enzymatic ROS sources, as a single agent or in combination, have to be tested. Polyphenols represent the potential for modulating biological events in thyroid cancer, including antioxidative activity. Targeting enzymatic ROS sources, without affecting the physiological redox state, might be an important purpose. As regards the underlying chemopreventive mechanisms of natural compounds that have been discussed in other cancer models, the confirmation of the influence of polyphenols on thyroid cancer is inconclusive and rarely available. Therefore, there is a need for further scientific investigations into the features of the antioxidative effects of polyphenols on thyroid cancer. The current review illustrates the association between some polyphenols and the key enzymes that take place in oxidation reactions in developing thyroid cancer cells. This review gives the main points of the enzymatic ROS sources act and redox signaling in normal physiological or pathological contexts and supplies a survey of the currently available modulators of TPO, LOX, NOX, DUOX, Nrf2, and LPO derived from polyphenols.

Also flagged:Methyltransferase-like 3MethyladenosineMETTL3ubiquitin-specific proteaseUSP7tumor
Journal Article 2022-05-05 ✓ 2 Snippets Yuan D, Chen J, Hao Q, Zhang P, Chen Z.
In-Text Gene Mentions

METTL3 is also upregulated in glioblastoma, and silence of METTL3 inhibits the growth of glioma stem cells by downregulating POU3F2, SOX2, SALL2, OLIG2, and other glioma recombinant factors [23].

…cells by downregulatingPOU3F2, SOX2, SALL2, OLIG2,…

Show Full Abstract

We aimed to investigate the role of methyltransferase-like 3 (METTL3) in regulating HCC by mediating m6A level of ubiquitin-specific protease (USP7). METTL3 levels and m6A contents in HCC tissues and cells were detected. Potential correlations between METTL3 level and lymphatic metastasis, tumor size, tumor staging, and overall survival of HCC patients were analyzed. Moreover, its regulatory effects on proliferative, migratory, and invasive rates of HCC cells were examined. Potential methylation of USP7 in HCC was predicted using an online software, and the correlation between USP7 and METTL3 was assessed. METTL3 and m6A were increased both in HCC cells and tissues. High level of METTL3 was associated with the incidence of lymphatic metastasis, large tumor size, advanced tumor staging, and low overall survival of HCC. Silencing of METTL3 reduced proliferation, migration, and invasion rates. USP7 was predicted to have a methylation site regulated by METTL3. It was upregulated in HCC and associated with METTL3 level positively. USP7 silencing decreased proliferation, migration, and invasion rates of HCC cells. METTL3 promotes HCC to proliferate, migrate, and invade by regulating m6A methylation of USP7.

Also flagged:gene expressionovarian cancertumorfemale reproductive system tumorscervical canceruterine corpus malignant tumors
Journal Article 2022-05-05 ✓ 2 Snippets Wang X, Wang J, Yu M.
In-Text Gene Mentions

…PDCD1, CD274, CD276,TNFSF4, and TNFRSF18 in…

…PDCD1, CD274, CD276,TNFSF4, and TNFRSF18) in…

Show Full Abstract

This study collected immune-related genes (IRGs) and used gene expression data from TCGA database to construct a molecular subtype of ovarian cancer (OV) based on immune-related lncRNA gene pairs (IRLnc_GPs). The relationships between molecular subtypes and prognosis and clinical characteristics were further explored. IRGs were acquired from the ImmPort database, and round-robin pairing of immune-related lncRNAs was performed. The NMF algorithm was used to identify molecular subtypes, and the immune score of a single sample was calculated through ESTIMATE, TIMER, ssGSEA, MCPcounter, and CIBERSORT. The relationship between molecular subtypes and immune microenvironments was identified. A hypergeometric test was used to test the lncRNA pairs among the OV molecular subtypes (C1 and C2 subtypes). The BH method was used to screen the different lncRNA pairs, and a predictive risk model was constructed and verified. Finally, correlation analysis between the risk model, immune checkpoint genes, and chemotherapy drugs was carried out. Based on IRLnc_GP to classify 373 OV samples of TCGA, the samples were divided into two subtypes, and the prognosis between the subtypes showed significant differences. The C1 subtype with a poor prognosis was more related to the pathways of tumor occurrence and development. We identified 180 differential lncRNA pairs between subtypes and constructed a prognostic risk model based on 8 IRLnc_GPs. In the independent dataset, the distribution of subtypes in functional modules was different and highly repeatable. There were significant differences in the molecular and clinical characteristics of the subtypes and the drug sensitivity of immunotherapy/chemotherapy. In conclusion, the risk model established based on IRLnc_GP can better evaluate the prognosis of OV samples and can also assess the effects of different drug treatments in the high- and low-risk groups, providing new insights and ideas for the treatment of OV.

Also flagged:Liver CancerPrimary liver cancerPLCcapsuleshighlymalignant neoplasms
Journal Article 2022-05-05 ✓ 1 Snippet Li K, Xiao K, Zhu S, Wang Y, Wang W.
In-Text Gene Mentions

…nonalcoholic fatty liver,hemochromatosis, and α-1 antitrypsin…

Show Full Abstract

Primary liver cancer (PLC) is one of the most common solid malignancies. However, PLC drug development has been slow, and first-line treatments are still needed; thus, studies exploring and developing alternative strategies for effective PLC treatment are urgently needed. Chinese herbal medicine (CHM) has long been applied in the clinic due to its advantages of low toxicity and targeting of multiple factors and pathways, and it has great potential for the development of novel natural drugs against PLC. <b>Purpose:</b> This review aims to provide an update on the pharmacological mechanisms of Chinese patent medicines (CPMs) and the latest CHM-derived compounds for the treatment of PLC and relevant clinical evaluations. <b>Materials and Methods:</b> A systematic search of English literature databases, Chinese literature, the Clinical Trials Registry Platform, and the Chinese Clinical Trial Registry for studies of CHMs for PLC treatment was performed. <b>Results:</b> In this review, we summarize the clinical trials and mechanisms of CPMs for PLC treatment that have entered the clinic with the approval of the Chinese medicine regulatory authority. These CPMs included Huaier granules, Ganfule granules, Fufang Banmao capsules, Jinlong capsules, Brucea <i>javanica</i> oil emulsions, and compound kushen injections. We also summarize the latest <i>in vivo</i>, <i>in vitro</i>, and clinical studies of CHM-derived compounds against PLC: icaritin and ginsenoside Rg3. Dilemmas facing the development of CHMs, such as drug toxicity and low oral availability, and future developments are also discussed. <b>Conclusion:</b> This review provides a deeper the understanding of CHMs as PLC treatments and provides ideas for the development of new natural drugs against PLC.

Also flagged:genetic diseasesregulation ofgene expressionPolyQ) diseasesHuntington diseaseSpinocerebellar ataxia
Journal Article 2022-05-05 ✓ 1 Snippet Liu Z, Zhao G, Xiao Y, Zeng S, Yuan Y, Zhou X, Fang Z, He R, Li B, Zhao Y, Pan H, Wang Y, Yu G, Peng IF, Wang D, Meng Q, Xu Q, Sun Q, Yan X, Shen L, Jiang H, Xia K, Wang J, Guo J, Liang F, Li J, Tang B.
In-Text Gene Mentions

Repeat unit CAG includes ATXN1 (Spinocerebellar Ataxia Type 1), ATXN2 (Spinocerebellar Ataxia Type 2), ATXN3 (Spinocerebellar Ataxia Type 3), CACNA1A (Spinocerebellar Ataxia Type 6), ATXN7 (Spinocerebellar Ataxia Type 7), ATXN8OS (Spinocerebellar Ataxia Type 8), HTT (Huntington’s disease), and AR (Spinal and Bulbar Muscular Atrophy).

Show Full Abstract

<b>Background:</b> Short tandem repeats (STRs) are highly variable elements that play a pivotal role in multiple genetic diseases and the regulation of gene expression. Long-read sequencing (LRS) offers a potential solution to genome-wide STR analysis. However, characterizing STRs in human genomes using LRS on a large population scale has not been reported. <b>Methods:</b> We conducted the large LRS-based STR analysis in 193 unrelated samples of the Chinese population and performed genome-wide profiling of STR variation in the human genome. The repeat dynamic index (RDI) was introduced to evaluate the variability of STR. We sourced the expression data from the Genotype-Tissue Expression to explore the tissue specificity of highly variable STRs related genes across tissues. Enrichment analyses were also conducted to identify potential functional roles of the high variable STRs. <b>Results:</b> This study reports the large-scale analysis of human STR variation by LRS and offers a reference STR database based on the LRS dataset. We found that the disease-associated STRs (dSTRs) and STRs associated with the expression of nearby genes (eSTRs) were highly variable in the general population. Moreover, tissue-specific expression analysis showed that those highly variable STRs related genes presented the highest expression level in brain tissues, and enrichment pathways analysis found those STRs are involved in synaptic function-related pathways. <b>Conclusion:</b> Our study profiled the genome-wide landscape of STR using LRS and highlighted the highly variable STRs in the human genome, which provide a valuable resource for studying the role of STRs in human disease and complex traits.

Also flagged:Peptidesynthesispeptidesamino acidglycoproteinsglycoprotein
Journal Article 2022-05-05 No Snippets Tian J, Li Y, Ma B, Tan Z, Shang S.
Show Full Abstract

The development and application of commercially available automated peptide synthesizers has played an essential role in almost all areas of peptide and protein research. Recent advances in peptide synthesis method and solid-phase chemistry provide new opportunities for optimizing synthetic efficiency of peptide synthesizers. The efforts in this direction have led to the successful preparation of peptides up to more than 150 amino acid residues in length. Such success is particularly useful for addressing the challenges associated with the chemical synthesis of glycoproteins. The purpose of this review is to provide a brief overview of the evolution of peptide synthesizer and glycoprotein synthesis. The discussions in this article include the principles underlying the representative synthesizers, the strengths and weaknesses of different synthesizers in light of their principles, and how to further improve the applicability of peptide synthesizers in glycoprotein synthesis.

Also flagged:neurological disorderscancermolecular chaperoneschaperonesCCTTailless complex polypeptide 1
Journal Article 2022-05-05 ✓ 5 Snippets Ghozlan H, Cox A, Nierenberg D, King S, Khaled AR.
In-Text Gene Mentions

In Huntington’s disease, the expansion of polyQ tracts in huntingtin (Htt) protein is a hallmark of disease (DiFiglia et al., 1995).

…tracts in huntingtin (Htt) protein is a…

…MutantHtt(mHtt) containing greater…

…aggregating form ofHtt, Htt53Q, showed that…

…expressing polyQ-EYFP orHtt-fusion constructs, by depleti…

Show Full Abstract

Maintenance of the cellular proteome or proteostasis is an essential process that when deregulated leads to diseases like neurological disorders and cancer. Central to proteostasis are the molecular chaperones that fold proteins into functional 3-dimensional (3D) shapes and prevent protein aggregation. Chaperonins, a family of chaperones found in all lineages of organisms, are efficient machines that fold proteins within central cavities. The eukaryotic Chaperonin Containing TCP1 (CCT), also known as Tailless complex polypeptide 1 (TCP-1) Ring Complex (TRiC), is a multi-subunit molecular complex that folds the obligate substrates, actin, and tubulin. But more than folding cytoskeletal proteins, CCT differs from most chaperones in its ability to fold proteins larger than its central folding chamber and in a sequential manner that enables it to tackle proteins with complex topologies or very large proteins and complexes. Unique features of CCT include an asymmetry of charges and ATP affinities across the eight subunits that form the hetero-oligomeric complex. Variable substrate binding capacities endow CCT with a plasticity that developed as the chaperonin evolved with eukaryotes and acquired functional capacity in the densely packed intracellular environment. Given the decades of discovery on the structure and function of CCT, much remains unknown such as the scope of its interactome. New findings on the role of CCT in disease, and potential for diagnostic and therapeutic uses, heighten the need to better understand the function of this essential molecular chaperone. Clues as to how CCT causes cancer or neurological disorders lie in the early studies of the chaperonin that form a foundational knowledgebase. In this review, we span the decades of CCT discoveries to provide critical context to the continued research on the diverse capacities in health and disease of this essential protein-folding complex.

Also flagged:PalmitoylethanolamideNeurodegenerative DiseaseslipidN-acetylanolaminephospholipidslecithin
Journal Article 2022-05-05 ✓ 4 Snippets Landolfo E, Cutuli D, Petrosini L, Caltagirone C.
In-Text Gene Mentions

HD is a rare devastating autosomal dominant disorder, caused by a CAG trinucleotide repeat expansion in the huntingtin gene on chromosome 4, which leads to the production of the mutant huntingtin (m-Htt) protein.

The degree of symptom severity, disease stage, and markers of neuronal damage correlate with levels of the m-Htt protein in the cerebrospinal fluid in patients with HD [97].

…the mutant huntingtin (m-Htt) protein.…

…levels of the m-Httprotein in the…

Show Full Abstract

Palmitoylethanolamide (PEA) stands out among endogenous lipid mediators for its neuroprotective, anti-inflammatory, and analgesic functions. PEA belonging to the N-acetylanolamine class of phospholipids was first isolated from soy lecithin, egg yolk, and peanut flour. It is currently used for the treatment of different types of neuropathic pain, such as fibromyalgia, osteoarthritis, carpal tunnel syndrome, and many other conditions. The properties of PEA, especially of its micronized or ultra-micronized forms maximizing bioavailability and efficacy, have sparked a series of innovative research to evaluate its possible application as therapeutic agent for neurodegenerative diseases. Neurodegenerative diseases are widespread throughout the world, and although they are numerous and different, they share common patterns of conditions that result from progressive damage to the brain areas involved in mobility, muscle coordination and strength, mood, and cognition. The present review is aimed at illustrating in vitro and in vivo research, as well as human studies, using PEA treatment, alone or in combination with other compounds, in the presence of neurodegeneration. Namely, attention has been paid to the effects of PEA in counteracting neuroinflammatory conditions and in slowing down the progression of diseases, such as Alzheimer's disease, Parkinson's disease, Huntington's disease, Frontotemporal dementia, Amyotrophic Lateral Sclerosis, and Multiple Sclerosis. Literature research demonstrated the efficacy of PEA in addressing the damage typical of major neurodegenerative diseases.

Also flagged:CancercancerstumorHedgehog receptorPtch1doxorubicin
Journal Article 2022-05-05 ✓ 2 Snippets Feliz Morel ÁJ, Hasanovic A, Morin A, Prunier C, Magnone V, Lebrigand K, Aouad A, Cogoluegnes S, Favier J, Pasquier C, Mus-Veteau I.
In-Text Gene Mentions

Interestingly, the downregulation of two genes from module 106 are associated with cancer cell phenotype switching: the microphthalmia-associated transcription factor (MITF) and the POU domain transcription factor POU3F2 (better known as BRN2) [100].

…domain transcription factorPOU3F2(better known as…

Show Full Abstract

Despite the development of new therapeutic strategies, cancer remains one of the leading causes of mortality worldwide. One of the current major challenges is the resistance of cancers to chemotherapy treatments inducing metastases and relapse of the tumor. The Hedgehog receptor Patched (Ptch1) is overexpressed in many types of cancers. We showed that Ptch1 contributes to the efflux of doxorubicin and plays an important role in the resistance to chemotherapy in adrenocortical carcinoma (ACC), a rare cancer which presents strong resistance to the standard of care chemotherapy treatment. In the present study, we isolated and characterized a subpopulation of the ACC cell line H295R in which Ptch1 is overexpressed and more present at the cell surface. This cell subpopulation is more resistant to doxorubicin, grows as spheroids, and has a greater capability of clonogenicity, migration, and invasion than the parental cells. Xenograft experiments performed in mice and in ovo showed that this cell subpopulation is more tumorigenic and metastatic than the parental cells. These results suggest that this cell subpopulation has cancer stem-like or persistent cell properties which were strengthened by RNA-seq. If present in tumors from ACC patients, these cells could be responsible for therapy resistance, relapse, and metastases.

Also flagged:Huntington's diseaseHDHuntington diseaseneurodegenerative disorderembryogenesisoligonucleotides
Journal Article 2022-05-05 ✓ 5 Snippets Kotowska-Zimmer A, Przybyl L, Pewinska M, Suszynska-Zajczyk J, Wronka D, Figiel M, Olejniczak M.
In-Text Gene Mentions

Huntington disease (HD) is an inherited neurodegenerative disorder caused by the expansion of CAG repeats that encode a polyglutamine (polyQ) tract in the huntingtin protein (HTT).

…the huntingtin protein (HTT).…

…67-exon huntingtin (HTT) gene, and…

…use of two anti-HTTantibodies, we demonstrated…

…decreased the mutantHTTprotein level.…

Show Full Abstract

Among the many proposed therapeutic strategies for Huntington's disease (HD), allele-selective therapies are the most desirable but also the most challenging. RNA interference (RNAi) tools that target CAG repeats selectively reduce the mutant huntingtin level in cellular models of HD. The purpose of this study was to test the efficacy, selectivity, and safety of two vector-based RNAi triggers in an animal model of HD. CAG repeat-targeting short hairpin RNA (shRNA) and artificial miRNA (amiRNA) were delivered to the brains of YAC128 mice via intrastriatal injection of AAV5 vectors. Molecular tests demonstrated that both the shRNA and amiRNA reduced the mutant huntingtin level by 50% without influencing endogenous mouse huntingtin. In addition, a concentration-dependent reduction in HTT aggregates in the striatum was observed. In contrast to the shRNA, the amiRNA was well tolerated and did not show signs of toxicity during the course of the experiment up to 20 weeks post injection. Interestingly, amiRNA treatment reduced the spleen weight to values characteristic of healthy (WT) mice and improved motor performance on the static rod test. These preclinical data demonstrate that the CAG-targeting strategy and amiRNA could make an original and valuable contribution to currently used therapeutic approaches for HD.

Also flagged:depolarizationbehavioralagingsynapsesynaptic fiberSchaffer collaterals
Journal Article 2022-05-05 No Snippets DiCola NM, Lacy AL, Bishr OJ, Kimsey KM, Whitney JL, Lovett SD, Burke SN, Maurer AP.
Show Full Abstract

Sharp wave/ripples/high frequency events (HFEs) are transient bursts of depolarization in hippocampal subregions CA3 and CA1 that occur during rest and pauses in behavior. Previous studies have reported that CA1 ripples in aged rats have lower frequency than those detected in young animals. While CA1 ripples are thought to be driven by CA3, HFEs in CA3 have not been examined in aged animals. The current study obtained simultaneous recordings from CA1 and CA3 in young and aged rats to examine sharp wave/ripples/HFEs in relation to age. While CA1 ripple frequency was reduced with age, there were no age differences in the frequency of CA3 HFEs, although power and length were lower in old animals. While there was a proportion of CA1 ripples that co-occurred with a CA3 HFE, none of the age-related differences in CA1 ripples could be explained by alterations in CA3 HFE characteristics. These findings suggest that age differences in CA1 are not due to altered CA3 activity, but instead reflect distinct mechanisms of ripple generation with age.

Also flagged:Polymicrogyrianeuronal migration disorderbrain malformationsACTBACTG1ADGRG1
Journal Article 2022-05-05 ✓ 1 Snippet James J, Iype M, Surendran MO, Anitha A, Thomas SV.
In-Text Gene Mentions

…ADGRG1 AKT3 ARHGAP31ARFGEF2ARX ASPM ATP6V0A2…

Show Full Abstract

Polymicrogyria (PMG) is a relatively common complex malformation with cortical development, characterized by an exorbitant number of abnormally tiny gyri separated by shallow sulci. It is a neuronal migration disorder. Familial cases of PMG and the manifestation of PMG in patients with chromosomal aberrations and mutations indicate their important role of genetics in this disorder. The highly stereotyped and well-conserved nature of the cortical folding pattern in humans is suggestive of the genetic regulation of the process. The chromosomal abnormalities observed in PMG include deletions, duplications, chromosomal rearrangements, and aneuploidies. Two of the most common deletions in PMG are 22q11.2 deletion and 1p36 deletion. Further, mutations in several genes such as <i>GPR56, TUBB2B, SRPX2, PAX6, EOMES, WDR62, TUBA8, KIAA1279</i>, and <i>COL18A1</i> are known to be associated with PMG. Intriguingly, these genes are responsible only for a small number of cases of PMG. The protein products of these genes are implicated in diverse molecular and cellular functions. Taken together, PMG could be the result of the disruption of several biological pathways. Different modes of Mendelian inheritance and non-Mendelian inheritance are seen in PMG. We have suggested a gene panel that can be used for the detection of malformations of cortical development.

bioRxiv 2022-05-05 Preprint (No Snippets API) Thaper D, Munuganti R, Aguda A, Kim S, Kim S, Ku S, Sivak O, Kumar S, Vahid S, Ganguli D, Beltran H, Morrissey C, Corey E, Zoubeidi A.
Show Full Abstract

The increased incidence of treatment-emergent neuroendocrine prostate cancer (NEPC) is particularly alarming as this diagnosis is associated with poor prognosis. Despite initial responses to platinum-based chemotherapy, relapses are common and there is no effective second line therapy for NEPC. We previously identified that neuronal transcription factor BRN2 (POU3F2) is a potent driver of neuroendocrine differentiation and an attractive target for NEPC. Utilizing a combination of in silico modeling and X-ray crystallography followed by structure-based lead optimization, we have developed the first potent, specific and orally bioavailable BRN2 inhibitor (B18-94), which inhibits the interaction between BRN2 and DNA. This loss of BRN2 on the chromatin drastically reduces its transcriptional output resulting in downregulation of several known targets in NEPC such as SOX2, ASCL1 and PEG10 . Additionally, B18-94 reduces specifically cell proliferation specifically in multiple NEPC models with no effect on adenocarcinoma and other BRN2 negative prostate cancer models. Importantly, the consistency in the transcriptomic changes driven by B18-94 and or CRISPR/Cas9 mediated BRN2 knockout confirmed the on-target specificity, with both methods of BRN2 inhibition downregulating pathways involved in cellular plasticity and proliferation. Finally, we have demonstrated that B18-94, the first-in-field POU-domain transcription factor inhibitor, significantly reduced tumor growth in several NEPC xenograft models with no observable toxicity, suggesting potential for therapeutic intervention of NEPC.

bioRxiv 2022-05-05 Preprint (No Snippets API) Aviner R, Lee T, Masto VB, Gestaut D, Li KH, Andino R, Frydman J.
Show Full Abstract

<h4>Summary</h4> Huntington’s disease (HD) is a devastating neurodegenerative disorder caused by CAG trinucleotide repeat expansions encoding a polyglutamine (polyQ) tract in the Huntingtin ( HTT ) gene 1 . Although mutant HTT (mHTT) protein tends to aggregate, the exact causes of neurotoxicity in HD remain unclear 2 . Here we show that altered elongation kinetics on CAG expansions cause ribosome collisions that trigger ribotoxicity, proteotoxicity and maladaptive stress responses. CAG expansions cause an elongation rate conflict during HTT translation, when ribosomes rapidly decoding the optimal polyQ encounter a flanking slowly-decoded polyproline tract. The ensuing ribosome collisions lead to premature termination and release of aggregation-prone mHTT fragments. Due to the presence of a stress-responsive upstream open reading frame (uORF), HTT translation and aggregation are limited under normal conditions but enhanced under stress, seeding a vicious cycle of dysfunction. mHTT further exacerbates ribotoxicity by progressively sequestering eIF5A, a key regulator of translation elongation, polyamine metabolism and stress responses. eIF5A depletion in HD cells leads to widespread ribosome pausing on eIF5A-dependent sites, impaired cotranslational proteostasis, disrupted polyamine metabolism and maladaptive stress responses. Importantly, drugs that reduce translation initiation attenuate ribosome collisions and mitigate this escalating cascade of ribotoxic stress and dysfunction in HD.

Also flagged:immune responseextracellularvesiclesamino acidsimmune responsesPIWI
Journal Article 2022-05-04 ✓ 1 Snippet Huang S, Nishiumi S, Asaduzzaman M, Pan Y, Liu G, Yoshitake K, Maeyama K, Kinoshita S, Nagai K, Watabe S, Yoshida T, Asakawa S.
In-Text Gene Mentions

…the targets ofPRDX6, PCD16 ,…

Show Full Abstract

Exosomes, a subset of small extracellular vesicles, carry various nucleic acids, proteins, lipids, amino acids and metabolites. They function as a mode of intercellular communication and molecular transfer. Exosome cargo molecules, including small non-coding RNAs (sncRNAs), are involved in the immune response in various organisms. However, the role of exosome-derived sncRNAs in immune responses in molluscs remains unclear. Here, we aimed to reveal the sncRNAs involved in the immune response during grafting transplantation by the pearl oyster <i>Pinctada fucata</i>. Exosomes were successfully extracted from the <i>P. fucata</i> haemolymph during graft transplantation. Abundant microRNAs (miRNAs) and PIWI-interacting RNAs (piRNAs) were simultaneously discovered in <i>P. fucata</i> exosomes by small RNA sequencing. The expression patterns of the miRNAs and piRNAs at the grafting and initial stages were not substantially different, but varied significantly between the initial and later stages. Target prediction and functional analysis indicate that these miRNAs and piRNAs are related to immune response upon grafting transplantation, whereas piRNAs may also be associated with transposon silencing by targeting with genome transposon elements. This work provides the basis for a functional understanding of exosome-derived sncRNAs and helps to gain further insight into the PIWI/piRNA pathway function outside of germline cells in molluscs.

Also flagged:lung cancerFolatedeathcancersorbitolgene transporter
Journal Article 2022-05-04 No Snippets Cho KS, Kim S, Chun HB, Cheon JH, Cho MH, Lee AY, Arote RB.
Show Full Abstract

Lung cancer is known to be one of the fatal diseases in the world and is experiencing treatment difficulties. Many treatments have been discovered and implemented, but death rate of patients with lung cancer continues to remain high. Current treatments for cancer such as chemotherapy, immunotherapy, and radiotherapy have shown considerable results, yet they are accompanied by side effects. One effective method for reducing the cytotoxicity of these treatments is via the use of a nanoparticle-mediated siRNA delivery strategy with selective silencing effects and non-viral vectors. In this study, a folate (FA) moiety ligand-conjugated poly(sorbitol-co-PEI)-based gene transporter was designed by combining low-molecular weight polyethyleneimine (LMW PEI) and D-sorbitol with FA to form FPS. Since folate receptors are commonly overexpressed in various cancer cells, folate-conjugated nanoparticles may be more effectively delivered to selective cancer cells. Additionally, siOPA1 was used to induce apoptosis through mitochondrial fusion. The OPA1 protein stability level is important for maintaining normal mitochondrial cristae structure and function, conserving the inner membrane structure, and protecting cells from apoptosis. Consequently, when FPS/siOPA1 was used for lung cancer in-vitro and in-vivo, it improved cell viability and cellular uptake.

Also flagged:agingkeratinocyte differentiationgene expressionIgfbp3asinfections
Journal Article 2022-05-04 ✓ 1 Snippet Savina A, Jaffredo T, Saldmann F, Faulkes CG, Moguelet P, Leroy C, Marmol DD, Codogno P, Foucher L, Zalc A, Viltard M, Friedlander G, Aractingi S, Fontaine RH.
In-Text Gene Mentions

…Indeed,Prdx6, P4hb, Sod1 and…

Show Full Abstract

Naked mole-rats (NMR) are subterranean rodents characterized by an unusual longevity coupled with an unexplained resistance to aging. In the present study, we performed extensive <i>in situ</i> analysis and single-cell RNA-sequencing comparing young and older animals. At variance with other species, NMR exhibited a striking stability of skin compartments and cell types, which remained stable over time without aging-associated changes. Remarkably, the number of stem cells was constant throughout aging. We found three classical cellular states defining a unique keratinocyte differentiation trajectory that were not altered after pseudo-temporal reconstruction. Epidermal gene expression did not change with aging either. Langerhans cell clusters were conserved, and only a higher basal stem cell expression of <i>Igfbp3</i> was found in aged animals. In accordance, NMR skin healing closure was similar in young and older animals. Altogether, these results indicate that NMR skin is characterized by peculiar genetic and cellular features, different from those previously demonstrated for mice and humans. The remarkable stability of the aging NMR skin transcriptome likely reflects unaltered homeostasis and resilience.

Also flagged:HemeMetabolismironoxygenmitochondrialsulfur
Journal Article 2022-05-04 No Snippets Dutt S, Hamza I, Bartnikas TB.
Show Full Abstract

An abundant metal in the human body, iron is essential for key biological pathways including oxygen transport, DNA metabolism, and mitochondrial function. Most iron is bound to heme but it can also be incorporated into iron-sulfur clusters or bind directly to proteins. Iron's capacity to cycle between Fe<sup>2+</sup> and Fe<sup>3+</sup> contributes to its biological utility but also renders it toxic in excess. Heme is an iron-containing tetrapyrrole essential for diverse biological functions including gas transport and sensing, oxidative metabolism, and xenobiotic detoxification. Like iron, heme is essential yet toxic in excess. As such, both iron and heme homeostasis are tightly regulated. Here we discuss molecular and physiologic aspects of iron and heme metabolism. We focus on dietary absorption; cellular import; utilization; and export, recycling, and elimination, emphasizing studies published in recent years. We end with a discussion on current challenges and needs in the field of iron and heme biology.

Also flagged:PeriostinLung cancerPOSTNcancerlung squamous cell carcinomaLUSC
Journal Article 2022-05-04 ✓ 1 Snippet Bai X, Chen H, Oliver BG.
In-Text Gene Mentions

…ENTPD1, IL2RA, andTNFSF4, and POSTN are…

Show Full Abstract

Lung cancer is one of the most common malignancies with a high mortality rate worldwide. POSTN has been shown to be strongly correlated with the poor prognosis of lung cancer patients. However, the function and mechanism of action of POSTN in lung cancer remain unclear. Here, we carried out a pan-cancer analysis to assess the clinical prognostic value of POSTN based on the TCGA, TIMER, Oncomine, Kaplan-Meier, and UALCAN databases. We found that upregulated POSTN can be a promising biomarker to predict the prognosis of patients with lung cancer. High levels of POSTN correlated with immune cell infiltration in lung cancer, especially lung squamous cell carcinoma (LUSC), which was further confirmed based on the results from the TISIDB database. Moreover, the expression analysis, correlation analysis, and survival analysis revealed that POSTN-targeted miRNAs, downregulation of has-miR-144-3p and has-miR-30e-3p, were significantly linked to poor prognosis in patients with LUSC. Taken together, we identified that POSTN can act as a novel biomarker for determining the prognosis related to immune infiltration in patients with LUSC and deserves further research.

Also flagged:mTORBipolar disordermental illnessdepressionmaniamechanistic target of rapamycine
Journal Article 2022-05-04 ✓ 1 Snippet Park SW, Seo MK, Webster MJ, Lee JG, Kim S.
In-Text Gene Mentions

…neural transcription factor,POU3F2, as a main…

Show Full Abstract

Bipolar disorder (BPD) is a severe mental illness characterized by episodes of depression and mania. To investigate the molecular mechanisms underlying the pathophysiology of bipolar disorder, we performed transcriptome studies using RNA-seq data from the prefrontal cortex (PFC) of individuals with BPD and matched controls, as well as data from cell culture and animal model studies. We found 879 differentially expressed genes that were also replicated in an independent cohort of post-mortem samples. Genes involving the mechanistic target of rapamycine (mTOR) pathway were down-regulated, while genes interrelated with the mTOR pathway such as Janus kinase (JAK)-signal transducer and activator of transcription (STAT) pathway were up-regulated. Gene co-expression network analyses identified a module related to the mTOR pathway that was up-regulated in BPD and also enriched for markers of endothelial cells. We also found a down-regulated co-expression module enriched for genes involved in mTOR signalling and in mTOR related pathways and enriched with neuronal markers. The mTOR related modules were also replicated in the independent cohort of samples. To investigate whether the expression of the modules related to mTOR signalling pathway could be differentially regulated in different cell types we performed comparative network analyses in experimental models. We found both up-regulated modules in the PFC significantly overlapped with an up-regulated module in the brain endothelial cells from mice treated with lipopolysaccharides (LPS) and mTOR related pathways such as JAK-STAT, PI3K-Akt and ribosome were enriched in the common genes. In addition, the down-regulated module in the PFC significantly overlapped with a down-regulated module from neurons treated with the mTOR inhibitor, Torin1 and mTOR signalling, autophagy, and synaptic vesicle cycles were significantly enriched in the common genes. These results suggest that co-expression networks related to mTOR signalling pathways may be up- or down-regulated in different cell types in the PFC of BPD. These results provide novel insights into the molecular mechanisms underlying the pathophysiology of BPD.

Also flagged:gonadal hormone receptorsOestradioltranscription factorbreast cancerbindinggene expression
Journal Article 2022-05-04 No Snippets Gegenhuber B, Wu MV, Bronstein R, Tollkuhn J.
Show Full Abstract

Oestradiol establishes neural sex differences in many vertebrates<sup>1-3</sup> and modulates mood, behaviour and energy balance in adulthood<sup>4-8</sup>. In the canonical pathway, oestradiol exerts its effects through the transcription factor oestrogen receptor-α (ERα)<sup>9</sup>. Although ERα has been extensively characterized in breast cancer, the neuronal targets of ERα, and their involvement in brain sex differences, remain largely unknown. Here we generate a comprehensive map of genomic ERα-binding sites in a sexually dimorphic neural circuit that mediates social behaviours. We conclude that ERα orchestrates sexual differentiation of the mouse brain through two mechanisms: establishing two male-biased neuron types and activating a sustained male-biased gene expression program. Collectively, our findings reveal that sex differences in gene expression are defined by hormonal activation of neuronal steroid receptors. The molecular targets we identify may underlie the effects of oestradiol on brain development, behaviour and disease.

Also flagged:gastric epithelial neoplasiaHelicobacter pylori infectiongastric cancerH. pylori infectiontumourpersistent infection
Journal Article 2022-05-04 ✓ 1 Snippet Kim YJ, Kim J, Chung WC.
In-Text Gene Mentions

…in colorectal cancer (DCC) loci on 18q21…

Show Full Abstract

<h4>Background/aims</h4>Helicobacter pylori eradication may prevent the recurrence of gastric epithelial neoplasia after endoscopic treatment. However, H. pylori eradication therapy is unlikely to prevent gastric cancer. This study determined the longterm results and clinical outcomes of patients with gastric epithelial neoplasia based on H. pylori infection status and microsatellite stability (MSS).<h4>Methods</h4>Patients diagnosed with gastric epithelial neoplasia who underwent an endoscopic mucosal resection or submucosal dissection between 2004 and 2010 were included in this retrospective study. During the follow-up period (range, 4 to 14 years), disease recurrence was monitored, and tissue examinations were conducted for seven sets of microsatellite loci initially linked to the tumour suppressor gene locus. When H. pylori infection was identified, patients underwent eradication therapy.<h4>Results</h4>The patients (n = 120) were divided into three groups: H. pylori-negative with MSS, H. pylori-positive with MSS, and microsatellite instability (MSI). After H. pylori eradication, the rate of metachronous recurrence was significantly different in the MSI (28.2%) and MSS groups (3.7%, p < 0.01). The mean duration of recurrence was 77 months (range, 24 to 139) in the MSI group. There was no recurrence after eradication therapy in patients who were positive for H. pylori in the MSS group.<h4>Conclusion</h4>H. pylori eradication could help prevent gastric cancer recurrence in patients with stable microsatellite loci. Careful, long-term monitoring is required in patients with unstable microsatellite loci.

Also flagged:Cas9cancerclustered regularly interspaced short palindromic repeatsCRISPR associated protein 9CRISPRchimeric antigen receptor
Journal Article 2022-05-04 ✓ 1 Snippet Shojaei Baghini S, Gardanova ZR, Abadi SAH, Zaman BA, İlhan A, Shomali N, Adili A, Moghaddar R, Yaseri AF.
In-Text Gene Mentions

Indeed, this technology has enabled the correction of the multiple mutated genes associated with responding genetic disorders, including the DMD gene in DMD, CFTR gene in CF, factor IX gene in hemophilia B, hemoglobin beta-chain gene in β-thalassemia, presenilin 1 and 2 (PSEN1 and PSEN2) and apolipoprotein E4 (apoE4) genes in AD, HTT gene in HD, leucine-rich repeat kinase 2 (LRRKK2) gene in PD, fumarylacetoacetate hydrolase (FAH) in tyrosinemia, Hex gene in TSD, fragile X mental retardation 1 (FMR1) gene in FXS, etc. [90, 91].

Show Full Abstract

The progress of genetic engineering in the 1970s brought about a paradigm shift in genome editing technology. The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system is a flexible means to target and modify particular DNA sequences in the genome. Several applications of CRISPR/Cas9 are presently being studied in cancer biology and oncology to provide vigorous site-specific gene editing to enhance its biological and clinical uses. CRISPR's flexibility and ease of use have enabled the prompt achievement of almost any preferred alteration with greater efficiency and lower cost than preceding modalities. Also, CRISPR/Cas9 technology has recently been applied to improve the safety and efficacy of chimeric antigen receptor (CAR)-T cell therapies and defeat tumor cell resistance to conventional treatments such as chemotherapy and radiotherapy. The current review summarizes the application of CRISPR/Cas9 in cancer therapy. We also discuss the present obstacles and contemplate future possibilities in this context.

Also flagged:cognitiontranslationalperinatal disordersfetal alcohol syndromeopioidchorioamnionitis
Journal Article 2022-05-04 No Snippets Muthukumar S, Mehrotra K, Fouda M, Hamimi S, Jantzie LL, Robinson S.
Show Full Abstract

The use of touchscreen technology to evaluate cognitive deficits in animal models has grown tremendously over the past 20 years. The touchscreen apparatus encompasses many advantages, namely a high level of standardization and translational capability. Improvements in technology in recent years have expanded the versatility of the touchscreen platform, as it is able to test distinct cognitive modalities including working memory, attention, discrimination, and association. Importantly, touchscreen technology has allowed researchers to explore deficits in multiple pillars of cognition in a wide variety of perinatal disorders with neurological sequelae across critical developmental windows. The touchscreen platform has been used to dissect deficits in antenatal CNS injury including fetal alcohol syndrome, prenatal opioid exposure, and chorioamnionitis, to peripartum insults such as term hypoxic-ischemic encephalopathy, to early postnatal insults including infantile traumatic brain injury. Most importantly, touchscreen technology offers the sensitivity necessary to detect subtle injury and treatment-induced changes in cognition and executive function beyond those offered by more rudimentary tests of rodent cognition. Understanding the pathophysiology of these disorders in rodents is paramount to addressing these deficits in human infants and dissecting the neural circuitry essential to perinatal brain injury pathophysiology and responsiveness to novel therapeutics. Touchscreen testing provides an effective, facile, sophisticated technique to accelerate the goal of improving cognitive and behavioral outcomes of children who suffer perinatal brain injury.

Also flagged:papillary thyroid cancermethylationgene expressionBRAFTumor suppressor geneshypermethylation
Journal Article 2022-05-04 No Snippets Yi JW, Ha SY, Jee HG, Kim K, Kim SJ, Chai YJ, Choi JY, Lee KE.
Show Full Abstract

<h4>Objectives</h4>The BRAFV600E mutation is a major driver mutation in papillary thyroid cancer. The aim of this study was to elucidate the correlation between DNA methylation and gene expression changes induced by the BRAFV600E mutation in thyroid cells.<h4>Methods</h4>We used Nthy/BRAF cell lines generated by transfection of Nthy/ori cells with the wild-type BRAF gene (Nthy/WT cells) and the V600E mutant-type BRAF gene (Nthy/V600E cells). We performed gene expression microarray and DNA methylation array analyses for Nthy/WT and Nthy/V600E cells. Two types of array data were integrated to identify inverse correlations between methylation and gene expression. The results were verified in silico using data from The Cancer Genome Atlas (TCGA) and in vivo through pyrosequencing and quantitative real-time polymerase chain reaction (qRT-PCR).<h4>Results</h4>In the Nthy/V600E cells, 199,821 probes were significantly hypermethylated, and 697 genes showed a "hypermethylation-downregulation" pattern in Nthy/V600E. Tumor suppressor genes and apoptosis-related genes were included. In total, 66,446 probes were significantly hypomethylated, and 227 genes showed a "hypomethylation-upregulation" pattern in Nthy/V600E cells. Protooncogenes and developmental protein-coding genes were included. In the TCGA analysis, 491/697 (70.44%) genes showed a hypermethylation-downregulation pattern, and 153/227 (67.40%) genes showed a hypomethylation-upregulation pattern. Ten selected genes showed a similar methylation-gene expression pattern in pyrosequencing and qRT-PCR.<h4>Conclusion</h4>Induction of the BRAFV600E mutation in thyroid cells led to frequent hypermethylation. Anticancer genes, such as those involved in tumor suppression or apoptosis, were downregulated by upstream hypermethylation, whereas carcinogenic genes, such as protooncogenes, were upregulated by hypomethylation. Our results suggest that the BRAFV600E mutation in thyroid cells modulates DNA methylation and results in cancer-related gene expression.

Also flagged:Oxytocin ReceptorDepressionbehaviouralpsychological problemsOXTRanxiety
Journal Article 2022-05-04 ✓ 2 Snippets Senese VP, Shinohara K, Venuti P, Bornstein MH, Rosanio V, Nasti C, Neoh MJ, Maresca M, Esposito G.
In-Text Gene Mentions

In a landmark study by Caspi et al. [30], a gene–environment interaction was found in which polymorphisms in the serotonin transporter gene (5-HTT) promoter moderated the influence of stressful life events on depression.

…serotonin transporter gene (5-HTT) promoter moderated the…

Show Full Abstract

Parental rejection has been consistently empirically implicated in a wide array of developmental, behavioural and psychological problems worldwide. However, the interaction effect between parental rejection in childhood and the oxytocin receptor genotype on psychological adjustment has yet to be investigated. The present study aimed to investigate gene-environment interaction effects between parental rejection (maternal and paternal) and oxytocin receptor (OXTR) gene polymorphisms (rs53576 and rs2254298) on depressive symptoms in adults in different cultural contexts. Adults from Italy and Japan (<i>N</i> = 133, age = 18-27 years, females = 68) were preliminarily genotyped and then completed the Parental Acceptance-Rejection Questionnaire for mothers and fathers and the Beck Depression Inventory. Hierarchical multiple regression analysis showed that paternal rejection was related to self-reported depression and that the effect of parental rejection was moderated by OXTR gene polymorphisms and nationality. Among Italians, OXTR rs2254298 A-carriers showed resilience to negative early parental care, whereas among Japanese, OXTR rs53576 non-A-carriers showed resistance to negative early paternal care. These findings align with expected relations between perceived acceptance-rejection and an individual's psychological adjustment, as proposed by interpersonal acceptance-rejection theory, and indicate the need for future studies adopting a multicultural and multilevel approach to better understand how the effects of parental rejection extend into adulthood.

Also flagged:Procyanidinsflavonoidtumortumorsobesityoral diseases
Journal Article 2022-05-04 No Snippets Chen H, Wang W, Yu S, Wang H, Tian Z, Zhu S.
Show Full Abstract

Procyanidins, as a kind of dietary flavonoid, have excellent pharmacological properties, such as antioxidant, antibacterial, anti-inflammatory and anti-tumor properties, and so they can be used to treat various diseases, including Alzheimer's disease, diabetes, rheumatoid arthritis, tumors, and obesity. Given the low bioavailability of procyanidins, great efforts have been made in drug delivery systems to address their limited use. Nowadays, the heavy burden of oral diseases such as dental caries, periodontitis, endodontic infections, etc., and their consequences on the patients' quality of life indicate a strong need for developing effective therapies. Recent years, plenty of efforts are being made to develop more effective treatments. Therefore, this review summarized the latest researches on versatile effects and enhanced bioavailability of procyanidins resulting from innovative drug delivery systems, particularly focused on its potential against oral diseases.

Also flagged:cancerrenal carcinomacell proliferationtumorsHMGA2tumor
Journal Article 2022-05-04 ✓ 3 Snippets Shi H, Zhu H, Zhang C, Zhou X, Ma W, Xu H, Yang X.
In-Text Gene Mentions

Recent studies have found that lncZFAS1 (ZNFX1 antisense RNA1) is closely associated with the growth and metastasis of many types of tumors, such as breast cancer [5], gastric cancer [6], nonsmall cell lung cancer [7], bladder cancer [8], and colorectal cancer [9].

…found that lncZFAS1 (ZNFX1antisense RNA1) is…

…of protein-coding geneZnfx1, and it has…

Show Full Abstract

<h4>Background</h4>Renal carcinoma is the 7th most common cancer in the world, with the 7th and 6th highest incidence and mortality rates worldwide. Although great progress has been made in the diagnosis and treatment of renal carcinoma, its prognosis is still unsatisfactory. It is important to study the molecular mechanisms of renal carcinoma occurrence and development and to find potential therapeutic targets.<h4>Objective</h4>The main objective is to investigate the effects of long noncoding RNA (lncRNA) ZFAS1 (lncZFAS1) on the proliferation, apoptosis, and migration of renal carcinoma cells and to preliminarily explore its mechanism.<h4>Methods</h4>A qRT-PCR method was used to detect the expression of lncZFAS1 in renal carcinoma tissues and renal carcinoma cells. After shRNA interference with lncZFAS1 expression, the effects of lncZFAS1 on cell proliferation, apoptosis, migration, and invasion were detected by CCK-8 method, flow cytometry, scratch test, and Transwell assay. The effect of the knockdown of lncZFAS1 on the growth of transplanted tumors was examined. The expression of lncZFAS1 in renal carcinoma tissues and renal carcinoma cells was significantly higher than that in paracancerous tissues and normal esophageal epithelial cells. Knockdown of lncZFAS1 significantly inhibited the proliferation, migration, and invasive ability of renal carcinoma cells; upregulated miR-150-5P expression and downregulated HMGA2 expression in renal carcinoma cells; and significantly inhibited the growth of transplanted tumors in nude mice.<h4>Conclusion</h4>Upregulation of miR-150-5P expression was detected after knockdown of lncZFAS1 in renal carcinoma cells, while both mRNA and protein expression levels of HMGA2 were decreased. lncZFAS1 can promote the proliferation and migration of renal carcinoma cells, and the mechanism may be related to the regulation of the miR-150-5P/HMGA2 molecular axis.

Also flagged:agingage-related diseasesHuntingtinHuntington's DiseaseAlzheimer's Diseasebrain
Journal Article 2022-05-04 ✓ 3 Snippets Ingannato A, Bagnoli S, Bessi V, Ferrari C, Mazzeo S, Sorbi S, Nacmias B.
In-Text Gene Mentions

HTT (Huntingtin) gene is linked to Huntington's Disease, but also associated to longevity in capuchins and mice.

HTT(Huntingtin) gene is…

…possible implication ofHTTgene in exceptional…

Show Full Abstract

Centenarians are the best example of successful aging, reaching extreme longevity escaping age-related diseases. Genome sequencing studies provided evidence for genetic factors linked to heathy long life, including genes related to age-dependent diseases. HTT (Huntingtin) gene is linked to Huntington's Disease, but also associated to longevity in capuchins and mice. HTT Intermediate alleles (IAs) are defined as CAG repeat expansion between 27 and 35. According to recent data IAs might increase Alzheimer's Disease risk, but also might have a neuroprotective effect and can confer an advantage in brain development. Here, we investigated, for the first time, the possible implication of HTT IAs in extreme longevity and their possible association in cognitive decline. We analysed the distribution of IAs in Italian Centenarians (n = 143) and compared with pathological controls with cognitive decline (n = 232, including 80 Alzheimer's Disease, 78 Frontotemporal Dementia and 74 Subjective Cognitive Decline patients) and healthy controls (n = 104). Our data show a statistically significant higher frequency of IAs in Centenarians with respect to pathological controls with cognitive decline (p = .031; OR = 2.3097 95% CI 1.0591 to 5.0371), with a percentage of 11.2 respect to 5.4 respectively. The highest presence of IAs in Centenarians confirms and extends in humans a possible implication of HTT gene in exceptional lifespan and in brain development with a neuroprotective effect.

Also flagged:ProteolysisReproductionpeptidetranscription factorsproteasesprotease
Journal Article 2022-05-04 No Snippets Kiyozumi D, Ikawa M.
Show Full Abstract

The physiological roles of proteolysis are not limited to degrading unnecessary proteins. Proteolysis plays pivotal roles in various biological processes through cleaving peptide bonds to activate and inactivate proteins including enzymes, transcription factors, and receptors. As a wide range of cellular processes is regulated by proteolysis, abnormalities or dysregulation of such proteolytic processes therefore often cause diseases. Recent genetic studies have clarified the inclusion of proteases and protease inhibitors in various reproductive processes such as development of gonads, generation and activation of gametes, and physical interaction between gametes in various species including yeast, animals, and plants. Such studies not only clarify proteolysis-related factors but the biological processes regulated by proteolysis for successful reproduction. Here the physiological roles of proteases and proteolysis in reproduction will be reviewed based on findings using gene-modified organisms.

Also flagged:malignant tumorsnon-small cell lung cancerNSCLCT cell receptortumorCD8
Journal Article 2022-05-04 ✓ 1 Snippet Wang Y, Liu Y, Li X, Li W, Xue Z, He X, Xiong W, He L, Bai Y.
In-Text Gene Mentions

…cytokines (INFG, IL1,TNFSF4, and TNFSF9), and…

Show Full Abstract

<b>Background</b>: Lung cancer has the highest morbidity and mortality rate among types of malignant tumors, and as such, research into prolonging the survival time of patients is vital. The emergence of immune checkpoint inhibitors (ICIs) has greatly improved the survival of patients with non-small cell lung cancer (NSCLC), however, the lack of effective biomarkers to predict the prognosis of immunotherapy has made it difficult to maximize the benefits. T cell receptor (TCR) is one of the most important components for recognizing tumor cells, and with this study we aim to clarify the relationship between TCR coexpression and the prognosis of NSCLC patients receiving immunotherapy. <b>Methods</b>: Univariate COX regression, logistics regression, and KM survival analysis were used to evaluate the relationship between TCR coexpression and the prognosis of immunotherapy. Additionally, CIBERSORT, Gene Set Enrichment Analysis (GSEA), and single-sample GSEA (ssGSEA) algorithms were used to evaluate the tumor immune microenvironment (TIME) of NSCLC patients. <b>Results</b>: Univariate Cox regression analysis showed that the TCR coexpression signature can be used as a clinical prognostic indicator for NSCLC patients receiving immunotherapy (<i>p</i> = 0.0205). In addition, those in the NSCLC group with a high TCR coexpression signature had significantly improved progression-free survival (PFS) (<i>p</i> = 0.014). In the ICI treatment cohort (GSE35640). In addition, there was a high infiltration of CD8+T cells, activated memory CD4+T cells, and M1 macrophages in the TIME of those with a high TCR coexpression signature. The results of pathway enrichment analysis showed that patients with a high TCR coexpression signature had significantly activated signal pathways such as lymphocyte proliferation and activation, chemokine binding, and inflammatory cytokine production. Also, we found that patients with a high TCR coexpression signature had an elevated T cell inflammation gene expression profile (GEP). <b>Conclusion</b>: We show that the TCR coexpression signature may be useful as a new biomarker for the prognosis of NSCLC patients undergoing immunotherapy, with high signatures indicating better treatment response. Additionally, we found that patients with a high TCR coexpression signature had tumor immune microenvironments with beneficial anti-tumor characteristics.

Also flagged:TEAD4transcriptional enhancer factorTEFtranscription factorscancerslung adenocarcinoma
Journal Article 2022-05-04 ✓ 1 Snippet Gong X, Li N, Sun C, Li Z, Xie H.
In-Text Gene Mentions

…( TAOK2 ,TAOK3, WWC1 ,…

Show Full Abstract

<b>Background:</b> TEA domain transcription factor 4 (TEAD4) is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which is studied to be linked to the tumorigenesis and progression of various forms of cancers, including lung adenocarcinoma (LUAD). However, the specific function of this gene in the progression of LUAD remains to be explored. <b>Method:</b> A total of 19 genes related to the Hippo pathway were analyzed to identify the significant genes involved in LUAD progression. The TCGA-LUAD data (n = 585) from public databases were mined, and the differentially expressed genes (DEGs) in patients with the differential level of <i>TEAD4</i> were identified. The univariate Cox regression, zero LASSO regression coefficients, and multivariate Cox regression were performed to identify the independent prognostic signatures. The immune microenvironment estimation in the two subgroups, including immune cell infiltration, HLA family genes, and immune checkpoint genes, was assessed. The Gene Set Enrichment Analysis (GSEA) and GO were conducted to analyze the functional enrichment of DEGs between the two risk groups. The potential drugs for the high-risk subtypes were forecasted <i>via</i> the mode of action (moa) module of the connectivity map (CMap) database. <b>Results:</b> <i>TEAD4</i> was found to be significantly correlated with poor prognosis in LUAD-patients. A total of 102 DEGs in <i>TEAD4</i>-high vs. <i>TEAD4</i>-low groups were identified. Among these DEGs, four genes (<i>CPS1</i>, <i>ANLN</i>, <i>RHOV</i>, and <i>KRT6A</i>) were identified as the independent prognostic signature to conduct the Cox risk model. The immune microenvironment estimation indicated a strong relationship between the high <i>TEAD4</i> expression and immunotherapeutic resistance. The GSEA and GO showed that pathways, including cell cycle regulation, were enriched in the high-risk group, while immune response-related and metabolism biological processes were enriched in the low-risk group. Several small molecular perturbagens targeting <i>CFTR</i> or <i>PLA2G1B</i>, by the mode of action (moa) modules of the glucocorticoid receptor agonist, cyclooxygenase inhibitor, and NFkB pathway inhibitor, were predicted to be suited for the high-risk subtypes based on the high <i>TEAD4</i> expression. <b>Conclusion:</b> The current study revealed <i>TEAD4</i> is an immune regulation-related predictor of prognosis and a novel therapeutic target for LUAD.

Also flagged:Ironplagueinfectious diseaseouter membrane proteininfectionsynthesis
Journal Article 2022-05-04 ✓ 1 Snippet Chen Y, Song K, Chen X, Li Y, Lv R, Zhang Q, Cui Y, Bi Y, Han Y, Tan Y, Du Z, Yang R, Qi Z, Song Y.
In-Text Gene Mentions

…researcher suffering fromhemochromatosiswas infected with…

Show Full Abstract

<i>Yersinia pestis</i> is the etiological agent of plague, a deadly infectious disease that has caused millions of deaths throughout history. Obtaining iron from the host is very important for bacterial pathogenicity<i>. Y. pestis</i> possesses many iron uptake systems. Yersiniabactin (Ybt) plays a major role in iron uptake <i>in vivo</i> and <i>in vitro</i>, and in virulence toward mice as well. FyuA, a β-barrel TonB-dependent outer membrane protein, serves as the receptor for Ybt. In this study, we examined the role of the <i>fyuA</i> gene in <i>Y. pestis</i> virulence using different challenging ways and explored the underlying mechanisms. The BALB/c mouse infection assay showed that the virulence of the mutant strains (Δ<i>fyuA</i> and Δ<i>fyuA</i><sub>GCAdel</sub>) was lower when compared with that of the wild-type (WT) strain 201. Furthermore, the attenuation of virulence of the mutant strains <i>via</i> subcutaneous and intraperitoneal challenges was far greater than that <i>via</i> intravenous injection. Iron supplementation restored lethality during subcutaneous challenge with the two mutants. Thus, we speculated that the attenuated virulence of the mutant strains toward the mice may be caused by dysfunctional iron uptake. Moreover, Δ<i>fyuA</i> and Δ<i>fyuA</i><sub>GCAdel</sub> strains exhibited lower survival rates in murine RAW264.7 macrophages, which might be another reason for the attenuation. We further explored the transcriptomic differences between the WT and mutant strains at different temperatures and found that the expressions of genes related to Ybt synthesis and its regulation were significantly downregulated in the mutant strains. This finding indicates that <i>fyuA</i> might exert a regulatory effect on Ybt. Additionally, the expressions of the components of the type III secretion system were unexpectedly upregulated in the mutants, which is inconsistent with the conventional view that the upregulation of the virulence genes enhances the virulence of the pathogens.

Also flagged:CopperAlzheimer diseaseHuntington diseasephenylenediaminemetforminsalicylate
Journal Article 2022-05-04 ✓ 2 Snippets Brinvillier D, Barrast M, Couderc-Murillo P, Bono-Yagüe J, Rousteau A, Gómez Escribano AP, Palmeira-Mello MV, Doménech-Carbó A, Passe-Coutrin N, Sylvestre M, Vázquez-Manrique RP, Cebrián-Torrejón G.
In-Text Gene Mentions

Huntington disease (HD) is a genetic neurodegenerativedisordercharacterized by uncoordination and choreic movements, progressiveloss of cognitive functions, and psychiatric alterations, leadingto repercussions in daily life activities.1 HD is characterized by intracellular deposits of mutant huntingtin(mHttt), which is an essential protein in mammals but with no clearfunction yet.2,3 Huntingtin is encoded by HTT, and patients of HD have an abnormal expansion of CAGtriplets (36 or more) in the first exon of the gene.

…is encoded byHTT, and patients…

Show Full Abstract

Neurodegenerative disorders, caused by prone-to-aggregation proteins, such as Alzheimer disease or Huntington disease, share other traits such as disrupted homeostasis of essential metal ions, like copper. In this context, in an attempt to identify Cu<sup>2+</sup> chelating agents, we study several organic compounds (ethylenediaminetetraacetic acid, phenylenediamine, metformin, salicylate, and trehalose) and organic extracts obtained from <i>Bacopa monnieri</i> L., which has been used in Ayurvedic therapies and presented a broad spectrum of biological properties. For this purpose, UV-visible spectroscopy analysis and electrochemical measurements were performed. Further, biological assays were performed in <i>Caenorhabditis elegans</i> models of polyQ toxicity, in an attempt to obtain better insights on neurodegenerative disorders.

Also flagged:LipomaDEAD-box helicase 27gastric cancerLPPcancerDEAD-box RNA helicases
Journal Article 2022-05-04 ✓ 5 Snippets Jin Y, Yang S, Gao X, Chen D, Luo T, Su S, Shi Y, Yang G, Dong L, Liang J.
In-Text Gene Mentions

Large amounts of studies have regarded DDX27 as vital cancer-promoting genes in distinct tumors (Tsukamoto et al., 2015; Tang et al., 2018).

Overall, we can draw the conclusion that DDX27 was significantly upregulated in GC and may participate in facilitating the GC malignancy development.

To unveil the role of DDX27 in tumor malignancy, we successfully constructed a stable DDX27 overexpression (LV-DDX27) and knockdown (shDDX27) cell models in three GC cell lines (AGS, HGC-27, and BGC823) using recombinant lentivirus infection.

Subsequently, we detected the DDX27 mRNA and protein levels in different GC cell lines and noticed that compared to the normal gastric epithelial cell line (GES-1), DDX27 was significantly upregulated in the GC cells (AGS, BGC-823, MKN-45, MKN-28, SNU-1, and HGC-27) (Figure 1B).

The effects of DDX27 and LPP expression on the survival time among the GC patients were analyzed by the Kaplan–Meier plotter (http://kmplot.com/analysis/).

Show Full Abstract

DEAD-box helicase 27 (DDX27) was previously identified as an important mediator during carcinogenesis, while its role in gastric cancer (GC) is not yet fully elucidated. Here, we aimed to investigate the mechanism and clinical significance of DDX27 in GC. Public datasets were analyzed to determine DDX27 expression profiling. The qRT-PCR, Western blot, and immunohistochemistry analyses were employed to investigate the DDX27 expression in GC cell lines and clinical samples. The role of DDX27 in GC metastasis was explored <i>in vitro</i> and <i>in vivo</i>. Mass spectrometry, RNA-seq, and alternative splicing analysis were conducted to demonstrate the DDX27-mediated molecular mechanisms in GC. We discovered that DDX27 was highly expressed in GCs, and a high level of DDX27 indicated poor prognosis. An increased DDX27 expression could promote GC metastasis, while DDX27 knockdown impaired GC aggressiveness. Mechanically, the LLP expression was significantly altered after DDX27 downregulation, and further results indicated that LPP may be regulated by DDX27 <i>via</i> alternative splicing. In summary, our study indicated that DDX27 contributed to GC malignant progression <i>via</i> a prometastatic DDX27/LPP/EMT regulatory axis.

Also flagged:MethyladenosineAcute Myeloid Leukemiaacute myelogenous leukemiaAMLtumorLAG3
Journal Article 2022-05-04 ✓ 2 Snippets Zheng G, Liu M, Chang X, Cao X, Dong A, Zhu H, Hu W, Xie J, Zhao Y, Hu D, Jia X, Yang Y, Shi X, Lu J.
In-Text Gene Mentions

The LASSO Cox regression analysis revealed that nine out of the 315 lncRNAs were with closely associated with AML prognosis (Figures 5A,B), which were LINC00852 (p < 0.001, coefficient = 0.0256), AL157392.3 (p < 0.001, coefficient = 0.0278), AC127459.1 (p < 0.001, coefficient = 0.0946), AC106820.3 (p < 0.001, coefficient = 0.0024), AC092757.2 (p = 0.004, coefficient = 1.6278), AC124248.1 (p < 0.001, coefficient = 0.0054), AC145207.5 (p < 0.001, coefficient = 0.0008), DNAAF4-CCPG1 (p < 0.001, coefficient = 0.0070), and AC023908.3 (p < 0.001, coefficient = 0.1977) with all HR greater than 1, as shown in Table 3.

…coefficient = 0.0008), DNAAF4-CCPG1( p <…

Show Full Abstract

N6-Methyladenosine-related long noncoding RNAs play an essential role in many cancers' development. However, the relationship between m6A-related lncRNAs and acute myelogenous leukemia (AML) prognosis remains unclear. We systematically analyzed the association of m6A-related lncRNAs with the prognosis and tumor immune microenvironment (TME) features using the therapeutically applicable research to generate effective treatment (TARGET) database. We screened 315 lncRNAs associated with AML prognosis and identified nine key lncRNAs associated with m6A by the LASSO Cox analysis. A model was established based on these nine lncRNAs and the predictive power was explored in The Cancer Genome Atlas (TCGA) database. The areas under the ROC curve of TARGET and TCGA databases for ROC at 1, 3, and 5 years are 0.701, 0.704, and 0.696, and 0.587, 0.639, and 0.685, respectively. The nomogram and decision curve analysis (DCA) showed that the risk score was more accurate than other clinical indicators in evaluating patients' prognoses. The clusters with a better prognosis enrich the AML pathways and immune-related pathways. We also found a close correlation between prognostic m6A-related lncRNAs and tumor immune cell infiltration. LAG3 expression at the immune checkpoint was lower in the worse prognostic cluster. In conclusion, m6A-related lncRNAs partly affected AML prognosis by remodeling the TME and affecting the anticarcinogenic ability of immune checkpoints, especially LAG3 inhibitors. The prognostic model constructed with nine key m6A-related lncRNAs can provide a method to assess the prognosis of AML patients in both adults and children.

Also flagged:FerroptosisBreast CancerBRCAreverse transcriptaselung cancercancer
Journal Article 2022-05-04 ✓ 1 Snippet Xu Y, Du Y, Zheng Q, Zhou T, Ye B, Wu Y, Xu Q, Meng X.
In-Text Gene Mentions

…as NOX3 andPEBP1had negative coefficients,…

Show Full Abstract

<h4>Purpose</h4>To identify molecular clusters associated with ferroptosis and to develop a ferroptosis-related signature for providing novel potential targets for the recurrence-free survival and treatment of breast cancer.<h4>Methods</h4>Ferroptosis-related gene (FRG) signature was constructed by univariate and multivariate Cox regression and least absolute shrinkage and selection operator (LASSO). Receiver operating characteristic curves, Kaplan-Meier survival analysis, principal component analysis, and univariate and multivariate Cox regression analyses in the training and test cohorts were used to evaluate the application of this signature. Quantitative reverse transcriptase-PCR (qRT-PCR) was employed to detect the expression of FRGs in the model. Furthermore, the correlations between the signature and immune microenvironment, somatic mutation, and chemotherapeutic drugs sensitivity were explored.<h4>Results</h4>Internal and external validations affirmed that relapse-free survival differed significantly between the high-risk and low-risk groups. Univariate and multivariate Cox regression analyses indicated that the riskScore was an independent prognostic factor for BRCA. The areas under the curve (AUCs) for predicting 1-, 2-, and 3-year survival in the training and test cohorts were satisfactory. Significant differences were also found in the immune microenvironment and IC50 of chemotherapeutic drugs between different risk groups. Furthermore, we divided patients into three clusters based on 18 FRGs to ameliorate the situation of immunotherapy failure in BRCA.<h4>Conclusions</h4>The FRG signature functions as a robust prognostic predictor of the immune microenvironment and therapeutic response, with great potential to guide individualized treatment strategies in the future.

Also flagged:transcriptional co-activatorOBF1cell differentiationCD4OCA-B
Journal Article 2022-05-04 ✓ 3 Snippets Betzler AC, Ezić J, Abou Kors T, Hoffmann TK, Wirth T, Brunner C.
In-Text Gene Mentions

Rc3h1and Rc3h2 associated…

…Interestingly,Rc3h1is also described…

…Still,Rc3h1and Rc3h2 associated…

Show Full Abstract

The transcriptional co-activator BOB.1/OBF.1 is expressed in both B and T cells. The main characteristic of conventional BOB.1/OBF.1 deficient mice is the complete absence of germinal centers (GCs). This defect was mainly attributed to the defective B cell compartment. However, it is unknown whether and how BOB.1/OBF.1 expression in T cells contributes to the GC reaction. To finally clarify this question, we studied the <i>in vivo</i> function of BOB.1/OBF.1 in CD4<sup>+</sup> T and follicular T helper (TFH) cell subpopulations by conditional mutagenesis, in the presence of immunocompetent B lymphocytes. BOB.1/OBF.1 deletion in CD4<sup>+</sup> T as well as TFH cells resulted in impaired GC formation demonstrating that the impaired GC reaction described for conventional BOB.1/OBF.1-deficient mice cannot exclusively be traced back to the B cell compartment. Furthermore, we show a requirement of BOB.1/OBF.1 for T helper (TH) cell subsets, particularly for TFH cell differentiation.

Also flagged:PLK1NK/T cell lymphomaNatural killer/T cell lymphomanon-Hodgkin lymphomaGemcitabineoxaliplatin
Journal Article 2022-05-04 No Snippets Zhang C, Xu H, Sui X, Chen L, Chen B, Lv H, Wang S, Wang X.
Show Full Abstract

Natural killer/T cell lymphoma (NKTCL) is a highly aggressive subtype of non-Hodgkin lymphoma. Gemcitabine, oxaliplatin, and L-asparaginase (GELOX) is one of the first-line chemotherapy regimens of NKTCL. Yet, the prognosis of NKTCL is poor. Icaritin is an herb-derived monomer from icariin with antitumor effects. We found that icaritin induced proliferation inhibition and apoptosis of NKTCL both <i>in vitro</i> and <i>in vivo</i>. Moreover, icaritin inhibited the dissemination of NKTCL <i>in vivo</i>. RNA sequencing revealed the Polo-like kinase 1 (PLK1) gene and DNA damage response (DDR) as the targets of icaritin. Mechanistically, icaritin inhibited PLK1 to promote checkpoint kinase 2 (Chk2) homodimerization and its T387 phosphorylation, which further activated p53, leading to the activation of the DDR pathway. Moreover, inhibiting PLK1 increased Forkhead box O3a nuclear localization, the latter of which activated ataxia telangiectasia mutated (ATM), an early sensor of DNA damage. Then ATM phosphorylated Chk2 T68 and initiated Chk2 activation. Remarkably, the combined treatment of icaritin and GELOX achieved better antitumor efficacy than single treatment <i>in vivo</i>. In summary, our results proved the efficacy of icaritin treating NKTCL, provided insights into its antitumor molecular mechanism, and revealed the application value of icaritin in facilitating clinical NKTCL treatment.

Also flagged:COVID-19oxygenSAA1SAA2ALBSERPING1
Journal Article 2022-05-04 No Snippets Chen T, Polak P, Uryasev S.
Show Full Abstract

Early detection and effective treatment of severe COVID-19 patients remain two major challenges during the current pandemic. Analysis of molecular changes in blood samples of severe patients is one of the promising approaches to this problem. From thousands of proteomic, metabolomic, lipidomic, and transcriptomic biomarkers selected in other research, we identify several <i>pairs of biomarkers</i> that after additional nonlinear spline transformation are highly effective in classifying and predicting severe COVID-19 cases. The performance of these pairs is evaluated in-sample, in a cross-validation exercise, and in an out-of-sample analysis on two independent datasets. We further improve our classifier by identifying complementary pairs using hierarchical clustering. In a result, we achieve 96-98% AUC on the validation data. Our findings can help medical experts to identify small groups of biomarkers that after nonlinear transformation can be used to construct a cost-effective test for patient screening and prediction of severity progression.

Authorea Preprints 2022-05-04 Preprint (No Snippets API) Salmeron-Villalobos J, Ramis-Zaldivar JE, Balagué O, Verdú-Amorós J, Celis V, Sábado C, Garrido M, Mato S, Uriz J, Ortega MJ, Gutierrez-Camino A, Sinnett D, Illarregi U, Carron M, Regueiro A, Miñarro AMG, Gonzalez-Farré B, Campo E, Garcia N, Colomer D, Astigarraga-Aguirre I, Andrés M, Llavador M, Martin-Guerrero I, Salaverria I.
Show Full Abstract

<h4>Background: </h4> T-cell lymphoblastic lymphoma (T-LBL) is an aggressive neoplasm closely related to T-cell acute lymphoblastic leukaemia (T-ALL). Despite their similarities, and contrary to T-ALL, studies on pediatric T-LBL are scarce and, therefore, its molecular landscape has not been fully elucidated yet. Procedure To characterize the genetic and molecular heterogeneity of paediatric T-LBL, 33 patients were analyzed using an integrated approach, including targeted next generation sequencing, RNA-sequencing transcriptome analysis and copy-number arrays. Results Copy number and mutational analyses allowed the detection of recurrent homozygous deletions of 9p/CDKN2A (78%), trisomy 20 (19%) and gains of 17q24-q25 (16%), as well as frequent mutations of NOTCH1 (62%), followed by BCL11B (23%), WT1 (19%) and FBXW7, PHF6 and RPL10 genes (15%, respectively). This genetic profile did not differ to that described in T-ALL in terms of mutation incidence and global genomic complexity level but unveiled virtually exclusive 17q25 gains and trisomy 20 in T-LBL. Additionally, we identified novel gene fusions in paediatric T-LBL including NOTCH1-IKZF2, RNGTT-SNAP91 and DDX3X-MLLT10, the latter being the only one previously described in T-ALL. Moreover, clinical correlations highlighted the presence of Notch pathway alterations as a factor related to favorable outcome. Conclusions In summary, the genomic landscape of paediatric T-LBL is similar to that observed in T-ALL and Notch signaling pathway deregulation remains the cornerstone in its pathogenesis, including not only mutations but fusion genes targeting NOTCH1.

bioRxiv 2022-05-04 Preprint (No Snippets API) Lee Y, Kim H, Barker D, Vijayvargia R, Atwal RS, Specht H, Keshishian H, Carr SA, Lee R, Kwak S, Hyun K, Loupe J, MacDonald ME, Song J, Seong IS.
Show Full Abstract

<h4>ABSTRACT</h4> Huntington’s disease (HD) is a neurodegerative disorder caused by an inherited unstable HTT CAG repeat that expands further, thereby eliciting a disease process that may be initiated by polyglutamine-expanded huntingtin or a short polyglutamine-product. Phosphorylation of selected candidate residues is reported to mediate polyglutamine-fragment degradation and toxicity. Here to support the discovery of phospho-sites involved in the life-cycle of (full-length) huntingtin, we employed mass spectrometry-based phosphoproteomics to systematically identify sites in purified huntingtin and in the endogenous protein, by proteomic and phospho-proteomic analyses of members of an HD neuronal progenitor cell panel. Our results bring total huntingtin phospho-sites to 95, with more located in the N-HEAT domain relative to numbers in the Bridge and C-HEAT domains. Moreover, phosphorylation of C-HEAT Ser2550 by cAMP-dependent protein kinase (PKA), the top hit in kinase activity screens, was found to hasten huntingtin degradation, such that levels of the catalytic subunit (PRKACA) were inversely related to huntingtin levels. Taken together these findings highlight categories of phospho-sites that merit further study and provide a phospho-site kinase pair (pSer2550-PKA) with which to investigate the biological processes that regulate huntingtin degradation and thereby influence the steady state levels of huntingtin in HD cells.

bioRxiv 2022-05-04 Preprint (No Snippets API) Bennett C, Jackson VE, Pettikiriarachchi A, Hayman T, Schaeper U, Moir-Meyer G, Fielding K, Ataide R, Clucas D, Baldi A, Garnham AL, Li-Wai-Suen CS, Alexander WS, Bahlo M, Burbury K, Ng AP, Pasricha S.
Show Full Abstract

Polycythemia Vera (PV) is a myeloproliferative neoplasm driven by activating mutations in JAK2 that result in unrestrained erythrocyte production, increasing patients’ hematocrit and hemoglobin concentration, placing them at risk of life-threatening thrombotic events. Our GWAS of 440 PV cases and 403,351 controls utilising UK Biobank data found that SNPs in HFE known to cause hemochromatosis are highly associated with PV diagnosis, linking iron regulation to PV. Analysis of the FinnGen dataset independently confirmed over-representation of homozygous HFE mutations in PV patients. HFE influences expression of hepcidin, the master regulator of systemic iron homeostasis. Through genetic dissection of PV mouse models, we show that the PV erythroid phenotype is directly linked to hepcidin expression: endogenous hepcidin upregulation alleviates erythroid disease whereas hepcidin ablation worsens it. Further, we demonstrate that in PV, hepcidin is not regulated by expanded erythropoiesis but is likely governed by inflammatory cytokines signalling via GP130 coupled receptors. These findings have important implications for understanding the pathophysiology of PV and offer new therapeutic strategies for this disease.

bioRxiv 2022-05-04 Preprint (No Snippets API) Layburn FE, Tan AYS, Mehrabi NF, Curtis MA, Tippett LJ, Riguet N, Aeschbach L, Lashuel HA, Dragunow M, Faull RLM, Singh-Bains MK.
Show Full Abstract

Huntington’s disease (HD) is caused by a CAG repeat expansion mutation in the gene encoding the huntingtin (Htt) protein, with mutant Htt protein subsequently forming aggregates within the brain. Mutant Htt is a current target for novel therapeutic strategies for HD, however, the lack of translation from preclinical research to disease-modifying treatments highlights the need to improve our understanding of the role of Htt protein in the human brain. This study aims to undertake a high-throughput screen of 12 candidate antibodies against various sequences along the Htt protein to characterize Htt distribution and expression in post-mortem human brain tissue microarrays (TMAs). Immunohistochemistry was performed on middle temporal gyrus TMAs comprising of up to 28 HD and 27 age-matched control cases, using 12 antibodies specific to various sequences along the Htt protein. From this study, six antibodies directed to the Htt N-terminus successfully immunolabelled human brain tissue. The Htt aggregates and Htt protein expression levels for the six successful antibodies were subsequently quantified with high-throughput analysis. Htt aggregates were detected in HD cases using antibodies MAB5374, MW1, and EPR5526, despite no change in overall Htt protein expression compared to control cases, suggesting a redistribution of Htt into aggregates in HD. Significant associations were found between the number of Htt aggregates and both age of disease onset, and CAG repeat length in HD. However, the number of Htt aggregates did not correlate with the degree of striatal degeneration or the degree of cortical neuron loss. Together, these results suggest that longer CAG repeat lengths correlate with Htt aggregation in the HD human brain, and Htt cortical aggregate deposition is associated with the onset of clinical symptoms. This study also reinforces that antibodies MAB5492, MW8, and 2B7 which have been utilized to characterize Htt in animal models of HD are not specific for Htt in human brain tissue, thereby highlighting the need for validated means of Htt detection to support drug development for HD.

Also flagged:Pyk2tauphosphorylationPTK2BAmyloid-β
Journal Article 2022-05-03 No Snippets Brody AH, Nies SH, Guan F, Smith LM, Mukherjee B, Salazar SA, Lee S, Lam TKT, Strittmatter SM.
Show Full Abstract

<h4>Background</h4>Genetic variation at the PTK2B locus encoding the protein Pyk2 influences Alzheimer's disease risk. Neurons express Pyk2 and the protein is required for Amyloid-β (Aβ) peptide driven deficits of synaptic function and memory in mouse models, but Pyk2 deletion has minimal effect on neuro-inflammation. Previous in vitro data suggested that Pyk2 activity might enhance GSK3β-dependent Tau phosphorylation and be required for tauopathy. Here, we examine the influence of Pyk2 on Tau phosphorylation and associated pathology.<h4>Methods</h4>The effect of Pyk2 on Tau phosphorylation was examined in cultured Hek cells through protein over-expression and in iPSC-derived human neurons through pharmacological Pyk2 inhibition. PS19 mice overexpressing the P301S mutant of human Tau were employed as an in vivo model of tauopathy. Phenotypes of PS19 mice with a targeted deletion of Pyk2 expression were compared with PS19 mice with intact Pyk2 expression. Phenotypes examined included Tau phosphorylation, Tau accumulation, synapse loss, gliosis, proteomic profiling and behavior.<h4>Results</h4>Over-expression experiments from Hek293T cells indicated that Pyk2 contributed to Tau phosphorylation, while iPSC-derived human neuronal cultures with endogenous protein levels supported the opposite conclusion. In vivo, multiple phenotypes of PS19 were exacerbated by Pyk2 deletion. In Pyk2-null PS19 mice, Tau phosphorylation and accumulation increased, mouse survival decreased, spatial memory was impaired and hippocampal C1q deposition increased relative to PS19 littermate controls. Proteomic profiles of Pyk2-null mouse brain revealed that several protein kinases known to interact with Tau are regulated by Pyk2. Endogenous Pyk2 suppresses LKB1 and p38 MAPK activity, validating one potential pathway contributing to increased Tau pathology.<h4>Conclusions</h4>The absence of Pyk2 results in greater mutant Tau-dependent phenotypes in PS19 mice, in part via increased LKB1 and MAPK activity. These data suggest that in AD, while Pyk2 activity mediates Aβ-driven deficits, Pyk2 suppresses Tau-related phenotypes.

Also flagged:irritable bowel syndromeIBSdiarrheaconstipationDNaseTRPV1
Journal Article 2022-05-03 ✓ 1 Snippet Camilleri M, Magnus Y, Carlson P, Wang XJ, Chedid V, Maselli D, Taylor A, McKinzie S, Kengunte Nagaraj N, Busciglio I, Nair A.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Altered mucosal functions are documented in jejunal or colorectal mucosa from patients with irritable bowel syndrome (IBS). Our aim was to quantify ileal, ascending, and rectosigmoid colon mucosal expression of genes in IBS-diarrhea (D) and IBS-constipation (C). Forty-four patients with IBS-D, 30 with IBS-C, and 30 healthy volunteers underwent colonoscopic ileal, ascending, and rectosigmoid colon biopsies. Biopsies were stored in RNA<sub>later</sub> at -80 °C, purified with on-column DNase, cDNA libraries prepared from 100-200 ng of total RNA, sequenced on Illumina NovaSeq 6000, and analyzed on Illumina's RTA version 3.4.4. Normalized mRNA expression was obtained using MAP-RSeq bioinformatics pipeline. Differential expressions in the groups (Log2-fold change) were measured using the bioinformatics package edgeR 2.6.2, corrected for false discovery rate (<i>P</i><sub>ADJ</sub> <0.05). There were 30 females with IBS-C and 31 females and 13 males with IBS-D. In IBS-D and IBS-C groups, there were differential expressions of 181 genes in ascending colon and 199 genes in rectosigmoid colon. The majority were gene upregulations in IBS-D with functions reflecting activation of inflammation genes, TRPV1 (visceral hypersensitivity) and neurotransmitters/receptors (specifically purinergic, GABA, and cannabinoid). Although gene differential expressions in the ascending and rectosigmoid colon mucosa of the two groups were different, the diverse upregulated genes involved immune functions, receptors, transmitters, ion channels, and transporters. Conversely, there was reduced expression of PI15 and PI16 genes that inhibit proteases. In patients with IBS-D and IBS-C, differential expressions of genes related to immune, transmitter, nociceptive, protease inhibition, channel, and transporter functions suggest opportunities to reverse the pathobiology and treat patients with IBS.<b>NEW & NOTEWORTHY</b> This study compares gene expression in mucosa of the terminal ileum, right colon, and left colon in patients with diarrhea- or constipation-predominant irritable bowel syndrome (IBS) and contrasts expression between these two disease entities and also between each entity and mucosa from healthy controls. The study shows there is differential expression of genes related to immune, transmitter, nociceptive, ion channel, and transporter functions, as well as reduced serine protease inhibition, in patients with IBS.

Also flagged:PolyQ) diseasesneurodegenerative disordersPolyQ diseasespathogenesistranslationalneurodegenerative disease
Journal Article 2022-05-03 No Snippets Costa MD, Maciel P, Maciel P.
Show Full Abstract

Polyglutamine (PolyQ) diseases include a group of inherited neurodegenerative disorders caused by unstable expansions of CAG trinucleotide repeats in the coding region of specific genes. Such genetic alterations produce abnormal proteins containing an unusually long PolyQ tract that renders them more prone to aggregate and cause toxicity. Although research in the field in the last years has contributed significantly to the knowledge of the biological mechanisms implicated in these diseases, effective treatments are still lacking. In this review, we revisit work performed in models of PolyQ diseases, namely the yeast Saccharomyces cerevisiae, the nematode worm Caenorhabditis elegans and the fruit fly Drosophila melanogaster, and provide a critical overview of the high-throughput unbiased genetic screens that have been performed using these systems to identify novel genetic modifiers of PolyQ diseases. These approaches have revealed a wide variety of cellular processes that modulate the toxicity and aggregation of mutant PolyQ proteins, reflecting the complexity of these disorders and demonstrating how challenging the development of therapeutic strategies can be. In addition to the unbiased large-scale genetic screenings in non-vertebrate models, complementary studies in mammalian systems, closer to humans, have contributed with novel genetic modifiers of PolyQ diseases, revealing neuronal function and inflammation as key disease modulators. A pathway enrichment analysis, using the human orthologues of genetic modifiers of PolyQ diseases clustered modifier genes into major themes translatable to the human disease context, such as protein folding and transport as well as transcription regulation. Innovative genetic strategies of genetic manipulation, together with significant advances in genomics and bioinformatics, are taking modifier genetic studies to more realistic disease contexts. The characterization of PolyQ disease modifier pathways is of extreme relevance to reveal novel therapeutic possibilities to delay disease onset and progression in patients.

Also flagged:agingmitochondrialovarian failureinfertilitymitochondriaalginate
Journal Article 2022-05-03 ✓ 1 Snippet Zhang Q, Liu C, Yu L, Wang X, Hao J.
In-Text Gene Mentions

…group, mt-Nd1, Immp2l,Mrpl39, mt-Ti, Mrpl45, Slc25a29,…

Show Full Abstract

Aging causes a decline in ovarian function and may contribute to ovarian failure and infertility. We investigated the effect of menstrual blood-derived mesenchymal stem cells (MenSCs) and their mitochondria on ovarian function in aged mice. We performed two treatment protocols: i) ovaries of recipient aged mice were treated <i>in vivo</i> with MenSCs 3D alginate gel; ii) ovaries were injected with mitochondria suspension and then incubated with mitochondrial 3D gel. Seven days after treatment, ovaries were harvested for histological assessment by HE staining and transcriptomic analysis by RNA-seq. Our data showed that after incubation with stem cell 3D gel, the MenSCs could be detected in the recipient mouse ovary. HE staining showed that the follicular state of aging ovary improved with both treatments. RNA-seq analysis showed that mitochondrial pathway-related genes were upregulated and significantly enriched in the ovaries treated by MenSCs or their mitochondria. Conclusions: Treatment with MenSCs or their mitochondria can enhance the expression of mitochondrial pathway-related genes and promote the recovery of ovarian function in aged mice.

Also flagged:Protocadherin-10Synapseautism spectrum disorderobsessive-compulsive disordermajor depressionMD
Journal Article 2022-05-03 No Snippets Hoshina N, Johnson-Venkatesh EM, Rally VR, Sant J, Hoshina M, Seiglie MP, Umemori H.
Show Full Abstract

The <i>Protocadherin-10</i> (<i>PCDH10</i>) gene is associated with autism spectrum disorder (ASD), obsessive-compulsive disorder (OCD), and major depression (MD). The PCDH10 protein is a homophilic cell adhesion molecule that belongs to the δ2-protocadherin family. PCDH10 is highly expressed in the developing brain, especially in the basolateral nucleus of the amygdala (BLA). However, the role of PCDH10 <i>in vivo</i> has been debatable: one paper reported that a <i>Pcdh10</i> mutant mouse line showed changes in axonal projections; however, another <i>Pcdh10</i> mutant mouse line was reported to have failed to detect axonal phenotypes. Therefore, the actual roles of PCDH10 in the brain remain to be elucidated. We established a new <i>Pcdh10</i> KO mouse line using the CRISPR/Cas9 system, without inserting gene cassettes to avoid nonspecific effects, examined the roles of PCDH10 in the brain, and studied the behavioral consequences of <i>Pcdh10</i> inactivation. Here, we show that <i>Pcdh10</i> KO mice do not show defects in axonal development. Instead, we find that <i>Pcdh10</i> KO mice exhibit impaired development of excitatory synapses in the dorsal BLA. We further demonstrate that male <i>Pcdh10</i> KO mice exhibit reduced anxiety-related behaviors, impaired fear conditioning, decreased stress-coping responses, and mildly impaired social recognition and communication. These results indicate that PCDH10 plays a critical role in excitatory synapse development, but not axon development, in the dorsal BLA and that PCDH10 regulates anxiety-related, fear-related, and stress-related behaviors. Our results reveal the roles of PCDH10 in the brain and its relationship to relevant psychiatric disorders such as ASD, OCD, and MD.<b>SIGNIFICANCE STATEMENT</b><i>Protocadherin-10</i> (<i>PCDH10</i>) encodes a cell adhesion molecule and is implicated in autism spectrum disorder (ASD), obsessive-compulsive disorder (OCD), and major depression (MD). PCDH10 is highly expressed in the basolateral nucleus of the amygdala (BLA). However, the phenotypes of previously published <i>Pcdh10</i> mutant mice are debatable, and some are possibly because of the nonspecific effects of the <i>LacZ/Neo</i> cassette inserted in the mice. We have generated a new <i>Pcdh10</i> mutant mouse line without the <i>LacZ/Neo</i> cassette. Using our new mouse line, we reveal the roles of PCDH10 for excitatory synapse development in the BLA. The mutant mice exhibit anxiety-related, fear-related, and stress-related behaviors, which are relevant to ASD, OCD, and MD, suggesting a possible treatment strategy for such psychiatric disorders.

Also flagged:diabetes mellituspathogenesisgene expressionCNOT6AXIN1STAT3
Journal Article 2022-05-03 No Snippets Zhao W, Meng X, Liang J.
Show Full Abstract

To study the pathogenesis of diabetes mellitus (DM) and identify new biomarkers, high-throughput RNA sequencing provides a technical means to explore the regulatory network of MD gene expression. To better elucidate the genetic basis of DM, we analysed the circRNA and mRNA expression profiles in serum samples from diabetic patients. The circRNAs and mRNAs with abnormal expression in the DM group and non-diabetic group (NDM) were classified by RNA sequencing and differential expression analysis. The circRNA-miRNA-mRNA regulatory network reveals the mechanism by which competitive endogenous RNAs (ceRNAs) regulate gene expression. The biological functions and interactions of circRNA and mRNA were analysed by gene ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Differential expression analysis showed that 441 circRNAs (366 up-regulated, 75 down-regulated) and 683 mRNAs (354 up-regulated, 329 down-regulated) were significantly differentially expressed in the DM group compared with the NDM group. Screening of the differential genes at the nodes of the interaction network showed that a single circRNA could interact with multiple miRNAs and then jointly regulate more mRNAs. In addition, the expressions of circRNA CNOT6 and AXIN1 as well as mRNA STAT3, MYD88, and B2M were associated with the progression of diabetes. Enrichment pathway analysis indicated that differentially expressed circRNA and mRNA may participate in Nod-like receptor signalling pathway, insulin signalling pathway, sphinolipid metabolism pathway, and ribosome pathway, and play a role in the pathogenesis of diabetes. This study provides a theoretical basis for elucidating the molecular mechanism of DM occurrence and development at circRNA and mRNA levels.

Also flagged:Synthesiscalciumpyrophosphatecalcium pyrophosphateCalcium phosphatesmetals
Journal Article 2022-05-03 No Snippets Griesiute D, Garskaite E, Antuzevics A, Klimavicius V, Balevicius V, Zarkov A, Katelnikovas A, Sandberg D, Kareiva A.
Show Full Abstract

In the present work, three different Mn<sup>2+</sup>-doped calcium pyrophosphate (CPP, Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub>) polymorphs were synthesized by wet co-precipitation method followed by annealing at different temperatures. The crystal structure and purity were studied by powder X-ray diffraction (XRD), Fourier-transform infrared (FTIR), solid-state nuclear magnetic resonance (SS-NMR), and electron paramagnetic resonance (EPR) spectroscopies. Scanning electron microscopy (SEM) was used to investigate the morphological features of the synthesized products. Optical properties were investigated using photoluminescence measurements. Excitation spectra, emission spectra, and photoluminescence decay curves of the samples were studied. All Mn-doped polymorphs exhibited a broadband emission ranging from approximately 500 to 730 nm. The emission maximum was host-dependent and centered at around 580, 570, and 595 nm for γ-, β-, and α-CPP, respectively.

Also flagged:enhancer of Zeste Homolog 2EZH2myelodysplastic syndromesTET2ASXL1RUNX1
Journal Article 2022-05-03 ✓ 1 Snippet Sakhdari A, Class C, Montalban-Bravo G, Sasaki K, Bueso-Ramos CE, Patel KP, Routbort MJ, Loghavi S, Ok CY, Quesada A, Khoury JD, Konoplev SN, Kantarjian HP, Garcia-Manero G, Medeiros LJ, Kanagal-Shamanna R.
In-Text Gene Mentions

chromatin modifier

Show Full Abstract

EZH2 coding mutation (EZH2<sup>MUT</sup>), resulting in loss-of-function, is an independent predictor of overall survival in MDS. EZH2 function can be altered by other mechanisms including copy number changes, and mutations in other genes and non-coding regions of EZH2. Assessment of EZH2 protein can identify alterations of EZH2 function missed by mutation assessment alone. Precise evaluation of EZH2 function and gene-protein correlation in clinical MDS cohorts is important in the context of upcoming targeted therapies aimed to restore EZH2 function. In this study, we evaluated the clinicopathologic characteristics of newly diagnosed MDS patients with EZH2<sup>MUT</sup> and correlated the findings with protein expression using immunohistochemistry. There were 40 (~6%) EZH2<sup>MUT</sup> MDS [33 men, seven women; median age 74 years (range, 55-90)]. EZH2 mutations spanned the entire coding region. Majority had dominant EZH2 clone [median VAF, 30% (1-92)], frequently co-occurring with co-dominant TET2 (38%) and sub-clonal ASXL1 (55%) and RUNX1 (43%) mutations. EZH2<sup>MUT</sup> MDS showed frequent loss-of-expression compared to EZH2<sup>WT</sup> (69% vs. 27%, p = 0.001). Interestingly, NINE (23%) EZH2<sup>WT</sup> MDS also showed loss-of-expression. EZH2<sup>MUT</sup> and loss-of-expression significantly associated with male predominance and chr(7) loss. Further, only EZH2 loss-of-expression patients showed significantly lower platelet counts, a trend for higher BM blast% and R-IPSS scores. Over a 14-month median follow-up, both EZH2<sup>MUT</sup> (p = 0.027) and loss-of-expression (p = 0.0063) correlated with poor survival, independent of R-IPSS, age and gender. When analyzed together, loss-of-expression showed a stronger correlation than mutation (p = 0.061 vs. p = 0.43). In conclusion, immunohistochemical assessment of EZH2 protein, alongside mutation, is important for prognostic workup of MDS.

Also flagged:deathextracellularheart failuremembranebenign tumoursAnti-phospholipid syndrome
Journal Article 2022-05-03 No Snippets Najafi-Ghalehlou N, Feizkhah A, Mobayen M, Pourmohammadi-Bejarpasi Z, Shekarchi S, Roushandeh AM, Roudkenar MH.
Show Full Abstract

Major breakthroughs and disruptive methods in disease treatment today owe their thanks to our inch by inch developing conception of the infinitive aspects of medicine since the very beginning, among which, the role of the regenerative medicine can on no account be denied, a branch of medicine dedicated to either repairing or replacing the injured or diseased cells, organs, and tissues. A novel means to accomplish such a quest is what is being called "medical biowaste", a large assortment of biological samples produced during a surgery session or as a result of physiological conditions and biological activities. The current paper accentuating several of a number of promising sources of biowaste together with their plausible applications in routine clinical practices and the confronting challenges aims at inspiring research on the existing gap between clinical and basic science to further extend our knowledge and understanding concerning the potential applications of medical biowaste.

Also flagged:TNF-αSATB2autophagyserotonindopamine receptortumor necrosis factor-α
Journal Article 2022-05-03 ✓ 1 Snippet Zhang S, He W, Li A, Zhao C, Chen Y, Xu C, Zhang Q, Zheng D, Chen M, Miao H, Huang Y.
In-Text Gene Mentions

…TNFRSF11A, LEP andHTT(Fig. 1 A),…

Show Full Abstract

<h4>Background</h4>Risperidone, an atypical antipsychotic, impedes serotonin and dopamine receptor systems. Meanwhile, tumor necrosis factor-α (TNF-α) is known to participate in regulating osteoblast functions. Consequently, the current study aimed to investigate whether the influences of Risperidone on osteoblast functions are associated with TNF-α and special AT-rich sequence-binding protein (SATB2).<h4>Methods</h4>Firstly, we searched the DGIdb, MEM and GeneCards databases to identify the critical factors involved in the effects of Risperidone on osteoblasts, as well as their interactions. Afterwards, osteoblast cell line MC3T3-E1 was transduced with lentivirus carrying si-TNF-α, si-SATB2 or both and subsequently treated with Risperidone. Various abilities including differentiation, autophagy and apoptosis of osteoblasts were examined after different treatments. Finally, animal experiments were performed with Risperidone alone or together with lentivirus to verify the function of Risperidone in vivo and the mechanism.<h4>Results</h4>It was found that Risperidone might promote TNF-α expression, thereby inhibiting the expression of SATB2 to affect the autophagy and apoptosis in osteoblasts. Furthermore, as shown by our experimental findings, Risperidone treatment inhibited the differentiation and autophagy, and promoted the apoptosis of osteoblasts, as evidenced by elevated levels of OPG, p62, cleaved PARP1, cleaved caspase-3, cleaved caspase-8, and cleaved caspase-9, and reduced levels of LC3 II/I, Beclin1, collagen I, and RANKL. In addition, Risperidone was also found to elevate the expression of TNF-α to down-regulate SATB2, thereby inhibiting the differentiation and autophagy and enhancing the apoptosis of osteoblasts in vitro and in vivo.<h4>Conclusions</h4>Collectively, our findings indicated that Risperidone affects the differentiation of osteoblasts by inhibiting autophagy and enhancing apoptosis via TNF-α-mediated down-regulation of SATB2.

Also flagged:Ironoxygensynthesisiron deficiencyiron overloadmetabolism
Journal Article 2022-05-03 ✓ 1 Snippet Taeubert MJ, de Prado-Bert P, Geurtsen ML, Mancano G, Vermeulen MJ, Reiss IKM, Caramaschi D, Sunyer J, Sharp GC, Julvez J, Muckenthaler MU, Felix JF.
In-Text Gene Mentions

…commonly caused byhemochromatosis[ 5 ].…

Show Full Abstract

<h4>Background</h4>Unbalanced iron homeostasis in pregnancy is associated with an increased risk of adverse birth and childhood health outcomes. DNA methylation has been suggested as a potential underlying mechanism linking environmental exposures such as micronutrient status during pregnancy with offspring health. We performed a meta-analysis on the association of maternal early-pregnancy serum ferritin concentrations, as a marker of body iron stores, and cord blood DNA methylation. We included 1286 mother-newborn pairs from two population-based prospective cohorts. Serum ferritin concentrations were measured in early pregnancy. DNA methylation was measured with the Infinium HumanMethylation450 BeadChip (Illumina). We examined epigenome-wide associations of maternal early-pregnancy serum ferritin and cord blood DNA methylation using robust linear regression analyses, with adjustment for confounders and performed fixed-effects meta-analyses. We additionally examined whether associations of any CpGs identified in cord blood persisted in the peripheral blood of older children and explored associations with other markers of maternal iron status. We also examined whether similar findings were present in the association of cord blood serum ferritin concentrations with cord blood DNA methylation.<h4>Results</h4>Maternal early-pregnancy serum ferritin concentrations were inversely associated with DNA methylation at two CpGs (cg02806645 and cg06322988) in PRR23A and one CpG (cg04468817) in PRSS22. Associations at two of these CpG sites persisted at each of the follow-up time points in childhood. Cord blood serum ferritin concentrations were not associated with cord blood DNA methylation levels at the three identified CpGs.<h4>Conclusion</h4>Maternal early-pregnancy serum ferritin concentrations were associated with lower cord blood DNA methylation levels at three CpGs and these associations partly persisted in older children. Further studies are needed to uncover the role of these CpGs in the underlying mechanisms of the associations of maternal iron status and offspring health outcomes.

Also flagged:gonadotropin releasing hormoneGnRH-IGnRH-IIIGnRH receptorscancertumor
Journal Article 2022-05-03 No Snippets Schuster S, Juhász É, Halmos G, Neundorf I, Gennari C, Mező G.
Show Full Abstract

The human gonadotropin releasing hormone (GnRH-I) and its sea lamprey analogue GnRH-III specifically bind to GnRH receptors on cancer cells and can be used as targeting moieties for targeted tumor therapy. Considering that the selective release of drugs in cancer cells is of high relevance, we were encouraged to develop cleavable, self-immolative GnRH-III-drug conjugates which consist of a <i>p</i>-aminobenzyloxycarbonlyl (PABC) spacer between a cathepsin B-cleavable dipeptide (Val-Ala, Val-Cit) and the classical anticancer drugs daunorubicin (Dau) and paclitaxel (PTX). Alongside these compounds, non-cleavable GnRH-III-drug conjugates were also synthesized, and all compounds were analyzed for their antiproliferative activity. The cleavable GnRH-III bioconjugates revealed a growth inhibitory effect on GnRH receptor-expressing A2780 ovarian cancer cells, while their activity was reduced on Panc-1 pancreatic cancer cells exhibiting a lower GnRH receptor level. Moreover, the antiproliferative activity of the non-cleavable counterparts was strongly reduced. Additionally, the efficient cleavage of the Val-Ala linker and the subsequent release of the drugs could be verified by lysosomal degradation studies, while radioligand binding studies ensured that the GnRH-III-drug conjugates bound to the GnRH receptor with high affinity. Our results underline the high value of GnRH-III-based homing devices and the application of cathepsin B-cleavable linker systems for the development of small molecule drug conjugates (SMDCs).

Also flagged:Glycofullerene Oligomerssynthesisfullereneglycofullerenecoppermannose
Journal Article 2022-05-03 No Snippets Ramos-Soriano J, Illescas BM, Pérez-Sánchez A, Sánchez-Bento R, Lasala F, Rojo J, Delgado R, Martín N.
Show Full Abstract

The synthesis of new biocompatible antiviral materials to fight against the development of multidrug resistance is being widely explored. Due to their unique globular structure and excellent properties, [60]fullerene-based antivirals are very promising bioconjugates. In this work, fullerene derivatives with different topologies and number of glycofullerene units were synthesized by using a SPAAC copper free strategy. This procedure allowed the synthesis of compounds <b>1</b>-<b>3</b>, containing from 20 to 40 mannose units, in a very efficient manner and in short reaction times under MW irradiation. The glycoderivatives were studied in an infection assay by a pseudotyped viral particle with Ebola virus GP1. The results obtained show that these glycofullerene oligomers are efficient inhibitors of EBOV infection with IC<sub>50</sub>s in the nanomolar range. In particular, compound <b>3</b>, with four glycofullerene moieties, presents an outstanding relative inhibitory potency (RIP). We propose that this high RIP value stems from the appropriate topological features that efficiently interact with DC-SIGN.

Also flagged:GPCRG Protein
Journal Article 2022-05-03 No Snippets Berchiche YA, Hébert TE.
Show Full Abstract

No abstract available.

Also flagged:coagulationtissue factorTFFFXFXI
Journal Article 2022-05-03 ✓ 5 Snippets Grover SP, Mackman N.
In-Text Gene Mentions

Based on these studies, a SERPINC1 targeting short interfering RNA is currently being evaluated in patients with hemophilia A and B (82).

SERPINC1 gene silencing in FVIII deficient mice supported increased platelet and fibrin accumulation at sites of vascular injury in a cremaster arteriole laser injury model of thrombosis (80).

…encoded by theSERPINC1gene.…

…mutations in theSERPINC1gene have been…

…Mutations in theSERPINC1gene can lead…

Show Full Abstract

Appropriate activation of coagulation requires a balance between procoagulant and anticoagulant proteins in blood. Loss in this balance leads to hemorrhage and thrombosis. A number of endogenous anticoagulant proteins, such as antithrombin and heparin cofactor II, are members of the serine protease inhibitor (SERPIN) family. These SERPIN anticoagulants function by forming irreversible inhibitory complexes with target coagulation proteases. Mutations in SERPIN family members, such as antithrombin, can cause hereditary thrombophilias. In addition, low plasma levels of SERPINs have been associated with an increased risk of thrombosis. Here, we review the biological activities of the different anticoagulant SERPINs. We further consider the clinical consequences of SERPIN deficiencies and insights gained from preclinical disease models. Finally, we discuss the potential utility of engineered SERPINs as novel therapies for the treatment of thrombotic pathologies.

Also flagged:Gastric cancercancerdeathIntestinal-type gastric canceratrophic gastritisAG
Journal Article 2022-05-03 No Snippets Yu C, Wang J.
Show Full Abstract

Gastric cancer is a daunting disease with a tragic impact on global health. It is the fourth most common cancer and has become the second most frequent cause of cancer death in recent times. According to the Lauren classification, gastric cancer can be classified into two types: intestinal and diffuse. Intestinal-type gastric cancer (IGC) is more common in elderly people, and atrophic gastritis (AG) and intestinal metaplasia (IM) have been proven to be the main premalignant causes of intestinal-type gastric cancer. In turn, <i>Helicobacter pylori</i> infection has been identified as the most significant cause of AG and IM. In this study, we determine the mechanism of IGC progression and how <i>H. pylori</i> infection induces IGC. Through researching the relevant literature, we identified the key genes associated with gastric cancer and the specific genes associated with IGC. We then use hese genes to build up a gene regulatory network for IGC. Based on this gene regulatory network, we quantify the IGC landscape. Within this landscape, there are three stable states, which are classified as the normal, AG, and gastric cancer states. Through landscape topography, we can determine the biological features and progression process of IGC. To investigate the influence of <i>H. pylori</i> infection on IGC, we simulated different degrees of <i>H. pylori</i> infection. As the <i>H. pylori</i> infection becomes more serious, the landscape topography changes accordingly. A fourth state, named the intestinal metaplasia (IM) state, emerges on the landscape and is associated with a very high risk of developing gastric cancer. The emergence of this state is due to the interactions/regulations among genes. Through variations in the landscape topography, we can determine the influence of <i>H. pylori</i> infection on IGC. Finally, we use global sensitivity analysis to research the regulations most sensitive to IGC prevention or therapies. This study presents a new approach and a novel model with which to explore the mechanism of IGC. The simulations of different degrees of <i>H. pylori</i> infection can provide us with a systematic view of IGC progression. The key regulations found can give us some insight and guidance for clinical trials and experimental studies.

Also flagged:Repeat diseasesfragile X syndromemyotonic dystrophyFriedreich ataxiaHuntington diseasespinocerebellar ataxias
Journal Article 2022-05-03 ✓ 2 Snippets Barbé L, Finkbeiner S.
In-Text Gene Mentions

ASD is predominantly a polygenic disorder, although some cases have been linked to mutations in the FMR1 gene, which is expanded in FXS (McCary and Roberts, 2013), and others to repeat expansions in DMPK, FXN, and HTT, which cause DM1, FRDA, and HD, respectively (Piras et al., 2020; Trost et al., 2020).

However, tissue-specific methylation differences between HD patients and controls have been found in the cortex, where differential methylation is found at a CTCF binding site in the HTT proximal promoter and increased DNA methylation is associated with earlier age of disease onset (De Souza et al., 2016; Lu et al., 2020).

Show Full Abstract

Repeat diseases, such as fragile X syndrome, myotonic dystrophy, Friedreich ataxia, Huntington disease, spinocerebellar ataxias, and some forms of amyotrophic lateral sclerosis, are caused by repetitive DNA sequences that are expanded in affected individuals. The age at which an individual begins to experience symptoms, and the severity of disease, are partially determined by the size of the repeat. However, the epigenetic state of the area in and around the repeat also plays an important role in determining the age of disease onset and the rate of disease progression. Many repeat diseases share a common epigenetic pattern of increased methylation at CpG islands near the repeat region. CpG islands are CG-rich sequences that are tightly regulated by methylation and are often found at gene enhancer or insulator elements in the genome. Methylation of CpG islands can inhibit binding of the transcriptional regulator CTCF, resulting in a closed chromatin state and gene down regulation. The downregulation of these genes leads to some disease-specific symptoms. Additionally, a genetic and epigenetic interplay is suggested by an effect of methylation on repeat instability, a hallmark of large repeat expansions that leads to increasing disease severity in successive generations. In this review, we will discuss the common epigenetic patterns shared across repeat diseases, how the genetics and epigenetics interact, and how this could be involved in disease manifestation. We also discuss the currently available stem cell and mouse models, which frequently do not recapitulate epigenetic patterns observed in human disease, and propose alternative strategies to study the role of epigenetics in repeat diseases.

Also flagged:GlioblastomaGPR56G protein-coupled receptor 56ADGRG1GPCRbrain development
Journal Article 2022-05-03 No Snippets Ganesh RA, Sonpatki P, Naik D, John AE, Sathe G, Lakshmikantha A, Chandrachari KP, Bauer L, Knäuper V, Aeschlimann D, Venkatraaman K, Shah N, Sirdeshmukh R.
Show Full Abstract

G protein-coupled receptor 56 (GPR56/ADGRG1) is an adhesion GPCR with an essential role in brain development and cancer. Elevated expression of GPR56 was observed in the clinical specimens of Glioblastoma (GBM), a highly invasive primary brain tumor. However, we found the expression to be variable across the specimens, presumably due to the intratumor heterogeneity of GBM. Therefore, we re-examined GPR56 expression in public domain spatial gene expression data and single-cell expression data for GBM, which revealed that GPR56 expression was high in cellular tumors, infiltrating tumor cells, and proliferating cells, low in microvascular proliferation and peri-necrotic areas of the tumor, especially in hypoxic mesenchymal-like cells. To gain a better understanding of the consequences of GPR56 downregulation in tumor cells and other molecular changes associated with it, we generated a sh-RNA-mediated GPR56 knockdown in the GBM cell line U373 and performed transcriptomics, proteomics, and phospho-proteomics analysis. Our analysis revealed enrichment of gene signatures, pathways, and phosphorylation of proteins potentially associated with mesenchymal (MES) transition in the tumor and concurrent increase in cell invasion and migration behavior of the GPR56 knockdown GBM cells. Interestingly, our analysis also showed elevated expression of Transglutaminase 2 (TG2) - a known interactor of GPR56, in the knockdown cells. The inverse expression of GPR56 and TG2 was also observed in intratumoral, spatial gene expression data for GBM and in GBM cell lines cultured <i>in vitro</i> under hypoxic conditions. Integrating all these observations, we propose a putative functional link between the inverse expression of the two proteins, the hypoxic niche and the mesenchymal status in the tumor. Hypoxia-induced downregulation of GPR56 and activation of TG2 may result in a network of molecular events that contribute to the mesenchymal transition of GBM cells, and we propose a putative model to explain this functional and regulatory relationship of the two proteins.

Also flagged:hydroxycarbonatehydroxyapatitedegradationmineralsmineral
Journal Article 2022-05-03 No Snippets Schweitzer MH, Zheng W, Equall N.
Show Full Abstract

The exceptional preservation of feathers in the fossil record has led to a better understanding of both phylogeny and evolution. Here we address factors that may have contributed to the preservation of feathers in ancient organisms using experimental taphonomy. We show that the atmospheres of the Mesozoic, known to be elevated in both CO<sub>2</sub> and with temperatures above present levels, may have contributed to the preservation of these soft tissues by facilitating rapid precipitation of hydroxy- or carbonate hydroxyapatite, thus outpacing natural degradative processes. Data also support that that microbial degradation was enhanced in elevated CO<sub>2</sub>, but mineral deposition was also enhanced, contributing to preservation by stabilizing the organic components of feathers.

Also flagged:codeineopiateacetaminophenDeathMetabolismMorphine
Journal Article 2022-05-03 ✓ 1 Snippet Tagwerker C, Carias-Marines MJ, Smith DJ.
In-Text Gene Mentions

…variant of the5-HTTgene-linked polymorphic region…

Show Full Abstract

<h4>Background</h4>The availability of pharmacogenomic (PGx) methods to determine the right drug and dosage for individualized patient treatment has increased over the past decade. Adoption of the resulting PGx reports in a clinical setting and monitoring of clinical outcomes is a challenging and long-term commitment.<h4>Objective</h4>This study summarizes an extended PGx deep sequencing panel intended for medication dosing and prescription guidance newly adopted in a pain management clinic. The primary outcome of this retrospective study reports the number of cases and types of drugs covered, for which PGx data appears to have assisted in optimal drug prescription and dosing.<h4>Methods</h4>A PGx panel is described, encompassing 23 genes and 141 single-nucleotide polymorphisms or indels, combined with PGx dosing guidance and drug-gene interaction (DGI) and drug-drug interaction (DDI) reporting to prevent adverse drug reactions (ADRs). During a 2-year period, patients (N=171) were monitored in a pain management clinic. Urine toxicology, PGx reports, and progress notes were studied retrospectively for changes in prescription regimens before and after the PGx report was made available to the provider. An additional algorithm provided DGIs and DDIs to prevent ADRs.<h4>Results</h4>Among patient PGx reports with medication lists provided (n=146), 57.5% (n=84) showed one or more moderate and 5.5% (n=8) at least one serious PGx interaction. A total of 96 (65.8%) patients showed at least one moderate and 15.1% (n=22) one or more serious DGIs or DDIs. A significant number of active changes in prescriptions based on the 102 PGx/DGI/DDI report results provided was observed for 85 (83.3%) patients for which a specific drug was either discontinued or switched within the defined drug classes of the report, or a new drug was added.<h4>Conclusions</h4>Preventative action was observed for all serious interactions, and only moderate interactions were tolerated for the lack of other alternatives. This study demonstrates the application of an extended PGx panel combined with a customized informational report to prevent ADRs and improve patient care.

Research Square 2022-05-03 Preprint (No Snippets API) Krach F, Stemick J, Boerstler T, Weiss A, Lingos I, Meixner H, Plötz S, Farrell M, Hehr U, Kohl Z, Winner B, Winkler J.
Show Full Abstract

<title>Abstract</title> <p>Huntington's disease (HD) is a neurodegenerative disorder caused by poly-Q expansion in the Huntingtin (HTT) protein. Here, we delineate elevated mutant HTT (mHTT) levels in patient-derived cells including fibroblasts and iPSC derived cortical neurons using a GLP approved HTT assay. HD patients’ fibroblasts and cortical neurons recapitulate aberrant alternative splicing as a molecular fingerprint of HD. Branaplam is a splicing modulator currently tested in a phase II study in HD (NCT05111249). The drug lowers total HTT (tHTT) and mHTT levels in fibroblasts, iPSC, cortical progenitors, and neurons in a dose dependent manner at an IC<sub>50</sub> consistently below 10nm without inducing cellular toxicity. Branaplam promotes inclusion of non-annotated novel exons. Amongst, a 115bp frameshift-inducing exon in the HTT transcript in Branaplam treated cells from Ctrl and HD patients leading to a profound reduction of HTT RNA and protein levels. Importantly, Branaplam ameliorates aberrant alternative splicing in HD patients’ fibroblasts and cortical neurons. These findings highlight the applicability of splicing modulators in the treatment of CAG repeat disorders and decipher their molecular effects associated with the pharmacokinetic and -dynamic properties in patient-derived cellular models.</p>

Also flagged:Periodontitischronic inflammatory diseaseperi-implantitischronic periodontitisgingivitiscalculus
Journal Article 2022-05-02 ✓ 3 Snippets Zhao Z, Wang H, Li X, Hou J, Yang Y, Li H.
In-Text Gene Mentions

In addition, the results showed that the hypo-methylation genes were mainly enriched in the pathways of: cancer pathway; cGMP–PKG signaling pathway; RAF/MAP kinase; PI3K–Akt signaling pathway; neuroactive ligand–receptor interaction; stem cells pluripotency, etc., while hyper-methylation genes were mainly enriched in the pathways of: bacterial invasion of epithelial cells; sphingolipid signaling pathway and DCC mediated attractive signaling (Fig. 3, Table 4, and Additional file 3).

…signaling pathway andDCCmediated attractive signaling…

…signaling pathway andDCCmediated attractive signaling.…

Show Full Abstract

<h4>Background</h4>Periodontitis is an infectious disease, and a risk factor for peri-implantitis that could result in the implant loss. DNA methylation has an essential role in the etiology and pathogenesis of inflammatory disease. However, there is lack of study on methylation status of genes in periodontitis. This study sought to explore the gene methylation profiling microarray in periodontitis.<h4>Methods</h4>Through searching in the Gene Expression Omnibus database, a gene methylation profiling data set GSE173081 was identified, which included 12 periodontitis samples and 12 normal samples, respectively. Thereafter, the data of GSE173081 was downloaded and analyzed to determined differentially methylated genes (DMGs), which then were used to perform Gene Ontology analysis and pathway enrichment analyses through online database. In addition, the DMGs were applied to construct the protein-protein interaction (PPI) network information, predict the hub genes in pathology of periodontitis.<h4>Results</h4>In total 668 DMGs were sorted and identified from the data set, which included 621 hypo-methylated genes and 47 hyper-methylated genes. Through the function and ontology analysis, these 668 genes are mainly classified into intracellular signaling pathway, cell components, cell-cell interaction, and cellular behaviors. The pathway analysis showed that the hypo-methylated genes were mostly enriched in the pathway of cGMP-PKG signaling pathway; RAF/MAP kinase; PI3K-Akt signaling pathway, while hyper-methylated genes were mostly enriched in the pathway of bacterial invasion of epithelial cells; sphingolipid signaling pathway and DCC mediated attractive signaling. The PPI network contained 630 nodes and 1790 interactions. Moreover, further analysis identified top 10 hub genes (APP; PAX6; LPAR1; WNT3A; BMP2; PI3KR2; GATA4; PLCB1; GATA6; CXCL12) as central nodes that are involved in the immune system and the inflammatory response.<h4>Conclusions</h4>This study provides comprehensive information of methylation status of genes to the revelation of periodontitis pathogenesis that may contribute to future research on periodontitis.

Also flagged:FBXW2prostate cancerEGFRdegradationF-box proteintumor
Journal Article 2022-05-02 No Snippets Zhou T, Chen T, Lai B, Zhang W, Luo X, Xia D, Fu W, Xu J.
Show Full Abstract

FBXW2 is a poorly characterized F-box protein, as a tumor suppressor that inhibits growth and metastasis of lung cancer by promoting ubiquitylation and degradation of oncogenic proteins, including SKP2 and β-catenin. However, what the biological functions of FBXW2 in prostate cancer cells and whether FBXW2 targets other substrates to involve in progression of prostate cancer is still unclear. Here, we reported that overexpression of FBXW2 attenuated proliferation and metastasis of PCa models both in vitro and in vivo, while FBXW2 depletion exhibited the opposite effects. Intriguingly, FBXW2 was an E3 ligase for EGFR in prostate cancer. EGFR protein level and its half-life were extended by FBXW2 depletion, while EGFR protein level was decreased, and its half-life was shortened upon overexpression of FBXW2, but not its dominant-negative mutant. Importantly, FBXW2 bond to EGFR via its consensus degron motif (TSNNST), and ubiquitylated and degraded EGFR, resulting in repression of EGF function. Thus, our data uncover a novel that FBXW2 as a tumor suppressor of prostate cancer, inhibits EGFR downstream by promoting EGFR ubiquitination and degradation, resulting in repression of cell proliferation and metastasis.

Also flagged:Degradationacid2,4-dichlorophenoxyacetic acid4,5-trichlorophenoxyacetic acidcytochromes P450laccase
Journal Article 2022-05-02 No Snippets Nguyen TLA, Dao ATN, Dang HTC, Koekkoek J, Brouwer A, de Boer TE, van Spanning RJM.
Show Full Abstract

Three different fungi were tested for their ability to degrade 2,4-dichlorophenoxyacetic acid and 2,4,5-trichlorophenoxyacetic acid and for the role of laccases and cytochromes P450-type in this process. We studied a white-rot fungus Rigidoporus sp. FMD21, which has a high laccase activity, for its efficiency to degrade these herbicides. A positive correlation was found between its laccase activity and the corresponding herbicide degradation rate. Even more, the doubling of the enzyme activity in this phase corresponded with a doubling of the herbicide degradation rate. It is, therefore, tempting to speculate that laccase is the most dominant enzyme in the degradation of 2,4-D and 2,4,5-T under these conditions. In addition, it was shown that Rigidoporus sp. FMD21 partly relies on cytochromes P450-type for the breakdown of the herbicides as well. Two filamentous fungi were isolated from soil contaminated with herbicides and dioxins located at Bien Hoa airbase. They belong to genera Fusarium and Verticillium of the phylum Ascomycota as judged by their 18S rRNA gene sequences. Both isolated fungi were able to degrade the herbicides but with different rates. Their laccase activity, however, was very low and did not correlate with the rate of breakdown of the herbicides. These data indicate that the white-rot fungus most likely synthesizes laccase and cytochromes P450-type for the breakdown of the herbicides, while the types of enzyme used for the breakdown of the herbicides by the two Ascomycota remain unclear.

Also flagged:MMP-14bindingmonomethyl auristatin Ecarbontritiumantibody
Journal Article 2022-05-02 No Snippets Cahuzac H, Sallustrau A, Malgorn C, Beau F, Barbe P, Babin V, Dubois S, Palazzolo A, Thai R, Correia I, Lee KB, Garcia-Argote S, Lequin O, Keck M, Nozach H, Feuillastre S, Ge X, Pieters G, Audisio D, Devel L.
Show Full Abstract

In preclinical models, the development and optimization of protein-drug conjugates require accurate determination of the plasma and tissue profiles of both the protein and its conjugated drug. To this aim, we developed a bioanalytical strategy based on dual radiolabeling and ex vivo digital imaging. By combining enzymatic and chemical reactions, we obtained homogeneous dual-labeled anti-MMP-14 Fabs (antigen-binding fragments) conjugated to monomethyl auristatin E where the protein scaffold was labeled with carbon-14 (14C) and the conjugated drug with tritium (3H). These antibody-drug conjugates with either a noncleavable or a cleavable linker were then evaluated in vivo. By combining liquid scintillation counting and ex vivo dual-isotope radio-imaging, it was possible not only to monitor both components simultaneously during their circulation phase but also to quantify accurately their amount accumulated within the different organs.

Also flagged:Transcription Factor 4TCF4autismschizophrenianeuropsychiatric disordersPitt-Hopkins Syndrome
Journal Article 2022-05-02 ✓ 2 Snippets Papes F, Camargo AP, de Souza JS, Carvalho VMA, Szeto RA, LaMontagne E, Teixeira JR, Avansini SH, Sánchez-Sánchez SM, Nakahara TS, Santo CN, Wu W, Yao H, Araújo BMP, Velho PENF, Haddad GG, Muotri AR.
In-Text Gene Mentions

…intermediate progenitor markerPOU3F2(BRN2) is lower…

…expression levels ofPOU3F2and pro-neural NEUROD6…

Show Full Abstract

Transcription Factor 4 (TCF4) has been associated with autism, schizophrenia, and other neuropsychiatric disorders. However, how pathological TCF4 mutations affect the human neural tissue is poorly understood. Here, we derive neural progenitor cells, neurons, and brain organoids from skin fibroblasts obtained from children with Pitt-Hopkins Syndrome carrying clinically relevant mutations in TCF4. We show that neural progenitors bearing these mutations have reduced proliferation and impaired capacity to differentiate into neurons. We identify a mechanism through which TCF4 loss-of-function leads to decreased Wnt signaling and then to diminished expression of SOX genes, culminating in reduced progenitor proliferation in vitro. Moreover, we show reduced cortical neuron content and impaired electrical activity in the patient-derived organoids, phenotypes that were rescued after correction of TCF4 expression or by pharmacological modulation of Wnt signaling. This work delineates pathological mechanisms in neural cells harboring TCF4 mutations and provides a potential target for therapeutic strategies for genetic disorders associated with this gene.

Also flagged:GPR88G-protein-coupled receptorbehavioralbindingcytoplasmictransmembrane
Journal Article 2022-05-02 ✓ 3 Snippets Chen G, Xu J, Inoue A, Schmidt MF, Bai C, Lu Q, Gmeiner P, Liu Z, Du Y.
In-Text Gene Mentions

…of the oGPCRGPR52reveal a unique…

…of the orphanGPR52in which the…

…of ECL2 ofGPR52and GPR88 shows…

Show Full Abstract

GPR88 is an orphan class A G-protein-coupled receptor that is highly expressed in the striatum and regulates diverse brain and behavioral functions. Here we present cryo-EM structures of the human GPR88-Gi1 signaling complex with or without a synthetic agonist (1R, 2R)-2-PCCA. We show that (1R, 2R)-2-PCCA is an allosteric modulator binding to a herein identified pocket formed by the cytoplasmic ends of transmembrane segments 5, 6, and the extreme C terminus of the α5 helix of Gi1. We also identify an electron density in the extracellular orthosteric site that may represent a putative endogenous ligand of GPR88. These structures, together with mutagenesis studies and an inactive state model obtained from metadynamics simulations, reveal a unique activation mechanism for GPR88 with a set of distinctive structure features and a water-mediated polar network. Overall, our results provide a structural framework for understanding the ligand binding, activation and signaling mechanism of GPR88, and will facilitate the innovative drug discovery for neuropsychiatric disorders and for deorphanization of this receptor.

Also flagged:tumorcanceraminoacyl-tRNA synthasesamino acidsprotein synthesisARS
Journal Article 2022-05-02 ✓ 1 Snippet Sung Y, Yoon I, Han JM, Kim S, Kim S.
In-Text Gene Mentions

SNPs in the DARS1, NARS1, DARS2 and NARS2 genes are reportedly related to cancer.

Show Full Abstract

Although key tumorigenic and tumor-suppressive factors have been unveiled over the last several decades, cancer remains the most life-threatening disease. Multiomic analyses of patient samples and an in-depth understanding of tumorigenic processes have rapidly revealed unexpected pathologic associations of new cellular factors previously overlooked in cancer biology. In this regard, the newly discovered activities of human aminoacyl-tRNA synthases (ARSs) deserve attention not only for their pathological significance in tumorigenesis but also regarding diagnostic and therapeutic implications. ARSs are not only essential enzymes covalently linking substrate amino acids to cognate tRNAs for protein synthesis but also function as regulators of cellular processes by sensing different cellular conditions. With their catalytic role in protein synthesis and their regulatory role in homeostasis, functional alterations or dysregulation of ARSs might be pathologically associated with tumorigenesis. This review focuses on the potential implications of ARS genes and proteins in different aspects of cancer based on various bioinformatic analyses and experimental data. We also review their diverse activities involving extracellular secretion, protein-protein interactions, and amino acid sensing, which are related to cancers. The newly discovered cancer-related activities of ARSs are expected to provide new opportunities for detecting, preventing and curing cancers.

Also flagged:SARS-CoV-2 proteinORF8infectionimmune responseviral infectionSARS-CoV-2 infection
Journal Article 2022-05-02 No Snippets Poletti M, Treveil A, Csabai L, Gul L, Modos D, Madgwick M, Olbei M, Bohar B, Valdeolivas A, Turei D, Verstockt B, Triana S, Alexandrov T, Saez-Rodriguez J, Stanifer ML, Boulant S, Korcsmaros T.
Show Full Abstract

Increasing evidence points towards the key role of the epithelium in the systemic and over-activated immune response to viral infection, including SARS-CoV-2 infection. Yet, how viral infection alters epithelial-immune cell interactions regulating inflammatory responses, is not well known. Available experimental approaches are insufficient to properly analyse this complex system, and computational predictions and targeted data integration are needed as an alternative approach. In this work, we propose an integrated computational biology framework that models how infection alters intracellular signalling of epithelial cells and how this change impacts the systemic immune response through modified interactions between epithelial cells and local immune cell populations. As a proof-of-concept, we focused on the role of intestinal and upper-airway epithelial infection. To characterise the modified epithelial-immune interactome, we integrated intra- and intercellular networks with single-cell RNA-seq data from SARS-CoV-2 infected human ileal and colonic organoids as well as from infected airway ciliated epithelial cells. This integrated methodology has proven useful to point out specific epithelial-immune interactions driving inflammation during disease response, and propose relevant molecular targets to guide focused experimental analysis.

Also flagged:complement C3aantibodySystemic lupus erythematosusSLEautoimmune diseaseautoantibodies
Journal Article 2022-05-02 ✓ 1 Snippet Cai YH, Deng J, Chen ZL, Mei H, Tang L, Luo SS, Hu Y.
In-Text Gene Mentions

…and Antithrombin III (ATIII)), inflammatory marker tests…

Show Full Abstract

Systemic lupus erythematosus (SLE) is a complex autoimmune disease characterized by the production of a diverse array of autoantibodies and the dysfunctional activation of the complement system. The specific association between the complement component C3a (C3a) protein and antibodies specific for double-stranded DNA (anti-dsDNA), however, has not been studied in detail to date. This study was thus designed to more fully explore circulating C3a levels in SLE patients. In total, 13 SLE patients were enrolled in this study after having been diagnosed in accordance with the SLICC classification criteria, with 7 and 6 patients respectively exhibiting positivity for anti-dsDNA and anti-Sm autoantibodies. Serum complement component C1q (C1q) and C3a levels in samples from these patients were detected via Western blotting, while other serological, biochemical, and clinical parkers associated with disease activity were detected using standard laboratory techniques. The levels of serum C3a in anti-dsDNA+ patients were significantly elevated as compared to those in anti-Sm+ patients (P < 0.01), and a positive correlation between serum C3a levels and SLE Disease Activity Index scores was detected (P < 0.05, r = 0.6134). C3a levels are correlated with the degree of SLE disease activity and other clinically relevant readouts in SLE patients. C3a levels may also enable the differentiation between inactive and active SLE, while also offering value as an advantageous biomarker for thrombophilia monitoring in SLE patients.

Also flagged:Kidney DiseaseIL1RNgouturategene-expression regulationpost-translational modifications
Journal Article 2022-05-02 No Snippets Zhang J, Dutta D, Köttgen A, Tin A, Schlosser P, Grams ME, Harvey B, CKDGen Consortium, Yu B, Boerwinkle E, Coresh J, Chatterjee N.
Show Full Abstract

Improved understanding of genetic regulation of the proteome can facilitate identification of the causal mechanisms for complex traits. We analyzed data on 4,657 plasma proteins from 7,213 European American (EA) and 1,871 African American (AA) individuals from the Atherosclerosis Risk in Communities study, and further replicated findings on 467 AA individuals from the African American Study of Kidney Disease and Hypertension study. Here, we identified 2,004 proteins in EA and 1,618 in AA, with most overlapping, which showed associations with common variants in cis-regions. Availability of AA samples led to smaller credible sets and notable number of population-specific cis-protein quantitative trait loci. Elastic Net produced powerful models for protein prediction in both populations. An application of proteome-wide association studies to serum urate and gout implicated several proteins, including IL1RN, revealing the promise of the drug anakinra to treat acute gout flares. Our study demonstrates the value of large and diverse ancestry study to investigate the genetic mechanisms of molecular phenotypes and their relationship with complex traits.

Also flagged:autismaxon guidancesynapseorganizationneuron migrationpathogenesis
Journal Article 2022-05-02 ✓ 1 Snippet Astorkia M, Lachman HM, Zheng D.
In-Text Gene Mentions

…and signaling (NEGR1, GADPS ,…

Show Full Abstract

<h4>Background</h4>Autism spectrum disorder is a neurodevelopmental disorder, affecting 1-2% of children. Studies have revealed genetic and cellular abnormalities in the brains of affected individuals, leading to both regional and distal cell communication deficits.<h4>Methods</h4>Recent application of single-cell technologies, especially single-cell transcriptomics, has significantly expanded our understanding of brain cell heterogeneity and further demonstrated that multiple cell types and brain layers or regions are perturbed in autism. The underlying high-dimensional single-cell data provides opportunities for multilevel computational analysis that collectively can better deconvolute the molecular and cellular events altered in autism. Here, we apply advanced computation and pattern recognition approaches on single-cell RNA-seq data to infer and compare inter-cell-type signaling communications in autism brains and controls.<h4>Results</h4>Our results indicate that at a global level, there are cell-cell communication differences in autism in comparison with controls, largely involving neurons as both signaling senders and receivers, but glia also contribute to the communication disruption. Although the magnitude of changes is moderate, we find that excitatory and inhibitor neurons are involved in multiple intercellular signaling that exhibits increased strengths in autism, such as NRXN and CNTN signaling. Not all genes in the intercellular signaling pathways show differential expression, but genes in the affected pathways are enriched for axon guidance, synapse organization, neuron migration, and other critical cellular functions. Furthermore, those genes are highly connected to and enriched for genes previously associated with autism risks.<h4>Conclusions</h4>Overall, our proof-of-principle computational study using single-cell data uncovers key intercellular signaling pathways that are potentially disrupted in the autism brains, suggesting that more studies examining cross-cell type effects can be valuable for understanding autism pathogenesis.

Also flagged:prokineticin 2decidualizationPK2tissue remodelingPKR1Matrix metalloproteinase 9
Journal Article 2022-05-02 No Snippets Zhai J, Ma L, Chang Z, Yu T.
Show Full Abstract

<h4>Background</h4>Studies have shown that abnormalities in the decidualization process were closely related to recurrent implantation failure (RIF). Prokineticin 2 (PK2) is a secreted protein with angiogenic and tissue remodeling functions but its role in the endometrium is unknown.<h4>Methods</h4>PK2 levels and its receptor PKR1 mRNA and protein levels in mid-secretory endometrium from normal and RIF women were examined by real-time PCR and western blotting, respectively. The effects of PK2 were evaluated by overexpressed PK2 in immortalized endometrial T-HESC cells using lentivirus vector and found different expression of Matrix metalloproteinase 9(MMP9) and lncRNA LUCAT1 by RNA-sequencing. The ability of PK2 to regulate LUCAT1 and MMP9 was verified in endometrial cells by real-time PCR and western blotting.<h4>Results</h4>Using endometrial biopsies from normal and RIF patients, we found increased expression of PK2, together with its receptor PKR1 in RIF patients. We then overexpressed PK2 in immortalized endometrial T-HESC cells using lentivirus vector and found decreased expression of Matrix metalloproteinase 9(MMP9), and increased expression of lncRNA LUCAT1. We verified the ability of PK2 to stimulate LUCAT1 and decrease MMP9 in endometrial cells. We further demonstrated that increased expression of a long noncoding RNA LUCAT1 and decreased expression of MMP9 in endometrial biopsies of patients with RIF. Thus, we highlighted the important role of PK2 and its receptor PKR1 in decidualization and RIF.<h4>Conclusion</h4>Prokineticin 2 and its receptor are important in endometrium decidualization. PK2 may affect endometrial decidualization through the LUCAT1- MMP9 pathway, thereby affecting embryo implantation.

Also flagged:necrotic enteritiscampylobacteriosiscoccidiosispericardialenteritissepticemia
Journal Article 2022-05-02 No Snippets Ledwoń A, Murawska M, Dolka I, Chmiel DC, Szleszczuk P.
Show Full Abstract

<h4>Background</h4>To date, Campylobacter jejuni has not been found to be pathogenic to peafowl. The available publications show that out of a total of 44 samples tested from peafowl, this bacterium was isolated only in two cases. Eimeria pavonina infestations in the peafowl have been described, but no fatal cases have been reported yet.<h4>Case presentation</h4>The four-year-old peacock was presented with chronic diarrhea, emaciation and weakness. Post mortem examination revealed enlarged and pale kidneys, small intestinal mucosal necrosis and thickening of intestinal wall, and pericardial effusion. The histopathological examination revealed necrotic enteritis with marked mononuclear cells infiltration associated with the presence of coccidia, additionally there was histological evidence of septicemia in liver and kidneys. Bacteria identification was based on light microscopy of the small intestine sample, culture, and biochemical tests. Further identification was based on PCR. Antimicrobial susceptibility profile was created by determination of minimal inhibitory concentration (MIC) values for 6 antimicrobial agents from 5 different classes. PCR assays were performed to detect virulence factors genes responsible for motility, cytolethal distending toxin production, adhesion and internalization. Bacteriology of the small intestine sample showed abundant growth almost exclusively of Campylobacter jejuni, resistant to ciprofloxacin, gentamycin and ampicillin. Bacteria was sensitive to Amoxicillin + clavulanic acid, tetracycline, and erythromycin. All tested virulence factors genes have been detected. The parasitological examination was performed by microscopic examination of fresh faeces and intestinal content, and revealed the moderate number of Eimeria pavonina, Histomonas meleagridis, single Capillaria spp. eggs as well Heterakis spp. like parasites.<h4>Conclusion</h4>The above case shows that a virulent isolate of Campylobacter jejuni in combination with a parasitic invasion may cause chronic enteritis in peafowl, which most likely led to extreme exhaustion of the host organism and death.

Also flagged:high-grade serous ovarian carcinomaplatinumtumorserous ovarian carcinomaCSPG4SLC35G5
Journal Article 2022-05-02 ✓ 1 Snippet Marchocki Z, Tone A, Virtanen C, de Borja R, Clarke B, Brown T, May T.
In-Text Gene Mentions

…DNAH2, DNAH5, andDNAH10genes of CpG-island…

Show Full Abstract

<h4>Background</h4>Patients treated with neoadjuvant chemotherapy (NACT) for advanced high-grade serous ovarian carcinoma (HGSC) have a higher rate and shorter time to platinum-resistant recurrence compared to patients treated with primary cytoreductive surgery (PCS) and adjuvant chemotherapy. The purpose of this study is to determine the impact of NACT on somatic mutation status in platinum-sensitive and resistant HGSC. Patients with advanced HGSC who had a documented response to platinum-based NACT, a banked blood sample, and a banked tumor sample before and after NACT were identified. Whole exome and/or targeted deep sequencing was performed in matched normal and pre/post-NACT tumor samples from 3 platinum-resistant and 2 platinum-sensitive patients to identify somatic non-synonymous mutations at each time point.<h4>Results</h4>When comparing exonic non-synonymous mutations in pre-NACT and post-NACT samples from the same patient, an average of 41% (1-68%) of genes were mutated at both time points. There were no trends detected in the mutational burden following exposure to NACT in platinum-resistant vs. platinum-sensitive cases. The majority of mutated genes were unique to each case. We identified several genes that were commonly mutated in pre-NACT samples specific to platinum-resistant (CSPG4, SLC35G5, TUBA3D) or sensitive (CYP2D6, NUTM1, DNAH5) cases. Four mutated genes emerged exclusively in the platinum-resistant cases (ADGRV1, MUC17, MUC20, PAK2) following NACT.<h4>Conclusions</h4>Patients with advanced HGSC present with significant intra-tumor heterogeneity. NACT significantly impacts the somatic mutation status irrespective of the time to recurrence. The mutated genes detected in chemo-naive pre-NACT tumor samples from either resistant or sensitive cases could potentially have a role in the prediction of chemotherapy response in patients scheduled to receive NACT; larger studies are required to further validate these genes.

Also flagged:agingspermatogenesishedgehogtestosteronedeathobesity
Journal Article 2022-05-02 ✓ 1 Snippet Nie X, Munyoki SK, Sukhwani M, Schmid N, Missel A, Emery BR, DonorConnect, Stukenborg JB, Mayerhofer A, Orwig KE, Aston KI, Hotaling JM, Cairns BR, Guo J.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Aging men display reduced reproductive health; however, testis aging is poorly understood at the molecular and genomic levels. Here, we utilized single-cell RNA-seq to profile over 44,000 cells from both young and older men and examined age-related changes in germline development and in the testicular somatic cells. Age-related changes in spermatogonial stem cells appeared modest, whereas age-related dysregulation of spermatogenesis and somatic cells ranged from moderate to severe. Altered pathways included signaling and inflammation in multiple cell types, metabolic signaling in Sertoli cells, hedgehog signaling and testosterone production in Leydig cells, cell death and growth in testicular peritubular cells, and possible developmental regression in both Leydig and peritubular cells. Remarkably, the extent of dysregulation correlated with body mass index in older but not in younger men. Collectively, we reveal candidate molecular mechanisms underlying the complex testicular changes conferred by aging and their possible exacerbation by concurrent chronic conditions such as obesity.

Also flagged:SynthesisnanomaterialsHydroxyapatitecollagenfibrilsfibril
Journal Article 2022-05-02 No Snippets Munir MU, Salman S, Ihsan A, Elsaman T.
Show Full Abstract

Hydroxyapatite (HA) is similar to natural bone regarding composition, and its structure favors in biomedical applications. Continuous research and progress on HA nanomaterials (HA-NMs) have explored novel fabrication approaches coupled with functionalization and characterization methods. These nanomaterials have a significant role in many biomedical areas like sustained drug and gene delivery, bio-imaging, magnetic resonance, cell separation, and hyperthermia treatment due to their promising biocompatibility. This review highlighted the HA-NMs chemical composition, recent progress in synthesis methods, characterization and surface modification methods, ion-doping, and role in biomedical applications. HA-NMs have a substantial role as drug delivery vehicles, coating material, bone implant, coating, ceramic, and composite materials. Here, we try to summarize an overview of HA-NMs with the provision of future directions.

Also flagged:Ubiquitin and Ubiquitin-like ProteinsCancerNeurodegenerative DisordersHeart DiseasesPost-translational modificationconjugation
Journal Article 2022-05-02 No Snippets Hwang JT, Lee A, Kho C.
Show Full Abstract

Post-translational modification (PTM) is an essential mechanism for enhancing the functional diversity of proteins and adjusting their signaling networks. The reversible conjugation of ubiquitin (Ub) and ubiquitin-like proteins (Ubls) to cellular proteins is among the most prevalent PTM, which modulates various cellular and physiological processes by altering the activity, stability, localization, trafficking, or interaction networks of its target molecules. The Ub/Ubl modification is tightly regulated as a multi-step enzymatic process by enzymes specific to this family. There is growing evidence that the dysregulation of Ub/Ubl modifications is associated with various diseases, providing new targets for drug development. In this review, we summarize the recent progress in understanding the roles and therapeutic targets of the Ub and Ubl systems in the onset and progression of human diseases, including cancer, neurodegenerative disorders, and heart diseases.

Also flagged:extracellularvesiclesagingendosomestoSucrose
Journal Article 2022-05-02 No Snippets Janouskova O, Herma R, Semeradtova A, Poustka D, Liegertova M, Hana Auer M, Maly J.
Show Full Abstract

Despite extensive study of extracellular vesicles (EVs), specifically exosomes (EXs) as biomarkers, important modulators of physiological or pathological processes, or therapeutic agents, relatively little is known about nonconventional sources of EXs, such as invertebrate or plant EXs, and their uses. Likewise, there is no clear information on the overview of storage conditions and currently used isolation methods, including new ones, such as microfluidics, which fundamentally affect the characterization of EXs and their other biomedical applications. The purpose of this review is to briefly summarize conventional and nonconventional sources of EXs, storage conditions and typical isolation methods, widely used kits and new "smart" technologies with emphasis on the influence of isolation techniques on EX content, protein detection, RNA, mRNA and others. At the same time, attention is paid to a brief overview of the direction of biomedical application of EXs, especially in diagnostics, therapy, senescence and aging and, with regard to the current situation, in issues related to Covid-19.

Also flagged:CancerPLOD2tumorsgastric cancertumormethyltransferase
Journal Article 2022-05-02 ✓ 4 Snippets Xu Q, Kong N, Zhao Y, Wu Q, Wang X, Xun X, Gao P.
In-Text Gene Mentions

As shown in Figure 4C, PLOD2 was significantly correlated with 19 immune checkpoints in patients with STAD, of which 80% (14/19, CD200, CD276, CD28, CD44, CD80, CD86, HAVCR2, LAIR1, NRP1, PDCD1LG2, TNFRSF25, TNFRSF9, TNFSF14, TNFSF18, TNFSF4) was positively correlated.

…, LAIR1 ,TNFSF4, CD244 ,…

…TNFRSF9, TNFSF14, TNFSF18,TNFSF4) was positively correlated.…

…, LAIR1 ,TNFSF4, CD276 ,…

Show Full Abstract

Some previous studies have shown that <i>PLOD2</i> has some value in tumorigenesis. However, the broad significance of <i>PLOD2</i> has not been discussed in depth. This study was aimed at elaborated and summarized the value of PLOD2 in various tumors. First, we integrated GTEx, The Cancer Genome Atlas and Cancer Cell Line Encyclopedia databases to analyze the expression of <i>PLOD2</i>, and found that it was expressed differently in normal tissues and significantly highly expressed in most tumors compared with normal tissues. Second, our analysis revealed that <i>PLOD2</i> expression was negatively correlated with the prognosis of several tumors. For gastric cancer, the median overall survival time was significantly higher in the <i>PLOD2</i> low expression group [HR 0.616 (95%CI 0.442-0.858), <i>p =</i> 0.004]. Third, for tumor immunity, <i>PLOD2</i> was significantly associated with tumor infiltration, including immune infiltrating cells; immune checkpoint expression; immune microenvironment scores (immune score, stromal score and estimate scores); immunotherapy-related scores (tumor mutational burden, microsatellite instability, tumor neoantigen burden); expression of DNA repair genes Mismatch Repairs and methyltransferase; and enrichment analyses identified <i>PLOD2</i>-associated terms and pathways. Lastly, twenty pairs of gastric cancer and adjacent immunohistochemistry showed that <i>PLOD2</i> was significantly overexpressed in gastric cancer (<i>p <</i> 0.001). Collectively, <i>PLOD2</i> played a significant role in tumorigenesis and maybe serve as a potential biomarker for diagnosis and prognosis in cancers.

Also flagged:Esophageal Carcinomaesophageal squamous carcinomaESCCgene expressionsynthesisEsophageal cancer
Journal Article 2022-05-02 ✓ 1 Snippet Yang H, Jin X, Cheng T, Shan G, Lu C, Gu J, Zhan C, Xu F, Ge D.
In-Text Gene Mentions

…cluster II), andDNAH10(71% in cluster…

Show Full Abstract

To figure out the molecular mechanism in the esophageal squamous carcinoma (ESCC) with the discrepancy in the tissue-resident microbiota, we selected clinical features, RNA sequences, and transcriptomes of ESCC patients from The Cancer Genome Atlas (TCGA) website and detailed tissue-resident microbiota information from The Cancer Microbiome Atlas (<i>n</i> = 60) and explored the infiltration condition of particular microbiota in each sample. We classified the tissue-resident micro-environment of ESCC into two clusters (A and B) and built a predictive classifier model. Cluster A has a higher proportion of certain tissue-resident microbiota with comparatively better survival, while Cluster B has a lower proportion of certain tissue-resident microbiota with comparatively worse survival. We showed traits of gene and clinicopathology in the esophageal tissue-resident micro-environment (ETM) phenotypes. By comparing the two clusters' molecular signatures, we find that the two clusters have obvious differences in gene expression and mutation, which lead to pathway expression discrepancy. Several pathways are closely related to tumorigenesis. Our results may demonstrate a synthesis of the infiltration pattern of the esophageal tissue-resident micro-environment in ESCC. We reveal the mechanism of esophageal tissue-resident microbiota discrepancy in ESCC, which may contribute to therapy progress for patients with ESCC.

Also flagged:Alcohol-Associated Liver Diseasealcohol use disorderaddictiondisulfiramacamprosatenaltrexone
Journal Article 2022-05-02 ✓ 1 Snippet Vannier AGL, Shay JES, Fomin V, Patel SJ, Schaefer E, Goodman RP, Luther J.
In-Text Gene Mentions

…-antitrypsin deficiency, orhemochromatosis) (eTable 1 in…

Show Full Abstract

<h4>Importance</h4>Alcohol-associated liver disease (ALD) is one of the most devastating complications of alcohol use disorder (AUD), an increasingly prevalent condition. Medical addiction therapy for AUD may play a role in protecting against the development and progression of ALD.<h4>Objective</h4>To ascertain whether medical addiction therapy was associated with an altered risk of developing ALD in patients with AUD.<h4>Design, setting, and participants</h4>This retrospective cohort study used the Mass General Brigham Biobank, an ongoing research initiative that had recruited 127 480 patients between its start in 2010 and August 17, 2021, when data for the present study were retrieved. The mean follow-up duration from AUD diagnosis was 9.2 years. International Statistical Classification of Diseases and Related Health Problems, Tenth Revision diagnosis codes were used to identify ALD and AUD diagnoses.<h4>Exposures</h4>Medical addiction therapy was defined as the documented use of disulfiram, acamprosate, naltrexone, gabapentin, topiramate, or baclofen. Patients were considered to be treated if they initiated medical addiction therapy before the relevant outcome.<h4>Main outcomes and measures</h4>Adjusted odds ratios (aORs) for the development of ALD and hepatic decompensation were calculated and adjusted for multiple risk factors.<h4>Results</h4>The cohort comprised 9635 patients with AUD, of whom 5821 were male individuals (60.4%), and the mean (SD) age was 54.8 (16.5) years. A total of 1135 patients (11.8%) had ALD and 3906 patients (40.5%) were treated with medical addiction therapy. In multivariable analyses, medical addiction therapy for AUD was associated with decreased incidence of ALD (aOR, 0.37; 95% CI, 0.31-0.43; P < .001). This association was evident for naltrexone (aOR, 0.67; 95% CI, 0.46-0.95; P = .03), gabapentin (aOR, 0.36; 95% CI, 0.30-0.43; P < .001), topiramate (aOR, 0.47; 95% CI, 0.32-0.66; P < .001), and baclofen (aOR, 0.57; 95% CI, 0.36-0.88; P = .01). In addition, pharmacotherapy for AUD was associated with lower incidence of hepatic decompensation in patients with cirrhosis (aOR, 0.35; 95% CI, 0.23-0.53, P < .001), including naltrexone (aOR, 0.27; 95% CI, 0.10-0.64; P = .005) and gabapentin (aOR, 0.36; 95% CI, 0.23-0.56; P < .001). This association persisted even when medical addiction therapy was initiated only after the diagnosis of cirrhosis (aOR, 0.41; 95% CI, 0.23-0.71; P = .002).<h4>Conclusions and relevance</h4>Results of this study showed that receipt of medical addiction therapy for AUD was associated with reduced incidence and progression of ALD. The associations of individual pharmacotherapy with the outcomes of ALD and hepatic decompensation varied widely.

Also flagged:CancerSHC-Adaptor Protein 1SHC1tumorstumorphosphorylation
Journal Article 2022-05-02 ✓ 2 Snippets Chen J, Gao G, Li L, Ding J, Chen X, Lei J, Long H, Wu L, Long X, He L, Shen Y, Yang J, Lu Y, Sun Y.
In-Text Gene Mentions

Interestingly, CD276, NRP1, and TNFSF4 expressions were significantly negatively correlated with SHC1 in various cancers.

…CD276, NRP1, andTNFSF4expressions were significantly…

Show Full Abstract

<b>Background:</b> Recent studies highlight the carcinogenesis role of SHC-adaptor protein 1 (SHC1) in cancer initiation, development, and progression. However, its aberrant expression, diagnostic and prognostic value remain unknown in a variety of tumors. <b>Methods:</b> The SHC1 expression profiles were analyzed using GTEx database, TCGA database, Oncomine and CPTAC database. The survival analysis was conducted using GEPIA2, Kaplan-Meier Plotter, UALCAN, and PrognoScan. The diagnostic values of SHC1 were calculated with the "pROC" package in R software. The genetic alteration of SHC1 and mutations were analyzed using cBioPortal. TIMER2 was employed to estimate the correlations between SHC1 expression and tumor-infiltrating immune cells in the TCGA cohort. Enrichment analysis of SHC1 was conducted using the R package "clusterProfiler." <b>Results:</b> SHC1 was ubiquitously highly expressed and closely associated with worse prognosis of multiple major cancer types (all <i>p</i> < 0.05). Further, SHC1 gene mutations were strongly linked to poor OS and DFS in SKCM (all <i>p</i> < 0.05). An enhanced phosphorylation level of SHC1 at the S139 site was observed in clear cell RCC. Additionally, the results revealed SHC1 expression was strongly linked to TMB, MMRs, MSI, TAMs, DNA methylation, m6A RNA methylation, tumor-associated immune infiltration, and immune checkpoints in multiple cancers (all <i>p</i> < 0.05). In addition, the results of the ROC analysis indicated the SHC1 exhibited strong diagnostic capability for KICH (AUC = 0.92), LIHC (AUC = 0.95), and PAAD (AUC = 0.95). Finally, enrichment analysis indicated that SHC1 may potentially involve in the regulation of numerous signaling pathways in cancer metabolism and protein phosphorylation-related functions. <b>Conclusions:</b> These findings highlight that SHC1 plays an important role in the tumor immune microenvironment, and SHC1 has been identified to have prognostic and diagnostic value in multiple cancers. Thus, SHC1 is a potential target for cancer immunotherapy and effective prognostic and diagnostic biomarker.

Also flagged:peptidespeptideamino acidlysinemucinsynthesis
Journal Article 2022-05-02 No Snippets Cheng YE, Wu IE, Chen YC, Chu IM.
Show Full Abstract

The oral route is the most popular way of drug administration because of good patient compliance and ease of use. However, the oral delivery of peptides and proteins is difficult, mainly due to poor oral bioavailability. In past decades, researchers have developed several strategies to improve oral bioavailability by avoiding losing activity in the gastrointestinal (GI) tract and enhancing the intestinal permeability of these drugs. Methoxy poly(ethylene glycol)-poly(l-alanine) (mPEG-PA) is a thermo-sensitive hydrogel exhibiting a sol-to-gel phase transition property. This characteristic is appropriate for encapsulating peptide or protein drugs. To enhance the adhesion ability to intestinal mucus, a thermo-sensitive polymer, mPEG-PA, modified with charged amino acid lysine was developed. This positively charged material would help to bind the negatively charged mucin in mucus. The synthesis was conducted by individually synthesizing mPEG-PA and poly(l-lysine) (PLL) of different lengths via ring-opening polymerization. Then, mPEG-PA and PLL were combined using an NHS ester reaction to synthesize the triblock copolymer (mPEG-PA-PLL). Biocompatibility and the release of calcitonin from the synthesized hydrogel particles under different pH were examined. The initial data showed that the newly design material had a promising potential for the oral delivery of peptide drugs.

Also flagged:deathnalidixic acidtrimethoprimsulfamethoxazoleSalmonella infectionsimmune response
Journal Article 2022-05-02 ✓ 1 Snippet Elsharkawy MS, Wang H, Ding J, Madkour M, Wang Q, Zhang Q, Zhang N, Li Q, Zhao G, Wen J.
In-Text Gene Mentions

…as CATH1, AvBD4,BTN3A3, AvBD1, AvBD7, and…

Show Full Abstract

Salmonella Typhimurium (ST) is a foodborne pathogen that adversely affects the health of both animals and humans. Since poultry is a common source and carrier of the disease, controlling ST infection in chickens will have a protective impact on human health. In the current study, Beijing-You (BY) and Cobb chicks (5-day-old specific-pathogen-free) were orally challenged by 2.4 × 1012 CFU ST, spleen transcriptome was conducted 1 day post-infection (DPI) to identify gene markers and pathways related to the immune system. A total of 775 significant differentially expressed genes (DEGs) in comparisons between BY and Cobb were identified, including 498 upregulated and 277 downregulated genes (fold change ≥2.0, p < 0.05). Several immune response pathways against Salmonella were enriched, including natural killer-cell-mediated-cytotoxicity, cytokine−cytokine receptor interaction, antigen processing and presentation, phagosomes, and intestinal immune network for IgA production, for both BY and Cobb chickens. The BY chicks showed a robust response for clearance of bacterial load, immune response, and robust activation of phagosomes, resulting in ST resistance. These results confirmed that BY breed more resistance to ST challenge and will provide a better understanding of BY and Cobb chickens’ susceptibility and resistance to ST infection at the early stages of host immune response, which could expand the known intricacies of molecular mechanisms in chicken immunological responses against ST. Pathways induced by Salmonella infection may provide a novel approach to developing preventive and curative strategies for ST, and increase inherent resistance in animals through genetic selection.

Also flagged:Huntington's diseaseHDwaterextracellularautosomal dominant genetic neurodegenerative diseasecognitive impairment
Journal Article 2022-05-01 ✓ 1 Snippet Gatto RG, Weissmann C.
In-Text Gene Mentions

…of the humanHTTgene in a…

Show Full Abstract

During the last decades, advances in the understanding of genetic, cellular, and microstructural alterations associated to Huntington's disease (HD) have improved the understanding of this progressive and fatal illness. However, events related to early neuropathological events, neuroinflammation, deterioration of neuronal connectivity and compensatory mechanisms still remain vastly unknown. Ultra-high field diffusion MRI (UHFD-MRI) techniques can contribute to a more comprehensive analysis of the early microstructural changes observed in HD. In addition, it is possible to evaluate if early imaging microstructural parameters might be linked to histological biomarkers. Moreover, qualitative studies analyzing histological complexity in brain areas susceptible to neurodegeneration could provide information on inflammatory events, compensatory increase of neuroconnectivity and mechanisms of brain repair and regeneration. The application of ultra-high field diffusion-MRI technology in animal models, particularly the R6/1 mice (a common preclinical mammalian model of HD), provide the opportunity to analyze alterations in a physiologically intact model of the disease. Although some disparities in volumetric changes across different brain structures between preclinical and clinical models has been documented, further application of different diffusion MRI techniques used in combination like diffusion tensor imaging, and neurite orientation dispersion and density imaging have proved effective in characterizing early parameters associated to alteration in water diffusion exchange within intracellular and extracellular compartments in brain white and grey matter. Thus, the combination of diffusion MRI imaging techniques and more complex neuropathological analysis could accelerate the discovery of new imaging biomarkers and the early diagnosis and neuromonitoring of patients affected with HD.

Also flagged:OAsensitizationarthritic diseasesjoint pathologieshypersensitivitysystemic inflammatory rheumatic diseases
Journal Article 2022-05-01 ✓ 1 Snippet Steen Pettersen P, Neogi T, Magnusson K, Mathiessen A, Hammer HB, Uhlig T, Kvien TK, Haugen IK.
In-Text Gene Mentions

…rheumatic diseases orhemochromatosis.…

Show Full Abstract

<h4>Objective</h4>Pain sensitization is associated with pain severity in persons with hand OA. What contributes to pain sensitization is unclear. This study explores whether hand OA pathologies and symptom duration are related to central sensitization.<h4>Method</h4>Participants with hand OA in the Nor-Hand study underwent bilateral hand radiography and US examination. Central sensitization was assessed with pressure pain thresholds (PPT) at remote sites (wrist, trapezius and tibialis anterior muscles) and temporal summation. We examined whether hand OA pathologies, independent of each other, including structural severity (Kellgren-Lawrence sum score, presence of erosive hand OA), inflammatory severity (greyscale synovitis and power Doppler activity sum scores) and symptom duration, were related to central sensitization, adjusting for age, sex, BMI, comorbidities and OA-severity of knee/hip.<h4>Results</h4>In 291 participants (88% women, median age 61 years, interquartile range 57-66 years) Kellgren-Lawrence, greyscale synovitis and power Doppler activity sum scores were not associated with lower PPTs at remote sites. Persons with erosive hand OA had lower PPTs at the wrist (adjusted beta -0.75, 95% CI -1.32, -0.19) and tibialis anterior (adjusted beta -0.82, 95% CI -1.54, -0.09) and had greater temporal summation (adjusted beta 0.56, 95% CI 0.12, 1.01) compared with persons with non-erosive disease. No associations were found for symptom duration.<h4>Conclusions</h4>A person's overall amount of structural or inflammatory hand OA pathologies was not associated with central sensitization. Although persons with erosive hand OA showed greater signs of central sensitization, the small differences suggest that central sensitization is mainly explained by factors other than joint pathologies.

Also flagged:ironarthritisdiabetesheart failurehepatic cirrhosishepatocellular carcinoma
Journal Article 2022-05-01 ✓ 5 Snippets Girelli D, Busti F, Brissot P, Cabantchik I, Muckenthaler MU, Porto G.
In-Text Gene Mentions

Initially, it appeared that up to 95% of HC cases could be attributed to homozygosity for a single nucleotide change (845 G→A), causing the substitution of cysteine by tyrosine at amino acid 282 (p.Cys282Tyr or C282Y variant).10, 11, 12, 13 A second HFE polymorphism, p.His63Asp, was detected, whose minor role became clearer later.14

As mentioned before, the term juvenile hemochromatosis classically designates an early-onset (within the second or third decades of life), fully-expressed HC phenotype showing similar penetrance in both genders and a tendency to present with cardiac and endocrine dysfunctions.27, 105 This phenotype is generally due to variants in HJV and HAMP genes causing much more severe iron hyperabsorption than the HFE mutations.

2Others do not display variants in any of the 5 classical hemochromatosis genes (ie, HFE, HAMP, HJV, TFR2, and SLC40A1).

This paved the way to the discovery, in 1996, of the “hemochromatosis gene” HFE (alias “high Fe,” official full name “homeostatic iron regulator”),9 which provided additional information about HC.

Hemochromatosisclassification: update and…

Show Full Abstract

Hemochromatosis (HC) is a genetically heterogeneous disorder in which uncontrolled intestinal iron absorption may lead to progressive iron overload (IO) responsible for disabling and life-threatening complications such as arthritis, diabetes, heart failure, hepatic cirrhosis, and hepatocellular carcinoma. The recent advances in the knowledge of pathophysiology and molecular basis of iron metabolism have highlighted that HC is caused by mutations in at least 5 genes, resulting in insufficient hepcidin production or, rarely, resistance to hepcidin action. This has led to an HC classification based on different molecular subtypes, mainly reflecting successive gene discovery. This scheme was difficult to adopt in clinical practice and therefore needs revision. Here we present recommendations for unambiguous HC classification developed by a working group of the International Society for the Study of Iron in Biology and Medicine (BIOIRON Society), including both clinicians and basic scientists during a meeting in Heidelberg, Germany. We propose to deemphasize the use of the molecular subtype criteria in favor of a classification addressing both clinical issues and molecular complexity. Ferroportin disease (former type 4a) has been excluded because of its distinct phenotype. The novel classification aims to be of practical help whenever a detailed molecular characterization of HC is not readily available.

Also flagged:argininemethylationneurodegenerative disorderPost-translational modificationsphosphorylationHD
Journal Article 2022-05-01 ✓ 5 Snippets Ratovitski T, Jiang M, O'Meally RN, Rauniyar P, Chighladze E, Faragó A, Kamath SV, Jin J, Shevelkin AV, Cole RN, Ross CA.
In-Text Gene Mentions

Using a combination of in vitro methylation and cell-based experiments, we identified PRMT4 (CARM1) and PRMT6 as major enzymes methylating HTT at specific arginines.

Interaction of huntingtin with PRMTs and its subsequent arginine methylation affects HTT solubility, phase transition behavior and neuronal toxicity.

Post-translational modifications of huntingtin protein (HTT), such as phosphorylation, acetylation and ubiquitination, have been implicated in HD pathogenesis.

Arginine methylation/dimethylation is an important modification with an emerging role in neurodegeneration; however, arginine methylation of HTT remains largely unexplored.

Thus, arginine methylation pathways that involve specific HTT-modifying PRMT enzymes and modulate HTT biochemical and toxic properties could provide targets for HD-modifying therapies.

Show Full Abstract

Huntington's disease (HD) is an incurable neurodegenerative disorder caused by a CAG expansion in the huntingtin gene (HTT). Post-translational modifications of huntingtin protein (HTT), such as phosphorylation, acetylation and ubiquitination, have been implicated in HD pathogenesis. Arginine methylation/dimethylation is an important modification with an emerging role in neurodegeneration; however, arginine methylation of HTT remains largely unexplored. Here we report nearly two dozen novel arginine methylation/dimethylation sites on the endogenous HTT from human and mouse brain and human cells suggested by mass spectrometry with data-dependent acquisition. Targeted quantitative mass spectrometry identified differential arginine methylation at specific sites in HD patient-derived striatal precursor cell lines compared to normal controls. We found that HTT can interact with several type I protein arginine methyltransferases (PRMTs) via its N-terminal domain. Using a combination of in vitro methylation and cell-based experiments, we identified PRMT4 (CARM1) and PRMT6 as major enzymes methylating HTT at specific arginines. Alterations of these methylation sites had a profound effect on biochemical properties of HTT rendering it less soluble in cells and affected its liquid-liquid phase separation and phase transition patterns in vitro. We found that expanded HTT 1-586 fragment can form liquid-like assemblies, which converted into solid-like assemblies when the R200/205 methylation sites were altered. Methyl-null alterations increased HTT toxicity to neuronal cells, while overexpression of PRMT 4 and 6 was beneficial for neuronal survival. Thus, arginine methylation pathways that involve specific HTT-modifying PRMT enzymes and modulate HTT biochemical and toxic properties could provide targets for HD-modifying therapies.

Also flagged:male infertilityazoospermiaoligospermiapathogenesisspermatogenesisgerm cell development
Journal Article 2022-05-01 No Snippets Chau MHK, Li Y, Dai P, Shi M, Zhu X, Wah Chung JP, Kwok YK, Choy KW, Kong X, Dong Z.
Show Full Abstract

Apparently balanced chromosomal structural rearrangements are known to cause male infertility and account for approximately 1% of azoospermia or severe oligospermia. However, the underlying mechanisms of pathogenesis and etiologies are still largely unknown. Herein, we investigated apparently balanced interchromosomal structural rearrangements in six cases with azoospermia/severe oligospermia to comprehensively identify and delineate cryptic structural rearrangements and the related copy number variants. In addition, high read-depth genome sequencing (GS) (30-fold) was performed to investigate point mutations causative of male infertility. Mate-pair GS (4-fold) revealed additional structural rearrangements and/or copy number changes in 5 of 6 cases and detected a total of 48 rearrangements. Overall, the breakpoints caused truncations of 30 RefSeq genes, five of which were associated with spermatogenesis. Furthermore, the breakpoints disrupted 43 topological-associated domains. Direct disruptions or potential dysregulations of genes, which play potential roles in male germ cell development, apoptosis, and spermatogenesis, were found in all cases (n = 6). In addition, high read-depth GS detected dual molecular findings in case MI6, involving a complex rearrangement and two point mutations in the gene DNAH1. Overall, our study provided the molecular characteristics of apparently balanced interchromosomal structural rearrangements in patients with male infertility. We demonstrated the complexity of chromosomal structural rearrangements, potential gene disruptions/dysregulation and single-gene mutations could be the contributing mechanisms underlie male infertility.

Also flagged:aryl hydrocarbon receptorAHRerythropoiesisSR1erythrocyte differentiationorganization
Journal Article 2022-05-01 ✓ 1 Snippet Chen Y, Dong Y, Lu X, Li W, Zhang Y, Mao B, Pan X, Li X, Zhou Y, An Q, Xie F, Wang S, Xue Y, Cai X, Lai M, Zhou Q, Yan Y, Fu R, Wang H, Nakahata T, An X, Shi L, Zhang Y, Ma F.
In-Text Gene Mentions

…TMEM14C , andSOX6), membrane protein-related…

Show Full Abstract

The aryl hydrocarbon receptor (AHR) plays an important role during mammalian embryo development. Inhibition of AHR signaling promotes the development of hematopoietic stem/progenitor cells. AHR also regulates the functional maturation of blood cells, such as T cells and megakaryocytes. However, little is known about the role of AHR modulation during the development of erythroid cells. In this study, we used the AHR antagonist StemRegenin 1 (SR1) and the AHR agonist 2,3,7,8-tetrachlorodibenzo-p-dioxin during different stages of human erythropoiesis to elucidate the function of AHR. We found that antagonizing AHR signaling improved the production of human embryonic stem cell derived erythrocytes and enhanced erythroid terminal differentiation. RNA sequencing showed that SR1 treatment of proerythroblasts upregulated the expression of erythrocyte differentiation-related genes and downregulated actin organization-associated genes. We found that SR1 accelerated F-actin remodeling in terminally differentiated erythrocytes, favoring their maturation of the cytoskeleton and enucleation. We demonstrated that the effects of AHR inhibition on erythroid maturation were associated with F-actin remodeling. Our findings help uncover the mechanism for AHR-mediated human erythroid cell differentiation. We also provide a new approach toward the large-scale production of functionally mature human pluripotent stem cell-derived erythrocytes for use in translational applications.

Also flagged:cystic fibrosisCFinfectionwaterpolyethersulfonemembrane
Journal Article 2022-05-01 No Snippets Gross JE, Caceres S, Poch K, Hasan NA, Jia F, Epperson LE, Lipner E, Vang C, Honda JR, Strand M, Calado Nogueira de Moura V, Daley CL, Strong M, Davidson RM, Nick JA.
Show Full Abstract

<b>Rationale:</b> Healthcare-associated transmission of nontuberculous mycobacteria (NTM) among people with cystic fibrosis (pwCF) has been investigated at CF centers worldwide, with conflicting conclusions. We investigated transmission at the Colorado Adult CF Program. <b>Objectives:</b> To systematically investigate healthcare-associated transmission and/or acquisition of NTM to determine similarity among respiratory and environmental isolates, and to compare home residence watershed mapping among pwCF having genetically similar NTM isolates. <b>Methods:</b> Whole-genome sequencing of NTM isolates from 80 pwCF was conducted to identify genetically similar isolate clusters (⩽30 SNP differences). Epidemiology, comparison of respiratory and environmental isolates, and home residence watershed mapping were analyzed. <b>Measurements and Main Results:</b> Whole-genome sequencing analysis revealed 11 clusters of NTM [6 <i>Mycobacterium abscessus</i> subspecies (ssp.) <i>abscessus</i>, 1 <i>M. abscessus</i> ssp. <i>massiliense</i>, 2 <i>Mycobacterium avium</i>, and 2 <i>Mycobacterium intracellulare</i>] among pwCF. Epidemiologic investigation demonstrated opportunities for healthcare-associated transmission in two <i>M. abscessus</i> and two <i>M. avium</i> clusters. Respiratory and healthcare environmental isolate comparisons revealed no genetic similarity. Individuals comprising one <i>M. abscessus</i> cluster, with no plausible healthcare-associated transmission, resided in the same watershed. <b>Conclusions:</b> This study suggests healthcare-associated transmission of <i>M. abscessus</i> is rare and includes a report of potential healthcare-associated transmission of <i>M. avium</i> among pwCF. One <i>M. abscessus</i> cluster possibly had common acquisition arising from residing in the same watershed. The presence of genetically similar isolates is insufficient to demonstrate healthcare-associated NTM transmission. Standardizing epidemiologic investigation, combined with environmental sampling and watershed analysis, will improve understanding of the frequency and nature of healthcare-associated NTM transmission among pwCF.

Also flagged:COVID-19Diabetic Gastroenteropathydiabetic gastroparesisdiabetesdiabetes gastroenteropathyfunctional dyspepsia
Journal Article 2022-05-01 No Snippets Deb B, O'Brien DR, Chunawala ZS, Bharucha AE.
Show Full Abstract

<h4>Context</h4>SARS-CoV-2 infects the gastrointestinal tract and may be associated with symptoms that resemble diabetic gastroparesis. Why patients with diabetes who contract COVID-19 are more likely to have severe disease is unknown.<h4>Objective</h4>We aimed to compare the duodenal mucosal expression of SARS-CoV-2 and inflammation-related genes in diabetes gastroenteropathy (DGE), functional dyspepsia (FD), and healthy controls.<h4>Methods</h4>Gastrointestinal transit, and duodenal mucosal mRNA expression of selected genes were compared in 21 controls, 39 DGE patients, and 37 FD patients from a tertiary referral center. Pathway analyses were performed.<h4>Results</h4>Patients had normal, delayed (5 FD [13%] and 13 DGE patients [33%]; P = 0.03 vs controls), or rapid (5 FD [12%] and 5 DGE [12%]) gastric emptying (GE). Compared with control participants, 100 SARS-CoV-2-related genes were increased in DGE (FDR < 0.05) vs 13 genes in FD; 71 of these 100 genes were differentially expressed in DGE vs FD but only 3 between DGE patients with normal vs delayed GE. Upregulated genes in DGE include the SARS-CoV2 viral entry genes CTSL (|Fold change [FC]|=1.16; FDR < 0.05) and CTSB (|FC|=1.24; FDR < 0.05) and selected genes involved in viral replication (eg, EIF2 pathways) and inflammation (CCR2, CXCL2, and LCN2, but not other inflammation-related pathways eg, IL-2 and IL-6 signaling).<h4>Conclusion</h4>Several SARS-CoV-2-related genes were differentially expressed between DGE vs healthy controls and vs FD but not between DGE patients with normal vs delayed GE, suggesting that the differential expression is related to diabetes per se. The upregulation of CTSL and CTSB and replication genes may predispose to SARS-CoV2 infection of the gastrointestinal tract in diabetes.

Also flagged:Cardiovascular DiseaseCVDadiponectinretinol binding protein 4RBP4coronary artery disease
Journal Article 2022-05-01 No Snippets Chen D, Zhang Y, Yidilisi A, Xu Y, Dong Q, Jiang J.
Show Full Abstract

<h4>Context</h4>Observational studies have suggested associations between adipokines and cardiovascular disease (CVD), but the roles of certain adipokines remain controversial, and these associations have not yet been ascertained causally.<h4>Objective</h4>To investigate whether circulating adipokines causally affect the risk of CVD using 2-sample Mendelian randomization (MR).<h4>Methods</h4>Independent genetic variants strongly associated with adiponectin, resistin, chemerin, and retinol binding protein 4 (RBP4) were selected from public genome-wide association studies. Summary-level statistics for CVD, including coronary artery disease (CAD), myocardial infarction, atrial fibrillation (AF), heart failure (HF), and stroke and its subtypes were collected. The inverse-variance weighted and Wald ratio methods were used for the MR estimates. The MR pleiotropy residual sum and outlier, weighted median, MR-Egger, leave-one-out analysis, MR Steiger, and colocalization analyses were used in the sensitivity analysis.<h4>Results</h4>Genetically predicted resistin levels were positively associated with AF risk (odds ratio [OR] 1.09; 95% confidence interval [CI], 1.04-1.13; P = 4.1 × 10-5), which was attenuated to null after adjusting for blood pressure. We observed suggestive associations between higher genetically predicted chemerin levels and an increased risk of CAD (OR 1.27; 95% CI, 1.01-1.60; P = 0.040), higher genetically predicted RBP4 levels and an increased risk of HF (OR 1.14; 95% CI, 1.02-1.27; P = 0.024). There was no causal association between genetically predicted adiponectin levels and CVD risk.<h4>Conclusions</h4>Our findings reveal the causal association between resistin and AF, probably acting through blood pressure, and suggest potential causal associations between chemerin and CAD, RBP4, and HF.

Also flagged:erythropoiesisgestationorganellemetabolismpentosephosphate
Journal Article 2022-05-01 ✓ 2 Snippets Nemkov T, Kingsley PD, Dzieciatkowska M, Malik J, McGrath KE, Hansen KC, D'Alessandro A, Palis J.
In-Text Gene Mentions

(F) These proteins are involved in the phenomenon of oxygen-dependent metabolic modulation, which regulates metabolic fluxes through glycolysis and the PPP as a function of Hb oxygenation status and competitive binding of deoxyhemoglobin and glycolytic enzymes for the N-terminus cytosolic domain of SLC4A1 band 3.59,73,74 (G-I) Switch-tag proteomic approach (G) revealed differing cysteine oxidation status (H) in the 2 cell populations; these differences were accompanied by altered expression levels of many redox enzymes (I), including CAT, superoxide dismutase 1 (SOD1), glutathione peroxidase 1 (GPX1) and GPX4, glutathione reductase (GSR), and peroxiredoxin 1 (PRDX1), PRDX2, and PRDX6.

…PRDX1, PRDX2, andPRDX6, in primitive OrthoEs…

Show Full Abstract

Primitive erythropoiesis is a critical component of the fetal cardiovascular network and is essential for the growth and survival of the mammalian embryo. The need to rapidly establish a functional cardiovascular system is met, in part, by the intravascular circulation of primitive erythroid precursors that mature as a single semisynchronous cohort. To better understand the processes that regulate erythroid precursor maturation, we analyzed the proteome, metabolome, and lipidome of primitive erythroblasts isolated from embryonic day (E) 10.5 and E12.5 of mouse gestation, representing their transition from basophilic erythroblast to orthochromatic erythroblast (OrthoE) stages of maturation. Previous transcriptional and biomechanical characterizations of these precursors have highlighted a transition toward the expression of protein elements characteristic of mature red blood cell structure and function. Our analysis confirmed a loss of organelle-specific protein components involved in messenger RNA processing, proteostasis, and metabolism. In parallel, we observed metabolic rewiring toward the pentose phosphate pathway, glycolysis, and the Rapoport-Luebering shunt. Activation of the pentose phosphate pathway in particular may have stemmed from increased expression of hemoglobin chains and band 3, which together control oxygen-dependent metabolic modulation. Increased expression of several antioxidant enzymes also indicated modification to redox homeostasis. In addition, accumulation of oxylipins and cholesteryl esters in primitive OrthoE cells was paralleled by increased transcript levels of the p53-regulated cholesterol transporter (ABCA1) and decreased transcript levels of cholesterol synthetic enzymes. The present study characterizes the extensive metabolic rewiring that occurs in primary embryonic erythroid precursors as they prepare to enucleate and continue circulating without internal organelles.

Also flagged:acute myeloid leukemiaHNRNPH1
Journal Article 2022-05-01 ✓ 5 Snippets Kudo K, Kubota Y, Toki T, Kanezaki R, Kobayashi A, Sato T, Kamio T, Sasaki S, Shiba N, Tomizawa D, Adachi S, Yoshida K, Ogawa S, Seki M, Takita J, Ito E, Terui K.
In-Text Gene Mentions

The immunophenotype and gene expression profile based on unsupervised clustering analysis confirmed the diagnosis of AML, and the gene expression patterns of this HNRNPH1-MLLT10 fusion case were similar to those of the PICALM-MLLT10 fusion, which has previously been identified in both AML and T-ALL (Figure 2A).6,7

Thus, our data suggested that AML with del(5q) and HNRNPH1-MLLT10 fusion has the gene expression profile signature of both immature myeloid precursors and early T-cell precursors.

HNRNPH1-MLLT10 fusion has been reported in T-ALL and shares the gene expression profile signatures of the HOXA subgroup,7 but no such fusion has ever been reported in AML.

Here, we report the first known case of pediatric AML with del(5q) and HNRNPH1-MLLT10 fusion and reveal similarities in gene expression profiles in AML (FAB M0) and T-ALL by transcriptome analysis.

In conclusion, we report the first case of pediatric AML with del(5q) and HNRNPH1-MLLT10 fusion, in which the gene expression profiling revealed similarities between immature AML and the subgroup of early T-cell precursor ALL.

Show Full Abstract

No abstract available.

Also flagged:distal cholangiocarcinomacarcinoembryonic antigencarbohydrateantigenCholangiocarcinomagastrointestinal cancers
Journal Article 2022-05-01 ✓ 5 Snippets Oh C, Kim HJ, Song SH, Park EK, Hur YH, Koh YS, Cho CK.
In-Text Gene Mentions

…prognostic factor ofDCCrelated to OS…

…the anatomical distinction,DCCprognosis and surgical…

…surgical resection ofDCC[ 13 ,…

…to be effectiveDCCprognostic indicators in…

…prognostic factor forDCC.…

Show Full Abstract

<h4>Backgrounds/aims</h4>The goal of the present study was to evaluate the prognostic value of lymph node ratio (LNR) in distal cholangiocarcinoma (DCC) after curative intended surgery.<h4>Methods</h4>Clinicopathological data of 162 DCC patients who underwent radical intended surgery between 2012 and 2020 were analyzed retrospectively. Prognostic factors related to overall survival (OS) and disease-free survival (DFS) were evaluated.<h4>Results</h4>Median OS time and DFS time were 41 and 29 months, and 5-year OS rate and DFS rate were 44.7% and 38.1%, respectively. In the univariate analysis, significant prognostic factors for OS were histologic differentiation, American Joint Committee on Cancer (AJCC) stage, positive lymph node count, LNR, R1 resection, and perineural invasion. Preoperative carcinoembryonic antigen, carbohydrate antigen 19-9, infiltrative type, histologic differentiation, AJCC stage, positive lymph node count, LNR, R1 resection, perineural invasion, and lymph-vascular invasion were significant prognostic factors for DFS in the univariate analysis. In the multivariate analysis, histologic differentiation, R1 resection, and LNR were the independent prognostic factors for both OS and DFS. The LNR ≥ 0.2 group had a significantly poor prognosis in terms of OS (hazard ratio, 3.915; <i>p</i> = 0.002) and DFS (hazard ratio, 5.840; <i>p</i> < 0.001).<h4>Conclusions</h4>LNR has significant value as a prognostic factor of DCC related to OS and DFS. LNR has the potential to be used as a modified staging system with furthermore studies.

Also flagged:TumorMethylationCancertumorsmelanomaTCF7
Journal Article 2022-05-01 ✓ 1 Snippet Yu X, Cen L, Chen YA, Markowitz J, Shaw TI, Tsai KY, Conejo-Garcia JR, Wang X.
In-Text Gene Mentions

BTN3A3

Show Full Abstract

DNA methylation signatures in tumors could serve as reliable biomarkers that are accessible in archival tissues for tracking the epigenetic dynamics shaped by both cancer cells and the tumor microenvironment. However, given the ultrahigh dimensionality and noncollapsible nature of the data, it remains challenging to screen all CpG sites to identify the most promising marker panels. In this article, we introduce the concept of tumor-based expression quantitative trait methylation (eQTM) for the prioritization and systematic mining of predictive biomarkers. In melanoma as a disease model, eQTM CpGs and genes represent new and efficient candidate targets to be investigated for both prognostic and immune status monitoring purposes. Three cis-eQTM CpGs (cg07786657, cg12446199, and cg00027570) were strongly associated with and can serve as surrogate biomarkers for the tumor immune cytolytic activity score (CYT). In addition, multiple eQTM genes could be further exploited for predicting immunoregulatory phenotypes. A targeted gene panel analysis identified one eQTM in TCF7 (cg25947408) as a novel candidate biomarker for uncoupling overall T-cell differentiation and exhaustion status in a tumor. The prognostic significance of this eQTM as an independent signature to CYT was validated by both The Cancer Genome Atlas and Moffitt melanoma cohort data. Overall, eQTMs represent a mechanistically distinct class of potential biomarkers that can be used to predict patient prognosis and immune status.<h4>Significance</h4>This study provides a novel and promising approach to identify targeted epigenetic biomarkers in cancer and will spur further analysis in tumor immune phenotyping.

Also flagged:UBTFacute myeloid leukemiaAMLbindingtranscription factorWT1
Journal Article 2022-05-01 ✓ 2 Snippets Umeda M, Ma J, Huang BJ, Hagiwara K, Westover T, Abdelhamed S, Barajas JM, Thomas ME, Walsh MP, Song G, Tian L, Liu Y, Chen X, Kolekar P, Tran Q, Foy SG, Maciaszek JL, Kleist AB, Leonti AR, Ju B, Easton J, Wu H, Valentine V, Valentine MB, Liu YC, Ries RE, Smith JL, Parganas E, Iacobucci I, Hiltenbrand R, Miller J, Myers JR, Rampersaud E, Rahbarinia D, Rusch M, Wu G, Inaba H, Wang YC, Alonzo TA, Downing JR, Mullighan CG, Pounds S, Babu MM, Zhang J, Rubnitz JE, Meshinchi S, Ma X, Klco JM.
In-Text Gene Mentions

…r prognosis, including PICALM-MLLT10(ref.…

…like DEK-NUP214 , PICALM-MLLT10, CBFA2T3-GLIS2 ,…

Show Full Abstract

The genetics of relapsed pediatric acute myeloid leukemia (AML) has yet to be comprehensively defined. Here, we present the spectrum of genomic alterations in 136 relapsed pediatric AMLs. We identified recurrent exon 13 tandem duplications (TD) in upstream binding transcription factor (UBTF) in 9% of relapsed AML cases. UBTF-TD AMLs commonly have normal karyotype or trisomy 8 with cooccurring WT1 mutations or FLT3-ITD but not other known oncogenic fusions. These UBTF-TD events are stable during disease progression and are present in the founding clone. In addition, we observed that UBTF-TD AMLs account for approximately 4% of all de novo pediatric AMLs, are less common in adults, and are associated with poor outcomes and MRD positivity. Expression of UBTF-TD in primary hematopoietic cells is sufficient to enhance serial clonogenic activity and to drive a similar transcriptional program to UBTF-TD AMLs. Collectively, these clinical, genomic, and functional data establish UBTF-TD as a new recurrent mutation in AML.<h4>Significance</h4>We defined the spectrum of mutations in relapsed pediatric AML and identified UBTF-TDs as a new recurrent genetic alteration. These duplications are more common in children and define a group of AMLs with intermediate-risk cytogenetic abnormalities, FLT3-ITD and WT1 alterations, and are associated with poor outcomes. See related commentary by Hasserjian and Nardi, p. 173. This article is highlighted in the In This Issue feature, p. 171.

Also flagged:lysinegestationcell proliferationIGF-1ureafatty acids
Journal Article 2022-05-01 ✓ 1 Snippet Farmer C, Palin MF, Hovey RC, Falt TD, Huber LA.
In-Text Gene Mentions

MRPL39

Show Full Abstract

The goal of this project was to determine if standardized ileal digestible (SID) lysine provided at 40% above estimated requirements, with the concomitant increase in protein intake, from days 90 to 110 of gestation would stimulate mammary development in gilts. From day 90 of gestation, Yorkshire × Landrace gilts were fed 2.65 kg of either a conventional diet (CTL, control, n = 19) providing 18.6 g/d of SID Lys or a diet providing 26.0 g/d of SID Lys via additional soybean meal (HILYS, n = 19). Both diets were isoenergetic. Jugular blood samples obtained on days 90 and 110 of gestation were used to measure concentrations of insulin-like growth factor-1 (IGF-1), metabolites, and amino acids (AA). Gilts were necropsied on day 110 ± 1 of gestation to obtain mammary glands for compositional analyses, immunohistochemistry, and analysis of mRNA abundance for AA transporters and markers of cell proliferation and differentiation. The HILYS gilts gained more body weight (P < 0.01) during the experimental period compared with CTL gilts, and had greater fetal weights (1.29 vs. 1.21 ± 0.03 kg, P < 0.05). There was no difference in circulating IGF-1, glucose, or albumin (P > 0.10) between HILYS and CTL gilts on day 110 of gestation, whereas concentrations of urea and free fatty acids were greater (P < 0.01), and those of Trp and Ala were lower (P < 0.05), in HILYS than CTL gilts. The provision of lysine at 40% above estimated requirements increased total mammary parenchymal mass by 44%, as well as total parenchymal fat, protein, DNA, and RNA (P < 0.01). The mRNA abundance of ACACA was greater (P < 0.05) in HILYS than CTL gilts, while only the AA transporter SLC6A14 tended (P < 0.10) to be greater. Results demonstrate that providing dietary Lys above current National Research Council recommendations in late gestation increases mammary development in gilts. Results also indicate that Lys may have been limiting for protein retention. These data suggest that the use of a two-phase feeding strategy during gestation, whereby dietary Lys is increased from day 90, could benefit potential sow milk yield in the subsequent lactation.

Also flagged:Bacterial Pneumonialymphoid interstitial pneumonitischroniclung diseasebronchiectasisrespiratory illness
Journal Article 2022-05-01 No Snippets Boettiger DC, An VT, Lumbiganon P, Wittawatmongkol O, Huu Truong K, Chau Do V, Van Nguyen L, Sun Ly P, Kinikar A, Ounchanum P, Puthanakit T, Kurniati N, Kumarasamy N, Kumara Wati D, Chokephaibulkit K, Jamal Mohamed TA, Sudjaritruk T, Nik Yusoff NK, Siew Fong M, Nallusamy RA, Kariminia A, TREAT Asia Pediatric HIV Observational Database.
Show Full Abstract

<h4>Background</h4>Bacterial pneumonia imparts a major morbidity and mortality burden on children living with HIV, yet effective prevention and treatment options are underutilized. We explored clinical factors associated with severe recurrent bacterial pneumonia among children living with HIV.<h4>Methods</h4>Children enrolled in the TREAT Asia Pediatric HIV Observational Database were included if they started antiretroviral therapy (ART) on or after January 1st, 2008. Factors associated with severe recurrent bacterial pneumonia were assessed using competing-risk regression.<h4>Results</h4>A total of 3,944 children were included in the analysis; 136 cases of severe recurrent bacterial pneumonia were reported at a rate of 6.5 [95% confidence interval (CI): 5.5-7.7] events per 1,000 patient-years. Clinical factors associated with severe recurrent bacterial pneumonia were younger age [adjusted subdistribution hazard ratio (aHR): 4.4 for <5 years versus ≥10 years, 95% CI: 2.2-8.4, P < 0.001], lower weight-for-age z-score (aHR: 1.5 for <-3.0 versus >-2.0, 95% CI: 1.1-2.3, P = 0.024), pre-ART diagnosis of severe recurrent bacterial pneumonia (aHR: 4.0 versus no pre-ART diagnosis, 95% CI: 2.7-5.8, P < 0.001), past diagnosis of symptomatic lymphoid interstitial pneumonitis or chronic HIV-associated lung disease, including bronchiectasis (aHR: 4.8 versus no past diagnosis, 95% CI: 2.8-8.4, P < 0.001), low CD4% (aHR: 3.5 for <10% versus ≥25%, 95% CI: 1.9-6.4, P < 0.001) and detectable HIV viral load (aHR: 2.6 versus undetectable, 95% CI: 1.2-5.9, P = 0.018).<h4>Conclusions</h4>Children <10-years-old and those with low weight-for-age, a history of respiratory illness, low CD4% or poorly controlled HIV are likely to gain the greatest benefit from targeted prevention and treatment programs to reduce the burden of bacterial pneumonia in children living with HIV.

Also flagged:chromosomechromatinArgonautedosage compensationxol-1chromosomes
Journal Article 2022-05-01 ✓ 1 Snippet Davis MB, Jash E, Chawla B, Haines RA, Tushman LE, Troll R, Csankovszki G.
In-Text Gene Mentions

DCC

Show Full Abstract

Dosage compensation involves chromosome-wide gene regulatory mechanisms which impact higher order chromatin structure and are crucial for organismal health. Using a genetic approach, we identified Argonaute genes which promote dosage compensation in Caenorhabditis elegans. Dosage compensation in C. elegans hermaphrodites is initiated by the silencing of xol-1 and subsequent activation of the dosage compensation complex which binds to both hermaphrodite X chromosomes and reduces transcriptional output by half. A hallmark phenotype of dosage compensation mutants is decondensation of the X chromosomes. We characterized this phenotype in Argonaute mutants using X chromosome paint probes and fluorescence microscopy. We found that while nuclear Argonaute mutants hrde-1 and nrde-3, as well as mutants for the piRNA Argonaute prg-1, exhibit derepression of xol-1 transcripts, they also affect X chromosome condensation in a xol-1-independent manner. We also characterized the physiological contribution of Argonaute genes to dosage compensation using genetic assays and found that hrde-1 and nrde-3 contribute to healthy dosage compensation both upstream and downstream of xol-1.

Also flagged:Breast CancercancerHER-2deathmineralsflavonoids
Journal Article 2022-05-01 No Snippets Nguyen SM, Tran HTT, Nguyen LM, Bui OT, Hoang DV, Hoang DV, Shrubsole MJ, Cai Q, Ye F, Zheng W, Luu HN, Tran TV, Shu XO.
Show Full Abstract

<h4>Background</h4>Evidence on associations between dietary intake and risk of breast cancer subtypes is limited and inconsistent. We evaluated associations of fruit, vegetable, meat, and fish consumption with risk of breast cancer overall and by molecular subtype in the Vietnamese Breast Cancer Study (VBCS).<h4>Method</h4>VBCS includes 476 incident breast cancer cases and 454 age-matched controls. Dietary habits over the past 5 years were assessed by in-person interviews using a validated food frequency questionnaire. Associations of food groups with breast cancer were evaluated via logistic regression for overall and molecular subtype with adjustment for age, education, income, family history of cancer, menopausal status, body mass index, exercise, total energy intake, and other potential dietary confounders. Odds ratio (OR) was used to approximate relative risk.<h4>Results</h4>High fruit intake was inversely associated with breast cancer risk, with adjusted ORs [95% confidence intervals (CI)] of 0.67 (95% CI, 0.47-0.95) and 0.41 (95% CI, 0.27-0.61) for second and third tertiles versus first tertile, respectively (Ptrend < 0.001). This association was stronger for triple-negative than other subtypes (Pheterogeneity < 0.001). High intake of freshwater fish was inversely associated with overall breast cancer (ORT3vsT1 = 0.63; 95% CI, 0.42-0.95; Ptrend = 0.03). An inverse association was observed between HER2-enriched subtype and red and organ meat intake (ORT3vsT1 = 0.40; 95% CI, 0.17-0.93; Ptrend = 0.04; Pheterogeneity = 0.50).<h4>Conclusions</h4>High intakes of fruit and freshwater fish were associated with reduced breast cancer risk; association for the former was stronger for triple-negative subtype.<h4>Impact</h4>Our findings suggest high intakes of fruit and freshwater fish may reduce breast cancer risk among Vietnamese women.

Also flagged:ZNF384leukemiasEp300leukemiamyeloid leukemiahistone 3
Journal Article 2022-05-01 No Snippets Dickerson KM, Qu C, Gao Q, Iacobucci I, Gu Z, Yoshihara H, Backhaus EA, Chang Y, Janke LJ, Xu B, Wu G, Papachristou EK, D'Santos CS, Roberts KG, Mullighan CG.
Show Full Abstract

ZNF384-rearranged fusion oncoproteins (FO) define a subset of lineage ambiguous leukemias, but their mechanistic role in leukemogenesis and lineage ambiguity is poorly understood. Using viral expression in mouse and human hematopoietic stem and progenitor cells (HSPC) and a Ep300::Znf384 knockin mouse model, we show that ZNF384 FO promote hematopoietic expansion, myeloid lineage skewing, and self-renewal. In mouse HSPCs, concomitant lesions, such as NRASG12D, were required for fully penetrant leukemia, whereas in human HSPCs, expression of ZNF384 FO drove B/myeloid leukemia, with sensitivity of a ZNF384-rearranged xenograft to FLT3 inhibition in vivo. Mechanistically, ZNF384 FO occupy a subset of predominantly intragenic/enhancer regions with increased histone 3 lysine acetylation and deregulate expression of hematopoietic stem cell transcription factors. These data define a paradigm for FO-driven lineage ambiguous leukemia, in which expression in HSPCs results in deregulation of lineage-specific genes and hematopoietic skewing, progressing to full leukemia in the context of proliferative stress.<h4>Significance</h4>Expression of ZNF384 FO early in hematopoiesis results in binding and deregulation of key hematopoietic regulators, skewing of hematopoiesis, and priming for leukemic transformation. These results reveal the interplay between cell of origin and expression of ZNF384 FO to mediate lineage ambiguity and leukemia development. This article is highlighted in the In This Issue feature, p. 171.

Also flagged:watercell growthα-amylasenitrosoguanidineextracellularkanamycin
Journal Article 2022-05-01 No Snippets Yuan H, Tu R, Tong X, Lin Y, Zhang Y, Wang Q.
Show Full Abstract

Droplet-based microfluidics has emerged as a powerful tool for single-cell screening with ultrahigh throughput, but its widespread application remains limited by the accessibility of a droplet microfluidic high-throughput screening (HTS) platform, especially to common laboratories having no background in microfluidics. Here, we first developed a microfluidic HTS platform based on fluorescence-activated droplet sorting technology. This platform allowed (i) encapsulation of single cells in monodisperse water-in-oil droplets; (ii) cell growth and protein production in droplets; and (iii) sorting of droplets based on their fluorescence intensities. To validate the platform, a model selection experiment of a binary mixture of Bacillus strains was performed, and a 45.6-fold enrichment was achieved at a sorting rate of 300 droplets per second. Furthermore, we used the platform for the selection of higher α-amylase-producing Bacillus licheniformis strains from a mutant library generated by atmospheric and room temperature plasma mutagenesis, and clones displaying over 50% improvement in α-amylase productivity were isolated. This droplet screening system could be applied to the engineering of other industrially valuable strains.

Also flagged:tumorcancerCD8pp65IFNγBTN3A1
Journal Article 2022-05-01 ✓ 1 Snippet Walwyn-Brown K, Pugh J, Cocker ATH, Beyzaie N, Singer BB, Olive D, Guethlein LA, Parham P, Djaoud Z.
In-Text Gene Mentions

BTN2A1

Show Full Abstract

γδ T cells stimulated by phosphoantigens (pAg) are potent effectors that secrete Th1 cytokines and kill tumor cells. Consequently, they are considered candidates for use in cancer immunotherapy. However, they have proven only moderately effective in several clinical trials. We studied the consequences of pAg-stimulated γδ T-cell interactions with natural killer (NK) cells and CD8+ T cells, major innate and adaptive effectors, respectively. We found that pAg-stimulated γδ T cells suppressed NK-cell responses to "missing-self" but had no effect on antigen-specific CD8+ T-cell responses. Extensive analysis of the secreted cytokines showed that pAg-stimulated γδ T cells had a proinflammatory profile. CMV-pp65-specific CD8+ T cells primed with pAg-stimulated γδ T cells showed little effect on responses to pp65-loaded target cells. By contrast, NK cells primed similarly with γδ T cells had impaired capacity to degranulate and produce IFNγ in response to HLA class I-deficient targets. This effect depended on BTN3A1 and required direct contact between NK cells and γδ T cells. γδ T-cell priming of NK cells also led to a downregulation of NKG2D and NKp44 on NK cells. Every NK-cell subset was affected by γδ T cell-mediated immunosuppression, but the strongest effect was on KIR+NKG2A- NK cells. We therefore report a previously unknown function for γδ T cells, as brakes of NK-cell responses to "missing-self." This provides a new perspective for optimizing the use of γδ T cells in cancer immunotherapy and for assessing their role in immune responses to pAg-producing pathogens. See related Spotlight by Kabelitz, p. 543.

Also flagged:PHFERMUNC-5growth coneNetrinaxon guidance
Journal Article 2022-05-01 ✓ 3 Snippets Mahadik SS, Lundquist EA.
In-Text Gene Mentions

…the UNC-6 receptor UNC-40/DCCstimulates protrusion dorsally…

…are independent of UNC-40/DCC, UNC-33/CRMP, and UNC-34/Enab…

DCC

Show Full Abstract

UNC-6/Netrin is a secreted conserved guidance cue that regulates dorsal-ventral axon guidance of Caenorhabditis elegans and in the vertebral spinal cord. In the polarity/protrusion model of VD growth cone guidance away from ventrally expressed UNC-6 (repulsion), UNC-6 first polarizes the growth cone via the UNC-5 receptor such that filopodial protrusions are biased dorsally. UNC-6 then regulates a balance of protrusion in the growth cone based upon this polarity. UNC-5 inhibits protrusion ventrally, and the UNC-6 receptor UNC-40/DCC stimulates protrusion dorsally, resulting in net dorsal growth cone outgrowth. UNC-5 inhibits protrusion through the flavin monooxygenases FMO-1, 4, and 5 and possible actin destabilization, and inhibits pro-protrusive microtubule entry into the growth cone utilizing UNC-33/CRMP. The PH/MyTH4/FERM myosin-like protein was previously shown to act with UNC-5 in VD axon guidance utilizing axon guidance endpoint analysis. Here, we analyzed the effects of MAX-1 on VD growth cone morphology during outgrowth. We found that max-1 mutant growth cones were smaller and less protrusive than wild type, the opposite of the unc-5 mutant phenotype. Furthermore, genetic interactions suggest that MAX-1 might normally inhibit UNC-5 activity, such that in a max-1 mutant growth cone, UNC-5 is overactive. Our results, combined with previous studies suggesting that MAX-1 might regulate UNC-5 levels in the cell or plasma membrane localization, suggest that MAX-1 attenuates UNC-5 signaling by regulating UNC-5 stability or trafficking. Alternately, MAX-1 might inhibit UNC-5 independent of this known mechanism. We also show that the effects of MAX-1 in growth cone protrusion are independent of UNC-40/DCC, UNC-33/CRMP, and UNC-34/Enabled. In summary, in the context of growth cone protrusion, MAX-1 inhibits UNC-5, demonstrating the mechanistic insight that can be gained by analyzing growth cones during outgrowth in addition to axon guidance endpoint analysis.

Also flagged:inheritedWilson diseaseWDATP7Bcoppermetabolism
Journal Article 2022-05-01 ✓ 4 Snippets Zhou D, Jia S, Yi L, Wu Z, Song Y, Zhang B, Li Y, Yang X, Xu A, Li X, Zhang W, Duan W, Li Z, Qi S, Chen Z, Ouyang Q, Jia J, Huang J, Ou X, You H.
In-Text Gene Mentions

A modifier gene is a gene that, when mutated, does not produce an effect on its own, but may produce or enhance clinical manifestations when coupled with another genetic mutation.13 Several genes have been proposed as potential modifier genes for WD, including ATOX1 (antioxidant copper chaperone 1)14, COMMD1 (copper metabolism domain-containing 1)15, XIAP (X-linked inhibitor of apoptosis)16, and HFE (hemochromatosis gene).17 However, none of these candidates has been confirmed by additional research.

…16 , andHFE(hemochromatosis gene).…

…, and HFE (hemochromatosisgene).…

…XIAP , andHFE.…

Show Full Abstract

The mutations in modifier genes may contribute to some inherited diseases including Wilson disease (WD). This study was designed to identify potential modifier genes that contribute to WD. A total of 10 WD patients with single or no heterozygous ATP7B mutations were recruited for whole-exome sequencing (WES). Five hundred and thirteen candidate genes, of which the genetic variants present in at least two patients, were identified. In order to clarify which proteins might be involved in copper transfer or metabolism processes, the isobaric tags for relative and absolute quantitation (iTRAQ) was performed to identify the differentially expressed proteins between normal and CuSO4-treated cell lines. Thirteen genes/proteins were identified by both WES and iTRAQ, indicating that disease-causing variants of these genes may actually contribute to the aberrant copper ion accumulation. Additionally, the c.86C > T (p.S29L) mutation in the SLC31A2 gene (coding CTR2) has a relative higher frequency in our cohort of WD patients (6/191) than reported (0.0024 in gnomAD database) in our healthy donors (0/109), and CTR2S29L leads to increased intracellular Cu concentration and Cu-induced apoptosis in cultured cell lines. In conclusion, the WES and iTRAQ approaches successfully identified several disease-causing variants in potential modifier genes that may be involved in the WD phenotype.

Also flagged:chromatinorganizationcell growthgene expressionextracellularPol II
Journal Article 2022-05-01 No Snippets Liu Y, Ding B, Zheng L, Xu P, Liu Z, Chen Z, Wu P, Zhao Y, Pan Q, Guo Y, Wang W, Wei W.
Show Full Abstract

Increasing evidence shows that promoters and enhancers could be related to 3D chromatin structure, thus affecting cellular functions. Except for their roles in forming canonical chromatin loops, promoters and enhancers have not been well studied regarding the maintenance of broad chromatin organization. Here, we focused on the active promoters/enhancers predicted to form many 3D contacts with other active promoters/enhancers (referred to as hotspots) and identified dozens of loci essential for cell growth and survival through CRISPR screening. We found that the deletion of an essential hotspot could lead to changes in broad chromatin organization and the expression of distal genes. We showed that the essentiality of hotspots does not result from their association with individual genes that are essential for cell viability but rather from their association with multiple dysregulated non-essential genes to synergistically impact cell fitness.

Also flagged:degradationdosage compensation proteindosage compensationspermiogenesisgene expressionmating
Journal Article 2022-05-01 ✓ 4 Snippets Li Q, Kaur A, Mallory B, Hariri S, Engebrecht J.
In-Text Gene Mentions

…dosage compensation complex (DCC; Plenefisch et al.…

…elegans , theDCCdownregulates gene expression…

…Consequently, theDCCis essential for…

…component of theDCCessential for embryonic…

Show Full Abstract

Biological sex affects numerous aspects of biology, yet how sex influences different biological processes have not been extensively studied at the molecular level. Caenorhabditis elegans, with both hermaphrodites (functionally females as adults) and males, is an excellent system to uncover how sex influences physiology. Here, we describe a method to isolate large quantities of C. elegans males by conditionally degrading DPY-27, a component of the dosage compensation complex essential for hermaphrodite, but not male, development. We show that germ cells from males isolated following DPY-27 degradation undergo meiosis and spermiogenesis like wild type and these males are competent to mate and sire viable offspring. We further demonstrate the efficacy of this system by analyzing gene expression and performing affinity pull-downs from male worm extracts.

Also flagged:SIRT1deacetylaseageingACANglycosaminoglycansARID5B
Journal Article 2022-05-01 ✓ 1 Snippet Smith CA, Humphreys PA, Bates N, Naven MA, Cain SA, Dvir-Ginzberg M, Kimber SJ.
In-Text Gene Mentions

…factors SOX5 ,SOX6and SOX9 .…

Show Full Abstract

Epigenetic modification is a key driver of differentiation, and the deacetylase Sirtuin1 (SIRT1) is an established regulator of cell function, ageing, and articular cartilage homeostasis. Here we investigate the role of SIRT1 during development of chondrocytes by using human embryonic stem cells (hESCs). HESC-chondroprogenitors were treated with SIRT1 activator; SRT1720, or inhibitor; EX527, during differentiation. Activation of SIRT1 early in 3D-pellet culture led to significant increases in the expression of ECM genes for type-II collagen (COL2A1) and aggrecan (ACAN), and chondrogenic transcription factors SOX5 and ARID5B, with SOX5 ChIP analysis demonstrating enrichment on the chondrocyte specific -10 (A1) enhancer of ACAN. Unexpectedly, when SIRT1 was activated, while ACAN was enhanced, glycosaminoglycans (GAGs) were reduced, paralleled by down regulation of gene expression for N-acetylgalactosaminyltransferase type 1 (GALNT1) responsible for GAG chain initiation/elongation. A positive correlation between ARID5B and COL2A1 was observed, and co-IP assays indicated association of ARID5B with SIRT1, further suggesting that COL2A1 expression is promoted by an ARID5B-SIRT1 interaction. In conclusion, SIRT1 activation positively impacts on the expression of the main ECM proteins, while altering ECM composition and suppressing GAG content during human cartilage development. These results suggest that SIRT1 activity has a differential effect on GAGs and proteins in developing hESC-chondrocytes and could only be beneficial to cartilage development and matrix protein synthesis if balanced by addition of positive GAG mediators.

Also flagged:insulininnate immunityhyperglycemiametabolic disordersdiabetesSirt1
Journal Article 2022-05-01 No Snippets Palu RAS, Owings KG, Garces JG, Nicol A.
Show Full Abstract

Variation in the onset, progression, and severity of symptoms associated with metabolic disorders such as diabetes impairs the diagnosis and treatment of at-risk patients. Diabetes symptoms, and patient variation in these symptoms, are attributed to a combination of genetic and environmental factors, but identifying the genes and pathways that modify diabetes in humans has proven difficult. A greater understanding of genetic modifiers and the ways in which they interact with metabolic pathways could improve the ability to predict a patient's risk for severe symptoms, as well as enhance the development of individualized therapeutic approaches. In this study, we use the Drosophila Genetic Reference Panel to identify genetic variation influencing hyperglycemia associated with loss of Sirt1 function. Through analysis of individual candidate functions, physical interaction networks, and gene set enrichment analysis, we identify not only modifiers involved in canonical glucose metabolism and insulin signaling, but also genes important for neuronal signaling and the innate immune response. Furthermore, reducing the expression of several of these candidates suppressed hyperglycemia, making them potential candidate therapeutic targets. These analyses showcase the diverse processes contributing to glucose homeostasis and open up several avenues of future investigation.

Also flagged:PERV-Atransposonviral infectioninfectiongagpol
Journal Article 2022-05-01 ✓ 1 Snippet Chen JQ, Zhang MP, Tong XK, Li JQ, Zhang Z, Huang F, Du HP, Zhou M, Ai HS, Huang LS.
In-Text Gene Mentions

…and human-tropic PERV-A/C.PERV-JX4diverged from the…

Show Full Abstract

In pig-to-human xenotransplantation, the transmission risk of porcine endogenous retroviruses (PERVs) is of great concern. However, the distribution of PERVs in pig genomes, their genetic variation among Eurasian pigs, and their evolutionary history remain unclear. We scanned PERVs in the current pig reference genome (assembly Build 11.1), and identified 36 long complete or near-complete PERVs (lcPERVs) and 23 short incomplete PERVs (siPERVs). Besides three known PERVs (PERV-A, -B, and -C), four novel types (PERV-JX1, -JX2, -JX3, and -JX4) were detected in this study. According to evolutionary analyses, the newly discovered PERVs were more ancient, and PERV-Bs probably experienced a bottleneck ~0.5 million years ago (Ma). By analyzing 63 high-quality porcine whole-genome resequencing data, we found that the PERV copy numbers in Chinese pigs were lower (32.0±4.0) than in Western pigs (49.1±6.5). Additionally, the PERV sequence diversity was lower in Chinese pigs than in Western pigs. Regarding the lcPERV copy numbers, PERV-A and -JX2 in Western pigs were higher than in Chinese pigs. Notably, Bama Xiang (BMX) pigs had the lowest PERV copy number (27.8±5.1), and a BMX individual had no PERV-C and the lowest PERV copy number (23), suggesting that BMX pigs were more suitable for screening and/or modification as xenograft donors. Furthermore, we identified 451 PERV transposon insertion polymorphisms (TIPs), of which 86 were shared by all 10 Chinese and Western pig breeds. Our findings provide systematic insights into the genomic distribution, variation, evolution, and possible biological function of PERVs.

Also flagged:COVID-19infectionssteroidbiosynthesiscomplement activationIL1
Journal Article 2022-05-01 ✓ 1 Snippet Budhraja A, Basu A, Gheware A, Abhilash D, Rajagopala S, Pakala S, Sumit M, Ray A, Subramaniam A, Mathur P, Nambirajan A, Kumar S, Gupta R, Wig N, Trikha A, Guleria R, Sarkar C, Gupta I, Jain D.
In-Text Gene Mentions

…( AGT ),SERPINC1and CYP2E1 are…

Show Full Abstract

To elucidate the molecular mechanisms that manifest lung abnormalities during severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infections, we performed whole-transcriptome sequencing of lung autopsies from 31 patients with severe COVID-19 and ten uninfected controls. Using metatranscriptomics, we identified the existence of two distinct molecular signatures of lethal COVID-19. The dominant 'classical' signature (n=23) showed upregulation of the unfolded protein response, steroid biosynthesis and complement activation, supported by massive metabolic reprogramming leading to characteristic lung damage. The rarer signature (n=8) that potentially represents 'cytokine release syndrome' (CRS) showed upregulation of cytokines such as IL1 and CCL19, but absence of complement activation. We found that a majority of patients cleared SARS-CoV-2 infection, but they suffered from acute dysbiosis with characteristic enrichment of opportunistic pathogens such as Staphylococcus cohnii in 'classical' patients and Pasteurella multocida in CRS patients. Our results suggest two distinct models of lung pathology in severe COVID-19 patients, which can be identified through complement activation, presence of specific cytokines and characteristic microbiome. These findings can be used to design personalized therapy using in silico identified drug molecules or in mitigating specific secondary infections.

Also flagged:chronic lung diseasebronchopulmonary dysplasiaSerpinf1cell communicationLy6aCol14a1
Journal Article 2022-05-01 ✓ 1 Snippet Mižíková I, Lesage F, Cyr-Depauw C, Cook DP, Hurskainen M, Hänninen SM, Vadivel A, Bardin P, Zhong S, Carpén O, Vanderhyden BC, Thébaud B.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Late lung development is a period of alveolar and microvascular formation, which is pivotal in ensuring sufficient and effective gas exchange. Defects in late lung development manifest in premature infants as a chronic lung disease named bronchopulmonary dysplasia (BPD). Numerous studies demonstrated the therapeutic properties of exogenous bone marrow and umbilical cord-derived mesenchymal stromal cells (MSCs) in experimental BPD. However, very little is known regarding the regenerative capacity of resident lung MSCs (L-MSCs) during normal development and in BPD. In this study we aimed to characterize the L-MSC population in homeostasis and upon injury. We used single-cell RNA sequencing (scRNA-seq) to profile in situ Ly6a+ L-MSCs in the lungs of normal and O2-exposed neonatal mice (a well-established model to mimic BPD) at 3 developmental timepoints (postnatal days 3, 7, and 14). Hyperoxia exposure increased the number and altered the expression profile of L-MSCs, particularly by increasing the expression of multiple pro-inflammatory, pro-fibrotic, and anti-angiogenic genes. In order to identify potential changes induced in the L-MSCs transcriptome by storage and culture, we profiled 15 000 Ly6a+ L-MSCs after in vitro culture. We observed great differences in expression profiles of in situ and cultured L-MSCs, particularly those derived from healthy lungs. Additionally, we have identified the location of Ly6a+/Col14a1+ L-MSCs in the developing lung and propose Serpinf1 as a novel, culture-stable marker of L-MSCs. Finally, cell communication analysis suggests inflammatory signals from immune and endothelial cells as main drivers of hyperoxia-induced changes in L-MSCs transcriptome.

Also flagged:RNA binding proteinsRNA‐binding proteinsFUS
Journal Article 2022-05-01 No Snippets Ho WL, Huang JR.
Show Full Abstract

Aromatic residues appeared relatively late in the evolution of protein sequences to stabilize the globular proteins' folding core and are less in the intrinsically disordered regions (IDRs). Recent advances in protein liquid-liquid phase separation (LLPS) studies have also shown that aromatic residues in IDRs often act as "stickers" to promote multivalent interactions in forming higher-order oligomers. To study how general these structure-promoting residues are in IDRs, we compared levels of sequence disorder in RNA binding proteins (RBPs), which are often found to undergo LLPS, and the human proteome. We found that aromatic residues appear more frequently than expected in the IDRs of RBPs and, through multiple sequence alignment analysis, those aromatic residues are often conserved among chordates. Using TDP-43, FUS, and some other well-studied LLPS proteins as examples, the conserved aromatic residues are important to their LLPS-related functions. These analyses suggest that aromatic residues may have contributed twice to evolution: stabilizing structured proteins and assembling biomolecular condensates.

Also flagged:delayed cognitive impairmentCIchromosomeschromosomeAgingAAO
Journal Article 2022-05-01 ✓ 3 Snippets Ramos J, Caywood LJ, Prough MB, Clouse JE, Herington SD, Slifer SH, Fuzzell MD, Fuzzell SL, Hochstetler SD, Miskimen KL, Main LR, Osterman MD, Zaman AF, Whitehead PL, Adams LD, Laux RA, Song YE, Foroud TM, Mayeux RP, St George-Hyslop P, Ogrocki PK, Lerner AJ, Vance JM, Cuccaro ML, Haines JL, Pericak-Vance MA, Scott WK.
In-Text Gene Mentions

…variants in theSHISA6gene are associated…

…located in theSHISA6gene, which is…

SHISA6

Show Full Abstract

<h4>Introduction</h4>Studies of cognitive impairment (CI) in Amish communities have identified sibships containing CI and cognitively unimpaired (CU) individuals. We hypothesize that CU individuals may carry protective alleles delaying age at onset (AAO) of CI.<h4>Methods</h4>A total of 1522 individuals screened for CI were genotyped. The outcome studied was AAO for CI individuals or age at last normal exam for CU individuals. Cox mixed-effects models examined association between age and single nucleotide variants (SNVs).<h4>Results</h4>Three SNVs were significantly associated (P < 5 × 10<sup>-8</sup> ) with AAO on chromosomes 6 (rs14538074; hazard ratio [HR] = 3.35), 9 (rs534551495; HR = 2.82), and 17 (rs146729640; HR = 6.38). The chromosome 17 association was replicated in the independent National Institute on Aging Genetics Initiative for Late-Onset Alzheimer's Disease dataset.<h4>Discussion</h4>The replicated genome-wide significant association with AAO on chromosome 17 is located in the SHISA6 gene, which is involved in post-synaptic transmission in the hippocampus and is a biologically plausible candidate gene for Alzheimer's disease.

Also flagged:TOMM40ZNRF2CSF2RACX3CR1GAPDHRNF146
Journal Article 2022-05-01 ✓ 5 Snippets Lee WS, Al-Ramahi I, Jeong HH, Jang Y, Lin T, Adamski CJ, Lavery LA, Rath S, Richman R, Bondar VV, Alcala E, Revelli JP, Orr HT, Liu Z, Botas J, Zoghbi HY.
In-Text Gene Mentions

DNAJC1

MLLT10

SUDS3

CCDC92

B4GALT5

Show Full Abstract

Many neurodegenerative disorders are caused by abnormal accumulation of misfolded proteins. In spinocerebellar ataxia type 1 (SCA1), accumulation of polyglutamine-expanded (polyQ-expanded) ataxin-1 (ATXN1) causes neuronal toxicity. Lowering total ATXN1, especially the polyQ-expanded form, alleviates disease phenotypes in mice, but the molecular mechanism by which the mutant ATXN1 is specifically modulated is not understood. Here, we identified 22 mutant ATXN1 regulators by performing a cross-species screen of 7787 and 2144 genes in human cells and Drosophila eyes, respectively. Among them, transglutaminase 5 (TG5) preferentially regulated mutant ATXN1 over the WT protein. TG enzymes catalyzed cross-linking of ATXN1 in a polyQ-length-dependent manner, thereby preferentially modulating mutant ATXN1 stability and oligomerization. Perturbing Tg in Drosophila SCA1 models modulated mutant ATXN1 toxicity. Moreover, TG5 was enriched in the nuclei of SCA1-affected neurons and colocalized with nuclear ATXN1 inclusions in brain tissue from patients with SCA1. Our work provides a molecular insight into SCA1 pathogenesis and an opportunity for allele-specific targeting for neurodegenerative disorders.

Also flagged:Autosomal dominant disordersADCasCas9SpCas9SaCas9
Journal Article 2022-05-01 ✓ 2 Snippets Caruso SM, Quinn PM, da Costa BL, Tsang SH.
In-Text Gene Mentions

…mutations in theHTTgene; a substantial…

…substantial decrease inHTTmRNA and protein…

Show Full Abstract

Autosomal dominant disorders present unique challenges, as therapeutics must often distinguish between healthy and diseased alleles while maintaining high efficiency, specificity, and safety. For this task, CRISPR/Cas remains particularly promising. Various CRISPR/Cas systems, like homology-directed repair, base editors, and prime editors, have been demonstrated to selectively edit mutant alleles either by incorporating these mutations into sgRNA sequences (near the protospacer-adjacent motif ["near the PAM"]) or by targeting a novel PAM generated by the mutation ("in the PAM"). However, these probability-based designs are not always assured, necessitating generalized, mutation-agnostic strategies like ablate-and-replace and single-nucleotide polymorphism editing. Here, we detail recent advancements in CRISPR therapeutics to treat a wide range of autosomal dominant disorders and discuss how they are altering the landscape for future therapies.

Also flagged:schizophreniaSETD1Ahistone H3 lysine 4 methyltransferaseneurodevelopmental syndromeCas9Protein Kinase A
Journal Article 2022-05-01 ✓ 2 Snippets Wang S, Rhijn JV, Akkouh I, Kogo N, Maas N, Bleeck A, Ortiz IS, Lewerissa E, Wu KM, Schoenmaker C, Djurovic S, van Bokhoven H, Kleefstra T, Nadif Kasri N, Schubert D.
In-Text Gene Mentions

…glutamatergic signaling (SHISA6, SHISA7, CAMK4, PSD93…

…In particular,SHISA6, which is…

Show Full Abstract

Heterozygous loss-of-function (LoF) mutations in SETD1A, which encodes a subunit of histone H3 lysine 4 methyltransferase, cause a neurodevelopmental syndrome and increase the risk for schizophrenia. Using CRISPR-Cas9, we generate excitatory/inhibitory neuronal networks from human induced pluripotent stem cells with a SETD1A heterozygous LoF mutation (SETD1A<sup>+/-</sup>). Our data show that SETD1A haploinsufficiency results in morphologically increased dendritic complexity and functionally increased bursting activity. This network phenotype is primarily driven by SETD1A haploinsufficiency in glutamatergic neurons. In accordance with the functional changes, transcriptomic profiling reveals perturbations in gene sets associated with glutamatergic synaptic function. At the molecular level, we identify specific changes in the cyclic AMP (cAMP)/Protein Kinase A pathway pointing toward a hyperactive cAMP pathway in SETD1A<sup>+/-</sup> neurons. Finally, by pharmacologically targeting the cAMP pathway, we are able to rescue the network deficits in SETD1A<sup>+/-</sup> cultures. Our results demonstrate a link between SETD1A and the cAMP-dependent pathway in human neurons.

Also flagged:efflux pumpclarithromycinCarbonyl Cyanide 3-chlorophenylhydrazoneVerapamilReserpineAlamar Blue
Journal Article 2022-05-01 No Snippets Teng TL, Shang YY, Huang HR, Chu NH, Chen ST.
Show Full Abstract

<b>Objective:</b> To detect the effects of four efflux pump inhibitors on the minimum inhibitory concentration of clarithromycin (CLA) against <i>Mycobacterium abscessus (M. abscessus)</i> <i>in vitro</i>, and to explore the role of efflux pump in CLA resistance of <i>M. abscessus</i>. <b>Methods:</b> Four frequently-used efflux pump inhibitors (Carbonyl Cyanide 3-chlorophenylhydrazone, CCCP, N, N'-dicyclohexylcarbodiimide, DCC, Verapamil, VP, Reserpine, RSP) were evaluated in this study. The minimum inhibitory concentration (MIC) values of clarithromycin against <i>M. abscessus</i> reference strain and 60 clinical strains with or without efflux pump inhibitors were detected by Alamar Blue method. Sequence analysis of <i>erm(41)</i> and <i>rrl</i> genes known to be associated with CLA resistance in <i>M. abscessus</i> was performed to analyze the correlation between the effect of efflux pump inhibitors on MIC and mutation of resistance-related genes. <b>Results:</b> CCCP, DCC, VP and RSP could reduce the MIC of <i>M. abscessus</i> to CLA, and the effect of RSP was weaker than the other three efflux pump inhibitors. Among the sixty <i>M. abscessus</i> clinical strains, ten strains were resistant to clarithromycin, seven of which had <i>rrl</i> gene mutation. The CLA resistance rate of smooth phenotype isolates was higher than that of rough phenotype isolates. At 3 day of clarithromycin incubation, the MICs of resistant strains were all reduced by efflux pump inhibitors. Compared with the strains with <i>rrl</i> gene mutation, efflux pump inhibitors had a greater effect on the strains without <i>rrl</i> gene mutation. At 14 day of clarithromycin incubation, 83% of <i>M. abscessus</i> subsp. <i>abscessus</i>, were induced to be resistant, and all of them were T28 sequence type of <i>erm(41)</i>. With the occurrence of induced drug resistance, the effect of efflux pump inhibitor on CLA MIC decreased. Efflux pump inhibitors had no statistically significant diffence in the effect of effcux pump inhibitors on CLA MIC levels in different phenotypes of isolates. <b>Conclusions:</b> Efflux pump is involved in the resistance process of <i>M. abscessus</i> to CLA. Efflux pump inhibitors reduce the drug resistance to clarithromycin against <i>M. abscessus</i> in different degrees. The use of efflux pump inhibitors may provide a new way to alleviate the drug resistance of <i>M. abscessus</i>.

Also flagged:PCSK9lipoproteincholesterolcellsurfaceLDL receptor
Journal Article 2022-05-01 No Snippets Seidah NG, Prat A.
Show Full Abstract

This article reviews the discovery of PCSK9, its structure-function characteristics, and its presently known and proposed novel biological functions. The major critical function of PCSK9 deduced from human and mouse studies, as well as cellular and structural analyses, is its role in increasing the levels of circulating low-density lipoprotein (LDL)-cholesterol (LDLc), via its ability to enhance the sorting and escort of the cell surface LDL receptor (LDLR) to lysosomes. This implicates the binding of the catalytic domain of PCSK9 to the EGF-A domain of the LDLR. This also requires the presence of the C-terminal Cys/His-rich domain, its binding to the secreted cytosolic cyclase associated protein 1, and possibly another membrane-bound "protein X". Curiously, in PCSK9-deficient mice, an alternative to the downregulation of the surface levels of the LDLR by PCSK9 is taking place in the liver of female mice in a 17β-estradiol-dependent manner by still an unknown mechanism. Recent studies have extended our understanding of the biological functions of PCSK9, namely its implication in septic shock, vascular inflammation, viral infections (Dengue; SARS-CoV-2) or immune checkpoint modulation in cancer via the regulation of the cell surface levels of the T-cell receptor and MHC-I, which govern the antitumoral activity of CD8+ T cells. Because PCSK9 inhibition may be advantageous in these processes, the availability of injectable safe PCSK9 inhibitors that reduces by 50% to 60% LDLc above the effect of statins is highly valuable. Indeed, injectable PCSK9 monoclonal antibody or small interfering RNA could be added to current immunotherapies in cancer/metastasis.

Also flagged:RhoARas homolog gene family member AsmallGTPaseRhosignal transduction
Journal Article 2022-05-01 ✓ 5 Snippets Schmidt SI, Blaabjerg M, Freude K, Meyer M.
In-Text Gene Mentions

The pathology of HD is caused by a mutation in the huntingtin gene (HTT), which results in the expansion of a CAG nucleotide repeat that leads to an elongated polyglutamine tract in the N-terminus of the huntingtin protein (Htt).

Dopamine D2 receptor stimulation by dopamine has been found to act in synergy with mutant Htt to increase aggregate formation, neuritic retraction, and striatal death through activation of the RhoA/ROCK/cofilin pathway, which could be reversed by ROCK inhibition [201,209].

In the R6/2 HD mouse model, Y27632-mediated ROCK inhibition improved rotarod performance and reduced soluble Htt, but it had no effect on Htt aggregation, cellular atrophy in the striatum, or survival, possibly due to suboptimal dosing as no significant reduction of ROCK effector protein phosphorylation was seen [199].

The mechanism was later found to involve Y27632-mediated increase in both proteasomal degradation of Htt and macroautophagy [200].

Despite ubiquitous expression of mutant Htt throughout the HD brain, it is the GABA’ergic medium spiny neurons in the striatum that predominantly degenerate.

Show Full Abstract

Ras homolog gene family member A (RhoA) is a small GTPase of the Rho family involved in regulating multiple signal transduction pathways that influence a diverse range of cellular functions. RhoA and many of its downstream effector proteins are highly expressed in the nervous system, implying an important role for RhoA signaling in neurons and glial cells. Indeed, emerging evidence points toward a role of aberrant RhoA signaling in neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, Huntington's disease, and amyotrophic lateral sclerosis. In this review, we summarize the current knowledge of RhoA regulation and downstream cellular functions with an emphasis on the role of RhoA signaling in neurodegenerative diseases and the therapeutic potential of RhoA inhibition in neurodegeneration.

Also flagged:SynthesisphosphoroushydroxyapatitephosphoruscarbohydrateHydroxyapatite Nanoparticles
Journal Article 2022-05-01 No Snippets Abdelmigid HM, Morsi MM, Hussien NA, Alyamani AA, Alhuthal NA, Albukhaty S.
Show Full Abstract

Nano-fertilizers are innovative materials created by nanotechnology methodologies that may potentially replace traditional fertilizers due to their rapid absorption and controlled distribution of nutrients in plants. In the current study, phosphorous-containing hydroxyapatite nanoparticles (nHAP) were synthesized as a novel phosphorus nano-fertilizer using an environmentally friendly green synthesis approach using pomegranate peel (PPE) and coffee ground (CE) extracts. nHAPs were physicochemically characterized and biologically evaluated utilizing the analysis of biochemical parameters such as photosynthetic activity, carbohydrate levels, metabolites, and biocompatibility changes in <i>Punica granatum</i> L. Cytocompatibility with mammalian cells was also investigated based on MTT assay on a Vero cell line. Dynamic light scattering (DLS) and zeta potential analysis were used to characterize the nHAPs for size and surface charge as well as morphology using scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The nHAPs were found to have different shapes with average sizes of 229.6 nm, 120.6 nm (nHAPs_PPE) and 167.5 nm, 153 nm (nHAPs_CE) using DLS and TEM, respectively. Overall, the present results showed that the synthesized nHAPs had a negative impact on the selected biochemical, cytotoxic, and genotoxic parameters, indicating that the evaluation of nHAP synthesized by this approach has a wide range of applications, especially as a nano-fertilizer.

Also flagged:chimeric antigen receptorhematological malignancieslymphopeniaassociated invariantCancerCTLA-4
Journal Article 2022-05-01 No Snippets Zhou Y, Li M, Zhou K, Brown J, Tsao T, Cen X, Husman T, Bajpai A, Dunn ZS, Yang L.
Show Full Abstract

Cell-based immunotherapy, such as chimeric antigen receptor (CAR) T cell therapy, has revolutionized the treatment of hematological malignancies, especially in patients who are refractory to other therapies. However, there are critical obstacles that hinder the widespread clinical applications of current autologous therapies, such as high cost, challenging large-scale manufacturing, and inaccessibility to the therapy for lymphopenia patients. Therefore, it is in great demand to generate the universal off-the-shelf cell products with significant scalability. Human induced pluripotent stem cells (iPSCs) provide an "unlimited supply" for cell therapy because of their unique self-renewal properties and the capacity to be genetically engineered. iPSCs can be differentiated into different immune cells, such as T cells, natural killer (NK) cells, invariant natural killer T (iNKT) cells, gamma delta T (γδ T), mucosal-associated invariant T (MAIT) cells, and macrophages (Mφs). In this review, we describe iPSC-based allogeneic cell therapy, the different culture methods of generating iPSC-derived immune cells (e.g., iPSC-T, iPSC-NK, iPSC-iNKT, iPSC-γδT, iPSC-MAIT and iPSC-Mφ), as well as the recent advances in iPSC-T and iPSC-NK cell therapies, particularly in combinations with CAR-engineering. We also discuss the current challenges and the future perspectives in this field towards the foreseeable applications of iPSC-based immune therapy.

Also flagged:colorectal cancerorganizationColorectal cancerstumorscancerLgr5
Journal Article 2022-05-01 ✓ 5 Snippets Heinz MC, Peters NA, Oost KC, Lindeboom RGH, van Voorthuijsen L, Fumagalli A, van der Net MC, de Medeiros G, Hageman JH, Verlaan-Klink I, Borel Rinkes IHM, Liberali P, Gloerich M, van Rheenen J, Vermeulen M, Kranenburg O, Snippert HJG.
In-Text Gene Mentions

…LGR5, ASCL2, andOLFM4( 30, 37–40…

…metastases with anOLFM4antibody whose suitability…

…a subpopulation ofOLFM4+ CSCs.…

…completely devoid ofOLFM4( Fig. 1D…

…the lack ofOLFM4+ CSCs at…

Show Full Abstract

Micrometastases of colorectal cancer can remain dormant for years prior to the formation of actively growing, clinically detectable lesions (i.e., colonization). A better understanding of this step in the metastatic cascade could help improve metastasis prevention and treatment. Here we analyzed liver specimens of patients with colorectal cancer and monitored real-time metastasis formation in mouse livers using intravital microscopy to reveal that micrometastatic lesions are devoid of cancer stem cells (CSC). However, lesions that grow into overt metastases demonstrated appearance of de novo CSCs through cellular plasticity at a multicellular stage. Clonal outgrowth of patient-derived colorectal cancer organoids phenocopied the cellular and transcriptomic changes observed during in vivo metastasis formation. First, formation of mature CSCs occurred at a multicellular stage and promoted growth. Conversely, failure of immature CSCs to generate more differentiated cells arrested growth, implying that cellular heterogeneity is required for continuous growth. Second, early-stage YAP activity was required for the survival of organoid-forming cells. However, subsequent attenuation of early-stage YAP activity was essential to allow for the formation of cell type heterogeneity, while persistent YAP signaling locked micro-organoids in a cellularly homogenous and growth-stalled state. Analysis of metastasis formation in mouse livers using single-cell RNA sequencing confirmed the transient presence of early-stage YAP activity, followed by emergence of CSC and non-CSC phenotypes, irrespective of the initial phenotype of the metastatic cell of origin. Thus, establishment of cellular heterogeneity after an initial YAP-controlled outgrowth phase marks the transition to continuously growing macrometastases.<h4>Significance</h4>Characterization of the cell type dynamics, composition, and transcriptome of early colorectal cancer liver metastases reveals that failure to establish cellular heterogeneity through YAP-controlled epithelial self-organization prohibits the outgrowth of micrometastases. See related commentary by LeBleu, p. 1870.

Also flagged:TumorUCP1Lipid
Journal Article 2022-05-01 ✓ 1 Snippet Xiong Z, Xiao W, Bao L, Xiong W, Xiao H, Qu Y, Yuan C, Ruan H, Cao Q, Wang K, Song Z, Wang C, Hu W, Ru Z, Tong J, Cheng G, Xu T, Meng X, Shi J, Chen Z, Yang H, Chen K, Zhang X.
In-Text Gene Mentions

…Tumor Progression throughPLCL1/UCP1‐Mediated Lipid Browning…

Show Full Abstract

No abstract available.

Also flagged:codingpSNVphosphositesphosphositeSRRM2TRIM28
Journal Article 2022-05-01 ✓ 4 Snippets Pellegrina D, Bahcheli AT, Krassowski M, Reimand J.
In-Text Gene Mentions

Other ARFGEF2 mutations have been linked to autosomal recessive periventricular heterotopia with microcephaly (ARPHM), a rare disorder involving cerebral malformations, severe developmental delay, and recurrent pulmonary infections, whereas loss‐of‐function experiments implicated the gene in neuronal proliferation and migration (Sheen et al, 2004).

…and hospitalization (STARD13,ARFGEF2).…

ARFGEF2regulates membrane trafficking…

…OtherARFGEF2mutations have been…

Show Full Abstract

SARS-CoV-2 infection hijacks signaling pathways and induces protein-protein interactions between human and viral proteins. Human genetic variation may impact SARS-CoV-2 infection and COVID-19 pathology; however, the genetic variation in these signaling networks remains uncharacterized. Here, we studied human missense single nucleotide variants (SNVs) altering phosphorylation sites modulated by SARS-CoV-2 infection, using machine learning to identify amino acid substitutions altering kinase-bound sequence motifs. We found 2,033 infrequent phosphorylation-associated SNVs (pSNVs) that are enriched in sequence motif alterations, potentially reflecting the evolution of signaling networks regulating host defenses. Proteins with pSNVs are involved in viral life cycle and host responses, including RNA splicing, interferon response (TRIM28), and glucose homeostasis (TBC1D4) with potential associations with COVID-19 comorbidities. pSNVs disrupt CDK and MAPK substrate motifs and replace these with motifs of Tank Binding Kinase 1 (TBK1) involved in innate immune responses, indicating consistent rewiring of signaling networks. Several pSNVs associate with severe COVID-19 and hospitalization (STARD13, ARFGEF2). Our analysis highlights potential genetic factors contributing to inter-individual variation of SARS-CoV-2 infection and COVID-19 and suggests leads for mechanistic and translational studies.

Also flagged:neuroblastomatranscription factorsgene expressionCancertumorNB
Journal Article 2022-05-01 ✓ 2 Snippets Shendy NAM, Zimmerman MW, Abraham BJ, Durbin AD.
In-Text Gene Mentions

The identification of SE-regulated loci in MYCN-non-amplified low-risk groups also includes other TFs, including RORA, STAT3, TCF4, SOX6, and EBF1, which provides a tantalizing selection of genes for further study of differences in transcriptional regulation between metastatic high- and low-risk tumors, which include the enigmatic self-involuting stage-4S NB.

…, TCF4 ,SOX6, and EBF1…

Show Full Abstract

Cell state is controlled by master transcription factors (mTFs) that determine the cellular gene expression program. Cancer cells acquire dysregulated gene expression programs by mutational and non-mutational processes. Intratumoral heterogeneity can result from cells displaying distinct mTF-regulated cell states, which co-exist within the tumor. One archetypal tumor associated with transcriptionally regulated heterogeneity is high-risk neuroblastoma (NB). Patients with NB have poor overall survival despite intensive therapies, and relapsed patients are commonly refractory to treatment. The cellular populations that comprise NB are marked by different cohorts of mTFs and differential sensitivity to conventional therapies. Recent studies have highlighted mechanisms by which NB cells dynamically shift the cell state with treatment, revealing new opportunities to control the cellular response to treatment by manipulating cell-state-defining transcriptional programs. Here, we review recent advances in understanding transcriptionally defined cancer heterogeneity. We offer challenges to the field to encourage translation of basic science into clinical benefit.

Also flagged:breast cancercell growthestrogen receptorRh2cell cycleestrogen receptors
Journal Article 2022-05-01 ✓ 1 Snippet Peng K, Luo T, Li J, Huang J, Dong Z, Liu J, Pi C, Zou Z, Gu Q, Liu O, Zhang JT, Luo ZY.
In-Text Gene Mentions

Tumor suppressor gene ERβsuppressor gene ERβ…

Show Full Abstract

Ginsenoside Rh2 is one of rare panaxidiols extracted from <i>Panax ginseng</i> and a potential estrogen receptor ligand that exhibits moderate estrogenic activity. However, the effect of Rh2 on growth inhibition and its underlying molecular mechanism in human breast cells are not fully understood. In this study, we tested cell viability by MTT and colony formation assays. Cell growth and cell cycle were determined to investigate the effect of ginsenoside Rh2 by flow cytometry. The expressions of estrogen receptors (ERs), TNFα, and apoptosis-related proteins were detected by qPCR and western blot analysis. The mechanisms of ERα and ERβ action were determined using transfection and inhibitors. Antitumor effect of ginsenoside Rh2 against MCF-7 cells was investigated in xenograft mice. Our results showed that ginsenoside Rh2 induced apoptosis and G1/S phase arrest in MCF-7 cells. Treatment of cells with ginsenoside Rh2 down-regulated protein levels of ERα, and up-regulated mRNA and protein levels of ERβ and TNFα. We also found that ginsenoside Rh2-induced TNFα over-expression is through up-regulation of ERβ initiated by ginsenoside Rh2. Furthermore, ginsenoside Rh2 induced MCF-7 cell apoptosis via estrogen receptor β-TNFα pathway <i>in vivo</i>. These results demonstrate that ginsenoside Rh2 promotes TNFα-induced apoptosis and G1/S phase arrest via regulation of ERβ.

Also flagged:PACAPPAC1-Rpituitary adenylate cyclase-activating polypeptidepeptideargininechromatin
Journal Article 2022-05-01 ✓ 4 Snippets Fan G, Tao Z, Chen S, Zhang H, Yu R.
In-Text Gene Mentions

…otective protein, huntingtin (Htt) can interact with…

…The expression ofHtthas been reported…

…the expression ofHtt.…

…proteins such asHtt, and reduces the…

Show Full Abstract

PAC1-R is a recognized preferential receptor for the neuropeptide of pituitary adenylate cyclase-activating polypeptide (PACAP), which mediates neuroprotective and nerve regenerative activities of PACAP. In this study, we found that in both PAC1R-CHO cells with high expression of PAC1R-eGFP and retinal ganglion cells (RGC-5) with the natural expression of PAC1-R, oligo-peptide PACAP(28-38) and the positively charged arginine-rich penetrating peptide TAT, as positive allosteric modulators of PAC1-R, significantly trigger the nuclear translocation of PAC1-R. The chromatin immunoprecipitation (ChIP)-PCR results show that the nuclear translocated PAC1-R binds with the promoter regions of <i>PAC1-R</i> and its specific ligand <i>PACAP</i>. The up-regulated promoter activities of <i>PAC1-R</i> and <i>PACAP</i> induced by PACAP(28-38) or TAT are positively correlative with the increase of the expression levels of PAC1-R and PACAP. Moreover, the nuclear translocation of PAC1-R induced by PACAP(28-38) or TAT is significantly inhibited by the mutation of PAC1-R on Cys25 and the palmitoylation inhibitor 2-bromopalmitate. Meanwhile, the increase in both PAC1-R and PACAP levels and the neuroprotective activities of PACAP(28-38) and TAT in MPP-induced cell model of Parkinson ' s disease are synchronously inhibited by 2-bromopalmitate, which are positively correlated with the nuclear translocation of PAC1-R induced by PACAP(28-38) or TAT. Bioinformatics analysis and motif enrichment analysis following ChIP-sequencing show that the transcription factors including SP1, Zic2, GATA1, REST and YY1 may be recruited by nuclear PAC1-R and involved in regulating the promoter activities of <i>PAC1-R</i> and <i>PACAP</i>. ChIP-sequencing and related bioinformatics analysis show that the downstream target genes regulated by the nuclear PAC1-R are mostly involved in the process of cellular stress and related to neuroprotection, neuronal genesis and development.

Also flagged:major depressive disordermajor depression disorderTMEM161BCRYBA1PMFBP1LHPP
Journal Article 2022-05-01 ✓ 3 Snippets Gao C, Luo LL, Yue S, Wang FT, Duan XM, Qian YD, Dong YJ, Li HY, Yue J, Xu RX, Liu Y, Gong YD.
In-Text Gene Mentions
⭐ same-sentence co-mention

An 8-loci interaction model (PMFBP1, OLFM4, LHPP, ENOX1, TMEM161B, SPPL3, FBXL4 and L3MBTL2) could predict MDD in women with an accuracy rate of 60.05%.

…interaction model (PMFBP1,OLFM4, LHPP, ENOX1, TMEM161B,…

…ENOX1, TMEM161B, SPPL3,FBXL4and L3MBTL2) could…

Show Full Abstract

<b>Objective:</b> To analyze the gender differences of genetic etiology in the incidence of major depression disorder among Han freshmen. <b>Methods:</b> A 1-year follow-up survey was carried out among 8 079 Han freshmen from Jining, Rizhao and Weifang without lifetime major depressive disorder (MDD) at baseline (April to October 2018) and 4 828 venous blood samples were also collected. After extracting DNA, Sequenom Mass Array time-of-flight mass spectrometry biochip technology was used to detect the genotypes of 17 single nucleotide polymorphisms (SNPs) MDD-related loci. Logistic regression was used for univariate analysis. Generalized multifactor dimension reduction was used to analyze gene-gene interactions. Composite International Diagnostic Interview (CIDI) 3.0 was used for MDD diagnosis. <b>Results:</b> The 1-year incidence of MDD among Han freshmen was 2.23% (95%<i>CI</i>: 1.91%-2.60%) and the gender difference of incidence between males (1.97%, 95%<i>CI</i>: 1.52%-2.56%) and females (2.39%, 95%<i>CI</i>: 1.98%-2.90%) was not statistically significant (<i>P</i>>0.05). AG genotype of rs768705 (nearby gene: TMEM161B) was a risk factor for MDD (<i>OR</i>=1.98, 95%<i>CI</i>: 1.24-2.83). The TC genotype of rs17727765 (nearby gene: CRYBA1) was only a risk factor for MDD in males (<i>OR</i>=9.61, 95%<i>CI</i>: 2.04-45.30). An 8-loci interaction model (PMFBP1, OLFM4, LHPP, ENOX1, TMEM161B, SPPL3, FBXL4 and L3MBTL2) could predict MDD in women with an accuracy rate of 60.05%. No effective prediction model was found for MDD in men. <b>Conclusions:</b> There might be gender differences in the genetic etiology of MDD. Further researches on the genetic causes of MDD in men should be explored.

Also flagged:polystyrenebindingOASoligonucleotidesGsynthesis
Journal Article 2022-05-01 No Snippets Platella C, Napolitano E, Riccardi C, Musumeci D, Montesarchio D.
Show Full Abstract

DNA G-quadruplexes (G4s) are key structures for the development of targeted anticancer therapies. In this context, ligands selectively interacting with G4s can represent valuable anticancer drugs. Aiming at speeding up the identification of G4-targeting synthetic or natural compounds, we developed an affinity chromatography-based assay, named G-quadruplex on Oligo Affinity Support (G4-OAS), by synthesizing G4-forming sequences on commercially available polystyrene OAS. Then, due to unspecific binding of several hydrophobic ligands on nude OAS, we moved to Controlled Pore Glass (CPG). We thus conceived an ad hoc functionalized, universal support on which both the on-support elongation and deprotection of the G4-forming oligonucleotides can be performed, along with the successive affinity chromatography-based assay, renamed as G-quadruplex on Controlled Pore Glass (G4-CPG) assay. Here we describe these assays and their applications to the screening of several libraries of chemically different putative G4 ligands. Finally, ongoing studies and outlook of our G4-CPG assay are reported.

Also flagged:HINoesophageal squamous cell carcinomatumourinvasive cancercancerhigh
Journal Article 2022-05-01 ✓ 1 Snippet Liao G, Dai N, Xiong T, Wang L, Diao X, Xu Z, Ni Y, Chen D, Jiang A, Lin H, Dai S, Bai J.
In-Text Gene Mentions

…genes, for example,SOX6, EHF and GRLH1.…

Show Full Abstract

<h4>Background</h4>High-grade intraepithelial neoplasia (HIN) is the precursor of oesophageal squamous cell carcinoma. The molecular and functional properties of HIN are determined by intrinsic origin cells and the extrinsic microenvironment. Yet, these factors are poorly understood.<h4>Methods</h4>We performed single-cell RNA sequencing of cells from HINs and adjacent tissues from the human oesophagus. We analysed the heterogeneity of basal layer cells and confirmed it using immunostaining. Aneuploid cells in HIN were studied using primary cell culture combined with karyotype analysis. We reconstructed the lineage relationship between tumour and normal populations based on transcriptome similarity. Integration analysis was applied to our epithelial data and published invasive cancer data, and results were confirmed by immunostaining and 3D organoid functional experiments. We also analysed the tumour microenvironment of HIN.<h4>Results</h4>The basal layer contained two cell populations: KRT15<sup>high</sup> STMN1<sup>low</sup> and KRT15<sup>high</sup> STMN1<sup>high</sup> cells, which were located mainly in the interpapillary and papillary zones, respectively. The KRT15<sup>high</sup> STMN1<sup>low</sup> population more closely resembled stem cells and transcriptome similarity revealed that HIN probably originated from these slow-cycling KRT15<sup>high</sup> STMN1<sup>low</sup> cells. 3D Organoid experiments and RNA-sequencing showed that basal-cell features and the differentiation ability of the normal epithelium were largely retained in HIN, but may change dramatically in tumour invasion stage. Moreover, the tumour microenvironment of HIN was characterised by both inflammation and immunosuppression.<h4>Conclusions</h4>Our study provides a comprehensive single-cell transcriptome landscape of human oesophageal HIN. Our findings on the origin cells and unique microenvironment of HIN will allow for the development of strategies to block tumour progression and even prevent cancer initiation.

Also flagged:COVID-19troponina IcTnISARSUTIBNP
Journal Article 2022-05-01 No Snippets Kozak MF, Pessoa YC, Silva LOCE, Cabral MB, Leite BCP, Diniz JD, Saliba A, Kawahara SH.
Show Full Abstract

<h4>Background</h4>Some patients with COVID-19 present myocardial injury.<h4>Objective</h4>To detect myocardial injury in critically ill paediatric patients, and to compare cardiac involvement between children with severe acute respiratory syndrome (SARS) and children with multisystemic inflammatory syndrome (MIS-C).<h4>Methods</h4>All COVID-19 children admitted to a referral intensive care unit were prospectively enrolled and had a two-dimensional echocardiogram (2D-TTE) and a cardiac troponin I (cTnI) assay within the first 72 hours. For statistical analysis, two-sided p < 0.05 was considered significant.<h4>Results</h4>Thirty-three patients were included, of which 51.5% presented elevated cTnI and/or abnormal 2D-TTE and 36.4% needed cardiovascular support, which was more frequent in patients with both raised cTnI and 2D-TTE abnormalities than in patients with normal exams (83.3% and 33.3%, respectively; p 0.006, 95% CI = 0.15-0.73). The most common 2D-TTE findings were pericardial effusion (15.2%) and mitral/tricuspid regurgitation (15.2%). Signs of cardiac involvement were more common in MIS-C than in SARS. MIS-C patients also presented a higher rate of the need for cardiovascular support (66.7% vs 25%, p 0.03, 95% CI = -0.7 to -0.04) and a more frequent rate of raised cTnI (77.8% vs 20.8%; p 0.002, 95% CI = 0.19 to 0.79). The negative predictive values of cTnI for the detection of 2D-TTE abnormalities were 100% for MIS-C patients and 73.7% for SARS patients.<h4>Conclusion</h4>signs of cardiac injury were common, mainly in MIS-C patients. 2D-TTE abnormalities were subtle. To perform a cTnI assay upon admission might help providers to discriminate those patients with a more urgent need for a 2D-TTE.

Also flagged:asthmachromosomeviral infectionsinnate immunitydetoxificationGSTP1
Journal Article 2022-05-01 ✓ 1 Snippet Hernandez-Pacheco N, Kere M, Melén E.
In-Text Gene Mentions

…(e.g., GSTP1 ,B4GALT5, ADCY2 ,…

Show Full Abstract

Investigation of gene-environment interactions (GxE) may provide important insights into the gene regulatory framework in response to environmental factors of relevance for childhood asthma. Over the years, different methodological strategies have been applied, more recently using genome-wide approaches. The best example to date is the major asthma locus on the 17q12-21 chromosome region, viral infections, and airway epithelium processes where recent studies have shed much light on mechanisms in childhood asthma. However, there are challenges with the traditional single variant-single exposure interaction models, as they do not encompass the complexity and cumulative effects of multiple exposures or multiple genetic variants. As such, we need to redefine our traditional GxE thinking, and we propose in this review to expand the GxE concept by also evaluating other omics layers, such as epigenetics, transcriptomics, metabolomics, and proteomics. In addition, host factors such as age, gender, and other exposures are very likely to influence GxE effects and need firmly to be considered in future studies.

Also flagged:DeltaglucoseglycerolNucleic Acidreverse-transcriptaseCOVID-19
Journal Article 2022-05-01 No Snippets Van Heirstraeten L, Ekinci E, Smet M, Berkell M, Willen L, Coppens J, Spiessens A, Xavier BB, Lammens C, Verhaegen J, Van Damme P, Goossens H, Beutels P, Matheeussen V, Desmet S, Theeten H, Malhotra-Kumar S.
Show Full Abstract

Presence of SARS-CoV-2 was monitored in nasopharyngeal samples from young children aged 6-30 months attending day-care centres (DCCs) in Belgium from May 2020-February 2022. SARS-CoV-2 carriage among DCC children was only detected from November 2021, after emergence of Delta and Omicron variants, in 9 of the 42 DCCs screened. In only one DCC, two children tested positive for SARS-CoV-2 at the same sampling time point, suggesting limited transmission of SARS-CoV-2 in Belgian DCCs among young children during the studied period.

Also flagged:Allergic rhinitisallergic diseasesnucleotidesglucocorticoidchronic sinusitisasthma
Journal Article 2022-05-01 ✓ 5 Snippets Kuang Y, Hu B, Huang M, Zhao S, Wu X, Zhang M, Xie Z.
In-Text Gene Mentions

Evidently, miR-205-5P/ PEBP1 plays a vital role in the pathogenesis of AR.

Phosphatidylethanolamine-binding protein 1 (PEBP1) mediates the regulatory role of microRNAs (miRNAs)-205-5p in degranulation and histamine release

In addition to these regulatory roles of PEBP1, some studies suggest that PEBP1 can inhibit the expression of high-mobility group box 1 (HMGB1) signal, which is a ubiquitous nuclear protein to trigger inflammation in AR [16,17].

We attempted to investigate whether miR-205-5P could modulate the expressions of PEBP1/HMGB1/TLR4 in AR mice.

More importantly, anti-DNP IgE increased β-hexosaminidase activity and histamine release of BL-2H3 cells, but miR-205-5P inhibitor treatment could significantly reverse this effect, while PEBP1 silencing could markedly reverse the effects of miR-205-5P inhibitor (Figure 6(c,d)).

Show Full Abstract

miR-205-5p plays a vital role in the inflammation of allergic rhinitis (AR). The study is designed to investigate the effects and mechanism of miR-205-5p in AR in vivo and in vitro. An OVA-induced mice model and anti-DNP IgE-induced RBL-2H3 cell model were established. The pathological alterations in the nasal mucosa were evaluated by hematoxylin-eosin (HE) staining. IgE and histamine levels were detected by corresponding kits and the expressions of PEBP1, High mobility group box-1 (HMGB1) and Toll-like receptor 4 (TLR4) were detected by western blot. The association of miR-205-5p and PEBP1 was determined by dual-luciferase reported assay. β-hexosaminidase activity was to evaluate the degranulation of RBL-2H3 cell. The pathological injury of nasal mucosa was significantly improved by miR-205-5p inhibition compared to AR mice. Following the treatment of miR-205-5p inhibitor, the levels of helper T cell (Th1) cytokines, interleukin (IL)-2 and interferon-γ (IFN-γ) were increased, while the levels of Th2 cytokines, IL-4 and IL-13, as well as the levels of IgE and histamine were markedly decreased in AR mice. We further found that miR-205-5P inhibition induced increased expression of PEBP1 and decreased expressions of HMGB1and TLR4. In vitro, miR-205-5P was verified to bind to PEBP1. PEBP1 silencing led to the reverse of miR-205-5p effects on decreasing the levels of β-hexosaminidase activity and histamine, as well as the expressions of HMGB1 and TLR4 on anti-DNP IgE-induced RBL-2H3 cells. Our results indicate that miR-205-5P inhibition may ameliorate pathological injury via PEBP1. MiR-205-5P/ PEBP1 could be potential drug targets in AR.

Also flagged:osteoarthritisOAzinc finger NFX1-type containing 1nuclear factor erythroid 2-related factor 2Nrf2heme oxygenase 1
Journal Article 2022-05-01 ✓ 5 Snippets Gu Y, Wang G, Xu H.
In-Text Gene Mentions

Long non-coding RNA ZNFX1 antisense 1 (ZFAS1) suppresses anti-oxidative stress in chondrocytes during osteoarthritis by sponging microRNA-1323

…Long non-coding RNAZNFX1 antisense 1antisense 1 (ZFAS1)…

…NFX1-type containing 1 (ZNFX1) antisenseantisense 1 (ZFAS1)…

…containing 1 (ZNFX1) [ 11…

…family member 3aZNFX1Zinc finger NFX1-type…

Show Full Abstract

LncRNAs play a regulatory role in osteoarthritis (OA); however, the detailed mechanism remains to be elucidated. This study aimed to investigate the role of lncRNA zinc finger NFX1-type containing 1 (ZNFX1) antisense 1 (ZFAS1) in OA progression and explore its possible mechanismsagainst oxidative stress. Human cartilage specimens were obtained from 10 patients without OA who underwent traumatic amputation and 25 patients with OA who underwent total knee replacement surgery. Chondrocytes were prepared from harvested articular cartilage. ZFAS1, nuclear factor erythroid 2-related factor 2 (Nrf2), and heme oxygenase 1 (HO-1) expression levels were analyzed using quantitative reverse transcription PCR and WB. The chondrocyte growth was indicated by MTT and colony formation assays. Chondrocyte apoptosis, reactive oxygen species generation, and anti-oxidative enzymes activities were also measured. ZFAS1 expression was reduced in OA samples and lipopolysaccharide (LPS)-treated chondrocytes used as an OA cell model mimic. ZFAS1 overexpression facilitated proliferation and repressed oxidative stress, inflammation, and apoptosis in LPS-induced chondrocytes. ZFAS1 also activated the anti-oxidative Nrf2-HO-1 pathway. ZFAS1 directly targeted miR-1323, which partially reversed the effects of ZFAS1 on chondrocyte proliferation, oxidative stress, inflammation, and apoptosis. Furthermore, Nrf2 was negatively regulated by miR-1323. The effect of miR-1323 inhibition was partly abrogated by the administration of brusatol, an Nrf2 inhibitor. Collectively, the results showed that ZFAS1 promoted chondrocyte proliferation and repressed oxidative stress, possibly by regulating the novel miR-1323-Nrf2 axis of the inflammation and apoptosis triggered by LPS, indicating that ZFAS1 is a promising therapeutic target for OA.

Also flagged:FADDFas-associated death domainadaptor proteinleukemiaacute lymphoblastic leukemiaALL
Journal Article 2022-05-01 No Snippets Zhou W, Lai Y, Zhu J, Xu X, Yu W, Du Z, Wu L, Zhang X, Hua Z.
Show Full Abstract

The Fas-associated death domain (FADD) has long been regarded as a crucial adaptor protein in the extrinsic apoptotic pathway. Despite the non-apoptotic function of FADD is gradually being discovered and confirmed, its corresponding physiological and pathological significance is still unclear. Based on the database of GWAS catalog and GTEx Portal, 17 SNPs associated with leukemia susceptibility were found to be linked to FADD expression. We then investigated a regulatory role of FADD in T-acute lymphoblastic leukemia (T-ALL) using Jurkat cells as a model. Jurkat cells stably depleted of FADD (FADD<sup>-/-</sup> Jurkat) expression exhibited dampened proliferation, hypersensitivity to Etoposide-induced intrinsic apoptosis whereas near total resistance to TRAIL-induced extrinsic apoptosis. Comparison between wild type and FADD<sup>-/-</sup> Jurkat cells using iTRAQ-based proteomics revealed considerably altered expression spectrum of genes, and led us to focus on metabolic pathways. Investigation of glycolytic and mitochondrial pathways and relevant enzymes revealed that FADD knockout triggered a metabolic shift from glycolysis to mitochondrial respiration in Jurkat cells. Re-expression of FADD in FADD<sup>-/-</sup> Jurkat cells partially rescued glycolytic capacity. FADD loss triggers global metabolic reprogramming in Jurkat cells and therefore remains as a potential druggable target for ALL treatment.

Also flagged:decidualizationEndometrial stromal-cell tumorsendometrial stromal sarcomaundifferentiated uterine sarcomaJAZF1SUZ12
Journal Article 2022-05-01 No Snippets Tavares M, Khandelwal G, Muter J, Viiri K, Beltran M, Brosens JJ, Jenner RG.
Show Full Abstract

Polycomb repressive complex 2 (PRC2) methylates histone H3 lysine 27 (H3K27me3) to maintain gene repression and is essential for cell differentiation. In low-grade endometrial stromal sarcoma (LG-ESS), the PRC2 subunit SUZ12 is often fused with the NuA4/TIP60 subunit JAZF1. We show that JAZF1-SUZ12 dysregulates PRC2 composition, genome occupancy, histone modification, gene expression, and cell differentiation. Loss of the SUZ12 N terminus in the fusion protein abrogates interaction with specific PRC2 accessory factors, reduces occupancy at PRC2 target genes, and diminishes H3K27me3. Fusion to JAZF1 increases H4Kac at PRC2 target genes and triggers recruitment to JAZF1 binding sites during cell differentiation. In human endometrial stromal cells, JAZF1-SUZ12 upregulated PRC2 target genes normally activated during decidualization while repressing genes associated with immune clearance, and JAZF1-SUZ12-induced genes were also overexpressed in LG-ESS. These results reveal defects in chromatin regulation, gene expression, and cell differentiation caused by JAZF1-SUZ12 that may underlie its role in oncogenesis.

Also flagged:psychiatric diseasepsychiatric diseasesresponses to externalpsychiatric disorderstranscription factorsgene expression
Journal Article 2022-05-01 No Snippets Sanchez-Priego C, Hu R, Boshans LL, Lalli M, Janas JA, Williams SE, Dong Z, Yang N.
Show Full Abstract

Genome-wide association studies (GWASs) have identified hundreds of loci associated with psychiatric diseases, yet there is a lack of understanding of disease pathophysiology. Common risk variants can shed light on the underlying molecular mechanisms; however, identifying causal variants remains challenging. We map cis-regulatory elements in human neurons derived from pluripotent stem cells. This system allows us to determine enhancers that activate the transcription of neuronal activity-regulated gene programs, which are thought to be critical for synaptic plasticity and are not possible to identify from postmortem tissues. Using the activity-by-contact model, we create variant-to-gene maps to interpret the function of GWAS variants. Our work nominates a subset of variants to elucidate the molecular mechanisms involving GWAS-significant loci. It also highlights that in vitro human cellular models are a powerful platform for identifying and mechanistic studies of human trait-associated genetic variants in cell states that are inaccessible from other types of human samples.

Also flagged:myelodysplastic syndromethrombocytopeniadeep vein thrombosiscoagulationhemostasisDVT
Journal Article 2022-05-01 ✓ 2 Snippets Liu WB, Ma JX, Tong HX.
In-Text Gene Mentions

…Binding toATIII, a highly selective…

…natural activity ofATIIIagainst FXa, thereby…

Show Full Abstract

<h4>Background</h4>The contradictory process of coagulation and anticoagulation maintains normal physiological function, and platelets (PLTs) play a key role in hemostasis and bleeding. When severe thrombocytopenia and deep vein thrombosis (DVT) occur simultaneously, the physician will be confronted with a great challenge, especially when interventional thrombectomy fails.<h4>Case summary</h4>We describe a 52-year-old woman who suffered from myelodysplastic syndrome with severe thrombocytopenia and protein S deficiency with right lower extremity DVT. In this patient, the treatment of DVT was associated with numerous contradictions due to severe thrombocytopenia, especially when interventional thrombectomy was not successful. Fortunately, fondaparinux sodium effectively alleviated the thrombus status of the patient and gradually decreased the D-dimer level. In addition, no increase in bleeding was noted. The application of eltrombopag stimulated the maturation and differentiation of megakaryocytes and increased the peripheral blood PLT count. The clinical symptoms of DVT in the right lower extremities in this patient significantly improved. The patient resumed daily life activities, and the treatment effects were independent of PLT transfusion.<h4>Conclusion</h4>This is a contradictory and complex case, and fondaparinux sodium and eltrombopag may represent a good choice for the treatment of DVT in patients with severe thrombocytopenia.

Also flagged:Primary myelofibrosisthrombophiliathalassemiaGilbert syndrometransverse sinus venous thrombosisJAK2
Journal Article 2022-05-01 ✓ 5 Snippets Wufuer G, Wufuer K, Ba T, Cui T, Tao L, Fu L, Mao M, Duan MH.
In-Text Gene Mentions

Genetic testing showed heterozygous SERPINC1 mutation, bone marrow biopsy showed fibrosis grade 1 (MF-1), and JAK2 V617F mutation was positive, accompanied by UGT1A1 mutation and β-thalassemia gene mutation.<h4>Case summary</h4>A 46-year-old Han man was first found to have sigmoid sinus and transverse sinus venous thrombosis at the age of 42 but had no individual or family thrombosis history, and he had been regularly taking warfarin anticoagulant therapy for a long period of time.

At the same time, UGT1A1 and β-thalassemia gene mutations existed, and a SERPINC1 mutation and UGT1A1 mutation were both found in his parents.<h4>Conclusion</h4>The patient in this case had thrombophilia as the primary symptom, JAK2V617-positive myeloproliferative neoplasm (MPN) was the main potential cause, and hereditary AT-III deficiency may have been one of multiple secondary causes.

…testing showed heterozygousSERPINC1mutation, bone marrow…

…carried a heterozygousSERPINC1mutation.…

…existed, and aSERPINC1mutation and UGT1A1…

Show Full Abstract

<h4>Background</h4>A 46-year-old Han man first had sigmoid sinus and transverse sinus venous thrombosis at the age of 42. At the age of 44, he once again developed thrombosis. Genetic testing showed heterozygous SERPINC1 mutation, bone marrow biopsy showed fibrosis grade 1 (MF-1), and JAK2 V617F mutation was positive, accompanied by UGT1A1 mutation and β-thalassemia gene mutation.<h4>Case summary</h4>A 46-year-old Han man was first found to have sigmoid sinus and transverse sinus venous thrombosis at the age of 42 but had no individual or family thrombosis history, and he had been regularly taking warfarin anticoagulant therapy for a long period of time. At the age of 44, venous thrombosis reappeared in parts of the intrahepatic vein, main portal vein, splenic vein, and superior mesenteric vein, and his spleen was obviously enlarged. He had a history of jaundice for many years, and genetic testing revealed that he carried a heterozygous SERPINC1 mutation. Bone marrow biopsy showed multifocal fibrous tissue hyperplasia among trabeculae and focal fibrosis. He was positive for the JAK2 V617F mutation. At the same time, UGT1A1 and β-thalassemia gene mutations existed, and a SERPINC1 mutation and UGT1A1 mutation were both found in his parents.<h4>Conclusion</h4>The patient in this case had thrombophilia as the primary symptom, JAK2V617-positive myeloproliferative neoplasm (MPN) was the main potential cause, and hereditary AT-III deficiency may have been one of multiple secondary causes. It remains to be determined whether UGT1A1 and β-thalassemia gene mutations are related to thrombophilia. However, the clinical features of MPN in this patient were hidden, and the relevant clinical features of coexisting thalassemia and hereditary Gilbert syndrome, reported here for the first time domestically and abroad, were complicating factors, causing great difficulties for a clear diagnosis. Thus, when thrombophilia has been determined, it is necessary to screen the relevant latent problems overall. When the clinical features cannot be perfectly explained by one etiology, a relevant comprehensive examination should also be initiated from the perspective of multiple etiologies.

Also flagged:HDmembraneneurodegenerative disorderHuntingtonnucleusmultisystem degenerative disorder
Journal Article 2022-05-01 ✓ 2 Snippets Holley SM, Oikonomou KD, Swift CM, Mohan L, Matthews B, Vega O, Mkrtchyan G, Cepeda C, Levine MS.
In-Text Gene Mentions

HD is caused by an autosomal dominant mutation in at least one copy of the huntingtin (HTT) gene (The Huntington’s Disease Collaborative Research Group, 1993).

…the huntingtin (HTT) gene (…

Show Full Abstract

As Huntington's disease (HD) progresses, there is a significant loss of neurons in the striatum in addition to a distinct thinning of the cerebral cortex. Despite an early presence of sensorimotor deficits in patients with HD, electrophysiological studies designed to assess the integrity of thalamocortical circuits are sparse. Using the R6/2 mouse model of HD, we provide evidence of reduced connectivity between thalamic cells and their targeted cortical regions. Whole-cell patch clamp recordings from ventral anterolateral nucleus (VAL; motor) and ventral posteromedial nucleus (VPM; somatosensory) thalamic neurons in <i>ex vivo</i> brain slices of R6/2 and wild-type (WT) mice revealed that cells in both thalamic nuclei of R6/2 mice exhibited significant differences in passive and active cell membrane properties (smaller cell membrane capacitances, faster decay time constants and increased input resistances) compared with WT cells. Although only cells in the VPM of symptomatic R6/2 mice had more depolarized resting membrane potentials compared with WTs, cells in both nuclei displayed increased excitability in symptomatic, but not presymptomatic, R6/2 mice. Optical activation of VAL and VPM terminals elicited smaller magnitude current responses in cortical pyramidal neurons (CPNs) in both motor cortex (M1CTX) and somatosensory barrel cortex (BCTX) of symptomatic R6/2 mice compared with CPNs in WT mice. Furthermore, we observed a decrease in the frequency of thalamocortical excitatory quantal events in R6/2 BCTX CPNs, with no genotype-dependent differences in AMPA:NMDA response amplitude ratios. These data suggest there is a decrease in the transmission of thalamocortical information that is likely because of impaired neurotransmitter release.

Also flagged:transcription factorsbreast cancercancertumor suppressorsoncogenesBRCA
Journal Article 2022-05-01 ✓ 2 Snippets Yang Y, Li Z, Zhong Q, Zhao L, Wang Y, Chi H.
In-Text Gene Mentions

…model, comprising PAX7,POU3F2, ZIC2, WT1, ALX4,…

POU3F2

Show Full Abstract

<h4>Background</h4>Breast cancer (BRCA) is the leading cause of cancer mortality among women, and it is associated with many tumor suppressors and oncogenes. There is increasing evidence that transcription factors (TFs) play vital roles in human malignancies, but TFs-based biomarkers for BRCA prognosis were still rare and necessary. This study sought to develop and validate a prognostic model based on TFs for BRCA patients.<h4>Methods</h4>Differentially expressed TFs were screened from 1,109 BRCA and 113 non-tumor samples downloaded from The Cancer Genome Atlas (TCGA). Univariate Cox regression analysis was used to identify TFs associated with overall survival (OS) of BRCA, and multivariate Cox regression analysis was performed to establish the optimal risk model. The predictive value of the TF model was established using TCGA database and validated using a Gene Expression Omnibus (GEO) data set (GSE20685). A gene set enrichment analysis was conducted to identify the enriched signaling pathways in high-risk and low-risk BRCA patients. Gene Ontology (GO) function and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of the TF target genes were also conducted separately.<h4>Results</h4>A total of 394 differentially expressed TFs were screened. A 9-TF prognostic model, comprising PAX7, POU3F2, ZIC2, WT1, ALX4, FOXJ1, SPIB, LEF1 and NFE2, was constructed and validated. Compared to those in the low-risk group, patients in the high-risk group had worse clinical outcomes (P<0.001). The areas under the curve of the prognostic model for 5-year OS were 0.722 in the training cohort and 0.651 in the testing cohort. Additionally, the risk score was an independent prediction indicator for BRCA patients both in the training cohort (HR =1.757, P<0.001) and testing cohort (HR =1.401, P=0.001). It was associated with various cancer signaling pathways. Ultimately, 9 overlapping target genes were predicted by 3 prediction nomograms. The GO and KEGG enrichment analyses of these target genes suggested that the TFs in the model may regulate the activation of some classical tumor signaling pathways to control the progression of BRCA through these target genes.<h4>Conclusions</h4>Our study developed and validated a novel prognostic TF model that can effectively predict 5-year OS for BRCA patients.

Also flagged:FNDC3Besophageal squamous cell carcinomaESCCwound healingluciferasethioredoxin reductase 1
Journal Article 2022-05-01 ✓ 2 Snippets Tang B, Zhang Q, Liu K, Huang Y.
In-Text Gene Mentions

Among the predicted targets, 7 (SOX6, PPM1L, FZD3, CDC25A, TXNRD1, LASP1, E2F3) genes that have been studied in ESCC were selected for analysis.

…predicted targets, 7 (SOX6, PPM1L, FZD3, CDC25A,…

Show Full Abstract

Exosomal circular RNAs (circRNAs) have been reported to play critical roles in esophageal squamous cell carcinoma (ESCC). We aimed to investigate the function of exosomal circRNA FNDC3B (circFNDC3B). The RNA levels and protein levels were examined using RT-qPCR and western blot (WB) assays. Colony formation and EdU assays were used to assess cell proliferative ability. Cell migratory and invasive abilities were detected by wound healing and transwell assays. Cell apoptosis was measured by flow cytometry. Glycolysis was measured using commercial kits. Transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA) were applied to examine the morphology and size of exosomes. Dual-luciferase reporter, RIP and RNA pull-down assays assessed the interaction of miR-490-5p with circFNDC3B or thioredoxin reductase 1 (TXNRD1). Xenograft tumor model determined the role of exosomal circFNDC3B <i>in vivo</i>. We observed that circFNDC3B was upregulated in ESCC samples and cells, as well as ESCC-derived exosomes. CircFNDC3B could be delivered via exosomes in tumor cells, and the colony formation, proliferation, migration, invasion, glycolysis, and <i>in vivo</i> growth ability of recipient cells were weakened after co-incubation with exosomal circFNDC3B-knockdown donor cells. CircFNDC3B was a miR-490-5p sponge, and miR-490-5p inhibition reversed the role of exosomal circFNDC3B-downregulating in ESCC cells. TXNRD1 was a miR-490-5p target, and TXNRD1 elevation weakened the anti-cancer function of miR-490-5p upregulation in ESCC cells. CircFNDC3B mediated TXNRD1 expression by interacting with miR-490-5p. In conclusion, exosomal circFNDC3B drove ESCC progression via regulating the miR-490-5p/TXNRD1 axis.AbbreviationsEC: esophageal cancer; ESCC: esophageal squamous cell carcinoma; circRNA: circular RNA; WB: western blot; TEM: transmission electron microscopy; NTA: nanoparticle tracking analysis; TXNRD1: thioredoxin reductase 1; IHC: immunohistochemistry; RT-qPCR: reverse transcription-polymerase quantitative chain reaction; GLUT1: glucose transport protein type 1; LDHA: lactate dehydrogenase A.

Also flagged:osteoarthritisOApathogenesisReverse transcriptionhematoxylinLuciferase
Journal Article 2022-05-01 No Snippets Liu J, Tang G, Liu W, Zhou Y, Fan C, Zhang W.
Show Full Abstract

Bone marrow mesenchymal stem cell (BMSC) chondrogenic differentiation contributes to the treatment of osteoarthritis (OA). Numerous studies have indicated that microRNAs (miRNAs) regulate the pathogenesis and development of multiple disorders, including OA. Nevertheless, the role of miR-20a-5p in OA remains obscure. Forty male C57BL/6 mice were divided into four groups and were surgically induced OA or underwent sham surgery in the presence or absence of miR-20a-5p. Flow cytometry was implemented to detect surface markers of BMSCs. Reverse transcription quantitative polymerase chain reaction revealed the upregulation of miR-20a-5p during BMSC chondrogenic differentiation. Western blotting displayed that miR-20a-5p inhibition decreased protein levels of cartilage matrix markers but enhanced those of catabolic and hypertrophic chondrocyte markers in BMSCs. Alcian blue staining, hematoxylin‑eosin staining and micro-CT revealed that miR-20a-5p inhibition restrained chondrogenic differentiation and miR-20a-5p overexpression promoted the repair of damaged cartilage and subchondral bone, respectively. Luciferase reporter assay identified that mitogen activated protein kinase kinase kinase 2 (Map3k2) was a target of miR-20a-5p in BMSCs. Moreover, the expression of miR-20a-5p and Map3k2 was negatively correlated in murine cartilage tissues. Knocking down Map3k2 could rescue the suppressive influence of miR-20a-5p inhibition on chondrogenic differentiation of BMSCs. In conclusion, miR-20a-5p facilitates BMSC chondrogenic differentiation and contributes to cartilage repair in OA by suppressing Map3k2.

Also flagged:DEAD-box helicase 56cell proliferationgastric cancerFOXO1c-Myccancer
Journal Article 2022-05-01 ✓ 3 Snippets Wang J, Wang Y, Wang J, Zhang S, Yu Z, Zheng K, Fu Z, Wang C, Huang W, Chen J.
In-Text Gene Mentions

Existing evidence indicates that DDX5, DDX27, and DDX39 played a major role as oncogenes in gastric cancer and hepatocellular carcinoma (HCC).

…indicates that DDX5,DDX27, and DDX39 played…

…that DDX5 andDDX27knockdown suppressed GC…

Show Full Abstract

DEAD-box helicase (DDX) family exerts a critical effect on cancer initiation and progression through alternative splicing, transcription and ribosome biogenesis. Increasing evidence has demonstrated that DEAD-box helicase 56 (DDX56) is over-expressed in several cancers, which plays an oncogenic role. Till the present, the impact of DDX56 on gastric cancer (GC) remains unclear. We conducted high-throughput sequencing (RNA-seq) to demonstrate aberrant DDX56 levels within 10 GC and matched non-carcinoma tissue samples. DDX56 levels were detected through qRT-PCR, western blotting (WB) and immunochemical staining in GC patients. We conducted gain- and loss-of-function studies to examine DDX56's biological role in GC development. In vitro, we carried out 5‑Ethynyl‑2‑deoxyuridine (EdU), scratch, Transwell, and flow cytometry (FCM) assays for detecting GC cell growth, invasion, migration and apoptosis. Additionally, gene set enrichment analysis (GSEA), WB assay, and Encyclopedia of RNA Interactomes (ENCORI) were carried out for analyzing DDX56-regulated downstream genes and signaling pathways. In vivo, tumor xenograft experiment was performed for investigating how DDX56 affected GC development within BALB/c nude mice. Functionally, DDX56 knockdown arrested cell cycle at G1 phase, invasion and migration of AGS and MKN28 cells, and enhanced their apoptosis. Ectopic DDX56 expression enhanced the cell growth, migration and invasion, and inhibited apoptosis. Knockdown of DDX56 suppressed GC growth in the tumor models of BALB/c nude mice. Mechanistically, DDX56 post-transcriptionally suppressed FOXO1/p21 Cip1 protein expression, which could activate its downstream cyclin E1/CDK2/c-Myc signaling pathways. This sheds lights on the GC pathogenic mechanism and offers a potential anti-cancer therapeutic target.

Also flagged:cGASSTINGnonalcoholic fatty liver diseasechronic liver diseasesynthesiscyclic guanosine monophosphate
Journal Article 2022-05-01 No Snippets Sha CX, Ju LL, Zhou P, Yao DF, Yao M.
Show Full Abstract

Today, nonalcoholic fatty liver disease remains the most dominant chronic liver disease. Cyclic guanosine monophosphate-adenosine monosphosphate synthase (cGAS) is a cytosolic DNA sensor that catalyzes the synthesis of cyclic guanosine monophosphate, activates stimulator of interferon genes (STING), and releases type-I interferon cytokines to trigger immune responses. Exogenous or endogenous DNA acts as a cGAS ligand to activate the cGAS-STING signaling pathway, which plays a role in hepatitis, nonalcoholic fatty liver disease, liver cancer and other diseases, and affects liver disease progression and metabolism through mechanisms such as autophagy. This article reviews the activation of cGAS-STING pathway and its molecular immunological role in nonalcoholic fatty liver disease progression.

Also flagged:infantilecancerinfectious diseasesautoimmune diseasescardiovascular diseasesasthma
Journal Article 2022-05-01 No Snippets Demirtaş MS, Yalçın SS.
Show Full Abstract

Human milk is a popular treatment method applied as a traditional, natural pharmacotherapy that has been going on for many years in many societies. Due to its low cost, widespread and easy use, and lack of undesirable effects, breast milk also has the potential to play a role in evidence-based treatment for tertiary people as well as infant and maternal health. Scientific databases were searched for Literature search from January 1995 to December 2021, including Ovid, PubMed, Google Scholar, Science Direct, ResearchGate, Web of Science Core Collection (Clavirate), and a total of 45 articles from 142 articles written in English were included in the study. According to the results of the current studies reviewed, there is a general conclusion about the positive effects of human milk in the treatment of tertiary persons in addition to the prevention and treatment of common maternal and infantile diseases. Human milk can be used as a different alternative in further studies, especially based on anti-tumoral and cancer studies. In addition, an accessible, safe, and suitable alternative treatment for the treatment of allergic skin and mucous tissue damage in infants and mothers may be suitable for societies with limited access to treatment.

Also flagged:Interleukin-10NotchCytokines(IL)-10IL-10colitis
Journal Article 2022-05-01 ✓ 3 Snippets Morales RA, Rabahi S, Diaz OE, Salloum Y, Kern BC, Westling M, Luo X, Parigi SM, Monasterio G, Das S, Hernández PP, Villablanca EJ.
In-Text Gene Mentions

…stem cell markerOlfm4, nor in the…

…stem cells (Olfm4) and other…

…stem cell markerOLFM4and a potential…

Show Full Abstract

Cytokines are immunomodulatory proteins that orchestrate cellular networks in health and disease. Among these, interleukin (IL)-10 is critical for the establishment of intestinal homeostasis, as mutations in components of the IL-10 signaling pathway result in spontaneous colitis. Whether IL-10 plays other than immunomodulatory roles in the intestines is poorly understood. Here, we report that il10, il10ra, and il10rb are expressed in the zebrafish developing intestine as early as 3 days post fertilization. CRISPR/Cas9-generated il10-deficient zebrafish larvae showed an increased expression of pro-inflammatory genes and an increased number of intestinal goblet cells compared to WT larvae. Mechanistically, Il10 promotes Notch signaling in zebrafish intestinal epithelial cells, which in turn restricts goblet cell expansion. Using murine organoids, we showed that IL-10 modulates goblet cell frequencies in mammals, suggesting conservation across species. This study demonstrates a previously unappreciated IL-10-Notch axis regulating goblet cell homeostasis in the developing zebrafish intestine and may help explain the disease severity of IL-10 deficiency in the intestines of mammals.

Also flagged:new-onset diabetes mellituscystic lesionspancreatic diseasemetabolic syndromecardiovascular diseaseDiabetes Mellitus
Journal Article 2022-05-01 ✓ 1 Snippet Firkins SA, Hart PA, Porter K, Chiang C, Cloyd JM, Dillhoff M, Lara LF, Manilchuk A, Papachristou GI, Pawlik TM, Tsung A, Conwell DL, Krishna SG.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objectives</h4>There is a paucity of literature evaluating new-onset diabetes mellitus (NODM) after resection of pancreatic cystic lesions (PCLs). We sought to characterize the incidence and risk factors associated with NODM after partial pancreatectomy for PCLs.<h4>Methods</h4>We utilized the IBM MarketScan Database (2012-2018) to identify all nondiabetic adults who underwent partial pancreatectomy for PCLs. Patients with any other pancreatic disease were excluded. We performed Kaplan-Meier analysis and multivariable Cox proportional hazards regression to define the incidence and risk factors of postoperative NODM.<h4>Results</h4>Among 311 patients, the overall risk (95% confidence interval) of NODM was 9.1% (6.3-12.9%), 15.1% (11.3-20.2%), and 20.2% (15.3-26.4%) at 6, 12 and 24 months, respectively. Multivariable analysis (adjusted hazard ratio; 95% confidence interval) revealed that older age (1.97; 1.04-3.72; 55-64 vs 18-54 years), obesity (2.63; 1.35-5.12), hypertension (1.79; 1.01-3.17), and cardiovascular disease (2.54; 1.02-6.28) were independent predictors of NODM. Rates of NODM were similar after distal pancreatectomy versus pancreaticoduodenectomy.<h4>Conclusions</h4>Within 2 years, 1 in 5 patients without any other pancreatic disease will develop NODM after partial pancreatectomy for PCLs. Those with advanced age, metabolic syndrome features, and/or cardiovascular disease may benefit from preoperative counseling and intensive postoperative monitoring, education, and treatment for diabetes mellitus.

Also flagged:colorectal cancermethylationmethylation-specifictumorsMLH1cancer
Journal Article 2022-05-01 ✓ 1 Snippet Afanador CH, Palacio KA, Isaza LF, Ahumada E, Ocampo CM, Muñetón CM.
In-Text Gene Mentions

El modelo clásico de múltiples pasos en la progresión del adenoma hacia el carcinoma, propuesto por Fearon, et al., involucra la inactivación de genes supresores de tumores, como el APC, el TP53 y el DCC, y mutaciones en los oncogenes KRAS, SMAD y BRAF, las cuales conducen a una inestabilidad genómica; esta vía es conocida como supresora o de inestabilidad cromosómica .8

Show Full Abstract

Introduction: Colorectal cancer has a high incidence in the world population. Different molecular pathways, such as chromosomal instability, microsatellite instability, and epigenetics are involved in its development. Objective: To perform molecular characterization in 44 individuals with sporadic colorectal cancer. Materials and methods: We conducted mutation analyses of the APC, KRAS, TP53 y BRAF genes using Sanger sequencing techniques; microsatellite instability was determined by capillary electrophoresis with five STR genetic markers while the methylation status of the MHL1 promotor gene was analyzed using methylation-specific PCR. Results: APC, KRAS, and TP53 genes mutation frequency was 18.1%, 25%, and 4.5%, respectively; the somatic mutations detected were located more frequently in the right colon. The frequency of microsatellite instability was 27.2% and 73.1% of the tumors had the MHL1 gene methylated while 91.6% of microsatellite instability-positive tumors had the methylated MLH1 gene. The mutation profile of microsatellite stability tumors APC, KRAS, and TP53 genes was more frequent than in the microsatellite instability-positive tumors. The methylation of the MLH1 gene was the most predominant molecular alteration. Conclusions: We identified molecular alterations in different genetic pathways of the colorectal cancer patients evaluated, which are common in the carcinogenesis of this cancer. These patients showed a different mutational profile compared to other populations. Our findings confirm the molecular heterogeneity described in the development of colorectal cancer.

Also flagged:TafamidisCardiomyopathytransthyretin amyloidosisATTRheart failuretechnetium
Journal Article 2022-05-01 No Snippets Doumas A, Zegkos T, Parcharidou D, Gossios T, Ntelios D, Chatzileontiadou S, Papanastasiou E, Hatjiharissi E, Iakovou I, Efthimiadis GK.
Show Full Abstract

<h4>Objective</h4>Cardiomyopathy is a common manifestation of transthyretin amyloidosis (ATTR), leading to heart failure, associated with high morbidity and mortality. The aim of this study was to investigate the effect of Tafamidis treatment by means of cardiac radiotracer uptake on myocardial scintigraphy.<h4>Subjects and methods</h4>Five male patients, mean age 76.2 years, with wild-type ATTR were included in the protocol. Total body scanning using technetium-99m-3,3-diphosphono-1,2-propanodicarboxylic acid (<sup>99m</sup>Tc-DPD) (in four patients) and technetium-99m-hydroxymethylene diphosphonate (<sup>99m</sup>Tc-HMDP) (in one) was performed pre- and one year post-Tafamidis therapy. A novel quantitation method for assessing radiotracer cardiac uptake was employed. The geometric mean was computed for both cardiac and thigh region of interest (ROI) and the heart-to-thigh (HtT) ratio was assessed by dividing the corresponding geometric mean counts.<h4>Results</h4>Heart-to-thigh ratio was improved (decreased) in four of the patients receiving Tafamidis, in keeping with lower uptake to the cardiac region. These patients also demonstrated a relatively favorable clinical response to Tafamidis. The patient evaluated by <sup>99m</sup>Tc-HMDP exhibited minimal HtT ratio reduction and stable clinical and echocardiographic characteristics.<h4>Conclusion</h4>Sequential HtT ratio measurements could potentially identify patients with a favorable response to Tafamidis treatment at earlier stages, compared to other imaging modalities or serological biomarkers.

Also flagged:deathcoronary artery diseaseIschemic coronary heart diseaseEMP2TEKT5KCNJ6
Journal Article 2022-05-01 ✓ 1 Snippet Dungan JR, Qin X, Gregory SG, Cooper-Dehoff R, Duarte JD, Qin H, Gulati M, Taylor JY, Pepine CJ, Hauser ER, Kraus WE.
In-Text Gene Mentions

…the intergenic regionUNC13C/LOC105370829 (15q21.3).…

Show Full Abstract

<h4>Background</h4>Ischemic coronary heart disease (IHD) is the leading cause of death worldwide. Genetic variation is presumed to be a major factor underlying sex differences for IHD events, including mortality. The purpose of this study was to identify sex-specific candidate genes associated with all-cause mortality among people diagnosed with coronary artery disease (CAD).<h4>Methods</h4>We performed a sex-stratified, exploratory genome-wide association (GWAS) screen using existing data from CAD-diagnosed males (<i>n</i> = 510) and females (<i>n</i> = 174) who reported European ancestry from the Duke Catheterization Genetics biorepository. Extant genotype data for 785,945 autosomal SNPs generated with the Human Omni1-Quad BeadChip (Illumina, CA, USA) were analyzed using an additive inheritance model. We estimated instantaneous risk of all-cause mortality by genotype groups across the 11-year follow-up using Cox multivariate regression, covarying for age and genomic ancestry.<h4>Results</h4>The top GWAS hits associated with all-cause mortality among people with CAD included 8 SNPs among males and 15 among females (<i>p</i> = 1 × 10<sup>-6</sup> or 10<sup>-7</sup>), adjusted for covariates. Cross-sex comparisons revealed distinct candidate genes. Biologically relevant candidates included rs9932462 (<i>EMP2/TEKT5)</i> and rs2835913 (<i>KCNJ6)</i> among males and rs7217169 (<i>RAP1GAP2</i>), rs8021816 (<i>PRKD1</i>), rs8133010 (<i>PDE9A</i>), and rs12145981 (<i>LPGAT1</i>) among females.<h4>Conclusions</h4>We report 20 sex-specific candidate genes having suggestive association with all-cause mortality among CAD-diagnosed subjects. Findings demonstrate proof of principle for identifying sex-associated genetic factors that may help explain differential mortality risk in people with CAD. Replication and meta-analyses in larger studies with more diverse samples will strengthen future work in this area.

Also flagged:Squamous Cell CarcinomaDuct Carcinoma in sitularge-cell neuroendocrine carcinomalarge-cell neuroendocrine carcinoma of thecervixbreast cancer
Journal Article 2022-05-01 No Snippets Le DT, Do KH, Do TA, Bui HTT, Nguyen CV.
Show Full Abstract

Squamous cell carcinoma admixed with large-cell neuroendocrine carcinoma of the uterine cervix is an extremely rare malignancy with a poor prognosis. We report a 50-year-old woman with mixed squamous cell carcinoma and large-cell neuroendocrine carcinoma of the uterine cervix with an individual history of early-stage breast cancer. She was diagnosed preoperatively with cervical cancer stage FIGO 1B2. However, during surgery, a lesion was found in Douglas's peritoneum. The histopathological result of surgical specimens was mixed squamous cell carcinoma and large-cell neuroendocrine carcinoma. Then, she received concurrent chemoradiotherapy. Currently, after 3 months of treatment, she has not developed recurrent lesions.

Also flagged:oxygennucleotidescancerscervical cancerIRdiabetic
Journal Article 2022-05-01 ✓ 1 Snippet Sun Q, Gong J, Gong X, Wu J, Hu Z, Zhang Q, Zhu X.
In-Text Gene Mentions

…IR injury through miR-126/SOX6axis [ 14…

Show Full Abstract

Long non-coding RNA (lncRNA) metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) plays a crucial role in the process of renal ischemia-reperfusion (IR) injury and myocardial IR injury. However, its mechanism in liver IR injury is not clear. IR and hypoxia/reoxygenation (H/R) model were built on C57BL/6 mice. Blood samples were obtained from the inferior vena cava of the model mice. MALAT1 expression was detected in IR model and H/R model. Supported by experimental results, the impacts of MALAT1 on viability, apoptosis, and inflammation of H/R model cells were detected. The correlation between MALAT1 and downstream genes was analyzed by mechanism assays. MALAT1 was detected to be upregulated in IR model and H/R model. MALAT1 knockdown had inhibitory effects on apoptosis and inflammatory reaction while promoting liver cell viability in H/R condition. Meanwhile, MALAT1 targeted miR-150-5p to regulate antizyme inhibitor 1 (AZIN1) in liver cells. Finally, MALAT1 regulated viability, apoptosis, and inflammatory reaction of liver cells by targeting miR-150-5p and AZIN1. To conclude, MALAT1 targeted miR-150-5p/AZIN1 to accelerate liver IR injury, suggesting that MALAT1 might be a novel target for liver IR injury.

ESOC 2022 Abstract Book

Also flagged:acute ischemic strokeintracranial hemorrhageischemic strokestrokePHischaemic stroke
Journal Article 2022-05-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.